Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Phenoscape: Identifying Candidate Genes for Evolutionary Phenotypes

PubMed Central

Edmunds, Richard C.; Su, Baofeng; Balhoff, James P.; Eames, B. Frank; Dahdul, Wasila M.; Lapp, Hilmar; Lundberg, John G.; Vision, Todd J.; Dunham, Rex A.; Mabee, Paula M.; Westerfield, Monte

2016-01-01

Phenotypes resulting from mutations in genetic model organisms can help reveal candidate genes for evolutionarily important phenotypic changes in related taxa. Although testing candidate gene hypotheses experimentally in nonmodel organisms is typically difficult, ontology-driven information systems can help generate testable hypotheses about developmental processes in experimentally tractable organisms. Here, we tested candidate gene hypotheses suggested by expert use of the Phenoscape Knowledgebase, specifically looking for genes that are candidates responsible for evolutionarily interesting phenotypes in the ostariophysan fishes that bear resemblance to mutant phenotypes in zebrafish. For this, we searched ZFIN for genetic perturbations that result in either loss of basihyal element or loss of scales phenotypes, because these are the ancestral phenotypes observed in catfishes (Siluriformes). We tested the identified candidate genes by examining their endogenous expression patterns in the channel catfish, Ictalurus punctatus. The experimental results were consistent with the hypotheses that these features evolved through disruption in developmental pathways at, or upstream of, brpf1 and eda/edar for the ancestral losses of basihyal element and scales, respectively. These results demonstrate that ontological annotations of the phenotypic effects of genetic alterations in model organisms, when aggregated within a knowledgebase, can be used effectively to generate testable, and useful, hypotheses about evolutionary changes in morphology. PMID:26500251

Identification and characterization of nuclear genes involved in photosynthesis in Populus

PubMed Central

2014-01-01

Background The gap between the real and potential photosynthetic rate under field conditions suggests that photosynthesis could potentially be improved. Nuclear genes provide possible targets for improving photosynthetic efficiency. Hence, genome-wide identification and characterization of the nuclear genes affecting photosynthetic traits in woody plants would provide key insights on genetic regulation of photosynthesis and identify candidate processes for improvement of photosynthesis. Results Using microarray and bulked segregant analysis strategies, we identified differentially expressed nuclear genes for photosynthesis traits in a segregating population of poplar. We identified 515 differentially expressed genes in this population (FC ≥ 2 or FC ≤ 0.5, P < 0.05), 163 up-regulated and 352 down-regulated. Real-time PCR expression analysis confirmed the microarray data. Singular Enrichment Analysis identified 48 significantly enriched GO terms for molecular functions (28), biological processes (18) and cell components (2). Furthermore, we selected six candidate genes for functional examination by a single-marker association approach, which demonstrated that 20 SNPs in five candidate genes significantly associated with photosynthetic traits, and the phenotypic variance explained by each SNP ranged from 2.3% to 12.6%. This revealed that regulation of photosynthesis by the nuclear genome mainly involves transport, metabolism and response to stimulus functions. Conclusions This study provides new genome-scale strategies for the discovery of potential candidate genes affecting photosynthesis in Populus, and for identification of the functions of genes involved in regulation of photosynthesis. This work also suggests that improving photosynthetic efficiency under field conditions will require the consideration of multiple factors, such as stress responses. PMID:24673936

Candidate innate immune system gene expression in the ecological model Daphnia

PubMed Central

Decaestecker, Ellen; Labbé, Pierrick; Ellegaard, Kirsten; Allen, Judith E.; Little, Tom J.

2011-01-01

The last ten years have witnessed increasing interest in host–pathogen interactions involving invertebrate hosts. The invertebrate innate immune system is now relatively well characterised, but in a limited range of genetic model organisms and under a limited number of conditions. Immune systems have been little studied under real-world scenarios of environmental variation and parasitism. Thus, we have investigated expression of candidate innate immune system genes in the water flea Daphnia, a model organism for ecological genetics, and whose capacity for clonal reproduction facilitates an exceptionally rigorous control of exposure dose or the study of responses at many time points. A unique characteristic of the particular Daphnia clones and pathogen strain combinations used presently is that they have been shown to be involved in specific host–pathogen coevolutionary interactions in the wild. We choose five genes, which are strong candidates to be involved in Daphnia–pathogen interactions, given that they have been shown to code for immune effectors in related organisms. Differential expression of these genes was quantified by qRT-PCR following exposure to the bacterial pathogen Pasteuria ramosa. Constitutive expression levels differed between host genotypes, and some genes appeared to show correlated expression. However, none of the genes appeared to show a major modification of expression level in response to Pasteuria exposure. By applying knowledge from related genetic model organisms (e.g. Drosophila) to models for the study of evolutionary ecology and coevolution (i.e. Daphnia), the candidate gene approach is temptingly efficient. However, our results show that detection of only weak patterns is likely if one chooses target genes for study based on previously identified genome sequences by comparison to homologues from other related organisms. Future work on the Daphnia–Pasteuria system will need to balance a candidate gene approach with more comprehensive approaches to de novo identify immune system genes specific to the Daphnia–Pasteuria interaction. PMID:21550363

Candidate innate immune system gene expression in the ecological model Daphnia.

PubMed

Decaestecker, Ellen; Labbé, Pierrick; Ellegaard, Kirsten; Allen, Judith E; Little, Tom J

2011-10-01

The last ten years have witnessed increasing interest in host-pathogen interactions involving invertebrate hosts. The invertebrate innate immune system is now relatively well characterised, but in a limited range of genetic model organisms and under a limited number of conditions. Immune systems have been little studied under real-world scenarios of environmental variation and parasitism. Thus, we have investigated expression of candidate innate immune system genes in the water flea Daphnia, a model organism for ecological genetics, and whose capacity for clonal reproduction facilitates an exceptionally rigorous control of exposure dose or the study of responses at many time points. A unique characteristic of the particular Daphnia clones and pathogen strain combinations used presently is that they have been shown to be involved in specific host-pathogen coevolutionary interactions in the wild. We choose five genes, which are strong candidates to be involved in Daphnia-pathogen interactions, given that they have been shown to code for immune effectors in related organisms. Differential expression of these genes was quantified by qRT-PCR following exposure to the bacterial pathogen Pasteuria ramosa. Constitutive expression levels differed between host genotypes, and some genes appeared to show correlated expression. However, none of the genes appeared to show a major modification of expression level in response to Pasteuria exposure. By applying knowledge from related genetic model organisms (e.g. Drosophila) to models for the study of evolutionary ecology and coevolution (i.e. Daphnia), the candidate gene approach is temptingly efficient. However, our results show that detection of only weak patterns is likely if one chooses target genes for study based on previously identified genome sequences by comparison to homologues from other related organisms. Future work on the Daphnia-Pasteuria system will need to balance a candidate gene approach with more comprehensive approaches to de novo identify immune system genes specific to the Daphnia-Pasteuria interaction. Copyright © 2011 Elsevier Ltd. All rights reserved.

A Strategy to Validate the Role of Callose-mediated Plasmodesmal Gating in the Tropic Response.

PubMed

Kumar, Ritesh; Wu, Shu Wei; Iswanto, Arya Bagus Boedi; Kumar, Dhinesh; Han, Xiao; Kim, Jae-Yean

2016-04-17

The plant hormone auxin plays an important role in many growth and developmental processes, including tropic responses to light and gravity. The establishment of an auxin gradient is a key event leading to phototropism and gravitropism. Previously, polar auxin transport (PAT) was shown to establish an auxin gradient in different cellular domains of plants. However, Han et al. recently demonstrated that for proper auxin gradient formation, plasmodesmal callose-mediated symplasmic connectivity between the adjacent cells is also a critical factor. In this manuscript, the strategy to elucidate the role of particular genes, which can affect phototropism and gravitropism by altering the symplasmic connectivity through modulating plasmodesmal callose synthesis, is discussed. The first step is to screen aberrant tropic responses from 3-day-old etiolated seedlings of mutants or over-expression lines of a gene along with the wild type. This preliminary screening can lead to the identification of a range of genes functioning in PAT or controlling symplasmic connectivity. The second screening involves the sorting of candidates that show altered tropic responses by affecting symplasmic connectivity. To address such candidates, the movement of a symplasmic tracer and the deposition of plasmodesmal callose were examined. This strategy would be useful to explore new candidate genes that can regulate symplasmic connectivity directly or indirectly during tropic responses and other developmental processes.

Generation of novel pharmacogenomic candidates in the response to methotrexate in juvenile idiopathic arthritis: correlation between gene expression and genotype

PubMed Central

Moncrieffe, Halima; Hinks, Anne; Ursu, Simona; Kassoumeri, Laura; Etheridge, Angela; Hubank, Mike; Martin, Paul; Weiler, Tracey; Glass, David N; Thompson, Susan D.; Thomson, Wendy; Wedderburn, Lucy R

2010-01-01

Objectives Little is known about mechanisms of efficacy of methotrexate (MTX) in childhood arthritis, or genetic influences upon response to MTX. The aims of this study were to use gene expression profiling to identify novel pathways/genes altered by MTX and then investigate these genes for genotype associations with response to MTX treatment. Methods Gene expression profiling before and after MTX treatment was performed on 11 children with juvenile idiopathic arthritis (JIA) treated with MTX, in whom response at 6 months of treatment was defined. Genes showing the most differential gene expression after treatment were selected for SNP genotyping. Genotype frequencies were compared between non-responders and responders (ACR-Ped70). An independent cohort was available for validation. Results Gene expression profiling before and after MTX treatment revealed 1222 differentially expressed probes sets (fold change >1.7, p< 0.05) and 1065 when restricted to full responder cases only. Six highly differentially expressed genes were analysed for genetic association to response to MTX. Three SNPs in the SLC16A7 gene showed significant association with MTX response. One SNP showed validated association in an independent cohort. Conclusions This study is the first, to our knowledge, to evaluate gene expression profiles in children with JIA before and after MTX, and to analyse genetic variation in differentially expressed genes. We have identified a gene which may contribute to genetic variability in MTX response in JIA, and established as proof of principle that genes which are differentially expressed at mRNA level after drug administration may also be good candidates for genetic analysis. PMID:20827233

DNA sequence variation and selection of tag single-nucleotide polymorphisms at candidate genes for drought-stress response in Pinus taeda L.

PubMed

González-Martínez, Santiago C; Ersoz, Elhan; Brown, Garth R; Wheeler, Nicholas C; Neale, David B

2006-03-01

Genetic association studies are rapidly becoming the experimental approach of choice to dissect complex traits, including tolerance to drought stress, which is the most common cause of mortality and yield losses in forest trees. Optimization of association mapping requires knowledge of the patterns of nucleotide diversity and linkage disequilibrium and the selection of suitable polymorphisms for genotyping. Moreover, standard neutrality tests applied to DNA sequence variation data can be used to select candidate genes or amino acid sites that are putatively under selection for association mapping. In this article, we study the pattern of polymorphism of 18 candidate genes for drought-stress response in Pinus taeda L., an important tree crop. Data analyses based on a set of 21 putatively neutral nuclear microsatellites did not show population genetic structure or genomewide departures from neutrality. Candidate genes had moderate average nucleotide diversity at silent sites (pi(sil) = 0.00853), varying 100-fold among single genes. The level of within-gene LD was low, with an average pairwise r2 of 0.30, decaying rapidly from approximately 0.50 to approximately 0.20 at 800 bp. No apparent LD among genes was found. A selective sweep may have occurred at the early-response-to-drought-3 (erd3) gene, although population expansion can also explain our results and evidence for selection was not conclusive. One other gene, ccoaomt-1, a methylating enzyme involved in lignification, showed dimorphism (i.e., two highly divergent haplotype lineages at equal frequency), which is commonly associated with the long-term action of balancing selection. Finally, a set of haplotype-tagging SNPs (htSNPs) was selected. Using htSNPs, a reduction of genotyping effort of approximately 30-40%, while sampling most common allelic variants, can be gained in our ongoing association studies for drought tolerance in pine.

Dissecting the organ specificity of insecticide resistance candidate genes in Anopheles gambiae: known and novel candidate genes.

PubMed

Ingham, Victoria A; Jones, Christopher M; Pignatelli, Patricia; Balabanidou, Vasileia; Vontas, John; Wagstaff, Simon C; Moore, Jonathan D; Ranson, Hilary

2014-11-25

The elevated expression of enzymes with insecticide metabolism activity can lead to high levels of insecticide resistance in the malaria vector, Anopheles gambiae. In this study, adult female mosquitoes from an insecticide susceptible and resistant strain were dissected into four different body parts. RNA from each of these samples was used in microarray analysis to determine the enrichment patterns of the key detoxification gene families within the mosquito and to identify additional candidate insecticide resistance genes that may have been overlooked in previous experiments on whole organisms. A general enrichment in the transcription of genes from the four major detoxification gene families (carboxylesterases, glutathione transferases, UDP glucornyltransferases and cytochrome P450s) was observed in the midgut and malpighian tubules. Yet the subset of P450 genes that have previously been implicated in insecticide resistance in An gambiae, show a surprisingly varied profile of tissue enrichment, confirmed by qPCR and, for three candidates, by immunostaining. A stringent selection process was used to define a list of 105 genes that are significantly (p ≤0.001) over expressed in body parts from the resistant versus susceptible strain. Over half of these, including all the cytochrome P450s on this list, were identified in previous whole organism comparisons between the strains, but several new candidates were detected, notably from comparisons of the transcriptomes from dissected abdomen integuments. The use of RNA extracted from the whole organism to identify candidate insecticide resistance genes has a risk of missing candidates if key genes responsible for the phenotype have restricted expression within the body and/or are over expression only in certain tissues. However, as transcription of genes implicated in metabolic resistance to insecticides is not enriched in any one single organ, comparison of the transcriptome of individual dissected body parts cannot be recommended as a preferred means to identify new candidate insecticide resistant genes. Instead the rich data set on in vivo sites of transcription should be consulted when designing follow up qPCR validation steps, or for screening known candidates in field populations.

Identification and fine mapping of a stay-green gene (Brnye1) in pakchoi (Brassica campestris L. ssp. chinensis).

PubMed

Wang, Nan; Liu, Zhiyong; Zhang, Yun; Li, Chengyu; Feng, Hui

2018-03-01

Using bulked segregant analysis combined with next-generation sequencing, we delimited the Brnye1 gene responsible for the stay-green trait of nye in pakchoi. Sequence analysis identified Bra019346 as the candidate gene. "Stay-green" refers to a plant trait whereby leaves remain green during senescence. This trait is useful in the cultivation of pakchoi (Brassica campestris L. ssp. chinensis), which is marketed as a green leaf product. This study aimed to identify the gene responsible for the stay-green trait in pakchoi. We identified a stay-green mutant in pakchoi, which we termed "nye". Genetic analysis revealed that the stay-green trait is controlled by a single recessive gene, Brnye1. Using the BSA-seq method, a 3.0-Mb candidate region was mapped on chromosome A03, which helped us localize Brnye1 to an 81.01-kb interval between SSR markers SSRWN27 and SSRWN30 via linkage analysis in an F 2 population. We identified 12 genes in this region, 11 of which were annotated based on the Brassica rapa annotation database, and one was a functionally unknown gene. An orthologous gene of the Arabidopsis gene AtNYE1, Bra019346, was identified as the potential candidate for Brnye1. Sequence analysis revealed a 40-bp insertion in the second exon of Bra019346 in nye, which generated the TAA stop codon. A candidate gene-specific Indel marker in 1561 F 2 individuals showed perfect cosegregation with Brnye1 in the nye mutant. These results provide a foundation for uncovering the molecular mechanism of the stay-green trait in pakchoi.

Comparative analysis of protein interactome networks prioritizes candidate genes with cancer signatures.

PubMed

Li, Yongsheng; Sahni, Nidhi; Yi, Song

2016-11-29

Comprehensive understanding of human cancer mechanisms requires the identification of a thorough list of cancer-associated genes, which could serve as biomarkers for diagnoses and therapies in various types of cancer. Although substantial progress has been made in functional studies to uncover genes involved in cancer, these efforts are often time-consuming and costly. Therefore, it remains challenging to comprehensively identify cancer candidate genes. Network-based methods have accelerated this process through the analysis of complex molecular interactions in the cell. However, the extent to which various interactome networks can contribute to prediction of candidate genes responsible for cancer is still enigmatic. In this study, we evaluated different human protein-protein interactome networks and compared their application to cancer gene prioritization. Our results indicate that network analyses can increase the power to identify novel cancer genes. In particular, such predictive power can be enhanced with the use of unbiased systematic protein interaction maps for cancer gene prioritization. Functional analysis reveals that the top ranked genes from network predictions co-occur often with cancer-related terms in literature, and further, these candidate genes are indeed frequently mutated across cancers. Finally, our study suggests that integrating interactome networks with other omics datasets could provide novel insights into cancer-associated genes and underlying molecular mechanisms.

Identification of positional candidates for bovine placental genes responsible for early embryonic death during cloning-attempted pregnancy.

PubMed

Yamada, Takahisa; Muramatsu, Youji; Taniguchi, Yukio; Sasaki, Yoshiyuki

Our previous study detected 291 and 77 genes showing early embryonic death-associated elevation and reduction of expression, respectively, in the fetal placenta of the cow carrying somatic nuclear transfer-derived cloned embryo. In this study, we mapped the 10 genes showing the elevation and the 10 genes doing the reduction most significantly, using somatic cell hybrid and bovine draft genome sequence. We then compared the mapped positions for these genes with the genomic locations of bovine quantitative trait loci for still-birth and/or abortion. Among the mapped genes, peptidylglycine alpha-amidating monooxygenase (PAM), spectrin, beta, nonerythrocytic 1 (SPTBNI), and an unknown novel gene containing AU277832 expressed sequence tag were intriguing, in that the mapped positions were consistent with the genomic locations of bovine still-birth and/or abortion quantitative trait loci, and thus identified as positional candidates for bovine placental genes responsible for the early embryonic death during the pregnancy attempted by somatic nuclear transfer-derived cloning.

Thermal tolerance in the keystone species Daphnia magna-a candidate gene and an outlier analysis approach.

PubMed

Jansen, M; Geerts, A N; Rago, A; Spanier, K I; Denis, C; De Meester, L; Orsini, L

2017-04-01

Changes in temperature have occurred throughout Earth's history. However, current warming trends exacerbated by human activities impose severe and rapid loss of biodiversity. Although understanding the mechanisms orchestrating organismal response to climate change is important, remarkably few studies document their role in nature. This is because only few systems enable the combined analysis of genetic and plastic responses to environmental change over long time spans. Here, we characterize genetic and plastic responses to temperature increase in the aquatic keystone grazer Daphnia magna combining a candidate gene and an outlier analysis approach. We capitalize on the short generation time of our species, facilitating experimental evolution, and the production of dormant eggs enabling the analysis of long-term response to environmental change through a resurrection ecology approach. We quantify plasticity in the expression of 35 candidate genes in D. magna populations resurrected from a lake that experienced changes in average temperature over the past century and from experimental populations differing in thermal tolerance isolated from a selection experiment. By measuring expression in multiple genotypes from each of these populations in control and heat treatments, we assess plastic responses to extreme temperature events. By measuring evolutionary changes in gene expression between warm- and cold-adapted populations, we assess evolutionary response to temperature changes. Evolutionary response to temperature increase is also assessed via an outlier analysis using EST-linked microsatellite loci. This study provides the first insights into the role of plasticity and genetic adaptation in orchestrating adaptive responses to environmental change in D. magna. © 2017 John Wiley & Sons Ltd.

Transcriptional Profiling and Identification of Heat-Responsive Genes in Perennial Ryegrass by RNA-Sequencing

PubMed Central

Wang, Kehua; Liu, Yanrong; Tian, Jinli; Huang, Kunyong; Shi, Tianran; Dai, Xiaoxia; Zhang, Wanjun

2017-01-01

Perennial ryegrass (Lolium perenne) is one of the most widely used forage and turf grasses in the world due to its desirable agronomic qualities. However, as a cool-season perennial grass species, high temperature is a major factor limiting its performance in warmer and transition regions. In this study, a de novo transcriptome was generated using a cDNA library constructed from perennial ryegrass leaves subjected to short-term heat stress treatment. Then the expression profiling and identification of perennial ryegrass heat response genes by digital gene expression analyses was performed. The goal of this work was to produce expression profiles of high temperature stress responsive genes in perennial ryegrass leaves and further identify the potentially important candidate genes with altered levels of transcript, such as those genes involved in transcriptional regulation, antioxidant responses, plant hormones and signal transduction, and cellular metabolism. The de novo assembly of perennial ryegrass transcriptome in this study obtained more total and annotated unigenes compared to previously published ones. Many DEGs identified were genes that are known to respond to heat stress in plants, including HSFs, HSPs, and antioxidant related genes. In the meanwhile, we also identified four gene candidates mainly involved in C4 carbon fixation, and one TOR gene. Their exact roles in plant heat stress response need to dissect further. This study would be important by providing the gene resources for improving heat stress tolerance in both perennial ryegrass and other cool-season perennial grass plants. PMID:28680431

Whole-genome resequencing of Bacillus cereus and expression of genes functioning in sodium chloride stress.

PubMed

Xu, Zhenbo; Xie, Jinhong; Liu, Junyan; Ji, Lili; Soteyome, Thanapop; Peters, Brian M; Chen, Dingqiang; Li, Bing; Li, Lin; Shirtliff, Mark E

2017-03-01

Bacillus cereus is one of the most common opportunistic pathogens responsible for various foodborn diseases. To investigate the regulatory mechanism of B. cereus under high osmotic pressure, two B. cereus strains B25 and B26 were isolated from the industrial soy sauce residue containing high-salt concentration. Resequencing was performed by Illumina/Solexa platform and 13,646 SNPs and 434 InDels were identified as common variants between B25 and B26 against reference genome, followed by COG, GO, and KEGG enrichment analysis. Furthermore, 49 key genes involving in Na + /H + ,K + transporter, dipeptide or tripeptide transporter, stress response were selected and classified into 27 groups. Further validation was performed by qRT-PCR, and 4 candidate genes were found most associated with osmotic response. Gene expression of the 4 candidate genes was then analyzed accordingly, and down regulation was obtained for gene BC0669 and BC0754 associated with K + transport system. However, dramatic up regulation was detected for gene BC2114 involving in glutathione peroxidase, indicating the activation of antioxidant responses by osmotic stress via genetic regulation. As concluded, bioinformatic analysis and gene expression profile represented the basis of further investigation on the genetic and regulatory mechanism of bacterial salt tolerance. Copyright © 2017 Elsevier Ltd. All rights reserved.

Identification of quantitative trait loci and candidate genes for cadmium tolerance in Populus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Induri, Brahma R; Ellis, Danielle R; Slavov, Goncho T.

2012-01-01

Understanding genetic variation for the response of Populus to heavy metals like cadmium (Cd) is an important step in elucidating the underlying mechanisms of tolerance. In this study, a pseudo-backcross pedigree of Populus trichocarpa Torr. & Gray and Populus deltoides Bart. was characterized for growth and performance traits after Cd exposure. A total of 16 quantitative trait loci (QTL) at logarithm of odds (LOD) ratio 2.5 were detected for total dry weight, its components and root volume. Major QTL for Cd responses were mapped to two different linkage groups and the relative allelic effects were in opposing directions on themore » two chromosomes, suggesting differential mechanisms at these two loci. The phenotypic variance explained by Cd QTL ranged from 5.9 to 11.6% and averaged 8.2% across all QTL. A whole-genome microarray study led to the identification of nine Cd-responsive genes from these QTL. Promising candidates for Cd tolerance include an NHL repeat membrane-spanning protein, a metal transporter and a putative transcription factor. Additional candidates in the QTL intervals include a putative homolog of a glutamate cysteine ligase, and a glutathione-S-transferase. Functional characterization of these candidate genes should enhance our understanding of Cd metabolism and transport and phytoremediation capabilities of Populus.« less

Transcriptome analysis of Brassica napus pod using RNA-Seq and identification of lipid-related candidate genes.

PubMed

Xu, Hai-Ming; Kong, Xiang-Dong; Chen, Fei; Huang, Ji-Xiang; Lou, Xiang-Yang; Zhao, Jian-Yi

2015-10-24

Brassica napus is an important oilseed crop. Dissection of the genetic architecture underlying oil-related biological processes will greatly facilitates the genetic improvement of rapeseed. The differential gene expression during pod development offers a snapshot on the genes responsible for oil accumulation in. To identify candidate genes in the linkage peaks reported previously, we used RNA sequencing (RNA-Seq) technology to analyze the pod transcriptomes of German cultivar Sollux and Chinese inbred line Gaoyou. The RNA samples were collected for RNA-Seq at 5-7, 15-17 and 25-27 days after flowering (DAF). Bioinformatics analysis was performed to investigate differentially expressed genes (DEGs). Gene annotation analysis was integrated with QTL mapping and Brassica napus pod transcriptome profiling to detect potential candidate genes in oilseed. Four hundred sixty five and two thousand, one hundred fourteen candidate DEGs were identified, respectively, between two varieties at the same stages and across different periods of each variety. Then, 33 DEGs between Sollux and Gaoyou were identified as the candidate genes affecting seed oil content by combining those DEGs with the quantitative trait locus (QTL) mapping results, of which, one was found to be homologous to Arabidopsis thaliana lipid-related genes. Intervarietal DEGs of lipid pathways in QTL regions represent important candidate genes for oil-related traits. Integrated analysis of transcriptome profiling, QTL mapping and comparative genomics with other relative species leads to efficient identification of most plausible functional genes underlying oil-content related characters, offering valuable resources for bettering breeding program of Brassica napus. This study provided a comprehensive overview on the pod transcriptomes of two varieties with different oil-contents at the three developmental stages.

Prediction of gene-phenotype associations in humans, mice, and plants using phenologs.

PubMed

Woods, John O; Singh-Blom, Ulf Martin; Laurent, Jon M; McGary, Kriston L; Marcotte, Edward M

2013-06-21

Phenotypes and diseases may be related to seemingly dissimilar phenotypes in other species by means of the orthology of underlying genes. Such "orthologous phenotypes," or "phenologs," are examples of deep homology, and may be used to predict additional candidate disease genes. In this work, we develop an unsupervised algorithm for ranking phenolog-based candidate disease genes through the integration of predictions from the k nearest neighbor phenologs, comparing classifiers and weighting functions by cross-validation. We also improve upon the original method by extending the theory to paralogous phenotypes. Our algorithm makes use of additional phenotype data--from chicken, zebrafish, and E. coli, as well as new datasets for C. elegans--establishing that several types of annotations may be treated as phenotypes. We demonstrate the use of our algorithm to predict novel candidate genes for human atrial fibrillation (such as HRH2, ATP4A, ATP4B, and HOPX) and epilepsy (e.g., PAX6 and NKX2-1). We suggest gene candidates for pharmacologically-induced seizures in mouse, solely based on orthologous phenotypes from E. coli. We also explore the prediction of plant gene-phenotype associations, as for the Arabidopsis response to vernalization phenotype. We are able to rank gene predictions for a significant portion of the diseases in the Online Mendelian Inheritance in Man database. Additionally, our method suggests candidate genes for mammalian seizures based only on bacterial phenotypes and gene orthology. We demonstrate that phenotype information may come from diverse sources, including drug sensitivities, gene ontology biological processes, and in situ hybridization annotations. Finally, we offer testable candidates for a variety of human diseases, plant traits, and other classes of phenotypes across a wide array of species.

Molecular response to water stress in two contrasting Mediterranean pines (Pinus pinaster and Pinus pinea).

PubMed

Perdiguero, Pedro; Barbero, María Del Carmen; Cervera, María Teresa; Collada, Carmen; Soto, Alvaro

2013-06-01

Adaptation to water stress has determined the evolution and diversification of vascular plants. Water stress is forecasted to increase drastically in the next decades in certain regions, such as in the Mediterranean basin. Consequently, a proper knowledge of the response and adaptations to drought stress is essential for the correct management of plant genetic resources. However, most of the advances in the understanding of the molecular response to water stress have been attained in angiosperms, and are not always applicable to gymnosperms. In this work we analyse the transcriptional response of two emblematic Mediterranean pines, Pinus pinaster and Pinus pinea, which show noticeable differences in their performance under water stress. Using microarray analysis, up to 113 genes have been detected as significantly induced by drought in both species. Reliability of expression patterns has been confirmed by RT-PCR. While induced genes with similar profiles in both species can be considered as general candidate genes for the study of drought response in conifers, genes with diverging expression patterns can underpin the differences displayed by these species under water stress. Most promising candidate genes for drought stress response include genes related to carbohydrate metabolism, such as glycosyltransferases or galactosidases, sugar transporters, dehydrins and transcription factors. Additionally, differences in the molecular response to drought and polyethylene-glycol-induced water stress are also discussed. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Listeria arpJ gene modifies T helper type 2 subset differentiation.

PubMed

Kanoh, Makoto; Maruyama, Saho; Shen, Hua; Matsumoto, Akira; Shinomiya, Hiroto; Przybilla, Karin; Gouin, Edith; Cossart, Pascale; Goebel, Werner; Asano, Yoshihiro

2015-07-15

Although the T-cell subset differentiation pathway has been characterized extensively from the view of host gene regulation, the effects of genes of the pathogen on T-cell subset differentiation during infection have yet to be elucidated. Especially, the bacterial genes that are responsible for this shift have not yet been determined. Utilizing a single-gene-mutation Listeria panel, we investigated genes involved in the host-pathogen interaction that are required for the initiation of T-cell subset differentiation in the early phase of pathogen infection. We demonstrate that the induction of T helper types 1 and 2 (Th1 and Th2) subsets are separate phenomena and are mediated by distinct Listeria genes. We identified several candidate Listeria genes that appear to be involved in the host-Listeria interaction. Among them, arpJ is the strongest candidate gene for inhibiting Th2 subset induction. Furthermore, the analysis utilizing arpJ-deficient Listeria monocytogenes (Lm) revealed that the tumor necrosis factor (TNF) superfamily (Tnfsf) 9-TNF receptor superfamily (Tnfrsf) 9 interaction inhibits the Th2 response during Lm infection. arpJ is the candidate gene for inhibiting Th2 T-cell subset induction. The arpJ gene product influences the expression of Tnfsf/Tnfrsf on antigen-presenting cells and inhibits the Th2 T-cell subset differentiation during Listeria infection. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Pool-based genome-wide association study identified novel candidate regions on BTA9 and 14 for oleic acid percentage in Japanese Black cattle.

PubMed

Kawaguchi, Fuki; Kigoshi, Hiroto; Nakajima, Ayaka; Matsumoto, Yuta; Uemoto, Yoshinobu; Fukushima, Moriyuki; Yoshida, Emi; Iwamoto, Eiji; Akiyama, Takayuki; Kohama, Namiko; Kobayashi, Eiji; Honda, Takeshi; Oyama, Kenji; Mannen, Hideyuki; Sasazaki, Shinji

2018-05-17

Fatty acid composition is an important indicator of beef quality. The objective of this study was to search the potential candidate region for fatty acid composition. We performed pool-based genome-wide association studies (GWAS) for oleic acid percentage (C18:1) in a Japanese Black cattle population from the Hyogo prefecture. GWAS analysis revealed two novel candidate regions on BTA9 and BTA14. The most significant single nucleotide polymorphisms (SNPs) in each region were genotyped in a population (n = 899) to verify their effect on C18:1. Statistical analysis revealed that both SNPs were significantly associated with C18:1 (p = .0080 and .0003), validating the quantitative trait loci (QTLs) detected in GWAS. We subsequently selected VNN1 and LYPLA1 genes as candidate genes from each region on BTA9 and BTA14, respectively. We sequenced full-length coding sequence (CDS) of these genes in eight individuals and identified a nonsynonymous SNP T66M on VNN1 gene as a putative candidate polymorphism. The polymorphism was also significantly associated with C18:1, but the p value (p = .0162) was higher than the most significant SNP on BTA9, suggesting that it would not be responsible for the QTL. Although further investigation will be needed to determine the responsible gene and polymorphism, our findings would contribute to development of selective markers for fatty acid composition in the Japanese Black cattle of Hyogo. © 2018 Japanese Society of Animal Science.

Transcriptome dynamics of a susceptible wheat upon Fusarium head blight reveals that molecular responses to Fusarium graminearum infection fit over the grain development processes.

PubMed

Chetouhi, Cherif; Bonhomme, Ludovic; Lasserre-Zuber, Pauline; Cambon, Florence; Pelletier, Sandra; Renou, Jean-Pierre; Langin, Thierry

2016-03-01

In many plant/pathogen interactions, host susceptibility factors are key determinants of disease development promoting pathogen growth and spreading in plant tissues. In the Fusarium head blight (FHB) disease, the molecular basis of wheat susceptibility is still poorly understood while it could provide new insights into the understanding of the wheat/Fusarium graminearum (Fg) interaction and guide future breeding programs to produce cultivars with sustainable resistance. To identify the wheat grain candidate genes, a genome-wide gene expression profiling was performed in the French susceptible wheat cultivar, Recital. Gene-specific two-way ANOVA of about 40 K transcripts at five grain developmental stages identified 1309 differentially expressed genes. Out of these, 536 were impacted by the Fg effect alone. Most of these Fg-responsive genes belonged to biological and molecular functions related to biotic and abiotic stresses indicating the activation of common stress pathways during susceptibility response of wheat grain to FHB. This analysis revealed also 773 other genes displaying either specific Fg-responsive profiles along with grain development stages or synergistic adjustments with the grain development effect. These genes were involved in various molecular pathways including primary metabolism, cell death, and gene expression reprogramming. An increasingly complex host response was revealed, as was the impact of both Fg infection and grain ontogeny on the transcription of wheat genes. This analysis provides a wealth of candidate genes and pathways involved in susceptibility responses to FHB and depicts new clues to the understanding of the susceptibility determinism in plant/pathogen interactions.

Influence of SNPs in nutrient-sensitive candidate genes and gene-diet interactions on blood lipids: the DiOGenes study.

PubMed

Brahe, Lena K; Ängquist, Lars; Larsen, Lesli H; Vimaleswaran, Karani S; Hager, Jörg; Viguerie, Nathalie; Loos, Ruth J F; Handjieva-Darlenska, Teodora; Jebb, Susan A; Hlavaty, Petr; Larsen, Thomas M; Martinez, J Alfredo; Papadaki, Angeliki; Pfeiffer, Andreas F H; van Baak, Marleen A; Sørensen, Thorkild I A; Holst, Claus; Langin, Dominique; Astrup, Arne; Saris, Wim H M

2013-09-14

Blood lipid response to a given dietary intervention could be determined by the effect of diet, gene variants or gene-diet interactions. The objective of the present study was to investigate whether variants in presumed nutrient-sensitive genes involved in lipid metabolism modified lipid profile after weight loss and in response to a given diet, among overweight European adults participating in the Diet Obesity and Genes study. By multiple linear regressions, 240 SNPs in twenty-four candidate genes were investigated for SNP main and SNP-diet interaction effects on total cholesterol, LDL-cholesterol, HDL-cholesterol and TAG after an 8-week low-energy diet (only main effect) ,and a 6-month ad libitum weight maintenance diet, with different contents of dietary protein or glycaemic index. After adjusting for multiple testing, a SNP-dietary protein interaction effect on TAG was identified for lipin 1 (LPIN1) rs4315495, with a decrease in TAG of 20.26 mmol/l per A-allele/protein unit (95% CI 20.38, 20.14, P=0.000043). In conclusion, we investigated SNP-diet interactions for blood lipid profiles for 240 SNPs in twenty-four candidate genes, selected for their involvement in lipid metabolism pathways, and identified one significant interaction between LPIN1 rs4315495 and dietary protein for TAG concentration.

Transcriptome-Wide Identification of Reference Genes for Expression Analysis of Soybean Responses to Drought Stress along the Day.

PubMed

Marcolino-Gomes, Juliana; Rodrigues, Fabiana Aparecida; Fuganti-Pagliarini, Renata; Nakayama, Thiago Jonas; Ribeiro Reis, Rafaela; Bouças Farias, Jose Renato; Harmon, Frank G; Correa Molinari, Hugo Bruno; Correa Molinari, Mayla Daiane; Nepomuceno, Alexandre

2015-01-01

The soybean transcriptome displays strong variation along the day in optimal growth conditions and also in response to adverse circumstances, like drought stress. However, no study conducted to date has presented suitable reference genes, with stable expression along the day, for relative gene expression quantification in combined studies on drought stress and diurnal oscillations. Recently, water deficit responses have been associated with circadian clock oscillations at the transcription level, revealing the existence of hitherto unknown processes and increasing the demand for studies on plant responses to drought stress and its oscillation during the day. We performed data mining from a transcriptome-wide background using microarrays and RNA-seq databases to select an unpublished set of candidate reference genes, specifically chosen for the normalization of gene expression in studies on soybean under both drought stress and diurnal oscillations. Experimental validation and stability analysis in soybean plants submitted to drought stress and sampled during a 24 h timecourse showed that four of these newer reference genes (FYVE, NUDIX, Golgin-84 and CYST) indeed exhibited greater expression stability than the conventionally used housekeeping genes (ELF1-β and β-actin) under these conditions. We also demonstrated the effect of using reference candidate genes with different stability values to normalize the relative expression data from a drought-inducible soybean gene (DREB5) evaluated in different periods of the day.

Diversity in Expression of Phosphorus (P) Responsive Genes in Cucumis melo L

PubMed Central

Fita, Ana; Bowen, Helen C.; Hayden, Rory M.; Nuez, Fernando; Picó, Belén; Hammond, John P.

2012-01-01

Background Phosphorus (P) is a major limiting nutrient for plant growth in many soils. Studies in model species have identified genes involved in plant adaptations to low soil P availability. However, little information is available on the genetic bases of these adaptations in vegetable crops. In this respect, sequence data for melon now makes it possible to identify melon orthologues of candidate P responsive genes, and the expression of these genes can be used to explain the diversity in the root system adaptation to low P availability, recently observed in this species. Methodology and Findings Transcriptional responses to P starvation were studied in nine diverse melon accessions by comparing the expression of eight candidate genes (Cm-PAP10.1, Cm-PAP10.2, Cm-RNS1, Cm-PPCK1, Cm-transferase, Cm-SQD1, Cm-DGD1 and Cm-SPX2) under P replete and P starved conditions. Differences among melon accessions were observed in response to P starvation, including differences in plant morphology, P uptake, P use efficiency (PUE) and gene expression. All studied genes were up regulated under P starvation conditions. Differences in the expression of genes involved in P mobilization and remobilization (Cm-PAP10.1, Cm-PAP10.2 and Cm-RNS1) under P starvation conditions explained part of the differences in P uptake and PUE among melon accessions. The levels of expression of the other studied genes were diverse among melon accessions, but contributed less to the phenotypical response of the accessions. Conclusions This is the first time that these genes have been described in the context of P starvation responses in melon. There exists significant diversity in gene expression levels and P use efficiency among melon accessions as well as significant correlations between gene expression levels and phenotypical measurements. PMID:22536378

Identification of drought-responsive genes in a drought-tolerant cotton (Gossypium hirsutum L.) cultivar under reduced irrigation field conditions and development of candidate gene markers for drought tolerance

USDA-ARS?s Scientific Manuscript database

Cotton productivity is affected by water deficit, and little is known about the molecular basis of drought tolerance in cotton. In this study, microarray analysis was conducted to identify drought-responsive genes in the third topmost leaves of the field-grown drought-tolerant cotton (Gossypium hirs...

Identification of Candidate Genes Responsible for Stem Pith Production Using Expression Analysis in Solid-Stemmed Wheat.

PubMed

Oiestad, A J; Martin, J M; Cook, J; Varella, A C; Giroux, M J

2017-07-01

The wheat stem sawfly (WSS) is an economically important pest of wheat in the Northern Great Plains. The primary means of WSS control is resistance associated with the single quantitative trait locus (QTL) , which controls most stem solidness variation. The goal of this study was to identify stem solidness candidate genes via RNA-seq. This study made use of 28 single nucleotide polymorphism (SNP) makers derived from expressed sequence tags (ESTs) linked to contained within a 5.13 cM region. Allele specific expression of EST markers was examined in stem tissue for solid and hollow-stemmed pairs of two spring wheat near isogenic lines (NILs) differing for the QTL. Of the 28 ESTs, 13 were located within annotated genes and 10 had detectable stem expression. Annotated genes corresponding to four of the ESTs were differentially expressed between solid and hollow-stemmed NILs and represent possible stem solidness gene candidates. Further examination of the 5.13 cM region containing the 28 EST markers identified 260 annotated genes. Twenty of the 260 linked genes were up-regulated in hollow NIL stems, while only seven genes were up-regulated in solid NIL stems. An -methyltransferase within the region of interest was identified as a candidate based on differential expression between solid and hollow-stemmed NILs and putative function. Further study of these candidate genes may lead to the identification of the gene(s) controlling stem solidness and an increased ability to select for wheat stem solidness and manage WSS. Copyright © 2017 Crop Science Society of America.

Genome-Wide Transcriptome Analysis of Cotton (Gossypium hirsutum L.) Identifies Candidate Gene Signatures in Response to Aflatoxin Producing Fungus Aspergillus flavus.

PubMed

Bedre, Renesh; Rajasekaran, Kanniah; Mangu, Venkata Ramanarao; Sanchez Timm, Luis Eduardo; Bhatnagar, Deepak; Baisakh, Niranjan

2015-01-01

Aflatoxins are toxic and potent carcinogenic metabolites produced from the fungi Aspergillus flavus and A. parasiticus. Aflatoxins can contaminate cottonseed under conducive preharvest and postharvest conditions. United States federal regulations restrict the use of aflatoxin contaminated cottonseed at >20 ppb for animal feed. Several strategies have been proposed for controlling aflatoxin contamination, and much success has been achieved by the application of an atoxigenic strain of A. flavus in cotton, peanut and maize fields. Development of cultivars resistant to aflatoxin through overexpression of resistance associated genes and/or knocking down aflatoxin biosynthesis of A. flavus will be an effective strategy for controlling aflatoxin contamination in cotton. In this study, genome-wide transcriptome profiling was performed to identify differentially expressed genes in response to infection with both toxigenic and atoxigenic strains of A. flavus on cotton (Gossypium hirsutum L.) pericarp and seed. The genes involved in antifungal response, oxidative burst, transcription factors, defense signaling pathways and stress response were highly differentially expressed in pericarp and seed tissues in response to A. flavus infection. The cell-wall modifying genes and genes involved in the production of antimicrobial substances were more active in pericarp as compared to seed. The genes involved in auxin and cytokinin signaling were also induced. Most of the genes involved in defense response in cotton were highly induced in pericarp than in seed. The global gene expression analysis in response to fungal invasion in cotton will serve as a source for identifying biomarkers for breeding, potential candidate genes for transgenic manipulation, and will help in understanding complex plant-fungal interaction for future downstream research.

Mapping QTLs for water-use efficiency reveals the potential candidate genes involved in regulating the trait in apple under drought stress.

PubMed

Wang, Haibo; Zhao, Shuang; Mao, Ke; Dong, Qinglong; Liang, Bowen; Li, Chao; Wei, Zhiwei; Li, Mingjun; Ma, Fengwang

2018-06-26

Improvement of water-use efficiency (WUE) can effectively reduce production losses caused by drought stress. A better understanding of the genetic determination of WUE in crops under drought stress has great potential value for developing cultivars adapted to arid regions. To identify the genetic loci associated with WUE and reveal genes responsible for the trait in apple, we aim to map the quantitative trait loci (QTLs) for carbon isotope composition, the proxy for WUE, applying two contrasting irrigating regimes over the two-year experiment and search for the candidate genes encompassed in the mapped QTLs. We constructed a high-density genetic linkage map with 10,172 markers of apple, using single nucleotide polymorphism (SNP) markers obtained through restriction site-associated DNA sequencing (RADseq) and a final segregating population of 350 seedlings from the cross of Honeycrisp and Qinguan. In total, 33 QTLs were identified for carbon isotope composition in apple under both well-watered and drought-stressed conditions. Three QTLs were stable over 2 years under drought stress on linkage groups LG8, LG15 and LG16, as validated by Kompetitive Allele-Specific PCR (KASP) assays. In those validated QTLs, 258 genes were screened according to their Gene Ontology functional annotations. Among them, 28 genes were identified, which exhibited significant responses to drought stress in 'Honeycrisp' and/or 'Qinguan'. These genes are involved in signaling, photosynthesis, response to stresses, carbohydrate metabolism, protein metabolism and modification, hormone metabolism and transport, transport, respiration, transcriptional regulation, and development regulation. They, especially those for photoprotection and relevant signal transduction, are potential candidate genes connected with WUE regulation in drought-stressed apple. We detected three stable QTLs for carbon isotope composition in apple under drought stress over 2 years, and validated them by KASP assay. Twenty-eight candidate genes encompassed in these QTLs were identified. These stable genetic loci and series of genes provided here serve as a foundation for further studies on marker-assisted selection of high WUE and regulatory mechanism of WUE in apple exposed to drought conditions, respectively.

Candidate genes for idiopathic epilepsy in four dog breeds.

PubMed

Ekenstedt, Kari J; Patterson, Edward E; Minor, Katie M; Mickelson, James R

2011-04-25

Idiopathic epilepsy (IE) is a naturally occurring and significant seizure disorder affecting all dog breeds. Because dog breeds are genetically isolated populations, it is possible that IE is attributable to common founders and is genetically homogenous within breeds. In humans, a number of mutations, the majority of which are genes encoding ion channels, neurotransmitters, or their regulatory subunits, have been discovered to cause rare, specific types of IE. It was hypothesized that there are simple genetic bases for IE in some purebred dog breeds, specifically in Vizslas, English Springer Spaniels (ESS), Greater Swiss Mountain Dogs (GSMD), and Beagles, and that the gene(s) responsible may, in some cases, be the same as those already discovered in humans. Candidate genes known to be involved in human epilepsy, along with selected additional genes in the same gene families that are involved in murine epilepsy or are expressed in neural tissue, were examined in populations of affected and unaffected dogs. Microsatellite markers in close proximity to each candidate gene were genotyped and subjected to two-point linkage in Vizslas, and association analysis in ESS, GSMD and Beagles. Most of these candidate genes were not significantly associated with IE in these four dog breeds, while a few genes remained inconclusive. Other genes not included in this study may still be causing monogenic IE in these breeds or, like many cases of human IE, the disease in dogs may be likewise polygenic.

Adaptation to climate through flowering phenology: a case study in Medicago truncatula.

PubMed

Burgarella, Concetta; Chantret, Nathalie; Gay, Laurène; Prosperi, Jean-Marie; Bonhomme, Maxime; Tiffin, Peter; Young, Nevin D; Ronfort, Joelle

2016-07-01

Local climatic conditions likely constitute an important selective pressure on genes underlying important fitness-related traits such as flowering time, and in many species, flowering phenology and climatic gradients strongly covary. To test whether climate shapes the genetic variation on flowering time genes and to identify candidate flowering genes involved in the adaptation to environmental heterogeneity, we used a large Medicago truncatula core collection to examine the association between nucleotide polymorphisms at 224 candidate genes and both climate variables and flowering phenotypes. Unlike genome-wide studies, candidate gene approaches are expected to enrich for the number of meaningful trait associations because they specifically target genes that are known to affect the trait of interest. We found that flowering time mediates adaptation to climatic conditions mainly by variation at genes located upstream in the flowering pathways, close to the environmental stimuli. Variables related to the annual precipitation regime reflected selective constraints on flowering time genes better than the other variables tested (temperature, altitude, latitude or longitude). By comparing phenotype and climate associations, we identified 12 flowering genes as the most promising candidates responsible for phenological adaptation to climate. Four of these genes were located in the known flowering time QTL region on chromosome 7. However, climate and flowering associations also highlighted largely distinct gene sets, suggesting different genetic architectures for adaptation to climate and flowering onset. © 2016 John Wiley & Sons Ltd.

Genetic risk factors of systemic lupus erythematosus in the Malaysian population: a minireview.

PubMed

Chai, Hwa Chia; Phipps, Maude Elvira; Chua, Kek Heng

2012-01-01

SLE is an autoimmune disease that is not uncommon in Malaysia. In contrast to Malays and Indians, the Chinese seem to be most affected. SLE is characterized by deficiency of body's immune response that leads to production of autoantibodies and failure of immune complex clearance. This minireview attempts to summarize the association of several candidate genes with risk for SLE in the Malaysian population and discuss the genetic heterogeneity that exists locally in Asians and in comparison with SLE in Caucasians. Several groups of researchers have been actively investigating genes that are associated with SLE susceptibility in the Malaysian population by screening possible reported candidate genes across the SLE patients and healthy controls. These candidate genes include MHC genes and genes encoding complement components, TNF, FcγR, T-cell receptors, and interleukins. However, most of the polymorphisms investigated in these genes did not show significant associations with susceptibility to SLE in the Malaysian scenario, except for those occurring in MHC genes and genes coding for TNF-α, IL-1β, IL-1RN, and IL-6.

Genetic Risk Factors of Systemic Lupus Erythematosus in the Malaysian Population: A Minireview

PubMed Central

Chai, Hwa Chia; Phipps, Maude Elvira; Chua, Kek Heng

2012-01-01

SLE is an autoimmune disease that is not uncommon in Malaysia. In contrast to Malays and Indians, the Chinese seem to be most affected. SLE is characterized by deficiency of body's immune response that leads to production of autoantibodies and failure of immune complex clearance. This minireview attempts to summarize the association of several candidate genes with risk for SLE in the Malaysian population and discuss the genetic heterogeneity that exists locally in Asians and in comparison with SLE in Caucasians. Several groups of researchers have been actively investigating genes that are associated with SLE susceptibility in the Malaysian population by screening possible reported candidate genes across the SLE patients and healthy controls. These candidate genes include MHC genes and genes encoding complement components, TNF, FcγR, T-cell receptors, and interleukins. However, most of the polymorphisms investigated in these genes did not show significant associations with susceptibility to SLE in the Malaysian scenario, except for those occurring in MHC genes and genes coding for TNF-α, IL-1β, IL-1RN, and IL-6. PMID:21941582

Mapping a candidate gene (MdMYB10) for red flesh and foliage colour in apple

PubMed Central

Chagné, David; Carlisle, Charmaine M; Blond, Céline; Volz, Richard K; Whitworth, Claire J; Oraguzie, Nnadozie C; Crowhurst, Ross N; Allan, Andrew C; Espley, Richard V; Hellens, Roger P; Gardiner, Susan E

2007-01-01

Background Integrating plant genomics and classical breeding is a challenge for both plant breeders and molecular biologists. Marker-assisted selection (MAS) is a tool that can be used to accelerate the development of novel apple varieties such as cultivars that have fruit with anthocyanin through to the core. In addition, determining the inheritance of novel alleles, such as the one responsible for red flesh, adds to our understanding of allelic variation. Our goal was to map candidate anthocyanin biosynthetic and regulatory genes in a population segregating for the red flesh phenotypes. Results We have identified the Rni locus, a major genetic determinant of the red foliage and red colour in the core of apple fruit. In a population segregating for the red flesh and foliage phenotype we have determined the inheritance of the Rni locus and DNA polymorphisms of candidate anthocyanin biosynthetic and regulatory genes. Simple Sequence Repeats (SSRs) and Single Nucleotide Polymorphisms (SNPs) in the candidate genes were also located on an apple genetic map. We have shown that the MdMYB10 gene co-segregates with the Rni locus and is on Linkage Group (LG) 09 of the apple genome. Conclusion We have performed candidate gene mapping in a fruit tree crop and have provided genetic evidence that red colouration in the fruit core as well as red foliage are both controlled by a single locus named Rni. We have shown that the transcription factor MdMYB10 may be the gene underlying Rni as there were no recombinants between the marker for this gene and the red phenotype in a population of 516 individuals. Associating markers derived from candidate genes with a desirable phenotypic trait has demonstrated the application of genomic tools in a breeding programme of a horticultural crop species. PMID:17608951

Genetic Variation in the MAPK/ERK Pathway Affects Contact Hypersensitivity Responses.

PubMed

Legrand, Julien M D; Roy, Edwige; Baz, Batoul; Mukhopadhyay, Pamela; Wong, Ho Yi; Ram, Ramesh; Morahan, Grant; Walker, Graeme; Khosrotehrani, Kiarash

2018-05-10

Using a genetic resource that enables rapid mapping of genes for complex traits, we demonstrate dramatic diversity between murine strains in response to immune challenge. We identified several candidate genes that point to the MAPK/ERK pathway as a key modulator of this process. Copyright © 2018. Published by Elsevier Inc.

RNA expression of genes involved in cytarabine metabolism and transport predicts cytarabine response in acute myeloid leukemia.

PubMed

Abraham, Ajay; Varatharajan, Savitha; Karathedath, Sreeja; Philip, Chepsy; Lakshmi, Kavitha M; Jayavelu, Ashok Kumar; Mohanan, Ezhilpavai; Janet, Nancy Beryl; Srivastava, Vivi M; Shaji, Ramachandran V; Zhang, Wei; Abraham, Aby; Viswabandya, Auro; George, Biju; Chandy, Mammen; Srivastava, Alok; Mathews, Vikram; Balasubramanian, Poonkuzhali

2015-07-01

Variation in terms of outcome and toxic side effects of treatment exists among acute myeloid leukemia (AML) patients on chemotherapy with cytarabine (Ara-C) and daunorubicin (Dnr). Candidate Ara-C metabolizing gene expression in primary AML cells is proposed to account for this variation. Ex vivo Ara-C sensitivity was determined in primary AML samples using MTT assay. mRNA expression of candidate Ara-C metabolizing genes were evaluated by RQPCR analysis. Global gene expression profiling was carried out for identifying differentially expressed genes between exvivo Ara-C sensitive and resistant samples. Wide interindividual variations in ex vivo Ara-C cytotoxicity were observed among samples from patients with AML and were stratified into sensitive, intermediately sensitive and resistant, based on IC50 values obtained by MTT assay. RNA expression of deoxycytidine kinase (DCK), human equilibrative nucleoside transporter-1 (ENT1) and ribonucleotide reductase M1 (RRM1) were significantly higher and cytidine deaminase (CDA) was significantly lower in ex vivo Ara-C sensitive samples. Higher DCK and RRM1 expression in AML patient's blast correlated with better DFS. Ara-C resistance index (RI), a mathematically derived quotient was proposed based on candidate gene expression pattern. Ara-C ex vivo sensitive samples were found to have significantly lower RI compared with resistant as well as samples from patients presenting with relapse. Patients with low RI supposedly highly sensitive to Ara-C were found to have higher incidence of induction death (p = 0.002; RR: 4.35 [95% CI: 1.69-11.22]). Global gene expression profiling undertaken to find out additional contributors of Ara-C resistance identified many apoptosis as well as metabolic pathway genes to be differentially expressed between Ara-C resistant and sensitive samples. This study highlights the importance of evaluating expression of candidate Ara-C metabolizing genes in predicting ex vivo drug response as well as treatment outcome. RI could be a predictor of ex vivo Ara-C response irrespective of cytogenetic and molecular risk groups and a potential biomarker for AML treatment outcome and toxicity. Original submitted 22 December 2014; Revision submitted 9 April 2015.

Transcriptome mining: Multigene panel to test delousing drug response in the sea louse Caligus rogercresseyi.

PubMed

Valenzuela-Muñoz, V; Gallardo-Escárate, C

2016-02-01

Controlling infestations of copepodid ectoparasites in the salmon industry is increasingly problematic given higher instances of drug resistance or loss of sensitivity. Despite the importance of this issue, the molecular mechanisms and genes implicated in resistance/susceptibility are only scarcely understood. The objective of the present study was to identify and evaluate the expression levels of candidate genes associated with delousing drug response in the sea louse Caligus rogercresseyi. From RNA-seq data obtained for adult male and female sea lice, 62.48 M reads were assembled in 70,349 high-quality contigs. BLASTX analysis against UniprotKB/Swiss-Prot and the ESTs available for crustaceans in the NCBI database identified 870 transcripts previously related to genes associated with delousing drug response. Furthermore, 14 candidate genes were validated through RT-qPCR and were evaluated with deltamethrin and azamethiphos bioassays. The results evidenced an overregulation of genes involved in ion transport in salmon lice treated with deltamethrin, while those treated with azamethiphos evidenced an overregulation of genes such as cytochrome P450, Carboxylesterase, and acetylcholine receptors. The present study provides a multigene panel to test delousing drug response to pyrethroids and organophosphates in a highly prevalent pathogen of the Chilean salmon industry. Copyright © 2015 Elsevier B.V. All rights reserved.

Implications of genome wide association studies for addiction: are our a priori assumptions all wrong?

PubMed

Hall, F Scott; Drgonova, Jana; Jain, Siddharth; Uhl, George R

2013-12-01

Substantial genetic contributions to addiction vulnerability are supported by data from twin studies, linkage studies, candidate gene association studies and, more recently, Genome Wide Association Studies (GWAS). Parallel to this work, animal studies have attempted to identify the genes that may contribute to responses to addictive drugs and addiction liability, initially focusing upon genes for the targets of the major drugs of abuse. These studies identified genes/proteins that affect responses to drugs of abuse; however, this does not necessarily mean that variation in these genes contributes to the genetic component of addiction liability. One of the major problems with initial linkage and candidate gene studies was an a priori focus on the genes thought to be involved in addiction based upon the known contributions of those proteins to drug actions, making the identification of novel genes unlikely. The GWAS approach is systematic and agnostic to such a priori assumptions. From the numerous GWAS now completed several conclusions may be drawn: (1) addiction is highly polygenic; each allelic variant contributing in a small, additive fashion to addiction vulnerability; (2) unexpected, compared to our a priori assumptions, classes of genes are most important in explaining addiction vulnerability; (3) although substantial genetic heterogeneity exists, there is substantial convergence of GWAS signals on particular genes. This review traces the history of this research; from initial transgenic mouse models based upon candidate gene and linkage studies, through the progression of GWAS for addiction and nicotine cessation, to the current human and transgenic mouse studies post-GWAS. © 2013.

Immune Profiles to Predict Response to Desensitization Therapy in Highly HLA-Sensitized Kidney Transplant Candidates

PubMed Central

Yabu, Julie M.; Siebert, Janet C.; Maecker, Holden T.

2016-01-01

Background Kidney transplantation is the most effective treatment for end-stage kidney disease. Sensitization, the formation of human leukocyte antigen (HLA) antibodies, remains a major barrier to successful kidney transplantation. Despite the implementation of desensitization strategies, many candidates fail to respond. Current progress is hindered by the lack of biomarkers to predict response and to guide therapy. Our objective was to determine whether differences in immune and gene profiles may help identify which candidates will respond to desensitization therapy. Methods and Findings Single-cell mass cytometry by time-of-flight (CyTOF) phenotyping, gene arrays, and phosphoepitope flow cytometry were performed in a study of 20 highly sensitized kidney transplant candidates undergoing desensitization therapy. Responders to desensitization therapy were defined as 5% or greater decrease in cumulative calculated panel reactive antibody (cPRA) levels, and non-responders had 0% decrease in cPRA. Using a decision tree analysis, we found that a combination of transitional B cell and regulatory T cell (Treg) frequencies at baseline before initiation of desensitization therapy could distinguish responders from non-responders. Using a support vector machine (SVM) and longitudinal data, TRAF3IP3 transcripts and HLA-DR-CD38+CD4+ T cells could also distinguish responders from non-responders. Combining all assays in a multivariate analysis and elastic net regression model with 72 analytes, we identified seven that were highly interrelated and eleven that predicted response to desensitization therapy. Conclusions Measuring baseline and longitudinal immune and gene profiles could provide a useful strategy to distinguish responders from non-responders to desensitization therapy. This study presents the integration of novel translational studies including CyTOF immunophenotyping in a multivariate analysis model that has potential applications to predict response to desensitization, select candidates, and personalize medicine to ultimately improve overall outcomes in highly sensitized kidney transplant candidates. PMID:27078882

Immune Profiles to Predict Response to Desensitization Therapy in Highly HLA-Sensitized Kidney Transplant Candidates.

PubMed

Yabu, Julie M; Siebert, Janet C; Maecker, Holden T

2016-01-01

Kidney transplantation is the most effective treatment for end-stage kidney disease. Sensitization, the formation of human leukocyte antigen (HLA) antibodies, remains a major barrier to successful kidney transplantation. Despite the implementation of desensitization strategies, many candidates fail to respond. Current progress is hindered by the lack of biomarkers to predict response and to guide therapy. Our objective was to determine whether differences in immune and gene profiles may help identify which candidates will respond to desensitization therapy. Single-cell mass cytometry by time-of-flight (CyTOF) phenotyping, gene arrays, and phosphoepitope flow cytometry were performed in a study of 20 highly sensitized kidney transplant candidates undergoing desensitization therapy. Responders to desensitization therapy were defined as 5% or greater decrease in cumulative calculated panel reactive antibody (cPRA) levels, and non-responders had 0% decrease in cPRA. Using a decision tree analysis, we found that a combination of transitional B cell and regulatory T cell (Treg) frequencies at baseline before initiation of desensitization therapy could distinguish responders from non-responders. Using a support vector machine (SVM) and longitudinal data, TRAF3IP3 transcripts and HLA-DR-CD38+CD4+ T cells could also distinguish responders from non-responders. Combining all assays in a multivariate analysis and elastic net regression model with 72 analytes, we identified seven that were highly interrelated and eleven that predicted response to desensitization therapy. Measuring baseline and longitudinal immune and gene profiles could provide a useful strategy to distinguish responders from non-responders to desensitization therapy. This study presents the integration of novel translational studies including CyTOF immunophenotyping in a multivariate analysis model that has potential applications to predict response to desensitization, select candidates, and personalize medicine to ultimately improve overall outcomes in highly sensitized kidney transplant candidates.

Transcriptional mechanisms of resistance to anti-PD-1 therapy

PubMed Central

Ascierto, Maria L.; Makohon-Moore, Alvin; Lipson, Evan J.; Taube, Janis M.; McMiller, Tracee L.; Berger, Alan E.; Fan, Jinshui; Kaunitz, Genevieve J.; Cottrell, Tricia R.; Kohutek, Zachary A.; Favorov, Alexander; Makarov, Vladimir; Riaz, Nadeem; Chan, Timothy A.; Cope, Leslie; Hruban, Ralph H.; Pardoll, Drew M.; Taylor, Barry S.; Solit, David B.; Iacobuzio-Donahue, Christine A; Topalian, Suzanne L.

2017-01-01

Purpose To explore factors associated with response and resistance to anti-PD-1 therapy, we analyzed multiple disease sites at autopsy in a patient with widely metastatic melanoma who had a heterogeneous response. Materials and Methods Twenty-six melanoma specimens (four pre-mortem, 22 post-mortem) were subjected to whole-exome sequencing. Candidate immunologic markers and gene expression were assessed in ten cutaneous metastases showing response or progression during therapy. Results The melanoma was driven by biallelic inactivation of NF1. All lesions had highly concordant mutational profiles and copy number alterations, indicating linear clonal evolution. Expression of candidate immunologic markers was similar in responding and progressing lesions. However, progressing cutaneous metastases were associated with over-expression of genes associated with extracellular matrix and neutrophil function. Conclusions Although mutational and immunologic differences have been proposed as the primary determinants of heterogeneous response/resistance to targeted therapies and immunotherapies, respectively, differential lesional gene expression profiles may also dictate anti-PD-1 outcomes. PMID:28193624

ARG1 Is a Novel Bronchodilator Response Gene

PubMed Central

Litonjua, Augusto A.; Lasky-Su, Jessica; Schneiter, Kady; Tantisira, Kelan G.; Lazarus, Ross; Klanderman, Barbara; Lima, John J.; Irvin, Charles G.; Peters, Stephen P.; Hanrahan, John P.; Liggett, Stephen B.; Hawkins, Gregory A.; Meyers, Deborah A.; Bleecker, Eugene R.; Lange, Christoph; Weiss, Scott T.

2008-01-01

Rationale: Inhaled β-agonists are one of the most widely used classes of drugs for the treatment of asthma. However, a substantial proportion of patients with asthma do not have a favorable response to these drugs, and identifying genetic determinants of drug response may aid in tailoring treatment for individual patients. Objectives: To screen variants in candidate genes in the steroid and β-adrenergic pathways for association with response to inhaled β-agonists. Methods: We genotyped 844 single nucleotide polymorphisms (SNPs) in 111 candidate genes in 209 children and their parents participating in the Childhood Asthma Management Program. We screened the association of these SNPs with acute response to inhaled β-agonists (bronchodilator response [BDR]) using a novel algorithm implemented in a family-based association test that ranked SNPs in order of statistical power. Genes that had SNPs with median power in the highest quartile were then taken for replication analyses in three other asthma cohorts. Measurements and Main Results: We identified 17 genes from the screening algorithm and genotyped 99 SNPs from these genes in a second population of patients with asthma. We then genotyped 63 SNPs from four genes with significant associations with BDR, for replication in a third and fourth population of patients with asthma. Evidence for association from the four asthma cohorts was combined, and SNPs from ARG1 were significantly associated with BDR. SNP rs2781659 survived Bonferroni correction for multiple testing (combined P value = 0.00048, adjusted P value = 0.047). Conclusions: These findings identify ARG1 as a novel gene for acute BDR in both children and adults with asthma. PMID:18617639

Predicting response to primary chemotherapy: gene expression profiling of paraffin-embedded core biopsy tissue.

PubMed

Mina, Lida; Soule, Sharon E; Badve, Sunil; Baehner, Fredrick L; Baker, Joffre; Cronin, Maureen; Watson, Drew; Liu, Mei-Lan; Sledge, George W; Shak, Steve; Miller, Kathy D

2007-06-01

Primary chemotherapy provides an ideal opportunity to correlate gene expression with response to treatment. We used paraffin-embedded core biopsies from a completed phase II trial to identify genes that correlate with response to primary chemotherapy. Patients with newly diagnosed stage II or III breast cancer were treated with sequential doxorubicin 75 mg/M2 q2 wks x 3 and docetaxel 40 mg/M2 weekly x 6; treatment order was randomly assigned. Pretreatment core biopsy samples were interrogated for genes that might correlate with pathologic complete response (pCR). In addition to the individual genes, the correlation of the Oncotype DX Recurrence Score with pCR was examined. Of 70 patients enrolled in the parent trial, core biopsies samples with sufficient RNA for gene analyses were available from 45 patients; 9 (20%) had inflammatory breast cancer (IBC). Six (14%) patients achieved a pCR. Twenty-two of the 274 candidate genes assessed correlated with pCR (p < 0.05). Genes correlating with pCR could be grouped into three large clusters: angiogenesis-related genes, proliferation related genes, and invasion-related genes. Expression of estrogen receptor (ER)-related genes and Recurrence Score did not correlate with pCR. In an exploratory analysis we compared gene expression in IBC to non-inflammatory breast cancer; twenty-four (9%) of the genes were differentially expressed (p < 0.05), 5 were upregulated and 19 were downregulated in IBC. Gene expression analysis on core biopsy samples is feasible and identifies candidate genes that correlate with pCR to primary chemotherapy. Gene expression in IBC differs significantly from noninflammatory breast cancer.

Pharmacogenetic study focused on fluoxetine pharmacodynamics in children and adolescent patients: impact of the serotonin pathway.

PubMed

Mas, Sergi; Blázquez, Ana; Rodríguez, Natalia; Boloc, Daniel; Lafuente, Amalia; Arnaiz, Joan A; Lázaro, Luisa; Gassó, Patricia

2016-11-01

Pharmacogenetic studies of fluoxetine in children and adolescents are scarce. After reporting the effect of genetic variants in genes related to the fluoxetine pharmacokinetics on clinical response in a pediatric population, we now evaluate the impact of genetic markers involved in its pharmacodynamics. The assessment was performed in 83 patients after 12 weeks of fluoxetine treatment. The genetic association analysis included a total of 316 validated single nucleotide polymorphisms in 45 candidate genes involved in six different pathways. Clinical improvement after treatment with fluoxetine in our pediatric population was associated significantly with two polymorphisms located in genes related to the serotonergic system: the 5-hydroxytryptamine receptor 1B (HTR1B) and the tryptophan 5-hydroxylase 2 (TPH2). Although a wide range of candidate genes related to different pathways were assessed, the results show that genetic markers directly related to serotonin have an important effect on fluoxetine response.

Genome-wide association study of acute post-surgical pain in humans

PubMed Central

Kim, Hyungsuk; Ramsay, Edward; Lee, Hyewon; Wahl, Sharon; Dionne, Raymond A

2009-01-01

Aims Testing a relatively small genomic region with a few hundred SNPs provides limited information. Genome-wide association studies (GWAS) provide an opportunity to overcome the limitation of candidate gene association studies. Here, we report the results of a GWAS for the responses to an NSAID analgesic. Materials & methods European Americans (60 females and 52 males) undergoing oral surgery were genotyped with Affymetrix 500K SNP assay. Additional SNP genotyping was performed from the gene in linkage disequilibrium with the candidate SNP revealed by the GWAS. Results GWAS revealed a candidate SNP (rs2562456) associated with analgesic onset, which is in linkage disequilibrium with a gene encoding a zinc finger protein. Additional SNP genotyping of ZNF429 confirmed the association with analgesic onset in humans (p = 1.8 × 10−10, degrees of freedom = 103, F = 28.3). We also found candidate loci for the maximum post-operative pain rating (rs17122021, p = 6.9 × 10−7) and post-operative pain onset time (rs6693882, p = 2.1 × 10−6), however, correcting for multiple comparisons did not sustain these genetic associations. Conclusion GWAS for acute clinical pain followed by additional SNP genotyping of a neighboring gene suggests that genetic variations in or near the loci encoding DNA binding proteins play a role in the individual variations in responses to analgesic drugs. PMID:19207018

Transcriptome profiling of two maize inbreds with distinct responses to Gibberella ear rot disease to identify candidate resistance genes.

PubMed

Kebede, Aida Z; Johnston, Anne; Schneiderman, Danielle; Bosnich, Whynn; Harris, Linda J

2018-02-09

Gibberella ear rot (GER) is one of the most economically important fungal diseases of maize in the temperate zone due to moldy grain contaminated with health threatening mycotoxins. To develop resistant genotypes and control the disease, understanding the host-pathogen interaction is essential. RNA-Seq-derived transcriptome profiles of fungal- and mock-inoculated developing kernel tissues of two maize inbred lines were used to identify differentially expressed transcripts and propose candidate genes mapping within GER resistance quantitative trait loci (QTL). A total of 1255 transcripts were significantly (P ≤ 0.05) up regulated due to fungal infection in both susceptible and resistant inbreds. A greater number of transcripts were up regulated in the former (1174) than the latter (497) and increased as the infection progressed from 1 to 2 days after inoculation. Focusing on differentially expressed genes located within QTL regions for GER resistance, we identified 81 genes involved in membrane transport, hormone regulation, cell wall modification, cell detoxification, and biosynthesis of pathogenesis related proteins and phytoalexins as candidate genes contributing to resistance. Applying droplet digital PCR, we validated the expression profiles of a subset of these candidate genes from QTL regions contributed by the resistant inbred on chromosomes 1, 2 and 9. By screening global gene expression profiles for differentially expressed genes mapping within resistance QTL regions, we have identified candidate genes for gibberella ear rot resistance on several maize chromosomes which could potentially lead to a better understanding of Fusarium resistance mechanisms.

Identification of Putative Transmembrane Proteins Involved in Salinity Tolerance in Chenopodium quinoa by Integrating Physiological Data, RNAseq, and SNP Analyses

PubMed Central

Schmöckel, Sandra M.; Lightfoot, Damien J.; Razali, Rozaimi; Tester, Mark; Jarvis, David E.

2017-01-01

Chenopodium quinoa (quinoa) is an emerging crop that produces nutritious grains with the potential to contribute to global food security. Quinoa can also grow on marginal lands, such as soils affected by high salinity. To identify candidate salt tolerance genes in the recently sequenced quinoa genome, we used a multifaceted approach integrating RNAseq analyses with comparative genomics and topology prediction. We identified 219 candidate genes by selecting those that were differentially expressed in response to salinity, were specific to or overrepresented in quinoa relative to other Amaranthaceae species, and had more than one predicted transmembrane domain. To determine whether these genes might underlie variation in salinity tolerance in quinoa and its close relatives, we compared the response to salinity stress in a panel of 21 Chenopodium accessions (14 C. quinoa, 5 C. berlandieri, and 2 C. hircinum). We found large variation in salinity tolerance, with one C. hircinum displaying the highest salinity tolerance. Using genome re-sequencing data from these accessions, we investigated single nucleotide polymorphisms and copy number variation (CNV) in the 219 candidate genes in accessions of contrasting salinity tolerance, and identified 15 genes that could contribute to the differences in salinity tolerance of these Chenopodium accessions. PMID:28680429

Transcriptome response of the foundation plant Spartina alterniflora to the Deepwater Horizon oil spill.

PubMed

Alvarez, Mariano; Ferreira de Carvalho, Julie; Salmon, Armel; Ainouche, Malika L; Cavé-Radet, Armand; El Amrani, Abdelhak; Foster, Tammy E; Moyer, Sydney; Richards, Christina L

2018-06-04

Despite the severe impacts of the Deepwater Horizon oil spill, the foundation plant species Spartina alterniflora proved resilient to heavy oiling, providing an opportunity to identify mechanisms of response to the anthropogenic stress of crude oil exposure. We assessed plants from oil-affected and unaffected populations using a custom DNA microarray to identify genomewide transcription patterns and gene expression networks that respond to crude oil exposure. In addition, we used T-DNA insertion lines of the model grass Brachypodium distachyon to assess the contribution of four novel candidate genes to crude oil response. Responses in S. alterniflora to hydrocarbon exposure across the transcriptome as well as xenobiotic specific response pathways had little overlap with those previously identified in the model plant Arabidopsis thaliana. Among T-DNA insertion lines of B. distachyon, we found additional support for two candidate genes, one (ATTPS21) involved in volatile production, and the other (SUVH5) involved in epigenetic regulation of gene expression, that may be important in the response to crude oil. The architecture of crude oil response in S. alterniflora is unique from that of the model species A. thaliana, suggesting that xenobiotic response may be highly variable across plant species. In addition, further investigations of regulatory networks may benefit from more information about epigenetic response pathways. © 2018 John Wiley & Sons Ltd.

Transcriptional Regulatory Network Analysis of MYB Transcription Factor Family Genes in Rice.

PubMed

Smita, Shuchi; Katiyar, Amit; Chinnusamy, Viswanathan; Pandey, Dev M; Bansal, Kailash C

2015-01-01

MYB transcription factor (TF) is one of the largest TF families and regulates defense responses to various stresses, hormone signaling as well as many metabolic and developmental processes in plants. Understanding these regulatory hierarchies of gene expression networks in response to developmental and environmental cues is a major challenge due to the complex interactions between the genetic elements. Correlation analyses are useful to unravel co-regulated gene pairs governing biological process as well as identification of new candidate hub genes in response to these complex processes. High throughput expression profiling data are highly useful for construction of co-expression networks. In the present study, we utilized transcriptome data for comprehensive regulatory network studies of MYB TFs by "top-down" and "guide-gene" approaches. More than 50% of OsMYBs were strongly correlated under 50 experimental conditions with 51 hub genes via "top-down" approach. Further, clusters were identified using Markov Clustering (MCL). To maximize the clustering performance, parameter evaluation of the MCL inflation score (I) was performed in terms of enriched GO categories by measuring F-score. Comparison of co-expressed cluster and clads analyzed from phylogenetic analysis signifies their evolutionarily conserved co-regulatory role. We utilized compendium of known interaction and biological role with Gene Ontology enrichment analysis to hypothesize function of coexpressed OsMYBs. In the other part, the transcriptional regulatory network analysis by "guide-gene" approach revealed 40 putative targets of 26 OsMYB TF hubs with high correlation value utilizing 815 microarray data. The putative targets with MYB-binding cis-elements enrichment in their promoter region, functional co-occurrence as well as nuclear localization supports our finding. Specially, enrichment of MYB binding regions involved in drought-inducibility implying their regulatory role in drought response in rice. Thus, the co-regulatory network analysis facilitated the identification of complex OsMYB regulatory networks, and candidate target regulon genes of selected guide MYB genes. The results contribute to the candidate gene screening, and experimentally testable hypotheses for potential regulatory MYB TFs, and their targets under stress conditions.

Genomic analysis of human lung fibroblasts exposed to vanadium pentoxide to identify candidate genes for occupational bronchitis

PubMed Central

Ingram, Jennifer L; Antao-Menezes, Aurita; Turpin, Elizabeth A; Wallace, Duncan G; Mangum, James B; Pluta, Linda J; Thomas, Russell S; Bonner, James C

2007-01-01

Background Exposure to vanadium pentoxide (V2O5) is a cause of occupational bronchitis. We evaluated gene expression profiles in cultured human lung fibroblasts exposed to V2O5 in vitro in order to identify candidate genes that could play a role in inflammation, fibrosis, and repair during the pathogenesis of V2O5-induced bronchitis. Methods Normal human lung fibroblasts were exposed to V2O5 in a time course experiment. Gene expression was measured at various time points over a 24 hr period using the Affymetrix Human Genome U133A 2.0 Array. Selected genes that were significantly changed in the microarray experiment were validated by RT-PCR. Results V2O5 altered more than 1,400 genes, of which ~300 were induced while >1,100 genes were suppressed. Gene ontology categories (GO) categories unique to induced genes included inflammatory response and immune response, while GO catogories unique to suppressed genes included ubiquitin cycle and cell cycle. A dozen genes were validated by RT-PCR, including growth factors (HBEGF, VEGF, CTGF), chemokines (IL8, CXCL9, CXCL10), oxidative stress response genes (SOD2, PIPOX, OXR1), and DNA-binding proteins (GAS1, STAT1). Conclusion Our study identified a variety of genes that could play pivotal roles in inflammation, fibrosis and repair during V2O5-induced bronchitis. The induction of genes that mediate inflammation and immune responses, as well as suppression of genes involved in growth arrest appear to be important to the lung fibrotic reaction to V2O5. PMID:17459161

Exploiting Differential Gene Expression and Epistasis to Discover Candidate Genes for Drought-Associated QTLs in Arabidopsis thaliana.

PubMed

Lovell, John T; Mullen, Jack L; Lowry, David B; Awole, Kedija; Richards, James H; Sen, Saunak; Verslues, Paul E; Juenger, Thomas E; McKay, John K

2015-04-01

Soil water availability represents one of the most important selective agents for plants in nature and the single greatest abiotic determinant of agricultural productivity, yet the genetic bases of drought acclimation responses remain poorly understood. Here, we developed a systems-genetic approach to characterize quantitative trait loci (QTLs), physiological traits and genes that affect responses to soil moisture deficit in the TSUxKAS mapping population of Arabidopsis thaliana. To determine the effects of candidate genes underlying QTLs, we analyzed gene expression as a covariate within the QTL model in an effort to mechanistically link markers, RNA expression, and the phenotype. This strategy produced ranked lists of candidate genes for several drought-associated traits, including water use efficiency, growth, abscisic acid concentration (ABA), and proline concentration. As a proof of concept, we recovered known causal loci for several QTLs. For other traits, including ABA, we identified novel loci not previously associated with drought. Furthermore, we documented natural variation at two key steps in proline metabolism and demonstrated that the mitochondrial genome differentially affects genomic QTLs to influence proline accumulation. These findings demonstrate that linking genome, transcriptome, and phenotype data holds great promise to extend the utility of genetic mapping, even when QTL effects are modest or complex. © 2015 American Society of Plant Biologists. All rights reserved.

Variants in Pharmacokinetic Transporters and Glycemic Response to Metformin: A Metgen Meta‐Analysis

PubMed Central

Dujic, T; Zhou, K; Yee, SW; van Leeuwen, N; de Keyser, CE; Javorský, M; Goswami, S; Zaharenko, L; Hougaard Christensen, MM; Out, M; Tavendale, R; Kubo, M; Hedderson, MM; van der Heijden, AA; Klimčáková, L; Pirags, V; Kooy, A; Brøsen, K; Klovins, J; Semiz, S; Tkáč, I; Stricker, BH; Palmer, CNA; 't Hart, LM; Giacomini, KM

2017-01-01

Therapeutic response to metformin, a first‐line drug for type 2 diabetes (T2D), is highly variable, in part likely due to genetic factors. To date, metformin pharmacogenetic studies have mainly focused on the impact of variants in metformin transporter genes, with inconsistent results. To clarify the significance of these variants in glycemic response to metformin in T2D, we performed a large‐scale meta‐analysis across the cohorts of the Metformin Genetics Consortium (MetGen). Nine candidate polymorphisms in five transporter genes (organic cation transporter [OCT]1, OCT2, multidrug and toxin extrusion transporter [MATE]1, MATE2‐K, and OCTN1) were analyzed in up to 7,968 individuals. None of the variants showed a significant effect on metformin response in the primary analysis, or in the exploratory secondary analyses, when patients were stratified according to possible confounding genotypes or prescribed a daily dose of metformin. Our results suggest that candidate transporter gene variants have little contribution to variability in glycemic response to metformin in T2D. PMID:27859023

Identifying positive selection candidate loci for high-altitude adaptation in Andean populations

PubMed Central

2009-01-01

High-altitude environments (>2,500 m) provide scientists with a natural laboratory to study the physiological and genetic effects of low ambient oxygen tension on human populations. One approach to understanding how life at high altitude has affected human metabolism is to survey genome-wide datasets for signatures of natural selection. In this work, we report on a study to identify selection-nominated candidate genes involved in adaptation to hypoxia in one highland group, Andeans from the South American Altiplano. We analysed dense microarray genotype data using four test statistics that detect departures from neutrality. Using a candidate gene, single nucleotide polymorphism-based approach, we identified genes exhibiting preliminary evidence of recent genetic adaptation in this population. These included genes that are part of the hypoxia-inducible transcription factor (HIF) pathway, a biochemical pathway involved in oxygen homeostasis, as well as three other genomic regions previously not known to be associated with high-altitude phenotypes. In addition to identifying selection-nominated candidate genes, we also tested whether the HIF pathway shows evidence of natural selection. Our results indicate that the genes of this biochemical pathway as a group show no evidence of having evolved in response to hypoxia in Andeans. Results from particular HIF-targeted genes, however, suggest that genes in this pathway could play a role in Andean adaptation to high altitude, even if the pathway as a whole does not show higher relative rates of evolution. These data suggest a genetic role in high-altitude adaptation and provide a basis for genotype/phenotype association studies that are necessary to confirm the role of putative natural selection candidate genes and gene regions in adaptation to altitude. PMID:20038496

Exome Sequencing and Linkage Analysis Identified Novel Candidate Genes in Recessive Intellectual Disability Associated with Ataxia.

PubMed

Jazayeri, Roshanak; Hu, Hao; Fattahi, Zohreh; Musante, Luciana; Abedini, Seyedeh Sedigheh; Hosseini, Masoumeh; Wienker, Thomas F; Ropers, Hans Hilger; Najmabadi, Hossein; Kahrizi, Kimia

2015-10-01

Intellectual disability (ID) is a neuro-developmental disorder which causes considerable socio-economic problems. Some ID individuals are also affected by ataxia, and the condition includes different mutations affecting several genes. We used whole exome sequencing (WES) in combination with homozygosity mapping (HM) to identify the genetic defects in five consanguineous families among our cohort study, with two affected children with ID and ataxia as major clinical symptoms. We identified three novel candidate genes, RIPPLY1, MRPL10, SNX14, and a new mutation in known gene SURF1. All are autosomal genes, except RIPPLY1, which is located on the X chromosome. Two are housekeeping genes, implicated in transcription and translation regulation and intracellular trafficking, and two encode mitochondrial proteins. The pathogenesis of these variants was evaluated by mutation classification, bioinformatic methods, review of medical and biological relevance, co-segregation studies in the particular family, and a normal population study. Linkage analysis and exome sequencing of a small number of affected family members is a powerful new technique which can be used to decrease the number of candidate genes in heterogenic disorders such as ID, and may even identify the responsible gene(s).

Genome-Wide Identification of Differentially Expressed Genes Associated with the High Yielding of Oleoresin in Secondary Xylem of Masson Pine (Pinus massoniana Lamb) by Transcriptomic Analysis

PubMed Central

Liu, Qinghua; Zhou, Zhichun; Wei, Yongcheng; Shen, Danyu; Feng, Zhongping; Hong, Shanping

2015-01-01

Masson pine is an important timber and resource for oleoresin in South China. Increasing yield of oleoresin in stems can raise economic benefits and enhance the resistance to bark beetles. However, the genetic mechanisms for regulating the yield of oleoresin were still unknown. Here, high-throughput sequencing technology was used to investigate the transcriptome and compare the gene expression profiles of high and low oleoresin-yielding genotypes. A total of 40,690,540 reads were obtained and assembled into 137,499 transcripts from the secondary xylem tissues. We identified 84,842 candidate unigenes based on sequence annotation using various databases and 96 unigenes were candidates for terpenoid backbone biosynthesis in pine. By comparing the expression profiles of high and low oleoresin-yielding genotypes, 649 differentially expressed genes (DEGs) were identified. GO enrichment analysis of DEGs revealed that multiple pathways were related to high yield of oleoresin. Nine candidate genes were validated by QPCR analysis. Among them, the candidate genes encoding geranylgeranyl diphosphate synthase (GGPS) and (-)-alpha/beta-pinene synthase were up-regulated in the high oleoresin-yielding genotype, while tricyclene synthase revealed lower expression level, which was in good agreement with the GC/MS result. In addition, DEG encoding ABC transporters, pathogenesis-related proteins (PR5 and PR9), phosphomethylpyrimidine synthase, non-specific lipid-transfer protein-like protein and ethylene responsive transcription factors (ERFs) were also confirmed to be critical for the biosynthesis of oleoresin. The next-generation sequencing strategy used in this study has proven to be a powerful means for analyzing transcriptome variation related to the yield of oleoresin in masson pine. The candidate genes encoding GGPS, (-)-alpha/beta-pinene, tricyclene synthase, ABC transporters, non-specific lipid-transfer protein-like protein, phosphomethylpyrimidine synthase, ERFs and pathogen responses may play important roles in regulating the yield of oleoresin. These DEGs are worthy of special attention in future studies. PMID:26167875

Genome-Wide Identification of Regulatory Elements and Reconstruction of Gene Regulatory Networks of the Green Alga Chlamydomonas reinhardtii under Carbon Deprivation

PubMed Central

Vischi Winck, Flavia; Arvidsson, Samuel; Riaño-Pachón, Diego Mauricio; Hempel, Sabrina; Koseska, Aneta; Nikoloski, Zoran; Urbina Gomez, David Alejandro; Rupprecht, Jens; Mueller-Roeber, Bernd

2013-01-01

The unicellular green alga Chlamydomonas reinhardtii is a long-established model organism for studies on photosynthesis and carbon metabolism-related physiology. Under conditions of air-level carbon dioxide concentration [CO2], a carbon concentrating mechanism (CCM) is induced to facilitate cellular carbon uptake. CCM increases the availability of carbon dioxide at the site of cellular carbon fixation. To improve our understanding of the transcriptional control of the CCM, we employed FAIRE-seq (formaldehyde-assisted Isolation of Regulatory Elements, followed by deep sequencing) to determine nucleosome-depleted chromatin regions of algal cells subjected to carbon deprivation. Our FAIRE data recapitulated the positions of known regulatory elements in the promoter of the periplasmic carbonic anhydrase (Cah1) gene, which is upregulated during CCM induction, and revealed new candidate regulatory elements at a genome-wide scale. In addition, time series expression patterns of 130 transcription factor (TF) and transcription regulator (TR) genes were obtained for cells cultured under photoautotrophic condition and subjected to a shift from high to low [CO2]. Groups of co-expressed genes were identified and a putative directed gene-regulatory network underlying the CCM was reconstructed from the gene expression data using the recently developed IOTA (inner composition alignment) method. Among the candidate regulatory genes, two members of the MYB-related TF family, Lcr1 (Low-CO 2 response regulator 1) and Lcr2 (Low-CO 2 response regulator 2), may play an important role in down-regulating the expression of a particular set of TF and TR genes in response to low [CO2]. The results obtained provide new insights into the transcriptional control of the CCM and revealed more than 60 new candidate regulatory genes. Deep sequencing of nucleosome-depleted genomic regions indicated the presence of new, previously unknown regulatory elements in the C. reinhardtii genome. Our work can serve as a basis for future functional studies of transcriptional regulator genes and genomic regulatory elements in Chlamydomonas. PMID:24224019

Identification of candidate genes affecting Δ9-tetrahydrocannabinol biosynthesis in Cannabis sativa

PubMed Central

Marks, M. David; Tian, Li; Wenger, Jonathan P.; Omburo, Stephanie N.; Soto-Fuentes, Wilfredo; He, Ji; Gang, David R.; Weiblen, George D.; Dixon, Richard A.

2009-01-01

RNA isolated from the glands of a Δ9-tetrahydrocannabinolic acid (THCA)-producing strain of Cannabis sativa was used to generate a cDNA library containing over 100 000 expressed sequence tags (ESTs). Sequencing of over 2000 clones from the library resulted in the identification of over 1000 unigenes. Candidate genes for almost every step in the biochemical pathways leading from primary metabolites to THCA were identified. Quantitative PCR analysis suggested that many of the pathway genes are preferentially expressed in the glands. Hexanoyl-CoA, one of the metabolites required for THCA synthesis, could be made via either de novo fatty acids synthesis or via the breakdown of existing lipids. qPCR analysis supported the de novo pathway. Many of the ESTs encode transcription factors and two putative MYB genes were identified that were preferentially expressed in glands. Given the similarity of the Cannabis MYB genes to those in other species with known functions, these Cannabis MYBs may play roles in regulating gland development and THCA synthesis. Three candidates for the polyketide synthase (PKS) gene responsible for the first committed step in the pathway to THCA were characterized in more detail. One of these was identical to a previously reported chalcone synthase (CHS) and was found to have CHS activity. All three could use malonyl-CoA and hexanoyl-CoA as substrates, including the CHS, but reaction conditions were not identified that allowed for the production of olivetolic acid (the proposed product of the PKS activity needed for THCA synthesis). One of the PKS candidates was highly and specifically expressed in glands (relative to whole leaves) and, on the basis of these expression data, it is proposed to be the most likely PKS responsible for olivetolic acid synthesis in Cannabis glands. PMID:19581347

Molecular evidence that the p55 gene is not responsible for either of two Xq28-linked disorders: Emery-Deifuss muscular dystrophy and dyskeratosis congenita

DOE Office of Scientific and Technical Information (OSTI.GOV)

Metzenberg, A.B.; Pan, Y.; Das, S.

1994-05-01

Mapping studies have indicated that over two dozen genetic diseases lie on Xq28, the distal long arm of the X chromosome. In most cases the responsible gene has not yet been isolated. Most of these diseases occur at low frequency, and together with small family sizes and the lack of associated cytogenetic aberrations, this characteristic has made isolation of the genes difficult. Identification of the genes responsible for inherited disorders should eventually lead to a greater understanding of biochemical and developmental pathways. We and others are attempting to find these genes by examining genes that are candidates by virtue ofmore » their map location. One candidate is the Xq28-linked gene MPP-1, which encodes the p55 protein. In this study, we asked whether mutations in the p55 gene are present in patients affected with the Xq28-linked disorders dyskeratosis congenita and Emergy-Dreifuss muscular dystrophy. The p55 cDNA is [approx]2 kb in length. The strategy for mutation detection in this sequence involved reverse transciption (RT)-PCR amplification of patient and control cDNA, yielding five sets of overlapping fragments, each set consisting of 400 bp, followed by SSCP analysis of each fragment. In no case was a true mutation in the p55 gene discovered. Therefore, it is highly unlikely that mutations in the p55 gene are responsible for any cases of dyskeratosis congenita or Emergy-Dreifuss muscular dystrophy.« less

Honey bee foraging induces upregulation of early growth response protein 1, hormone receptor 38 and candidate downstream genes of the ecdysteroid signalling pathway.

PubMed

Singh, A S; Shah, A; Brockmann, A

2018-02-01

In honey bees, continuous foraging at an artificial feeder induced a sustained upregulation of the immediate early genes early growth response protein 1 (Egr-1) and hormone receptor 38 (Hr38). This gene expression response was accompanied by an upregulation of several Egr-1 candidate downstream genes: ecdysone receptor (EcR), dopamine/ecdysteroid receptor (DopEcR), dopamine decarboxylase and dopamine receptor 2. Hr38, EcR and DopEcR are components of the ecdysteroid signalling pathway, which is highly probably involved in learning and memory processes in honey bees and other insects. Time-trained foragers still showed an upregulation of Egr-1 when the feeder was presented at an earlier time of the day, suggesting that the genomic response is more dependent on the food reward than training time. However, presentation of the feeder at the training time without food was still capable of inducing a transient increase in Egr-1 expression. Thus, learnt feeder cues, or even training time, probably affect Egr-1 expression. In contrast, whole brain Egr-1 expression changes did not differ between dancing and nondancing foragers. On the basis of our results we propose that food reward induced continuous foraging ultimately elicits a genomic response involving Egr-1 and Hr38 and their downstream genes. Furthermore this genomic response is highly probably involved in foraging-related learning and memory responses. © 2017 The Royal Entomological Society.

Identification and expression analysis of CYS-A1, CYS-C1, NIT4 genes in rice seedlings exposed to cyanide.

