Transcriptional regulation of the operon encoding stress-responsive ECF sigma factor SigH and its anti-sigma factor RshA, and control of its regulatory network in Corynebacterium glutamicum.

PubMed

Busche, Tobias; Silar, Radoslav; Pičmanová, Martina; Pátek, Miroslav; Kalinowski, Jörn

2012-09-03

The expression of genes in Corynebacterium glutamicum, a Gram-positive non-pathogenic bacterium used mainly for the industrial production of amino acids, is regulated by seven different sigma factors of RNA polymerase, including the stress-responsive ECF-sigma factor SigH. The sigH gene is located in a gene cluster together with the rshA gene, putatively encoding an anti-sigma factor. The aim of this study was to analyze the transcriptional regulation of the sigH and rshA gene cluster and the effects of RshA on the SigH regulon, in order to refine the model describing the role of SigH and RshA during stress response. Transcription analyses revealed that the sigH gene and rshA gene are cotranscribed from four sigH housekeeping promoters in C. glutamicum. In addition, a SigH-controlled rshA promoter was found to only drive the transcription of the rshA gene. To test the role of the putative anti-sigma factor gene rshA under normal growth conditions, a C. glutamicum rshA deletion strain was constructed and used for genome-wide transcription profiling with DNA microarrays. In total, 83 genes organized in 61 putative transcriptional units, including those previously detected using sigH mutant strains, exhibited increased transcript levels in the rshA deletion mutant compared to its parental strain. The genes encoding proteins related to disulphide stress response, heat stress proteins, components of the SOS-response to DNA damage and proteasome components were the most markedly upregulated gene groups. Altogether six SigH-dependent promoters upstream of the identified genes were determined by primer extension and a refined consensus promoter consisting of 45 original promoter sequences was constructed. The rshA gene codes for an anti-sigma factor controlling the function of the stress-responsive sigma factor SigH in C. glutamicum. Transcription of rshA from a SigH-dependent promoter may serve to quickly shutdown the SigH-dependent stress response after the cells have overcome the stress condition. Here we propose a model of the regulation of oxidative and heat stress response including redox homeostasis by SigH, RshA and the thioredoxin system.

Evaluation of a toxicogenomic approach to the local lymph node assay (LLNA).

PubMed

Boverhof, Darrell R; Gollapudi, B Bhaskar; Hotchkiss, Jon A; Osterloh-Quiroz, Mandy; Woolhiser, Michael R

2009-02-01

Genomic technologies have the potential to enhance and complement existing toxicology endpoints; however, assessment of these approaches requires a systematic evaluation including a robust experimental design with genomic endpoints anchored to traditional toxicology endpoints. The present study was conducted to assess the sensitivity of genomic responses when compared with the traditional local lymph node assay (LLNA) endpoint of lymph node cell proliferation and to evaluate the responses for their ability to provide insights into mode of action. Female BALB/c mice were treated with the sensitizer trimellitic anhydride (TMA), following the standard LLNA dosing regimen, at doses of 0.1, 1, or 10% and traditional tritiated thymidine ((3)HTdR) incorporation and gene expression responses were monitored in the auricular lymph nodes. Additional mice dosed with either vehicle or 10% TMA and sacrificed on day 4 or 10, were also included to examine temporal effects on gene expression. Analysis of (3)HTdR incorporation revealed TMA-induced stimulation indices of 2.8, 22.9, and 61.0 relative to vehicle with an EC(3) of 0.11%. Examination of the dose-response gene expression responses identified 9, 833, and 2122 differentially expressed genes relative to vehicle for the 0.1, 1, and 10% TMA dose groups, respectively. Calculation of EC(3) values for differentially expressed genes did not identify a response that was more sensitive than the (3)HTdR value, although a number of genes displayed comparable sensitivity. Examination of temporal responses revealed 1760, 1870, and 953 differentially expressed genes at the 4-, 6-, and 10-day time points respectively. Functional analysis revealed many responses displayed dose- and time-specific induction patterns within the functional categories of cellular proliferation and immune response, including numerous immunoglobin genes which were highly induced at the day 10 time point. Overall, these experiments have systematically illustrated the potential utility of genomic endpoints to enhance the LLNA and support further exploration of this approach through examination of a more diverse array of chemicals.

Transcriptional responses of Arabidopsis thaliana to chewing and sucking insect herbivores

DOE PAGES

Appel, Heidi M.; Fescemyer, Howard; Ehlting, Juergen; ...

2014-11-14

We tested the hypothesis that Arabidopsis can recognize and respond differentially to insect species at the transcriptional level using a genome wide microarray. Transcriptional reprogramming was characterized using co-expression analysis in damaged and undamaged leaves at two times in response to mechanical wounding and four insect species. In all, 2778 (10.6%) of annotated genes on the array were differentially expressed in at least one treatment. Responses differed mainly between aphid and caterpillar and sampling times. Responses to aphids and caterpillars shared only 10% of up-regulated and 8% of down-regulated genes. Responses to two caterpillars shared 21 and 12% of up-more » and down-regulated genes, whereas responses to the two aphids shared only 7 and 4% of up-regulated and down-regulated genes. Overlap in genes expressed between 6 and 24 h was 3–15%, and depended on the insect species. Responses in attacked and unattacked leaves differed at 6 h but converged by 24 h. Genes responding to the insects are also responsive to many stressors and included primary metabolism. Aphids down-regulated amino acid catabolism; caterpillars stimulated production of amino acids involved in glucosinolate synthesis. Co-expression analysis revealed 17 response networks. Transcription factors were a major portion of differentially expressed genes throughout and responsive genes shared most of the known or postulated binding sites. However, cis-element composition of genes down regulated by the aphid M. persicae was unique, as were those of genes down-regulated by caterpillars. As many as 20 cis-elements were over-represented in one or more treatments, including some from well-characterized classes and others as yet uncharacterized. We suggest that transcriptional changes elicited by wounding and insects are heavily influenced by transcription factors and involve both enrichment of a common set of cis-elements and a unique enrichment of a few cis-elements in responding genes.« less

Transcriptional responses of Arabidopsis thaliana to chewing and sucking insect herbivores

DOE Office of Scientific and Technical Information (OSTI.GOV)

Appel, Heidi M.; Fescemyer, Howard; Ehlting, Juergen

We tested the hypothesis that Arabidopsis can recognize and respond differentially to insect species at the transcriptional level using a genome wide microarray. Transcriptional reprogramming was characterized using co-expression analysis in damaged and undamaged leaves at two times in response to mechanical wounding and four insect species. In all, 2778 (10.6%) of annotated genes on the array were differentially expressed in at least one treatment. Responses differed mainly between aphid and caterpillar and sampling times. Responses to aphids and caterpillars shared only 10% of up-regulated and 8% of down-regulated genes. Responses to two caterpillars shared 21 and 12% of up-more » and down-regulated genes, whereas responses to the two aphids shared only 7 and 4% of up-regulated and down-regulated genes. Overlap in genes expressed between 6 and 24 h was 3–15%, and depended on the insect species. Responses in attacked and unattacked leaves differed at 6 h but converged by 24 h. Genes responding to the insects are also responsive to many stressors and included primary metabolism. Aphids down-regulated amino acid catabolism; caterpillars stimulated production of amino acids involved in glucosinolate synthesis. Co-expression analysis revealed 17 response networks. Transcription factors were a major portion of differentially expressed genes throughout and responsive genes shared most of the known or postulated binding sites. However, cis-element composition of genes down regulated by the aphid M. persicae was unique, as were those of genes down-regulated by caterpillars. As many as 20 cis-elements were over-represented in one or more treatments, including some from well-characterized classes and others as yet uncharacterized. We suggest that transcriptional changes elicited by wounding and insects are heavily influenced by transcription factors and involve both enrichment of a common set of cis-elements and a unique enrichment of a few cis-elements in responding genes.« less

Global gene expression during stringent response in Corynebacterium glutamicum in presence and absence of the rel gene encoding (p)ppGpp synthase

PubMed Central

Brockmann-Gretza, Olaf; Kalinowski, Jörn

2006-01-01

Background The stringent response is the initial reaction of microorganisms to nutritional stress. During stringent response the small nucleotides (p)ppGpp act as global regulators and reprogram bacterial transcription. In this work, the genetic network controlled by the stringent response was characterized in the amino acid-producing Corynebacterium glutamicum. Results The transcriptome of a C. glutamicum rel gene deletion mutant, unable to synthesize (p)ppGpp and to induce the stringent response, was compared with that of its rel-proficient parent strain by microarray analysis. A total of 357 genes were found to be transcribed differentially in the rel-deficient mutant strain. In a second experiment, the stringent response was induced by addition of DL-serine hydroxamate (SHX) in early exponential growth phase. The time point of the maximal effect on transcription was determined by real-time RT-PCR using the histidine and serine biosynthetic genes. Transcription of all of these genes reached a maximum at 10 minutes after SHX addition. Microarray experiments were performed comparing the transcriptomes of SHX-induced cultures of the rel-proficient strain and the rel mutant. The differentially expressed genes were grouped into three classes. Class A comprises genes which are differentially regulated only in the presence of an intact rel gene. This class includes the non-essential sigma factor gene sigB which was upregulated and a large number of genes involved in nitrogen metabolism which were downregulated. Class B comprises genes which were differentially regulated in response to SHX in both strains, independent of the rel gene. A large number of genes encoding ribosomal proteins fall into this class, all being downregulated. Class C comprises genes which were differentially regulated in response to SHX only in the rel mutant. This class includes genes encoding putative stress proteins and global transcriptional regulators that might be responsible for the complex transcriptional patterns detected in the rel mutant when compared directly with its rel-proficient parent strain. Conclusion In C. glutamicum the stringent response enfolds a fast answer to an induced amino acid starvation on the transcriptome level. It also showed some significant differences to the transcriptional reactions occuring in Escherichia coli and Bacillus subtilis. Notable are the rel-dependent regulation of the nitrogen metabolism genes and the rel-independent regulation of the genes encoding ribosomal proteins. PMID:16961923

ChIP-Seq Analysis for Identifying Genome-Wide Histone Modifications Associated with Stress-Responsive Genes in Plants.

PubMed

Li, Guosheng; Jagadeeswaran, Guru; Mort, Andrew; Sunkar, Ramanjulu

2017-01-01

Histone modifications represent the crux of epigenetic gene regulation essential for most biological processes including abiotic stress responses in plants. Thus, identification of histone modifications at the genome-scale can provide clues for how some genes are 'turned-on' while some others are "turned-off" in response to stress. This chapter details a step-by-step protocol for identifying genome-wide histone modifications associated with stress-responsive gene regulation using chromatin immunoprecipitation (ChIP) followed by sequencing of the DNA (ChIP-seq).

Transcriptome Profiling of Shewanella oneidensis Gene Expression following Exposure to Acidic and Alkaline pH†

PubMed Central

Leaphart, Adam B.; Thompson, Dorothea K.; Huang, Katherine; Alm, Eric; Wan, Xiu-Feng; Arkin, Adam; Brown, Steven D.; Wu, Liyou; Yan, Tingfen; Liu, Xueduan; Wickham, Gene S.; Zhou, Jizhong

2006-01-01

The molecular response of Shewanella oneidensis MR-1 to variations in extracellular pH was investigated based on genomewide gene expression profiling. Microarray analysis revealed that cells elicited both general and specific transcriptome responses when challenged with environmental acid (pH 4) or base (pH 10) conditions over a 60-min period. Global responses included the differential expression of genes functionally linked to amino acid metabolism, transcriptional regulation and signal transduction, transport, cell membrane structure, and oxidative stress protection. Response to acid stress included the elevated expression of genes encoding glycogen biosynthetic enzymes, phosphate transporters, and the RNA polymerase sigma-38 factor (rpoS), whereas the molecular response to alkaline pH was characterized by upregulation of nhaA and nhaR, which are predicted to encode an Na+/H+ antiporter and transcriptional activator, respectively, as well as sulfate transport and sulfur metabolism genes. Collectively, these results suggest that S. oneidensis modulates multiple transporters, cell envelope components, and pathways of amino acid consumption and central intermediary metabolism as part of its transcriptome response to changing external pH conditions. PMID:16452448

Sarcoptes scabiei Mites Modulate Gene Expression in Human Skin Equivalents

PubMed Central

Morgan, Marjorie S.; Arlian, Larry G.; Markey, Michael P.

2013-01-01

The ectoparasitic mite, Sarcoptes scabiei that burrows in the epidermis of mammalian skin has a long co-evolution with its hosts. Phenotypic studies show that the mites have the ability to modulate cytokine secretion and expression of cell adhesion molecules in cells of the skin and other cells of the innate and adaptive immune systems that may assist the mites to survive in the skin. The purpose of this study was to identify genes in keratinocytes and fibroblasts in human skin equivalents (HSEs) that changed expression in response to the burrowing of live scabies mites. Overall, of the more than 25,800 genes measured, 189 genes were up-regulated >2-fold in response to scabies mite burrowing while 152 genes were down-regulated to the same degree. HSEs differentially expressed large numbers of genes that were related to host protective responses including those involved in immune response, defense response, cytokine activity, taxis, response to other organisms, and cell adhesion. Genes for the expression of interleukin-1α (IL-1α) precursor, IL-1β, granulocyte/macrophage-colony stimulating factor (GM-CSF) precursor, and G-CSF precursor were up-regulated 2.8- to 7.4-fold, paralleling cytokine secretion profiles. A large number of genes involved in epithelium development and keratinization were also differentially expressed in response to live scabies mites. Thus, these skin cells are directly responding as expected in an inflammatory response to products of the mites and the disruption of the skin’s protective barrier caused by burrowing. This suggests that in vivo the interplay among these skin cells and other cell types, including Langerhans cells, dendritic cells, lymphocytes and endothelial cells, is responsible for depressing the host’s protective response allowing these mites to survive in the skin. PMID:23940705

HRGFish: A database of hypoxia responsive genes in fishes

NASA Astrophysics Data System (ADS)

Rashid, Iliyas; Nagpure, Naresh Sahebrao; Srivastava, Prachi; Kumar, Ravindra; Pathak, Ajey Kumar; Singh, Mahender; Kushwaha, Basdeo

2017-02-01

Several studies have highlighted the changes in the gene expression due to the hypoxia response in fishes, but the systematic organization of the information and the analytical platform for such genes are lacking. In the present study, an attempt was made to develop a database of hypoxia responsive genes in fishes (HRGFish), integrated with analytical tools, using LAMPP technology. Genes reported in hypoxia response for fishes were compiled through literature survey and the database presently covers 818 gene sequences and 35 gene types from 38 fishes. The upstream fragments (3,000 bp), covered in this database, enables to compute CG dinucleotides frequencies, motif finding of the hypoxia response element, identification of CpG island and mapping with the reference promoter of zebrafish. The database also includes functional annotation of genes and provides tools for analyzing sequences and designing primers for selected gene fragments. This may be the first database on the hypoxia response genes in fishes that provides a workbench to the scientific community involved in studying the evolution and ecological adaptation of the fish species in relation to hypoxia.

Combining suppressive subtractive hybridization and cDNA microarrays to identify dietary phosphorus-responsive genes of the rainbow trout (Oncorhynchus mykiss) kidney.

PubMed

Lake, Jennifer; Gravel, Catherine; Koko, Gabriel Koffi D; Robert, Claude; Vandenberg, Grant W

2010-03-01

Phosphorus (P)-responsive genes and how they regulate renal adaptation to phosphorous-deficient diets in animals, including fish, are not well understood. RNA abundance profiling using cDNA microarrays is an efficient approach to study nutrient-gene interactions and identify these dietary P-responsive genes. To test the hypothesis that dietary P-responsive genes are differentially expressed in fish fed varying P levels, rainbow trout were fed a practical high-P diet (R20: 0.96% P) or a low-P diet (R0: 0.38% P) for 7 weeks. The differentially-expressed genes between dietary groups were identified and compared from the kidney by combining suppressive subtractive hybridization (SSH) with cDNA microarray analysis. A number of genes were confirmed by real-time PCR, and correlated with plasma and bone P concentrations. Approximately 54 genes were identified as potential dietary P-responsive after 7 weeks on a diet deficient in P according to cDNA microarray analysis. Of 18 selected genes, 13 genes were confirmed to be P-responsive at 7 weeks by real-time PCR analysis, including: iNOS, cytochrome b, cytochrome c oxidase subunit II , alpha-globin I, beta-globin, ATP synthase, hyperosmotic protein 21, COL1A3, Nkef, NDPK, glucose phosphate isomerase 1, Na+/H+ exchange protein and GDP dissociation inhibitor 2. Many of these dietary P-responsive genes responded in a moderate way (R0/R20 ratio: <2-3 or >0.5) and in a transient manner to dietary P limitation. In summary, renal adaptation to dietary P deficiency in trout involves changes in the expression of several genes, suggesting a profile of metabolic stress, since many of these differentially-expressed candidates are associated with the cellular adaptative responses. Crown Copyright 2009. Published by Elsevier Inc. All rights reserved.

Identification of conserved pathways of DNA-damage response and radiation protection by genome-wide RNAi.

PubMed

van Haaften, Gijs; Romeijn, Ron; Pothof, Joris; Koole, Wouter; Mullenders, Leon H F; Pastink, Albert; Plasterk, Ronald H A; Tijsterman, Marcel

2006-07-11

Ionizing radiation is extremely harmful for human cells, and DNA double-strand breaks (DSBs) are considered to be the main cytotoxic lesions induced. Improper processing of DSBs contributes to tumorigenesis, and mutations in DSB response genes underlie several inherited disorders characterized by cancer predisposition. Here, we performed a comprehensive screen for genes that protect animal cells against ionizing radiation. A total of 45 C. elegans genes were identified in a genome-wide RNA interference screen for increased sensitivity to ionizing radiation in germ cells. These genes include orthologs of well-known human cancer predisposition genes as well as novel genes, including human disease genes not previously linked to defective DNA-damage responses. Knockdown of eleven genes also impaired radiation-induced cell-cycle arrest, and seven genes were essential for apoptosis upon exposure to irradiation. The gene set was further clustered on the basis of increased sensitivity to DNA-damaging cancer drugs cisplatin and camptothecin. Almost all genes are conserved across animal phylogeny, and their relevance for humans was directly demonstrated by showing that their knockdown in human cells results in radiation sensitivity, indicating that this set of genes is important for future cancer profiling and drug development.

Gene Expression Profiling and Molecular Signaling of Various Cells in Response to Tricalcium Silicate Cements: A Systematic Review.

PubMed

Rathinam, Elanagai; Rajasekharan, Sivaprakash; Chitturi, Ravi Teja; Declercq, Heidi; Martens, Luc; De Coster, Peter

2016-12-01

The aim of this study was to present a systematic review investigating the gene expression of various cells (other than dental pulp cells) in response to different variants of tricalcium silicate cements (TSCs). A systematic search of the literature was performed by 2 independent reviewers followed by article selection and data extraction. Studies analyzing any cell type except dental pulp stem cells and any variant of tricalcium silicate cement either as the experimental or as the control group were included. A total of 41 relevant articles were included in this review. Among the included studies, ProRoot MTA (Dentsply, Tulsa, OK) was the most commonly studied (69.1%) TSC variant, and 11 cell types were identified, with 13 articles investigating gene expression in osteoblasts. A total of 39 different genes/molecules expressed were found in the selected studies. The experimental group (irrespective of the TSC variant) was identified to express significantly increased gene expression compared with the control group (untreated) in all included studies. Recent studies have provided useful insight into the gene expression and molecular signaling of various cells in response to TSCs, and new elements have been supplied on the pathways activated in this process. TSCs are capable of eliciting a favorable cellular response in periapical regeneration. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Transcriptome profiling of low temperature-treated cassava apical shoots showed dynamic responses of tropical plant to cold stress

PubMed Central

2012-01-01

Background Cassava is an important tropical root crop adapted to a wide range of environmental stimuli such as drought and acid soils. Nevertheless, it is an extremely cold-sensitive tropical species. Thus far, there is limited information about gene regulation and signalling pathways related to the cold stress response in cassava. The development of microarray technology has accelerated the study of global transcription profiling under certain conditions. Results A 60-mer oligonucleotide microarray representing 20,840 genes was used to perform transcriptome profiling in apical shoots of cassava subjected to cold at 7°C for 0, 4 and 9 h. A total of 508 transcripts were identified as early cold-responsive genes in which 319 sequences had functional descriptions when aligned with Arabidopsis proteins. Gene ontology annotation analysis identified many cold-relevant categories, including 'Response to abiotic and biotic stimulus', 'Response to stress', 'Transcription factor activity', and 'Chloroplast'. Various stress-associated genes with a wide range of biological functions were found, such as signal transduction components (e.g., MAP kinase 4), transcription factors (TFs, e.g., RAP2.11), and reactive oxygen species (ROS) scavenging enzymes (e.g., catalase 2), as well as photosynthesis-related genes (e.g., PsaL). Seventeen major TF families including many well-studied members (e.g., AP2-EREBP) were also involved in the early response to cold stress. Meanwhile, KEGG pathway analysis uncovered many important pathways, such as 'Plant hormone signal transduction' and 'Starch and sucrose metabolism'. Furthermore, the expression changes of 32 genes under cold and other abiotic stress conditions were validated by real-time RT-PCR. Importantly, most of the tested stress-responsive genes were primarily expressed in mature leaves, stem cambia, and fibrous roots rather than apical buds and young leaves. As a response to cold stress in cassava, an increase in transcripts and enzyme activities of ROS scavenging genes and the accumulation of total soluble sugars (including sucrose and glucose) were also detected. Conclusions The dynamic expression changes reflect the integrative controlling and transcriptome regulation of the networks in the cold stress response of cassava. The biological processes involved in the signal perception and physiological response might shed light on the molecular mechanisms related to cold tolerance in tropical plants and provide useful candidate genes for genetic improvement. PMID:22321773

Genomic architecture of biomass heterosis in Arabidopsis.

PubMed

Yang, Mei; Wang, Xuncheng; Ren, Diqiu; Huang, Hao; Xu, Miqi; He, Guangming; Deng, Xing Wang

2017-07-25

Heterosis is most frequently manifested by the substantially increased vigorous growth of hybrids compared with their parents. Investigating genomic variations in natural populations is essential to understand the initial molecular mechanisms underlying heterosis in plants. Here, we characterized the genomic architecture associated with biomass heterosis in 200 Arabidopsis hybrids. The genome-wide heterozygosity of hybrids makes a limited contribution to biomass heterosis, and no locus shows an obvious overdominance effect in hybrids. However, the accumulation of significant genetic loci identified in genome-wide association studies (GWAS) in hybrids strongly correlates with better-parent heterosis (BPH). Candidate genes for biomass BPH fall into diverse biological functions, including cellular, metabolic, and developmental processes and stimulus-responsive pathways. Important heterosis candidates include WUSCHEL , ARGOS , and some genes that encode key factors involved in cell cycle regulation. Interestingly, transcriptomic analyses in representative Arabidopsis hybrid combinations reveal that heterosis candidate genes are functionally enriched in stimulus-responsive pathways, including responses to biotic and abiotic stimuli and immune responses. In addition, stimulus-responsive genes are repressed to low-parent levels in hybrids with high BPH, whereas middle-parent expression patterns are exhibited in hybrids with no BPH. Our study reveals a genomic architecture for understanding the molecular mechanisms of biomass heterosis in Arabidopsis , in which the accumulation of the superior alleles of genes involved in metabolic and cellular processes improve the development and growth of hybrids, whereas the overall repressed expression of stimulus-responsive genes prioritizes growth over responding to environmental stimuli in hybrids under normal conditions.

Late Multiple Organ Surge in Interferon-Regulated Target Genes Characterizes Staphylococcal Enterotoxin B Lethality

PubMed Central

Ferreyra, Gabriela A.; Elinoff, Jason M.; Demirkale, Cumhur Y.; Starost, Matthew F.; Buckley, Marilyn; Munson, Peter J.; Krakauer, Teresa; Danner, Robert L.

2014-01-01

Background Bacterial superantigens are virulence factors that cause toxic shock syndrome. Here, the genome-wide, temporal response of mice to lethal intranasal staphylococcal enterotoxin B (SEB) challenge was investigated in six tissues. Results The earliest responses and largest number of affected genes occurred in peripheral blood mononuclear cells (PBMC), spleen, and lung tissues with the highest content of both T-cells and monocyte/macrophages, the direct cellular targets of SEB. In contrast, the response of liver, kidney, and heart was delayed and involved fewer genes, but revealed a dominant genetic program that was seen in all 6 tissues. Many of the 85 uniquely annotated transcripts participating in this shared genomic response have not been previously linked to SEB. Nine of the 85 genes were subsequently confirmed by RT-PCR in every tissue/organ at 24 h. These 85 transcripts, up-regulated in all tissues, annotated to the interferon (IFN)/antiviral-response and included genes belonging to the DNA/RNA sensing system, DNA damage repair, the immunoproteasome, and the ER/metabolic stress-response and apoptosis pathways. Overall, this shared program was identified as a type I and II interferon (IFN)-response and the promoters of these genes were highly enriched for IFN regulatory matrices. Several genes whose secreted products induce the IFN pathway were up-regulated at early time points in PBMCs, spleen, and/or lung. Furthermore, IFN regulatory factors including Irf1, Irf7 and Irf8, and Zbp1, a DNA sensor/transcription factor that can directly elicit an IFN innate immune response, participated in this host-wide SEB signature. Conclusion Global gene-expression changes across multiple organs implicated a host-wide IFN-response in SEB-induced death. Therapies aimed at IFN-associated innate immunity may improve outcome in toxic shock syndromes. PMID:24551153

Genetic predictors of antipsychotic response to lurasidone identified in a genome wide association study and by schizophrenia risk genes.

PubMed

Li, Jiang; Yoshikawa, Akane; Brennan, Mark D; Ramsey, Timothy L; Meltzer, Herbert Y

2018-02-01

Biomarkers which predict response to atypical antipsychotic drugs (AAPDs) increases their benefit/risk ratio. We sought to identify common variants in genes which predict response to lurasidone, an AAPD, by associating genome-wide association study (GWAS) data and changes (Δ) in Positive And Negative Syndrome Scale (PANSS) scores from two 6-week randomized, placebo-controlled trials of lurasidone in schizophrenia (SCZ) patients. We also included SCZ risk SNPs identified by the Psychiatric Genomics Consortium using a polygenic risk analysis. The top genomic loci, with uncorrected p<10 -4 , include: 1) synaptic adhesion (PTPRD, LRRC4C, NRXN1, ILIRAPL1, SLITRK1) and scaffolding (MAGI1, MAGI2, NBEA) genes, both essential for synaptic function; 2) other synaptic plasticity-related genes (NRG1/3 and KALRN); 3) the neuron-specific RNA splicing regulator, RBFOX1; and 4) ion channel genes, e.g. KCNA10, KCNAB1, KCNK9 and CACNA2D3). Some genes predicted response for patients with both European and African Ancestries. We replicated some SNPs reported to predict response to other atypical APDs in other GWAS. Although none of the biomarkers reached genome-wide significance, many of the genes and associated pathways have previously been linked to SCZ. Two polygenic modeling approaches, GCTA-GREML and PLINK-Polygenic Risk Score, demonstrated that some risk genes related to neurodevelopment, synaptic biology, immune response, and histones, also contributed to prediction of response. The top hits predicting response to lurasidone did not predict improvement with placebo. This is the first evidence from clinical trials that SCZ risk SNPs are related to clinical response to an AAPD. These results need to be replicated in an independent sample. Copyright © 2017. Published by Elsevier B.V.

Identification of unique cis-element pattern on simulated microgravity treated Arabidopsis by in silico and gene expression

NASA Astrophysics Data System (ADS)

Soh, Hyuncheol; Choi, Yongsang; Lee, Taek-Kyun; Yeo, Up-Dong; Han, Kyeongsik; Auh, Chungkyun; Lee, Sukchan

2012-08-01

Arabidopsis gene expression microarray (44 K) was used to detect genes highly induced under simulated microgravity stress (SMS). Ten SMS-inducible genes were selected from the microarray data and these 10 genes were found to be abundantly expressed in 3-week-old plants. Nine out of the 10 SMS-inducible genes were also expressed in response to the three abiotic stresses of drought, touch, and wounding in 3-week-old Arabidopsis plants respectively. However, WRKY46 was elevated only in response to SMS. Six other WRKY genes did not respond to SMS. To clarify the characteristics of the genes expressed at high levels in response to SMS, 20 cis-elements in the promoters of the 40 selected genes including the 10 SMS-inducible genes, the 6 WRKY genes, and abiotic stress-inducible genes were analyzed and their spatial positions on each promoter were determined. Four cis-elements (M/T-G-T-P from MYB1AT or TATABOX5, GT1CONSENSUS, TATABOX5, and POLASIG1) showed a unique spatial arrangement in most SMS-inducible genes including WRKY46. Therefore the M/T-G-T-P cis-element patterns identified in the promoter of WRKY46 may play important roles in regulating gene expression in response to SMS. The presences of the cis-element patterns suggest that the order or spatial positioning of certain groups of cis-elements is more important than the existence or numbers of specific cis-elements. Taken together, our data indicate that WRKY46 is a novel SMS inducible transcription factor and the unique spatial arrangement of cis-elements shown in WRKY46 promoter may play an important role for its response to SMS.

ABA signaling in stress-response and seed development.

PubMed

Nakashima, Kazuo; Yamaguchi-Shinozaki, Kazuko

2013-07-01

KEY MESSAGE : We review the recent progress on ABA signaling, especially ABA signaling for ABA-dependent gene expression, including the AREB/ABF regulon, SnRK2 protein kinase, 2C-type protein phosphatases and ABA receptors. Drought negatively impacts plant growth and the productivity of crops. Drought causes osmotic stress to organisms, and the osmotic stress causes dehydration in plant cells. Abscisic acid (ABA) is produced under osmotic stress conditions, and it plays an important role in the stress response and tolerance of plants. ABA regulates many genes under osmotic stress conditions. It also regulates gene expression during seed development and germination. The ABA-responsive element (ABRE) is the major cis-element for ABA-responsive gene expression. ABRE-binding protein (AREB)/ABRE-binding factor (ABF) transcription factors (TFs) regulate ABRE-dependent gene expression. Other TFs are also involved in ABA-responsive gene expression. SNF1-related protein kinases 2 are the key regulators of ABA signaling including the AREB/ABF regulon. Recently, ABA receptors and group A 2C-type protein phosphatases were shown to govern the ABA signaling pathway. Moreover, recent studies have suggested that there are interactions between the major ABA signaling pathway and other signaling factors in stress-response and seed development. The control of the expression of ABA signaling factors may improve tolerance to environmental stresses.

Global Gene-Expression Analysis to Identify Differentially Expressed Genes Critical for the Heat Stress Response in Brassica rapa

PubMed Central

Dong, Xiangshu; Yi, Hankuil; Lee, Jeongyeo; Nou, Ill-Sup; Han, Ching-Tack; Hur, Yoonkang

2015-01-01

Genome-wide dissection of the heat stress response (HSR) is necessary to overcome problems in crop production caused by global warming. To identify HSR genes, we profiled gene expression in two Chinese cabbage inbred lines with different thermotolerances, Chiifu and Kenshin. Many genes exhibited >2-fold changes in expression upon exposure to 0.5– 4 h at 45°C (high temperature, HT): 5.2% (2,142 genes) in Chiifu and 3.7% (1,535 genes) in Kenshin. The most enriched GO (Gene Ontology) items included ‘response to heat’, ‘response to reactive oxygen species (ROS)’, ‘response to temperature stimulus’, ‘response to abiotic stimulus’, and ‘MAPKKK cascade’. In both lines, the genes most highly induced by HT encoded small heat shock proteins (Hsps) and heat shock factor (Hsf)-like proteins such as HsfB2A (Bra029292), whereas high-molecular weight Hsps were constitutively expressed. Other upstream HSR components were also up-regulated: ROS-scavenging genes like glutathione peroxidase 2 (BrGPX2, Bra022853), protein kinases, and phosphatases. Among heat stress (HS) marker genes in Arabidopsis, only exportin 1A (XPO1A) (Bra008580, Bra006382) can be applied to B. rapa for basal thermotolerance (BT) and short-term acquired thermotolerance (SAT) gene. CYP707A3 (Bra025083, Bra021965), which is involved in the dehydration response in Arabidopsis, was associated with membrane leakage in both lines following HS. Although many transcription factors (TF) genes, including DREB2A (Bra005852), were involved in HS tolerance in both lines, Bra024224 (MYB41) and Bra021735 (a bZIP/AIR1 [Anthocyanin-Impaired-Response-1]) were specific to Kenshin. Several candidate TFs involved in thermotolerance were confirmed as HSR genes by real-time PCR, and these assignments were further supported by promoter analysis. Although some of our findings are similar to those obtained using other plant species, clear differences in Brassica rapa reveal a distinct HSR in this species. Our data could also provide a springboard for developing molecular markers of HS and for engineering HS tolerant B. rapa. PMID:26102990

Localized epigenetic silencing of a damage-activated WNT enhancer limits regeneration in mature Drosophila imaginal discs

PubMed Central

Harris, Robin E; Setiawan, Linda; Saul, Josh; Hariharan, Iswar K

2016-01-01

Many organisms lose the capacity to regenerate damaged tissues as they mature. Damaged Drosophila imaginal discs regenerate efficiently early in the third larval instar (L3) but progressively lose this ability. This correlates with reduced damage-responsive expression of multiple genes, including the WNT genes wingless (wg) and Wnt6. We demonstrate that damage-responsive expression of both genes requires a bipartite enhancer whose activity declines during L3. Within this enhancer, a damage-responsive module stays active throughout L3, while an adjacent silencing element nucleates increasing levels of epigenetic silencing restricted to this enhancer. Cas9-mediated deletion of the silencing element alleviates WNT repression, but is, in itself, insufficient to promote regeneration. However, directing Myc expression to the blastema overcomes repression of multiple genes, including wg, and restores cellular responses necessary for regeneration. Localized epigenetic silencing of damage-responsive enhancers can therefore restrict regenerative capacity in maturing organisms without compromising gene functions regulated by developmental signals. DOI: http://dx.doi.org/10.7554/eLife.11588.001 PMID:26840050

Assessing senescence in Drosophila using video tracking.

PubMed

Ardekani, Reza; Tavaré, Simon; Tower, John

2013-01-01

Senescence is associated with changes in gene expression, including the upregulation of stress response- and innate immune response-related genes. In addition, aging animals exhibit characteristic changes in movement behaviors including decreased gait speed and a deterioration in sleep/wake rhythms. Here, we describe methods for tracking Drosophila melanogaster movements in 3D with simultaneous quantification of fluorescent transgenic reporters. This approach allows for the assessment of correlations between behavior, aging, and gene expression as well as for the quantification of biomarkers of aging.

Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters.

PubMed

Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

2005-02-01

cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

Identification of the Regulator Gene Responsible for the Acetone-Responsive Expression of the Binuclear Iron Monooxygenase Gene Cluster in Mycobacteria ▿

PubMed Central

Furuya, Toshiki; Hirose, Satomi; Semba, Hisashi; Kino, Kuniki

2011-01-01

The mimABCD gene cluster encodes the binuclear iron monooxygenase that oxidizes propane and phenol in Mycobacterium smegmatis strain MC2 155 and Mycobacterium goodii strain 12523. Interestingly, expression of the mimABCD gene cluster is induced by acetone. In this study, we investigated the regulator gene responsible for this acetone-responsive expression. In the genome sequence of M. smegmatis strain MC2 155, the mimABCD gene cluster is preceded by a gene designated mimR, which is divergently transcribed. Sequence analysis revealed that MimR exhibits amino acid similarity with the NtrC family of transcriptional activators, including AcxR and AcoR, which are involved in acetone and acetoin metabolism, respectively. Unexpectedly, many homologs of the mimR gene were also found in the sequenced genomes of actinomycetes. A plasmid carrying a transcriptional fusion of the intergenic region between the mimR and mimA genes with a promoterless green fluorescent protein (GFP) gene was constructed and introduced into M. smegmatis strain MC2 155. Using a GFP reporter system, we confirmed by deletion and complementation analyses that the mimR gene product is the positive regulator of the mimABCD gene cluster expression that is responsive to acetone. M. goodii strain 12523 also utilized the same regulatory system as M. smegmatis strain MC2 155. Although transcriptional activators of the NtrC family generally control transcription using the σ54 factor, a gene encoding the σ54 factor was absent from the genome sequence of M. smegmatis strain MC2 155. These results suggest the presence of a novel regulatory system in actinomycetes, including mycobacteria. PMID:21856847

Variants in the interleukin 8 gene and the response to inhaled bronchodilators in cystic fibrosis.

PubMed

Furlan, Larissa Lazzarini; Ribeiro, José Dirceu; Bertuzzo, Carmen Sílvia; Salomão Junior, João Batista; Souza, Dorotéia Rossi Silva; Marson, Fernando Augusto Lima

Interleukin 8 protein promotes inflammatory responses, even in airways. The presence of interleukin 8 gene variants causes altered inflammatory responses and possibly varied responses to inhaled bronchodilators. Thus, this study analyzed the interleukin 8 variants (rs4073, rs2227306, and rs2227307) and their association with the response to inhaled bronchodilators in cystic fibrosis patients. Analysis of interleukin 8 gene variants was performed by restriction fragment length polymorphism of polymerase chain reaction. The association between spirometry markers and the response to inhaled bronchodilators was evaluated by Mann-Whitney and Kruskal-Wallis tests. The analysis included all cystic fibrosis patients, and subsequently patients with two mutations in the cystic fibrosis transmembrane conductance regulator gene belonging to classes I to III. This study included 186 cystic fibrosis patients. There was no association of the rs2227307 variant with the response to inhaled bronchodilators. The rs2227306 variant was associated with FEF 50% in the dominant group and in the group with two identified mutations in the cystic fibrosis transmembrane conductance regulator gene. The rs4073 variant was associated with spirometry markers in four genetic models: co-dominant (FEF 25-75% and FEF 75% ), dominant (FEV 1 , FEF 50% , FEF 75% , and FEF 25-75% ), recessive (FEF 75% and FEF 25-75% ), and over-dominant (FEV 1 /FVC). This study highlighted the importance of the rs4073 variant of the interleukin 8 gene, regarding response to inhaled bronchodilators, and of the assessment of mutations in the cystic fibrosis transmembrane conductance regulator gene. Copyright © 2017 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

The NAC transcription factor family in maritime pine (Pinus Pinaster): molecular regulation of two genes involved in stress responses.

PubMed

Pascual, Ma Belén; Cánovas, Francisco M; Ávila, Concepción

2015-10-24

NAC transcription factors comprise a large plant-specific gene family involved in the regulation of diverse biological processes. Despite the growing number of studies on NAC transcription factors in various species, little information is available about this family in conifers. The goal of this study was to identify the NAC transcription family in maritime pine (Pinus pinaster), to characterize ATAF-like genes in response to various stresses and to study their molecular regulation. We have isolated two maritime pine NAC genes and using a transient expression assay in N. benthamiana leaves estudied the promoter jasmonate response. In this study, we identified 37 NAC genes from maritime pine and classified them into six main subfamilies. The largest group includes 12 sequences corresponding to stress-related genes. Two of these NAC genes, PpNAC2 and PpNAC3, were isolated and their expression profiles were examined at various developmental stages and in response to various types of stress. The expression of both genes was strongly induced by methyl jasmonate (MeJA), mechanical wounding, and high salinity. The promoter regions of these genes were shown to contain cis-elements involved in the stress response and plant hormonal regulation, including E-boxes, which are commonly found in the promoters of genes that respond to jasmonate, and binding sites for bHLH proteins. Using a transient expression assay in N. benthamiana leaves, we found that the promoter of PpNAC3 was rapidly induced upon MeJA treatment, while this response disappeared in plants in which the transcription factor NbbHLH2 was silenced. Our results suggest that PpNAC2 and PpNAC3 encode stress-responsive NAC transcription factors involved in the jasmonate response in pine. Furthermore, these data also suggest that the jasmonate signaling pathway is conserved between angiosperms and gymnosperms. These findings may be useful for engineering stress tolerance in pine via biotechnological approaches.

Resistant and susceptible responses in alfalfa (Medicago sativa) to bacterial stem blight caused by Pseudomonas syringae pv. syringae.

PubMed

Nemchinov, Lev G; Shao, Jonathan; Lee, Maya N; Postnikova, Olga A; Samac, Deborah A

2017-01-01

Bacterial stem blight caused by Pseudomonas syringae pv. syringae is a common disease of alfalfa (Medicago sativa L). Little is known about host-pathogen interactions and host defense mechanisms. Here, individual resistant and susceptible plants were selected from cultivars Maverick and ZG9830 and used for transcript profiling at 24 and 72 hours after inoculation (hai) with the isolate PssALF3. Bioinformatic analysis revealed a number of differentially expressed genes (DEGs) in resistant and susceptible genotypes. Although resistant plants from each cultivar produced a hypersensitive response, transcriptome analyses indicated that they respond differently at the molecular level. The number of DEGs was higher in resistant plants of ZG9830 at 24 hai than in Maverick, suggesting that ZG9830 plants had a more rapid effector triggered immune response. Unique up-regulated genes in resistant ZG9830 plants included genes encoding putative nematode resistance HSPRO2-like proteins, orthologs for the rice Xa21 and soybean Rpg1-b resistance genes, and TIR-containing R genes lacking both NBS and LRR domains. The suite of R genes up-regulated in resistant Maverick plants had an over-representation of R genes in the CC-NBS-LRR family including two genes for atypical CCR domains and a putative ortholog of the Arabidopsis RPM1 gene. Resistance in both cultivars appears to be mediated primarily by WRKY family transcription factors and expression of genes involved in protein phosphorylation, regulation of transcription, defense response including synthesis of isoflavonoids, and oxidation-reduction processes. These results will further the identification of mechanisms involved in resistance to facilitate selection of parent populations and development of commercial varieties.

Resistant and susceptible responses in alfalfa (Medicago sativa) to bacterial stem blight caused by Pseudomonas syringae pv. syringae

PubMed Central

Shao, Jonathan; Lee, Maya N.; Postnikova, Olga A.; Samac, Deborah A.

2017-01-01

Bacterial stem blight caused by Pseudomonas syringae pv. syringae is a common disease of alfalfa (Medicago sativa L). Little is known about host-pathogen interactions and host defense mechanisms. Here, individual resistant and susceptible plants were selected from cultivars Maverick and ZG9830 and used for transcript profiling at 24 and 72 hours after inoculation (hai) with the isolate PssALF3. Bioinformatic analysis revealed a number of differentially expressed genes (DEGs) in resistant and susceptible genotypes. Although resistant plants from each cultivar produced a hypersensitive response, transcriptome analyses indicated that they respond differently at the molecular level. The number of DEGs was higher in resistant plants of ZG9830 at 24 hai than in Maverick, suggesting that ZG9830 plants had a more rapid effector triggered immune response. Unique up-regulated genes in resistant ZG9830 plants included genes encoding putative nematode resistance HSPRO2-like proteins, orthologs for the rice Xa21 and soybean Rpg1-b resistance genes, and TIR-containing R genes lacking both NBS and LRR domains. The suite of R genes up-regulated in resistant Maverick plants had an over-representation of R genes in the CC-NBS-LRR family including two genes for atypical CCR domains and a putative ortholog of the Arabidopsis RPM1 gene. Resistance in both cultivars appears to be mediated primarily by WRKY family transcription factors and expression of genes involved in protein phosphorylation, regulation of transcription, defense response including synthesis of isoflavonoids, and oxidation-reduction processes. These results will further the identification of mechanisms involved in resistance to facilitate selection of parent populations and development of commercial varieties. PMID:29244864

Genome-wide identification of galactinol synthase (GolS) genes in Solanum lycopersicum and Brachypodium distachyon.

PubMed

Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep

2015-10-01

GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.

Restraint stress differentially regulates inflammation and glutamate receptor gene expression in the hippocampus of C57BL/6 and BALB/c mice.

PubMed

Sathyanesan, Monica; Haiar, Jacob M; Watt, Michael J; Newton, Samuel S

2017-03-01

The inbred mouse strains, C57BL/6 and BALB/c have been used widely in preclinical psychiatric research. The differences in stress susceptibility of available strains has provided a useful platform to test pharmacological agents and behavioral responses. Previous brain gene profiling efforts have indicated that the inflammation and immune response gene pathway is the predominant gene network in the differential stress response of BALB/c and C57BL/6 mice. The implication is that a composite stress paradigm that includes a sequence of extended, varied and unpredictable stressors induces inflammation-related genes in the hippocampus. We hypothesized that the regulation of inflammation genes in the brain could constitute a primary stress response and tested this by employing a simple stress protocol, repeated exposure to the same stressor for 10 days, 2 h of restraint per day. We examined stress-induced regulation of 13 proinflammatory cytokine genes in male BALB/c and C57BL/6 mice using quantitative PCR. Elevated cytokine genes included tumor necrosis factor alpha (TNFα), interleukin 6 (IL6), interleukin 10 (IL10), tumor necrosis factor (TNF) super family members and interleukin 1 receptor 1 (IL1R1). In addition, we examined restraint stress-induced regulation of 12 glutamate receptor genes in both strains. Our results show that restraint stress is sufficient to elevate the expression of inflammation-related genes in the hippocampus of both BABLB/c and C57BL/6 mice, but they differ in the genes that are induced and the magnitude of change. Cell types that are involved in this response include endothelial cells and astrocytes. Lay summary Repeated exposure to a simple restraint stress altered the activities of genes involved in inflammation and the functions of the excitatory neurotransmitter, glutamate. These changes in the hippocampus of the mouse brain showed differences that were dependent on the strain of mice and the length of the stress exposure. The effects of stress on activity of these genes may lead to alterations in behavior.

Genetic variants in cellular transport do not affect mesalamine response in ulcerative colitis

PubMed Central

Huang, Hailiang; Rivas, Manuel; Kaplan, Jess L.; Daly, Mark J.; Winter, Harland S.

2018-01-01

Background and aims Mesalamine is commonly used to treat ulcerative colitis (UC). Although mesalamine acts topically, in vitro data suggest that intracellular transport is required for its beneficial effect. Genetic variants in mucosal transport proteins may affect this uptake, but the clinical relevance of these variants has not been studied. The aim of this study was to determine whether variants in genes involved in cellular transport affect the response to mesalamine in UC. Methods Subjects with UC from a 6-week clinical trial using multiple doses of mesalamine were genotyped using a genome-wide array that included common exome variants. Analysis focused on cellular transport gene variants with a minor allele frequency >5%. Mesalamine response was defined as improvement in Week 6 Physician’s Global Assessment (PGA) and non-response as a lack of improvement in Week 6 PGA. Quality control thresholds included an individual genotyping rate of >90%, SNP genotyping rate of >98%, and exclusion for subjects with cryptic relatedness. All included variants met Hardy-Weinberg equilibrium (p>0.001). Results 457 adults with UC were included with 280 responders and 177 non-responders. There were no common variants in transporter genes that were associated with response to mesalamine. The genetic risk score of responders was similar to that of non-responders (p = 0.18). Genome-wide variants demonstrating a trend towards mesalamine response included ST8SIA5 (p = 1x10-5). Conclusions Common transporter gene variants did not affect response to mesalamine in adult UC. The response to mesalamine may be due to rare genetic events or environmental factors such as the intestinal microbiome. PMID:29579042

Genome-Wide Identification and Characterization of Warming-Related Genes in Brassica rapa ssp. pekinensis.

PubMed

Song, Hayoung; Dong, Xiangshu; Yi, Hankuil; Ahn, Ju Young; Yun, Keunho; Song, Myungchul; Han, Ching-Tack; Hur, Yoonkang

2018-06-11

For sustainable crop cultivation in the face of global warming, it is important to unravel the genetic mechanisms underlying plant adaptation to a warming climate and apply this information to breeding. Thermomorphogenesis and ambient temperature signaling pathways have been well studied in model plants, but little information is available for vegetable crops. Here, we investigated genes responsive to warming conditions from two Brassica rapa inbred lines with different geographic origins: subtropical (Kenshin) and temperate (Chiifu). Genes in Gene Ontology categories “response to heat”, “heat acclimation”, “response to light intensity”, “response to oxidative stress”, and “response to temperature stimulus” were upregulated under warming treatment in both lines, but genes involved in “response to auxin stimulus” were upregulated only in Kenshin under both warming and minor-warming conditions. We identified 16 putative high temperature (HT) adaptation-related genes, including 10 heat-shock response genes, 2 transcription factor genes, 1 splicing factor gene, and 3 others. BrPIF4 , BrROF2 , and BrMPSR1 are candidate genes that might function in HT adaptation. Auxin response, alternative splicing of BrHSFA2 , and heat shock memory appear to be indispensable for HT adaptation in B. rapa . These results lay the foundation for molecular breeding and marker development to improve warming tolerance in B. rapa .

Bacterial discrimination by Dictyostelid amoebae reveals the complexity of ancient interspecies interactions

PubMed Central

Nasser, Waleed; Santhanam, Balaji; Miranda, Edward Roshan; Parikh, Anup; Juneja, Kavina; Rot, Gregor; Dinh, Chris; Chen, Rui; Zupan, Blaz; Shaulsky, Gad; Kuspa, Adam

2014-01-01

Background Amoebae and bacteria interact within predator/prey and host/pathogen relationships, but the general response of amoeba to bacteria is not well understood. The amoeba Dictyostelium discoideum feeds on, and is colonized by diverse bacterial species including Gram-positive [Gram(+)] and Gram-negative [Gram(−)] bacteria, two major groups of bacteria that differ in structure and macromolecular composition. Results Transcriptional profiling of D. discoideum revealed sets of genes whose expression is enriched in amoebae interacting with different species of bacteria, including sets that appear specific to amoebae interacting with Gram(+), or with Gram(−) bacteria. In a genetic screen utilizing the growth of mutant amoebae on a variety of bacteria as a phenotypic readout, we identified amoebal genes that are only required for growth on Gram(+) bacteria, including one that encodes the cell surface protein gp130, as well as several genes that are only required for growth on Gram(−) bacteria including one that encodes a putative lysozyme, AlyL. These genes are required for parts of the transcriptional response of wild-type amoebae, and this allowed their classification into potential response pathways. Conclusions We have defined genes that are critical for amoebal survival during feeding on Gram(+), or Gram(−), bacteria which we propose form part of a regulatory network that allows D. discoideum to elicit specific cellular responses to different species of bacteria in order to optimize survival. PMID:23664307

Immune and stress responses in oysters with insights on adaptation.

PubMed

Guo, Ximing; He, Yan; Zhang, Linlin; Lelong, Christophe; Jouaux, Aude

2015-09-01

Oysters are representative bivalve molluscs that are widely distributed in world oceans. As successful colonizers of estuaries and intertidal zones, oysters are remarkably resilient against harsh environmental conditions including wide fluctuations in temperature and salinity as well as prolonged air exposure. Oysters have no adaptive immunity but can thrive in microbe-rich estuaries as filter-feeders. These unique adaptations make oysters interesting models to study the evolution of host-defense systems. Recent advances in genomic studies including sequencing of the oyster genome have provided insights into oyster's immune and stress responses underlying their amazing resilience. Studies show that the oyster genomes are highly polymorphic and complex, which may be key to their resilience. The oyster genome has a large gene repertoire that is enriched for immune and stress response genes. Thousands of genes are involved in oyster's immune and stress responses, through complex interactions, with many gene families expanded showing high sequence, structural and functional diversity. The high diversity of immune receptors and effectors may provide oysters with enhanced specificity in immune recognition and response to cope with diverse pathogens in the absence of adaptive immunity. Some members of expanded immune gene families have diverged to function at different temperatures and salinities or assumed new roles in abiotic stress response. Most canonical innate immunity pathways are conserved in oysters and supported by a large number of diverse and often novel genes. The great diversity in immune and stress response genes exhibited by expanded gene families as well as high sequence and structural polymorphisms may be central to oyster's adaptation to highly stressful and widely changing environments. Copyright © 2015 Elsevier Ltd. All rights reserved.