PubMed

Yu, Xiao-Zhang; Lin, Yu-Juan; Lu, Chun-Jiao; Zhang, Xue-Hong

2017-09-01

Involvement of genes (CYS-A1, CYS-C1 and NIT4) encoded with cysteine synthase, β-cyanoalanine synthase, nitrilase and cyanide metabolisms are evident in Arabidopsis. In the present study, identifications of CYS-A1, CYS-C1 and NIT4, predictions of conserved motifs, and constructions of phylogenetic relationships, based on their amino acid sequences in rice, were conducted. In order to elucidate the transcriptional responses of these cyanide-degrading genes, two candidate homologues were selected for each gene to test their expression changes upon exposure to exogenous KCN in rice seedlings using RT-PCR. Results showed that all selected candidate homologous genes were differentially expressed at different exposure points in roots and shoots of rice seedlings, suggesting their distinct roles during cyanide assimilation. Both candidate homologues for CYS-A1 constantly exhibited more abundant transcripts in comparison to control. However, only one candidate homologue for CYS-C1 and NIT4 showed a remarkable up-regulation during KCN exposure. Analysis of both tissue and solution cyanide indicated that rice seedlings were quickly able to metabolize exogenous KCN with minor accumulation in plant tissues. In conclusion, significant up-regulation of CYS-A1 suggested that the endogenous pool of cysteine catalyzed by cysteine synthase does not restrict the conversion of exogenous KCN into cyanoalanine through the β-cyanoalanine pathway. However, insufficient responses of the transcription level of NIT4 suggested that NIT enzyme may be a limiting factor for cyanoalanine assimilation by rice seedlings.

SNP discovery and marker development for disease resistance candidate genes in common carp (Cyprinus carpio)

USDA-ARS?s Scientific Manuscript database

Single nucleotide polymorphisms (SNPs) in immune response genes have been reported as markers of susceptibility to infectious diseases in human and livestock. A disease caused by cyprinid herpes virus 3 (CyHV-3) is highly contagious and virulent in common carp. With the aim to investigate the gene...

Association between IL-10a SNPs and resistance to cyprinid herpesvirus-3 infection in common carp (Cyprinus carpio)

USDA-ARS?s Scientific Manuscript database

Analysis of gene polymorphisms and disease association is essential for assessing putative candidate genes affecting susceptibility or resistance to disease. In this paper, we report the results of an association analysis between SNPs in common carp innate immune response genes and resistance to Cy...

A Stratified Transcriptomics Analysis of Polygenic Fat and Lean Mouse Adipose Tissues Identifies Novel Candidate Obesity Genes

PubMed Central

Morton, Nicholas M.; Nelson, Yvonne B.; Michailidou, Zoi; Di Rollo, Emma M.; Ramage, Lynne; Hadoke, Patrick W. F.; Seckl, Jonathan R.; Bunger, Lutz; Horvat, Simon; Kenyon, Christopher J.; Dunbar, Donald R.

2011-01-01

Background Obesity and metabolic syndrome results from a complex interaction between genetic and environmental factors. In addition to brain-regulated processes, recent genome wide association studies have indicated that genes highly expressed in adipose tissue affect the distribution and function of fat and thus contribute to obesity. Using a stratified transcriptome gene enrichment approach we attempted to identify adipose tissue-specific obesity genes in the unique polygenic Fat (F) mouse strain generated by selective breeding over 60 generations for divergent adiposity from a comparator Lean (L) strain. Results To enrich for adipose tissue obesity genes a ‘snap-shot’ pooled-sample transcriptome comparison of key fat depots and non adipose tissues (muscle, liver, kidney) was performed. Known obesity quantitative trait loci (QTL) information for the model allowed us to further filter genes for increased likelihood of being causal or secondary for obesity. This successfully identified several genes previously linked to obesity (C1qr1, and Np3r) as positional QTL candidate genes elevated specifically in F line adipose tissue. A number of novel obesity candidate genes were also identified (Thbs1, Ppp1r3d, Tmepai, Trp53inp2, Ttc7b, Tuba1a, Fgf13, Fmr) that have inferred roles in fat cell function. Quantitative microarray analysis was then applied to the most phenotypically divergent adipose depot after exaggerating F and L strain differences with chronic high fat feeding which revealed a distinct gene expression profile of line, fat depot and diet-responsive inflammatory, angiogenic and metabolic pathways. Selected candidate genes Npr3 and Thbs1, as well as Gys2, a non-QTL gene that otherwise passed our enrichment criteria were characterised, revealing novel functional effects consistent with a contribution to obesity. Conclusions A focussed candidate gene enrichment strategy in the unique F and L model has identified novel adipose tissue-enriched genes contributing to obesity. PMID:21915269

A stratified transcriptomics analysis of polygenic fat and lean mouse adipose tissues identifies novel candidate obesity genes.

PubMed

Morton, Nicholas M; Nelson, Yvonne B; Michailidou, Zoi; Di Rollo, Emma M; Ramage, Lynne; Hadoke, Patrick W F; Seckl, Jonathan R; Bunger, Lutz; Horvat, Simon; Kenyon, Christopher J; Dunbar, Donald R

2011-01-01

Obesity and metabolic syndrome results from a complex interaction between genetic and environmental factors. In addition to brain-regulated processes, recent genome wide association studies have indicated that genes highly expressed in adipose tissue affect the distribution and function of fat and thus contribute to obesity. Using a stratified transcriptome gene enrichment approach we attempted to identify adipose tissue-specific obesity genes in the unique polygenic Fat (F) mouse strain generated by selective breeding over 60 generations for divergent adiposity from a comparator Lean (L) strain. To enrich for adipose tissue obesity genes a 'snap-shot' pooled-sample transcriptome comparison of key fat depots and non adipose tissues (muscle, liver, kidney) was performed. Known obesity quantitative trait loci (QTL) information for the model allowed us to further filter genes for increased likelihood of being causal or secondary for obesity. This successfully identified several genes previously linked to obesity (C1qr1, and Np3r) as positional QTL candidate genes elevated specifically in F line adipose tissue. A number of novel obesity candidate genes were also identified (Thbs1, Ppp1r3d, Tmepai, Trp53inp2, Ttc7b, Tuba1a, Fgf13, Fmr) that have inferred roles in fat cell function. Quantitative microarray analysis was then applied to the most phenotypically divergent adipose depot after exaggerating F and L strain differences with chronic high fat feeding which revealed a distinct gene expression profile of line, fat depot and diet-responsive inflammatory, angiogenic and metabolic pathways. Selected candidate genes Npr3 and Thbs1, as well as Gys2, a non-QTL gene that otherwise passed our enrichment criteria were characterised, revealing novel functional effects consistent with a contribution to obesity. A focussed candidate gene enrichment strategy in the unique F and L model has identified novel adipose tissue-enriched genes contributing to obesity.

SNPs in stress-responsive rice genes: validation, genotyping, functional relevance and population structure

PubMed Central

2012-01-01

Background Single nucleotide polymorphism (SNP) validation and large-scale genotyping are required to maximize the use of DNA sequence variation and determine the functional relevance of candidate genes for complex stress tolerance traits through genetic association in rice. We used the bead array platform-based Illumina GoldenGate assay to validate and genotype SNPs in a select set of stress-responsive genes to understand their functional relevance and study the population structure in rice. Results Of the 384 putative SNPs assayed, we successfully validated and genotyped 362 (94.3%). Of these 325 (84.6%) showed polymorphism among the 91 rice genotypes examined. Physical distribution, degree of allele sharing, admixtures and introgression, and amino acid replacement of SNPs in 263 abiotic and 62 biotic stress-responsive genes provided clues for identification and targeted mapping of trait-associated genomic regions. We assessed the functional and adaptive significance of validated SNPs in a set of contrasting drought tolerant upland and sensitive lowland rice genotypes by correlating their allelic variation with amino acid sequence alterations in catalytic domains and three-dimensional secondary protein structure encoded by stress-responsive genes. We found a strong genetic association among SNPs in the nine stress-responsive genes with upland and lowland ecological adaptation. Higher nucleotide diversity was observed in indica accessions compared with other rice sub-populations based on different population genetic parameters. The inferred ancestry of 16% among rice genotypes was derived from admixed populations with the maximum between upland aus and wild Oryza species. Conclusions SNPs validated in biotic and abiotic stress-responsive rice genes can be used in association analyses to identify candidate genes and develop functional markers for stress tolerance in rice. PMID:22921105

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Genome-wide association study for host response to bovine leukemia virus in Holstein cows.

PubMed

Brym, P; Bojarojć-Nosowicz, B; Oleński, K; Hering, D M; Ruść, A; Kaczmarczyk, E; Kamiński, S

2016-07-01

The mechanisms of leukemogenesis induced by bovine leukemia virus (BLV) and the processes underlying the phenomenon of differential host response to BLV infection still remain poorly understood. The aim of the study was to screen the entire cattle genome to identify markers and candidate genes that might be involved in host response to bovine leukemia virus infection. A genome-wide association study was performed using Holstein cows naturally infected by BLV. A data set included 43 cows (BLV positive) and 30 cows (BLV negative) genotyped for 54,609 SNP markers (Illumina Bovine SNP50 BeadChip). The BLV status of cows was determined by serum ELISA, nested-PCR and hematological counts. Linear Regression Analysis with a False Discovery Rate and kinship matrix (computed on the autosomal SNPs) was calculated to find out which SNP markers significantly differentiate BLV-positive and BLV-negative cows. Nine markers reached genome-wide significance. The most significant SNPs were located on chromosomes 23 (rs41583098), 3 (rs109405425, rs110785500) and 8 (rs43564499) in close vicinity of a patatin-like phospholipase domain containing 1 (PNPLA1); adaptor-related protein complex 4, beta 1 subunit (AP4B1); tripartite motif-containing 45 (TRIM45) and cell division cycle associated 2 (CDCA2) genes, respectively. Furthermore, a list of 41 candidate genes was composed based on their proximity to significant markers (within a distance of ca. 1 Mb) and functional involvement in processes potentially underlying BLV-induced pathogenesis. In conclusion, it was demonstrated that host response to BLV infection involves nine sub-regions of the cattle genome (represented by 9 SNP markers), containing many genes which, based on the literature, could be involved to enzootic bovine leukemia progression. New group of promising candidate genes associated with the host response to BLV infection were identified and could therefore be a target for future studies. The functions of candidate genes surrounding significant SNP markers imply that there is no single regulatory process that is solely targeted by BLV infection, but rather the network of interrelated pathways is deregulated, leading to the disruption of the control of B-cell proliferation and programmed cell death. Copyright © 2016 Elsevier B.V. All rights reserved.

Identification of possible genetic polymorphisms involved in cancer cachexia: a systematic review.

PubMed

Tan, Benjamin H L; Ross, James A; Kaasa, Stein; Skorpen, Frank; Fearon, Kenneth C H

2011-04-01

Cancer cachexia is a polygenic and complex syndrome. Genetic variations in regulation of the inflammatory response, muscle and fat metabolic pathways, and pathways in appetite regulation are likely to contribute to the susceptibility or resistance to developing cancer cachexia. A systematic search of Medline and EmBase databases, covering 1986-2008 was performed for potential candidate genes/genetic polymorphisms relating to cancer cachexia. Related genes were then identified using pathway functional analysis software. All candidate genes were reviewed for functional polymorphisms or clinically significant polymorphisms associated with cachexia using the OMIM and GeneRIF databases. Genes with variants which had functional or clinical associations with cachexia and replicated in at least one study were entered into pathway analysis software to reveal possible network associations between genes. A total of 184 polymorphisms with functional or clinical relevance to cancer cachexia were identified in 92 candidate genes. Of these, 42 polymorphisms (in 33 genes) were replicated in more than one study with 13 polymorphisms found to influence two or more hallmarks of cachexia (i.e. inflammation, loss of fat mass and/or lean mass and reduced survival). Thirty-three genes were found to be significantly interconnected in two major networks with four genes (ADIPOQ, IL6, NFKB1 and TLR4) interlinking both networks. Selection of candidate genes and polymorphisms is a key element of multigene study design. The present study provides an initial framework to select genes/polymorphisms for further study in cancer cachexia, and to develop their potential as susceptibility biomarkers of developing cachexia.

TOM: a web-based integrated approach for identification of candidate disease genes.

PubMed

Rossi, Simona; Masotti, Daniele; Nardini, Christine; Bonora, Elena; Romeo, Giovanni; Macii, Enrico; Benini, Luca; Volinia, Stefano

2006-07-01

The massive production of biological data by means of highly parallel devices like microarrays for gene expression has paved the way to new possible approaches in molecular genetics. Among them the possibility of inferring biological answers by querying large amounts of expression data. Based on this principle, we present here TOM, a web-based resource for the efficient extraction of candidate genes for hereditary diseases. The service requires the previous knowledge of at least another gene responsible for the disease and the linkage area, or else of two disease associated genetic intervals. The algorithm uses the information stored in public resources, including mapping, expression and functional databases. Given the queries, TOM will select and list one or more candidate genes. This approach allows the geneticist to bypass the costly and time consuming tracing of genetic markers through entire families and might improve the chance of identifying disease genes, particularly for rare diseases. We present here the tool and the results obtained on known benchmark and on hereditary predisposition to familial thyroid cancer. Our algorithm is available at http://www-micrel.deis.unibo.it/~tom/.

Genome-wide identification and characterization of WRKY transcriptional factor family in apple and analysis of their responses to waterlogging and drought stress.

PubMed

Meng, Dong; Li, Yuanyuan; Bai, Yang; Li, Mingjun; Cheng, Lailiang

2016-06-01

As one of the largest transcriptional factor families in plants, WRKY genes play significant roles in various biotic and abiotic stress responses. Although the WRKY gene family has been characterized in a few plant species, the details remain largely unknown in the apple (Malus domestica Borkh.). In this study, we identified a total of 127 MdWRKYs from the apple genome, which were divided into four subgroups according to the WRKY domains and zinc finger motif. Most of them were mapped onto the apple's 17 chromosomes and were expressed in more than one tissue, including shoot tips, mature leaves, fruit and apple calli. We then contrasted WRKY expression patterns between calli grown in solid medium (control) and liquid medium (representing waterlogging stress) and found that 34 WRKY genes were differentially expressed between the two growing conditions. Finally, we determined the expression patterns of 10 selected WRKY genes in an apple rootstock, G41, in response to waterlogging and drought stress, which identified candidate genes involved in responses to water stress for functional analysis. Our data provide interesting candidate MdWRKYs for future functional analysis and demonstrate that apple callus is a useful system for characterizing gene expression and function in apple. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

A comprehensive study of the genomic differentiation between temperate Dent and Flint maize.

PubMed

Unterseer, Sandra; Pophaly, Saurabh D; Peis, Regina; Westermeier, Peter; Mayer, Manfred; Seidel, Michael A; Haberer, Georg; Mayer, Klaus F X; Ordas, Bernardo; Pausch, Hubert; Tellier, Aurélien; Bauer, Eva; Schön, Chris-Carolin

2016-07-08

Dent and Flint represent two major germplasm pools exploited in maize breeding. Several traits differentiate the two pools, like cold tolerance, early vigor, and flowering time. A comparative investigation of their genomic architecture relevant for quantitative trait expression has not been reported so far. Understanding the genomic differences between germplasm pools may contribute to a better understanding of the complementarity in heterotic patterns exploited in hybrid breeding and of mechanisms involved in adaptation to different environments. We perform whole-genome screens for signatures of selection specific to temperate Dent and Flint maize by comparing high-density genotyping data of 70 American and European Dent and 66 European Flint inbred lines. We find 2.2 % and 1.4 % of the genes are under selective pressure, respectively, and identify candidate genes associated with agronomic traits known to differ between the two pools. Taking flowering time as an example for the differentiation between Dent and Flint, we investigate candidate genes involved in the flowering network by phenotypic analyses in a Dent-Flint introgression library and find that the Flint haplotypes of the candidates promote earlier flowering. Within the flowering network, the majority of Flint candidates are associated with endogenous pathways in contrast to Dent candidate genes, which are mainly involved in response to environmental factors like light and photoperiod. The diversity patterns of the candidates in a unique panel of more than 900 individuals from 38 European landraces indicate a major contribution of landraces from France, Germany, and Spain to the candidate gene diversity of the Flint elite lines. In this study, we report the investigation of pool-specific differences between temperate Dent and Flint on a genome-wide scale. The identified candidate genes represent a promising source for the functional investigation of pool-specific haplotypes in different genetic backgrounds and for the evaluation of their potential for future crop improvement like the adaptation to specific environments.

Gene expression changes in the coccolithophore Emiliania huxleyi after 500 generations of selection to ocean acidification

PubMed Central

Lohbeck, Kai T.; Riebesell, Ulf; Reusch, Thorsten B. H.

2014-01-01

Coccolithophores are unicellular marine algae that produce biogenic calcite scales and substantially contribute to marine primary production and carbon export to the deep ocean. Ongoing ocean acidification particularly impairs calcifying organisms, mostly resulting in decreased growth and calcification. Recent studies revealed that the immediate physiological response in the coccolithophore Emiliania huxleyi to ocean acidification may be partially compensated by evolutionary adaptation, yet the underlying molecular mechanisms are currently unknown. Here, we report on the expression levels of 10 candidate genes putatively relevant to pH regulation, carbon transport, calcification and photosynthesis in E. huxleyi populations short-term exposed to ocean acidification conditions after acclimation (physiological response) and after 500 generations of high CO2 adaptation (adaptive response). The physiological response revealed downregulation of candidate genes, well reflecting the concomitant decrease of growth and calcification. In the adaptive response, putative pH regulation and carbon transport genes were up-regulated, matching partial restoration of growth and calcification in high CO2-adapted populations. Adaptation to ocean acidification in E. huxleyi likely involved improved cellular pH regulation, presumably indirectly affecting calcification. Adaptive evolution may thus have the potential to partially restore cellular pH regulatory capacity and thereby mitigate adverse effects of ocean acidification. PMID:24827439

Dehydration induced transcriptomic responses in two Tibetan hulless barley (Hordeum vulgare var. nudum) accessions distinguished by drought tolerance.

PubMed

Liang, Junjun; Chen, Xin; Deng, Guangbing; Pan, Zhifen; Zhang, Haili; Li, Qiao; Yang, Kaijun; Long, Hai; Yu, Maoqun

2017-10-11

The harsh environment on the Qinghai-Tibetan Plateau gives Tibetan hulless barley (Hordeum vulgare var. nudum) great ability to resist adversities such as drought, salinity, and low temperature, and makes it a good subject for the analysis of drought tolerance mechanism. To elucidate the specific gene networks and pathways that contribute to its drought tolerance, and for identifying new candidate genes for breeding purposes, we performed a transcriptomic analysis using two accessions of Tibetan hulless barley, namely Z772 (drought-tolerant) and Z013 (drought-sensitive). There were more up-regulated genes of Z772 than Z013 under both mild (5439-VS-2604) and severe (7203-VS-3359) dehydration treatments. Under mild dehydration stress, the pathways exclusively enriched in drought-tolerance genotype Z772 included Protein processing in endoplasmic reticulum, tricarboxylic acid (TCA) cycle, Wax biosynthesis, and Spliceosome. Under severe dehydration stress, the pathways that were mainly enriched in Z772 included Carbon fixation in photosynthetic organisms, Pyruvate metabolism, Porphyrin and chlorophyll metabolism. The main differentially expressed genes (DEGs) in response to dehydration stress and genes whose expression was different between tolerant and sensitive genotypes were presented in this study, respectively. The candidate genes for drought tolerance were selected based on their expression patterns. The RNA-Seq data obtained in this study provided an initial overview on global gene expression patterns and networks that related to dehydration shock in Tibetan hulless barley. Furthermore, these data provided pathways and a targeted set of candidate genes that might be essential for deep analyzing the molecular mechanisms of plant tolerance to drought stress.

Global Transcriptome Changes Underlying Colony Growth in the Opportunistic Human Pathogen Aspergillus fumigatus

PubMed Central

Gibbons, John G.; Beauvais, Anne; Beau, Remi; McGary, Kriston L.

2012-01-01

Aspergillus fumigatus is the most common and deadly pulmonary fungal infection worldwide. In the lung, the fungus usually forms a dense colony of filaments embedded in a polymeric extracellular matrix. To identify candidate genes involved in this biofilm (BF) growth, we used RNA-Seq to compare the transcriptomes of BF and liquid plankton (PL) growth. Sequencing and mapping of tens of millions sequence reads against the A. fumigatus transcriptome identified 3,728 differentially regulated genes in the two conditions. Although many of these genes, including the ones coding for transcription factors, stress response, the ribosome, and the translation machinery, likely reflect the different growth demands in the two conditions, our experiment also identified hundreds of candidate genes for the observed differences in morphology and pathobiology between BF and PL. We found an overrepresentation of upregulated genes in transport, secondary metabolism, and cell wall and surface functions. Furthermore, upregulated genes showed significant spatial structure across the A. fumigatus genome; they were more likely to occur in subtelomeric regions and colocalized in 27 genomic neighborhoods, many of which overlapped with known or candidate secondary metabolism gene clusters. We also identified 1,164 genes that were downregulated. This gene set was not spatially structured across the genome and was overrepresented in genes participating in primary metabolic functions, including carbon and amino acid metabolism. These results add valuable insight into the genetics of biofilm formation in A. fumigatus and other filamentous fungi and identify many relevant, in the context of biofilm biology, candidate genes for downstream functional experiments. PMID:21724936

An integrated and comparative approach towards identification, characterization and functional annotation of candidate genes for drought tolerance in sorghum (Sorghum bicolor (L.) Moench).

PubMed

Woldesemayat, Adugna Abdi; Van Heusden, Peter; Ndimba, Bongani K; Christoffels, Alan

2017-12-22

Drought is the most disastrous abiotic stress that severely affects agricultural productivity worldwide. Understanding the biological basis of drought-regulated traits, requires identification and an in-depth characterization of genetic determinants using model organisms and high-throughput technologies. However, studies on drought tolerance have generally been limited to traditional candidate gene approach that targets only a single gene in a pathway that is related to a trait. In this study, we used sorghum, one of the model crops that is well adapted to arid regions, to mine genes and define determinants for drought tolerance using drought expression libraries and RNA-seq data. We provide an integrated and comparative in silico candidate gene identification, characterization and annotation approach, with an emphasis on genes playing a prominent role in conferring drought tolerance in sorghum. A total of 470 non-redundant functionally annotated drought responsive genes (DRGs) were identified using experimental data from drought responses by employing pairwise sequence similarity searches, pathway and interpro-domain analysis, expression profiling and orthology relation. Comparison of the genomic locations between these genes and sorghum quantitative trait loci (QTLs) showed that 40% of these genes were co-localized with QTLs known for drought tolerance. The genome reannotation conducted using the Program to Assemble Spliced Alignment (PASA), resulted in 9.6% of existing single gene models being updated. In addition, 210 putative novel genes were identified using AUGUSTUS and PASA based analysis on expression dataset. Among these, 50% were single exonic, 69.5% represented drought responsive and 5.7% were complete gene structure models. Analysis of biochemical metabolism revealed 14 metabolic pathways that are related to drought tolerance and also had a strong biological network, among categories of genes involved. Identification of these pathways, signifies the interplay of biochemical reactions that make up the metabolic network, constituting fundamental interface for sorghum defence mechanism against drought stress. This study suggests untapped natural variability in sorghum that could be used for developing drought tolerance. The data presented here, may be regarded as an initial reference point in functional and comparative genomics in the Gramineae family.

Genes related to sex steroids, neural growth, and social-emotional behavior are associated with autistic traits, empathy, and Asperger syndrome.

PubMed

Chakrabarti, B; Dudbridge, F; Kent, L; Wheelwright, S; Hill-Cawthorne, G; Allison, C; Banerjee-Basu, S; Baron-Cohen, S

2009-06-01

Genetic studies of autism spectrum conditions (ASC) have mostly focused on the "low functioning" severe clinical subgroup, treating it as a rare disorder. However, ASC is now thought to be relatively common ( approximately 1%), and representing one end of a quasi-normal distribution of autistic traits in the general population. Here we report a study of common genetic variation in candidate genes associated with autistic traits and Asperger syndrome (AS). We tested single nucleotide polymorphisms in 68 candidate genes in three functional groups (sex steroid synthesis/transport, neural connectivity, and social-emotional responsivity) in two experiments. These were (a) an association study of relevant behavioral traits (the Empathy Quotient (EQ), the Autism Spectrum Quotient (AQ)) in a population sample (n=349); and (b) a case-control association study on a sample of people with AS, a "high-functioning" subgroup of ASC (n=174). 27 genes showed a nominally significant association with autistic traits and/or ASC diagnosis. Of these, 19 genes showed nominally significant association with AQ/EQ. In the sex steroid group, this included ESR2 and CYP11B1. In the neural connectivity group, this included HOXA1, NTRK1, and NLGN4X. In the socio-responsivity behavior group, this included MAOB, AVPR1B, and WFS1. Fourteen genes showed nominally significant association with AS. In the sex steroid group, this included CYP17A1 and CYP19A1. In the socio-emotional behavior group, this included OXT. Six genes were nominally associated in both experiments, providing a partial replication. Eleven genes survived family wise error rate (FWER) correction using permutations across both experiments, which is greater than would be expected by chance. CYP11B1 and NTRK1 emerged as significantly associated genes in both experiments, after FWER correction (P<0.05). This is the first candidate-gene association study of AS and of autistic traits. The most promising candidate genes require independent replication and fine mapping.

Optimization of HIV-1 Envelope DNA Vaccine Candidates within Three Different Animal Models, Guinea Pigs, Rabbits and Cynomolgus Macaques.

PubMed

Borggren, Marie; Vinner, Lasse; Andresen, Betina Skovgaard; Grevstad, Berit; Repits, Johanna; Melchers, Mark; Elvang, Tara Laura; Sanders, Rogier W; Martinon, Frédéric; Dereuddre-Bosquet, Nathalie; Bowles, Emma Joanne; Stewart-Jones, Guillaume; Biswas, Priscilla; Scarlatti, Gabriella; Jansson, Marianne; Heyndrickx, Leo; Grand, Roger Le; Fomsgaard, Anders

2013-07-19

HIV-1 DNA vaccines have many advantageous features. Evaluation of HIV-1 vaccine candidates often starts in small animal models before macaque and human trials. Here, we selected and optimized DNA vaccine candidates through systematic testing in rabbits for the induction of broadly neutralizing antibodies (bNAb). We compared three different animal models: guinea pigs, rabbits and cynomolgus macaques. Envelope genes from the prototype isolate HIV-1 Bx08 and two elite neutralizers were included. Codon-optimized genes, encoded secreted gp140 or membrane bound gp150, were modified for expression of stabilized soluble trimer gene products, and delivered individually or mixed. Specific IgG after repeated i.d. inoculations with electroporation confirmed in vivo expression and immunogenicity. Evaluations of rabbits and guinea pigs displayed similar results. The superior DNA construct in rabbits was a trivalent mix of non-modified codon-optimized gp140 envelope genes. Despite NAb responses with some potency and breadth in guinea pigs and rabbits, the DNA vaccinated macaques displayed less bNAb activity. It was concluded that a trivalent mix of non-modified gp140 genes from rationally selected clinical isolates was, in this study, the best option to induce high and broad NAb in the rabbit model, but this optimization does not directly translate into similar responses in cynomolgus macaques.

Optimization of HIV-1 Envelope DNA Vaccine Candidates within Three Different Animal Models, Guinea Pigs, Rabbits and Cynomolgus Macaques

PubMed Central

Borggren, Marie; Vinner, Lasse; Andresen, Betina Skovgaard; Grevstad, Berit; Repits, Johanna; Melchers, Mark; Elvang, Tara Laura; Sanders, Rogier W; Martinon, Frédéric; Dereuddre-Bosquet, Nathalie; Bowles, Emma Joanne; Stewart-Jones, Guillaume; Biswas, Priscilla; Scarlatti, Gabriella; Jansson, Marianne; Heyndrickx, Leo; Le Grand, Roger; Fomsgaard, Anders

2013-01-01

HIV-1 DNA vaccines have many advantageous features. Evaluation of HIV-1 vaccine candidates often starts in small animal models before macaque and human trials. Here, we selected and optimized DNA vaccine candidates through systematic testing in rabbits for the induction of broadly neutralizing antibodies (bNAb). We compared three different animal models: guinea pigs, rabbits and cynomolgus macaques. Envelope genes from the prototype isolate HIV-1 Bx08 and two elite neutralizers were included. Codon-optimized genes, encoded secreted gp140 or membrane bound gp150, were modified for expression of stabilized soluble trimer gene products, and delivered individually or mixed. Specific IgG after repeated i.d. inoculations with electroporation confirmed in vivo expression and immunogenicity. Evaluations of rabbits and guinea pigs displayed similar results. The superior DNA construct in rabbits was a trivalent mix of non-modified codon-optimized gp140 envelope genes. Despite NAb responses with some potency and breadth in guinea pigs and rabbits, the DNA vaccinated macaques displayed less bNAb activity. It was concluded that a trivalent mix of non-modified gp140 genes from rationally selected clinical isolates was, in this study, the best option to induce high and broad NAb in the rabbit model, but this optimization does not directly translate into similar responses in cynomolgus macaques. PMID:26344115

Genetic polymorphism in ATG16L1 gene influences the response to adalimumab in Crohn's disease patients.

PubMed

Koder, Silvo; Repnik, Katja; Ferkolj, Ivan; Pernat, Cvetka; Skok, Pavel; Weersma, Rinse K; Potočnik, Uroš

2015-01-01

To see if SNPs could help predict response to biological therapy using adalimumab (ADA) in Crohn's disease (CD). IBDQ index and CRP levels were used to monitor therapy response. We genotyped 31 CD-associated genes in 102 Slovenian CD patients. The strongest association for treatment response defined as decrease in CRP levels was found for ATG16L1 SNP rs10210302. Additional SNPs in 7 out of 31 tested CD-associated genes (PTGER4, CASP9, IL27, C11orf30, CCNY, IL13, NR1I2) showed suggestive association with ADA response. Our results suggest ADA response in CD patients is genetically predisposed by SNPs in CD risk genes and suggest ATG16L1 as most promising candidate gene for drug response in ADA treatment. Original submitted 24 September 2014; Revision submitted 1 December 2014.

Pervasive and opposing effects of Unpredictable Chronic Mild Stress (UCMS) on hippocampal gene expression in BALB/cJ and C57BL/6J mouse strains.

PubMed

Malki, Karim; Mineur, Yann S; Tosto, Maria Grazia; Campbell, James; Karia, Priya; Jumabhoy, Irfan; Sluyter, Frans; Crusio, Wim E; Schalkwyk, Leonard C

2015-04-03

BALB/cJ is a strain susceptible to stress and extremely susceptible to a defective hedonic impact in response to chronic stressors. The strain offers much promise as an animal model for the study of stress related disorders. We present a comparative hippocampal gene expression study on the effects of unpredictable chronic mild stress on BALB/cJ and C57BL/6J mice. Affymetrix MOE 430 was used to measure hippocampal gene expression from 16 animals of two different strains (BALB/cJ and C57BL/6J) of both sexes and subjected to either unpredictable chronic mild stress (UCMS) or no stress. Differences were statistically evaluated through supervised and unsupervised linear modelling and using Weighted Gene Coexpression Network Analysis (WGCNA). In order to gain further understanding into mechanisms related to stress response, we cross-validated our results with a parallel study from the GENDEP project using WGCNA in a meta-analysis design. The effects of UCMS are visible through Principal Component Analysis which highlights the stress sensitivity of the BALB/cJ strain. A number of genes and gene networks related to stress response were uncovered including the Creb1 gene. WGCNA and pathway analysis revealed a gene network centered on Nfkb1. Results from the meta-analysis revealed a highly significant gene pathway centred on the Ubiquitin C (Ubc) gene. All pathways uncovered are associated with inflammation and immune response. The study investigated the molecular mechanisms underlying the response to adverse environment in an animal model using a GxE design. Stress-related differences were visible at the genomic level through PCA analysis highlighting the high sensitivity of BALB/cJ animals to environmental stressors. Several candidate genes and gene networks reported are associated with inflammation and neurogenesis and could serve to inform candidate gene selection in human studies and provide additional insight into the pathology of Major Depressive Disorder.

Fine mapping of Restorer-of-fertility in pepper (Capsicum annuum L.) identified a candidate gene encoding a pentatricopeptide repeat (PPR)-containing protein.

PubMed

Jo, Yeong Deuk; Ha, Yeaseong; Lee, Joung-Ho; Park, Minkyu; Bergsma, Alex C; Choi, Hong-Il; Goritschnig, Sandra; Kloosterman, Bjorn; van Dijk, Peter J; Choi, Doil; Kang, Byoung-Cheorl

2016-10-01

Using fine mapping techniques, the genomic region co-segregating with Restorer - of - fertility ( Rf ) in pepper was delimited to a region of 821 kb in length. A PPR gene in this region, CaPPR6 , was identified as a strong candidate for Rf based on expression pattern and characteristics of encoding sequence. Cytoplasmic-genic male sterility (CGMS) has been used for the efficient production of hybrid seeds in peppers (Capsicum annuum L.). Although the mitochondrial candidate genes that might be responsible for cytoplasmic male sterility (CMS) have been identified, the nuclear Restorer-of-fertility (Rf) gene has not been isolated. To identify the genomic region co-segregating with Rf in pepper, we performed fine mapping using an Rf-segregating population consisting of 1068 F2 individuals, based on BSA-AFLP and a comparative mapping approach. Through six cycles of chromosome walking, the co-segregating region harboring the Rf locus was delimited to be within 821 kb of sequence. Prediction of expressed genes in this region based on transcription analysis revealed four candidate genes. Among these, CaPPR6 encodes a pentatricopeptide repeat (PPR) protein with PPR motifs that are repeated 14 times. Characterization of the CaPPR6 protein sequence, based on alignment with other homologs, showed that CaPPR6 is a typical Rf-like (RFL) gene reported to have undergone diversifying selection during evolution. A marker developed from a sequence near CaPPR6 showed a higher prediction rate of the Rf phenotype than those of previously developed markers when applied to a panel of breeding lines of diverse origin. These results suggest that CaPPR6 is a strong candidate for the Rf gene in pepper.

In Vitro Evaluation of Glycoengineered RSV-F in the Human Artificial Lymph Node Reactor.

PubMed

Radke, Lars; Sandig, Grit; Lubitz, Annika; Schließer, Ulrike; von Horsten, Hans Henning; Blanchard, Veronique; Keil, Karolin; Sandig, Volker; Giese, Christoph; Hummel, Michael; Hinderlich, Stephan; Frohme, Marcus

2017-08-15

Subunit vaccines often require adjuvants to elicit sustained immune activity. Here, a method is described to evaluate the efficacy of single vaccine candidates in the preclinical stage based on cytokine and gene expression analysis. As a model, the recombinant human respiratory syncytial virus (RSV) fusion protein (RSV-F) was produced in CHO cells. For comparison, wild-type and glycoengineered, afucosylated RSV-F were established. Both glycoprotein vaccines were tested in a commercial Human Artificial Lymph Node in vitro model (HuALN ® ). The analysis of six key cytokines in cell culture supernatants showed well-balanced immune responses for the afucosylated RSV-F, while immune response of wild-type RSV-F was more Th1 accentuated. In particular, stronger and specific secretion of interleukin-4 after each round of re-stimulation underlined higher potency and efficacy of the afucosylated vaccine candidate. Comprehensive gene expression analysis by nCounter gene expression assay confirmed the stronger onset of the immunologic reaction in stimulation experiments with the afucosylated vaccine in comparison to wild-type RSV-F and particularly revealed prominent activation of Th17 related genes, innate immunity, and comprehensive activation of humoral immunity. We, therefore, show that our method is suited to distinguish the potency of two vaccine candidates with minor structural differences.

Genome-wide transcriptomic analysis of response to low temperature reveals candidate genes determining divergent cold-sensitivity of maize inbred lines.

PubMed

Sobkowiak, Alicja; Jończyk, Maciej; Jarochowska, Emilia; Biecek, Przemysław; Trzcinska-Danielewicz, Joanna; Leipner, Jörg; Fronk, Jan; Sowiński, Paweł

2014-06-01

Maize, despite being thermophyllic due to its tropical origin, demonstrates high intraspecific diversity in cold-tolerance. To search for molecular mechanisms of this diversity, transcriptomic response to cold was studied in two inbred lines of contrasting cold-tolerance. Microarray analysis was followed by extensive statistical elaboration of data, literature data mining, and gene ontology-based classification. The lines used had been bred earlier specifically for determination of QTLs for cold-performance of photosynthesis. This allowed direct comparison of present transcriptomic data with the earlier QTL mapping results. Cold-treated (14 h at 8/6 °C) maize seedlings of cold-tolerant ETH-DH7 and cold-sensitive ETH-DL3 lines at V3 stage showed strong, consistent response of the third leaf transcriptome: several thousand probes showed similar, statistically significant change in both lines, while only tens responded differently in the two lines. The most striking difference between the responses of the two lines to cold was the induction of expression of ca. twenty genes encoding membrane/cell wall proteins exclusively in the cold-tolerant ETH-DH7 line. The common response comprised mainly repression of numerous genes related to photosynthesis and induction of genes related to basic biological activity: transcription, regulation of gene expression, protein phosphorylation, cell wall organization. Among the genes showing differential response, several were close to the QTL regions identified in earlier studies with the same inbred lines and associated with biometrical, physiological or biochemical parameters. These transcripts, including two apparently non-protein-coding ones, are particularly attractive candidates for future studies on mechanisms determining divergent cold-tolerance of inbred maize lines.

Identification of Novel Associations of Candidate Genes with Resistance to Late Blight in Solanum tuberosum Group Phureja

PubMed Central

Álvarez, María F.; Angarita, Myrian; Delgado, María C.; García, Celsa; Jiménez-Gomez, José; Gebhardt, Christiane; Mosquera, Teresa

2017-01-01

The genetic basis of quantitative disease resistance has been studied in crops for several decades as an alternative to R gene mediated resistance. The most important disease in the potato crop is late blight, caused by the oomycete Phytophthora infestans. Quantitative disease resistance (QDR), as any other quantitative trait in plants, can be genetically mapped to understand the genetic architecture. Association mapping using DNA-based markers has been implemented in many crops to dissect quantitative traits. We used an association mapping approach with candidate genes to identify the first genes associated with quantitative resistance to late blight in Solanum tuberosum Group Phureja. Twenty-nine candidate genes were selected from a set of genes that were differentially expressed during the resistance response to late blight in tetraploid European potato cultivars. The 29 genes were amplified and sequenced in 104 accessions of S. tuberosum Group Phureja from Latin America. We identified 238 SNPs in the selected genes and tested them for association with resistance to late blight. The phenotypic data were obtained under field conditions by determining the area under disease progress curve (AUDPC) in two seasons and in two locations. Two genes were associated with QDR to late blight, a potato homolog of thylakoid lumen 15 kDa protein (StTL15A) and a stem 28 kDa glycoprotein (StGP28). Key message: A first association mapping experiment was conducted in Solanum tuberosum Group Phureja germplasm, which identified among 29 candidates two genes associated with quantitative resistance to late blight. PMID:28674545

Identification of Novel Associations of Candidate Genes with Resistance to Late Blight in Solanum tuberosum Group Phureja.

PubMed

Álvarez, María F; Angarita, Myrian; Delgado, María C; García, Celsa; Jiménez-Gomez, José; Gebhardt, Christiane; Mosquera, Teresa

2017-01-01

The genetic basis of quantitative disease resistance has been studied in crops for several decades as an alternative to R gene mediated resistance. The most important disease in the potato crop is late blight, caused by the oomycete Phytophthora infestans. Quantitative disease resistance (QDR), as any other quantitative trait in plants, can be genetically mapped to understand the genetic architecture. Association mapping using DNA-based markers has been implemented in many crops to dissect quantitative traits. We used an association mapping approach with candidate genes to identify the first genes associated with quantitative resistance to late blight in Solanum tuberosum Group Phureja. Twenty-nine candidate genes were selected from a set of genes that were differentially expressed during the resistance response to late blight in tetraploid European potato cultivars. The 29 genes were amplified and sequenced in 104 accessions of S. tuberosum Group Phureja from Latin America. We identified 238 SNPs in the selected genes and tested them for association with resistance to late blight. The phenotypic data were obtained under field conditions by determining the area under disease progress curve (AUDPC) in two seasons and in two locations. Two genes were associated with QDR to late blight, a potato homolog of thylakoid lumen 15 kDa protein ( StTL15A ) and a stem 28 kDa glycoprotein ( StGP28 ). Key message : A first association mapping experiment was conducted in Solanum tuberosum Group Phureja germplasm, which identified among 29 candidates two genes associated with quantitative resistance to late blight.

Structural and Functional Analysis of the GRAS Gene Family in Grapevine Indicates a Role of GRAS Proteins in the Control of Development and Stress Responses

PubMed Central

Grimplet, Jérôme; Agudelo-Romero, Patricia; Teixeira, Rita T.; Martinez-Zapater, Jose M.; Fortes, Ana M.

2016-01-01

GRAS transcription factors are involved in many processes of plant growth and development (e.g., axillary shoot meristem formation, root radial patterning, nodule morphogenesis, arbuscular development) as well as in plant disease resistance and abiotic stress responses. However, little information is available concerning this gene family in grapevine (Vitis vinifera L.), an economically important woody crop. We performed a model curation of GRAS genes identified in the latest genome annotation leading to the identification of 52 genes. Gene models were improved and three new genes were identified that could be grapevine- or woody-plant specific. Phylogenetic analysis showed that GRAS genes could be classified into 13 groups that mapped on the 19 V. vinifera chromosomes. Five new subfamilies, previously not characterized in other species, were identified. Multiple sequence alignment showed typical GRAS domain in the proteins and new motifs were also described. As observed in other species, both segmental and tandem duplications contributed significantly to the expansion and evolution of the GRAS gene family in grapevine. Expression patterns across a variety of tissues and upon abiotic and biotic conditions revealed possible divergent functions of GRAS genes in grapevine development and stress responses. By comparing the information available for tomato and grapevine GRAS genes, we identified candidate genes that might constitute conserved transcriptional regulators of both climacteric and non-climacteric fruit ripening. Altogether this study provides valuable information and robust candidate genes for future functional analysis aiming at improving the quality of fleshy fruits. PMID:27065316

Diversifying selection in the wheat stem rust fungus acts predominantly on pathogen-associated gene families and reveals candidate effectors

PubMed Central

Sperschneider, Jana; Ying, Hua; Dodds, Peter N.; Gardiner, Donald M.; Upadhyaya, Narayana M.; Singh, Karam B.; Manners, John M.; Taylor, Jennifer M.

2014-01-01

Plant pathogens cause severe losses to crop plants and threaten global food production. One striking example is the wheat stem rust fungus, Puccinia graminis f. sp. tritici, which can rapidly evolve new virulent pathotypes in response to resistant host lines. Like several other filamentous fungal and oomycete plant pathogens, its genome features expanded gene families that have been implicated in host-pathogen interactions, possibly encoding effector proteins that interact directly with target host defense proteins. Previous efforts to understand virulence largely relied on the prediction of secreted, small and cysteine-rich proteins as candidate effectors and thus delivered an overwhelming number of candidates. Here, we implement an alternative analysis strategy that uses the signal of adaptive evolution as a line of evidence for effector function, combined with comparative information and expression data. We demonstrate that in planta up-regulated genes that are rapidly evolving are found almost exclusively in pathogen-associated gene families, affirming the impact of host-pathogen co-evolution on genome structure and the adaptive diversification of specialized gene families. In particular, we predict 42 effector candidates that are conserved only across pathogens, induced during infection and rapidly evolving. One of our top candidates has recently been shown to induce genotype-specific hypersensitive cell death in wheat. This shows that comparative genomics incorporating the evolutionary signal of adaptation is powerful for predicting effector candidates for laboratory verification. Our system can be applied to a wide range of pathogens and will give insight into host-pathogen dynamics, ultimately leading to progress in strategies for disease control. PMID:25225496

Pharmacogenetic Predictors of Methylphenidate Dose-Response in Attention-Deficit/Hyperactivity Disorder

ERIC Educational Resources Information Center

Froehlich, Tanya E.; Epstein, Jeffery N.; Nick, Todd G.; Melguizo Castro, Maria S.; Stein, Mark A.; Brinkman, William B.; Graham, Amanda J.; Langberg, Joshua M.; Kahn, Robert S.

2011-01-01

Objective: Because of significant individual variability in attention-deficit/hyperactivity disorder (ADHD) medication response, there is increasing interest in identifying genetic predictors of treatment effects. This study examined the role of four catecholamine-related candidate genes in moderating methylphenidate (MPH) dose-response. Method:…

[Discovery of the target genes inhibited by formic acid in Candida shehatae].

PubMed

Cai, Peng; Xiong, Xujie; Xu, Yong; Yong, Qiang; Zhu, Junjun; Shiyuan, Yu

2014-01-04

At transcriptional level, the inhibitory effects of formic acid was investigated on Candida shehatae, a model yeast strain capable of fermenting xylose to ethanol. Thereby, the target genes were regulated by formic acid and the transcript profiles were discovered. On the basis of the transcriptome data of C. shehatae metabolizing glucose and xylose, the genes responsible for ethanol fermentation were chosen as candidates by the combined method of yeast metabolic pathway analysis and manual gene BLAST search. These candidates were then quantitatively detected by RQ-PCR technique to find the regulating genes under gradient doses of formic acid. By quantitative analysis of 42 candidate genes, we finally identified 10 and 5 genes as markedly down-regulated and up-regulated targets by formic acid, respectively. With regard to gene transcripts regulated by formic acid in C. shehatae, the markedly down-regulated genes ranking declines as follows: xylitol dehydrogenase (XYL2), acetyl-CoA synthetase (ACS), ribose-5-phosphate isomerase (RKI), transaldolase (TAL), phosphogluconate dehydrogenase (GND1), transketolase (TKL), glucose-6-phosphate dehydrogenase (ZWF1), xylose reductase (XYL1), pyruvate dehydrogenase (PDH) and pyruvate decarboxylase (PDC); and a declining rank for up-regulated gens as follows: fructose-bisphosphate aldolase (ALD), glucokinase (GLK), malate dehydrogenase (MDH), 6-phosphofructokinase (PFK) and alcohol dehydrogenase (ADH).

Large-scale identification of wheat genes resistant to cereal cyst nematode Heterodera avenae using comparative transcriptomic analysis.

PubMed

Kong, Ling-An; Wu, Du-Qing; Huang, Wen-Kun; Peng, Huan; Wang, Gao-Feng; Cui, Jiang-Kuan; Liu, Shi-Ming; Li, Zhi-Gang; Yang, Jun; Peng, De-Liang

2015-10-16

Cereal cyst nematode Heterodera avenae, an important soil-borne pathogen in wheat, causes numerous annual yield losses worldwide, and use of resistant cultivars is the best strategy for control. However, target genes are not readily available for breeding resistant cultivars. Therefore, comparative transcriptomic analyses were performed to identify more applicable resistance genes for cultivar breeding. The developing nematodes within roots were stained with acid fuchsin solution. Transcriptome assemblies and redundancy filteration were obtained by Trinity, TGI Clustering Tool and BLASTN, respectively. Gene Ontology annotation was yielded by Blast2GO program, and metabolic pathways of transcripts were analyzed by Path_finder. The ROS levels were determined by luminol-chemiluminescence assay. The transcriptional gene expression profiles were obtained by quantitative RT-PCR. The RNA-sequencing was performed using an incompatible wheat cultivar VP1620 and a compatible control cultivar WEN19 infected with H. avenae at 24 h, 3 d and 8 d. Infection assays showed that VP1620 failed to block penetration of H. avenae but disturbed the transition of developmental stages, leading to a significant reduction in cyst formation. Two types of expression profiles were established to predict candidate resistance genes after developing a novel strategy to generate clean RNA-seq data by removing the transcripts of H. avenae within the raw data before assembly. Using the uncoordinated expression profiles with transcript abundance as a standard, 424 candidate resistance genes were identified, including 302 overlapping genes and 122 VP1620-specific genes. Genes with similar expression patterns were further classified according to the scales of changed transcript abundances, and 182 genes were rescued as supplementary candidate resistance genes. Functional characterizations revealed that diverse defense-related pathways were responsible for wheat resistance against H. avenae. Moreover, phospholipase was involved in many defense-related pathways and localized in the connection position. Furthermore, strong bursts of reactive oxygen species (ROS) within VP1620 roots infected with H. avenae were induced at 24 h and 3 d, and eight ROS-producing genes were significantly upregulated, including three class III peroxidase and five lipoxygenase genes. Large-scale identification of wheat resistance genes were processed by comparative transcriptomic analysis. Functional characterization showed that phospholipases associated with ROS production played vital roles in early defense responses to H. avenae via involvement in diverse defense-related pathways as a hub switch. This study is the first to investigate the early defense responses of wheat against H. avenae, not only provides applicable candidate resistance genes for breeding novel wheat cultivars, but also enables a better understanding of the defense mechanisms of wheat against H. avenae.

Lathyrus sativus transcriptome resistance response to Ascochyta lathyri investigated by deepSuperSAGE analysis

PubMed Central

Almeida, Nuno F.; Krezdorn, Nicolas; Rotter, Björn; Winter, Peter; Rubiales, Diego; Vaz Patto, Maria C.

2015-01-01

Lathyrus sativus (grass pea) is a temperate grain legume crop with a great potential for expansion in dry areas or zones that are becoming more drought-prone. It is also recognized as a potential source of resistance to several important diseases in legumes, such as ascochyta blight. Nevertheless, the lack of detailed genomic and/or transcriptomic information hampers further exploitation of grass pea resistance-related genes in precision breeding. To elucidate the pathways differentially regulated during ascochyta-grass pea interaction and to identify resistance candidate genes, we compared the early response of the leaf gene expression profile of a resistant L. sativus genotype to Ascochyta lathyri infection with a non-inoculated control sample from the same genotype employing deepSuperSAGE. This analysis generated 14.387 UniTags of which 95.7% mapped to a reference grass pea/rust interaction transcriptome. From the total mapped UniTags, 738 were significantly differentially expressed between control and inoculated leaves. The results indicate that several gene classes acting in different phases of the plant/pathogen interaction are involved in the L. sativus response to A. lathyri infection. Most notably a clear up-regulation of defense-related genes involved in and/or regulated by the ethylene pathway was observed. There was also evidence of alterations in cell wall metabolism indicated by overexpression of cellulose synthase and lignin biosynthesis genes. This first genome-wide overview of the gene expression profile of the L. sativus response to ascochyta infection delivered a valuable set of candidate resistance genes for future use in precision breeding. PMID:25852725

Combining gene expression and genetic analyses to identify candidate genes involved in cold responses in pea.

PubMed

Legrand, Sylvain; Marque, Gilles; Blassiau, Christelle; Bluteau, Aurélie; Canoy, Anne-Sophie; Fontaine, Véronique; Jaminon, Odile; Bahrman, Nasser; Mautord, Julie; Morin, Julie; Petit, Aurélie; Baranger, Alain; Rivière, Nathalie; Wilmer, Jeroen; Delbreil, Bruno; Lejeune-Hénaut, Isabelle

2013-09-01

Cold stress affects plant growth and development. In order to better understand the responses to cold (chilling or freezing tolerance), we used two contrasted pea lines. Following a chilling period, the Champagne line becomes tolerant to frost whereas the Terese line remains sensitive. Four suppression subtractive hybridisation libraries were obtained using mRNAs isolated from pea genotypes Champagne and Terese. Using quantitative polymerase chain reaction (qPCR) performed on 159 genes, 43 and 54 genes were identified as differentially expressed at the initial time point and during the time course study, respectively. Molecular markers were developed from the differentially expressed genes and were genotyped on a population of 164 RILs derived from a cross between Champagne and Terese. We identified 5 candidate genes colocalizing with 3 different frost damage quantitative trait loci (QTL) intervals and a protein quantity locus (PQL) rich region previously reported. This investigation revealed the role of constitutive differences between both genotypes in the cold responses, in particular with genes related to glycine degradation pathway that could confer to Champagne a better frost tolerance. We showed that freezing tolerance involves a decrease of expression of genes related to photosynthesis and the expression of a gene involved in the production of cysteine and methionine that could act as cryoprotectant molecules. Although it remains to be confirmed, this study could also reveal the involvement of the jasmonate pathway in the cold responses, since we observed that two genes related to this pathway were mapped in a frost damage QTL interval and in a PQL rich region interval, respectively. Copyright © 2013 Elsevier GmbH. All rights reserved.

Omics and Environmental Science Genomic Approaches With Natural Fish Populations From Polluted Environments

PubMed Central

Bozinovic, Goran; Oleksiak, Marjorie F.

2010-01-01

Transcriptomics and population genomics are two complementary genomic approaches that can be used to gain insight into pollutant effects in natural populations. Transcriptomics identify altered gene expression pathways while population genomics approaches more directly target the causative genomic polymorphisms. Neither approach is restricted to a pre-determined set of genes or loci. Instead, both approaches allow a broad overview of genomic processes. Transcriptomics and population genomic approaches have been used to explore genomic responses in populations of fish from polluted environments and have identified sets of candidate genes and loci that appear biologically important in response to pollution. Often differences in gene expression or loci between polluted and reference populations are not conserved among polluted populations suggesting a biological complexity that we do not yet fully understand. As genomic approaches become less expensive with the advent of new sequencing and genotyping technologies, they will be more widely used in complimentary studies. However, while these genomic approaches are immensely powerful for identifying candidate gene and loci, the challenge of determining biological mechanisms that link genotypes and phenotypes remains. PMID:21072843

Transcriptome Sequencing of Codonopsis pilosula and Identification of Candidate Genes Involved in Polysaccharide Biosynthesis

PubMed Central

Gao, Jian Ping; Wang, Dong; Cao, Ling Ya; Sun, Hai Feng

2015-01-01

Background Codonopsis pilosula (Franch.) Nannf. is one of the most widely used medicinal plants. Although chemical and pharmacological studies have shown that codonopsis polysaccharides (CPPs) are bioactive compounds and that their composition is variable, their biosynthetic pathways remain largely unknown. Next-generation sequencing is an efficient and high-throughput technique that allows the identification of candidate genes involved in secondary metabolism. Principal Findings To identify the components involved in CPP biosynthesis, a transcriptome library, prepared using root and other tissues, was assembled with the help of Illumina sequencing. A total of 9.2 Gb of clean nucleotides was obtained comprising 91,175,044 clean reads, 102,125 contigs, and 45,511 unigenes. After aligning the sequences to the public protein databases, 76.1% of the unigenes were annotated. Among these annotated unigenes, 26,189 were assigned to Gene Ontology categories, 11,415 to Clusters of Orthologous Groups, and 18,848 to Kyoto Encyclopedia of Genes and Genomes pathways. Analysis of abundance of transcripts in the library showed that genes, including those encoding metallothionein, aquaporin, and cysteine protease that are related to stress responses, were in the top list. Among genes involved in the biosynthesis of CPP, those responsible for the synthesis of UDP-L-arabinose and UDP-xylose were highly expressed. Significance To our knowledge, this is the first study to provide a public transcriptome dataset prepared from C. pilosula and an outline of the biosynthetic pathway of polysaccharides in a medicinal plant. Identified candidate genes involved in CPP biosynthesis provide understanding of the biosynthesis and regulation of CPP at the molecular level. PMID:25719364

NAC transcription factor genes: genome-wide identification, phylogenetic, motif and cis-regulatory element analysis in pigeonpea (Cajanus cajan (L.) Millsp.).

PubMed

Satheesh, Viswanathan; Jagannadham, P Tej Kumar; Chidambaranathan, Parameswaran; Jain, P K; Srinivasan, R

2014-12-01

The NAC (NAM, ATAF and CUC) proteins are plant-specific transcription factors implicated in development and stress responses. In the present study 88 pigeonpea NAC genes were identified from the recently published draft genome of pigeonpea by using homology based and de novo prediction programmes. These sequences were further subjected to phylogenetic, motif and promoter analyses. In motif analysis, highly conserved motifs were identified in the NAC domain and also in the C-terminal region of the NAC proteins. A phylogenetic reconstruction using pigeonpea, Arabidopsis and soybean NAC genes revealed 33 putative stress-responsive pigeonpea NAC genes. Several stress-responsive cis-elements were identified through in silico analysis of the promoters of these putative stress-responsive genes. This analysis is the first report of NAC gene family in pigeonpea and will be useful for the identification and selection of candidate genes associated with stress tolerance.

Fine-mapping of qGW4.05, a major QTL for kernel weight and size in maize.

PubMed

Chen, Lin; Li, Yong-xiang; Li, Chunhui; Wu, Xun; Qin, Weiwei; Li, Xin; Jiao, Fuchao; Zhang, Xiaojing; Zhang, Dengfeng; Shi, Yunsu; Song, Yanchun; Li, Yu; Wang, Tianyu

2016-04-12

Kernel weight and size are important components of grain yield in cereals. Although some information is available concerning the map positions of quantitative trait loci (QTL) for kernel weight and size in maize, little is known about the molecular mechanisms of these QTLs. qGW4.05 is a major QTL that is associated with kernel weight and size in maize. We combined linkage analysis and association mapping to fine-map and identify candidate gene(s) at qGW4.05. QTL qGW4.05 was fine-mapped to a 279.6-kb interval in a segregating population derived from a cross of Huangzaosi with LV28. By combining the results of regional association mapping and linkage analysis, we identified GRMZM2G039934 as a candidate gene responsible for qGW4.05. Candidate gene-based association mapping was conducted using a panel of 184 inbred lines with variable kernel weights and kernel sizes. Six polymorphic sites in the gene GRMZM2G039934 were significantly associated with kernel weight and kernel size. The results of linkage analysis and association mapping revealed that GRMZM2G039934 is the most likely candidate gene for qGW4.05. These results will improve our understanding of the genetic architecture and molecular mechanisms underlying kernel development in maize.

Deletion of the Vaccinia Virus Gene A46R, Encoding for an Inhibitor of TLR Signalling, Is an Effective Approach to Enhance the Immunogenicity in Mice of the HIV/AIDS Vaccine Candidate NYVAC-C

PubMed Central

Perdiguero, Beatriz; Gómez, Carmen Elena; Di Pilato, Mauro; Sorzano, Carlos Oscar S.; Delaloye, Julie; Roger, Thierry; Calandra, Thierry; Pantaleo, Giuseppe; Esteban, Mariano

2013-01-01

Viruses have developed strategies to counteract signalling through Toll-like receptors (TLRs) that are involved in the detection of viruses and induction of proinflammatory cytokines and IFNs. Vaccinia virus (VACV) encodes A46 protein which disrupts TLR signalling by interfering with TLR: adaptor interactions. Since the innate immune response to viruses is critical to induce protective immunity, we studied whether deletion of A46R gene in a NYVAC vector expressing HIV-1 Env, Gag, Pol and Nef antigens (NYVAC-C) improves immune responses against HIV-1 antigens. This question was examined in human macrophages and in mice infected with a single A46R deletion mutant of the vaccine candidate NYVAC-C (NYVAC-C-ΔA46R). The viral gene A46R is not required for virus replication in primary chicken embryo fibroblast (CEF) cells and its deletion in NYVAC-C markedly increases TNF, IL-6 and IL-8 secretion by human macrophages. Analysis of the immune responses elicited in BALB/c mice after DNA prime/NYVAC boost immunization shows that deletion of A46R improves the magnitude of the HIV-1-specific CD4 and CD8 T cell immune responses during adaptive and memory phases, maintains the functional profile observed with the parental NYVAC-C and enhances anti-gp120 humoral response during the memory phase. These findings establish the immunological role of VACV A46R on innate immune responses of macrophages in vitro and antigen-specific T and B cell immune responses in vivo and suggest that deletion of viral inhibitors of TLR signalling is a useful approach for the improvement of poxvirus-based vaccine candidates. PMID:24069354

Differential gene expression in response to Fusarium oxysporum infection in resistant and susceptible genotypes of flax (Linum usitatissimum L.).

PubMed

Dmitriev, Alexey A; Krasnov, George S; Rozhmina, Tatiana A; Novakovskiy, Roman O; Snezhkina, Anastasiya V; Fedorova, Maria S; Yurkevich, Olga Yu; Muravenko, Olga V; Bolsheva, Nadezhda L; Kudryavtseva, Anna V; Melnikova, Nataliya V

2017-12-28

Flax (Linum usitatissimum L.) is a crop plant used for fiber and oil production. Although potentially high-yielding flax varieties have been developed, environmental stresses markedly decrease flax production. Among biotic stresses, Fusarium oxysporum f. sp. lini is recognized as one of the most devastating flax pathogens. It causes wilt disease that is one of the major limiting factors for flax production worldwide. Breeding and cultivation of flax varieties resistant to F. oxysporum is the most effective method for controlling wilt disease. Although the mechanisms of flax response to Fusarium have been actively studied, data on the plant response to infection and resistance gene candidates are currently very limited. The transcriptomes of two resistant and two susceptible flax cultivars with respect to Fusarium wilt, as well as two resistant BC 2 F 5 populations, which were grown under control conditions or inoculated with F. oxysporum, were sequenced using the Illumina platform. Genes showing changes in expression under F. oxysporum infection were identified in both resistant and susceptible flax genotypes. We observed the predominant overexpression of numerous genes that are involved in defense response. This was more pronounced in resistant cultivars. In susceptible cultivars, significant downregulation of genes involved in cell wall organization or biogenesis was observed in response to F. oxysporum. In the resistant genotypes, upregulation of genes related to NAD(P)H oxidase activity was detected. Upregulation of a number of genes, including that encoding beta-1,3-glucanase, was significantly greater in the cultivars and BC 2 F 5 populations resistant to Fusarium wilt than in susceptible cultivars in response to F. oxysporum infection. Using high-throughput sequencing, we identified genes involved in the early defense response of L. usitatissimum against the fungus F. oxysporum. In response to F. oxysporum infection, we detected changes in the expression of pathogenesis-related protein-encoding genes and genes involved in ROS production or related to cell wall biogenesis. Furthermore, we identified genes that were upregulated specifically in flax genotypes resistant to Fusarium wilt. We suggest that the identified genes in resistant cultivars and BC 2 F 5 populations showing induced expression in response to F. oxysporum infection are the most promising resistance gene candidates.

Molecular insight into the association between cartilage regeneration and ear wound healing in genetic mouse models: targeting new genes in regeneration.

PubMed

Rai, Muhammad Farooq; Schmidt, Eric J; McAlinden, Audrey; Cheverud, James M; Sandell, Linda J

2013-11-06

Tissue regeneration is a complex trait with few genetic models available. Mouse strains LG/J and MRL are exceptional healers. Using recombinant inbred strains from a large (LG/J, healer) and small (SM/J, nonhealer) intercross, we have previously shown a positive genetic correlation between ear wound healing, knee cartilage regeneration, and protection from osteoarthritis. We hypothesize that a common set of genes operates in tissue healing and articular cartilage regeneration. Taking advantage of archived histological sections from recombinant inbred strains, we analyzed expression of candidate genes through branched-chain DNA technology directly from tissue lysates. We determined broad-sense heritability of candidates, Pearson correlation of candidates with healing phenotypes, and Ward minimum variance cluster analysis for strains. A bioinformatic assessment of allelic polymorphisms within and near candidate genes was also performed. The expression of several candidates was significantly heritable among strains. Although several genes correlated with both ear wound healing and cartilage healing at a marginal level, the expression of four genes representing DNA repair (Xrcc2, Pcna) and Wnt signaling (Axin2, Wnt16) pathways was significantly positively correlated with both phenotypes. Cluster analysis accurately classified healers and nonhealers for seven out of eight strains based on gene expression. Specific sequence differences between LG/J and SM/J were identified as potential causal polymorphisms. Our study suggests a common genetic basis between tissue healing and osteoarthritis susceptibility. Mapping genetic variations causing differences in diverse healing responses in multiple tissues may reveal generic healing processes in pursuit of new therapeutic targets designed to induce or enhance regeneration and, potentially, protection from osteoarthritis.

Association of candidate genes with drought tolerance traits in diverse perennial ryegrass accessions

PubMed Central

Jiang, Yiwei

2013-01-01

Drought is a major environmental stress limiting growth of perennial grasses in temperate regions. Plant drought tolerance is a complex trait that is controlled by multiple genes. Candidate gene association mapping provides a powerful tool for dissection of complex traits. Candidate gene association mapping of drought tolerance traits was conducted in 192 diverse perennial ryegrass (Lolium perenne L.) accessions from 43 countries. The panel showed significant variations in leaf wilting, leaf water content, canopy and air temperature difference, and chlorophyll fluorescence under well-watered and drought conditions across six environments. Analysis of 109 simple sequence repeat markers revealed five population structures in the mapping panel. A total of 2520 expression-based sequence readings were obtained for a set of candidate genes involved in antioxidant metabolism, dehydration, water movement across membranes, and signal transduction, from which 346 single nucleotide polymorphisms were identified. Significant associations were identified between a putative LpLEA3 encoding late embryogenesis abundant group 3 protein and a putative LpFeSOD encoding iron superoxide dismutase and leaf water content, as well as between a putative LpCyt Cu-ZnSOD encoding cytosolic copper-zinc superoxide dismutase and chlorophyll fluorescence under drought conditions. Four of these identified significantly associated single nucleotide polymorphisms from these three genes were also translated to amino acid substitutions in different genotypes. These results indicate that allelic variation in these genes may affect whole-plant response to drought stress in perennial ryegrass. PMID:23386684

Transcriptome-wide characterization of candidate genes for improving the water use efficiency of energy crops grown on semiarid land.

PubMed

Fan, Yangyang; Wang, Qian; Kang, Lifang; Liu, Wei; Xu, Qin; Xing, Shilai; Tao, Chengcheng; Song, Zhihong; Zhu, Caiyun; Lin, Cong; Yan, Juan; Li, Jianqiang; Sang, Tao

2015-10-01

Understanding the genetic basis of water use efficiency (WUE) and its roles in plant adaptation to a drought environment is essential for the production of second-generation energy crops in water-deficit marginal land. In this study, RNA-Seq and WUE measurements were performed for 78 individuals of Miscanthus lutarioriparius grown in two common gardens, one located in warm and wet Central China near the native habitats of the species and the other located in the semiarid Loess Plateau, the domestication site of the energy crop. The field measurements showed that WUE of M. lutarioriparius in the semiarid location was significantly higher than that in the wet location. A matrix correlation analysis was conducted between gene expression levels and WUE to identify candidate genes involved in the improvement of WUE from the native to the domestication site. A total of 48 candidate genes were identified and assigned to functional categories, including photosynthesis, stomatal regulation, protein metabolism, and abiotic stress responses. Of these genes, nearly 73% were up-regulated in the semiarid site. It was also found that the relatively high expression variation of the WUE-related genes was affected to a larger extent by environment than by genetic variation. The study demonstrates that transcriptome-wide correlation between physiological phenotypes and expression levels offers an effective means for identifying candidate genes involved in the adaptation to environmental changes. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Comparative Transcriptional Profiling of the Axolotl Limb Identifies a Tripartite Regeneration-Specific Gene Program

PubMed Central

Knapp, Dunja; Schulz, Herbert; Rascon, Cynthia Alexander; Volkmer, Michael; Scholz, Juliane; Nacu, Eugen; Le, Mu; Novozhilov, Sergey; Tazaki, Akira; Protze, Stephanie; Jacob, Tina; Hubner, Norbert; Habermann, Bianca; Tanaka, Elly M.

2013-01-01

Understanding how the limb blastema is established after the initial wound healing response is an important aspect of regeneration research. Here we performed parallel expression profile time courses of healing lateral wounds versus amputated limbs in axolotl. This comparison between wound healing and regeneration allowed us to identify amputation-specific genes. By clustering the expression profiles of these samples, we could detect three distinguishable phases of gene expression – early wound healing followed by a transition-phase leading to establishment of the limb development program, which correspond to the three phases of limb regeneration that had been defined by morphological criteria. By focusing on the transition-phase, we identified 93 strictly amputation-associated genes many of which are implicated in oxidative-stress response, chromatin modification, epithelial development or limb development. We further classified the genes based on whether they were or were not significantly expressed in the developing limb bud. The specific localization of 53 selected candidates within the blastema was investigated by in situ hybridization. In summary, we identified a set of genes that are expressed specifically during regeneration and are therefore, likely candidates for the regulation of blastema formation. PMID:23658691

Transcriptome profiling during a natural host-parasite interaction.

PubMed

McTaggart, Seanna J; Cézard, Timothée; Garbutt, Jennie S; Wilson, Phil J; Little, Tom J

2015-08-28

Infection outcome in some coevolving host-pathogens is characterised by host-pathogen genetic interactions, where particular host genotypes are susceptible only to a subset of pathogen genotypes. To identify candidate genes responsible for the infection status of the host, we exposed a Daphnia magna host genotype to two bacterial strains of Pasteuria ramosa, one of which results in infection, while the other does not. At three time points (four, eight and 12 h) post pathogen exposure, we sequenced the complete transcriptome of the hosts using RNA-Seq (Illumina). We observed a rapid and transient response to pathogen treatment. Specifically, at the four-hour time point, eight genes were differentially expressed. At the eight-hour time point, a single gene was differentially expressed in the resistant combination only, and no genes were differentially expressed at the 12-h time point. We found that pathogen-associated transcriptional activity is greatest soon after exposure. Genome-wide resistant combinations were more likely to show upregulation of genes, while susceptible combinations were more likely to be downregulated, relative to controls. Our results also provide several novel candidate genes that may play a pivotal role in determining infection outcomes.

A Genomics Approach to Deciphering Lignin Biosynthesis in Switchgrass[W

PubMed Central

Shen, Hui; Mazarei, Mitra; Hisano, Hiroshi; Escamilla-Trevino, Luis; Fu, Chunxiang; Pu, Yunqiao; Rudis, Mary R.; Tang, Yuhong; Xiao, Xirong; Jackson, Lisa; Li, Guifen; Hernandez, Tim; Chen, Fang; Ragauskas, Arthur J.; Stewart, C. Neal; Wang, Zeng-Yu; Dixon, Richard A.

2013-01-01

It is necessary to overcome recalcitrance of the biomass to saccharification (sugar release) to make switchgrass (Panicum virgatum) economically viable as a feedstock for liquid biofuels. Lignin content correlates negatively with sugar release efficiency in switchgrass, but selecting the right gene candidates for engineering lignin biosynthesis in this tetraploid outcrossing species is not straightforward. To assist this endeavor, we have used an inducible switchgrass cell suspension system for studying lignin biosynthesis in response to exogenous brassinolide. By applying a combination of protein sequence phylogeny with whole-genome microarray analyses of induced cell cultures and developing stem internode sections, we have generated a list of candidate monolignol biosynthetic genes for switchgrass. Several genes that were strongly supported through our bioinformatics analysis as involved in lignin biosynthesis were confirmed by gene silencing studies, in which lignin levels were reduced as a result of targeting a single gene. However, candidate genes encoding enzymes involved in the early steps of the currently accepted monolignol biosynthesis pathway in dicots may have functionally redundant paralogues in switchgrass and therefore require further evaluation. This work provides a blueprint and resources for the systematic genome-wide study of the monolignol pathway in switchgrass, as well as other C4 monocot species. PMID:24285795

Comparative analysis of transcriptome in two wheat genotypes with contrasting levels of drought tolerance

USDA-ARS?s Scientific Manuscript database

Drought tolerance is a complex trait that is governed by multiple genes. To identify the potential candidate genes, comparative analysis of drought stress-responsive transcriptome between drought-tolerant (Triticum aestivum Cv. C306) and drought-sensitive (Triticum aestivum Cv. WL711) genotypes was ...

Polymorphism within thyroid hormone responsive (THRSP) associated with weaning-to-oestrus interval in swine

USDA-ARS?s Scientific Manuscript database

The objective of this study was to assess polymorphisms within lipogenic-related candidate genes for association with the reproductive traits; age at puberty (AP), ovulation rate (OR), and weaning-to-estrus interval (WEI). Variations within the anorectic gene Cocaine- and Amphetamine-Regulated Trans...

Candidate genes for obesity-susceptibility show enriched association within a large genome-wide association study for BMI.

PubMed

Vimaleswaran, Karani S; Tachmazidou, Ioanna; Zhao, Jing Hua; Hirschhorn, Joel N; Dudbridge, Frank; Loos, Ruth J F

2012-10-15

Before the advent of genome-wide association studies (GWASs), hundreds of candidate genes for obesity-susceptibility had been identified through a variety of approaches. We examined whether those obesity candidate genes are enriched for associations with body mass index (BMI) compared with non-candidate genes by using data from a large-scale GWAS. A thorough literature search identified 547 candidate genes for obesity-susceptibility based on evidence from animal studies, Mendelian syndromes, linkage studies, genetic association studies and expression studies. Genomic regions were defined to include the genes ±10 kb of flanking sequence around candidate and non-candidate genes. We used summary statistics publicly available from the discovery stage of the genome-wide meta-analysis for BMI performed by the genetic investigation of anthropometric traits consortium in 123 564 individuals. Hypergeometric, rank tail-strength and gene-set enrichment analysis tests were used to test for the enrichment of association in candidate compared with non-candidate genes. The hypergeometric test of enrichment was not significant at the 5% P-value quantile (P = 0.35), but was nominally significant at the 25% quantile (P = 0.015). The rank tail-strength and gene-set enrichment tests were nominally significant for the full set of genes and borderline significant for the subset without SNPs at P < 10(-7). Taken together, the observed evidence for enrichment suggests that the candidate gene approach retains some value. However, the degree of enrichment is small despite the extensive number of candidate genes and the large sample size. Studies that focus on candidate genes have only slightly increased chances of detecting associations, and are likely to miss many true effects in non-candidate genes, at least for obesity-related traits.

Identification and expression of the WRKY transcription factors of Carica papaya in response to abiotic and biotic stresses.

PubMed

Pan, Lin-Jie; Jiang, Ling

2014-03-01

The WRKY transcription factor (TF) plays a very important role in the response of plants to various abiotic and biotic stresses. A local papaya database was built according to the GenBank expressed sequence tag database using the BioEdit software. Fifty-two coding sequences of Carica papaya WRKY TFs were predicted using the tBLASTn tool. The phylogenetic tree of the WRKY proteins was classified. The expression profiles of 13 selected C. papaya WRKY TF genes under stress induction were constructed by quantitative real-time polymerase chain reaction. The expression levels of these WRKY genes in response to 3 abiotic and 2 biotic stresses were evaluated. TF807.3 and TF72.14 are upregulated by low temperature; TF807.3, TF43.76, TF12.199 and TF12.62 are involved in the response to drought stress; TF9.35, TF18.51, TF72.14 and TF12.199 is involved in response to wound; TF12.199, TF807.3, TF21.156 and TF18.51 was induced by PRSV pathogen; TF72.14 and TF43.76 are upregulated by SA. The regulated expression levels of above eight genes normalized against housekeeping gene actin were significant at probability of 0.01 levels. These WRKY TFs could be related to corresponding stress resistance and selected as the candidate genes, especially, the two genes TF807.3 and TF12.199, which were regulated notably by four stresses respectively. This study may provide useful information and candidate genes for the development of transgenic stress tolerant papaya varieties.

Gene expression changes in the coccolithophore Emiliania huxleyi after 500 generations of selection to ocean acidification.

PubMed

Lohbeck, Kai T; Riebesell, Ulf; Reusch, Thorsten B H

2014-07-07

Coccolithophores are unicellular marine algae that produce biogenic calcite scales and substantially contribute to marine primary production and carbon export to the deep ocean. Ongoing ocean acidification particularly impairs calcifying organisms, mostly resulting in decreased growth and calcification. Recent studies revealed that the immediate physiological response in the coccolithophore Emiliania huxleyi to ocean acidification may be partially compensated by evolutionary adaptation, yet the underlying molecular mechanisms are currently unknown. Here, we report on the expression levels of 10 candidate genes putatively relevant to pH regulation, carbon transport, calcification and photosynthesis in E. huxleyi populations short-term exposed to ocean acidification conditions after acclimation (physiological response) and after 500 generations of high CO2 adaptation (adaptive response). The physiological response revealed downregulation of candidate genes, well reflecting the concomitant decrease of growth and calcification. In the adaptive response, putative pH regulation and carbon transport genes were up-regulated, matching partial restoration of growth and calcification in high CO2-adapted populations. Adaptation to ocean acidification in E. huxleyi likely involved improved cellular pH regulation, presumably indirectly affecting calcification. Adaptive evolution may thus have the potential to partially restore cellular pH regulatory capacity and thereby mitigate adverse effects of ocean acidification. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

Identification of positional candidate genes for response to crowding stress in rainbow trout

USDA-ARS?s Scientific Manuscript database

Fish under intensive rearing conditions experience various stressors which have negative impacts on survival, growth, reproduction and fillet quality. Identifying and characterizing the molecular mechanisms underlying stress responses will facilitate the development of strategies for improving anima...

Identifying gnostic predictors of the vaccine response.

PubMed

Haining, W Nicholas; Pulendran, Bali

2012-06-01

Molecular predictors of the response to vaccination could transform vaccine development. They would allow larger numbers of vaccine candidates to be rapidly screened, shortening the development time for new vaccines. Gene-expression based predictors of vaccine response have shown early promise. However, a limitation of gene-expression based predictors is that they often fail to reveal the mechanistic basis of their ability to classify response. Linking predictive signatures to the function of their component genes would advance basic understanding of vaccine immunity and also improve the robustness of vaccine prediction. New analytic tools now allow more biological meaning to be extracted from predictive signatures. Functional genomic approaches to perturb gene expression in mammalian cells permit the function of predictive genes to be surveyed in highly parallel experiments. The challenge for vaccinologists is therefore to use these tools to embed mechanistic insights into predictors of vaccine response. Copyright © 2012 Elsevier Ltd. All rights reserved.

Identifying gnostic predictors of the vaccine response

PubMed Central

Haining, W. Nicholas; Pulendran, Bali

2012-01-01

Molecular predictors of the response to vaccination could transform vaccine development. They would allow larger numbers of vaccine candidates to be rapidly screened, shortening the development time for new vaccines. Gene-expression based predictors of vaccine response have shown early promise. However, a limitation of gene-expression based predictors is that they often fail to reveal the mechanistic basis for their ability to classify response. Linking predictive signatures to the function of their component genes would advance basic understanding of vaccine immunity and also improve the robustness of outcome classification. New analytic tools now allow more biological meaning to be extracted from predictive signatures. Functional genomic approaches to perturb gene expression in mammalian cells permit the function of predictive genes to be surveyed in highly parallel experiments. The challenge for vaccinologists is therefore to use these tools to embed mechanistic insights into predictors of vaccine response. PMID:22633886

Epigenetics of human asthma and allergy: promises to keep.

PubMed

Devries, Avery; Vercelli, Donata

2013-09-01

The interest in asthma epigenetics is high because epigenetic mechanisms likely contribute to the environmental origins of the disease and its phenotypic variability. This review presents the main findings of asthma epigenetics and the challenges that still delay progress. We examined the current literature on asthma epigenetics (31 reviews and 25 original data publications). We focused on DNA methylation studies in populations. Both genome-wide and candidate gene studies have explored DNA methylation in allergic disease. Genome-wide studies ask whether and which regions of the genome are differentially methylated in relation to the phenotype of interest. Identification of such regions provides clues about the identity of the genes, pathways and networks underpinning a phenotype and connects these networks to the phenotype through epigenetic mechanisms. Candidate gene studies examine DNA methylation in genes chosen because of their known or hypothesized role in immunity, responses to environmental stimuli or disease pathogenesis. Most existing studies in asthma and allergy focused on candidate genes involved in the response to environmental pollutants. Asthma epigenetics is still in its infancy. The paucity of primary literature originates from methodological and analytical challenges of genome-wide studies, the difficulties in interpreting small differences in DNA methylation, and the need to develop robust bioinformatic tools for pathway, network and system analyses of epigenetic data. Once these challenges have been overcome, epigenetic studies will likely provide important insights about the inception and pathogenesis of allergic disease and will help define disease endotypes.

Fast Evolution and Lineage-Specific Gene Family Expansions of Aphid Salivary Effectors Driven by Interactions with Host-Plants.

PubMed

Boulain, Hélène; Legeai, Fabrice; Guy, Endrick; Morlière, Stéphanie; Douglas, Nadine E; Oh, Jonghee; Murugan, Marimuthu; Smith, Michael; Jaquiéry, Julie; Peccoud, Jean; White, Frank F; Carolan, James C; Simon, Jean-Christophe; Sugio, Akiko

2018-05-18

Effector proteins play crucial roles in plant-parasite interactions by suppressing plant defenses and hijacking plant physiological responses to facilitate parasite invasion and propagation. Although effector proteins have been characterized in many microbial plant pathogens, their nature and role in adaptation to host plants are largely unknown in insect herbivores. Aphids rely on salivary effector proteins injected into the host plants to promote phloem sap uptake. Therefore, gaining insight into the repertoire and evolution of aphid effectors is key to unveiling the mechanisms responsible for aphid virulence and host plant specialization. With this aim in mind, we assembled catalogues of putative effectors in the legume specialist aphid, Acyrthosiphon pisum, using transcriptomics and proteomics approaches. We identified 3603 candidate effector genes predicted to be expressed in A. pisum salivary glands (SGs), and 740 of which displayed up-regulated expression in SGs in comparison to the alimentary tract. A search for orthologs in 17 arthropod genomes revealed that SG-up-regulated effector candidates of A. pisum are enriched in aphid-specific genes and tend to evolve faster compared to the whole gene set. We also found that a large fraction of proteins detected in the A. pisum saliva belonged to three gene families, of which certain members show evidence consistent with positive selection. Overall, this comprehensive analysis suggests that the large repertoire of effector candidates in A. pisum constitutes a source of novelties promoting plant adaptation to legumes.

Genome-Wide Investigation and Expression Profiling of AP2/ERF Transcription Factor Superfamily in Foxtail Millet (Setaria italica L.)

PubMed Central

Lata, Charu; Mishra, Awdhesh Kumar; Muthamilarasan, Mehanathan; Bonthala, Venkata Suresh; Khan, Yusuf; Prasad, Manoj

2014-01-01

The APETALA2/ethylene-responsive element binding factor (AP2/ERF) family is one of the largest transcription factor (TF) families in plants that includes four major sub-families, namely AP2, DREB (dehydration responsive element binding), ERF (ethylene responsive factors) and RAV (Related to ABI3/VP). AP2/ERFs are known to play significant roles in various plant processes including growth and development and biotic and abiotic stress responses. Considering this, a comprehensive genome-wide study was conducted in foxtail millet (Setaria italica L.). A total of 171 AP2/ERF genes were identified by systematic sequence analysis and were physically mapped onto nine chromosomes. Phylogenetic analysis grouped AP2/ERF genes into six classes (I to VI). Duplication analysis revealed that 12 (∼7%) SiAP2/ERF genes were tandem repeated and 22 (∼13%) were segmentally duplicated. Comparative physical mapping between foxtail millet AP2/ERF genes and its orthologs of sorghum (18 genes), maize (14 genes), rice (9 genes) and Brachypodium (6 genes) showed the evolutionary insights of AP2/ERF gene family and also the decrease in orthology with increase in phylogenetic distance. The evolutionary significance in terms of gene-duplication and divergence was analyzed by estimating synonymous and non-synonymous substitution rates. Expression profiling of candidate AP2/ERF genes against drought, salt and phytohormones revealed insights into their precise and/or overlapping expression patterns which could be responsible for their functional divergence in foxtail millet. The study showed that the genes SiAP2/ERF-069, SiAP2/ERF-103 and SiAP2/ERF-120 may be considered as potential candidate genes for further functional validation as well for utilization in crop improvement programs for stress resistance since these genes were up-regulated under drought and salinity stresses in ABA dependent manner. Altogether the present study provides new insights into evolution, divergence and systematic functional analysis of AP2/ERF gene family at genome level in foxtail millet which may be utilized for improving stress adaptation and tolerance in millets, cereals and bioenergy grasses. PMID:25409524

Genome-wide investigation and expression profiling of AP2/ERF transcription factor superfamily in foxtail millet (Setaria italica L.).

PubMed

Lata, Charu; Mishra, Awdhesh Kumar; Muthamilarasan, Mehanathan; Bonthala, Venkata Suresh; Khan, Yusuf; Prasad, Manoj

2014-01-01

The APETALA2/ethylene-responsive element binding factor (AP2/ERF) family is one of the largest transcription factor (TF) families in plants that includes four major sub-families, namely AP2, DREB (dehydration responsive element binding), ERF (ethylene responsive factors) and RAV (Related to ABI3/VP). AP2/ERFs are known to play significant roles in various plant processes including growth and development and biotic and abiotic stress responses. Considering this, a comprehensive genome-wide study was conducted in foxtail millet (Setaria italica L.). A total of 171 AP2/ERF genes were identified by systematic sequence analysis and were physically mapped onto nine chromosomes. Phylogenetic analysis grouped AP2/ERF genes into six classes (I to VI). Duplication analysis revealed that 12 (∼7%) SiAP2/ERF genes were tandem repeated and 22 (∼13%) were segmentally duplicated. Comparative physical mapping between foxtail millet AP2/ERF genes and its orthologs of sorghum (18 genes), maize (14 genes), rice (9 genes) and Brachypodium (6 genes) showed the evolutionary insights of AP2/ERF gene family and also the decrease in orthology with increase in phylogenetic distance. The evolutionary significance in terms of gene-duplication and divergence was analyzed by estimating synonymous and non-synonymous substitution rates. Expression profiling of candidate AP2/ERF genes against drought, salt and phytohormones revealed insights into their precise and/or overlapping expression patterns which could be responsible for their functional divergence in foxtail millet. The study showed that the genes SiAP2/ERF-069, SiAP2/ERF-103 and SiAP2/ERF-120 may be considered as potential candidate genes for further functional validation as well for utilization in crop improvement programs for stress resistance since these genes were up-regulated under drought and salinity stresses in ABA dependent manner. Altogether the present study provides new insights into evolution, divergence and systematic functional analysis of AP2/ERF gene family at genome level in foxtail millet which may be utilized for improving stress adaptation and tolerance in millets, cereals and bioenergy grasses.

Human native lipoprotein-induced de novo DNA methylation is associated with repression of inflammatory genes in THP-1 macrophages.

PubMed

Rangel-Salazar, Rubén; Wickström-Lindholm, Marie; Aguilar-Salinas, Carlos A; Alvarado-Caudillo, Yolanda; Døssing, Kristina B V; Esteller, Manel; Labourier, Emmanuel; Lund, Gertrud; Nielsen, Finn C; Rodríguez-Ríos, Dalia; Solís-Martínez, Martha O; Wrobel, Katarzyna; Wrobel, Kazimierz; Zaina, Silvio

2011-11-25

We previously showed that a VLDL- and LDL-rich mix of human native lipoproteins induces a set of repressive epigenetic marks, i.e. de novo DNA methylation, histone 4 hypoacetylation and histone 4 lysine 20 (H4K20) hypermethylation in THP-1 macrophages. Here, we: 1) ask what gene expression changes accompany these epigenetic responses; 2) test the involvement of candidate factors mediating the latter. We exploited genome expression arrays to identify target genes for lipoprotein-induced silencing, in addition to RNAi and expression studies to test the involvement of candidate mediating factors. The study was conducted in human THP-1 macrophages. Native lipoprotein-induced de novo DNA methylation was associated with a general repression of various critical genes for macrophage function, including pro-inflammatory genes. Lipoproteins showed differential effects on epigenetic marks, as de novo DNA methylation was induced by VLDL and to a lesser extent by LDL, but not by HDL, and VLDL induced H4K20 hypermethylation, while HDL caused H4 deacetylation. The analysis of candidate factors mediating VLDL-induced DNA hypermethylation revealed that this response was: 1) surprisingly, mediated exclusively by the canonical maintenance DNA methyltransferase DNMT1, and 2) independent of the Dicer/micro-RNA pathway. Our work provides novel insights into epigenetic gene regulation by native lipoproteins. Furthermore, we provide an example of DNMT1 acting as a de novo DNA methyltransferase independently of canonical de novo enzymes, and show proof of principle that de novo DNA methylation can occur independently of a functional Dicer/micro-RNA pathway in mammals.

Identification of KIF3A as a Novel Candidate Gene for Childhood Asthma Using RNA Expression and Population Allelic Frequencies Differences

PubMed Central

Butsch Kovacic, Melinda; Biagini Myers, Jocelyn M.; Wang, Ning; Martin, Lisa J.; Lindsey, Mark; Ericksen, Mark B.; He, Hua; Patterson, Tia L.; Baye, Tesfaye M.; Torgerson, Dara; Roth, Lindsey A.; Gupta, Jayanta; Sivaprasad, Umasundari; Gibson, Aaron M.; Tsoras, Anna M.; Hu, Donglei; Eng, Celeste; Chapela, Rocío; Rodríguez-Santana, José R.; Rodríguez-Cintrón, William; Avila, Pedro C.; Beckman, Kenneth; Seibold, Max A.; Gignoux, Chris; Musaad, Salma M.; Chen, Weiguo; Burchard, Esteban González; Khurana Hershey, Gurjit K.

2011-01-01

Background Asthma is a chronic inflammatory disease with a strong genetic predisposition. A major challenge for candidate gene association studies in asthma is the selection of biologically relevant genes. Methodology/Principal Findings Using epithelial RNA expression arrays, HapMap allele frequency variation, and the literature, we identified six possible candidate susceptibility genes for childhood asthma including ADCY2, DNAH5, KIF3A, PDE4B, PLAU, SPRR2B. To evaluate these genes, we compared the genotypes of 194 predominantly tagging SNPs in 790 asthmatic, allergic and non-allergic children. We found that SNPs in all six genes were nominally associated with asthma (p<0.05) in our discovery cohort and in three independent cohorts at either the SNP or gene level (p<0.05). Further, we determined that our selection approach was superior to random selection of genes either differentially expressed in asthmatics compared to controls (p = 0.0049) or selected based on the literature alone (p = 0.0049), substantiating the validity of our gene selection approach. Importantly, we observed that 7 of 9 SNPs in the KIF3A gene more than doubled the odds of asthma (OR = 2.3, p<0.0001) and increased the odds of allergic disease (OR = 1.8, p<0.008). Our data indicate that KIF3A rs7737031 (T-allele) has an asthma population attributable risk of 18.5%. The association between KIF3A rs7737031 and asthma was validated in 3 independent populations, further substantiating the validity of our gene selection approach. Conclusions/Significance Our study demonstrates that KIF3A, a member of the kinesin superfamily of microtubule associated motors that are important in the transport of protein complexes within cilia, is a novel candidate gene for childhood asthma. Polymorphisms in KIF3A may in part be responsible for poor mucus and/or allergen clearance from the airways. Furthermore, our study provides a promising framework for the identification and evaluation of novel candidate susceptibility genes. PMID:21912604

Novel genes on rat chromosome 10 are linked to body fat mass, preadipocyte number and adipocyte size.

PubMed

Weingarten, A; Turchetti, L; Krohn, K; Klöting, I; Kern, M; Kovacs, P; Stumvoll, M; Blüher, M; Klöting, N

2016-12-01

The genetic architecture of obesity is multifactorial. We have previously identified a quantitative trait locus (QTL) on rat chromosome 10 in a F2 cross of Wistar Ottawa Karlsburg (WOKW) and Dark Agouti (DA) rats responsible for obesity-related traits. The QTL was confirmed in congenic DA.WOKW10 rats. To pinpoint the region carrying causal genes, we established two new subcongenic lines, L1 and L2, with smaller refined segments of chromosome 10 to identify novel candidate genes. All lines were extensively characterized under different diet conditions. We employed transcriptome analysis in visceral adipose tissue (VAT) by RNA-Seq technology to identify potential underlying genes in the segregating regions. Three candidate genes were measured in human paired samples of VAT and subcutaneous (SC) AT (SAT) (N=304) individuals with a wide range of body weight and glucose homeostasis parameters. DA.WOKW and L1 subcongenic lines were protected against body fat gain under high-fat diet (HFD), whereas L2 and DA had significantly more body fat after high-fat feeding. Interestingly, adipocyte size distribution in SAT and epigonadal AT of L1 subcongenic rats did not undergo typical ballooning under HFD and the number of preadipocytes in AT was significantly elevated in L2 compared with L1 and parental rats. Transcriptome analysis identified three candidate genes in VAT on rat chromosome 10. In humans, these candidate genes were differentially expressed between SAT and VAT. Moreover, HID1 mRNA significantly correlates with parameters of obesity and glucose metabolism. Our data suggest novel candidate genes for obesity that map on rat chromosome 10 in an interval 102.2-104.7 Mb and are strongly associated with body fat mass regulation, preadipocyte number and adipocyte size in rats. Among those genes, AT head involution defective (HID1) mRNA expression may be relevant for human fat distribution and glucose homeostasis.

Using microarrays to identify positional candidate genes for QTL: the case study of ACTH response in pigs.

PubMed

Jouffe, Vincent; Rowe, Suzanne; Liaubet, Laurence; Buitenhuis, Bart; Hornshøj, Henrik; SanCristobal, Magali; Mormède, Pierre; de Koning, D J

2009-07-16

Microarray studies can supplement QTL studies by suggesting potential candidate genes in the QTL regions, which by themselves are too large to provide a limited selection of candidate genes. Here we provide a case study where we explore ways to integrate QTL data and microarray data for the pig, which has only a partial genome sequence. We outline various procedures to localize differentially expressed genes on the pig genome and link this with information on published QTL. The starting point is a set of 237 differentially expressed cDNA clones in adrenal tissue from two pig breeds, before and after treatment with adrenocorticotropic hormone (ACTH). Different approaches to localize the differentially expressed (DE) genes to the pig genome showed different levels of success and a clear lack of concordance for some genes between the various approaches. For a focused analysis on 12 genes, overlapping QTL from the public domain were presented. Also, differentially expressed genes underlying QTL for ACTH response were described. Using the latest version of the draft sequence, the differentially expressed genes were mapped to the pig genome. This enabled co-location of DE genes and previously studied QTL regions, but the draft genome sequence is still incomplete and will contain many errors. A further step to explore links between DE genes and QTL at the pathway level was largely unsuccessful due to the lack of annotation of the pig genome. This could be improved by further comparative mapping analyses but this would be time consuming. This paper provides a case study for the integration of QTL data and microarray data for a species with limited genome sequence information and annotation. The results illustrate the challenges that must be addressed but also provide a roadmap for future work that is applicable to other non-model species.

A Controlled Pharmacogenetic Trial of Sibutramine on Weight Loss and Body Composition in Obese or Overweight Adults

PubMed Central

Grudell, April B.M.; Sweetser, Seth; Camilleri, Michael; Eckert, Deborah J.; Vazquez-Roque, Maria I.; Carlson, Paula J.; Burton, Duane D.; Braddock, Autumn E.; Clark, Matthew M.; Graszer, Karen M.; Kalsy, Sarah A.; Zinsmeister, Alan R.

2008-01-01

Background/ Aim Weight loss in response to sibutramine is highly variable. We assessed the association of specific markers of polymorphisms of candidate a2A adrenoreceptor, 5-HT transporter and GNβ3 genes and weight loss with sibutramine. Methods We conducted a randomized, double-blind, pharmacogenetic study of behavioral therapy and sibutramine (10 or 15 mg daily) or placebo for 12 weeks in 181 overweight or obese participants. We measured body weight, BMI, body composition, gastric emptying and genetic variation (α2A C1291G, 5-HTTLPR, and GNβ3 C825T genotypes). ANCOVA was used to assess treatment effects on, and associations of the specific markers of candidate genes with weight loss and body composition. Results Sibutramine, 10 and 15 mg, caused significant weight loss (p = 0.009); there was a statistically significant gene by dose interaction for GNβ3 genotype. For each candidate gene, significant treatment effects at 12 weeks were observed (p<0.017) for all specific genotype variants (delta weight loss in the 2 sibutramine doses versus placebo): α2A CC genotype ( Δ ~5kg), GNβ3 TC/TT genotype (Δ ~6kg), and 5-HTTLPR LS/SS (Δ ~4.5kg). Gene pairs resulted in significantly greater sibutramine treatment effects on weight (both p<0.002): in participants with 5-HTTLPR LS/SS with GNβ3 TC/TT, Δ ~6kg and those with a2A CC with GNβ3 TC/TT, Δ ~8kg; however, effects were not synergistic. Treatment with sibutramine also resulted in significantly greater reduction of body fat for specific α2A CC and GNβ3 TC/TT genotype variants individually (both p<0.02). Conclusions Selection of patients with obesity based on candidate genes may enhance response to multidimensional sibutramine and behavioral therapy. PMID:18725220

Identification of evolutionarily conserved DNA damage response genes that alter sensitivity to cisplatin

PubMed Central

Gaponova, Anna V.; Deneka, Alexander Y.; Beck, Tim N.; Liu, Hanqing; Andrianov, Gregory; Nikonova, Anna S.; Nicolas, Emmanuelle; Einarson, Margret B.; Golemis, Erica A.; Serebriiskii, Ilya G.

2017-01-01

Ovarian, head and neck, and other cancers are commonly treated with cisplatin and other DNA damaging cytotoxic agents. Altered DNA damage response (DDR) contributes to resistance of these tumors to chemotherapies, some targeted therapies, and radiation. DDR involves multiple protein complexes and signaling pathways, some of which are evolutionarily ancient and involve protein orthologs conserved from yeast to humans. To identify new regulators of cisplatin-resistance in human tumors, we integrated high throughput and curated datasets describing yeast genes that regulate sensitivity to cisplatin and/or ionizing radiation. Next, we clustered highly validated genes based on chemogenomic profiling, and then mapped orthologs of these genes in expanded genomic networks for multiple metazoans, including humans. This approach identified an enriched candidate set of genes involved in the regulation of resistance to radiation and/or cisplatin in humans. Direct functional assessment of selected candidate genes using RNA interference confirmed their activity in influencing cisplatin resistance, degree of γH2AX focus formation and ATR phosphorylation, in ovarian and head and neck cancer cell lines, suggesting impaired DDR signaling as the driving mechanism. This work enlarges the set of genes that may contribute to chemotherapy resistance and provides a new contextual resource for interpreting next generation sequencing (NGS) genomic profiling of tumors. PMID:27863405

Tumour gene expression predicts response to cetuximab in patients with KRAS wild-type metastatic colorectal cancer.

PubMed

Baker, J B; Dutta, D; Watson, D; Maddala, T; Munneke, B M; Shak, S; Rowinsky, E K; Xu, L-A; Harbison, C T; Clark, E A; Mauro, D J; Khambata-Ford, S

2011-02-01

Although it is accepted that metastatic colorectal cancers (mCRCs) that carry activating mutations in KRAS are unresponsive to anti-epidermal growth factor receptor (EGFR) monoclonal antibodies, a significant fraction of KRAS wild-type (wt) mCRCs are also unresponsive to anti-EGFR therapy. Genes encoding EGFR ligands amphiregulin (AREG) and epiregulin (EREG) are promising gene expression-based markers but have not been incorporated into a test to dichotomise KRAS wt mCRC patients with respect to sensitivity to anti-EGFR treatment. We used RT-PCR to test 110 candidate gene expression markers in primary tumours from 144 KRAS wt mCRC patients who received monotherapy with the anti-EGFR antibody cetuximab. Results were correlated with multiple clinical endpoints: disease control, objective response, and progression-free survival (PFS). Expression of many of the tested candidate genes, including EREG and AREG, strongly associate with all clinical endpoints. Using multivariate analysis with two-layer five-fold cross-validation, we constructed a four-gene predictive classifier. Strikingly, patients below the classifier cutpoint had PFS and disease control rates similar to those of patients with KRAS mutant mCRC. Gene expression appears to identify KRAS wt mCRC patients who receive little benefit from cetuximab. It will be important to test this model in an independent validation study.

A Simple Screening Approach To Prioritize Genes for Functional Analysis Identifies a Role for Interferon Regulatory Factor 7 in the Control of Respiratory Syncytial Virus Disease

PubMed Central

McDonald, Jacqueline U.; Kaforou, Myrsini; Clare, Simon; Hale, Christine; Ivanova, Maria; Huntley, Derek; Dorner, Marcus; Wright, Victoria J.; Levin, Michael; Martinon-Torres, Federico; Herberg, Jethro A.

2016-01-01

ABSTRACT Greater understanding of the functions of host gene products in response to infection is required. While many of these genes enable pathogen clearance, some enhance pathogen growth or contribute to disease symptoms. Many studies have profiled transcriptomic and proteomic responses to infection, generating large data sets, but selecting targets for further study is challenging. Here we propose a novel data-mining approach combining multiple heterogeneous data sets to prioritize genes for further study by using respiratory syncytial virus (RSV) infection as a model pathogen with a significant health care impact. The assumption was that the more frequently a gene is detected across multiple studies, the more important its role is. A literature search was performed to find data sets of genes and proteins that change after RSV infection. The data sets were standardized, collated into a single database, and then panned to determine which genes occurred in multiple data sets, generating a candidate gene list. This candidate gene list was validated by using both a clinical cohort and in vitro screening. We identified several genes that were frequently expressed following RSV infection with no assigned function in RSV control, including IFI27, IFIT3, IFI44L, GBP1, OAS3, IFI44, and IRF7. Drilling down into the function of these genes, we demonstrate a role in disease for the gene for interferon regulatory factor 7, which was highly ranked on the list, but not for IRF1, which was not. Thus, we have developed and validated an approach for collating published data sets into a manageable list of candidates, identifying novel targets for future analysis. IMPORTANCE Making the most of “big data” is one of the core challenges of current biology. There is a large array of heterogeneous data sets of host gene responses to infection, but these data sets do not inform us about gene function and require specialized skill sets and training for their utilization. Here we describe an approach that combines and simplifies these data sets, distilling this information into a single list of genes commonly upregulated in response to infection with RSV as a model pathogen. Many of the genes on the list have unknown functions in RSV disease. We validated the gene list with new clinical, in vitro, and in vivo data. This approach allows the rapid selection of genes of interest for further, more-detailed studies, thus reducing time and costs. Furthermore, the approach is simple to use and widely applicable to a range of diseases. PMID:27822537

Genetic Correlates of Individual Differences in Sleep Behavior of Free-Living Great Tits (Parus major)

PubMed Central

Stuber, Erica F.; Baumgartner, Christine; Dingemanse, Niels J.; Kempenaers, Bart; Mueller, Jakob C.

2016-01-01

Within populations, free-living birds display considerable variation in observable sleep behaviors, reflecting dynamic interactions between individuals and their environment. Genes are expected to contribute to repeatable between-individual differences in sleep behaviors, which may be associated with individual fitness. We identified and genotyped polymorphisms in nine candidate genes for sleep, and measured five repeatable sleep behaviors in free-living great tits (Parus major), partly replicating a previous study in blue tits (Cyanistes caeruleus). Microsatellites in the CLOCK and NPAS2 clock genes exhibited an association with sleep duration relative to night length, and morning latency to exit the nest box, respectively. Furthermore, microsatellites in the NPSR1 and PCSK2 genes associated with relative sleep duration and proportion of time spent awake at night, respectively. Given the detection rate of associations in the same models run with random markers instead of candidate genes, we expected two associations to arise by chance. The detection of four associations between candidate genes and sleep, however, suggests that clock genes, a clock-related gene, or a gene involved in the melanocortin system, could play key roles in maintaining phenotypic variation in sleep behavior in avian populations. Knowledge of the genetic architecture underlying sleep behavior in the wild is important because it will enable ecologists to assess the evolution of sleep in response to selection. PMID:26739645

Cross-species multiple environmental stress responses: An integrated approach to identify candidate genes for multiple stress tolerance in sorghum (Sorghum bicolor (L.) Moench) and related model species

PubMed Central

Modise, David M.; Gemeildien, Junaid; Ndimba, Bongani K.; Christoffels, Alan

2018-01-01

Background Crop response to the changing climate and unpredictable effects of global warming with adverse conditions such as drought stress has brought concerns about food security to the fore; crop yield loss is a major cause of concern in this regard. Identification of genes with multiple responses across environmental stresses is the genetic foundation that leads to crop adaptation to environmental perturbations. Methods In this paper, we introduce an integrated approach to assess candidate genes for multiple stress responses across-species. The approach combines ontology based semantic data integration with expression profiling, comparative genomics, phylogenomics, functional gene enrichment and gene enrichment network analysis to identify genes associated with plant stress phenotypes. Five different ontologies, viz., Gene Ontology (GO), Trait Ontology (TO), Plant Ontology (PO), Growth Ontology (GRO) and Environment Ontology (EO) were used to semantically integrate drought related information. Results Target genes linked to Quantitative Trait Loci (QTLs) controlling yield and stress tolerance in sorghum (Sorghum bicolor (L.) Moench) and closely related species were identified. Based on the enriched GO terms of the biological processes, 1116 sorghum genes with potential responses to 5 different stresses, such as drought (18%), salt (32%), cold (20%), heat (8%) and oxidative stress (25%) were identified to be over-expressed. Out of 169 sorghum drought responsive QTLs associated genes that were identified based on expression datasets, 56% were shown to have multiple stress responses. On the other hand, out of 168 additional genes that have been evaluated for orthologous pairs, 90% were conserved across species for drought tolerance. Over 50% of identified maize and rice genes were responsive to drought and salt stresses and were co-located within multifunctional QTLs. Among the total identified multi-stress responsive genes, 272 targets were shown to be co-localized within QTLs associated with different traits that are responsive to multiple stresses. Ontology mapping was used to validate the identified genes, while reconstruction of the phylogenetic tree was instrumental to infer the evolutionary relationship of the sorghum orthologs. The results also show specific genes responsible for various interrelated components of drought response mechanism such as drought tolerance, drought avoidance and drought escape. Conclusions We submit that this approach is novel and to our knowledge, has not been used previously in any other research; it enables us to perform cross-species queries for genes that are likely to be associated with multiple stress tolerance, as a means to identify novel targets for engineering stress resistance in sorghum and possibly, in other crop species. PMID:29590108

Decoy receptor 1 (DCR1) promoter hypermethylation and response to irinotecan in metastatic colorectal cancer

PubMed Central

Bosch, Linda J.W.; Coupé, Veerle M.H.; Mongera, Sandra; Haan, Josien C.; Richman, Susan D.; Koopman, Miriam; Tol, Jolien; de Meyer, Tim; Louwagie, Joost; Dehaspe, Luc; van Grieken, Nicole C.T.; Ylstra, Bauke; Verheul, Henk M.W.; van Engeland, Manon; Nagtegaal, Iris D.; Herman, James G.; Quirke, Philip; Seymour, Matthew T.; Punt, Cornelis J.A.; van Criekinge, Wim; Carvalho, Beatriz; Meijer, Gerrit A.

2017-01-01

Diversity in colorectal cancer biology is associated with variable responses to standard chemotherapy. We aimed to identify and validate DNA hypermethylated genes as predictive biomarkers for irinotecan treatment of metastatic CRC patients. Candidate genes were selected from 389 genes involved in DNA Damage Repair by correlation analyses between gene methylation status and drug response in 32 cell lines. A large series of samples (n=818) from two phase III clinical trials was used to evaluate these candidate genes by correlating methylation status to progression-free survival after treatment with first-line single-agent fluorouracil (Capecitabine or 5-fluorouracil) or combination chemotherapy (Capecitabine or 5-fluorouracil plus irinotecan (CAPIRI/FOLFIRI)). In the discovery (n=185) and initial validation set (n=166), patients with methylated Decoy Receptor 1 (DCR1) did not benefit from CAPIRI over Capecitabine treatment (discovery set: HR=1.2 (95%CI 0.7-1.9, p=0.6), validation set: HR=0.9 (95%CI 0.6-1.4, p=0.5)), whereas patients with unmethylated DCR1 did (discovery set: HR=0.4 (95%CI 0.3-0.6, p=0.00001), validation set: HR=0.5 (95%CI 0.3-0.7, p=0.0008)). These results could not be replicated in the external data set (n=467), where a similar effect size was found in patients with methylated and unmethylated DCR1 for FOLFIRI over 5FU treatment (methylated DCR1: HR=0.7 (95%CI 0.5-0.9, p=0.01), unmethylated DCR1: HR=0.8 (95%CI 0.6-1.2, p=0.4)). In conclusion, DCR1 promoter hypermethylation status is a potential predictive biomarker for response to treatment with irinotecan, when combined with capecitabine. This finding could not be replicated in an external validation set, in which irinotecan was combined with 5FU. These results underline the challenge and importance of extensive clinical evaluation of candidate biomarkers in multiple trials. PMID:28968978

Decoy receptor 1 (DCR1) promoter hypermethylation and response to irinotecan in metastatic colorectal cancer.

PubMed

Bosch, Linda J W; Trooskens, Geert; Snaebjornsson, Petur; Coupé, Veerle M H; Mongera, Sandra; Haan, Josien C; Richman, Susan D; Koopman, Miriam; Tol, Jolien; de Meyer, Tim; Louwagie, Joost; Dehaspe, Luc; van Grieken, Nicole C T; Ylstra, Bauke; Verheul, Henk M W; van Engeland, Manon; Nagtegaal, Iris D; Herman, James G; Quirke, Philip; Seymour, Matthew T; Punt, Cornelis J A; van Criekinge, Wim; Carvalho, Beatriz; Meijer, Gerrit A

2017-09-08

Diversity in colorectal cancer biology is associated with variable responses to standard chemotherapy. We aimed to identify and validate DNA hypermethylated genes as predictive biomarkers for irinotecan treatment of metastatic CRC patients. Candidate genes were selected from 389 genes involved in DNA Damage Repair by correlation analyses between gene methylation status and drug response in 32 cell lines. A large series of samples (n=818) from two phase III clinical trials was used to evaluate these candidate genes by correlating methylation status to progression-free survival after treatment with first-line single-agent fluorouracil (Capecitabine or 5-fluorouracil) or combination chemotherapy (Capecitabine or 5-fluorouracil plus irinotecan (CAPIRI/FOLFIRI)). In the discovery (n=185) and initial validation set (n=166), patients with methylated Decoy Receptor 1 ( DCR1) did not benefit from CAPIRI over Capecitabine treatment (discovery set: HR=1.2 (95%CI 0.7-1.9, p =0.6), validation set: HR=0.9 (95%CI 0.6-1.4, p =0.5)), whereas patients with unmethylated DCR1 did (discovery set: HR=0.4 (95%CI 0.3-0.6, p =0.00001), validation set: HR=0.5 (95%CI 0.3-0.7, p =0.0008)). These results could not be replicated in the external data set (n=467), where a similar effect size was found in patients with methylated and unmethylated DCR1 for FOLFIRI over 5FU treatment (methylated DCR1 : HR=0.7 (95%CI 0.5-0.9, p =0.01), unmethylated DCR1 : HR=0.8 (95%CI 0.6-1.2, p =0.4)). In conclusion, DCR1 promoter hypermethylation status is a potential predictive biomarker for response to treatment with irinotecan, when combined with capecitabine. This finding could not be replicated in an external validation set, in which irinotecan was combined with 5FU. These results underline the challenge and importance of extensive clinical evaluation of candidate biomarkers in multiple trials.

Induction of a robust immunity response against novel duck reovirus in ducklings using a subunit vaccine of sigma C protein

PubMed Central

Bi, Zhuangli; Zhu, Yingqi; Chen, Zongyan; Li, Chuanfeng; Wang, Yong; Wang, Guijun; Liu, Guangqing

2016-01-01

Novel duck reovirus (NDRV) disease emerged in China in 2011 and continues to cause high morbidity and about 5.0 to 50% mortality in ducklings. Currently there are no approved vaccines for the virus. This study aimed to assess the efficacy of a new vaccine created from the baculovirus and sigma C gene against NDRV. In this study, a recombinant baculovirus containing the sigma C gene was constructed, and the purified protein was used as a vaccine candidate in ducklings. The efficacy of sigma C vaccine was estimated according to humoral immune responses, cellular immune response and protection against NDRV challenge. The results showed that sigma C was highly expressed in Sf9 cells. Robust humoral and cellular immune responses were induced in all ducklings immunized with the recombinant sigma C protein. Moreover, 100% protection against lethal challenge with NDRV TH11 strain was observed. Summary, the recombinant sigma C protein could be utilized as a good candidate against NDRV infection. PMID:27974824

The genome sequence of the most widely cultivated cacao type and its use to identify candidate genes regulating pod color.

PubMed

Motamayor, Juan C; Mockaitis, Keithanne; Schmutz, Jeremy; Haiminen, Niina; Livingstone, Donald; Cornejo, Omar; Findley, Seth D; Zheng, Ping; Utro, Filippo; Royaert, Stefan; Saski, Christopher; Jenkins, Jerry; Podicheti, Ram; Zhao, Meixia; Scheffler, Brian E; Stack, Joseph C; Feltus, Frank A; Mustiga, Guiliana M; Amores, Freddy; Phillips, Wilbert; Marelli, Jean Philippe; May, Gregory D; Shapiro, Howard; Ma, Jianxin; Bustamante, Carlos D; Schnell, Raymond J; Main, Dorrie; Gilbert, Don; Parida, Laxmi; Kuhn, David N

2013-06-03

Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. We describe the sequencing and assembly of the genome of Theobroma cacao L. cultivar Matina 1-6. The genome of the Matina 1-6 cultivar is 445 Mbp, which is significantly larger than a sequenced Criollo cultivar, and more typical of other cultivars. The chromosome-scale assembly, version 1.1, contains 711 scaffolds covering 346.0 Mbp, with a contig N50 of 84.4 kbp, a scaffold N50 of 34.4 Mbp, and an evidence-based gene set of 29,408 loci. Version 1.1 has 10x the scaffold N50 and 4x the contig N50 as Criollo, and includes 111 Mb more anchored sequence. The version 1.1 assembly has 4.4% gap sequence, while Criollo has 10.9%. Through a combination of haplotype, association mapping and gene expression analyses, we leverage this robust reference genome to identify a promising candidate gene responsible for pod color variation. We demonstrate that green/red pod color in cacao is likely regulated by the R2R3 MYB transcription factor TcMYB113, homologs of which determine pigmentation in Rosaceae, Solanaceae, and Brassicaceae. One SNP within the target site for a highly conserved trans-acting siRNA in dicots, found within TcMYB113, seems to affect transcript levels of this gene and therefore pod color variation. We report a high-quality sequence and annotation of Theobroma cacao L. and demonstrate its utility in identifying candidate genes regulating traits.

The genome sequence of the most widely cultivated cacao type and its use to identify candidate genes regulating pod color

PubMed Central

2013-01-01

Background Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. Results We describe the sequencing and assembly of the genome of Theobroma cacao L. cultivar Matina 1-6. The genome of the Matina 1-6 cultivar is 445 Mbp, which is significantly larger than a sequenced Criollo cultivar, and more typical of other cultivars. The chromosome-scale assembly, version 1.1, contains 711 scaffolds covering 346.0 Mbp, with a contig N50 of 84.4 kbp, a scaffold N50 of 34.4 Mbp, and an evidence-based gene set of 29,408 loci. Version 1.1 has 10x the scaffold N50 and 4x the contig N50 as Criollo, and includes 111 Mb more anchored sequence. The version 1.1 assembly has 4.4% gap sequence, while Criollo has 10.9%. Through a combination of haplotype, association mapping and gene expression analyses, we leverage this robust reference genome to identify a promising candidate gene responsible for pod color variation. We demonstrate that green/red pod color in cacao is likely regulated by the R2R3 MYB transcription factor TcMYB113, homologs of which determine pigmentation in Rosaceae, Solanaceae, and Brassicaceae. One SNP within the target site for a highly conserved trans-acting siRNA in dicots, found within TcMYB113, seems to affect transcript levels of this gene and therefore pod color variation. Conclusions We report a high-quality sequence and annotation of Theobroma cacao L. and demonstrate its utility in identifying candidate genes regulating traits. PMID:23731509

"Contrasting patterns of selection at Pinus pinaster Ait. Drought stress candidate genes as revealed by genetic differentiation analyses".

PubMed

Eveno, Emmanuelle; Collada, Carmen; Guevara, M Angeles; Léger, Valérie; Soto, Alvaro; Díaz, Luis; Léger, Patrick; González-Martínez, Santiago C; Cervera, M Teresa; Plomion, Christophe; Garnier-Géré, Pauline H

2008-02-01

The importance of natural selection for shaping adaptive trait differentiation among natural populations of allogamous tree species has long been recognized. Determining the molecular basis of local adaptation remains largely unresolved, and the respective roles of selection and demography in shaping population structure are actively debated. Using a multilocus scan that aims to detect outliers from simulated neutral expectations, we analyzed patterns of nucleotide diversity and genetic differentiation at 11 polymorphic candidate genes for drought stress tolerance in phenotypically contrasted Pinus pinaster Ait. populations across its geographical range. We compared 3 coalescent-based methods: 2 frequentist-like, including 1 approach specifically developed for biallelic single nucleotide polymorphisms (SNPs) here and 1 Bayesian. Five genes showed outlier patterns that were robust across methods at the haplotype level for 2 of them. Two genes presented higher F(ST) values than expected (PR-AGP4 and erd3), suggesting that they could have been affected by the action of diversifying selection among populations. In contrast, 3 genes presented lower F(ST) values than expected (dhn-1, dhn2, and lp3-1), which could represent signatures of homogenizing selection among populations. A smaller proportion of outliers were detected at the SNP level suggesting the potential functional significance of particular combinations of sites in drought-response candidate genes. The Bayesian method appeared robust to low sample sizes, flexible to assumptions regarding migration rates, and powerful for detecting selection at the haplotype level, but the frequentist-like method adapted to SNPs was more efficient for the identification of outlier SNPs showing low differentiation. Population-specific effects estimated in the Bayesian method also revealed populations with lower immigration rates, which could have led to favorable situations for local adaptation. Outlier patterns are discussed in relation to the different genes' putative involvement in drought tolerance responses, from published results in transcriptomics and association mapping in P. pinaster and other related species. These genes clearly constitute relevant candidates for future association studies in P. pinaster.

Machine Learning–Based Differential Network Analysis: A Study of Stress-Responsive Transcriptomes in Arabidopsis[W

PubMed Central

Ma, Chuang; Xin, Mingming; Feldmann, Kenneth A.; Wang, Xiangfeng

2014-01-01

Machine learning (ML) is an intelligent data mining technique that builds a prediction model based on the learning of prior knowledge to recognize patterns in large-scale data sets. We present an ML-based methodology for transcriptome analysis via comparison of gene coexpression networks, implemented as an R package called machine learning–based differential network analysis (mlDNA) and apply this method to reanalyze a set of abiotic stress expression data in Arabidopsis thaliana. The mlDNA first used a ML-based filtering process to remove nonexpressed, constitutively expressed, or non-stress-responsive “noninformative” genes prior to network construction, through learning the patterns of 32 expression characteristics of known stress-related genes. The retained “informative” genes were subsequently analyzed by ML-based network comparison to predict candidate stress-related genes showing expression and network differences between control and stress networks, based on 33 network topological characteristics. Comparative evaluation of the network-centric and gene-centric analytic methods showed that mlDNA substantially outperformed traditional statistical testing–based differential expression analysis at identifying stress-related genes, with markedly improved prediction accuracy. To experimentally validate the mlDNA predictions, we selected 89 candidates out of the 1784 predicted salt stress–related genes with available SALK T-DNA mutagenesis lines for phenotypic screening and identified two previously unreported genes, mutants of which showed salt-sensitive phenotypes. PMID:24520154

Identification of Beet necrotic yellow vein virus P25 pathogenicity factor-interacting sugar beet proteins that represent putative virus targets or components of plant resistance.

PubMed

Thiel, Heike; Varrelmann, Mark

2009-08-01

Beet necrotic yellow vein virus (BNYVV) induces the most important disease threatening sugar beet. The growth of partially resistant hybrids carrying monogenic dominant resistance genes stabilize yield but are unable to entirely prevent virus infection and replication. P25 is responsible for symptom development and previous studies have shown that recently occurring resistance-breaking isolates possess increased P25 variability. To better understand the viral pathogenicity factor's interplay with plant proteins and to possibly unravel the molecular basis of sugar beet antivirus resistance, P25 was applied in a yeast two-hybrid screen of a resistant sugar beet cDNA library. This screen identified candidate proteins recognized as orthologues from other plant species which are known to be expressed following pathogen infection and involved in plant defense response. Most of the candidates potentially related to host-pathogen interactions were involved in the ubiquitylation process and plants response to stress, and were part of cell and metabolism components. The interaction of several candidate genes with P25 was confirmed in Nicotiana benthamiana leaf cells by transient agrobacterium-mediated expression applying bimolecular fluorescence complementation assay. The putative functions of several of the candidates identified support previous findings and present first targets for understanding the BNYVV pathogenicity and antivirus resistance mechanism.

A microarray analysis of potential genes underlying the neurosensitivity of mice to propofol.

PubMed

Lowes, Damon A; Galley, Helen F; Lowe, Peter R; Rikke, Brad A; Johnson, Thomas E; Webster, Nigel R

2005-09-01

Establishing the mechanism of action of general anesthetics at the molecular level is difficult because of the multiple targets with which these drugs are associated. Inbred short sleep (ISS) and long sleep (ILS) mice are differentially sensitive in response to ethanol and other sedative hypnotics and contain a single quantitative trait locus (Lorp1) that accounts for the genetic variance of loss-of-righting reflex in response to propofol (LORP). In this study, we used high-density oligonucleotide microarrays to identify global gene expression and candidate genes differentially expressed within the Lorp1 region that may give insight into the molecular mechanism underlying LORP. Microarray analysis was performed using Affymetrix MG-U74Av2 Genechips and a selection of differentially expressed genes was confirmed by semiquantitative reverse transcription-polymerase chain reaction. Global expression in the brains of ILS and ISS mice revealed 3423 genes that were significantly expressed, of which 139 (4%) were differentially expressed. Analysis of genes located within the Lorp1 region showed that 26 genes were significantly expressed and that just 2 genes (7%) were differentially expressed. These genes encoded for the proteins AWP1 (associated with protein kinase 1) and "BTB (POZ) domain containing 1," whose functions are largely uncharacterized. Genes differentially expressed outside Lorp1 included seven genes with previously characterized neuronal functions and thus stand out as additional candidate genes that may be involved in mediating the neurosensitivity differences between ISS and ILS.

[Comparison of protective properties of the smallpox DNA-vaccine based on the variola virus A30L gene and its variant with modified codon usage].

PubMed

Maksiutov, R A; Shchelkunov, S N

2011-01-01

Efficacy of candidate DNA-vaccines based on the variola virus natural gene A30L and artificial gene A30Lopt with modified codon usage, optimized for expression in mammalian cells, was tested. The groups of mice were intracutaneously immunized three times with three-week intervals with candidate DNA-vaccines: pcDNA_A30L or pcDNA_A30Lopt, and in three weeks after the last immunization all mice in the groups were intraperitoneally infected by the ectromelia virus K1 strain in 10 LD50 dose for the estimation of protection. It was shown that the DNA-vaccines based on natural gene A30L and codon-optimized gene A30Lopt elicited virus, thereby neutralizing the antibody response and protected mice from lethal intraperitoneal challenge with the ectromelia virus with lack of statistically significant difference.

The effects of polymorphisms in 7 candidate genes on resistance to Salmonella Enteritidis in native chickens.

PubMed

Tohidi, R; Idris, I B; Malar Panandam, J; Hair Bejo, M

2013-04-01

Salmonella enterica serovar Enteritidis infection is a common concern in poultry production for its negative effects on growth as well as food safety for humans. Identification of molecular markers that are linked to resistance to Salmonella Enteritidis may lead to appropriate solutions to control Salmonella infection in chickens. This study investigated the association of candidate genes with resistance to Salmonella Enteritidis in young chickens. Two native breeds of Malaysian chickens, namely, Village Chickens and Red Junglefowl, were evaluated for bacterial colonization after Salmonella Enteritidis inoculation. Seven candidate genes were selected on the basis of their physiological role in immune response, as determined by prior studies in other genetic lines: natural resistance-associated protein 1 (NRAMP1), transforming growth factor β3 (TGFβ3), transforming growth factor β4 (TGFβ4), inhibitor of apoptosis protein 1 (IAP1), caspase 1 (CASP1), lipopolysaccharide-induced tumor necrosis factor (TNF) α factor (LITAF), and TNF-related apoptosis-inducing ligand (TRAIL). Polymerase chain reaction-RFLP was used to identify polymorphisms in the candidate genes; all genes exhibited polymorphisms in at least one breed. The NRAMP1-SacI polymorphism correlated with the differences in Salmonella Enteritidis load in the cecum (P = 0.002) and spleen (P = 0.01) of Village Chickens. Polymorphisms in the restriction sites of TGFβ3-BsrI, TGFβ4-MboII, and TRAIL-StyI were associated with Salmonella Enteritidis burden in the cecum, spleen, and liver of Village Chickens and Red Junglefowl (P < 0.05). These results indicate that the NRAMP1, TGFβ3, TGFβ4, and TRAIL genes are potential candidates for use in selection programs for increasing genetic resistance against Salmonella Enteritidis in native Malaysian chickens.

Candidacy of a chitin-inducible gibberellin-responsive gene for a major locus affecting plant height in rice that is closely linked to Green Revolution gene sd1.

PubMed

Kovi, Mallikarjuna Rao; Zhang, Yushan; Yu, Sibin; Yang, Gaiyu; Yan, Wenhao; Xing, Yongzhong

2011-09-01

Appropriate plant height is crucial for lodging resistance to improve the rice crop yield. The application of semi-dwarf 1 led to the green revolution in the 1960s, by predominantly increasing the rice yield. However, the frequent use of single sd1 gene sources may cause genetic vulnerability to pests and diseases. Identifying useful novel semi-dwarf genes is important for the genetic manipulation of plant architecture in practical rice breeding. In this study, introgression lines derived from two parents contrasting in plant height, Zhenshan 97 and Pokkali were employed to locate a gene with a large effect on plant height by the bulk segregant analysis method. A major gene, ph1, was mapped to a region closely linked to sd1 on chromosome 1; the additive effects of ph1 were more than 50 cm on the plant height and 2 days on the heading date in a BC(4)F(2) population and its progeny. ph1 was then fine mapped to BAC AP003227. Gene annotation indicated that LOC_OS01g65990 encoding a chitin-inducible gibberellin-responsive protein (CIGR), which belongs to the GRAS family, might be the right candidate gene of ph1. Co-segregation analysis of the candidate gene-derived marker finally confirmed its identity as the candidate gene. A higher expression level of the CIGR was detected in all the tested tissues in tall plants compared to those of short plants, especially in the young leaf sheath containing elongating tissues, which indicated its importance role in regulating plant height. ph1 showed a tremendous genetic effect on plant height, which is distinct from sd1 and could be a new resource for breeding semi-dwarf varieties.

IFRD1 Is a Candidate Gene for SMNA on Chromosome 7q22-q23

PubMed Central

Brkanac, Zoran; Spencer, David; Shendure, Jay; Robertson, Peggy D.; Matsushita, Mark; Vu, Tiffany; Bird, Thomas D.; Olson, Maynard V.; Raskind, Wendy H.

2009-01-01

We have established strong linkage evidence that supports mapping autosomal-dominant sensory/motor neuropathy with ataxia (SMNA) to chromosome 7q22-q32. SMNA is a rare neurological disorder whose phenotype encompasses both the central and the peripheral nervous system. In order to identify a gene responsible for SMNA, we have undertaken a comprehensive genomic evaluation of the region of linkage, including evaluation for repeat expansion and small deletions or duplications, capillary sequencing of candidate genes, and massively parallel sequencing of all coding exons. We excluded repeat expansion and small deletions or duplications as causative, and through microarray-based hybrid capture and massively parallel short-read sequencing, we identified a nonsynonymous variant in the human interferon-related developmental regulator gene 1 (IFRD1) as a disease-causing candidate. Sequence conservation, animal models, and protein structure evaluation support the involvement of IFRD1 in SMNA. Mutation analysis of IFRD1 in additional patients with similar phenotypes is needed for demonstration of causality and further evaluation of its importance in neurological diseases. PMID:19409521

Transcriptomic and physiological analyses of Medicago sativa L. roots in response to lead stress

PubMed Central

Zhang, Shichao; Guo, Qiang; Jin, Yan; Chen, Jingjing; Ma, Hongxia

2017-01-01

Lead (Pb) is one of the nonessential and toxic metals that threaten the environment and human health. Medicago sativa L. is a legume with high salt tolerance and high biomass production. It is not only a globally important forage crop but is also an ideal plant for phytoremediation. However, the biological and molecular mechanisms that respond to heavy metals are still not well defined in M. sativa. In this study, de novo and strand-specific RNA-sequencing was performed to identify genes involved in the Pb stress response in M. sativa roots. A total of 415,350 unigenes were obtained from the assembled cDNA libraries, among which 5,416 were identified as significantly differentially expressed genes (DEGs) (false discovery rate < 0.005) between cDNA libraries from control and Pb-treated plants. Gene ontology and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses of the DEGs showed they mainly clustered with terms associated with binding, transport, membranes, and the pathways related to signal and energy metabolism. Moreover, a number of candidate genes included antioxidant enzymes, metal transporters, and transcription factors involved in heavy metal response were upregulated under Pb stress. Quantitative real-time PCR(qRT-PCR) validation of the expression patterns of 10 randomly selected candidate DEGs were consistent with the transcriptome analysis results. Thus, this study offers new information towards the investigation of biological changes and molecular mechanisms related to Pb stress response in plants. PMID:28388670

Improving Microbial Biogasoline Production in Escherichia coli Using Tolerance Engineering

PubMed Central

Foo, Jee Loon; Jensen, Heather M.; Dahl, Robert H.; George, Kevin; Keasling, Jay D.; Lee, Taek Soon; Leong, Susanna

2014-01-01

ABSTRACT Engineering microbial hosts for the production of fungible fuels requires mitigation of limitations posed on the production capacity. One such limitation arises from the inherent toxicity of solvent-like biofuel compounds to production strains, such as Escherichia coli. Here we show the importance of host engineering for the production of short-chain alcohols by studying the overexpression of genes upregulated in response to exogenous isopentenol. Using systems biology data, we selected 40 genes that were upregulated following isopentenol exposure and subsequently overexpressed them in E. coli. Overexpression of several of these candidates improved tolerance to exogenously added isopentenol. Genes conferring isopentenol tolerance phenotypes belonged to diverse functional groups, such as oxidative stress response (soxS, fpr, and nrdH), general stress response (metR, yqhD, and gidB), heat shock-related response (ibpA), and transport (mdlB). To determine if these genes could also improve isopentenol production, we coexpressed the tolerance-enhancing genes individually with an isopentenol production pathway. Our data show that expression of 6 of the 8 candidates improved the production of isopentenol in E. coli, with the methionine biosynthesis regulator MetR improving the titer for isopentenol production by 55%. Additionally, expression of MdlB, an ABC transporter, facilitated a 12% improvement in isopentenol production. To our knowledge, MdlB is the first example of a transporter that can be used to improve production of a short-chain alcohol and provides a valuable new avenue for host engineering in biogasoline production. PMID:25370492

Transcriptomic analysis of the mussel Elliptio complanata identifies candidate stress-response genes and an abundance of novel or noncoding transcripts

USGS Publications Warehouse

Cornman, Robert S.; Robertson, Laura S.; Galbraith, Heather S.; Blakeslee, Carrie J.

2014-01-01

Mussels are useful indicator species of environmental stress and degradation, and the global decline in freshwater mussel diversity and abundance is of conservation concern. Elliptio complanata is a common freshwater mussel of eastern North America that can serve both as an indicator and as an experimental model for understanding mussel physiology and genetics. To support genetic components of these research goals, we assembled transcriptome contigs from Illumina paired-end reads. Despite efforts to collapse similar contigs, the final assembly was in excess of 136,000 contigs with an N50 of 982 bp. Even so, comparisons to the CEGMA database of conserved eukaryotic genes indicated that ∼20% of genes remain unrepresented. However, numerous candidate stress-response genes were present, and we identified lineage-specific patterns of diversification among molluscs for cytochrome P450 detoxification genes and two saccharide-modifying enzymes: 1,3 beta-galactosyltransferase and fucosyltransferase. Less than a quarter of contigs had protein-level similarity based on modest BLAST and Hmmer3 statistical thresholds. These results add comparative genomic resources for molluscs and suggest a wealth of novel proteins and noncoding transcripts.

Gene expression under chronic heat stress in populations of the mustard hill coral (Porites astreoides) from different thermal environments.

PubMed

Kenkel, C D; Meyer, E; Matz, M V

2013-08-01

Recent evidence suggests that corals can acclimatize or adapt to local stress factors through differential regulation of their gene expression. Profiling gene expression in corals from diverse environments can elucidate the physiological processes that may be responsible for maximizing coral fitness in their natural habitat and lead to a better understanding of the coral's capacity to survive the effects of global climate change. In an accompanying paper, we show that Porites astreoides from thermally different reef habitats exhibit distinct physiological responses when exposed to 6 weeks of chronic temperature stress in a common garden experiment. Here, we describe expression profiles obtained from the same corals for a panel of 9 previously reported and 10 novel candidate stress response genes identified in a pilot RNA-Seq experiment. The strongest expression change was observed in a novel candidate gene potentially involved in calcification, SLC26, a member of the solute carrier family 26 anion exchangers, which was down-regulated by 92-fold in bleached corals relative to controls. The most notable signature of divergence between coral populations was constitutive up-regulation of metabolic genes in corals from the warmer inshore location, including the gluconeogenesis enzymes pyruvate carboxylase and phosphoenolpyruvate carboxykinase and the lipid beta-oxidation enzyme acyl-CoA dehydrogenase. Our observations highlight several molecular pathways that were not previously implicated in the coral stress response and suggest that host management of energy budgets might play an adaptive role in holobiont thermotolerance. © 2013 John Wiley & Sons Ltd.

Validation of reference genes for accurate normalization of gene expression for real time-quantitative PCR in strawberry fruits using different cultivars and osmotic stresses.

PubMed

Galli, Vanessa; Borowski, Joyce Moura; Perin, Ellen Cristina; Messias, Rafael da Silva; Labonde, Julia; Pereira, Ivan dos Santos; Silva, Sérgio Delmar Dos Anjos; Rombaldi, Cesar Valmor

2015-01-10

The increasing demand of strawberry (Fragaria×ananassa Duch) fruits is associated mainly with their sensorial characteristics and the content of antioxidant compounds. Nevertheless, the strawberry production has been hampered due to its sensitivity to abiotic stresses. Therefore, to understand the molecular mechanisms highlighting stress response is of great importance to enable genetic engineering approaches aiming to improve strawberry tolerance. However, the study of expression of genes in strawberry requires the use of suitable reference genes. In the present study, seven traditional and novel candidate reference genes were evaluated for transcript normalization in fruits of ten strawberry cultivars and two abiotic stresses, using RefFinder, which integrates the four major currently available software programs: geNorm, NormFinder, BestKeeper and the comparative delta-Ct method. The results indicate that the expression stability is dependent on the experimental conditions. The candidate reference gene DBP (DNA binding protein) was considered the most suitable to normalize expression data in samples of strawberry cultivars and under drought stress condition, and the candidate reference gene HISTH4 (histone H4) was the most stable under osmotic stresses and salt stress. The traditional genes GAPDH (glyceraldehyde-3-phosphate dehydrogenase) and 18S (18S ribosomal RNA) were considered the most unstable genes in all conditions. The expression of phenylalanine ammonia lyase (PAL) and 9-cis epoxycarotenoid dioxygenase (NCED1) genes were used to further confirm the validated candidate reference genes, showing that the use of an inappropriate reference gene may induce erroneous results. This study is the first survey on the stability of reference genes in strawberry cultivars and osmotic stresses and provides guidelines to obtain more accurate RT-qPCR results for future breeding efforts. Copyright © 2014 Elsevier B.V. All rights reserved.

Identification of candidate infection genes from the model entomopathogenic nematode Heterorhabditis bacteriophora.

PubMed

Vadnal, Jonathan; Ratnappan, Ramesh; Keaney, Melissa; Kenney, Eric; Eleftherianos, Ioannis; O'Halloran, Damien; Hawdon, John M

2017-01-03

Despite important progress in the field of innate immunity, our understanding of host immune responses to parasitic nematode infections lags behind that of responses to microbes. A limiting factor has been the obligate requirement for a vertebrate host which has hindered investigation of the parasitic nematode infective process. The nematode parasite Heterorhabditis bacteriophora offers great potential as a model to genetically dissect the process of infection. With its mutualistic Photorhabdus luminescens bacteria, H. bacteriophora invades multiple species of insects, which it kills and exploits as a food source for the development of several nematode generations. The ability to culture the life cycle of H. bacteriophora on plates growing the bacterial symbiont makes it a very exciting model of parasitic infection that can be used to unlock the molecular events occurring during infection of a host that are inaccessible using vertebrate hosts. To profile the transcriptional response of an infective nematode during the early stage of infection, we performed next generation RNA sequencing on H. bacteriophora IJs incubated in Manduca sexta hemolymph plasma for 9 h. A subset of up-regulated and down-regulated genes were validated using qRT-PCR. Comparative analysis of the transcriptome with untreated controls found a number of differentially expressed genes (DEGs) which cover a number of different functional categories. A subset of DEGs is conserved across Clade V parasitic nematodes revealing an array of candidate parasitic genes. Our analysis reveals transcriptional changes in the regulation of a large number of genes, most of which have not been shown previously to play a role in the process of infection. A significant proportion of these genes are unique to parasitic nematodes, suggesting the identification of a group of parasitism factors within nematodes. Future studies using these candidates may provide functional insight into the process of nematode parasitism and also the molecular evolution of parasitism within nematodes.

Editor's Highlight: Genetic Targets of Acute Toluene Inhalation in Drosophila melanogaster.

PubMed

Bushnell, Philip J; Ward, William O; Morozova, Tatiana V; Oshiro, Wendy M; Lin, Mimi T; Judson, Richard S; Hester, Susan D; McKee, John M; Higuchi, Mark

2017-03-01

Interpretation and use of data from high-throughput assays for chemical toxicity require links between effects at molecular targets and adverse outcomes in whole animals. The well-characterized genome of Drosophila melanogaster provides a potential model system by which phenotypic responses to chemicals can be mapped to genes associated with those responses, which may in turn suggest adverse outcome pathways associated with those genes. To determine the utility of this approach, we used the Drosophila Genetics Reference Panel (DGRP), a collection of ∼200 homozygous lines of fruit flies whose genomes have been sequenced. We quantified toluene-induced suppression of motor activity in 123 lines of these flies during exposure to toluene, a volatile organic compound known to induce narcosis in mammals via its effects on neuronal ion channels. We then applied genome-wide association analyses on this effect of toluene using the DGRP web portal (http://dgrp2.gnets.ncsu.edu), which identified polymorphisms in candidate genes associated with the variation in response to toluene exposure. We tested ∼2 million variants and found 82 polymorphisms located in or near 66 candidate genes that were associated with phenotypic variation for sensitivity to toluene at P < 5 × 10-5, and human orthologs for 52 of these candidate Drosophila genes. None of these orthologs are known to be involved in canonical pathways for mammalian neuronal ion channels, including GABA, glutamate, dopamine, glycine, serotonin, and voltage sensitive calcium channels. Thus this analysis did not reveal a genetic signature consistent with processes previously shown to be involved in toluene-induced narcosis in mammals. The list of the human orthologs included Gene Ontology terms associated with signaling, nervous system development and embryonic morphogenesis; these orthologs may provide insight into potential new pathways that could mediate the narcotic effects of toluene. Published by Oxford University Press on behalf of the Society of Toxicology 2016. This work is written by US Government employees and is in the public domain in the US.

Restriction site polymorphism-based candidate gene mapping for seedling drought tolerance in cowpea [Vigna unguiculata (L.) Walp.].

PubMed

Muchero, Wellington; Ehlers, Jeffrey D; Roberts, Philip A

2010-02-01

Quantitative trait loci (QTL) studies provide insight into the complexity of drought tolerance mechanisms. Molecular markers used in these studies also allow for marker-assisted selection (MAS) in breeding programs, enabling transfer of genetic factors between breeding lines without complete knowledge of their exact nature. However, potential for recombination between markers and target genes limit the utility of MAS-based strategies. Candidate gene mapping offers an alternative solution to identify trait determinants underlying QTL of interest. Here, we used restriction site polymorphisms to investigate co-location of candidate genes with QTL for seedling drought stress-induced premature senescence identified previously in cowpea. Genomic DNA isolated from 113 F(2:8) RILs of drought-tolerant IT93K503-1 and drought susceptible CB46 genotypes was digested with combinations of EcoR1 and HpaII, Mse1, or Msp1 restriction enzymes and amplified with primers designed from 13 drought-responsive cDNAs. JoinMap 3.0 and MapQTL 4.0 software were used to incorporate polymorphic markers onto the AFLP map and to analyze their association with the drought response QTL. Seven markers co-located with peaks of previously identified QTL. Isolation, sequencing, and blast analysis of these markers confirmed their significant homology with drought or other abiotic stress-induced expressed sequence tags (EST) from cowpea and other plant systems. Further, homology with coding sequences for a multidrug resistance protein 3 and a photosystem I assembly protein ycf3 was revealed in two of these candidates. These results provide a platform for the identification and characterization of genetic trait determinants underlying seedling drought tolerance in cowpea.

Large-scale functional RNAi screen in C. elegans identifies genes that regulate the dysfunction of mutant polyglutamine neurons

PubMed Central

2012-01-01

Background A central goal in Huntington's disease (HD) research is to identify and prioritize candidate targets for neuroprotective intervention, which requires genome-scale information on the modifiers of early-stage neuron injury in HD. Results Here, we performed a large-scale RNA interference screen in C. elegans strains that express N-terminal huntingtin (htt) in touch receptor neurons. These neurons control the response to light touch. Their function is strongly impaired by expanded polyglutamines (128Q) as shown by the nearly complete loss of touch response in adult animals, providing an in vivo model in which to manipulate the early phases of expanded-polyQ neurotoxicity. In total, 6034 genes were examined, revealing 662 gene inactivations that either reduce or aggravate defective touch response in 128Q animals. Several genes were previously implicated in HD or neurodegenerative disease, suggesting that this screen has effectively identified candidate targets for HD. Network-based analysis emphasized a subset of high-confidence modifier genes in pathways of interest in HD including metabolic, neurodevelopmental and pro-survival pathways. Finally, 49 modifiers of 128Q-neuron dysfunction that are dysregulated in the striatum of either R/2 or CHL2 HD mice, or both, were identified. Conclusions Collectively, these results highlight the relevance to HD pathogenesis, providing novel information on the potential therapeutic targets for neuroprotection in HD. PMID:22413862

Large-scale functional RNAi screen in C. elegans identifies genes that regulate the dysfunction of mutant polyglutamine neurons.

PubMed

Lejeune, François-Xavier; Mesrob, Lilia; Parmentier, Frédéric; Bicep, Cedric; Vazquez-Manrique, Rafael P; Parker, J Alex; Vert, Jean-Philippe; Tourette, Cendrine; Neri, Christian

2012-03-13

A central goal in Huntington's disease (HD) research is to identify and prioritize candidate targets for neuroprotective intervention, which requires genome-scale information on the modifiers of early-stage neuron injury in HD. Here, we performed a large-scale RNA interference screen in C. elegans strains that express N-terminal huntingtin (htt) in touch receptor neurons. These neurons control the response to light touch. Their function is strongly impaired by expanded polyglutamines (128Q) as shown by the nearly complete loss of touch response in adult animals, providing an in vivo model in which to manipulate the early phases of expanded-polyQ neurotoxicity. In total, 6034 genes were examined, revealing 662 gene inactivations that either reduce or aggravate defective touch response in 128Q animals. Several genes were previously implicated in HD or neurodegenerative disease, suggesting that this screen has effectively identified candidate targets for HD. Network-based analysis emphasized a subset of high-confidence modifier genes in pathways of interest in HD including metabolic, neurodevelopmental and pro-survival pathways. Finally, 49 modifiers of 128Q-neuron dysfunction that are dysregulated in the striatum of either R/2 or CHL2 HD mice, or both, were identified. Collectively, these results highlight the relevance to HD pathogenesis, providing novel information on the potential therapeutic targets for neuroprotection in HD. © 2012 Lejeune et al; licensee BioMed Central Ltd.

The prediction of candidate genes for cervix related cancer through gene ontology and graph theoretical approach.

PubMed

Hindumathi, V; Kranthi, T; Rao, S B; Manimaran, P

2014-06-01

With rapidly changing technology, prediction of candidate genes has become an indispensable task in recent years mainly in the field of biological research. The empirical methods for candidate gene prioritization that succors to explore the potential pathway between genetic determinants and complex diseases are highly cumbersome and labor intensive. In such a scenario predicting potential targets for a disease state through in silico approaches are of researcher's interest. The prodigious availability of protein interaction data coupled with gene annotation renders an ease in the accurate determination of disease specific candidate genes. In our work we have prioritized the cervix related cancer candidate genes by employing Csaba Ortutay and his co-workers approach of identifying the candidate genes through graph theoretical centrality measures and gene ontology. With the advantage of the human protein interaction data, cervical cancer gene sets and the ontological terms, we were able to predict 15 novel candidates for cervical carcinogenesis. The disease relevance of the anticipated candidate genes was corroborated through a literature survey. Also the presence of the drugs for these candidates was detected through Therapeutic Target Database (TTD) and DrugMap Central (DMC) which affirms that they may be endowed as potential drug targets for cervical cancer.

Inheritance of partial resistance against Colletotrichum lindemuthianum in Phaseolus vulgaris and co-localization of quantitative trait loci with genes involved in specific resistance.

PubMed

Geffroy, V; Sévignac, M; De Oliveira, J C; Fouilloux, G; Skroch, P; Thoquet, P; Gepts, P; Langin, T; Dron, M

2000-03-01

Anthracnose, one of the most important diseases of common bean (Phaseolus vulgaris), is caused by the fungus Colletotrichum lindemuthianum. A "candidate gene" approach was used to map anthracnose resistance quantitative trait loci (QTL). Candidate genes included genes for both pathogen recognition (resistance genes and resistance gene analogs [RGAs]) and general plant defense (defense response genes). Two strains of C. lindemuthianum, identified in a world collection of 177 strains, displayed a reproducible and differential aggressiveness toward BAT93 and JaloEEP558, two parental lines of P. vulgaris representing the two major gene pools of this crop. A reliable test was developed to score partial resistance in aerial organs of the plant (stem, leaf, petiole) under controlled growth chamber conditions. BAT93 was more resistant than JaloEEP558 regardless of the organ or strain tested. With a recombinant inbred line (RIL) population derived from a cross between these two parental lines, 10 QTL were located on a genetic map harboring 143 markers, including known defense response genes, anthracnose-specific resistance genes, and RGAs. Eight of the QTL displayed isolate specificity. Two were co-localized with known defense genes (phenylalanine ammonia-lyase and hydroxyproline-rich glycoprotein) and three with anthracnose-specific resistance genes and/or RGAs. Interestingly, two QTL, with different allelic contribution, mapped on linkage group B4 in a 5.0 cM interval containing Andean and Mesoamerican specific resistance genes against C. lindemuthianum and 11 polymorphic fragments revealed with a RGA probe. The possible relationship between genes underlying specific and partial resistance is discussed.

Unsupervised, statistically-based systems biology approach for unraveling the genetics of complex traits: A demonstration with ethanol metabolism.

PubMed

Lusk, Ryan; Saba, Laura M; Vanderlinden, Lauren A; Zidek, Vaclav; Silhavy, Jan; Pravenec, Michal; Hoffman, Paula L; Tabakoff, Boris

2018-04-24

A statistical pipeline was developed and used for determining candidate genes and candidate gene co-expression networks involved in two alcohol (i.e., ethanol) metabolism phenotypes, namely alcohol clearance and acetate area under the curve (AUC) in a recombinant inbred (HXB/BXH) rat panel. The approach was also used to provide an indication of how ethanol metabolism can impact the normal function of the identified networks. RNA was extracted from alcohol-naïve liver tissue of 30 strains of HXB/BXH recombinant inbred rats. The reconstructed transcripts were quantitated and data was used to construct gene co-expression modules and networks. A separate group of rats, comprising the same 30 strains, were injected with ethanol (2 gm/kg) for measurement of blood ethanol and acetate levels. These data were used for QTL analysis of the rate of ethanol disappearance and circulating acetate levels. The analysis pipeline required calculation of the module eigengene values, the correction of these values with ethanol metabolism rates and acetate levels across the rat strains and the determination of the eigengene QTLs. For a module to be considered a candidate for determining phenotype, the module eigengene values had to have significant correlation with the strain phenotypic values and the module eigengene QTLs had to overlap the phenotypic QTLs. Of the 658 transcript co-expression modules generated from liver RNA sequencing data, a single module satisfied all criteria for being a candidate for determining the alcohol clearance trait. This module contained two alcohol dehydrogenase genes, including the gene whose product was previously shown to be responsible for the majority of alcohol elimination in the rat. This module was also the only module identified as a candidate for influencing circulating acetate levels. This module was also linked to the process of generation and utilization of retinoic acid as related to the autonomous immune response. We propose that our analytical pipeline can successfully identify genetic regions and transcripts which predispose a particular phenotype and our analysis provides functional context for co-expression module components. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Characterization of a gene cluster responsible for the biosynthesis of anticancer agent FK228 in Chromobacterium violaceum No. 968.

PubMed

Cheng, Yi-Qiang; Yang, Min; Matter, Andrea M

2007-06-01

A gene cluster responsible for the biosynthesis of anticancer agent FK228 has been identified, cloned, and partially characterized in Chromobacterium violaceum no. 968. First, a genome-scanning approach was applied to identify three distinctive C. violaceum no. 968 genomic DNA clones that code for portions of nonribosomal peptide synthetase and polyketide synthase. Next, a gene replacement system developed originally for Pseudomonas aeruginosa was adapted to inactivate the genomic DNA-associated candidate natural product biosynthetic genes in vivo with high efficiency. Inactivation of a nonribosomal peptide synthetase-encoding gene completely abolished FK228 production in mutant strains. Subsequently, the entire FK228 biosynthetic gene cluster was cloned and sequenced. This gene cluster is predicted to encompass a 36.4-kb DNA region that includes 14 genes. The products of nine biosynthetic genes are proposed to constitute an unusual hybrid nonribosomal peptide synthetase-polyketide synthase-nonribosomal peptide synthetase assembly line including accessory activities for the biosynthesis of FK228. In particular, a putative flavin adenine dinucleotide-dependent pyridine nucleotide-disulfide oxidoreductase is proposed to catalyze disulfide bond formation between two sulfhydryl groups of cysteine residues as the final step in FK228 biosynthesis. Acquisition of the FK228 biosynthetic gene cluster and acclimation of an efficient genetic system should enable genetic engineering of the FK228 biosynthetic pathway in C. violaceum no. 968 for the generation of structural analogs as anticancer drug candidates.

Novel candidate genes for alcoholism--transcriptomic analysis of prefrontal medial cortex, hippocampus and nucleus accumbens of Warsaw alcohol-preferring and non-preferring rats.

PubMed

Stankiewicz, Adrian M; Goscik, Joanna; Dyr, Wanda; Juszczak, Grzegorz R; Ryglewicz, Danuta; Swiergiel, Artur H; Wieczorek, Marek; Stefanski, Roman

2015-12-01

Animal models provide opportunity to study neurobiological aspects of human alcoholism. Changes in gene expression have been implicated in mediating brain functions, including reward system and addiction. The current study aimed to identify genes that may underlie differential ethanol preference in Warsaw High Preferring (WHP) and Warsaw Low Preferring (WLP) rats. Microarray analysis comparing gene expression in nucleus accumbens (NAc), hippocampus (HP) and medial prefrontal cortex (mPFC) was performed in male WHP and WLP rats bred for differences in ethanol preference. Differential and stable between biological repeats expression of 345, 254 and 129 transcripts in NAc, HP and mPFC was detected. Identified genes and processes included known mediators of ethanol response (Mx2, Fam111a, Itpr1, Gabra4, Agtr1a, LTP/LTD, renin-angiotensin signaling pathway), toxicity (Sult1c2a, Ces1, inflammatory response), as well as genes involved in regulation of important addiction-related brain systems such as dopamine, tachykinin or acetylcholine (Gng7, Tac4, Slc5a7). The identified candidate genes may underlie differential ethanol preference in an animal model of alcoholism. Names of genes are written in italics, while names of proteins are written in standard font. Names of human genes/proteins are written in all capital letters. Names of rodent genes/proteins are written in capital letter followed by small letters. Copyright © 2015 Elsevier Inc. All rights reserved.

Identification of key candidate genes and pathways in hepatitis B virus-associated acute liver failure by bioinformatical analysis

PubMed Central

Lin, Huapeng; Zhang, Qian; Li, Xiaocheng; Wu, Yushen; Liu, Ye; Hu, Yingchun

2018-01-01

Abstract Hepatitis B virus-associated acute liver failure (HBV-ALF) is a rare but life-threatening syndrome that carried a high morbidity and mortality. Our study aimed to explore the possible molecular mechanisms of HBV-ALF by means of bioinformatics analysis. In this study, genes expression microarray datasets of HBV-ALF from Gene Expression Omnibus were collected, and then we identified differentially expressed genes (DEGs) by the limma package in R. After functional enrichment analysis, we constructed the protein–protein interaction (PPI) network by the Search Tool for the Retrieval of Interacting Genes online database and weighted genes coexpression network by the WGCNA package in R. Subsequently, we picked out the hub genes among the DEGs. A total of 423 DEGs with 198 upregulated genes and 225 downregulated genes were identified between HBV-ALF and normal samples. The upregulated genes were mainly enriched in immune response, and the downregulated genes were mainly enriched in complement and coagulation cascades. Orosomucoid 1 (ORM1), orosomucoid 2 (ORM2), plasminogen (PLG), and aldehyde oxidase 1 (AOX1) were picked out as the hub genes that with a high degree in both PPI network and weighted genes coexpression network. The weighted genes coexpression network analysis found out 3 of the 5 modules that upregulated genes enriched in were closely related to immune system. The downregulated genes enriched in only one module, and the genes in this module majorly enriched in the complement and coagulation cascades pathway. In conclusion, 4 genes (ORM1, ORM2, PLG, and AOX1) with immune response and the complement and coagulation cascades pathway may take part in the pathogenesis of HBV-ALF, and these candidate genes and pathways could be therapeutic targets for HBV-ALF. PMID:29384847

Fungal Screening on Olive Oil for Extracellular Triacylglycerol Lipases: Selection of a Trichoderma harzianum Strain and Genome Wide Search for the Genes

PubMed Central

Canseco-Pérez, Miguel Angel; Castillo-Avila, Genny Margarita; Islas-Flores, Ignacio; Apolinar-Hernández, Max M.; Rivera-Muñoz, Gerardo; Gamboa-Angulo, Marcela; Couoh-Uicab, Yeny

2018-01-01

A lipolytic screening with fungal strains isolated from lignocellulosic waste collected in banana plantation dumps was carried out. A Trichoderma harzianum strain (B13-1) showed good extracellular lipolytic activity (205 UmL−1). Subsequently, functional screening of the lipolytic activity on Rhodamine B enriched with olive oil as the only carbon source was performed. The successful growth of the strain allows us to suggest that a true lipase is responsible for the lipolytic activity in the B13-1 strain. In order to identify the gene(s) encoding the protein responsible for the lipolytic activity, in silico identification and characterization of triacylglycerol lipases from T. harzianum is reported for the first time. A survey in the genome of this fungus retrieved 50 lipases; however, bioinformatic analyses and putative functional descriptions in different databases allowed us to choose seven lipases as candidates. Suitability of the bioinformatic screening to select the candidates was confirmed by reverse transcription polymerase chain reaction (RT-PCR). The gene codifying 526309 was expressed when the fungus grew in a medium with olive oil as carbon source. This protein shares homology with commercial lipases, making it a candidate for further applications. The success in identifying a lipase gene inducible with olive oil and the suitability of the functional screening and bioinformatic survey carried out herein, support the premise that the strategy can be used in other microorganisms with sequenced genomes to search for true lipases, or other enzymes belonging to large protein families. PMID:29370083

The genome sequence of the most widely cultivated cacao type and its use to identify candidate genes regulating pod color

USDA-ARS?s Scientific Manuscript database

Background: Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. Results: We describe the sequencing and assembly of...

Identification and Analyses of AUX-IAA target genes controlling multiple pathways in developing fiber cells of Gossypium hirsutum L

PubMed Central

Nigam, Deepti; Sawant, Samir V

2013-01-01

Technological development led to an increased interest in systems biological approaches in plants to characterize developmental mechanism and candidate genes relevant to specific tissue or cell morphology. AUX-IAA proteins are important plant-specific putative transcription factors. There are several reports on physiological response of this family in Arabidopsis but in cotton fiber the transcriptional network through which AUX-IAA regulated its target genes is still unknown. in-silico modelling of cotton fiber development specific gene expression data (108 microarrays and 22,737 genes) using Algorithm for the Reconstruction of Accurate Cellular Networks (ARACNe) reveals 3690 putative AUX-IAA target genes of which 139 genes were known to be AUX-IAA co-regulated within Arabidopsis. Further AUX-IAA targeted gene regulatory network (GRN) had substantial impact on the transcriptional dynamics of cotton fiber, as showed by, altered TF networks, and Gene Ontology (GO) biological processes and metabolic pathway associated with its target genes. Analysis of the AUX-IAA-correlated gene network reveals multiple functions for AUX-IAA target genes such as unidimensional cell growth, cellular nitrogen compound metabolic process, nucleosome organization, DNA-protein complex and process related to cell wall. These candidate networks/pathways have a variety of profound impacts on such cellular functions as stress response, cell proliferation, and cell differentiation. While these functions are fairly broad, their underlying TF networks may provide a global view of AUX-IAA regulated gene expression and a GRN that guides future studies in understanding role of AUX-IAA box protein and its targets regulating fiber development. PMID:24497725

Single nucleotide polymorphisms in multiple sclerosis: disease susceptibility and treatment response biomarkers.

PubMed

Pravica, Vera; Popadic, Dusan; Savic, Emina; Markovic, Milos; Drulovic, Jelena; Mostarica-Stojkovic, Marija

2012-04-01

Multiple sclerosis (MS) is a chronic inflammatory demyelinating and neurodegenerative disease of the central nervous system characterized by unpredictable and variable clinical course. Etiology of MS involves both genetic and environmental factors. New technologies identified genetic polymorphisms associated with MS susceptibility among which immunologically relevant genes are significantly overrepresented. Although individual genes contribute only a small part to MS susceptibility, they might be used as biomarkers, thus helping to identify accurate diagnosis, predict clinical disease course and response to therapy. This review focuses on recent progress in research on MS genetics with special emphasis on the possibility to use single nucleotide polymorphism of candidate genes as biomarkers of susceptibility to disease and response to therapy.

Saccharomyces cerevisiae gene expression changes during rotating wall vessel suspension culture

NASA Technical Reports Server (NTRS)

Johanson, Kelly; Allen, Patricia L.; Lewis, Fawn; Cubano, Luis A.; Hyman, Linda E.; Hammond, Timothy G.

2002-01-01

This study utilizes Saccharomyces cerevisiae to study genetic responses to suspension culture. The suspension culture system used in this study is the high-aspect-ratio vessel, one type of the rotating wall vessel, that provides a high rate of gas exchange necessary for rapidly dividing cells. Cells were grown in the high-aspect-ratio vessel, and DNA microarray and metabolic analyses were used to determine the resulting changes in yeast gene expression. A significant number of genes were found to be up- or downregulated by at least twofold as a result of rotational growth. By using Gibbs promoter alignment, clusters of genes were examined for promoter elements mediating these genetic changes. Candidate binding motifs similar to the Rap1p binding site and the stress-responsive element were identified in the promoter regions of differentially regulated genes. This study shows that, as in higher order organisms, S. cerevisiae changes gene expression in response to rotational culture and also provides clues for investigations into the signaling pathways involved in gravitational response.

Sequence Evolution and Expression Regulation of Stress-Responsive Genes in Natural Populations of Wild Tomato

PubMed Central

Fischer, Iris; Steige, Kim A.; Stephan, Wolfgang; Mboup, Mamadou

2013-01-01

The wild tomato species Solanum chilense and S. peruvianum are a valuable non-model system for studying plant adaptation since they grow in diverse environments facing many abiotic constraints. Here we investigate the sequence evolution of regulatory regions of drought and cold responsive genes and their expression regulation. The coding regions of these genes were previously shown to exhibit signatures of positive selection. Expression profiles and sequence evolution of regulatory regions of members of the Asr (ABA/water stress/ripening induced) gene family and the dehydrin gene pLC30-15 were analyzed in wild tomato populations from contrasting environments. For S. chilense, we found that Asr4 and pLC30-15 appear to respond much faster to drought conditions in accessions from very dry environments than accessions from more mesic locations. Sequence analysis suggests that the promoter of Asr2 and the downstream region of pLC30-15 are under positive selection in some local populations of S. chilense. By investigating gene expression differences at the population level we provide further support of our previous conclusions that Asr2, Asr4, and pLC30-15 are promising candidates for functional studies of adaptation. Our analysis also demonstrates the power of the candidate gene approach in evolutionary biology research and highlights the importance of wild Solanum species as a genetic resource for their cultivated relatives. PMID:24205149

Identification of Candidate Genes Involved in the Salt Tolerance of Date Palm (Phoenix dactylifera L.) Based on a Yeast Functional Bioassay.

PubMed

Patankar, Himanshu V; Al-Harrasi, Ibtisam; Al-Yahyai, Rashid; Yaish, Mahmoud W

2018-06-01

Although date palm is a relatively salt-tolerant plant, the molecular basis of this tolerance is complex and poorly understood. Therefore, this study aimed to identify the genes involved in salinity tolerance using a basic yeast functional bioassay. To achieve this, a date palm cDNA library was overexpressed in Saccharomyces cerevisiae cells. The expression levels of selected genes that make yeast cells tolerant to salt were subsequently validated in the leaf and root tissues of date palm seedlings using a quantitative PCR method. About 6000 yeast transformant cells were replica printed and screened on a synthetic minimal medium containing 1.0 M of NaCl. The screening results showed the presence of 62 salt-tolerant transformant colonies. Sequence analysis of the recombinant yeast plasmids revealed the presence of a group of genes with potential salt-tolerance functions, such as aquaporins (PIP), serine/threonine protein kinases (STKs), ethylene-responsive transcription factor 1 (ERF1), and peroxidases (PRX). The expression pattern of the selected genes endorsed the hypothesis that these genes may be involved in salinity tolerance, as they showed a significant (p < 0.05) overexpression trend in both the leaf and root tissues in response to salinity. The genes identified in this project are suitable candidates for the further functional characterization of date palms.

Genome-Wide Identification and Characterization of Warming-Related Genes in Brassica rapa ssp. pekinensis.

PubMed

Song, Hayoung; Dong, Xiangshu; Yi, Hankuil; Ahn, Ju Young; Yun, Keunho; Song, Myungchul; Han, Ching-Tack; Hur, Yoonkang

2018-06-11

For sustainable crop cultivation in the face of global warming, it is important to unravel the genetic mechanisms underlying plant adaptation to a warming climate and apply this information to breeding. Thermomorphogenesis and ambient temperature signaling pathways have been well studied in model plants, but little information is available for vegetable crops. Here, we investigated genes responsive to warming conditions from two Brassica rapa inbred lines with different geographic origins: subtropical (Kenshin) and temperate (Chiifu). Genes in Gene Ontology categories “response to heat”, “heat acclimation”, “response to light intensity”, “response to oxidative stress”, and “response to temperature stimulus” were upregulated under warming treatment in both lines, but genes involved in “response to auxin stimulus” were upregulated only in Kenshin under both warming and minor-warming conditions. We identified 16 putative high temperature (HT) adaptation-related genes, including 10 heat-shock response genes, 2 transcription factor genes, 1 splicing factor gene, and 3 others. BrPIF4 , BrROF2 , and BrMPSR1 are candidate genes that might function in HT adaptation. Auxin response, alternative splicing of BrHSFA2 , and heat shock memory appear to be indispensable for HT adaptation in B. rapa . These results lay the foundation for molecular breeding and marker development to improve warming tolerance in B. rapa .

De novo Transcriptome Assembly of Floral Buds of Pineapple and Identification of Differentially Expressed Genes in Response to Ethephon Induction

PubMed Central

Liu, Chuan-He; Fan, Chao

2016-01-01

A remarkable characteristic of pineapple is its ability to undergo floral induction in response to external ethylene stimulation. However, little information is available regarding the molecular mechanism underlying this process. In this study, the differentially expressed genes (DEGs) in plants exposed to 1.80 mL·L−1 (T1) or 2.40 mL·L−1 ethephon (T2) compared with Ct plants (control, cleaning water) were identified using RNA-seq and gene expression profiling. Illumina sequencing generated 65,825,224 high-quality reads that were assembled into 129,594 unigenes with an average sequence length of 1173 bp. Of these unigenes, 24,775 were assigned to specific KEGG pathways, of which metabolic pathways and biosynthesis of secondary metabolites were the most highly represented. Gene Ontology (GO) analysis of the annotated unigenes revealed that the majority were involved in metabolic and cellular processes, cell and cell part, catalytic activity and binding. Gene expression profiling analysis revealed 3788, 3062, and 758 DEGs in the comparisons of T1 with Ct, T2 with Ct, and T2 with T1, respectively. GO analysis indicated that these DEGs were predominantly annotated to metabolic and cellular processes, cell and cell part, catalytic activity, and binding. KEGG pathway analysis revealed the enrichment of several important pathways among the DEGs, including metabolic pathways, biosynthesis of secondary metabolites and plant hormone signal transduction. Thirteen DEGs were identified as candidate genes associated with the process of floral induction by ethephon, including three ERF-like genes, one ETR-like gene, one LTI-like gene, one FT-like gene, one VRN1-like gene, three FRI-like genes, one AP1-like gene, one CAL-like gene, and one AG-like gene. qPCR analysis indicated that the changes in the expression of these 13 candidate genes were consistent with the alterations in the corresponding RPKM values, confirming the accuracy and credibility of the RNA-seq and gene expression profiling results. Ethephon-mediated induction likely mimics the process of vernalization in the floral transition in pineapple by increasing LTI, FT, and VRN1 expression and promoting the up-regulation of floral meristem identity genes involved in flower development. The candidate genes screened can be used in investigations of the molecular mechanisms of the flowering pathway and of various other biological mechanisms in pineapple. PMID:26955375

The Transcriptional Response of Drosophila melanogaster to Infection with the Sigma Virus (Rhabdoviridae)

PubMed Central

Baines, John F.; Roller, Julia; Saminadin-Peter, Sarah S.; Parsch, John; Jiggins, Francis M.

2009-01-01

Background Bacterial and fungal infections induce a potent immune response in Drosophila melanogaster, but it is unclear whether viral infections induce an antiviral immune response. Using microarrays, we examined the changes in gene expression in Drosophila that occur in response to infection with the sigma virus, a negative-stranded RNA virus (Rhabdoviridae) that occurs in wild populations of D. melanogaster. Principal Findings We detected many changes in gene expression in infected flies, but found no evidence for the activation of the Toll, IMD or Jak-STAT pathways, which control immune responses against bacteria and fungi. We identified a number of functional categories of genes, including serine proteases, ribosomal proteins and chorion proteins that were overrepresented among the differentially expressed genes. We also found that the sigma virus alters the expression of many more genes in males than in females. Conclusions These data suggest that either Drosophila do not mount an immune response against the sigma virus, or that the immune response is not controlled by known immune pathways. If the latter is true, the genes that we identified as differentially expressed after infection are promising candidates for controlling the host's response to the sigma virus. PMID:19718442

The transcriptional response of Drosophila melanogaster to infection with the sigma virus (Rhabdoviridae).

PubMed

Carpenter, Jennifer; Hutter, Stephan; Baines, John F; Roller, Julia; Saminadin-Peter, Sarah S; Parsch, John; Jiggins, Francis M

2009-08-31

Bacterial and fungal infections induce a potent immune response in Drosophila melanogaster, but it is unclear whether viral infections induce an antiviral immune response. Using microarrays, we examined the changes in gene expression in Drosophila that occur in response to infection with the sigma virus, a negative-stranded RNA virus (Rhabdoviridae) that occurs in wild populations of D. melanogaster. We detected many changes in gene expression in infected flies, but found no evidence for the activation of the Toll, IMD or Jak-STAT pathways, which control immune responses against bacteria and fungi. We identified a number of functional categories of genes, including serine proteases, ribosomal proteins and chorion proteins that were overrepresented among the differentially expressed genes. We also found that the sigma virus alters the expression of many more genes in males than in females. These data suggest that either Drosophila do not mount an immune response against the sigma virus, or that the immune response is not controlled by known immune pathways. If the latter is true, the genes that we identified as differentially expressed after infection are promising candidates for controlling the host's response to the sigma virus.

No Evidence That Schizophrenia Candidate Genes Are More Associated With Schizophrenia Than Noncandidate Genes.

PubMed

Johnson, Emma C; Border, Richard; Melroy-Greif, Whitney E; de Leeuw, Christiaan A; Ehringer, Marissa A; Keller, Matthew C

2017-11-15

A recent analysis of 25 historical candidate gene polymorphisms for schizophrenia in the largest genome-wide association study conducted to date suggested that these commonly studied variants were no more associated with the disorder than would be expected by chance. However, the same study identified other variants within those candidate genes that demonstrated genome-wide significant associations with schizophrenia. As such, it is possible that variants within historic schizophrenia candidate genes are associated with schizophrenia at levels above those expected by chance, even if the most-studied specific polymorphisms are not. The present study used association statistics from the largest schizophrenia genome-wide association study conducted to date as input to a gene set analysis to investigate whether variants within schizophrenia candidate genes are enriched for association with schizophrenia. As a group, variants in the most-studied candidate genes were no more associated with schizophrenia than were variants in control sets of noncandidate genes. While a small subset of candidate genes did appear to be significantly associated with schizophrenia, these genes were not particularly noteworthy given the large number of more strongly associated noncandidate genes. The history of schizophrenia research should serve as a cautionary tale to candidate gene investigators examining other phenotypes: our findings indicate that the most investigated candidate gene hypotheses of schizophrenia are not well supported by genome-wide association studies, and it is likely that this will be the case for other complex traits as well. Copyright © 2017 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

STAYGREEN (CsSGR) is a candidate for the anthracnose (Colletotrichum orbiculare) resistance locus cla in Gy14 cucumber.

PubMed

Pan, Junsong; Tan, Junyi; Wang, Yuhui; Zheng, Xiangyang; Owens, Ken; Li, Dawei; Li, Yuhong; Weng, Yiqun

2018-04-21

Map-based cloning identified a candidate gene for resistance to the anthracnose fungal pathogen Colletotrichum orbiculare in cucumber, which reveals a novel function for the highly conserved STAYGREEN family genes for host disease resistance in plants. Colletotrichum orbiculare is a hemibiotrophic fungal pathogen that causes anthracnose disease in cucumber and other cucurbit crops. No host resistance genes against the anthracnose pathogens have been cloned in crop plants. Here, we reported fine mapping and cloning of a resistance gene to the race 1 anthracnose pathogen in cucumber inbred lines Gy14 and WI 2757. Phenotypic and QTL analysis in multiple populations revealed that a single recessive gene, cla, was underlying anthracnose resistance in both lines, but WI2757 carried an additional minor-effect QTL. Fine mapping using 150 Gy14 × 9930 recombinant inbred lines and 1043 F 2 individuals delimited the cla locus into a 32 kb region in cucumber Chromosome 5 with three predicted genes. Multiple lines of evidence suggested that the cucumber STAYGREEN (CsSGR) gene is a candidate for the anthracnose resistance locus. A single nucleotide mutation in the third exon of CsSGR resulted in the substitution of Glutamine in 9930 to Arginine in Gy14 in CsSGR protein which seems responsible for the differential anthracnose inoculation responses between Gy14 and 9930. Quantitative real-time PCR analysis indicated that CsSGR was significantly upregulated upon anthracnose pathogen inoculation in the susceptible 9930, while its expression was much lower in the resistant Gy14. Investigation of allelic diversities in natural cucumber populations revealed that the resistance allele in almost all improved cultivars or breeding lines of the U.S. origin was derived from PI 197087. This work reveals an unknown function for the highly conserved STAYGREEN (SGR) family genes for host disease resistance in plants.

A Strong Immune Response in Young Adult Honeybees Masks Their Increased Susceptibility to Infection Compared to Older Bees

PubMed Central

Bull, James C.; Ryabov, Eugene V.; Prince, Gill; Mead, Andrew; Zhang, Cunjin; Baxter, Laura A.; Pell, Judith K.; Osborne, Juliet L.; Chandler, Dave

2012-01-01

Honeybees, Apis mellifera, show age-related division of labor in which young adults perform maintenance (“housekeeping”) tasks inside the colony before switching to outside foraging at approximately 23 days old. Disease resistance is an important feature of honeybee biology, but little is known about the interaction of pathogens and age-related division of labor. We tested a hypothesis that older forager bees and younger “house” bees differ in susceptibility to infection. We coupled an infection bioassay with a functional analysis of gene expression in individual bees using a whole genome microarray. Forager bees treated with the entomopathogenic fungus Metarhizium anisopliae s.l. survived for significantly longer than house bees. This was concomitant with substantial differences in gene expression including genes associated with immune function. In house bees, infection was associated with differential expression of 35 candidate immune genes contrasted with differential expression of only two candidate immune genes in forager bees. For control bees (i.e. not treated with M. anisopliae) the development from the house to the forager stage was associated with differential expression of 49 candidate immune genes, including up-regulation of the antimicrobial peptide gene abaecin, plus major components of the Toll pathway, serine proteases, and serpins. We infer that reduced pathogen susceptibility in forager bees was associated with age-related activation of specific immune system pathways. Our findings contrast with the view that the immunocompetence in social insects declines with the onset of foraging as a result of a trade-off in the allocation of resources for foraging. The up-regulation of immune-related genes in young adult bees in response to M. anisopliae infection was an indicator of disease susceptibility; this also challenges previous research in social insects, in which an elevated immune status has been used as a marker of increased disease resistance and fitness without considering the effects of age-related development. PMID:23300441

Artificial selection on brain-expressed genes during the domestication of dog.

PubMed

Li, Yan; Vonholdt, Bridgett M; Reynolds, Andy; Boyko, Adam R; Wayne, Robert K; Wu, Dong-Dong; Zhang, Ya-Ping

2013-08-01

Domesticated dogs have many unique behaviors not found in gray wolves that have augmented their interaction and communication with humans. The genetic basis of such unique behaviors in dogs remains poorly understood. We found that genes within regions highly differentiated between outbred Chinese native dogs (CNs) and wolves show high bias for expression localized to brain tissues, particularly the prefrontal cortex, a specific region responsible for complex cognitive behaviors. In contrast, candidate genes showing high population differentiation between CNs and German Shepherd dogs (GSs) did not demonstrate significant expression bias. These observations indicate that these candidate genes highly expressed in the brain have rapidly evolved. This rapid evolution was probably driven by artificial selection during the primary transition from wolves to ancient dogs and was consistent with the evolution of dog-specific characteristics, such as behavior transformation, for thousands of years.

Identifying candidate genes for 2p15p16.1 microdeletion syndrome using clinical, genomic, and functional analysis

PubMed Central

Bagheri, Hani; Badduke, Chansonette; Qiao, Ying; Colnaghi, Rita; Abramowicz, Iga; Alcantara, Diana; Dunham, Christopher; Wen, Jiadi; Wildin, Robert S.; Nowaczyk, Malgorzata J.M.; Eichmeyer, Jennifer; Lehman, Anna; Maranda, Bruno; Martell, Sally; Shan, Xianghong; Lewis, Suzanne M.E.; O’Driscoll, Mark; Gregory-Evans, Cheryl Y.

2016-01-01

The 2p15p16.1 microdeletion syndrome has a core phenotype consisting of intellectual disability, microcephaly, hypotonia, delayed growth, common craniofacial features, and digital anomalies. So far, more than 20 cases of 2p15p16.1 microdeletion syndrome have been reported in the literature; however, the size of the deletions and their breakpoints vary, making it difficult to identify the candidate genes. Recent reports pointed to 4 genes (XPO1, USP34, BCL11A, and REL) that were included, alone or in combination, in the smallest deletions causing the syndrome. Here, we describe 8 new patients with the 2p15p16.1 deletion and review all published cases to date. We demonstrate functional deficits for the above 4 candidate genes using patients’ lymphoblast cell lines (LCLs) and knockdown of their orthologs in zebrafish. All genes were dosage sensitive on the basis of reduced protein expression in LCLs. In addition, deletion of XPO1, a nuclear exporter, cosegregated with nuclear accumulation of one of its cargo molecules (rpS5) in patients’ LCLs. Other pathways associated with these genes (e.g., NF-κB and Wnt signaling as well as the DNA damage response) were not impaired in patients’ LCLs. Knockdown of xpo1a, rel, bcl11aa, and bcl11ab resulted in abnormal zebrafish embryonic development including microcephaly, dysmorphic body, hindered growth, and small fins as well as structural brain abnormalities. Our multifaceted analysis strongly implicates XPO1, REL, and BCL11A as candidate genes for 2p15p16.1 microdeletion syndrome. PMID:27699255

Genome-wide detection of selection signatures in Chinese indigenous Laiwu pigs revealed candidate genes regulating fat deposition in muscle.

PubMed

Chen, Minhui; Wang, Jiying; Wang, Yanping; Wu, Ying; Fu, Jinluan; Liu, Jian-Feng

2018-05-18

Currently, genome-wide scans for positive selection signatures in commercial breed have been investigated. However, few studies have focused on selection footprints of indigenous breeds. Laiwu pig is an invaluable Chinese indigenous pig breed with extremely high proportion of intramuscular fat (IMF), and an excellent model to detect footprint as the result of natural and artificial selection for fat deposition in muscle. In this study, based on GeneSeek Genomic profiler Porcine HD data, three complementary methods, F ST , iHS (integrated haplotype homozygosity score) and CLR (composite likelihood ratio), were implemented to detect selection signatures in the whole genome of Laiwu pigs. Totally, 175 candidate selected regions were obtained by at least two of the three methods, which covered 43.75 Mb genomic regions and corresponded to 1.79% of the genome sequence. Gene annotation of the selected regions revealed a list of functionally important genes for feed intake and fat deposition, reproduction, and immune response. Especially, in accordance to the phenotypic features of Laiwu pigs, among the candidate genes, we identified several genes, NPY1R, NPY5R, PIK3R1 and JAKMIP1, involved in the actions of two sets of neurons, which are central regulators in maintaining the balance between food intake and energy expenditure. Our results identified a number of regions showing signatures of selection, as well as a list of functionally candidate genes with potential effect on phenotypic traits, especially fat deposition in muscle. Our findings provide insights into the mechanisms of artificial selection of fat deposition and further facilitate follow-up functional studies.

Allele specific expression analysis identifies regulatory variation associated with stress-related genes in the Mexican highland maize landrace Palomero Toluqueño

PubMed Central

González-Segovia, Eric; Ross-Ibarra, Jeffrey; Simpson, June K.

2017-01-01

Background Gene regulatory variation has been proposed to play an important role in the adaptation of plants to environmental stress. In the central highlands of Mexico, farmer selection has generated a unique group of maize landraces adapted to the challenges of the highland niche. In this study, gene expression in Mexican highland maize and a reference maize breeding line were compared to identify evidence of regulatory variation in stress-related genes. It was hypothesised that local adaptation in Mexican highland maize would be associated with a transcriptional signature observable even under benign conditions. Methods Allele specific expression analysis was performed using the seedling-leaf transcriptome of an F1 individual generated from the cross between the highland adapted Mexican landrace Palomero Toluqueño and the reference line B73, grown under benign conditions. Results were compared with a published dataset describing the transcriptional response of B73 seedlings to cold, heat, salt and UV treatments. Results A total of 2,386 genes were identified to show allele specific expression. Of these, 277 showed an expression difference between Palomero Toluqueño and B73 alleles under benign conditions that anticipated the response of B73 cold, heat, salt and/or UV treatments, and, as such, were considered to display a prior stress response. Prior stress response candidates included genes associated with plant hormone signaling and a number of transcription factors. Construction of a gene co-expression network revealed further signaling and stress-related genes to be among the potential targets of the transcription factors candidates. Discussion Prior activation of responses may represent the best strategy when stresses are severe but predictable. Expression differences observed here between Palomero Toluqueño and B73 alleles indicate the presence of cis-acting regulatory variation linked to stress-related genes in Palomero Toluqueño. Considered alongside gene annotation and population data, allele specific expression analysis of plants grown under benign conditions provides an attractive strategy to identify functional variation potentially linked to local adaptation. PMID:28852597

Candidate Gene Study of TRAIL and TRAIL Receptors: Association with Response to Interferon Beta Therapy in Multiple Sclerosis Patients

PubMed Central

Órpez-Zafra, Teresa; Pinto-Medel, María Jesús; Oliver-Martos, Begoña; Ortega-Pinazo, Jesús; Arnáiz, Carlos; Guijarro-Castro, Cristina; Varadé, Jezabel; Álvarez-Lafuente, Roberto; Urcelay, Elena; Sánchez-Jiménez, Francisca

2013-01-01

TRAIL and TRAIL Receptor genes have been implicated in Multiple Sclerosis pathology as well as in the response to IFN beta therapy. The objective of our study was to evaluate the association of these genes in relation to the age at disease onset (AAO) and to the clinical response upon IFN beta treatment in Spanish MS patients. We carried out a candidate gene study of TRAIL, TRAILR-1, TRAILR-2, TRAILR-3 and TRAILR-4 genes. A total of 54 SNPs were analysed in 509 MS patients under IFN beta treatment, and an additional cohort of 226 MS patients was used to validate the results. Associations of rs1047275 in TRAILR-2 and rs7011559 in TRAILR-4 genes with AAO under an additive model did not withstand Bonferroni correction. In contrast, patients with the TRAILR-1 rs20576-CC genotype showed a better clinical response to IFN beta therapy compared with patients carrying the A-allele (recessive model: p = 8.88×10−4, pc = 0.048, OR = 0.30). This SNP resulted in a non synonymous substitution of Glutamic acid to Alanine in position 228 (E228A), a change previously associated with susceptibility to different cancer types and risk of metastases, suggesting a lack of functionality of TRAILR-1. In order to unravel how this amino acid change in TRAILR-1 would affect to death signal, we performed a molecular modelling with both alleles. Neither TRAIL binding sites in the receptor nor the expression levels of TRAILR-1 in peripheral blood mononuclear cell subsets (monocytes, CD4+ and CD8+ T cells) were modified, suggesting that this SNP may be altering the death signal by some other mechanism. These findings show a role for TRAILR-1 gene variations in the clinical outcome of IFN beta therapy that might have relevance as a biomarker to predict the response to IFN beta in MS. PMID:23658636

Physiological and genetic correlates of boldness: characterising the mechanisms of behavioural variation in rainbow trout, Oncorhynchus mykiss.

PubMed

Thomson, Jack S; Watts, Phillip C; Pottinger, Tom G; Sneddon, Lynne U

2011-01-01

Bold, risk-taking animals have previously been putatively linked with a proactive stress coping style whereas it is suggested shyer, risk-averse animals exhibit a reactive coping style. The aim of this study was to investigate whether differences in the expression of bold-type behaviour were evident within and between two lines of rainbow trout, Oncorhynchus mykiss, selectively bred for a low (LR) or high (HR) endocrine response to stress, and to link boldness and stress responsiveness with the expression of related candidate genes. Boldness was determined in individual fish over two trials by measuring the latency to approach a novel object. Differences in plasma cortisol concentrations and the expression of eight novel candidate genes previously identified as being linked with divergent behaviours or stress were determined. Bold and shy individuals, approaching the object within 180 s or not approaching within 300 s respectively, were evident within each line, and this was linked with activity levels in the HR line. Post-stress plasma cortisol concentrations were significantly greater in the HR line compared with the LR line, and six of the eight tested genes were upregulated in the brains of LR fish compared with HR fish. However, no direct relationship between boldness and either stress responsiveness or gene expression was found, although clear differences in stress physiology and, for the first time, gene expression could be identified between the lines. This lack of correlation between physiological and molecular responses and behavioural variation within both lines highlights the complexity of the behavioural-physiological complex. Copyright © 2010 Elsevier Inc. All rights reserved.

Candidate gene association studies in syndromic and non-syndromic cleft lip and palate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Daack-Hirsch, S.; Basart, A.; Frischmeyer, P.

1994-09-01

Using ongoing case ascertainment through a birth defects registry, we have collected 219 nuclear families with non-syndromic cleft lip and/or palate and 111 families with a collection of syndromic forms. Syndromic cases include 24 with recognized forms and 72 with unrecognized syndromes. Candidate gene studies as well as genome-wide searches for evidence of microdeletions and isodisomy are currently being carried out. Candidate gene association studies, to date, have made use of PCR-based polymorphisms for TGFA, MSX1, CLPG13 (a CA repeat associated with a human homologue of a locus that results in craniofacial dysmorphogenesis in the mouse) and an STRP foundmore » in a Van der Woude syndrome microdeletion. Control tetranucleotide repeats, which insure that population-based differences are not responsible for any observed associations, are also tested. Studies of the syndromic cases have included the same list of candidate genes searching for evidence of microdeletions and a genome-wide search using tri- and tetranucleotide polymorphic markers to search for isodisomy or structural rearrangements. Significant associations have previously been identified for TGFA, and, in this report, identified for MSX1 and nonsyndromic cleft palate only (p = 0.04, uncorrected). Preliminary results of the genome-wide scan for isodisomy has returned no true positives and there has been no evidence for microdeletion cases.« less

The Brown Midrib Leaf (bml) Mutation in Rice (Oryza sativa L.) Causes Premature Leaf Senescence and the Induction of Defense Responses.

PubMed

Akhter, Delara; Qin, Ran; Nath, Ujjal Kumar; Alamin, Md; Jin, Xiaoli; Shi, Chunhai

2018-04-09

Isolating and characterizing mutants with altered senescence phenotypes is one of the ways to understand the molecular basis of leaf aging. Using ethyl methane sulfonate mutagenesis, a new rice ( Oryza sativa ) mutant, brown midrib leaf ( bml ), was isolated from the indica cultivar 'Zhenong34'. The bml mutants had brown midribs in their leaves and initiated senescence prematurely, at the onset of heading. The mutants had abnormal cells with degraded chloroplasts and contained less chlorophyll compared to the wild type (WT). The bml mutant showed excessive accumulation of reactive oxygen species (ROS), increased activities of superoxide dismutase, catalase, and malondialdehyde, upregulation of senescence-induced STAY-GREEN genes and senescence-related transcription factors, and down regulation of photosynthesis-related genes. The levels of abscisic acid (ABA) and jasmonic acid (JA) were increased in bml with the upregulation of some ABA and JA biosynthetic genes. In pathogen response, bml demonstrated higher resistance against Xanthomonas oryzae pv. oryzae and upregulation of four pathogenesis-related genes compared to the WT. A genetic study confirmed that the bml trait was caused by a single recessive nuclear gene ( BML ). A map-based cloning using insertion/deletion markers confirmed that BML was located in the 57.32kb interval between the L5IS7 and L5IS11 markers on the short arm of chromosome 5. A sequence analysis of the candidate region identified a 1 bp substitution (G to A) in the 5'-UTR (+98) of bml . BML is a candidate gene associated with leaf senescence, ROS regulation, and disease response, also involved in hormone signaling in rice. Therefore, this gene might be useful in marker-assisted backcrossing/gene editing to improve rice cultivars.