Early and delayed long-term transcriptional changes and short-term transient responses during cold acclimation in olive leaves

PubMed Central

Leyva-Pérez, María de la O; Valverde-Corredor, Antonio; Valderrama, Raquel; Jiménez-Ruiz, Jaime; Muñoz-Merida, Antonio; Trelles, Oswaldo; Barroso, Juan Bautista; Mercado-Blanco, Jesús; Luque, Francisco

2015-01-01

Low temperature severely affects plant growth and development. To overcome this constraint, several plant species from regions having a cool season have evolved an adaptive response, called cold acclimation. We have studied this response in olive tree (Olea europaea L.) cv. Picual. Biochemical stress markers and cold-stress symptoms were detected after the first 24 h as sagging leaves. After 5 days, the plants were found to have completely recovered. Control and cold-stressed plants were sequenced by Illumina HiSeq 1000 paired-end technique. We also assembled a new olive transcriptome comprising 157,799 unigenes and found 6,309 unigenes differentially expressed in response to cold. Three types of response that led to cold acclimation were found: short-term transient response, early long-term response, and late long-term response. These subsets of unigenes were related to different biological processes. Early responses involved many cold-stress-responsive genes coding for, among many other things, C-repeat binding factor transcription factors, fatty acid desaturases, wax synthesis, and oligosaccharide metabolism. After long-term exposure to cold, a large proportion of gene down-regulation was found, including photosynthesis and plant growth genes. Up-regulated genes after long-term cold exposure were related to organelle fusion, nucleus organization, and DNA integration, including retrotransposons. PMID:25324298

Plant responses to environmental stress: regulation and functions of the Arabidopsis TCH genes

NASA Technical Reports Server (NTRS)

Braam, J.; Sistrunk, M. L.; Polisensky, D. H.; Xu, W.; Purugganan, M. M.; Antosiewicz, D. M.; Campbell, P.; Johnson, K. A.; McIntire, L. V. (Principal Investigator)

1997-01-01

Expression of the Arabidopsis TCH genes is markedly upregulated in response to a variety of environmental stimuli including the seemingly innocuous stimulus of touch. Understanding the mechanism(s) and factors that control TCH gene regulation will shed light on the signaling pathways that enable plants to respond to environmental conditions. The TCH proteins include calmodulin, calmodulin-related proteins and a xyloglucan endotransglycosylase. Expression analyses and localization of protein accumulation indicates that the potential sites of TCH protein function include expanding cells and tissues under mechanical strain. We hypothesize that at least a subset of the TCH proteins may collaborate in cell wall biogenesis.

Impaired Cytogenetic Damage Repair and Cell Cycle Regulation in Response to Ionizing Radiation in Human Fibroblast Cells with Individual Knock-down of 25 Genes

NASA Technical Reports Server (NTRS)

Zhang, Ye; Rohde, Larry; Emami, Kamal; Hammond, Dianne; Casey, Rachael; Mehta, Satish; Jeevarajan, Antony; Pierson, Duane; Wu, Honglu

2008-01-01

Changes of gene expression profile are one of the most important biological responses in living cells after ionizing radiation (IR) exposure. Although some studies have demonstrated that genes with upregulated expression induced by IR may play important roles in DNA damage sensing, cell cycle checkpoint and chromosomal repair, the relationship between the regulation of gene expression by IR and its impact on cytogenetic responses to ionizing radiation has not been systematically studied. In our present study, the expression of 25 genes selected based on their transcriptional changes in response to IR or from their known DNA repair roles were individually knocked down by siRNA transfection in human fibroblast cells. Chromosome aberrations (CA) and micronuclei (MN) formation were measured as the cytogenetic endpoints. Our results showed that the yield of MN and/or CA formation were significantly increased by suppressed expression of 5 genes that included Ku70 in the DSB repair pathway; XPA in the NER pathway; RPA1 in the MMR pathway; RAD17 and RBBP8 in cell cycle control. Knocked-down expression of 4 genes including MRE11A, RAD51 in the DSB pathway, and SESN1 and SUMO1 showed significant inhibition of cell cycle progression, possibly because of severe impairment of DNA damage repair. Furthermore, loss of XPA, p21 and MLH1 expression resulted in both enhanced cell cycle progression and significantly higher yield of cytogenetic damage, indicating the involvement of these gene products in both cell cycle control and DNA damage repair. Of these 11 genes that affected the cytogenetic response, 9 were up-regulated in the cells exposed to gamma radiation, suggesting that genes transcriptionally modulated by IR were critical to regulating the biological consequences after IR. Failure to express these IR-responsive genes, such as by gene mutation, could seriously change the outcome of the post IR scenario and lead to carcinogenesis.

Expression profiling of chickpea genes differentially regulated during a resistance response to Ascochyta rabiei.

PubMed

Coram, Tristan E; Pang, Edwin C K

2006-11-01

Using microarray technology and a set of chickpea (Cicer arietinum L.) unigenes, grasspea (Lathyrus sativus L.) expressed sequence tags (ESTs) and lentil (Lens culinaris Med.) resistance gene analogues, the ascochyta blight (Ascochyta rabiei (Pass.) L.) resistance response was studied in four chickpea genotypes, including resistant, moderately resistant, susceptible and wild relative (Cicer echinospermum L.) genotypes. The experimental system minimized environmental effects and was conducted in reference design, in which samples from mock-inoculated controls acted as reference against post-inoculation samples. Robust data quality was achieved through the use of three biological replicates (including a dye swap), the inclusion of negative controls and strict selection criteria for differentially expressed genes, including a fold change cut-off determined by self-self hybridizations, Student's t-test and multiple testing correction (P < 0.05). Microarray observations were also validated by quantitative reverse transcriptase-polymerase chain reaction (RT-PCR). The time course expression patterns of 756 microarray features resulted in the differential expression of 97 genes in at least one genotype at one time point. k-means clustering grouped the genes into clusters of similar observations for each genotype, and comparisons between A. rabiei-resistant and A. rabiei-susceptible genotypes revealed potential gene 'signatures' predictive of effective A. rabiei resistance. These genes included several pathogenesis-related proteins, SNAKIN2 antimicrobial peptide, proline-rich protein, disease resistance response protein DRRG49-C, environmental stress-inducible protein, leucine-zipper protein, polymorphic antigen membrane protein, Ca-binding protein and several unknown proteins. The potential involvement of these genes and their pathways of induction are discussed. This study represents the first large-scale gene expression profiling in chickpea, and future work will focus on the functional validation of the genes of interest.

Mutations within the HBc gene of the hepatitis B virus: a study on Iranian patients.

PubMed

Zare-Bidaki, Mohammad; Ayoobi, Fatemeh; Hassanshahi, Gholamhossein; Arababadi, Mohammad Kazemi; Mirzaei, Tayebeh; Darehdori, Ahmad Shebanizade; Kennedy, Derek

2014-01-01

Hepatitis B virus (HBV) is a serious risk factor for several severe liver diseases such as cirrhosis and hepatocellular carcinoma. HBV, like other viruses, uses several mechanisms to escape from specific immune responses including the use of mutations in the genome which lead to epitope variations. There are several immune responses, including T helper cells, cytotoxic T lymphocytes, and B cells, against the core antigen of HBV (HBcAg) that can lead to HBV eradication. Therefore, mutations within the HBc gene can lead to escape from immune responses by HBV and, hence, understanding the prevalence of HBc mutations among a specific population can be helpful for future treatment and vaccination. This review addresses the recent information regarding the prevalence of mutations within the HBc gene among Iranian HBV infected patients. The data presented here was collected gene sequences reported from Iran to the NCBI nucleotide Gen Bank. Results showed that the prevalence of HBc gene mutations is frequent in Iranian HBV infected patients. Based on our searches it seems that escape from immune responses is a plausible reason for the high prevalence of HBc gene mutations among Iranian HBV infected patients.

Transcriptional response of Leptospira interrogans to iron limitation and characterization of a PerR homolog.

PubMed

Lo, Miranda; Murray, Gerald L; Khoo, Chen Ai; Haake, David A; Zuerner, Richard L; Adler, Ben

2010-11-01

Leptospirosis is a globally significant zoonosis caused by Leptospira spp. Iron is essential for growth of most bacterial species. Since iron availability is low in the host, pathogens have evolved complex iron acquisition mechanisms to survive and establish infection. In many bacteria, expression of iron uptake and storage proteins is regulated by Fur. L. interrogans encodes four predicted Fur homologs; we have constructed a mutation in one of these, la1857. We conducted microarray analysis to identify iron-responsive genes and to study the effects of la1857 mutation on gene expression. Under iron-limiting conditions, 43 genes were upregulated and 49 genes were downregulated in the wild type. Genes encoding proteins with predicted involvement in inorganic ion transport and metabolism (including TonB-dependent proteins and outer membrane transport proteins) were overrepresented in the upregulated list, while 54% of differentially expressed genes had no known function. There were 16 upregulated genes of unknown function which are absent from the saprophyte L. biflexa and which therefore may encode virulence-associated factors. Expression of iron-responsive genes was not significantly affected by mutagenesis of la1857, indicating that LA1857 is not a global regulator of iron homeostasis. Upregulation of heme biosynthetic genes and a putative catalase in the mutant suggested that LA1857 is more similar to PerR, a regulator of the oxidative stress response. Indeed, the la1857 mutant was more resistant to peroxide stress than the wild type. Our results provide insights into the role of iron in leptospiral metabolism and regulation of the oxidative stress response, including genes likely to be important for virulence.

Comparative Analysis of AhR-Mediated TCDD-Elicited Gene Expression in Human Liver Adult Stem Cells

PubMed Central

Kim, Suntae; Dere, Edward; Burgoon, Lyle D.; Chang, Chia-Cheng; Zacharewski, Timothy R.

2009-01-01

Time course and dose-response studies were conducted in HL1-1 cells, a human liver cell line with stem cell–like characteristics, to assess the differential gene expression elicited by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) compared with other established models. Cells were treated with 0.001, 0.01, 0.1, 1, 10, or 100nM TCDD or dimethyl sulfoxide vehicle control for 12 h for the dose-response study, or with 10nM TCDD or vehicle for 1, 2, 4, 8, 12, 24, or 48 h for the time course study. Elicited changes were monitored using a human cDNA microarray with 6995 represented genes. Empirical Bayes analysis identified 144 genes differentially expressed at one or more time points following treatment. Most genes exhibited dose-dependent responses including CYP1A1, CYP1B1, ALDH1A3, and SLC7A5 genes. Comparative analysis of HL1-1 differential gene expression to human HepG2 data identified 74 genes with comparable temporal expression profiles including 12 putative primary responses. HL1-1–specific changes were related to lipid metabolism and immune responses, consistent with effects elicited in vivo. Furthermore, comparative analysis of HL1-1 cells with mouse Hepa1c1c7 hepatoma cell lines and C57BL/6 hepatic tissue identified 18 and 32 commonly regulated orthologous genes, respectively, with functions associated with signal transduction, transcriptional regulation, metabolism and transport. Although some common pathways are affected, the results suggest that TCDD elicits species- and model-specific gene expression profiles. PMID:19684285

Genetic Factors of Autoimmune Thyroid Diseases in Japanese

PubMed Central

Ban, Yoshiyuki

2012-01-01

Autoimmune thyroid diseases (AITDs), including Graves' disease (GD) and Hashimoto's thyroiditis (HT), are caused by immune response to self-thyroid antigens and affect approximately 2–5% of the general population. Genetic susceptibility in combination with external factors, such as smoking, viral/bacterial infection, and chemicals, is believed to initiate the autoimmune response against thyroid antigens. Abundant epidemiological data, including family and twin studies, point to a strong genetic influence on the development of AITDs. Various techniques have been employed to identify genes contributing to the etiology of AITDs, including candidate gene analysis and whole genome screening. These studies have enabled the identification of several loci (genetic regions) that are linked to AITDs, and, in some of these loci, putative AITD susceptibility genes have been identified. Some of these genes/loci are unique to GD and HT and some are common to both diseases, indicating that there is a shared genetic susceptibility to GD and HT. Known AITD-susceptibility genes are classified into three groups: HLA genes, non-HLA immune-regulatory genes (e.g., CTLA-4, PTPN22, and CD40), and thyroid-specific genes (e.g., TSHR and Tg). In this paper, we will summarize the latest findings on AITD susceptibility genes in Japanese. PMID:22242199

Influence of white spot syndrome virus infection on hepatopancreas gene expression of `Huanghai No. 2' shrimp ( Fenneropenaeus chinensis)

NASA Astrophysics Data System (ADS)

Meng, Xianhong; Shi, Xiaoli; Kong, Jie; Luan, Sheng; Luo, Kun; Cao, Baoxiang; Liu, Ning; Lu, Xia; Li, Xupeng; Deng, Kangyu; Cao, Jiawang; Zhang, Yingxue; Zhang, Hengheng

2017-10-01

To elucidate the molecular response of shrimp hepatopancreas to white spot syndrome virus (WSSV) infection, microarray was applied to investigate the differentially expressed genes in the hepatopancreas of `Huanghai No. 2' ( Fenneropenaeus chinensis). A total of 59137 unigenes were designed onto a custom-made 60K Agilent chip. After infection, the gene expression profiles in the hepatopancreas of the shrimp with a lower viral load at early (48-96 h), peak (168-192 h) and late (264-288 h) infection phases were analyzed. Of 18704 differentially expressed genes, 6412 were annotated. In total, 5453 differentially expressed genes (1916 annotated) expressed at all three phases, and most of the annotated were either up- or down-regulated continuously. These genes function diversely in, for example, immune response, cytoskeletal system, signal transduction, stress resistance, protein synthesis and processing, metabolism among others. Some of the immune-related genes, including antilipopolysaccharide factor, Kazal-type proteinase inhibitor, C-type lectin and serine protease encoding genes, were up-regulated after WSSV infection. These genes have been reported to be involved in the anti-WSSV responses. The expression of genes related to the cytoskeletal system, including β-actin and myosin but without tubulin genes, were down-regulated after WSSV infection. Astakine was found for the first time in the WSSV-infected F. chinensis. To further confirm the expression of differentially expressed genes, quantitative real-time PCR was performed to test the expression of eight randomly selected genes and verified the reliability and accuracy of the microarray expression analysis. The data will provide valuable information to understanding the immune mechanism of shrimp's response to WSSV.

Gravity-regulated gene expression in Arabidopsis thaliana

NASA Astrophysics Data System (ADS)

Sederoff, Heike; Brown, Christopher S.; Heber, Steffen; Kajla, Jyoti D.; Kumar, Sandeep; Lomax, Terri L.; Wheeler, Benjamin; Yalamanchili, Roopa

Plant growth and development is regulated by changes in environmental signals. Plants sense environmental changes and respond to them by modifying gene expression programs to ad-just cell growth, differentiation, and metabolism. Functional expression of genes comprises many different processes including transcription, translation, post-transcriptional and post-translational modifications, as well as the degradation of RNA and proteins. Recently, it was discovered that small RNAs (sRNA, 18-24 nucleotides long), which are heritable and systemic, are key elements in regulating gene expression in response to biotic and abiotic changes. Sev-eral different classes of sRNAs have been identified that are part of a non-cell autonomous and phloem-mobile network of regulators affecting transcript stability, translational kinetics, and DNA methylation patterns responsible for heritable transcriptional silencing (epigenetics). Our research has focused on gene expression changes in response to gravistimulation of Arabidopsis roots. Using high-throughput technologies including microarrays and 454 sequencing, we iden-tified rapid changes in transcript abundance of genes as well as differential expression of small RNA in Arabidopsis root apices after minutes of reorientation. Some of the differentially regu-lated transcripts are encoded by genes that are important for the bending response. Functional mutants of those genes respond faster to reorientation than the respective wild type plants, indicating that these proteins are repressors of differential cell elongation. We compared the gravity responsive sRNAs to the changes in transcript abundances of their putative targets and identified several potential miRNA: target pairs. Currently, we are using mutant and transgenic Arabidopsis plants to characterize the function of those miRNAs and their putative targets in gravitropic and phototropic responses in Arabidopsis.

The Arabidopsis mediator complex subunits MED16, MED14, and MED2 regulate mediator and RNA polymerase II recruitment to CBF-responsive cold-regulated genes.

PubMed

Hemsley, Piers A; Hurst, Charlotte H; Kaliyadasa, Ewon; Lamb, Rebecca; Knight, Marc R; De Cothi, Elizabeth A; Steele, John F; Knight, Heather

2014-01-01

The Mediator16 (MED16; formerly termed SENSITIVE TO FREEZING6 [SFR6]) subunit of the plant Mediator transcriptional coactivator complex regulates cold-responsive gene expression in Arabidopsis thaliana, acting downstream of the C-repeat binding factor (CBF) transcription factors to recruit the core Mediator complex to cold-regulated genes. Here, we use loss-of-function mutants to show that RNA polymerase II recruitment to CBF-responsive cold-regulated genes requires MED16, MED2, and MED14 subunits. Transcription of genes known to be regulated via CBFs binding to the C-repeat motif/drought-responsive element promoter motif requires all three Mediator subunits, as does cold acclimation-induced freezing tolerance. In addition, these three subunits are required for low temperature-induced expression of some other, but not all, cold-responsive genes, including genes that are not known targets of CBFs. Genes inducible by darkness also required MED16 but required a different combination of Mediator subunits for their expression than the genes induced by cold. Together, our data illustrate that plants control transcription of specific genes through the action of subsets of Mediator subunits; the specific combination defined by the nature of the stimulus but also by the identity of the gene induced.

Expression profiles of adult T-cell leukemia–lymphoma and associations with clinical responses to zidovudine and interferon α

PubMed Central

ALIZADEH, ASH A.; BOHEN, SEAN P.; LOSSOS, CHEN; MARTINEZ-CLIMENT, JOSE A.; RAMOS, JUAN CARLOS; CUBEDO-GIL, ELENA; HARRINGTON, WILLIAM J.; LOSSOS, IZIDORE S.

2014-01-01

Adult T-cell leukemia–lymphoma (ATLL) is an HTLV-1-associated lymphoproliferative malignancy that is frequently fatal. We compared gene expression profiles (GEPs) of leukemic specimens from nine patients with ATLL at the time of diagnosis and immediately after combination therapy with zidovudine (AZT) and interferon α (IFNα). GEPs were also related to genetic aberrations determined by comparative genomic hybridization. We identified several genes anomalously over-expressed in the ATLL leukemic cells at the mRNA level, including LYN, CSPG2, and LMO2, and confirmed LMO2 expression in ATLL cells at the protein level. In vivo AZT–IFNα therapy evoked a marked induction of interferon-induced genes accompanied by repression of cell-cycle regulated genes, including those encoding ribosomal proteins. Remarkably, patients not responding to AZT–IFNα differed most from responding patients in lower expression of these same IFN-responsive genes, as well as components of the antigen processing and presentation apparatus. Demonstration of specific gene expression signatures associated with response to AZT–IFNα therapy may provide novel insights into the mechanisms of action in ATLL. PMID:20370541

Role of Adrenal Glucocorticoid Signaling in Prefrontal Cortex Gene Expression and Acute Behavioral Responses to Ethanol

PubMed Central

Costin, Blair N.; Wolen, Aaron R.; Fitting, Sylvia; Shelton, Keith L.; Miles, Michael F.

2012-01-01

Background Glucocorticoid hormones modulate acute and chronic behavioral and molecular responses to drugs of abuse including psychostimulants and opioids. There is growing evidence that glucocorticoids might also modulate behavioral responses to ethanol. Acute ethanol activates the HPA axis, causing release of adrenal glucocorticoid hormones. Our prior genomic studies suggest glucocorticoids play a role in regulating gene expression in the prefrontal cortex (PFC) of DBA2/J (D2) mice following acute ethanol administration. However, few studies have analyzed the role of glucocorticoid signaling in behavioral responses to acute ethanol. Such work could be significant, given the predictive value for level of response to acute ethanol in the risk for alcoholism. Methods We studied whether the glucocorticoid receptor (GR) antagonist, RU-486, or adrenalectomy (ADX) altered male D2 mouse behavioral responses to acute (locomotor activation, anxiolysis or loss-of-righting reflex (LORR)) or repeated (sensitization) ethanol treatment. Whole genome microarray analysis and bioinformatics approaches were used to identify PFC candidate genes possibly responsible for altered behavioral responses to ethanol following ADX. Results ADX and RU-486 both impaired acute ethanol (2 g/kg) induced locomotor activation in D2 mice without affecting basal locomotor activity. However, neither ADX nor RU-486 altered initiation of ethanol sensitization (locomotor activation or jump counts), ethanol-induced anxiolysis or LORR. ADX mice showed microarray gene expression changes in PFC that significantly overlapped with acute ethanol-responsive gene sets derived by our prior microarray studies. Q-rtPCR analysis verified that ADX decreased PFC expression of Fkbp5 while significantly increasing Gpr6 expression. In addition, high dose RU-486 pre-treatment blunted ethanol-induced Fkbp5 expression. Conclusions Our studies suggest that ethanol’s activation of adrenal glucocorticoid release and subsequent GR activation may partially modulate ethanol’s acute locomotor activation in male D2 mice. Furthermore, since adrenal glucocorticoid basal tone regulated PFC gene expression, including a significant set of acute ethanol-responsive genes, this suggests that glucocorticoid regulated PFC gene expression may be an important factor modulating acute behavioral responses to ethanol. PMID:22671426

Coding and non-coding gene regulatory networks underlie the immune response in liver cirrhosis.

PubMed

Gao, Bo; Zhang, Xueming; Huang, Yongming; Yang, Zhengpeng; Zhang, Yuguo; Zhang, Weihui; Gao, Zu-Hua; Xue, Dongbo

2017-01-01

Liver cirrhosis is recognized as being the consequence of immune-mediated hepatocyte damage and repair processes. However, the regulation of these immune responses underlying liver cirrhosis has not been elucidated. In this study, we used GEO datasets and bioinformatics methods to established coding and non-coding gene regulatory networks including transcription factor-/lncRNA-microRNA-mRNA, and competing endogenous RNA interaction networks. Our results identified 2224 mRNAs, 70 lncRNAs and 46 microRNAs were differentially expressed in liver cirrhosis. The transcription factor -/lncRNA- microRNA-mRNA network we uncovered that results in immune-mediated liver cirrhosis is comprised of 5 core microRNAs (e.g., miR-203; miR-219-5p), 3 transcription factors (i.e., FOXP3, ETS1 and FOS) and 7 lncRNAs (e.g., ENTS00000671336, ENST00000575137). The competing endogenous RNA interaction network we identified includes a complex immune response regulatory subnetwork that controls the entire liver cirrhosis network. Additionally, we found 10 overlapping GO terms shared by both liver cirrhosis and hepatocellular carcinoma including "immune response" as well. Interestingly, the overlapping differentially expressed genes in liver cirrhosis and hepatocellular carcinoma were enriched in immune response-related functional terms. In summary, a complex gene regulatory network underlying immune response processes may play an important role in the development and progression of liver cirrhosis, and its development into hepatocellular carcinoma.

Characterizing the stress/defense transcriptome of Arabidopsis

PubMed Central

Mahalingam, Ramamurthy; Gomez-Buitrago, AnaMaria; Eckardt, Nancy; Shah, Nigam; Guevara-Garcia, Angel; Day, Philip; Raina, Ramesh; Fedoroff, Nina V

2003-01-01

Background To understand the gene networks that underlie plant stress and defense responses, it is necessary to identify and characterize the genes that respond both initially and as the physiological response to the stress or pathogen develops. We used PCR-based suppression subtractive hybridization to identify Arabidopsis genes that are differentially expressed in response to ozone, bacterial and oomycete pathogens and the signaling molecules salicylic acid (SA) and jasmonic acid. Results We identified a total of 1,058 differentially expressed genes from eight stress cDNA libraries. Digital northern analysis revealed that 55% of the stress-inducible genes are rarely transcribed in unstressed plants and 17% of them were not previously represented in Arabidopsis expressed sequence tag databases. More than two-thirds of the genes in the stress cDNA collection have not been identified in previous studies as stress/defense response genes. Several stress-responsive cis-elements showed a statistically significant over-representation in the promoters of the genes in the stress cDNA collection. These include W- and G-boxes, the SA-inducible element, the abscisic acid response element and the TGA motif. Conclusions The stress cDNA collection comprises a broad repertoire of stress-responsive genes encoding proteins that are involved in both the initial and subsequent stages of the physiological response to abiotic stress and pathogens. This set of stress-, pathogen- and hormone-modulated genes is an important resource for understanding the genetic interactions underlying stress signaling and responses and may contribute to the characterization of the stress transcriptome through the construction of standardized specialized arrays. PMID:12620105

Gene therapy for prostate cancer: where are we now?

PubMed

Steiner, M S; Gingrich, J R

2000-10-01

The ability to recombine specifically and alter DNA sequences followed by techniques to transfer these sequences or even whole genes into normal and diseased cells has revolutionized medical research and ushered the clinicians of today into the age of gene therapy. We provide urologists a review of relevant background information, outline current treatment strategies and clinical trials, and delineate current challenges facing the field of gene therapy for advanced prostate cancer. We comprehensively reviewed the literature, including PubMed and recent abstract proceedings from national meetings, relevant to gene therapy and advanced prostate cancer. We selected for review literature representative of the principal scientific background for current gene therapy strategies and National Institutes of Health Recombinant DNA Advisory Committee approved clinical trials. Current prostate cancer gene therapy strategies include correcting aberrant gene expression, exploiting programmed cell death pathways, targeting critical cell biological functions, introducing toxic or cell lytic suicide genes, enhancing the immune system antitumor response and combining treatment with conventional cytotoxic chemotherapy or radiation therapy. Many challenges lie ahead for gene therapy, including improving DNA transfer efficiency to cells locally and at distant sites, enhancing levels of gene expression and overcoming immune responses that limit the time that genes are expressed. Nevertheless, despite these current challenges it is almost certain that gene therapy will be part of the urological armamentarium against prostate cancer in this century.

The Transcriptional Response of Drosophila melanogaster to Infection with the Sigma Virus (Rhabdoviridae)

PubMed Central

Baines, John F.; Roller, Julia; Saminadin-Peter, Sarah S.; Parsch, John; Jiggins, Francis M.

2009-01-01

Background Bacterial and fungal infections induce a potent immune response in Drosophila melanogaster, but it is unclear whether viral infections induce an antiviral immune response. Using microarrays, we examined the changes in gene expression in Drosophila that occur in response to infection with the sigma virus, a negative-stranded RNA virus (Rhabdoviridae) that occurs in wild populations of D. melanogaster. Principal Findings We detected many changes in gene expression in infected flies, but found no evidence for the activation of the Toll, IMD or Jak-STAT pathways, which control immune responses against bacteria and fungi. We identified a number of functional categories of genes, including serine proteases, ribosomal proteins and chorion proteins that were overrepresented among the differentially expressed genes. We also found that the sigma virus alters the expression of many more genes in males than in females. Conclusions These data suggest that either Drosophila do not mount an immune response against the sigma virus, or that the immune response is not controlled by known immune pathways. If the latter is true, the genes that we identified as differentially expressed after infection are promising candidates for controlling the host's response to the sigma virus. PMID:19718442

The transcriptional response of Drosophila melanogaster to infection with the sigma virus (Rhabdoviridae).

PubMed

Carpenter, Jennifer; Hutter, Stephan; Baines, John F; Roller, Julia; Saminadin-Peter, Sarah S; Parsch, John; Jiggins, Francis M

2009-08-31

Bacterial and fungal infections induce a potent immune response in Drosophila melanogaster, but it is unclear whether viral infections induce an antiviral immune response. Using microarrays, we examined the changes in gene expression in Drosophila that occur in response to infection with the sigma virus, a negative-stranded RNA virus (Rhabdoviridae) that occurs in wild populations of D. melanogaster. We detected many changes in gene expression in infected flies, but found no evidence for the activation of the Toll, IMD or Jak-STAT pathways, which control immune responses against bacteria and fungi. We identified a number of functional categories of genes, including serine proteases, ribosomal proteins and chorion proteins that were overrepresented among the differentially expressed genes. We also found that the sigma virus alters the expression of many more genes in males than in females. These data suggest that either Drosophila do not mount an immune response against the sigma virus, or that the immune response is not controlled by known immune pathways. If the latter is true, the genes that we identified as differentially expressed after infection are promising candidates for controlling the host's response to the sigma virus.

Early and delayed long-term transcriptional changes and short-term transient responses during cold acclimation in olive leaves.

PubMed

Leyva-Pérez, María de la O; Valverde-Corredor, Antonio; Valderrama, Raquel; Jiménez-Ruiz, Jaime; Muñoz-Merida, Antonio; Trelles, Oswaldo; Barroso, Juan Bautista; Mercado-Blanco, Jesús; Luque, Francisco

2015-02-01

Low temperature severely affects plant growth and development. To overcome this constraint, several plant species from regions having a cool season have evolved an adaptive response, called cold acclimation. We have studied this response in olive tree (Olea europaea L.) cv. Picual. Biochemical stress markers and cold-stress symptoms were detected after the first 24 h as sagging leaves. After 5 days, the plants were found to have completely recovered. Control and cold-stressed plants were sequenced by Illumina HiSeq 1000 paired-end technique. We also assembled a new olive transcriptome comprising 157,799 unigenes and found 6,309 unigenes differentially expressed in response to cold. Three types of response that led to cold acclimation were found: short-term transient response, early long-term response, and late long-term response. These subsets of unigenes were related to different biological processes. Early responses involved many cold-stress-responsive genes coding for, among many other things, C-repeat binding factor transcription factors, fatty acid desaturases, wax synthesis, and oligosaccharide metabolism. After long-term exposure to cold, a large proportion of gene down-regulation was found, including photosynthesis and plant growth genes. Up-regulated genes after long-term cold exposure were related to organelle fusion, nucleus organization, and DNA integration, including retrotransposons. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Association genetics and transcriptome analysis reveal a gibberellin-responsive pathway involved in regulating photosynthesis.

PubMed

Xie, Jianbo; Tian, Jiaxing; Du, Qingzhang; Chen, Jinhui; Li, Ying; Yang, Xiaohui; Li, Bailian; Zhang, Deqiang

2016-05-01

Gibberellins (GAs) regulate a wide range of important processes in plant growth and development, including photosynthesis. However, the mechanism by which GAs regulate photosynthesis remains to be understood. Here, we used multi-gene association to investigate the effect of genes in the GA-responsive pathway, as constructed by RNA sequencing, on photosynthesis, growth, and wood property traits, in a population of 435 Populus tomentosa By analyzing changes in the transcriptome following GA treatment, we identified many key photosynthetic genes, in agreement with the observed increase in measurements of photosynthesis. Regulatory motif enrichment analysis revealed that 37 differentially expressed genes related to photosynthesis shared two essential GA-related cis-regulatory elements, the GA response element and the pyrimidine box. Thus, we constructed a GA-responsive pathway consisting of 47 genes involved in regulating photosynthesis, including GID1, RGA, GID2, MYBGa, and 37 photosynthetic differentially expressed genes. Single nucleotide polymorphism (SNP)-based association analysis showed that 142 SNPs, representing 40 candidate genes in this pathway, were significantly associated with photosynthesis, growth, and wood property traits. Epistasis analysis uncovered interactions between 310 SNP-SNP pairs from 37 genes in this pathway, revealing possible genetic interactions. Moreover, a structural gene-gene matrix based on a time-course of transcript abundances provided a better understanding of the multi-gene pathway affecting photosynthesis. The results imply a functional role for these genes in mediating photosynthesis, growth, and wood properties, demonstrating the potential of combining transcriptome-based regulatory pathway construction and genetic association approaches to detect the complex genetic networks underlying quantitative traits. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

The Trophic Life Cycle Stage of the Opportunistic Fungal Pathogen Pneumocystis murina Hinders the Ability of Dendritic Cells To Stimulate CD4+ T Cell Responses

PubMed Central

Evans, Heather M.; Simpson, Andrew; Shen, Shu; Stromberg, Arnold J.; Pickett, Carol L.

2017-01-01

ABSTRACT The life cycle of the opportunistic fungal pathogen Pneumocystis murina consists of a trophic stage and an ascus-like cystic stage. Infection with the cyst stage induces proinflammatory immune responses, while trophic forms suppress the cytokine response to multiple pathogen-associated molecular patterns (PAMPs), including β-glucan. A targeted gene expression assay was used to evaluate the dendritic cell response following stimulation with trophic forms alone, with a normal mixture of trophic forms and cysts, or with β-glucan. We demonstrate that stimulation with trophic forms downregulated the expression of multiple genes normally associated with the response to infection, including genes encoding transcription factors. Trophic forms also suppressed the expression of genes related to antigen processing and presentation, including the gene encoding the major histocompatibility complex (MHC) class II transactivator, CIITA. Stimulation of dendritic cells with trophic forms, but not a mixture of trophic forms and cysts, reduced the expression of MHC class II and the costimulatory molecule CD40 on the surface of the cells. These defects in the expression of MHC class II and costimulatory molecules corresponded with a reduced capacity for trophic form-loaded dendritic cells to stimulate CD4+ T cell proliferation and polarization. These data are consistent with the delayed innate and adaptive responses previously observed in immunocompetent mice inoculated with trophic forms compared to responses in mice inoculated with a mixture of trophic forms and cysts. We propose that trophic forms broadly inhibit the ability of dendritic cells to fulfill their role as antigen-presenting cells. PMID:28694293

Transcriptomic analysis of grape (Vitis vinifera L.) leaves during and after recovery from heat stress.

PubMed

Liu, Guo-Tian; Wang, Jun-Fang; Cramer, Grant; Dai, Zhan-Wu; Duan, Wei; Xu, Hong-Guo; Wu, Ben-Hong; Fan, Pei-Ge; Wang, Li-Jun; Li, Shao-Hua

2012-09-28

Grapes are a major fruit crop around the world. Heat stress can significantly reduce grape yield and quality. Changes at the molecular level in response to heat stress and subsequent recovery are poorly understood. To elucidate the effect of heat stress and subsequent recovery on expression of genes by grape leaves representing the classic heat stress response and thermotolerance mechanisms, transcript abundance of grape (Vitis vinifera L.) leaves was quantified using the Affymetrix Grape Genome oligonucleotide microarray (15,700 transcripts), followed by quantitative Real-Time PCR validation for some transcript profiles. We found that about 8% of the total probe sets were responsive to heat stress and/or to subsequent recovery in grape leaves. The heat stress and recovery responses were characterized by different transcriptional changes. The number of heat stress-regulated genes was almost twice the number of recovery-regulated genes. The responsive genes identified in this study belong to a large number of important traits and biological pathways, including cell rescue (i.e., antioxidant enzymes), protein fate (i.e., HSPs), primary and secondary metabolism, transcription factors, signal transduction, and development. We have identified some common genes and heat shock factors (HSFs) that were modulated differentially by heat stress and recovery. Most HSP genes were upregulated by heat stress but were downregulated by the recovery. On the other hand, some specific HSP genes or HSFs were uniquely responsive to heat stress or recovery. The effect of heat stress and recovery on grape appears to be associated with multiple processes and mechanisms including stress-related genes, transcription factors, and metabolism. Heat stress and recovery elicited common up- or downregulated genes as well as unique sets of responsive genes. Moreover, some genes were regulated in opposite directions by heat stress and recovery. The results indicated HSPs, especially small HSPs, antioxidant enzymes (i.e., ascorbate peroxidase), and galactinol synthase may be important to thermotolerance of grape. HSF30 may be a key regulator for heat stress and recovery, while HSF7 and HSF1 may only be specific to recovery. The identification of heat stress or recovery responsive genes in this study provides novel insights into the molecular basis for heat tolerance in grape leaves.

Bioinformatic and expression analyses on carotenoid dioxygenase genes in fruit development and abiotic stress responses in Fragaria vesca.

PubMed

Wang, Yong; Ding, Guanqun; Gu, Tingting; Ding, Jing; Li, Yi

2017-08-01

Carotenoid dioxygenases, including 9-cis-epoxycarotenoid dioxygenases (NCEDs) and carotenoid cleavage dioxygenases (CCDs), can selectively cleave carotenoids into various apocarotenoid products that play important roles in fleshy fruit development and abiotic stress response. In this study, we identified 12 carotenoid dioxygenase genes in diploid strawberry Fragaria vesca, and explored their evolution with orthologous genes from nine other species. Phylogenetic analyses suggested that the NCED and CCDL groups moderately expanded during their evolution, whereas gene numbers of the CCD1, CCD4, CCD7, and CCD8 groups maintained conserved. We characterized the expression profiles of FveNCED and FveCCD genes during flower and fruit development, and in response to several abiotic stresses. FveNCED1 expression positively responded to osmotic, cold, and heat stresses, whereas FveNCED2 was only induced under cold stress. In contrast, FveNCED2 was the unique gene highly and continuously increasing in receptacle during fruit ripening, which co-occurred with the increase in endogenous abscisic acid (ABA) content previously reported in octoploid strawberry. The differential expression patterns suggested that FveNCED1 and FveNCED2 were key genes for ABA biosynthesis in abiotic stress responses and fruit ripening, respectively. FveCCD1 exhibited the highest expression in most stages of flower and fruit development, while the other FveCCDs were expressed in a subset of stages and tissues. Our study suggests distinct functions of FveNCED and FveCCD genes in fruit development and stress responses and lays a foundation for future study to understand the roles of these genes and their metabolites, including ABA and other apocarotenoid products, in the growth and development of strawberry.

Study on predictive role of AR and EGFR family genes with response to neoadjuvant chemotherapy in locally advanced breast cancer in Indian women.

PubMed

Singh, L C; Chakraborty, Anurupa; Mishra, Ashwani K; Devi, Thoudam Regina; Sugandhi, Nidhi; Chintamani, Chintamani; Bhatnagar, Dinesh; Kapur, Sujala; Saxena, Sunita

2012-06-01

Locally advanced breast cancer (LABC) remains a clinical challenge as the majority of patients with this diagnosis develop distant metastases despite appropriate therapy. We analyzed expression of steroid and growth hormone receptor genes as well as gene associated with metabolism of chemotherapeutic drugs in locally advanced breast cancer before and after neoadjuvant chemotherapy (NACT) to study whether there is a change in gene expression induced by chemotherapy and whether such changes are associated with tumor response or non-response. Fifty patients were included with locally advanced breast cancer treated with cyclophosphamide, adriamycin, 5-fluorouracil (CAF)-based neoadjuvant chemotherapy before surgery. Total RNA was extracted from 50 match samples of pre- and post-NACT tumor tissues. RNA expression levels of epidermal growth factor receptor family genes including EGFR, ERBB2, ERBB3, androgen receptor (AR), and multidrug-resistance gene 1 (MDR1) were determined by quantitative real-time reverse transcriptase-polymerase chain reaction. Responders show significantly high levels of pre-NACT AR gene expression (P = 0.016), which reduces following NACT (P = 0.008), and hence can serve as a useful tool for the prediction of the success of neoadjuvant chemotherapy in individual cancer patients with locally advanced breast carcinoma. Moreover, a significant post-therapeutic increase in the expression levels of EGFR and MDR1 gene in responders (P = 0.026 and P < 0.001) as well as in non-responders (P = 0.055, P = 0.001) suggests that expression of these genes changes during therapy but they do not have any impact on tumor response, whereas a post-therapeutic reduction was observed in AR in responders. This indicates an independent predictive role of AR with response to NACT.

Evolution of the metabolic and regulatory networks associated with oxygen availability in two phytopathogenic enterobacteria

PubMed Central

2012-01-01

Background Dickeya dadantii and Pectobacterium atrosepticum are phytopathogenic enterobacteria capable of facultative anaerobic growth in a wide range of O2 concentrations found in plant and natural environments. The transcriptional response to O2 remains under-explored for these and other phytopathogenic enterobacteria although it has been well characterized for animal-associated genera including Escherichia coli and Salmonella enterica. Knowledge of the extent of conservation of the transcriptional response across orthologous genes in more distantly related species is useful to identify rates and patterns of regulon evolution. Evolutionary events such as loss and acquisition of genes by lateral transfer events along each evolutionary branch results in lineage-specific genes, some of which may have been subsequently incorporated into the O2-responsive stimulon. Here we present a comparison of transcriptional profiles measured using densely tiled oligonucleotide arrays for two phytopathogens, Dickeya dadantii 3937 and Pectobacterium atrosepticum SCRI1043, grown to mid-log phase in MOPS minimal medium (0.1% glucose) with and without O2. Results More than 7% of the genes of each phytopathogen are differentially expressed with greater than 3-fold changes under anaerobic conditions. In addition to anaerobic metabolism genes, the O2 responsive stimulon includes a variety of virulence and pathogenicity-genes. Few of these genes overlap with orthologous genes in the anaerobic stimulon of E. coli. We define these as the conserved core, in which the transcriptional pattern as well as genetic architecture are well preserved. This conserved core includes previously described anaerobic metabolic pathways such as fermentation. Other components of the anaerobic stimulon show variation in genetic content, genome architecture and regulation. Notably formate metabolism, nitrate/nitrite metabolism, and fermentative butanediol production, differ between E. coli and the phytopathogens. Surprisingly, the overlap of the anaerobic stimulon between the phytopathogens is also relatively small considering that they are closely related, occupy similar niches and employ similar strategies to cause disease. There are cases of interesting divergences in the pattern of transcription of genes between Dickeya and Pectobacterium for virulence-associated subsystems including the type VI secretion system (T6SS), suggesting that fine-tuning of the stimulon impacts interaction with plants or competing microbes. Conclusions The small number of genes (an even smaller number if we consider operons) comprising the conserved core transcriptional response to O2 limitation demonstrates the extent of regulatory divergence prevalent in the Enterobacteriaceae. Our orthology-driven comparative transcriptomics approach indicates that the adaptive response in the eneterobacteria is a result of interaction of core (regulators) and lineage-specific (structural and regulatory) genes. Our subsystems based approach reveals that similar phenotypic outcomes are sometimes achieved by each organism using different genes and regulatory strategies. PMID:22439737

Microarray Analysis Reveals Characteristic Changes of Host Cell Gene Expression in Response to Attenuated Modified Vaccinia Virus Ankara Infection of Human HeLa Cells

PubMed Central

Guerra, Susana; López-Fernández, Luis A.; Conde, Raquel; Pascual-Montano, Alberto; Harshman, Keith; Esteban, Mariano

2004-01-01

The potential use of the modified vaccinia virus Ankara (MVA) strain as a live recombinant vector to deliver antigens and elicit protective immune responses against infectious diseases demands a comprehensive understanding of the effect of MVA infection on human host gene expression. We used microarrays containing more than 15,000 human cDNAs to identify gene expression changes in human HeLa cell cultures at 2, 6, and 16 h postinfection. Clustering of the 410 differentially regulated genes identified 11 discrete gene clusters with altered expression patterns after MVA infection. Clusters 1 and 2 (accounting for 16.59% [68 of 410] of the genes) contained 68 transcripts showing a robust induction pattern that was maintained during the course of infection. Changes in cellular gene transcription detected by microarrays after MVA infection were confirmed for selected genes by Northern blot analysis and by real-time reverse transcription-PCR. Upregulated transcripts in clusters 1 and 2 included 20 genes implicated in immune responses, including interleukin 1A (IL-1A), IL-6, IL-7, IL-8, and IL-15 genes. MVA infection also stimulated the expression of NF-κB and components of the NF-κB signal transduction pathway, including p50 and TRAF-interacting protein. A marked increase in the expression of histone family members was also induced during MVA infection. Expression of the Wiskott-Aldrich syndrome family members WAS, WASF1, and the small GTP-binding protein RAC-1, which are involved in actin cytoskeleton reorganization, was enhanced after MVA infection. This study demonstrates that MVA infection triggered the induction of groups of genes, some of which may be involved in host resistance and immune modulation during virus infection. PMID:15140980

Changes in expression of genes involved in apoptosis in activated human T-cells in response to modeled microgravity

NASA Astrophysics Data System (ADS)

Ward, Nancy E.; Pellis, Neal R.; Risin, Diana; Risin, Semyon A.; Liu, Wenbin

2006-09-01

Space flights result in remarkable effects on various physiological systems, including a decline in cellular immune functions. Previous studies have shown that exposure to microgravity, both true and modeled, can cause significant changes in numerous lymphocyte functions. The purpose of this study was to search for microgravity-sensitive genes, and specifically for apoptotic genes influenced by the microgravity environment and other genes related to immune response. The experiments were performed on anti-CD3 and IL-2 activated human T cells. To model microgravity conditions we have utilized the NASA rotating wall vessel bioreactor. Control lymphocytes were cultured in static 1g conditions. To assess gene expression we used DNA microarray chip technology. We had shown that multiple genes (approximately 3-8% of tested genes) respond to microgravity conditions by 1.5 and more fold change in expression. There is a significant variability in the response. However, a certain reproducible pattern in gene response could be identified. Among the genes showing reproducible changes in expression in modeled microgravity, several genes involved in apoptosis as well as in immune response were identified. These are IL-7 receptor, Granzyme B, Beta-3-endonexin, Apo2 ligand and STAT1. Possible functional consequences of these changes are discussed.

Comparative Transcriptomic and Phenotypic Analysis of the Responses of Bacillus cereus to Various Disinfectant Treatments▿ †

PubMed Central

Ceragioli, Mara; Mols, Maarten; Moezelaar, Roy; Ghelardi, Emilia; Senesi, Sonia; Abee, Tjakko

2010-01-01

Antimicrobial chemicals are widely applied to clean and disinfect food-contacting surfaces. However, the cellular response of bacteria to various disinfectants is unclear. In this study, the physiological and genome-wide transcriptional responses of Bacillus cereus ATCC 14579 exposed to four different disinfectants (benzalkonium chloride, sodium hypochlorite, hydrogen peroxide, and peracetic acid) were analyzed. For each disinfectant, concentrations leading to the attenuation of growth, growth arrest, and cell death were determined. The transcriptome analysis revealed that B. cereus, upon exposure to the selected concentrations of disinfectants, induced common and specific responses. Notably, the common response included genes involved in the general and oxidative stress responses. Exposure to benzalkonium chloride, a disinfectant known to induce membrane damage, specifically induced genes involved in fatty acid metabolism. Membrane damage induced by benzalkonium chloride was confirmed by fluorescence microscopy, and fatty acid analysis revealed modulation of the fatty acid composition of the cell membrane. Exposure to sodium hypochlorite induced genes involved in metabolism of sulfur and sulfur-containing amino acids, which correlated with the excessive oxidation of sulfhydryl groups observed in sodium hypochlorite-stressed cells. Exposures to hydrogen peroxide and peracetic acid induced highly similar responses, including the upregulation of genes involved in DNA damage repair and SOS response. Notably, hydrogen peroxide- and peracetic acid-treated cells exhibited high mutation rates correlating with the induced SOS response. PMID:20348290

Host genetic variation influences gene expression response to rhinovirus infection.

PubMed

Çalışkan, Minal; Baker, Samuel W; Gilad, Yoav; Ober, Carole

2015-04-01

Rhinovirus (RV) is the most prevalent human respiratory virus and is responsible for at least half of all common colds. RV infections may result in a broad spectrum of effects that range from asymptomatic infections to severe lower respiratory illnesses. The basis for inter-individual variation in the response to RV infection is not well understood. In this study, we explored whether host genetic variation is associated with variation in gene expression response to RV infections between individuals. To do so, we obtained genome-wide genotype and gene expression data in uninfected and RV-infected peripheral blood mononuclear cells (PBMCs) from 98 individuals. We mapped local and distant genetic variation that is associated with inter-individual differences in gene expression levels (eQTLs) in both uninfected and RV-infected cells. We focused specifically on response eQTLs (reQTLs), namely, genetic associations with inter-individual variation in gene expression response to RV infection. We identified local reQTLs for 38 genes, including genes with known functions in viral response (UBA7, OAS1, IRF5) and genes that have been associated with immune and RV-related diseases (e.g., ITGA2, MSR1, GSTM3). The putative regulatory regions of genes with reQTLs were enriched for binding sites of virus-activated STAT2, highlighting the role of condition-specific transcription factors in genotype-by-environment interactions. Overall, we suggest that the 38 loci associated with inter-individual variation in gene expression response to RV-infection represent promising candidates for affecting immune and RV-related respiratory diseases.

Irf8-Regulated Genomic Responses Drive Pathological Inflammation during Cerebral Malaria

PubMed Central

Radovanovic, Irena; Tam, Mifong; MacMicking, John D.; Stevenson, Mary M.; Gros, Philippe

2013-01-01

Interferon Regulatory Factor 8 (IRF8) is required for development, maturation and expression of anti-microbial defenses of myeloid cells. BXH2 mice harbor a severely hypomorphic allele at Irf8 (Irf8R294C) that causes susceptibility to infection with intracellular pathogens including Mycobacterium tuberculosis. We report that BXH2 are completely resistant to the development of cerebral malaria (ECM) following Plasmodium berghei ANKA infection. Comparative transcriptional profiling of brain RNA as well as chromatin immunoprecipitation and high-throughput sequencing (ChIP-seq) was used to identify IRF8-regulated genes whose expression is associated with pathological acute neuroinflammation. Genes increased by infection were strongly enriched for IRF8 binding sites, suggesting that IRF8 acts as a transcriptional activator in inflammatory programs. These lists were enriched for myeloid-specific pathways, including interferon responses, antigen presentation and Th1 polarizing cytokines. We show that inactivation of several of these downstream target genes (including the Irf8 transcription partner Irf1) confers protection against ECM. ECM-resistance in Irf8 and Irf1 mutants is associated with impaired myeloid and lymphoid cells function, including production of IL12p40 and IFNγ. We note strong overlap between genes bound and regulated by IRF8 during ECM and genes regulated in the lungs of M. tuberculosis infected mice. This IRF8-dependent network contains several genes recently identified as risk factors in acute and chronic human inflammatory conditions. We report a common core of IRF8-bound genes forming a critical inflammatory host-response network. PMID:23853600

Oxygen and tissue culture affect placental gene expression.

PubMed

Brew, O; Sullivan, M H F

2017-07-01

Placental explant culture is an important model for studying placental development and functions. We investigated the differences in placental gene expression in response to tissue culture, atmospheric and physiologic oxygen concentrations. Placental explants were collected from normal term (38-39 weeks of gestation) placentae with no previous uterine contractile activity. Placental transcriptomic expressions were evaluated with GeneChip ® Human Genome U133 Plus 2.0 arrays (Affymetrix). We uncovered sub-sets of genes that regulate response to stress, induction of apoptosis programmed cell death, mis-regulation of cell growth, proliferation, cell morphogenesis, tissue viability, and protection from apoptosis in cultured placental explants. We also identified a sub-set of genes with highly unstable pattern of expression after exposure to tissue culture. Tissue culture irrespective of oxygen concentration induced dichotomous increase in significant gene expression and increased enrichment of significant pathways and transcription factor targets (TFTs) including HIF1A. The effect was exacerbated by culture at atmospheric oxygen concentration, where further up-regulation of TFTs including PPARA, CEBPD, HOXA9 and down-regulated TFTs such as JUND/FOS suggest intrinsic heightened key biological and metabolic mechanisms such as glucose use, lipid biosynthesis, protein metabolism; apoptosis, inflammatory responses; and diminished trophoblast proliferation, differentiation, invasion, regeneration, and viability. These findings demonstrate that gene expression patterns differ between pre-culture and cultured explants, and the gene expression of explants cultured at atmospheric oxygen concentration favours stressed, pro-inflammatory and increased apoptotic transcriptomic response. Copyright © 2017 Elsevier Ltd. All rights reserved.

Dynamic gene expression analysis in a H1N1 influenza virus mouse pneumonia model.

PubMed

Bao, Yanyan; Gao, Yingjie; Shi, Yujing; Cui, Xiaolan

2017-06-01

H1N1, a major pathogenic subtype of influenza A virus, causes a respiratory infection in humans and livestock that can range from a mild infection to more severe pneumonia associated with acute respiratory distress syndrome. Understanding the dynamic changes in the genome and the related functional changes induced by H1N1 influenza virus infection is essential to elucidating the pathogenesis of this virus and thereby determining strategies to prevent future outbreaks. In this study, we filtered the significantly expressed genes in mouse pneumonia using mRNA microarray analysis. Using STC analysis, seven significant gene clusters were revealed, and using STC-GO analysis, we explored the significant functions of these seven gene clusters. The results revealed GOs related to H1N1 virus-induced inflammatory and immune functions, including innate immune response, inflammatory response, specific immune response, and cellular response to interferon-beta. Furthermore, the dynamic regulation relationships of the key genes in mouse pneumonia were revealed by dynamic gene network analysis, and the most important genes were filtered, including Dhx58, Cxcl10, Cxcl11, Zbp1, Ifit1, Ifih1, Trim25, Mx2, Oas2, Cd274, Irgm1, and Irf7. These results suggested that during mouse pneumonia, changes in the expression of gene clusters and the complex interactions among genes lead to significant changes in function. Dynamic gene expression analysis revealed key genes that performed important functions. These results are a prelude to advancements in mouse H1N1 influenza virus infection biology, as well as the use of mice as a model organism for human H1N1 influenza virus infection studies.