RNAseq reveals weed-induced PIF3-like as a candidate target to manipulate weed stress response in soybean.

PubMed

Horvath, David P; Hansen, Stephanie A; Moriles-Miller, Janet P; Pierik, Ronald; Yan, Changhui; Clay, David E; Scheffler, Brian; Clay, Sharon A

2015-07-01

Weeds reduce yield in soybeans (Glycine max) through incompletely defined mechanisms. The effects of weeds on the soybean transcriptome were evaluated in field conditions during four separate growing seasons. RNASeq data were collected from six biological samples of soybeans growing with or without weeds. Weed species and the methods to maintain weed-free controls varied between years to mitigate treatment effects, and to allow detection of general soybean weed responses. Soybean plants were not visibly nutrient- or water-stressed. We identified 55 consistently downregulated genes in weedy plots. Many of the downregulated genes were heat shock genes. Fourteen genes were consistently upregulated. Several transcription factors including a PHYTOCHROME INTERACTING FACTOR 3-like gene (PIF3) were included among the upregulated genes. Gene set enrichment analysis indicated roles for increased oxidative stress and jasmonic acid signaling responses during weed stress. The relationship of this weed-induced PIF3 gene to genes involved in shade avoidance responses in Arabidopsis provide evidence that this gene may be important in the response of soybean to weeds. These results suggest that the weed-induced PIF3 gene will be a target for manipulating weed tolerance in soybean. No claim to original US government works New Phytologist © 2015 New Phytologist Trust.

The effects of genes implicated in cardiovascular disease on blood-pressure response to treatment among treatment-naïve hypertensive African Americans in the GenHAT study

PubMed Central

Do, Anh N; Lynch, Amy I; Claas, Steven A; Boerwinkle, Eric; Davis, Barry R; Ford, Charles E; Eckfeldt, John H; Tiwari, Hemant K; Arnett, Donna K; Irvin, Marguerite R

2015-01-01

African Americans have the highest prevalence of hypertension in the United States. Blood-pressure control is important to reduce cardiovascular disease (CVD)-related morbidity and mortality in this ethnic group. Genetic variants have been found to be associated with BP response to treatment. Previous pharmacogenetic studies of blood-pressure response to treatment in African Americans suffer limitations of small sample size as well as a limited number of candidate genes, and often focused on one antihypertensive treatment. Using 1,131 African-American treatment naïve participants from the Genetics of Hypertension Associated Treatment (GenHAT) Study, we examined whether variants in 35 candidate genes might modulate blood-pressure response to four different antihypertensive medications, including an angiotensin converting enzyme (ACE) inhibitor (lisinopril), a calcium channel blocker (amlodipine), and an α-adrenergic blocker (doxazosin) as compared to a thiazide diuretic (chlorthalidone) after 6 months of follow-up. Several suggestive gene by treatment interactions were identified. For example, among participants with two minor alleles of REN rs6681776, diastolic blood-pressure response was much improved on doxazosin compared to chlorthalidone (on average −9.49 mmHg vs. −1.70 mmHg) (P=0.007). Although several suggestive loci were identified, none of the findings passed significance criteria after correction for multiple testing. Given the impact of hypertension and its sequelae in this population, this research highlights the potential for genetic factors to contribute to blood-pressure response to treatment. Continued concerted research efforts focused on genetics are needed to improve treatment response in this high risk group. PMID:26791477

Transcript map of the Ovum mutant (Om) locus: isolation by exon trapping of new candidate genes for the DDK syndrome.

PubMed

Le Bras, Stéphanie; Cohen-Tannoudji, Michel; Guyot, Valérie; Vandormael-Pournin, Sandrine; Coumailleau, Franck; Babinet, Charles; Baldacci, Patricia

2002-08-21

The DDK syndrome is defined as the embryonic lethality of F1 mouse embryos from crosses between DDK females and males from other strains (named hereafter as non-DDK strains). Genetically controlled by the Ovum mutant (Om) locus, it is due to a deleterious interaction between a maternal factor present in DDK oocytes and the non-DDK paternal pronucleus. Therefore, the DDK syndrome constitutes a unique genetic tool to study the crucial interactions that take place between the parental genomes and the egg cytoplasm during mammalian development. In this paper, we present an extensive analysis performed by exon trapping on the Om region. Twenty-seven trapped sequences were from genes in the databases: beta-adaptin, CCT zeta2, DNA LigaseIII, Notchless, Rad51l3 and Scya1. Twenty-eight other sequences presented similarities with expressed sequence tags and genomic sequences whereas 57 did not. The pattern of expression of 37 of these markers was established. Importantly, five of them are expressed in DDK oocytes and are candidate genes for the maternal factor, and 20 are candidate genes for the paternal factor since they are expressed in testis. This data is an important step towards identifying the genes responsible for the DDK syndrome.

Positional cloning of a gene responsible for the cts mutation of the silkworm, Bombyx mori.

PubMed

Ito, Katsuhiko; Kidokoro, Kurako; Katsuma, Susumu; Shimada, Toru; Yamamoto, Kimiko; Mita, Kazuei; Kadono-Okuda, Keiko

2012-07-01

The larval head cuticle and anal plates of the silkworm mutant cheek and tail spot (cts) have chocolate-colored spots, unlike the entirely white appearance of the wild-type (WT) strain. We report the identification and characterization of the gene responsible for the cts mutation. Positional cloning revealed a cts candidate on chromosome 16, designated BmMFS, based on the high similarity of the deduced amino acid sequence between the candidate gene from the WT strain and the major facilitator superfamily (MFS) protein. BmMFS likely encodes a membrane protein with 11 putative transmembrane domains, while the putative structure deduced from the cts-type allele possesses only 10-pass transmembrane domains owing to a deletion in its coding region. Quantitative RT-PCR analysis showed that BmMFS mRNA was strongly expressed in the integument of the head and tail, where the cts phenotype is observed; expression markedly increased at the molting and newly ecdysed stages. These results indicate that the novel BmMFS gene is cts and the membrane structure of its protein accounts for the cts phenotype. These expression profiles and the cts phenotype are quite similar to those of melanin-related genes, such as Bmyellow-e and Bm-iAANAT, suggesting that BmMFS is involved in the melanin synthesis pathway.

Involvement of Ethylene in the Latex Metabolism and Tapping Panel Dryness of Hevea brasiliensis

PubMed Central

Putranto, Riza-Arief; Herlinawati, Eva; Rio, Maryannick; Leclercq, Julie; Piyatrakul, Piyanuch; Gohet, Eric; Sanier, Christine; Oktavia, Fetrina; Pirrello, Julien; Kuswanhadi; Montoro, Pascal

2015-01-01

Ethephon, an ethylene releaser, is used to stimulate latex production in Hevea brasiliensis. Ethylene induces many functions in latex cells including the production of reactive oxygen species (ROS). The accumulation of ROS is responsible for the coagulation of rubber particles in latex cells, resulting in the partial or complete stoppage of latex flow. This study set out to assess biochemical and histological changes as well as changes in gene expression in latex and phloem tissues from trees grown under various harvesting systems. The Tapping Panel Dryness (TPD) susceptibility of Hevea clones was found to be related to some biochemical parameters, such as low sucrose and high inorganic phosphorus contents. A high tapping frequency and ethephon stimulation induced early TPD occurrence in a high latex metabolism clone and late occurrence in a low latex metabolism clone. TPD-affected trees had smaller number of laticifer vessels compared to healthy trees, suggesting a modification of cambial activity. The differential transcript abundance was observed for twenty-seven candidate genes related to TPD occurrence in latex and phloem tissues for ROS-scavenging, ethylene biosynthesis and signalling genes. The predicted function for some Ethylene Response Factor genes suggested that these candidate genes should play an important role in regulating susceptibility to TPD. PMID:26247941

HvLUX1 is a candidate gene underlying the early maturity 10 locus in barley: phylogeny, diversity, and interactions with the circadian clock and photoperiodic pathways

PubMed Central

Campoli, Chiara; Pankin, Artem; Drosse, Benedikt; Casao, Cristina M; Davis, Seth J; von Korff, Maria

2013-01-01

Photoperiodic flowering is a major factor determining crop performance and is controlled by interactions between environmental signals and the circadian clock. We proposed Hvlux1, an ortholog of the Arabidopsis circadian gene LUX ARRHYTHMO, as a candidate underlying the early maturity 10 (eam10) locus in barley (Hordeum vulgare L.). The link between eam10 and Hvlux1 was discovered using high-throughput sequencing of enriched libraries and segregation analysis. We conducted functional, phylogenetic, and diversity studies of eam10 and HvLUX1 to understand the genetic control of photoperiod response in barley and to characterize the evolution of LUX-like genes within barley and across monocots and eudicots. We demonstrate that eam10 causes circadian defects and interacts with the photoperiod response gene Ppd-H1 to accelerate flowering under long and short days. The results of phylogenetic and diversity analyses indicate that HvLUX1 was under purifying selection, duplicated at the base of the grass clade, and diverged independently of LUX-like genes in other plant lineages. Taken together, these findings contribute to improved understanding of the barley circadian clock, its interaction with the photoperiod pathway, and evolution of circadian systems in barley and across monocots and eudicots. PMID:23731278

Involvement of Ethylene in the Latex Metabolism and Tapping Panel Dryness of Hevea brasiliensis.

PubMed

Putranto, Riza-Arief; Herlinawati, Eva; Rio, Maryannick; Leclercq, Julie; Piyatrakul, Piyanuch; Gohet, Eric; Sanier, Christine; Oktavia, Fetrina; Pirrello, Julien; Kuswanhadi; Montoro, Pascal

2015-08-04

Ethephon, an ethylene releaser, is used to stimulate latex production in Hevea brasiliensis. Ethylene induces many functions in latex cells including the production of reactive oxygen species (ROS). The accumulation of ROS is responsible for the coagulation of rubber particles in latex cells, resulting in the partial or complete stoppage of latex flow. This study set out to assess biochemical and histological changes as well as changes in gene expression in latex and phloem tissues from trees grown under various harvesting systems. The Tapping Panel Dryness (TPD) susceptibility of Hevea clones was found to be related to some biochemical parameters, such as low sucrose and high inorganic phosphorus contents. A high tapping frequency and ethephon stimulation induced early TPD occurrence in a high latex metabolism clone and late occurrence in a low latex metabolism clone. TPD-affected trees had smaller number of laticifer vessels compared to healthy trees, suggesting a modification of cambial activity. The differential transcript abundance was observed for twenty-seven candidate genes related to TPD occurrence in latex and phloem tissues for ROS-scavenging, ethylene biosynthesis and signalling genes. The predicted function for some Ethylene Response Factor genes suggested that these candidate genes should play an important role in regulating susceptibility to TPD.

Transcriptomic biomarkers of altered erythropoiesis to detect autologous blood transfusion.

PubMed

Salamin, Olivier; Mignot, Jonathan; Kuuranne, Tiia; Saugy, Martial; Leuenberger, Nicolas

2018-03-01

Autologous blood transfusion is a powerful means of improving performance and remains one of the most challenging methods to detect. Recent investigations have identified 3 candidate reticulocytes genes whose expression was significantly influenced by blood transfusion. Using quantitative reverse transcription polymerase chain reaction as an alternative quantitative method, the present study supports that delta-aminolevulinate synthase 2 (ALAS2), carbonic anhydrase (CA1), and solute carrier family 4 member 1 (SLC4A1) genes are down-regulated post-transfusion. The expression of these genes exhibited stronger correlation with immature reticulocyte fraction than with reticulocytes percentage. Moreover, the repression of reticulocytes' gene expression was more pronounced than the diminution of immature reticulocyte fraction and reticulocyte percentage following blood transfusion. It suggests that the 3 candidate genes are reliable predictors of bone marrow's response to blood transfusion and that they represent potential biomarkers for the detection of this method prohibited in sports. Copyright © 2017 John Wiley & Sons, Ltd.

Leishmania genome analysis and high-throughput immunological screening identifies tuzin as a novel vaccine candidate against visceral leishmaniasis.

PubMed

Lakshmi, Bhavana Sethu; Wang, Ruobing; Madhubala, Rentala

2014-06-24

Leishmaniasis is a neglected tropical disease caused by Leishmania species. It is a major health concern affecting 88 countries and threatening 350 million people globally. Unfortunately, there are no vaccines and there are limitations associated with the current therapeutic regimens for leishmaniasis. The emerging cases of drug-resistance further aggravate the situation, demanding rapid drug and vaccine development. The genome sequence of Leishmania, provides access to novel genes that hold potential as chemotherapeutic targets or vaccine candidates. In this study, we selected 19 antigenic genes from about 8000 common Leishmania genes based on the Leishmania major and Leishmania infantum genome information available in the pathogen databases. Potential vaccine candidates thus identified were screened using an in vitro high throughput immunological platform developed in the laboratory. Four candidate genes coding for tuzin, flagellar glycoprotein-like protein (FGP), phospholipase A1-like protein (PLA1) and potassium voltage-gated channel protein (K VOLT) showed a predominant protective Th1 response over disease exacerbating Th2. We report the immunogenic properties and protective efficacy of one of the four antigens, tuzin, as a DNA vaccine against Leishmania donovani challenge. Our results show that administration of tuzin DNA protected BALB/c mice against L. donovani challenge and that protective immunity was associated with higher levels of IFN-γ and IL-12 production in comparison to IL-4 and IL-10. Our study presents a simple approach to rapidly identify potential vaccine candidates using the exhaustive information stored in the genome and an in vitro high-throughput immunological platform. Copyright © 2014. Published by Elsevier Ltd.

Integrative mouse and human mRNA studies using WGCNA nominates novel candidate genes involved in the pathogenesis of major depressive disorder.

PubMed

Malki, Karim; Tosto, Maria Grazia; Jumabhoy, Irfan; Lourdusamy, Anbarasu; Sluyter, Frans; Craig, Ian; Uher, Rudolf; McGuffin, Peter; Schalkwyk, Leonard C

2013-12-01

This study aims to identify novel genes associated with major depressive disorder and pharmacological treatment response using animal and human mRNA studies. Weighted gene coexpression network analysis was used to uncover genes associated with stress factors in mice and to inform mRNA probe set selection in a post-mortem study of depression. A total of 171 genes were found to be differentially regulated in response to both early and late stress protocols in a mouse study. Ten human genes, orthologous to mouse genes differentially expressed by stress, were also found to be dysregulated in depressed cases in a human post-mortem brain study from the Stanley Foundation Brain Collection. Several novel genes associated with depression were uncovered, including NOVA1 and USP9X. Moreover, we found further evidence in support of hippocampal neurogenesis and peripheral inflammation in major depressive disorder.

Repressed expression of a gene for a basic helix-loop-helix protein causes a white flower phenotype in carnation

PubMed Central

Totsuka, Akane; Okamoto, Emi; Miyahara, Taira; Kouno, Takanobu; Cano, Emilio A.; Sasaki, Nobuhiro; Watanabe, Aiko; Tasaki, Keisuke; Nishihara, Masahiro; Ozeki, Yoshihiro

2018-01-01

In a previous study, two genes responsible for white flower phenotypes in carnation were identified. These genes encoded enzymes involved in anthocyanin synthesis, namely, flavanone 3-hydroxylase (F3H) and dihydroflavonol 4-reductase (DFR), and showed reduced expression in the white flower phenotypes. Here, we identify another candidate gene for white phenotype in carnation flowers using an RNA-seq analysis followed by RT-PCR. This candidate gene encodes a transcriptional regulatory factor of the basic helix-loop-helix (bHLH) type. In the cultivar examined here, both F3H and DFR genes produced active enzyme proteins; however, expression of DFR and of genes for enzymes involved in the downstream anthocyanin synthetic pathway from DFR was repressed in the absence of bHLH expression. Occasionally, flowers of the white flowered cultivar used here have red speckles and stripes on the white petals. We found that expression of bHLH occurred in these red petal segments and induced expression of DFR and the following downstream enzymes. Our results indicate that a member of the bHLH superfamily is another gene involved in anthocyanin synthesis in addition to structural genes encoding enzymes. PMID:29681756

Sex-dependent genetic effects on immune responses to a parasitic nematode.

PubMed

Hayes, Kelly S; Hager, Reinmar; Grencis, Richard K

2014-03-14

Many disease aetiologies have sex specific effects, which have important implications for disease management. It is now becoming increasingly evident that such effects are the result of the differential expression of autosomal genes rather than sex-specific genes. Such sex-specific variation in the response to Trichuris muris, a murine parasitic nematode infection and model for the human parasitic nematode T. trichiura, has been well documented, however, the underlying genetic causes of these differences have been largely neglected. We used the BXD mouse set of recombinant inbred strains to identify sex-specific loci that contribute to immune phenotypes in T. muris infection. Response phenotypes to T. muris infection were found to be highly variable between different lines of BXD mice. A significant QTL on chromosome 5 (TM5) associated with IFN-γ production was found in male mice but not in female mice. This QTL was in the same location as a suggestive QTL for TNF-α and IL-6 production in male mice suggesting a common control of these pro-inflammatory cytokines. A second QTL was identified on chromosome 4 (TM4) affecting worm burden in both male and female cohorts. We have identified several genes as potential candidates for modifying responses to T. muris infection. We have used the largest mammalian genetic model system, the BXD mouse population, to identify candidate genes with sex-specific effects in immune responses to T. muris infection. Some of these genes may be differentially expressed in male and female mice leading to the difference in immune response between the sexes reported in previous studies. Our study further highlights the importance of considering sex as an important factor in investigations of immune response at the genome-wide level, in particular the bias that can be introduced when generalizing results obtained from only one sex or a mixed sex population. Rather, analyses of interaction effects between sex and genotype should be part of future studies.

Transcription Factor Binding Site Enrichment Analysis in Co-Expression Modules in Celiac Disease

PubMed Central

Romero-Garmendia, Irati; Jauregi-Miguel, Amaia; Plaza-Izurieta, Leticia; Cros, Marie-Pierre; Legarda, Maria; Irastorza, Iñaki; Herceg, Zdenko; Fernandez-Jimenez, Nora

2018-01-01

The aim of this study was to construct celiac co-expression patterns at a whole genome level and to identify transcription factors (TFs) that could drive the gliadin-related changes in coordination of gene expression observed in celiac disease (CD). Differential co-expression modules were identified in the acute and chronic responses to gliadin using expression data from a previous microarray study in duodenal biopsies. Transcription factor binding site (TFBS) and Gene Ontology (GO) annotation enrichment analyses were performed in differentially co-expressed genes (DCGs) and selection of candidate regulators was performed. Expression of candidates was measured in clinical samples and the activation of the TFs was further characterized in C2BBe1 cells upon gliadin challenge. Enrichment analyses of the DCGs identified 10 TFs and five were selected for further investigation. Expression changes related to active CD were detected in four TFs, as well as in several of their in silico predicted targets. The activation of TFs was further characterized in C2BBe1 cells upon gliadin challenge, and an increase in nuclear translocation of CAMP Responsive Element Binding Protein 1 (CREB1) and IFN regulatory factor-1 (IRF1) in response to gliadin was observed. Using transcriptome-wide co-expression analyses we are able to propose novel genes involved in CD pathogenesis that respond upon gliadin stimulation, also in non-celiac models. PMID:29748492

Transcription Factor Binding Site Enrichment Analysis in Co-Expression Modules in Celiac Disease.

PubMed

Romero-Garmendia, Irati; Garcia-Etxebarria, Koldo; Hernandez-Vargas, Hector; Santin, Izortze; Jauregi-Miguel, Amaia; Plaza-Izurieta, Leticia; Cros, Marie-Pierre; Legarda, Maria; Irastorza, Iñaki; Herceg, Zdenko; Fernandez-Jimenez, Nora; Bilbao, Jose Ramon

2018-05-10

The aim of this study was to construct celiac co-expression patterns at a whole genome level and to identify transcription factors (TFs) that could drive the gliadin-related changes in coordination of gene expression observed in celiac disease (CD). Differential co-expression modules were identified in the acute and chronic responses to gliadin using expression data from a previous microarray study in duodenal biopsies. Transcription factor binding site (TFBS) and Gene Ontology (GO) annotation enrichment analyses were performed in differentially co-expressed genes (DCGs) and selection of candidate regulators was performed. Expression of candidates was measured in clinical samples and the activation of the TFs was further characterized in C2BBe1 cells upon gliadin challenge. Enrichment analyses of the DCGs identified 10 TFs and five were selected for further investigation. Expression changes related to active CD were detected in four TFs, as well as in several of their in silico predicted targets. The activation of TFs was further characterized in C2BBe1 cells upon gliadin challenge, and an increase in nuclear translocation of CAMP Responsive Element Binding Protein 1 (CREB1) and IFN regulatory factor-1 (IRF1) in response to gliadin was observed. Using transcriptome-wide co-expression analyses we are able to propose novel genes involved in CD pathogenesis that respond upon gliadin stimulation, also in non-celiac models.

Identifying signatures of natural selection in Tibetan and Andean populations using dense genome scan data.

PubMed

Bigham, Abigail; Bauchet, Marc; Pinto, Dalila; Mao, Xianyun; Akey, Joshua M; Mei, Rui; Scherer, Stephen W; Julian, Colleen G; Wilson, Megan J; López Herráez, David; Brutsaert, Tom; Parra, Esteban J; Moore, Lorna G; Shriver, Mark D

2010-09-09

High-altitude hypoxia (reduced inspired oxygen tension due to decreased barometric pressure) exerts severe physiological stress on the human body. Two high-altitude regions where humans have lived for millennia are the Andean Altiplano and the Tibetan Plateau. Populations living in these regions exhibit unique circulatory, respiratory, and hematological adaptations to life at high altitude. Although these responses have been well characterized physiologically, their underlying genetic basis remains unknown. We performed a genome scan to identify genes showing evidence of adaptation to hypoxia. We looked across each chromosome to identify genomic regions with previously unknown function with respect to altitude phenotypes. In addition, groups of genes functioning in oxygen metabolism and sensing were examined to test the hypothesis that particular pathways have been involved in genetic adaptation to altitude. Applying four population genetic statistics commonly used for detecting signatures of natural selection, we identified selection-nominated candidate genes and gene regions in these two populations (Andeans and Tibetans) separately. The Tibetan and Andean patterns of genetic adaptation are largely distinct from one another, with both populations showing evidence of positive natural selection in different genes or gene regions. Interestingly, one gene previously known to be important in cellular oxygen sensing, EGLN1 (also known as PHD2), shows evidence of positive selection in both Tibetans and Andeans. However, the pattern of variation for this gene differs between the two populations. Our results indicate that several key HIF-regulatory and targeted genes are responsible for adaptation to high altitude in Andeans and Tibetans, and several different chromosomal regions are implicated in the putative response to selection. These data suggest a genetic role in high-altitude adaption and provide a basis for future genotype/phenotype association studies necessary to confirm the role of selection-nominated candidate genes and gene regions in adaptation to altitude.

Identifying Signatures of Natural Selection in Tibetan and Andean Populations Using Dense Genome Scan Data

PubMed Central

Bigham, Abigail; Bauchet, Marc; Pinto, Dalila; Mao, Xianyun; Akey, Joshua M.; Mei, Rui; Scherer, Stephen W.; Julian, Colleen G.; Wilson, Megan J.; López Herráez, David; Brutsaert, Tom; Parra, Esteban J.; Moore, Lorna G.; Shriver, Mark D.

2010-01-01

High-altitude hypoxia (reduced inspired oxygen tension due to decreased barometric pressure) exerts severe physiological stress on the human body. Two high-altitude regions where humans have lived for millennia are the Andean Altiplano and the Tibetan Plateau. Populations living in these regions exhibit unique circulatory, respiratory, and hematological adaptations to life at high altitude. Although these responses have been well characterized physiologically, their underlying genetic basis remains unknown. We performed a genome scan to identify genes showing evidence of adaptation to hypoxia. We looked across each chromosome to identify genomic regions with previously unknown function with respect to altitude phenotypes. In addition, groups of genes functioning in oxygen metabolism and sensing were examined to test the hypothesis that particular pathways have been involved in genetic adaptation to altitude. Applying four population genetic statistics commonly used for detecting signatures of natural selection, we identified selection-nominated candidate genes and gene regions in these two populations (Andeans and Tibetans) separately. The Tibetan and Andean patterns of genetic adaptation are largely distinct from one another, with both populations showing evidence of positive natural selection in different genes or gene regions. Interestingly, one gene previously known to be important in cellular oxygen sensing, EGLN1 (also known as PHD2), shows evidence of positive selection in both Tibetans and Andeans. However, the pattern of variation for this gene differs between the two populations. Our results indicate that several key HIF-regulatory and targeted genes are responsible for adaptation to high altitude in Andeans and Tibetans, and several different chromosomal regions are implicated in the putative response to selection. These data suggest a genetic role in high-altitude adaption and provide a basis for future genotype/phenotype association studies necessary to confirm the role of selection-nominated candidate genes and gene regions in adaptation to altitude. PMID:20838600

Filling gaps in PPAR-alpha signaling through comparative nutrigenomics analysis.

PubMed

Cavalieri, Duccio; Calura, Enrica; Romualdi, Chiara; Marchi, Emmanuela; Radonjic, Marijana; Van Ommen, Ben; Müller, Michael

2009-12-11

The application of high-throughput genomic tools in nutrition research is a widespread practice. However, it is becoming increasingly clear that the outcome of individual expression studies is insufficient for the comprehensive understanding of such a complex field. Currently, the availability of the large amounts of expression data in public repositories has opened up new challenges on microarray data analyses. We have focused on PPARalpha, a ligand-activated transcription factor functioning as fatty acid sensor controlling the gene expression regulation of a large set of genes in various metabolic organs such as liver, small intestine or heart. The function of PPARalpha is strictly connected to the function of its target genes and, although many of these have already been identified, major elements of its physiological function remain to be uncovered. To further investigate the function of PPARalpha, we have applied a cross-species meta-analysis approach to integrate sixteen microarray datasets studying high fat diet and PPARalpha signal perturbations in different organisms. We identified 164 genes (MDEGs) that were differentially expressed in a constant way in response to a high fat diet or to perturbations in PPARs signalling. In particular, we found five genes in yeast which were highly conserved and homologous of PPARalpha targets in mammals, potential candidates to be used as models for the equivalent mammalian genes. Moreover, a screening of the MDEGs for all known transcription factor binding sites and the comparison with a human genome-wide screening of Peroxisome Proliferating Response Elements (PPRE), enabled us to identify, 20 new potential candidate genes that show, both binding site, both change in expression in the condition studied. Lastly, we found a non random localization of the differentially expressed genes in the genome. The results presented are potentially of great interest to resume the currently available expression data, exploiting the power of in silico analysis filtered by evolutionary conservation. The analysis enabled us to indicate potential gene candidates that could fill in the gaps with regards to the signalling of PPARalpha and, moreover, the non-random localization of the differentially expressed genes in the genome, suggest that epigenetic mechanisms are of importance in the regulation of the transcription operated by PPARalpha.

Characterization of the acute heat stress response in gilts: III. Genome-wide association studies of thermotolerance traits in pigs.

PubMed

Kim, Kwan-Suk; Seibert, Jacob T; Edea, Zewde; Graves, Kody L; Kim, Eui-Soo; Keating, Aileen F; Baumgard, Lance H; Ross, Jason W; Rothschild, Max F

2018-06-04

Heat stress is one of the limiting factors negatively affecting pig production, health, and fertility. Characterizing genomic regions responsible for variation in HS tolerance would be useful in identifying important genetic factor(s) regulating physiological responses to HS. In the present study, we performed genome-wide association analyses for respiration rate (RR), rectal temperature (TR), and skin temperature (TS) during HS in 214 crossbred gilts genotyped for 68,549 single nucleotide polymorphisms (SNP) using the Porcine SNP 70K BeadChip. Considering the top 0.1% smoothed phenotypic variances explained by SNP windows, we detected 26, 26, 21, and 14 genes that reside within SNPs explaining the largest proportion of variance (top 25 SNP windows) and associated with change in RR (ΔRR) from thermoneutral (TN) conditions to HS environment, as well as the change in prepubertal TR (ΔTR), change in postpubertal ΔTR, and change in TS (ΔTS), respectively. The region between 28.85 Mb and 29.10 Mb on chromosome 16 explained about 0.05% of the observed variation for ΔRR. The growth hormone receptor (GHR) gene resides in this region and is associated with the HS response. The other important candidate genes associated with ΔRR (PAIP1, NNT, and TEAD4), ΔTR (LIMS2, TTR, and TEAD4), and ΔTS (ERBB4, FKBP1B, NFATC2, and ATP9A) have reported roles in the cellular stress response. The SNP explaining the largest proportion of variance and located within and in the vicinity of genes were related to apoptosis or cellular stress and are potential candidates that underlie the physiological response to HS in pigs.

Genome-wide identification, phylogeny, and expression analysis of the SWEET gene family in tomato.

PubMed

Feng, Chao-Yang; Han, Jia-Xuan; Han, Xiao-Xue; Jiang, Jing

2015-12-01

The SWEET (Sugars Will Eventually Be Exported Transporters) gene family encodes membrane-embedded sugar transporters containing seven transmembrane helices harboring two MtN3 and saliva domain. SWEETs play important roles in diverse biological processes, including plant growth, development, and response to environmental stimuli. Here, we conducted an exhaustive search of the tomato genome, leading to the identification of 29 SWEET genes. We analyzed the structures, conserved domains, and phylogenetic relationships of these protein-coding genes in detail. We also analyzed the transcript levels of SWEET genes in various tissues, organs, and developmental stages to obtain information about their functions. Furthermore, we investigated the expression patterns of the SWEET genes in response to exogenous sugar and adverse environmental stress (high and low temperatures). Some family members exhibited tissue-specific expression, whereas others were more ubiquitously expressed. Numerous stress-responsive candidate genes were obtained. The results of this study provide insights into the characteristics of the SWEET genes in tomato and may serve as a basis for further functional studies of such genes. Copyright © 2015 Elsevier B.V. All rights reserved.

Identifying candidate drivers of drug response in heterogeneous cancer by mining high throughput genomics data.

PubMed

Nabavi, Sheida

2016-08-15

With advances in technologies, huge amounts of multiple types of high-throughput genomics data are available. These data have tremendous potential to identify new and clinically valuable biomarkers to guide the diagnosis, assessment of prognosis, and treatment of complex diseases, such as cancer. Integrating, analyzing, and interpreting big and noisy genomics data to obtain biologically meaningful results, however, remains highly challenging. Mining genomics datasets by utilizing advanced computational methods can help to address these issues. To facilitate the identification of a short list of biologically meaningful genes as candidate drivers of anti-cancer drug resistance from an enormous amount of heterogeneous data, we employed statistical machine-learning techniques and integrated genomics datasets. We developed a computational method that integrates gene expression, somatic mutation, and copy number aberration data of sensitive and resistant tumors. In this method, an integrative method based on module network analysis is applied to identify potential driver genes. This is followed by cross-validation and a comparison of the results of sensitive and resistance groups to obtain the final list of candidate biomarkers. We applied this method to the ovarian cancer data from the cancer genome atlas. The final result contains biologically relevant genes, such as COL11A1, which has been reported as a cis-platinum resistant biomarker for epithelial ovarian carcinoma in several recent studies. The described method yields a short list of aberrant genes that also control the expression of their co-regulated genes. The results suggest that the unbiased data driven computational method can identify biologically relevant candidate biomarkers. It can be utilized in a wide range of applications that compare two conditions with highly heterogeneous datasets.

Google Goes Cancer: Improving Outcome Prediction for Cancer Patients by Network-Based Ranking of Marker Genes

PubMed Central

Roy, Janine; Aust, Daniela; Knösel, Thomas; Rümmele, Petra; Jahnke, Beatrix; Hentrich, Vera; Rückert, Felix; Niedergethmann, Marco; Weichert, Wilko; Bahra, Marcus; Schlitt, Hans J.; Settmacher, Utz; Friess, Helmut; Büchler, Markus; Saeger, Hans-Detlev; Schroeder, Michael; Pilarsky, Christian; Grützmann, Robert

2012-01-01

Predicting the clinical outcome of cancer patients based on the expression of marker genes in their tumors has received increasing interest in the past decade. Accurate predictors of outcome and response to therapy could be used to personalize and thereby improve therapy. However, state of the art methods used so far often found marker genes with limited prediction accuracy, limited reproducibility, and unclear biological relevance. To address this problem, we developed a novel computational approach to identify genes prognostic for outcome that couples gene expression measurements from primary tumor samples with a network of known relationships between the genes. Our approach ranks genes according to their prognostic relevance using both expression and network information in a manner similar to Google's PageRank. We applied this method to gene expression profiles which we obtained from 30 patients with pancreatic cancer, and identified seven candidate marker genes prognostic for outcome. Compared to genes found with state of the art methods, such as Pearson correlation of gene expression with survival time, we improve the prediction accuracy by up to 7%. Accuracies were assessed using support vector machine classifiers and Monte Carlo cross-validation. We then validated the prognostic value of our seven candidate markers using immunohistochemistry on an independent set of 412 pancreatic cancer samples. Notably, signatures derived from our candidate markers were independently predictive of outcome and superior to established clinical prognostic factors such as grade, tumor size, and nodal status. As the amount of genomic data of individual tumors grows rapidly, our algorithm meets the need for powerful computational approaches that are key to exploit these data for personalized cancer therapies in clinical practice. PMID:22615549

Whole genome analysis using Bayesian models to identify candidate genes for immune response to vaccination

USDA-ARS?s Scientific Manuscript database

This study identified genome regions associated with variation in immune response to vaccination against bovine viral diarrhea virus type 2 (BVDV 2) in American Angus calves. Calves were born in the spring or fall of 2006-2008 (n = 620). Two doses of modified live vaccine were administered three wee...

Updates on the COPD gene list

PubMed Central

Bossé, Yohan

2012-01-01

A genetic contribution to develop chronic obstructive pulmonary disease (COPD) is well established. However, the specific genes responsible for enhanced risk or host differences in susceptibility to smoke exposure remain poorly understood. The goal of this review is to provide a comprehensive literature overview on the genetics of COPD, highlight the most promising findings during the last few years, and ultimately provide an updated COPD gene list. Candidate gene studies on COPD and related phenotypes indexed in PubMed before January 5, 2012 are tabulated. An exhaustive list of publications for any given gene was looked for. This well-documented COPD candidate-gene list is expected to serve many purposes for future replication studies and meta-analyses as well as for reanalyzing collected genomic data in the field. In addition, this review summarizes recent genetic loci identified by genome-wide association studies on COPD, lung function, and related complications. Assembling resources, integrative genomic approaches, and large sample sizes of well-phenotyped subjects is part of the path forward to elucidate the genetic basis of this debilitating disease. PMID:23055711

Comprehensive analysis of alternative splicing and functionality in neuronal differentiation of P19 cells.

PubMed

Suzuki, Hitoshi; Osaki, Ken; Sano, Kaori; Alam, A H M Khurshid; Nakamura, Yuichiro; Ishigaki, Yasuhito; Kawahara, Kozo; Tsukahara, Toshifumi

2011-02-18

Alternative splicing, which produces multiple mRNAs from a single gene, occurs in most human genes and contributes to protein diversity. Many alternative isoforms are expressed in a spatio-temporal manner, and function in diverse processes, including in the neural system. The purpose of the present study was to comprehensively investigate neural-splicing using P19 cells. GeneChip Exon Array analysis was performed using total RNAs purified from cells during neuronal cell differentiation. To efficiently and readily extract the alternative exon candidates, 9 filtering conditions were prepared, yielding 262 candidate exons (236 genes). Semiquantitative RT-PCR results in 30 randomly selected candidates suggested that 87% of the candidates were differentially alternatively spliced in neuronal cells compared to undifferentiated cells. Gene ontology and pathway analyses suggested that many of the candidate genes were associated with neural events. Together with 66 genes whose functions in neural cells or organs were reported previously, 47 candidate genes were found to be linked to 189 events in the gene-level profile of neural differentiation. By text-mining for the alternative isoform, distinct functions of the isoforms of 9 candidate genes indicated by the result of Exon Array were confirmed. Alternative exons were successfully extracted. Results from the informatics analyses suggested that neural events were primarily governed by genes whose expression was increased and whose transcripts were differentially alternatively spliced in the neuronal cells. In addition to known functions in neural cells or organs, the uninvestigated alternative splicing events of 11 genes among 47 candidate genes suggested that cell cycle events are also potentially important. These genes may help researchers to differentiate the roles of alternative splicing in cell differentiation and cell proliferation.

Transcriptome analysis of nitric oxide-responsive genes in upland cotton (Gossypium hirsutum).

PubMed

Huang, Juan; Wei, Hengling; Li, Libei; Yu, Shuxun

2018-01-01

Nitric oxide (NO) is an important signaling molecule with diverse physiological functions in plants. It is therefore important to characterize the downstream genes and signal transduction networks modulated by NO. Here, we identified 1,932 differentially expressed genes (DEGs) responding to NO in upland cotton using high throughput tag sequencing. The results of quantitative real-time polymerase chain reaction (qRT-PCR) analysis of 25 DEGs showed good consistency. Gene Ontology (GO) and KEGG pathway were analyzed to gain a better understanding of these DEGs. We identified 157 DEGs belonging to 36 transcription factor (TF) families and 72 DEGs related to eight plant hormones, among which several TF families and hormones were involved in stress responses. Hydrogen peroxide and malondialdehyde (MDA) contents were increased, as well related genes after treatment with sodium nitroprusside (SNP) (an NO donor), suggesting a role for NO in the plant stress response. Finally, we compared of the current and previous data indicating a massive number of NO-responsive genes at the large-scale transcriptome level. This study evaluated the landscape of NO-responsive genes in cotton and identified the involvement of NO in the stress response. Some of the identified DEGs represent good candidates for further functional analysis in cotton.

Comparison of gene co-networks reveals the molecular mechanisms of the rice (Oryza sativa L.) response to Rhizoctonia solani AG1 IA infection.

PubMed

Zhang, Jinfeng; Zhao, Wenjuan; Fu, Rong; Fu, Chenglin; Wang, Lingxia; Liu, Huainian; Li, Shuangcheng; Deng, Qiming; Wang, Shiquan; Zhu, Jun; Liang, Yueyang; Li, Ping; Zheng, Aiping

2018-05-05

Rhizoctonia solani causes rice sheath blight, an important disease affecting the growth of rice (Oryza sativa L.). Attempts to control the disease have met with little success. Based on transcriptional profiling, we previously identified more than 11,947 common differentially expressed genes (TPM > 10) between the rice genotypes TeQing and Lemont. In the current study, we extended these findings by focusing on an analysis of gene co-expression in response to R. solani AG1 IA and identified gene modules within the networks through weighted gene co-expression network analysis (WGCNA). We compared the different genes assigned to each module and the biological interpretations of gene co-expression networks at early and later modules in the two rice genotypes to reveal differential responses to AG1 IA. Our results show that different changes occurred in the two rice genotypes and that the modules in the two groups contain a number of candidate genes possibly involved in pathogenesis, such as the VQ protein. Furthermore, these gene co-expression networks provide comprehensive transcriptional information regarding gene expression in rice in response to AG1 IA. The co-expression networks derived from our data offer ideas for follow-up experimentation that will help advance our understanding of the translational regulation of rice gene expression changes in response to AG1 IA.

Genome-Wide Association Mapping Combined with Reverse Genetics Identifies New Effectors of Low Water Potential-Induced Proline Accumulation in Arabidopsis1[W][OPEN

PubMed Central

Verslues, Paul E.; Lasky, Jesse R.; Juenger, Thomas E.; Liu, Tzu-Wen; Kumar, M. Nagaraj

2014-01-01

Arabidopsis (Arabidopsis thaliana) exhibits natural genetic variation in drought response, including varying levels of proline (Pro) accumulation under low water potential. As Pro accumulation is potentially important for stress tolerance and cellular redox control, we conducted a genome-wide association (GWAS) study of low water potential-induced Pro accumulation using a panel of natural accessions and publicly available single-nucleotide polymorphism (SNP) data sets. Candidate genomic regions were prioritized for subsequent study using metrics considering both the strength and spatial clustering of the association signal. These analyses found many candidate regions likely containing gene(s) influencing Pro accumulation. Reverse genetic analysis of several candidates identified new Pro effector genes, including thioredoxins and several genes encoding Universal Stress Protein A domain proteins. These new Pro effector genes further link Pro accumulation to cellular redox and energy status. Additional new Pro effector genes found include the mitochondrial protease LON1, ribosomal protein RPL24A, protein phosphatase 2A subunit A3, a MADS box protein, and a nucleoside triphosphate hydrolase. Several of these new Pro effector genes were from regions with multiple SNPs, each having moderate association with Pro accumulation. This pattern supports the use of summary approaches that incorporate clusters of SNP associations in addition to consideration of individual SNP probability values. Further GWAS-guided reverse genetics promises to find additional effectors of Pro accumulation. The combination of GWAS and reverse genetics to efficiently identify new effector genes may be especially applicable for traits difficult to analyze by other genetic screening methods. PMID:24218491

Evaluation of the tobacco heating system 2.2. Part 9: Application of systems pharmacology to identify exposure response markers in peripheral blood of smokers switching to THS2.2.

PubMed

Martin, Florian; Talikka, Marja; Ivanov, Nikolai V; Haziza, Christelle; Hoeng, Julia; Peitsch, Manuel C

2016-11-30

As part of current harm reduction strategies, candidate modified risk tobacco products (MRTP) are developed to offer adult smokers who want to continue using tobacco product an alternative to cigarettes while potentially reducing individual risk and population harm compared to smoking cigarettes. One of these candidate MRTPs is the Tobacco Heating System (THS) 2.2 which does not burn tobacco, but instead heats it, thus producing significantly reduced levels of harmful and potentially harmful constituents (HPHC) compared with combustible cigarettes (CC). A controlled, parallel group, open-label clinical study was conducted with subjects randomized to three monitored groups: (1) switching from CCs to THS2.2; (2) continuous use of non-menthol CC brand (CC arm); or (3) smoking abstinence (SA arm) for five days. Exposure response was assessed by measuring biomarkers of exposure to selected HPHCs. To complement the classical exposure response measurements, we have used the previously reported whole blood derived gene signature that can distinguish current smokers from either non-smokers or former smokers with high specificity and sensitivity. We tested the small signature consisting of only 11 genes on the blood transcriptome of subjects enrolled in the clinical study and showed a reduced exposure response in subjects that either stopped smoking or switched to a candidate MRTP, the THS2.2, compared with subjects who continued smoking their regular tobacco product. Copyright © 2016. Published by Elsevier Inc.

Convergence of GWA and candidate gene studies for alcoholism

PubMed Central

Olfson, Emily; Bierut, Laura Jean

2012-01-01

Background Genome-wide association (GWA) studies have led to a paradigm shift in how researchers study the genetics underlying disease. Many GWA studies are now publicly available and can be used to examine whether or not previously proposed candidate genes are supported by GWA data. This approach is particularly important for the field of alcoholism because the contribution of many candidate genes remains controversial. Methods Using the Human Genome Epidemiology (HuGE) Navigator, we selected candidate genes for alcoholism that have been frequently examined in scientific articles in the past decade. Specific candidate loci as well as all the reported SNPs in candidate genes were examined in the Study of Alcohol Addiction: Genetics and Addiction (SAGE), a GWA study comparing alcohol dependent and non-dependent subjects. Results Several commonly reported candidate loci, including rs1800497 in DRD2, rs698 in ADH1C, rs1799971 in OPRM1 and rs4680 in COMT, are not replicated in SAGE (p> .05). Among candidate loci available for analysis, only rs279858 in GABRA2 (p=0.0052, OR=1.16) demonstrated a modest association. Examination of all SNPs reported in SAGE in over 50 candidate genes revealed no SNPs with large frequency differences between cases and controls and the lowest p value of any SNP was .0006. Discussion We provide evidence that several extensively studied candidate loci do not have a strong contribution to risk of developing alcohol dependence in European and African Ancestry populations. Due to lack of coverage, we were unable to rule out the contribution of other variants and these genes and particular loci warrant further investigation. Our analysis demonstrates that publicly available GWA results can be used to better understand which if any of previously proposed candidate genes contribute to disease. Furthermore, we illustrate how examining the convergence of candidate gene and GWA studies can help elucidate the genetic architecture of alcoholism and more generally complex diseases. PMID:22978509

Exome-based analysis of cardiac arrhythmia, respiratory control, and epilepsy genes in sudden unexpected death in epilepsy.

PubMed

Bagnall, Richard D; Crompton, Douglas E; Petrovski, Slavé; Lam, Lien; Cutmore, Carina; Garry, Sarah I; Sadleir, Lynette G; Dibbens, Leanne M; Cairns, Anita; Kivity, Sara; Afawi, Zaid; Regan, Brigid M; Duflou, Johan; Berkovic, Samuel F; Scheffer, Ingrid E; Semsarian, Christopher

2016-04-01

The leading cause of epilepsy-related premature mortality is sudden unexpected death in epilepsy (SUDEP). The cause of SUDEP remains unknown. To search for genetic risk factors in SUDEP cases, we performed an exome-based analysis of rare variants. Demographic and clinical information of 61 SUDEP cases were collected. Exome sequencing and rare variant collapsing analysis with 2,936 control exomes were performed to test for genes enriched with damaging variants. Additionally, cardiac arrhythmia, respiratory control, and epilepsy genes were screened for variants with frequency of <0.1% and predicted to be pathogenic with multiple in silico tools. The 61 SUDEP cases were categorized as definite SUDEP (n = 54), probable SUDEP (n = 5), and definite SUDEP plus (n = 2). We identified de novo mutations, previously reported pathogenic mutations, or candidate pathogenic variants in 28 of 61 (46%) cases. Four SUDEP cases (7%) had mutations in common genes responsible for the cardiac arrhythmia disease, long QT syndrome (LQTS). Nine cases (15%) had candidate pathogenic variants in dominant cardiac arrhythmia genes. Fifteen cases (25%) had mutations or candidate pathogenic variants in dominant epilepsy genes. No gene reached genome-wide significance with rare variant collapsing analysis; however, DEPDC5 (p = 0.00015) and KCNH2 (p = 0.0037) were among the top 30 genes, genome-wide. A sizeable proportion of SUDEP cases have clinically relevant mutations in cardiac arrhythmia and epilepsy genes. In cases with an LQTS gene mutation, SUDEP may occur as a result of a predictable and preventable cause. Understanding the genetic basis of SUDEP may inform cascade testing of at-risk family members. © 2016 American Neurological Association.

Extra Large G-Protein Interactome Reveals Multiple Stress Response Function and Partner-Dependent XLG Subcellular Localization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liang, Ying; Gao, Yajun; Jones, Alan M.

The three-member family of Arabidopsis extra-large G proteins (XLG1-3) defines the prototype of an atypical Ga subunit in the heterotrimeric G protein complex. Some recent evidence indicate that XLG subunits operate along with its Gbg dimer in root morphology, stress responsiveness, and cytokinin induced development, however downstream targets of activated XLG proteins in the stress pathways are rarely known. In order to assemble a set of candidate XLG-targeted proteins, a yeast two-hybrid complementation-based screen was performed using XLG protein baits to query interactions between XLG and partner protein found in glucose-treated seedlings, roots, and Arabidopsis cells in culture. Seventy twomore » interactors were identified and >60% of a test set displayed in vivo interaction with XLG proteins. Gene co-expression analysis shows that >70% of the interactors are positively correlated with the corresponding XLG partners. Gene Ontology enrichment for all the candidates indicates stress responses and posits a molecular mechanism involving a specific set of transcription factor partners to XLG. Genes encoding two of these transcription factors, SZF1 and 2, require XLG proteins for full NaCl-induced expression. Furthermore, the subcellular localization of the XLG proteins in the nucleus, endosome, and plasma membrane is dependent on the specific interacting partner.« less

Extra Large G-Protein Interactome Reveals Multiple Stress Response Function and Partner-Dependent XLG Subcellular Localization

DOE PAGES

Liang, Ying; Gao, Yajun; Jones, Alan M.

2017-06-13

The three-member family of Arabidopsis extra-large G proteins (XLG1-3) defines the prototype of an atypical Ga subunit in the heterotrimeric G protein complex. Some recent evidence indicate that XLG subunits operate along with its Gbg dimer in root morphology, stress responsiveness, and cytokinin induced development, however downstream targets of activated XLG proteins in the stress pathways are rarely known. In order to assemble a set of candidate XLG-targeted proteins, a yeast two-hybrid complementation-based screen was performed using XLG protein baits to query interactions between XLG and partner protein found in glucose-treated seedlings, roots, and Arabidopsis cells in culture. Seventy twomore » interactors were identified and >60% of a test set displayed in vivo interaction with XLG proteins. Gene co-expression analysis shows that >70% of the interactors are positively correlated with the corresponding XLG partners. Gene Ontology enrichment for all the candidates indicates stress responses and posits a molecular mechanism involving a specific set of transcription factor partners to XLG. Genes encoding two of these transcription factors, SZF1 and 2, require XLG proteins for full NaCl-induced expression. Furthermore, the subcellular localization of the XLG proteins in the nucleus, endosome, and plasma membrane is dependent on the specific interacting partner.« less

Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq

PubMed Central

Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

2018-01-01

Flax (Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits. PMID:29375606

Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq.

PubMed

Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

2017-01-01

Flax ( Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

Identifying ultrasensitive HGF dose-response functions in a 3D mammalian system for synthetic morphogenesis.

PubMed

Senthivel, Vivek Raj; Sturrock, Marc; Piedrafita, Gabriel; Isalan, Mark

2016-12-16

Nonlinear responses to signals are widespread natural phenomena that affect various cellular processes. Nonlinearity can be a desirable characteristic for engineering living organisms because it can lead to more switch-like responses, similar to those underlying the wiring in electronics. Steeper functions are described as ultrasensitive, and can be applied in synthetic biology by using various techniques including receptor decoys, multiple co-operative binding sites, and sequential positive feedbacks. Here, we explore the inherent non-linearity of a biological signaling system to identify functions that can potentially be exploited using cell genome engineering. For this, we performed genome-wide transcription profiling to identify genes with ultrasensitive response functions to Hepatocyte Growth Factor (HGF). We identified 3,527 genes that react to increasing concentrations of HGF, in Madin-Darby canine kidney (MDCK) cells, grown as cysts in 3D collagen cell culture. By fitting a generic Hill function to the dose-responses of these genes we obtained a measure of the ultrasensitivity of HGF-responsive genes, identifying a subset with higher apparent Hill coefficients (e.g. MMP1, TIMP1, SNORD75, SNORD86 and ERRFI1). The regulatory regions of these genes are potential candidates for future engineering of synthetic mammalian gene circuits requiring nonlinear responses to HGF signalling.

Identification of putative QTLs for seedling stage phosphorus starvation response in finger millet (Eleusine coracana L. Gaertn.) by association mapping and cross species synteny analysis

PubMed Central

Ramakrishnan, M.; Ceasar, S. Antony; Vinod, K. K.; Duraipandiyan, V.; Ajeesh Krishna, T. P.; Upadhyaya, Hari D.; Al-Dhabi, N. A.

2017-01-01

A germplasm assembly of 128 finger millet genotypes from 18 countries was evaluated for seedling-stage phosphorus (P) responses by growing them in P sufficient (Psuf) and P deficient (Pdef) treatments. Majority of the genotypes showed adaptive responses to low P condition. Based on phenotype behaviour using the best linear unbiased predictors for each trait, genotypes were classified into, P responsive, low P tolerant and P non-responsive types. Based on the overall phenotype performance under Pdef, 10 genotypes were identified as low P tolerants. The low P tolerant genotypes were characterised by increased shoot and root length and increased root hair induction with longer root hairs under Pdef, than under Psuf. Association mapping of P response traits using mixed linear models revealed four quantitative trait loci (QTLs). Two QTLs (qLRDW.1 and qLRDW.2) for low P response affecting root dry weight explained over 10% phenotypic variation. In silico synteny analysis across grass genomes for these QTLs identified putative candidate genes such as Ser-Thr kinase and transcription factors such as WRKY and basic helix-loop-helix (bHLH). The QTLs for response under Psuf were mapped for traits such as shoot dry weight (qHSDW.1) and root length (qHRL.1). Putative associations of these QTLs over the syntenous regions on the grass genomes revealed proximity to cytochrome P450, phosphate transporter and pectin methylesterase inhibitor (PMEI) genes. This is the first report of the extent of phenotypic variability for P response in finger millet genotypes during seedling-stage, along with the QTLs and putative candidate genes associated with P starvation tolerance. PMID:28820887

Identification of putative QTLs for seedling stage phosphorus starvation response in finger millet (Eleusine coracana L. Gaertn.) by association mapping and cross species synteny analysis.

PubMed

Ramakrishnan, M; Ceasar, S Antony; Vinod, K K; Duraipandiyan, V; Ajeesh Krishna, T P; Upadhyaya, Hari D; Al-Dhabi, N A; Ignacimuthu, S

2017-01-01

A germplasm assembly of 128 finger millet genotypes from 18 countries was evaluated for seedling-stage phosphorus (P) responses by growing them in P sufficient (Psuf) and P deficient (Pdef) treatments. Majority of the genotypes showed adaptive responses to low P condition. Based on phenotype behaviour using the best linear unbiased predictors for each trait, genotypes were classified into, P responsive, low P tolerant and P non-responsive types. Based on the overall phenotype performance under Pdef, 10 genotypes were identified as low P tolerants. The low P tolerant genotypes were characterised by increased shoot and root length and increased root hair induction with longer root hairs under Pdef, than under Psuf. Association mapping of P response traits using mixed linear models revealed four quantitative trait loci (QTLs). Two QTLs (qLRDW.1 and qLRDW.2) for low P response affecting root dry weight explained over 10% phenotypic variation. In silico synteny analysis across grass genomes for these QTLs identified putative candidate genes such as Ser-Thr kinase and transcription factors such as WRKY and basic helix-loop-helix (bHLH). The QTLs for response under Psuf were mapped for traits such as shoot dry weight (qHSDW.1) and root length (qHRL.1). Putative associations of these QTLs over the syntenous regions on the grass genomes revealed proximity to cytochrome P450, phosphate transporter and pectin methylesterase inhibitor (PMEI) genes. This is the first report of the extent of phenotypic variability for P response in finger millet genotypes during seedling-stage, along with the QTLs and putative candidate genes associated with P starvation tolerance.

Genome-wide association study identified genetic variations and candidate genes for plant architecture component traits in Chinese upland cotton.

PubMed

Su, Junji; Li, Libei; Zhang, Chi; Wang, Caixiang; Gu, Lijiao; Wang, Hantao; Wei, Hengling; Liu, Qibao; Huang, Long; Yu, Shuxun

2018-06-01

Thirty significant associations between 22 SNPs and five plant architecture component traits in Chinese upland cotton were identified via GWAS. Four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits. A candidate gene, Gh_D03G0922, might be responsible for plant height in upland cotton. A compact plant architecture is increasingly required for mechanized harvesting processes in China. Therefore, cotton plant architecture is an important trait, and its components, such as plant height, fruit branch length and fruit branch angle, affect the suitability of a cultivar for mechanized harvesting. To determine the genetic basis of cotton plant architecture, a genome-wide association study (GWAS) was performed using a panel composed of 355 accessions and 93,250 single nucleotide polymorphisms (SNPs) identified using the specific-locus amplified fragment sequencing method. Thirty significant associations between 22 SNPs and five plant architecture component traits were identified via GWAS. Most importantly, four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits, and these SNPs were harbored in one linkage disequilibrium block. Furthermore, 21 candidate genes for plant architecture were predicted in a 0.95-Mb region including the four peak SNPs. One of these genes (Gh_D03G0922) was near the significant SNP D03_31584163 (8.40 kb), and its Arabidopsis homologs contain MADS-box domains that might be involved in plant growth and development. qRT-PCR showed that the expression of Gh_D03G0922 was upregulated in the apical buds and young leaves of the short and compact cotton varieties, and virus-induced gene silencing (VIGS) proved that the silenced plants exhibited increased PH. These results indicate that Gh_D03G0922 is likely the candidate gene for PH in cotton. The genetic variations and candidate genes identified in this study lay a foundation for cultivating moderately short and compact varieties in future Chinese cotton-breeding programs.

Mapping by sequencing in cotton (Gossypium hirsutum) line MD52ne identified candidate genes for fiber strength and its related quality attributes.

PubMed

Islam, Md S; Zeng, Linghe; Thyssen, Gregory N; Delhom, Christopher D; Kim, Hee Jin; Li, Ping; Fang, David D

2016-06-01

Three QTL regions controlling three fiber quality traits were validated and further fine-mapped with 27 new single nucleotide polymorphism (SNP) markers. Transcriptome analysis suggests that receptor-like kinases found within the validated QTLs are potential candidate genes responsible for superior fiber strength in cotton line MD52ne. Fiber strength, length, maturity and fineness determine the market value of cotton fibers and the quality of spun yarn. Cotton fiber strength has been recognized as a critical quality attribute in the modern textile industry. Fine mapping along with quantitative trait loci (QTL) validation and candidate gene prediction can uncover the genetic and molecular basis of fiber quality traits. Four previously-identified QTLs (qFBS-c3, qSFI-c14, qUHML-c14 and qUHML-c24) related to fiber bundle strength, short fiber index and fiber length, respectively, were validated using an F3 population that originated from a cross of MD90ne × MD52ne. A group of 27 new SNP markers generated from mapping-by-sequencing (MBS) were placed in QTL regions to improve and validate earlier maps. Our refined QTL regions spanned 4.4, 1.8 and 3.7 Mb of physical distance in the Gossypium raimondii reference genome. We performed RNA sequencing (RNA-seq) of 15 and 20 days post-anthesis fiber cells from MD52ne and MD90ne and aligned reads to the G. raimondii genome. The QTL regions contained 21 significantly differentially expressed genes (DEGs) between the two near-isogenic parental lines. SNPs that result in non-synonymous substitutions to amino acid sequences of annotated genes were identified within these DEGs, and mapped. Taken together, transcriptome and amino acid mutation analysis indicate that receptor-like kinase pathway genes are likely candidates for superior fiber strength and length in MD52ne. MBS along with RNA-seq demonstrated a powerful strategy to elucidate candidate genes for the QTLs that control complex traits in a complex genome like tetraploid upland cotton.

Characterization of the canine desmin (DES) gene and evaluation as a candidate gene for dilated cardiomyopathy in the Dobermann.

PubMed

Stabej, Polona; Imholz, Sandra; Versteeg, Serge A; Zijlstra, Carla; Stokhof, Arnold A; Domanjko-Petric, Aleksandra; Leegwater, Peter A J; van Oost, Bernard A

2004-10-13

Canine-dilated cardiomyopathy (DCM) in dogs is a disease of the myocardium associated with dilatation and impaired contraction of the ventricles and is suspected to have a genetic cause. A missense mutation in the desmin gene (DES) causes DCM in a human family. Human DCM closely resembles the canine disease. In the present study, we evaluated whether DES gene mutations are responsible for DCM in Dobermann dogs. We have isolated bacterial artificial chromosome clones (BACs) containing the canine DES gene and determined the chromosomal location by fluorescence in situ hybridization (FISH). Using data deposited in the NCBI trace archive and GenBank, the canine DES gene DNA sequence was assembled and seven single nucleotide polymorphisms (SNPs) were identified. From the canine DES gene BAC clones, a polymorphic microsatellite marker was isolated. The microsatellite marker and four informative desmin SNPs were typed in a Dobermann family with frequent DCM occurrence, but the disease phenotype did not associate with a desmin haplotype. We concluded that mutations in the DES gene do not play a role in Dobermann DCM. Availability of the microsatellite marker, SNPs and DNA sequence reported in this study enable fast evaluation of the DES gene as a DCM candidate gene in other dog breeds with DCM occurrence.

A direct molecular link between the autism candidate gene RORa and the schizophrenia candidate MIR137

NASA Astrophysics Data System (ADS)

Devanna, Paolo; Vernes, Sonja C.

2014-02-01

Retinoic acid-related orphan receptor alpha gene (RORa) and the microRNA MIR137 have both recently been identified as novel candidate genes for neuropsychiatric disorders. RORa encodes a ligand-dependent orphan nuclear receptor that acts as a transcriptional regulator and miR-137 is a brain enriched small non-coding RNA that interacts with gene transcripts to control protein levels. Given the mounting evidence for RORa in autism spectrum disorders (ASD) and MIR137 in schizophrenia and ASD, we investigated if there was a functional biological relationship between these two genes. Herein, we demonstrate that miR-137 targets the 3'UTR of RORa in a site specific manner. We also provide further support for MIR137 as an autism candidate by showing that a large number of previously implicated autism genes are also putatively targeted by miR-137. This work supports the role of MIR137 as an ASD candidate and demonstrates a direct biological link between these previously unrelated autism candidate genes.

Candidate genes and molecular markers associated with heat tolerance in colonial Bentgrass.

PubMed

Jespersen, David; Belanger, Faith C; Huang, Bingru

2017-01-01

Elevated temperature is a major abiotic stress limiting the growth of cool-season grasses during the summer months. The objectives of this study were to determine the genetic variation in the expression patterns of selected genes involved in several major metabolic pathways regulating heat tolerance for two genotypes contrasting in heat tolerance to confirm their status as potential candidate genes, and to identify PCR-based markers associated with candidate genes related to heat tolerance in a colonial (Agrostis capillaris L.) x creeping bentgrass (Agrostis stolonifera L.) hybrid backcross population. Plants were subjected to heat stress in controlled-environmental growth chambers for phenotypic evaluation and determination of genetic variation in candidate gene expression. Molecular markers were developed for genes involved in protein degradation (cysteine protease), antioxidant defense (catalase and glutathione-S-transferase), energy metabolism (glyceraldehyde-3-phosphate dehydrogenase), cell expansion (expansin), and stress protection (heat shock proteins HSP26, HSP70, and HSP101). Kruskal-Wallis analysis, a commonly used non-parametric test used to compare population individuals with or without the gene marker, found the physiological traits of chlorophyll content, electrolyte leakage, normalized difference vegetative index, and turf quality were associated with all candidate gene markers with the exception of HSP101. Differential gene expression was frequently found for the tested candidate genes. The development of candidate gene markers for important heat tolerance genes may allow for the development of new cultivars with increased abiotic stress tolerance using marker-assisted selection.

Candidate genes and molecular markers associated with heat tolerance in colonial Bentgrass

PubMed Central

Jespersen, David; Belanger, Faith C.; Huang, Bingru

2017-01-01

Elevated temperature is a major abiotic stress limiting the growth of cool-season grasses during the summer months. The objectives of this study were to determine the genetic variation in the expression patterns of selected genes involved in several major metabolic pathways regulating heat tolerance for two genotypes contrasting in heat tolerance to confirm their status as potential candidate genes, and to identify PCR-based markers associated with candidate genes related to heat tolerance in a colonial (Agrostis capillaris L.) x creeping bentgrass (Agrostis stolonifera L.) hybrid backcross population. Plants were subjected to heat stress in controlled-environmental growth chambers for phenotypic evaluation and determination of genetic variation in candidate gene expression. Molecular markers were developed for genes involved in protein degradation (cysteine protease), antioxidant defense (catalase and glutathione-S-transferase), energy metabolism (glyceraldehyde-3-phosphate dehydrogenase), cell expansion (expansin), and stress protection (heat shock proteins HSP26, HSP70, and HSP101). Kruskal-Wallis analysis, a commonly used non-parametric test used to compare population individuals with or without the gene marker, found the physiological traits of chlorophyll content, electrolyte leakage, normalized difference vegetative index, and turf quality were associated with all candidate gene markers with the exception of HSP101. Differential gene expression was frequently found for the tested candidate genes. The development of candidate gene markers for important heat tolerance genes may allow for the development of new cultivars with increased abiotic stress tolerance using marker-assisted selection. PMID:28187136

Analysis of the QTL for sleep homeostasis in mice: Homer1a is a likely candidate.

PubMed

Mackiewicz, M; Paigen, B; Naidoo, N; Pack, A I

2008-03-14

Electroencephalographic oscillations in the frequency range of 0.5-4 Hz, characteristic of slow-wave sleep (SWS), are often referred to as the delta oscillation or delta power. Delta power reflects sleep intensity and correlates with the homeostatic response to sleep loss. A published survey of inbred strains of mice demonstrated that the time course of accumulation of delta power varied among inbred strains, and the segregation of the rebound of delta power in BxD recombinant inbred strains identified a genomic region on chromosome 13 referred to as the delta power in SWS (or Dps1). The quantitative trait locus (QTL) contains genes that modify the accumulation of delta power after sleep deprivation. Here, we narrow the QTL using interval-specific haplotype analysis and present a comprehensive annotation of the remaining genes in the Dps1 region with sequence comparisons to identify polymorphisms within the coding and regulatory regions. We established the expression pattern of selected genes located in the Dps1 interval in sleep and wakefulness in B6 and D2 parental strains. Taken together, these steps reduced the number of potential candidate genes that may underlie the accumulation of delta power after sleep deprivation and explain the Dps1 QTL. The strongest candidate gene is Homer1a, which is supported by expression differences between sleep and wakefulness and the SNP polymorphism in the upstream regulatory regions.

Integrative Transcriptomic Analysis Uncovers Novel Gene Modules That Underlie the Sulfate Response in Arabidopsis thaliana

PubMed Central

Henríquez-Valencia, Carlos; Arenas-M, Anita; Medina, Joaquín; Canales, Javier

2018-01-01

Sulfur is an essential nutrient for plant growth and development. Sulfur is a constituent of proteins, the plasma membrane and cell walls, among other important cellular components. To obtain new insights into the gene regulatory networks underlying the sulfate response, we performed an integrative meta-analysis of transcriptomic data from five different sulfate experiments available in public databases. This bioinformatic approach allowed us to identify a robust set of genes whose expression depends only on sulfate availability, indicating that those genes play an important role in the sulfate response. In relation to sulfate metabolism, the biological function of approximately 45% of these genes is currently unknown. Moreover, we found several consistent Gene Ontology terms related to biological processes that have not been extensively studied in the context of the sulfate response; these processes include cell wall organization, carbohydrate metabolism, nitrogen compound transport, and the regulation of proteolysis. Gene co-expression network analyses revealed relationships between the sulfate-responsive genes that were distributed among seven function-specific co-expression modules. The most connected genes in the sulfate co-expression network belong to a module related to the carbon response, suggesting that this biological function plays an important role in the control of the sulfate response. Temporal analyses of the network suggest that sulfate starvation generates a biphasic response, which involves that major changes in gene expression occur during both the early and late responses. Network analyses predicted that the sulfate response is regulated by a limited number of transcription factors, including MYBs, bZIPs, and NF-YAs. In conclusion, our analysis identified new candidate genes and provided new hypotheses to advance our understanding of the transcriptional regulation of sulfate metabolism in plants. PMID:29692794

Integrative Transcriptomic Analysis Uncovers Novel Gene Modules That Underlie the Sulfate Response in Arabidopsis thaliana.

PubMed

Henríquez-Valencia, Carlos; Arenas-M, Anita; Medina, Joaquín; Canales, Javier

2018-01-01

Sulfur is an essential nutrient for plant growth and development. Sulfur is a constituent of proteins, the plasma membrane and cell walls, among other important cellular components. To obtain new insights into the gene regulatory networks underlying the sulfate response, we performed an integrative meta-analysis of transcriptomic data from five different sulfate experiments available in public databases. This bioinformatic approach allowed us to identify a robust set of genes whose expression depends only on sulfate availability, indicating that those genes play an important role in the sulfate response. In relation to sulfate metabolism, the biological function of approximately 45% of these genes is currently unknown. Moreover, we found several consistent Gene Ontology terms related to biological processes that have not been extensively studied in the context of the sulfate response; these processes include cell wall organization, carbohydrate metabolism, nitrogen compound transport, and the regulation of proteolysis. Gene co-expression network analyses revealed relationships between the sulfate-responsive genes that were distributed among seven function-specific co-expression modules. The most connected genes in the sulfate co-expression network belong to a module related to the carbon response, suggesting that this biological function plays an important role in the control of the sulfate response. Temporal analyses of the network suggest that sulfate starvation generates a biphasic response, which involves that major changes in gene expression occur during both the early and late responses. Network analyses predicted that the sulfate response is regulated by a limited number of transcription factors, including MYBs, bZIPs, and NF-YAs. In conclusion, our analysis identified new candidate genes and provided new hypotheses to advance our understanding of the transcriptional regulation of sulfate metabolism in plants.

Tumour angiogenesis is reduced in the Tc1 mouse model of Down's syndrome.

PubMed

Reynolds, Louise E; Watson, Alan R; Baker, Marianne; Jones, Tania A; D'Amico, Gabriela; Robinson, Stephen D; Joffre, Carine; Garrido-Urbani, Sarah; Rodriguez-Manzaneque, Juan Carlos; Martino-Echarri, Estefanía; Aurrand-Lions, Michel; Sheer, Denise; Dagna-Bricarelli, Franca; Nizetic, Dean; McCabe, Christopher J; Turnell, Andrew S; Kermorgant, Stephanie; Imhof, Beat A; Adams, Ralf; Fisher, Elizabeth M C; Tybulewicz, Victor L J; Hart, Ian R; Hodivala-Dilke, Kairbaan M

2010-06-10

Down's syndrome (DS) is a genetic disorder caused by full or partial trisomy of human chromosome 21 and presents with many clinical phenotypes including a reduced incidence of solid tumours. Recent work with the Ts65Dn model of DS, which has orthologues of about 50% of the genes on chromosome 21 (Hsa21), has indicated that three copies of the ETS2 (ref. 3) or DS candidate region 1 (DSCR1) genes (a previously known suppressor of angiogenesis) is sufficient to inhibit tumour growth. Here we use the Tc1 transchromosomic mouse model of DS to dissect the contribution of extra copies of genes on Hsa21 to tumour angiogenesis. This mouse expresses roughly 81% of Hsa21 genes but not the human DSCR1 region. We transplanted B16F0 and Lewis lung carcinoma tumour cells into Tc1 mice and showed that growth of these tumours was substantially reduced compared with wild-type littermate controls. Furthermore, tumour angiogenesis was significantly repressed in Tc1 mice. In particular, in vitro and in vivo angiogenic responses to vascular endothelial growth factor (VEGF) were inhibited. Examination of the genes on the segment of Hsa21 in Tc1 mice identified putative anti-angiogenic genes (ADAMTS1and ERG) and novel endothelial cell-specific genes, never previously shown to be involved in angiogenesis (JAM-B and PTTG1IP), that, when overexpressed, are responsible for inhibiting angiogenic responses to VEGF. Three copies of these genes within the stromal compartment reduced tumour angiogenesis, explaining the reduced tumour growth in DS. Furthermore, we expect that, in addition to the candidate genes that we show to be involved in the repression of angiogenesis, the Tc1 mouse model of DS will permit the identification of other endothelium-specific anti-angiogenic targets relevant to a broad spectrum of cancer patients.

Use of homologous and heterologous gene expression profiling tools to characterize transcription dynamics during apple fruit maturation and ripening.

PubMed

Costa, Fabrizio; Alba, Rob; Schouten, Henk; Soglio, Valeria; Gianfranceschi, Luca; Serra, Sara; Musacchi, Stefano; Sansavini, Silviero; Costa, Guglielmo; Fei, Zhangjun; Giovannoni, James

2010-10-25

Fruit development, maturation and ripening consists of a complex series of biochemical and physiological changes that in climacteric fruits, including apple and tomato, are coordinated by the gaseous hormone ethylene. These changes lead to final fruit quality and understanding of the functional machinery underlying these processes is of both biological and practical importance. To date many reports have been made on the analysis of gene expression in apple. In this study we focused our investigation on the role of ethylene during apple maturation, specifically comparing transcriptomics of normal ripening with changes resulting from application of the hormone receptor competitor 1-methylcyclopropene. To gain insight into the molecular process regulating ripening in apple, and to compare to tomato (model species for ripening studies), we utilized both homologous and heterologous (tomato) microarray to profile transcriptome dynamics of genes involved in fruit development and ripening, emphasizing those which are ethylene regulated.The use of both types of microarrays facilitated transcriptome comparison between apple and tomato (for the later using data previously published and available at the TED: tomato expression database) and highlighted genes conserved during ripening of both species, which in turn represent a foundation for further comparative genomic studies. The cross-species analysis had the secondary aim of examining the efficiency of heterologous (specifically tomato) microarray hybridization for candidate gene identification as related to the ripening process. The resulting transcriptomics data revealed coordinated gene expression during fruit ripening of a subset of ripening-related and ethylene responsive genes, further facilitating the analysis of ethylene response during fruit maturation and ripening. Our combined strategy based on microarray hybridization enabled transcriptome characterization during normal climacteric apple ripening, as well as definition of ethylene-dependent transcriptome changes. Comparison with tomato fruit maturation and ethylene responsive transcriptome activity facilitated identification of putative conserved orthologous ripening-related genes, which serve as an initial set of candidates for assessing conservation of gene activity across genomes of fruit bearing plant species.

Global analysis of WRKY transcription factor superfamily in Setaria identifies potential candidates involved in abiotic stress signaling

PubMed Central

Muthamilarasan, Mehanathan; Bonthala, Venkata S.; Khandelwal, Rohit; Jaishankar, Jananee; Shweta, Shweta; Nawaz, Kashif; Prasad, Manoj

2015-01-01

Transcription factors (TFs) are major players in stress signaling and constitute an integral part of signaling networks. Among the major TFs, WRKY proteins play pivotal roles in regulation of transcriptional reprogramming associated with stress responses. In view of this, genome- and transcriptome-wide identification of WRKY TF family was performed in the C4model plants, Setaria italica (SiWRKY) and S. viridis (SvWRKY), respectively. The study identified 105 SiWRKY and 44 SvWRKY proteins that were computationally analyzed for their physicochemical properties. Sequence alignment and phylogenetic analysis classified these proteins into three major groups, namely I, II, and III with majority of WRKY proteins belonging to group II (53 SiWRKY and 23 SvWRKY), followed by group III (39 SiWRKY and 11 SvWRKY) and group I (10 SiWRKY and 6 SvWRKY). Group II proteins were further classified into 5 subgroups (IIa to IIe) based on their phylogeny. Domain analysis showed the presence of WRKY motif and zinc finger-like structures in these proteins along with additional domains in a few proteins. All SiWRKY genes were physically mapped on the S. italica genome and their duplication analysis revealed that 10 and 8 gene pairs underwent tandem and segmental duplications, respectively. Comparative mapping of SiWRKY and SvWRKY genes in related C4 panicoid genomes demonstrated the orthologous relationships between these genomes. In silico expression analysis of SiWRKY and SvWRKY genes showed their differential expression patterns in different tissues and stress conditions. Expression profiling of candidate SiWRKY genes in response to stress (dehydration and salinity) and hormone treatments (abscisic acid, salicylic acid, and methyl jasmonate) suggested the putative involvement of SiWRKY066 and SiWRKY082 in stress and hormone signaling. These genes could be potential candidates for further characterization to delineate their functional roles in abiotic stress signaling. PMID:26635818

Global analysis of WRKY transcription factor superfamily in Setaria identifies potential candidates involved in abiotic stress signaling.

PubMed

Muthamilarasan, Mehanathan; Bonthala, Venkata S; Khandelwal, Rohit; Jaishankar, Jananee; Shweta, Shweta; Nawaz, Kashif; Prasad, Manoj

2015-01-01

Transcription factors (TFs) are major players in stress signaling and constitute an integral part of signaling networks. Among the major TFs, WRKY proteins play pivotal roles in regulation of transcriptional reprogramming associated with stress responses. In view of this, genome- and transcriptome-wide identification of WRKY TF family was performed in the C4model plants, Setaria italica (SiWRKY) and S. viridis (SvWRKY), respectively. The study identified 105 SiWRKY and 44 SvWRKY proteins that were computationally analyzed for their physicochemical properties. Sequence alignment and phylogenetic analysis classified these proteins into three major groups, namely I, II, and III with majority of WRKY proteins belonging to group II (53 SiWRKY and 23 SvWRKY), followed by group III (39 SiWRKY and 11 SvWRKY) and group I (10 SiWRKY and 6 SvWRKY). Group II proteins were further classified into 5 subgroups (IIa to IIe) based on their phylogeny. Domain analysis showed the presence of WRKY motif and zinc finger-like structures in these proteins along with additional domains in a few proteins. All SiWRKY genes were physically mapped on the S. italica genome and their duplication analysis revealed that 10 and 8 gene pairs underwent tandem and segmental duplications, respectively. Comparative mapping of SiWRKY and SvWRKY genes in related C4 panicoid genomes demonstrated the orthologous relationships between these genomes. In silico expression analysis of SiWRKY and SvWRKY genes showed their differential expression patterns in different tissues and stress conditions. Expression profiling of candidate SiWRKY genes in response to stress (dehydration and salinity) and hormone treatments (abscisic acid, salicylic acid, and methyl jasmonate) suggested the putative involvement of SiWRKY066 and SiWRKY082 in stress and hormone signaling. These genes could be potential candidates for further characterization to delineate their functional roles in abiotic stress signaling.

High early growth response 1 (EGR1) expression correlates with resistance to anti-EGFR treatment in vitro and with poorer outcome in metastatic colorectal cancer patients treated with cetuximab.

PubMed

Kumar, S S; Tomita, Y; Wrin, J; Bruhn, M; Swalling, A; Mohammed, M; Price, T J; Hardingham, J E

2017-06-01

Biomarkers, such as mutant RAS, predict resistance to anti-EGFR therapy in only a proportion of patients, and hence, other predictive biomarkers are needed. The aims were to identify candidate genes upregulated in colorectal cancer cell lines resistant to anti-EGFR monoclonal antibody treatment, to knockdown (KD) these genes in the resistant cell lines to determine if sensitivity to anti-EGFR antibody was restored, and finally to perform a pilot correlative study of EGR1 expression and outcomes in a cohort of metastatic colorectal cancer (mCRC) patients given cetuximab therapy. Comparative expression array analysis of resistant cell lines (SW48, COLO-320DM, and SNU-C1) vs sensitive cell lines (LIM1215, CaCo2, and SW948) was performed. The highest up-regulated gene in each resistant cell line was knocked down (KD) using RNA interference, and effect on proliferation was assessed with and without anti-EGFR treatment. Expression of the candidate genes in patients' tumours treated with cetuximab was assessed by immunohistochemistry; survival analyses were performed comparing high vs low expression. Genes significantly upregulated in resistant cell lines were EGR1 (early growth response protein 1), HBEGF (heparin-binding epidermal growth factor-like growth factor), and AKT3 (AKT serine/threonine kinase 3). KD of each gene resulted in the respective cells being more sensitive to anti-EGFR treatment, suggesting that the resistant phenotype was reversed. In the pilot study of mCRC patients treated with cetuximab, both median PFS (1.38 months vs 6.79 months; HR 2.77 95% CI 1.2-19.4) and median OS (2.59 months vs 9.82 months; HR 3.0 95% CI 1.3-23.2) were significantly worse for those patients with high EGR1 expression. High EGR1 expression may be a candidate biomarker of resistance to anti-EGFR therapy.

Mapping-by-Sequencing Identifies HvPHYTOCHROME C as a Candidate Gene for the early maturity 5 Locus Modulating the Circadian Clock and Photoperiodic Flowering in Barley

PubMed Central

Pankin, Artem; Campoli, Chiara; Dong, Xue; Kilian, Benjamin; Sharma, Rajiv; Himmelbach, Axel; Saini, Reena; Davis, Seth J; Stein, Nils; Schneeberger, Korbinian; von Korff, Maria

2014-01-01

Phytochromes play an important role in light signaling and photoperiodic control of flowering time in plants. Here we propose that the red/far-red light photoreceptor HvPHYTOCHROME C (HvPHYC), carrying a mutation in a conserved region of the GAF domain, is a candidate underlying the early maturity 5 locus in barley (Hordeum vulgare L.). We fine mapped the gene using a mapping-by-sequencing approach applied on the whole-exome capture data from bulked early flowering segregants derived from a backcross of the Bowman(eam5) introgression line. We demonstrate that eam5 disrupts circadian expression of clock genes. Moreover, it interacts with the major photoperiod response gene Ppd-H1 to accelerate flowering under noninductive short days. Our results suggest that HvPHYC participates in transmission of light signals to the circadian clock and thus modulates light-dependent processes such as photoperiodic regulation of flowering. PMID:24996910

Genetic approaches to understanding post-traumatic stress disorder

PubMed Central

Almli, Lynn M.; Fani, Negar; Smith, Alicia K.; Ressler, Kerry J.

2015-01-01

Post-traumatic stress disorder (PTSD) is increasingly recognized as both a disorder of enormous mental health and societal burden, but also as an anxiety disorder that may be particularly understandable from a scientific perspective. Specifically, PTSD can be conceptualized as a disorder of fear and stress dysregulation, and the neural circuitry underlying these pathways in both animals and humans are becoming increasingly well understood. Furthermore, PTSD is the only disorder in psychiatry in which the initiating factor, the trauma exposure, can be identified. Thus, the pathophysiology of the fear and stress response underlying PTSD can be examined and potentially interrupted. Twin studies have shown that the development of PTSD following a trauma is heritable, and that genetic risk factors may account for up to 30–40% of this heritability. A current goal is to understand the gene pathways that are associated with PTSD, and how those genes act on the fear/stress circuitry to mediate risk vs. resilience for PTSD. This review will examine gene pathways that have recently been analysed, primarily through candidate gene studies (including neuroimaging studies of candidate genes), in addition to genome-wide associations and the epigenetic regulation of PTSD. Future and on-going studies are utilizing larger and collaborative cohorts to identify novel gene candidates through genome-wide association and other powerful genomic approaches. Identification of PTSD biological pathways strengthens the hope of progress in the mechanistic understanding of a model psychiatric disorder and allows for the development of targeted treatments and interventions. PMID:24103155

Introgression of Novel Traits from a Wild Wheat Relative Improves Drought Adaptation in Wheat1[W

PubMed Central

Placido, Dante F.; Campbell, Malachy T.; Folsom, Jing J.; Cui, Xinping; Kruger, Greg R.; Baenziger, P. Stephen; Walia, Harkamal

2013-01-01

Root architecture traits are an important component for improving water stress adaptation. However, selection for aboveground traits under favorable environments in modern cultivars may have led to an inadvertent loss of genes and novel alleles beneficial for adapting to environments with limited water. In this study, we elucidate the physiological and molecular consequences of introgressing an alien chromosome segment (7DL) from a wild wheat relative species (Agropyron elongatum) into cultivated wheat (Triticum aestivum). The wheat translocation line had improved water stress adaptation and higher root and shoot biomass compared with the control genotypes, which showed significant drops in root and shoot biomass during stress. Enhanced access to water due to higher root biomass enabled the translocation line to maintain more favorable gas-exchange and carbon assimilation levels relative to the wild-type wheat genotypes during water stress. Transcriptome analysis identified candidate genes associated with root development. Two of these candidate genes mapped to the site of translocation on chromosome 7DL based on single-feature polymorphism analysis. A brassinosteroid signaling pathway was predicted to be involved in the novel root responses observed in the A. elongatum translocation line, based on the coexpression-based gene network generated by seeding the network with the candidate genes. We present an effective and highly integrated approach that combines root phenotyping, whole-plant physiology, and functional genomics to discover novel root traits and the underlying genes from a wild related species to improve drought adaptation in cultivated wheat. PMID:23426195

A genome-wide association scan for acute insulin response to glucose in Hispanic Americans: The IRAS Family Study

PubMed Central

Rich, S. S.; Goodarzi, M. O.; Palmer, N. D.; Langefeld, C. D.; Ziegler, J.; Haffner, S. M.; Bryer-Ash, M.; Norris, J. M.; Taylor, K. D.; Haritunians, T.; Rotter, J. I.; Chen, Y-D. I.; Wagenknecht, L. E.; Bowden, D. W.; Bergman, R. N.

2009-01-01

Aims/Hypothesis The goal of this study was to identify genes and regions in the human genome that are associated with the acute insulin response to glucose (AIRg), an important predictor of type 2 diabetes, in Hispanic-American participants from the Insulin Resistance Atherosclerosis Family Study (IRAS FS). Methods A two-stage genome-wide association scan (GWAS) was performed in IRAS FS Hispanic-American samples. In the first stage, 318K single nucleotide polymorphisms (SNPs) were assessed in 229 Hispanic-American DNA samples (from 34 families) from San Antonio, TX. SNPs with the most significant associations with AIRg were genotyped in the entire set of IRAS FS Hispanic-American samples (n = 1190). In chromosomal regions with evidence of association, additional SNPs were genotyped to capture variation in genes. Results No individual SNP achieved genome-wide levels of significance (P < 5 × 10-7); however, two regions — chromosomes 6p21 and 20p11 — had multiple highly-ranked SNPs that were associated with AIRg. Additional genotyping in these regions supported the initial evidence for variants contributing to variation in AIRg. One region resides in a gene desert between PXT1 and KCTD20 on 6p21 while the region on 20p11 has several viable candidate genes (ENTPD6, PYGB, GINS1 and R4-691N24.1). Conclusions/Interpretation A GWAS in Hispanic-American samples identified several candidate genes and loci that may be associated with AIRg. These associations explain a small component of variation in AIRg. The genes identified are involved in phosphorylation and ion transport and provide preliminary evidence that these processes have importance in beta cell response. PMID:19430760

A genome-wide association scan for acute insulin response to glucose in Hispanic-Americans: the Insulin Resistance Atherosclerosis Family Study (IRAS FS).

PubMed

Rich, S S; Goodarzi, M O; Palmer, N D; Langefeld, C D; Ziegler, J; Haffner, S M; Bryer-Ash, M; Norris, J M; Taylor, K D; Haritunians, T; Rotter, J I; Chen, Y-D I; Wagenknecht, L E; Bowden, D W; Bergman, R N

2009-07-01

This study sought to identify genes and regions in the human genome that are associated with the acute insulin response to glucose (AIRg), an important predictor of type 2 diabetes, in Hispanic-American participants from the Insulin Resistance Atherosclerosis Family Study (IRAS FS). A two-stage genome-wide association scan (GWAS) was performed in IRAS FS Hispanic-American samples. In the first stage, 317K single nucleotide polymorphisms (SNPs) were assessed in 229 Hispanic-American DNA samples from 34 families from San Antonio, TX, USA. SNPs with the most significant associations with AIRg were genotyped in the entire set of IRAS FS Hispanic-American samples (n = 1,190). In chromosomal regions with evidence of association, additional SNPs were genotyped to capture variation in genes. No individual SNP achieved genome-wide levels of significance (p < 5 x 10(-7)); however, two regions (chromosomes 6p21 and 20p11) had multiple highly ranked SNPs that were associated with AIRg. Additional genotyping in these regions supported the initial evidence of variants contributing to variation in AIRg. One region resides in a gene desert between PXT1 and KCTD20 on 6p21, while the region on 20p11 has several viable candidate genes (ENTPD6, PYGB, GINS1 and RP4-691N24.1). A GWAS in Hispanic-American samples identified several candidate genes and loci that may be associated with AIRg. These associations explain a small component of variation in AIRg. The genes identified are involved in phosphorylation and ion transport, and provide preliminary evidence that these processes are important in beta cell response.

Mannosyltransferase is required for cell wall biosynthesis, morphology and control of asexual development in Neurospora crassa.

PubMed

Bowman, Shaun M; Piwowar, Amy; Ciocca, Maria; Free, Stephen J

2005-01-01

Two Neurospora mutants with a phenotype that includes a tight colonial growth pattern, an inability to form conidia and an inability to form protoperithecia have been isolated and characterized. The relevant mutations were mapped to the same locus on the sequenced Neurospora genome. The mutations responsible for the mutant phenotype then were identified by examining likely candidate genes from the mutant genomes at the mapped locus with PCR amplification and a sequencing assay. The results demonstrate that a map and sequence strategy is a feasible way to identify mutant genes in Neurospora. The gene responsible for the phenotype is a putative alpha-1,2-mannosyltransferase gene. The mutant cell wall has an altered composition demonstrating that the gene functions in cell wall biosynthesis. The results demonstrate that the mnt-1 gene is required for normal cell wall biosynthesis, morphology and for the regulation of asexual development.

A small number of candidate gene SNPs reveal continental ancestry in African Americans

PubMed Central

KODAMAN, NURI; ALDRICH, MELINDA C.; SMITH, JEFFREY R.; SIGNORELLO, LISA B.; BRADLEY, KEVIN; BREYER, JOAN; COHEN, SARAH S.; LONG, JIRONG; CAI, QIUYIN; GILES, JUSTIN; BUSH, WILLIAM S.; BLOT, WILLIAM J.; MATTHEWS, CHARLES E.; WILLIAMS, SCOTT M.

2013-01-01

SUMMARY Using genetic data from an obesity candidate gene study of self-reported African Americans and European Americans, we investigated the number of Ancestry Informative Markers (AIMs) and candidate gene SNPs necessary to infer continental ancestry. Proportions of African and European ancestry were assessed with STRUCTURE (K=2), using 276 AIMs. These reference values were compared to estimates derived using 120, 60, 30, and 15 SNP subsets randomly chosen from the 276 AIMs and from 1144 SNPs in 44 candidate genes. All subsets generated estimates of ancestry consistent with the reference estimates, with mean correlations greater than 0.99 for all subsets of AIMs, and mean correlations of 0.99±0.003; 0.98± 0.01; 0.93±0.03; and 0.81± 0.11 for subsets of 120, 60, 30, and 15 candidate gene SNPs, respectively. Among African Americans, the median absolute difference from reference African ancestry values ranged from 0.01 to 0.03 for the four AIMs subsets and from 0.03 to 0.09 for the four candidate gene SNP subsets. Furthermore, YRI/CEU Fst values provided a metric to predict the performance of candidate gene SNPs. Our results demonstrate that a small number of SNPs randomly selected from candidate genes can be used to estimate admixture proportions in African Americans reliably. PMID:23278390

A HECT Ubiquitin-Protein Ligase as a Novel Candidate Gene for Altered Quinine and Quinidine Responses in Plasmodium falciparum

PubMed Central

Sanchez, Cecilia P.; Cyrklaff, Marek; Mu, Jianbing; Ferdig, Michael T.; Stein, Wilfred D.; Lanzer, Michael

2014-01-01

The emerging resistance to quinine jeopardizes the efficacy of a drug that has been used in the treatment of malaria for several centuries. To identify factors contributing to differential quinine responses in the human malaria parasite Plasmodium falciparum, we have conducted comparative quantitative trait locus analyses on the susceptibility to quinine and also its stereoisomer quinidine, and on the initial and steady-state intracellular drug accumulation levels in the F1 progeny of a genetic cross. These data, together with genetic screens of field isolates and laboratory strains associated differential quinine and quinidine responses with mutated pfcrt, a segment on chromosome 13, and a novel candidate gene, termed MAL7P1.19 (encoding a HECT ubiquitin ligase). Despite a strong likelihood of association, episomal transfections demonstrated a role for the HECT ubiquitin-protein ligase in quinine and quinidine sensitivity in only a subset of genetic backgrounds, and here the changes in IC50 values were moderate (approximately 2-fold). These data show that quinine responsiveness is a complex genetic trait with multiple alleles playing a role and that more experiments are needed to unravel the role of the contributing factors. PMID:24830312

Pathway deregulation and expression QTLs in response to Actinobacillus pleuropneumoniae infection in swine.

PubMed

Reiner, Gerald; Dreher, Felix; Drungowski, Mario; Hoeltig, Doris; Bertsch, Natalie; Selke, Martin; Willems, Hermann; Gerlach, Gerald Friedrich; Probst, Inga; Tuemmler, Burkhardt; Waldmann, Karl-Heinz; Herwig, Ralf

2014-12-01

Actinobacillus (A.) pleuropneumoniae is among the most important pathogens in pig. The agent causes severe economic losses due to decreased performance, the occurrence of acute or chronic pleuropneumonia, and an increase in death incidence. Since therapeutics cannot be used in a sustainable manner, and vaccination is not always available, new prophylactic measures are urgently needed. Recent research has provided evidence for a genetic predisposition in susceptibility to A. pleuropneumoniae in a Hampshire × German Landrace F2 family with 170 animals. The aim of the present study is to characterize the expression response in this family in order to unravel resistance and susceptibility mechanisms and to prioritize candidate genes for future fine mapping approaches. F2 pigs differed distinctly in clinical, pathological, and microbiological parameters after challenge with A. pleuropneumoniae. We monitored genome-wide gene expression from the 50 most and 50 least susceptible F2 pigs and identified 171 genes differentially expressed between these extreme phenotypes. We combined expression QTL analyses with network analyses and functional characterization using gene set enrichment analysis and identified a functional hotspot on SSC13, including 55 eQTL. The integration of the different results provides a resource for candidate prioritization for fine mapping strategies, such as TF, TFRC, RUNX1, TCN1, HP, CD14, among others.

Genetic architecture of wild soybean (Glycine soja) response to soybean cyst nematode (Heterodera glycines).

PubMed

Zhang, Hengyou; Song, Qijian; Griffin, Joshua D; Song, Bao-Hua

2017-12-01

The soybean cyst nematode (SCN) is one of the most destructive pathogens of soybean plants worldwide. Host-plant resistance is an environmentally friendly method to mitigate SCN damage. To date, the resistant soybean cultivars harbor limited genetic variation, and some are losing resistance. Thus, a better understanding of the genetic mechanisms of the SCN resistance, as well as developing diverse resistant soybean cultivars, is urgently needed. In this study, a genome-wide association study (GWAS) was conducted using 1032 wild soybean (Glycine soja) accessions with over 42,000 single-nucleotide polymorphisms (SNPs) to understand the genetic architecture of G. soja resistance to SCN race 1. Ten SNPs were significantly associated with the response to race 1. Three SNPs on chromosome 18 were localized within the previously identified quantitative trait loci (QTLs), and two of which were localized within a strong linkage disequilibrium block encompassing a nucleotide-binding (NB)-ARC disease resistance gene (Glyma.18G102600). Genes encoding methyltransferases, the calcium-dependent signaling protein, the leucine-rich repeat kinase family protein, and the NB-ARC disease resistance protein, were identified as promising candidate genes. The identified SNPs and candidate genes can not only shed light on the molecular mechanisms underlying SCN resistance, but also can facilitate soybean improvement employing wild genetic resources.

Identification of water stress genes in Pinus pinaster Ait. by controlled progressive stress and suppression-subtractive hybridization.

PubMed

Perdiguero, Pedro; Collada, Carmen; Barbero, María Del Carmen; García Casado, Gloria; Cervera, María Teresa; Soto, Alvaro

2012-01-01

Climate change is a major challenge particularly for forest tree species, which will have to face the severe alterations of environmental conditions with their current genetic pool. Thus, an understanding of their adaptive responses is of the utmost interest. In this work we have selected Pinus pinaster as a model species. This pine is one of the most important conifers (for which molecular tools and knowledge are far more scarce than for angiosperms) in the Mediterranean Basin, which is characterised in all foreseen scenarios as one of the regions most drastically affected by climate change, mainly because of increasing temperature and, particularly, by increasing drought. We have induced a controlled, increasing water stress by adding PEG to a hydroponic culture. We have generated a subtractive library, with the aim of identifying the genes induced by this stress and have searched for the most reliable expressional candidate genes, based on their overexpression during water stress, as revealed by microarray analysis and confirmed by RT-PCR. We have selected a set of 67 candidate genes belonging to different functional groups that will be useful molecular tools for further studies on drought stress responses, adaptation, and population genomics in conifers, as well as in breeding programs. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

EnRICH: Extraction and Ranking using Integration and Criteria Heuristics.

PubMed

Zhang, Xia; Greenlee, M Heather West; Serb, Jeanne M

2013-01-15

High throughput screening technologies enable biologists to generate candidate genes at a rate that, due to time and cost constraints, cannot be studied by experimental approaches in the laboratory. Thus, it has become increasingly important to prioritize candidate genes for experiments. To accomplish this, researchers need to apply selection requirements based on their knowledge, which necessitates qualitative integration of heterogeneous data sources and filtration using multiple criteria. A similar approach can also be applied to putative candidate gene relationships. While automation can assist in this routine and imperative procedure, flexibility of data sources and criteria must not be sacrificed. A tool that can optimize the trade-off between automation and flexibility to simultaneously filter and qualitatively integrate data is needed to prioritize candidate genes and generate composite networks from heterogeneous data sources. We developed the java application, EnRICH (Extraction and Ranking using Integration and Criteria Heuristics), in order to alleviate this need. Here we present a case study in which we used EnRICH to integrate and filter multiple candidate gene lists in order to identify potential retinal disease genes. As a result of this procedure, a candidate pool of several hundred genes was narrowed down to five candidate genes, of which four are confirmed retinal disease genes and one is associated with a retinal disease state. We developed a platform-independent tool that is able to qualitatively integrate multiple heterogeneous datasets and use different selection criteria to filter each of them, provided the datasets are tables that have distinct identifiers (required) and attributes (optional). With the flexibility to specify data sources and filtering criteria, EnRICH automatically prioritizes candidate genes or gene relationships for biologists based on their specific requirements. Here, we also demonstrate that this tool can be effectively and easily used to apply highly specific user-defined criteria and can efficiently identify high quality candidate genes from relatively sparse datasets.

How immunogenetically different are domestic pigs from wild boars: a perspective from single-nucleotide polymorphisms of 19 immunity-related candidate genes.

PubMed

Chen, Shanyuan; Gomes, Rui; Costa, Vânia; Santos, Pedro; Charneca, Rui; Zhang, Ya-ping; Liu, Xue-hong; Wang, Shao-qing; Bento, Pedro; Nunes, Jose-Luis; Buzgó, József; Varga, Gyula; Anton, István; Zsolnai, Attila; Beja-Pereira, Albano

2013-10-01

The coexistence of wild boars and domestic pigs across Eurasia makes it feasible to conduct comparative genetic or genomic analyses for addressing how genetically different a domestic species is from its wild ancestor. To test whether there are differences in patterns of genetic variability between wild and domestic pigs at immunity-related genes and to detect outlier loci putatively under selection that may underlie differences in immune responses, here we analyzed 54 single-nucleotide polymorphisms (SNPs) of 19 immunity-related candidate genes on 11 autosomes in three pairs of wild boar and domestic pig populations from China, Iberian Peninsula, and Hungary. Our results showed no statistically significant differences in allele frequency and heterozygosity across SNPs between three pairs of wild and domestic populations. This observation was more likely due to the widespread and long-lasting gene flow between wild boars and domestic pigs across Eurasia. In addition, we detected eight coding SNPs from six genes as outliers being under selection consistently by three outlier tests (BayeScan2.1, FDIST2, and Arlequin3.5). Among four non-synonymous outlier SNPs, one from TLR4 gene was identified as being subject to positive (diversifying) selection and three each from CD36, IFNW1, and IL1B genes were suggested as under balancing selection. All of these four non-synonymous variants were predicted as being benign by PolyPhen-2. Our results were supported by other independent lines of evidence for positive selection or balancing selection acting on these four immune genes (CD36, IFNW1, IL1B, and TLR4). Our study showed an example applying a candidate gene approach to identify functionally important mutations (i.e., outlier loci) in wild and domestic pigs for subsequent functional experiments.

Host genetic variation influences gene expression response to rhinovirus infection.

PubMed

Çalışkan, Minal; Baker, Samuel W; Gilad, Yoav; Ober, Carole

2015-04-01

Rhinovirus (RV) is the most prevalent human respiratory virus and is responsible for at least half of all common colds. RV infections may result in a broad spectrum of effects that range from asymptomatic infections to severe lower respiratory illnesses. The basis for inter-individual variation in the response to RV infection is not well understood. In this study, we explored whether host genetic variation is associated with variation in gene expression response to RV infections between individuals. To do so, we obtained genome-wide genotype and gene expression data in uninfected and RV-infected peripheral blood mononuclear cells (PBMCs) from 98 individuals. We mapped local and distant genetic variation that is associated with inter-individual differences in gene expression levels (eQTLs) in both uninfected and RV-infected cells. We focused specifically on response eQTLs (reQTLs), namely, genetic associations with inter-individual variation in gene expression response to RV infection. We identified local reQTLs for 38 genes, including genes with known functions in viral response (UBA7, OAS1, IRF5) and genes that have been associated with immune and RV-related diseases (e.g., ITGA2, MSR1, GSTM3). The putative regulatory regions of genes with reQTLs were enriched for binding sites of virus-activated STAT2, highlighting the role of condition-specific transcription factors in genotype-by-environment interactions. Overall, we suggest that the 38 loci associated with inter-individual variation in gene expression response to RV-infection represent promising candidates for affecting immune and RV-related respiratory diseases.

Vanilloid receptor-related osmotically activated channel (VR-OAC), a candidate vertebrate osmoreceptor

PubMed Central

Liedtke, Wolfgang; Choe, Yong; Martí-Renom, Marc A.; Bell, Andrea M.; Denis, Charlotte S.; Šali, Andrej; Hudspeth, A. J.; Friedman, Jeffrey M.; Heller, Stefan

2008-01-01

SUMMARY The detection of osmotic stimuli is essential for all organisms, yet few osmoreceptive proteins are known, none of them in vertebrates. By employing a candidate-gene approach based on genes encoding members of the TRP superfamily of ion channels, we cloned cDNAs encoding the vanilloid receptor-related osmotically activated channel (VR-OAC) from the rat, mouse, human, and chicken. This novel cation-selective channel is gated by exposure to hypotonicity within the physiological range. In the central nevous system, the channel is expressed neurons of the circumventricular organs, neurosensory cells responsive to systemic osmotic pressure. The channel also occurs in other neurosensory cells, including inner-ear hair cells, sensory neurons, and Merkel cells. PMID:11081638

Degrees of separation as a statistical tool for evaluating candidate genes.

PubMed

Nelson, Ronald M; Pettersson, Mats E

2014-12-01

Selection of candidate genes is an important step in the exploration of complex genetic architecture. The number of gene networks available is increasing and these can provide information to help with candidate gene selection. It is currently common to use the degree of connectedness in gene networks as validation in Genome Wide Association (GWA) and Quantitative Trait Locus (QTL) mapping studies. However, it can cause misleading results if not validated properly. Here we present a method and tool for validating the gene pairs from GWA studies given the context of the network they co-occur in. It ensures that proposed interactions and gene associations are not statistical artefacts inherent to the specific gene network architecture. The CandidateBacon package provides an easy and efficient method to calculate the average degree of separation (DoS) between pairs of genes to currently available gene networks. We show how these empirical estimates of average connectedness are used to validate candidate gene pairs. Validation of interacting genes by comparing their connectedness with the average connectedness in the gene network will provide support for said interactions by utilising the growing amount of gene network information available. Copyright © 2014 Elsevier Ltd. All rights reserved.

Comparative MicroRNA Expression Patterns in Fibroblasts after Low and High Doses of Low-LET Radiation Exposure

NASA Technical Reports Server (NTRS)

Maes, Olivier C.; Xu, Suying; Hada, Megumi; Wu, Honglu; Wang, Eugenia

2007-01-01

Exposure to ionizing radiation causes DNA damage to cells, and provokes a plethora of cellular responses controlled by unique gene-directed signaling pathways. MicroRNAs (miRNAs) are small (22-nucleotide), non-coding RNAs which functionally silence gene expression by either degrading the messages or inhibiting translation. Here we investigate radiation-dependent changes in these negative regulators by comparing the expression patterns of all 462 known human miRNAs in fibroblasts, after exposure to low (0.1 Gy) or high (2 Gy) doses of X-rays at 30 min, 2, 6 and 24 hrs post-treatment. The expression patterns of microRNAs after low and high doses of radiation show a similar qualitative down-regulation trend at early (0.5 hr) and late (24 hr) time points, with a quantitatively steeper slope following the 2 Gy exposures. Interestingly, an interruption of this downward trend is observed after the 2 Gy exposure, i.e. a significant up-regulation of microRNAs at 2 hrs, then reverting to the downward trend by 6 hrs; this interruption at the intermediate time point was not observed with the 0.1 Gy exposure. At the early time point (0.5 hr), candidate gene targets of selected down-regulated microRNAs, common to both 0.1 and 2 Gy exposures, were those functioning in chromatin remodeling. Candidate target genes of unique up-regulated microRNAs seen at a 2 hr intermediate time point, after the 2 Gy exposure only, are those involved in cell death signaling. Finally, putative target genes of down-regulated microRNAs seen at the late (24 hr) time point after either doses of radiation are those involved in the up-regulation of DNA repair, cell signaling and homeostasis. Thus we hypothesize that after radiation exposure, microRNAs acting as hub negative regulators for unique signaling pathways needed to be down-regulated so as to de-repress their target genes for the proper cellular responses, including DNA repair and cell maintenance. The unique microRNAs up-regulated at 2 hr after 2 Gy suggest the cellular response to functionally suppress the apoptotic death signaling reflex after exposure to high dose radiation. Further analyses with transcriptome and global proteomic profiling will validate the reciprocal expression of signature microRNAs selected in our radiation-exposed cells, and their candidate target gene families, and test our hypothesis that unique radiation-specific microRNAs are keys in governing signaling responses for damage control of this environmental hazard.

Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus.

PubMed

Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W

2017-12-01

Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions.

Selection of Reference Genes for Normalization of MicroRNA Expression by RT-qPCR in Sugarcane Buds under Cold Stress

PubMed Central

Yang, Yuting; Zhang, Xu; Chen, Yun; Guo, Jinlong; Ling, Hui; Gao, Shiwu; Su, Yachun; Que, Youxiong; Xu, Liping

2016-01-01

Sugarcane, accounting for 80% of world's sugar, originates in the tropics but is cultivated mainly in the subtropics. Therefore, chilling injury frequently occurs and results in serious losses. Recent studies in various plant species have established microRNAs as key elements in the post-transcriptional regulation of response to biotic and abiotic stresses including cold stress. Though, its accuracy is largely influenced by the use of reference gene for normalization, quantitative PCR is undoubtedly a popular method used for identification of microRNAs. For identifying the most suitable reference genes for normalizing miRNAs expression in sugarcane under cold stress, 13 candidates among 17 were investigated using four algorithms: geNorm, NormFinder, deltaCt, and Bestkeeper, and four candidates were excluded because of unsatisfactory efficiency and specificity. Verification was carried out using cold-related genes miR319 and miR393 in cold-tolerant and sensitive cultivars. The results suggested that miR171/18S rRNA and miR171/miR5059 were the best reference gene sets for normalization for miRNA RT-qPCR, followed by the single miR171 and 18S rRNA. These results can aid research on miRNA responses during sugarcane stress, and the development of sugarcane tolerant to cold stress. This study is the first report concerning the reference gene selection of miRNA RT-qPCR in sugarcane. PMID:26904058

Chronomics of pressure overload-induced cardiac hypertrophy in mice reveals altered day/night gene expression and biomarkers of heart disease.

PubMed

Tsimakouridze, Elena V; Straume, Marty; Podobed, Peter S; Chin, Heather; LaMarre, Jonathan; Johnson, Ron; Antenos, Monica; Kirby, Gordon M; Mackay, Allison; Huether, Patsy; Simpson, Jeremy A; Sole, Michael; Gadal, Gerard; Martino, Tami A

2012-08-01

There is critical demand in contemporary medicine for gene expression markers in all areas of human disease, for early detection of disease, classification, prognosis, and response to therapy. The integrity of circadian gene expression underlies cardiovascular health and disease; however time-of-day profiling in heart disease has never been examined. We hypothesized that a time-of-day chronomic approach using samples collected across 24-h cycles and analyzed by microarrays and bioinformatics advances contemporary approaches, because it includes sleep-time and/or wake-time molecular responses. As proof of concept, we demonstrate the value of this approach in cardiovascular disease using a murine Transverse Aortic Constriction (TAC) model of pressure overload-induced cardiac hypertrophy in mice. First, microarrays and a novel algorithm termed DeltaGene were used to identify time-of-day differences in gene expression in cardiac hypertrophy 8 wks post-TAC. The top 300 candidates were further analyzed using knowledge-based platforms, paring the list to 20 candidates, which were then validated by real-time polymerase chain reaction (RTPCR). Next, we tested whether the time-of-day gene expression profiles could be indicative of disease progression by comparing the 1- vs. 8-wk TAC. Lastly, since protein expression is functionally relevant, we monitored time-of-day cycling for the analogous cardiac proteins. This approach is generally applicable and can lead to new understanding of disease.

High-throughput cell-based screening reveals a role for ZNF131 as a repressor of ERalpha signaling

PubMed Central

Han, Xiao; Guo, Jinhai; Deng, Weiwei; Zhang, Chenying; Du, Peige; Shi, Taiping; Ma, Dalong

2008-01-01

Background Estrogen receptor α (ERα) is a transcription factor whose activity is affected by multiple regulatory cofactors. In an effort to identify the human genes involved in the regulation of ERα, we constructed a high-throughput, cell-based, functional screening platform by linking a response element (ERE) with a reporter gene. This allowed the cellular activity of ERα, in cells cotransfected with the candidate gene, to be quantified in the presence or absence of its cognate ligand E2. Results From a library of 570 human cDNA clones, we identified zinc finger protein 131 (ZNF131) as a repressor of ERα mediated transactivation. ZNF131 is a typical member of the BTB/POZ family of transcription factors, and shows both ubiquitous expression and a high degree of sequence conservation. The luciferase reporter gene assay revealed that ZNF131 inhibits ligand-dependent transactivation by ERα in a dose-dependent manner. Electrophoretic mobility shift assay clearly demonstrated that the interaction between ZNF131 and ERα interrupts or prevents ERα binding to the estrogen response element (ERE). In addition, ZNF131 was able to suppress the expression of pS2, an ERα target gene. Conclusion We suggest that the functional screening platform we constructed can be applied for high-throughput genomic screening candidate ERα-related genes. This in turn may provide new insights into the underlying molecular mechanisms of ERα regulation in mammalian cells. PMID:18847501

Genomic Trajectories to Desiccation Resistance: Convergence and Divergence Among Replicate Selected Drosophila Lines

PubMed Central

Griffin, Philippa C.; Hangartner, Sandra B.; Fournier-Level, Alexandre; Hoffmann, Ary A.

2017-01-01

Adaptation to environmental stress is critical for long-term species persistence. With climate change and other anthropogenic stressors compounding natural selective pressures, understanding the nature of adaptation is as important as ever in evolutionary biology. In particular, the number of alternative molecular trajectories available for an organism to reach the same adaptive phenotype remains poorly understood. Here, we investigate this issue in a set of replicated Drosophila melanogaster lines selected for increased desiccation resistance—a classical physiological trait that has been closely linked to Drosophila species distributions. We used pooled whole-genome sequencing (Pool-Seq) to compare the genetic basis of their selection responses, using a matching set of replicated control lines for characterizing laboratory (lab-)adaptation, as well as the original base population. The ratio of effective population size to census size was high over the 21 generations of the experiment at 0.52–0.88 for all selected and control lines. While selected SNPs in replicates of the same treatment (desiccation-selection or lab-adaptation) tended to change frequency in the same direction, suggesting some commonality in the selection response, candidate SNP and gene lists often differed among replicates. Three of the five desiccation-selection replicates showed significant overlap at the gene and network level. All five replicates showed enrichment for ovary-expressed genes, suggesting maternal effects on the selected trait. Divergence between pairs of replicate lines for desiccation-candidate SNPs was greater than between pairs of control lines. This difference also far exceeded the divergence between pairs of replicate lines for neutral SNPs. Overall, while there was overlap in the direction of allele frequency changes and the network and functional categories affected by desiccation selection, replicates showed unique responses at all levels, likely reflecting hitchhiking effects, and highlighting the challenges in identifying candidate genes from these types of experiments when traits are likely to be polygenic. PMID:28007884

Genome-Wide Identification and Expression Analyses of Aquaporin Gene Family during Development and Abiotic Stress in Banana

PubMed Central

Hu, Wei; Hou, Xiaowan; Huang, Chao; Yan, Yan; Tie, Weiwei; Ding, Zehong; Wei, Yunxie; Liu, Juhua; Miao, Hongxia; Lu, Zhiwei; Li, Meiying; Xu, Biyu; Jin, Zhiqiang

2015-01-01

Aquaporins (AQPs) function to selectively control the flow of water and other small molecules through biological membranes, playing crucial roles in various biological processes. However, little information is available on the AQP gene family in bananas. In this study, we identified 47 banana AQP genes based on the banana genome sequence. Evolutionary analysis of AQPs from banana, Arabidopsis, poplar, and rice indicated that banana AQPs (MaAQPs) were clustered into four subfamilies. Conserved motif analysis showed that all banana AQPs contained the typical AQP-like or major intrinsic protein (MIP) domain. Gene structure analysis suggested the majority of MaAQPs had two to four introns with a highly specific number and length for each subfamily. Expression analysis of MaAQP genes during fruit development and postharvest ripening showed that some MaAQP genes exhibited high expression levels during these stages, indicating the involvement of MaAQP genes in banana fruit development and ripening. Additionally, some MaAQP genes showed strong induction after stress treatment and therefore, may represent potential candidates for improving banana resistance to abiotic stress. Taken together, this study identified some excellent tissue-specific, fruit development- and ripening-dependent, and abiotic stress-responsive candidate MaAQP genes, which could lay a solid foundation for genetic improvement of banana cultivars. PMID:26307965

Transcriptome and proteome data reveal candidate genes for pollinator attraction in sexually deceptive orchids.

PubMed

Sedeek, Khalid E M; Qi, Weihong; Schauer, Monica A; Gupta, Alok K; Poveda, Lucy; Xu, Shuqing; Liu, Zhong-Jian; Grossniklaus, Ueli; Schiestl, Florian P; Schlüter, Philipp M

2013-01-01

Sexually deceptive orchids of the genus Ophrys mimic the mating signals of their pollinator females to attract males as pollinators. This mode of pollination is highly specific and leads to strong reproductive isolation between species. This study aims to identify candidate genes responsible for pollinator attraction and reproductive isolation between three closely related species, O. exaltata, O. sphegodes and O. garganica. Floral traits such as odour, colour and morphology are necessary for successful pollinator attraction. In particular, different odour hydrocarbon profiles have been linked to differences in specific pollinator attraction among these species. Therefore, the identification of genes involved in these traits is important for understanding the molecular basis of pollinator attraction by sexually deceptive orchids. We have created floral reference transcriptomes and proteomes for these three Ophrys species using a combination of next-generation sequencing (454 and Solexa), Sanger sequencing, and shotgun proteomics (tandem mass spectrometry). In total, 121 917 unique transcripts and 3531 proteins were identified. This represents the first orchid proteome and transcriptome from the orchid subfamily Orchidoideae. Proteome data revealed proteins corresponding to 2644 transcripts and 887 proteins not observed in the transcriptome. Candidate genes for hydrocarbon and anthocyanin biosynthesis were represented by 156 and 61 unique transcripts in 20 and 7 genes classes, respectively. Moreover, transcription factors putatively involved in the regulation of flower odour, colour and morphology were annotated, including Myb, MADS and TCP factors. Our comprehensive data set generated by combining transcriptome and proteome technologies allowed identification of candidate genes for pollinator attraction and reproductive isolation among sexually deceptive orchids. This includes genes for hydrocarbon and anthocyanin biosynthesis and regulation, and the development of floral morphology. These data will serve as an invaluable resource for research in orchid floral biology, enabling studies into the molecular mechanisms of pollinator attraction and speciation.

Transcriptome and Proteome Data Reveal Candidate Genes for Pollinator Attraction in Sexually Deceptive Orchids

PubMed Central

Sedeek, Khalid E. M.; Qi, Weihong; Schauer, Monica A.; Gupta, Alok K.; Poveda, Lucy; Xu, Shuqing; Liu, Zhong-Jian; Grossniklaus, Ueli; Schiestl, Florian P.; Schlüter, Philipp M.

2013-01-01

Background Sexually deceptive orchids of the genus Ophrys mimic the mating signals of their pollinator females to attract males as pollinators. This mode of pollination is highly specific and leads to strong reproductive isolation between species. This study aims to identify candidate genes responsible for pollinator attraction and reproductive isolation between three closely related species, O. exaltata, O. sphegodes and O. garganica. Floral traits such as odour, colour and morphology are necessary for successful pollinator attraction. In particular, different odour hydrocarbon profiles have been linked to differences in specific pollinator attraction among these species. Therefore, the identification of genes involved in these traits is important for understanding the molecular basis of pollinator attraction by sexually deceptive orchids. Results We have created floral reference transcriptomes and proteomes for these three Ophrys species using a combination of next-generation sequencing (454 and Solexa), Sanger sequencing, and shotgun proteomics (tandem mass spectrometry). In total, 121 917 unique transcripts and 3531 proteins were identified. This represents the first orchid proteome and transcriptome from the orchid subfamily Orchidoideae. Proteome data revealed proteins corresponding to 2644 transcripts and 887 proteins not observed in the transcriptome. Candidate genes for hydrocarbon and anthocyanin biosynthesis were represented by 156 and 61 unique transcripts in 20 and 7 genes classes, respectively. Moreover, transcription factors putatively involved in the regulation of flower odour, colour and morphology were annotated, including Myb, MADS and TCP factors. Conclusion Our comprehensive data set generated by combining transcriptome and proteome technologies allowed identification of candidate genes for pollinator attraction and reproductive isolation among sexually deceptive orchids. This includes genes for hydrocarbon and anthocyanin biosynthesis and regulation, and the development of floral morphology. These data will serve as an invaluable resource for research in orchid floral biology, enabling studies into the molecular mechanisms of pollinator attraction and speciation. PMID:23734209

Inter-relationships among behavioral markers, genes, brain and treatment in dyslexia and dysgraphia

PubMed Central

Berninger, Virginia; Richards, Todd

2010-01-01

Cross-country, longitudinal twin studies provide strong evidence for both the biological and environmental basis of dyslexia, and the stability of genetic influences on reading and spelling, even when skills improve in response to instruction. Although DNA studies aimed at identifying gene candidates in dyslexia and related phenotypes (behavioral expression of underlying genotypes); and imaging studies of brain differences between individuals with and without dyslexia and the brain’s response to instructional treatment are increasing, this review illustrates, with the findings of one multidisciplinary research center, an emerging trend to investigate the inter-relationships among genetic, brain and instructional treatment findings in the same sample, which are interpreted in reference to a working-memory architecture, for dyslexia (impaired decoding and spelling) and/or dysgraphia (impaired handwriting). General principles for diagnosis and treatment, based on research with children who failed to respond to the regular instructional program, are summarized for children meeting research criteria for having or being at risk for dyslexia or dysgraphia. Research documenting earlier emerging specific oral language impairment during preschool years associated with reading and writing disabilities during school years is also reviewed. Recent seminal advances and projected future trends are discussed for linking brain endophenotypes and gene candidates, identifying transchromosomal interactions, and exploring epigenetics (chemic al modifications of gene expression in response to developmental or environmental changes). Rather than providing final answers, this review highlights past, current and emerging issues in dyslexia research and practice. PMID:20953351

LOD score exclusion analyses for candidate QTLs using random population samples.

PubMed

Deng, Hong-Wen

2003-11-01

While extensive analyses have been conducted to test for, no formal analyses have been conducted to test against, the importance of candidate genes as putative QTLs using random population samples. Previously, we developed an LOD score exclusion mapping approach for candidate genes for complex diseases. Here, we extend this LOD score approach for exclusion analyses of candidate genes for quantitative traits. Under this approach, specific genetic effects (as reflected by heritability) and inheritance models at candidate QTLs can be analyzed and if an LOD score is < or = -2.0, the locus can be excluded from having a heritability larger than that specified. Simulations show that this approach has high power to exclude a candidate gene from having moderate genetic effects if it is not a QTL and is robust to population admixture. Our exclusion analysis complements association analysis for candidate genes as putative QTLs in random population samples. The approach is applied to test the importance of Vitamin D receptor (VDR) gene as a potential QTL underlying the variation of bone mass, an important determinant of osteoporosis.

Gene expression factor analysis to differentiate pathways linked to fibromyalgia, chronic fatigue syndrome, and depression in a diverse patient sample

PubMed Central

Iacob, Eli; Light, Alan R.; Donaldson, Gary W.; Okifuji, Akiko; Hughen, Ronald W.; White, Andrea T.; Light, Kathleen C.

2015-01-01

Objective To determine if independent candidate genes can be grouped into meaningful biological factors and if these factors are associated with the diagnosis of chronic fatigue syndrome (CFS) and fibromyalgia (FMS) while controlling for co-morbid depression, sex, and age. Methods We included leukocyte mRNA gene expression from a total of 261 individuals including healthy controls (n=61), patients with FMS only (n=15), CFS only (n=33), co-morbid CFS and FMS (n=79), and medication-resistant (n=42) or medication-responsive (n=31) depression. We used Exploratory Factor Analysis (EFA) on 34 candidate genes to determine factor scores and regression analysis to examine if these factors were associated with specific diagnoses. Results EFA resulted in four independent factors with minimal overlap of genes between factors explaining 51% of the variance. We labeled these factors by function as: 1) Purinergic and cellular modulators; 2) Neuronal growth and immune function; 3) Nociception and stress mediators; 4) Energy and mitochondrial function. Regression analysis predicting these biological factors using FMS, CFS, depression severity, age, and sex revealed that greater expression in Factors 1 and 3 was positively associated with CFS and negatively associated with depression severity (QIDS score), but not associated with FMS. Conclusion Expression of candidate genes can be grouped into meaningful clusters, and CFS and depression are associated with the same 2 clusters but in opposite directions when controlling for co-morbid FMS. Given high co-morbid disease and interrelationships between biomarkers, EFA may help determine patient subgroups in this population based on gene expression. PMID:26097208

Association of candidate genes with drought tolerance traits in diverse perennial ryegrass accessions

Treesearch

Xiaoqing Yu; Guihua Bai; Shuwei Liu; Na Luo; Ying Wang; Douglas S. Richmond; Paula M. Pijut; Scott A. Jackson; Jianming Yu; Yiwei Jiang

2013-01-01

Drought is a major environmental stress limiting growth of perennial grasses in temperate regions. Plant drought tolerance is a complex trait that is controlled by multiple genes. Candidate gene association mapping provides a powerful tool for dissection of complex traits. Candidate gene association mapping of drought tolerance traits was conducted in 192 diverse...

Pharmacokinetic optimization of class-selective histone deacetylase inhibitors and identification of associated candidate predictive biomarkers of hepatocellular carcinoma tumor response.

PubMed

Wong, Jason C; Tang, Guozhi; Wu, Xihan; Liang, Chungen; Zhang, Zhenshan; Guo, Lei; Peng, Zhenghong; Zhang, Weixing; Lin, Xianfeng; Wang, Zhanguo; Mei, Jianghua; Chen, Junli; Pan, Song; Zhang, Nan; Liu, Yongfu; Zhou, Mingwei; Feng, Lichun; Zhao, Weili; Li, Shijie; Zhang, Chao; Zhang, Meifang; Rong, Yiping; Jin, Tai-Guang; Zhang, Xiongwen; Ren, Shuang; Ji, Ying; Zhao, Rong; She, Jin; Ren, Yi; Xu, Chunping; Chen, Dawei; Cai, Jie; Shan, Song; Pan, Desi; Ning, Zhiqiang; Lu, Xianping; Chen, Taiping; He, Yun; Chen, Li

2012-10-25

Herein, we describe the pharmacokinetic optimization of a series of class-selective histone deacetylase (HDAC) inhibitors and the subsequent identification of candidate predictive biomarkers of hepatocellular carcinoma (HCC) tumor response for our clinical lead using patient-derived HCC tumor xenograft models. Through a combination of conformational constraint and scaffold hopping, we lowered the in vivo clearance (CL) and significantly improved the bioavailability (F) and exposure (AUC) of our HDAC inhibitors while maintaining selectivity toward the class I HDAC family with particular potency against HDAC1, resulting in clinical lead 5 (HDAC1 IC₅₀ = 60 nM, mouse CL = 39 mL/min/kg, mouse F = 100%, mouse AUC after single oral dose at 10 mg/kg = 6316 h·ng/mL). We then evaluated 5 in a biomarker discovery pilot study using patient-derived tumor xenograft models, wherein two out of the three models responded to treatment. By comparing tumor response status to compound tumor exposure, induction of acetylated histone H3, candidate gene expression changes, and promoter DNA methylation status from all three models at various time points, we identified preliminary candidate response prediction biomarkers that warrant further validation in a larger cohort of patient-derived tumor models and through confirmatory functional studies.

Comparative Transcriptomes Analysis of Red- and White-Fleshed Apples in an F1 Population of Malus sieversii f. niedzwetzkyana Crossed with M. domestica ‘Fuji’

PubMed Central

Wang, Nan; Zheng, Yi; Duan, Naibin; Zhang, Zongying; Ji, Xiaohao; Jiang, Shenghui; Sun, Shasha; Yang, Long; Bai, Yang; Fei, Zhangjun; Chen, Xuesen

2015-01-01

Transcriptome profiles of the red- and white-fleshed apples in an F1 segregating population of Malus sieversii f.Niedzwetzkyana and M.domestica ‘Fuji’ were generated using the next-generation high-throughput RNA sequencing (RNA-Seq) technology and compared. A total of 114 differentially expressed genes (DEGs) were obtained, of which 88 were up-regulated and 26 were down-regulated in red-fleshed apples. The 88 up-regulated genes were enriched with those related to flavonoid biosynthetic process and stress responses. Further analysis identified 22 genes associated with flavonoid biosynthetic process and 68 genes that may be related to stress responses. Furthermore, the expression of 20 up-regulated candidate genes (10 related to flavonoid biosynthesis, two encoding MYB transcription factors and eight related to stress responses) and 10 down-regulated genes were validated by quantitative real-time PCR. After exploring the possible regulatory network, we speculated that flavonoid metabolism might be involved in stress responses in red-fleshed apple. Our findings provide a theoretical basis for further enriching gene resources associated with flavonoid synthesis and stress responses of fruit trees and for breeding elite apples with high flavonoid content and/or increased stress tolerances. PMID:26207813

Comparative Transcriptomes Analysis of Red- and White-Fleshed Apples in an F1 Population of Malus sieversii f. niedzwetzkyana Crossed with M. domestica 'Fuji'.

PubMed

Wang, Nan; Zheng, Yi; Duan, Naibin; Zhang, Zongying; Ji, Xiaohao; Jiang, Shenghui; Sun, Shasha; Yang, Long; Bai, Yang; Fei, Zhangjun; Chen, Xuesen

2015-01-01

Transcriptome profiles of the red- and white-fleshed apples in an F1 segregating population of Malus sieversii f.Niedzwetzkyana and M.domestica 'Fuji' were generated using the next-generation high-throughput RNA sequencing (RNA-Seq) technology and compared. A total of 114 differentially expressed genes (DEGs) were obtained, of which 88 were up-regulated and 26 were down-regulated in red-fleshed apples. The 88 up-regulated genes were enriched with those related to flavonoid biosynthetic process and stress responses. Further analysis identified 22 genes associated with flavonoid biosynthetic process and 68 genes that may be related to stress responses. Furthermore, the expression of 20 up-regulated candidate genes (10 related to flavonoid biosynthesis, two encoding MYB transcription factors and eight related to stress responses) and 10 down-regulated genes were validated by quantitative real-time PCR. After exploring the possible regulatory network, we speculated that flavonoid metabolism might be involved in stress responses in red-fleshed apple. Our findings provide a theoretical basis for further enriching gene resources associated with flavonoid synthesis and stress responses of fruit trees and for breeding elite apples with high flavonoid content and/or increased stress tolerances.

Genetics and Genomics of Endometriosis

PubMed Central

Hansen, Keith A.; Eyster, Kathleen M.

2015-01-01

Endometriosis is a common cause of morbidity in women with an unknown etiology. Studies have demonstrated the familial nature of endometriosis and suggest that inheritance occurs in a polygenic/multifactorial fashion. Studies have attempted to define the gene or genes responsible for endometriosis through association or linkage studies with candidate genes or DNA mapping technology. A number of genomics studies have demonstrated significant alterations in gene expression in endometriosis. A more thorough understanding of the genetics and genomics of endometriosis will facilitate understanding the basic biology of the disease and open new inroads to diagnosis and treatment of this enigmatic condition. PMID:20436317

Host adaptation to viruses relies on few genes with different cross-resistance properties

PubMed Central

Martins, Nelson E.; Faria, Vítor G.; Nolte, Viola; Schlötterer, Christian; Teixeira, Luis; Sucena, Élio; Magalhães, Sara

2014-01-01

Host adaptation to one parasite may affect its response to others. However, the genetics of these direct and correlated responses remains poorly studied. The overlap between these responses is instrumental for the understanding of host evolution in multiparasite environments. We determined the genetic and phenotypic changes underlying adaptation of Drosophila melanogaster to Drosophila C virus (DCV). Within 20 generations, flies selected with DCV showed increased survival after DCV infection, but also after cricket paralysis virus (CrPV) and flock house virus (FHV) infection. Whole-genome sequencing identified two regions of significant differentiation among treatments, from which candidate genes were functionally tested with RNAi. Three genes were validated—pastrel, a known DCV-response gene, and two other loci, Ubc-E2H and CG8492. Knockdown of Ubc-E2H and pastrel also led to increased sensitivity to CrPV, whereas knockdown of CG8492 increased susceptibility to FHV infection. Therefore, Drosophila adaptation to DCV relies on few major genes, each with different cross-resistance properties, conferring host resistance to several parasites. PMID:24711428

Identification of candidate genes for drought tolerance in coffee by high-throughput sequencing in the shoot apex of different Coffea arabica cultivars.

PubMed

Mofatto, Luciana Souto; Carneiro, Fernanda de Araújo; Vieira, Natalia Gomes; Duarte, Karoline Estefani; Vidal, Ramon Oliveira; Alekcevetch, Jean Carlos; Cotta, Michelle Guitton; Verdeil, Jean-Luc; Lapeyre-Montes, Fabienne; Lartaud, Marc; Leroy, Thierry; De Bellis, Fabien; Pot, David; Rodrigues, Gustavo Costa; Carazzolle, Marcelo Falsarella; Pereira, Gonçalo Amarante Guimarães; Andrade, Alan Carvalho; Marraccini, Pierre

2016-04-19

Drought is a widespread limiting factor in coffee plants. It affects plant development, fruit production, bean development and consequently beverage quality. Genetic diversity for drought tolerance exists within the coffee genus. However, the molecular mechanisms underlying the adaptation of coffee plants to drought are largely unknown. In this study, we compared the molecular responses to drought in two commercial cultivars (IAPAR59, drought-tolerant and Rubi, drought-susceptible) of Coffea arabica grown in the field under control (irrigation) and drought conditions using the pyrosequencing of RNA extracted from shoot apices and analysing the expression of 38 candidate genes. Pyrosequencing from shoot apices generated a total of 34.7 Mbp and 535,544 reads enabling the identification of 43,087 clusters (41,512 contigs and 1,575 singletons). These data included 17,719 clusters (16,238 contigs and 1,575 singletons) exclusively from 454 sequencing reads, along with 25,368 hybrid clusters assembled with 454 sequences. The comparison of DNA libraries identified new candidate genes (n = 20) presenting differential expression between IAPAR59 and Rubi and/or drought conditions. Their expression was monitored in plagiotropic buds, together with those of other (n = 18) candidates genes. Under drought conditions, up-regulated expression was observed in IAPAR59 but not in Rubi for CaSTK1 (protein kinase), CaSAMT1 (SAM-dependent methyltransferase), CaSLP1 (plant development) and CaMAS1 (ABA biosynthesis). Interestingly, the expression of lipid-transfer protein (nsLTP) genes was also highly up-regulated under drought conditions in IAPAR59. This may have been related to the thicker cuticle observed on the abaxial leaf surface in IAPAR59 compared to Rubi. The full transcriptome assembly of C. arabica, followed by functional annotation, enabled us to identify differentially expressed genes related to drought conditions. Using these data, candidate genes were selected and their differential expression profiles were confirmed by qPCR experiments in plagiotropic buds of IAPAR59 and Rubi under drought conditions. As regards the genes up-regulated under drought conditions, specifically in the drought-tolerant IAPAR59, several corresponded to orphan genes but also to genes coding proteins involved in signal transduction pathways, as well as ABA and lipid metabolism, for example. The identification of these genes should help advance our understanding of the genetic determinism of drought tolerance in coffee.

Identification and characterization of genes responsible for biosynthesis of kojic acid, an industrially important compound from Aspergillus oryzae.

PubMed

Terabayashi, Yasunobu; Sano, Motoaki; Yamane, Noriko; Marui, Junichiro; Tamano, Koichi; Sagara, Junichi; Dohmoto, Mitsuko; Oda, Ken; Ohshima, Eiji; Tachibana, Kuniharu; Higa, Yoshitaka; Ohashi, Shinichi; Koike, Hideaki; Machida, Masayuki

2010-12-01

Kojic acid is produced in large amounts by Aspergillus oryzae as a secondary metabolite and is widely used in the cosmetic industry. Glucose can be converted to kojic acid, perhaps by only a few steps, but no genes for the conversion have thus far been revealed. Using a DNA microarray, gene expression profiles under three pairs of conditions significantly affecting kojic acid production were compared. All genes were ranked using an index parameter reflecting both high amounts of transcription and a high induction ratio under producing conditions. After disruption of nine candidate genes selected from the top of the list, two genes of unknown function were found to be responsible for kojic acid biosynthesis, one having an oxidoreductase motif and the other a transporter motif. These two genes are closely associated in the genome, showing typical characteristics of genes involved in secondary metabolism. Copyright © 2010 Elsevier Inc. All rights reserved.

Convergence of genome-wide association and candidate gene studies for alcoholism.

PubMed

Olfson, Emily; Bierut, Laura Jean

2012-12-01

Genome-wide association (GWA) studies have led to a paradigm shift in how researchers study the genetics underlying disease. Many GWA studies are now publicly available and can be used to examine whether or not previously proposed candidate genes are supported by GWA data. This approach is particularly important for the field of alcoholism because the contribution of many candidate genes remains controversial. Using the Human Genome Epidemiology (HuGE) Navigator, we selected candidate genes for alcoholism that have been frequently examined in scientific articles in the past decade. Specific candidate loci as well as all the reported single nucleotide polymorphisms (SNPs) in candidate genes were examined in the Study of Addiction: Genetics and Environment (SAGE), a GWA study comparing alcohol-dependent and nondependent subjects. Several commonly reported candidate loci, including rs1800497 in DRD2, rs698 in ADH1C, rs1799971 in OPRM1, and rs4680 in COMT, are not replicated in SAGE (p > 0.05). Among candidate loci available for analysis, only rs279858 in GABRA2 (p = 0.0052, OR = 1.16) demonstrated a modest association. Examination of all SNPs reported in SAGE in over 50 candidate genes revealed no SNPs with large frequency differences between cases and controls, and the lowest p-value of any SNP was 0.0006. We provide evidence that several extensively studied candidate loci do not have a strong contribution to risk of developing alcohol dependence in European and African ancestry populations. Owing to the lack of coverage, we were unable to rule out the contribution of other variants, and these genes and particular loci warrant further investigation. Our analysis demonstrates that publicly available GWA results can be used to better understand which if any of previously proposed candidate genes contribute to disease. Furthermore, we illustrate how examining the convergence of candidate gene and GWA studies can help elucidate the genetic architecture of alcoholism and more generally complex diseases. Copyright © 2012 by the Research Society on Alcoholism.

Identification of Quantitative Trait Loci (QTL) and Candidate Genes for Cadmium Tolerance in Populus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Induri, Brahma R; Ellis, Danielle R; Slavov, Gancho

2012-01-01

Knowledge of genetic variation in response of Populus to heavy metals like cadmium (Cd) is an important step in understanding the underlying mechanisms of tolerance. In this study, a pseudo-backcross pedigree of Populus trichocarpa and Populus deltoides was characterized for Cd exposure. The pedigree showed significant variation for Cd tolerance thus enabling the identification of relatively tolerant and susceptible genotypes for intensive characterization. A total of 16 QTLs at logarithm of odds (LOD) ratio > 2.5, were found to be associated with total dry weight, its components, and root volume. Four major QTLs for total dry weight were mapped tomore » different linkage groups in control (LG III) and Cd conditions (LG XVI) and had opposite allelic effects on Cd tolerance, suggesting that these genomic regions were differentially controlled. The phenotypic variation explained by Cd QTL for all traits under study varied from 5.9% to 11.6% and averaged 8.2% across all QTL. Leaf Cd contents also showed significant variation suggesting the phytoextraction potential of Populus genotypes, though heritability of this trait was low (0.22). A whole-genome microarray study was conducted by using two genotypes with extreme responses for Cd tolerance in the above study and differentially expressed genes were identified. Candidate genes including CAD2 (CADMIUM SENSITIVE 2), HMA5 (HEAVY METAL ATPase5), ATGTST1 (Arabidopsis thaliana Glutathione S-Transferase1), ATGPX6 (Glutathione peroxidase 6), and ATMRP 14 (Arabidopsis thaliana Multidrug Resistance associated Protein 14) were identified from QTL intervals and microarray study. Functional characterization of these candidate genes could enhance phytoremediation capabilities of Populus.« less

Systems genetics of intravenous cocaine self-administration in the BXD recombinant inbred mouse panel

PubMed Central

Dickson, Price E.; Miller, Mellessa M.; Calton, Michele A.; Bubier, Jason A.; Cook, Melloni N.; Goldowitz, Daniel; Chesler, Elissa J.; Mittleman, Guy

2015-01-01

Rationale Cocaine addiction is a major public health problem with a substantial genetic basis for which the biological mechanisms remain largely unknown. Systems genetics is a powerful method for discovering novel mechanisms underlying complex traits, and intravenous drug self-administration (IVSA) is the gold standard for assessing volitional drug use in preclinical studies. We have integrated these approaches to identify novel genes and networks underling cocaine use in mice. Methods Mice from 39 BXD strains acquired cocaine IVSA (0.56 mg/kg/infusion). Mice from 29 BXD strains completed a full dose-response curve (0.032 – 1.8 mg/kg/infusion). Results We identified independent genetic correlations between cocaine IVSA and measures of environmental exploration and cocaine sensitization. We identified genome-wide significant QTL on chromosomes 7 and 11 associated with shifts in the dose-response curve and on chromosome 16 associated with sessions to acquire cocaine IVSA. Using publicly available gene expression data from the nucleus accumbens, midbrain, and prefrontal cortex of drug-naïve mice, we identified Aplp1 and Cyfip2 as positional candidates underlying the behavioral QTL on chromosomes 7 and 11, respectively. A genome-wide significant trans-eQTL linking Fam53b (a GWAS candidate for human cocaine dependence) on chromosome 7 to the cocaine IVSA behavioral QTL on chromosome 11 was identified in the midbrain; Fam53b and Cyfip2 were co-expressed genome-wide significantly in the midbrain. This finding indicates that cocaine IVSA studies using mice can identify genes involved in human cocaine use. Conclusions These data provide novel candidate genes underlying cocaine IVSA in mice, and suggest mechanisms driving human cocaine use. PMID:26581503

A candidate multimodal functional genetic network for thermal adaptation

PubMed Central

Pathak, Rachana; Prajapati, Indira; Bankston, Shannon; Thompson, Aprylle; Usher, Jaytriece; Isokpehi, Raphael D.

2014-01-01

Vertebrate ectotherms such as reptiles provide ideal organisms for the study of adaptation to environmental thermal change. Comparative genomic and exomic studies can recover markers that diverge between warm and cold adapted lineages, but the genes that are functionally related to thermal adaptation may be difficult to identify. We here used a bioinformatics genome-mining approach to predict and identify functions for suitable candidate markers for thermal adaptation in the chicken. We first established a framework of candidate functions for such markers, and then compiled the literature on genes known to adapt to the thermal environment in different lineages of vertebrates. We then identified them in the genomes of human, chicken, and the lizard Anolis carolinensis, and established a functional genetic interaction network in the chicken. Surprisingly, markers initially identified from diverse lineages of vertebrates such as human and fish were all in close functional relationship with each other and more associated than expected by chance. This indicates that the general genetic functional network for thermoregulation and/or thermal adaptation to the environment might be regulated via similar evolutionarily conserved pathways in different vertebrate lineages. We were able to identify seven functions that were statistically overrepresented in this network, corresponding to four of our originally predicted functions plus three unpredicted functions. We describe this network as multimodal: central regulator genes with the function of relaying thermal signal (1), affect genes with different cellular functions, namely (2) lipoprotein metabolism, (3) membrane channels, (4) stress response, (5) response to oxidative stress, (6) muscle contraction and relaxation, and (7) vasodilation, vasoconstriction and regulation of blood pressure. This network constitutes a novel resource for the study of thermal adaptation in the closely related nonavian reptiles and other vertebrate ectotherms. PMID:25289178

Structural modelling and transcriptional responses highlight a clade of PpKAI2-LIKE genes as candidate receptors for strigolactones in Physcomitrella patens.

PubMed

Lopez-Obando, Mauricio; Conn, Caitlin E; Hoffmann, Beate; Bythell-Douglas, Rohan; Nelson, David C; Rameau, Catherine; Bonhomme, Sandrine

2016-06-01

A set of PpKAI2 - LIKE paralogs that may encode strigolactone receptors in Physcomitrella patens were identified through evolutionary, structural, and transcriptional analyses, suggesting that strigolactone perception may have evolved independently in basal land plants in a similar manner as spermatophytes. Carotenoid-derived compounds known as strigolactones are a new class of plant hormones that modulate development and interactions with parasitic plants and arbuscular mycorrhizal fungi. The strigolactone receptor protein DWARF14 (D14) belongs to the α/β hydrolase family. D14 is closely related to KARRIKIN INSENSITIVE2 (KAI2), a receptor of smoke-derived germination stimulants called karrikins. Strigolactone and karrikin structures share a butenolide ring that is necessary for bioactivity. Charophyte algae and basal land plants produce strigolactones that influence their development. However phylogenetic studies suggest that D14 is absent from algae, moss, and liverwort genomes, raising the question of how these basal plants perceive strigolactones. Strigolactone perception during seed germination putatively evolved in parasitic plants through gene duplication and neofunctionalization of KAI2 paralogs. The moss Physcomitrella patens shows an increase in KAI2 gene copy number, similar to parasitic plants. In this study we investigated whether P. patens KAI2-LIKE (PpKAI2L) genes may contribute to strigolactone perception. Based on phylogenetic analyses and homology modelling, we predict that a clade of PpKAI2L proteins have enlarged ligand-binding cavities, similar to D14. We observed that some PpKAI2L genes have transcriptional responses to the synthetic strigolactone GR24 racemate or its enantiomers. These responses were influenced by light and dark conditions. Moreover, (+)-GR24 seems to be the active enantiomer that induces the transcriptional responses of PpKAI2L genes. We hypothesize that members of specific PpKAI2L clades are candidate strigolactone receptors in moss.

Cross-Study Comparison Reveals Common Genomic, Network, and Functional Signatures of Desiccation Resistance in Drosophila melanogaster

PubMed Central

Telonis-Scott, Marina; Sgrò, Carla M.; Hoffmann, Ary A.; Griffin, Philippa C.

2016-01-01

Repeated attempts to map the genomic basis of complex traits often yield different outcomes because of the influence of genetic background, gene-by-environment interactions, and/or statistical limitations. However, where repeatability is low at the level of individual genes, overlap often occurs in gene ontology categories, genetic pathways, and interaction networks. Here we report on the genomic overlap for natural desiccation resistance from a Pool-genome-wide association study experiment and a selection experiment in flies collected from the same region in southeastern Australia in different years. We identified over 600 single nucleotide polymorphisms associated with desiccation resistance in flies derived from almost 1,000 wild-caught genotypes, a similar number of loci to that observed in our previous genomic study of selected lines, demonstrating the genetic complexity of this ecologically important trait. By harnessing the power of cross-study comparison, we narrowed the candidates from almost 400 genes in each study to a core set of 45 genes, enriched for stimulus, stress, and defense responses. In addition to gene-level overlap, there was higher order congruence at the network and functional levels, suggesting genetic redundancy in key stress sensing, stress response, immunity, signaling, and gene expression pathways. We also identified variants linked to different molecular aspects of desiccation physiology previously verified from functional experiments. Our approach provides insight into the genomic basis of a complex and ecologically important trait and predicts candidate genetic pathways to explore in multiple genetic backgrounds and related species within a functional framework. PMID:26733490

Defining the Human Macula Transcriptome and Candidate Retinal Disease Genes UsingEyeSAGE

PubMed Central

Rickman, Catherine Bowes; Ebright, Jessica N.; Zavodni, Zachary J.; Yu, Ling; Wang, Tianyuan; Daiger, Stephen P.; Wistow, Graeme; Boon, Kathy; Hauser, Michael A.

2009-01-01

Purpose To develop large-scale, high-throughput annotation of the human macula transcriptome and to identify and prioritize candidate genes for inherited retinal dystrophies, based on ocular-expression profiles using serial analysis of gene expression (SAGE). Methods Two human retina and two retinal pigment epithelium (RPE)/choroid SAGE libraries made from matched macula or midperipheral retina and adjacent RPE/choroid of morphologically normal 28- to 66-year-old donors and a human central retina longSAGE library made from 41- to 66-year-old donors were generated. Their transcription profiles were entered into a relational database, EyeSAGE, including microarray expression profiles of retina and publicly available normal human tissue SAGE libraries. EyeSAGE was used to identify retina- and RPE-specific and -associated genes, and candidate genes for retina and RPE disease loci. Differential and/or cell-type specific expression was validated by quantitative and single-cell RT-PCR. Results Cone photoreceptor-associated gene expression was elevated in the macula transcription profiles. Analysis of the longSAGE retina tags enhanced tag-to-gene mapping and revealed alternatively spliced genes. Analysis of candidate gene expression tables for the identified Bardet-Biedl syndrome disease gene (BBS5) in the BBS5 disease region table yielded BBS5 as the top candidate. Compelling candidates for inherited retina diseases were identified. Conclusions The EyeSAGE database, combining three different gene-profiling platforms including the authors’ multidonor-derived retina/RPE SAGE libraries and existing single-donor retina/RPE libraries, is a powerful resource for definition of the retina and RPE transcriptomes. It can be used to identify retina-specific genes, including alternatively spliced transcripts and to prioritize candidate genes within mapped retinal disease regions. PMID:16723438

Defining the human macula transcriptome and candidate retinal disease genes using EyeSAGE.

PubMed

Bowes Rickman, Catherine; Ebright, Jessica N; Zavodni, Zachary J; Yu, Ling; Wang, Tianyuan; Daiger, Stephen P; Wistow, Graeme; Boon, Kathy; Hauser, Michael A

2006-06-01

To develop large-scale, high-throughput annotation of the human macula transcriptome and to identify and prioritize candidate genes for inherited retinal dystrophies, based on ocular-expression profiles using serial analysis of gene expression (SAGE). Two human retina and two retinal pigment epithelium (RPE)/choroid SAGE libraries made from matched macula or midperipheral retina and adjacent RPE/choroid of morphologically normal 28- to 66-year-old donors and a human central retina longSAGE library made from 41- to 66-year-old donors were generated. Their transcription profiles were entered into a relational database, EyeSAGE, including microarray expression profiles of retina and publicly available normal human tissue SAGE libraries. EyeSAGE was used to identify retina- and RPE-specific and -associated genes, and candidate genes for retina and RPE disease loci. Differential and/or cell-type specific expression was validated by quantitative and single-cell RT-PCR. Cone photoreceptor-associated gene expression was elevated in the macula transcription profiles. Analysis of the longSAGE retina tags enhanced tag-to-gene mapping and revealed alternatively spliced genes. Analysis of candidate gene expression tables for the identified Bardet-Biedl syndrome disease gene (BBS5) in the BBS5 disease region table yielded BBS5 as the top candidate. Compelling candidates for inherited retina diseases were identified. The EyeSAGE database, combining three different gene-profiling platforms including the authors' multidonor-derived retina/RPE SAGE libraries and existing single-donor retina/RPE libraries, is a powerful resource for definition of the retina and RPE transcriptomes. It can be used to identify retina-specific genes, including alternatively spliced transcripts and to prioritize candidate genes within mapped retinal disease regions.

Signatures of Rapid Evolution in Urban and Rural Transcriptomes of White-Footed Mice (Peromyscus leucopus) in the New York Metropolitan Area

PubMed Central

Harris, Stephen E.; Munshi-South, Jason; Obergfell, Craig; O’Neill, Rachel

2013-01-01

Urbanization is a major cause of ecological degradation around the world, and human settlement in large cities is accelerating. New York City (NYC) is one of the oldest and most urbanized cities in North America, but still maintains 20% vegetation cover and substantial populations of some native wildlife. The white-footed mouse, Peromyscus leucopus , is a common resident of NYC’s forest fragments and an emerging model system for examining the evolutionary consequences of urbanization. In this study, we developed transcriptomic resources for urban P . leucopus to examine evolutionary changes in protein-coding regions for an exemplar “urban adapter.” We used Roche 454 GS FLX+ high throughput sequencing to derive transcriptomes from multiple tissues from individuals across both urban and rural populations. From these data, we identified 31,015 SNPs and several candidate genes potentially experiencing positive selection in urban populations of P . leucopus . These candidate genes are involved in xenobiotic metabolism, innate immune response, demethylation activity, and other important biological phenomena in novel urban environments. This study is one of the first to report candidate genes exhibiting signatures of directional selection in divergent urban ecosystems. PMID:24015321

Evolutionary transgenomics: prospects and challenges.

PubMed

Correa, Raul; Baum, David A

2015-01-01

Many advances in our understanding of the genetic basis of species differences have arisen from transformation experiments, which allow us to study the effect of genes from one species (the donor) when placed in the genetic background of another species (the recipient). Such interspecies transformation experiments are usually focused on candidate genes - genes that, based on work in model systems, are suspected to be responsible for certain phenotypic differences between the donor and recipient species. We suggest that the high efficiency of transformation in a few plant species, most notably Arabidopsis thaliana, combined with the small size of typical plant genes and their cis-regulatory regions allow implementation of a screening strategy that does not depend upon a priori candidate gene identification. This approach, transgenomics, entails moving many large genomic inserts of a donor species into the wild type background of a recipient species and then screening for dominant phenotypic effects. As a proof of concept, we recently conducted a transgenomic screen that analyzed more than 1100 random, large genomic inserts of the Alabama gladecress Leavenworthia alabamica for dominant phenotypic effects in the A. thaliana background. This screen identified one insert that shortens fruit and decreases A. thaliana fertility. In this paper we discuss the principles of transgenomic screens and suggest methods to help minimize the frequencies of false positive and false negative results. We argue that, because transgenomics avoids committing in advance to candidate genes it has the potential to help us identify truly novel genes or cryptic functions of known genes. Given the valuable knowledge that is likely to be gained, we believe the time is ripe for the plant evolutionary community to invest in transgenomic screens, at least in the mustard family Brassicaceae where many species are amenable to efficient transformation.

Candidate gene identification of ovulation-inducing genes by RNA sequencing with an in vivo assay in zebrafish.

PubMed

Klangnurak, Wanlada; Fukuyo, Taketo; Rezanujjaman, M D; Seki, Masahide; Sugano, Sumio; Suzuki, Yutaka; Tokumoto, Toshinobu

2018-01-01

We previously reported the microarray-based selection of three ovulation-related genes in zebrafish. We used a different selection method in this study, RNA sequencing analysis. An additional eight up-regulated candidates were found as specifically up-regulated genes in ovulation-induced samples. Changes in gene expression were confirmed by qPCR analysis. Furthermore, up-regulation prior to ovulation during natural spawning was verified in samples from natural pairing. Gene knock-out zebrafish strains of one of the candidates, the starmaker gene (stm), were established by CRISPR genome editing techniques. Unexpectedly, homozygous mutants were fertile and could spawn eggs. However, a high percentage of unfertilized eggs and abnormal embryos were produced from these homozygous females. The results suggest that the stm gene is necessary for fertilization. In this study, we selected additional ovulation-inducing candidate genes, and a novel function of the stm gene was investigated.

Candidate genes for Alzheimer's disease are associated with individual differences in plasma levels of beta amyloid peptides in adults with Down syndrome.

PubMed

Schupf, Nicole; Lee, Annie; Park, Naeun; Dang, Lam-Ha; Pang, Deborah; Yale, Alexander; Oh, David Kyung-Taek; Krinsky-McHale, Sharon J; Jenkins, Edmund C; Luchsinger, José A; Zigman, Warren B; Silverman, Wayne; Tycko, Benjamin; Kisselev, Sergey; Clark, Lorraine; Lee, Joseph H

2015-10-01

We examined the contribution of candidates genes for Alzheimer's disease (AD) to individual differences in levels of beta amyloid peptides in adults with Down syndrom, a population at high risk for AD. Participants were 254 non-demented adults with Down syndrome, 30-78 years of age. Genomic deoxyribonucleic acid was genotyped using an Illumina GoldenGate custom array. We used linear regression to examine differences in levels of Aβ peptides associated with the number of risk alleles, adjusting for age, sex, level of intellectual disability, race and/or ethnicity, and the presence of the APOE ε4 allele. For Aβ42 levels, the strongest gene-wise association was found for a single nucleotide polymorphism (SNP) on CAHLM1; for Aβ40 levels, the strongest gene-wise associations were found for SNPs in IDE and SOD1, while the strongest gene-wise associations with levels of the Aβ42/Aβ40 ratio were found for SNPs in SORCS1. Broadly classified, variants in these genes may influence amyloid precursor protein processing (CALHM1, IDE), vesicular trafficking (SORCS1), and response to oxidative stress (SOD1). Copyright © 2015 Elsevier Inc. All rights reserved.

Abscisic Acid (ABA) Regulation of Arabidopsis SR Protein Gene Expression

PubMed Central

Cruz, Tiago M. D.; Carvalho, Raquel F.; Richardson, Dale N.; Duque, Paula

2014-01-01

Serine/arginine-rich (SR) proteins are major modulators of alternative splicing, a key generator of proteomic diversity and flexible means of regulating gene expression likely to be crucial in plant environmental responses. Indeed, mounting evidence implicates splicing factors in signal transduction of the abscisic acid (ABA) phytohormone, which plays pivotal roles in the response to various abiotic stresses. Using real-time RT-qPCR, we analyzed total steady-state transcript levels of the 18 SR and two SR-like genes from Arabidopsis thaliana in seedlings treated with ABA and in genetic backgrounds with altered expression of the ABA-biosynthesis ABA2 and the ABA-signaling ABI1 and ABI4 genes. We also searched for ABA-responsive cis elements in the upstream regions of the 20 genes. We found that members of the plant-specific SC35-Like (SCL) Arabidopsis SR protein subfamily are distinctively responsive to exogenous ABA, while the expression of seven SR and SR-related genes is affected by alterations in key components of the ABA pathway. Finally, despite pervasiveness of established ABA-responsive promoter elements in Arabidopsis SR and SR-like genes, their expression is likely governed by additional, yet unidentified cis-acting elements. Overall, this study pinpoints SR34, SR34b, SCL30a, SCL28, SCL33, RS40, SR45 and SR45a as promising candidates for involvement in ABA-mediated stress responses. PMID:25268622

Long-term affected flat oyster (Ostrea edulis) haemocytes show differential gene expression profiles from naïve oysters in response to Bonamia ostreae.

PubMed

Ronza, P; Cao, A; Robledo, D; Gómez-Tato, A; Álvarez-Dios, J A; Hasanuzzaman, A F M; Quiroga, M I; Villalba, A; Pardo, B G; Martínez, P

2018-04-18

European flat oyster (Ostrea edulis) production has suffered a severe decline due to bonamiosis. The responsible parasite enters in oyster haemocytes, causing an acute inflammatory response frequently leading to death. We used an immune-enriched oligo-microarray to understand the haemocyte response to Bonamia ostreae by comparing expression profiles between naïve (NS) and long-term affected (AS) populations along a time series (1 d, 30 d, 90 d). AS showed a much higher response just after challenge, which might be indicative of selection for resistance. No regulated genes were detected at 30 d in both populations while a notable reactivation was observed at 90 d, suggesting parasite latency during infection. Genes related to extracellular matrix and protease inhibitors, up-regulated in AS, and those related to histones, down-regulated in NS, might play an important role along the infection. Twenty-four candidate genes related to resistance should be further validated for selection programs aimed to control bonamiosis. Copyright © 2018 Elsevier Inc. All rights reserved.

Filling gaps in PPAR-alpha signaling through comparative nutrigenomics analysis

PubMed Central

2009-01-01

Background The application of high-throughput genomic tools in nutrition research is a widespread practice. However, it is becoming increasingly clear that the outcome of individual expression studies is insufficient for the comprehensive understanding of such a complex field. Currently, the availability of the large amounts of expression data in public repositories has opened up new challenges on microarray data analyses. We have focused on PPARα, a ligand-activated transcription factor functioning as fatty acid sensor controlling the gene expression regulation of a large set of genes in various metabolic organs such as liver, small intestine or heart. The function of PPARα is strictly connected to the function of its target genes and, although many of these have already been identified, major elements of its physiological function remain to be uncovered. To further investigate the function of PPARα, we have applied a cross-species meta-analysis approach to integrate sixteen microarray datasets studying high fat diet and PPARα signal perturbations in different organisms. Results We identified 164 genes (MDEGs) that were differentially expressed in a constant way in response to a high fat diet or to perturbations in PPARs signalling. In particular, we found five genes in yeast which were highly conserved and homologous of PPARα targets in mammals, potential candidates to be used as models for the equivalent mammalian genes. Moreover, a screening of the MDEGs for all known transcription factor binding sites and the comparison with a human genome-wide screening of Peroxisome Proliferating Response Elements (PPRE), enabled us to identify, 20 new potential candidate genes that show, both binding site, both change in expression in the condition studied. Lastly, we found a non random localization of the differentially expressed genes in the genome. Conclusion The results presented are potentially of great interest to resume the currently available expression data, exploiting the power of in silico analysis filtered by evolutionary conservation. The analysis enabled us to indicate potential gene candidates that could fill in the gaps with regards to the signalling of PPARα and, moreover, the non-random localization of the differentially expressed genes in the genome, suggest that epigenetic mechanisms are of importance in the regulation of the transcription operated by PPARα. PMID:20003344

Partial genome assembly for a candidate division OP11 single cell from an anoxic spring (Zodletone Spring, Oklahoma).

PubMed

Youssef, Noha H; Blainey, Paul C; Quake, Stephen R; Elshahed, Mostafa S

2011-11-01

Members of candidate division OP11 are widely distributed in terrestrial and marine ecosystems, yet little information regarding their metabolic capabilities and ecological role within such habitats is currently available. Here, we report on the microfluidic isolation, multiple-displacement-amplification, pyrosequencing, and genomic analysis of a single cell (ZG1) belonging to candidate division OP11. Genome analysis of the ∼270-kb partial genome assembly obtained showed that it had no particular similarity to a specific phylum. Four hundred twenty-three open reading frames were identified, 46% of which had no function prediction. In-depth analysis revealed a heterotrophic lifestyle, with genes encoding endoglucanase, amylopullulanase, and laccase enzymes, suggesting a capacity for utilization of cellulose, starch, and, potentially, lignin, respectively. Genes encoding several glycolysis enzymes as well as formate utilization were identified, but no evidence for an electron transport chain was found. The presence of genes encoding various components of lipopolysaccharide biosynthesis indicates a Gram-negative bacterial cell wall. The partial genome also provides evidence for antibiotic resistance (β-lactamase, aminoglycoside phosphotransferase), as well as antibiotic production (bacteriocin) and extracellular bactericidal peptidases. Multiple mechanisms for stress response were identified, as were elements of type I and type IV secretion systems. Finally, housekeeping genes identified within the partial genome were used to demonstrate the OP11 affiliation of multiple hitherto unclassified genomic fragments from multiple database-deposited metagenomic data sets. These results provide the first glimpse into the lifestyle of a member of a ubiquitous, yet poorly understood bacterial candidate division.

Pea Marker Database (PMD) - A new online database combining known pea (Pisum sativum L.) gene-based markers.

PubMed

Kulaeva, Olga A; Zhernakov, Aleksandr I; Afonin, Alexey M; Boikov, Sergei S; Sulima, Anton S; Tikhonovich, Igor A; Zhukov, Vladimir A

2017-01-01

Pea (Pisum sativum L.) is the oldest model object of plant genetics and one of the most agriculturally important legumes in the world. Since the pea genome has not been sequenced yet, identification of genes responsible for mutant phenotypes or desirable agricultural traits is usually performed via genetic mapping followed by candidate gene search. Such mapping is best carried out using gene-based molecular markers, as it opens the possibility for exploiting genome synteny between pea and its close relative Medicago truncatula Gaertn., possessing sequenced and annotated genome. In the last 5 years, a large number of pea gene-based molecular markers have been designed and mapped owing to the rapid evolution of "next-generation sequencing" technologies. However, the access to the complete set of markers designed worldwide is limited because the data are not uniformed and therefore hard to use. The Pea Marker Database was designed to combine the information about pea markers in a form of user-friendly and practical online tool. Version 1 (PMD1) comprises information about 2484 genic markers, including their locations in linkage groups, the sequences of corresponding pea transcripts and the names of related genes in M. truncatula. Version 2 (PMD2) is an updated version comprising 15944 pea markers in the same format with several advanced features. To test the performance of the PMD, fine mapping of pea symbiotic genes Sym13 and Sym27 in linkage groups VII and V, respectively, was carried out. The results of mapping allowed us to propose the Sen1 gene (a homologue of SEN1 gene of Lotus japonicus (Regel) K. Larsen) as the best candidate gene for Sym13, and to narrow the list of possible candidate genes for Sym27 to ten, thus proving PMD to be useful for pea gene mapping and cloning. All information contained in PMD1 and PMD2 is available at www.peamarker.arriam.ru.

Mapping of Mcs30, a new mammary carcinoma susceptibility quantitative trait locus (QTL30) on rat chromosome 12: identification of fry as a candidate Mcs gene.

PubMed

Ren, Xuefeng; Graham, Jessica C; Jing, Lichen; Mikheev, Andrei M; Gao, Yuan; Lew, Jenny Pan; Xie, Hong; Kim, Andrea S; Shang, Xiuling; Friedman, Cynthia; Vail, Graham; Fang, Ming Zhu; Bromberg, Yana; Zarbl, Helmut

2013-01-01

Rat strains differ dramatically in their susceptibility to mammary carcinogenesis. On the assumption that susceptibility genes are conserved across mammalian species and hence inform human carcinogenesis, numerous investigators have used genetic linkage studies in rats to identify genes responsible for differential susceptibility to carcinogenesis. Using a genetic backcross between the resistant Copenhagen (Cop) and susceptible Fischer 344 (F344) strains, we mapped a novel mammary carcinoma susceptibility (Mcs30) locus to the centromeric region on chromosome 12 (LOD score of ∼8.6 at the D12Rat59 marker). The Mcs30 locus comprises approximately 12 Mbp on the long arm of rat RNO12 whose synteny is conserved on human chromosome 13q12 to 13q13. After analyzing numerous genes comprising this locus, we identified Fry, the rat ortholog of the furry gene of Drosophila melanogaster, as a candidate Mcs gene. We cloned and determined the complete nucleotide sequence of the 13 kbp Fry mRNA. Sequence analysis indicated that the Fry gene was highly conserved across evolution, with 90% similarity of the predicted amino acid sequence among eutherian mammals. Comparison of the Fry sequence in the Cop and F344 strains identified two non-synonymous single nucleotide polymorphisms (SNPs), one of which creates a putative, de novo phosphorylation site. Further analysis showed that the expression of the Fry gene is reduced in a majority of rat mammary tumors. Our results also suggested that FRY activity was reduced in human breast carcinoma cell lines as a result of reduced levels or mutation. This study is the first to identify the Fry gene as a candidate Mcs gene. Our data suggest that the SNPs within the Fry gene contribute to the genetic susceptibility of the F344 rat strain to mammary carcinogenesis. These results provide the foundation for analyzing the role of the human FRY gene in cancer susceptibility and progression.

Genetic and Genomic Response to Selection for Food Consumption in Drosophila melanogaster.

PubMed

Garlapow, Megan E; Everett, Logan J; Zhou, Shanshan; Gearhart, Alexander W; Fay, Kairsten A; Huang, Wen; Morozova, Tatiana V; Arya, Gunjan H; Turlapati, Lavanya; St Armour, Genevieve; Hussain, Yasmeen N; McAdams, Sarah E; Fochler, Sophia; Mackay, Trudy F C

2017-03-01

Food consumption is an essential component of animal fitness; however, excessive food intake in humans increases risk for many diseases. The roles of neuroendocrine feedback loops, food sensing modalities, and physiological state in regulating food intake are well understood, but not the genetic basis underlying variation in food consumption. Here, we applied ten generations of artificial selection for high and low food consumption in replicate populations of Drosophila melanogaster. The phenotypic response to selection was highly asymmetric, with significant responses only for increased food consumption and minimal correlated responses in body mass and composition. We assessed the molecular correlates of selection responses by DNA and RNA sequencing of the selection lines. The high and low selection lines had variants with significantly divergent allele frequencies within or near 2081 genes and 3526 differentially expressed genes in one or both sexes. A total of 519 genes were both genetically divergent and differentially expressed between the divergent selection lines. We performed functional analyses of the effects of RNAi suppression of gene expression and induced mutations for 27 of these candidate genes that have human orthologs and the strongest statistical support, and confirmed that 25 (93 %) affected the mean and/or variance of food consumption.

Gene expression patterns in formalin-fixed, paraffin-embedded core biopsies predict docetaxel chemosensitivity in breast cancer patients.

PubMed

Chang, Jenny C; Makris, Andreas; Gutierrez, M Carolina; Hilsenbeck, Susan G; Hackett, James R; Jeong, Jennie; Liu, Mei-Lan; Baker, Joffre; Clark-Langone, Kim; Baehner, Frederick L; Sexton, Krsytal; Mohsin, Syed; Gray, Tara; Alvarez, Laura; Chamness, Gary C; Osborne, C Kent; Shak, Steven

2008-03-01

Previously, we had identified gene expression patterns that predicted response to neoadjuvant docetaxel. Other studies have validated that a high Recurrence Score (RS) by the 21-gene RT-PCR assay is predictive of worse prognosis but better response to chemotherapy. We investigated whether tumor expression of these 21 genes and other candidate genes can predict response to docetaxel. Core biopsies from 97 patients were obtained before treatment with neoadjuvant docetaxel (4 cycles, 100 mg/m2 q3 weeks). Three 10-microm FFPE sections were submitted for quantitative RT-PCR assays of 192 genes that were selected from our previous work and the literature. Of the 97 patients, 81 (84%) had sufficient invasive cancer, 80 (82%) had sufficient RNA for QRTPCR assay, and 72 (74%) had clinical response data. Mean age was 48.5 years, and the median tumor size was 6 cm. Clinical complete responses (CR) were observed in 12 (17%), partial responses in 41 (57%), stable disease in 17 (24%), and progressive disease in 2 patients (3%). A significant relationship (P<0.05) between gene expression and CR was observed for 14 genes, including CYBA. CR was associated with lower expression of the ER gene group and higher expression of the proliferation gene group from the 21 gene assay. Of note, CR was more likely with a high RS (P=0.008). We have established molecular profiles of sensitivity to docetaxel. RT-PCR technology provides a potential platform for a predictive test of docetaxel chemosensitivity using small amounts of routinely processed material.

Transcriptomic analysis of Prunus domestica undergoing hypersensitive response to plum pox virus infection.

PubMed

Rodamilans, Bernardo; San León, David; Mühlberger, Louisa; Candresse, Thierry; Neumüller, Michael; Oliveros, Juan Carlos; García, Juan Antonio

2014-01-01

Plum pox virus (PPV) infects Prunus trees around the globe, posing serious fruit production problems and causing severe economic losses. One variety of Prunus domestica, named 'Jojo', develops a hypersensitive response to viral infection. Here we compared infected and non-infected samples using next-generation RNA sequencing to characterize the genetic complexity of the viral population in infected samples and to identify genes involved in development of the resistance response. Analysis of viral reads from the infected samples allowed reconstruction of a PPV-D consensus sequence. De novo reconstruction showed a second viral isolate of the PPV-Rec strain. RNA-seq analysis of PPV-infected 'Jojo' trees identified 2,234 and 786 unigenes that were significantly up- or downregulated, respectively (false discovery rate; FDR≤0.01). Expression of genes associated with defense was generally enhanced, while expression of those related to photosynthesis was repressed. Of the total of 3,020 differentially expressed unigenes, 154 were characterized as potential resistance genes, 10 of which were included in the NBS-LRR type. Given their possible role in plant defense, we selected 75 additional unigenes as candidates for further study. The combination of next-generation sequencing and a Prunus variety that develops a hypersensitive response to PPV infection provided an opportunity to study the factors involved in this plant defense mechanism. Transcriptomic analysis presented an overview of the changes that occur during PPV infection as a whole, and identified candidates suitable for further functional characterization.

Early induced protein 1 (PrELIP1) and other photosynthetic, stress and epigenetic regulation genes are involved in Pinus radiata D. don UV-B radiation response.

PubMed

Valledor, Luis; Cañal, María Jesús; Pascual, Jesús; Rodríguez, Roberto; Meijón, Mónica

2012-11-01

The continuous atmospheric and environmental deterioration is likely to increase, among others, the influx of ultraviolet B (UV-B) radiation. The plants have photoprotective responses, which are complex mechanisms involving different physiological responses, to avoid the damages caused by this radiation that may lead to plant death. We have studied the adaptive responses to UV-B in Pinus radiata, given the importance of this species in conifer forests and reforestation programs. We analyzed the photosynthetic activity, pigments content, and gene expression of candidate genes related to photosynthesis, stress and gene regulation in needles exposed to UV-B during a 96 h time course. The results reveal a clear increase of pigments under UV-B stress while photosynthetic activity decreased. The expression levels of the studied genes drastically changed after UV-B exposure, were stress related genes were upregulated while photosynthesis (RBCA and RBCS) and epigenetic regulation were downregulated (MSI1, CSDP2, SHM4). The novel gene PrELIP1, fully sequenced for this work, was upregulated and expressed mainly in the palisade parenchyma of needles. This gene has conserved domains related to the dissipation of the UV-B radiation that give to this protein a key role during photoprotection response of the needles in Pinus radiata. Copyright © Physiologia Plantarum 2012.

Characterization of WRKY transcription factors in Solanum lycopersicum reveals collinearity and their expression patterns under cold treatment.

PubMed

Chen, Lin; Yang, Yang; Liu, Can; Zheng, Yanyan; Xu, Mingshuang; Wu, Na; Sheng, Jiping; Shen, Lin

2015-08-28

WRKY transcription factors play an important role in cold defense of plants. However, little information is available about the cold-responsive WRKYs in tomato (Solanum lycopersicum). In the present study, a complete characterization of this gene family was described. Eighty WRKY genes in the tomato genome were identified. Almost all WRKY genes contain putative stress-responsive cis-elements in their promoter regions. Segmental duplications contributed significantly to the expansion of the SlWRKY gene family. Transcriptional analysis revealed notable differential expression in tomato tissues and expression patterns under cold stress, which indicated wide functional divergence in this family. Ten WRKYs in tomato were strongly induced more than 2-fold during cold stress. These genes represented candidate genes for future functional analysis of WRKYs involved in the cold-related signal pathways. Our data provide valuable information about tomato WRKY proteins and form a foundation for future studies of these proteins, especially for those that play an important role in response to cold stress. Copyright © 2015 Elsevier Inc. All rights reserved.

Linkage analysis of schizophrenia with five dopamine receptor genes in nine pedigrees

DOE Office of Scientific and Technical Information (OSTI.GOV)

Coon, H.; Byerley, W.; Holik, J.

Alterations in dopamine neurotransmission have been strongly implicated in the pathogenesis of schizophrenia for nearly 2 decades. Recently, the genes for five dopamine receptors have been cloned and characterized, and genetic and physical map information has become available. Using these five loci as candidate genes, the authors have tested for genetic linkage to schizophrenia in nine multigenerational families which include multiple affected individuals. In addition to testing conservative disease models, the have used a neurophysiological indicator variable, the P50 auditory evoked response. Deficits in gating of the P50 response have been shown to segregate with schizophrenia in this sample andmore » may identify carriers of gene(s) predisposing for schizophrenia. Linkage results were consistently negative, indicating that a defect at any of the actual receptor sites is unlikely to be a major contributor to schizophrenia in the nine families studied. 47 refs., 1 fig., 4 tabs.« less

Next-generation sequencing to identify candidate genes and develop diagnostic markers for a novel Phytophthora resistance gene, RpsHC18, in soybean.

PubMed

Zhong, Chao; Sun, Suli; Li, Yinping; Duan, Canxing; Zhu, Zhendong

2018-03-01

A novel Phytophthora sojae resistance gene RpsHC18 was identified and finely mapped on soybean chromosome 3. Two NBS-LRR candidate genes were identified and two diagnostic markers of RpsHC18 were developed. Phytophthora root rot caused by Phytophthora sojae is a destructive disease of soybean. The most effective disease-control strategy is to deploy resistant cultivars carrying Phytophthora-resistant Rps genes. The soybean cultivar Huachun 18 has a broad and distinct resistance spectrum to 12 P. sojae isolates. Quantitative trait loci sequencing (QTL-seq), based on the whole-genome resequencing (WGRS) of two extreme resistant and susceptible phenotype bulks from an F 2:3 population, was performed, and one 767-kb genomic region with ΔSNP-index ≥ 0.9 on chromosome 3 was identified as the RpsHC18 candidate region in Huachun 18. The candidate region was reduced to a 146-kb region by fine mapping. Nonsynonymous SNP and haplotype analyses were carried out in the 146-kb region among ten soybean genotypes using WGRS. Four specific nonsynonymous SNPs were identified in two nucleotide-binding sites-leucine-rich repeat (NBS-LRR) genes, RpsHC18-NBL1 and RpsHC18-NBL2, which were considered to be the candidate genes. Finally, one specific SNP marker in each candidate gene was successfully developed using a tetra-primer ARMS-PCR assay, and the two markers were verified to be specific for RpsHC18 and to effectively distinguish other known Rps genes. In this study, we applied an integrated genomic-based strategy combining WGRS with traditional genetic mapping to identify RpsHC18 candidate genes and develop diagnostic markers. These results suggest that next-generation sequencing is a precise, rapid and cost-effective way to identify candidate genes and develop diagnostic markers, and it can accelerate Rps gene cloning and marker-assisted selection for breeding of P. sojae-resistant soybean cultivars.

Database of cattle candidate genes and genetic markers for milk production and mastitis

PubMed Central

Ogorevc, J; Kunej, T; Razpet, A; Dovc, P

2009-01-01

A cattle database of candidate genes and genetic markers for milk production and mastitis has been developed to provide an integrated research tool incorporating different types of information supporting a genomic approach to study lactation, udder development and health. The database contains 943 genes and genetic markers involved in mammary gland development and function, representing candidates for further functional studies. The candidate loci were drawn on a genetic map to reveal positional overlaps. For identification of candidate loci, data from seven different research approaches were exploited: (i) gene knockouts or transgenes in mice that result in specific phenotypes associated with mammary gland (143 loci); (ii) cattle QTL for milk production (344) and mastitis related traits (71); (iii) loci with sequence variations that show specific allele-phenotype interactions associated with milk production (24) or mastitis (10) in cattle; (iv) genes with expression profiles associated with milk production (207) or mastitis (107) in cattle or mouse; (v) cattle milk protein genes that exist in different genetic variants (9); (vi) miRNAs expressed in bovine mammary gland (32) and (vii) epigenetically regulated cattle genes associated with mammary gland function (1). Fourty-four genes found by multiple independent analyses were suggested as the most promising candidates and were further in silico analysed for expression levels in lactating mammary gland, genetic variability and top biological functions in functional networks. A miRNA target search for mammary gland expressed miRNAs identified 359 putative binding sites in 3′UTRs of candidate genes. PMID:19508288

Reference genes for normalization of qPCR assays in sugarcane plants under water deficit.

PubMed

de Andrade, Larissa Mara; Dos Santos Brito, Michael; Fávero Peixoto Junior, Rafael; Marchiori, Paulo Eduardo Ribeiro; Nóbile, Paula Macedo; Martins, Alexandre Palma Boer; Ribeiro, Rafael Vasconcelos; Creste, Silvana

2017-01-01

Sugarcane ( Saccharum spp.) is the main raw material for sugar and ethanol production. Among the abiotic stress, drought is the main one that negatively impact sugarcane yield. Although gene expression analysis through quantitative PCR (qPCR) has increased our knowledge about biological processes related to drought, gene network that mediates sugarcane responses to water deficit remains elusive. In such scenario, validation of reference gene is a major requirement for successful analyzes involving qPCR. In this study, candidate genes were tested for their suitable as reference genes for qPCR analyses in two sugarcane cultivars with varying drought tolerance. Eight candidate reference genes were evaluated in leaves sampled in plants subjected to water deficit in both field and greenhouse conditions. In addition, five genes were evaluated in shoot roots of plants subjected to water deficit by adding PEG8000 to the nutrient solution. NormFinder and RefFinder algorithms were used to identify the most stable gene(s) among genotypes and under different experimental conditions. Both algorithms revealed that in leaf samples, UBQ1 and GAPDH genes were more suitable as reference genes, whereas GAPDH was the best reference one in shoot roots. Reference genes suitable for sugarcane under water deficit were identified, which would lead to a more accurate and reliable analysis of qPCR. Thus, results obtained in this study may guide future research on gene expression in sugarcane under varying water conditions.

Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters

PubMed Central

Mishra, Avinash; Tanna, Bhakti

2017-01-01

Halophytes have demonstrated their capability to thrive under extremely saline conditions and thus considered as one of the best germplasm for saline agriculture. Salinity is a worldwide problem, and the salt-affected areas are increasing day-by-day because of scanty rainfall, poor irrigation system, salt ingression, water contamination, and other environmental factors. The salinity stress tolerance mechanism is a very complex phenomenon, and some pathways are coordinately linked for imparting salinity tolerance. Though a number of salt responsive genes have been reported from the halophytes, there is always a quest for promising stress-responsive genes that can modulate plant physiology according to the salt stress. Halophytes such as Aeluropus, Mesembryanthemum, Suaeda, Atriplex, Thellungiella, Cakile, and Salicornia serve as a potential candidate for the salt-responsive genes and promoters. Several known genes like antiporters (NHX, SOS, HKT, VTPase), ion channels (Cl−, Ca2+, aquaporins), antioxidant encoding genes (APX, CAT, GST, BADH, SOD) and some novel genes such as USP, SDR1, SRP etc. were isolated from halophytes and explored for developing stress tolerance in the crop plants (glycophytes). It is evidenced that stress triggers salt sensors that lead to the activation of stress tolerance mechanisms which involve multiple signaling proteins, up- or down-regulation of several genes, and finally the distinctive or collective effects of stress-responsive genes. In this review, halophytes are discussed as an excellent platform for salt responsive genes which can be utilized for developing salinity tolerance in crop plants through genetic engineering. PMID:28572812

Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters.

PubMed

Mishra, Avinash; Tanna, Bhakti

2017-01-01

Halophytes have demonstrated their capability to thrive under extremely saline conditions and thus considered as one of the best germplasm for saline agriculture. Salinity is a worldwide problem, and the salt-affected areas are increasing day-by-day because of scanty rainfall, poor irrigation system, salt ingression, water contamination, and other environmental factors. The salinity stress tolerance mechanism is a very complex phenomenon, and some pathways are coordinately linked for imparting salinity tolerance. Though a number of salt responsive genes have been reported from the halophytes, there is always a quest for promising stress-responsive genes that can modulate plant physiology according to the salt stress. Halophytes such as Aeluropus, Mesembryanthemum, Suaeda, Atriplex, Thellungiella, Cakile , and Salicornia serve as a potential candidate for the salt-responsive genes and promoters. Several known genes like antiporters ( NHX, SOS, HKT, VTPase ), ion channels (Cl - , Ca 2+ , aquaporins), antioxidant encoding genes ( APX, CAT, GST, BADH, SOD ) and some novel genes such as USP, SDR1, SRP etc. were isolated from halophytes and explored for developing stress tolerance in the crop plants (glycophytes). It is evidenced that stress triggers salt sensors that lead to the activation of stress tolerance mechanisms which involve multiple signaling proteins, up- or down-regulation of several genes, and finally the distinctive or collective effects of stress-responsive genes. In this review, halophytes are discussed as an excellent platform for salt responsive genes which can be utilized for developing salinity tolerance in crop plants through genetic engineering.

Comparison of immune responses to different foot-and-mouth disease genetically engineered vaccines in guinea pigs.

PubMed

Yao, Qingxia; Qian, Ping; Huang, Qinfeng; Cao, Yi; Chen, Huanchun

2008-01-01

The P12A3C gene from FMDV (serotype O) encoding the capsid precursor protein, and the highly immunogenic gene FHG, which encodes multiple epitopes of FMDV capsid proteins, were inserted into eukaryotic expression vectors to compare different candidate genetically engineered vaccines for foot-and-mouth disease (FMD). A modified live pseudorabies virus (MLPRV) was also used to deliver P12A3C. Guinea pigs were inoculated intramuscularly with the candidate vaccines to compare the ability to elicit immunity of the DNA vector and a live viral vector. An indirect enzyme-linked immunosorbent assay (iELISA), virus-neutralization test and lymphoproliferation assay were used to detect antibody and cellular responses. The group immunized with P12A3C delivered by MLPRV produced significantly greater antibody and cellular responses indicating that MLPRV has a greater ability to mediate exogenous gene delivery than the plasmid DNA vector. Comparison of the immune responses induced by P12A3C and FHG, which were both mediated by DNA plasmids, showed that FHG and P12A3C elicited similar cellular responses, while P12A3C induced higher antibody levels, suggesting that P12A3C is a more powerful immunogen than FHG. In challenge experiments, guinea pigs vaccinated with P12A3C delivered by MLPRV were protected fully from FMDV challenge, whereas guinea pigs vaccinated with P12A3C or FHG delivered by DNA plasmid were only protected partially. This study provides a basis for future construction of a genetically engineered vaccine for FMDV.

The response and recovery of the Arabidopsis thaliana transcriptome to phosphate starvation.

PubMed

Woo, Jongchan; MacPherson, Cameron Ross; Liu, Jun; Wang, Huan; Kiba, Takatoshi; Hannah, Matthew A; Wang, Xiu-Jie; Bajic, Vladimir B; Chua, Nam-Hai

2012-05-03

Over application of phosphate fertilizers in modern agriculture contaminates waterways and disrupts natural ecosystems. Nevertheless, this is a common practice among farmers, especially in developing countries as abundant fertilizers are believed to boost crop yields. The study of plant phosphate metabolism and its underlying genetic pathways is key to discovering methods of efficient fertilizer usage. The work presented here describes a genome-wide resource on the molecular dynamics underpinning the response and recovery in roots and shoots of Arabidopsis thaliana to phosphate-starvation. Genome-wide profiling by micro- and tiling-arrays (accessible from GEO: GSE34004) revealed minimal overlap between root and shoot transcriptomes suggesting two independent phosphate-starvation regulons. Novel gene expression patterns were detected for over 1000 candidates and were classified as either initial, persistent, or latent responders. Comparative analysis to AtGenExpress identified cohorts of genes co-regulated across multiple stimuli. The hormone ABA displayed a dominant role in regulating many phosphate-responsive candidates. Analysis of co-regulation enabled the determination of specific versus generic members of closely related gene families with respect to phosphate-starvation. Thus, among others, we showed that PHR1-regulated members of closely related phosphate-responsive families (PHT1;1, PHT1;7-9, SPX1-3, and PHO1;H1) display greater specificity to phosphate-starvation than their more generic counterparts. Our results uncover much larger, staged responses to phosphate-starvation than previously described. To our knowledge, this work describes the most complete genome-wide data on plant nutrient stress to-date.

Meta-review of protein network regulating obesity between validated obesity candidate genes in the white adipose tissue of high-fat diet-induced obese C57BL/6J mice.

PubMed

Kim, Eunjung; Kim, Eun Jung; Seo, Seung-Won; Hur, Cheol-Goo; McGregor, Robin A; Choi, Myung-Sook

2014-01-01

Worldwide obesity and related comorbidities are increasing, but identifying new therapeutic targets remains a challenge. A plethora of microarray studies in diet-induced obesity models has provided large datasets of obesity associated genes. In this review, we describe an approach to examine the underlying molecular network regulating obesity, and we discuss interactions between obesity candidate genes. We conducted network analysis on functional protein-protein interactions associated with 25 obesity candidate genes identified in a literature-driven approach based on published microarray studies of diet-induced obesity. The obesity candidate genes were closely associated with lipid metabolism and inflammation. Peroxisome proliferator activated receptor gamma (Pparg) appeared to be a core obesity gene, and obesity candidate genes were highly interconnected, suggesting a coordinately regulated molecular network in adipose tissue. In conclusion, the current network analysis approach may help elucidate the underlying molecular network regulating obesity and identify anti-obesity targets for therapeutic intervention.

Discovery of genomic intervals that underlie nematode responses to benzimidazoles.

PubMed

Zamanian, Mostafa; Cook, Daniel E; Zdraljevic, Stefan; Brady, Shannon C; Lee, Daehan; Lee, Junho; Andersen, Erik C

2018-03-01

Parasitic nematodes impose a debilitating health and economic burden across much of the world. Nematode resistance to anthelmintic drugs threatens parasite control efforts in both human and veterinary medicine. Despite this threat, the genetic landscape of potential resistance mechanisms to these critical drugs remains largely unexplored. Here, we exploit natural variation in the model nematodes Caenorhabditis elegans and Caenorhabditis briggsae to discover quantitative trait loci (QTL) that control sensitivity to benzimidazoles widely used in human and animal medicine. High-throughput phenotyping of albendazole, fenbendazole, mebendazole, and thiabendazole responses in panels of recombinant lines led to the discovery of over 15 QTL in C. elegans and four QTL in C. briggsae associated with divergent responses to these anthelmintics. Many of these QTL are conserved across benzimidazole derivatives, but others show drug and dose specificity. We used near-isogenic lines to recapitulate and narrow the C. elegans albendazole QTL of largest effect and identified candidate variants correlated with the resistance phenotype. These QTL do not overlap with known benzimidazole target resistance genes from parasitic nematodes and present specific new leads for the discovery of novel mechanisms of nematode benzimidazole resistance. Analyses of orthologous genes reveal conservation of candidate benzimidazole resistance genes in medically important parasitic nematodes. These data provide a basis for extending these approaches to other anthelmintic drug classes and a pathway towards validating new markers for anthelmintic resistance that can be deployed to improve parasite disease control.

Colon Cancer-Upregulated Long Non-Coding RNA lincDUSP Regulates Cell Cycle Genes and Potentiates Resistance to Apoptosis.