Genome-Wide Investigation and Expression Profiling of AP2/ERF Transcription Factor Superfamily in Foxtail Millet (Setaria italica L.)

PubMed Central

Lata, Charu; Mishra, Awdhesh Kumar; Muthamilarasan, Mehanathan; Bonthala, Venkata Suresh; Khan, Yusuf; Prasad, Manoj

2014-01-01

The APETALA2/ethylene-responsive element binding factor (AP2/ERF) family is one of the largest transcription factor (TF) families in plants that includes four major sub-families, namely AP2, DREB (dehydration responsive element binding), ERF (ethylene responsive factors) and RAV (Related to ABI3/VP). AP2/ERFs are known to play significant roles in various plant processes including growth and development and biotic and abiotic stress responses. Considering this, a comprehensive genome-wide study was conducted in foxtail millet (Setaria italica L.). A total of 171 AP2/ERF genes were identified by systematic sequence analysis and were physically mapped onto nine chromosomes. Phylogenetic analysis grouped AP2/ERF genes into six classes (I to VI). Duplication analysis revealed that 12 (∼7%) SiAP2/ERF genes were tandem repeated and 22 (∼13%) were segmentally duplicated. Comparative physical mapping between foxtail millet AP2/ERF genes and its orthologs of sorghum (18 genes), maize (14 genes), rice (9 genes) and Brachypodium (6 genes) showed the evolutionary insights of AP2/ERF gene family and also the decrease in orthology with increase in phylogenetic distance. The evolutionary significance in terms of gene-duplication and divergence was analyzed by estimating synonymous and non-synonymous substitution rates. Expression profiling of candidate AP2/ERF genes against drought, salt and phytohormones revealed insights into their precise and/or overlapping expression patterns which could be responsible for their functional divergence in foxtail millet. The study showed that the genes SiAP2/ERF-069, SiAP2/ERF-103 and SiAP2/ERF-120 may be considered as potential candidate genes for further functional validation as well for utilization in crop improvement programs for stress resistance since these genes were up-regulated under drought and salinity stresses in ABA dependent manner. Altogether the present study provides new insights into evolution, divergence and systematic functional analysis of AP2/ERF gene family at genome level in foxtail millet which may be utilized for improving stress adaptation and tolerance in millets, cereals and bioenergy grasses. PMID:25409524

Genome-wide investigation and expression profiling of AP2/ERF transcription factor superfamily in foxtail millet (Setaria italica L.).

PubMed

Lata, Charu; Mishra, Awdhesh Kumar; Muthamilarasan, Mehanathan; Bonthala, Venkata Suresh; Khan, Yusuf; Prasad, Manoj

2014-01-01

The APETALA2/ethylene-responsive element binding factor (AP2/ERF) family is one of the largest transcription factor (TF) families in plants that includes four major sub-families, namely AP2, DREB (dehydration responsive element binding), ERF (ethylene responsive factors) and RAV (Related to ABI3/VP). AP2/ERFs are known to play significant roles in various plant processes including growth and development and biotic and abiotic stress responses. Considering this, a comprehensive genome-wide study was conducted in foxtail millet (Setaria italica L.). A total of 171 AP2/ERF genes were identified by systematic sequence analysis and were physically mapped onto nine chromosomes. Phylogenetic analysis grouped AP2/ERF genes into six classes (I to VI). Duplication analysis revealed that 12 (∼7%) SiAP2/ERF genes were tandem repeated and 22 (∼13%) were segmentally duplicated. Comparative physical mapping between foxtail millet AP2/ERF genes and its orthologs of sorghum (18 genes), maize (14 genes), rice (9 genes) and Brachypodium (6 genes) showed the evolutionary insights of AP2/ERF gene family and also the decrease in orthology with increase in phylogenetic distance. The evolutionary significance in terms of gene-duplication and divergence was analyzed by estimating synonymous and non-synonymous substitution rates. Expression profiling of candidate AP2/ERF genes against drought, salt and phytohormones revealed insights into their precise and/or overlapping expression patterns which could be responsible for their functional divergence in foxtail millet. The study showed that the genes SiAP2/ERF-069, SiAP2/ERF-103 and SiAP2/ERF-120 may be considered as potential candidate genes for further functional validation as well for utilization in crop improvement programs for stress resistance since these genes were up-regulated under drought and salinity stresses in ABA dependent manner. Altogether the present study provides new insights into evolution, divergence and systematic functional analysis of AP2/ERF gene family at genome level in foxtail millet which may be utilized for improving stress adaptation and tolerance in millets, cereals and bioenergy grasses.

Response of Desulfovibrio vulgaris to Alkaline Stress

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stolyar, S.; He, Q.; He, Z.

2007-11-30

The response of exponentially growing Desulfovibrio vulgarisHildenborough to pH 10 stress was studied using oligonucleotidemicroarrays and a study set of mutants with genes suggested by microarraydata to be involved in the alkaline stress response deleted. The datashowed that the response of D. vulgaris to increased pH is generallysimilar to that of Escherichia coli but is apparently controlled byunique regulatory circuits since the alternative sigma factors (sigma Sand sigma E) contributing to this stress response in E. coli appear to beabsent in D. vulgaris. Genes previously reported to be up-regulated in E.coli were up-regulated in D. vulgaris; these genes included threemore » ATPasegenes and a tryptophan synthase gene. Transcription of chaperone andprotease genes (encoding ATP-dependent Clp and La proteases and DnaK) wasalso elevated in D. vulgaris. As in E. coli, genes involved in flagellumsynthesis were down-regulated. The transcriptional data also identifiedregulators, distinct from sigma S and sigma E, that are likely part of aD. vulgaris Hildenborough-specific stress response system.Characterization of a study set of mutants with genes implicated inalkaline stress response deleted confirmed that there was protectiveinvolvement of the sodium/proton antiporter NhaC-2, tryptophanase A, andtwo putative regulators/histidine kinases (DVU0331 andDVU2580).« less

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Transcriptomic Signatures of Tacaribe Virus-Infected Jamaican Fruit Bats

PubMed Central

Gerrard, Diana L.; Hawkinson, Ann; Sherman, Tyler; Modahl, Cassandra M.; Hume, Gretchen; Campbell, Corey L.; Schountz, Tony

2017-01-01

ABSTRACT Tacaribe virus (TCRV) is a mammalian arenavirus that was first isolated from artibeus bats in the 1950s. Subsequent experimental infection of Jamaican fruit bats (Artibeus jamaicensis) caused a disease similar to that of naturally infected bats. Although substantial attention has focused on bats as reservoir hosts of viruses that cause human disease, little is known about the interactions between bats and their pathogens. We performed a transcriptome-wide study to illuminate the response of Jamaican fruit bats experimentally infected with TCRV. Differential gene expression analysis of multiple tissues revealed global and organ-specific responses associated with innate antiviral responses, including interferon alpha/beta and Toll-like receptor signaling, activation of complement cascades, and cytokine signaling, among others. Genes encoding proteins involved in adaptive immune responses, such as gamma interferon signaling and costimulation of T cells by the CD28 family, were also altered in response to TCRV infection. Immunoglobulin gene expression was also elevated in the spleens of infected bats, including IgG, IgA, and IgE isotypes. These results indicate an active innate and adaptive immune response to TCRV infection occurred but did not prevent fatal disease. This de novo assembly provides a high-throughput data set of the Jamaican fruit bat and its host response to TCRV infection, which remains a valuable tool to understand the molecular signatures involved in antiviral responses in bats. IMPORTANCE As reservoir hosts of viruses associated with human disease, little is known about the interactions between bats and viruses. Using Jamaican fruit bats infected with Tacaribe virus (TCRV) as a model, we characterized the gene expression responses to infection in different tissues and identified pathways involved with the response to infection. This report is the most detailed gene discovery work in the species to date and the first to describe immune gene expression responses in bats during a pathogenic viral infection. PMID:28959737

Gingival transcriptome patterns during induction and resolution of experimental gingivitis in humans.

PubMed

Offenbacher, Steven; Barros, Silvana P; Paquette, David W; Winston, J Leslie; Biesbrock, Aaron R; Thomason, Ryan G; Gibb, Roger D; Fulmer, Andy W; Tiesman, Jay P; Juhlin, Kenton D; Wang, Shuo L; Reichling, Tim D; Chen, Ker-Sang; Ho, Begonia

2009-12-01

To our knowledge, changes in the patterns of whole-transcriptome gene expression that occur during the induction and resolution of experimental gingivitis in humans were not previously explored using bioinformatic tools. Gingival biopsy samples collected from 14 subjects during a 28-day stent-induced experimental gingivitis model, followed by treatment, and resolution at days 28 through 35 were analyzed using gene-expression arrays. Biopsy samples were collected at different sites within each subject at baseline (day 0), at the peak of gingivitis (day 28), and at resolution (day 35) and processed using whole-transcriptome gene-expression arrays. Gene-expression data were analyzed to identify biologic themes and pathways associated with changes in gene-expression profiles that occur during the induction and resolution of experimental gingivitis using bioinformatic tools. During disease induction and resolution, the dominant expression pathway was the immune response, with 131 immune response genes significantly up- or downregulated during induction, during resolution, or during both at P <0.05. During induction, there was significant transient increase in the expression of inflammatory and oxidative stress mediators, including interleukin (IL)-1 alpha (IL1A), IL-1 beta (IL1B), IL8, RANTES, colony stimulating factor 3 (CSF3), and superoxide dismutase 2 (SOD2), and a decreased expression of IP10, interferon inducible T-cell alpha chemoattractant (ITAC), matrix metalloproteinase 10 (MMP10), and beta 4 defensin (DEFB4). These genes reversed expression patterns upon resolution in parallel with the reversal of gingival inflammation. A relatively small subset (11.9%) of the immune response genes analyzed by array was transiently activated in response to biofilm overgrowth, suggesting a degree of specificity in the transcriptome-expression response. The fact that this same subset demonstrates a reversal in expression patterns during clinical resolution implicates these genes as being critical for maintaining tissue homeostasis at the biofilm-gingival interface. In addition to the immune response pathway as the dominant response theme, new candidate genes and pathways were identified as being selectively modulated in experimental gingivitis, including neural processes, epithelial defenses, angiogenesis, and wound healing.

Dehydrin gene expression provides an indicator of low temperature and drought stress: transcriptome-based analysis of barley (Hordeum vulgare L.).

PubMed

Tommasini, Livia; Svensson, Jan T; Rodriguez, Edmundo M; Wahid, Abdul; Malatrasi, Marina; Kato, Kenji; Wanamaker, Steve; Resnik, Josh; Close, Timothy J

2008-11-01

Low temperature and drought have major influences on plant growth and productivity. To identify barley genes involved in responses to these stresses and to specifically test the hypothesis that the dehydrin (Dhn) multigene family can serve as an indicator of the entire transcriptome response, we investigated the response of barley cv. Morex to: (1) gradual drought over 21 days and (2) low temperature including chilling, freeze-thaw cycles, and deacclimation over 33 days. We found 4,153 genes that responded to at least one component of these two stress regimes, about one fourth of all genes called "present" under any condition. About 44% (1,822 of 4,153) responded specifically to drought, whereas only 3.8% (158 of 4,153) were chilling specific and 2.8% (119 of 4,153) freeze-thaw specific, with 34.1% responsive to freeze-thaw and drought. The intersection between chilling and drought (31.9%) was somewhat smaller than the intersection between freeze-thaw and drought, implying an element of osmotic stress response to freeze-thaw. About 82.4% of the responsive genes were similar to Arabidopsis genes. The expression of 13 barley Dhn genes mirrored the global clustering of all transcripts, with specific combinations of Dhn genes providing an excellent indicator of each stress response. Data from these studies provide a robust reference data set for abiotic stress.

Response of Desulfovibrio vulgaris to Alkaline Stress▿ †

PubMed Central

Stolyar, Sergey; He, Qiang; Joachimiak, Marcin P.; He, Zhili; Yang, Zamin Koo; Borglin, Sharon E.; Joyner, Dominique C.; Huang, Katherine; Alm, Eric; Hazen, Terry C.; Zhou, Jizhong; Wall, Judy D.; Arkin, Adam P.; Stahl, David A.

2007-01-01

The response of exponentially growing Desulfovibrio vulgaris Hildenborough to pH 10 stress was studied using oligonucleotide microarrays and a study set of mutants with genes suggested by microarray data to be involved in the alkaline stress response deleted. The data showed that the response of D. vulgaris to increased pH is generally similar to that of Escherichia coli but is apparently controlled by unique regulatory circuits since the alternative sigma factors (sigma S and sigma E) contributing to this stress response in E. coli appear to be absent in D. vulgaris. Genes previously reported to be up-regulated in E. coli were up-regulated in D. vulgaris; these genes included three ATPase genes and a tryptophan synthase gene. Transcription of chaperone and protease genes (encoding ATP-dependent Clp and La proteases and DnaK) was also elevated in D. vulgaris. As in E. coli, genes involved in flagellum synthesis were down-regulated. The transcriptional data also identified regulators, distinct from sigma S and sigma E, that are likely part of a D. vulgaris Hildenborough-specific stress response system. Characterization of a study set of mutants with genes implicated in alkaline stress response deleted confirmed that there was protective involvement of the sodium/proton antiporter NhaC-2, tryptophanase A, and two putative regulators/histidine kinases (DVU0331 and DVU2580). PMID:17921288

Application of pharmacogenomics to vaccines

PubMed Central

Poland, Gregory A; Ovsyannikova, Inna G; Jacobson, Robert M

2009-01-01

The field of pharmacogenomics and pharmacogenetics provides a promising science base for vaccine research and development. A broad range of phenotype/genotype data combined with high-throughput genetic sequencing and bioinformatics are increasingly being integrated into this emerging field of vaccinomics. This paper discusses the hypothesis of the ‘immune response gene network’ and genetic (and bioinformatic) strategies to study associations between immune response gene polymorphisms and variations in humoral and cellular immune responses to prophylactic viral vaccines, such as measles–mumps–rubella, influenza, HIV, hepatitis B and smallpox. Immunogenetic studies reveal promising new vaccine targets by providing a better understanding of the mechanisms by which gene polymorphisms may influence innate and adaptive immune responses to vaccines, including vaccine failure and vaccine-associated adverse events. Additional benefits from vaccinomic studies include the development of personalized vaccines, the development of novel vaccines and the development of novel vaccine adjuvants. PMID:19450131

Identification of fever and vaccine-associated gene interaction networks using ontology-based literature mining

PubMed Central

2012-01-01

Background Fever is one of the most common adverse events of vaccines. The detailed mechanisms of fever and vaccine-associated gene interaction networks are not fully understood. In the present study, we employed a genome-wide, Centrality and Ontology-based Network Discovery using Literature data (CONDL) approach to analyse the genes and gene interaction networks associated with fever or vaccine-related fever responses. Results Over 170,000 fever-related articles from PubMed abstracts and titles were retrieved and analysed at the sentence level using natural language processing techniques to identify genes and vaccines (including 186 Vaccine Ontology terms) as well as their interactions. This resulted in a generic fever network consisting of 403 genes and 577 gene interactions. A vaccine-specific fever sub-network consisting of 29 genes and 28 gene interactions was extracted from articles that are related to both fever and vaccines. In addition, gene-vaccine interactions were identified. Vaccines (including 4 specific vaccine names) were found to directly interact with 26 genes. Gene set enrichment analysis was performed using the genes in the generated interaction networks. Moreover, the genes in these networks were prioritized using network centrality metrics. Making scientific discoveries and generating new hypotheses were possible by using network centrality and gene set enrichment analyses. For example, our study found that the genes in the generic fever network were more enriched in cell death and responses to wounding, and the vaccine sub-network had more gene enrichment in leukocyte activation and phosphorylation regulation. The most central genes in the vaccine-specific fever network are predicted to be highly relevant to vaccine-induced fever, whereas genes that are central only in the generic fever network are likely to be highly relevant to generic fever responses. Interestingly, no Toll-like receptors (TLRs) were found in the gene-vaccine interaction network. Since multiple TLRs were found in the generic fever network, it is reasonable to hypothesize that vaccine-TLR interactions may play an important role in inducing fever response, which deserves a further investigation. Conclusions This study demonstrated that ontology-based literature mining is a powerful method for analyzing gene interaction networks and generating new scientific hypotheses. PMID:23256563

The Arabidopsis Mediator Complex Subunits MED16, MED14, and MED2 Regulate Mediator and RNA Polymerase II Recruitment to CBF-Responsive Cold-Regulated Genes[C][W][OPEN

PubMed Central

Hemsley, Piers A.; Hurst, Charlotte H.; Kaliyadasa, Ewon; Lamb, Rebecca; Knight, Marc R.; De Cothi, Elizabeth A.; Steele, John F.; Knight, Heather

2014-01-01

The Mediator16 (MED16; formerly termed SENSITIVE TO FREEZING6 [SFR6]) subunit of the plant Mediator transcriptional coactivator complex regulates cold-responsive gene expression in Arabidopsis thaliana, acting downstream of the C-repeat binding factor (CBF) transcription factors to recruit the core Mediator complex to cold-regulated genes. Here, we use loss-of-function mutants to show that RNA polymerase II recruitment to CBF-responsive cold-regulated genes requires MED16, MED2, and MED14 subunits. Transcription of genes known to be regulated via CBFs binding to the C-repeat motif/drought-responsive element promoter motif requires all three Mediator subunits, as does cold acclimation–induced freezing tolerance. In addition, these three subunits are required for low temperature–induced expression of some other, but not all, cold-responsive genes, including genes that are not known targets of CBFs. Genes inducible by darkness also required MED16 but required a different combination of Mediator subunits for their expression than the genes induced by cold. Together, our data illustrate that plants control transcription of specific genes through the action of subsets of Mediator subunits; the specific combination defined by the nature of the stimulus but also by the identity of the gene induced. PMID:24415770

Transcriptome profiling in imipenem-selected Acinetobacter baumannii.

PubMed

Chang, Kai-Chih; Kuo, Han-Yueh; Tang, Chuan Yi; Chang, Cheng-Wei; Lu, Chia-Wei; Liu, Chih-Chin; Lin, Huei-Ru; Chen, Kuan-Hsueh; Liou, Ming-Li

2014-09-26

Carbapenem-resistance in Acinetobacter baumannii has gradually become a global challenge. To identify the genes involved in carbapenem resistance in A. baumannii, the transcriptomic responses of the completely sequenced strain ATCC 17978 selected with 0.5 mg/L (IPM-2 m) and 2 mg/L (IPM-8 m) imipenem were investigated using RNA-sequencing to identify differences in the gene expression patterns. A total of 88 and 68 genes were differentially expressed in response to IPM-2 m and IPM-8 m selection, respectively. Among the expressed genes, 50 genes were highly expressed in IPM-2 m, 30 genes were highly expressed in IPM-8 m, and 38 genes were expressed common in both strains. Six groups of genes were simultaneously expressed in IPM-2 m and IPM-8 m mutants. The three gene groups involved in DNA recombination were up-regulated, including recombinase, transposase and DNA repair, and beta-lactamase OXA-95 and homologous recombination. The remaining gene groups involved in biofilm formation were down-regulated, including quorum sensing, secretion systems, and the csu operon. The antibiotic resistance determinants, including RND efflux transporters and multidrug resistance pumps, were over-expressed in response to IPM-2 m selection, followed by a decrease in response to IPM-8 m selection. Among the genes over-expressed in both strains, blaOXA-95, previously clustered with the blaOXA-51-like family, showed 14-fold (IPM-2 m) to 330-fold (IPM-8 m) over-expression. The expression of blaOXA-95 in IPM-2 m and IPM-8 m cells was positively correlated with the rate of imipenem hydrolysis, as demonstrated through Liquid Chromatography-Mass Spectrometry/Mass Spectrometry, suggesting that blaOXA-95 plays a critical role in conferring carbapenem resistance. In addition, A. baumannii shows an inverse relationship between carbapenem resistance and biofilm production. Gene recombination and blaOXA-95 play critical roles in carbapenem resistance in A. baumannii. Taken together, the results of the present study provide a foundation for future studies of the network systems associated with carbapenem resistance.

Immune response of the Caribbean sea fan, Gorgonia ventalina, exposed to an Aplanochytrium parasite as revealed by transcriptome sequencing

PubMed Central

Burge, Colleen A.; Mouchka, Morgan E.; Harvell, C. Drew; Roberts, Steven

2013-01-01

Coral reef communities are undergoing marked declines due to a variety of stressors including disease. The sea fan coral, Gorgonia ventalina, is a tractable study system to investigate mechanisms of immunity to a naturally occurring pathogen. Functional studies in Gorgonia ventalina immunity indicate that several key pathways and cellular components are involved in response to natural microbial invaders, although to date the functional and regulatory pathways remain largely un-described. This study used short-read sequencing (Illumina GAIIx) to identify genes involved in the response of G. ventalina to a naturally occurring Aplanochytrium spp. parasite. De novo assembly of the G. ventalina transcriptome yielded 90,230 contigs of which 40,142 were annotated. RNA-Seq analysis revealed 210 differentially expressed genes in sea fans exposed to the Aplanochytrium parasite. Differentially expressed genes involved in immunity include pattern recognition molecules, anti-microbial peptides, and genes involved in wound repair and reactive oxygen species formation. Gene enrichment analysis indicated eight biological processes were enriched representing 36 genes, largely involved with protein translation and energy production. This is the first report using high-throughput sequencing to characterize the host response of a coral to a natural pathogen. Furthermore, we have generated the first transcriptome for a soft (octocoral or non-scleractinian) coral species. Expression analysis revealed genes important in invertebrate innate immune pathways, as well as those whose role is previously un-described in cnidarians. This resource will be valuable in characterizing G. ventalina immune response to infection and co-infection of pathogens in the context of environmental change. PMID:23898300

Identification, characterization, and expression analysis of calmodulin and calmodulin-like genes in grapevine (Vitis vinifera) reveal likely roles in stress responses.

PubMed

Vandelle, Elodie; Vannozzi, Alessandro; Wong, Darren; Danzi, Davide; Digby, Anne-Marie; Dal Santo, Silvia; Astegno, Alessandra

2018-06-04

Calcium (Ca 2+ ) is an ubiquitous key second messenger in plants, where it modulates many developmental and adaptive processes in response to various stimuli. Several proteins containing Ca 2+ binding domain have been identified in plants, including calmodulin (CaM) and calmodulin-like (CML) proteins, which play critical roles in translating Ca 2+ signals into proper cellular responses. In this work, a genome-wide analysis conducted in Vitis vinifera identified three CaM- and 62 CML-encoding genes. We assigned gene family nomenclature, analyzed gene structure, chromosomal location and gene duplication, as well as protein motif organization. The phylogenetic clustering revealed a total of eight subgroups, including one unique clade of VviCaMs distinct from VviCMLs. VviCaMs were found to contain four EF-hand motifs whereas VviCML proteins have one to five. Most of grapevine CML genes were intronless, while VviCaMs were intron rich. All the genes were well spread among the 19 grapevine chromosomes and displayed a high level of duplication. The expression profiling of VviCaM/VviCML genes revealed a broad expression pattern across all grape organs and tissues at various developmental stages, and a significant modulation in biotic stress-related responses. Our results highlight the complexity of CaM/CML protein family also in grapevine, supporting the versatile role of its different members in modulating cellular responses to various stimuli, in particular to biotic stresses. This work lays the foundation for further functional and structural studies on specific grapevine CaMs/CMLs in order to better understand the role of Ca 2+ -binding proteins in grapevine and to explore their potential for further biotechnological applications. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Identification of Differential Gene Expression Patterns after Acute Exposure to High and Low Doses of Low-LET Ionizing Radiation in a Reconstituted Human Skin Tissue

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tilton, Susan C.; Markillie, Lye Meng; Hays, Spencer

Our goal here was to identify dose and temporal dependent radiation responses in a complex tissue, reconstituted human skin. Direct sequencing of RNA (RNA-seq) was used to quantify altered transcripts following exposure to 0.1, 2 and 10 Gy of ionizing radiation at 3 and 8 hours. These doses include a low dose in the range of some medical diagnostic procedures (0.1 Gy), a dose typically received during radiotherapy (2.0 Gy) and a lethal dose (10 Gy). These doses could be received after an intentional or accidental radiation exposure and biomarkers are needed to rapidly and accurately triage exposed individuals. Amore » total of 1701 genes were deemed to be significantly affected by high dose radiation exposure with the majority of genes affected at 10 Gy. A group of 29 genes including GDF15, BBC3, PPM1D, FDXR, GADD45A, MDM2, CDKN1A, TP53INP1, CYCSP27, SESN1, SESN2, PCNA, and AEN were similarly altered at both 2 and 10 Gy, but not 0.1 Gy, at multiple time points. A much larger group of up regulated genes, including those involved in inflammatory responses, was significantly altered only after a 10 Gy exposure. At high doses, down regulated genes were associated with cell cycle regulation and exhibited an apparent linear response between 2 and 10 Gy. While only a handful of genes were significantly affected by 0.1 Gy exposure using stringent statistical filters, groups of related genes regulating cell cycle progression and inflammatory responses consistently exhibited opposite trends in their regulation compared to the high dose exposures. Differential regulation of PLK1 signaling at low and high doses was confirmed using qRT-PCR. These results indicate that some alterations in gene expression are qualitatively different at low and high doses of radiation in this model system.« less

Genome-wide screen for inositol auxotrophy in Saccharomyces cerevisiae implicates lipid metabolism in stress response signaling.

PubMed

Villa-García, Manuel J; Choi, Myung Sun; Hinz, Flora I; Gaspar, María L; Jesch, Stephen A; Henry, Susan A

2011-02-01

Inositol auxotrophy (Ino(-) phenotype) in budding yeast has classically been associated with misregulation of INO1 and other genes involved in lipid metabolism. To identify all non-essential yeast genes that are necessary for growth in the absence of inositol, we carried out a genome-wide phenotypic screening for deletion mutants exhibiting Ino(-) phenotypes under one or more growth conditions. We report the identification of 419 genes, including 385 genes not previously reported, which exhibit this phenotype when deleted. The identified genes are involved in a wide range of cellular processes, but are particularly enriched in those affecting transcription, protein modification, membrane trafficking, diverse stress responses, and lipid metabolism. Among the Ino(-) mutants involved in stress response, many exhibited phenotypes that are strengthened at elevated temperature and/or when choline is present in the medium. The role of inositol in regulation of lipid metabolism and stress response signaling is discussed.

Endogenous small RNAs and antibacterial immunity in plants.

PubMed

Jin, Hailing

2008-08-06

Small RNAs are non-coding regulatory RNA molecules that control gene expression by mediating mRNA degradation, translational inhibition, or chromatin modification. Virus-derived small RNAs induce silencing of viral RNAs and are essential for antiviral defense in both animal and plant systems. The role of host endogenous small RNAs on antibacterial immunity has only recently been recognized. Host disease resistance and defense responses are achieved by activation and repression of a large array of genes. Certain endogenous small RNAs in plants, including microRNAs (miRNAs) and small interfering RNAs (siRNAs), are induced or repressed in response to pathogen attack and subsequently regulate the expression of genes involved in disease resistance and defense responses by mediating transcriptional or post-transcriptional gene silencing. Thus, these small RNAs play an important role in gene expression reprogramming in plant disease resistance and defense responses. This review focuses on the recent findings of plant endogenous small RNAs in antibacterial immunity.

Automated Discovery of Functional Generality of Human Gene Expression Programs

PubMed Central

Gerber, Georg K; Dowell, Robin D; Jaakkola, Tommi S; Gifford, David K

2007-01-01

An important research problem in computational biology is the identification of expression programs, sets of co-expressed genes orchestrating normal or pathological processes, and the characterization of the functional breadth of these programs. The use of human expression data compendia for discovery of such programs presents several challenges including cellular inhomogeneity within samples, genetic and environmental variation across samples, uncertainty in the numbers of programs and sample populations, and temporal behavior. We developed GeneProgram, a new unsupervised computational framework based on Hierarchical Dirichlet Processes that addresses each of the above challenges. GeneProgram uses expression data to simultaneously organize tissues into groups and genes into overlapping programs with consistent temporal behavior, to produce maps of expression programs, which are sorted by generality scores that exploit the automatically learned groupings. Using synthetic and real gene expression data, we showed that GeneProgram outperformed several popular expression analysis methods. We applied GeneProgram to a compendium of 62 short time-series gene expression datasets exploring the responses of human cells to infectious agents and immune-modulating molecules. GeneProgram produced a map of 104 expression programs, a substantial number of which were significantly enriched for genes involved in key signaling pathways and/or bound by NF-κB transcription factors in genome-wide experiments. Further, GeneProgram discovered expression programs that appear to implicate surprising signaling pathways or receptor types in the response to infection, including Wnt signaling and neurotransmitter receptors. We believe the discovered map of expression programs involved in the response to infection will be useful for guiding future biological experiments; genes from programs with low generality scores might serve as new drug targets that exhibit minimal “cross-talk,” and genes from high generality programs may maintain common physiological responses that go awry in disease states. Further, our method is multipurpose, and can be applied readily to novel compendia of biological data. PMID:17696603

Comparative analysis of chrysanthemum transcriptome in response to three RNA viruses: Cucumber mosaic virus, Tomato spotted wilt virus and Potato virus X.

PubMed

Choi, Hoseong; Jo, Yeonhwa; Lian, Sen; Jo, Kyoung-Min; Chu, Hyosub; Yoon, Ju-Yeon; Choi, Seung-Kook; Kim, Kook-Hyung; Cho, Won Kyong

2015-06-01

The chrysanthemum is one of popular flowers in the world and a host for several viruses. So far, molecular interaction studies between the chrysanthemum and viruses are limited. In this study, we carried out a transcriptome analysis of chrysanthemum in response to three different viruses including Cucumber mosaic virus (CMV), Tomato spotted wilt virus (TSWV) and Potato virus X (PVX). A chrysanthemum 135K microarray derived from expressed sequence tags was successfully applied for the expression profiles of the chrysanthemum at early stage of virus infection. Finally, we identified a total of 125, 70 and 124 differentially expressed genes (DEGs) for CMV, TSWV and PVX, respectively. Many DEGs were virus specific; however, 33 DEGs were commonly regulated by three viruses. Gene ontology (GO) enrichment analysis identified a total of 132 GO terms, and of them, six GO terms related stress response and MCM complex were commonly identified for three viruses. Several genes functioning in stress response such as chitin response and ethylene mediated signaling pathway were up-regulated indicating their involvement in establishment of host immune system. In particular, TSWV infection significantly down-regulated genes related to DNA metabolic process including DNA replication, chromatin organization, histone modification and cytokinesis, and they are mostly targeted to nucleosome and MCM complex. Taken together, our comparative transcriptome analysis revealed several genes related to hormone mediated viral stress response and DNA modification. The identified chrysanthemums genes could be good candidates for further functional study associated with resistant to various plant viruses.

Early-onset L-dopa-responsive parkinsonism with pyramidal signs due to ATP13A2, PLA2G6, FBXO7 and spatacsin mutations.

PubMed

Paisán-Ruiz, Coro; Guevara, Rocio; Federoff, Monica; Hanagasi, Hasmet; Sina, Fardaz; Elahi, Elahe; Schneider, Susanne A; Schwingenschuh, Petra; Bajaj, Nin; Emre, Murat; Singleton, Andrew B; Hardy, John; Bhatia, Kailash P; Brandner, Sebastian; Lees, Andrew J; Houlden, Henry

2010-09-15

Seven autosomal recessive genes associated with juvenile and young-onset Levodopa-responsive parkinsonism have been identified. Mutations in PRKN, DJ-1, and PINK1 are associated with a rather pure parkinsonian phenotype, and have a more benign course with sustained treatment response and absence of dementia. On the other hand, Kufor-Rakeb syndrome has additional signs, which distinguish it clearly from Parkinson's disease including supranuclear vertical gaze palsy, myoclonic jerks, pyramidal signs, and cognitive impairment. Neurodegeneration with brain iron accumulation type I (Hallervorden-Spatz syndrome) due to mutations in PANK2 gene may share similar features with Kufor-Rakeb syndrome. Mutations in three other genes, PLA2G6 (PARK14), FBXO7 (PARK15), and Spatacsin (SPG11) also produce clinical similar phenotypes in that they presented with rapidly progressive parkinsonism, initially responsive to Levodopa treatment but later, developed additional features including cognitive decline and loss of Levodopa responsiveness. Here, using homozygosity mapping and sequence analysis in families with complex parkinsonisms, we identified genetic defects in the ATP13A2 (1 family), PLA2G6 (1 family) FBXO7 (2 families), and SPG11 (1 family). The genetic heterogeneity was surprising given their initially common clinical features. On careful review, we found the FBXO7 cases to have a phenotype more similar to PRKN gene associated parkinsonism. The ATP13A2 and PLA2G6 cases were more seriously disabled with additional swallowing problems, dystonic features, severe in some, and usually pyramidal involvement including pyramidal weakness. These data suggest that these four genes account for many cases of Levodopa responsive parkinsonism with pyramidal signs cases formerly categorized clinically as pallido-pyramidal syndrome. © 2010 Movement Disorder Society.

Early-Onset L-dopa-Responsive Parkinsonism with Pyramidal Signs Due to ATP13A2, PLA2G6, FBXO7 and Spatacsin Mutations

PubMed Central

Paisán-Ruiz, Coro; Guevara, Rocio; Federoff, Monica; Hanagasi, Hasmet; Sina, Fardaz; Elahi, Elahe; Schneider, Susanne A.; Schwingenschuh, Petra; Bajaj, Nin; Emre, Murat; Singleton, Andrew B.; Hardy, John; Bhatia, Kailash P.; Brandner, Sebastian; Lees, Andrew J.; Houlden, Henry

2018-01-01

Seven autosomal recessive genes associated with juvenile and young-onset Levodopa-responsive parkinsonism have been identified. Mutations in PRKN, DJ-1, and PINK1 are associated with a rather pure parkinsonian phenotype, and have a more benign course with sustained treatment response and absence of dementia. On the other hand, Kufor-Rakeb syndrome has additional signs, which distinguish it clearly from Parkinson’s disease including supranu-clear vertical gaze palsy, myoclonic jerks, pyramidal signs, and cognitive impairment. Neurodegeneration with brain iron accumulation type I (Hallervorden-Spatz syndrome) due to mutations in PANK2 gene may share similar features with Kufor-Rakeb syndrome. Mutations in three other genes, PLA2G6 (PARK14), FBXO7 (PARK15), and Spatacsin (SPG11) also produce clinical similar phenotypes in that they presented with rapidly progressive parkinsonism, initially responsive to Levodopa treatment but later, developed additional features including cognitive decline and loss of Levodopa responsiveness. Here, using homozygosity mapping and sequence analysis in families with complex parkinsonisms, we identified genetic defects in the ATP13A2 (1 family), PLA2G6 (1 family) FBXO7 (2 families), and SPG11 (1 family). The genetic heterogeneity was surprising given their initially common clinical features. On careful review, we found the FBXO7 cases to have a phenotype more similar to PRKN gene associated parkinsonism. The ATP13A2 and PLA2G6 cases were more seriously disabled with additional swallowing problems, dystonic features, severe in some, and usually pyramidal involvement including pyramidal weakness. These data suggest that these four genes account for many cases of Levodopa responsive parkinsonism with pyramidal signs cases formerly categorized clinically as pallido-pyramidal syndrome. 3 2010 Movement Disorder Society PMID:20669327

Recent advances in understanding vitiligo.

PubMed

Manga, Prashiela; Elbuluk, Nada; Orlow, Seth J

2016-01-01

Vitiligo, an acquired depigmentation disorder, manifests as white macules on the skin and can cause significant psychological stress and stigmatization. Recent advances have shed light on key components that drive disease onset and progression as well as therapeutic approaches. Vitiligo can be triggered by stress to the melanin pigment-producing cells of the skin, the melanocytes. The triggers, which range from sunburn to mechanical trauma and chemical exposures, ultimately cause an autoimmune response that targets melanocytes, driving progressive skin depigmentation. The most significant progress in our understanding of disease etiology has been made on three fronts: (1) identifying cellular responses to stress, including antioxidant pathways and the unfolded protein response (UPR), as key players in disease onset, (2) characterizing immune responses that target melanocytes and drive disease progression, and (3) identifying major susceptibility genes. The current model for vitiligo pathogenesis postulates that oxidative stress causes cellular disruptions, including interruption of protein maturation in the endoplasmic reticulum (ER), leading to the activation of the UPR and expression of UPR-regulated chemokines such as interleukin 6 (IL-6) and IL-8. These chemokines recruit immune components to the skin, causing melanocytes to be targeted for destruction. Oxidative stress can further increase melanocyte targeting by promoting antigen presentation. Two key components of the autoimmune response that promote disease progression are the interferon (IFN)-γ/CXCL10 axis and IL-17-mediated responses. Several genome-wide association studies support a role for these pathways, with the antioxidant gene NRF2, UPR gene XBP1, and numerous immune-related genes including class I and class II major histocompatibility genes associated with a risk for developing vitiligo. Novel approaches to promote repigmentation in vitiligo are being investigated and may yield effective, long-lasting therapies.

Bridging the gap between high-throughput genetic and transcriptional data reveals cellular pathways responding to alpha-synuclein toxicity

PubMed Central

Yeger-Lotem, Esti; Riva, Laura; Su, Linhui Julie; Gitler, Aaron D.; Cashikar, Anil; King, Oliver D.; Auluck, Pavan K.; Geddie, Melissa L.; Valastyan, Julie S.; Karger, David R.; Lindquist, Susan; Fraenkel, Ernest

2009-01-01

Cells respond to stimuli by changes in various processes, including signaling pathways and gene expression. Efforts to identify components of these responses increasingly depend on mRNA profiling and genetic library screens, yet the functional roles of the genes identified by these assays often remain enigmatic. By comparing the results of these two assays across various cellular responses, we found that they are consistently distinct. Moreover, genetic screens tend to identify response regulators, while mRNA profiling frequently detects metabolic responses. We developed an integrative approach that bridges the gap between these data using known molecular interactions, thus highlighting major response pathways. We harnessed this approach to reveal cellular pathways related to alpha-synuclein, a small lipid-binding protein implicated in several neurodegenerative disorders including Parkinson disease. For this we screened an established yeast model for alpha-synuclein toxicity to identify genes that when overexpressed alter cellular survival. Application of our algorithm to these data and data from mRNA profiling provided functional explanations for many of these genes and revealed novel relations between alpha-synuclein toxicity and basic cellular pathways. PMID:19234470

Microarray analysis and scale-free gene networks identify candidate regulators in drought-stressed roots of loblolly pine (P. taeda L.)

PubMed Central

2011-01-01

Background Global transcriptional analysis of loblolly pine (Pinus taeda L.) is challenging due to limited molecular tools. PtGen2, a 26,496 feature cDNA microarray, was fabricated and used to assess drought-induced gene expression in loblolly pine propagule roots. Statistical analysis of differential expression and weighted gene correlation network analysis were used to identify drought-responsive genes and further characterize the molecular basis of drought tolerance in loblolly pine. Results Microarrays were used to interrogate root cDNA populations obtained from 12 genotype × treatment combinations (four genotypes, three watering regimes). Comparison of drought-stressed roots with roots from the control treatment identified 2445 genes displaying at least a 1.5-fold expression difference (false discovery rate = 0.01). Genes commonly associated with drought response in pine and other plant species, as well as a number of abiotic and biotic stress-related genes, were up-regulated in drought-stressed roots. Only 76 genes were identified as differentially expressed in drought-recovered roots, indicating that the transcript population can return to the pre-drought state within 48 hours. Gene correlation analysis predicts a scale-free network topology and identifies eleven co-expression modules that ranged in size from 34 to 938 members. Network topological parameters identified a number of central nodes (hubs) including those with significant homology (E-values ≤ 2 × 10-30) to 9-cis-epoxycarotenoid dioxygenase, zeatin O-glucosyltransferase, and ABA-responsive protein. Identified hubs also include genes that have been associated previously with osmotic stress, phytohormones, enzymes that detoxify reactive oxygen species, and several genes of unknown function. Conclusion PtGen2 was used to evaluate transcriptome responses in loblolly pine and was leveraged to identify 2445 differentially expressed genes responding to severe drought stress in roots. Many of the genes identified are known to be up-regulated in response to osmotic stress in pine and other plant species and encode proteins involved in both signal transduction and stress tolerance. Gene expression levels returned to control values within a 48-hour recovery period in all but 76 transcripts. Correlation network analysis indicates a scale-free network topology for the pine root transcriptome and identifies central nodes that may serve as drivers of drought-responsive transcriptome dynamics in the roots of loblolly pine. PMID:21609476

The transcriptional regulatory network in the drought response and its crosstalk in abiotic stress responses including drought, cold, and heat.

PubMed

Nakashima, Kazuo; Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

2014-01-01

Drought negatively impacts plant growth and the productivity of crops around the world. Understanding the molecular mechanisms in the drought response is important for improvement of drought tolerance using molecular techniques. In plants, abscisic acid (ABA) is accumulated under osmotic stress conditions caused by drought, and has a key role in stress responses and tolerance. Comprehensive molecular analyses have shown that ABA regulates the expression of many genes under osmotic stress conditions, and the ABA-responsive element (ABRE) is the major cis-element for ABA-responsive gene expression. Transcription factors (TFs) are master regulators of gene expression. ABRE-binding protein and ABRE-binding factor TFs control gene expression in an ABA-dependent manner. SNF1-related protein kinases 2, group A 2C-type protein phosphatases, and ABA receptors were shown to control the ABA signaling pathway. ABA-independent signaling pathways such as dehydration-responsive element-binding protein TFs and NAC TFs are also involved in stress responses including drought, heat, and cold. Recent studies have suggested that there are interactions between the major ABA signaling pathway and other signaling factors in stress responses. The important roles of these TFs in crosstalk among abiotic stress responses will be discussed. Control of ABA or stress signaling factor expression can improve tolerance to environmental stresses. Recent studies using crops have shown that stress-specific overexpression of TFs improves drought tolerance and grain yield compared with controls in the field.

RNA-Seq and Gene Network Analysis Uncover Activation of an ABA-Dependent Signalosome During the Cork Oak Root Response to Drought

PubMed Central

Magalhães, Alexandre P.; Verde, Nuno; Reis, Francisca; Martins, Inês; Costa, Daniela; Lino-Neto, Teresa; Castro, Pedro H.; Tavares, Rui M.; Azevedo, Herlânder

2016-01-01

Quercus suber (cork oak) is a West Mediterranean species of key economic interest, being extensively explored for its ability to generate cork. Like other Mediterranean plants, Q. suber is significantly threatened by climatic changes, imposing the need to quickly understand its physiological and molecular adaptability to drought stress imposition. In the present report, we uncovered the differential transcriptome of Q. suber roots exposed to long-term drought, using an RNA-Seq approach. 454-sequencing reads were used to de novo assemble a reference transcriptome, and mapping of reads allowed the identification of 546 differentially expressed unigenes. These were enriched in both effector genes (e.g., LEA, chaperones, transporters) as well as regulatory genes, including transcription factors (TFs) belonging to various different classes, and genes associated with protein turnover. To further extend functional characterization, we identified the orthologs of differentially expressed unigenes in the model species Arabidopsis thaliana, which then allowed us to perform in silico functional inference, including gene network analysis for protein function, protein subcellular localization and gene co-expression, and in silico enrichment analysis for TFs and cis-elements. Results indicated the existence of extensive transcriptional regulatory events, including activation of ABA-responsive genes and ABF-dependent signaling. We were then able to establish that a core ABA-signaling pathway involving PP2C-SnRK2-ABF components was induced in stressed Q. suber roots, identifying a key mechanism in this species’ response to drought. PMID:26793200

Rosette iron deficiency transcript and microRNA profiling reveals links between copper and iron homeostasis in Arabidopsis thaliana

PubMed Central

Waters, Brian M.; Stein, Ricardo J.

2012-01-01

Iron (Fe) is an essential plant micronutrient, and its deficiency limits plant growth and development on alkaline soils. Under Fe deficiency, plant responses include up-regulation of genes involved in Fe uptake from the soil. However, little is known about shoot responses to Fe deficiency. Using microarrays to probe gene expression in Kas-1 and Tsu-1 ecotypes of Arabidopsis thaliana, and comparison with existing Col-0 data, revealed conserved rosette gene expression responses to Fe deficiency. Fe-regulated genes included known metal homeostasis-related genes, and a number of genes of unknown function. Several genes responded to Fe deficiency in both roots and rosettes. Fe deficiency led to up-regulation of Cu,Zn superoxide dismutase (SOD) genes CSD1 and CSD2, and down-regulation of FeSOD genes FSD1 and FSD2. Eight microRNAs were found to respond to Fe deficiency. Three of these (miR397a, miR398a, and miR398b/c) are known to regulate transcripts of Cu-containing proteins, and were down-regulated by Fe deficiency, suggesting that they could be involved in plant adaptation to Fe limitation. Indeed, Fe deficiency led to accumulation of Cu in rosettes, prior to any detectable decrease in Fe concentration. ccs1 mutants that lack functional Cu,ZnSOD proteins were prone to greater oxidative stress under Fe deficiency, indicating that increased Cu concentration under Fe limitation has an important role in oxidative stress prevention. The present results show that Cu accumulation, microRNA regulation, and associated differential expression of Fe and CuSOD genes are coordinated responses to Fe limitation. PMID:22962679

Dietary fructooligosaccharides and wheat bran elicit specific and dose-dependent gene expression profiles in the proximal colon epithelia of healthy Fischer 344 rats.

PubMed

Chen, Qixuan; Swist, Eleonora; Beckstead, Jocelyn; Green, Judy; Matias, Fernando; Roberts, Jennifer; Qiao, Cunye; Raju, Jayadev; Brooks, Stephen P J; Scoggan, Kylie A

2011-05-01

Proximal colon epithelial gene responses to diets containing increasing levels of dietary fermentable material (FM) from 2 different sources were measured to determine whether gene expression patterns were independent of the source of FM. Male Fischer 344 rats (10/group) were fed for 6 wk a control diet containing 10% (g/g) cellulose (0% FM); or a 2, 5, or 10% wheat bran (WB) diet (1, 2, 5% FM); or a 2, 5, or 8% fructooligosaccharides (FOS) diet (2, 5, 8% FM). WB and FOS were substituted for cellulose to give a final 10% nondigestible material content including FM. Gene responses were relative to expression in rats fed the control diet. The gene response patterns associated with feeding ∼2% FM (5% WB and 2% FOS) were similar (∼10 gene changes ≥ 1.6-fold; P ≤ 0.01) and involved genes associated with transport (Scnn1g, Mt1a), transcription (Zbtb16, Egr1), immunity (Fkbp5), a gut hormone (Retn1β), and lipid metabolism (Scd2, Insig1). These changes were also similar to those associated with 5% FM but only in rats fed the 10% WB diet. In contrast, the 5% FOS diet (~5% FM) was associated with 68 gene expression changes ≥ 1.6-fold (P ≤ 0.01). The diet with the highest level of fermentation (8% FOS, ~8% FM) was associated with 132 changes ≥ 1.6-fold (P ≤ 0.01), including genes associated with transport, cellular proliferation, oncogene and tumor metastasis, the cell cycle, apoptosis, signal transduction, transcript regulation, immunity, gut hormones, and lipid metabolic processes. These results show that both the amount and source of FM determine proximal colon epithelial gene response patterns in rats.

Gene Expression and Pharmacodynamic Changes in 1,760 Systemic Lupus Erythematosus Patients From Two Phase III Trials of BAFF Blockade With Tabalumab.

PubMed

Hoffman, Robert W; Merrill, Joan T; Alarcón-Riquelme, Marta M E; Petri, Michelle; Dow, Ernst R; Nantz, Eric; Nisenbaum, Laura K; Schroeder, Krista M; Komocsar, Wendy J; Perumal, Narayanan B; Linnik, Matthew D; Airey, David C; Liu, Yushi; Rocha, Guilherme V; Higgs, Richard E

2017-03-01

To characterize baseline gene expression and pharmacodynamically induced changes in whole blood gene expression in 1,760 systemic lupus erythematosus (SLE) patients from 2 phase III, 52-week, randomized, placebo-controlled, double-blind studies in which patients were treated with the BAFF-blocking IgG4 monoclonal antibody tabalumab. Patient samples were obtained from SLE patients from the ILLUMINATE-1 and ILLUMINATE-2 studies, and control samples were obtained from healthy donors. Blood was collected in Tempus tubes at baseline, week 16, and week 52. RNA was analyzed using Affymetrix Human Transcriptome Array 2.0 and NanoString. At baseline, expression of the interferon (IFN) response gene was elevated in patients compared with controls, with 75% of patients being positive for this IFN response gene signature. There was, however, substantial heterogeneity of IFN response gene expression and complex relationships among gene networks. The IFN response gene signature was a predictor of time to disease flare, independent of anti-double-stranded DNA (anti-dsDNA) antibody and C3 and C4 levels, and overall disease activity. Pharmacodynamically induced changes in gene expression following tabalumab treatment were extensive, occurring predominantly in B cell-related and immunoglobulin genes, and were consistent with other pharmacodynamic changes including anti-dsDNA antibody, C3, and immunoglobulin levels. SLE patients demonstrated increased expression of an IFN response gene signature (75% of patients had an elevated IFN response gene signature) at baseline in ILLUMINATE-1 and ILLUMINATE-2. Substantial heterogeneity of gene expression was detected among individual patients and in gene networks. The IFN response gene signature was an independent risk factor for future disease flares. Pharmacodynamic changes in gene expression were consistent with the mechanism of BAFF blockade by tabalumab. © 2016, American College of Rheumatology.

Transcriptome analysis reveals key roles of AtLBR-2 in LPS-induced defense responses in plants.

PubMed

Iizasa, Sayaka; Iizasa, Ei'ichi; Watanabe, Keiichi; Nagano, Yukio

2017-12-29

Lipopolysaccharide (LPS) from Gram-negative bacteria cause innate immune responses in animals and plants. The molecules involved in LPS signaling in animals are well studied, whereas those in plants are not yet as well documented. Recently, we identified Arabidopsis AtLBR-2, which binds to LPS from Pseudomonas aeruginosa (pLPS) directly and regulates pLPS-induced defense responses, such as pathogenesis-related 1 (PR1) expression and reactive oxygen species (ROS) production. In this study, we investigated the pLPS-induced transcriptomic changes in wild-type (WT) and the atlbr-2 mutant Arabidopsis plants using RNA-Seq technology. RNA-Seq data analysis revealed that pLPS treatment significantly altered the expression of 2139 genes, with 605 up-regulated and 1534 down-regulated genes in WT. Gene ontology (GO) analysis on these genes showed that GO terms, "response to bacterium", "response to salicylic acid (SA) stimulus", and "response to abscisic acid (ABA) stimulus" were enriched amongst only in up-regulated genes, as compared to the genes that were down-regulated. Comparative analysis of differentially expressed genes between WT and the atlbr-2 mutant revealed that 65 genes were up-regulated in WT but not in the atlbr-2 after pLPS treatment. Furthermore, GO analysis on these 65 genes demonstrated their importance for the enrichment of several defense-related GO terms, including "response to bacterium", "response to SA stimulus", and "response to ABA stimulus". We also found reduced levels of pLPS-induced conjugated SA glucoside (SAG) accumulation in atlbr-2 mutants, and no differences were observed in the gene expression levels in SA-treated WT and the atlbr-2 mutants. These 65 AtLBR-2-dependent up-regulated genes appear to be important for the enrichment of some defense-related GO terms. Moreover, AtLBR-2 might be a key molecule that is indispensable for the up-regulation of defense-related genes and for SA signaling pathway, which is involved in defense against pathogens containing LPS.

Transcriptional response of Musca domestica larvae to bacterial infection.

PubMed

Tang, Ting; Li, Xiang; Yang, Xue; Yu, Xue; Wang, Jianhui; Liu, Fengsong; Huang, Dawei

2014-01-01

The house fly Musca domestica, a cosmopolitan dipteran insect, is a significant vector for human and animal bacterial pathogens, but little is known about its immune response to these pathogens. To address this issue, we inoculated the larvae with a mixture of Escherichia coli and Staphylococcus aureus and profiled the transcriptome 6, 24, and 48 h thereafter. Many genes known to controlling innate immunity in insects were induced following infection, including genes encoding pattern recognition proteins (PGRPs), various components of the Toll and IMD signaling pathways and of the proPO-activating and redox systems, and multiple antimicrobial peptides. Interestingly, we also uncovered a large set of novel immune response genes including two broad-spectrum antimicrobial peptides (muscin and domesticin), which might have evolved to adapt to house-fly's unique ecological environments. Finally, genes mediating oxidative phosphorylation were repressed at 48 h post-infection, suggesting disruption of energy homeostasis and mitochondrial function at the late stages of infection. Collectively, our data reveal dynamic changes in gene expression following bacterial infection in the house fly, paving the way for future in-depth analysis of M. domestica's immune system.

Meta-analysis of studies using suppression subtractive hybridization and microarrays to investigate the effects of environmental stress on gene transcription in oysters.

PubMed

Anderson, Kelli; Taylor, Daisy A; Thompson, Emma L; Melwani, Aroon R; Nair, Sham V; Raftos, David A

2015-01-01

Many microarray and suppression subtractive hybridization (SSH) studies have analyzed the effects of environmental stress on gene transcription in marine species. However, there have been no unifying analyses of these data to identify common stress response pathways. To address this shortfall, we conducted a meta-analysis of 14 studies that investigated the effects of different environmental stressors on gene expression in oysters. The stressors tested included chemical contamination, hypoxia and infection, as well as extremes of temperature, pH and turbidity. We found that the expression of over 400 genes in a range of oyster species changed significantly after exposure to environmental stress. A repeating pattern was evident in these transcriptional responses, regardless of the type of stress applied. Many of the genes that responded to environmental stress encoded proteins involved in translation and protein processing (including molecular chaperones), the mitochondrial electron transport chain, anti-oxidant activity and the cytoskeleton. In light of these findings, we put forward a consensus model of sub-cellular stress responses in oysters.

Meta-Analysis of Studies Using Suppression Subtractive Hybridization and Microarrays to Investigate the Effects of Environmental Stress on Gene Transcription in Oysters

PubMed Central

Thompson, Emma L.; Melwani, Aroon R.; Nair, Sham V.; Raftos, David A.

2015-01-01

Many microarray and suppression subtractive hybridization (SSH) studies have analyzed the effects of environmental stress on gene transcription in marine species. However, there have been no unifying analyses of these data to identify common stress response pathways. To address this shortfall, we conducted a meta-analysis of 14 studies that investigated the effects of different environmental stressors on gene expression in oysters. The stressors tested included chemical contamination, hypoxia and infection, as well as extremes of temperature, pH and turbidity. We found that the expression of over 400 genes in a range of oyster species changed significantly after exposure to environmental stress. A repeating pattern was evident in these transcriptional responses, regardless of the type of stress applied. Many of the genes that responded to environmental stress encoded proteins involved in translation and protein processing (including molecular chaperones), the mitochondrial electron transport chain, anti-oxidant activity and the cytoskeleton. In light of these findings, we put forward a consensus model of sub-cellular stress responses in oysters. PMID:25768438

Tissue-Specific Transcriptomic Profiling of Sorghum propinquum using a Rice Genome Array

PubMed Central

Zhang, Ting; Zhao, Xiuqin; Huang, Liyu; Liu, Xiaoyue; Zong, Ying; Zhu, Linghua; Yang, Daichang; Fu, Binying

2013-01-01

Sorghum (Sorghum bicolor) is one of the world's most important cereal crops. S. propinquum is a perennial wild relative of S. bicolor with well-developed rhizomes. Functional genomics analysis of S. propinquum, especially with respect to molecular mechanisms related to rhizome growth and development, can contribute to the development of more sustainable grain, forage, and bioenergy cropping systems. In this study, we used a whole rice genome oligonucleotide microarray to obtain tissue-specific gene expression profiles of S. propinquum with special emphasis on rhizome development. A total of 548 tissue-enriched genes were detected, including 31 and 114 unique genes that were expressed predominantly in the rhizome tips (RT) and internodes (RI), respectively. Further GO analysis indicated that the functions of these tissue-enriched genes corresponded to their characteristic biological processes. A few distinct cis-elements, including ABA-responsive RY repeat CATGCA, sugar-repressive TTATCC, and GA-responsive TAACAA, were found to be prevalent in RT-enriched genes, implying an important role in rhizome growth and development. Comprehensive comparative analysis of these rhizome-enriched genes and rhizome-specific genes previously identified in Oryza longistaminata and S. propinquum indicated that phytohormones, including ABA, GA, and SA, are key regulators of gene expression during rhizome development. Co-localization of rhizome-enriched genes with rhizome-related QTLs in rice and sorghum generated functional candidates for future cloning of genes associated with rhizome growth and development. PMID:23536906

Integrated analysis of rice transcriptomic and metabolomic responses to elevated night temperatures identifies sensitivity- and tolerance-related profiles.

PubMed

Glaubitz, Ulrike; Li, Xia; Schaedel, Sandra; Erban, Alexander; Sulpice, Ronan; Kopka, Joachim; Hincha, Dirk K; Zuther, Ellen

2017-01-01

Transcript and metabolite profiling were performed on leaves from six rice cultivars under high night temperature (HNT) condition. Six genes were identified as central for HNT response encoding proteins involved in transcription regulation, signal transduction, protein-protein interactions, jasmonate response and the biosynthesis of secondary metabolites. Sensitive cultivars showed specific changes in transcript abundance including abiotic stress responses, changes of cell wall-related genes, of ABA signaling and secondary metabolism. Additionally, metabolite profiles revealed a highly activated TCA cycle under HNT and concomitantly increased levels in pathways branching off that could be corroborated by enzyme activity measurements. Integrated data analysis using clustering based on one-dimensional self-organizing maps identified two profiles highly correlated with HNT sensitivity. The sensitivity profile included genes of the functional bins abiotic stress, hormone metabolism, cell wall, signaling, redox state, transcription factors, secondary metabolites and defence genes. In the tolerance profile, similar bins were affected with slight differences in hormone metabolism and transcription factor responses. Metabolites of the two profiles revealed involvement of GABA signaling, thus providing a link to the TCA cycle status in sensitive cultivars and of myo-inositol as precursor for inositol phosphates linking jasmonate signaling to the HNT response specifically in tolerant cultivars. © 2016 John Wiley & Sons Ltd.

Microarray analysis of gene expression alteration in human middle ear epithelial cells induced by micro particle.

PubMed

Song, Jae-Jun; Kwon, Jee Young; Park, Moo Kyun; Seo, Young Rok

2013-10-01

The primary aim of this study is to reveal the effect of particulate matter (PM) on the human middle ear epithelial cell (HMEEC). The HMEEC was treated with PM (300 μg/ml) for 24 h. Total RNA was extracted and used for microarray analysis. Molecular pathways among differentially expressed genes were further analyzed by using Pathway Studio 9.0 software. For selected genes, the changes in gene expression were confirmed by real-time PCR. A total of 611 genes were regulated by PM. Among them, 366 genes were up-regulated, whereas 245 genes were down-regulated. Up-regulated genes were mainly involved in cellular processes, including reactive oxygen species generation, cell proliferation, apoptosis, cell differentiation, inflammatory response and immune response. Down-regulated genes affected several cellular processes, including cell differentiation, cell cycle, proliferation, apoptosis and cell migration. A total of 21 genes were discovered as crucial components in potential signaling networks containing 2-fold up regulated genes. Four genes, VEGFA, IL1B, CSF2 and HMOX1 were revealed as key mediator genes among the up-regulated genes. A total of 25 genes were revealed as key modulators in the signaling pathway associated with 2-fold down regulated genes. Four genes, including IGF1R, TIMP1, IL6 and FN1, were identified as the main modulator genes. We identified the differentially expressed genes in PM-treated HMEEC, whose expression profile may provide a useful clue for the understanding of environmental pathophysiology of otitis media. Our work indicates that air pollution, like PM, plays an important role in the pathogenesis of otitis media. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Early transcriptomic changes induced by magnesium deficiency in Arabidopsis thaliana reveal the alteration of circadian clock gene expression in roots and the triggering of abscisic acid-responsive genes.

PubMed

Hermans, Christian; Vuylsteke, Marnik; Coppens, Frederik; Craciun, Adrian; Inzé, Dirk; Verbruggen, Nathalie

2010-07-01

*Plant growth and development ultimately depend on environmental variables such as the availability of essential minerals. Unravelling how nutrients affect gene expression will help to understand how they regulate plant growth. *This study reports the early transcriptomic response to magnesium (Mg) deprivation in Arabidopsis. Whole-genome transcriptome was studied in the roots and young mature leaves 4, 8 and 28 h after the removal of Mg from the nutrient solution. *The highest number of regulated genes was first observed in the roots. Contrary to other mineral deficiencies, Mg depletion did not induce a higher expression of annotated genes in Mg uptake. Remarkable responses include the perturbation of the central oscillator of the circadian clock in roots and the triggering of abscisic acid (ABA) signalling, with half of the up-regulated Mg genes in leaves being ABA-responsive. However, no change in ABA content was observed. *The specificity of the response of some Mg-regulated genes was challenged by studying their expression after other mineral deficiencies and environmental stresses. The possibility to develop markers for Mg incipient deficiency is discussed here.

Hormonal response to bidirectional selection on social behavior

USDA-ARS?s Scientific Manuscript database

Behavior is a quantitative trait determined through the actions of multiple genes. These genes form pleiotropic networks that are sensitive to environmental variation and genetic background. One aspect of behavioral gene networks that is of special interest includes effects during early development....

Innate immune genes including a mucin-like gene, mul-1, induced by ionizing radiation in Caenorhabditis elegans.

PubMed

Kimura, Takafumi; Takanami, Takako; Sakashita, Tetsuya; Wada, Seiichi; Kobayashi, Yasuhiko; Higashitani, Atsushi

2012-10-01

The effect of radiation on the intestine has been studied for more than one hundred years. It remains unclear, however, whether this organ uses specific defensive mechanisms against ionizing radiation. The infection with Pseudomonas aeruginosa (PA14) in Caenorhabditis elegans induces up-regulation of innate immune response genes. Here, we found that exposure to ionizing radiation also induces certain innate immune response genes such as F49F1.6 (termed mul-1), clec-4, clec-67, lys-1 and lys-2 in the intestine. Moreover, pre-treatment with ionizing radiation before seeding on PA14 lawn plate significantly increased survival rate in the nematode. We also studied transcription pathway of the mul-1 in response to ionizing radiation. Induction of mul-1 gene was highly dependent on the ELT-2 transcription factor and p38 MAPK. Moreover, the insulin/IGF-1 signal pathway works to enhance induction of this gene. The mul-1 gene showed a different induction pattern from the DNA damage response gene, ced-13, which implies that the expression of this gene might be triggered as an indirect effect of radiation. Silencing of the mul-1 gene led to growth retardation after treatment with ionizing radiation. We describe the cross-tolerance between the response to radiation exposure and the innate immune system.

EGRINs (Environmental Gene Regulatory Influence Networks) in Rice That Function in the Response to Water Deficit, High Temperature, and Agricultural Environments[OPEN

PubMed Central

Hafemeister, Christoph; Nicotra, Adrienne B.; Jagadish, S.V. Krishna; Bonneau, Richard; Purugganan, Michael

2016-01-01

Environmental gene regulatory influence networks (EGRINs) coordinate the timing and rate of gene expression in response to environmental signals. EGRINs encompass many layers of regulation, which culminate in changes in accumulated transcript levels. Here, we inferred EGRINs for the response of five tropical Asian rice (Oryza sativa) cultivars to high temperatures, water deficit, and agricultural field conditions by systematically integrating time-series transcriptome data, patterns of nucleosome-free chromatin, and the occurrence of known cis-regulatory elements. First, we identified 5447 putative target genes for 445 transcription factors (TFs) by connecting TFs with genes harboring known cis-regulatory motifs in nucleosome-free regions proximal to their transcriptional start sites. We then used network component analysis to estimate the regulatory activity for each TF based on the expression of its putative target genes. Finally, we inferred an EGRIN using the estimated transcription factor activity (TFA) as the regulator. The EGRINs include regulatory interactions between 4052 target genes regulated by 113 TFs. We resolved distinct regulatory roles for members of the heat shock factor family, including a putative regulatory connection between abiotic stress and the circadian clock. TFA estimation using network component analysis is an effective way of incorporating multiple genome-scale measurements into network inference. PMID:27655842

The identification of key genes and pathways in hepatocellular carcinoma by bioinformatics analysis of high-throughput data.

PubMed

Zhang, Chaoyang; Peng, Li; Zhang, Yaqin; Liu, Zhaoyang; Li, Wenling; Chen, Shilian; Li, Guancheng

2017-06-01

Liver cancer is a serious threat to public health and has fairly complicated pathogenesis. Therefore, the identification of key genes and pathways is of much importance for clarifying molecular mechanism of hepatocellular carcinoma (HCC) initiation and progression. HCC-associated gene expression dataset was downloaded from Gene Expression Omnibus database. Statistical software R was used for significance analysis of differentially expressed genes (DEGs) between liver cancer samples and normal samples. Gene Ontology (GO) term enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, based on R software, were applied for the identification of pathways in which DEGs significantly enriched. Cytoscape software was for the construction of protein-protein interaction (PPI) network and module analysis to find the hub genes and key pathways. Finally, weighted correlation network analysis (WGCNA) was conducted to further screen critical gene modules with similar expression pattern and explore their biological significance. Significance analysis identified 1230 DEGs with fold change >2, including 632 significantly down-regulated DEGs and 598 significantly up-regulated DEGs. GO term enrichment analysis suggested that up-regulated DEG significantly enriched in immune response, cell adhesion, cell migration, type I interferon signaling pathway, and cell proliferation, and the down-regulated DEG mainly enriched in response to endoplasmic reticulum stress and endoplasmic reticulum unfolded protein response. KEGG pathway analysis found DEGs significantly enriched in five pathways including complement and coagulation cascades, focal adhesion, ECM-receptor interaction, antigen processing and presentation, and protein processing in endoplasmic reticulum. The top 10 hub genes in HCC were separately GMPS, ACACA, ALB, TGFB1, KRAS, ERBB2, BCL2, EGFR, STAT3, and CD8A, which resulted from PPI network. The top 3 gene interaction modules in PPI network enriched in immune response, organ development, and response to other organism, respectively. WGCNA revealed that the confirmed eight gene modules significantly enriched in monooxygenase and oxidoreductase activity, response to endoplasmic reticulum stress, type I interferon signaling pathway, processing, presentation and binding of peptide antigen, cellular response to cadmium and zinc ion, cell locomotion and differentiation, ribonucleoprotein complex and RNA processing, and immune system process, respectively. In conclusion, we identified some key genes and pathways closely related with HCC initiation and progression by a series of bioinformatics analysis on DEGs. These screened genes and pathways provided for a more detailed molecular mechanism underlying HCC occurrence and progression, holding promise for acting as biomarkers and potential therapeutic targets.

Genome-wide expression profiling in leaves and roots of date palm (Phoenix dactylifera L.) exposed to salinity.

PubMed

Yaish, Mahmoud W; Patankar, Himanshu V; Assaha, Dekoum V M; Zheng, Yun; Al-Yahyai, Rashid; Sunkar, Ramanjulu

2017-03-22

Date palm, as one of the most important fruit crops in North African and West Asian countries including Oman, is facing serious growth problems due to salinity, arising from persistent use of saline water for irrigation. Although date palm is a relatively salt-tolerant plant species, its adaptive mechanisms to salt stress are largely unknown. In order to get an insight into molecular mechanisms of salt tolerance, RNA was profiled in leaves and roots of date palm seedlings subjected to NaCl for 10 days. Under salt stress, photosynthetic parameters were differentially affected; all gas exchange parameters were decreased but the quantum yield of PSII was unaffected while non-photochemical quenching was increased. Analyses of gene expression profiles revealed 2630 and 4687 genes were differentially expressed in leaves and roots, respectively, under salt stress. Of these, 194 genes were identified as commonly responding in both the tissue sources. Gene ontology (GO) analysis in leaves revealed enrichment of transcripts involved in metabolic pathways including photosynthesis, sucrose and starch metabolism, and oxidative phosphorylation, while in roots genes involved in membrane transport, phenylpropanoid biosynthesis, purine, thiamine, and tryptophan metabolism, and casparian strip development were enriched. Differentially expressed genes (DEGs) common to both tissues included the auxin responsive gene, GH3, a putative potassium transporter 8 and vacuolar membrane proton pump. Leaf and root tissues respond differentially to salinity stress and this study has revealed genes and pathways that are associated with responses to elevated NaCl levels and thus may play important roles in salt tolerance providing a foundation for functional characterization of salt stress-responsive genes in the date palm.

Global identification and expression analysis of stress-responsive genes of the Argonaute family in apple.

PubMed

Xu, Ruirui; Liu, Caiyun; Li, Ning; Zhang, Shizhong

2016-12-01

Argonaute (AGO) proteins, which are found in yeast, animals, and plants, are the core molecules of the RNA-induced silencing complex. These proteins play important roles in plant growth, development, and responses to biotic stresses. The complete analysis and classification of the AGO gene family have been recently reported in different plants. Nevertheless, systematic analysis and expression profiling of these genes have not been performed in apple (Malus domestica). Approximately 15 AGO genes were identified in the apple genome. The phylogenetic tree, chromosome location, conserved protein motifs, gene structure, and expression of the AGO gene family in apple were analyzed for gene prediction. All AGO genes were phylogenetically clustered into four groups (i.e., AGO1, AGO4, MEL1/AGO5, and ZIPPY/AGO7) with the AGO genes of Arabidopsis. These groups of the AGO gene family were statistically analyzed and compared among 31 plant species. The predicted apple AGO genes are distributed across nine chromosomes at different densities and include three segment duplications. Expression studies indicated that 15 AGO genes exhibit different expression patterns in at least one of the tissues tested. Additionally, analysis of gene expression levels indicated that the genes are mostly involved in responses to NaCl, PEG, heat, and low-temperature stresses. Hence, several candidate AGO genes are involved in different aspects of physiological and developmental processes and may play an important role in abiotic stress responses in apple. To the best of our knowledge, this study is the first to report a comprehensive analysis of the apple AGO gene family. Our results provide useful information to understand the classification and putative functions of these proteins, especially for gene members that may play important roles in abiotic stress responses in M. hupehensis.

KERIS: kaleidoscope of gene responses to inflammation between species

PubMed Central

Li, Peng; Tompkins, Ronald G; Xiao, Wenzhong

2017-01-01

A cornerstone of modern biomedical research is the use of animal models to study disease mechanisms and to develop new therapeutic approaches. In order to help the research community to better explore the similarities and differences of genomic response between human inflammatory diseases and murine models, we developed KERIS: kaleidoscope of gene responses to inflammation between species (available at http://www.igenomed.org/keris/). As of June 2016, KERIS includes comparisons of the genomic response of six human inflammatory diseases (burns, trauma, infection, sepsis, endotoxin and acute respiratory distress syndrome) and matched mouse models, using 2257 curated samples from the Inflammation and the Host Response to Injury Glue Grant studies and other representative studies in Gene Expression Omnibus. A researcher can browse, query, visualize and compare the response patterns of genes, pathways and functional modules across different diseases and corresponding murine models. The database is expected to help biologists choosing models when studying the mechanisms of particular genes and pathways in a disease and prioritizing the translation of findings from disease models into clinical studies. PMID:27789704

Genome-Wide Gene Expression Analysis Shows AKAP13-Mediated PKD1 Signaling Regulates the Transcriptional Response to Cardiac Hypertrophy.

PubMed

Johnson, Keven R; Nicodemus-Johnson, Jessie; Spindler, Mathew J; Carnegie, Graeme K

2015-01-01

In the heart, scaffolding proteins such as A-Kinase Anchoring Proteins (AKAPs) play a crucial role in normal cellular function by serving as a signaling hub for multiple protein kinases including protein kinase D1 (PKD1). Under cardiac hypertrophic conditions AKAP13 anchored PKD1 activates the transcription factor MEF2 leading to subsequent fetal gene activation and hypertrophic response. We used an expression microarray to identify the global transcriptional response in the hearts of wild-type mice expressing the native form of AKAP13 compared to a gene-trap mouse model expressing a truncated form of AKAP13 that is unable to bind PKD1 (AKAP13-ΔPKD1). Microarray analysis showed that AKAP13-ΔPKD1 mice broadly failed to exhibit the transcriptional profile normally associated with compensatory cardiac hypertrophy following trans-aortic constriction (TAC). The identified differentially expressed genes in WT and AKAP13-ΔPKD1 hearts are vital for the compensatory hypertrophic response to pressure-overload and include myofilament, apoptotic, and cell growth/differentiation genes in addition to genes not previously identified as affected by AKAP13-anchored PKD1. Our results show that AKAP13-PKD1 signaling is critical for transcriptional regulation of key contractile, cell death, and metabolic pathways during the development of compensatory hypertrophy in vivo.

Genome-Wide Gene Expression Analysis Shows AKAP13-Mediated PKD1 Signaling Regulates the Transcriptional Response to Cardiac Hypertrophy

PubMed Central

Johnson, Keven R.; Nicodemus-Johnson, Jessie; Spindler, Mathew J.

2015-01-01

In the heart, scaffolding proteins such as A-Kinase Anchoring Proteins (AKAPs) play a crucial role in normal cellular function by serving as a signaling hub for multiple protein kinases including protein kinase D1 (PKD1). Under cardiac hypertrophic conditions AKAP13 anchored PKD1 activates the transcription factor MEF2 leading to subsequent fetal gene activation and hypertrophic response. We used an expression microarray to identify the global transcriptional response in the hearts of wild-type mice expressing the native form of AKAP13 compared to a gene-trap mouse model expressing a truncated form of AKAP13 that is unable to bind PKD1 (AKAP13-ΔPKD1). Microarray analysis showed that AKAP13-ΔPKD1 mice broadly failed to exhibit the transcriptional profile normally associated with compensatory cardiac hypertrophy following trans-aortic constriction (TAC). The identified differentially expressed genes in WT and AKAP13-ΔPKD1 hearts are vital for the compensatory hypertrophic response to pressure-overload and include myofilament, apoptotic, and cell growth/differentiation genes in addition to genes not previously identified as affected by AKAP13-anchored PKD1. Our results show that AKAP13-PKD1 signaling is critical for transcriptional regulation of key contractile, cell death, and metabolic pathways during the development of compensatory hypertrophy in vivo. PMID:26192751

Tissue-Specific Transcriptomics Reveals an Important Role of the Unfolded Protein Response in Maintaining Fertility upon Heat Stress in Arabidopsis

PubMed Central

Zhang, Shuang-Shuang; Yang, Hongxing; Ding, Lan; Song, Ze-Ting; Ma, Hong; Chang, Fang

2017-01-01

High temperatures have a great impact on plant reproductive development and subsequent fruit and seed set, but the underlying molecular mechanisms are not well understood. We used transcriptome profiling to investigate the effect of heat stress on reproductive development of Arabidopsis thaliana plants and observed distinct response patterns in vegetative versus reproductive tissues. Exposure to heat stress affected reproductive developmental programs, including early phases of anther/ovule development and meiosis. Also, genes participating in the unfolded protein response (UPR) were enriched in the reproductive tissue-specific genes that were upregulated by heat. Moreover, we found that the UPR-deficient bzip28 bzip60 double mutant was sensitive to heat stresses and had reduced silique length and fertility. Comparison of heat-responsive wild type versus bzip28 bzip60 plants identified 521 genes that were regulated by bZIP28 and bZIP60 upon heat stress during reproductive stages, most of which were noncanonical UPR genes. Chromatin immunoprecipitation coupled with high-throughput sequencing analyses revealed 133 likely direct targets of bZIP28 in Arabidopsis seedlings subjected to heat stress, including 27 genes that were also upregulated by heat during reproductive development. Our results provide important insights into heat responsiveness in Arabidopsis reproductive tissues and demonstrate the protective roles of the UPR for maintaining fertility upon heat stress. PMID:28442596

Pharmacogenetics of clozapine treatment response and side-effects in schizophrenia: an update.

PubMed

Sriretnakumar, Venuja; Huang, Eric; Müller, Daniel J

2015-01-01

Clozapine (CLZ) is the most effective treatment for treatment-resistant schizophrenia (SCZ) patients, with potential added benefits of reduction in suicide risk and aggression. However, CLZ is also mainly underused due to its high risk for the potentially lethal side-effect of agranulocytosis as well as weight gain and related metabolic dysregulation. Pharmacogenetics promises to enable the prediction of patient treatment response and risk of adverse effects based on patients' genetics, paving the way toward individualized treatment. This article reviews pharmacogenetics studies of CLZ response and side-effects with a focus on articles from January 2012 to February 2015, as an update to the previous reviews. Pharmacokinetic genes explored primarily include CYP1A2, while pharmacodynamic genes consisted of traditional pharmacogenetic targets such as brain-derived neurotrophic factor as well novel mitochondrial genes, NDUFS-1 and translocator protein. Pharmacogenetics is a promising avenue for individualized medication of CLZ in SCZ, with several consistently replicated gene variants predicting CLZ response and side-effects. However, a large proportion of studies have yielded mixed results. Large-scale Genome-wide association studies (e.g., CRESTAR) and targeted gene studies with standardized designs (response measurements, treatment durations, plasma level monitoring) are required for further progress toward clinical translation. Additionally, in order to improve study quality, we recommend accounting for important confounders, including polypharmacy, baseline measurements, treatment duration, gender, and age at onset.

DPYD, TYMS, TYMP, TK1, and TK2 Genetic Expressions as Response Markers in Locally Advanced Rectal Cancer Patients Treated with Fluoropyrimidine-Based Chemoradiotherapy

PubMed Central

Wu, Chan-Han; Huang, Chun-Ming; Chung, Fu-Yen; Huang, Ching-Wen; Tsai, Hsiang-Lin; Chen, Chin-Fan; Wang, Jaw-Yuan

2013-01-01

This study is to investigate multiple chemotherapeutic agent- and radiation-related genetic biomarkers in locally advanced rectal cancer (LARC) patients following fluoropyrimidine-based concurrent chemoradiotherapy (CCRT) for response prediction. We initially selected 6 fluoropyrimidine metabolism-related genes (DPYD, ORPT, TYMS, TYMP, TK1, and TK2) and 3 radiotherapy response-related genes (GLUT1, HIF-1 α, and HIF-2 α) as targets for gene expression identification in 60 LARC cancer specimens. Subsequently, a high-sensitivity weighted enzymatic chip array was designed and constructed to predict responses following CCRT. After CCRT, 39 of 60 (65%) LARC patients were classified as responders (pathological tumor regression grade 2 ~ 4). Using a panel of multiple genetic biomarkers (chip), including DPYD, TYMS, TYMP, TK1, and TK2, at a cutoff value for 3 positive genes, a sensitivity of 89.7% and a specificity of 81% were obtained (AUC: 0.915; 95% CI: 0.840–0.991). Negative chip results were significantly correlated to poor CCRT responses (TRG 0-1) (P = 0.014, hazard ratio: 22.704, 95% CI: 3.055–235.448 in multivariate analysis). Disease-free survival analysis showed significantly better survival rate in patients with positive chip results (P = 0.0001). We suggest that a chip including DPYD, TYMS, TYMP, TK1, and TK2 genes is a potential tool to predict response in LARC following fluoropyrimidine-based CCRT. PMID:24455740

Transcriptome profiling of soybean (Glycine max) roots challenged with pathogenic and non-pathogenic isolates of Fusarium oxysporum.

PubMed

Lanubile, Alessandra; Muppirala, Usha K; Severin, Andrew J; Marocco, Adriano; Munkvold, Gary P

2015-12-21

Fusarium oxysporum is one of the most common fungal pathogens causing soybean root rot and seedling blight in U.S.A. In a recent study, significant variation in aggressiveness was observed among isolates of F. oxysporum collected from roots in Iowa, ranging from highly pathogenic to weakly or non-pathogenic isolates. We used RNA-seq analysis to investigate the molecular aspects of the interactions of a partially resistant soybean genotype with non-pathogenic/pathogenic isolates of F. oxysporum at 72 and 96 h post inoculation (hpi). Markedly different gene expression profiles were observed in response to the two isolates. A peak of highly differentially expressed genes (HDEGs) was triggered at 72 hpi in soybean roots and the number of HDEGs was about eight times higher in response to the pathogenic isolate compared to the non-pathogenic one (1,659 vs. 203 HDEGs, respectively). Furthermore, the magnitude of induction was much greater in response to the pathogenic isolate. This response included a stronger activation of defense-related genes, transcription factors, and genes involved in ethylene biosynthesis, secondary and sugar metabolism. The obtained data provide an important insight into the transcriptional responses of soybean-F. oxysporum interactions and illustrate the more drastic changes in the host transcriptome in response to the pathogenic isolate. These results may be useful in the developing new methods of broadening resistance of soybean to F. oxysporum, including the over-expression of key soybean genes.

Transcriptome analysis of salinity stress responses in common wheat using a 22k oligo-DNA microarray.

PubMed

Kawaura, Kanako; Mochida, Keiichi; Yamazaki, Yukiko; Ogihara, Yasunari

2006-04-01

In this study, we constructed a 22k wheat oligo-DNA microarray. A total of 148,676 expressed sequence tags of common wheat were collected from the database of the Wheat Genomics Consortium of Japan. These were grouped into 34,064 contigs, which were then used to design an oligonucleotide DNA microarray. Following a multistep selection of the sense strand, 21,939 60-mer oligo-DNA probes were selected for attachment on the microarray slide. This 22k oligo-DNA microarray was used to examine the transcriptional response of wheat to salt stress. More than 95% of the probes gave reproducible hybridization signals when targeted with RNAs extracted from salt-treated wheat shoots and roots. With the microarray, we identified 1,811 genes whose expressions changed more than 2-fold in response to salt. These included genes known to mediate response to salt, as well as unknown genes, and they were classified into 12 major groups by hierarchical clustering. These gene expression patterns were also confirmed by real-time reverse transcription-PCR. Many of the genes with unknown function were clustered together with genes known to be involved in response to salt stress. Thus, analysis of gene expression patterns combined with gene ontology should help identify the function of the unknown genes. Also, functional analysis of these wheat genes should provide new insight into the response to salt stress. Finally, these results indicate that the 22k oligo-DNA microarray is a reliable method for monitoring global gene expression patterns in wheat.

Gene expression patterns in formalin-fixed, paraffin-embedded core biopsies predict docetaxel chemosensitivity in breast cancer patients.

PubMed

Chang, Jenny C; Makris, Andreas; Gutierrez, M Carolina; Hilsenbeck, Susan G; Hackett, James R; Jeong, Jennie; Liu, Mei-Lan; Baker, Joffre; Clark-Langone, Kim; Baehner, Frederick L; Sexton, Krsytal; Mohsin, Syed; Gray, Tara; Alvarez, Laura; Chamness, Gary C; Osborne, C Kent; Shak, Steven

2008-03-01

Previously, we had identified gene expression patterns that predicted response to neoadjuvant docetaxel. Other studies have validated that a high Recurrence Score (RS) by the 21-gene RT-PCR assay is predictive of worse prognosis but better response to chemotherapy. We investigated whether tumor expression of these 21 genes and other candidate genes can predict response to docetaxel. Core biopsies from 97 patients were obtained before treatment with neoadjuvant docetaxel (4 cycles, 100 mg/m2 q3 weeks). Three 10-microm FFPE sections were submitted for quantitative RT-PCR assays of 192 genes that were selected from our previous work and the literature. Of the 97 patients, 81 (84%) had sufficient invasive cancer, 80 (82%) had sufficient RNA for QRTPCR assay, and 72 (74%) had clinical response data. Mean age was 48.5 years, and the median tumor size was 6 cm. Clinical complete responses (CR) were observed in 12 (17%), partial responses in 41 (57%), stable disease in 17 (24%), and progressive disease in 2 patients (3%). A significant relationship (P<0.05) between gene expression and CR was observed for 14 genes, including CYBA. CR was associated with lower expression of the ER gene group and higher expression of the proliferation gene group from the 21 gene assay. Of note, CR was more likely with a high RS (P=0.008). We have established molecular profiles of sensitivity to docetaxel. RT-PCR technology provides a potential platform for a predictive test of docetaxel chemosensitivity using small amounts of routinely processed material.

Genome-Wide Characterization of Transcriptional Patterns in High and Low Antibody Responders to Rubella Vaccination

PubMed Central

Haralambieva, Iana H.; Oberg, Ann L.; Ovsyannikova, Inna G.; Kennedy, Richard B.; Grill, Diane E.; Middha, Sumit; Bot, Brian M.; Wang, Vivian W.; Smith, David I.; Jacobson, Robert M.; Poland, Gregory A.

2013-01-01

Immune responses to current rubella vaccines demonstrate significant inter-individual variability. We performed mRNA-Seq profiling on PBMCs from high and low antibody responders to rubella vaccination to delineate transcriptional differences upon viral stimulation. Generalized linear models were used to assess the per gene fold change (FC) for stimulated versus unstimulated samples or the interaction between outcome and stimulation. Model results were evaluated by both FC and p-value. Pathway analysis and self-contained gene set tests were performed for assessment of gene group effects. Of 17,566 detected genes, we identified 1,080 highly significant differentially expressed genes upon viral stimulation (p<1.00E−15, FDR<1.00E−14), including various immune function and inflammation-related genes, genes involved in cell signaling, cell regulation and transcription, and genes with unknown function. Analysis by immune outcome and stimulation status identified 27 genes (p≤0.0006 and FDR≤0.30) that responded differently to viral stimulation in high vs. low antibody responders, including major histocompatibility complex (MHC) class I genes (HLA-A, HLA-B and B2M with p = 0.0001, p = 0.0005 and p = 0.0002, respectively), and two genes related to innate immunity and inflammation (EMR3 and MEFV with p = 1.46E−08 and p = 0.0004, respectively). Pathway and gene set analysis also revealed transcriptional differences in antigen presentation and innate/inflammatory gene sets and pathways between high and low responders. Using mRNA-Seq genome-wide transcriptional profiling, we identified antigen presentation and innate/inflammatory genes that may assist in explaining rubella vaccine-induced immune response variations. Such information may provide new scientific insights into vaccine-induced immunity useful in rational vaccine development and immune response monitoring. PMID:23658707

The Root Hair “Infectome” of Medicago truncatula Uncovers Changes in Cell Cycle Genes and Reveals a Requirement for Auxin Signaling in Rhizobial Infection[W][OPEN

PubMed Central

Breakspear, Andrew; Liu, Chengwu; Roy, Sonali; Stacey, Nicola; Rogers, Christian; Trick, Martin; Morieri, Giulia; Mysore, Kirankumar S.; Wen, Jiangqi; Oldroyd, Giles E.D.; Downie, J. Allan

2014-01-01

Nitrogen-fixing rhizobia colonize legume roots via plant-made intracellular infection threads. Genetics has identified some genes involved but has not provided sufficient detail to understand requirements for infection thread development. Therefore, we transcriptionally profiled Medicago truncatula root hairs prior to and during the initial stages of infection. This revealed changes in the responses to plant hormones, most notably auxin, strigolactone, gibberellic acid, and brassinosteroids. Several auxin responsive genes, including the ortholog of Arabidopsis thaliana Auxin Response Factor 16, were induced at infection sites and in nodule primordia, and mutation of ARF16a reduced rhizobial infection. Associated with the induction of auxin signaling genes, there was increased expression of cell cycle genes including an A-type cyclin and a subunit of the anaphase promoting complex. There was also induction of several chalcone O-methyltransferases involved in the synthesis of an inducer of Sinorhizobium meliloti nod genes, as well as a gene associated with Nod factor degradation, suggesting both positive and negative feedback loops that control Nod factor levels during rhizobial infection. We conclude that the onset of infection is associated with reactivation of the cell cycle as well as increased expression of genes required for hormone and flavonoid biosynthesis and that the regulation of auxin signaling is necessary for initiation of rhizobial infection threads. PMID:25527707

Identifying ultrasensitive HGF dose-response functions in a 3D mammalian system for synthetic morphogenesis.

PubMed

Senthivel, Vivek Raj; Sturrock, Marc; Piedrafita, Gabriel; Isalan, Mark

2016-12-16

Nonlinear responses to signals are widespread natural phenomena that affect various cellular processes. Nonlinearity can be a desirable characteristic for engineering living organisms because it can lead to more switch-like responses, similar to those underlying the wiring in electronics. Steeper functions are described as ultrasensitive, and can be applied in synthetic biology by using various techniques including receptor decoys, multiple co-operative binding sites, and sequential positive feedbacks. Here, we explore the inherent non-linearity of a biological signaling system to identify functions that can potentially be exploited using cell genome engineering. For this, we performed genome-wide transcription profiling to identify genes with ultrasensitive response functions to Hepatocyte Growth Factor (HGF). We identified 3,527 genes that react to increasing concentrations of HGF, in Madin-Darby canine kidney (MDCK) cells, grown as cysts in 3D collagen cell culture. By fitting a generic Hill function to the dose-responses of these genes we obtained a measure of the ultrasensitivity of HGF-responsive genes, identifying a subset with higher apparent Hill coefficients (e.g. MMP1, TIMP1, SNORD75, SNORD86 and ERRFI1). The regulatory regions of these genes are potential candidates for future engineering of synthetic mammalian gene circuits requiring nonlinear responses to HGF signalling.

Preferential epigenetic programming of estrogen response after in utero xenoestrogen (bisphenol-A) exposure

PubMed Central

Jorgensen, Elisa M.; Alderman, Myles H.; Taylor, Hugh S.

2016-01-01

Bisphenol-A (BPA) is an environmentally ubiquitous estrogen-like endocrine-disrupting compound. Exposure to BPA in utero has been linked to female reproductive disorders, including endometrial hyperplasia and breast cancer. Estrogens are an etiological factor in many of these conditions. We sought to determine whether in utero exposure to BPA altered the global CpG methylation pattern of the uterine genome, subsequent gene expression, and estrogen response. Pregnant mice were exposed to an environmentally relevant dose of BPA or DMSO control. Uterine DNA and RNA were examined by using methylated DNA immunoprecipitation methylation microarray, expression microarray, and quantitative PCR. In utero BPA exposure altered the global CpG methylation profile of the uterine genome and subsequent gene expression. The effect on gene expression was not apparent until sexual maturation, which suggested that estrogen response was the primary alteration. Indeed, prenatal BPA exposure preferentially altered adult estrogen-responsive gene expression. Changes in estrogen response were accompanied by altered methylation that preferentially affected estrogen receptor-α (ERα)–binding genes. The majority of genes that demonstrated both altered expression and ERα binding had decreased methylation. BPA selectively altered the normal developmental programming of estrogen-responsive genes via modification of the genes that bind ERα. Gene–environment interactions driven by early life xenoestrogen exposure likely contributes to increased risk of estrogen-related disease in adults.—Jorgensen, E. M., Alderman, M. H., III, Taylor, H. S. Preferential epigenetic programming of estrogen response after in utero xenoestrogen (bisphenol-A) exposure. PMID:27312807

Characterization of basal gene expression trends over a diurnal cycle in Xiphophorus maculatus skin, brain and liver.

PubMed

Lu, Yuan; Reyes, Jose; Walter, Sean; Gonzalez, Trevor; Medrano, Geraldo; Boswell, Mikki; Boswell, William; Savage, Markita; Walter, Ronald

2018-06-01

Evolutionarily conserved diurnal circadian mechanisms maintain oscillating patterns of gene expression based on the day-night cycle. Xiphophorus fish have been used to evaluate transcriptional responses after exposure to various light sources and it was determined that each source incites distinct genetic responses in skin tissue. However, basal expression levels of genes that show oscillating expression patterns in day-night cycle, may affect the outcomes of such experiments, since basal gene expression levels at each point in the circadian path may influence the profile of identified light responsive genes. Lack of knowledge regarding diurnal fluctuations in basal gene expression patterns may confound the understanding of genetic responses to external stimuli (e.g., light) since the dynamic nature of gene expression implies animals subjected to stimuli at different times may be at very different stages within the continuum of genetic homeostasis. We assessed basal gene expression changes over a 24-hour period in 200 select Xiphophorus gene targets known to transcriptionally respond to various types of light exposure. We identified 22 genes in skin, 36 genes in brain and 28 genes in liver that exhibit basal oscillation of expression patterns. These genes, including known circadian regulators, produced the expected expression patterns over a 24-hour cycle when compared to circadian regulatory genes identified in other species, especially human and other vertebrate animal models. Our results suggest the regulatory network governing diurnal oscillating gene expression is similar between Xiphophorus and other vertebrates for the three Xiphophorus organs tested. In addition, we were able to categorize light responsive gene sets in Xiphophorus that do, and do not, exhibit circadian based oscillating expression patterns. Copyright © 2017 Elsevier Inc. All rights reserved.

Characterization of temperature and light effects on the defense response phenotypes associated with the maize Rp1-D21 gene

USDA-ARS?s Scientific Manuscript database

Rp1 is a complex locus of maize controlling race-specific resistance to the common rust fungus, Puccinia sorghi. The resistance response includes the “Hypersensitive response” (HR) – a rapid localized cell death at the point of pathogen penetration - and the induction of pathogenesis associated gene...

Genome-wide identification of 99 autophagy-related (Atg) genes in the monogonont rotifer Brachionus spp. and transcriptional modulation in response to cadmium.

PubMed

Kang, Hye-Min; Lee, Jin-Sol; Kim, Min-Sub; Lee, Young Hwan; Jung, Jee-Hyun; Hagiwara, Atsushi; Zhou, Bingsheng; Lee, Jae-Seong; Jeong, Chang-Bum

2018-05-30

Autophagy originated from the common ancestor of all life forms, and its function is highly conserved from yeast to humans. Autophagy plays a key role in various fundamental biological processes including defense, and has developed through serial interactions of multiple gene sets referred to as autophagy-related (Atg) genes. Despite their significance in metazoan life and evolution, few studies have been conducted to identify these genes in aquatic invertebrates. In this study, we identified whole Atg genes in four Brachionus rotifer spp., namely B. calyciflorus, B. koreanus, B. plicatilis, and B. rotundiformis, through searches of their entire genomes; and we annotated them according to the yeast nomenclature. Twenty-four genes orthologous to yeast genes were present in all of the Brachionus spp. while three additional gene duplicates were identified in the genome of B. koreanus, indicating that these genes had diversified during the speciation. Also, their transcriptional responses to cadmium exposure indicated regulation by cadmium-induced oxidative-stress-related signaling pathways. This study provides valuable information on 99 conserved Atg genes involved in autophagosome formation in Brachionus spp., with transcriptional modulation in response to cadmium, in the context of the role of autophagy in the damage response. Copyright © 2018 Elsevier B.V. All rights reserved.

Transcriptional Profiling and Identification of Heat-Responsive Genes in Perennial Ryegrass by RNA-Sequencing

PubMed Central

Wang, Kehua; Liu, Yanrong; Tian, Jinli; Huang, Kunyong; Shi, Tianran; Dai, Xiaoxia; Zhang, Wanjun

2017-01-01

Perennial ryegrass (Lolium perenne) is one of the most widely used forage and turf grasses in the world due to its desirable agronomic qualities. However, as a cool-season perennial grass species, high temperature is a major factor limiting its performance in warmer and transition regions. In this study, a de novo transcriptome was generated using a cDNA library constructed from perennial ryegrass leaves subjected to short-term heat stress treatment. Then the expression profiling and identification of perennial ryegrass heat response genes by digital gene expression analyses was performed. The goal of this work was to produce expression profiles of high temperature stress responsive genes in perennial ryegrass leaves and further identify the potentially important candidate genes with altered levels of transcript, such as those genes involved in transcriptional regulation, antioxidant responses, plant hormones and signal transduction, and cellular metabolism. The de novo assembly of perennial ryegrass transcriptome in this study obtained more total and annotated unigenes compared to previously published ones. Many DEGs identified were genes that are known to respond to heat stress in plants, including HSFs, HSPs, and antioxidant related genes. In the meanwhile, we also identified four gene candidates mainly involved in C4 carbon fixation, and one TOR gene. Their exact roles in plant heat stress response need to dissect further. This study would be important by providing the gene resources for improving heat stress tolerance in both perennial ryegrass and other cool-season perennial grass plants. PMID:28680431

Dose response evaluation of gene expression profiles in the skin of K6/ODC mice exposed to sodium arsenite.

PubMed

Ahlborn, Gene J; Nelson, Gail M; Ward, William O; Knapp, Geremy; Allen, James W; Ouyang, Ming; Roop, Barbara C; Chen, Yan; O'Brien, Thomas; Kitchin, Kirk T; Delker, Don A

2008-03-15

Chronic drinking water exposure to inorganic arsenic and its metabolites increases tumor frequency in the skin of K6/ODC transgenic mice. To identify potential biomarkers and modes of action for this skin tumorigenicity, we characterized gene expression profiles from analysis of K6/ODC mice administered 0, 0.05, 0.25, 1.0 and 10 ppm sodium arsenite in their drinking water for 4 weeks. Following exposure, total RNA was isolated from mouse skin and processed to biotin-labeled cRNA for microarray analyses. Skin gene expression was analyzed with Affymetrix Mouse Genome 430A 2.0 GeneChips, and pathway analysis was conducted with DAVID (NIH), Ingenuity Systems and MetaCore's GeneGo. Differential expression of several key genes was verified through qPCR. Only the highest dose (10 ppm) resulted in significantly altered KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways, including MAPK, regulation of actin cytoskeleton, Wnt, Jak-Stat, Tight junction, Toll-like, phosphatidylinositol and insulin signaling pathways. Approximately 20 genes exhibited a dose response, including several genes known to be associated with carcinogenesis or tumor progression including cyclin D1, CLIC4, Ephrin A1, STAT3 and DNA methyltransferase 3a. Although transcription changes in all identified genes have not previously been linked to arsenic carcinogenesis, their association with carcinogenesis in other systems suggests that these genes may play a role in the early stages of arsenic-induced skin carcinogenesis and can be considered potential biomarkers.

Transcriptome Analysis of Aspergillus flavus Reveals veA-Dependent Regulation of Secondary Metabolite Gene Clusters, Including the Novel Aflavarin Cluster

PubMed Central

Cary, J. W.; Han, Z.; Yin, Y.; Lohmar, J. M.; Shantappa, S.; Harris-Coward, P. Y.; Mack, B.; Ehrlich, K. C.; Wei, Q.; Arroyo-Manzanares, N.; Uka, V.; Vanhaecke, L.; Bhatnagar, D.; Yu, J.; Nierman, W. C.; Johns, M. A.; Sorensen, D.; Shen, H.; De Saeger, S.; Diana Di Mavungu, J.

2015-01-01

The global regulatory veA gene governs development and secondary metabolism in numerous fungal species, including Aspergillus flavus. This is especially relevant since A. flavus infects crops of agricultural importance worldwide, contaminating them with potent mycotoxins. The most well-known are aflatoxins, which are cytotoxic and carcinogenic polyketide compounds. The production of aflatoxins and the expression of genes implicated in the production of these mycotoxins are veA dependent. The genes responsible for the synthesis of aflatoxins are clustered, a signature common for genes involved in fungal secondary metabolism. Studies of the A. flavus genome revealed many gene clusters possibly connected to the synthesis of secondary metabolites. Many of these metabolites are still unknown, or the association between a known metabolite and a particular gene cluster has not yet been established. In the present transcriptome study, we show that veA is necessary for the expression of a large number of genes. Twenty-eight out of the predicted 56 secondary metabolite gene clusters include at least one gene that is differentially expressed depending on presence or absence of veA. One of the clusters under the influence of veA is cluster 39. The absence of veA results in a downregulation of the five genes found within this cluster. Interestingly, our results indicate that the cluster is expressed mainly in sclerotia. Chemical analysis of sclerotial extracts revealed that cluster 39 is responsible for the production of aflavarin. PMID:26209694

Global gene expression analysis of early response to chemotherapy treatment in ovarian cancer spheroids.

PubMed

L'Espérance, Sylvain; Bachvarova, Magdalena; Tetu, Bernard; Mes-Masson, Anne-Marie; Bachvarov, Dimcho

2008-02-26

Chemotherapy (CT) resistance in ovarian cancer (OC) is broad and encompasses diverse unrelated drugs, suggesting more than one mechanism of resistance. To better understand the molecular mechanisms controlling the immediate response of OC cells to CT exposure, we have performed gene expression profiling in spheroid cultures derived from six OC cell lines (OVCAR3, SKOV3, TOV-112, TOV-21, OV-90 and TOV-155), following treatment with 10,0 microM cisplatin, 2,5 microM paclitaxel or 5,0 microM topotecan for 72 hours. Exposure of OC spheroids to these CT drugs resulted in differential expression of genes associated with cell growth and proliferation, cellular assembly and organization, cell death, cell cycle control and cell signaling. Genes, functionally involved in DNA repair, DNA replication and cell cycle arrest were mostly overexpressed, while genes implicated in metabolism (especially lipid metabolism), signal transduction, immune and inflammatory response, transport, transcription regulation and protein biosynthesis, were commonly suppressed following all treatments. Cisplatin and topotecan treatments triggered similar alterations in gene and pathway expression patterns, while paclitaxel action was mainly associated with induction of genes and pathways linked to cellular assembly and organization (including numerous tubulin genes), cell death and protein synthesis. The microarray data were further confirmed by pathway and network analyses. Most alterations in gene expression were directly related to mechanisms of the cytotoxics actions in OC spheroids. However, the induction of genes linked to mechanisms of DNA replication and repair in cisplatin- and topotecan-treated OC spheroids could be associated with immediate adaptive response to treatment. Similarly, overexpression of different tubulin genes upon exposure to paclitaxel could represent an early compensatory effect to this drug action. Finally, multicellular growth conditions that are known to alter gene expression (including cell adhesion and cytoskeleton organization), could substantially contribute in reducing the initial effectiveness of CT drugs in OC spheroids. Results described in this study underscore the potential of the microarray technology for unraveling the complex mechanisms of CT drugs actions in OC spheroids and early cellular response to treatment.

Aflatoxin formation and gene expression in response to carbon source media shift in Aspergillus parasiticus.

PubMed

Wilkinson, J R; Yu, J; Abbas, H K; Scheffler, B E; Kim, H S; Nierman, W C; Bhatnagar, D; Cleveland, T E

2007-10-01

Aflatoxins are toxic and carcinogenic polyketide metabolites produced by fungal species, including Aspergillus flavus and A. parasiticus. The biosynthesis of aflatoxins is modulated by many environmental factors, including the availability of a carbon source. The gene expression profile of A. parasiticus was evaluated during a shift from a medium with low concentration of simple sugars, yeast extract (YE), to a similar medium with sucrose, yeast extract sucrose (YES). Gene expression and aflatoxins (B1, B2, G1, and G2) were quantified from fungal mycelia harvested pre- and post-shifting. When compared with YE media, YES caused temporary reduction of the aflatoxin levels detected at 3-h post-shifting and they remained low well past 12 h post-shift. Aflatoxin levels did not exceed the levels in YE until 24 h post-shift, at which time point a tenfold increase was observed over YE. Microarray analysis comparing the RNA samples from the 48-h YE culture to the YES samples identified a total of 2120 genes that were expressed across all experiments, including most of the aflatoxin biosynthesis genes. One-way analysis of variance (ANOVA) identified 56 genes that were expressed with significant variation across all time points. Three genes responsible for converting norsolorinic acid to averantin were identified among these significantly expressed genes. The potential involvement of these genes in the regulation of aflatoxin biosynthesis is discussed.

A Genome-Wide Identification of the WRKY Family Genes and a Survey of Potential WRKY Target Genes in Dendrobium officinale.