PubMed

Forrest, Megan E; Saiakhova, Alina; Beard, Lydia; Buchner, David A; Scacheri, Peter C; LaFramboise, Thomas; Markowitz, Sanford; Khalil, Ahmad M

2018-05-09

Long non-coding RNAs (lncRNAs) are frequently dysregulated in many human cancers. We sought to identify candidate oncogenic lncRNAs in human colon tumors by utilizing RNA sequencing data from 22 colon tumors and 22 adjacent normal colon samples from The Cancer Genome Atlas (TCGA). The analysis led to the identification of ~200 differentially expressed lncRNAs. Validation in an independent cohort of normal colon and patient-derived colon cancer cell lines identified a novel lncRNA, lincDUSP, as a potential candidate oncogene. Knockdown of lincDUSP in patient-derived colon tumor cell lines resulted in significantly decreased cell proliferation and clonogenic potential, and increased susceptibility to apoptosis. The knockdown of lincDUSP affects the expression of ~800 genes, and NCI pathway analysis showed enrichment of DNA damage response and cell cycle control pathways. Further, identification of lincDUSP chromatin occupancy sites by ChIRP-Seq demonstrated association with genes involved in the replication-associated DNA damage response and cell cycle control. Consistent with these findings, lincDUSP knockdown in colon tumor cell lines increased both the accumulation of cells in early S-phase and γH2AX foci formation, indicating increased DNA damage response induction. Taken together, these results demonstrate a key role of lincDUSP in the regulation of important pathways in colon cancer.

RNA-Seq identification of candidate defense genes targeted by endophytic Bacillus cereus-mediated induced systemic resistance against Meloidogyne incognita in tomato.

PubMed

Hu, Haijing; Wang, Cong; Li, Xia; Tang, Yunyun; Wang, Yufang; Chen, Shuanglin; Yan, Shuzhen

2018-05-08

The endophytic bacteria Bacillus cereus BCM2 has shown great potential as a defense against the parasitic nematode Meloidogyne incognita. Here, we studied the endophytic bacteria-mediated plant defense against M. incognita and searched for defense-related candidate genes using RNA-Seq. The induced systemic resistance of BCM2 against M. incognita was tested using the split-root method. Pre-inoculated BCM2 on the inducer side was associated with a dramatic reduction in galls and egg masses at the responder side, but inoculated BCM2 alone did not produce the same effect. In order to investigate which plant defense-related genes are specifically activated by BCM2, four RNA samples from tomato roots were sequenced, and four high quality total clean bases were obtained, ranging from 6.64 to 6.75 Gb, with an average of 21558 total genes. The 34 candidate defense-related genes were identified by pair-wise comparison among libraries, representing the targets for BCM2 priming resistance against M. incognita. Functional characterization revealed that the plant-pathogen interaction pathway (ID: ko04626) was significantly enriched for BCM2-mediated M. incognita resistance. This study demonstrates that B. cereus BCM2 maintains a harmonious host-microbe relationship with tomato, but appeared to prime the plant, resulting in more vigorous defense response toward the infection nematode. This article is protected by copyright. All rights reserved.

Genome-wide analysis of aquaporin gene family and their responses to water-deficit stress conditions in cassava.

PubMed

Putpeerawit, Pattaranit; Sojikul, Punchapat; Thitamadee, Siripong; Narangajavana, Jarunya

2017-12-01

Cassava (Manihot esculenta Crantz) is an important economic crop in tropical countries. Although cassava is considered a drought-tolerant crop that can grow in arid areas, the impact of drought can significantly reduce the growth and yield of cassava storage roots. The discovery of aquaporin molecules (AQPs) in plants has resulted in a paradigm shift in the understanding of plant-water relationships, whereas the relationship between aquaporin and drought resistance in cassava still remains elusive. To investigate the potential role of aquaporin in cassava under water-deficit conditions, 45 putative MeAQPs were identified in the cassava genome. Six members of MeAQPs, containing high numbers of water stress-responsive motifs in their promoter regions, were selected for a gene expression study. Two cassava cultivars, which showed different degrees of responses to water-deficit stress, were used to test in in vitro and potted plant systems. The differential expression of all candidate MeAQPs were found in only leaves from the potted plant system were consistent with the relative water content and with the stomatal closure profile of the two cultivars. MePIP2-1 and MePIP2-10 were up-regulated and this change in their expression might regulate a special signal for water efflux out of guard cells, thus inducing stomatal closure under water-deficit conditions. In addition, the expression profiles of genes in the ABA-dependent pathway revealed an essential correlation with stomatal closure. The potential functions of MeAQPs and candidate ABA-dependent pathway genes in response to water deficit in the more tolerant cassava cultivar were discussed. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Global identification and expression analysis of stress-responsive genes of the Argonaute family in apple.

PubMed

Xu, Ruirui; Liu, Caiyun; Li, Ning; Zhang, Shizhong

2016-12-01

Argonaute (AGO) proteins, which are found in yeast, animals, and plants, are the core molecules of the RNA-induced silencing complex. These proteins play important roles in plant growth, development, and responses to biotic stresses. The complete analysis and classification of the AGO gene family have been recently reported in different plants. Nevertheless, systematic analysis and expression profiling of these genes have not been performed in apple (Malus domestica). Approximately 15 AGO genes were identified in the apple genome. The phylogenetic tree, chromosome location, conserved protein motifs, gene structure, and expression of the AGO gene family in apple were analyzed for gene prediction. All AGO genes were phylogenetically clustered into four groups (i.e., AGO1, AGO4, MEL1/AGO5, and ZIPPY/AGO7) with the AGO genes of Arabidopsis. These groups of the AGO gene family were statistically analyzed and compared among 31 plant species. The predicted apple AGO genes are distributed across nine chromosomes at different densities and include three segment duplications. Expression studies indicated that 15 AGO genes exhibit different expression patterns in at least one of the tissues tested. Additionally, analysis of gene expression levels indicated that the genes are mostly involved in responses to NaCl, PEG, heat, and low-temperature stresses. Hence, several candidate AGO genes are involved in different aspects of physiological and developmental processes and may play an important role in abiotic stress responses in apple. To the best of our knowledge, this study is the first to report a comprehensive analysis of the apple AGO gene family. Our results provide useful information to understand the classification and putative functions of these proteins, especially for gene members that may play important roles in abiotic stress responses in M. hupehensis.

Role of skeletal muscle in ear development.

PubMed

Rot, Irena; Baguma-Nibasheka, Mark; Costain, Willard J; Hong, Paul; Tafra, Robert; Mardesic-Brakus, Snjezana; Mrduljas-Djujic, Natasa; Saraga-Babic, Mirna; Kablar, Boris

2017-10-01

The current paper is a continuation of our work described in Rot and Kablar, 2010. Here, we show lists of 10 up- and 87 down-regulated genes obtained by a cDNA microarray analysis that compared developing Myf5-/-:Myod-/- (and Mrf4-/-) petrous part of the temporal bone, containing middle and inner ear, to the control, at embryonic day 18.5. Myf5-/-:Myod-/- fetuses entirely lack skeletal myoblasts and muscles. They are unable to move their head, which interferes with the perception of angular acceleration. Previously, we showed that the inner ear areas most affected in Myf5-/-:Myod-/- fetuses were the vestibular cristae ampullaris, sensitive to angular acceleration. Our finding that the type I hair cells were absent in the mutants' cristae was further used here to identify a profile of genes specific to the lacking cell type. Microarrays followed by a detailed consultation of web-accessible mouse databases allowed us to identify 6 candidate genes with a possible role in the development of the inner ear sensory organs: Actc1, Pgam2, Ldb3, Eno3, Hspb7 and Smpx. Additionally, we searched for human homologues of the candidate genes since a number of syndromes in humans have associated inner ear abnormalities. Mutations in one of our candidate genes, Smpx, have been reported as the cause of X-linked deafness in humans. Our current study suggests an epigenetic role that mechanical, and potentially other, stimuli originating from muscle, play in organogenesis, and offers an approach to finding novel genes responsible for altered inner ear phenotypes.

Gene expression profiles of putative biomarker candidates in Mycobacterium avium subsp. paratuberculosis-infected cattle.

PubMed

Park, Hyun-Eui; Shin, Min-Kyoung; Park, Hong-Tae; Jung, Myunghwan; Cho, Yong Il; Yoo, Han Sang

2016-06-01

This study was conducted to analyze the gene expression of prognostic potential biomarker candidates using the whole blood of cattle naturally infected with ITALIC! Mycobacterium aviumsubsp. ITALIC! paratuberculosis(MAP). We conducted real-time PCR to evaluate 23 potential biomarker candidates. Experimental animals were divided into four groups based on fecal MAP PCR and serum ELISA. Seven ( ITALIC! KLRB1, ITALIC! HGF, ITALIC! MPO, ITALIC! LTF, ITALIC! SERPINE1, ITALIC! S100A8and ITALIC! S100A9) genes were up-regulated in fecal MAP-positive cattle and three ( ITALIC! KLRB1, ITALIC! MPOand ITALIC! S100A9) were up-regulated in MAP-seropositive cattle relative to uninfected cattle. In subclinically infected animals, 17 genes ( ITALIC! TFRC, ITALIC! S100A8, ITALIC! S100A9, ITALIC! MPO, ITALIC! GBP6, ITALIC! LTF, ITALIC! KLRB1, ITALIC! SERPINE1, ITALIC! PIGR, ITALIC! IL-10, ITALIC! CXCR3, ITALIC! CD14, ITALIC! MMP9, ITALIC! ELANE, ITALIC! CHI3L1, ITALIC! HPand ITALIC! HGF) were up-regulated compared with the control group. Moreover, six genes ( ITALIC! CXCR3, ITALIC! HP, ITALIC! HGF, ITALIC! LTF, ITALIC! TFRCand ITALIC! GBP6) showed significant differences between experimental groups. Taken together, our data suggest that six genes ( ITALIC! LTF, ITALIC! HGF, ITALIC! HP, ITALIC! CXCR3, ITALIC! GBP6and ITALIC! TFRC) played essential roles in the immune response to MAP during the subclinical stage and therefore might be useful as prognostic biomarkers. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Landscape genomic analysis of candidate genes for climate adaptation in a California endemic oak, Quercus lobata.

PubMed

Sork, Victoria L; Squire, Kevin; Gugger, Paul F; Steele, Stephanie E; Levy, Eric D; Eckert, Andrew J

2016-01-01

The ability of California tree populations to survive anthropogenic climate change will be shaped by the geographic structure of adaptive genetic variation. Our goal is to test whether climate-associated candidate genes show evidence of spatially divergent selection in natural populations of valley oak, Quercus lobata, as preliminary indication of local adaptation. Using DNA from 45 individuals from 13 localities across the species' range, we sequenced portions of 40 candidate genes related to budburst/flowering, growth, osmotic stress, and temperature stress. Using 195 single nucleotide polymorphisms (SNPs), we estimated genetic differentiation across populations and correlated allele frequencies with climate gradients using single-locus and multivariate models. The top 5% of FST estimates ranged from 0.25 to 0.68, yielding loci potentially under spatially divergent selection. Environmental analyses of SNP frequencies with climate gradients revealed three significantly correlated SNPs within budburst/flowering genes and two SNPs within temperature stress genes with mean annual precipitation, after controlling for multiple testing. A redundancy model showed a significant association between SNPs and climate variables and revealed a similar set of SNPs with high loadings on the first axis. In the RDA, climate accounted for 67% of the explained variation, when holding climate constant, in contrast to a putatively neutral SSR data set where climate accounted for only 33%. Population differentiation and geographic gradients of allele frequencies in climate-associated functional genes in Q. lobata provide initial evidence of adaptive genetic variation and background for predicting population response to climate change. © 2016 Botanical Society of America.

Cross-talk of the biotrophic pathogen Claviceps purpurea and its host Secale cereale.

PubMed

Oeser, Birgitt; Kind, Sabine; Schurack, Selma; Schmutzer, Thomas; Tudzynski, Paul; Hinsch, Janine

2017-04-04

The economically important Ergot fungus Claviceps purpurea is an interesting biotrophic model system because of its strict organ specificity (grass ovaries) and the lack of any detectable plant defense reactions. Though several virulence factors were identified, the exact infection mechanisms are unknown, e.g. how the fungus masks its attack and if the host detects the infection at all. We present a first dual transcriptome analysis using an RNA-Seq approach. We studied both, fungal and plant gene expression in young ovaries infected by the wild-type and two virulence-attenuated mutants. We can show that the plant recognizes the fungus, since defense related genes are upregulated, especially several phytohormone genes. We present a survey of in planta expressed fungal genes, among them several confirmed virulence genes. Interestingly, the set of most highly expressed genes includes a high proportion of genes encoding putative effectors, small secreted proteins which might be involved in masking the fungal attack or interfering with host defense reactions. As known from several other phytopathogens, the C. purpurea genome contains more than 400 of such genes, many of them clustered and probably highly redundant. Since the lack of effective defense reactions in spite of recognition of the fungus could very well be achieved by effectors, we started a functional analysis of some of the most highly expressed candidates. However, the redundancy of the system made the identification of a drastic effect of a single gene most unlikely. We can show that at least one candidate accumulates in the plant apoplast. Deletion of some candidates led to a reduced virulence of C. purpurea on rye, indicating a role of the respective proteins during the infection process. We show for the first time that- despite the absence of effective plant defense reactions- the biotrophic pathogen C. purpurea is detected by its host. This points to a role of effectors in modulation of the effective plant response. Indeed, several putative effector genes are among the highest expressed genes in planta.

Molecular responses in root-associative rhizospheric bacteria to variations in plant exudates

NASA Astrophysics Data System (ADS)

Abdoun, Hamid; McMillan, Mary; Pereg, Lily

2015-04-01

Plant exudates are a major factor in the interface of plant-soil-microbe interactions and it is well documented that the microbial community structure in the rhizosphere is largely influenced by the particular exudates excreted by various plants. Azospirillum brasilense is a plant growth promoting rhizobacterium that is known to interact with a large number of plants, including important food crops. The regulatory gene flcA has an important role in this interaction as it controls morphological differentiation of the bacterium that is essential for attachment to root surfaces. Being a response regulatory gene, flcA mediates the response of the bacterial cell to signals from the surrounding rhizosphere. This makes this regulatory gene a good candidate for analysis of the response of bacteria to rhizospheric alterations, in this case, variations in root exudates. We will report on our studies on the response of Azospirillum, an ecologically, scientifically and agriculturally important bacterial genus, to variations in the rhizosphere.

Genome-wide characterization of differentially expressed genes provides insights into regulatory network of heat stress response in radish (Raphanus sativus L.).

PubMed

Wang, Ronghua; Mei, Yi; Xu, Liang; Zhu, Xianwen; Wang, Yan; Guo, Jun; Liu, Liwang

2018-03-01

Heat stress (HS) causes detrimental effects on plant morphology, physiology, and biochemistry that lead to drastic reduction in plant biomass production and economic yield worldwide. To date, little is known about HS-responsive genes involved in thermotolerance mechanism in radish. In this study, a total of 6600 differentially expressed genes (DEGs) from the control and Heat24 cDNA libraries of radish were isolated by high-throughput sequencing. With Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, some genes including MAPK, DREB, ERF, AP2, GST, Hsf, and Hsp were predominantly assigned in signal transductions, metabolic pathways, and biosynthesis and abiotic stress-responsive pathways. These pathways played significant roles in reducing stress-induced damages and enhancing heat tolerance in radish. Expression patterns of 24 candidate genes were validated by reverse-transcription quantitative PCR (RT-qPCR). Based mainly on the analysis of DEGs combining with the previous miRNAs analysis, the schematic model of HS-responsive regulatory network was proposed. To counter the effects of HS, a rapid response of the plasma membrane leads to the opening of specific calcium channels and cytoskeletal reorganization, after which HS-responsive genes are activated to repair damaged proteins and ultimately facilitate further enhancement of thermotolerance in radish. These results could provide fundamental insight into the regulatory network underlying heat tolerance in radish and facilitate further genetic manipulation of thermotolerance in root vegetable crops.

Comparative Genomics and Immunoinformatics Approach for the Identification of Vaccine Candidates for Enterohemorrhagic Escherichia coli O157:H7

PubMed Central

García-Angulo, Víctor A.; Kalita, Anjana; Kalita, Mridul; Lozano, Luis

2014-01-01

Enterohemorrhagic Escherichia coli (EHEC) O157:H7 strains are major human food-borne pathogens, responsible for bloody diarrhea and hemolytic-uremic syndrome worldwide. Thus far, there is no vaccine for humans against EHEC infections. In this study, a comparative genomics analysis was performed to identify EHEC-specific antigens useful as potential vaccines. The genes present in both EHEC EDL933 and Sakai strains but absent in nonpathogenic E. coli K-12 and HS strains were subjected to an in silico analysis to identify secreted or surface-expressed proteins. We obtained a total of 65 gene-encoding protein candidates, which were subjected to immunoinformatics analysis. Our criteria of selection aided in categorizing the candidates as high, medium, and low priority. Three members of each group were randomly selected and cloned into pVAX-1. Candidates were pooled accordingly to their priority group and tested for immunogenicity against EHEC O157:H7 using a murine model of gastrointestinal infection. The high-priority (HP) pool, containing genes encoding a Lom-like protein (pVAX-31), a putative pilin subunit (pVAX-12), and a fragment of the type III secretion structural protein EscC (pVAX-56.2), was able to induce the production of EHEC IgG and sIgA in sera and feces. HP candidate-immunized mice displayed elevated levels of Th2 cytokines and diminished cecum colonization after wild-type challenge. Individually tested HP vaccine candidates showed that pVAX-12 and pVAX-56.2 significantly induced Th2 cytokines and production of fecal EHEC sIgA, with pVAX-56.2 reducing EHEC cecum colonization. We describe here a bioinformatics approach able to identify novel vaccine candidates potentially useful for preventing EHEC O157:H7 infections. PMID:24595137

Genome-wide scan for selection signatures in six cattle breeds in South Africa.

PubMed

Makina, Sithembile O; Muchadeyi, Farai C; van Marle-Köster, Este; Taylor, Jerry F; Makgahlela, Mahlako L; Maiwashe, Azwihangwisi

2015-11-26

The detection of selection signatures in breeds of livestock species can contribute to the identification of regions of the genome that are, or have been, functionally important and, as a consequence, have been targeted by selection. This study used two approaches to detect signatures of selection within and between six cattle breeds in South Africa, including Afrikaner (n = 44), Nguni (n = 54), Drakensberger (n = 47), Bonsmara (n = 44), Angus (n = 31) and Holstein (n = 29). The first approach was based on the detection of genomic regions in which haplotypes have been driven towards complete fixation within breeds. The second approach identified regions of the genome that had very different allele frequencies between populations (F ST). Forty-seven candidate genomic regions were identified as harbouring putative signatures of selection using both methods. Twelve of these candidate selected regions were shared among the breeds and ten were validated by previous studies. Thirty-three of these regions were successfully annotated and candidate genes were identified. Among these genes the keratin genes (KRT222, KRT24, KRT25, KRT26, and KRT27) and one heat shock protein gene (HSPB9) on chromosome 19 between 42,896,570 and 42,897,840 bp were detected for the Nguni breed. These genes were previously associated with adaptation to tropical environments in Zebu cattle. In addition, a number of candidate genes associated with the nervous system (WNT5B, FMOD, PRELP, and ATP2B), immune response (CYM, CDC6, and CDK10), production (MTPN, IGFBP4, TGFB1, and AJAP1) and reproductive performance (ADIPOR2, OVOS2, and RBBP8) were also detected as being under selection. The results presented here provide a foundation for detecting mutations that underlie genetic variation of traits that have economic importance for cattle breeds in South Africa.

Combined serial analysis of gene expression and transcription factor binding site prediction identifies novel-candidate-target genes of Nr2e1 in neocortex development.

PubMed

Schmouth, Jean-François; Arenillas, David; Corso-Díaz, Ximena; Xie, Yuan-Yun; Bohacec, Slavita; Banks, Kathleen G; Bonaguro, Russell J; Wong, Siaw H; Jones, Steven J M; Marra, Marco A; Simpson, Elizabeth M; Wasserman, Wyeth W

2015-07-24

Nr2e1 (nuclear receptor subfamily 2, group e, member 1) encodes a transcription factor important in neocortex development. Previous work has shown that nuclear receptors can have hundreds of target genes, and bind more than 300 co-interacting proteins. However, recognition of the critical role of Nr2e1 in neural stem cells and neocortex development is relatively recent, thus the molecular mechanisms involved for this nuclear receptor are only beginning to be understood. Serial analysis of gene expression (SAGE), has given researchers both qualitative and quantitative information pertaining to biological processes. Thus, in this work, six LongSAGE mouse libraries were generated from laser microdissected tissue samples of dorsal VZ/SVZ (ventricular zone and subventricular zone) from the telencephalon of wild-type (Wt) and Nr2e1-null embryos at the critical development ages E13.5, E15.5, and E17.5. We then used a novel approach, implementing multiple computational methods followed by biological validation to further our understanding of Nr2e1 in neocortex development. In this work, we have generated a list of 1279 genes that are differentially expressed in response to altered Nr2e1 expression during in vivo neocortex development. We have refined this list to 64 candidate direct-targets of NR2E1. Our data suggested distinct roles for Nr2e1 during different neocortex developmental stages. Most importantly, our results suggest a possible novel pathway by which Nr2e1 regulates neurogenesis, which includes Lhx2 as one of the candidate direct-target genes, and SOX9 as a co-interactor. In conclusion, we have provided new candidate interacting partners and numerous well-developed testable hypotheses for understanding the pathways by which Nr2e1 functions to regulate neocortex development.

Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus

PubMed Central

Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W

2017-01-01

BACKGROUND Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. OBJECTIVES Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). METHODS Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. FINDINGS The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. MAIN CONCLUSIONS These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions. PMID:29211244

Evaluating Reported Candidate Gene Associations with Polycystic Ovary Syndrome

PubMed Central

Pau, Cindy; Saxena, Richa; Welt, Corrine Kolka

2013-01-01

Objective To replicate variants in candidate genes associated with PCOS in a population of European PCOS and control subjects. Design Case-control association analysis and meta-analysis. Setting Major academic hospital Patients Women of European ancestry with PCOS (n=525) and controls (n=472), aged 18 to 45 years. Intervention Variants previously associated with PCOS in candidate gene studies were genotyped (n=39). Metabolic, reproductive and anthropomorphic parameters were examined as a function of the candidate variants. All genetic association analyses were adjusted for age, BMI and ancestry and were reported after correction for multiple testing. Main Outcome Measure Association of candidate gene variants with PCOS. Results Three variants, rs3797179 (SRD5A1), rs12473543 (POMC), and rs1501299 (ADIPOQ), were nominally associated with PCOS. However, they did not remain significant after correction for multiple testing and none of the variants replicated in a sufficiently powered meta-analysis. Variants in the FBN3 gene (rs17202517 and rs73503752) were associated with smaller waist circumferences and variant rs727428 in the SHBG gene was associated with lower SHBG levels. Conclusion Previously identified variants in candidate genes do not appear to be associated with PCOS risk. PMID:23375202

RiceMetaSys for salt and drought stress responsive genes in rice: a web interface for crop improvement.

PubMed

Sandhu, Maninder; Sureshkumar, V; Prakash, Chandra; Dixit, Rekha; Solanke, Amolkumar U; Sharma, Tilak Raj; Mohapatra, Trilochan; S V, Amitha Mithra

2017-09-30

Genome-wide microarray has enabled development of robust databases for functional genomics studies in rice. However, such databases do not directly cater to the needs of breeders. Here, we have attempted to develop a web interface which combines the information from functional genomic studies across different genetic backgrounds with DNA markers so that they can be readily deployed in crop improvement. In the current version of the database, we have included drought and salinity stress studies since these two are the major abiotic stresses in rice. RiceMetaSys, a user-friendly and freely available web interface provides comprehensive information on salt responsive genes (SRGs) and drought responsive genes (DRGs) across genotypes, crop development stages and tissues, identified from multiple microarray datasets. 'Physical position search' is an attractive tool for those using QTL based approach for dissecting tolerance to salt and drought stress since it can provide the list of SRGs and DRGs in any physical interval. To identify robust candidate genes for use in crop improvement, the 'common genes across varieties' search tool is useful. Graphical visualization of expression profiles across genes and rice genotypes has been enabled to facilitate the user and to make the comparisons more impactful. Simple Sequence Repeat (SSR) search in the SRGs and DRGs is a valuable tool for fine mapping and marker assisted selection since it provides primers for survey of polymorphism. An external link to intron specific markers is also provided for this purpose. Bulk retrieval of data without any limit has been enabled in case of locus and SSR search. The aim of this database is to facilitate users with a simple and straight-forward search options for identification of robust candidate genes from among thousands of SRGs and DRGs so as to facilitate linking variation in expression profiles to variation in phenotype. Database URL: http://14.139.229.201.

Chronic psychosocial stressors and salivary biomarkers in emerging adults.

PubMed

Bergen, Andrew W; Mallick, Aditi; Nishita, Denise; Wei, Xin; Michel, Martha; Wacholder, Aaron; David, Sean P; Swan, Gary E; Reid, Mark W; Simons, Anne; Andrews, Judy A

2012-08-01

We investigated whole saliva as a source of biomarkers to distinguish individuals who have, and who have not, been chronically exposed to severe and threatening life difficulties. We evaluated RNA and DNA metrics, expression of 37 candidate genes, and cortisol release in response to the Trier Social Stress Test, as well as clinical characteristics, from 48 individuals stratified on chronic exposure to psychosocial stressors within the last year as measured by the Life Events and Difficulties Schedule. Candidate genes were selected based on their differential gene expression ratio in circulating monocytes from a published genome-wide analysis of adults experiencing different levels of exposure to a chronic stressor. In univariate analyses, we observed significantly decreased RNA integrity (RIN) score (P = 0.04), and reduced expression of glucocorticoid receptor-regulated genes (Ps < 0.05) in whole saliva RNA from individuals exposed to chronic stressors, as compared to those with no exposure. In those exposed, we observed significantly decreased BMI (P < 0.001), increased ever-smoking and increased lifetime alcohol abuse or dependence (P ≤ 0.03), and a reduction of cortisol release. In post hoc multivariate analyses including clinical and biospecimen-derived variables, we consistently observed significantly decreased expression of IL8 (Ps<0.05) in individuals exposed, with no significant association to RIN score. Alcohol use disorders, tobacco use, a reduced acute stress response and decreased salivary IL8 gene expression characterize emerging adults chronically exposed to severe and threatening psychosocial stressors. Copyright © 2011 Elsevier Ltd. All rights reserved.

Patterns of Piscirickettsia salmonis load in susceptible and resistant families of Salmo salar.

PubMed

Dettleff, Phillip; Bravo, Cristian; Patel, Alok; Martinez, Victor

2015-07-01

The pathogen Piscirickettsia salmonis produces a systemic aggressive infection that involves several organs and tissues in salmonids. In spite of the great economic losses caused by this pathogen in the Atlantic salmon (Salmo salar) industry, very little is known about the resistance mechanisms of the host to this pathogen. In this paper, for the first time, we aimed to identify the bacterial load in head kidney and muscle of Atlantic salmon exhibiting differential familiar mortality. Furthermore, in order to assess the patterns of gene expression of immune related genes in susceptible and resistant families, a set of candidate genes was evaluated using deep sequencing of the transcriptome. The results showed that the bacterial load was significantly lower in resistant fish, when compared with the susceptible individuals. Based on the candidate genes analysis, we infer that the resistant hosts triggered up-regulation of specific genes (such as for example the LysC), which may explain a decrease in the bacterial load in head kidney, while the susceptible fish presented an exacerbated innate response, which is unable to exert an effective response against the bacteria. Interestingly, we found a higher bacterial load in muscle when compared with head kidney. We argue that this is possible due to the availability of an additional source of iron in muscle. Besides, the results show that the resistant fish could not be a likely reservoir of the bacteria. Copyright © 2015 Elsevier Ltd. All rights reserved.

Reranking candidate gene models with cross-species comparison for improved gene prediction

PubMed Central

Liu, Qian; Crammer, Koby; Pereira, Fernando CN; Roos, David S

2008-01-01

Background Most gene finders score candidate gene models with state-based methods, typically HMMs, by combining local properties (coding potential, splice donor and acceptor patterns, etc). Competing models with similar state-based scores may be distinguishable with additional information. In particular, functional and comparative genomics datasets may help to select among competing models of comparable probability by exploiting features likely to be associated with the correct gene models, such as conserved exon/intron structure or protein sequence features. Results We have investigated the utility of a simple post-processing step for selecting among a set of alternative gene models, using global scoring rules to rerank competing models for more accurate prediction. For each gene locus, we first generate the K best candidate gene models using the gene finder Evigan, and then rerank these models using comparisons with putative orthologous genes from closely-related species. Candidate gene models with lower scores in the original gene finder may be selected if they exhibit strong similarity to probable orthologs in coding sequence, splice site location, or signal peptide occurrence. Experiments on Drosophila melanogaster demonstrate that reranking based on cross-species comparison outperforms the best gene models identified by Evigan alone, and also outperforms the comparative gene finders GeneWise and Augustus+. Conclusion Reranking gene models with cross-species comparison improves gene prediction accuracy. This straightforward method can be readily adapted to incorporate additional lines of evidence, as it requires only a ranked source of candidate gene models. PMID:18854050

The WRKY Transcription Factor Family in Citrus: Valuable and Useful Candidate Genes for Citrus Breeding.

PubMed

Ayadi, M; Hanana, M; Kharrat, N; Merchaoui, H; Marzoug, R Ben; Lauvergeat, V; Rebaï, A; Mzid, R

2016-10-01

WRKY transcription factors belong to a large family of plant transcriptional regulators whose members have been reported to be involved in a wide range of biological roles including plant development, adaptation to environmental constraints and response to several diseases. However, little or poor information is available about WRKY's in Citrus. The recent release of completely assembled genomes sequences of Citrus sinensis and Citrus clementina and the availability of ESTs sequences from other citrus species allowed us to perform a genome survey for Citrus WRKY proteins. In the present study, we identified 100 WRKY members from C. sinensis (51), C. clementina (48) and Citrus unshiu (1), and analyzed their chromosomal distribution, gene structure, gene duplication, syntenic relation and phylogenetic analysis. A phylogenetic tree of 100 Citrus WRKY sequences with their orthologs from Arabidopsis has distinguished seven groups. The CsWRKY genes were distributed across all ten sweet orange chromosomes. A comprehensive approach and an integrative analysis of Citrus WRKY gene expression revealed variable profiles of expression within tissues and stress conditions indicating functional diversification. Thus, candidate Citrus WRKY genes have been proposed as potentially involved in fruit acidification, essential oil biosynthesis and abiotic/biotic stress tolerance. Our results provided essential prerequisites for further WRKY genes cloning and functional analysis with an aim of citrus crop improvement.

‘Obesity’ is healthy for cetaceans? Evidence from pervasive positive selection in genes related to triacylglycerol metabolism

PubMed Central

Wang, Zhengfei; Chen, Zhuo; Xu, Shixia; Ren, Wenhua; Zhou, Kaiya; Yang, Guang

2015-01-01

Cetaceans are a group of secondarily adapted marine mammals with an enigmatic history of transition from terrestrial to fully aquatic habitat and subsequent adaptive radiation in waters around the world. Numerous physiological and morphological cetacean characteristics have been acquired in response to this drastic habitat transition; for example, the thickened blubber is one of the most striking changes that increases their buoyancy, supports locomotion, and provides thermal insulation. However, the genetic basis underlying the blubber thickening in cetaceans remains poorly explored. Here, 88 candidate genes associated with triacylglycerol metabolism were investigated in representative cetaceans and other mammals to test whether the thickened blubber matched adaptive evolution of triacylglycerol metabolism-related genes. Positive selection was detected in 41 of the 88 candidate genes, and functional characterization of these genes indicated that these are involved mainly in triacylglycerol synthesis and lipolysis processes. In addition, some essential regulatory genes underwent significant positive selection in cetacean-specific lineages, whereas no selection signal was detected in the counterpart terrestrial mammals. The extensive occurrence of positive selection in triacylglycerol metabolism-related genes is suggestive of their essential role in secondary adaptation to an aquatic life, and further implying that ‘obesity’ might be an indicator of good health for cetaceans. PMID:26381091

'Obesity' is healthy for cetaceans? Evidence from pervasive positive selection in genes related to triacylglycerol metabolism.

PubMed

Wang, Zhengfei; Chen, Zhuo; Xu, Shixia; Ren, Wenhua; Zhou, Kaiya; Yang, Guang

2015-09-18

Cetaceans are a group of secondarily adapted marine mammals with an enigmatic history of transition from terrestrial to fully aquatic habitat and subsequent adaptive radiation in waters around the world. Numerous physiological and morphological cetacean characteristics have been acquired in response to this drastic habitat transition; for example, the thickened blubber is one of the most striking changes that increases their buoyancy, supports locomotion, and provides thermal insulation. However, the genetic basis underlying the blubber thickening in cetaceans remains poorly explored. Here, 88 candidate genes associated with triacylglycerol metabolism were investigated in representative cetaceans and other mammals to test whether the thickened blubber matched adaptive evolution of triacylglycerol metabolism-related genes. Positive selection was detected in 41 of the 88 candidate genes, and functional characterization of these genes indicated that these are involved mainly in triacylglycerol synthesis and lipolysis processes. In addition, some essential regulatory genes underwent significant positive selection in cetacean-specific lineages, whereas no selection signal was detected in the counterpart terrestrial mammals. The extensive occurrence of positive selection in triacylglycerol metabolism-related genes is suggestive of their essential role in secondary adaptation to an aquatic life, and further implying that 'obesity' might be an indicator of good health for cetaceans.

A novel locus for split-hand/foot malformation associated with tibial hemimelia (SHFLD syndrome) maps to chromosome region 17p13.1-17p13.3.

PubMed

Lezirovitz, Karina; Maestrelli, Sylvia Regina Pedrosa; Cotrim, Nelson Henderson; Otto, Paulo A; Pearson, Peter L; Mingroni-Netto, Regina Celia

2008-07-01

Split-hand/foot malformation (SHFM) associated with aplasia of long bones, SHFLD syndrome or Tibial hemimelia-ectrodactyly syndrome is a rare condition with autosomal dominant inheritance, reduced penetrance and an incidence estimated to be about 1 in 1,000,000 liveborns. To date, three chromosomal regions have been reported as strong candidates for harboring SHFLD syndrome genes: 1q42.2-q43, 6q14.1 and 2q14.2. We characterized the phenotype of nine affected individuals from a large family with the aim of mapping the causative gene. Among the nine affected patients, four had only SHFM of the hands and no tibial defects, three had both defects and two had only unilateral tibial hemimelia. In keeping with previous publications of this and other families, there was clear evidence of both variable expression and incomplete penetrance, the latter bearing hallmarks of anticipation. Segregation analysis and multipoint Lod scores calculations (maximum Lod score of 5.03 using the LINKMAP software) using all potentially informative family members, both affected and unaffected, identified the chromosomal region 17p13.1-17p13.3 as the best and only candidate for harboring a novel mutated gene responsible for the syndrome in this family. The candidate gene CRK located within this region was sequenced but no pathogenic mutation was detected.

Coexpression network analysis of the genes regulated by two types of resistance responses to powdery mildew in wheat

PubMed Central

Zhang, Juncheng; Zheng, Hongyuan; Li, Yiwen; Li, Hongjie; Liu, Xin; Qin, Huanju; Dong, Lingli; Wang, Daowen

2016-01-01

Powdery mildew disease caused by Blumeria graminis f. sp. tritici (Bgt) inflicts severe economic losses in wheat crops. A systematic understanding of the molecular mechanisms involved in wheat resistance to Bgt is essential for effectively controlling the disease. Here, using the diploid wheat Triticum urartu as a host, the genes regulated by immune (IM) and hypersensitive reaction (HR) resistance responses to Bgt were investigated through transcriptome sequencing. Four gene coexpression networks (GCNs) were developed using transcriptomic data generated for 20 T. urartu accessions showing IM, HR or susceptible responses. The powdery mildew resistance regulated (PMRR) genes whose expression was significantly correlated with Bgt resistance were identified, and they tended to be hubs and enriched in six major modules. A wide occurrence of negative regulation of PMRR genes was observed. Three new candidate immune receptor genes (TRIUR3_13045, TRIUR3_01037 and TRIUR3_06195) positively associated with Bgt resistance were discovered. Finally, the involvement of TRIUR3_01037 in Bgt resistance was tentatively verified through cosegregation analysis in a F2 population and functional expression assay in Bgt susceptible leaf cells. This research provides insights into the global network properties of PMRR genes. Potential molecular differences between IM and HR resistance responses to Bgt are discussed. PMID:27033636

Candidate gene prioritization by network analysis of differential expression using machine learning approaches

PubMed Central

2010-01-01

Background Discovering novel disease genes is still challenging for diseases for which no prior knowledge - such as known disease genes or disease-related pathways - is available. Performing genetic studies frequently results in large lists of candidate genes of which only few can be followed up for further investigation. We have recently developed a computational method for constitutional genetic disorders that identifies the most promising candidate genes by replacing prior knowledge by experimental data of differential gene expression between affected and healthy individuals. To improve the performance of our prioritization strategy, we have extended our previous work by applying different machine learning approaches that identify promising candidate genes by determining whether a gene is surrounded by highly differentially expressed genes in a functional association or protein-protein interaction network. Results We have proposed three strategies scoring disease candidate genes relying on network-based machine learning approaches, such as kernel ridge regression, heat kernel, and Arnoldi kernel approximation. For comparison purposes, a local measure based on the expression of the direct neighbors is also computed. We have benchmarked these strategies on 40 publicly available knockout experiments in mice, and performance was assessed against results obtained using a standard procedure in genetics that ranks candidate genes based solely on their differential expression levels (Simple Expression Ranking). Our results showed that our four strategies could outperform this standard procedure and that the best results were obtained using the Heat Kernel Diffusion Ranking leading to an average ranking position of 8 out of 100 genes, an AUC value of 92.3% and an error reduction of 52.8% relative to the standard procedure approach which ranked the knockout gene on average at position 17 with an AUC value of 83.7%. Conclusion In this study we could identify promising candidate genes using network based machine learning approaches even if no knowledge is available about the disease or phenotype. PMID:20840752

Signature gene expressions of cell wall integrity pathway concur with tolerance response of industrial yeast Saccharomyces cerevisiae against biomass pretreatment inhibitors

USDA-ARS?s Scientific Manuscript database

Traditional industrial ethanologenic yeast Saccharomyces cerevisiae has a robust performance under various environmental conditions and can be served as a candidate for the next-generation biocatalyst development for advanced biofuels production using lignocellulose mateials. Overcoming toxic compou...

Uncovering the genetic basis of attenuation in Marek’s disease virus

USDA-ARS?s Scientific Manuscript database

While in vitro serial passage of Marek’s disease virus (MDV) is a proven method to attenuate MDV strains, the underlying genetic changes responsible for attenuation remains unknown. To identify candidate genes and mutations, a virulent MDV generated from an Md5-containing BAC clone was serially pass...

[Stability analysis of reference gene based on real-time PCR in Artemisia annua under cadmium treatment].

PubMed

Zhou, Liang-Yun; Mo, Ge; Wang, Sheng; Tang, Jin-Fu; Yue, Hong; Huang, Lu-Qi; Shao, Ai-Juan; Guo, Lan-Ping

2014-03-01

In this study, Actin, 18S rRNA, PAL, GAPDH and CPR of Artemisia annua were selected as candidate reference genes, and their gene-specific primers for real-time PCR were designed, then geNorm, NormFinder, BestKeeper, Delta CT and RefFinder were used to evaluate their expression stability in the leaves of A. annua under treatment of different concentrations of Cd, with the purpose of finding a reliable reference gene to ensure the reliability of gene-expression analysis. The results showed that there were some significant differences among the candidate reference genes under different treatments and the order of expression stability of candidate reference gene was Actin > 18S rRNA > PAL > GAPDH > CPR. These results suggested that Actin, 18S rRNA and PAL could be used as ideal reference genes of gene expression analysis in A. annua and multiple internal control genes were adopted for results calibration. In addition, differences in expression stability of candidate reference genes in the leaves of A. annua under the same concentrations of Cd were observed, which suggested that the screening of candidate reference genes was needed even under the same treatment. To our best knowledge, this study for the first time provided the ideal reference genes under Cd treatment in the leaves of A. annua and offered reference for the gene expression analysis of A. annua under other conditions.

Fine Mapping Identifies SmFAS Encoding an Anthocyanidin Synthase as a Putative Candidate Gene for Flower Purple Color in Solanum melongena L.

PubMed Central

Chen, Mengqiang; Xu, Mengyun; Xiao, Yao; Cui, Dandan; Qin, Yongqiang; Wu, Jiaqi; Wang, Wenyi; Wang, Guoping

2018-01-01

Anthocyanins are the main pigments in flowers and fruits. These pigments are responsible for the red, red-purple, violet, and purple color in plants, and act as insect and animal attractants. In this study, phenotypic analysis of the purple flower color in eggplant indicated that the flower color is controlled by a single dominant gene, FAS. Using an F2 mapping population derived from a cross between purple-flowered ‘Blacknite’ and white-flowered ‘Small Round’, Flower Anthocyanidin Synthase (FAS) was fine mapped to an approximately 165.6-kb region between InDel marker Indel8-11 and Cleaved Amplified Polymorphic Sequences (CAPS) marker Efc8-32 on Chromosome 8. On the basis of bioinformatic analysis, 29 genes were subsequently located in the FAS target region, among which were two potential Anthocyanidin Synthase (ANS) gene candidates. Allelic sequence comparison results showed that one ANS gene (Sme2.5_01638.1_g00003.1) was conserved in promoter and coding sequences without any nucleotide change between parents, whereas four single-nucleotide polymorphisms were detected in another ANS gene (Sme2.5_01638.1_g00005.1). Crucially, a single base pair deletion at site 438 resulted in premature termination of FAS, leading to the loss of anthocyanin accumulation. In addition, FAS displayed strong expression in purple flowers compared with white flowers and other tissues. Collectively, our results indicate that Sme2.5_01638.1_g00005.1 is a good candidate gene for FAS, which controls anthocyanidin synthase in eggplant flowers. The present study provides information for further potential facilitate genetic engineering for improvement of anthocyanin levels in plants. PMID:29522465

Extensive transcriptional response associated with seasonal plasticity of butterfly wing patterns.

PubMed

Daniels, Emily V; Murad, Rabi; Mortazavi, Ali; Reed, Robert D

2014-12-01

In the eastern United States, the buckeye butterfly, Junonia coenia, shows seasonal wing colour plasticity where adults emerging in the spring are tan, while those emerging in the autumn are dark red. This variation can be artificially induced in laboratory colonies, thus making J. coenia a useful model system to examine the mechanistic basis of plasticity. To better understand the developmental basis of seasonal plasticity, we used RNA-seq to quantify transcription profiles associated with development of alternative seasonal wing morphs. Depending on the developmental stage, between 547 and 1420 transfrags were significantly differentially expressed between morphs. These extensive differences in gene expression stand in contrast to the much smaller numbers of differentially expressed transcripts identified in previous studies of genetic wing pattern variation in other species and suggest that environmentally induced phenotypic shifts arise from very broad systemic processes. Analyses of candidate endocrine and pigmentation transcripts revealed notable genes upregulated in the red morph, including several ecdysone-associated genes, and cinnabar, an ommochrome pigmentation gene implicated in colour pattern variation in other butterflies. We also found multiple melanin-related transcripts strongly upregulated in the red morph, including tan and yellow-family genes, leading us to speculate that dark red pigmentation in autumn J. coenia may involve nonommochrome pigments. While we identified several endocrine and pigmentation genes as obvious candidates for seasonal colour morph differentiation, we speculate that the majority of observed expression differences were due to thermal stress response. The buckeye transcriptome provides a basis for further developmental studies of phenotypic plasticity. © 2014 John Wiley & Sons Ltd.

Systems genetic analysis of multivariate response to iron deficiency in mice

PubMed Central

Yin, Lina; Unger, Erica L.; Jellen, Leslie C.; Earley, Christopher J.; Allen, Richard P.; Tomaszewicz, Ann; Fleet, James C.

2012-01-01

The aim of this study was to identify genes that influence iron regulation under varying dietary iron availability. Male and female mice from 20+ BXD recombinant inbred strains were fed iron-poor or iron-adequate diets from weaning until 4 mo of age. At death, the spleen, liver, and blood were harvested for the measurement of hemoglobin, hematocrit, total iron binding capacity, transferrin saturation, and liver, spleen and plasma iron concentration. For each measure and diet, we found large, strain-related variability. A principal-components analysis (PCA) was performed on the strain means for the seven parameters under each dietary condition for each sex, followed by quantitative trait loci (QTL) analysis on the factors. Compared with the iron-adequate diet, iron deficiency altered the factor structure of the principal components. QTL analysis, combined with PosMed (a candidate gene searching system) published gene expression data and literature citations, identified seven candidate genes, Ptprd, Mdm1, Picalm, lip1, Tcerg1, Skp2, and Frzb based on PCA factor, diet, and sex. Expression of each of these is cis-regulated, significantly correlated with the corresponding PCA factor, and previously reported to regulate iron, directly or indirectly. We propose that polymorphisms in multiple genes underlie individual differences in iron regulation, especially in response to dietary iron challenge. This research shows that iron management is a highly complex trait, influenced by multiple genes. Systems genetics analysis of iron homeostasis holds promise for developing new methods for prevention and treatment of iron deficiency anemia and related diseases. PMID:22461179

Global transcriptomic responses of Escherichia coli K-12 to volatile organic compounds.

PubMed

Yung, Pui Yi; Grasso, Letizia Lo; Mohidin, Abeed Fatima; Acerbi, Enzo; Hinks, Jamie; Seviour, Thomas; Marsili, Enrico; Lauro, Federico M

2016-01-28

Volatile organic compounds (VOCs) are commonly used as solvents in various industrial settings. Many of them present a challenge to receiving environments, due to their toxicity and low bioavailability for degradation. Microorganisms are capable of sensing and responding to their surroundings and this makes them ideal detectors for toxic compounds. This study investigates the global transcriptomic responses of Escherichia coli K-12 to selected VOCs at sub-toxic levels. Cells grown in the presence of VOCs were harvested during exponential growth, followed by whole transcriptome shotgun sequencing (RNAseq). The analysis of the data revealed both shared and unique genetic responses compared to cells without exposure to VOCs. Results suggest that various functional gene categories, for example, those relating to Fe/S cluster biogenesis, oxidative stress responses and transport proteins, are responsive to selected VOCs in E. coli. The differential expression (DE) of genes was validated using GFP-promoter fusion assays. A variety of genes were differentially expressed even at non-inhibitory concentrations and when the cells are at their balanced-growth. Some of these genes belong to generic stress response and others could be specific to VOCs. Such candidate genes and their regulatory elements could be used as the basis for designing biosensors for selected VOCs.

Global transcriptomic responses of Escherichia coli K-12 to volatile organic compounds

PubMed Central

Yung, Pui Yi; Grasso, Letizia Lo; Mohidin, Abeed Fatima; Acerbi, Enzo; Hinks, Jamie; Seviour, Thomas; Marsili, Enrico; Lauro, Federico M.

2016-01-01

Volatile organic compounds (VOCs) are commonly used as solvents in various industrial settings. Many of them present a challenge to receiving environments, due to their toxicity and low bioavailability for degradation. Microorganisms are capable of sensing and responding to their surroundings and this makes them ideal detectors for toxic compounds. This study investigates the global transcriptomic responses of Escherichia coli K-12 to selected VOCs at sub-toxic levels. Cells grown in the presence of VOCs were harvested during exponential growth, followed by whole transcriptome shotgun sequencing (RNAseq). The analysis of the data revealed both shared and unique genetic responses compared to cells without exposure to VOCs. Results suggest that various functional gene categories, for example, those relating to Fe/S cluster biogenesis, oxidative stress responses and transport proteins, are responsive to selected VOCs in E. coli. The differential expression (DE) of genes was validated using GFP-promoter fusion assays. A variety of genes were differentially expressed even at non-inhibitory concentrations and when the cells are at their balanced-growth. Some of these genes belong to generic stress response and others could be specific to VOCs. Such candidate genes and their regulatory elements could be used as the basis for designing biosensors for selected VOCs. PMID:26818886

Identification of High-Temperature-Responsive Genes in Cereals1[C][W

PubMed Central

Hemming, Megan N.; Walford, Sally A.; Fieg, Sarah; Dennis, Elizabeth S.; Trevaskis, Ben

2012-01-01

High temperature influences plant development and can reduce crop yields. We examined how ambient temperature influences reproductive development in the temperate cereals wheat (Triticum aestivum) and barley (Hordeum vulgare). High temperature resulted in rapid progression through reproductive development in long days, but inhibited early stages of reproductive development in short days. Activation of the long-day flowering response pathway through day-length-insensitive alleles of the PHOTOPERIOD1 gene, which result in high FLOWERING LOCUS T-like1 transcript levels, did not allow rapid early reproductive development at high temperature in short days. Furthermore, high temperature did not increase transcript levels of FLOWERING LOCUS T-like genes. These data suggest that genes or pathways other than the long-day response pathway mediate developmental responses to high temperature in cereals. Transcriptome analyses suggested a possible role for vernalization-responsive genes in the developmental response to high temperature. The MADS-box floral repressor HvODDSOC2 is expressed at elevated levels at high temperature in short days, and might contribute to the inhibition of early reproductive development under these conditions. FLOWERING PROMOTING FACTOR1-like, RNase-S-like genes, and VER2-like genes were also identified as candidates for high-temperature-responsive developmental regulators. Overall, these data suggest that rising temperatures might elicit different developmental responses in cereal crops at different latitudes or times of year, due to the interaction between temperature and day length. Additionally, we suggest that different developmental regulators might mediate the response to high temperature in cereals compared to Arabidopsis (Arabidopsis thaliana). PMID:22279145

Downregulation of the expression of mitochondrial electron transport complex genes in autism brains.

PubMed

Anitha, Ayyappan; Nakamura, Kazuhiko; Thanseem, Ismail; Matsuzaki, Hideo; Miyachi, Taishi; Tsujii, Masatsugu; Iwata, Yasuhide; Suzuki, Katsuaki; Sugiyama, Toshiro; Mori, Norio

2013-05-01

Mitochondrial dysfunction (MtD) and abnormal brain bioenergetics have been implicated in autism, suggesting possible candidate genes in the electron transport chain (ETC). We compared the expression of 84 ETC genes in the post-mortem brains of autism patients and controls. Brain tissues from the anterior cingulate gyrus, motor cortex, and thalamus of autism patients (n = 8) and controls (n = 10) were obtained from Autism Tissue Program, USA. Quantitative real-time PCR arrays were used to quantify gene expression. We observed reduced expression of several ETC genes in autism brains compared to controls. Eleven genes of Complex I, five genes each of Complex III and Complex IV, and seven genes of Complex V showed brain region-specific reduced expression in autism. ATP5A1 (Complex V), ATP5G3 (Complex V) and NDUFA5 (Complex I) showed consistently reduced expression in all the brain regions of autism patients. Upon silencing ATP5A1, the expression of mitogen-activated protein kinase 13 (MAPK13), a p38 MAPK responsive to stress stimuli, was upregulated in HEK 293 cells. This could have been induced by oxidative stress due to impaired ATP synthesis. We report new candidate genes involved in abnormal brain bioenergetics in autism, supporting the hypothesis that mitochondria, critical for neurodevelopment, may play a role in autism. © 2012 The Authors; Brain Pathology © 2012 International Society of Neuropathology.

Analysis of Gene Regulatory Networks of Maize in Response to Nitrogen.

PubMed

Jiang, Lu; Ball, Graham; Hodgman, Charlie; Coules, Anne; Zhao, Han; Lu, Chungui

2018-03-08

Nitrogen (N) fertilizer has a major influence on the yield and quality. Understanding and optimising the response of crop plants to nitrogen fertilizer usage is of central importance in enhancing food security and agricultural sustainability. In this study, the analysis of gene regulatory networks reveals multiple genes and biological processes in response to N. Two microarray studies have been used to infer components of the nitrogen-response network. Since they used different array technologies, a map linking the two probe sets to the maize B73 reference genome has been generated to allow comparison. Putative Arabidopsis homologues of maize genes were used to query the Biological General Repository for Interaction Datasets (BioGRID) network, which yielded the potential involvement of three transcription factors (TFs) (GLK5, MADS64 and bZIP108) and a Calcium-dependent protein kinase. An Artificial Neural Network was used to identify influential genes and retrieved bZIP108 and WRKY36 as significant TFs in both microarray studies, along with genes for Asparagine Synthetase, a dual-specific protein kinase and a protein phosphatase. The output from one study also suggested roles for microRNA (miRNA) 399b and Nin-like Protein 15 (NLP15). Co-expression-network analysis of TFs with closely related profiles to known Nitrate-responsive genes identified GLK5, GLK8 and NLP15 as candidate regulators of genes repressed under low Nitrogen conditions, while bZIP108 might play a role in gene activation.

In-vitro responses of T lymphocytes to poly(butylene succinate) based biomaterials.

PubMed

Toso, Montree; Patntirapong, Somying; Janvikul, Wanida; Singhatanadgit, Weerachai

2017-04-01

Polybutylene succinate (PBSu) and PBSu/β-tricalcium phosphate (TCP) composites are biocompatible and good candidates as bone graft materials. However, little is known about the responses of T lymphocytes to these biomaterials, which play an important role in the success of bone grafting. Activated T lymphocytes were cultured onto 32 mm diameter films (PBSu/TCP films), that had previously been placed in 6-well culture plates, for 8, 24 and 72 hours. A plastic-well culture plate was used as a control surface. The effects of PBSu-based biomaterials on T lymphocytes were examined by the using flow cytometry and reverse-transcription polymerase chain reaction. These biomaterials were non-toxic to T lymphocytes, allowing their normal DNA synthesis and activation. All materials induced only transient activation of T lymphocytes, which existed no longer than 72 hours. Proportions of four main CD4/CD8 T lymphocyte subpopulations were not affected by these biomaterials. Moreover, PBSu and PBSu/TCP significantly suppressed the expression of IL-1β and IL-6 genes by 15-35% and 21-26%, respectively. In contrast, a PBSu/TCP composite (at PBSu:TCP=60:40) significantly stimulated the expression of IL-10 and IL-13 genes by 17% and 19%, respectively. PBSu and PBSu/TCP composites were non-toxic to T lymphocytes and did not induce unfavorable responses of T lymphocytes. The tested biomaterials down-regulated key proinflammatory cytokine genes and up-regulated anti-inflammatory cytokine genes in T lymphocytes. These suggest that the biomaterials studied are good candidates as bone graft materials.

Linkage of autosomal recessive lamellar ichthyosis to chromosome 14q

DOE Office of Scientific and Technical Information (OSTI.GOV)

Russell, L.J.; Compton, J.G.; Bale, S.J.

The authors have mapped the locus for lamellar ichthyosis (LI), an autosomal recessive skin disease characterized by abnormal cornification of the epidermis. Analysis using both inbred and outbred families manifesting severe LI showed complete linkage to several markers within a 9.3-cM region on chromosome 14q11. Affected individuals in inbred families were also found to have striking homozygosity for markers in this region. Linkage-based genetic counseling and prenatal diagnosis is now available for informative at-risk families. Several transcribed genes have been mapped to the chromosome 14 region containing the LI gene. The transglutaminase 1 gene (TGM1), which encodes one of themore » enzymes responsible for cross-linking epidermal proteins during formation of the stratum corneum, maps to this interval. The TGM1 locus was completely linked to LI (Z = 9.11), suggesting that TGM1 is a good candidate for further investigation of this disorder. The genes for four serine proteases also map to this region but are expressed only in hematopoietic or mast cells, making them less likely candidates.« less

Transcriptional profiling of human breast cancer cells cultured under microgravity conditions revealed the key role of genetic gravity sensors previously detected in Drosophila melanogaster

NASA Astrophysics Data System (ADS)

Valdivia-Silva, Julio E.; Lavan, David; Diego Orihuela-Tacuri, M.; Sanabria, Gabriela

2016-07-01

Currently, studies in Drosophila melanogaster has shown emerging evidence that microgravity stimuli can be detected at the genetic level. Analysis of the transcriptome in the pupal stage of the fruit flies under microgravity conditions versus ground controls has suggested the presence of a few candidate genes as "gravity sensors" which are experimentally validated. Additionally, several studies have shown that microgravity causes inhibitory effects in different types of cancer cells, although the genes involved and responsible for these effects are still unknown. Here, we demonstrate that the genes suggested as the sensors of gravitational waves in Drosophila melanogaster and their human counterpart (orthologous genes) are highly involved in carcinogenesis, proliferation, anti-apoptotic signals, invasiveness, and metastatic potential of breast cancer cell tumors. The transcriptome analyses suggested that the observed inhibitory effect in cancer cells could be due to changes in the genetic expression of these candidates. These results encourage the possibility of new therapeutic targets managed together and not in isolation.

The ECF sigma factor, PSPTO_1043, in Pseudomonas syringae pv. tomato DC3000 is induced by oxidative stress and regulates genes involved in oxidative stress response

PubMed Central

Butcher, Bronwyn G.; Bao, Zhongmeng; Wilson, Janet; Swingle, Bryan; Filiatrault, Melanie; Schneider, David; Cartinhour, Samuel

2017-01-01

The bacterial plant pathogen Pseudomonas syringae adapts to changes in the environment by modifying its gene expression profile. In many cases, the response is mediated by the activation of extracytoplasmic function (ECF) sigma factors that direct RNA polymerase to transcribe specific sets of genes. In this study we focus on PSPTO_1043, one of ten ECF sigma factors in P. syringae pv. tomato DC3000 (DC3000). PSPTO_1043, together with PSPTO_1042, encode an RpoERsp/ChrR-like sigma/anti-sigma factor pair. Although this gene pair is unique to the P. syringae group among the pseudomonads, homologous genes can be found in photosynthetic genera such as Rhodospirillum, Thalassospira, Phaeospirillum and Parvibaculum. Using ChIP-Seq, we detected 137 putative PSPTO_1043 binding sites and identified a likely promoter motif. We characterized 13 promoter candidates, six of which regulate genes that appear to be found only in P. syringae. PSPTO_1043 responds to the presence of singlet oxygen (1O2) and tert-butyl hydroperoxide (tBOOH) and several of the genes regulated by PSPTO_1043 appear to be involved in response to oxidative stress. PMID:28700608

Radiation Gene-expression Signatures in Primary Breast Cancer Cells.

PubMed

Minafra, Luigi; Bravatà, Valentina; Cammarata, Francesco P; Russo, Giorgio; Gilardi, Maria C; Forte, Giusi I

2018-05-01

In breast cancer (BC) care, radiation therapy (RT) is an efficient treatment to control localized tumor. Radiobiological research is needed to understand molecular differences that affect radiosensitivity of different tumor subtypes and the response variability. The aim of this study was to analyze gene expression profiling (GEP) in primary BC cells following irradiation with doses of 9 Gy and 23 Gy delivered by intraoperative electron radiation therapy (IOERT) in order to define gene signatures of response to high doses of ionizing radiation. We performed GEP by cDNA microarrays and evaluated cell survival after IOERT treatment in primary BC cell cultures. Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed to validate candidate genes. We showed, for the first time, a 4-gene and a 6-gene signature, as new molecular biomarkers, in two primary BC cell cultures after exposure at 9 Gy and 23 Gy respectively, for which we observed a significantly high survival rate. Gene signatures activated by different doses of ionizing radiation may predict response to RT and contribute to defining a personalized biological-driven treatment plan. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

The ECF sigma factor, PSPTO_1043, in Pseudomonas syringae pv. tomato DC3000 is induced by oxidative stress and regulates genes involved in oxidative stress response.

PubMed

Butcher, Bronwyn G; Bao, Zhongmeng; Wilson, Janet; Stodghill, Paul; Swingle, Bryan; Filiatrault, Melanie; Schneider, David; Cartinhour, Samuel

2017-01-01

The bacterial plant pathogen Pseudomonas syringae adapts to changes in the environment by modifying its gene expression profile. In many cases, the response is mediated by the activation of extracytoplasmic function (ECF) sigma factors that direct RNA polymerase to transcribe specific sets of genes. In this study we focus on PSPTO_1043, one of ten ECF sigma factors in P. syringae pv. tomato DC3000 (DC3000). PSPTO_1043, together with PSPTO_1042, encode an RpoERsp/ChrR-like sigma/anti-sigma factor pair. Although this gene pair is unique to the P. syringae group among the pseudomonads, homologous genes can be found in photosynthetic genera such as Rhodospirillum, Thalassospira, Phaeospirillum and Parvibaculum. Using ChIP-Seq, we detected 137 putative PSPTO_1043 binding sites and identified a likely promoter motif. We characterized 13 promoter candidates, six of which regulate genes that appear to be found only in P. syringae. PSPTO_1043 responds to the presence of singlet oxygen (1O2) and tert-butyl hydroperoxide (tBOOH) and several of the genes regulated by PSPTO_1043 appear to be involved in response to oxidative stress.

Prediction of Human Disease Genes by Human-Mouse Conserved Coexpression Analysis

PubMed Central

Grassi, Elena; Damasco, Christian; Silengo, Lorenzo; Oti, Martin; Provero, Paolo; Di Cunto, Ferdinando

2008-01-01

Background Even in the post-genomic era, the identification of candidate genes within loci associated with human genetic diseases is a very demanding task, because the critical region may typically contain hundreds of positional candidates. Since genes implicated in similar phenotypes tend to share very similar expression profiles, high throughput gene expression data may represent a very important resource to identify the best candidates for sequencing. However, so far, gene coexpression has not been used very successfully to prioritize positional candidates. Methodology/Principal Findings We show that it is possible to reliably identify disease-relevant relationships among genes from massive microarray datasets by concentrating only on genes sharing similar expression profiles in both human and mouse. Moreover, we show systematically that the integration of human-mouse conserved coexpression with a phenotype similarity map allows the efficient identification of disease genes in large genomic regions. Finally, using this approach on 850 OMIM loci characterized by an unknown molecular basis, we propose high-probability candidates for 81 genetic diseases. Conclusion Our results demonstrate that conserved coexpression, even at the human-mouse phylogenetic distance, represents a very strong criterion to predict disease-relevant relationships among human genes. PMID:18369433

Physiological and transcriptomic analyses reveal a response mechanism to cold stress in Santalum album L. leaves

PubMed Central

Zhang, Xinhua; Teixeira da Silva, Jaime A.; Niu, Meiyun; Li, Mingzhi; He, Chunmei; Zhao, Jinhui; Zeng, Songjun; Duan, Jun; Ma, Guohua

2017-01-01

Santalum album L. (Indian sandalwood) is an economically important plant species because of its ability to produce highly valued perfume oils. Little is known about the mechanisms by which S. album adapts to low temperatures. In this study, we obtained 100,445,724 raw reads by paired-end sequencing from S. album leaves. Physiological and transcriptomic changes in sandalwood seedlings exposed to 4 °C for 0–48 h were characterized. Cold stress induced the accumulation of malondialdehyde, proline and soluble carbohydrates, and increased the levels of antioxidants. A total of 4,424 differentially expressed genes were responsive to cold, including 3,075 cold-induced and 1,349 cold-repressed genes. When cold stress was prolonged, there was an increase in the expression of cold-responsive genes coding for transporters, responses to stimuli and stress, regulation of defense response, as well as genes related to signal transduction of all phytohormones. Candidate genes in the terpenoid biosynthetic pathway were identified, eight of which were significantly involved in the cold stress response. Gene expression analyses using qRT-PCR showed a peak in the accumulation of SaCBF2 to 4, 50-fold more than control leaves and roots following 12 h and 24 h of cold stress, respectively. The CBF-dependent pathway may play a crucial role in increasing cold tolerance. PMID:28169358

Comparative transcriptome analysis of stylar canal cells identifies novel candidate genes implicated in the self-incompatibility response of Citrus clementina

PubMed Central

2012-01-01

Background Reproductive biology in citrus is still poorly understood. Although in recent years several efforts have been made to study pollen-pistil interaction and self-incompatibility, little information is available about the molecular mechanisms regulating these processes. Here we report the identification of candidate genes involved in pollen-pistil interaction and self-incompatibility in clementine (Citrus clementina Hort. ex Tan.). These genes have been identified comparing the transcriptomes of laser-microdissected stylar canal cells (SCC) isolated from two genotypes differing for self-incompatibility response ('Comune', a self-incompatible cultivar and 'Monreal', a self- compatible mutation of 'Comune'). Results The transcriptome profiling of SCC indicated that the differential regulation of few specific, mostly uncharacterized transcripts is associated with the breakdown of self-incompatibility in 'Monreal'. Among them, a novel F-box gene showed a drastic up-regulation both in laser microdissected stylar canal cells and in self-pollinated whole styles with stigmas of 'Comune' in concomitance with the arrest of pollen tube growth. Moreover, we identify a non-characterized gene family as closely associated to the self-incompatibility genetic program activated in 'Comune'. Three different aspartic-acid rich (Asp-rich) protein genes, located in tandem in the clementine genome, were over-represented in the transcriptome of 'Comune'. These genes are tightly linked to a DELLA gene, previously found to be up-regulated in the self-incompatible genotype during pollen-pistil interaction. Conclusion The highly specific transcriptome survey of the stylar canal cells identified novel genes which have not been previously associated with self-pollen rejection in citrus and in other plant species. Bioinformatic and transcriptional analyses suggested that the mutation leading to self-compatibility in 'Monreal' affected the expression of non-homologous genes located in a restricted genome region. Also, we hypothesize that the Asp-rich protein genes may act as Ca2+ "entrapping" proteins, potentially regulating Ca2+ homeostasis during self-pollen recognition. PMID:22333138

Mutations in the unfolded protein response regulator ATF6 cause the cone dysfunction disorder achromatopsia

PubMed Central

Kohl, Susanne; Zobor, Ditta; Chiang, Wei-Chieh; Weisschuh, Nicole; Staller, Jennifer; Menendez, Irene Gonzalez; Chang, Stanley; Beck, Susanne C; Garrido, Marina Garcia; Sothilingam, Vithiyanjali; Seeliger, Mathias W; Stanzial, Franco; Benedicenti, Francesco; Inzana, Francesca; Héon, Elise; Vincent, Ajoy; Beis, Jill; Strom, Tim M; Rudolph, Günther; Roosing, Susanne; den Hollander, Anneke I; Cremers, Frans P M; Lopez, Irma; Ren, Huanan; Moore, Anthony T; Webster, Andrew R; Michaelides, Michel; Koenekoop, Robert K; Zrenner, Eberhart; Kaufman, Randal J; Tsang, Stephen H; Wissinger, Bernd; Lin, Jonathan H

2015-01-01

Achromatopsia (ACHM) is an autosomal recessive disorder characterized by color blindness, photophobia, nystagmus and severely reduced visual acuity. Using homozygosity mapping and whole-exome and candidate gene sequencing, we identified ten families carrying six homozygous and two compound-heterozygous mutations in the ATF6 gene (encoding activating transcription factor 6A), a key regulator of the unfolded protein response (UPR) and cellular endoplasmic reticulum (ER) homeostasis. Patients had evidence of foveal hypoplasia and disruption of the cone photoreceptor layer. The ACHM-associated ATF6 mutations attenuate ATF6 transcriptional activity in response to ER stress. Atf6−/− mice have normal retinal morphology and function at a young age but develop rod and cone dysfunction with increasing age. This new ACHM-related gene suggests a crucial and unexpected role for ATF6A in human foveal development and cone function and adds to the list of genes that, despite ubiquitous expression, when mutated can result in an isolated retinal photoreceptor phenotype. PMID:26029869

Time-course microarray analysis for identifying candidate genes involved in obesity-associated pathological changes in the mouse colon.

PubMed

Bae, Yun Jung; Kim, Sung-Eun; Hong, Seong Yeon; Park, Taesun; Lee, Sang Gyu; Choi, Myung-Sook; Sung, Mi-Kyung

2016-01-01

Obesity is known to increase the risk of colorectal cancer. However, mechanisms underlying the pathogenesis of obesity-induced colorectal cancer are not completely understood. The purposes of this study were to identify differentially expressed genes in the colon of mice with diet-induced obesity and to select candidate genes as early markers of obesity-associated abnormal cell growth in the colon. C57BL/6N mice were fed normal diet (11% fat energy) or high-fat diet (40% fat energy) and were euthanized at different time points. Genome-wide expression profiles of the colon were determined at 2, 4, 8, and 12 weeks. Cluster analysis was performed using expression data of genes showing log 2 fold change of ≥1 or ≤-1 (twofold change), based on time-dependent expression patterns, followed by virtual network analysis. High-fat diet-fed mice showed significant increase in body weight and total visceral fat weight over 12 weeks. Time-course microarray analysis showed that 50, 47, 36, and 411 genes were differentially expressed at 2, 4, 8, and 12 weeks, respectively. Ten cluster profiles representing distinguishable patterns of genes differentially expressed over time were determined. Cluster 4, which consisted of genes showing the most significant alterations in expression in response to high-fat diet over 12 weeks, included Apoa4 (apolipoprotein A-IV), Ppap2b (phosphatidic acid phosphatase type 2B), Cel (carboxyl ester lipase), and Clps (colipase, pancreatic), which interacted strongly with surrounding genes associated with colorectal cancer or obesity. Our data indicate that Apoa4 , Ppap2b , Cel , and Clps are candidate early marker genes associated with obesity-related pathological changes in the colon. Genome-wide analyses performed in the present study provide new insights on selecting novel genes that may be associated with the development of diseases of the colon.

Identification of Inherited Retinal Disease-Associated Genetic Variants in 11 Candidate Genes.

PubMed

Astuti, Galuh D N; van den Born, L Ingeborgh; Khan, M Imran; Hamel, Christian P; Bocquet, Béatrice; Manes, Gaël; Quinodoz, Mathieu; Ali, Manir; Toomes, Carmel; McKibbin, Martin; El-Asrag, Mohammed E; Haer-Wigman, Lonneke; Inglehearn, Chris F; Black, Graeme C M; Hoyng, Carel B; Cremers, Frans P M; Roosing, Susanne

2018-01-10

Inherited retinal diseases (IRDs) display an enormous genetic heterogeneity. Whole exome sequencing (WES) recently identified genes that were mutated in a small proportion of IRD cases. Consequently, finding a second case or family carrying pathogenic variants in the same candidate gene often is challenging. In this study, we searched for novel candidate IRD gene-associated variants in isolated IRD families, assessed their causality, and searched for novel genotype-phenotype correlations. Whole exome sequencing was performed in 11 probands affected with IRDs. Homozygosity mapping data was available for five cases. Variants with minor allele frequencies ≤ 0.5% in public databases were selected as candidate disease-causing variants. These variants were ranked based on their: (a) presence in a gene that was previously implicated in IRD; (b) minor allele frequency in the Exome Aggregation Consortium database (ExAC); (c) in silico pathogenicity assessment using the combined annotation dependent depletion (CADD) score; and (d) interaction of the corresponding protein with known IRD-associated proteins. Twelve unique variants were found in 11 different genes in 11 IRD probands. Novel autosomal recessive and dominant inheritance patterns were found for variants in Small Nuclear Ribonucleoprotein U5 Subunit 200 ( SNRNP200 ) and Zinc Finger Protein 513 ( ZNF513 ), respectively. Using our pathogenicity assessment, a variant in DEAH-Box Helicase 32 ( DHX32 ) was the top ranked novel candidate gene to be associated with IRDs, followed by eight medium and lower ranked candidate genes. The identification of candidate disease-associated sequence variants in 11 single families underscores the notion that the previously identified IRD-associated genes collectively carry > 90% of the defects implicated in IRDs. To identify multiple patients or families with variants in the same gene and thereby provide extra proof for pathogenicity, worldwide data sharing is needed.

Expression of zinc and cadmium responsive genes in leaves of willow (Salix caprea L.) genotypes with different accumulation characteristics

PubMed Central

Konlechner, Cornelia; Türktaş, Mine; Langer, Ingrid; Vaculík, Marek; Wenzel, Walter W.; Puschenreiter, Markus; Hauser, Marie-Theres

2013-01-01

Salix caprea is well suited for phytoextraction strategies. In a previous survey we showed that genetically distinct S. caprea plants isolated from metal-polluted and unpolluted sites differed in their zinc (Zn) and cadmium (Cd) tolerance and accumulation abilities. To determine the molecular basis of this difference we examined putative homologues of genes involved in heavy metal responses and identified over 200 new candidates with a suppression subtractive hybridization (SSH) screen. Quantitative expression analyses of 20 genes in leaves revealed that some metallothioneins and cell wall modifying genes were induced irrespective of the genotype's origin and metal uptake capacity while a cysteine biosynthesis gene was expressed constitutively higher in the metallicolous genotype. The third and largest group of genes was only induced in the metallicolous genotype. These data demonstrate that naturally adapted woody non-model species can help to discover potential novel molecular mechanisms for metal accumulation and tolerance. PMID:23562959

Schistosoma mansoni: resistant specific infection-induced gene expression in Biomphalaria glabrata identified by fluorescent-based differential display.

PubMed

Lockyer, Anne E; Noble, Leslie R; Rollinson, David; Jones, Catherine S

2004-01-01

The freshwater tropical snail Biomphalaria glabrata is an intermediate host for Schistosoma mansoni, the causative agent of human intestinal schistosomiasis, and strains differ in their susceptibility to parasite infection. Changes in gene expression in response to parasite infection have been simultaneously examined in a susceptible strain (NHM1742) and a resistant strain (NHM1981) using a newly developed fluorescent-based differential display method. Such RNA profiling techniques allow the examination of changes in gene expression in response to parasite infection, without requiring previous sequence knowledge, or selecting candidate genes that may be involved in the complex neuroendocrine or defence systems of the snail. Thus, novel genes may be identified. Ten transcripts were initially identified, present only in the profiles derived from snails of the resistant strain when exposed to infection. The differential expression of five of these genes, including HSP70 and several novel transcripts with one containing at least two globin-like domains, has been confirmed by semi-quantitative RT-PCR.

Polymorphisms of genes related to the hypothalamic-pituitary-adrenal axis influence the cortisol awakening response as well as self-perceived stress.

PubMed

Li-Tempel, Ting; Larra, Mauro F; Winnikes, Ulrike; Tempel, Tobias; DeRijk, Roel H; Schulz, André; Schächinger, Hartmut; Meyer, Jobst; Schote, Andrea B

2016-09-01

The hypothalamus-pituitary-adrenal (HPA) axis is a crucial endocrine system for coping with stress. A reliable and stable marker for the basal state of that system is the cortisol awakening response (CAR). We examined the influence of variants of four relevant candidate genes; the mineralocorticoid receptor gene (MR), the glucocorticoid receptor gene (GR), the serotonin transporter gene (5-HTT) and the gene encoding the brain-derived neurotrophic factor (BDNF) on CAR and self-perceived stress in 217 healthy subjects. We found that polymorphisms of GR influenced both, the basal state of the HPA axis as well as self-perceived stress. MR only associated with self-perceived stress and 5-HTT only with CAR. BDNF did not affected any of the investigated indices. In summary, we suggest that GR variants together with the CAR and supplemented with self reports on perceived stress might be useful indicators for the basal HPA axis activity. Copyright © 2016 Elsevier B.V. All rights reserved.

Looking into flowering time in almond (Prunus dulcis (Mill) D. A. Webb): the candidate gene approach.

PubMed

Silva, C; Garcia-Mas, J; Sánchez, A M; Arús, P; Oliveira, M M

2005-03-01

Blooming time is one of the most important agronomic traits in almond. Biochemical and molecular events underlying flowering regulation must be understood before methods to stimulate late flowering can be developed. Attempts to elucidate the genetic control of this process have led to the identification of a major gene (Lb) and quantitative trait loci (QTLs) linked to observed phenotypic differences, but although this gene and these QTLs have been placed on the Prunus reference genetic map, their sequences and specific functions remain unknown. The aim of our investigation was to associate these loci with known genes using a candidate gene approach. Two almond cDNAs and eight Prunus expressed sequence tags were selected as candidate genes (CGs) since their sequences were highly identical to those of flowering regulatory genes characterized in other species. The CGs were amplified from both parental lines of the mapping population using specific primers. Sequence comparison revealed DNA polymorphisms between the parental lines, mainly of the single nucleotide type. Polymorphisms were used to develop co-dominant cleaved amplified polymorphic sequence markers or length polymorphisms based on insertion/deletion events for mapping the candidate genes on the Prunus reference map. Ten candidate genes were assigned to six linkage groups in the Prunus genome. The positions of two of these were compatible with the regions where two QTLs for blooming time were detected. One additional candidate was localized close to the position of the Evergrowing gene, which determines a non-deciduous behaviour in peach.

Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

NASA Astrophysics Data System (ADS)

Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

An analysis of Methylenetetrahydrofolate reductase and Glutathione S-transferase omega-1 genes as modifiers of the cerebral response to ischemia

PubMed Central

Peddareddygari, Leema Reddy; Dutra, Ana Virginia; Levenstien, Mark A; Sen, Souvik; Grewal, Raji P

2009-01-01

Background Cerebral ischemia involves a series of reactions which ultimately influence the final volume of a brain infarction. We hypothesize that polymorphisms in genes encoding proteins involved in these reactions could act as modifiers of the cerebral response to ischemia and impact the resultant stroke volume. The final volume of a cerebral infarct is important as it correlates with the morbidity and mortality associated with non-lacunar ischemic strokes. Methods The proteins encoded by the methylenetetrahydrofolate reductase (MTHFR) and glutathione S-transferase omega-1 (GSTO-1) genes are, through oxidative mechanisms, key participants in the cerebral response to ischemia. On the basis of these biological activities, they were selected as candidate genes for further investigation. We analyzed the C677T polymorphism in the MTHFR gene and the C419A polymorphism in the GSTO-1 gene in 128 patients with non-lacunar ischemic strokes. Results We found no significant association of either the MTHFR (p = 0.72) or GSTO-1 (p = 0.58) polymorphisms with cerebral infarct volume. Conclusion Our study shows no major gene effect of either the MTHFR or GSTO-1 genes as a modifier of ischemic stroke volume. However, given the relatively small sample size, a minor gene effect is not excluded by this investigation. PMID:19624857

Migration phenology and breeding success are predicted by methylation of a photoperiodic gene in the barn swallow

PubMed Central

Saino, Nicola; Ambrosini, Roberto; Albetti, Benedetta; Caprioli, Manuela; De Giorgio, Barbara; Gatti, Emanuele; Liechti, Felix; Parolini, Marco; Romano, Andrea; Romano, Maria; Scandolara, Chiara; Gianfranceschi, Luca; Bollati, Valentina; Rubolini, Diego

2017-01-01

Individuals often considerably differ in the timing of their life-cycle events, with major consequences for individual fitness, and, ultimately, for population dynamics. Phenological variation can arise from genetic effects but also from epigenetic modifications in DNA expression and translation. Here, we tested if CpG methylation at the poly-Q and 5′-UTR loci of the photoperiodic Clock gene predicted migration and breeding phenology of long-distance migratory barn swallows (Hirundo rustica) that were tracked year-round using light-level geolocators. Increasing methylation at Clock poly-Q was associated with earlier spring departure from the African wintering area, arrival date at the European breeding site, and breeding date. Higher methylation levels also predicted increased breeding success. Thus, we showed for the first time in any species that CpG methylation at a candidate gene may affect phenology and breeding performance. Methylation at Clock may be a candidate mechanism mediating phenological responses of migratory birds to ongoing climate change. PMID:28361883

GhNAC12, a neutral candidate gene, leads to early aging in cotton (Gossypium hirsutum L).

PubMed

Zhao, Fengli; Ma, Jianhui; Li, Libei; Fan, Shuli; Guo, Yaning; Song, Meizhen; Wei, Hengling; Pang, Chaoyou; Yu, Shuxun

2016-01-15

NAC (NAM, ATAF, and CUC) is one of the largest transcription factor families in plants, and its members play various roles in plant growth, development, and the response to biotic and abiotic stresses. Currently, 77 NAC genes have been reported in cotton (Gossypium hirsutum L.). And GhNAC12 showed up-regulation during leaf senescence, but its role in this process is poorly understood. In the present study, a preliminary function analysis of GhNAC12 was performed during leaf senescence. qRT-PCR analysis indicated that GhNAC12 expression increased during the early-aging process and the aging of cotyledons. Additionally, we observed that overexpression of GhNAC12 in Arabidopsis led to early senescence (early aging). Our findings suggest that GhNAC12 is a candidate gene for early aging in upland cotton cultivars. Neutrality tests suggested that there was no selection pressure imposed on GhNAC12 during the domestication of upland cotton. Copyright © 2015 Elsevier B.V. All rights reserved.

Migration phenology and breeding success are predicted by methylation of a photoperiodic gene in the barn swallow.

PubMed

Saino, Nicola; Ambrosini, Roberto; Albetti, Benedetta; Caprioli, Manuela; De Giorgio, Barbara; Gatti, Emanuele; Liechti, Felix; Parolini, Marco; Romano, Andrea; Romano, Maria; Scandolara, Chiara; Gianfranceschi, Luca; Bollati, Valentina; Rubolini, Diego

2017-03-31

Individuals often considerably differ in the timing of their life-cycle events, with major consequences for individual fitness, and, ultimately, for population dynamics. Phenological variation can arise from genetic effects but also from epigenetic modifications in DNA expression and translation. Here, we tested if CpG methylation at the poly-Q and 5'-UTR loci of the photoperiodic Clock gene predicted migration and breeding phenology of long-distance migratory barn swallows (Hirundo rustica) that were tracked year-round using light-level geolocators. Increasing methylation at Clock poly-Q was associated with earlier spring departure from the African wintering area, arrival date at the European breeding site, and breeding date. Higher methylation levels also predicted increased breeding success. Thus, we showed for the first time in any species that CpG methylation at a candidate gene may affect phenology and breeding performance. Methylation at Clock may be a candidate mechanism mediating phenological responses of migratory birds to ongoing climate change.

Human genetic factors in tuberculosis: an update.

PubMed

van Tong, Hoang; Velavan, Thirumalaisamy P; Thye, Thorsten; Meyer, Christian G

2017-09-01

Tuberculosis (TB) is a major threat to human health, especially in many developing countries. Human genetic variability has been recognised to be of great relevance in host responses to Mycobacterium tuberculosis infection and in regulating both the establishment and the progression of the disease. An increasing number of candidate gene and genome-wide association studies (GWAS) have focused on human genetic factors contributing to susceptibility or resistance to TB. To update previous reviews on human genetic factors in TB we searched the MEDLINE database and PubMed for articles from 1 January 2014 through 31 March 2017 and reviewed the role of human genetic variability in TB. Search terms applied in various combinations were 'tuberculosis', 'human genetics', 'candidate gene studies', 'genome-wide association studies' and 'Mycobacterium tuberculosis'. Articles in English retrieved and relevant references cited in these articles were reviewed. Abstracts and reports from meetings were also included. This review provides a recent summary of associations of polymorphisms of human genes with susceptibility/resistance to TB. © 2017 John Wiley & Sons Ltd.

Circadian expression profiles of chromatin remodeling factor genes in Arabidopsis.

PubMed

Lee, Hong Gil; Lee, Kyounghee; Jang, Kiyoung; Seo, Pil Joon

2015-01-01

The circadian clock is a biological time keeper mechanism that regulates biological rhythms to a period of approximately 24 h. The circadian clock enables organisms to anticipate environmental cycles and coordinates internal cellular physiology with external environmental cues. In plants, correct matching of the clock with the environment confers fitness advantages to plant survival and reproduction. Therefore, circadian clock components are regulated at multiple layers to fine-tune the circadian oscillation. Epigenetic regulation provides an additional layer of circadian control. However, little is known about which chromatin remodeling factors are responsible for circadian control. In this work, we analyzed circadian expression of 109 chromatin remodeling factor genes and identified 17 genes that display circadian oscillation. In addition, we also found that a candidate interacts with a core clock component, supporting that clock activity is regulated in part by chromatin modification. As an initial attempt to elucidate the relationship between chromatin modification and circadian oscillation, we identified novel regulatory candidates that provide a platform for future investigations of chromatin regulation of the circadian clock.

Tumour angiogenesis is reduced in the Tc1 mouse model of Down Syndrome

PubMed Central

Reynolds, Louise E.; Watson, Alan R.; Baker, Marianne; Jones, Tania A.; D’Amico, Gabriela; Robinson, Stephen D.; Joffre, Carine; Garrido-Urbani, Sarah; Rodriguez-Manzaneque, Juan Carlos; Martino-Echarri, Estefanía; Aurrand-Lions, Michel; Sheer, Denise; Dagna-Bricarelli, Franca; Nizetic, Dean; McCabe, Christopher J.; Turnell, Andrew S.; Kermorgant, Stephanie; Imhof, Beat A.; Adams, Ralf; Fisher, Elizabeth M.C.; Tybulewicz, Victor L. J.; Hart, Ian R.; Hodivala-Dilke, Kairbaan M.

2012-01-01

Down Syndrome (DS) is a genetic disorder caused by full or partial trisomy of chromosome 21. It occurs in approximately 1/750 live births and presents with many clinical phenotypes including a reduced incidence of solid tumours1,2. Recent work using the Ts65Dn model of DS, that has orthologs of approximately 50% of the genes on human chromosome 21 (Hsa21), has suggested that three copies of the ETS23 or Down Syndrome candidate region 1 (DSCR1) genes4 (a previously known suppressor of angiogenesis5,6) is sufficient to inhibit tumour growth. We have used the Tc1 transchromosomic mouse model of DS9 to dissect the contribution of extra copies of genes on Hsa21 to tumour angiogenesis. This mouse expresses approximately 81% of Hsa21 genes but not the human DSCR1 region (Supplementary Fig. 1). We transplanted B16F0 and Lewis Lung Carcinoma (LLC) tumour cells into Tc1 mice and showed that growth of these tumours was reduced substantially when compared to wild-type littermate controls. Furthermore, tumour angiogenesis was repressed significantly in Tc1 mice. In particular, in vitro and in vivo angiogenic responses to vascular endothelial growth factor (VEGF) were inhibited. Examination of the genes on the segment of Hsa21 in Tc1 mice identified putative anti-angiogenic genes (ADAMTS17,8 and ERG9) and novel endothelial cell-specific genes10, never shown before to be involved in angiogenesis (JAM-B11 and PTTG1IP) that, when overexpressed, are responsible for the inhibition of angiogenic responses to VEGF. Three copies of these genes within the stromal compartment reduced tumour angiogenesis providing an explanation for the reduced tumour growth in DS. Furthermore, we anticipate that, in addition to the candidate genes that we show to be involved in the repression of angiogenesis, the Tc1 mouse model of DS will likely allow for the identification of other endothelial-specific anti-angiogenic targets relevant to a broad spectrum of cancer patients. PMID:20535211

Use of homologous and heterologous gene expression profiling tools to characterize transcription dynamics during apple fruit maturation and ripening

PubMed Central

2010-01-01

Background Fruit development, maturation and ripening consists of a complex series of biochemical and physiological changes that in climacteric fruits, including apple and tomato, are coordinated by the gaseous hormone ethylene. These changes lead to final fruit quality and understanding of the functional machinery underlying these processes is of both biological and practical importance. To date many reports have been made on the analysis of gene expression in apple. In this study we focused our investigation on the role of ethylene during apple maturation, specifically comparing transcriptomics of normal ripening with changes resulting from application of the hormone receptor competitor 1-Methylcyclopropene. Results To gain insight into the molecular process regulating ripening in apple, and to compare to tomato (model species for ripening studies), we utilized both homologous and heterologous (tomato) microarray to profile transcriptome dynamics of genes involved in fruit development and ripening, emphasizing those which are ethylene regulated. The use of both types of microarrays facilitated transcriptome comparison between apple and tomato (for the later using data previously published and available at the TED: tomato expression database) and highlighted genes conserved during ripening of both species, which in turn represent a foundation for further comparative genomic studies. The cross-species analysis had the secondary aim of examining the efficiency of heterologous (specifically tomato) microarray hybridization for candidate gene identification as related to the ripening process. The resulting transcriptomics data revealed coordinated gene expression during fruit ripening of a subset of ripening-related and ethylene responsive genes, further facilitating the analysis of ethylene response during fruit maturation and ripening. Conclusion Our combined strategy based on microarray hybridization enabled transcriptome characterization during normal climacteric apple ripening, as well as definition of ethylene-dependent transcriptome changes. Comparison with tomato fruit maturation and ethylene responsive transcriptome activity facilitated identification of putative conserved orthologous ripening-related genes, which serve as an initial set of candidates for assessing conservation of gene activity across genomes of fruit bearing plant species. PMID:20973957

SomInaClust: detection of cancer genes based on somatic mutation patterns of inactivation and clustering.

PubMed

Van den Eynden, Jimmy; Fierro, Ana Carolina; Verbeke, Lieven P C; Marchal, Kathleen

2015-04-23

With the advances in high throughput technologies, increasing amounts of cancer somatic mutation data are being generated and made available. Only a small number of (driver) mutations occur in driver genes and are responsible for carcinogenesis, while the majority of (passenger) mutations do not influence tumour biology. In this study, SomInaClust is introduced, a method that accurately identifies driver genes based on their mutation pattern across tumour samples and then classifies them into oncogenes or tumour suppressor genes respectively. SomInaClust starts from the observation that oncogenes mainly contain mutations that, due to positive selection, cluster at similar positions in a gene across patient samples, whereas tumour suppressor genes contain a high number of protein-truncating mutations throughout the entire gene length. The method was shown to prioritize driver genes in 9 different solid cancers. Furthermore it was found to be complementary to existing similar-purpose methods with the additional advantages that it has a higher sensitivity, also for rare mutations (occurring in less than 1% of all samples), and it accurately classifies candidate driver genes in putative oncogenes and tumour suppressor genes. Pathway enrichment analysis showed that the identified genes belong to known cancer signalling pathways, and that the distinction between oncogenes and tumour suppressor genes is biologically relevant. SomInaClust was shown to detect candidate driver genes based on somatic mutation patterns of inactivation and clustering and to distinguish oncogenes from tumour suppressor genes. The method could be used for the identification of new cancer genes or to filter mutation data for further data-integration purposes.

RNA-seq Transcriptome Response of Flax (Linum usitatissimum L.) to the Pathogenic Fungus Fusarium oxysporum f. sp. lini

PubMed Central

Galindo-González, Leonardo; Deyholos, Michael K.

2016-01-01

Fusarium oxysporum f. sp. lini is a hemibiotrophic fungus that causes wilt in flax. Along with rust, fusarium wilt has become an important factor in flax production worldwide. Resistant flax cultivars have been used to manage the disease, but the resistance varies, depending on the interactions between specific cultivars and isolates of the pathogen. This interaction has a strong molecular basis, but no genomic information is available on how the plant responds to attempted infection, to inform breeding programs on potential candidate genes to evaluate or improve resistance across cultivars. In the current study, disease progression in two flax cultivars [Crop Development Center (CDC) Bethune and Lutea], showed earlier disease symptoms and higher susceptibility in the later cultivar. Chitinase gene expression was also divergent and demonstrated and earlier molecular response in Lutea. The most resistant cultivar (CDC Bethune) was used for a full RNA-seq transcriptome study through a time course at 2, 4, 8, and 18 days post-inoculation (DPI). While over 100 genes were significantly differentially expressed at both 4 and 8 DPI, the broadest deployment of plant defense responses was evident at 18 DPI with transcripts of more than 1,000 genes responding to the treatment. These genes evidenced a reception and transduction of pathogen signals, a large transcriptional reprogramming, induction of hormone signaling, activation of pathogenesis-related genes, and changes in secondary metabolism. Among these, several key genes that consistently appear in studies of plant-pathogen interactions, had increased transcript abundance in our study, and constitute suitable candidates for resistance breeding programs. These included: an induced RPMI-induced protein kinase; transcription factors WRKY3, WRKY70, WRKY75, MYB113, and MYB108; the ethylene response factors ERF1 and ERF14; two genes involved in auxin/glucosinolate precursor synthesis (CYP79B2 and CYP79B3); the flavonoid-related enzymes chalcone synthase, dihydroflavonol reductase and multiple anthocyanidin synthases; and a peroxidase implicated in lignin formation (PRX52). Additionally, regulation of some genes indicated potential pathogen manipulation to facilitate infection; these included four disease resistance proteins that were repressed, indole acetic acid amido/amino hydrolases which were upregulated, activated expansins and glucanases, amino acid transporters and aquaporins, and finally, repression of major latex proteins. PMID:27933082

RNA-seq Transcriptome Response of Flax (Linum usitatissimum L.) to the Pathogenic Fungus Fusarium oxysporum f. sp. lini.

PubMed

Galindo-González, Leonardo; Deyholos, Michael K

2016-01-01

Fusarium oxysporum f. sp. lini is a hemibiotrophic fungus that causes wilt in flax. Along with rust, fusarium wilt has become an important factor in flax production worldwide. Resistant flax cultivars have been used to manage the disease, but the resistance varies, depending on the interactions between specific cultivars and isolates of the pathogen. This interaction has a strong molecular basis, but no genomic information is available on how the plant responds to attempted infection, to inform breeding programs on potential candidate genes to evaluate or improve resistance across cultivars. In the current study, disease progression in two flax cultivars [Crop Development Center (CDC) Bethune and Lutea], showed earlier disease symptoms and higher susceptibility in the later cultivar. Chitinase gene expression was also divergent and demonstrated and earlier molecular response in Lutea. The most resistant cultivar (CDC Bethune) was used for a full RNA-seq transcriptome study through a time course at 2, 4, 8, and 18 days post-inoculation (DPI). While over 100 genes were significantly differentially expressed at both 4 and 8 DPI, the broadest deployment of plant defense responses was evident at 18 DPI with transcripts of more than 1,000 genes responding to the treatment. These genes evidenced a reception and transduction of pathogen signals, a large transcriptional reprogramming, induction of hormone signaling, activation of pathogenesis-related genes, and changes in secondary metabolism. Among these, several key genes that consistently appear in studies of plant-pathogen interactions, had increased transcript abundance in our study, and constitute suitable candidates for resistance breeding programs. These included: an induced R PMI-induced protein kinase; transcription factors WRKY3, WRKY70, WRKY75, MYB113 , and MYB108 ; the ethylene response factors ERF1 and ERF14 ; two genes involved in auxin/glucosinolate precursor synthesis ( CYP79B2 and CYP79B3 ); the flavonoid-related enzymes chalcone synthase, dihydroflavonol reductase and multiple anthocyanidin synthases; and a peroxidase implicated in lignin formation ( PRX52 ). Additionally, regulation of some genes indicated potential pathogen manipulation to facilitate infection; these included four disease resistance proteins that were repressed, indole acetic acid amido/amino hydrolases which were upregulated, activated expansins and glucanases, amino acid transporters and aquaporins, and finally, repression of major latex proteins.