PubMed

He, Chunmei; Teixeira da Silva, Jaime A; Tan, Jianwen; Zhang, Jianxia; Pan, Xiaoping; Li, Mingzhi; Luo, Jianping; Duan, Jun

2017-08-23

The WRKY family, one of the largest families of transcription factors, plays important roles in the regulation of various biological processes, including growth, development and stress responses in plants. In the present study, 63 DoWRKY genes were identified from the Dendrobium officinale genome. These were classified into groups I, II, III and a non-group, each with 14, 28, 10 and 11 members, respectively. ABA-responsive, sulfur-responsive and low temperature-responsive elements were identified in the 1-k upstream regulatory region of DoWRKY genes. Subsequently, the expression of the 63 DoWRKY genes under cold stress was assessed, and the expression profiles of a large number of these genes were regulated by low temperature in roots and stems. To further understand the regulatory mechanism of DoWRKY genes in biological processes, potential WRKY target genes were investigated. Among them, most stress-related genes contained multiple W-box elements in their promoters. In addition, the genes involved in polysaccharide synthesis and hydrolysis contained W-box elements in their 1-k upstream regulatory regions, suggesting that DoWRKY genes may play a role in polysaccharide metabolism. These results provide a basis for investigating the function of WRKY genes and help to understand the downstream regulation network in plants within the Orchidaceae.

Strengthening insights into host responses to mastitis infection in ruminants by combining heterogeneous microarray data sources

PubMed Central

2011-01-01

Background Gene expression profiling studies of mastitis in ruminants have provided key but fragmented knowledge for the understanding of the disease. A systematic combination of different expression profiling studies via meta-analysis techniques has the potential to test the extensibility of conclusions based on single studies. Using the program Pointillist, we performed meta-analysis of transcription-profiling data from six independent studies of infections with mammary gland pathogens, including samples from cattle challenged in vivo with S. aureus, E. coli, and S. uberis, samples from goats challenged in vivo with S. aureus, as well as cattle macrophages and ovine dendritic cells infected in vitro with S. aureus. We combined different time points from those studies, testing different responses to mastitis infection: overall (common signature), early stage, late stage, and cattle-specific. Results Ingenuity Pathway Analysis of affected genes showed that the four meta-analysis combinations share biological functions and pathways (e.g. protein ubiquitination and polyamine regulation) which are intrinsic to the general disease response. In the overall response, pathways related to immune response and inflammation, as well as biological functions related to lipid metabolism were altered. This latter observation is consistent with the milk fat content depression commonly observed during mastitis infection. Complementarities between early and late stage responses were found, with a prominence of metabolic and stress signals in the early stage and of the immune response related to the lipid metabolism in the late stage; both mechanisms apparently modulated by few genes, including XBP1 and SREBF1. The cattle-specific response was characterized by alteration of the immune response and by modification of lipid metabolism. Comparison of E. coli and S. aureus infections in cattle in vivo revealed that affected genes showing opposite regulation had the same altered biological functions and provided evidence that E. coli caused a stronger host response. Conclusions This meta-analysis approach reinforces previous findings but also reveals several novel themes, including the involvement of genes, biological functions, and pathways that were not identified in individual studies. As such, it provides an interesting proof of principle for future studies combining information from diverse heterogeneous sources. PMID:21569310

Spaceflight modulates gene expression in the whole blood of astronauts.

PubMed

Barrila, Jennifer; Ott, C Mark; LeBlanc, Carly; Mehta, Satish K; Crabbé, Aurélie; Stafford, Phillip; Pierson, Duane L; Nickerson, Cheryl A

2016-01-01

Astronauts are exposed to a unique combination of stressors during spaceflight, which leads to alterations in their physiology and potentially increases their susceptibility to disease, including infectious diseases. To evaluate the potential impact of the spaceflight environment on the regulation of molecular pathways mediating cellular stress responses, we performed a first-of-its-kind pilot study to assess spaceflight-related gene-expression changes in the whole blood of astronauts. Using an array comprised of 234 well-characterized stress-response genes, we profiled transcriptomic changes in six astronauts (four men and two women) from blood preserved before and immediately following the spaceflight. Differentially regulated transcripts included those important for DNA repair, oxidative stress, and protein folding/degradation, including HSP90AB1 , HSP27 , GPX1 , XRCC1 , BAG-1 , HHR23A , FAP48 , and C-FOS . No gender-specific differences or relationship to number of missions flown was observed. This study provides a first assessment of transcriptomic changes occurring in the whole blood of astronauts in response to spaceflight.

Spaceflight modulates gene expression in the whole blood of astronauts

PubMed Central

Barrila, Jennifer; Ott, C Mark; LeBlanc, Carly; Mehta, Satish K; Crabbé, Aurélie; Stafford, Phillip; Pierson, Duane L; Nickerson, Cheryl A

2016-01-01

Astronauts are exposed to a unique combination of stressors during spaceflight, which leads to alterations in their physiology and potentially increases their susceptibility to disease, including infectious diseases. To evaluate the potential impact of the spaceflight environment on the regulation of molecular pathways mediating cellular stress responses, we performed a first-of-its-kind pilot study to assess spaceflight-related gene-expression changes in the whole blood of astronauts. Using an array comprised of 234 well-characterized stress-response genes, we profiled transcriptomic changes in six astronauts (four men and two women) from blood preserved before and immediately following the spaceflight. Differentially regulated transcripts included those important for DNA repair, oxidative stress, and protein folding/degradation, including HSP90AB1, HSP27, GPX1, XRCC1, BAG-1, HHR23A, FAP48, and C-FOS. No gender-specific differences or relationship to number of missions flown was observed. This study provides a first assessment of transcriptomic changes occurring in the whole blood of astronauts in response to spaceflight. PMID:28725744

Diversity in Expression of Phosphorus (P) Responsive Genes in Cucumis melo L

PubMed Central

Fita, Ana; Bowen, Helen C.; Hayden, Rory M.; Nuez, Fernando; Picó, Belén; Hammond, John P.

2012-01-01

Background Phosphorus (P) is a major limiting nutrient for plant growth in many soils. Studies in model species have identified genes involved in plant adaptations to low soil P availability. However, little information is available on the genetic bases of these adaptations in vegetable crops. In this respect, sequence data for melon now makes it possible to identify melon orthologues of candidate P responsive genes, and the expression of these genes can be used to explain the diversity in the root system adaptation to low P availability, recently observed in this species. Methodology and Findings Transcriptional responses to P starvation were studied in nine diverse melon accessions by comparing the expression of eight candidate genes (Cm-PAP10.1, Cm-PAP10.2, Cm-RNS1, Cm-PPCK1, Cm-transferase, Cm-SQD1, Cm-DGD1 and Cm-SPX2) under P replete and P starved conditions. Differences among melon accessions were observed in response to P starvation, including differences in plant morphology, P uptake, P use efficiency (PUE) and gene expression. All studied genes were up regulated under P starvation conditions. Differences in the expression of genes involved in P mobilization and remobilization (Cm-PAP10.1, Cm-PAP10.2 and Cm-RNS1) under P starvation conditions explained part of the differences in P uptake and PUE among melon accessions. The levels of expression of the other studied genes were diverse among melon accessions, but contributed less to the phenotypical response of the accessions. Conclusions This is the first time that these genes have been described in the context of P starvation responses in melon. There exists significant diversity in gene expression levels and P use efficiency among melon accessions as well as significant correlations between gene expression levels and phenotypical measurements. PMID:22536378

Environmental stress alters genes expression and induces ovule abortion: reactive oxygen species appear as ovules commit to abort.

PubMed

Sun, Kelian; Cui, Yuehua; Hauser, Bernard A

2005-11-01

Environmental stress dramatically reduces plant reproduction. Previous results showed that placing roots in 200 mM NaCl for 12 h caused 90% of the developing Arabidopsis ovules to abort (Sun et al. in Plant Physiol 135:2358-2367, 2004). To discover the molecular responses that occur during ovule abortion, gene expression was monitored using Affymetrix 24k genome arrays. Transcript levels were measured in pistils that were stressed for 6, 12, 18, and 24 h, then compared with the levels in healthy pistils. Over the course of this experiment, a total of 535 salt-responsive genes were identified. Cluster analysis showed that differentially expressed genes exhibited reproducible changes in expression. The expression of 65 transcription factors, some of which are known to be involved in stress responses, were modulated during ovule abortion. In flowers, salt stress led to a 30-fold increase in Na+ ions and modest, but significant, decreases in the accumulation of other ions. The expression of cation exchangers and ion transporters were induced, presumably to reestablish ion homeostasis following salt stress. Genes that encode enzymes that detoxify reactive oxygen species (ROS), including ascorbate peroxidase and peroxidase, were downregulated after ovules committed to abort. These changes in gene expression coincided with the synthesis of ROS in female gametophytes. One day after salt stress, ROS spread from the gametophytes to the maternal chalaza and integuments. In addition, genes encoding proteins that regulate ethylene responses, including ethylene biosynthesis, ethylene signal transduction and ethylene-responsive transcription factors, were upregulated after stress. Hypotheses are proposed on the basis of this expression analysis, which will be evaluated further in future experiments.

Differential gene expression profile from haematopoietic tissue stem cells of red claw crayfish, Cherax quadricarinatus, in response to WSSV infection.

PubMed

Liu, Hai-peng; Chen, Rong-yuan; Zhang, Qiu-xia; Peng, Hui; Wang, Ke-jian

2011-07-01

White spot syndrome virus (WSSV) is one of the most important viral pathogens in crustaceans. During WSSV infection, multiple cell signaling cascades are activated, leading to the generation of antiviral molecules and initiation of programmed cell death of the virus infected cells. To gain novel insight into cell signaling mechanisms employed in WSSV infection, we have used suppression subtractive hybridization (SSH) to elucidate the cellular response to WSSV challenge at the gene level in red claw crayfish haematopoietic tissue (Hpt) stem cell cultures. Red claw crayfish Hpt cells were infected with WSSV for 1h (L1 library) and 12h (L12 library), respectively, after which the cell RNA was prepared for SSH using uninfected cells as drivers. By screening the L1 and L12 forward libraries, we have isolated the differentially expressed genes of crayfish Hpt cells upon WSSV infection. Among these genes, the level of many key molecules showed clearly up-regulated expression, including the genes involved in immune responses, cytoskeletal system, signal transduction molecules, stress, metabolism and homestasis related genes, and unknown genes in both L1 and L12 libraries. Importantly, of the 2123 clones screened, 176 novel genes were found the first time to be up-regulated in WSSV infection in crustaceans. To further confirm the up-regulation of differentially expressed genes, the semi-quantitative RT-PCR were performed to test twenty randomly selected genes, in which eight of the selected genes exhibited clear up-regulation upon WSSV infection in red claw crayfish Hpt cells, including DNA helicase B-like, multiprotein bridging factor 1, apoptosis-linked gene 2 and an unknown gene-L1635 from L1 library; coatomer gamma subunit, gabarap protein gene, tripartite motif-containing 32 and an unknown gene-L12-254 from L2 library, respectively. Taken together, as well as in immune and stress responses are regulated during WSSV infection of crayfish Hpt cells, our results also light the significance of cytoskeletal system, signal transduction and other unknown genes in the regulation of antiviral signals during WSSV infection. Copyright © 2011 Elsevier Ltd. All rights reserved.

Activin Modulates the Transcriptional Response of LβT2 Cells to Gonadotropin-Releasing Hormone and Alters Cellular Proliferation

PubMed Central

Zhang, Hao; Bailey, Janice S.; Coss, Djurdjica; Lin, Bo; Tsutsumi, Rie; Lawson, Mark A.; Mellon, Pamela L.; Webster, Nicholas J. G.

2009-01-01

Both GnRH and activin are crucial for the correct function of pituitary gonadotrope cells. GnRH regulates LH and FSH synthesis and secretion and gonadotrope proliferation, whereas activin is essential for expression of FSH. Little is known, however, about the interplay of signaling downstream of these two hormones. In this study, we undertook expression profiling to determine how activin pre-treatment alters the transcriptional response of LβT2 gonadotrope cells to GnRH stimulation. Activin treatment alone altered the transcriptional profile of 303 genes including inducing that of the 17β-hydroxysteroid dehydrogenase B1 gene that converts estrone to 17β-estradiol, altering the sensitivity of the cells to estrone. Furthermore, activin had a dramatic effect on the response of LβT2 cells to GnRH. Hierarchical clustering of 2453 GnRH-responsive genes identified groups of genes the response of which to GnRH was either enhanced or blunted after activin treatment. Mapping of these genes to gene ontology classifications or signaling pathways highlighted significant differences in the classes of altered genes. In the presence of activin, GnRH regulates genes in pathways controlling cell energetics, cytoskeletal rearrangements, organelle organization, and mitosis in the absence of activin, but genes controlling protein processing, cell differentiation, and secretion. Therefore, we demonstrated that activin enhanced GnRH induction of p38MAPK activity, caused GnRH-dependent phosphorylation of p53, and reduced the ability of GnRH to cause G1 arrest. Thus, although activin alone changes a modest number of transcripts, activin pretreatment dramatically alters the response to GnRH from an antiproliferative response to a more differentiated, synthetic response appropriate for a secretory cell. PMID:16772531

Gene expression from plants grown on the International Space Station

NASA Astrophysics Data System (ADS)

Stimpson, Alexander; Pereira, Rhea; Kiss, John Z.; Correll, Melanie

Three experiments were performed on the International Space Station (ISS) in 2006 as part of the TROPI experiments. These experiments were performed to study graviTROPIsm and photoTROPIsm responses of Arabidopsis in microgravity (µg). Seedlings were grown with a variety of light and gravitational treatments for approximately five days. The frozen samples were returned to Earth during three space shuttle missions in 2007 and stored at -80° C. Due to the limited amount of plant biomass returned, new protocols were developed to minimize the amount of material needed for RNA extraction as a preparation for microarray analysis. Using these new protocols, RNA was extracted from several sets of seedlings grown in red light followed by blue light with one sample from 1.0g treatment and the other at µg. Using a 2-fold change criterion, microarray (Affymetrix, GeneChip) results showed that 613 genes were upregulated in the µg sample while 757 genes were downregulated. Upregulated genes in response to µg included transcription factors from the WRKY (15 genes), MYB (3) and ZF (8) families as well as those that are involved in auxin responses (10). Downregulated genes also included transcription factors such as MYB (5) and Zinc finger (10) but interestingly only two WRKY family genes were down-regulated during the µg treatment. Studies are underway to compare these results with other samples to identify the genes involved in the gravity and light signal transduction pathways (this project is Supported By: NASA NCC2-1200).

Structural and functional annotation of the porcine immunome

PubMed Central

2013-01-01

Background The domestic pig is known as an excellent model for human immunology and the two species share many pathogens. Susceptibility to infectious disease is one of the major constraints on swine performance, yet the structure and function of genes comprising the pig immunome are not well-characterized. The completion of the pig genome provides the opportunity to annotate the pig immunome, and compare and contrast pig and human immune systems. Results The Immune Response Annotation Group (IRAG) used computational curation and manual annotation of the swine genome assembly 10.2 (Sscrofa10.2) to refine the currently available automated annotation of 1,369 immunity-related genes through sequence-based comparison to genes in other species. Within these genes, we annotated 3,472 transcripts. Annotation provided evidence for gene expansions in several immune response families, and identified artiodactyl-specific expansions in the cathelicidin and type 1 Interferon families. We found gene duplications for 18 genes, including 13 immune response genes and five non-immune response genes discovered in the annotation process. Manual annotation provided evidence for many new alternative splice variants and 8 gene duplications. Over 1,100 transcripts without porcine sequence evidence were detected using cross-species annotation. We used a functional approach to discover and accurately annotate porcine immune response genes. A co-expression clustering analysis of transcriptomic data from selected experimental infections or immune stimulations of blood, macrophages or lymph nodes identified a large cluster of genes that exhibited a correlated positive response upon infection across multiple pathogens or immune stimuli. Interestingly, this gene cluster (cluster 4) is enriched for known general human immune response genes, yet contains many un-annotated porcine genes. A phylogenetic analysis of the encoded proteins of cluster 4 genes showed that 15% exhibited an accelerated evolution as compared to 4.1% across the entire genome. Conclusions This extensive annotation dramatically extends the genome-based knowledge of the molecular genetics and structure of a major portion of the porcine immunome. Our complementary functional approach using co-expression during immune response has provided new putative immune response annotation for over 500 porcine genes. Our phylogenetic analysis of this core immunome cluster confirms rapid evolutionary change in this set of genes, and that, as in other species, such genes are important components of the pig’s adaptation to pathogen challenge over evolutionary time. These comprehensive and integrated analyses increase the value of the porcine genome sequence and provide important tools for global analyses and data-mining of the porcine immune response. PMID:23676093

Genome-wide identification, phylogeny, and expression analysis of the SWEET gene family in tomato.

PubMed

Feng, Chao-Yang; Han, Jia-Xuan; Han, Xiao-Xue; Jiang, Jing

2015-12-01

The SWEET (Sugars Will Eventually Be Exported Transporters) gene family encodes membrane-embedded sugar transporters containing seven transmembrane helices harboring two MtN3 and saliva domain. SWEETs play important roles in diverse biological processes, including plant growth, development, and response to environmental stimuli. Here, we conducted an exhaustive search of the tomato genome, leading to the identification of 29 SWEET genes. We analyzed the structures, conserved domains, and phylogenetic relationships of these protein-coding genes in detail. We also analyzed the transcript levels of SWEET genes in various tissues, organs, and developmental stages to obtain information about their functions. Furthermore, we investigated the expression patterns of the SWEET genes in response to exogenous sugar and adverse environmental stress (high and low temperatures). Some family members exhibited tissue-specific expression, whereas others were more ubiquitously expressed. Numerous stress-responsive candidate genes were obtained. The results of this study provide insights into the characteristics of the SWEET genes in tomato and may serve as a basis for further functional studies of such genes. Copyright © 2015 Elsevier B.V. All rights reserved.

Product-induced gene expression, a product-responsive reporter assay used to screen metagenomic libraries for enzyme-encoding genes.

PubMed

Uchiyama, Taku; Miyazaki, Kentaro

2010-11-01

A reporter assay-based screening method for enzymes, which we named product-induced gene expression (PIGEX), was developed and used to screen a metagenomic library for amidases. A benzoate-responsive transcriptional activator, BenR, was placed upstream of the gene encoding green fluorescent protein and used as a sensor. Escherichia coli sensor cells carrying the benR-gfp gene cassette fluoresced in response to benzoate concentrations as low as 10 μM but were completely unresponsive to the substrate benzamide. An E. coli metagenomic library consisting of 96,000 clones was grown in 96-well format in LB medium containing benzamide. The library cells were then cocultivated with sensor cells. Eleven amidase genes were recovered from 143 fluorescent wells; eight of these genes were homologous to known bacterial amidase genes while three were novel genes. In addition to their activity toward benzamide, the enzymes were active toward various substrates, including d- and l-amino acid amides, and displayed enantioselectivity. Thus, we demonstrated that PIGEX is an effective approach for screening novel enzymes based on product detection.

Functional link between DNA damage responses and transcriptional regulation by ATM in response to a histone deacetylase inhibitor TSA.

PubMed

Lee, Jong-Soo

2007-09-01

Mutations in the ATM (ataxia-telangiectasia mutated) gene, which encodes a 370 kd protein with a kinase catalytic domain, predisposes people to cancers, and these mutations are also linked to ataxia-telangiectasia (A-T). The histone acetylaion/deacetylation- dependent chromatin remodeling can activate the ATM kinase-mediated DNA damage signal pathway (in an accompanying work, Lee, 2007). This has led us to study whether this modification can impinge on the ATM-mediated DNA damage response via transcriptional modulation in order to understand the function of ATM in the regulation of gene transcription. To identify the genes whose expression is regulated by ATM in response to histone deaceylase (HDAC) inhibition, we performed an analysis of oligonucleotide microarrays with using the appropriate cell lines, isogenic A-T (ATM(-)) and control (ATM(+)) cells, following treatment with a HDAC inhibitor TSA. Treatment with TSA reprograms the differential gene expression profile in response to HDAC inhibition in ATM(-) cells and ATM(+) cells. We analyzed the genes that are regulated by TSA in the ATM-dependent manner, and we classified these genes into different functional categories, including those involved in cell cycle/DNA replication, DNA repair, apoptosis, growth/differentiation, cell- cell adhesion, signal transduction, metabolism and transcription. We found that while some genes are regulated by TSA without regard to ATM, the patterns of gene regulation are differentially regulated in an ATM-dependent manner. Taken together, these finding indicate that ATM can regulate the transcription of genes that play critical roles in the molecular response to DNA damage, and this response is modulated through an altered HDAC inhibition-mediated gene expression.

Differential Responses of Soleus and Plantaris Muscle Fibers to Overloading

NASA Astrophysics Data System (ADS)

Kawano, Fuminori; Shibaguchi, Tsubasa; Ohira, Takashi; Nakai, Naoya; Ohira, Yoshinobu

2013-02-01

Responses of slow and fast fibers in soleus and plantaris muscles of adult rats to overloading by the tendon transection of synergists were studied. Overloading-related hypertrophy was noted in the slow fibers of plantaris and soleus, although the magnitude was greater in plantaris. Five genes with minor expression in slow soleus muscle were identified by microarray analysis. Base-line expressions of these genes in slow fibers of plantaris were also low. Further, repressive effects of overloading on these genes were seen in some fast fibers of plantaris, not in whole plantaris and soleus. The data suggested that the repression of particular genes might be related to the pronounced morphological response of fibers expressing type II, including I+II, myosin heavy chain (MyHC), although these genes with lower base-line expression in slow fibers did not respond to overloading.

Transcriptome dynamics of a susceptible wheat upon Fusarium head blight reveals that molecular responses to Fusarium graminearum infection fit over the grain development processes.

PubMed

Chetouhi, Cherif; Bonhomme, Ludovic; Lasserre-Zuber, Pauline; Cambon, Florence; Pelletier, Sandra; Renou, Jean-Pierre; Langin, Thierry

2016-03-01

In many plant/pathogen interactions, host susceptibility factors are key determinants of disease development promoting pathogen growth and spreading in plant tissues. In the Fusarium head blight (FHB) disease, the molecular basis of wheat susceptibility is still poorly understood while it could provide new insights into the understanding of the wheat/Fusarium graminearum (Fg) interaction and guide future breeding programs to produce cultivars with sustainable resistance. To identify the wheat grain candidate genes, a genome-wide gene expression profiling was performed in the French susceptible wheat cultivar, Recital. Gene-specific two-way ANOVA of about 40 K transcripts at five grain developmental stages identified 1309 differentially expressed genes. Out of these, 536 were impacted by the Fg effect alone. Most of these Fg-responsive genes belonged to biological and molecular functions related to biotic and abiotic stresses indicating the activation of common stress pathways during susceptibility response of wheat grain to FHB. This analysis revealed also 773 other genes displaying either specific Fg-responsive profiles along with grain development stages or synergistic adjustments with the grain development effect. These genes were involved in various molecular pathways including primary metabolism, cell death, and gene expression reprogramming. An increasingly complex host response was revealed, as was the impact of both Fg infection and grain ontogeny on the transcription of wheat genes. This analysis provides a wealth of candidate genes and pathways involved in susceptibility responses to FHB and depicts new clues to the understanding of the susceptibility determinism in plant/pathogen interactions.

Influenza A Virus Infection of Human Respiratory Cells Induces Primary MicroRNA Expression*

PubMed Central

Buggele, William A.; Johnson, Karen E.; Horvath, Curt M.

2012-01-01

The cellular response to virus infection is initiated by recognition of the invading pathogen and subsequent changes in gene expression mediated by both transcriptional and translational mechanisms. In addition to well established means of regulating antiviral gene expression, it has been demonstrated that RNA interference (RNAi) can play an important role in antiviral responses. Virus-derived small interfering RNA (siRNA) is a primary antiviral response exploited by plants and invertebrate animals, and host-encoded microRNA (miRNA) species have been clearly implicated in the regulation of innate and adaptive immune responses in mammals and other vertebrates. Examination of miRNA abundance in human lung cell lines revealed endogenous miRNAs, including miR-7, miR-132, miR-146a, miR-187, miR-200c, and miR-1275, to specifically accumulate in response to infection with two influenza A virus strains, A/Udorn/72 and A/WSN/33. Known antiviral response pathways, including Toll-like receptor, RIG-I-like receptor, and direct interferon or cytokine stimulation did not alter the abundance of the tested miRNAs to the extent of influenza A virus infection, which initiates primary miRNA transcription via a secondary response pathway. Gene expression profiling identified 26 cellular mRNAs targeted by these miRNAs, including IRAK1, MAPK3, and other components of innate immune signaling systems. PMID:22822053

Analysis of gene expression profile microarray data in complex regional pain syndrome.

PubMed

Tan, Wulin; Song, Yiyan; Mo, Chengqiang; Jiang, Shuangjian; Wang, Zhongxing

2017-09-01

The aim of the present study was to predict key genes and proteins associated with complex regional pain syndrome (CRPS) using bioinformatics analysis. The gene expression profiling microarray data, GSE47603, which included peripheral blood samples from 4 patients with CRPS and 5 healthy controls, was obtained from the Gene Expression Omnibus (GEO) database. The differentially expressed genes (DEGs) in CRPS patients compared with healthy controls were identified using the GEO2R online tool. Functional enrichment analysis was then performed using The Database for Annotation Visualization and Integrated Discovery online tool. Protein‑protein interaction (PPI) network analysis was subsequently performed using Search Tool for the Retrieval of Interaction Genes database and analyzed with Cytoscape software. A total of 257 DEGs were identified, including 243 upregulated genes and 14 downregulated ones. Genes in the human leukocyte antigen (HLA) family were most significantly differentially expressed. Enrichment analysis demonstrated that signaling pathways, including immune response, cell motion, adhesion and angiogenesis were associated with CRPS. PPI network analysis revealed that key genes, including early region 1A binding protein p300 (EP300), CREB‑binding protein (CREBBP), signal transducer and activator of transcription (STAT)3, STAT5A and integrin α M were associated with CRPS. The results suggest that the immune response may therefore serve an important role in CRPS development. In addition, genes in the HLA family, such as HLA‑DQB1 and HLA‑DRB1, may present potential biomarkers for the diagnosis of CRPS. Furthermore, EP300, its paralog CREBBP, and the STAT family genes, STAT3 and STAT5 may be important in the development of CRPS.

Gene regulatory network of unfolded protein response genes in endoplasmic reticulum stress.

PubMed

Takayanagi, Sayuri; Fukuda, Riga; Takeuchi, Yuuki; Tsukada, Sakiko; Yoshida, Kenichi

2013-01-01

In the endoplasmic reticulum (ER), secretory and membrane proteins are properly folded and modified, and the failure of these processes leads to ER stress. At the same time, unfolded protein response (UPR) genes are activated to maintain homeostasis. Despite the thorough characterization of the individual gene regulation of UPR genes to date, further investigation of the mutual regulation among UPR genes is required to understand the complex mechanism underlying the ER stress response. In this study, we aimed to reveal a gene regulatory network formed by UPR genes, including immunoglobulin heavy chain-binding protein (BiP), X-box binding protein 1 (XBP1), C/EBP [CCAAT/enhancer-binding protein]-homologous protein (CHOP), PKR-like endoplasmic reticulum kinase (PERK), inositol-requiring 1 (IRE1), activating transcription factor 6 (ATF6), and ATF4. For this purpose, we focused on promoter-luciferase reporters for BiP, XBP1, and CHOP genes, which bear an ER stress response element (ERSE), and p5 × ATF6-GL3, which bears an unfolded protein response element (UPRE). We demonstrated that the luciferase activities of the BiP and CHOP promoters were upregulated by all the UPR genes, whereas those of the XBP1 promoter and p5 × ATF6-GL3 were upregulated by all the UPR genes except for BiP, CHOP, and ATF4 in HeLa cells. Therefore, an ERSE- and UPRE-centered gene regulatory network of UPR genes could be responsible for the robustness of the ER stress response. Finally, we revealed that BiP protein was degraded when cells were treated with DNA-damaging reagents, such as etoposide and doxorubicin; this finding suggests that the expression level of BiP is tightly regulated at the post-translational level, rather than at the transcriptional level, in the presence of DNA damage.

An Integrated Functional Genomics Consortium to Increase Carbon Sequestration in Poplars: Optimizing Aboveground Carbon Gain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karnosky, David F; Podila, G Krishna; Burton, Andrew J

2009-02-17

This project used gene expression patterns from two forest Free-Air CO2 Enrichment (FACE) experiments (Aspen FACE in northern Wisconsin and POPFACE in Italy) to examine ways to increase the aboveground carbon sequestration potential of poplars (Populus). The aim was to use patterns of global gene expression to identify candidate genes for increased carbon sequestration. Gene expression studies were linked to physiological measurements in order to elucidate bottlenecks in carbon acquisition in trees grown in elevated CO2 conditions. Delayed senescence allowing additional carbon uptake late in the growing season, was also examined, and expression of target genes was tested in elitemore » P. deltoides x P. trichocarpa hybrids. In Populus euramericana, gene expression was sensitive to elevated CO2, but the response depended on the developmental age of the leaves. Most differentially expressed genes were upregulated in elevated CO2 in young leaves, while most were downregulated in elevated CO2 in semi-mature leaves. In P. deltoides x P. trichocarpa hybrids, leaf development and leaf quality traits, including leaf area, leaf shape, epidermal cell area, stomatal number, specific leaf area, and canopy senescence were sensitive to elevated CO2. Significant increases under elevated CO2 occurred for both above- and belowground growth in the F-2 generation. Three areas of the genome played a role in determining aboveground growth response to elevated CO2, with three additional areas of the genome important in determining belowground growth responses to elevated CO2. In Populus tremuloides, CO2-responsive genes in leaves were found to differ between two aspen clones that showed different growth responses, despite similarity in many physiological parameters (photosynthesis, stomatal conductance, and leaf area index). The CO2-responsive clone shunted C into pathways associated with active defense/response to stress, carbohydrate/starch biosynthesis and subsequent growth. The CO2-unresponsive clone partitioned C into pathways associated with passive defense and cell wall thickening. These results indicate that there is significant variation in gene expression patterns between different tree genotypes. Consequently, future efforts to improve productivity or other advantageous traits for carbon sequestration should include an examination of genetic variability in CO2 responsiveness.« less

Parallel epigenomic and transcriptomic responses to viral infection in honey bees (Apis mellifera).

PubMed

Galbraith, David A; Yang, Xingyu; Niño, Elina Lastro; Yi, Soojin; Grozinger, Christina

2015-03-01

Populations of honey bees are declining throughout the world, with US beekeepers losing 30% of their colonies each winter. Though multiple factors are driving these colony losses, it is increasingly clear that viruses play a major role. However, information about the molecular mechanisms mediating antiviral immunity in honey bees is surprisingly limited. Here, we examined the transcriptional and epigenetic (DNA methylation) responses to viral infection in honey bee workers. One-day old worker honey bees were fed solutions containing Israeli Acute Paralysis Virus (IAPV), a virus which causes muscle paralysis and death and has previously been associated with colony loss. Uninfected control and infected, symptomatic bees were collected within 20-24 hours after infection. Worker fat bodies, the primary tissue involved in metabolism, detoxification and immune responses, were collected for analysis. We performed transcriptome- and bisulfite-sequencing of the worker fat bodies to identify genome-wide gene expression and DNA methylation patterns associated with viral infection. There were 753 differentially expressed genes (FDR<0.05) in infected versus control bees, including several genes involved in epigenetic and antiviral pathways. DNA methylation status of 156 genes (FDR<0.1) changed significantly as a result of the infection, including those involved in antiviral responses in humans. There was no significant overlap between the significantly differentially expressed and significantly differentially methylated genes, and indeed, the genomic characteristics of these sets of genes were quite distinct. Our results indicate that honey bees have two distinct molecular pathways, mediated by transcription and methylation, that modulate protein levels and/or function in response to viral infections.

Genome-wide organization and expression profiling of the NAC transcription factor family in potato (Solanum tuberosum L.).

PubMed

Singh, Anil Kumar; Sharma, Vishal; Pal, Awadhesh Kumar; Acharya, Vishal; Ahuja, Paramvir Singh

2013-08-01

NAC [no apical meristem (NAM), Arabidopsis thaliana transcription activation factor [ATAF1/2] and cup-shaped cotyledon (CUC2)] proteins belong to one of the largest plant-specific transcription factor (TF) families and play important roles in plant development processes, response to biotic and abiotic cues and hormone signalling. Our genome-wide analysis identified 110 StNAC genes in potato encoding for 136 proteins, including 14 membrane-bound TFs. The physical map positions of StNAC genes on 12 potato chromosomes were non-random, and 40 genes were found to be distributed in 16 clusters. The StNAC proteins were phylogenetically clustered into 12 subgroups. Phylogenetic analysis of StNACs along with their Arabidopsis and rice counterparts divided these proteins into 18 subgroups. Our comparative analysis has also identified 36 putative TNAC proteins, which appear to be restricted to Solanaceae family. In silico expression analysis, using Illumina RNA-seq transcriptome data, revealed tissue-specific, biotic, abiotic stress and hormone-responsive expression profile of StNAC genes. Several StNAC genes, including StNAC072 and StNAC101that are orthologs of known stress-responsive Arabidopsis RESPONSIVE TO DEHYDRATION 26 (RD26) were identified as highly abiotic stress responsive. Quantitative real-time polymerase chain reaction analysis largely corroborated the expression profile of StNAC genes as revealed by the RNA-seq data. Taken together, this analysis indicates towards putative functions of several StNAC TFs, which will provide blue-print for their functional characterization and utilization in potato improvement.

Coding and non-coding gene regulatory networks underlie the immune response in liver cirrhosis

PubMed Central

Zhang, Xueming; Huang, Yongming; Yang, Zhengpeng; Zhang, Yuguo; Zhang, Weihui; Gao, Zu-hua; Xue, Dongbo

2017-01-01

Liver cirrhosis is recognized as being the consequence of immune-mediated hepatocyte damage and repair processes. However, the regulation of these immune responses underlying liver cirrhosis has not been elucidated. In this study, we used GEO datasets and bioinformatics methods to established coding and non-coding gene regulatory networks including transcription factor-/lncRNA-microRNA-mRNA, and competing endogenous RNA interaction networks. Our results identified 2224 mRNAs, 70 lncRNAs and 46 microRNAs were differentially expressed in liver cirrhosis. The transcription factor -/lncRNA- microRNA-mRNA network we uncovered that results in immune-mediated liver cirrhosis is comprised of 5 core microRNAs (e.g., miR-203; miR-219-5p), 3 transcription factors (i.e., FOXP3, ETS1 and FOS) and 7 lncRNAs (e.g., ENTS00000671336, ENST00000575137). The competing endogenous RNA interaction network we identified includes a complex immune response regulatory subnetwork that controls the entire liver cirrhosis network. Additionally, we found 10 overlapping GO terms shared by both liver cirrhosis and hepatocellular carcinoma including “immune response” as well. Interestingly, the overlapping differentially expressed genes in liver cirrhosis and hepatocellular carcinoma were enriched in immune response-related functional terms. In summary, a complex gene regulatory network underlying immune response processes may play an important role in the development and progression of liver cirrhosis, and its development into hepatocellular carcinoma. PMID:28355233

Gene Expression Patterns Define Key Transcriptional Events InCell-Cycle Regulation By cAMP And Protein Kinase A

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zambon, Alexander C.; Zhang, Lingzhi; Minovitsky, Simon

Although a substantial number of hormones and drugs increase cellular cAMP levels, the global impact of cAMP and its major effector mechanism, protein kinase A (PKA), on gene expression is not known. Here we show that treatment of murine wild-type S49 lymphoma cells for 24 h with 8-(4-chlorophenylthio)-cAMP (8-CPTcAMP), a PKA-selective cAMP analog, alters the expression of approx equal to 4,500 of approx. equal to 13,600 unique genes. By contrast, gene expression was unaltered in Kin- S49 cells (that lack PKA) incubated with 8-CPTcAMP. Changes in mRNA and protein expression of several cell cycle regulators accompanied cAMP-induced G1-phase cell-cycle arrestmore » of wild-type S49 cells. Within 2h, 8-CPT-cAMP altered expression of 152 genes that contain evolutionarily conserved cAMP-response elements within 5 kb of transcriptional start sites, including the circadian clock gene Per1. Thus, cAMP through its activation of PKA produces extensive transcriptional regulation in eukaryotic cells. These transcriptional networks include a primary group of cAMP-response element-containing genes and secondary networks that include the circadian clock.« less

Gene expression changes in female zebrafish (Danio rerio) brain in response to acute exposure to methylmercury

USGS Publications Warehouse

Richter, Catherine A.; Garcia-Reyero, Natàlia; Martyniuk, Chris; Knoebl, Iris; Pope, Marie; Wright-Osment, Maureen K.; Denslow, Nancy D.; Tillitt, Donald E.

2011-01-01

Methylmercury (MeHg) is a potent neurotoxicant and endocrine disruptor that accumulates in aquatic systems. Previous studies have shown suppression of hormone levels in both male and female fish, suggesting effects on gonadotropin regulation in the brain. The gene expression profile in adult female zebrafish whole brain induced by acute (96 h) MeHg exposure was investigated. Fish were exposed by injection to 0 or 0.5(mu or u)g MeHg/g. Gene expression changes in the brain were examined using a 22,000-feature zebrafish microarray. At a significance level of p

Dynamic gene expression changes precede dioxin-induced liver pathogenesis in medaka fish.

PubMed

Volz, David C; Hinton, David E; Law, J McHugh; Kullman, Seth W

2006-02-01

A major challenge for environmental genomics is linking gene expression to cellular toxicity and morphological alteration. Herein, we address complexities related to hepatic gene expression responses after a single injection of the aryl hydrocarbon receptor (AHR) agonist 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) and illustrate an initial stress response followed by cytologic and adaptive changes in the teleost fish medaka. Using a custom 175-gene array, we find that overall hepatic gene expression and histological changes are strongly dependent on dose and time. The most pronounced dioxin-induced gene expression changes occurred early and preceded morphologic alteration in the liver. Following a systematic search for putative Ah response elements (AHREs) (5'-CACGCA-3') within 2000 bp upstream of the predicted transcriptional start site, the majority (87%) of genes screened in this study did not contain an AHRE, suggesting that gene expression was not solely dependent on AHRE-mediated transcription. Moreover, in the highest dosage, we observed gene expression changes associated with adaptation that persisted for almost two weeks, including induction of a gene putatively identified as ependymin that may function in hepatic injury repair. These data suggest that the cellular response to dioxin involves both AHRE- and non-AHRE-mediated transcription, and that coupling gene expression profiling with analysis of morphologic pathogenesis is essential for establishing temporal relationships between transcriptional changes, toxicity, and adaptation to hepatic injury.

RNA-seq based transcriptomic analysis uncovers α-linolenic acid and jasmonic acid biosynthesis pathways respond to cold acclimation in Camellia japonica

PubMed Central

Li, Qingyuan; Lei, Sheng; Du, Kebing; Li, Lizhi; Pang, Xufeng; Wang, Zhanchang; Wei, Ming; Fu, Shao; Hu, Limin; Xu, Lin

2016-01-01

Camellia is a well-known ornamental flower native to Southeast of Asia, including regions such as Japan, Korea and South China. However, most species in the genus Camellia are cold sensitive. To elucidate the cold stress responses in camellia plants, we carried out deep transcriptome sequencing of ‘Jiangxue’, a cold-tolerant cultivar of Camellia japonica, and approximately 1,006 million clean reads were generated using Illumina sequencing technology. The assembly of the clean reads produced 367,620 transcripts, including 207,592 unigenes. Overall, 28,038 differentially expressed genes were identified during cold acclimation. Detailed elucidation of responses of transcription factors, protein kinases and plant hormone signalling-related genes described the interplay of signal that allowed the plant to fine-tune cold stress responses. On the basis of global gene regulation of unsaturated fatty acid biosynthesis- and jasmonic acid biosynthesis-related genes, unsaturated fatty acid biosynthesis and jasmonic acid biosynthesis pathways were deduced to be involved in the low temperature responses in C. japonica. These results were supported by the determination of the fatty acid composition and jasmonic acid content. Our results provide insights into the genetic and molecular basis of the responses to cold acclimation in camellia plants. PMID:27819341

Image-guided genomic analysis of tissue response to laser-induced thermal stress

NASA Astrophysics Data System (ADS)

Mackanos, Mark A.; Helms, Mike; Kalish, Flora; Contag, Christopher H.

2011-05-01

The cytoprotective response to thermal injury is characterized by transcriptional activation of ``heat shock proteins'' (hsp) and proinflammatory proteins. Expression of these proteins may predict cellular survival. Microarray analyses were performed to identify spatially distinct gene expression patterns responding to thermal injury. Laser injury zones were identified by expression of a transgene reporter comprised of the 70 kD hsp gene and the firefly luciferase coding sequence. Zones included the laser spot, the surrounding region where hsp70-luc expression was increased, and a region adjacent to the surrounding region. A total of 145 genes were up-regulated in the laser irradiated region, while 69 were up-regulated in the adjacent region. At 7 hours the chemokine Cxcl3 was the highest expressed gene in the laser spot (24 fold) and adjacent region (32 fold). Chemokines were the most common up-regulated genes identified. Microarray gene expression was successfully validated using qRT- polymerase chain reaction for selected genes of interest. The early response genes are likely involved in cytoprotection and initiation of the healing response. Their regulatory elements will benefit creating the next generation reporter mice and controlling expression of therapeutic proteins. The identified genes serve as drug development targets that may prevent acute tissue damage and accelerate healing.

NCI-60 Whole Exome Sequencing and Pharmacological CellMiner Analyses

PubMed Central

Reinhold, William C.; Varma, Sudhir; Sousa, Fabricio; Sunshine, Margot; Abaan, Ogan D.; Davis, Sean R.; Reinhold, Spencer W.; Kohn, Kurt W.; Morris, Joel; Meltzer, Paul S.; Doroshow, James H.; Pommier, Yves

2014-01-01

Exome sequencing provides unprecedented insights into cancer biology and pharmacological response. Here we assess these two parameters for the NCI-60, which is among the richest genomic and pharmacological publicly available cancer cell line databases. Homozygous genetic variants that putatively affect protein function were identified in 1,199 genes (approximately 6% of all genes). Variants that are either enriched or depleted compared to non-cancerous genomes, and thus may be influential in cancer progression and differential drug response were identified for 2,546 genes. Potential gene knockouts are made available. Assessment of cell line response to 19,940 compounds, including 110 FDA-approved drugs, reveals ≈80-fold range in resistance versus sensitivity response across cell lines. 103,422 gene variants were significantly correlated with at least one compound (at p<0.0002). These include genes of known pharmacological importance such as IGF1R, BRAF, RAD52, MTOR, STAT2 and TSC2 as well as a large number of candidate genes such as NOM1, TLL2, and XDH. We introduce two new web-based CellMiner applications that enable exploration of variant-to-compound relationships for a broad range of researchers, especially those without bioinformatics support. The first tool, “Genetic variant versus drug visualization”, provides a visualization of significant correlations between drug activity-gene variant combinations. Examples are given for the known vemurafenib-BRAF, and novel ifosfamide-RAD52 pairings. The second, “Genetic variant summation” allows an assessment of cumulative genetic variations for up to 150 combined genes together; and is designed to identify the variant burden for molecular pathways or functional grouping of genes. An example of its use is provided for the EGFR-ERBB2 pathway gene variant data and the identification of correlated EGFR, ERBB2, MTOR, BRAF, MEK and ERK inhibitors. The new tools are implemented as an updated web-based CellMiner version, for which the present publication serves as a compendium. PMID:25032700

Identification of the acclimation genes in transcriptomic responses to heat stress of White Pekin duck.

PubMed

Kim, Jun-Mo; Lim, Kyu-Sang; Byun, Mijeong; Lee, Kyung-Tai; Yang, Young-Rok; Park, Mina; Lim, Dajeong; Chai, Han-Ha; Bang, Han-Tae; Hwangbo, Jong; Choi, Yang-Ho; Cho, Yong-Min; Park, Jong-Eun

2017-11-01

White Pekin duck is an important meat resource in the livestock industries. However, the temperature increase due to global warming has become a serious environmental factor in duck production, because of hyperthermia. Therefore, identifying the gene regulations and understanding the molecular mechanism for adaptation to the warmer environment will provide insightful information on the acclimation system of ducks. This study examined transcriptomic responses to heat stress treatments (3 and 6 h at 35 °C) and control (C, 25 °C) using RNA-sequencing analysis of genes from the breast muscle tissue. Based on three distinct differentially expressed gene (DEG) sets (3H/C, 6H/C, and 6H/3H), the expression patterns of significant DEGs (absolute log2 > 1.0 and false discovery rate < 0.05) were clustered into three responsive gene groups divided into upregulated and downregulated genes. Next, we analyzed the clusters that showed relatively higher expression levels in 3H/C and lower levels in 6H/C with much lower or opposite levels in 6H/3H; we referred to these clusters as the adaptable responsive gene group. These genes were significantly enriched in the ErbB signaling pathway, neuroactive ligand-receptor interaction and type II diabetes mellitus in the KEGG pathways (P < 0.01). From the functional enrichment analysis and significantly regulated genes observed in the enriched pathways, we think that the adaptable responsive genes are responsible for the acclimation mechanism of ducks and suggest that the regulation of phosphoinositide 3-kinase genes including PIK3R6, PIK3R5, and PIK3C2B has an important relationship with the mechanisms of adaptation to heat stress in ducks.

Distribution and evolution of genes responsible for biosynthesis of mycotoxins in Fusarium

USDA-ARS?s Scientific Manuscript database

Fusarium secondary metabolites (SMs) include some of the mycotoxins of greatest concern to food and feed safety. In fungi, genes directly involved in synthesis of the same SM are typically located adjacent to one another in gene clusters. To better understand the distribution and evolution of mycoto...

Congenital Cytomegalovirus Infection: Molecular Mechanisms Mediating Viral Pathogenesis

PubMed Central

Schleiss, Mark R.

2013-01-01

Human cytomegalovirus (CMV) is responsible for approximately 40,000 congenital infections in the United States each year. Congenital CMV disease frequently produces serious neurodevelopmental disability, as well as vision impairment and sensorineural hearing loss. Development of a CMV vaccine is therefore considered to be a major public health priority. The mechanisms by which CMV injures the fetus are complex and likely include a combination of direct fetal injury induced by pathologic virally-encoded gene products, an inability of the maternal immune response to control infection, and the direct impact of infection on placental function. CMV encodes gene products that function, both at the RNA and the protein level, to interfere with many cellular processes. These include gene products that modify the cell cycle; interfere with apoptosis; induce an inflammatory response; mediate vascular injury; induce site-specific breakage of chromosomes; promote oncogenesis; dysregulate cellular proliferation; and facilitate evasion of host immune responses. This minireview summarizes current concepts regarding these aspects of the molecular virology of CMV and the potential pathogenic impact of viral gene expression on the developing fetus. Areas for potential development of novel therapeutic intervention are suggested for improving the outcome of this disabling congenital infection. PMID:21827434

Ezrin Inhibition Up-regulates Stress Response Gene Expression*

PubMed Central

Çelik, Haydar; Bulut, Gülay; Han, Jenny; Graham, Garrett T.; Minas, Tsion Z.; Conn, Erin J.; Hong, Sung-Hyeok; Pauly, Gary T.; Hayran, Mutlu; Li, Xin; Özdemirli, Metin; Ayhan, Ayşe; Rudek, Michelle A.; Toretsky, Jeffrey A.; Üren, Aykut

2016-01-01

Ezrin is a member of the ERM (ezrin/radixin/moesin) family of proteins that links cortical cytoskeleton to the plasma membrane. High expression of ezrin correlates with poor prognosis and metastasis in osteosarcoma. In this study, to uncover specific cellular responses evoked by ezrin inhibition that can be used as a specific pharmacodynamic marker(s), we profiled global gene expression in osteosarcoma cells after treatment with small molecule ezrin inhibitors, NSC305787 and NSC668394. We identified and validated several up-regulated integrated stress response genes including PTGS2, ATF3, DDIT3, DDIT4, TRIB3, and ATF4 as novel ezrin-regulated transcripts. Analysis of transcriptional response in skin and peripheral blood mononuclear cells from NSC305787-treated mice compared with a control group revealed that, among those genes, the stress gene DDIT4/REDD1 may be used as a surrogate pharmacodynamic marker of ezrin inhibitor compound activity. In addition, we validated the anti-metastatic effects of NSC305787 in reducing the incidence of lung metastasis in a genetically engineered mouse model of osteosarcoma and evaluated the pharmacokinetics of NSC305787 and NSC668394 in mice. In conclusion, our findings suggest that cytoplasmic ezrin, previously considered a dormant and inactive protein, has important functions in regulating gene expression that may result in down-regulation of stress response genes. PMID:27137931

Fetal-sex dependent genomic responses in the circulating lymphocytes of arsenic-exposed pregnant women in New Hampshire.

PubMed

Bommarito, Paige A; Martin, Elizabeth; Smeester, Lisa; Palys, Thomas; Baker, Emily R; Karagas, Margaret R; Fry, Rebecca C

2017-10-01

Exposure to inorganic arsenic (iAs) during pregnancy is associated with adverse health outcomes present both at birth and later in life. A biological mechanism may include epigenetic and genomic alterations in fetal genes involved in immune functioning. To investigate the role of the maternal immune response to in utero iAs exposure, we conducted an analysis of the expression of immune-related genes in pregnant women from the New Hampshire Birth Cohort Study. A set of 31 genes was identified with altered expression in association with levels of urinary total arsenic, urinary iAs, urinary monomethylated arsenic and urinary dimethylated arsenic. Notably, maternal gene expression signatures differed when stratified on fetal sex, with a more robust inflammatory response observed in male pregnancies. Moreover, the differentially expressed genes were also related to birth outcomes. These findings highlight the sex-dependent nature of the maternal iAs-induced inflammatory response in relationship to fetal outcomes. Copyright © 2017. Published by Elsevier Inc.

Changes in the transcriptomic profiles of maize roots in response to iron-deficiency stress.

PubMed

Li, Yan; Wang, Nian; Zhao, Fengtao; Song, Xuejiao; Yin, Zhaohua; Huang, Rong; Zhang, Chunqing

2014-07-01

Plants are often subjected to iron (Fe)-deficiency stress because of its low solubility. Plants have evolved two distinct strategies to solubilize and transport Fe to acclimate to this abiotic stress condition. Transcriptomic profiling analysis was performed using Illumina digital gene expression to understand the mechanism underlying resistance responses of roots to Fe starvation in maize, an important Strategy II plant. A total of 3,427, 4,069, 4,881, and 2,610 genes had significantly changed expression levels after Fe-deficiency treatments of 1, 2, 4 or 7 days, respectively. Genes involved in 2'-deoxymugineic acid (DMA) synthesis, secretion, and Fe(III)-DMA uptake were significantly induced. Many genes related to plant hormones, protein kinases, and protein phosphatases responded to Fe-deficiency stress, suggesting their regulatory roles in response to the Fe-deficiency stress. Functional annotation clustering analysis, using the Database for Annotation, Visualization and Integrated Discovery, revealed maize root responses to Fe starvation. This resulted in 38 functional annotation clusters: 25 for up-regulated genes, and 13 for down-regulated ones. These included genes encoding enzymes involved in the metabolism of carboxylic acids, isoprenoids and aromatic compounds, transporters, and stress response proteins. Our work provides integrated information for understanding maize response to Fe-deficiency stress.

AtHD2D Gene Plays a Role in Plant Growth, Development, and Response to Abiotic Stresses in Arabidopsis thaliana.