Phylogenetic analysis of IDD gene family and characterization of its expression in response to flower induction in Malus.

PubMed

Fan, Sheng; Zhang, Dong; Xing, Libo; Qi, Siyan; Du, Lisha; Wu, Haiqin; Shao, Hongxia; Li, Youmei; Ma, Juanjuan; Han, Mingyu

2017-08-01

Although INDETERMINATE DOMAIN (IDD) genes encoding specific plant transcription factors have important roles in plant growth and development, little is known about apple IDD (MdIDD) genes and their potential functions in the flower induction. In this study, we identified 20 putative IDD genes in apple and named them according to their chromosomal locations. All identified MdIDD genes shared a conserved IDD domain. A phylogenetic analysis separated MdIDDs and other plant IDD genes into four groups. Bioinformatic analysis of chemical characteristics, gene structure, and prediction of protein-protein interactions demonstrated the functional and structural diversity of MdIDD genes. To further uncover their potential functions, we performed analysis of tandem, synteny, and gene duplications, which indicated several paired homologs of IDD genes between apple and Arabidopsis. Additionally, genome duplications also promoted the expansion and evolution of the MdIDD genes. Quantitative real-time PCR revealed that all the MdIDD genes showed distinct expression levels in five different tissues (stems, leaves, buds, flowers, and fruits). Furthermore, the expression levels of candidate MdIDD genes were also investigated in response to various circumstances, including GA treatment (decreased the flowering rate), sugar treatment (increased the flowering rate), alternate-bearing conditions, and two varieties with different-flowering intensities. Parts of them were affected by exogenous treatments and showed different expression patterns. Additionally, changes in response to alternate-bearing and different-flowering varieties of apple trees indicated that they were also responsive to flower induction. Taken together, our comprehensive analysis provided valuable information for further analysis of IDD genes aiming at flower induction.

Defining a new candidate gene for amelogenesis imperfecta: from molecular genetics to biochemistry.

PubMed

Urzúa, Blanca; Ortega-Pinto, Ana; Morales-Bozo, Irene; Rojas-Alcayaga, Gonzalo; Cifuentes, Víctor

2011-02-01

Amelogenesis imperfecta is a group of genetic conditions that affect the structure and clinical appearance of tooth enamel. The types (hypoplastic, hypocalcified, and hypomature) are correlated with defects in different stages of the process of enamel synthesis. Autosomal dominant, recessive, and X-linked types have been previously described. These disorders are considered clinically and genetically heterogeneous in etiology, involving a variety of genes, such as AMELX, ENAM, DLX3, FAM83H, MMP-20, KLK4, and WDR72. The mutations identified within these causal genes explain less than half of all cases of amelogenesis imperfecta. Most of the candidate and causal genes currently identified encode proteins involved in enamel synthesis. We think it is necessary to refocus the search for candidate genes using biochemical processes. This review provides theoretical evidence that the human SLC4A4 gene (sodium bicarbonate cotransporter) may be a new candidate gene.

A public platform for the verification of the phenotypic effect of candidate genes for resistance to aflatoxin accumulation and Aspergillus flavus infection in maize.

PubMed

Warburton, Marilyn L; Williams, William Paul; Hawkins, Leigh; Bridges, Susan; Gresham, Cathy; Harper, Jonathan; Ozkan, Seval; Mylroie, J Erik; Shan, Xueyan

2011-07-01

A public candidate gene testing pipeline for resistance to aflatoxin accumulation or Aspergillus flavus infection in maize is presented here. The pipeline consists of steps for identifying, testing, and verifying the association of selected maize gene sequences with resistance under field conditions. Resources include a database of genetic and protein sequences associated with the reduction in aflatoxin contamination from previous studies; eight diverse inbred maize lines for polymorphism identification within any maize gene sequence; four Quantitative Trait Loci (QTL) mapping populations and one association mapping panel, all phenotyped for aflatoxin accumulation resistance and associated phenotypes; and capacity for Insertion/Deletion (InDel) and SNP genotyping in the population(s) for mapping. To date, ten genes have been identified as possible candidate genes and put through the candidate gene testing pipeline, and results are presented here to demonstrate the utility of the pipeline.

ENU Mutagenesis in Mice Identifies Candidate Genes For Hypogonadism

PubMed Central

Weiss, Jeffrey; Hurley, Lisa A.; Harris, Rebecca M.; Finlayson, Courtney; Tong, Minghan; Fisher, Lisa A.; Moran, Jennifer L.; Beier, David R.; Mason, Christopher; Jameson, J. Larry

2012-01-01

Genome-wide mutagenesis was performed in mice to identify candidate genes for male infertility, for which the predominant causes remain idiopathic. Mice were mutagenized using N-ethyl-N-nitrosourea (ENU), bred, and screened for phenotypes associated with the male urogenital system. Fifteen heritable lines were isolated and chromosomal loci were assigned using low density genome-wide SNP arrays. Ten of the fifteen lines were pursued further using higher resolution SNP analysis to narrow the candidate gene regions. Exon sequencing of candidate genes identified mutations in mice with cystic kidneys (Bicc1), cryptorchidism (Rxfp2), restricted germ cell deficiency (Plk4), and severe germ cell deficiency (Prdm9). In two other lines with severe hypogonadism candidate sequencing failed to identify mutations, suggesting defects in genes with previously undocumented roles in gonadal function. These genomic intervals were sequenced in their entirety and a candidate mutation was identified in SnrpE in one of the two lines. The line harboring the SnrpE variant retains substantial spermatogenesis despite small testis size, an unusual phenotype. In addition to the reproductive defects, heritable phenotypes were observed in mice with ataxia (Myo5a), tremors (Pmp22), growth retardation (unknown gene), and hydrocephalus (unknown gene). These results demonstrate that the ENU screen is an effective tool for identifying potential causes of male infertility. PMID:22258617

Sporulation genes associated with sporulation efficiency in natural isolates of yeast.

PubMed

Tomar, Parul; Bhatia, Aatish; Ramdas, Shweta; Diao, Liyang; Bhanot, Gyan; Sinha, Himanshu

2013-01-01

Yeast sporulation efficiency is a quantitative trait and is known to vary among experimental populations and natural isolates. Some studies have uncovered the genetic basis of this variation and have identified the role of sporulation genes (IME1, RME1) and sporulation-associated genes (FKH2, PMS1, RAS2, RSF1, SWS2), as well as non-sporulation pathway genes (MKT1, TAO3) in maintaining this variation. However, these studies have been done mostly in experimental populations. Sporulation is a response to nutrient deprivation. Unlike laboratory strains, natural isolates have likely undergone multiple selections for quick adaptation to varying nutrient conditions. As a result, sporulation efficiency in natural isolates may have different genetic factors contributing to phenotypic variation. Using Saccharomyces cerevisiae strains in the genetically and environmentally diverse SGRP collection, we have identified genetic loci associated with sporulation efficiency variation in a set of sporulation and sporulation-associated genes. Using two independent methods for association mapping and correcting for population structure biases, our analysis identified two linked clusters containing 4 non-synonymous mutations in genes - HOS4, MCK1, SET3, and SPO74. Five regulatory polymorphisms in five genes such as MLS1 and CDC10 were also identified as putative candidates. Our results provide candidate genes contributing to phenotypic variation in the sporulation efficiency of natural isolates of yeast.

Sporulation Genes Associated with Sporulation Efficiency in Natural Isolates of Yeast

PubMed Central

Ramdas, Shweta; Diao, Liyang; Bhanot, Gyan; Sinha, Himanshu

2013-01-01

Yeast sporulation efficiency is a quantitative trait and is known to vary among experimental populations and natural isolates. Some studies have uncovered the genetic basis of this variation and have identified the role of sporulation genes (IME1, RME1) and sporulation-associated genes (FKH2, PMS1, RAS2, RSF1, SWS2), as well as non-sporulation pathway genes (MKT1, TAO3) in maintaining this variation. However, these studies have been done mostly in experimental populations. Sporulation is a response to nutrient deprivation. Unlike laboratory strains, natural isolates have likely undergone multiple selections for quick adaptation to varying nutrient conditions. As a result, sporulation efficiency in natural isolates may have different genetic factors contributing to phenotypic variation. Using Saccharomyces cerevisiae strains in the genetically and environmentally diverse SGRP collection, we have identified genetic loci associated with sporulation efficiency variation in a set of sporulation and sporulation-associated genes. Using two independent methods for association mapping and correcting for population structure biases, our analysis identified two linked clusters containing 4 non-synonymous mutations in genes – HOS4, MCK1, SET3, and SPO74. Five regulatory polymorphisms in five genes such as MLS1 and CDC10 were also identified as putative candidates. Our results provide candidate genes contributing to phenotypic variation in the sporulation efficiency of natural isolates of yeast. PMID:23874994

De Novo Foliar Transcriptome of Chenopodium amaranticolor and Analysis of Its Gene Expression During Virus-Induced Hypersensitive Response

PubMed Central

Zhang, Yongqiang; Pei, Xinwu; Zhang, Chao; Lu, Zifeng; Wang, Zhixing; Jia, Shirong; Li, Weimin

2012-01-01

Background The hypersensitive response (HR) system of Chenopodium spp. confers broad-spectrum virus resistance. However, little knowledge exists at the genomic level for Chenopodium, thus impeding the advanced molecular research of this attractive feature. Hence, we took advantage of RNA-seq to survey the foliar transcriptome of C. amaranticolor, a Chenopodium species widely used as laboratory indicator for pathogenic viruses, in order to facilitate the characterization of the HR-type of virus resistance. Methodology and Principal Findings Using Illumina HiSeq™ 2000 platform, we obtained 39,868,984 reads with 3,588,208,560 bp, which were assembled into 112,452 unigenes (3,847 clusters and 108,605 singletons). BlastX search against the NCBI NR database identified 61,698 sequences with a cut-off E-value above 10−5. Assembled sequences were annotated with gene descriptions, GO, COG and KEGG terms, respectively. A total number of 738 resistance gene analogs (RGAs) and homology sequences of 6 key signaling proteins within the R proteins-directed signaling pathway were identified. Based on this transcriptome data, we investigated the gene expression profiles over the stage of HR induced by Tobacco mosaic virus and Cucumber mosaic virus by using digital gene expression analysis. Numerous candidate genes specifically or commonly regulated by these two distinct viruses at early and late stages of the HR were identified, and the dynamic changes of the differently expressed genes enriched in the pathway of plant-pathogen interaction were particularly emphasized. Conclusions To our knowledge, this study is the first description of the genetic makeup of C. amaranticolor, providing deep insight into the comprehensive gene expression information at transcriptional level in this species. The 738 RGAs as well as the differentially regulated genes, particularly the common genes regulated by both TMV and CMV, are suitable candidates which merit further functional characterization to dissect the molecular mechanisms and regulatory pathways of the HR-type of virus resistance in Chenopodium. PMID:23029338

Genome-Wide Identification, Characterization, and Expression Profiling of Glutathione S-Transferase (GST) Family in Pumpkin Reveals Likely Role in Cold-Stress Tolerance

PubMed Central

Abdul Kayum, Md.; Nath, Ujjal Kumar; Park, Jong-In; Choi, Eung Kyoo; Song, Jae-Young; Kim, Hoy-Taek; Nou, Ill-Sup

2018-01-01

Plant growth and development can be adversely affected by cold stress, limiting productivity. The glutathione S-transferase (GST) family comprises important detoxifying enzymes, which play major roles in biotic and abiotic stress responses by reducing the oxidative damage caused by reactive oxygen species. Pumpkins (Cucurbita maxima) are widely grown, economically important, and nutritious; however, their yield can be severely affected by cold stress. The identification of putative candidate genes responsible for cold-stress tolerance, including the GST family genes, is therefore vital. For the first time, we identified 32 C. maxima GST (CmaGST) genes using a combination of bioinformatics approaches and characterized them by expression profiling. These CmaGST genes represent seven of the 14 known classes of plant GSTs, with 18 CmaGSTs categorized into the tau class. The CmaGSTs were distributed across 13 of pumpkin’s 20 chromosomes, with the highest numbers found on chromosomes 4 and 6. The large number of CmaGST genes resulted from gene duplication; 11 and 5 pairs of CmaGST genes were segmental- and tandem-duplicated, respectively. In addition, all CmaGST genes showed organ-specific expression. The expression of the putative GST genes in pumpkin was examined under cold stress in two lines with contrasting cold tolerance: cold-tolerant CP-1 (C. maxima) and cold-susceptible EP-1 (Cucurbita moschata). Seven genes (CmaGSTU3, CmaGSTU7, CmaGSTU8, CmaGSTU9, CmaGSTU11, CmaGSTU12, and CmaGSTU14) were highly expressed in the cold-tolerant line and are putative candidates for use in breeding cold-tolerant crop varieties. These results increase our understanding of the cold-stress-related functions of the GST family, as well as potentially enhancing pumpkin breeding programs. PMID:29439434

Transcriptomic Response of Porcine PBMCs to Vaccination with Tetanus Toxoid as a Model Antigen

PubMed Central

Adler, Marcel; Murani, Eduard; Brunner, Ronald; Ponsuksili, Siriluck; Wimmers, Klaus

2013-01-01

The aim of the present study was to characterize in vivo genome-wide transcriptional responses to immune stimulation in order to get insight into the resulting changes of allocation of resources. Vaccination with tetanus toxoid was used as a model for a mixed Th1 and Th2 immune response in pig. Expression profiles of PBMCs (peripheral blood mononuclear cells) before and at 12 time points over a period of four weeks after initial and booster vaccination at day 14 were studied by use of Affymetrix GeneChip microarrays and Ingenuity Pathway Analysis (IPA). The transcriptome data in total comprised more than 5000 genes with different transcript abundances (DE-genes). Within the single time stages the numbers of DE-genes were between several hundred and more than 1000. Ingenuity Pathway Analysis mainly revealed canonical pathways of cellular immune response and cytokine signaling as well as a broad range of processes in cellular and organismal growth, proliferation and development, cell signaling, biosynthesis and metabolism. Significant changes in the expression profiles of PBMCs already occurred very early after immune stimulation. At two hours after the first vaccination 679 DE-genes corresponding to 110 canonical pathways of cytokine signaling, cellular immune response and other multiple cellular functions were found. Immune competence and global disease resistance are heritable but difficult to measure and to address by breeding. Besides QTL mapping of immune traits gene expression profiling facilitates the detection of functional gene networks and thus functional candidate genes. PMID:23536793

Transcriptomic response of porcine PBMCs to vaccination with tetanus toxoid as a model antigen.

PubMed

Adler, Marcel; Murani, Eduard; Brunner, Ronald; Ponsuksili, Siriluck; Wimmers, Klaus

2013-01-01

The aim of the present study was to characterize in vivo genome-wide transcriptional responses to immune stimulation in order to get insight into the resulting changes of allocation of resources. Vaccination with tetanus toxoid was used as a model for a mixed Th1 and Th2 immune response in pig. Expression profiles of PBMCs (peripheral blood mononuclear cells) before and at 12 time points over a period of four weeks after initial and booster vaccination at day 14 were studied by use of Affymetrix GeneChip microarrays and Ingenuity Pathway Analysis (IPA). The transcriptome data in total comprised more than 5000 genes with different transcript abundances (DE-genes). Within the single time stages the numbers of DE-genes were between several hundred and more than 1000. Ingenuity Pathway Analysis mainly revealed canonical pathways of cellular immune response and cytokine signaling as well as a broad range of processes in cellular and organismal growth, proliferation and development, cell signaling, biosynthesis and metabolism. Significant changes in the expression profiles of PBMCs already occurred very early after immune stimulation. At two hours after the first vaccination 679 DE-genes corresponding to 110 canonical pathways of cytokine signaling, cellular immune response and other multiple cellular functions were found. Immune competence and global disease resistance are heritable but difficult to measure and to address by breeding. Besides QTL mapping of immune traits gene expression profiling facilitates the detection of functional gene networks and thus functional candidate genes.

Genetic basis of qualitative and quantitative resistance to powdery mildew in wheat: from consensus regions to candidate genes.

PubMed

Marone, Daniela; Russo, Maria A; Laidò, Giovanni; De Vita, Pasquale; Papa, Roberto; Blanco, Antonio; Gadaleta, Agata; Rubiales, Diego; Mastrangelo, Anna M

2013-08-19

Powdery mildew (Blumeria graminis f. sp. tritici) is one of the most damaging diseases of wheat. The objective of this study was to identify the wheat genomic regions that are involved in the control of powdery mildew resistance through a quantitative trait loci (QTL) meta-analysis approach. This meta-analysis allows the use of collected QTL data from different published studies to obtain consensus QTL across different genetic backgrounds, thus providing a better definition of the regions responsible for the trait, and the possibility to obtain molecular markers that will be suitable for marker-assisted selection. Five QTL for resistance to powdery mildew were identified under field conditions in the durum-wheat segregating population Creso × Pedroso. An integrated map was developed for the projection of resistance genes/ alleles and the QTL from the present study and the literature, and to investigate their distribution in the wheat genome. Molecular markers that correspond to candidate genes for plant responses to pathogens were also projected onto the map, particularly considering NBS-LRR and receptor-like protein kinases. More than 80 independent QTL and 51 resistance genes from 62 different mapping populations were projected onto the consensus map using the Biomercator statistical software. Twenty-four MQTL that comprised 2-6 initial QTL that had widely varying confidence intervals were found on 15 chromosomes. The co-location of the resistance QTL and genes was investigated. Moreover, from analysis of the sequences of DArT markers, 28 DArT clones mapped on wheat chromosomes have been shown to be associated with the NBS-LRR genes and positioned in the same regions as the MQTL for powdery mildew resistance. The results from the present study provide a detailed analysis of the genetic basis of resistance to powdery mildew in wheat. The study of the Creso × Pedroso durum-wheat population has revealed some QTL that had not been previously identified. Furthermore, the analysis of the co-localization of resistance loci and functional markers provides a large list of candidate genes and opens up a new perspective for the fine mapping and isolation of resistance genes, and for the marker-assisted improvement of resistance in wheat.

Genetic basis of qualitative and quantitative resistance to powdery mildew in wheat: from consensus regions to candidate genes

PubMed Central

2013-01-01

Background Powdery mildew (Blumeria graminis f. sp. tritici) is one of the most damaging diseases of wheat. The objective of this study was to identify the wheat genomic regions that are involved in the control of powdery mildew resistance through a quantitative trait loci (QTL) meta-analysis approach. This meta-analysis allows the use of collected QTL data from different published studies to obtain consensus QTL across different genetic backgrounds, thus providing a better definition of the regions responsible for the trait, and the possibility to obtain molecular markers that will be suitable for marker-assisted selection. Results Five QTL for resistance to powdery mildew were identified under field conditions in the durum-wheat segregating population Creso × Pedroso. An integrated map was developed for the projection of resistance genes/ alleles and the QTL from the present study and the literature, and to investigate their distribution in the wheat genome. Molecular markers that correspond to candidate genes for plant responses to pathogens were also projected onto the map, particularly considering NBS-LRR and receptor-like protein kinases. More than 80 independent QTL and 51 resistance genes from 62 different mapping populations were projected onto the consensus map using the Biomercator statistical software. Twenty-four MQTL that comprised 2–6 initial QTL that had widely varying confidence intervals were found on 15 chromosomes. The co-location of the resistance QTL and genes was investigated. Moreover, from analysis of the sequences of DArT markers, 28 DArT clones mapped on wheat chromosomes have been shown to be associated with the NBS-LRR genes and positioned in the same regions as the MQTL for powdery mildew resistance. Conclusions The results from the present study provide a detailed analysis of the genetic basis of resistance to powdery mildew in wheat. The study of the Creso × Pedroso durum-wheat population has revealed some QTL that had not been previously identified. Furthermore, the analysis of the co-localization of resistance loci and functional markers provides a large list of candidate genes and opens up a new perspective for the fine mapping and isolation of resistance genes, and for the marker-assisted improvement of resistance in wheat. PMID:23957646

Combining suppressive subtractive hybridization and cDNA microarrays to identify dietary phosphorus-responsive genes of the rainbow trout (Oncorhynchus mykiss) kidney.

PubMed

Lake, Jennifer; Gravel, Catherine; Koko, Gabriel Koffi D; Robert, Claude; Vandenberg, Grant W

2010-03-01

Phosphorus (P)-responsive genes and how they regulate renal adaptation to phosphorous-deficient diets in animals, including fish, are not well understood. RNA abundance profiling using cDNA microarrays is an efficient approach to study nutrient-gene interactions and identify these dietary P-responsive genes. To test the hypothesis that dietary P-responsive genes are differentially expressed in fish fed varying P levels, rainbow trout were fed a practical high-P diet (R20: 0.96% P) or a low-P diet (R0: 0.38% P) for 7 weeks. The differentially-expressed genes between dietary groups were identified and compared from the kidney by combining suppressive subtractive hybridization (SSH) with cDNA microarray analysis. A number of genes were confirmed by real-time PCR, and correlated with plasma and bone P concentrations. Approximately 54 genes were identified as potential dietary P-responsive after 7 weeks on a diet deficient in P according to cDNA microarray analysis. Of 18 selected genes, 13 genes were confirmed to be P-responsive at 7 weeks by real-time PCR analysis, including: iNOS, cytochrome b, cytochrome c oxidase subunit II , alpha-globin I, beta-globin, ATP synthase, hyperosmotic protein 21, COL1A3, Nkef, NDPK, glucose phosphate isomerase 1, Na+/H+ exchange protein and GDP dissociation inhibitor 2. Many of these dietary P-responsive genes responded in a moderate way (R0/R20 ratio: <2-3 or >0.5) and in a transient manner to dietary P limitation. In summary, renal adaptation to dietary P deficiency in trout involves changes in the expression of several genes, suggesting a profile of metabolic stress, since many of these differentially-expressed candidates are associated with the cellular adaptative responses. Crown Copyright 2009. Published by Elsevier Inc. All rights reserved.

Xanthine urolithiasis in a cat: a case report and evaluation of a candidate gene for xanthine dehydrogenase.

PubMed

Tsuchida, Shuichi; Kagi, Akiko; Koyama, Hidekazu; Tagawa, Masahiro

2007-12-01

Xanthine urolithiasis was found in a 4-year-old spayed female Himalayan cat with a 10-month history of intermittent haematuria and dysuria. Ultrasonographs indicated the existence of several calculi in the bladder that were undetectable by survey radiographic examination. Four bladder stones were removed by cystotomy. The stones were spherical brownish-yellow and their surface was smooth and glossy. Quantitative mineral analysis showed a representative urolith to be composed of more than 95% xanthine. Ultrasonographic examination of the bladder 4.5 months postoperatively indicated the recurrence of urolithiasis. Analysis of purine concentration in urine and blood showed that the cat excreted excessive amounts of xanthine. In order to test the hypothesis that xanthinuria was caused by a homozygote of the inherited mutant allele of a gene responsible for deficiency of enzyme activity in purine degradation pathway, the allele composition of xanthine dehydrogenase (XDH) gene (one of the candidate genes for hereditary xanthinuria) was evaluated. The cat with xanthinuria was a heterozygote of the polymorphism. A single nucleotide polymorphism analysis of the cat XDH gene strongly indicated that the XDH gene of the patient cat was composed of two kinds of alleles and ruled out the hypothesis that the cat inherited the same recessive XDH allele suggesting no activity from a single ancestor.

Quality controls in cellular immunotherapies: rapid assessment of clinical grade dendritic cells by gene expression profiling.

PubMed

Castiello, Luciano; Sabatino, Marianna; Zhao, Yingdong; Tumaini, Barbara; Ren, Jiaqiang; Ping, Jin; Wang, Ena; Wood, Lauren V; Marincola, Francesco M; Puri, Raj K; Stroncek, David F

2013-02-01

Cell-based immunotherapies are among the most promising approaches for developing effective and targeted immune response. However, their clinical usefulness and the evaluation of their efficacy rely heavily on complex quality control assessment. Therefore, rapid systematic methods are urgently needed for the in-depth characterization of relevant factors affecting newly developed cell product consistency and the identification of reliable markers for quality control. Using dendritic cells (DCs) as a model, we present a strategy to comprehensively characterize manufactured cellular products in order to define factors affecting their variability, quality and function. After generating clinical grade human monocyte-derived mature DCs (mDCs), we tested by gene expression profiling the degrees of product consistency related to the manufacturing process and variability due to intra- and interdonor factors, and how each factor affects single gene variation. Then, by calculating for each gene an index of variation we selected candidate markers for identity testing, and defined a set of genes that may be useful comparability and potency markers. Subsequently, we confirmed the observed gene index of variation in a larger clinical data set. In conclusion, using high-throughput technology we developed a method for the characterization of cellular therapies and the discovery of novel candidate quality assurance markers.

Brain Transcriptional Profiles of Male Alternative Reproductive Tactics and Females in Bluegill Sunfish

PubMed Central

Partridge, Charlyn G.; MacManes, Matthew D.; Knapp, Rosemary; Neff, Bryan D.

2016-01-01

Bluegill sunfish (Lepomis macrochirus) are one of the classic systems for studying male alternative reproductive tactics (ARTs) in teleost fishes. In this species, there are two distinct life histories: parental and cuckolder, encompassing three reproductive tactics, parental, satellite, and sneaker. The parental life history is fixed, whereas individuals who enter the cuckolder life history transition from sneaker to satellite tactic as they grow. For this study, we used RNAseq to characterize the brain transcriptome of the three male tactics and females during spawning to identify gene ontology (GO) categories and potential candidate genes associated with each tactic. We found that sneaker males had higher levels of gene expression differentiation compared to the other two male tactics. Sneaker males also had higher expression in ionotropic glutamate receptor genes, specifically AMPA receptors, compared to other males, which may be important for increased spatial working memory while attempting to cuckold parental males at their nests. Larger differences in gene expression also occurred among male tactics than between males and females. We found significant expression differences in several candidate genes that were previously identified in other species with ARTs and suggest a previously undescribed role for cAMP-responsive element modulator (crem) in influencing parental male behaviors during spawning. PMID:27907106

Understanding the pharmacogenetics of selective serotonin reuptake inhibitors.

PubMed

Fabbri, Chiara; Minarini, Alessandro; Niitsu, Tomihisa; Serretti, Alessandro

2014-08-01

The genetic background of antidepressant response represents a unique opportunity to identify biological markers of treatment outcome. Encouraging results alternating with inconsistent findings made antidepressant pharmacogenetics a stimulating but often discouraging field that requires careful discussion about cumulative evidence and methodological issues. The present review discusses both known and less replicated genes that have been implicated in selective serotonin reuptake inhibitors (SSRIs) efficacy and side effects. Candidate genes studies and genome-wide association studies (GWAS) were collected through MEDLINE database search (articles published till January 2014). Further, GWAS signals localized in promising genetic regions according to candidate gene studies are reported in order to assess the general comparability of results obtained through these two types of pharmacogenetic studies. Finally, a pathway enrichment approach is applied to the top genes (those harboring SNPs with p < 0.0001) outlined by previous GWAS in order to identify possible molecular mechanisms involved in SSRI effect. In order to improve the understanding of SSRI pharmacogenetics, the present review discusses the proposal of moving from the analysis of individual polymorphisms to genes and molecular pathways, and from the separation across different methodological approaches to their combination. Efforts in this direction are justified by the recent evidence of a favorable cost-utility of gene-guided antidepressant treatment.

Brain Transcriptional Profiles of Male Alternative Reproductive Tactics and Females in Bluegill Sunfish.

PubMed

Partridge, Charlyn G; MacManes, Matthew D; Knapp, Rosemary; Neff, Bryan D

2016-01-01

Bluegill sunfish (Lepomis macrochirus) are one of the classic systems for studying male alternative reproductive tactics (ARTs) in teleost fishes. In this species, there are two distinct life histories: parental and cuckolder, encompassing three reproductive tactics, parental, satellite, and sneaker. The parental life history is fixed, whereas individuals who enter the cuckolder life history transition from sneaker to satellite tactic as they grow. For this study, we used RNAseq to characterize the brain transcriptome of the three male tactics and females during spawning to identify gene ontology (GO) categories and potential candidate genes associated with each tactic. We found that sneaker males had higher levels of gene expression differentiation compared to the other two male tactics. Sneaker males also had higher expression in ionotropic glutamate receptor genes, specifically AMPA receptors, compared to other males, which may be important for increased spatial working memory while attempting to cuckold parental males at their nests. Larger differences in gene expression also occurred among male tactics than between males and females. We found significant expression differences in several candidate genes that were previously identified in other species with ARTs and suggest a previously undescribed role for cAMP-responsive element modulator (crem) in influencing parental male behaviors during spawning.

Exclusion of the Sonic Hedgehog gene as responsible for Currarino syndrome and anorectal malformations with sacral hypodevelopment.

PubMed

Seri, M; Martucciello, G; Paleari, L; Bolino, A; Priolo, M; Salemi, G; Forabosco, P; Caroli, F; Cusano, R; Tocco, T; Lerone, M; Cama, A; Torre, M; Guys, J M; Romeo, G; Jasonni, V

1999-01-01

Anorectal malformations (ARMs) are common congenital anomalies that account for 1:4 digestive malformations. ARM patients show different degrees of sacral hypodevelopment while the hemisacrum is characteristic of the Currarino syndrome (CS). Cases of CS present an association of ARM, hemisacrum and presacral mass. A gene responsible for CS has recently been mapped in 7q36. Among the genes localized in this critical region, sonic hedgehog (SHH) was thought to represent a candidate gene for CS as well as for ARM with different levels of sacral hypodevelopment according to its role in the differentiation of midline mesoderm. By linkage analysis we confirmed the critical region in one large family with recurrence of CS. In addition, the screening of SHH in 7 CS and in 15 sporadic ARM patients with sacral hypodevelopment allowed us to exclude its role in the pathogenesis of these disorders.

The cld mutation: narrowing the critical chromosomal region and selecting candidate genes.

PubMed

Péterfy, Miklós; Mao, Hui Z; Doolittle, Mark H

2006-10-01

Combined lipase deficiency (cld) is a recessive, lethal mutation specific to the tw73 haplotype on mouse Chromosome 17. While the cld mutation results in lipase proteins that are inactive, aggregated, and retained in the endoplasmic reticulum (ER), it maps separately from the lipase structural genes. We have narrowed the gene critical region by about 50% using the tw18 haplotype for deletion mapping and a recombinant chromosome used originally to map cld with respect to the phenotypic marker tf. The region now extends from 22 to 25.6 Mbp on the wild-type chromosome, currently containing 149 genes and 50 expressed sequence tags (ESTs). To identify the affected gene, we have selected candidates based on their known role in associated biological processes, cellular components, and molecular functions that best fit with the predicted function of the cld gene. A secondary approach was based on differences in mRNA levels between mutant (cld/cld) and unaffected (+/cld) cells. Using both approaches, we have identified seven functional candidates with an ER localization and/or an involvement in protein maturation and folding that could explain the lipase deficiency, and six expression candidates that exhibit large differences in mRNA levels between mutant and unaffected cells. Significantly, two genes were found to be candidates with regard to both function and expression, thus emerging as the strongest candidates for cld. We discuss the implications of our mapping results and our selection of candidates with respect to other genes, deletions, and mutations occurring in the cld critical region.

A novel ALMS1 splice mutation in a non-obese juvenile-onset insulin-dependent syndromic diabetic patient

PubMed Central

Sanyoura, May; Woudstra, Cédric; Halaby, George; Baz, Patrick; Senée, Valérie; Guillausseau, Pierre-Jean; Zalloua, Pierre; Julier, Cécile

2014-01-01

Insulin-dependent juvenile-onset diabetes may occur in the context of rare syndromic presentations suggesting monogenic inheritance rather than common multifactorial autoimmune type 1 diabetes. Here, we report the case of a Lebanese patient diagnosed with juvenile-onset insulin-dependent diabetes presenting ketoacidosis, early-onset retinopathy with optic atrophy, hearing loss, diabetes insipidus, epilepsy, and normal weight and stature, who later developed insulin resistance. Despite similarities with Wolfram syndrome, we excluded the WFS1 gene as responsible for this disease. Using combined linkage and candidate gene study, we selected ALMS1, responsible for Alström syndrome, as a candidate gene. We identified a novel splice mutation in intron 18 located 3 bp before the intron–exon junction (IVS18-3T>G), resulting in exon 19 skipping and consequent frameshift generating a truncated protein (V3958fs3964X). The clinical presentation of the patient significantly differed from typical Alström syndrome by the absence of truncal obesity and short stature, and by the presence of ketoacidotic insulin-dependent diabetes, optic atrophy and diabetes insipidus. Our observation broadens the clinical spectrum of Alström syndrome and suggests that ALMS1 mutations may be considered in patients who initially present with an acute onset of insulin-dependent diabetes. PMID:23652376

De Novo Transcriptome Assembly and Identification of Gene Candidates for Rapid Evolution of Soil Al Tolerance in Anthoxanthum odoratum at the Long-Term Park Grass Experiment

PubMed Central

Gould, Billie; McCouch, Susan; Geber, Monica

2015-01-01

Studies of adaptation in the wild grass Anthoxanthum odoratum at the Park Grass Experiment (PGE) provided one of the earliest examples of rapid evolution in plants. Anthoxanthum has become locally adapted to differences in soil Al toxicity, which have developed there due to soil acidification from long-term experimental fertilizer treatments. In this study, we used transcriptome sequencing to identify Al stress responsive genes in Anthoxanhum and identify candidates among them for further molecular study of rapid Al tolerance evolution at the PGE. We examined the Al content of Anthoxanthum tissues and conducted RNA-sequencing of root tips, the primary site of Al induced damage. We found that despite its high tolerance Anthoxanthum is not an Al accumulating species. Genes similar to those involved in organic acid exudation (TaALMT1, ZmMATE), cell wall modification (OsSTAR1), and internal Al detoxification (OsNRAT1) in cultivated grasses were responsive to Al exposure. Expression of a large suite of novel loci was also triggered by early exposure to Al stress in roots. Three-hundred forty five transcripts were significantly more up- or down-regulated in tolerant vs. sensitive Anthoxanthum genotypes, providing important targets for future study of rapid evolution at the PGE. PMID:26148203

De Novo Transcriptome Assembly and Identification of Gene Candidates for Rapid Evolution of Soil Al Tolerance in Anthoxanthum odoratum at the Long-Term Park Grass Experiment.

PubMed

Gould, Billie; McCouch, Susan; Geber, Monica

2015-01-01

Studies of adaptation in the wild grass Anthoxanthum odoratum at the Park Grass Experiment (PGE) provided one of the earliest examples of rapid evolution in plants. Anthoxanthum has become locally adapted to differences in soil Al toxicity, which have developed there due to soil acidification from long-term experimental fertilizer treatments. In this study, we used transcriptome sequencing to identify Al stress responsive genes in Anthoxanhum and identify candidates among them for further molecular study of rapid Al tolerance evolution at the PGE. We examined the Al content of Anthoxanthum tissues and conducted RNA-sequencing of root tips, the primary site of Al induced damage. We found that despite its high tolerance Anthoxanthum is not an Al accumulating species. Genes similar to those involved in organic acid exudation (TaALMT1, ZmMATE), cell wall modification (OsSTAR1), and internal Al detoxification (OsNRAT1) in cultivated grasses were responsive to Al exposure. Expression of a large suite of novel loci was also triggered by early exposure to Al stress in roots. Three-hundred forty five transcripts were significantly more up- or down-regulated in tolerant vs. sensitive Anthoxanthum genotypes, providing important targets for future study of rapid evolution at the PGE.

Genetic and Genomic Response to Selection for Food Consumption in Drosophila melanogaster

PubMed Central

Garlapow, Megan E.; Everett, Logan J.; Zhou, Shanshan; Gearhart, Alexander W.; Fay, Kairsten A.; Huang, Wen; Morozova, Tatiana V.; Arya, Gunjan H.; Turlapati, Lavanya; Armour, Genevieve St.; Hussain, Yasmeen N.; McAdams, Sarah E.; Fochler, Sophia; Mackay, Trudy F. C.

2016-01-01

Food consumption is an essential component of animal fitness; however, excessive food intake in humans increases risk for many diseases. The roles of neuroendocrine feedback loops, food sensing modalities, and physiological state in regulating food intake are well understood, but not the genetic basis underlying variation in food consumption. Here, we applied ten generations of artificial selection for high and low food consumption in replicate populations of Drosophila melanogaster. The phenotypic response to selection was highly asymmetric, with significant responses only for increased food consumption and minimal correlated responses in body mass and composition. We assessed the molecular correlates of selection responses by DNA and RNA sequencing of the selection lines. The high and low selection lines had variants with significantly divergent allele frequencies within or near 2,081 genes and 3,526 differentially expressed genes in one or both sexes. A total of 519 genes were both genetically divergent and differentially expressed between the divergent selection lines. We performed functional analyses of the effects of RNAi suppression of gene expression and induced mutations for 27 of these candidate genes that have human orthologs and the strongest statistical support, and confirmed that 25 (93%) affected the mean and/or variance of food consumption. PMID:27704301

Genome-Wide Characterization and Expression Profiling of the AUXIN RESPONSE FACTOR (ARF) Gene Family in Eucalyptus grandis

PubMed Central

Yu, Hong; Soler, Marçal; Mila, Isabelle; San Clemente, Hélène; Savelli, Bruno; Dunand, Christophe; Paiva, Jorge A. P.; Myburg, Alexander A.; Bouzayen, Mondher; Grima-Pettenati, Jacqueline; Cassan-Wang, Hua

2014-01-01

Auxin is a central hormone involved in a wide range of developmental processes including the specification of vascular stem cells. Auxin Response Factors (ARF) are important actors of the auxin signalling pathway, regulating the transcription of auxin-responsive genes through direct binding to their promoters. The recent availability of the Eucalyptus grandis genome sequence allowed us to examine the characteristics and evolutionary history of this gene family in a woody plant of high economic importance. With 17 members, the E. grandis ARF gene family is slightly contracted, as compared to those of most angiosperms studied hitherto, lacking traces of duplication events. In silico analysis of alternative transcripts and gene truncation suggested that these two mechanisms were preeminent in shaping the functional diversity of the ARF family in Eucalyptus. Comparative phylogenetic analyses with genomes of other taxonomic lineages revealed the presence of a new ARF clade found preferentially in woody and/or perennial plants. High-throughput expression profiling among different organs and tissues and in response to environmental cues highlighted genes expressed in vascular cambium and/or developing xylem, responding dynamically to various environmental stimuli. Finally, this study allowed identification of three ARF candidates potentially involved in the auxin-regulated transcriptional program underlying wood formation. PMID:25269088

In silico analysis of cacao (Theobroma cacao L.) genes that involved in pathogen and disease responses

NASA Astrophysics Data System (ADS)

Agung, Muhammad Budi; Budiarsa, I. Made; Suwastika, I. Nengah

2017-02-01

Cocoa bean is one of the main commodities from Indonesia for the world, which still have problem regarding yield degradation due to pathogens and disease attack. Developing robust cacao plant that genetically resistant to pathogen and disease attack is an ideal solution in over taking on this problem. The aim of this study was to identify Theobroma cacao genes on database of cacao genome that homolog to response genes of pathogen and disease attack in other plant, through in silico analysis. Basic information survey and gene identification were performed in GenBank and The Arabidopsis Information Resource database. The In silico analysis contains protein BLAST, homology test of each gene's protein candidates, and identification of homologue gene in Cacao Genome Database using data source "Theobroma cacao cv. Matina 1-6 v1.1" genome. Identification found that Thecc1EG011959t1 (EDS1), Thecc1EG006803t1 (EDS5), Thecc1EG013842t1 (ICS1), and Thecc1EG015614t1 (BG_PPAP) gene of Cacao Genome Database were Theobroma cacao genes that homolog to plant's resistance genes which highly possible to have similar functions of each gene's homologue gene.

Transcriptomics-based analysis using RNA-Seq of the coconut (Cocos nucifera) leaf in response to yellow decline phytoplasma infection.

PubMed

Nejat, Naghmeh; Cahill, David M; Vadamalai, Ganesan; Ziemann, Mark; Rookes, James; Naderali, Neda

2015-10-01

Invasive phytoplasmas wreak havoc on coconut palms worldwide, leading to high loss of income, food insecurity and extreme poverty of farmers in producing countries. Phytoplasmas as strictly biotrophic insect-transmitted bacterial pathogens instigate distinct changes in developmental processes and defence responses of the infected plants and manipulate plants to their own advantage; however, little is known about the cellular and molecular mechanisms underlying host-phytoplasma interactions. Further, phytoplasma-mediated transcriptional alterations in coconut palm genes have not yet been identified. This study evaluated the whole transcriptome profiles of naturally infected leaves of Cocos nucifera ecotype Malayan Red Dwarf in response to yellow decline phytoplasma from group 16SrXIV, using RNA-Seq technique. Transcriptomics-based analysis reported here identified genes involved in coconut innate immunity. The number of down-regulated genes in response to phytoplasma infection exceeded the number of genes up-regulated. Of the 39,873 differentially expressed unigenes, 21,860 unigenes were suppressed and 18,013 were induced following infection. Comparative analysis revealed that genes associated with defence signalling against biotic stimuli were significantly overexpressed in phytoplasma-infected leaves versus healthy coconut leaves. Genes involving cell rescue and defence, cellular transport, oxidative stress, hormone stimulus and metabolism, photosynthesis reduction, transcription and biosynthesis of secondary metabolites were differentially represented. Our transcriptome analysis unveiled a core set of genes associated with defence of coconut in response to phytoplasma attack, although several novel defence response candidate genes with unknown function have also been identified. This study constitutes valuable sequence resource for uncovering the resistance genes and/or susceptibility genes which can be used as genetic tools in disease resistance breeding.

Identification of Padi2 as a novel angiogenesis-regulating gene by genome association studies in mice.

PubMed

Khajavi, Mehrdad; Zhou, Yi; Birsner, Amy E; Bazinet, Lauren; Rosa Di Sant, Amanda; Schiffer, Alex J; Rogers, Michael S; Krishnaji, Subrahmanian Tarakkad; Hu, Bella; Nguyen, Vy; Zon, Leonard; D'Amato, Robert J

2017-06-01

Recent findings indicate that growth factor-driven angiogenesis is markedly influenced by genetic variation. This variation in angiogenic responsiveness may alter the susceptibility to a number of angiogenesis-dependent diseases. Here, we utilized the genetic diversity available in common inbred mouse strains to identify the loci and candidate genes responsible for differences in angiogenic response. The corneal micropocket neovascularization assay was performed on 42 different inbred mouse strains using basic fibroblast growth factor (bFGF) pellets. We performed a genome-wide association study utilizing efficient mixed-model association (EMMA) mapping using the induced vessel area from all strains. Our analysis yielded five loci with genome-wide significance on chromosomes 4, 8, 11, 15 and 16. We further refined the mapping on chromosome 4 within a haplotype block containing multiple candidate genes. These genes were evaluated by expression analysis in corneas of various inbred strains and in vitro functional assays in human microvascular endothelial cells (HMVECs). Of these, we found the expression of peptidyl arginine deiminase type II (Padi2), known to be involved in metabolic pathways, to have a strong correlation with a haplotype shared by multiple high angiogenic strains. In addition, inhibition of Padi2 demonstrated a dosage-dependent effect in HMVECs. To investigate its role in vivo, we knocked down Padi2 in transgenic kdrl:zsGreen zebrafish embryos using morpholinos. These embryos had disrupted vessel formation compared to control siblings. The impaired vascular pattern was partially rescued by human PADI2 mRNA, providing evidence for the specificity of the morphant phenotype. Taken together, our study is the first to indicate the potential role of Padi2 as an angiogenesis-regulating gene. The characterization of Padi2 and other genes in associated pathways may provide new understanding of angiogenesis regulation and novel targets for diagnosis and treatment of a wide variety of angiogenesis-dependent diseases.

Identification of Padi2 as a novel angiogenesis-regulating gene by genome association studies in mice

PubMed Central

Zhou, Yi; Bazinet, Lauren; Rosa Di Sant, Amanda; Hu, Bella; Nguyen, Vy; Zon, Leonard

2017-01-01

Recent findings indicate that growth factor-driven angiogenesis is markedly influenced by genetic variation. This variation in angiogenic responsiveness may alter the susceptibility to a number of angiogenesis-dependent diseases. Here, we utilized the genetic diversity available in common inbred mouse strains to identify the loci and candidate genes responsible for differences in angiogenic response. The corneal micropocket neovascularization assay was performed on 42 different inbred mouse strains using basic fibroblast growth factor (bFGF) pellets. We performed a genome-wide association study utilizing efficient mixed-model association (EMMA) mapping using the induced vessel area from all strains. Our analysis yielded five loci with genome-wide significance on chromosomes 4, 8, 11, 15 and 16. We further refined the mapping on chromosome 4 within a haplotype block containing multiple candidate genes. These genes were evaluated by expression analysis in corneas of various inbred strains and in vitro functional assays in human microvascular endothelial cells (HMVECs). Of these, we found the expression of peptidyl arginine deiminase type II (Padi2), known to be involved in metabolic pathways, to have a strong correlation with a haplotype shared by multiple high angiogenic strains. In addition, inhibition of Padi2 demonstrated a dosage-dependent effect in HMVECs. To investigate its role in vivo, we knocked down Padi2 in transgenic kdrl:zsGreen zebrafish embryos using morpholinos. These embryos had disrupted vessel formation compared to control siblings. The impaired vascular pattern was partially rescued by human PADI2 mRNA, providing evidence for the specificity of the morphant phenotype. Taken together, our study is the first to indicate the potential role of Padi2 as an angiogenesis-regulating gene. The characterization of Padi2 and other genes in associated pathways may provide new understanding of angiogenesis regulation and novel targets for diagnosis and treatment of a wide variety of angiogenesis-dependent diseases. PMID:28617813

Identification of candidate genes involved in witches’ broom disease resistance in a segregating mapping population of Theobroma cacao L. in Brazil

USDA-ARS?s Scientific Manuscript database

Witches’ broom disease (WBD) caused by the fungus Moniliophthora perniciosa is responsible for considerable economic losses for cacao producers in the Americas. Protective fungicides are ineffective, and disease management involving repeated phytosanitary removals increases labor costs. The best al...

Identification and confirmation of greenbug resistance loci in an advanced mapping population of sorghum

USDA-ARS?s Scientific Manuscript database

Greenbug infestations to sorghum can cause severe and above economic threshold damage in the Great Plains of the United States. This study was to identify quantitative trait loci (QTL) and potential candidate genes residing within the QTL region responsible for greenbug resistance in an advanced ma...

Natural Genetic Variation for Acclimation of Photosynthetic Light Use Efficiency to Growth Irradiance in Arabidopsis1[OPEN

PubMed Central

Harbinson, Jeremy

2015-01-01

Plants are known to be able to acclimate their photosynthesis to the level of irradiance. Here, we present the analysis of natural genetic variation for photosynthetic light use efficiency (ΦPSII) in response to five light environments among 12 genetically diverse Arabidopsis (Arabidopsis thaliana) accessions. We measured the acclimation of ΦPSII to constant growth irradiances of four different levels (100, 200, 400, and 600 µmol m−2 s−1) by imaging chlorophyll fluorescence after 24 d of growth and compared these results with acclimation of ΦPSII to a step-wise change in irradiance where the growth irradiance was increased from 100 to 600 µmol m−2 s−1 after 24 d of growth. Genotypic variation for ΦPSII is shown by calculating heritability for the short-term ΦPSII response to different irradiance levels as well as for the relation of ΦPSII measured at light saturation (a measure of photosynthetic capacity) to growth irradiance level and for the kinetics of the response to a step-wise increase in irradiance from 100 to 600 µmol m−2 s−1. A genome-wide association study for ΦPSII measured 1 h after a step-wise increase in irradiance identified several new candidate genes controlling this trait. In conclusion, the different photosynthetic responses to a changing light environment displayed by different Arabidopsis accessions are due to genetic differences, and we have identified candidate genes for the photosynthetic response to an irradiance change. The genetic variation for photosynthetic acclimation to irradiance found in this study will allow future identification and analysis of the causal genes for the regulation of ΦPSII in plants. PMID:25670817

Genome-wide characterization and analysis of bZIP transcription factor gene family related to abiotic stress in cassava.

PubMed

Hu, Wei; Yang, Hubiao; Yan, Yan; Wei, Yunxie; Tie, Weiwei; Ding, Zehong; Zuo, Jiao; Peng, Ming; Li, Kaimian

2016-03-07

The basic leucine zipper (bZIP) transcription factor family plays crucial roles in various aspects of biological processes. Currently, no information is available regarding the bZIP family in the important tropical crop cassava. Herein, 77 bZIP genes were identified from cassava. Evolutionary analysis indicated that MebZIPs could be divided into 10 subfamilies, which was further supported by conserved motif and gene structure analyses. Global expression analysis suggested that MebZIPs showed similar or distinct expression patterns in different tissues between cultivated variety and wild subspecies. Transcriptome analysis of three cassava genotypes revealed that many MebZIP genes were activated by drought in the root of W14 subspecies, indicating the involvement of these genes in the strong resistance of cassava to drought. Expression analysis of selected MebZIP genes in response to osmotic, salt, cold, ABA, and H2O2 suggested that they might participate in distinct signaling pathways. Our systematic analysis of MebZIPs reveals constitutive, tissue-specific and abiotic stress-responsive candidate MebZIP genes for further functional characterization in planta, yields new insights into transcriptional regulation of MebZIP genes, and lays a foundation for understanding of bZIP-mediated abiotic stress response.

Identification of Transcriptional Modules and Key Genes in Chickens Infected with Salmonella enterica Serovar Pullorum Using Integrated Coexpression Analyses.

PubMed

Liu, Bao-Hong; Cai, Jian-Ping

2017-01-01

Salmonella enterica Pullorum is one of the leading causes of mortality in poultry. Understanding the molecular response in chickens in response to the infection by S. enterica is important in revealing the mechanisms of pathogenesis and disease progress. There have been studies on identifying genes associated with Salmonella infection by differential expression analysis, but the relationships among regulated genes have not been investigated. In this study, we employed weighted gene coexpression network analysis (WGCNA) and differential coexpression analysis (DCEA) to identify coexpression modules by exploring microarray data derived from chicken splenic tissues in response to the S. enterica infection. A total of 19 modules from 13,538 genes were associated with the Jak-STAT signaling pathway, the extracellular matrix, cytoskeleton organization, the regulation of the actin cytoskeleton, G-protein coupled receptor activity, Toll-like receptor signaling pathways, and immune system processes; among them, 14 differentially coexpressed modules (DCMs) and 2,856 differentially coexpressed genes (DCGs) were identified. The global expression of module genes between infected and uninfected chickens showed slight differences but considerable changes for global coexpression. Furthermore, DCGs were consistently linked to the hubs of the modules. These results will help prioritize candidate genes for future studies of Salmonella infection.

Identification of Transcriptional Modules and Key Genes in Chickens Infected with Salmonella enterica Serovar Pullorum Using Integrated Coexpression Analyses

PubMed Central

2017-01-01

Salmonella enterica Pullorum is one of the leading causes of mortality in poultry. Understanding the molecular response in chickens in response to the infection by S. enterica is important in revealing the mechanisms of pathogenesis and disease progress. There have been studies on identifying genes associated with Salmonella infection by differential expression analysis, but the relationships among regulated genes have not been investigated. In this study, we employed weighted gene coexpression network analysis (WGCNA) and differential coexpression analysis (DCEA) to identify coexpression modules by exploring microarray data derived from chicken splenic tissues in response to the S. enterica infection. A total of 19 modules from 13,538 genes were associated with the Jak-STAT signaling pathway, the extracellular matrix, cytoskeleton organization, the regulation of the actin cytoskeleton, G-protein coupled receptor activity, Toll-like receptor signaling pathways, and immune system processes; among them, 14 differentially coexpressed modules (DCMs) and 2,856 differentially coexpressed genes (DCGs) were identified. The global expression of module genes between infected and uninfected chickens showed slight differences but considerable changes for global coexpression. Furthermore, DCGs were consistently linked to the hubs of the modules. These results will help prioritize candidate genes for future studies of Salmonella infection. PMID:28529955

Alkane hydroxylase genes in psychrophile genomes and the potential for cold active catalysis.

PubMed

Bowman, Jeff S; Deming, Jody W

2014-12-16

Psychrophiles are presumed to play a large role in the catabolism of alkanes and other components of crude oil in natural low temperature environments. In this study we analyzed the functional diversity of genes for alkane hydroxylases, the enzymes responsible for converting alkanes to more labile alcohols, as found in the genomes of nineteen psychrophiles for which alkane degradation has not been reported. To identify possible mechanisms of low temperature optimization we compared putative alkane hydroxylases from these psychrophiles with homologues from nineteen taxonomically related mesophilic strains. Seven of the analyzed psychrophile genomes contained a total of 27 candidate alkane hydroxylase genes, only two of which are currently annotated as alkane hydroxylase. These candidates were mostly related to the AlkB and cytochrome p450 alkane hydroxylases, but several homologues of the LadA and AlmA enzymes, significant for their ability to degrade long-chain alkanes, were also detected. These putative alkane hydroxylases showed significant differences in primary structure from their mesophile homologues, with preferences for specific amino acids and increased flexibility on loops, bends, and α-helices. A focused analysis on psychrophile genomes led to discovery of numerous candidate alkane hydroxylase genes not currently annotated as alkane hydroxylase. Gene products show signs of optimization to low temperature, including regions of increased flexibility and amino acid preferences typical of psychrophilic proteins. These findings are consistent with observations of microbial degradation of crude oil in cold environments and identify proteins that can be targeted in rate studies and in the design of molecular tools for low temperature bioremediation.

Candidate genes, pathways and mechanisms for alcoholism: an expanded convergent functional genomics approach.

PubMed

Rodd, Z A; Bertsch, B A; Strother, W N; Le-Niculescu, H; Balaraman, Y; Hayden, E; Jerome, R E; Lumeng, L; Nurnberger, J I; Edenberg, H J; McBride, W J; Niculescu, A B

2007-08-01

We describe a comprehensive translational approach for identifying candidate genes for alcoholism. The approach relies on the cross-matching of animal model brain gene expression data with human genetic linkage data, as well as human tissue data and biological roles data, an approach termed convergent functional genomics. An analysis of three animal model paradigms, based on inbred alcohol-preferring (iP) and alcohol-non-preferring (iNP) rats, and their response to treatments with alcohol, was used. A comprehensive analysis of microarray gene expression data from five key brain regions (frontal cortex, amygdala, caudate-putamen, nucleus accumbens and hippocampus) was carried out. The Bayesian-like integration of multiple independent lines of evidence, each by itself lacking sufficient discriminatory power, led to the identification of high probability candidate genes, pathways and mechanisms for alcoholism. These data reveal that alcohol has pleiotropic effects on multiple systems, which may explain the diverse neuropsychiatric and medical pathology in alcoholism. Some of the pathways identified suggest avenues for pharmacotherapy of alcoholism with existing agents, such as angiotensin-converting enzyme (ACE) inhibitors. Experiments we carried out in alcohol-preferring rats with an ACE inhibitor show a marked modulation of alcohol intake. Other pathways are new potential targets for drug development. The emergent overall picture is that physical and physiological robustness may permit alcohol-preferring individuals to withstand the aversive effects of alcohol. In conjunction with a higher reactivity to its rewarding effects, they may able to ingest enough of this nonspecific drug for a strong hedonic and addictive effect to occur.

Comparative genomics identifies candidate genes for infectious salmon anemia (ISA) resistance in Atlantic salmon (Salmo salar).

PubMed

Li, Jieying; Boroevich, Keith A; Koop, Ben F; Davidson, William S

2011-04-01

Infectious salmon anemia (ISA) has been described as the hoof and mouth disease of salmon farming. ISA is caused by a lethal and highly communicable virus, which can have a major impact on salmon aquaculture, as demonstrated by an outbreak in Chile in 2007. A quantitative trait locus (QTL) for ISA resistance has been mapped to three microsatellite markers on linkage group (LG) 8 (Chr 15) on the Atlantic salmon genetic map. We identified bacterial artificial chromosome (BAC) clones and three fingerprint contigs from the Atlantic salmon physical map that contains these markers. We made use of the extensive BAC end sequence database to extend these contigs by chromosome walking and identified additional two markers in this region. The BAC end sequences were used to search for conserved synteny between this segment of LG8 and the fish genomes that have been sequenced. An examination of the genes in the syntenic segments of the tetraodon and medaka genomes identified candidates for association with ISA resistance in Atlantic salmon based on differential expression profiles from ISA challenges or on the putative biological functions of the proteins they encode. One gene in particular, HIV-EP2/MBP-2, caught our attention as it may influence the expression of several genes that have been implicated in the response to infection by infectious salmon anemia virus (ISAV). Therefore, we suggest that HIV-EP2/MBP-2 is a very strong candidate for the gene associated with the ISAV resistance QTL in Atlantic salmon and is worthy of further study.

Genome-wide analyses of the bZIP family reveal their involvement in the development, ripening and abiotic stress response in banana

PubMed Central

Hu, Wei; Wang, Lianzhe; Tie, Weiwei; Yan, Yan; Ding, Zehong; Liu, Juhua; Li, Meiying; Peng, Ming; Xu, Biyu; Jin, Zhiqiang

2016-01-01

The leucine zipper (bZIP) transcription factors play important roles in multiple biological processes. However, less information is available regarding the bZIP family in the important fruit crop banana. In this study, 121 bZIP transcription factor genes were identified in the banana genome. Phylogenetic analysis showed that MabZIPs were classified into 11 subfamilies. The majority of MabZIP genes in the same subfamily shared similar gene structures and conserved motifs. The comprehensive transcriptome analysis of two banana genotypes revealed the differential expression patterns of MabZIP genes in different organs, in various stages of fruit development and ripening, and in responses to abiotic stresses, including drought, cold, and salt. Interaction networks and co-expression assays showed that group A MabZIP-mediated networks participated in various stress signaling, which was strongly activated in Musa ABB Pisang Awak. This study provided new insights into the complicated transcriptional control of MabZIP genes and provided robust tissue-specific, development-dependent, and abiotic stress-responsive candidate MabZIP genes for potential applications in the genetic improvement of banana cultivars. PMID:27445085

The Arabidopsis endoplasmic reticulum associated degradation pathways are involved in the regulation of heat stress response

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Lin-Mao; University of Chinese Academy of Sciences, Beijing; Lü, Shi-You

Abstracts: The Cytosolic Protein Response (CPR) in the cytosol and the Unfolded Protein Response (UPR) and ER-associated degradation (ERAD) in the endoplasmic reticulum are major pathways of the cellular proteostasis network. However, despite years of effort, how these protein quality control systems coordinated in vivo remains largely unknown, particularly in plants. In this study, the roles of two evolutionarily conserved ERAD pathways (DOA10 and HRD1) in heat stress response were investigated through reverse genetic approaches in Arabidopsis. Phenotypic analysis of the mutants showed that the two ERAD pathways additively play negative roles in heat tolerance, which was demonstrated by higher survivalmore » rate and lower electrolyte leakage in the loss of function mutants compared to the wild type plants. Importantly, gene expression analysis revealed that the mutant plants showed elevated transcriptional regulation of several downstream genes, including those encoding CPR and UPR marker genes, under both basal and heat stress conditions. Finally, multiple components of ERAD genes exhibited rapid response to increasing temperature. Taken together, our data not only unravels key insights into the crosstalk between different protein quality control processes, but also provides candidate genes to genetically improve plant heat tolerance in the future. - Highlights: • ERAD pathways cooperatively regulate plant thermotolerance. • ERAD pathways cooperatively regulate UPR and CPR. • ERAD components gene expression are upregulated by heat stress.« less

Transcriptomic and Physiological Variations of Three Arabidopsis Ecotypes in Response to Salt Stress

PubMed Central

Wang, Yanping; Yang, Li; Zheng, Zhimin; Grumet, Rebecca; Loescher, Wayne; Zhu, Jian-Kang; Yang, Pingfang; Hu, Yuanlei; Chan, Zhulong

2013-01-01

Salt stress is one of the major abiotic stresses in agriculture worldwide. Analysis of natural genetic variation in Arabidopsis is an effective approach to characterize candidate salt responsive genes. Differences in salt tolerance of three Arabidopsis ecotypes were compared in this study based on their responses to salt treatments at two developmental stages: seed germination and later growth. The Sha ecotype had higher germination rates, longer roots and less accumulation of superoxide radical and hydrogen peroxide than the Ler and Col ecotypes after short term salt treatment. With long term salt treatment, Sha exhibited higher survival rates and lower electrolyte leakage. Transcriptome analysis revealed that many genes involved in cell wall, photosynthesis, and redox were mainly down-regulated by salinity effects, while transposable element genes, microRNA and biotic stress related genes were significantly changed in comparisons of Sha vs. Ler and Sha vs. Col. Several pathways involved in tricarboxylic acid cycle, hormone metabolism and development, and the Gene Ontology terms involved in response to stress and defense response were enriched after salt treatment, and between Sha and other two ecotypes. Collectively, these results suggest that the Sha ecotype is preconditioned to withstand abiotic stress. Further studies about detailed gene function are needed. These comparative transcriptomic and analytical results also provide insight into the complexity of salt stress tolerance mechanisms. PMID:23894403

How Artificial Intelligence Can Improve Our Understanding of the Genes Associated with Endometriosis: Natural Language Processing of the PubMed Database

PubMed Central

Mashiach, R.; Cohen, S.; Kedem, A.; Baron, A.; Zajicek, M.; Feldman, I.; Seidman, D.; Soriano, D.

2018-01-01

Endometriosis is a disease characterized by the development of endometrial tissue outside the uterus, but its cause remains largely unknown. Numerous genes have been studied and proposed to help explain its pathogenesis. However, the large number of these candidate genes has made functional validation through experimental methodologies nearly impossible. Computational methods could provide a useful alternative for prioritizing those most likely to be susceptibility genes. Using artificial intelligence applied to text mining, this study analyzed the genes involved in the pathogenesis, development, and progression of endometriosis. The data extraction by text mining of the endometriosis-related genes in the PubMed database was based on natural language processing, and the data were filtered to remove false positives. Using data from the text mining and gene network information as input for the web-based tool, 15,207 endometriosis-related genes were ranked according to their score in the database. Characterization of the filtered gene set through gene ontology, pathway, and network analysis provided information about the numerous mechanisms hypothesized to be responsible for the establishment of ectopic endometrial tissue, as well as the migration, implantation, survival, and proliferation of ectopic endometrial cells. Finally, the human genome was scanned through various databases using filtered genes as a seed to determine novel genes that might also be involved in the pathogenesis of endometriosis but which have not yet been characterized. These genes could be promising candidates to serve as useful diagnostic biomarkers and therapeutic targets in the management of endometriosis. PMID:29750165

How Artificial Intelligence Can Improve Our Understanding of the Genes Associated with Endometriosis: Natural Language Processing of the PubMed Database.

PubMed

Bouaziz, J; Mashiach, R; Cohen, S; Kedem, A; Baron, A; Zajicek, M; Feldman, I; Seidman, D; Soriano, D

2018-01-01

Endometriosis is a disease characterized by the development of endometrial tissue outside the uterus, but its cause remains largely unknown. Numerous genes have been studied and proposed to help explain its pathogenesis. However, the large number of these candidate genes has made functional validation through experimental methodologies nearly impossible. Computational methods could provide a useful alternative for prioritizing those most likely to be susceptibility genes. Using artificial intelligence applied to text mining, this study analyzed the genes involved in the pathogenesis, development, and progression of endometriosis. The data extraction by text mining of the endometriosis-related genes in the PubMed database was based on natural language processing, and the data were filtered to remove false positives. Using data from the text mining and gene network information as input for the web-based tool, 15,207 endometriosis-related genes were ranked according to their score in the database. Characterization of the filtered gene set through gene ontology, pathway, and network analysis provided information about the numerous mechanisms hypothesized to be responsible for the establishment of ectopic endometrial tissue, as well as the migration, implantation, survival, and proliferation of ectopic endometrial cells. Finally, the human genome was scanned through various databases using filtered genes as a seed to determine novel genes that might also be involved in the pathogenesis of endometriosis but which have not yet been characterized. These genes could be promising candidates to serve as useful diagnostic biomarkers and therapeutic targets in the management of endometriosis.

A computational approach to candidate gene prioritization for X-linked mental retardation using annotation-based binary filtering and motif-based linear discriminatory analysis

PubMed Central

2011-01-01

Background Several computational candidate gene selection and prioritization methods have recently been developed. These in silico selection and prioritization techniques are usually based on two central approaches - the examination of similarities to known disease genes and/or the evaluation of functional annotation of genes. Each of these approaches has its own caveats. Here we employ a previously described method of candidate gene prioritization based mainly on gene annotation, in accompaniment with a technique based on the evaluation of pertinent sequence motifs or signatures, in an attempt to refine the gene prioritization approach. We apply this approach to X-linked mental retardation (XLMR), a group of heterogeneous disorders for which some of the underlying genetics is known. Results The gene annotation-based binary filtering method yielded a ranked list of putative XLMR candidate genes with good plausibility of being associated with the development of mental retardation. In parallel, a motif finding approach based on linear discriminatory analysis (LDA) was employed to identify short sequence patterns that may discriminate XLMR from non-XLMR genes. High rates (>80%) of correct classification was achieved, suggesting that the identification of these motifs effectively captures genomic signals associated with XLMR vs. non-XLMR genes. The computational tools developed for the motif-based LDA is integrated into the freely available genomic analysis portal Galaxy (http://main.g2.bx.psu.edu/). Nine genes (APLN, ZC4H2, MAGED4, MAGED4B, RAP2C, FAM156A, FAM156B, TBL1X, and UXT) were highlighted as highly-ranked XLMR methods. Conclusions The combination of gene annotation information and sequence motif-orientated computational candidate gene prediction methods highlight an added benefit in generating a list of plausible candidate genes, as has been demonstrated for XLMR. Reviewers: This article was reviewed by Dr Barbara Bardoni (nominated by Prof Juergen Brosius); Prof Neil Smalheiser and Dr Dustin Holloway (nominated by Prof Charles DeLisi). PMID:21668950

The CanOE strategy: integrating genomic and metabolic contexts across multiple prokaryote genomes to find candidate genes for orphan enzymes.

PubMed

Smith, Adam Alexander Thil; Belda, Eugeni; Viari, Alain; Medigue, Claudine; Vallenet, David

2012-05-01

Of all biochemically characterized metabolic reactions formalized by the IUBMB, over one out of four have yet to be associated with a nucleic or protein sequence, i.e. are sequence-orphan enzymatic activities. Few bioinformatics annotation tools are able to propose candidate genes for such activities by exploiting context-dependent rather than sequence-dependent data, and none are readily accessible and propose result integration across multiple genomes. Here, we present CanOE (Candidate genes for Orphan Enzymes), a four-step bioinformatics strategy that proposes ranked candidate genes for sequence-orphan enzymatic activities (or orphan enzymes for short). The first step locates "genomic metabolons", i.e. groups of co-localized genes coding proteins catalyzing reactions linked by shared metabolites, in one genome at a time. These metabolons can be particularly helpful for aiding bioanalysts to visualize relevant metabolic data. In the second step, they are used to generate candidate associations between un-annotated genes and gene-less reactions. The third step integrates these gene-reaction associations over several genomes using gene families, and summarizes the strength of family-reaction associations by several scores. In the final step, these scores are used to rank members of gene families which are proposed for metabolic reactions. These associations are of particular interest when the metabolic reaction is a sequence-orphan enzymatic activity. Our strategy found over 60,000 genomic metabolons in more than 1,000 prokaryote organisms from the MicroScope platform, generating candidate genes for many metabolic reactions, of which more than 70 distinct orphan reactions. A computational validation of the approach is discussed. Finally, we present a case study on the anaerobic allantoin degradation pathway in Escherichia coli K-12.

Genome-wide digital transcript analysis of putative fruitlet abscission related genes regulated by ethephon in litchi

PubMed Central

Li, Caiqin; Wang, Yan; Ying, Peiyuan; Ma, Wuqiang; Li, Jianguo

2015-01-01

The high level of physiological fruitlet abscission in litchi (Litchi chinensis Sonn.) causes severe yield loss. Cell separation occurs at the fruit abscission zone (FAZ) and can be triggered by ethylene. However, a deep knowledge of the molecular events occurring in the FAZ is still unknown. Here, genome-wide digital transcript abundance (DTA) analysis of putative fruit abscission related genes regulated by ethephon in litchi were studied. More than 81 million high quality reads from seven ethephon treated and untreated control libraries were obtained by high-throughput sequencing. Through DTA profile analysis in combination with Gene Ontology and KEGG pathway enrichment analyses, a total of 2730 statistically significant candidate genes were involved in the ethephon-promoted litchi fruitlet abscission. Of these, there were 1867 early-responsive genes whose expressions were up- or down-regulated from 0 to 1 d after treatment. The most affected genes included those related to ethylene biosynthesis and signaling, auxin transport and signaling, transcription factors (TFs), protein ubiquitination, ROS response, calcium signal transduction, and cell wall modification. These genes could be clustered into four groups and 13 subgroups according to their similar expression patterns. qRT-PCR displayed the expression pattern of 41 selected candidate genes, which proved the accuracy of our DTA data. Ethephon treatment significantly increased fruit abscission and ethylene production of fruitlet. The possible molecular events to control the ethephon-promoted litchi fruitlet abscission were prompted out. The increased ethylene evolution in fruitlet would suppress the synthesis and polar transport of auxin and trigger abscission signaling. To the best of our knowledge, it is the first time to monitor the gene expression profile occurring in the FAZ-enriched pedicel during litchi fruit abscission induced by ethephon on the genome-wide level. This study will contribute to a better understanding for the molecular regulatory mechanism of fruit abscission in litchi. PMID:26217356

Concurrent Drought Stress and Vascular Pathogen Infection Induce Common and Distinct Transcriptomic Responses in Chickpea

PubMed Central

Sinha, Ranjita; Gupta, Aarti; Senthil-Kumar, Muthappa

2017-01-01

Chickpea (Cicer arietinum); the second largest legume grown worldwide is prone to drought and various pathogen infections. These drought and pathogen stresses often occur concurrently in the field conditions. However, the molecular events in response to that are largely unknown. The present study examines the transcriptome dynamics in chickpea plants exposed to a combination of water-deficit stress and Ralstonia solanacearum infection. R. solanacearum is a potential wilt disease causing pathogen in chickpea. Drought stressed chickpea plants were infected with this pathogen and the plants were allowed to experience progressive drought with 2 and 4 days of R. solanacearum infection called short duration stress (SD stresses) and long duration stress (LD stresses), respectively. Our study showed that R. solanacearum multiplication decreased under SD-combined stress compared to SD-pathogen but there was no significant change in LD-combined stress compared to LD-pathogen. The microarray analysis during these conditions showed that 821 and 1039 differentially expressed genes (DEGs) were unique to SD- and LD-combined stresses, respectively, when compared with individual stress conditions. Three and fifteen genes were common among all the SD-stress treatments and LD-stress treatments, respectively. Genes involved in secondary cell wall biosynthesis, alkaloid biosynthesis, defense related proteins, and osmo-protectants were up-regulated during combined stress. The expression of genes involved in lignin and cellulose biosynthesis were specifically up-regulated in SD-combined, LD-combined, and LD-pathogen stress. A close transcriptomic association of LD-pathogen stress with SD-combined stress was observed in this study which indicates that R. solanacearum infection also exerts drought stress along with pathogen stress thus mimics combined stress effect. Furthermore the expression profiling of candidate genes using real-time quantitative PCR validated the microarray data. The study showed that down-regulation of defense-related genes during LD-combined stress resulted in an increased bacterial multiplication as compared to SD-combined stress. Overall, our study highlights a sub-set of DEGs uniquely expressed in response to combined stress, which serve as potential candidates for further functional characterization to delineate the molecular response of the plant to concurrent drought-pathogen stress. PMID:28382041

Predictive biomarkers of sensitivity to the phosphatidylinositol 3' kinase inhibitor GDC-0941 in breast cancer preclinical models.

PubMed

O'Brien, Carol; Wallin, Jeffrey J; Sampath, Deepak; GuhaThakurta, Debraj; Savage, Heidi; Punnoose, Elizabeth A; Guan, Jane; Berry, Leanne; Prior, Wei Wei; Amler, Lukas C; Belvin, Marcia; Friedman, Lori S; Lackner, Mark R

2010-07-15

The class I phosphatidylinositol 3' kinase (PI3K) plays a major role in proliferation and survival in a wide variety of human cancers. A key factor in successful development of drugs targeting this pathway is likely to be the identification of responsive patient populations with predictive diagnostic biomarkers. This study sought to identify candidate biomarkers of response to the selective PI3K inhibitor GDC-0941. We used a large panel of breast cancer cell lines and in vivo xenograft models to identify candidate predictive biomarkers for a selective inhibitor of class I PI3K that is currently in clinical development. The approach involved pharmacogenomic profiling as well as analysis of gene expression data sets from cells profiled at baseline or after GDC-0941 treatment. We found that models harboring mutations in PIK3CA, amplification of human epidermal growth factor receptor 2, or dual alterations in two pathway components were exquisitely sensitive to the antitumor effects of GDC-0941. We found that several models that do not harbor these alterations also showed sensitivity, suggesting a need for additional diagnostic markers. Gene expression studies identified a collection of genes whose expression was associated with in vitro sensitivity to GDC-0941, and expression of a subset of these genes was found to be intimately linked to signaling through the pathway. Pathway focused biomarkers and the gene expression signature described in this study may have utility in the identification of patients likely to benefit from therapy with a selective PI3K inhibitor. Copyright 2010 AACR.

Improved Innate and Adaptive Immunostimulation by Genetically Modified HIV-1 Protein Expressing NYVAC Vectors

PubMed Central

Quakkelaar, Esther D.; Redeker, Anke; Haddad, Elias K.; Harari, Alexandre; McCaughey, Stella Mayo; Duhen, Thomas; Filali-Mouhim, Abdelali; Goulet, Jean-Philippe; Loof, Nikki M.; Ossendorp, Ferry; Perdiguero, Beatriz; Heinen, Paul; Gomez, Carmen E.; Kibler, Karen V.; Koelle, David M.; Sékaly, Rafick P.; Sallusto, Federica; Lanzavecchia, Antonio; Pantaleo, Giuseppe; Esteban, Mariano; Tartaglia, Jim; Jacobs, Bertram L.; Melief, Cornelis J. M.

2011-01-01

Attenuated poxviruses are safe and capable of expressing foreign antigens. Poxviruses are applied in veterinary vaccination and explored as candidate vaccines for humans. However, poxviruses express multiple genes encoding proteins that interfere with components of the innate and adaptive immune response. This manuscript describes two strategies aimed to improve the immunogenicity of the highly attenuated, host-range restricted poxvirus NYVAC: deletion of the viral gene encoding type-I interferon-binding protein and development of attenuated replication-competent NYVAC. We evaluated these newly generated NYVAC mutants, encoding HIV-1 env, gag, pol and nef, for their ability to stimulate HIV-specific CD8 T-cell responses in vitro from blood mononuclear cells of HIV-infected subjects. The new vectors were evaluated and compared to the parental NYVAC vector in dendritic cells (DCs), RNA expression arrays, HIV gag expression and cross-presentation assays in vitro. Deletion of type-I interferon-binding protein enhanced expression of interferon and interferon-induced genes in DCs, and increased maturation of infected DCs. Restoration of replication competence induced activation of pathways involving antigen processing and presentation. Also, replication-competent NYVAC showed increased Gag expression in infected cells, permitting enhanced cross-presentation to HIV-specific CD8 T cells and proliferation of HIV-specific memory CD8 T-cells in vitro. The recombinant NYVAC combining both modifications induced interferon-induced genes and genes involved in antigen processing and presentation, as well as increased Gag expression. This combined replication-competent NYVAC is a promising candidate for the next generation of HIV vaccines. PMID:21347234

Endeavour update: a web resource for gene prioritization in multiple species

PubMed Central

Tranchevent, Léon-Charles; Barriot, Roland; Yu, Shi; Van Vooren, Steven; Van Loo, Peter; Coessens, Bert; De Moor, Bart; Aerts, Stein; Moreau, Yves

2008-01-01

Endeavour (http://www.esat.kuleuven.be/endeavourweb; this web site is free and open to all users and there is no login requirement) is a web resource for the prioritization of candidate genes. Using a training set of genes known to be involved in a biological process of interest, our approach consists of (i) inferring several models (based on various genomic data sources), (ii) applying each model to the candidate genes to rank those candidates against the profile of the known genes and (iii) merging the several rankings into a global ranking of the candidate genes. In the present article, we describe the latest developments of Endeavour. First, we provide a web-based user interface, besides our Java client, to make Endeavour more universally accessible. Second, we support multiple species: in addition to Homo sapiens, we now provide gene prioritization for three major model organisms: Mus musculus, Rattus norvegicus and Caenorhabditis elegans. Third, Endeavour makes use of additional data sources and is now including numerous databases: ontologies and annotations, protein–protein interactions, cis-regulatory information, gene expression data sets, sequence information and text-mining data. We tested the novel version of Endeavour on 32 recent disease gene associations from the literature. Additionally, we describe a number of recent independent studies that made use of Endeavour to prioritize candidate genes for obesity and Type II diabetes, cleft lip and cleft palate, and pulmonary fibrosis. PMID:18508807

Identification and validation of reference genes for quantitative real-time PCR normalization and its applications in lycium.

PubMed

Zeng, Shaohua; Liu, Yongliang; Wu, Min; Liu, Xiaomin; Shen, Xiaofei; Liu, Chunzhao; Wang, Ying

2014-01-01

Lycium barbarum and L. ruthenicum are extensively used as traditional Chinese medicinal plants. Next generation sequencing technology provides a powerful tool for analyzing transcriptomic profiles of gene expression in non-model species. Such gene expression can then be confirmed with quantitative real-time polymerase chain reaction (qRT-PCR). Therefore, use of systematically identified suitable reference genes is a prerequisite for obtaining reliable gene expression data. Here, we calculated the expression stability of 18 candidate reference genes across samples from different tissues and grown under salt stress using geNorm and NormFinder procedures. The geNorm-determined rank of reference genes was similar to those defined by NormFinder with some differences. Both procedures confirmed that the single most stable reference gene was ACNTIN1 for L. barbarum fruits, H2B1 for L. barbarum roots, and EF1α for L. ruthenicum fruits. PGK3, H2B2, and PGK3 were identified as the best stable reference genes for salt-treated L. ruthenicum leaves, roots, and stems, respectively. H2B1 and GAPDH1+PGK1 for L. ruthenicum and SAMDC2+H2B1 for L. barbarum were the best single and/or combined reference genes across all samples. Finally, expression of salt-responsive gene NAC, fruit ripening candidate gene LrPG, and anthocyanin genes were investigated to confirm the validity of the selected reference genes. Suitable reference genes identified in this study provide a foundation for accurately assessing gene expression and further better understanding of novel gene function to elucidate molecular mechanisms behind particular biological/physiological processes in Lycium.

A comprehensive resource of drought- and salinity- responsive ESTs for gene discovery and marker development in chickpea (Cicer arietinum L.)

PubMed Central

2009-01-01

Background Chickpea (Cicer arietinum L.), an important grain legume crop of the world is seriously challenged by terminal drought and salinity stresses. However, very limited number of molecular markers and candidate genes are available for undertaking molecular breeding in chickpea to tackle these stresses. This study reports generation and analysis of comprehensive resource of drought- and salinity-responsive expressed sequence tags (ESTs) and gene-based markers. Results A total of 20,162 (18,435 high quality) drought- and salinity- responsive ESTs were generated from ten different root tissue cDNA libraries of chickpea. Sequence editing, clustering and assembly analysis resulted in 6,404 unigenes (1,590 contigs and 4,814 singletons). Functional annotation of unigenes based on BLASTX analysis showed that 46.3% (2,965) had significant similarity (≤1E-05) to sequences in the non-redundant UniProt database. BLASTN analysis of unique sequences with ESTs of four legume species (Medicago, Lotus, soybean and groundnut) and three model plant species (rice, Arabidopsis and poplar) provided insights on conserved genes across legumes as well as novel transcripts for chickpea. Of 2,965 (46.3%) significant unigenes, only 2,071 (32.3%) unigenes could be functionally categorised according to Gene Ontology (GO) descriptions. A total of 2,029 sequences containing 3,728 simple sequence repeats (SSRs) were identified and 177 new EST-SSR markers were developed. Experimental validation of a set of 77 SSR markers on 24 genotypes revealed 230 alleles with an average of 4.6 alleles per marker and average polymorphism information content (PIC) value of 0.43. Besides SSR markers, 21,405 high confidence single nucleotide polymorphisms (SNPs) in 742 contigs (with ≥ 5 ESTs) were also identified. Recognition sites for restriction enzymes were identified for 7,884 SNPs in 240 contigs. Hierarchical clustering of 105 selected contigs provided clues about stress- responsive candidate genes and their expression profile showed predominance in specific stress-challenged libraries. Conclusion Generated set of chickpea ESTs serves as a resource of high quality transcripts for gene discovery and development of functional markers associated with abiotic stress tolerance that will be helpful to facilitate chickpea breeding. Mapping of gene-based markers in chickpea will also add more anchoring points to align genomes of chickpea and other legume species. PMID:19912666

Heat Shock Protein 70 Enhances Mucosal Immunity against Human Norovirus When Coexpressed from a Vesicular Stomatitis Virus Vector

PubMed Central

Ma, Yuanmei; Duan, Yue; Wei, Yongwei; Liang, Xueya; Niewiesk, Stefan; Oglesbee, Michael

2014-01-01

ABSTRACT Human norovirus (NoV) accounts for 95% of nonbacterial gastroenteritis worldwide. Currently, there is no vaccine available to combat human NoV as it is not cultivable and lacks a small-animal model. Recently, we demonstrated that recombinant vesicular stomatitis virus (rVSV) expressing human NoV capsid protein (rVSV-VP1) induced strong immunities in mice (Y. Ma and J. Li, J. Virol. 85:2942–2952, 2011). To further improve the safety and efficacy of the vaccine candidate, heat shock protein 70 (HSP70) was inserted into the rVSV-VP1 backbone vector. A second construct was generated in which the firefly luciferase (Luc) gene was inserted in place of HSP70 as a control for the double insertion. The resultant recombinant viruses (rVSV-HSP70-VP1 and rVSV-Luc-VP1) were significantly more attenuated in cell culture and viral spread in mice than rVSV-VP1. At the inoculation dose of 1.0 × 106 PFU, rVSV-HSP70-VP1 triggered significantly higher vaginal IgA than rVSV-VP1 and significantly higher fecal and vaginal IgA responses than rVSV-Luc-VP1, although serum IgG and T cell responses were similar. At the inoculation dose of 5.0 × 106 PFU, rVSV-HSP70-VP1 stimulated significantly higher T cell, fecal, and vaginal IgA responses than rVSV-VP1. Fecal and vaginal IgA responses were also significantly increased when combined vaccination of rVSV-VP1 and rVSV-HSP70 was used. Collectively, these data indicate that (i) insertion of an additional gene (HSP70 or Luc) into the rVSV-VP1 backbone further attenuates the VSV-based vaccine in vitro and in vivo, thus improving the safety of the vaccine candidate, and (ii) HSP70 enhances the human NoV-specific mucosal and T cell immunities triggered by a VSV-based human NoV vaccine. IMPORTANCE Human norovirus (NoV) is responsible for more than 95% of acute nonbacterial gastroenteritis worldwide. Currently, there is no vaccine for this virus. Development of a live attenuated vaccine for human NoV has not been possible because it is uncultivable. Thus, a live vector-based vaccine may provide an alternative vaccine strategy. In this study, we developed a vesicular stomatitis virus (VSV)-based human NoV vaccine candidate. We constructed rVSV-HSP70-VP1, coexpressing heat shock protein (HSP70) and capsid (VP1) genes of human NoV, and rVSV-Luc-VP1, coexpressing firefly luciferase (Luc) and VP1 genes. We found that VSVs with a double gene insertion were significantly more attenuated than VSV with a single VP1 insertion (rVSV-VP1). Furthermore, we found that coexpression or coadministration of HSP70 from VSV vector significantly enhanced human NoV-specific mucosal immunity. Collectively, we developed an improved live vectored vaccine candidate for human NoV which will be useful for future clinical studies. PMID:24574391

Novel CREB3L3 Nonsense Mutation in a Family With Dominant Hypertriglyceridemia.

PubMed

Cefalù, Angelo B; Spina, Rossella; Noto, Davide; Valenti, Vincenza; Ingrassia, Valeria; Giammanco, Antonina; Panno, Maria D; Ganci, Antonina; Barbagallo, Carlo M; Averna, Maurizio R

2015-12-01

Cyclic AMP responsive element-binding protein 3-like 3 (CREB3L3) is a novel candidate gene for dominant hypertriglyceridemia. To date, only 4 kindred with dominant hypertriglyceridemia have been found to be carriers of 2 nonsense mutations in CREB3L3 gene (245fs and W46X). We investigated a family in which hypertriglyceridemia displayed an autosomal dominant pattern of inheritance. The proband was a 49-year-old woman with high plasma triglycerides (≤1300 mg/dL; 14.68 mmol/L). Her father had a history of moderate hypertriglyceridemia, and her 51-year-old brother had triglycerides levels as high as 1600 mg/dL (18.06 mmol/L). To identify the causal mutation in this family, we analyzed the candidate genes of recessive and dominant forms of primary hypertriglyceridemia by direct sequencing. The sequencing of CREB3L3 gene led to the discovery of a novel minute frame shift mutation in exon 3 of CREB3L3 gene, predicted to result in the formation of a truncated protein devoid of function (c.359delG-p.K120fsX20). Heterozygosity for the c.359delG mutation resulted in a severe phenotype occurring later in life in the proband and her brother and a good response to diet and a hypotriglyceridemic treatment. The same mutation was detected in a 13-year-old daughter who to date is normotriglyceridemic. We have identified a novel pathogenic mutation in CREB3L3 gene in a family with dominant hypertriglyceridemia with a variable pattern of penetrance. © 2015 American Heart Association, Inc.

Genome-wide transcriptome profiling of black poplar (Populus nigra L.) under boron toxicity revealed candidate genes responsible in boron uptake, transport and detoxification.

PubMed

Yıldırım, Kubilay; Uylaş, Senem

2016-12-01

Boron (B) is an essential nutrient for normal growth of plants. Despite its low abundance in soils, it could be highly toxic to plants in especially arid and semi-arid environments. Poplars are known to be tolerant species to B toxicity and accumulation. However, physiological and gene regulation responses of these trees to B toxicity have not been investigated yet. Here, B accumulation and tolerance level of black poplar clones were firstly tested in the current study. Rooted cutting of these clones were treated with elevated B toxicity to select the most B accumulator and tolerant genotype. Then we carried out a microarray based transcriptome experiment on the leaves and roots of this genotype to find out transcriptional networks, genes and molecular mechanisms behind B toxicity tolerance. The results of the study indicated that black poplar is quite suitable for phytoremediation of B pollution. It could resist 15 ppm soil B content and >1500 ppm B accumulation in leaves, which are highly toxic concentrations for almost all agricultural plants. Transcriptomics results of study revealed totally 1625 and 1419 altered probe sets under 15 ppm B toxicity in leaf and root tissues, respectively. The highest induction were recorded for the probes sets annotated to tyrosine aminotransferase, ATP binding cassette transporters, glutathione S transferases and metallochaperone proteins. Strong up regulation of these genes attributed to internal excretion of B into the cell vacuole and existence of B detoxification processes in black poplar. Many other candidate genes functional in signalling, gene regulation, antioxidation, B uptake and transport processes were also identified in this hyper B accumulator plant for the first time with the current study. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Identification of downy mildew resistance gene candidates by positional cloning in maize (Zea mays subsp. mays; Poaceae)1

PubMed Central

Kim, Jae Yoon; Moon, Jun-Cheol; Kim, Hyo Chul; Shin, Seungho; Song, Kitae; Kim, Kyung-Hee; Lee, Byung-Moo

2017-01-01

Premise of the study: Positional cloning in combination with phenotyping is a general approach to identify disease-resistance gene candidates in plants; however, it requires several time-consuming steps including population or fine mapping. Therefore, in the present study, we suggest a new combined strategy to improve the identification of disease-resistance gene candidates. Methods and Results: Downy mildew (DM)–resistant maize was selected from five cultivars using a spreader row technique. Positional cloning and bioinformatics tools were used to identify the DM-resistance quantitative trait locus marker (bnlg1702) and 47 protein-coding gene annotations. Eventually, five DM-resistance gene candidates, including bZIP34, Bak1, and Ppr, were identified by quantitative reverse-transcription PCR (RT-PCR) without fine mapping of the bnlg1702 locus. Conclusions: The combined protocol with the spreader row technique, quantitative trait locus positional cloning, and quantitative RT-PCR was effective for identifying DM-resistance candidate genes. This cloning approach may be applied to other whole-genome-sequenced crops or resistance to other diseases. PMID:28224059

"Bad genes" & criminal responsibility.

PubMed

González-Tapia, María Isabel; Obsuth, Ingrid

2015-01-01

The genetics of the accused is trying to break into the courts. To date several candidate genes have been put forward and their links to antisocial behavior have been examined and documented with some consistency. In this paper, we focus on the so called "warrior gene", or the low-activity allele of the MAOA gene, which has been most consistently related to human behavior and specifically to violence and antisocial behavior. In preparing this paper we had two objectives. First, to summarize and analyze the current scientific evidence, in order to gain an in depth understanding of the state of the issue and determine whether a dominant line of generally accepted scientific knowledge in this field can be asserted. Second, to derive conclusions and put forward recommendations related to the use of genetic information, specifically the presence of the low-activity genotype of the MAOA gene, in modulation of criminal responsibility in European and US courts. Copyright © 2015 Elsevier Ltd. All rights reserved.

Genes Involved in the Balance between Neuronal Survival and Death during Inflammation

PubMed Central

Glezer, Isaias; Chernomoretz, Ariel; David, Samuel; Plante, Marie-Michèle; Rivest, Serge

2007-01-01

Glucocorticoids are potent regulators of the innate immune response, and alteration in this inhibitory feedback has detrimental consequences for the neural tissue. This study profiled and investigated functionally candidate genes mediating this switch between cell survival and death during an acute inflammatory reaction subsequent to the absence of glucocorticoid signaling. Oligonucleotide microarray analysis revealed that following lipopolysaccharide (LPS) intracerebral administration at striatum level, more modulated genes presented transcription impairment than exacerbation upon glucocorticoid receptor blockage. Among impaired genes we identified ceruloplasmin (Cp), which plays a key role in iron metabolism and is implicated in a neurodegenative disease. Microglial and endothelial induction of Cp is a natural neuroprotective mechanism during inflammation, because Cp-deficient mice exhibited increased iron accumulation and demyelination when exposed to LPS and neurovascular reactivity to pneumococcal meningitis. This study has identified genes that can play a critical role in programming the innate immune response, helping to clarify the mechanisms leading to protection or damage during inflammatory conditions in the CNS. PMID:17375196

A role for neurotransmission and neurodevelopment in attention-deficit/hyperactivity disorder

PubMed Central

2009-01-01

Attention-deficit/hyperactivity disorder (ADHD) has a moderate to high genetic component, probably due to many genes with small effects. Several susceptibility genes have been suggested on the basis of hypotheses that catecholaminergic pathways in the brain are responsible for ADHD. However, many negative association findings have been reported, indicating a limited success for investigations using this approach. The results from genome-wide association studies have suggested that genes related to general brain functions rather than specific aspects of the disorder may contribute to its development. Plausible biological hypotheses linked to neurotransmission and neurodevelopment in general and common to different psychiatric conditions need to be considered when defining candidate genes for ADHD association studies. PMID:19930624

Transcriptome Analysis of Early Responsive Genes in Rice during Magnaporthe oryzae Infection.

PubMed

Wang, Yiming; Kwon, Soon Jae; Wu, Jingni; Choi, Jaeyoung; Lee, Yong-Hwan; Agrawal, Ganesh Kumar; Tamogami, Shigeru; Rakwal, Randeep; Park, Sang-Ryeol; Kim, Beom-Gi; Jung, Ki-Hong; Kang, Kyu Young; Kim, Sang Gon; Kim, Sun Tae

2014-12-01

Rice blast disease caused by Magnaporthe oryzae is one of the most serious diseases of cultivated rice (Oryza sativa L.) in most rice-growing regions of the world. In order to investigate early response genes in rice, we utilized the transcriptome analysis approach using a 300 K tilling microarray to rice leaves infected with compatible and incompatible M. oryzae strains. Prior to the microarray experiment, total RNA was validated by measuring the differential expression of rice defense-related marker genes (chitinase 2, barwin, PBZ1, and PR-10) by RT-PCR, and phytoalexins (sakuranetin and momilactone A) with HPLC. Microarray analysis revealed that 231 genes were up-regulated (>2 fold change, p < 0.05) in the incompatible interaction compared to the compatible one. Highly expressed genes were functionally characterized into metabolic processes and oxidation-reduction categories. The oxidative stress response was induced in both early and later infection stages. Biotic stress overview from MapMan analysis revealed that the phytohormone ethylene as well as signaling molecules jasmonic acid and salicylic acid is important for defense gene regulation. WRKY and Myb transcription factors were also involved in signal transduction processes. Additionally, receptor-like kinases were more likely associated with the defense response, and their expression patterns were validated by RT-PCR. Our results suggest that candidate genes, including receptor-like protein kinases, may play a key role in disease resistance against M. oryzae attack.

Transcriptional dynamics of a conserved gene expression network associated with craniofacial divergence in Arctic charr.

PubMed

Ahi, Ehsan Pashay; Kapralova, Kalina Hristova; Pálsson, Arnar; Maier, Valerie Helene; Gudbrandsson, Jóhannes; Snorrason, Sigurdur S; Jónsson, Zophonías O; Franzdóttir, Sigrídur Rut

2014-01-01

Understanding the molecular basis of craniofacial variation can provide insights into key developmental mechanisms of adaptive changes and their role in trophic divergence and speciation. Arctic charr (Salvelinus alpinus) is a polymorphic fish species, and, in Lake Thingvallavatn in Iceland, four sympatric morphs have evolved distinct craniofacial structures. We conducted a gene expression study on candidates from a conserved gene coexpression network, focusing on the development of craniofacial elements in embryos of two contrasting Arctic charr morphotypes (benthic and limnetic). Four Arctic charr morphs were studied: one limnetic and two benthic morphs from Lake Thingvallavatn and a limnetic reference aquaculture morph. The presence of morphological differences at developmental stages before the onset of feeding was verified by morphometric analysis. Following up on our previous findings that Mmp2 and Sparc were differentially expressed between morphotypes, we identified a network of genes with conserved coexpression across diverse vertebrate species. A comparative expression study of candidates from this network in developing heads of the four Arctic charr morphs verified the coexpression relationship of these genes and revealed distinct transcriptional dynamics strongly correlated with contrasting craniofacial morphologies (benthic versus limnetic). A literature review and Gene Ontology analysis indicated that a significant proportion of the network genes play a role in extracellular matrix organization and skeletogenesis, and motif enrichment analysis of conserved noncoding regions of network candidates predicted a handful of transcription factors, including Ap1 and Ets2, as potential regulators of the gene network. The expression of Ets2 itself was also found to associate with network gene expression. Genes linked to glucocorticoid signalling were also studied, as both Mmp2 and Sparc are responsive to this pathway. Among those, several transcriptional targets and upstream regulators showed differential expression between the contrasting morphotypes. Interestingly, although selected network genes showed overlapping expression patterns in situ and no morph differences, Timp2 expression patterns differed between morphs. Our comparative study of transcriptional dynamics in divergent craniofacial morphologies of Arctic charr revealed a conserved network of coexpressed genes sharing functional roles in structural morphogenesis. We also implicate transcriptional regulators of the network as targets for future functional studies.

Integrative strategies to identify candidate genes in rodent models of human alcoholism.

PubMed

Treadwell, Julie A

2006-01-01

The search for genes underlying alcohol-related behaviours in rodent models of human alcoholism has been ongoing for many years with only limited success. Recently, new strategies that integrate several of the traditional approaches have provided new insights into the molecular mechanisms underlying ethanol's actions in the brain. We have used alcohol-preferring C57BL/6J (B6) and alcohol-avoiding DBA/2J (D2) genetic strains of mice in an integrative strategy combining high-throughput gene expression screening, genetic segregation analysis, and mapping to previously published quantitative trait loci to uncover candidate genes for the ethanol-preference phenotype. In our study, 2 genes, retinaldehyde binding protein 1 (Rlbp1) and syntaxin 12 (Stx12), were found to be strong candidates for ethanol preference. Such experimental approaches have the power and the potential to greatly speed up the laborious process of identifying candidate genes for the animal models of human alcoholism.

Survival dimensionality reduction (SDR): development and clinical application of an innovative approach to detect epistasis in presence of right-censored data.

PubMed

Beretta, Lorenzo; Santaniello, Alessandro; van Riel, Piet L C M; Coenen, Marieke J H; Scorza, Raffaella

2010-08-06

Epistasis is recognized as a fundamental part of the genetic architecture of individuals. Several computational approaches have been developed to model gene-gene interactions in case-control studies, however, none of them is suitable for time-dependent analysis. Herein we introduce the Survival Dimensionality Reduction (SDR) algorithm, a non-parametric method specifically designed to detect epistasis in lifetime datasets. The algorithm requires neither specification about the underlying survival distribution nor about the underlying interaction model and proved satisfactorily powerful to detect a set of causative genes in synthetic epistatic lifetime datasets with a limited number of samples and high degree of right-censorship (up to 70%). The SDR method was then applied to a series of 386 Dutch patients with active rheumatoid arthritis that were treated with anti-TNF biological agents. Among a set of 39 candidate genes, none of which showed a detectable marginal effect on anti-TNF responses, the SDR algorithm did find that the rs1801274 SNP in the Fc gamma RIIa gene and the rs10954213 SNP in the IRF5 gene non-linearly interact to predict clinical remission after anti-TNF biologicals. Simulation studies and application in a real-world setting support the capability of the SDR algorithm to model epistatic interactions in candidate-genes studies in presence of right-censored data. http://sourceforge.net/projects/sdrproject/.

LOD score exclusion analyses for candidate genes using random population samples.

PubMed

Deng, H W; Li, J; Recker, R R

2001-05-01

While extensive analyses have been conducted to test for, no formal analyses have been conducted to test against, the importance of candidate genes with random population samples. We develop a LOD score approach for exclusion analyses of candidate genes with random population samples. Under this approach, specific genetic effects and inheritance models at candidate genes can be analysed and if a LOD score is < or = - 2.0, the locus can be excluded from having an effect larger than that specified. Computer simulations show that, with sample sizes often employed in association studies, this approach has high power to exclude a gene from having moderate genetic effects. In contrast to regular association analyses, population admixture will not affect the robustness of our analyses; in fact, it renders our analyses more conservative and thus any significant exclusion result is robust. Our exclusion analysis complements association analysis for candidate genes in random population samples and is parallel to the exclusion mapping analyses that may be conducted in linkage analyses with pedigrees or relative pairs. The usefulness of the approach is demonstrated by an application to test the importance of vitamin D receptor and estrogen receptor genes underlying the differential risk to osteoporotic fractures.

Genome-wide analysis identifies chickpea (Cicer arietinum) heat stress transcription factors (Hsfs) responsive to heat stress at the pod development stage.

PubMed

Chidambaranathan, Parameswaran; Jagannadham, Prasanth Tej Kumar; Satheesh, Viswanathan; Kohli, Deshika; Basavarajappa, Santosh Halasabala; Chellapilla, Bharadwaj; Kumar, Jitendra; Jain, Pradeep Kumar; Srinivasan, R

2018-05-01

The heat stress transcription factors (Hsfs) play a prominent role in thermotolerance and eliciting the heat stress response in plants. Identification and expression analysis of Hsfs gene family members in chickpea would provide valuable information on heat stress responsive Hsfs. A genome-wide analysis of Hsfs gene family resulted in the identification of 22 Hsf genes in chickpea in both desi and kabuli genome. Phylogenetic analysis distinctly separated 12 A, 9 B, and 1 C class Hsfs, respectively. An analysis of cis-regulatory elements in the upstream region of the genes identified many stress responsive elements such as heat stress elements (HSE), abscisic acid responsive element (ABRE) etc. In silico expression analysis showed nine and three Hsfs were also expressed in drought and salinity stresses, respectively. Q-PCR expression analysis of Hsfs under heat stress at pod development and at 15 days old seedling stage showed that CarHsfA2, A6, and B2 were significantly upregulated in both the stages of crop growth and other four Hsfs (CarHsfA2, A6a, A6c, B2a) showed early transcriptional upregulation for heat stress at seedling stage of chickpea. These subclasses of Hsfs identified in this study can be further evaluated as candidate genes in the characterization of heat stress response in chickpea.

IGF-I and GH: potential use in gene doping.

PubMed

Harridge, Stephen D R; Velloso, Cristiana P

2009-08-01

Gene doping is the term given to the potential misuse of gene therapy for the purposes of enhancing athletic performance. Insulin like growth factor-I (IGF-I), the prime target of growth hormone action, is one candidate gene for improving performance. In recent years a number of transgenic and somatic gene transfer studies on animals have shown that upregulation of IGF-I stimulates muscle growth and improves function. This increase in muscle IGF-I is not reflected in measurable increases in circulating IGF-I. Whilst the responses obtained in the animal studies would appear to give clear benefits for performance, the transfer of such techniques to humans still presents many technical challenges. Further challenges will also be faced by the anti doping authorities in detecting the endogenously produced products of enhanced gene expression.

Transcriptional response of honey bee larvae infected with the bacterial pathogen Paenibacillus larvae.

PubMed

Cornman, Robert Scott; Lopez, Dawn; Evans, Jay D

2013-01-01

American foulbrood disease of honey bees is caused by the bacterium Paenibacillus larvae. Infection occurs per os in larvae and systemic infection requires a breaching of the host peritrophic matrix and midgut epithelium. Genetic variation exists for both bacterial virulence and host resistance, and a general immunity is achieved by larvae as they age, the basis of which has not been identified. To quickly identify a pool of candidate genes responsive to P. larvae infection, we sequenced transcripts from larvae inoculated with P. larvae at 12 hours post-emergence and incubated for 72 hours, and compared expression levels to a control cohort. We identified 75 genes with significantly higher expression and six genes with significantly lower expression. In addition to several antimicrobial peptides, two genes encoding peritrophic-matrix domains were also up-regulated. Extracellular matrix proteins, proteases/protease inhibitors, and members of the Osiris gene family were prevalent among differentially regulated genes. However, analysis of Drosophila homologs of differentially expressed genes revealed spatial and temporal patterns consistent with developmental asynchrony as a likely confounder of our results. We therefore used qPCR to measure the consistency of gene expression changes for a subset of differentially expressed genes. A replicate experiment sampled at both 48 and 72 hours post infection allowed further discrimination of genes likely to be involved in host response. The consistently responsive genes in our test set included a hymenopteran-specific protein tyrosine kinase, a hymenopteran specific serine endopeptidase, a cytochrome P450 (CYP9Q1), and a homolog of trynity, a zona pellucida domain protein. Of the known honey bee antimicrobial peptides, apidaecin was responsive at both time-points studied whereas hymenoptaecin was more consistent in its level of change between biological replicates and had the greatest increase in expression by RNA-seq analysis.

Alfalfa Cellulose Synthase Gene Expression under Abiotic Stress: A Hitchhiker’s Guide to RT-qPCR Normalization

PubMed Central

Guerriero, Gea; Legay, Sylvain; Hausman, Jean-Francois

2014-01-01

Abiotic stress represents a serious threat affecting both plant fitness and productivity. One of the promptest responses that plants trigger following abiotic stress is the differential expression of key genes, which enable to face the adverse conditions. It is accepted and shown that the cell wall senses and broadcasts the stress signal to the interior of the cell, by triggering a cascade of reactions leading to resistance. Therefore the study of wall-related genes is particularly relevant to understand the metabolic remodeling triggered by plants in response to exogenous stresses. Despite the agricultural and economical relevance of alfalfa (Medicago sativa L.), no study, to our knowledge, has addressed specifically the wall-related gene expression changes in response to exogenous stresses in this important crop, by monitoring the dynamics of wall biosynthetic gene expression. We here identify and analyze the expression profiles of nine cellulose synthases, together with other wall-related genes, in stems of alfalfa plants subjected to different abiotic stresses (cold, heat, salt stress) at various time points (e.g. 0, 24, 72 and 96 h). We identify 2 main responses for specific groups of genes, i.e. a salt/heat-induced and a cold/heat-repressed group of genes. Prior to this analysis we identified appropriate reference genes for expression analyses in alfalfa, by evaluating the stability of 10 candidates across different tissues (namely leaves, stems, roots), under the different abiotic stresses and time points chosen. The results obtained confirm an active role played by the cell wall in response to exogenous stimuli and constitute a step forward in delineating the complex pathways regulating the response of plants to abiotic stresses. PMID:25084115

Functional analysis of MeCIPK23 and MeCBL1/9 in cassava defense response against Xanthomonas axonopodis pv. manihotis.

PubMed

Yan, Yu; He, Xinyi; Hu, Wei; Liu, Guoyin; Wang, Peng; He, Chaozu; Shi, Haitao

2018-06-01

MeCIPK23 interacts with MeCBL1/9, and they confer improved defense response, providing potential genes for further genetic breeding in cassava. Cassava (Manihot esculenta) is an important food crop in tropical area, but its production is largely affected by cassava bacterial blight. However, the information of defense-related genes in cassava is very limited. Calcium ions play essential roles in plant development and stress signaling pathways. Calcineurin B-like proteins (CBLs) and CBL-interacting protein kinases (CIPKs) are crucial components of calcium signals. In this study, systematic expression profile of 25MeCIPKs in response to Xanthomonas axonopodis pv. manihotis (Xam) infection was examined, by which seven candidate MeCIPKs were chosen for functional investigation. Through transient expression in Nicotiana benthamiana leaves, we found that six MeCIPKs (MeCIPK5, MeCIPK8, MeCIPK12, MeCIPK22, MeCIPK23 and MeCIPK24) conferred improved defense response, via regulating the transcripts of several defense-related genes. Notably, we found that MeCIPK23 interacted with MeCBL1 and MeCBL9, and overexpression of these genes conferred improved defense response. On the contrary, virus-induced gene silencing of either MeCIPK23 or MeCBL1/9 or both genes resulted in disease sensitive in cassava. To our knowledge, this is the first study identifying MeCIPK23 as well as MeCBL1 and MeCBL9 that confer enhanced defense response against Xam.

Genetic factors regulating lung vasculature and immune cell functions associate with resistance to pneumococcal infection.

PubMed

Jonczyk, Magda S; Simon, Michelle; Kumar, Saumya; Fernandes, Vitor E; Sylvius, Nicolas; Mallon, Ann-Marie; Denny, Paul; Andrew, Peter W

2014-01-01

Streptococcus pneumoniae is an important human pathogen responsible for high mortality and morbidity worldwide. The susceptibility to pneumococcal infections is controlled by as yet unknown genetic factors. To elucidate these factors could help to develop new medical treatments and tools to identify those most at risk. In recent years genome wide association studies (GWAS) in mice and humans have proved successful in identification of causal genes involved in many complex diseases for example diabetes, systemic lupus or cholesterol metabolism. In this study a GWAS approach was used to map genetic loci associated with susceptibility to pneumococcal infection in 26 inbred mouse strains. As a result four candidate QTLs were identified on chromosomes 7, 13, 18 and 19. Interestingly, the QTL on chromosome 7 was located within S. pneumoniae resistance QTL (Spir1) identified previously in a linkage study of BALB/cOlaHsd and CBA/CaOlaHsd F2 intercrosses. We showed that only a limited number of genes encoded within the QTLs carried phenotype-associated polymorphisms (22 genes out of several hundred located within the QTLs). These candidate genes are known to regulate TGFβ signalling, smooth muscle and immune cells functions. Interestingly, our pulmonary histopathology and gene expression data demonstrated, lung vasculature plays an important role in resistance to pneumococcal infection. Therefore we concluded that the cumulative effect of these candidate genes on vasculature and immune cells functions as contributory factors in the observed differences in susceptibility to pneumococcal infection. We also propose that TGFβ-mediated regulation of fibroblast differentiation plays an important role in development of invasive pneumococcal disease. Gene expression data submitted to the NCBI Gene Expression Omnibus Accession No: GSE49533 SNP data submitted to NCBI dbSNP Short Genetic Variation http://www.ncbi.nlm.nih.gov/projects/SNP/snp_viewTable.cgi?handle=MUSPNEUMONIA.

Differential Expression Analysis of a Subset of Drought-Responsive GmNAC Genes in Two Soybean Cultivars Differing in Drought Tolerance

PubMed Central

Thao, Nguyen Phuong; Thu, Nguyen Binh Anh; Hoang, Xuan Lan Thi; Van Ha, Chien; Tran, Lam-Son Phan

2013-01-01

The plant-specific NAC transcription factors play important roles in plant response to drought stress. Here, we have compared the expression levels of a subset of GmNAC genes in drought-tolerant DT51 and drought-sensitive MTD720 under both normal and drought stress conditions aimed at identifying correlation between GmNAC expression levels and drought tolerance degree, as well as potential GmNAC candidates for genetic engineering. The expression of 23 selected dehydration-responsive GmNACs was assessed in both stressed and unstressed root tissues of DT51 and MTD720 using real-time quantitative PCR. The results indicated that expression of GmNACs was genotype-dependent. Seven and 13 of 23 tested GmNACs showed higher expression levels in roots of DT51 in comparison with MTD720 under normal and drought stress conditions, respectively, whereas none of them displayed lower transcript levels under any conditions. This finding suggests that the higher drought tolerance of DT51 might be positively correlated with the higher induction of the GmNAC genes during water deficit. The drought-inducible GmNAC011 needs to be mentioned as its transcript accumulation was more than 76-fold higher in drought-stressed DT51 roots relative to MTD720 roots. Additionally, among the GmNAC genes examined, GmNAC085, 092, 095, 101 and 109 were not only drought-inducible but also more highly up-regulated in DT51 roots than in that of MTD720 under both treatment conditions. These data together suggest that GmNAC011, 085, 092, 095, 101 and 109 might be promising candidates for improvement of drought tolerance in soybean by biotechnological approaches. PMID:24322442

Walking the interactome for candidate prioritization in exome sequencing studies of Mendelian diseases

DOE PAGES

Smedley, Damian; Kohler, Sebastian; Czeschik, Johanna Christina; ...

2014-07-30

Here, whole-exome sequencing (WES) has opened up previously unheard of possibilities for identifying novel disease genes in Mendelian disorders, only about half of which have been elucidated to date. However, interpretation of WES data remains challenging. As a result, we analyze protein–protein association (PPA) networks to identify candidate genes in the vicinity of genes previously implicated in a disease. The analysis, using a random-walk with restart (RWR) method, is adapted to the setting of WES by developing a composite variant-gene relevance score based on the rarity, location and predicted pathogenicity of variants and the RWR evaluation of genes harboring themore » variants. Benchmarking using known disease variants from 88 disease-gene families reveals that the correct gene is ranked among the top 10 candidates in ≥50% of cases, a figure which we confirmed using a prospective study of disease genes identified in 2012 and PPA data produced before that date. In conclusion, we implement our method in a freely available Web server, ExomeWalker, that displays a ranked list of candidates together with information on PPAs, frequency and predicted pathogenicity of the variants to allow quick and effective searches for candidates that are likely to reward closer investigation.« less

Integration of QTL and bioinformatic tools to identify candidate genes for triglycerides in mice[S

PubMed Central

Leduc, Magalie S.; Hageman, Rachael S.; Verdugo, Ricardo A.; Tsaih, Shirng-Wern; Walsh, Kenneth; Churchill, Gary A.; Paigen, Beverly

2011-01-01

To identify genetic loci influencing lipid levels, we performed quantitative trait loci (QTL) analysis between inbred mouse strains MRL/MpJ and SM/J, measuring triglyceride levels at 8 weeks of age in F2 mice fed a chow diet. We identified one significant QTL on chromosome (Chr) 15 and three suggestive QTL on Chrs 2, 7, and 17. We also carried out microarray analysis on the livers of parental strains of 282 F2 mice and used these data to find cis-regulated expression QTL. We then narrowed the list of candidate genes under significant QTL using a “toolbox” of bioinformatic resources, including haplotype analysis; parental strain comparison for gene expression differences and nonsynonymous coding single nucleotide polymorphisms (SNP); cis-regulated eQTL in livers of F2 mice; correlation between gene expression and phenotype; and conditioning of expression on the phenotype. We suggest Slc25a7 as a candidate gene for the Chr 7 QTL and, based on expression differences, five genes (Polr3 h, Cyp2d22, Cyp2d26, Tspo, and Ttll12) as candidate genes for Chr 15 QTL. This study shows how bioinformatics can be used effectively to reduce candidate gene lists for QTL related to complex traits. PMID:21622629

Walking the interactome for candidate prioritization in exome sequencing studies of Mendelian diseases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smedley, Damian; Kohler, Sebastian; Czeschik, Johanna Christina

Here, whole-exome sequencing (WES) has opened up previously unheard of possibilities for identifying novel disease genes in Mendelian disorders, only about half of which have been elucidated to date. However, interpretation of WES data remains challenging. As a result, we analyze protein–protein association (PPA) networks to identify candidate genes in the vicinity of genes previously implicated in a disease. The analysis, using a random-walk with restart (RWR) method, is adapted to the setting of WES by developing a composite variant-gene relevance score based on the rarity, location and predicted pathogenicity of variants and the RWR evaluation of genes harboring themore » variants. Benchmarking using known disease variants from 88 disease-gene families reveals that the correct gene is ranked among the top 10 candidates in ≥50% of cases, a figure which we confirmed using a prospective study of disease genes identified in 2012 and PPA data produced before that date. In conclusion, we implement our method in a freely available Web server, ExomeWalker, that displays a ranked list of candidates together with information on PPAs, frequency and predicted pathogenicity of the variants to allow quick and effective searches for candidates that are likely to reward closer investigation.« less

Genetic dissection of ozone tolerance in rice (Oryza sativa L.) by a genome-wide association study

PubMed Central

Ueda, Yoshiaki; Frimpong, Felix; Qi, Yitao; Matthus, Elsa; Wu, Linbo; Höller, Stefanie; Kraska, Thorsten; Frei, Michael

2015-01-01

Tropospheric ozone causes various negative effects on plants and affects the yield and quality of agricultural crops. Here, we report a genome-wide association study (GWAS) in rice (Oryza sativa L.) to determine candidate loci associated with ozone tolerance. A diversity panel consisting of 328 accessions representing all subgroups of O. sativa was exposed to ozone stress at 60 nl l–1 for 7h every day throughout the growth season, or to control conditions. Averaged over all genotypes, ozone significantly affected biomass-related traits (plant height –1.0%, shoot dry weight –15.9%, tiller number –8.3%, grain weight –9.3%, total panicle weight –19.7%, single panicle weight –5.5%) and biochemical/physiological traits (symptom formation, SPAD value –4.4%, foliar lignin content +3.4%). A wide range of genotypic variance in response to ozone stress were observed in all phenotypes. Association mapping based on more than 30 000 single-nucleotide polymorphism (SNP) markers yielded 16 significant markers throughout the genome by applying a significance threshold of P<0.0001. Furthermore, by determining linkage disequilibrium blocks associated with significant SNPs, we gained a total of 195 candidate genes for these traits. The following sequence analysis revealed a number of novel polymorphisms in two candidate genes for the formation of visible leaf symptoms, a RING and an EREBP gene, both of which are involved in cell death and stress defence reactions. This study demonstrated substantial natural variation of responses to ozone in rice and the possibility of using GWAS in elucidating the genetic factors underlying ozone tolerance. PMID:25371505

Novel small RNA (sRNA) landscape of the starvation-stress response transcriptome of Salmonella enterica serovar typhimurium.

PubMed

Amin, Shivam V; Roberts, Justin T; Patterson, Dillon G; Coley, Alexander B; Allred, Jonathan A; Denner, Jason M; Johnson, Justin P; Mullen, Genevieve E; O'Neal, Trenton K; Smith, Jason T; Cardin, Sara E; Carr, Hank T; Carr, Stacie L; Cowart, Holly E; DaCosta, David H; Herring, Brendon R; King, Valeria M; Polska, Caroline J; Ward, Erin E; Wise, Alice A; McAllister, Kathleen N; Chevalier, David; Spector, Michael P; Borchert, Glen M

2016-01-01

Small RNAs (sRNAs) are short (∼50-200 nucleotides) noncoding RNAs that regulate cellular activities across bacteria. Salmonella enterica starved of a carbon-energy (C) source experience a host of genetic and physiological changes broadly referred to as the starvation-stress response (SSR). In an attempt to identify novel sRNAs contributing to SSR control, we grew log-phase, 5-h C-starved and 24-h C-starved cultures of the virulent Salmonella enterica subspecies enterica serovar Typhimurium strain SL1344 and comprehensively sequenced their small RNA transcriptomes. Strikingly, after employing a novel strategy for sRNA discovery based on identifying dynamic transcripts arising from "gene-empty" regions, we identify 58 wholly undescribed Salmonella sRNA genes potentially regulating SSR averaging an ∼1,000-fold change in expression between log-phase and C-starved cells. Importantly, the expressions of individual sRNA loci were confirmed by both comprehensive transcriptome analyses and northern blotting of select candidates. Of note, we find 43 candidate sRNAs share significant sequence identity to characterized sRNAs in other bacteria, and ∼70% of our sRNAs likely assume characteristic sRNA structural conformations. In addition, we find 53 of our 58 candidate sRNAs either overlap neighboring mRNA loci or share significant sequence complementarity to mRNAs transcribed elsewhere in the SL1344 genome strongly suggesting they regulate the expression of transcripts via antisense base-pairing. Finally, in addition to this work resulting in the identification of 58 entirely novel Salmonella enterica genes likely participating in the SSR, we also find evidence suggesting that sRNAs are significantly more prevalent than currently appreciated and that Salmonella sRNAs may actually number in the thousands.

Novel small RNA (sRNA) landscape of the starvation-stress response transcriptome of Salmonella enterica serovar typhimurium

PubMed Central

Amin, Shivam V.; Roberts, Justin T.; Patterson, Dillon G.; Coley, Alexander B.; Allred, Jonathan A.; Denner, Jason M.; Johnson, Justin P.; Mullen, Genevieve E.; O'Neal, Trenton K.; Smith, Jason T.; Cardin, Sara E.; Carr, Hank T.; Carr, Stacie L.; Cowart, Holly E.; DaCosta, David H.; Herring, Brendon R.; King, Valeria M.; Polska, Caroline J.; Ward, Erin E.; Wise, Alice A.; McAllister, Kathleen N.; Chevalier, David; Spector, Michael P.; Borchert, Glen M.

2016-01-01

ABSTRACT Small RNAs (sRNAs) are short (∼50–200 nucleotides) noncoding RNAs that regulate cellular activities across bacteria. Salmonella enterica starved of a carbon-energy (C) source experience a host of genetic and physiological changes broadly referred to as the starvation-stress response (SSR). In an attempt to identify novel sRNAs contributing to SSR control, we grew log-phase, 5-h C-starved and 24-h C-starved cultures of the virulent Salmonella enterica subspecies enterica serovar Typhimurium strain SL1344 and comprehensively sequenced their small RNA transcriptomes. Strikingly, after employing a novel strategy for sRNA discovery based on identifying dynamic transcripts arising from “gene-empty” regions, we identify 58 wholly undescribed Salmonella sRNA genes potentially regulating SSR averaging an ∼1,000-fold change in expression between log-phase and C-starved cells. Importantly, the expressions of individual sRNA loci were confirmed by both comprehensive transcriptome analyses and northern blotting of select candidates. Of note, we find 43 candidate sRNAs share significant sequence identity to characterized sRNAs in other bacteria, and ∼70% of our sRNAs likely assume characteristic sRNA structural conformations. In addition, we find 53 of our 58 candidate sRNAs either overlap neighboring mRNA loci or share significant sequence complementarity to mRNAs transcribed elsewhere in the SL1344 genome strongly suggesting they regulate the expression of transcripts via antisense base-pairing. Finally, in addition to this work resulting in the identification of 58 entirely novel Salmonella enterica genes likely participating in the SSR, we also find evidence suggesting that sRNAs are significantly more prevalent than currently appreciated and that Salmonella sRNAs may actually number in the thousands. PMID:26853797

Enhanced motivation to alcohol in transgenic mice expressing human α-synuclein.

PubMed

Rotermund, Carola; Reolon, Gustavo K; Leixner, Sarah; Boden, Cindy; Bilbao, Ainhoa; Kahle, Philipp J

2017-11-01

α-Synuclein (αSYN) is the neuropathological hallmark protein of Parkinson's disease (PD) and related neurodegenerative disorders. Moreover, the gene encoding αSYN (SNCA) is a major genetic contributor to PD. Interestingly, independent genome-wide association studies also identified SNCA as the most important candidate gene for alcoholism. Furthermore, single-nucleotide-polymorphisms have been associated with alcohol-craving behavior and alcohol-craving patients showed augmented αSYN expression in blood. To investigate the effect of αSYN on the addictive properties of chronic alcohol use, we examined consumption, motivation, and seeking responses induced by environmental stimuli and relapse behavior in transgenic mice expressing the human mutant [A30P]αSYN throughout the brain. The primary reinforcing effects of alcohol under operant self-administration conditions were increased, while consumption and the alcohol deprivation effect were not altered in the transgenic mice. The same mice were subjected to immunohistochemical measurements of immediate-early gene inductions in brain regions involved in addiction-related behaviors. Acute ethanol injection enhanced immunostaining for the phosphorylated form of cAMP response element binding protein in both amygdala and nucleus accumbens of αSYN transgenic mice, while in wild-type mice no effect was visible. However, at the same time, levels of cFos remain unchanged in both genotypes. These results provide experimental confirmation of SNCA as a candidate gene for alcoholism in addition to its known link to PD. © 2017 International Society for Neurochemistry.

Prioritization of candidate disease genes by topological similarity between disease and protein diffusion profiles.

PubMed

Zhu, Jie; Qin, Yufang; Liu, Taigang; Wang, Jun; Zheng, Xiaoqi

2013-01-01

Identification of gene-phenotype relationships is a fundamental challenge in human health clinic. Based on the observation that genes causing the same or similar phenotypes tend to correlate with each other in the protein-protein interaction network, a lot of network-based approaches were proposed based on different underlying models. A recent comparative study showed that diffusion-based methods achieve the state-of-the-art predictive performance. In this paper, a new diffusion-based method was proposed to prioritize candidate disease genes. Diffusion profile of a disease was defined as the stationary distribution of candidate genes given a random walk with restart where similarities between phenotypes are incorporated. Then, candidate disease genes are prioritized by comparing their diffusion profiles with that of the disease. Finally, the effectiveness of our method was demonstrated through the leave-one-out cross-validation against control genes from artificial linkage intervals and randomly chosen genes. Comparative study showed that our method achieves improved performance compared to some classical diffusion-based methods. To further illustrate our method, we used our algorithm to predict new causing genes of 16 multifactorial diseases including Prostate cancer and Alzheimer's disease, and the top predictions were in good consistent with literature reports. Our study indicates that integration of multiple information sources, especially the phenotype similarity profile data, and introduction of global similarity measure between disease and gene diffusion profiles are helpful for prioritizing candidate disease genes. Programs and data are available upon request.

Gene Variations in the Protein C and Fibrinolytic Pathway: Relevance for Severity and Outcome in Pediatric Sepsis.

PubMed

Boeddha, Navin P; Emonts, Marieke; Cnossen, Marjon H; de Maat, Moniek P; Leebeek, Frank W; Driessen, Gertjan J; Hazelzet, Jan A

2017-02-01

The host response to infection involves complex interplays between inflammation, coagulation, and fibrinolysis. Deregulation of hemostasis and fibrinolysis are major causes of critical illness and important determinants of outcome in severe sepsis. The hemostatic responses to infection vary widely between individuals, and are in part explained by polymorphisms in genes responsible for the protein C and fibrinolytic pathway. This review gives an overview of genetic polymorphisms in the protein C and fibrinolytic pathway associated with susceptibility and severity of pediatric sepsis. In addition, genetic polymorphisms associated with adult sepsis and other pediatric thromboembolic disorders are discussed, as these polymorphisms might be candidates for future molecular genetic research in pediatric sepsis. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

In Silico Gene Prioritization by Integrating Multiple Data Sources

PubMed Central

Zhou, Yingyao; Shields, Robert; Chanda, Sumit K.; Elston, Robert C.; Li, Jing

2011-01-01

Identifying disease genes is crucial to the understanding of disease pathogenesis, and to the improvement of disease diagnosis and treatment. In recent years, many researchers have proposed approaches to prioritize candidate genes by considering the relationship of candidate genes and existing known disease genes, reflected in other data sources. In this paper, we propose an expandable framework for gene prioritization that can integrate multiple heterogeneous data sources by taking advantage of a unified graphic representation. Gene-gene relationships and gene-disease relationships are then defined based on the overall topology of each network using a diffusion kernel measure. These relationship measures are in turn normalized to derive an overall measure across all networks, which is utilized to rank all candidate genes. Based on the informativeness of available data sources with respect to each specific disease, we also propose an adaptive threshold score to select a small subset of candidate genes for further validation studies. We performed large scale cross-validation analysis on 110 disease families using three data sources. Results have shown that our approach consistently outperforms other two state of the art programs. A case study using Parkinson disease (PD) has identified four candidate genes (UBB, SEPT5, GPR37 and TH) that ranked higher than our adaptive threshold, all of which are involved in the PD pathway. In particular, a very recent study has observed a deletion of TH in a patient with PD, which supports the importance of the TH gene in PD pathogenesis. A web tool has been implemented to assist scientists in their genetic studies. PMID:21731658

Genetic Factors of Autoimmune Thyroid Diseases in Japanese

PubMed Central

Ban, Yoshiyuki

2012-01-01

Autoimmune thyroid diseases (AITDs), including Graves' disease (GD) and Hashimoto's thyroiditis (HT), are caused by immune response to self-thyroid antigens and affect approximately 2–5% of the general population. Genetic susceptibility in combination with external factors, such as smoking, viral/bacterial infection, and chemicals, is believed to initiate the autoimmune response against thyroid antigens. Abundant epidemiological data, including family and twin studies, point to a strong genetic influence on the development of AITDs. Various techniques have been employed to identify genes contributing to the etiology of AITDs, including candidate gene analysis and whole genome screening. These studies have enabled the identification of several loci (genetic regions) that are linked to AITDs, and, in some of these loci, putative AITD susceptibility genes have been identified. Some of these genes/loci are unique to GD and HT and some are common to both diseases, indicating that there is a shared genetic susceptibility to GD and HT. Known AITD-susceptibility genes are classified into three groups: HLA genes, non-HLA immune-regulatory genes (e.g., CTLA-4, PTPN22, and CD40), and thyroid-specific genes (e.g., TSHR and Tg). In this paper, we will summarize the latest findings on AITD susceptibility genes in Japanese. PMID:22242199

The Genetic Basis for Variation in Sensitivity to Lead Toxicity in Drosophila melanogaster.

PubMed

Zhou, Shanshan; Morozova, Tatiana V; Hussain, Yasmeen N; Luoma, Sarah E; McCoy, Lenovia; Yamamoto, Akihiko; Mackay, Trudy F C; Anholt, Robert R H

2016-07-01

Lead toxicity presents a worldwide health problem, especially due to its adverse effects on cognitive development in children. However, identifying genes that give rise to individual variation in susceptibility to lead toxicity is challenging in human populations. Our goal was to use Drosophila melanogaster to identify evolutionarily conserved candidate genes associated with individual variation in susceptibility to lead exposure. To identify candidate genes associated with variation in susceptibility to lead toxicity, we measured effects of lead exposure on development time, viability and adult activity in the Drosophila melanogaster Genetic Reference Panel (DGRP) and performed genome-wide association analyses to identify candidate genes. We used mutants to assess functional causality of candidate genes and constructed a genetic network associated with variation in sensitivity to lead exposure, on which we could superimpose human orthologs. We found substantial heritabilities for all three traits and identified candidate genes associated with variation in susceptibility to lead exposure for each phenotype. The genetic architectures that determine variation in sensitivity to lead exposure are highly polygenic. Gene ontology and network analyses showed enrichment of genes associated with early development and function of the nervous system. Drosophila melanogaster presents an advantageous model to study the genetic underpinnings of variation in susceptibility to lead toxicity. Evolutionary conservation of cellular pathways that respond to toxic exposure allows predictions regarding orthologous genes and pathways across phyla. Thus, studies in the D. melanogaster model system can identify candidate susceptibility genes to guide subsequent studies in human populations. Zhou S, Morozova TV, Hussain YN, Luoma SE, McCoy L, Yamamoto A, Mackay TF, Anholt RR. 2016. The genetic basis for variation in sensitivity to lead toxicity in Drosophila melanogaster. Environ Health Perspect 124:1062-1070; http://dx.doi.org/10.1289/ehp.1510513.

Replication of type 2 diabetes candidate genes variations in three geographically unrelated Indian population groups.

PubMed

Ali, Shafat; Chopra, Rupali; Manvati, Siddharth; Singh, Yoginder Pal; Kaul, Nabodita; Behura, Anita; Mahajan, Ankit; Sehajpal, Prabodh; Gupta, Subash; Dhar, Manoj K; Chainy, Gagan B N; Bhanwer, Amarjit S; Sharma, Swarkar; Bamezai, Rameshwar N K

2013-01-01

Type 2 diabetes (T2D) is a syndrome of multiple metabolic disorders and is genetically heterogeneous. India comprises one of the largest global populations with highest number of reported type 2 diabetes cases. However, limited information about T2D associated loci is available for Indian populations. It is, therefore, pertinent to evaluate the previously associated candidates as well as identify novel genetic variations in Indian populations to understand the extent of genetic heterogeneity. We chose to do a cost effective high-throughput mass-array genotyping and studied the candidate gene variations associated with T2D in literature. In this case-control candidate genes association study, 91 SNPs from 55 candidate genes have been analyzed in three geographically independent population groups from India. We report the genetic variants in five candidate genes: TCF7L2, HHEX, ENPP1, IDE and FTO, are significantly associated (after Bonferroni correction, p<5.5E-04) with T2D susceptibility in combined population. Interestingly, SNP rs7903146 of the TCF7L2 gene passed the genome wide significance threshold (combined P value = 2.05E-08) in the studied populations. We also observed the association of rs7903146 with blood glucose (fasting and postprandial) levels, supporting the role of TCF7L2 gene in blood glucose homeostasis. Further, we noted that the moderate risk provided by the independently associated loci in combined population with Odds Ratio (OR)<1.38 increased to OR = 2.44, (95%CI = 1.67-3.59) when the risk providing genotypes of TCF7L2, HHEX, ENPP1 and FTO genes were combined, suggesting the importance of gene-gene interactions evaluation in complex disorders like T2D.

Replication of Type 2 Diabetes Candidate Genes Variations in Three Geographically Unrelated Indian Population Groups

PubMed Central

Ali, Shafat; Chopra, Rupali; Manvati, Siddharth; Mahajan, Ankit; Sehajpal, Prabodh; Gupta, Subash; Dhar, Manoj K.; Chainy, Gagan B. N.; Bhanwer, Amarjit S.; Sharma, Swarkar; Bamezai, Rameshwar N. K.

2013-01-01

Type 2 diabetes (T2D) is a syndrome of multiple metabolic disorders and is genetically heterogeneous. India comprises one of the largest global populations with highest number of reported type 2 diabetes cases. However, limited information about T2D associated loci is available for Indian populations. It is, therefore, pertinent to evaluate the previously associated candidates as well as identify novel genetic variations in Indian populations to understand the extent of genetic heterogeneity. We chose to do a cost effective high-throughput mass-array genotyping and studied the candidate gene variations associated with T2D in literature. In this case-control candidate genes association study, 91 SNPs from 55 candidate genes have been analyzed in three geographically independent population groups from India. We report the genetic variants in five candidate genes: TCF7L2, HHEX, ENPP1, IDE and FTO, are significantly associated (after Bonferroni correction, p<5.5E−04) with T2D susceptibility in combined population. Interestingly, SNP rs7903146 of the TCF7L2 gene passed the genome wide significance threshold (combined P value = 2.05E−08) in the studied populations. We also observed the association of rs7903146 with blood glucose (fasting and postprandial) levels, supporting the role of TCF7L2 gene in blood glucose homeostasis. Further, we noted that the moderate risk provided by the independently associated loci in combined population with Odds Ratio (OR)<1.38 increased to OR = 2.44, (95%CI = 1.67–3.59) when the risk providing genotypes of TCF7L2, HHEX, ENPP1 and FTO genes were combined, suggesting the importance of gene-gene interactions evaluation in complex disorders like T2D. PMID:23527042

Genetic basis of interindividual susceptibility to cancer cachexia: selection of potential candidate gene polymorphisms for association studies.

PubMed

Johns, N; Tan, B H; MacMillan, M; Solheim, T S; Ross, J A; Baracos, V E; Damaraju, S; Fearon, K C H

2014-12-01

Cancer cachexia is a complex and multifactorial disease. Evolving definitions highlight the fact that a diverse range of biological processes contribute to cancer cachexia. Part of the variation in who will and who will not develop cancer cachexia may be genetically determined. As new definitions, classifications and biological targets continue to evolve, there is a need for reappraisal of the literature for future candidate association studies. This review summarizes genes identified or implicated as well as putative candidate genes contributing to cachexia, identified through diverse technology platforms and model systems to further guide association studies. A systematic search covering 1986-2012 was performed for potential candidate genes / genetic polymorphisms relating to cancer cachexia. All candidate genes were reviewed for functional polymorphisms or clinically significant polymorphisms associated with cachexia using the OMIM and GeneRIF databases. Pathway analysis software was used to reveal possible network associations between genes. Functionality of SNPs/genes was explored based on published literature, algorithms for detecting putative deleterious SNPs and interrogating the database for expression of quantitative trait loci (eQTLs). A total of 154 genes associated with cancer cachexia were identified and explored for functional polymorphisms. Of these 154 genes, 119 had a combined total of 281 polymorphisms with functional and/or clinical significance in terms of cachexia associated with them. Of these, 80 polymorphisms (in 51 genes) were replicated in more than one study with 24 polymorphisms found to influence two or more hallmarks of cachexia (i.e., inflammation, loss of fat mass and/or lean mass and reduced survival). Selection of candidate genes and polymorphisms is a key element of multigene study design. The present study provides a contemporary basis to select genes and/or polymorphisms for further association studies in cancer cachexia, and to develop their potential as susceptibility biomarkers of cachexia.

Interaction with extracellular matrix proteins influences Lsh/Ity/Bcg (candidate Nramp) gene regulation of macrophage priming/activation for tumour necrosis factor-alpha and nitrite release.

PubMed

Formica, S; Roach, T I; Blackwell, J M

1994-05-01

The murine resistance gene Lsh/Ity/Bcg regulates activation of macrophages for tumour necrosis factor-alpha (TNF-alpha)-dependent production of nitric oxide mediating antimicrobial activity against Leishmania, Salmonella and Mycobacterium. As Lsh is differentially expressed in macrophages from different tissue sites, experiments were performed to determine whether interaction with extracellular matrix (ECM) proteins would influence the macrophage TNF-alpha response. Plating of bone marrow-derived macrophages onto purified fibrinogen or fibronectin-rich L929 cell-derived matrices, but not onto mannan, was itself sufficient to stimulate TNF-alpha release, with significantly higher levels released from congenic B10.L-Lshr compared to C57BL/10ScSn (Lshs) macrophages. Only macrophages plated onto fibrinogen also released measurable levels of nitrites, again higher in Lshr compared to Lshs macrophages. Addition of interferon-gamma (IFN-gamma), but not bacterial lipopolysaccharide or mycobacterial lipoarabinomannan, as a second signal enhanced the TNF-alpha and nitrite responses of macrophages plated onto fibrinogen, particularly in the Lshr macrophages. Interaction with fibrinogen and fibronectin also primed macrophages for an enhanced TNF-alpha response to leishmanial parasites, but this was only translated into enhanced nitrite responses in the presence of IFN-gamma. In these experiments, Lshr macrophages remained superior in their TNF-alpha responses throughout, but to a degree which reflected the magnitude of the difference observed on ECM alone. Hence, the specificity for the enhanced TNF-alpha responses of Lshr macrophages lay in their interaction with fibrinogen and fibronectin ECM, while a differential nitrite response was only observed with fibrinogen and/or IFN-gamma. The results are discussed in relation to the possible function of the recently cloned candidate gene Nramp, which has structural identity to eukaryote transporters and an N-terminal cytoplasmic proline/serine-rich putative SH3 binding domain.

Candidate Gene Identification of Feed Efficiency and Coat Color Traits in a C57BL/6J × Kunming F2 Mice Population Using Genome-Wide Association Study.

PubMed

Miao, Yuanxin; Soudy, Fathia; Xu, Zhong; Liao, Mingxing; Zhao, Shuhong; Li, Xinyun

2017-01-01

Feed efficiency (FE) is a very important trait in livestock industry. Identification of the candidate genes could be of benefit for the improvement of FE trait. Mouse is used as the model for many studies in mammals. In this study, the candidate genes related to FE and coat color were identified using C57BL/6J (C57) × Kunming (KM) F2 mouse population. GWAS results showed that 61 and 2 SNPs were genome-wise suggestive significantly associated with feed conversion ratio (FCR) and feed intake (FI) traits, respectively. Moreover, the Erbin, Msrb2, Ptf1a, and Fgf10 were considered as the candidate genes of FE. The Lpl was considered as the candidate gene of FI. Further, the coat color trait was studied. KM mice are white and C57 ones are black. The GWAS results showed that the most significant SNP was located at chromosome 7, and the closely linked gene was Tyr. Therefore, our study offered useful target genes related to FE in mice; these genes may play similar roles in FE of livestock. Also, we identified the major gene of coat color in mice, which would be useful for better understanding of natural mutation of the coat color in mice.

The role of HPV RNA transcription, immune response-related gene expression and disruptive TP53 mutations in diagnostic and prognostic profiling of head and neck cancer.

PubMed

Wichmann, Gunnar; Rosolowski, Maciej; Krohn, Knut; Kreuz, Markus; Boehm, Andreas; Reiche, Anett; Scharrer, Ulrike; Halama, Dirk; Bertolini, Julia; Bauer, Ulrike; Holzinger, Dana; Pawlita, Michael; Hess, Jochen; Engel, Christoph; Hasenclever, Dirk; Scholz, Markus; Ahnert, Peter; Kirsten, Holger; Hemprich, Alexander; Wittekind, Christian; Herbarth, Olf; Horn, Friedemann; Dietz, Andreas; Loeffler, Markus

2015-12-15

Stratification of head and neck squamous cell carcinomas (HNSCC) based on HPV16 DNA and RNA status, gene expression patterns, and mutated candidate genes may facilitate patient treatment decision. We characterize head and neck squamous cell carcinomas (HNSCC) with different HPV16 DNA and RNA (E6*I) status from 290 consecutively recruited patients by gene expression profiling and targeted sequencing of 50 genes. We show that tumors with transcriptionally inactive HPV16 (DNA+ RNA-) are similar to HPV-negative (DNA-) tumors regarding gene expression and frequency of TP53 mutations (47%, 8/17 and 43%, 72/167, respectively). We also find that an immune response-related gene expression cluster is associated with lymph node metastasis, independent of HPV16 status and that disruptive TP53 mutations are associated with lymph node metastasis in HPV16 DNA- tumors. We validate each of these associations in another large data set. Four gene expression clusters which we identify differ moderately but significantly in overall survival. Our findings underscore the importance of measuring the HPV16 RNA (E6*I) and TP53-mutation status for patient stratification and identify associations of an immune response-related gene expression cluster and TP53 mutations with lymph node metastasis in HNSCC. © 2015 UICC.

Global Gene-Expression Analysis to Identify Differentially Expressed Genes Critical for the Heat Stress Response in Brassica rapa

PubMed Central

Dong, Xiangshu; Yi, Hankuil; Lee, Jeongyeo; Nou, Ill-Sup; Han, Ching-Tack; Hur, Yoonkang

2015-01-01

Genome-wide dissection of the heat stress response (HSR) is necessary to overcome problems in crop production caused by global warming. To identify HSR genes, we profiled gene expression in two Chinese cabbage inbred lines with different thermotolerances, Chiifu and Kenshin. Many genes exhibited >2-fold changes in expression upon exposure to 0.5– 4 h at 45°C (high temperature, HT): 5.2% (2,142 genes) in Chiifu and 3.7% (1,535 genes) in Kenshin. The most enriched GO (Gene Ontology) items included ‘response to heat’, ‘response to reactive oxygen species (ROS)’, ‘response to temperature stimulus’, ‘response to abiotic stimulus’, and ‘MAPKKK cascade’. In both lines, the genes most highly induced by HT encoded small heat shock proteins (Hsps) and heat shock factor (Hsf)-like proteins such as HsfB2A (Bra029292), whereas high-molecular weight Hsps were constitutively expressed. Other upstream HSR components were also up-regulated: ROS-scavenging genes like glutathione peroxidase 2 (BrGPX2, Bra022853), protein kinases, and phosphatases. Among heat stress (HS) marker genes in Arabidopsis, only exportin 1A (XPO1A) (Bra008580, Bra006382) can be applied to B. rapa for basal thermotolerance (BT) and short-term acquired thermotolerance (SAT) gene. CYP707A3 (Bra025083, Bra021965), which is involved in the dehydration response in Arabidopsis, was associated with membrane leakage in both lines following HS. Although many transcription factors (TF) genes, including DREB2A (Bra005852), were involved in HS tolerance in both lines, Bra024224 (MYB41) and Bra021735 (a bZIP/AIR1 [Anthocyanin-Impaired-Response-1]) were specific to Kenshin. Several candidate TFs involved in thermotolerance were confirmed as HSR genes by real-time PCR, and these assignments were further supported by promoter analysis. Although some of our findings are similar to those obtained using other plant species, clear differences in Brassica rapa reveal a distinct HSR in this species. Our data could also provide a springboard for developing molecular markers of HS and for engineering HS tolerant B. rapa. PMID:26102990

Therapeutics of Ebola hemorrhagic fever: whole-genome transcriptional analysis of successful disease mitigation.

PubMed

Yen, Judy Y; Garamszegi, Sara; Geisbert, Joan B; Rubins, Kathleen H; Geisbert, Thomas W; Honko, Anna; Xia, Yu; Connor, John H; Hensley, Lisa E

2011-11-01

The mechanisms of Ebola (EBOV) pathogenesis are only partially understood, but the dysregulation of normal host immune responses (including destruction of lymphocytes, increases in circulating cytokine levels, and development of coagulation abnormalities) is thought to play a major role. Accumulating evidence suggests that much of the observed pathology is not the direct result of virus-induced structural damage but rather is due to the release of soluble immune mediators from EBOV-infected cells. It is therefore essential to understand how the candidate therapeutic may be interrupting the disease process and/or targeting the infectious agent. To identify genetic signatures that are correlates of protection, we used a DNA microarray-based approach to compare the host genome-wide responses of EBOV-infected nonhuman primates (NHPs) responding to candidate therapeutics. We observed that, although the overall circulating immune response was similar in the presence and absence of coagulation inhibitors, surviving NHPs clustered together. Noticeable differences in coagulation-associated genes appeared to correlate with survival, which revealed a subset of distinctly differentially expressed genes, including chemokine ligand 8 (CCL8/MCP-2), that may provide possible targets for early-stage diagnostics or future therapeutics. These analyses will assist us in understanding the pathogenic mechanisms of EBOV infection and in identifying improved therapeutic strategies.

Poultry Allele-Specific Expression (ASE) of CD4+ T Cells in Response to Marek’s Disease Virus Infection

USDA-ARS?s Scientific Manuscript database

Marek’s disease (MD) is a T cell lymphoma disease of poultry induced by Marek’s disease virus (MDV), a highly oncogenic alphaherpesvirus. To identify high-confidence candidate genes of MD genetic resistance, transcriptomic data in CD4+ T cells were obtained from MDV infected and non-infected groups ...

Expression Characterization of Stress Genes Under High and Low Temperature Stresses in the Pacific Oyster, Crassostrea gigas.

PubMed

Zhu, Qihui; Zhang, Linlin; Li, Li; Que, Huayong; Zhang, Guofan

2016-04-01

As a characteristic sessile inhabitant of the intertidal zone, the Pacific oyster Crassostrea gigas occupies one of the most physically stressful environments on earth. With high exposure to terrestrial conditions, oysters must tolerate broad fluctuations in temperature range. However, oysters' cellular and molecular responses to temperature stresses have not been fully characterized. Here, we analyzed oyster transcriptome data under high and low temperatures. We also identified over 30 key temperature stress-responsive candidate genes, which encoded stress proteins such as heat shock proteins and apoptosis-associated proteins. The expression characterization of these genes under short-term cold and hot environments (5 and 35 °C) and long-term cold environments (5 °C) was detected by quantitative real-time PCR. Most of these genes reached expression peaks during the recovery stage after 24 h of heat stress, and these genes were greatly induced around day 3 in long-term cold stress while responded little to short-term cold stress. In addition, in the second heat stress after 2 days of recovery, oysters showed milder expression in these genes and a lower mortality rate, which indicated the existence of plasticity in the oyster's response to heat stress. We confirmed that homeostatic flexibility and anti-apoptosis might be crucial centers of temperature stress responses in oysters. Furthermore, we analyzed stress gene families in 11 different species and found that the linage-specific expansion of stress genes might be implicated in adaptive evolution. These results indicated that both plasticity and evolution played an important role in the stress response adaptation of oysters.

Gene mapping study for constitutive skin color in an isolated Mongolian population.

PubMed

Paik, Seung Hwan; Kim, Hyun-Jin; Son, Ho-Young; Lee, Seungbok; Im, Sun-Wha; Ju, Young Seok; Yeon, Je Ho; Jo, Seong Jin; Eun, Hee Chul; Seo, Jeong-Sun; Kwon, Oh Sang; Kim, Jong-Il

2012-03-31

To elucidate the genes responsible for constitutive human skin color, we measured the extent of skin pigmentation in the buttock, representative of lifelong non-sun-exposed skin, and conducted a gene mapping study on skin color in an isolated Mongolian population composed of 344 individuals from 59 families who lived in Dashbalbar, Mongolia. The heritability of constitutive skin color was 0.82, indicating significant genetic association on this trait. Through the linkage analysis using 1,039 short tandem repeat (STR) microsatellite markers, we identified a novel genomic region regulating constitutive skin color on 11q24.2 with an logarithm of odds (LOD) score of 3.39. In addition, we also found other candidate regions on 17q23.2, 6q25.1, and 13q33.2 (LOD ≥ 2). Family-based association tests on these regions with suggestive linkage peaks revealed ten and two significant single nucleotide polymorphisms (SNPs) on the linkage regions of chromosome 11 and 17, respectively. We were able to discover four possible candidate genes that would be implicated to regulate human skin color: ETS1, UBASH3B, ASAM, and CLTC.

Gene mapping study for constitutive skin color in an isolated Mongolian population

PubMed Central

Paik, Seung Hwan; Kim, Hyun-Jin; Son, Ho-Young; Lee, Seungbok; Im, Sun-Wha; Ju, Young Seok; Yeon, Je Ho; Jo, Seong Jin; Eun, Hee Chul; Seo, Jeong-Sun

2012-01-01

To elucidate the genes responsible for constitutive human skin color, we measured the extent of skin pigmentation in the buttock, representative of lifelong non-sun-exposed skin, and conducted a gene mapping study on skin color in an isolated Mongolian population composed of 344 individuals from 59 families who lived in Dashbalbar, Mongolia. The heritability of constitutive skin color was 0.82, indicating significant genetic association on this trait. Through the linkage analysis using 1,039 short tandem repeat (STR) microsatellite markers, we identified a novel genomic region regulating constitutive skin color on 11q24.2 with an logarithm of odds (LOD) score of 3.39. In addition, we also found other candidate regions on 17q23.2, 6q25.1, and 13q33.2 (LOD ≥ 2). Family-based association tests on these regions with suggestive linkage peaks revealed ten and two significant single nucleotide polymorphisms (SNPs) on the linkage regions of chromosome 11 and 17, respectively. We were able to discover four possible candidate genes that would be implicated to regulate human skin color: ETS1, UBASH3B, ASAM, and CLTC. PMID:22198297

Differential Gene Expression During Compensatory Sprouting of Dendrites in the Auditory System of the Cricket Gryllus bimaculatus

PubMed Central

Horch, Hadley W.; McCarthy, Sarah S.; Johansen, Susan L.; Harris, James M.

2013-01-01

Neurons that lose their pre-synaptic partners due to injury usually retract or die. However, when the auditory interneurons of the cricket are denervated, dendrites respond by growing across the midline and forming novel synapses with the opposite auditory afferents. Suppression subtractive hybridization was used to detect transcriptional changes three days after denervation. This is a stage at which we demonstrate robust compensatory dendritic sprouting. While 49 unique candidates were downregulated, no sufficiently upregulated candidates were identified at this time point. Several candidates identified in this study are known to influence the translation and degradation of proteins in other systems. The potential role of these factors in the compensatory sprouting of cricket auditory interneurons in response to denervation is discussed. PMID:19453768

Defining the role of the MADS-box gene, Zea agamous like1, in maize domestication

USDA-ARS?s Scientific Manuscript database

Genomic scans for genes that show the signature of past selection have been widely applied to a number of species and have identified a large number of selection candidate genes. In cultivated maize (Zea mays ssp. mays) selection scans have identified several hundred candidate domestication genes...

The genetic overlap between mood disorders and cardiometabolic diseases: a systematic review of genome wide and candidate gene studies

PubMed Central

Amare, A T; Schubert, K O; Klingler-Hoffmann, M; Cohen-Woods, S; Baune, B T

2017-01-01

Meta-analyses of genome-wide association studies (meta-GWASs) and candidate gene studies have identified genetic variants associated with cardiovascular diseases, metabolic diseases and mood disorders. Although previous efforts were successful for individual disease conditions (single disease), limited information exists on shared genetic risk between these disorders. This article presents a detailed review and analysis of cardiometabolic diseases risk (CMD-R) genes that are also associated with mood disorders. First, we reviewed meta-GWASs published until January 2016, for the diseases ‘type 2 diabetes, coronary artery disease, hypertension’ and/or for the risk factors ‘blood pressure, obesity, plasma lipid levels, insulin and glucose related traits’. We then searched the literature for published associations of these CMD-R genes with mood disorders. We considered studies that reported a significant association of at least one of the CMD-R genes and ‘depression’ or ‘depressive disorder’ or ‘depressive symptoms’ or ‘bipolar disorder’ or ‘lithium treatment response in bipolar disorder’, or ‘serotonin reuptake inhibitors treatment response in major depression’. Our review revealed 24 potential pleiotropic genes that are likely to be shared between mood disorders and CMD-Rs. These genes include MTHFR, CACNA1D, CACNB2, GNAS, ADRB1, NCAN, REST, FTO, POMC, BDNF, CREB, ITIH4, LEP, GSK3B, SLC18A1, TLR4, PPP1R1B, APOE, CRY2, HTR1A, ADRA2A, TCF7L2, MTNR1B and IGF1. A pathway analysis of these genes revealed significant pathways: corticotrophin-releasing hormone signaling, AMPK signaling, cAMP-mediated or G-protein coupled receptor signaling, axonal guidance signaling, serotonin or dopamine receptors signaling, dopamine-DARPP32 feedback in cAMP signaling, circadian rhythm signaling and leptin signaling. Our review provides insights into the shared biological mechanisms of mood disorders and cardiometabolic diseases. PMID:28117839

An eQTL Analysis of Partial Resistance to Puccinia hordei in Barley

PubMed Central

Chen, Xinwei; Hackett, Christine A.; Niks, Rients E.; Hedley, Peter E.; Booth, Clare; Druka, Arnis; Marcel, Thierry C.; Vels, Anton; Bayer, Micha; Milne, Iain; Morris, Jenny; Ramsay, Luke; Marshall, David; Cardle, Linda; Waugh, Robbie

2010-01-01

Background Genetic resistance to barley leaf rust caused by Puccinia hordei involves both R genes and quantitative trait loci. The R genes provide higher but less durable resistance than the quantitative trait loci. Consequently, exploring quantitative or partial resistance has become a favorable alternative for controlling disease. Four quantitative trait loci for partial resistance to leaf rust have been identified in the doubled haploid Steptoe (St)/Morex (Mx) mapping population. Further investigations are required to study the molecular mechanisms underpinning partial resistance and ultimately identify the causal genes. Methodology/Principal Findings We explored partial resistance to barley leaf rust using a genetical genomics approach. We recorded RNA transcript abundance corresponding to each probe on a 15K Agilent custom barley microarray in seedlings from St and Mx and 144 doubled haploid lines of the St/Mx population. A total of 1154 and 1037 genes were, respectively, identified as being P. hordei-responsive among the St and Mx and differentially expressed between P. hordei-infected St and Mx. Normalized ratios from 72 distant-pair hybridisations were used to map the genetic determinants of variation in transcript abundance by expression quantitative trait locus (eQTL) mapping generating 15685 eQTL from 9557 genes. Correlation analysis identified 128 genes that were correlated with resistance, of which 89 had eQTL co-locating with the phenotypic quantitative trait loci (pQTL). Transcript abundance in the parents and conservation of synteny with rice allowed us to prioritise six genes as candidates for Rphq11, the pQTL of largest effect, and highlight one, a phospholipid hydroperoxide glutathione peroxidase (HvPHGPx) for detailed analysis. Conclusions/Significance The eQTL approach yielded information that led to the identification of strong candidate genes underlying pQTL for resistance to leaf rust in barley and on the general pathogen response pathway. The dataset will facilitate a systems appraisal of this host-pathogen interaction and, potentially, for other traits measured in this population. PMID:20066049

Genetic and Proteomic Interrogation of Lower Confidence Candidate Genes Reveals Signaling Networks in beta-Catenin-Active Cancers | Office of Cancer Genomics

Cancer.gov

Genome-scale expression studies and comprehensive loss-of-function genetic screens have focused almost exclusively on the highest confidence candidate genes. Here, we describe a strategy for characterizing the lower confidence candidates identified by such approaches.

Identification of a Novel De Novo Heterozygous Deletion in the SOX10 Gene in Waardenburg Syndrome Type II Using Next-Generation Sequencing.

PubMed

Li, Haonan; Jin, Peng; Hao, Qian; Zhu, Wei; Chen, Xia; Wang, Ping

2017-11-01

Waardenburg syndrome (WS) is a rare autosomal dominant disorder associated with pigmentation abnormalities and sensorineural hearing loss. In this study, we investigated the genetic cause of WSII in a patient and evaluated the reliability of the targeted next-generation exome sequencing method for the genetic diagnosis of WS. Clinical evaluations were conducted on the patient and targeted next-generation sequencing (NGS) was used to identify the candidate genes responsible for WSII. Multiplex ligation-dependent probe amplification (MLPA) and real-time quantitative polymerase chain reaction (qPCR) were performed to confirm the targeted NGS results. Targeted NGS detected the entire deletion of the coding sequence (CDS) of the SOX10 gene in the WSII patient. MLPA results indicated that all exons of the SOX10 heterozygous deletion were detected; no aberrant copy number in the PAX3 and microphthalmia-associated transcription factor (MITF) genes was found. Real-time qPCR results identified the mutation as a de novo heterozygous deletion. This is the first report of using a targeted NGS method for WS candidate gene sequencing; its accuracy was verified by using the MLPA and qPCR methods. Our research provides a valuable method for the genetic diagnosis of WS.

Knockdown of Dyslexia-Gene Dcdc2 Interferes with Speech Sound Discrimination in Continuous Streams.

PubMed

Centanni, Tracy Michelle; Booker, Anne B; Chen, Fuyi; Sloan, Andrew M; Carraway, Ryan S; Rennaker, Robert L; LoTurco, Joseph J; Kilgard, Michael P

2016-04-27

Dyslexia is the most common developmental language disorder and is marked by deficits in reading and phonological awareness. One theory of dyslexia suggests that the phonological awareness deficit is due to abnormal auditory processing of speech sounds. Variants in DCDC2 and several other neural migration genes are associated with dyslexia and may contribute to auditory processing deficits. In the current study, we tested the hypothesis that RNAi suppression of Dcdc2 in rats causes abnormal cortical responses to sound and impaired speech sound discrimination. In the current study, rats were subjected in utero to RNA interference targeting of the gene Dcdc2 or a scrambled sequence. Primary auditory cortex (A1) responses were acquired from 11 rats (5 with Dcdc2 RNAi; DC-) before any behavioral training. A separate group of 8 rats (3 DC-) were trained on a variety of speech sound discrimination tasks, and auditory cortex responses were acquired following training. Dcdc2 RNAi nearly eliminated the ability of rats to identify specific speech sounds from a continuous train of speech sounds but did not impair performance during discrimination of isolated speech sounds. The neural responses to speech sounds in A1 were not degraded as a function of presentation rate before training. These results suggest that A1 is not directly involved in the impaired speech discrimination caused by Dcdc2 RNAi. This result contrasts earlier results using Kiaa0319 RNAi and suggests that different dyslexia genes may cause different deficits in the speech processing circuitry, which may explain differential responses to therapy. Although dyslexia is diagnosed through reading difficulty, there is a great deal of variation in the phenotypes of these individuals. The underlying neural and genetic mechanisms causing these differences are still widely debated. In the current study, we demonstrate that suppression of a candidate-dyslexia gene causes deficits on tasks of rapid stimulus processing. These animals also exhibited abnormal neural plasticity after training, which may be a mechanism for why some children with dyslexia do not respond to intervention. These results are in stark contrast to our previous work with a different candidate gene, which caused a different set of deficits. Our results shed some light on possible neural and genetic mechanisms causing heterogeneity in the dyslexic population. Copyright © 2016 the authors 0270-6474/16/364895-12$15.00/0.

Transcriptome Analysis of the Melon-Fusarium oxysporum f. sp. melonis Race 1.2 Pathosystem in Susceptible and Resistant Plants

PubMed Central

Silvia Sebastiani, M.; Bagnaresi, Paolo; Sestili, Sara; Biselli, Chiara; Zechini, Antonella; Orrù, Luigi; Cattivelli, Luigi; Ficcadenti, Nadia

2017-01-01

Fusarium oxysporum f. sp. melonis Snyd. & Hans race 1.2 (FOM1.2) is the most virulent and yield-limiting pathogen of melon (Cucumis melo L.) worldwide. Current information suggest that the resistance to race 1.2 is controlled by multiple recessive genes and strongly affected by the environment. RNA-Seq analysis was used to identify candidate resistance genes and to dissect the early molecular processes deployed during melon-FOM1.2 interaction in the resistant doubled haploid line NAD and in the susceptible genotype Charentais-T (CHT) at 24 and 48 h post-inoculation (hpi). The transcriptome analysis of the NAD-FOM1.2 interaction identified 2,461 and 821 differentially expressed genes (DEGs) at 24 hpi and at 48 hpi, respectively, while in susceptible combination CHT-FOM1.2, 882 and 2,237 DEGs were recovered at 24 hpi and at 48 hpi, respectively. The overall expression profile suggests a prompt activation of the defense responses in NAD due to its basal defense-related machinery that allows an early pathogen recognition. Gene Ontology (GO) enrichment analyses revealed a total of 57 GO terms shared by both genotypes and consistent with response to fungal infection. GO classes named “chitinase activity,” “cellulase activity,” “defense response, incompatible interaction,” “auxin polar transport” emerged as major factors of resistance to FOM1.2. The data indicated that NAD reacts to FOM1.2 with a fine regulation of Ca2+-mediated signaling pathways, cell wall reorganization, and hormone crosstalk (jasmonate and ethylene, auxin and abscissic acid). Several unannotated transcripts were recovered providing a basis for a further exploration of the melon resistance genes. DEGs belonging to the FOM1.2 genome were also detected in planta as a resource for the identification of potential pathogenicity factors. This work provides a broader view of the dynamic changes of the melon transcriptome triggered by FOM1.2 and highlights that the resistance response of NAD is mainly signaled by jasmonic acid and ethylene pathways mediated by ABA and auxin. The role of candidate plant and fungal responsive genes involved in the resistance is discussed. PMID:28367157

Knockdown of Dyslexia-Gene Dcdc2 Interferes with Speech Sound Discrimination in Continuous Streams

PubMed Central

Booker, Anne B.; Chen, Fuyi; Sloan, Andrew M.; Carraway, Ryan S.; Rennaker, Robert L.; LoTurco, Joseph J.; Kilgard, Michael P.

2016-01-01

Dyslexia is the most common developmental language disorder and is marked by deficits in reading and phonological awareness. One theory of dyslexia suggests that the phonological awareness deficit is due to abnormal auditory processing of speech sounds. Variants in DCDC2 and several other neural migration genes are associated with dyslexia and may contribute to auditory processing deficits. In the current study, we tested the hypothesis that RNAi suppression of Dcdc2 in rats causes abnormal cortical responses to sound and impaired speech sound discrimination. In the current study, rats were subjected in utero to RNA interference targeting of the gene Dcdc2 or a scrambled sequence. Primary auditory cortex (A1) responses were acquired from 11 rats (5 with Dcdc2 RNAi; DC−) before any behavioral training. A separate group of 8 rats (3 DC−) were trained on a variety of speech sound discrimination tasks, and auditory cortex responses were acquired following training. Dcdc2 RNAi nearly eliminated the ability of rats to identify specific speech sounds from a continuous train of speech sounds but did not impair performance during discrimination of isolated speech sounds. The neural responses to speech sounds in A1 were not degraded as a function of presentation rate before training. These results suggest that A1 is not directly involved in the impaired speech discrimination caused by Dcdc2 RNAi. This result contrasts earlier results using Kiaa0319 RNAi and suggests that different dyslexia genes may cause different deficits in the speech processing circuitry, which may explain differential responses to therapy. SIGNIFICANCE STATEMENT Although dyslexia is diagnosed through reading difficulty, there is a great deal of variation in the phenotypes of these individuals. The underlying neural and genetic mechanisms causing these differences are still widely debated. In the current study, we demonstrate that suppression of a candidate-dyslexia gene causes deficits on tasks of rapid stimulus processing. These animals also exhibited abnormal neural plasticity after training, which may be a mechanism for why some children with dyslexia do not respond to intervention. These results are in stark contrast to our previous work with a different candidate gene, which caused a different set of deficits. Our results shed some light on possible neural and genetic mechanisms causing heterogeneity in the dyslexic population. PMID:27122044

Gene expression in cerebral ischemia: a new approach for neuroprotection.

PubMed

Millán, Mónica; Arenillas, Juan

2006-01-01

Cerebral ischemia is one of the strongest stimuli for gene induction in the brain. Hundreds of genes have been found to be induced by brain ischemia. Many genes are involved in neurodestructive functions such as excitotoxicity, inflammatory response and neuronal apoptosis. However, cerebral ischemia is also a powerful reformatting and reprogramming stimulus for the brain through neuroprotective gene expression. Several genes may participate in both cellular responses. Thus, isolation of candidate genes for neuroprotection strategies and interpretation of expression changes have been proven difficult. Nevertheless, many studies are being carried out to improve the knowledge of the gene activation and protein expression following ischemic stroke, as well as in the development of new therapies that modify biochemical, molecular and genetic changes underlying cerebral ischemia. Owing to the complexity of the process involving numerous critical genes expressed differentially in time, space and concentration, ongoing therapeutic efforts should be based on multiple interventions at different levels. By modification of the acute gene expression induced by ischemia or the apoptotic gene program, gene therapy is a promising treatment but is still in a very experimental phase. Some hurdles will have to be overcome before these therapies can be introduced into human clinical stroke trials. Copyright 2006 S. Karger AG, Basel.

Genome-Wide Identification and Expression Analysis of the WRKY Gene Family in Cassava

PubMed Central

Wei, Yunxie; Shi, Haitao; Xia, Zhiqiang; Tie, Weiwei; Ding, Zehong; Yan, Yan; Wang, Wenquan; Hu, Wei; Li, Kaimian

2016-01-01

The WRKY family, a large family of transcription factors (TFs) found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta). In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing three exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava. PMID:26904033

Genome-Wide Identification and Expression Analysis of the WRKY Gene Family in Cassava.

PubMed

Wei, Yunxie; Shi, Haitao; Xia, Zhiqiang; Tie, Weiwei; Ding, Zehong; Yan, Yan; Wang, Wenquan; Hu, Wei; Li, Kaimian

2016-01-01

The WRKY family, a large family of transcription factors (TFs) found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta). In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing three exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

A candidate gene study in low HDL-cholesterol families provides evidence for the involvement of the APOA2 gene and the APOA1C3A4 gene cluster.

PubMed

Lilja, Heidi E; Soro, Aino; Ylitalo, Kati; Nuotio, Ilpo; Viikari, Jorma S A; Salomaa, Veikko; Vartiainen, Erkki; Taskinen, Marja-Riitta; Peltonen, Leena; Pajukanta, Päivi

2002-09-01

In patients with premature coronary heart disease, the most common lipoprotein abnormality is high-density lipoprotein (HDL) deficiency. To assess the genetic background of the low HDL-cholesterol trait, we performed a candidate gene study in 25 families with low HDL, collected from the genetically isolated population of Finland. We studied 21 genes encoding essential proteins involved in the HDL metabolism by genotyping intragenic and flanking markers for these genes. We found suggestive evidence for linkage in two candidate regions: Marker D1S2844, in the apolipoprotein A-II (APOA2) region, yielded a LOD score of 2.14 and marker D11S939 flanking the apolipoprotein A-I/C-III/A-IV gene cluster (APOA1C3A4) produced a LOD score of 1.69. Interestingly, we identified potential shared haplotypes in these two regions in a subset of low HDL families. These families also contributed to the obtained positive LOD scores, whereas the rest of the families produced negative LOD scores. None of the remaining candidate regions provided any evidence for linkage. Since only a limited number of loci were tested in this candidate gene study, these LOD scores suggest significant involvement of the APOA2 gene and the APOA1C3A4 gene cluster, or loci in their immediate vicinity, in the pathogenesis of low HDL.

IL1RN Variation Influences both Disease Susceptibility and Response to Human Recombinant IL-1RA Therapy in Systemic Juvenile Idiopathic Arthritis.

PubMed

Arthur, Victoria L; Shuldiner, Emily; Remmers, Elaine F; Hinks, Anne; Grom, Alexei A; Foell, Dirk; Martini, Alberto; Gattorno, Marco; Özen, Seza; Prahalad, Sampath; Zeft, Andrew S; Bohnsack, John F; Ilowite, Norman T; Mellins, Elizabeth D; Russo, Ricardo; Len, Claudio; Oliveira, Sheila; Yeung, Rae S M; Rosenberg, Alan M; Wedderburn, Lucy R; Anton, Jordi; Haas, Johannes-Peter; Rösen-Wolff, Angela; Minden, Kirsten; Szymanski, Ann Marie; Thomson, Wendy; Kastner, Daniel L; Woo, Patricia; Ombrello, Michael J

2018-04-02

To determine whether systemic juvenile idiopathic arthritis (sJIA) susceptibility loci identified by candidate gene studies demonstrated association with sJIA in the largest study population assembled to date. Single nucleotide polymorphisms (SNPs) from 11 previously reported sJIA risk loci were examined for association in 9 populations, including 770 sJIA cases and 6947 control subjects. The effect of sJIA-associated SNPs on gene expression was evaluated in silico in paired whole genome and RNA sequencing data from lymphoblastoid cell lines (LCL) of 373 European 1000 Genomes Project subjects. The relationship between sJIA-associated SNPs and response to anakinra treatment was evaluated in 38 US patients for whom treatment response data were available. We found no association of the 26 SNPs previously reported as sJIA-associated. Expanded analysis of the regions containing the 26 SNPs revealed only one significant association, the promoter region of IL1RN (p<1E-4). sJIA-associated SNPs correlated with IL1RN expression in LCLs, with an inverse correlation between sJIA risk and IL1RN expression. The presence of homozygous IL1RN high expression alleles correlated strongly with non-response to anakinra therapy (OR 28.7 [3.2, 255.8]). IL1RN was the only candidate locus associated with sJIA in our study. The implicated SNPs are among the strongest known determinants of IL1RN and IL1RA levels, linking low expression with increased sJIA risk. Homozygous high expression alleles predicted non-response to anakinra therapy, nominating them as candidate biomarkers to guide sJIA treatment. This is an important first step towards the personalized treatment of sJIA. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Combining mouse mammary gland gene expression and comparative mapping for the identification of candidate genes for QTL of milk production traits in cattle

PubMed Central

Ron, Micha; Israeli, Galit; Seroussi, Eyal; Weller, Joel I; Gregg, Jeffrey P; Shani, Moshe; Medrano, Juan F

2007-01-01

Background Many studies have found segregating quantitative trait loci (QTL) for milk production traits in different dairy cattle populations. However, even for relatively large effects with a saturated marker map the confidence interval for QTL location by linkage analysis spans tens of map units, or hundreds of genes. Combining mapping and arraying has been suggested as an approach to identify candidate genes. Thus, gene expression analysis in the mammary gland of genes positioned in the confidence interval of the QTL can bridge the gap between fine mapping and quantitative trait nucleotide (QTN) determination. Results We hybridized Affymetrix microarray (MG-U74v2), containing 12,488 murine probes, with RNA derived from mammary gland of virgin, pregnant, lactating and involuting C57BL/6J mice in a total of nine biological replicates. We combined microarray data from two additional studies that used the same design in mice with a total of 75 biological replicates. The same filtering and normalization was applied to each microarray data using GeneSpring software. Analysis of variance identified 249 differentially expressed probe sets common to the three experiments along the four developmental stages of puberty, pregnancy, lactation and involution. 212 genes were assigned to their bovine map positions through comparative mapping, and thus form a list of candidate genes for previously identified QTLs for milk production traits. A total of 82 of the genes showed mammary gland-specific expression with at least 3-fold expression over the median representing all tissues tested in GeneAtlas. Conclusion This work presents a web tool for candidate genes for QTL (cgQTL) that allows navigation between the map of bovine milk production QTL, potential candidate genes and their level of expression in mammary gland arrays and in GeneAtlas. Three out of four confirmed genes that affect QTL in livestock (ABCG2, DGAT1, GDF8, IGF2) were over expressed in the target organ. Thus, cgQTL can be used to determine priority of candidate genes for QTN analysis based on differential expression in the target organ. PMID:17584498

DEAF-1 regulates immunity gene expression in Drosophila.

PubMed

Reed, Darien E; Huang, Xinhua M; Wohlschlegel, James A; Levine, Michael S; Senger, Kate

2008-06-17

Immunity genes are activated in the Drosophila fat body by Rel and GATA transcription factors. Here, we present evidence that an additional regulatory factor, deformed epidermal autoregulatory factor-1 (DEAF-1), also contributes to the immune response and is specifically important for the induction of two genes encoding antimicrobial peptides, Metchnikowin (Mtk) and Drosomycin (Drs). The systematic mutagenesis of a minimal Mtk 5' enhancer identified a sequence motif essential for both a response to LPS preparations in S2 cells and activation in the larval fat body in response to bacterial infection. Using affinity chromatography coupled to multidimensional protein identification technology (MudPIT), we identified DEAF-1 as a candidate regulator. DEAF-1 activates the expression of Mtk and Drs promoter-luciferase fusion genes in S2 cells. SELEX assays and footprinting data indicate that DEAF-1 binds to and activates Mtk and Drs regulatory DNAs via a TTCGGBT motif. The insertion of this motif into the Diptericin (Dpt) regulatory region confers DEAF-1 responsiveness to this normally DEAF-1-independent enhancer. The coexpression of DEAF-1 with Dorsal, Dif, and Relish results in the synergistic activation of transcription. We propose that DEAF-1 is a regulator of Drosophila immunity.

Genome-wide linkage and positional candidate gene study of blood pressure response to dietary potassium intervention: the genetic epidemiology network of salt sensitivity study.

PubMed

Kelly, Tanika N; Hixson, James E; Rao, Dabeeru C; Mei, Hao; Rice, Treva K; Jaquish, Cashell E; Shimmin, Lawrence C; Schwander, Karen; Chen, Chung-Shuian; Liu, Depei; Chen, Jichun; Bormans, Concetta; Shukla, Pramila; Farhana, Naveed; Stuart, Colin; Whelton, Paul K; He, Jiang; Gu, Dongfeng

2010-12-01

Genetic determinants of blood pressure (BP) response to potassium, or potassium sensitivity, are largely unknown. We conducted a genome-wide linkage scan and positional candidate gene analysis to identify genetic determinants of potassium sensitivity. A total of 1906 Han Chinese participants took part in a 7-day high-sodium diet followed by a 7-day high-sodium plus potassium dietary intervention. BP measurements were obtained at baseline and after each intervention using a random-zero sphygmomanometer. Significant linkage signals (logarithm of odds [LOD] score, >3) for BP responses to potassium were detected at chromosomal regions 3q24-q26.1, 3q28, and 11q22.3-q24.3. Maximum multipoint LOD scores of 3.09 at 3q25.2 and 3.41 at 11q23.3 were observed for absolute diastolic BP (DBP) and mean arterial pressure (MAP) responses, respectively. Linkage peaks of 3.56 at 3q25.1 and 3.01 at 11q23.3 for percent DBP response and 3.22 at 3q25.2, 3.01 at 3q28, and 4.48 at 11q23.3 for percent MAP response also were identified. Angiotensin II receptor, type 1 (AGTR1), single-nucleotide polymorphism rs16860760 in the 3q24-q26.1 region was significantly associated with absolute and percent systolic BP responses to potassium (P=0.0008 and P=0.0006, respectively). Absolute (95% CI) systolic BP responses for genotypes C/C, C/T, and T/T were -3.71 (-4.02 to -3.40), -2.62 (-3.38 to -1.85), and 1.03 (-3.73 to 5.79) mm Hg, respectively, and percent responses (95% CI) were -3.07 (-3.33 to -2.80), -2.07 (-2.74 to -1.41), and 0.90 (-3.20 to 4.99), respectively. Similar trends were observed for DBP and MAP responses. Genetic regions on chromosomes 3 and 11 may harbor important susceptibility loci for potassium sensitivity. Furthermore, the AGTR1 gene was a significant predictor of BP responses to potassium intake.

Transcriptional response of the extremophile red alga Cyanidioschyzon merolae to changes in CO2 concentrations.

PubMed

Rademacher, Nadine; Wrobel, Thomas J; Rossoni, Alessandro W; Kurz, Samantha; Bräutigam, Andrea; Weber, Andreas P M; Eisenhut, Marion

2017-10-01

Cyanidioschyzon merolae (C. merolae) is an acidophilic red alga growing in a naturally low carbon dioxide (CO 2 ) environment. Although it uses a ribulose 1,5-bisphosphate carboxylase/oxygenase with high affinity for CO 2 , the survival of C. merolae relies on functional photorespiratory metabolism. In this study, we quantified the transcriptomic response of C. merolae to changes in CO 2 conditions. We found distinct changes upon shifts between CO 2 conditions, such as a concerted up-regulation of photorespiratory genes and responses to carbon starvation. We used the transcriptome data set to explore a hypothetical CO 2 concentrating mechanism in C. merolae, based on the assumption that photorespiratory genes and possible candidate genes involved in a CO 2 concentrating mechanism are co-expressed. A putative bicarbonate transport protein and two α-carbonic anhydrases were identified, which showed enhanced transcript levels under reduced CO 2 conditions. Genes encoding enzymes of a PEPCK-type C 4 pathway were co-regulated with the photorespiratory gene cluster. We propose a model of a hypothetical low CO 2 compensation mechanism in C. merolae integrating these low CO 2 -inducible components. Copyright © 2017 Elsevier GmbH. All rights reserved.

Breast Tumors with Elevated Expression of 1q Candidate Genes Confer Poor Clinical Outcome and Sensitivity to Ras/PI3K Inhibition

PubMed Central

Viveka Thangaraj, Soundara; Periasamy, Jayaprakash; Bhaskar Rao, Divya; Barnabas, Georgina D.; Raghavan, Swetha; Ganesan, Kumaresan

2013-01-01

Genomic aberrations are common in cancers and the long arm of chromosome 1 is known for its frequent amplifications in breast cancer. However, the key candidate genes of 1q, and their contribution in breast cancer pathogenesis remain unexplored. We have analyzed the gene expression profiles of 1635 breast tumor samples using meta-analysis based approach and identified clinically significant candidates from chromosome 1q. Seven candidate genes including exonuclease 1 (EXO1) are consistently over expressed in breast tumors, specifically in high grade and aggressive breast tumors with poor clinical outcome. We derived a EXO1 co-expression module from the mRNA profiles of breast tumors which comprises 1q candidate genes and their co-expressed genes. By integrative functional genomics investigation, we identified the involvement of EGFR, RAS, PI3K / AKT, MYC, E2F signaling in the regulation of these selected 1q genes in breast tumors and breast cancer cell lines. Expression of EXO1 module was found as indicative of elevated cell proliferation, genomic instability, activated RAS/AKT/MYC/E2F1 signaling pathways and loss of p53 activity in breast tumors. mRNA–drug connectivity analysis indicates inhibition of RAS/PI3K as a possible targeted therapeutic approach for the patients with activated EXO1 module in breast tumors. Thus, we identified seven 1q candidate genes strongly associated with the poor survival of breast cancer patients and identified the possibility of targeting them with EGFR/RAS/PI3K inhibitors. PMID:24147022

Identification of genes from the Treacher Collins candidate region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dixon, M.; Dixon, J.; Edwards, S.

Treacher Collins syndrome (TCOF1) is an autosomal dominant disorder of craniofacial development. The TCOF1 locus has previously been mapped to chromosome 5q32-33. The candidate gene region has been defined as being between two flanking markers, ribosomal protein S14 (RPS14) and Annexin 6 (ANX6), by analyzing recombination events in affected individuals. It is estimated that the distance between these flanking markers is 500 kb by three separate analysis methods: (1) radiation hybrid mapping; (2) genetic linkage; and (3) YAC contig analysis. A cosmid contig which spans the candidate gene region for TCOF1 has been constructed by screening the Los Alamos Nationalmore » Laboratory flow-sorted chromosome 5 cosmid library. Cosmids were obtained by using a combination of probes generated from YAC end clones, Alu-PCR fragments from YACs, and asymmetric PCR fragments from both T7 and T3 cosmid ends. Exon amplifications, the selection of genomic coding sequences based upon the presence of functional splice acceptor and donor sites, was used to identify potential exon sequences. Sequences found to be conserved between species were then used to screen cDNA libraries in order to identify candidate genes. To date, four different cDNAs have been isolated from this region and are being analyzed as potential candidate genes for TCOF1. These include the genes encoding plasma glutathione peroxidase (GPX3), heparin sulfate sulfotransferase (HSST), a gene with homology to the ETS family of proteins and one which shows no homology to any known genes. Work is also in progress to identify and characterize additional cDNAs from the candidate gene region.« less

Antennal transcriptome analysis of the piercing moth Oraesia emarginata (Lepidoptera: Noctuidae)

PubMed Central

Feng, Bo; Guo, Qianshuang; Zheng, Kaidi; Qin, Yuanxia; Du, Yongjun

2017-01-01

The piercing fruit moth Oraesia emarginata is an economically significant pest; however, our understanding of its olfactory mechanisms in infestation is limited. The present study conducted antennal transcriptome analysis of olfactory genes using real-time quantitative reverse transcription PCR analysis (RT-qPCR). We identified a total of 104 candidate chemosensory genes from several gene families, including 35 olfactory receptors (ORs), 41 odorant-binding proteins, 20 chemosensory proteins, 6 ionotropic receptors, and 2 sensory neuron membrane proteins. Seven candidate pheromone receptors (PRs) and 3 candidate pheromone-binding proteins (PBPs) for sex pheromone recognition were found. OemaOR29 and OemaPBP1 had the highest fragments per kb per million fragments (FPKM) values in all ORs and OBPs, respectively. Eighteen olfactory genes were upregulated in females, including 5 candidate PRs, and 20 olfactory genes were upregulated in males, including 2 candidate PRs (OemaOR29 and 4) and 2 PBPs (OemaPBP1 and 3). These genes may have roles in mediating sex-specific behaviors. Most candidate olfactory genes of sex pheromone recognition (except OemaOR29 and OemaPBP3) in O. emarginata were not clustered with those of studied noctuid species (type I pheromone). In addition, OemaOR29 was belonged to cluster PRIII, which comprise proteins that recognize type II pheromones instead of type I pheromones. The structure and function of olfactory genes that encode sex pheromones in O. emarginata might thus differ from those of other studied noctuids. The findings of the present study may help explain the molecular mechanism underlying olfaction and the evolution of olfactory genes encoding sex pheromones in O. emarginata. PMID:28614384

Elevated transcription factor specificity protein 1 in autistic brains alters the expression of autism candidate genes.

PubMed

Thanseem, Ismail; Anitha, Ayyappan; Nakamura, Kazuhiko; Suda, Shiro; Iwata, Keiko; Matsuzaki, Hideo; Ohtsubo, Masafumi; Ueki, Takatoshi; Katayama, Taiichi; Iwata, Yasuhide; Suzuki, Katsuaki; Minoshima, Shinsei; Mori, Norio

2012-03-01

Profound changes in gene expression can result from abnormalities in the concentrations of sequence-specific transcription factors like specificity protein 1 (Sp1). Specificity protein 1 binding sites have been reported in the promoter regions of several genes implicated in autism. We hypothesize that dysfunction of Sp1 could affect the expression of multiple autism candidate genes, contributing to the heterogeneity of autism. We assessed any alterations in the expression of Sp1 and that of autism candidate genes in the postmortem brain (anterior cingulate gyrus [ACG], motor cortex, and thalamus) of autism patients (n = 8) compared with healthy control subjects (n = 13). Alterations in the expression of candidate genes upon Sp1/DNA binding inhibition with mithramycin and Sp1 silencing by RNAi were studied in SK-N-SH neuronal cells. We observed elevated expression of Sp1 in ACG of autism patients (p = .010). We also observed altered expression of several autism candidate genes. GABRB3, RELN, and HTR2A showed reduced expression, whereas CD38, ITGB3, MAOA, MECP2, OXTR, and PTEN showed elevated expression in autism. In SK-N-SH cells, OXTR, PTEN, and RELN showed reduced expression upon Sp1/DNA binding inhibition and Sp1 silencing. The RNA integrity number was not available for any of the samples. Transcription factor Sp1 is dysfunctional in the ACG of autistic brain. Consequently, the expression of potential autism candidate genes regulated by Sp1, especially OXTR and PTEN, could be affected. The diverse downstream pathways mediated by the Sp1-regulated genes, along with the environmental and intracellular signal-related regulation of Sp1, could explain the complex phenotypes associated with autism.

Modulators of sensitivity and resistance to inhibition of PI3K identified in a pharmacogenomic screen of the NCI-60 human tumor cell line collection.

PubMed

Kwei, Kevin A; Baker, Joffre B; Pelham, Robert J

2012-01-01

The phosphoinositide 3-kinase (PI3K) signaling pathway is significantly altered in a wide variety of human cancers, driving cancer cell growth and survival. Consequently, a large number of PI3K inhibitors are now in clinical development. To begin to improve the selection of patients for treatment with PI3K inhibitors and to identify de novo determinants of patient response, we sought to identify and characterize candidate genomic and phosphoproteomic biomarkers predictive of response to the selective PI3K inhibitor, GDC-0941, using the NCI-60 human tumor cell line collection. In this study, sixty diverse tumor cell lines were exposed to GDC-0941 and classified by GI(50) value as sensitive or resistant. The most sensitive and resistant cell lines were analyzed for their baseline levels of gene expression and phosphorylation of key signaling nodes. Phosphorylation or activation status of both the PI3K-Akt signaling axis and PARP were correlated with in vitro response to GDC-0941. A gene expression signature associated with in vitro sensitivity to GDC-0941 was also identified. Furthermore, in vitro siRNA-mediated silencing of two genes in this signature, OGT and DDN, validated their role in modulating sensitivity to GDC-0941 in numerous cell lines and begins to provide biological insights into their role as chemosensitizers. These candidate biomarkers will offer useful tools to begin a more thorough understanding of determinants of patient response to PI3K inhibitors and merit exploration in human cancer patients treated with PI3K inhibitors.

Modulators of Sensitivity and Resistance to Inhibition of PI3K Identified in a Pharmacogenomic Screen of the NCI-60 Human Tumor Cell Line Collection

PubMed Central

Kwei, Kevin A.; Baker, Joffre B.; Pelham, Robert J.

2012-01-01

The phosphoinositide 3-kinase (PI3K) signaling pathway is significantly altered in a wide variety of human cancers, driving cancer cell growth and survival. Consequently, a large number of PI3K inhibitors are now in clinical development. To begin to improve the selection of patients for treatment with PI3K inhibitors and to identify de novo determinants of patient response, we sought to identify and characterize candidate genomic and phosphoproteomic biomarkers predictive of response to the selective PI3K inhibitor, GDC-0941, using the NCI-60 human tumor cell line collection. In this study, sixty diverse tumor cell lines were exposed to GDC-0941 and classified by GI50 value as sensitive or resistant. The most sensitive and resistant cell lines were analyzed for their baseline levels of gene expression and phosphorylation of key signaling nodes. Phosphorylation or activation status of both the PI3K-Akt signaling axis and PARP were correlated with in vitro response to GDC-0941. A gene expression signature associated with in vitro sensitivity to GDC-0941 was also identified. Furthermore, in vitro siRNA-mediated silencing of two genes in this signature, OGT and DDN, validated their role in modulating sensitivity to GDC-0941 in numerous cell lines and begins to provide biological insights into their role as chemosensitizers. These candidate biomarkers will offer useful tools to begin a more thorough understanding of determinants of patient response to PI3K inhibitors and merit exploration in human cancer patients treated with PI3K inhibitors. PMID:23029544