PubMed

Han, Zhaofen; Yu, Huimin; Zhao, Zhong; Hunter, David; Luo, Xinjuan; Duan, Jun; Tian, Lining

2016-01-01

The histone deacetylases play important roles in the regulation of gene expression and the subsequent control of a number of important biological processes, including those involved in the response to environmental stress. A specific group of histone deacetylase genes, HD2, is present in plants. In Arabidopsis, HD2s include HD2A, HD2B, HD2C, and HD2D. Previous research showed that HD2A, HD2B, and HD2C are more related in terms of expression and function, but not HD2D. In this report, we studied different aspects of AtHD2D in Arabidopsis with respect to plant response to drought and other abiotic stresses. Bioinformatics analysis indicates that HD2D is distantly related to other HD2 genes. Transient expression in Nicotiana benthamiana and stable expression in Arabidopsis of AtHD2D fused with gfp showed that AtHD2D was expressed in the nucleus. Overexpression of AtHD2D resulted in developmental changes including fewer main roots, more lateral roots, and a higher root:shoot ratio. Seed germination and plant flowering time were delayed in transgenic plants expressing AtHD2D, but these plants exhibited higher degrees of tolerance to abiotic stresses, including drought, salt, and cold stresses. Physiological studies indicated that the malondialdehyde (MDA) content was high in wild-type plants but in plants overexpressing HD2D the MDA level increased slowly in response to stress conditions of drought, cold, and salt stress. Furthermore, electrolyte leakage in leaf cells of wild type plants increased but remained stable in transgenic plants. Our results indicate that AtHD2D is unique among HD2 genes and it plays a role in plant growth and development regulation and these changes can modulate plant stress responses.

Discovering causal signaling pathways through gene-expression patterns

PubMed Central

Parikh, Jignesh R.; Klinger, Bertram; Xia, Yu; Marto, Jarrod A.; Blüthgen, Nils

2010-01-01

High-throughput gene-expression studies result in lists of differentially expressed genes. Most current meta-analyses of these gene lists include searching for significant membership of the translated proteins in various signaling pathways. However, such membership enrichment algorithms do not provide insight into which pathways caused the genes to be differentially expressed in the first place. Here, we present an intuitive approach for discovering upstream signaling pathways responsible for regulating these differentially expressed genes. We identify consistently regulated signature genes specific for signal transduction pathways from a panel of single-pathway perturbation experiments. An algorithm that detects overrepresentation of these signature genes in a gene group of interest is used to infer the signaling pathway responsible for regulation. We expose our novel resource and algorithm through a web server called SPEED: Signaling Pathway Enrichment using Experimental Data sets. SPEED can be freely accessed at http://speed.sys-bio.net/. PMID:20494976

Genome-wide characterization of differentially expressed genes provides insights into regulatory network of heat stress response in radish (Raphanus sativus L.).

PubMed

Wang, Ronghua; Mei, Yi; Xu, Liang; Zhu, Xianwen; Wang, Yan; Guo, Jun; Liu, Liwang

2018-03-01

Heat stress (HS) causes detrimental effects on plant morphology, physiology, and biochemistry that lead to drastic reduction in plant biomass production and economic yield worldwide. To date, little is known about HS-responsive genes involved in thermotolerance mechanism in radish. In this study, a total of 6600 differentially expressed genes (DEGs) from the control and Heat24 cDNA libraries of radish were isolated by high-throughput sequencing. With Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, some genes including MAPK, DREB, ERF, AP2, GST, Hsf, and Hsp were predominantly assigned in signal transductions, metabolic pathways, and biosynthesis and abiotic stress-responsive pathways. These pathways played significant roles in reducing stress-induced damages and enhancing heat tolerance in radish. Expression patterns of 24 candidate genes were validated by reverse-transcription quantitative PCR (RT-qPCR). Based mainly on the analysis of DEGs combining with the previous miRNAs analysis, the schematic model of HS-responsive regulatory network was proposed. To counter the effects of HS, a rapid response of the plasma membrane leads to the opening of specific calcium channels and cytoskeletal reorganization, after which HS-responsive genes are activated to repair damaged proteins and ultimately facilitate further enhancement of thermotolerance in radish. These results could provide fundamental insight into the regulatory network underlying heat tolerance in radish and facilitate further genetic manipulation of thermotolerance in root vegetable crops.

Transcriptional analysis of different stress response genes in Escherichia coli strains subjected to sodium chloride and lactic acid stress.

PubMed

Peng, Silvio; Stephan, Roger; Hummerjohann, Jörg; Tasara, Taurai

2014-12-01

Survival of Escherichia coli in food depends on its ability to adapt against encountered stress typically involving induction of stress response genes. In this study, the transcriptional induction of selected acid (cadA, speF) and salt (kdpA, proP, proW, otsA, betA) stress response genes was investigated among five E. coli strains, including three Shiga toxin-producing strains, exposed to sodium chloride or lactic acid stress. Transcriptional induction upon lactic acid stress exposure was similar in all but one E. coli strain, which lacked the lysine decarboxylase gene cadA. In response to sodium chloride stress exposure, proW and otsA were similarly induced, while significant differences were observed between the E. coli strains in induction of kdpA, proP and betA. The kdpA and betA genes were significantly induced in four and three strains, respectively, whereas one strain did not induce these genes. The proP gene was only induced in two E. coli strains. Interestingly, transcriptional induction differences in response to sodium chloride stress exposure were associated with survival phenotypes observed for the E. coli strains in cheese as the E. coli strain lacking significant induction in three salt stress response genes investigated also survived poorly compared to the other E. coli strains in cheese. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Single sea urchin phagocytes express messages of a single sequence from the diverse Sp185/333 gene family in response to bacterial challenge.

PubMed

Majeske, Audrey J; Oren, Matan; Sacchi, Sandro; Smith, L Courtney

2014-12-01

Immune systems in animals rely on fast and efficient responses to a wide variety of pathogens. The Sp185/333 gene family in the purple sea urchin, Strongylocentrotus purpuratus, consists of an estimated 50 (±10) members per genome that share a basic gene structure but show high sequence diversity, primarily due to the mosaic appearance of short blocks of sequence called elements. The genes show significantly elevated expression in three subpopulations of phagocytes responding to marine bacteria. The encoded Sp185/333 proteins are highly diverse and have central effector functions in the immune system. In this study we report the Sp185/333 gene expression in single sea urchin phagocytes. Sea urchins challenged with heat-killed marine bacteria resulted in a typical increase in coelomocyte concentration within 24 h, which included an increased proportion of phagocytes expressing Sp185/333 proteins. Phagocyte fractions enriched from coelomocytes were used in limiting dilutions to obtain samples of single cells that were evaluated for Sp185/333 gene expression by nested RT-PCR. Amplicon sequences showed identical or nearly identical Sp185/333 amplicon sequences in single phagocytes with matches to six known Sp185/333 element patterns, including both common and rare element patterns. This suggested that single phagocytes show restricted expression from the Sp185/333 gene family and infers a diverse, flexible, and efficient response to pathogens. This type of expression pattern from a family of immune response genes in single cells has not been identified previously in other invertebrates. Copyright © 2014 by The American Association of Immunologists, Inc.

Chromatin Configuration Determines Cell Responses to Hormone Stimuli | Center for Cancer Research

Cancer.gov

Ever since selective gene expression was established as the central driver of cell behavior, researchers have been working to understand the forces that control gene transcription. Aberrant gene expression can cause or promote many diseases, including cancer, and alterations in gene expression are the goal of many therapeutic agents. Recent work has focused on the potential

Temporal Changes in Gene Expression after Injury in the Rat Retina

PubMed Central

Vázquez-Chona, Félix; Song, Bong K.; Geisert, Eldon E.

2010-01-01

Purpose The goal of this study was to define the temporal changes in gene expression after retinal injury and to relate these changes to the inflammatory and reactive response. A specific emphasis was placed on the tetraspanin family of proteins and their relationship with markers of reactive gliosis. Methods Retinal tears were induced in adult rats by scraping the retina with a needle. After different survival times (4 hours, and 1, 3, 7, and 30 days), the retinas were removed, and mRNA was isolated, prepared, and hybridized to the Affymatrix RGU34A microarray (Santa Clara, CA). Microarray results were confirmed by using RT-PCR and correlation to protein levels was determined. Results Of the 8750 genes analyzed, approximately 393 (4.5%) were differentially expressed. Clustering analysis revealed three major profiles: (1) The early response was characterized by the upregulation of transcription factors; (2) the delayed response included a high percentage of genes related to cell cycle and cell death; and (3) the late, sustained profile clustered a significant number of genes involved in retinal gliosis. The late, sustained cluster also contained the upregulated crystallin genes. The tetraspanins Cd9, Cd81, and Cd82 were also associated with the late, sustained response. Conclusions The use of microarray technology enables definition of complex genetic changes underlying distinct phases of the cellular response to retinal injury. The early response clusters genes associate with the transcriptional regulation of the wound-healing process and cell death. Most of the genes in the late, sustained response appear to be associated with reactive gliosis. PMID:15277499

Lineage-specific expansion of IFIT gene family: an insight into coevolution with IFN gene family.

PubMed

Liu, Ying; Zhang, Yi-Bing; Liu, Ting-Kai; Gui, Jian-Fang

2013-01-01

In mammals, IFIT (Interferon [IFN]-induced proteins with Tetratricopeptide Repeat [TPR] motifs) family genes are involved in many cellular and viral processes, which are tightly related to mammalian IFN response. However, little is known about non-mammalian IFIT genes. In the present study, IFIT genes are identified in the genome databases from the jawed vertebrates including the cartilaginous elephant shark but not from non-vertebrates such as lancelet, sea squirt and acorn worm, suggesting that IFIT gene family originates from a vertebrate ancestor about 450 million years ago. IFIT family genes show conserved gene structure and gene arrangements. Phylogenetic analyses reveal that this gene family has expanded through lineage-specific and species-specific gene duplication. Interestingly, IFN gene family seem to share a common ancestor and a similar evolutionary mechanism; the function link of IFIT genes to IFN response is present early since the origin of both gene families, as evidenced by the finding that zebrafish IFIT genes are upregulated by fish IFNs, poly(I:C) and two transcription factors IRF3/IRF7, likely via the IFN-stimulated response elements (ISRE) within the promoters of vertebrate IFIT family genes. These coevolution features creates functional association of both family genes to fulfill a common biological process, which is likely selected by viral infection during evolution of vertebrates. Our results are helpful for understanding of evolution of vertebrate IFN system.

Transcriptional regulation of mammalian selenoprotein expression

PubMed Central

Stoytcheva, Zoia R.; Berry, Marla J.

2009-01-01

Background Selenoproteins contain the twenty-first amino acid, selenocysteine, and are involved in cellular defenses against oxidative damage, important metabolic and developmental pathways, and responses to environmental challenges. Elucidating the mechanisms regulating selenoprotein expression at the transcriptional level is key to understanding how these mechanisms are called into play to respond to the changing environment. Methods This review summarizes published studies on transcriptional regulation of selenoprotein genes, focused primarily on genes whose encoded protein functions are at least partially understood. This is followed by in silico analysis of predicted regulatory elements in selenoprotein genes, including those in the aforementioned category as well as the genes whose functions are not known. Results Our findings reveal regulatory pathways common to many selenoprotein genes, including several involved in stress-responses. In addition, tissue-specific regulatory factors are implicated in regulating many selenoprotein genes. Conclusions These studies provide new insights into how selenoprotein genes respond to environmental and other challenges, and the roles these proteins play in allowing cells to adapt to these changes. General Significance Elucidating the regulatory mechanisms affecting selenoprotein expression is essential for understanding their roles in human diseases, and for developing diagnostic and potential therapeutic approaches to address dysregulation of members of this gene family. PMID:19465084

Repressor- and Activator-Type Ethylene Response Factors Functioning in Jasmonate Signaling and Disease Resistance Identified via a Genome-Wide Screen of Arabidopsis Transcription Factor Gene Expression[w

PubMed Central

McGrath, Ken C.; Dombrecht, Bruno; Manners, John M.; Schenk, Peer M.; Edgar, Cameron I.; Maclean, Donald J.; Scheible, Wolf-Rüdiger; Udvardi, Michael K.; Kazan, Kemal

2005-01-01

To identify transcription factors (TFs) involved in jasmonate (JA) signaling and plant defense, we screened 1,534 Arabidopsis (Arabidopsis thaliana) TFs by real-time quantitative reverse transcription-PCR for their altered transcript at 6 h following either methyl JA treatment or inoculation with the incompatible pathogen Alternaria brassicicola. We identified 134 TFs that showed a significant change in expression, including many APETALA2/ethylene response factor (AP2/ERF), MYB, WRKY, and NAC TF genes with unknown functions. Twenty TF genes were induced by both the pathogen and methyl JA and these included 10 members of the AP2/ERF TF family, primarily from the B1a and B3 subclusters. Functional analysis of the B1a TF AtERF4 revealed that AtERF4 acts as a novel negative regulator of JA-responsive defense gene expression and resistance to the necrotrophic fungal pathogen Fusarium oxysporum and antagonizes JA inhibition of root elongation. In contrast, functional analysis of the B3 TF AtERF2 showed that AtERF2 is a positive regulator of JA-responsive defense genes and resistance to F. oxysporum and enhances JA inhibition of root elongation. Our results suggest that plants coordinately express multiple repressor- and activator-type AP2/ERFs during pathogen challenge to modulate defense gene expression and disease resistance. PMID:16183832

Tissue-Specific Transcriptomics Reveals an Important Role of the Unfolded Protein Response in Maintaining Fertility upon Heat Stress in Arabidopsis.

PubMed

Zhang, Shuang-Shuang; Yang, Hongxing; Ding, Lan; Song, Ze-Ting; Ma, Hong; Chang, Fang; Liu, Jian-Xiang

2017-05-01

High temperatures have a great impact on plant reproductive development and subsequent fruit and seed set, but the underlying molecular mechanisms are not well understood. We used transcriptome profiling to investigate the effect of heat stress on reproductive development of Arabidopsis thaliana plants and observed distinct response patterns in vegetative versus reproductive tissues. Exposure to heat stress affected reproductive developmental programs, including early phases of anther/ovule development and meiosis. Also, genes participating in the unfolded protein response (UPR) were enriched in the reproductive tissue-specific genes that were upregulated by heat. Moreover, we found that the UPR-deficient bzip28 bzip60 double mutant was sensitive to heat stresses and had reduced silique length and fertility. Comparison of heat-responsive wild type versus bzip28 bzip60 plants identified 521 genes that were regulated by bZIP28 and bZIP60 upon heat stress during reproductive stages, most of which were noncanonical UPR genes. Chromatin immunoprecipitation coupled with high-throughput sequencing analyses revealed 133 likely direct targets of bZIP28 in Arabidopsis seedlings subjected to heat stress, including 27 genes that were also upregulated by heat during reproductive development. Our results provide important insights into heat responsiveness in Arabidopsis reproductive tissues and demonstrate the protective roles of the UPR for maintaining fertility upon heat stress. © 2017 American Society of Plant Biologists. All rights reserved.

Soybean DREB1/CBF-type transcription factors function in heat and drought as well as cold stress-responsive gene expression.

PubMed

Kidokoro, Satoshi; Watanabe, Keitaro; Ohori, Teppei; Moriwaki, Takashi; Maruyama, Kyonoshin; Mizoi, Junya; Myint Phyu Sin Htwe, Nang; Fujita, Yasunari; Sekita, Sachiko; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

2015-02-01

Soybean (Glycine max) is a globally important crop, and its growth and yield are severely reduced by abiotic stresses, such as drought, heat, and cold. The cis-acting element DRE (dehydration-responsive element)/CRT plays an important role in activating gene expression in response to these stresses. The Arabidopsis DREB1/CBF genes that encode DRE-binding proteins function as transcriptional activators in the cold stress responsive gene expression. In this study, we identified 14 DREB1-type transcription factors (GmDREB1s) from a soybean genome database. The expression of most GmDREB1 genes in soybean was strongly induced by a variety of abiotic stresses, such as cold, drought, high salt, and heat. The GmDREB1 proteins activated transcription via DREs (dehydration-responsive element) in Arabidopsis and soybean protoplasts. Transcriptome analyses using transgenic Arabidopsis plants overexpressing GmDREB1s indicated that many of the downstream genes are cold-inducible and overlap with those of Arabidopsis DREB1A. We then comprehensively analyzed the downstream genes of GmDREB1B;1, which is closely related to DREB1A, using a transient expression system in soybean protoplasts. The expression of numerous genes induced by various abiotic stresses were increased by overexpressing GmDREB1B;1 in soybean, and DREs were the most conserved element in the promoters of these genes. The downstream genes of GmDREB1B;1 included numerous soybean-specific stress-inducible genes that encode an ABA receptor family protein, GmPYL21, and translation-related genes, such as ribosomal proteins. We confirmed that GmDREB1B;1 directly activates GmPYL21 expression and enhances ABRE-mediated gene expression in an ABA-independent manner. These results suggest that GmDREB1 proteins activate the expression of numerous soybean-specific stress-responsive genes under diverse abiotic stress conditions. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

Identification and Expression Profiling of the Auxin Response Factors in Dendrobium officinale under Abiotic Stresses

PubMed Central

Chen, Zhehao; Yuan, Ye; Fu, Di; Shen, Chenjia; Yang, Yanjun

2017-01-01

Auxin response factor (ARF) proteins play roles in plant responses to diverse environmental stresses by binding specifically to the auxin response element in the promoters of target genes. Using our latest public Dendrobium transcriptomes, a comprehensive characterization and analysis of 14 DnARF genes were performed. Three selected DnARFs, including DnARF1, DnARF4, and DnARF6, were confirmed to be nuclear proteins according to their transient expression in epidermal cells of Nicotiana benthamiana leaves. Furthermore, the transcription activation abilities of DnARF1, DnARF4, and DnARF6 were tested in a yeast system. Our data showed that DnARF6 is a transcriptional activator in Dendrobium officinale. To uncover the basic information of DnARF gene responses to abiotic stresses, we analyzed their expression patterns under various hormones and abiotic treatments. Based on our data, several hormones and significant stress responsive DnARF genes have been identified. Since auxin and ARF genes have been identified in many plant species, our data is imperative to reveal the function of ARF mediated auxin signaling in the adaptation to the challenging Dendrobium environment. PMID:28471373

Identification and Expression Profiling of the Auxin Response Factors in Dendrobium officinale under Abiotic Stresses.

PubMed

Chen, Zhehao; Yuan, Ye; Fu, Di; Shen, Chenjia; Yang, Yanjun

2017-05-04

Auxin response factor (ARF) proteins play roles in plant responses to diverse environmental stresses by binding specifically to the auxin response element in the promoters of target genes. Using our latest public Dendrobium transcriptomes, a comprehensive characterization and analysis of 14 DnARF genes were performed. Three selected DnARFs , including DnARF1 , DnARF4 , and DnARF6 , were confirmed to be nuclear proteins according to their transient expression in epidermal cells of Nicotiana benthamiana leaves. Furthermore, the transcription activation abilities of DnARF1 , DnARF4 , and DnARF6 were tested in a yeast system. Our data showed that DnARF6 is a transcriptional activator in Dendrobium officinale . To uncover the basic information of DnARF gene responses to abiotic stresses, we analyzed their expression patterns under various hormones and abiotic treatments. Based on our data, several hormones and significant stress responsive DnARF genes have been identified. Since auxin and ARF genes have been identified in many plant species, our data is imperative to reveal the function of ARF mediated auxin signaling in the adaptation to the challenging Dendrobium environment.

Gene expression profile predicting the response to anti-TNF treatment in patients with rheumatoid arthritis; analysis of GEO datasets.

PubMed

Kim, Tae-Hwan; Choi, Sung Jae; Lee, Young Ho; Song, Gwan Gyu; Ji, Jong Dae

2014-07-01

Anti-tumor necrosis factor (TNF) therapy is the treatment of choice for rheumatoid arthritis (RA) patients in whom standard disease-modifying anti-rheumatic drugs are ineffective. However, a substantial proportion of RA patients treated with anti-TNF agents do not show a significant clinical response. Therefore, biomarkers predicting response to anti-TNF agents are needed. Recently, gene expression profiling has been applied in research for developing such biomarkers. We compared gene expression profiles reported by previous studies dealing with the responsiveness of anti-TNF therapy in RA patients and attempted to identify differentially expressed genes (DEGs) that discriminated between responders and non-responders to anti-TNF therapy. We used microarray datasets available at the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO). This analysis included 6 studies and 5 sets of microarray data that used peripheral blood samples for identification of DEGs predicting response to anti-TNF therapy. We found little overlap in the DEGs that were highly ranked in each study. Three DEGs including IL2RB, SH2D2A and G0S2 appeared in more than 1 study. In addition, a meta-analysis designed to increase statistical power found one DEG, G0S2 by the Fisher's method. Our finding suggests the possibility that G0S2 plays as a biomarker to predict response to anti-TNF therapy in patients with rheumatoid arthritis. Further investigations based on larger studies are therefore needed to confirm the significance of G0S2 in predicting response to anti-TNF therapy. Copyright © 2014 Société française de rhumatologie. Published by Elsevier SAS. All rights reserved.

Identification of Early Nuclear Target Genes of Plastidial Redox Signals that Trigger the Long-Term Response of Arabidopsis to Light Quality Shifts.

PubMed

Dietzel, Lars; Gläßer, Christine; Liebers, Monique; Hiekel, Stefan; Courtois, Florence; Czarnecki, Olaf; Schlicke, Hagen; Zubo, Yan; Börner, Thomas; Mayer, Klaus; Grimm, Bernhard; Pfannschmidt, Thomas

2015-08-01

Natural illumination conditions are highly variable and because of their sessile life style, plants are forced to acclimate to them at the cellular and molecular level. Changes in light intensity or quality induce changes in the reduction/oxidation (redox) state of the photosynthetic electron chain that acts as a trigger for compensatory acclimation responses comprising functional and structural adjustments of photosynthesis and metabolism. Such responses include redox-controlled changes in plant gene expression in the nucleus and organelles. Here we describe a strategy for the identification of early redox-regulated genes (ERGs) in the nucleus of the model organism Arabidopsis thaliana that respond significantly 30 or 60 min after the generation of a reduction signal in the photosynthetic electron transport chain. By comparing the response of wild-type plants with that of the acclimation mutant stn7, we could specifically identify ERGs. The results reveal a significant impact of chloroplast redox signals on distinct nuclear gene groups including genes for the mitochondrial electron transport chain, tetrapyrrole biosynthesis, carbohydrate metabolism, and signaling lipid synthesis. These expression profiles are clearly different from those observed in response to the reduction of photosynthetic electron transport by high light treatments. Thus, the ERGs identified are unique to redox imbalances in photosynthetic electron transport and were then used for analyzing potential redox-responsive cis-elements, trans-factors, and chromosomal regulatory hot spots. The data identify a novel redox-responsive element and indicate extensive redox control at transcriptional and chromosomal levels that point to an unprecedented impact of redox signals on epigenetic processes. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

Molecular response to water stress in two contrasting Mediterranean pines (Pinus pinaster and Pinus pinea).

PubMed

Perdiguero, Pedro; Barbero, María Del Carmen; Cervera, María Teresa; Collada, Carmen; Soto, Alvaro

2013-06-01

Adaptation to water stress has determined the evolution and diversification of vascular plants. Water stress is forecasted to increase drastically in the next decades in certain regions, such as in the Mediterranean basin. Consequently, a proper knowledge of the response and adaptations to drought stress is essential for the correct management of plant genetic resources. However, most of the advances in the understanding of the molecular response to water stress have been attained in angiosperms, and are not always applicable to gymnosperms. In this work we analyse the transcriptional response of two emblematic Mediterranean pines, Pinus pinaster and Pinus pinea, which show noticeable differences in their performance under water stress. Using microarray analysis, up to 113 genes have been detected as significantly induced by drought in both species. Reliability of expression patterns has been confirmed by RT-PCR. While induced genes with similar profiles in both species can be considered as general candidate genes for the study of drought response in conifers, genes with diverging expression patterns can underpin the differences displayed by these species under water stress. Most promising candidate genes for drought stress response include genes related to carbohydrate metabolism, such as glycosyltransferases or galactosidases, sugar transporters, dehydrins and transcription factors. Additionally, differences in the molecular response to drought and polyethylene-glycol-induced water stress are also discussed. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Transcriptional Profiling of Murine Organ Genes in Response to Infection with Bacillus anthracis Ames Spores

PubMed Central

Moen, Scott T.; Yeager, Linsey A.; Lawrence, William S.; Ponce, Cindy; Galindo, Cristi L.; Garner, Harold R.; Baze, Wallace B.; Suarez, Giovanni; Peterson, Johnny W.; Chopra, Ashok K.

2008-01-01

Bacillus anthracis is the gram positive, spore-forming etiological agent of anthrax, an affliction studied because of its importance as a potential bioweapon. Although in vitro transcriptional responses of macrophages to either spore or anthrax toxins have been previously reported, little is known regarding the impact of infection on gene expression in host tissues. We infected Swiss-Webster mice intranasally with 5 LD50 of B. anthracis virulent Ames spores and observed the global transcriptional profiles of various tissues over a 48 hr time period. RNA was extracted from spleen, lung, and heart tissues of infected and control mice and examined by Affymetrix GeneChip analysis. Approximately 580 host genes were significantly over or under expressed among the lung, spleen, and heart tissues at 8 hr and 48 hr time points. Expression of genes encoding for surfactant and major histocompatibility complex (MHC) presentation was diminished during the early phase of infection in lungs. By 48 hr, a significant number of genes were modulated in the heart, including up-regulation of calcium-binding related gene expression, and down-regulation of multiple genes related to cell adhesion, formation of the extracellular matrix, and the cell cytoskeleton. Interestingly, the spleen 8 hr post-infection showed striking increases in the expression of genes that encode hydrolytic enzymes, and these levels remained elevated throughout infection. Further, genes involving antigen presentation and interferon responses were down-regulated in the spleen at 8 hr. In late stages of infection, splenic genes related to the inflammatory response were up-regulated. This study is the first to describe the in vivo global transcriptional response of multiple organs during inhalational anthrax. Although numerous genes related to the host immunological response and certain protection mechanisms were up-regulated in these organs, a vast list of genes important for fully developing and maintaining this response were decreased. Additionally, the lung, spleen, and heart showed differential responses to the infection, further validating the demand for a better understanding of anthrax pathogenesis in order to design therapies against novel targets. PMID:18037264

PRENATAL ALCOHOL EXPOSURE ALTERS STEADY-STATE AND ACTIVATED GENE EXPRESSION IN THE ADULT RAT BRAIN

PubMed Central

Stepien, Katarzyna A.; Lussier, Alexandre A.; Neumann, Sarah M.; Pavlidis, Paul; Kobor, Michael S.; Weinberg, Joanne

2016-01-01

Background Prenatal alcohol exposure (PAE) is associated with alterations in numerous physiological systems, including the stress and immune systems . We have previously shown that PAE increases the course and severity of arthritis in an adjuvant-induced arthritis (AA) model. While the molecular mechanisms underlying these effects are not fully known, changes in neural gene expression are emerging as important factors in the etiology of PAE effects. As the prefrontal cortex (PFC) and hippocampus (HPC) play key roles in neuroimmune function, PAE-induced alterations to their transcriptome may underlie abnormal steady-state functions and responses to immune challenge. The current study examined brains from adult PAE and control females from our recent AA study to determine whether PAE causes long-term alterations in gene expression and whether these mediate the altered severity and course of arthritis in PAE females Methods Adult females from PAE, pair-fed [PF], and ad libitum-fed control [C]) groups were injected with either saline or complete Freund’s adjuvant. Animals were terminated at the peak of inflammation or during resolution (days 16 and 39 post-injection, respectively); cohorts of saline-injected PAE, PF and C females were terminated in parallel. Gene expression was analyzed in the PFC and HPC using whole genome mRNA expression microarrays. Results Significant changes in gene expression in both the PFC and HPC were found in PAE compared to controls in response to ethanol exposure alone (saline-injected females), including genes involved in neurodevelopment, apoptosis, and energy metabolism. Moreover, in response to inflammation (adjuvant-injected females), PAE animals showed unique expression patterns, while failing to exhibit the activation of genes and regulators involved in the immune response observed in control and pair-fed animals. Conclusions These results support the hypothesis that PAE affects neuroimmune function at the level of gene expression, demonstrating long-term effects of PAE on the CNS response under steady-state conditions and following an inflammatory insult. PMID:25684047

Genetic variation in insulin-induced kinase signaling

PubMed Central

Wang, Isabel Xiaorong; Ramrattan, Girish; Cheung, Vivian G

2015-01-01

Individual differences in sensitivity to insulin contribute to disease susceptibility including diabetes and metabolic syndrome. Cellular responses to insulin are well studied. However, which steps in these response pathways differ across individuals remains largely unknown. Such knowledge is needed to guide more precise therapeutic interventions. Here, we studied insulin response and found extensive individual variation in the activation of key signaling factors, including ERK whose induction differs by more than 20-fold among our subjects. This variation in kinase activity is propagated to differences in downstream gene expression response to insulin. By genetic analysis, we identified cis-acting DNA variants that influence signaling response, which in turn affects downstream changes in gene expression and cellular phenotypes, such as protein translation and cell proliferation. These findings show that polymorphic differences in signal transduction contribute to individual variation in insulin response, and suggest kinase modulators as promising therapeutics for diseases characterized by insulin resistance. PMID:26202599

Microarray analysis reveals overlapping and specific transcriptional responses to different plant hormones in rice

PubMed Central

Garg, Rohini; Tyagi, Akhilesh K.; Jain, Mukesh

2012-01-01

Hormones exert pleiotropic effects on plant growth and development throughout the life cycle. Many of these effects are mediated at molecular level via altering gene expression. In this study, we investigated the exogenous effect of plant hormones, including auxin, cytokinin, abscisic acid, ethylene, salicylic acid and jasmonic acid, on the transcription of rice genes at whole genome level using microarray. Our analysis identified a total of 4171 genes involved in several biological processes, whose expression was altered significantly in the presence of different hormones. Further, 28% of these genes exhibited overlapping transcriptional responses in the presence of any two hormones, indicating crosstalk among plant hormones. In addition, we identified genes showing only a particular hormone-specific response, which can be used as hormone-specific markers. The results of this study will facilitate further studies in hormone biology in rice. PMID:22827941

Global transcriptional profiling of a cold-tolerant rice variety under moderate cold stress reveals different cold stress response mechanisms.

PubMed

Zhao, Junliang; Zhang, Shaohong; Yang, Tifeng; Zeng, Zichong; Huang, Zhanghui; Liu, Qing; Wang, Xiaofei; Leach, Jan; Leung, Hei; Liu, Bin

2015-07-01

Gene expression profiling under severe cold stress (4°C) has been conducted in plants including rice. However, rice seedlings are frequently exposed to milder cold stresses under natural environments. To understand the responses of rice to milder cold stress, a moderately low temperature (8°C) was used for cold treatment prior to genome-wide profiling of gene expression in a cold-tolerant japonica variety, Lijiangxintuanheigu (LTH). A total of 5557 differentially expressed genes (DEGs) were found at four time points during moderate cold stress. Both the DEGs and differentially expressed transcription factor genes were clustered into two groups based on their expression, suggesting a two-phase response to cold stress and a determinative role of transcription factors in the regulation of stress response. The induction of OsDREB2A under cold stress is reported for the first time in this study. Among the anti-oxidant enzyme genes, glutathione peroxidase (GPX) and glutathione S-transferase (GST) were upregulated, suggesting that the glutathione system may serve as the main reactive oxygen species (ROS) scavenger in LTH. Changes in expression of genes in signal transduction pathways for auxin, abscisic acid (ABA) and salicylic acid (SA) imply their involvement in cold stress responses. The induction of ABA response genes and detection of enriched cis-elements in DEGs suggest that ABA signaling pathway plays a dominant role in the cold stress response. Our results suggest that rice responses to cold stress vary with the specific temperature imposed and the rice genotype. © 2014 Scandinavian Plant Physiology Society.

Rice ABI5-Like1 Regulates Abscisic Acid and Auxin Responses by Affecting the Expression of ABRE-Containing Genes1[W][OA

PubMed Central

Yang, Xi; Yang, Ya-Nan; Xue, Liang-Jiao; Zou, Mei-Juan; Liu, Jian-Ying; Chen, Fan; Xue, Hong-Wei

2011-01-01

Abscisic acid (ABA) regulates plant development and is crucial for plant responses to biotic and abiotic stresses. Studies have identified the key components of ABA signaling in Arabidopsis (Arabidopsis thaliana), some of which regulate ABA responses by the transcriptional regulation of downstream genes. Here, we report the functional identification of rice (Oryza sativa) ABI5-Like1 (ABL1), which is a basic region/leucine zipper motif transcription factor. ABL1 is expressed in various tissues and is induced by the hormones ABA and indole-3-acetic acid and stress conditions including salinity, drought, and osmotic pressure. The ABL1 deficiency mutant, abl1, shows suppressed ABA responses, and ABL1 expression in the Arabidopsis abi5 mutant rescued the ABA sensitivity. The ABL1 protein is localized to the nucleus and can directly bind ABA-responsive elements (ABREs; G-box) in vitro. A gene expression analysis by DNA chip hybridization confirms that a large proportion of down-regulated genes of abl1 are involved in stress responses, consistent with the transcriptional activating effects of ABL1. Further studies indicate that ABL1 regulates the plant stress responses by regulating a series of ABRE-containing WRKY family genes. In addition, the abl1 mutant is hypersensitive to exogenous indole-3-acetic acid, and some ABRE-containing genes related to auxin metabolism or signaling are altered under ABL1 deficiency, suggesting that ABL1 modulates ABA and auxin responses by directly regulating the ABRE-containing genes. PMID:21546455

Gene Networks and Functional Features of Gravitropic response in Rice Shoot Bases

NASA Astrophysics Data System (ADS)

Hu, Liwei; Zang, Aiping; Ai, Qianru; Chen, Haiying; Li, Lin; Li, Rui; Su, Feng; Chen, Xijiang; Rong, Hui; Dou, Xianying; Reinhold-Hurek, Barbara; Li, Qi; Cai, Weiming

To delineate key genes and the corresponding physiological functions as well as the coordina-tion of genes involved in the gravitropism of rice shoot bases, we used whole-genome microarray analysis of upper and lower parts of rice shoot bases at 0.5 h and 6 h after gravistimulation. And bio-information analysis was applied including GO-analysis, expression tendency and net-work analysis. In the lower shoot bases, auxin-mediated signaling pathway and glutathione transferase activity with the biggest enrichment were activated at 0.5 h, while cytokinin stimu-lus and photosynthesis were activated at 6 h. Meanwhile, several processes were suppressed in the lower shoot bases, including: xyloglucan:xyloglucosyl transferase activity, glucan metabolic processes, and ATPase activity at 0.5 h; and tRNA isopentenyltransferase activity, and chiti-nase activity, etc. at 6 h. Gene expression profile responding to gravistimulation suggested that the asymmetrically activation of several phytohormone signaling pathways including auxin, gib-berellin and cytokinin brassinolide ethylene and cytokinin-related genes were involved in the differentially growth between the upper and lower parts of rice shoot bases, and so do cell wall-related genes. Topological analysis of the coexpression networks revealed the core statue of AY177699.1(apetala3-like protein) and AK105103.1 at 0.5 h; AK062612.1 (ethylene response factor) and AK099932.1 (lectin-like receptor kinase 72) at 6 h. All the core factors have the function "response to endogenous stimulus". Additionally, AK108057.1(similar to germin-like protein precursor) was discovered as the most important core gene in the upper shoot bases in 6h after gravistimualtion while AK067424.1(cellulose synthase-like protein), AK120101.1 (Zinc finger, B-box domain containing protein) and CR278698 (ATPase associated with various cel-lular activities cellulose synthase-like protein) contribute equally to gravitropic response in the lower shoot bases.

Characterization of Changes in Global Genes Expression in the Distal Colon of Loperamide-Induced Constipation SD Rats in Response to the Laxative Effects of Liriope platyphylla

PubMed Central

Kim, Ji Eun; Park, So Hae; Kwak, Moon Hwa; Go, Jun; Koh, Eun Kyoung; Song, Sung Hwa; Sung, Ji Eun; Lee, Hee Seob; Hong, Jin Tae; Hwang, Dae Youn

2015-01-01

To characterize the changes in global gene expression in the distal colon of constipated SD rats in response to the laxative effects of aqueous extracts of Liriope platyphylla (AEtLP), including isoflavone, saponin, oligosaccharide, succinic acid and hydroxyproline, the total RNA extracted from the distal colon of AEtLP-treated constipation rats was hybridized to oligonucleotide microarrays. The AEtLP treated rats showed an increase in the number of stools, mucosa thickness, flat luminal surface thickness, mucin secretion, and crypt number. Overall, compared to the controls, 581 genes were up-regulated and 216 genes were down-regulated by the constipation induced by loperamide in the constipated rats. After the AEtLP treatment, 67 genes were up-regulated and 421 genes were down-regulated. Among the transcripts up-regulated by constipation, 89 were significantly down-regulated and 22 were recovered to the normal levels by the AEtLP treatment. The major genes in the down-regulated categories included Slc9a5, klk10, Fgf15, and Alpi, whereas the major genes in the recovered categories were Cyp2b2, Ace, G6pc, and Setbp1. On the other hand, after the AEtLP treatment, ten of these genes down-regulated by constipation were up-regulated significantly and five were recovered to the normal levels. The major genes in the up-regulated categories included Serpina3n, Lcn2 and Slc5a8, whereas the major genes in the recovered categories were Tmem45a, Rerg and Rgc32. These results indicate that several gene functional groups and individual genes as constipation biomarkers respond to an AEtLP treatment in constipated model rats. PMID:26151867

Complex modulation of androgen responsive gene expression by methoxyacetic acid

PubMed Central

2011-01-01

Background Optimal androgen signaling is critical for testicular development and spermatogenesis. Methoxyacetic acid (MAA), the primary active metabolite of the industrial chemical ethylene glycol monomethyl ether, disrupts spermatogenesis and causes testicular atrophy. Transcriptional trans-activation studies have indicated that MAA can enhance androgen receptor activity, however, whether MAA actually impacts the expression of androgen-responsive genes in vivo, and which genes might be affected is not known. Methods A mouse TM3 Leydig cell line that stably expresses androgen receptor (TM3-AR) was prepared and analyzed by transcriptional profiling to identify target gene interactions between MAA and testosterone on a global scale. Results MAA is shown to have widespread effects on androgen-responsive genes, affecting processes ranging from apoptosis to ion transport, cell adhesion, phosphorylation and transcription, with MAA able to enhance, as well as antagonize, androgenic responses. Moreover, testosterone is shown to exert both positive and negative effects on MAA gene responses. Motif analysis indicated that binding sites for FOX, HOX, LEF/TCF, STAT5 and MEF2 family transcription factors are among the most highly enriched in genes regulated by testosterone and MAA. Notably, 65 FOXO targets were repressed by testosterone or showed repression enhanced by MAA with testosterone; these include 16 genes associated with developmental processes, six of which are Hox genes. Conclusions These findings highlight the complex interactions between testosterone and MAA, and provide insight into the effects of MAA exposure on androgen-dependent processes in a Leydig cell model. PMID:21453523

Integrative Analysis of Response to Tamoxifen Treatment in ER-Positive Breast Cancer Using GWAS Information and Transcription Profiling.

PubMed

Hicks, Chindo; Kumar, Ranjit; Pannuti, Antonio; Miele, Lucio

2012-01-01

Variable response and resistance to tamoxifen treatment in breast cancer patients remains a major clinical problem. To determine whether genes and biological pathways containing SNPs associated with risk for breast cancer are dysregulated in response to tamoxifen treatment, we performed analysis combining information from 43 genome-wide association studies with gene expression data from 298 ER(+) breast cancer patients treated with tamoxifen and 125 ER(+) controls. We identified 95 genes which distinguished tamoxifen treated patients from controls. Additionally, we identified 54 genes which stratified tamoxifen treated patients into two distinct groups. We identified biological pathways containing SNPs associated with risk for breast cancer, which were dysregulated in response to tamoxifen treatment. Key pathways identified included the apoptosis, P53, NFkB, DNA repair and cell cycle pathways. Combining GWAS with transcription profiling provides a unified approach for associating GWAS findings with response to drug treatment and identification of potential drug targets.

NET1 and HFI1 genes of yeast mediate both chromosome maintenance and mitochondrial rho(-) mutagenesis.

PubMed

Koltovaya, N A; Guerasimova, A S; Tchekhouta, I A; Devin, A B

2003-08-01

An increase in the mitochondrial rho(-) mutagenesis is a well-known response of yeast cells to mutations in numerous nuclear genes as well as to various kinds of stress. Despite extensive studies for several decades, the biological significance of this response is still not fully understood. The genetic approach to solving this enigma includes a study of genes that are required for the high incidence of spontaneous rho(-) mutants. We have obtained mutations of a few nuclear genes of that sort and found that mutations in certain genes, including CDC28, the central cell-cycle regulation gene, result in a decrease in spontaneous rho(-) mutability and simultaneously affect the maintenance of the yeast chromosomes and plasmids. Two more genes resembling CDC28 in this respect are identified in the present work as a result of the characterization of four new mutants. These two genes are NET1 and HFI1 which mediate important regulatory protein-protein interactions in the yeast cell. The effects of four mutations, including net1-srm and hfi1-srm, on the maintenance of the yeast mitochondrial genome, chromosomes and plasmids, as well as on the cell's sensitivity to ionizing radiation, are also described. The data presented suggest that the pleiotropic srm mutations determining coordinate changes in the fidelity of mitotic transmission of chromosomes, plasmids and mtDNA molecules identify genes that most probably operate high up in the hierarchy of the general genetic regulation of yeast. Copyright 2003 John Wiley & Sons, Ltd.

A Host Transcriptional Signature for Presymptomatic Detection of Infection in Humans Exposed to Influenza H1N1 or H3N2

DTIC Science & Technology

2013-01-09

specificity. The majority of the top 50 predictive genes contained in each factor are known to characterize host response to viral infection, and include...RSAD2, the OAS family, multiple interferon response elements, the myxovirus- resistance gene MX1, cytokine response pathways and others [16,17,18]. Many...antiviral pathways (Fig. s4). Furthermore, the high degree of similarity and cross- applicability of the two signatures permit the mathematical

Phylogenetic analysis of IDD gene family and characterization of its expression in response to flower induction in Malus.

PubMed

Fan, Sheng; Zhang, Dong; Xing, Libo; Qi, Siyan; Du, Lisha; Wu, Haiqin; Shao, Hongxia; Li, Youmei; Ma, Juanjuan; Han, Mingyu

2017-08-01

Although INDETERMINATE DOMAIN (IDD) genes encoding specific plant transcription factors have important roles in plant growth and development, little is known about apple IDD (MdIDD) genes and their potential functions in the flower induction. In this study, we identified 20 putative IDD genes in apple and named them according to their chromosomal locations. All identified MdIDD genes shared a conserved IDD domain. A phylogenetic analysis separated MdIDDs and other plant IDD genes into four groups. Bioinformatic analysis of chemical characteristics, gene structure, and prediction of protein-protein interactions demonstrated the functional and structural diversity of MdIDD genes. To further uncover their potential functions, we performed analysis of tandem, synteny, and gene duplications, which indicated several paired homologs of IDD genes between apple and Arabidopsis. Additionally, genome duplications also promoted the expansion and evolution of the MdIDD genes. Quantitative real-time PCR revealed that all the MdIDD genes showed distinct expression levels in five different tissues (stems, leaves, buds, flowers, and fruits). Furthermore, the expression levels of candidate MdIDD genes were also investigated in response to various circumstances, including GA treatment (decreased the flowering rate), sugar treatment (increased the flowering rate), alternate-bearing conditions, and two varieties with different-flowering intensities. Parts of them were affected by exogenous treatments and showed different expression patterns. Additionally, changes in response to alternate-bearing and different-flowering varieties of apple trees indicated that they were also responsive to flower induction. Taken together, our comprehensive analysis provided valuable information for further analysis of IDD genes aiming at flower induction.

New findings in pharmacogenetics of schizophrenia.

PubMed

Zai, Clement C; Tiwari, Arun K; Zai, Gwyneth C; Maes, Miriam S; Kennedy, James L

2018-05-01

This review highlights recent advances in the investigation of genetic factors for antipsychotic response and side effects. Antipsychotics prescribed to treat psychotic symptoms are variable in efficacy and propensity for causing side effects. The major side effects include tardive dyskinesia, antipsychotic-induced weight gain (AIWG), and clozapine-induced agranulocytosis (CIA). Several promising associations of polymorphisms in genes including HSPG2, CNR1, and DPP6 with tardive dyskinesia have been reported. In particular, a functional genetic polymorphism in SLC18A2, which is a target of recently approved tardive dyskinesia medication valbenazine, was associated with tardive dyskinesia. Similarly, several consistent findings primarily from genes modulating energy homeostasis have also been reported (e.g. MC4R, HTR2C). CIA has been consistently associated with polymorphisms in the HLA genes (HLA-DQB1 and HLA-B). The association findings between glutamate system genes and antipsychotic response require additional replications. The findings to date are promising and provide us a better understanding of the development of side effects and response to antipsychotics. However, more comprehensive investigations in large, well characterized samples will bring us closer to clinically actionable findings.

Integrative mouse and human mRNA studies using WGCNA nominates novel candidate genes involved in the pathogenesis of major depressive disorder.

PubMed

Malki, Karim; Tosto, Maria Grazia; Jumabhoy, Irfan; Lourdusamy, Anbarasu; Sluyter, Frans; Craig, Ian; Uher, Rudolf; McGuffin, Peter; Schalkwyk, Leonard C

2013-12-01

This study aims to identify novel genes associated with major depressive disorder and pharmacological treatment response using animal and human mRNA studies. Weighted gene coexpression network analysis was used to uncover genes associated with stress factors in mice and to inform mRNA probe set selection in a post-mortem study of depression. A total of 171 genes were found to be differentially regulated in response to both early and late stress protocols in a mouse study. Ten human genes, orthologous to mouse genes differentially expressed by stress, were also found to be dysregulated in depressed cases in a human post-mortem brain study from the Stanley Foundation Brain Collection. Several novel genes associated with depression were uncovered, including NOVA1 and USP9X. Moreover, we found further evidence in support of hippocampal neurogenesis and peripheral inflammation in major depressive disorder.

Defensive repertoire of Drosophila larvae in response to toxic fungi.

PubMed

Trienens, Monika; Kraaijeveld, Ken; Wertheim, Bregje

2017-10-01

Chemical warfare including insecticidal secondary metabolites is a well-known strategy for environmental microbes to monopolize a food source. Insects in turn have evolved behavioural and physiological defences to eradicate or neutralize the harmful microorganisms. We studied the defensive repertoire of insects in this interference competition by combining behavioural and developmental assays with whole-transcriptome time-series analysis. Confrontation with the toxic filamentous fungus Aspergillus nidulans severely reduced the survival of Drosophila melanogaster larvae. Nonetheless, the larvae did not behaviourally avoid the fungus, but aggregated at it. Confrontation with fungi strongly affected larval gene expression, including many genes involved in detoxification (e.g., CYP, GST and UGT genes) and the formation of the insect cuticle (e.g., Tweedle genes). The most strongly upregulated genes were several members of the insect-specific gene family Osiris, and CHK-kinase-like domains were over-represented. Immune responses were not activated, reflecting the competitive rather than pathogenic nature of the antagonistic interaction. While internal microbes are widely acknowledged as important, our study emphasizes the underappreciated role of environmental microbes as fierce competitors. © 2017 John Wiley & Sons Ltd.

Transcriptome analysis of the sulfate deficiency response in the marine microalga Emiliania huxleyi.

PubMed

Bochenek, Michal; Etherington, Graham J; Koprivova, Anna; Mugford, Sam T; Bell, Thomas G; Malin, Gill; Kopriva, Stanislav

2013-08-01

The response to sulfate deficiency of plants and freshwater green algae has been extensively analysed by system biology approaches. By contrast, seawater sulfate concentration is high and very little is known about the sulfur metabolism of marine organisms. Here, we used a combination of metabolite analysis and transcriptomics to analyse the response of the marine microalga Emiliania huxleyi as it acclimated to sulfate limitation. Lowering sulfate availability in artificial seawater from 25 to 5 mM resulted in significant reduction in growth and intracellular concentrations of dimethylsulfoniopropionate and glutathione. Sulfate-limited E. huxleyi cells showed increased sulfate uptake but sulfate reduction to sulfite did not seem to be regulated. Sulfate limitation in E. huxleyi affected expression of 1718 genes. The vast majority of these genes were upregulated, including genes involved in carbohydrate and lipid metabolism, and genes involved in the general stress response. The acclimation response of E. huxleyi to sulfate deficiency shows several similarities to the well-described responses of Arabidopsis and Chlamydomonas, but also has many unique features. This dataset shows that even though E. huxleyi is adapted to constitutively high sulfate concentration, it retains the ability to re-program its gene expression in response to reduced sulfate availability. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

Genetic Variants Within Molecular Targets of Antipsychotic Treatment: Effects on Treatment Response, Schizophrenia Risk, and Psychopathological Features.

PubMed

Calabrò, Marco; Porcelli, Stefano; Crisafulli, Concetta; Wang, Sheng-Min; Lee, Soo-Jung; Han, Changsu; Patkar, Ashwin A; Masand, Prakash S; Albani, Diego; Raimondi, Ilaria; Forloni, Gianluigi; Bin, Sofia; Cristalli, Carlotta; Mantovani, Vilma; Pae, Chi-Un; Serretti, Alessandro

2018-01-01

Schizophrenia (SCZ) is a common and severe mental disorder. Genetic factors likely play a role in its pathophysiology as well as in treatment response. In the present study, we investigated the effects of several single nucleotide polymorphisms (SNPs) within 9 genes involved with antipsychotic (AP) mechanisms of action. Two independent samples were recruited. The Korean sample included 176 subjects diagnosed with SCZ and 326 healthy controls, while the Italian sample included 83 subjects and 194 controls. AP response as measured by the positive and negative syndrome scale (PANSS) was the primary outcome, while the secondary outcome was the SCZ risk. Exploratory analyses were performed on (1) symptom clusters response (as measured by PANSS subscales); (2) age of onset; (3) family history; and (4) suicide history. Associations evidenced in the primary analyses did not survive to the FDR correction. Concerning SCZ risk, we partially confirmed the associations among COMT and MAPK1 genetic variants and SCZ. Finally, our exploratory analysis suggested that CHRNA7 and HTR2A genes may modulate both positive and negative symptoms responses, while PLA2G4A and SIGMAR1 may modulate respectively positive and negative symptoms responses. Moreover, GSK3B, HTR2A, PLA2G4A, and S100B variants may determine an anticipation of SCZ age of onset. Our results did not support a primary role for the genes investigated in AP response as a whole. However, our exploratory findings suggested that these genes may be involved in symptom clusters response.

Comparative transcriptome and gene co-expression network analysis reveal genes and signaling pathways adaptively responsive to varied adverse stresses in the insect fungal pathogen, Beauveria bassiana.

PubMed

He, Zhangjiang; Zhao, Xin; Lu, Zhuoyue; Wang, Huifang; Liu, Pengfei; Zeng, Fanqin; Zhang, Yongjun

2018-01-01

Sensing, responding, and adapting to the surrounding environment are crucial for all living organisms to survive, proliferate, and differentiate in their biological niches. Beauveria bassiana is an economically important insect-pathogenic fungus which is widely used as a biocontrol agent to control a variety of insect pests. The fungal pathogen unavoidably encounters a variety of adverse environmental stresses and defense response from the host insects during application of the fungal agents. However, few are known about the transcription response of the fungus to respond or adapt varied adverse stresses. Here, we comparatively analyzed the transcriptome of B. bassiana in globe genome under the varied stationary-phase stresses including osmotic agent (0.8 M NaCl), high temperature (32 °C), cell wall-perturbing agent (Congo red), and oxidative agents (H 2 O 2 or menadione). Total of 12,412 reads were obtained, and mapped to the 6767 genes of the B. bassiana. All of these stresses caused transcription responses involved in basal metabolism, cell wall construction, stress response or cell rescue/detoxification, signaling transduction and gene transcription regulation, and likely other cellular processes. An array of genes displayed similar transcription patterns in response to at least two of the five stresses, suggesting a shared transcription response to varied adverse stresses. Gene co-expression network analysis revealed that mTOR signaling pathway, but not HOG1 MAP kinase pathway, played a central role in regulation the varied adverse stress responses, which was verified by RNAi-mediated knockdown of TOR1. Our findings provided an insight of transcription response and gene co-expression network of B. bassiana in adaptation to varied environments. Copyright © 2017 Elsevier Inc. All rights reserved.

HIV infection-induced transcriptional program in renal tubular epithelial cells activates a CXCR2-driven CD4+ T-cell chemotactic response.

PubMed

Chen, Ping; Yi, Zhengzi; Zhang, Weijia; Klotman, Mary E; Chen, Benjamin K

2016-07-31

Viral replication and interstitial inflammation play important roles in the pathogenesis of HIV-associated nephropathy. Cell-cell interactions between renal tubule epithelial cells (RTECs) and HIV-infected T cells can trigger efficient virus internalization and viral gene expression by RTEC. To understand how HIV replication initiates HIV-associated nephropathy, we studied the cellular response of RTECs to HIV, examining the transcriptional profiles of primary RTECs exposed to cell-free HIV or HIV-infected T cells. HIV-induced gene expression in hRTECs was examined in vitro by Illumina RNA deep sequencing and revealed an innate response to HIV, which was subclassified by gene ontology biological process terms. Chemokine responses were examined by CD4 T-cell chemotaxis assays. As compared with cell-free virus infection, exposure to HIV-infected T cells elicited a stronger upregulation of inflammatory and immune response genes. A major category of upregulated genes are chemokine/cytokine families involved in inflammation and immune response, including inflammatory cytokines CCL20, IL6 and IL8-related chemokines: IL8, CXCL1, CXCL2, CXCL3, CXCL5 and CXCL6. Supernatants from virus-exposed RTECs contained strong chemoattractant activity on primary CD4 T cells, which was potently blocked by a CXCR2 antagonist that antagonizes IL8-related chemokines. We observed a preferential migration of CXCR2-expressing, central memory CD4 T cells in response to HIV infection of RTECs. Interactions between primary RTECs and HIV-infected T cells result in potent induction of inflammatory response genes and release of cytokines/chemokines from RTECs that can attract additional T cells. Activation of these genes reflects an innate response to HIV by nonimmune cells.

Genome-Wide Mapping of Cystitis Due to Streptococcus agalactiae and Escherichia coli in Mice Identifies a Unique Bladder Transcriptome That Signifies Pathogen-Specific Antimicrobial Defense against Urinary Tract Infection

PubMed Central

Tan, Chee K.; Carey, Alison J.; Cui, Xiangqin; Webb, Richard I.; Ipe, Deepak; Crowley, Michael; Cripps, Allan W.; Benjamin, William H.; Ulett, Kimberly B.; Schembri, Mark A.

2012-01-01

The most common causes of urinary tract infections (UTIs) are Gram-negative pathogens such as Escherichia coli; however, Gram-positive organisms, including Streptococcus agalactiae, or group B streptococcus (GBS), also cause UTI. In GBS infection, UTI progresses to cystitis once the bacteria colonize the bladder, but the host responses triggered in the bladder immediately following infection are largely unknown. Here, we used genome-wide expression profiling to map the bladder transcriptome of GBS UTI in mice infected transurethrally with uropathogenic GBS that was cultured from a 35-year-old women with cystitis. RNA from bladders was applied to Affymetrix Gene-1.0ST microarrays; quantitative reverse transcriptase PCR (qRT-PCR) was used to analyze selected gene responses identified in array data sets. A surprisingly small significant-gene list of 172 genes was identified at 24 h; this compared to 2,507 genes identified in a side-by-side comparison with uropathogenic E. coli (UPEC). No genes exhibited significantly altered expression at 2 h in GBS-infected mice according to arrays despite high bladder bacterial loads at this early time point. The absence of a marked early host response to GBS juxtaposed with broad-based bladder responses activated by UPEC at 2 h. Bioinformatics analyses, including integrative system-level network mapping, revealed multiple activated biological pathways in the GBS bladder transcriptome that regulate leukocyte activation, inflammation, apoptosis, and cytokine-chemokine biosynthesis. These findings define a novel, minimalistic type of bladder host response triggered by GBS UTI, which comprises collective antimicrobial pathways that differ dramatically from those activated by UPEC. Overall, this study emphasizes the unique nature of bladder immune activation mechanisms triggered by distinct uropathogens. PMID:22733575

phoP, SPI1, SPI2 and aroA mutants of Salmonella Enteritidis induce a different immune response in chickens.

PubMed

Elsheimer-Matulova, Marta; Varmuzova, Karolina; Kyrova, Kamila; Havlickova, Hana; Sisak, Frantisek; Rahman, Masudur; Rychlik, Ivan

2015-09-17

Poultry is the most frequent reservoir of non-typhoid Salmonella enterica for humans. Understanding the interactions between chickens and S. enterica is therefore important for vaccine design and subsequent decrease in the incidence of human salmonellosis. In this study we therefore characterized the interactions between chickens and phoP, aroA, SPI1 and SPI2 mutants of S. Enteritidis. First we tested the response of HD11 chicken macrophage-like cell line to S. Enteritidis infection monitoring the transcription of 36 genes related to immune response. All the mutants and the wild type strain induced inflammatory signaling in the HD11 cell line though the response to SPI1 mutant infection was different from the rest of the mutants. When newly hatched chickens were inoculated, the phoP as well as the SPI1 mutant did not induce an expression of any of the tested genes in the cecum. Despite this, such chickens were protected against challenge with wild-type S. Enteritidis. On the other hand, inoculation of chickens with the aroA or SPI2 mutant induced expression of 27 and 18 genes, respectively, including genes encoding immunoglobulins. Challenge of chickens inoculated with these two mutants resulted in repeated induction of 11 and 13 tested genes, respectively, including the genes encoding immunoglobulins. In conclusion, SPI1 and phoP mutants induced protective immunity without inducing an inflammatory response and antibody production. Inoculation of chickens with the SPI2 and aroA mutants also led to protective immunity but was associated with inflammation and antibody production. The differences in interaction between the mutants and chicken host can be used for a more detailed understanding of the chicken immune system.

JUN regulates early transcriptional responses to axonal injury in retinal ganglion cells.

PubMed

Fernandes, Kimberly A; Harder, Jeffrey M; Kim, Jessica; Libby, Richard T

2013-07-01

The AP1 family transcription factor JUN is an important molecule in the neuronal response to injury. In retinal ganglion cells (RGCs), JUN is upregulated soon after axonal injury and disrupting JUN activity delays RGC death. JUN is known to participate in the control of many different injury response pathways in neurons, including pathways controlling cell death and axonal regeneration. The role of JUN in regulating genes involved in cell death, ER stress, and regeneration was tested to determine the overall importance of JUN in regulating RGC response to axonal injury. Genes from each of these pathways were transcriptionally controlled following axonal injury and Jun deficiency altered the expression of many of these genes. The differentially expressed genes included, Atf3, Ddit3, Ecel1, Gadd45α, Gal, Hrk, Pten, Socs3, and Sprr1a. Two of these genes, Hrk and Atf3, were tested for importance in RGC death using null alleles of each gene. Disruption of the prodeath Bcl2 family member Hrk did not affect the rate or amount of RGC death after axonal trauma. Deficiency in the ATF/CREB family transcription factor Atf3 did lessen the amount of RGC death after injury, though it did not provide long term protection to RGCs. Since JUN's dimerization partner determines its transcriptional targets, the expression of several candidate AP1 family members were examined. Multiple AP1 family members were induced by axonal injury and had a different expression profile in Jun deficient retinas compared to wildtype retinas (Fosl1, Fosl2 and Jund). Overall, JUN appears to play a multifaceted role in regulating RGC response to axonal injury. Copyright © 2013 Elsevier Ltd. All rights reserved.

Progress and Promise of Attention-Deficit Hyperactivity Disorder Pharmacogenetics

PubMed Central

Froehlich, Tanya E.; McGough, James J.; Stein, Mark A.

2010-01-01

One strategy for understanding variability in attention-deficit hyperactivity disorder (ADHD) medication response, and therefore redressing the current trial-and-error approach to ADHD medication management, is to identify genetic moderators of treatment. This article summarizes ADHD pharmacogenetic investigative efforts to date, which have primarily focused on short-term response to methylphenidate and largely been limited by modest sample sizes. The most well studied genes include the dopamine transporter and dopamine D4 receptor, with additional genes that have been significantly associated with stimulant medication response including the adrenergic α2A-receptor, catechol-O-methyltransferase, D5 receptor, noradrenaline (norepinephrine) transporter protein 1 and synaptosomal-associated protein 25 kDa. Unfortunately, results of current ADHD pharmacogenetic studies have not been entirely consistent, possibly due to differences in study design, medication dosing regimens and outcome measures. Future directions for ADHD pharmacogenetics investigations may include examination of drug-metabolizing enzymes and a wider range of stimulant and non-stimulant medications. In addition, researchers are increasingly interested in going beyond the individual candidate gene approach to investigate gene-gene interactions or pathways, effect modification by additional environmental exposures and whole genome approaches. Advancements in ADHD pharmacogenetics will be facilitated by multi-site collaborations to obtain larger sample sizes using standardized protocols. Although ADHD pharmacogenetic efforts are still in a relatively early stage, their potential clinical applications may include the development of treatment efficacy and adverse effect prediction algorithms that incorporate the interplay of genetic and environmental factors, as well as the development of novel ADHD treatments. PMID:20088618

The impact of a moderate chronic temperature increase on spleen immune-relevant gene transcription depends on whether Atlantic cod (Gadus morhua) are stimulated with bacterial versus viral antigens.

PubMed

Hori, Tiago S; Gamperl, A Kurt; Nash, Gord; Booman, Marije; Barat, Ashoktaru; Rise, Matthew L

2013-10-01

Exposure to elevated temperature is an inherent feature of Atlantic cod (Gadus morhua) sea-cage culture in some regions (e.g., Newfoundland) and may also become an increasingly prevalent challenge for wild fish populations because of accelerated climate change. Therefore, understanding how elevated temperatures impacts the immune response of this commercially important species may help to reduce the potential negative impacts of such challenges. Previously, we investigated the impacts of moderately elevated temperature on the antiviral responses of Atlantic cod (Hori et al. 2012) and reported that elevated temperature modulated the spleen transcriptome response to polyriboinosinic polyribocytidylic acid (pIC, a viral mimic). Herein, we report a complementary microarray study that investigated the impact of the same elevated temperature regime on the Atlantic cod spleen transcriptome response to intraperitoneal (IP) injection of formalin-killed Aeromonas salmonicida (ASAL). Fish were held at two different temperatures (10 °C and 16 °C) prior to immune stimulation and sampled 6 and 24 h post-injection (HPI). In this experiment, we identified 711 and 666 nonredundant ASAL-responsive genes at 6HPI and 24HPI, respectively. These included several known antibacterial genes, including hepcidin, cathelicidin, ferritin heavy subunit, and interleukin 8. However, we only identified 15 differentially expressed genes at 6HPI and 2 at 24HPI (FDR 1%) when comparing ASAL-injected fish held at 10 °C versus 16 °C. In contrast, the same comparisons with pIC-injected fish yielded 290 and 339 differentially expressed genes (FDR 1%) at 6HPI and 24HPI, respectively. These results suggest that moderately elevated temperature has a lesser effect on the Atlantic cod spleen transcriptome response to ASAL (i.e., the antibacterial response) than to pIC (i.e., antiviral response). Thus, the impacts of high temperatures on the cod's immune response may be pathogen dependent.

Heat Shock Protein Genes Undergo Dynamic Alteration in Their Three-Dimensional Structure and Genome Organization in Response to Thermal Stress

PubMed Central

Chowdhary, Surabhi; Kainth, Amoldeep S.

2017-01-01

ABSTRACT Three-dimensional (3D) chromatin organization is important for proper gene regulation, yet how the genome is remodeled in response to stress is largely unknown. Here, we use a highly sensitive version of chromosome conformation capture in combination with fluorescence microscopy to investigate Heat Shock Protein (HSP) gene conformation and 3D nuclear organization in budding yeast. In response to acute thermal stress, HSP genes undergo intense intragenic folding interactions that go well beyond 5′-3′ gene looping previously described for RNA polymerase II genes. These interactions include looping between upstream activation sequence (UAS) and promoter elements, promoter and terminator regions, and regulatory and coding regions (gene “crumpling”). They are also dynamic, being prominent within 60 s, peaking within 2.5 min, and attenuating within 30 min, and correlate with HSP gene transcriptional activity. With similarly striking kinetics, activated HSP genes, both chromosomally linked and unlinked, coalesce into discrete intranuclear foci. Constitutively transcribed genes also loop and crumple yet fail to coalesce. Notably, a missense mutation in transcription factor TFIIB suppresses gene looping, yet neither crumpling nor HSP gene coalescence is affected. An inactivating promoter mutation, in contrast, obviates all three. Our results provide evidence for widespread, transcription-associated gene crumpling and demonstrate the de novo assembly and disassembly of HSP gene foci. PMID:28970326

Heat Shock Protein Genes Undergo Dynamic Alteration in Their Three-Dimensional Structure and Genome Organization in Response to Thermal Stress.

PubMed

Chowdhary, Surabhi; Kainth, Amoldeep S; Gross, David S

2017-12-15

Three-dimensional (3D) chromatin organization is important for proper gene regulation, yet how the genome is remodeled in response to stress is largely unknown. Here, we use a highly sensitive version of chromosome conformation capture in combination with fluorescence microscopy to investigate Heat Shock Protein ( HSP ) gene conformation and 3D nuclear organization in budding yeast. In response to acute thermal stress, HSP genes undergo intense intragenic folding interactions that go well beyond 5'-3' gene looping previously described for RNA polymerase II genes. These interactions include looping between upstream activation sequence (UAS) and promoter elements, promoter and terminator regions, and regulatory and coding regions (gene "crumpling"). They are also dynamic, being prominent within 60 s, peaking within 2.5 min, and attenuating within 30 min, and correlate with HSP gene transcriptional activity. With similarly striking kinetics, activated HSP genes, both chromosomally linked and unlinked, coalesce into discrete intranuclear foci. Constitutively transcribed genes also loop and crumple yet fail to coalesce. Notably, a missense mutation in transcription factor TFIIB suppresses gene looping, yet neither crumpling nor HSP gene coalescence is affected. An inactivating promoter mutation, in contrast, obviates all three. Our results provide evidence for widespread, transcription-associated gene crumpling and demonstrate the de novo assembly and disassembly of HSP gene foci. Copyright © 2017 American Society for Microbiology.

Transcriptomics Modeling of the Late-Gestation Fetal Pituitary Response to Transient Hypoxia

PubMed Central

Wood, Charles E.; Chang, Eileen I.; Richards, Elaine M.; Rabaglino, Maria Belen; Keller-Wood, Maureen

2016-01-01

Background The late-gestation fetal sheep responds to hypoxia with physiological, neuroendocrine, and cellular responses that aid in fetal survival. The response of the fetus to hypoxia represents a coordinated effort to maximize oxygen transfer from the mother and minimize wasteful oxygen consumption by the fetus. While there have been many studies aimed at investigating the coordinated physiological and endocrine responses to hypoxia, and while immunohistochemical or in situ hybridization studies have revealed pathways supporting the endocrine function of the pituitary, there is little known about the coordinated cellular response of the pituitary to the hypoxia. Results Thirty min hypoxia (from 17.0±1.7 to 8.0±0.8 mm Hg, followed by 30 min normoxia) upregulated 595 and downregulated 790 genes in fetal pituitary (123–132 days’ gestation; term = 147 days). Network inference of up- and down- regulated genes revealed a high degree of functional relatedness amongst the gene sets. Gene ontology analysis revealed upregulation of cellular metabolic processes (e.g., RNA synthesis, response to estrogens) and downregulation of protein phosphorylation, protein metabolism, and mitosis. Genes found to be at the center of the network of upregulated genes included genes important for purine binding and signaling. At the center of the downregulated network were genes involved in mRNA processing, DNA repair, sumoylation, and vesicular trafficking. Transcription factor analysis revealed that both up- and down-regulated gene sets are enriched for control by several transcription factors (e.g., SP1, MAZ, LEF1, NRF1, ELK1, NFAT, E12, PAX4) but not for HIF-1, which is known to be an important controller of genomic responses to hypoxia. Conclusions The multiple analytical approaches used in this study suggests that the acute response to 30 min of transient hypoxia in the late-gestation fetus results in reduced cellular metabolism and a pattern of gene expression that is consistent with cellular oxygen and ATP starvation. In this early time point, we see a vigorous gene response. But, like the hypothalamus, the transcriptomic response is not consistent with mediation by HIF-1. If HIF-1 is a significant controller of gene expression in the fetal pituitary after hypoxia, it must be at a later time. PMID:26859870

Alternative Splicing of Barley Clock Genes in Response to Low Temperature

PubMed Central

Calixto, Cristiane P. G.; Simpson, Craig G.; Waugh, Robbie; Brown, John W. S.

2016-01-01

Alternative splicing (AS) is a regulated mechanism that generates multiple transcripts from individual genes. It is widespread in eukaryotic genomes and provides an effective way to control gene expression. At low temperatures, AS regulates Arabidopsis clock genes through dynamic changes in the levels of productive mRNAs. We examined AS in barley clock genes to assess whether temperature-dependent AS responses also occur in a monocotyledonous crop species. We identify changes in AS of various barley core clock genes including the barley orthologues of Arabidopsis AtLHY and AtPRR7 which showed the most pronounced AS changes in response to low temperature. The AS events modulate the levels of functional and translatable mRNAs, and potentially protein levels, upon transition to cold. There is some conservation of AS events and/or splicing behaviour of clock genes between Arabidopsis and barley. In addition, novel temperature-dependent AS of the core clock gene HvPPD-H1 (a major determinant of photoperiod response and AtPRR7 orthologue) is conserved in monocots. HvPPD-H1 showed a rapid, temperature-sensitive isoform switch which resulted in changes in abundance of AS variants encoding different protein isoforms. This novel layer of low temperature control of clock gene expression, observed in two very different species, will help our understanding of plant adaptation to different environments and ultimately offer a new range of targets for plant improvement. PMID:27959947

Knowledge-guided gene prioritization reveals new insights into the mechanisms of chemoresistance.

PubMed

Emad, Amin; Cairns, Junmei; Kalari, Krishna R; Wang, Liewei; Sinha, Saurabh

2017-08-11

Identification of genes whose basal mRNA expression predicts the sensitivity of tumor cells to cytotoxic treatments can play an important role in individualized cancer medicine. It enables detailed characterization of the mechanism of action of drugs. Furthermore, screening the expression of these genes in the tumor tissue may suggest the best course of chemotherapy or a combination of drugs to overcome drug resistance. We developed a computational method called ProGENI to identify genes most associated with the variation of drug response across different individuals, based on gene expression data. In contrast to existing methods, ProGENI also utilizes prior knowledge of protein-protein and genetic interactions, using random walk techniques. Analysis of two relatively new and large datasets including gene expression data on hundreds of cell lines and their cytotoxic responses to a large compendium of drugs reveals a significant improvement in prediction of drug sensitivity using genes identified by ProGENI compared to other methods. Our siRNA knockdown experiments on ProGENI-identified genes confirmed the role of many new genes in sensitivity to three chemotherapy drugs: cisplatin, docetaxel, and doxorubicin. Based on such experiments and extensive literature survey, we demonstrate that about 73% of our top predicted genes modulate drug response in selected cancer cell lines. In addition, global analysis of genes associated with groups of drugs uncovered pathways of cytotoxic response shared by each group. Our results suggest that knowledge-guided prioritization of genes using ProGENI gives new insight into mechanisms of drug resistance and identifies genes that may be targeted to overcome this phenomenon.

Hepatic transcriptome analysis and identification of differentially expressed genes response to dietary oxidized fish oil in loach Misgurnus anguillicaudatus.

PubMed

Zhang, Yin; Li, Yang; Liang, Xiao; Cao, Xiaojuan; Huang, Longfei; Yan, Jie; Wei, Yanxing; Gao, Jian

2017-01-01

RNA sequencing and short-read assembly were utilized to produce a transcriptome of livers from loaches (Misgurnus anguillicaudatus) fed with three different diets respectively containing fresh fish oil (FO group), medium oxidized fish oil (MO group) and high oxidized fish oil (HO group). A total of 60,663 unigenes were obtained in this study, with mean length 848.74 bp. 50,814, 49,584 and 49,814 unigenes were respectively obtained from FO, MO and HO groups. There were 2,343 differentially expressed genes between FO and MO, with 855 down- and 1,488 up-regulated genes in the MO group. 2,813 genes were differentially expressed between FO and HO, including 1,256 down- and 1,552 up-regulated genes in the HO group. 2,075 differentially expressed genes were found in the comparison of MO and HO, including 1,074 up- and 1,001 down-regulated genes in the MO group. Some differentially expressed genes, such as fatty acid transport protein (fatp), fatty acid binding protein (fabp), apolipoprotein (apo), peroxisome proliferator activated receptor-gamma (ppar-γ), acetyl-CoA synthetase (acs) and arachidonate 5-lipoxygenase (alox5), were involved in lipid metabolism, suggesting these genes in the loach were responsive to dietary oxidized fish oil. Results of transcriptome profilings here were validated using quantitative real time PCR in fourteen randomly selected unigenes. The present study provides insights into hepatic transcriptome profile of the loach, which is a valuable resource for studies of loach genomics. More importantly, this study identifies some important genes responsible for dietary oxidized fish oil, which will benefit researches of lipid metabolism in fish.

The immune gene repertoire of an important viral reservoir, the Australian black flying fox.

PubMed

Papenfuss, Anthony T; Baker, Michelle L; Feng, Zhi-Ping; Tachedjian, Mary; Crameri, Gary; Cowled, Chris; Ng, Justin; Janardhana, Vijaya; Field, Hume E; Wang, Lin-Fa

2012-06-20

Bats are the natural reservoir host for a range of emerging and re-emerging viruses, including SARS-like coronaviruses, Ebola viruses, henipaviruses and Rabies viruses. However, the mechanisms responsible for the control of viral replication in bats are not understood and there is little information available on any aspect of antiviral immunity in bats. Massively parallel sequencing of the bat transcriptome provides the opportunity for rapid gene discovery. Although the genomes of one megabat and one microbat have now been sequenced to low coverage, no transcriptomic datasets have been reported from any bat species. In this study, we describe the immune transcriptome of the Australian flying fox, Pteropus alecto, providing an important resource for identification of genes involved in a range of activities including antiviral immunity. Towards understanding the adaptations that have allowed bats to coexist with viruses, we have de novo assembled transcriptome sequence from immune tissues and stimulated cells from P. alecto. We identified about 18,600 genes involved in a broad range of activities with the most highly expressed genes involved in cell growth and maintenance, enzyme activity, cellular components and metabolism and energy pathways. 3.5% of the bat transcribed genes corresponded to immune genes and a total of about 500 immune genes were identified, providing an overview of both innate and adaptive immunity. A small proportion of transcripts found no match with annotated sequences in any of the public databases and may represent bat-specific transcripts. This study represents the first reported bat transcriptome dataset and provides a survey of expressed bat genes that complement existing bat genomic data. In addition, these data provide insight into genes relevant to the antiviral responses of bats, and form a basis for examining the roles of these molecules in immune response to viral infection.

Gene-gene-environment interactions between drugs, transporters, receptors, and metabolizing enzymes: Statins, SLCO1B1, and CYP3A4 as an example.

PubMed

Sadee, Wolfgang

2013-09-01

Pharmacogenetic biomarker tests include mostly specific single gene-drug pairs, capable of accounting for a portion of interindividual variability in drug response and toxicity. However, multiple genes are likely to contribute, either acting independently or epistatically, with the CYP2C9-VKORC1-warfarin test panel, an example of a clinically used gene-gene-dug interaction. I discuss here further instances of gene-gene-drug interactions, including a proposed dynamic effect on statin therapy by genetic variants in both a transporter (SLCO1B1) and a metabolizing enzyme (CYP3A4) in liver cells, the main target site where statins block cholesterol synthesis. These examples set a conceptual framework for developing diagnostic panels involving multiple gene-drug combinations. Copyright © 2013 Wiley Periodicals, Inc.

RNA-Seq reveals complex genetic response to Deepwater Horizon oil release in Fundulus grandis.

PubMed

Garcia, Tzintzuni I; Shen, Yingjia; Crawford, Douglas; Oleksiak, Marjorie F; Whitehead, Andrew; Walter, Ronald B

2012-09-12

The release of oil resulting from the blowout of the Deepwater Horizon (DH) drilling platform was one of the largest in history discharging more than 189 million gallons of oil and subject to widespread application of oil dispersants. This event impacted a wide range of ecological habitats with a complex mix of pollutants whose biological impact is still not yet fully understood. To better understand the effects on a vertebrate genome, we studied gene expression in the salt marsh minnow Fundulus grandis, which is local to the northern coast of the Gulf of Mexico and is a sister species of the ecotoxicological model Fundulus heteroclitus. To assess genomic changes, we quantified mRNA expression using high throughput sequencing technologies (RNA-Seq) in F. grandis populations in the marshes and estuaries impacted by DH oil release. This application of RNA-Seq to a non-model, wild, and ecologically significant organism is an important evaluation of the technology to quickly assess similar events in the future. Our de novo assembly of RNA-Seq data produced a large set of sequences which included many duplicates and fragments. In many cases several of these could be associated with a common reference sequence using blast to query a reference database. This reduced the set of significant genes to 1,070 down-regulated and 1,251 up-regulated genes. These genes indicate a broad and complex genomic response to DH oil exposure including the expected AHR-mediated response and CYP genes. In addition a response to hypoxic conditions and an immune response are also indicated. Several genes in the choriogenin family were down-regulated in the exposed group; a response that is consistent with AH exposure. These analyses are in agreement with oligonucleotide-based microarray analyses, and describe only a subset of significant genes with aberrant regulation in the exposed set. RNA-Seq may be successfully applied to feral and extremely polymorphic organisms that do not have an underlying genome sequence assembly to address timely environmental problems. Additionally, the observed changes in a large set of transcript expression levels are indicative of a complex response to the varied petroleum components to which the fish were exposed.

Time-Resolved Transcriptome Analysis of Bacillus subtilis Responding to Valine, Glutamate, and Glutamine

PubMed Central

Ye, Bang-Ce; Zhang, Yan; Yu, Hui; Yu, Wen-Bang; Liu, Bao-Hong; Yin, Bin-Cheng; Yin, Chun-Yun; Li, Yuan-Yuan; Chu, Ju; Zhang, Si-Liang

2009-01-01

Microorganisms can restructure their transcriptional output to adapt to environmental conditions by sensing endogenous metabolite pools. In this paper, an Agilent customized microarray representing 4,106 genes was used to study temporal transcript profiles of Bacillus subtilis in response to valine, glutamate and glutamine pulses over 24 h. A total of 673, 835, and 1135 amino-acid-regulated genes were identified having significantly changed expression at one or more time points in response to valine, glutamate, and glutamine, respectively, including genes involved in cell wall, cellular import, metabolism of amino-acids and nucleotides, transcriptional regulation, flagellar motility, chemotaxis, phage proteins, sporulation, and many genes of unknown function. Different amino acid treatments were compared in terms of both the global temporal profiles and the 5-minute quick regulations, and between-experiment differential genes were identified. The highlighted genes were analyzed based on diverse sources of gene functions using a variety of computational tools, including T-profiler analysis, and hierarchical clustering. The results revealed the common and distinct modes of action of these three amino acids, and should help to elucidate the specific signaling mechanism of each amino acid as an effector. PMID:19763274

Differential gene expression in response to Fusarium oxysporum infection in resistant and susceptible genotypes of flax (Linum usitatissimum L.).

PubMed

Dmitriev, Alexey A; Krasnov, George S; Rozhmina, Tatiana A; Novakovskiy, Roman O; Snezhkina, Anastasiya V; Fedorova, Maria S; Yurkevich, Olga Yu; Muravenko, Olga V; Bolsheva, Nadezhda L; Kudryavtseva, Anna V; Melnikova, Nataliya V

2017-12-28

Flax (Linum usitatissimum L.) is a crop plant used for fiber and oil production. Although potentially high-yielding flax varieties have been developed, environmental stresses markedly decrease flax production. Among biotic stresses, Fusarium oxysporum f. sp. lini is recognized as one of the most devastating flax pathogens. It causes wilt disease that is one of the major limiting factors for flax production worldwide. Breeding and cultivation of flax varieties resistant to F. oxysporum is the most effective method for controlling wilt disease. Although the mechanisms of flax response to Fusarium have been actively studied, data on the plant response to infection and resistance gene candidates are currently very limited. The transcriptomes of two resistant and two susceptible flax cultivars with respect to Fusarium wilt, as well as two resistant BC 2 F 5 populations, which were grown under control conditions or inoculated with F. oxysporum, were sequenced using the Illumina platform. Genes showing changes in expression under F. oxysporum infection were identified in both resistant and susceptible flax genotypes. We observed the predominant overexpression of numerous genes that are involved in defense response. This was more pronounced in resistant cultivars. In susceptible cultivars, significant downregulation of genes involved in cell wall organization or biogenesis was observed in response to F. oxysporum. In the resistant genotypes, upregulation of genes related to NAD(P)H oxidase activity was detected. Upregulation of a number of genes, including that encoding beta-1,3-glucanase, was significantly greater in the cultivars and BC 2 F 5 populations resistant to Fusarium wilt than in susceptible cultivars in response to F. oxysporum infection. Using high-throughput sequencing, we identified genes involved in the early defense response of L. usitatissimum against the fungus F. oxysporum. In response to F. oxysporum infection, we detected changes in the expression of pathogenesis-related protein-encoding genes and genes involved in ROS production or related to cell wall biogenesis. Furthermore, we identified genes that were upregulated specifically in flax genotypes resistant to Fusarium wilt. We suggest that the identified genes in resistant cultivars and BC 2 F 5 populations showing induced expression in response to F. oxysporum infection are the most promising resistance gene candidates.

Identification of diverse nerve growth factor-regulated genes by serial analysis of gene expression (SAGE) profiling

PubMed Central

Angelastro, James M.; Klimaschewski, Lars; Tang, Song; Vitolo, Ottavio V.; Weissman, Tamily A.; Donlin, Laura T.; Shelanski, Michael L.; Greene, Lloyd A.

2000-01-01

Neurotrophic factors such as nerve growth factor (NGF) promote a wide variety of responses in neurons, including differentiation, survival, plasticity, and repair. Such actions often require changes in gene expression. To identify the regulated genes and thereby to more fully understand the NGF mechanism, we carried out serial analysis of gene expression (SAGE) profiling of transcripts derived from rat PC12 cells before and after NGF-promoted neuronal differentiation. Multiple criteria supported the reliability of the profile. Approximately 157,000 SAGE tags were analyzed, representing at least 21,000 unique transcripts. Of these, nearly 800 were regulated by 6-fold or more in response to NGF. Approximately 150 of the regulated transcripts have been matched to named genes, the majority of which were not previously known to be NGF-responsive. Functional categorization of the regulated genes provides insight into the complex, integrated mechanism by which NGF promotes its multiple actions. It is anticipated that as genomic sequence information accrues the data derived here will continue to provide information about neurotrophic factor mechanisms. PMID:10984536

Toxic Diatom Aldehydes Affect Defence Gene Networks in Sea Urchins

PubMed Central

Varrella, Stefano; Ruocco, Nadia; Ianora, Adrianna; Bentley, Matt G.; Costantini, Maria

2016-01-01

Marine organisms possess a series of cellular strategies to counteract the negative effects of toxic compounds, including the massive reorganization of gene expression networks. Here we report the modulated dose-dependent response of activated genes by diatom polyunsaturated aldehydes (PUAs) in the sea urchin Paracentrotus lividus. PUAs are secondary metabolites deriving from the oxidation of fatty acids, inducing deleterious effects on the reproduction and development of planktonic and benthic organisms that feed on these unicellular algae and with anti-cancer activity. Our previous results showed that PUAs target several genes, implicated in different functional processes in this sea urchin. Using interactomic Ingenuity Pathway Analysis we now show that the genes targeted by PUAs are correlated with four HUB genes, NF-κB, p53, δ-2-catenin and HIF1A, which have not been previously reported for P. lividus. We propose a working model describing hypothetical pathways potentially involved in toxic aldehyde stress response in sea urchins. This represents the first report on gene networks affected by PUAs, opening new perspectives in understanding the cellular mechanisms underlying the response of benthic organisms to diatom exposure. PMID:26914213

Ezrin Inhibition Up-regulates Stress Response Gene Expression.

PubMed

Çelik, Haydar; Bulut, Gülay; Han, Jenny; Graham, Garrett T; Minas, Tsion Z; Conn, Erin J; Hong, Sung-Hyeok; Pauly, Gary T; Hayran, Mutlu; Li, Xin; Özdemirli, Metin; Ayhan, Ayşe; Rudek, Michelle A; Toretsky, Jeffrey A; Üren, Aykut

2016-06-17

Ezrin is a member of the ERM (ezrin/radixin/moesin) family of proteins that links cortical cytoskeleton to the plasma membrane. High expression of ezrin correlates with poor prognosis and metastasis in osteosarcoma. In this study, to uncover specific cellular responses evoked by ezrin inhibition that can be used as a specific pharmacodynamic marker(s), we profiled global gene expression in osteosarcoma cells after treatment with small molecule ezrin inhibitors, NSC305787 and NSC668394. We identified and validated several up-regulated integrated stress response genes including PTGS2, ATF3, DDIT3, DDIT4, TRIB3, and ATF4 as novel ezrin-regulated transcripts. Analysis of transcriptional response in skin and peripheral blood mononuclear cells from NSC305787-treated mice compared with a control group revealed that, among those genes, the stress gene DDIT4/REDD1 may be used as a surrogate pharmacodynamic marker of ezrin inhibitor compound activity. In addition, we validated the anti-metastatic effects of NSC305787 in reducing the incidence of lung metastasis in a genetically engineered mouse model of osteosarcoma and evaluated the pharmacokinetics of NSC305787 and NSC668394 in mice. In conclusion, our findings suggest that cytoplasmic ezrin, previously considered a dormant and inactive protein, has important functions in regulating gene expression that may result in down-regulation of stress response genes. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

JC virus induces altered patterns of cellular gene expression: Interferon-inducible genes as major transcriptional targets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Verma, Saguna; Ziegler, Katja; Ananthula, Praveen

2006-02-20

Human polyomavirus JC (JCV) infects 80% of the population worldwide. Primary infection, typically occurring during childhood, is asymptomatic in immunocompetent individuals and results in lifelong latency and persistent infection. However, among the severely immunocompromised, JCV may cause a fatal demyelinating disease, progressive multifocal leukoencephalopathy (PML). Virus-host interactions influencing persistence and pathogenicity are not well understood, although significant regulation of JCV activity is thought to occur at the level of transcription. Regulation of the JCV early and late promoters during the lytic cycle is a complex event that requires participation of both viral and cellular factors. We have used cDNA microarraymore » technology to analyze global alterations in gene expression in JCV-permissive primary human fetal glial cells (PHFG). Expression of more than 400 cellular genes was altered, including many that influence cell proliferation, cell communication and interferon (IFN)-mediated host defense responses. Genes in the latter category included signal transducer and activator of transcription 1 (STAT1), interferon stimulating gene 56 (ISG56), myxovirus resistance 1 (MxA), 2'5'-oligoadenylate synthetase (OAS), and cig5. The expression of these genes was further confirmed in JCV-infected PHFG cells and the human glioblastoma cell line U87MG to ensure the specificity of JCV in inducing this strong antiviral response. Results obtained by real-time RT-PCR and Western blot analyses supported the microarray data and provide temporal information related to virus-induced changes in the IFN response pathway. Our data indicate that the induction of an antiviral response may be one of the cellular factors regulating/controlling JCV replication in immunocompetent hosts and therefore constraining the development of PML.« less

Physiological and transcriptomic analyses reveal a response mechanism to cold stress in Santalum album L. leaves

PubMed Central

Zhang, Xinhua; Teixeira da Silva, Jaime A.; Niu, Meiyun; Li, Mingzhi; He, Chunmei; Zhao, Jinhui; Zeng, Songjun; Duan, Jun; Ma, Guohua

2017-01-01

Santalum album L. (Indian sandalwood) is an economically important plant species because of its ability to produce highly valued perfume oils. Little is known about the mechanisms by which S. album adapts to low temperatures. In this study, we obtained 100,445,724 raw reads by paired-end sequencing from S. album leaves. Physiological and transcriptomic changes in sandalwood seedlings exposed to 4 °C for 0–48 h were characterized. Cold stress induced the accumulation of malondialdehyde, proline and soluble carbohydrates, and increased the levels of antioxidants. A total of 4,424 differentially expressed genes were responsive to cold, including 3,075 cold-induced and 1,349 cold-repressed genes. When cold stress was prolonged, there was an increase in the expression of cold-responsive genes coding for transporters, responses to stimuli and stress, regulation of defense response, as well as genes related to signal transduction of all phytohormones. Candidate genes in the terpenoid biosynthetic pathway were identified, eight of which were significantly involved in the cold stress response. Gene expression analyses using qRT-PCR showed a peak in the accumulation of SaCBF2 to 4, 50-fold more than control leaves and roots following 12 h and 24 h of cold stress, respectively. The CBF-dependent pathway may play a crucial role in increasing cold tolerance. PMID:28169358

Transcriptional response of honey bee larvae infected with the bacterial pathogen Paenibacillus larvae.

PubMed

Cornman, Robert Scott; Lopez, Dawn; Evans, Jay D

2013-01-01

American foulbrood disease of honey bees is caused by the bacterium Paenibacillus larvae. Infection occurs per os in larvae and systemic infection requires a breaching of the host peritrophic matrix and midgut epithelium. Genetic variation exists for both bacterial virulence and host resistance, and a general immunity is achieved by larvae as they age, the basis of which has not been identified. To quickly identify a pool of candidate genes responsive to P. larvae infection, we sequenced transcripts from larvae inoculated with P. larvae at 12 hours post-emergence and incubated for 72 hours, and compared expression levels to a control cohort. We identified 75 genes with significantly higher expression and six genes with significantly lower expression. In addition to several antimicrobial peptides, two genes encoding peritrophic-matrix domains were also up-regulated. Extracellular matrix proteins, proteases/protease inhibitors, and members of the Osiris gene family were prevalent among differentially regulated genes. However, analysis of Drosophila homologs of differentially expressed genes revealed spatial and temporal patterns consistent with developmental asynchrony as a likely confounder of our results. We therefore used qPCR to measure the consistency of gene expression changes for a subset of differentially expressed genes. A replicate experiment sampled at both 48 and 72 hours post infection allowed further discrimination of genes likely to be involved in host response. The consistently responsive genes in our test set included a hymenopteran-specific protein tyrosine kinase, a hymenopteran specific serine endopeptidase, a cytochrome P450 (CYP9Q1), and a homolog of trynity, a zona pellucida domain protein. Of the known honey bee antimicrobial peptides, apidaecin was responsive at both time-points studied whereas hymenoptaecin was more consistent in its level of change between biological replicates and had the greatest increase in expression by RNA-seq analysis.

A toolbox of genes, proteins, metabolites and promoters for improving drought tolerance in soybean includes the metabolite coumestrol and stomatal development genes.

PubMed

Tripathi, Prateek; Rabara, Roel C; Reese, R Neil; Miller, Marissa A; Rohila, Jai S; Subramanian, Senthil; Shen, Qingxi J; Morandi, Dominique; Bücking, Heike; Shulaev, Vladimir; Rushton, Paul J

2016-02-09

The purpose of this project was to identify metabolites, proteins, genes, and promoters associated with water stress responses in soybean. A number of these may serve as new targets for the biotechnological improvement of drought responses in soybean (Glycine max). We identified metabolites, proteins, and genes that are strongly up or down regulated during rapid water stress following removal from a hydroponics system. 163 metabolites showed significant changes during water stress in roots and 93 in leaves. The largest change was a root-specific 160-fold increase in the coumestan coumestrol making it a potential biomarker for drought and a promising target for improving drought responses. Previous reports suggest that coumestrol stimulates mycorrhizal colonization and under certain conditions mycorrhizal plants have improved drought tolerance. This suggests that coumestrol may be part of a call for help to the rhizobiome during stress. About 3,000 genes were strongly up-regulated by drought and we identified regulators such as ERF, MYB, NAC, bHLH, and WRKY transcription factors, receptor-like kinases, and calcium signaling components as potential targets for soybean improvement as well as the jasmonate and abscisic acid biosynthetic genes JMT, LOX1, and ABA1. Drought stressed soybean leaves show reduced mRNA levels of stomatal development genes including FAMA-like, MUTE-like and SPEECHLESS-like bHLH transcription factors and leaves formed after drought stress had a reduction in stomatal density of 22.34 % and stomatal index of 17.56 %. This suggests that reducing stomatal density may improve drought tolerance. MEME analyses suggest that ABRE (CACGT/CG), CRT/DRE (CCGAC) and a novel GTGCnTGC/G element play roles in transcriptional activation and these could form components of synthetic promoters to drive expression of transgenes. Using transformed hairy roots, we validated the increase in promoter activity of GmWRKY17 and GmWRKY67 during dehydration and after 20 μM ABA treatment. Our toolbox provides new targets and strategies for improving soybean drought tolerance and includes the coumestan coumestrol, transcription factors that regulate stomatal density, water stress-responsive WRKY gene promoters and a novel DNA element that appears to be enriched in water stress responsive promoters.

A Role for the GCC-Box in Jasmonate-Mediated Activation of the PDF1.2 Gene of Arabidopsis1

PubMed Central

Brown, Rebecca L.; Kazan, Kemal; McGrath, Ken C.; Maclean, Don J.; Manners, John M.

2003-01-01

The PDF1.2 gene of Arabidopsis encoding a plant defensin is commonly used as a marker for characterization of the jasmonate-dependent defense responses. Here, using PDF1.2 promoter-deletion lines linked to the β-glucoronidase-reporter gene, we examined putative promoter elements associated with jasmonate-responsive expression of this gene. Using stably transformed plants, we first characterized the extended promoter region that positively regulates basal expression from the PDF1.2 promoter. Second, using promoter deletion constructs including one from which the GCC-box region was deleted, we observed a substantially lower response to jasmonate than lines carrying this motif. In addition, point mutations introduced into the core GCC-box sequence substantially reduced jasmonate responsiveness, whereas addition of a 20-nucleotide-long promoter element carrying the core GCC-box and flanking nucleotides provided jasmonate responsiveness to a 35S minimal promoter. Taken together, these results indicated that the GCC-box plays a key role in conferring jasmonate responsiveness to the PDF1.2 promoter. However, deletion or specific mutations introduced into the core GCC-box did not completely abolish the jasmonate responsiveness of the promoter, suggesting that the other promoter elements lying downstream from the GCC-box region may also contribute to jasmonate responsiveness. In other experiments, we identified a jasmonate- and pathogen-responsive ethylene response factor transcription factor, AtERF2, which when overexpressed in transgenic Arabidopsis plants activated transcription from the PDF1.2, Thi2.1, and PR4 (basic chitinase) genes, all of which contain a GCC-box sequence in their promoters. Our results suggest that in addition to their roles in regulating ethylene-mediated gene expression, ethylene response factors also appear to play important roles in regulating jasmonate-responsive gene expression, possibly via interaction with the GCC-box. PMID:12805630

Comparing Gene Expression Profiles Between Bt and non-Bt Rice in Response to Brown Planthopper Infestation

PubMed Central

Wang, Fang; Ning, Duo; Chen, Yang; Dang, Cong; Han, Nai-Shun; Liu, Yu'e; Ye, Gong-Yin

2015-01-01

Bt proteins are the most widely used insecticidal proteins in transgenic crops for improving insect resistance. We previously observed longer nymphal developmental duration and lower fecundity in brown planthopper (BPH) fed on Bt rice line KMD2, although Bt insecticidal protein Cry1Ab could rarely concentrate in this non-target rice pest. In the present study, we performed microarray analysis in an effort to detect Bt-independent variation, which might render Bt rice more defensive and/or less nutritious to BPH. We detected 3834 and 3273 differentially expressed probe-sets in response to BPH infestation in non-Bt parent Xiushui 11 and Bt rice KMD2, respectively, only 439 of which showed significant differences in expression between rice lines. Our analysis revealed a shift from growth to defense responses in response to BPH infestation, which was also detected in many other studies of plants suffering biotic and abiotic stresses. Chlorophyll biosynthesis and basic metabolism pathways were inhibited in response to infestation. IAA and GA levels decreased as a result of the repression of biosynthesis-related genes or the induction of inactivation-related genes. In accordance with these observations, a number of IAA-, GA-, BR-signaling genes were downregulated in response to BPH. Thus, the growth of rice plants under BPH attack was reduced and defense related hormone signaling like JA, SA and ET were activated. In addition, growth-related hormone signaling pathways, such as GA, BR, and auxin signaling pathways, as well as ABA, were also found to be involved in BPH-induced defense. On the other side, 51 probe-sets (represented 50 genes) that most likely contribute to the impact of Bt rice on BPH were identified, including three early nodulin genes, four lipid metabolic genes, 14 stress response genes, three TF genes and genes with other functions. Two transcription factor genes, bHLH and MYB, together with lipid transfer protein genes LTPL65 and early nodulin gene ENOD93, are the most likely candidates for improving herbivore resistance in plants. PMID:26734057

Identification of differentially-expressed genes potentially implicated in drought response in pitaya (Hylocereus undatus) by suppression subtractive hybridization and cDNA microarray analysis.

PubMed

Fan, Qing-Jie; Yan, Feng-Xia; Qiao, Guang; Zhang, Bing-Xue; Wen, Xiao-Peng

2014-01-01

Drought is one of the most severe threats to the growth, development and yield of plant. In order to unravel the molecular basis underlying the high tolerance of pitaya (Hylocereus undatus) to drought stress, suppression subtractive hybridization (SSH) and cDNA microarray approaches were firstly combined to identify the potential important or novel genes involved in the plant responses to drought stress. The forward (drought over drought-free) and reverse (drought-free over drought) suppression subtractive cDNA libraries were constructed using in vitro shoots of cultivar 'Zihonglong' exposed to drought stress and drought-free (control). A total of 2112 clones, among which half were from either forward or reverse SSH library, were randomly picked up to construct a pitaya cDNA microarray. Microarray analysis was carried out to verify the expression fluctuations of this set of clones upon drought treatment compared with the controls. A total of 309 expressed sequence tags (ESTs), 153 from forward library and 156 from reverse library, were obtained, and 138 unique ESTs were identified after sequencing by clustering and blast analyses, which included genes that had been previously reported as responsive to water stress as well as some functionally unknown genes. Thirty six genes were mapped to 47 KEGG pathways, including carbohydrate metabolism, lipid metabolism, energy metabolism, nucleotide metabolism, and amino acid metabolism of pitaya. Expression analysis of the selected ESTs by reverse transcriptase polymerase chain reaction (RT-PCR) corroborated the results of differential screening. Moreover, time-course expression patterns of these selected ESTs further confirmed that they were closely responsive to drought treatment. Among the differentially expressed genes (DEGs), many are related to stress tolerances including drought tolerance. Thereby, the mechanism of drought tolerance of this pitaya genotype is a very complex physiological and biochemical process, in which multiple metabolism pathways and many genes were implicated. The data gained herein provide an insight into the mechanism underlying the drought stress tolerance of pitaya, as well as may facilitate the screening of candidate genes for drought tolerance. © 2013 Elsevier B.V. All rights reserved.

Auxin as a player in the biocontrol of Fusarium head blight disease of barley and its potential as a disease control agent.

PubMed

Petti, Carloalberto; Reiber, Kathrin; Ali, Shahin S; Berney, Margaret; Doohan, Fiona M

2012-11-22

Mechanisms involved in the biological control of plant diseases are varied and complex. Hormones, including the auxin indole acetic acid (IAA) and abscisic acid (ABA), are essential regulators of a multitude of biological functions, including plant responses to biotic and abiotic stressors. This study set out to determine what hormones might play a role in Pseudomonas fluorescens -mediated control of Fusarium head blight (FHB) disease of barley and to determine if biocontrol-associated hormones directly affect disease development. A previous study distinguished bacterium-responsive genes from bacterium-primed genes, distinguished by the fact that the latter are only up-regulated when both P. fluorescens and the pathogen Fusarium culmorum are present. In silico analysis of the promoter sequences available for a subset of the bacterium-primed genes identified several hormones, including IAA and ABA as potential regulators of transcription. Treatment with the bacterium or pathogen resulted in increased IAA and ABA levels in head tissue; both microbes had additive effects on the accumulation of IAA but not of ABA. The microbe-induced accumulation of ABA preceded that of IAA. Gene expression analysis showed that both hormones up-regulated the accumulation of bacterium-primed genes. But IAA, more than ABA up-regulated the transcription of the ABA biosynthesis gene NCED or the signalling gene Pi2, both of which were previously shown to be bacterium-responsive rather than primed. Application of IAA, but not of ABA reduced both disease severity and yield loss caused by F. culmorum, but neither hormone affect in vitro fungal growth. Both IAA and ABA are involved in the P. fluorescens-mediated control of FHB disease of barley. Gene expression studies also support the hypothesis that IAA plays a role in the primed response to F. culmorum. This hypothesis was validated by the fact that pre-application of IAA reduced both symptoms and yield loss asssociated with the disease. This is the first evidence that IAA plays a role in the control of FHB disease and in the bacterial priming of host defences.

Auxin as a player in the biocontrol of Fusarium head blight disease of barley and its potential as a disease control agent

PubMed Central

2012-01-01

Background Mechanisms involved in the biological control of plant diseases are varied and complex. Hormones, including the auxin indole acetic acid (IAA) and abscisic acid (ABA), are essential regulators of a multitude of biological functions, including plant responses to biotic and abiotic stressors. This study set out to determine what hormones might play a role in Pseudomonas fluorescens –mediated control of Fusarium head blight (FHB) disease of barley and to determine if biocontrol-associated hormones directly affect disease development. Results A previous study distinguished bacterium-responsive genes from bacterium-primed genes, distinguished by the fact that the latter are only up-regulated when both P. fluorescens and the pathogen Fusarium culmorum are present. In silico analysis of the promoter sequences available for a subset of the bacterium-primed genes identified several hormones, including IAA and ABA as potential regulators of transcription. Treatment with the bacterium or pathogen resulted in increased IAA and ABA levels in head tissue; both microbes had additive effects on the accumulation of IAA but not of ABA. The microbe-induced accumulation of ABA preceded that of IAA. Gene expression analysis showed that both hormones up-regulated the accumulation of bacterium-primed genes. But IAA, more than ABA up-regulated the transcription of the ABA biosynthesis gene NCED or the signalling gene Pi2, both of which were previously shown to be bacterium-responsive rather than primed. Application of IAA, but not of ABA reduced both disease severity and yield loss caused by F. culmorum, but neither hormone affect in vitro fungal growth. Conclusions Both IAA and ABA are involved in the P. fluorescens-mediated control of FHB disease of barley. Gene expression studies also support the hypothesis that IAA plays a role in the primed response to F. culmorum. This hypothesis was validated by the fact that pre-application of IAA reduced both symptoms and yield loss asssociated with the disease. This is the first evidence that IAA plays a role in the control of FHB disease and in the bacterial priming of host defences. PMID:23173736

Biological mechanisms discriminating growth rate and adult body weight phenotypes in two Chinese indigenous chicken breeds.

PubMed

Dou, Tengfei; Zhao, Sumei; Rong, Hua; Gu, Dahai; Li, Qihua; Huang, Ying; Xu, Zhiqiang; Chu, Xiaohui; Tao, Linli; Liu, Lixian; Ge, Changrong; Te Pas, Marinus F W; Jia, Junjing

2017-06-20

Intensive selection has resulted in increased growth rates and muscularity in broiler chickens, in addition to adverse effects, including delayed organ development, sudden death syndrome, and altered metabolic rates. The biological mechanisms underlying selection responses remain largely unknown. Non-artificially-selected indigenous Chinese chicken breeds display a wide variety of phenotypes, including differential growth rate, body weight, and muscularity. The Wuding chicken breed is a fast growing large chicken breed, and the Daweishan mini chicken breed is a slow growing small chicken breed. Together they form an ideal model system to study the biological mechanisms underlying broiler chicken selection responses in a natural system. The objective of this study was to study the biological mechanisms underlying differential phenotypes between the two breeds in muscle and liver tissues, and relate these to the growth rate and body development phenotypes of the two breeds. The muscle tissue in the Wuding breed showed higher expression of muscle development genes than muscle tissue in the Daweishan chicken breed. This expression was accompanied by higher expression of acute inflammatory response genes in Wuding chicken than in Daweishan chicken. The muscle tissue of the Daweishan mini chicken breed showed higher expression of genes involved in several metabolic mechanisms including endoplasmic reticulum, protein and lipid metabolism, energy metabolism, as well as specific immune traits than in the Wuding chicken. The liver tissue showed fewer differences between the two breeds. Genes displaying higher expression in the Wuding breed than in the Daweishan breed were not associated with a specific gene network or biological mechanism. Genes highly expressed in the Daweishan mini chicken breed compared to the Wuding breed were enriched for protein metabolism, ABC receptors, signal transduction, and IL6-related mechanisms. We conclude that faster growth rates and larger body size are related to increased expression of genes involved in muscle development and immune response in muscle, while slower growth rates and smaller body size are related to increased general cellular metabolism. The liver of the Daweishan breed displayed increased expression of metabolic genes.

Genomic Profiling of Tumor Necrosis Factor Alpha (TNF-α) Receptor and Interleukin-1 Receptor Knockout Mice Reveals a Link between TNF-α Signaling and Increased Severity of 1918 Pandemic Influenza Virus Infection▿ †

PubMed Central

Belisle, Sarah E.; Tisoncik, Jennifer R.; Korth, Marcus J.; Carter, Victoria S.; Proll, Sean C.; Swayne, David E.; Pantin-Jackwood, Mary; Tumpey, Terrence M.; Katze, Michael G.

2010-01-01

The influenza pandemic of 1918 to 1919 was one of the worst global pandemics in recent history. The highly pathogenic nature of the 1918 virus is thought to be mediated in part by a dysregulation of the host response, including an exacerbated proinflammatory cytokine response. In the present study, we compared the host transcriptional response to infection with the reconstructed 1918 virus in wild-type, tumor necrosis factor (TNF) receptor-1 knockout (TNFRKO), and interleukin-1 (IL-1) receptor-1 knockout (IL1RKO) mice as a means of further understanding the role of proinflammatory cytokine signaling during the acute response to infection. Despite reported redundancy in the functions of IL-1β and TNF-α, we observed that reducing the signaling capacity of each of these molecules by genetic disruption of their key receptor genes had very different effects on the host response to infection. In TNFRKO mice, we found delayed or decreased expression of genes associated with antiviral and innate immune signaling, complement, coagulation, and negative acute-phase response. In contrast, in IL1RKO mice numerous genes were differentially expressed at 1 day postinoculation, including an increase in the expression of genes that contribute to dendritic and natural killer cell processes and cellular movement, and gene expression profiles remained relatively constant at later time points. We also observed a compensatory increase in TNF-α expression in virus-infected IL1RKO mice. Our data suggest that signaling through the IL-1 receptor is protective, whereas signaling through the TNF-α receptor increases the severity of 1918 virus infection. These findings suggest that manipulation of these pathways may have therapeutic benefit. PMID:20926563

Suppression of the rice fatty-acid desaturase gene OsSSI2 enhances resistance to blast and leaf blight diseases in rice.

PubMed

Jiang, Chang-Jie; Shimono, Masaki; Maeda, Satoru; Inoue, Haruhiko; Mori, Masaki; Hasegawa, Morifumi; Sugano, Shoji; Takatsuji, Hiroshi

2009-07-01

Fatty acids and their derivatives play important signaling roles in plant defense responses. It has been shown that suppressing a gene for stearoyl acyl carrier protein fatty-acid desaturase (SACPD) enhances the resistance of Arabidopsis (SSI2) and soybean to multiple pathogens. In this study, we present functional analyses of a rice homolog of SSI2 (OsSSI2) in disease resistance of rice plants. A transposon insertion mutation (Osssi2-Tos17) and RNAi-mediated knockdown of OsSSI2 (OsSSI2-kd) reduced the oleic acid (18:1) level and increased that of stearic acid (18:0), indicating that OsSSI2 is responsible for fatty-acid desaturase activity. These plants displayed spontaneous lesion formation in leaf blades, retarded growth, slight increase in endogenous free salicylic acid (SA) levels, and SA/benzothiadiazole (BTH)-specific inducible genes, including WRKY45, a key regulator of SA/BTH-induced resistance, in rice. Moreover, the OsSSI2-kd plants showed markedly enhanced resistance to the blast fungus Magnaporthe grisea and leaf-blight bacteria Xanthomonas oryzae pv. oryzae. These results suggest that OsSSI2 is involved in the negative regulation of defense responses in rice, as are its Arabidopsis and soybean counterparts. Microarray analyses identified 406 genes that were differentially expressed (>or=2-fold) in OsSSI2-kd rice plants compared with wild-type rice and, of these, approximately 39% were BTH responsive. Taken together, our results suggest that induction of SA-responsive genes, including WRKY45, is likely responsible for enhanced disease resistance in OsSSI2-kd rice plants.

Comparative analysis of differential gene expression in kidney tissues of moribund and surviving crucian carp (Carassius auratus gibelio) in response to cyprinid herpesvirus 2 infection.

PubMed

Xu, Lijuan; Podok, Patarida; Xie, Jun; Lu, Liqun

2014-08-01

Cyprinid herpesvirus 2 (CyHV-2) has recently been associated with high mortality of cultured crucian carp (Carassius auratus gibelio) in eastern China. In this study, we established a real-time PCR method to confirm viral infection of crucian carp and to quantify CyHV-2 particles obtained by sucrose gradient centrifugation from diseased fish. Virus-free crucian carp were artificially infected with CyHV-2 using an injection method, which resulted in a dose-dependent death rate. In situ hybridization analysis indicated that there was extensive viral replication and lysis in the kidneys of moribund fish, in contrast to very limited replication in surviving fish. To probe the host immune response to viral infection at the level of gene expression, we identified virus-responsive genes using suppression subtractive hybridization (SSH) in head kidney tissues, the principal immune organ of fish, from moribund and surviving crucian carps after viral challenge. From the moribund SSH library, 363 expressed sequence tags (ESTs) were clustered to 234 unigenes (including 15 singletons and 45 contigs). From the survivor SSH library, 599 ESTs was clustered to 549 unigenes (including 107 singletons and 105 contigs). We further analyzed the transcriptional levels of all immune-related genes by quantitative real-time RT-PCR, which confirmed the upregulation of 90.48 % of these genes. The significantly upregulated immune-related genes identified in this study can serve as candidate marker genes for acute CyHV-2 infection.

Feedback inhibition by thiols outranks glutathione depletion: a luciferase-based screen reveals glutathione-deficient γ -ECS and glutathione synthetase mutants impaired in cadmium-induced sulfate assimilation

PubMed Central

Jobe, Timothy O.; Sung, Dong-Yul; Akmakjian, Garo; Pham, Allis; Komives, Elizabeth A.; Mendoza-Cózatl, David G.; Schroeder, Julian I.

2015-01-01

Summary Plants exposed to heavy metals rapidly induce changes in gene expression that activate and enhance detoxification mechanisms, including toxic-metal chelation and the scavenging of reactive oxygen species. However, the mechanisms mediating toxic heavy metal-induced gene expression remain largely unknown. To genetically elucidate cadmium-specific transcriptional responses in Arabidopsis, we designed a genetic screen based on the activation of a cadmium-inducible reporter gene. Microarray studies identified a high-affinity sulfate transporter (SULTR1;2) among the most robust and rapid cadmium-inducible transcripts. The SULTR1;2 promoter (2.2 kb) was fused with the firefly luciferase reporter gene to quantitatively report the transcriptional response of plants exposed to cadmium. Stably transformed luciferase reporter lines were ethyl methanesulfonate (EMS) mutagenized, and stable M2 seedlings were screened for an abnormal luciferase response during exposure to cadmium. The screen identified non-allelic mutant lines that fell into one of three categories: (i) super response to cadmium (SRC) mutants; (ii) constitutive response to cadmium (CRC) mutants; or (iii) non-response and reduced response to cadmium (NRC) mutants. Two nrc mutants, nrc1 and nrc2, were mapped, cloned and further characterized. The nrc1 mutation was mapped to the γ-glutamylcysteine synthetase gene and the nrc2 mutation was identified as the first viable recessive mutant allele in the glutathione synthetase gene. Moreover, genetic, HPLC mass spectrometry, and gene expression analysis of the nrc1 and nrc2 mutants, revealed that intracellular glutathione depletion alone would be insufficient to induce gene expression of sulfate uptake and assimilation mechanisms. Our results modify the glutathione-depletion driven model for sulfate assimilation gene induction during cadmium stress, and suggest that an enhanced oxidative state and depletion of upstream thiols, in addition to glutathione depletion, are necessary to induce the transcription of sulfate assimilation genes during early cadmium stress. PMID:22283708

Network analysis of oyster transcriptome revealed a cascade of cellular responses during recovery after heat shock.

PubMed

Zhang, Lingling; Hou, Rui; Su, Hailin; Hu, Xiaoli; Wang, Shi; Bao, Zhenmin

2012-01-01

Oysters, as a major group of marine bivalves, can tolerate a wide range of natural and anthropogenic stressors including heat stress. Recent studies have shown that oysters pretreated with heat shock can result in induced heat tolerance. A systematic study of cellular recovery from heat shock may provide insights into the mechanism of acquired thermal tolerance. In this study, we performed the first network analysis of oyster transcriptome by reanalyzing microarray data from a previous study. Network analysis revealed a cascade of cellular responses during oyster recovery after heat shock and identified responsive gene modules and key genes. Our study demonstrates the power of network analysis in a non-model organism with poor gene annotations, which can lead to new discoveries that go beyond the focus on individual genes.

Transcriptome profiling of postharvest strawberry fruit in response to exogenous auxin and abscisic acid.

PubMed

Chen, Jingxin; Mao, Linchun; Lu, Wenjing; Ying, Tiejin; Luo, Zisheng

2016-01-01

Auxin and abscisic acid regulate strawberry fruit ripening and senescence through cross-talk of their signal transduction pathways that further modulate the structural genes related to physico-chemical properties of fruit. The physiological and transcriptomic changes in harvested strawberry fruits in responses to IAA, ABA and their combination were analyzed. Exogenous IAA delayed the ripening process of strawberries after harvest while ABA promoted the postharvest ripening. However, treatment with a combination of IAA and ABA did not slow down nor accelerate the postharvest ripening in the strawberry fruits. At the molecular level, exogenous IAA up regulated the expressions of genes related to IAA signaling, including AUX/IAA, ARF, TOPLESS and genes encoding E3 ubiquitin protein ligase and annexin, and down regulated genes related to pectin depolymerization, cell wall degradation, sucrose and anthocyanin biosyntheses. In contrast, exogenous ABA induced genes related to fruit softening, and genes involved in signaling pathways including SKP1, HSPs, CK2, and SRG1. Comparison of transcriptomes in responses to individual treatments with IAA or ABA or the combination revealed that there were cooperative and antagonistic actions between IAA and ABA in fruit. However, 17% of the differentially expressed unigenes in response to the combination of IAA and ABA were unique and were not found in those unigenes responding to either IAA or ABA alone. The analyses also found that receptor-like kinases and ubiquitin ligases responded to both IAA and ABA, which seemed to play a pivotal role in both hormones' signaling pathways and thus might be the cross-talk points of both hormones.

Expression patterns and promoter analyses of aluminum-responsive NAC genes suggest a possible growth regulation of rice mediated by aluminum, hormones and NAC transcription factors.

PubMed

Escobar-Sepúlveda, Hugo Fernando; Trejo-Téllez, Libia Iris; García-Morales, Soledad; Gómez-Merino, Fernando Carlos

2017-01-01

In acid soils, the solubilized form of aluminum, Al+3, decreases root growth and affects the development of most crops. However, like other toxic elements, Al can have hormetic effects on plant metabolism. Rice (Oryza sativa) is one of the most tolerant species to Al toxicity, and when this element is supplied at low doses, growth stimulation has been observed, which could be due to combined mechanisms that are partly triggered by NAC transcription factors. This protein family can regulate vital processes in plants, including growth, development, and response to environmental stimuli, whether biotic or abiotic. Under our experimental conditions, 200 μM Al stimulated root growth and the formation of tillers; it also caused differential expression of a set of NAC genes. The promoter regions of the genes regulated by Al were analyzed and the cis-acting elements that are potentially involved in the responses to different stimuli, including environmental stress, were identified. Through the Genevestigator platform, data on the expression of NAC genes were obtained by experimental condition, tissue, and vegetative stage. This is the first study on NAC genes where in vivo and in silico data are complementarily analyzed, relating the hormetic effect of Al on plant growth and gene expression with a possible interaction in the response to phytohormones in rice. These findings could help to elucidate the possible convergence between the signaling pathways mediated by phytohormones and the role of the NAC transcription factors in the regulation of growth mediated by low Al doses.

Expression patterns and promoter analyses of aluminum-responsive NAC genes suggest a possible growth regulation of rice mediated by aluminum, hormones and NAC transcription factors

PubMed Central

2017-01-01

In acid soils, the solubilized form of aluminum, Al+3, decreases root growth and affects the development of most crops. However, like other toxic elements, Al can have hormetic effects on plant metabolism. Rice (Oryza sativa) is one of the most tolerant species to Al toxicity, and when this element is supplied at low doses, growth stimulation has been observed, which could be due to combined mechanisms that are partly triggered by NAC transcription factors. This protein family can regulate vital processes in plants, including growth, development, and response to environmental stimuli, whether biotic or abiotic. Under our experimental conditions, 200 μM Al stimulated root growth and the formation of tillers; it also caused differential expression of a set of NAC genes. The promoter regions of the genes regulated by Al were analyzed and the cis-acting elements that are potentially involved in the responses to different stimuli, including environmental stress, were identified. Through the Genevestigator platform, data on the expression of NAC genes were obtained by experimental condition, tissue, and vegetative stage. This is the first study on NAC genes where in vivo and in silico data are complementarily analyzed, relating the hormetic effect of Al on plant growth and gene expression with a possible interaction in the response to phytohormones in rice. These findings could help to elucidate the possible convergence between the signaling pathways mediated by phytohormones and the role of the NAC transcription factors in the regulation of growth mediated by low Al doses. PMID:29023561

Elicitors and defense gene induction in plants with altered lignin compositions.

PubMed

Gallego-Giraldo, Lina; Posé, Sara; Pattathil, Sivakumar; Peralta, Angelo Gabriel; Hahn, Michael G; Ayre, Brian G; Sunuwar, Janak; Hernandez, Jonathan; Patel, Monika; Shah, Jyoti; Rao, Xiaolan; Knox, J Paul; Dixon, Richard A

2018-06-27

A reduction in the lignin content in transgenic plants induces the ectopic expression of defense genes, but the importance of altered lignin composition in such phenomena remains unclear. Two Arabidopsis lines with similar lignin contents, but strikingly different lignin compositions, exhibited different quantitative and qualitative transcriptional responses. Plants with lignin composed primarily of guaiacyl units overexpressed genes responsive to oomycete and bacterial pathogen attack, whereas plants with lignin composed primarily of syringyl units expressed a far greater number of defense genes, including some associated with cis-jasmone-mediated responses to aphids; these plants exhibited altered responsiveness to bacterial and aphid inoculation. Several of the defense genes were differentially induced by water-soluble extracts from cell walls of plants of the two lines. Glycome profiling, fractionation and enzymatic digestion studies indicated that the different lignin compositions led to differential extractability of a range of heterogeneous oligosaccharide epitopes, with elicitor activity originating from different cell wall polymers. Alteration of lignin composition affects interactions with plant cell wall matrix polysaccharides to alter the sequestration of multiple latent defense signal molecules with an impact on biotic stress responses. © 2018 The Authors. New Phytologist © 2018 New Phytologist Trust.

Transcriptome Analysis of Quantitative Resistance-Specific Response upon Ralstonia solanacearum Infection in Tomato

PubMed Central

Ishihara, Takeaki; Mitsuhara, Ichiro; Takahashi, Hideki; Nakaho, Kazuhiro

2012-01-01

Bacterial wilt, caused by the soil-borne bacterium Ralstonia solanacearum, is a lethal disease of tomato, but the molecular mechanisms of the host resistance responses to R. solanacearum remain unclear. In this study, we report the first work describing the transcriptome of cultivar resistance and susceptible tomato cultivar after inoculation with R. solanacearum. To elucidate the characteristics of resistance early in the interaction, we analyzed microarrays for resistant cultivar LS-89 and susceptible cultivar Ponderosa 1 day after stem inoculation. No change in gene expression was detected for Ponderosa, but expression levels of over 140 genes, including pathogenesis-related, hormone signaling and lignin biosynthesis genes, increased in LS-89. Expression of β-1,3-glucanase genes increased substantially. In an immunohistochemical study, glucanase in LS-89 accumulated in the xylem and pith tissues surrounding xylem vessels filled with R. solanacearum. The expression of these genes also increased in four other resistant cultivars, but changed little in four susceptible cultivars in response to R. solanacearum, suggesting that similar reactions occur in other cultivars. These gene expression profiles will serve as fundamental information to elucidate the molecular mechanisms in the resistance response to R. solanacearum in tomato. PMID:23071630

Transcriptional profiling of host gene expression in chicken embryo lung cells infected with laryngotracheitis virus

PubMed Central

2010-01-01

Background Infection by infectious laryngotracheitis virus (ILTV; gallid herpesvirus 1) causes acute respiratory diseases in chickens often with high mortality. To better understand host-ILTV interactions at the host transcriptional level, a microarray analysis was performed using 4 × 44 K Agilent chicken custom oligo microarrays. Results Microarrays were hybridized using the two color hybridization method with total RNA extracted from ILTV infected chicken embryo lung cells at 0, 1, 3, 5, and 7 days post infection (dpi). Results showed that 789 genes were differentially expressed in response to ILTV infection that include genes involved in the immune system (cytokines, chemokines, MHC, and NF-κB), cell cycle regulation (cyclin B2, CDK1, and CKI3), matrix metalloproteinases (MMPs) and cellular metabolism. Differential expression for 20 out of 789 genes were confirmed by quantitative reverse transcription-PCR (qRT-PCR). A bioinformatics tool (Ingenuity Pathway Analysis) used to analyze biological functions and pathways on the group of 789 differentially expressed genes revealed that 21 possible gene networks with intermolecular connections among 275 functionally identified genes. These 275 genes were classified into a number of functional groups that included cancer, genetic disorder, cellular growth and proliferation, and cell death. Conclusion The results of this study provide comprehensive knowledge on global gene expression, and biological functionalities of differentially expressed genes in chicken embryo lung cells in response to ILTV infections. PMID:20663125

Xenobiotic metabolism in the fourth dimension: PARtners in time.

PubMed

Green, Carla B; Takahashi, Joseph S

2006-07-01

A significant portion of the transcriptome in mammals, including the PAR bZIP transcription factors DBP, HLF, and TEF, is under circadian clock control. In this issue of Cell Metabolism, Gachon and colleagues (Gachon et al., 2006) show that disruption of these three genes in mice alters gene expression patterns of many proteins involved in drug metabolism and in liver and kidney responses to xenobiotic agents. Triple mutant mice have severe physiological deficits, including increased hypersensitivity to xenobiotic agents and premature aging, highlighting the profound effect the circadian clock has on this important response system.

Gene-expression profiling using suppression-subtractive hybridization and cDNA microarray in rat mononuclear cells in response to welding-fume exposure.

PubMed

Rim, Kyung Taek; Park, Kun Koo; Sung, Jae Hyuck; Chung, Yong Hyun; Han, Jeong Hee; Cho, Key Seung; Kim, Kwang Jong; Yu, Il Je

2004-06-01

Welders with radiographic pneumoconiosis abnormalities have shown a gradual clearing of the X-ray identified effects following removal from exposure. In some cases, the pulmonary fibrosis associated with welding fumes appears in a more severe form in welders. Accordingly, for the early detection of welding-fume-exposure-induced pulmonary fibrosis, the gene expression profiles of peripheral mononuclear cells from rats exposed to welding fumes were studied using suppression-subtractive hybridization (SSH) and a cDNA microarray. As such, Sprague-Dawley rats were exposed to a stainless steel arc welding fume for 2 h/day in an inhalation chamber with a 1107.5 +/- 2.6 mg/m3 concentration of total suspended particulate (TSP) for 30 days. Thereafter, the total RNA was extracted from the peripheral blood mononuclear cells, the cDNA synthesized from the total RNA using the SMART PCR cDNA method, and SSH performed to select the welding-fume-exposure-regulated genes. The cDNAs identified by the SSH were then cloned into a plasmid miniprep, sequenced and the sequences analysed using the NCBI BLAST programme. In the SSH cloned cDNA microarray analysis, five genes were found to increase their expression by 1.9-fold or more, including Rgs 14, which plays an important function in cellular signal transduction pathways; meanwhile 36 genes remained the same and 30 genes decreased their expression by more than 59%, including genes associated with the immune response, transcription factors and tyrosine kinases. Among the 5200 genes analysed, 256 genes (5.1%) were found to increase their gene expression, while 742 genes (15%) decreased their gene expression in response to the welding-fume exposure when tested using a commercial 5.0k DNA microarray. Therefore, unlike exposure to other toxic substances, prolonged welding-fume exposure was found to substantially downregulate many genes.

Response of the goat mammary gland to infection with Staphylococcus aureus revealed by gene expression profiling in milk somatic and white blood cells

PubMed Central

2012-01-01

Background S. aureus is one of the main pathogens responsible for the intra-mammary infection in dairy ruminants. Although much work has been carried out to understand the complex physiological and cellular events that occur in the mammary gland in response to S. aureus, the protective mechanisms are still poorly understood. The objectives of the present study were to investigate gene expression during the early response of the goat mammary gland to an experimental challenge with S. aureus, in order to better understand the local and systemic response and to compare them in two divergent lines of goat selected for high and low milk somatic cell scores. Results No differences in gene expression were found between high and low SCS (Somatic Cells Score) selection lines. Analysing the two groups together, an expression of 300 genes were found to change from T0 before infection, and T4 at 24 hours and T5 at 30 hours following challenge. In blood derived white blood cells 8 genes showed increased expression between T0 and T5 and 1 gene has reduced expression. The genes showing the greatest increase in expression following challenge (5.65 to 3.16 fold change) play an important role in (i) immune and inflammatory response (NFKB1, TNFAIP6, BASP1, IRF1, PLEK, BATF3); (ii) the regulation of innate resistance to pathogens (PTX3); and (iii) the regulation of cell metabolism (CYTH4, SLC2A6, ARG2). The genes with reduced expression (−1.5 to −2.5 fold) included genes involved in (i) lipid metabolism (ABCG2, FASN), (ii) chemokine, cytokine and intracellular signalling (SPPI), and (iii) cell cytoskeleton and extracellular matrix (KRT19). Conclusions Analysis of genes with differential expression following infection showed an inverse relationship between immune response and lipid metabolism in the early response of the mammary gland to the S. aureus challenge. PTX3 showed a large change in expression in both milk and blood, and is therefore a candidate for further studies on immune response associated with mastitis. PMID:23046560

Phenotype discovery by gene expression profiling: mapping of biological processes linked to BMP-2-mediated osteoblast differentiation.

PubMed

Balint, Eva; Lapointe, David; Drissi, Hicham; van der Meijden, Caroline; Young, Daniel W; van Wijnen, Andre J; Stein, Janet L; Stein, Gary S; Lian, Jane B

2003-05-15

Understanding physiological control of osteoblast differentiation necessitates characterization of the regulatory signals that initiate the events directing a cell to lineage commitment and establishing competency for bone formation. The bone morphogenetic protein, BMP-2, a member of the TGFbeta superfamily, induces osteoblast differentiation and functions through the Smad signal transduction pathway during in vivo bone formation. However, the molecular targets of BMP-mediated gene transcription during the process of osteoblast differentiation have not been comprehensively identified. In the present study, BMP-2 responsive factors involved in the early stages of commitment and differentiation to the osteoblast phenotype were analyzed by microarray gene expression profiling in samples ranging from 1 to 24 h following BMP-2 dependent differentiation of C2C12 premyoblasts into the osteogenic lineage. A total of 1,800 genes were responsive to BMP-2 and expression was modulated from 3- to 14-fold for less than 100 genes during the time course. Approximately 50% of these 100 genes are either up- or downregulated. Major events associated with phenotypic changes towards the osteogenic lineage were identified from hierarchical and functional clustering analyses. BMP-2 immediately responsive genes (1-4 h), which exhibited either transient or sustained expression, reflect activation and repression of non-osseous BMP-2 developmental systems. This initial response was followed by waves of expression of nuclear proteins and developmental regulatory factors including inhibitors of DNA binding, Runx2, C/EBP, Zn finger binding proteins, forkhead, and numerous homeobox proteins (e.g., CDP/cut, paired, distaless, Hox) which are expressed at characterized stages during osteoblast differentiation. A sequential profile of genes mediating changes in cell morphology, cell growth, and basement membrane formation is observed as a secondary transient early response (2-8 h). Commitment to the osteogenic phenotype is recognized by 8 h, reflected by downregulation of most myogenic-related genes and induction of a spectrum of signaling proteins and enzymes facilitating synthesis and assembly of an extracellular skeletal environment. These genes included collagens Type I and VI and the small leucine rich repeat family of proteoglycans (e.g., decorin, biglycan, osteomodulin, fibromodulin, and osteoadherin/osteoglycin) that reached peak expression at 24 h. With extracellular matrix development, the bone phenotype was further established from 16 to 24 h by induction of genes for cell adhesion and communication and enzymes that organize the bone ECM. Our microarray analysis resulted in the discovery of a class of genes, initially described in relation to differentiation of astrocytes and oligodendrocytes that are functionally coupled to signals for cellular extensions. They include nexin, neuropilin, latexin, neuroglian, neuron specific gene 1, and Ulip; suggesting novel roles for these genes in the bone microenvironment. This global analysis identified a multistage molecular and cellular cascade that supports BMP-2-mediated osteoblast differentiation. Copyright 2003 Wiley-Liss, Inc.

Transcriptional responses in thyroid tissues from rats treated with a tumorigenic and a non-tumorigenic triazole conazole fungicide.

PubMed

Hester, Susan D; Nesnow, Stephen

2008-03-15

Conazoles are azole-containing fungicides that are used in agriculture and medicine. Conazoles can induce follicular cell adenomas of the thyroid in rats after chronic bioassay. The goal of this study was to identify pathways and networks of genes that were associated with thyroid tumorigenesis through transcriptional analyses. To this end, we compared transcriptional profiles from tissues of rats treated with a tumorigenic and a non-tumorigenic conazole. Triadimefon, a rat thyroid tumorigen, and myclobutanil, which was not tumorigenic in rats after a 2-year bioassay, were administered in the feed to male Wistar/Han rats for 30 or 90 days similar to the treatment conditions previously used in their chronic bioassays. Thyroid gene expression was determined using high density Affymetrix GeneChips (Rat 230_2). Gene expression was analyzed by the Gene Set Expression Analyses method which clearly separated the tumorigenic treatments (tumorigenic response group (TRG)) from the non-tumorigenic treatments (non-tumorigenic response group (NRG)). Core genes from these gene sets were mapped to canonical, metabolic, and GeneGo processes and these processes compared across group and treatment time. Extensive analyses were performed on the 30-day gene sets as they represented the major perturbations. Gene sets in the 30-day TRG group had over representation of fatty acid metabolism, oxidation, and degradation processes (including PPARgamma and CYP involvement), and of cell proliferation responses. Core genes from these gene sets were combined into networks and found to possess signaling interactions. In addition, the core genes in each gene set were compared with genes known to be associated with human thyroid cancer. Among the genes that appeared in both rat and human data sets were: Acaca, Asns, Cebpg, Crem, Ddit3, Gja1, Grn, Jun, Junb, and Vegf. These genes were major contributors in the previously developed network from triadimefon-treated rat thyroids. It is postulated that triadimefon induces oxidative response genes and activates the nuclear receptor, Ppargamma, initiating transcription of gene products and signaling to a series of genes involved in cell proliferation.

A transcriptomic study reveals differentially expressed genes and pathways respond to simulated acid rain in Arabidopsis thaliana.

PubMed

Liu, Ting-Wu; Niu, Li; Fu, Bin; Chen, Juan; Wu, Fei-Hua; Chen, Juan; Wang, Wen-Hua; Hu, Wen-Jun; He, Jun-Xian; Zheng, Hai-Lei

2013-01-01

Acid rain, as a worldwide environmental issue, can cause serious damage to plants. In this study, we provided the first case study on the systematic responses of arabidopsis (Arabidopsis thaliana (L.) Heynh.) to simulated acid rain (SiAR) by transcriptome approach. Transcriptomic analysis revealed that the expression of a set of genes related to primary metabolisms, including nitrogen, sulfur, amino acid, photosynthesis, and reactive oxygen species metabolism, were altered under SiAR. In addition, transport and signal transduction related pathways, especially calcium-related signaling pathways, were found to play important roles in the response of arabidopsis to SiAR stress. Further, we compared our data set with previously published data sets on arabidopsis transcriptome subjected to various stresses, including wound, salt, light, heavy metal, karrikin, temperature, osmosis, etc. The results showed that many genes were overlapped in several stresses, suggesting that plant response to SiAR is a complex process, which may require the participation of multiple defense-signaling pathways. The results of this study will help us gain further insights into the response mechanisms of plants to acid rain stress.

Varroa destructor induces changes in the expression of immunity-related genes during the development of Apis mellifera worker and drone broods.

PubMed

Zaobidna, Ewa A; Żółtowska, Krystyna; Łopieńska-Biernat, Elżbieta

2017-12-20

The ectoparasitic mite Varroa destructor has emerged as the major pest of honeybees. Despite extensive research efforts, the pathogenesis of varroosis has not been fully explained. Earlier studies suggested that V. destructor infestation leads to the suppression of the host's immune system. The aim of this study was to analyze the immune responses of 14 genes in the Toll signal transduction pathways, including effector genes of antimicrobial peptides (AMPs), in developing Apis mellifera workers and drones infested with V. destructor. Four developmental stages (L5 larvae, prepupae, and 2 pupal stages) and newly emerged imagines were analyzed. In workers, the most significant changes were observed in L5 larvae in the initial stages of infestation. A significant increase in the relative expression of 10 of the 14 analyzed genes, including defensin-1 and defensin-2, was observed in infested bees relative to non-infested individuals. The immune response in drones developed at a slower rate. The expression of genes regulating cytoplasmic signal transduction increased in prepupae, whereas the expression of defensin-1 and defensin-2 effector genes increased in P3 pupae with red eyes. The expression of many immunity-related genes was silenced in successive life stages and in imagines, and it was more profound in workers than in drones. The results indicate that V. destructor significantly influences immune responses regulated by the Toll signal transduction pathway in bees. In infested bees, the observed changes in Toll pathway genes varied between life stages and the sexes.

The Soybean Rhg1 Locus for Resistance to the Soybean Cyst Nematode Heterodera glycines Regulates the Expression of a Large Number of Stress- and Defense-Related Genes in Degenerating Feeding Cells1[C][W][OA

PubMed Central

Kandoth, Pramod Kaitheri; Ithal, Nagabhushana; Recknor, Justin; Maier, Tom; Nettleton, Dan; Baum, Thomas J.; Mitchum, Melissa G.

2011-01-01

To gain new insights into the mechanism of soybean (Glycine max) resistance to the soybean cyst nematode (Heterodera glycines), we compared gene expression profiles of developing syncytia in soybean near-isogenic lines differing at Rhg1 (for resistance to Heterodera glycines), a major quantitative trait locus for resistance, by coupling laser capture microdissection with microarray analysis. Gene expression profiling revealed that 1,447 genes were differentially expressed between the two lines. Of these, 241 (16.8%) were stress- and defense-related genes. Several stress-related genes were up-regulated in the resistant line, including those encoding homologs of enzymes that lead to increased levels of reactive oxygen species and proteins associated with the unfolded protein response. These results indicate that syncytia induced in the resistant line are undergoing severe oxidative stress and imbalanced endoplasmic reticulum homeostasis, both of which likely contribute to the resistance reaction. Defense-related genes up-regulated within syncytia of the resistant line included those predominantly involved in apoptotic cell death, the plant hypersensitive response, and salicylic acid-mediated defense signaling; many of these genes were either partially suppressed or not induced to the same level by a virulent soybean cyst nematode population for successful nematode reproduction and development on the resistant line. Our study demonstrates that a network of molecular events take place during Rhg1-mediated resistance, leading to a highly complex defense response against a root pathogen. PMID:21335526

Interactome analysis of longitudinal pharyngeal infection of cynomolgus macaques by group A Streptococcus.

PubMed

Shea, Patrick R; Virtaneva, Kimmo; Kupko, John J; Porcella, Stephen F; Barry, William T; Wright, Fred A; Kobayashi, Scott D; Carmody, Aaron; Ireland, Robin M; Sturdevant, Daniel E; Ricklefs, Stacy M; Babar, Imran; Johnson, Claire A; Graham, Morag R; Gardner, Donald J; Bailey, John R; Parnell, Michael J; Deleo, Frank R; Musser, James M

2010-03-09

Relatively little is understood about the dynamics of global host-pathogen transcriptome changes that occur during bacterial infection of mucosal surfaces. To test the hypothesis that group A Streptococcus (GAS) infection of the oropharynx provokes a distinct host transcriptome response, we performed genome-wide transcriptome analysis using a nonhuman primate model of experimental pharyngitis. We also identified host and pathogen biological processes and individual host and pathogen gene pairs with correlated patterns of expression, suggesting interaction. For this study, 509 host genes and seven biological pathways were differentially expressed throughout the entire 32-day infection cycle. GAS infection produced an initial widespread significant decrease in expression of many host genes, including those involved in cytokine production, vesicle formation, metabolism, and signal transduction. This repression lasted until day 4, at which time a large increase in expression of host genes was observed, including those involved in protein translation, antigen presentation, and GTP-mediated signaling. The interactome analysis identified 73 host and pathogen gene pairs with correlated expression levels. We discovered significant correlations between transcripts of GAS genes involved in hyaluronic capsule production and host endocytic vesicle formation, GAS GTPases and host fibrinolytic genes, and GAS response to interaction with neutrophils. We also identified a strong signal, suggesting interaction between host gammadelta T cells and genes in the GAS mevalonic acid synthesis pathway responsible for production of isopentenyl-pyrophosphate, a short-chain phospholipid that stimulates these T cells. Taken together, our results are unique in providing a comprehensive understanding of the host-pathogen interactome during mucosal infection by a bacterial pathogen.

Elucidating a molecular mechanism that the deterioration of porcine meat quality responds to increased cortisol based on transcriptome sequencing.

PubMed

Wan, Xuebin; Wang, Dan; Xiong, Qi; Xiang, Hong; Li, Huanan; Wang, Hongshuai; Liu, Zezhang; Niu, Hongdan; Peng, Jian; Jiang, Siwen; Chai, Jin

2016-11-11

Stress response is tightly linked to meat quality. The current understanding of the intrinsic mechanism of meat deterioration under stress is limited. Here, male piglets were randomly assigned to cortisol and control groups. Our results showed that when serum cortisol level was significantly increased, the meat color at 1 h postmortem, muscle bundle ratio, apoptosis rate, and gene expression levels of calcium channel and cell apoptosis including SERCA1, IP3R1, BAX, Bcl-2, and Caspase-3, were notably increased. However, the value of drip loss at 24 h postmortem and serum CK were significantly decreased. Additionally, a large number of differentially expressed genes (DEGs) in GC regulation mechanism were screened out using transcriptome sequencing technology. A total of 223 DEGs were found, including 80 up-regulated genes and 143 down-regulated genes. A total of 204 genes were enriched in GO terms, and 140 genes annotated into in KEGG database. Numerous genes were primarily involved in defense, inflammatory and wound responses. This study not only identifies important genes and signalling pathways that may affect the meat quality but also offers a reference for breeding and feeding management to provide consumers with better quality pork products.

Acclimatization to long-term hypoxia: gene expression in ovine carotid arteries

PubMed Central

Goyal, Ravi

2014-01-01

Exposure to acute high-altitude hypoxia is associated with an increase in cerebral blood flow (CBF) as a consequence of low arterial O2 tension. However, in response to high altitude acclimatization, CBF returns to levels similar to those at sea level, and tissue blood flow is maintained by an increase in angiogenesis. Of consequence, dysregulation of the acclimatization responses and CBF can result in acute mountain sickness, acute cerebral and/or pulmonary edema. To elucidate the signal transduction pathways involved in successful acclimatization to high altitude, in ovine carotid arteries, we tested the hypothesis that high altitude-associated long-term hypoxia results in changes in gene expression of critical signaling pathways. We acclimatized nonpregnant adult sheep to 3,801 m altitude for ∼110 days and conducted oligonucleotide microarray experiments on carotid arteries. Of a total of 116 regulated genes, 58 genes were significantly upregulated and 58 genes were significantly downregulated (each >2-fold, P < 0.05). Major upregulated genes included suprabasin and myelin basic protein, whereas downregulated genes included BAG2. Several of these genes are known to activate the ERK canonical signal transduction pathway and the process of angiogenesis. We conclude that among other changes, the altered signal transduction molecules involved in high-altitude acclimatization are associated ERK activation and angiogenesis. PMID:25052263

Mechanism of the synergistic effect of amiodarone and fluconazole in Candida albicans.

PubMed

Gamarra, Soledad; Rocha, Elousa Maria F; Zhang, Yong-Qiang; Park, Steven; Rao, Rajini; Perlin, David S

2010-05-01

The antiarrhythmic drug amiodarone has been found to have fungicidal activity. In Saccharomyces cerevisiae, its antifungal activity is mediated by calcium overload stress, which leads to a rapid nuclear accumulation of the calcineurin-regulated transcription factor CRZ1. In addition, low doses of amiodarone have been reported to be synergistic with fluconazole in fluconazole-resistant Candida albicans. To establish its mechanism of toxicity in C. albicans, we used expression profiling of key pathway genes to examine cellular responses to amiodarone alone and in combination with fluconazole. Gene expression profiling of 59 genes was done in five C. albicans strains (three fluconazole-susceptible strains and two fluconazole-resistant strains) after amiodarone and/or fluconazole exposure. Of the 59 genes, 27 analyzed showed a significant change (>2-fold) in expression levels after amiodarone exposure. The up- or downregulated genes included genes involved in Ca(2+) homeostasis, cell wall synthesis, vacuolar/lysosomal transport, diverse pathway regulation, stress response, and pseudohyphal morphogenesis. As expected, fluconazole induces an increase in ergosterol pathway genes expression levels. The combination treatment significantly dampened the transcriptional response to either drug, suggesting that synergism was due to an inhibition of compensatory response pathways. This dampening resulted in a decrease in total ergosterol levels and decreased pseudohyphal formation, a finding consistent with decreased virulence in a murine candidiasis model.

Transcriptional profiling of Haemophilus parasuis SH0165 response to tilmicosin.

PubMed

Liu, Yingyu; Chen, Pin; Wang, Yang; Li, Wentao; Cheng, Shuang; Wang, Chunmei; Zhang, Anding; He, Qigai

2012-12-01

The Haemophilus parasuis respiratory tract pathogen poses a severe threat to the swine industry despite available antimicrobial therapies. To gain a more detailed understanding of the molecular mechanisms underlying H. parasuis response to tilmicosin treatment, microarray technology was applied to analyze the variation in gene expression of isolated H. parasuis SH0165 treated in vitro with subinhibitory (0.25 μg/ml) and inhibitory (8 μg/ml) concentrations. Tilmicosin treatment induced differential expression of 405 genes, the encoded products of which are mainly involved in the heat shock response, protein synthesis, and intracellular transportation. The subinhibitory and inhibitory concentrations of tilmicosin induced distinctive gene expression profiles of shared and unique changes, respectively. These changes included 302 genes mainly involved in protein export and the phosphotransferase system to sustain cell growth, and 198 genes mainly related to RNA polymerase, recombination, and repair to inhibit cell growth. In silico analysis of functions related to the differentially expressed genes suggested that adaptation of H. parasuis SH0165 to tilmicosin involves modulation of protein synthesis and membrane transport. Collectively, the genes comprising each transcriptional profile of H. parasuis response to tilmicosin provide novel insights into the physiological functions of this economically significant bacterium and may represent targets of future molecular therapeutic strategies.

Plants, plant pathogens, and microgravity--a deadly trio.

PubMed

Leach, J E; Ryba-White, M; Sun, Q; Wu, C J; Hilaire, E; Gartner, C; Nedukha, O; Kordyum, E; Keck, M; Leung, H; Guikema, J A

2001-06-01

Plants grown in spaceflight conditions are more susceptible to colonization by plant pathogens. The underlying causes for this enhanced susceptibility are not known. Possibly the formation of structural barriers and the activation of plant defense response components are impaired in spaceflight conditions. Either condition would result from altered gene expression of the plant. Because of the tools available, past studies focused on a few physiological responses or biochemical pathways. With recent advances in genomics research, new tools, including microarray technologies, are available to examine the global impact of growth in the spacecraft on the plant's gene expression profile. In ground-based studies, we have developed cDNA subtraction libraries of rice that are enriched for genes induced during pathogen infection and the defense response. Arrays of these genes are being used to dissect plant defense response pathways in a model system involving wild-type rice plants and lesion mimic mutants. The lesion mimic mutants are ideal experimental tools because they erratically develop defense response-like lesions in the absence of pathogens. The gene expression profiles from these ground-based studies will provide the molecular basis for understanding the biochemical and physiological impacts of spaceflight on plant growth, development and disease defense responses. This, in turn, will allow the development of strategies to manage plant disease for life in the space environment.

Plants, plant pathogens, and microgravity--a deadly trio

NASA Technical Reports Server (NTRS)

Leach, J. E.; Ryba-White, M.; Sun, Q.; Wu, C. J.; Hilaire, E.; Gartner, C.; Nedukha, O.; Kordyum, E.; Keck, M.; Leung, H.;

Chromatin Configuration Determines Cell Responses to Hormone Stimuli | Center for Cancer Research

Cancer.gov

Ever since selective gene expression was established as the central driver of cell behavior, researchers have been working to understand the forces that control gene transcription. Aberrant gene expression can cause or promote many diseases, including cancer, and alterations in gene expression are the goal of many therapeutic agents. Recent work has focused on the potential role of chromatin structure as a contributor to gene regulation. Chromatin can exist in a tightly packed/inaccessible or loose/accessible configuration depending on the interactions between DNA and its associated proteins. Patterns of chromatin structure can differ between cell types and can also change within cells in response to certain signals. Cancer researchers are particularly interested in the role of chromatin in gene regulation because many of the genomic regions found to be associated with cancer risk are in open chromatin structures.

Mechanical stretch is a highly selective regulator of gene expression in human bladder smooth muscle cells.

PubMed

Adam, Rosalyn M; Eaton, Samuel H; Estrada, Carlos; Nimgaonkar, Ashish; Shih, Shu-Ching; Smith, Lois E H; Kohane, Isaac S; Bägli, Darius; Freeman, Michael R

2004-12-15

Application of mechanical stimuli has been shown to alter gene expression in bladder smooth muscle cells (SMC). To date, only a limited number of "stretch-responsive" genes in this cell type have been reported. We employed oligonucleotide arrays to identify stretch-sensitive genes in primary culture human bladder SMC subjected to repetitive mechanical stimulation for 4 h. Differential gene expression between stretched and nonstretched cells was assessed using Significance Analysis of Microarrays (SAM). Expression of 20 out of 11,731 expressed genes ( approximately 0.17%) was altered >2-fold following stretch, with 19 genes induced and one gene (FGF-9) repressed. Using real-time RT-PCR, we tested independently the responsiveness of 15 genes to stretch and to platelet-derived growth factor-BB (PDGF-BB), another hypertrophic stimulus for bladder SMC. In response to both stimuli, expression of 13 genes increased, 1 gene (FGF-9) decreased, and 1 gene was unchanged. Six transcripts (HB-EGF, BMP-2, COX-2, LIF, PAR-2, and FGF-9) were evaluated using an ex vivo rat model of bladder distension. HB-EGF, BMP-2, COX-2, LIF, and PAR-2 increased with bladder stretch ex vivo, whereas FGF-9 decreased, consistent with expression changes observed in vitro. In silico analysis of microarray data using the FIRED algorithm identified c-jun, AP-1, ATF-2, and neurofibromin-1 (NF-1) as potential transcriptional mediators of stretch signals. Furthermore, the promoters of 9 of 13 stretch-responsive genes contained AP-1 binding sites. These observations identify stretch as a highly selective regulator of gene expression in bladder SMC. Moreover, they suggest that mechanical and growth factor signals converge on common transcriptional regulators that include members of the AP-1 family.

Global gene expression and systems biology analysis of bovine monocyte-derived macrophages in response to in vitro challenge with Mycobacterium bovis.

PubMed

Magee, David A; Taraktsoglou, Maria; Killick, Kate E; Nalpas, Nicolas C; Browne, John A; Park, Stephen D E; Conlon, Kevin M; Lynn, David J; Hokamp, Karsten; Gordon, Stephen V; Gormley, Eamonn; MacHugh, David E

2012-01-01

Mycobacterium bovis, the causative agent of bovine tuberculosis, is a major cause of mortality in global cattle populations. Macrophages are among the first cell types to encounter M. bovis following exposure and the response elicited by these cells is pivotal in determining the outcome of infection. Here, a functional genomics approach was undertaken to investigate global gene expression profiles in bovine monocyte-derived macrophages (MDM) purified from seven age-matched non-related females, in response to in vitro challenge with M. bovis (multiplicity of infection 2:1). Total cellular RNA was extracted from non-challenged control and M. bovis-challenged MDM for all animals at intervals of 2 hours, 6 hours and 24 hours post-challenge and prepared for global gene expression analysis using the Affymetrix® GeneChip® Bovine Genome Array. Comparison of M. bovis-challenged MDM gene expression profiles with those from the non-challenged MDM controls at each time point identified 3,064 differentially expressed genes 2 hours post-challenge, with 4,451 and 5,267 differentially expressed genes detected at the 6 hour and 24 hour time points, respectively (adjusted P-value threshold ≤ 0.05). Notably, the number of downregulated genes exceeded the number of upregulated genes in the M. bovis-challenged MDM across all time points; however, the fold-change in expression for the upregulated genes was markedly higher than that for the downregulated genes. Systems analysis revealed enrichment for genes involved in: (1) the inflammatory response; (2) cell signalling pathways, including Toll-like receptors and intracellular pathogen recognition receptors; and (3) apoptosis. The increased number of downregulated genes is consistent with previous studies showing that M. bovis infection is associated with the repression of host gene expression. The results also support roles for MyD88-independent signalling and intracellular PRRs in mediating the host response to M. bovis.

Serum Response Factor (SRF) Ablation Interferes with Acute Stress-Associated Immediate and Long-Term Coping Mechanisms.

PubMed

Zimprich, Annemarie; Mroz, Gabi; Meyer Zu Reckendorf, Christopher; Anastasiadou, Sofia; Förstner, Philip; Garrett, Lillian; Hölter, Sabine M; Becker, Lore; Rozman, Jan; Prehn, Cornelia; Rathkolb, Birgit; Moreth, Kristin; Wurst, Wolfgang; Klopstock, Thomas; Klingenspor, Martin; Adamski, Jerzy; Wolf, Eckhard; Bekeredjian, Raffi; Fuchs, Helmut; Gailus-Durner, Valerie; de Angelis, Martin Hrabe; Knöll, Bernd

2017-12-01

Stress experience modulates behavior, metabolism, and energy expenditure of organisms. One molecular hallmark of an acute stress response is a rapid induction of immediate early genes (IEGs) such as c-Fos and Egr family members. IEG transcription in neurons is mediated by the neuronal activity-driven gene regulator serum response factor (SRF). We show a first role of SRF in immediate and long-lasting acute restraint stress (AS) responses. For this, we employed a standardized mouse phenotyping protocol at the German Mouse Clinic (GMC) including behavioral, metabolic, and cardiologic tests as well as gene expression profiling to analyze the consequences of forebrain-specific SRF deletion in mice exposed to AS. Adult mice with an SRF deletion in glutamatergic neurons (Srf; CaMKIIa-CreERT2 ) showed hyperactivity, decreased anxiety, and impaired working memory. In response to restraint AS, instant stress reactivity including locomotor behavior and corticosterone induction was impaired in Srf mutant mice. Interestingly, even several weeks after previous AS exposure, SRF-deficient mice showed long-lasting AS-associated changes including altered locomotion, metabolism, energy expenditure, and cardiovascular changes. This suggests a requirement of SRF for mediating long-term stress coping mechanisms in wild-type mice. SRF ablation decreased AS-mediated IEG induction and activity of the actin severing protein cofilin. In summary, our data suggest an SRF function in immediate AS reactions and long-term post-stress-associated coping mechanisms.

Highly polygenic architecture of antidepressant treatment response: Comparative analysis of SSRI and NRI treatment in an animal model of depression.

PubMed

Malki, Karim; Tosto, Maria Grazia; Mouriño-Talín, Héctor; Rodríguez-Lorenzo, Sabela; Pain, Oliver; Jumhaboy, Irfan; Liu, Tina; Parpas, Panos; Newman, Stuart; Malykh, Artem; Carboni, Lucia; Uher, Rudolf; McGuffin, Peter; Schalkwyk, Leonard C; Bryson, Kevin; Herbster, Mark

2017-04-01

Response to antidepressant (AD) treatment may be a more polygenic trait than previously hypothesized, with many genetic variants interacting in yet unclear ways. In this study we used methods that can automatically learn to detect patterns of statistical regularity from a sparsely distributed signal across hippocampal transcriptome measurements in a large-scale animal pharmacogenomic study to uncover genomic variations associated with AD. The study used four inbred mouse strains of both sexes, two drug treatments, and a control group (escitalopram, nortriptyline, and saline). Multi-class and binary classification using Machine Learning (ML) and regularization algorithms using iterative and univariate feature selection methods, including InfoGain, mRMR, ANOVA, and Chi Square, were used to uncover genomic markers associated with AD response. Relevant genes were selected based on Jaccard distance and carried forward for gene-network analysis. Linear association methods uncovered only one gene associated with drug treatment response. The implementation of ML algorithms, together with feature reduction methods, revealed a set of 204 genes associated with SSRI and 241 genes associated with NRI response. Although only 10% of genes overlapped across the two drugs, network analysis shows that both drugs modulated the CREB pathway, through different molecular mechanisms. Through careful implementation and optimisations, the algorithms detected a weak signal used to predict whether an animal was treated with nortriptyline (77%) or escitalopram (67%) on an independent testing set. The results from this study indicate that the molecular signature of AD treatment may include a much broader range of genomic markers than previously hypothesized, suggesting that response to medication may be as complex as the pathology. The search for biomarkers of antidepressant treatment response could therefore consider a higher number of genetic markers and their interactions. Through predominately different molecular targets and mechanisms of action, the two drugs modulate the same Creb1 pathway which plays a key role in neurotrophic responses and in inflammatory processes. © 2016 The Authors. American Journal of Medical Genetics Part B: Neuropsychiatric Genetics Published by Wiley Periodicals, Inc. © 2016 The Authors. American Journal of Medical Genetics Part B: Neuropsychiatric Genetics Published by Wiley Periodicals, Inc.

Genomic responses in rat cerebral cortex after traumatic brain injury

PubMed Central

von Gertten, Christina; Morales, Amilcar Flores; Holmin, Staffan; Mathiesen, Tiit; Nordqvist, Ann-Christin Sandberg

2005-01-01

Background Traumatic brain injury (TBI) initiates a complex sequence of destructive and neuroprotective cellular responses. The initial mechanical injury is followed by an extended time period of secondary brain damage. Due to the complicated pathological picture a better understanding of the molecular events occurring during this secondary phase of injury is needed. This study was aimed at analysing gene expression patterns following cerebral cortical contusion in rat using high throughput microarray technology with the goal of identifying genes involved in an early and in a more delayed phase of trauma, as genomic responses behind secondary mechanisms likely are time-dependent. Results Among the upregulated genes 1 day post injury, were transcription factors and genes involved in metabolism, e.g. STAT-3, C/EBP-δ and cytochrome p450. At 4 days post injury we observed increased gene expression of inflammatory factors, proteases and their inhibitors, like cathepsins, α-2-macroglobulin and C1q. Notably, genes with biological function clustered to immune response were significantly upregulated 4 days after injury, which was not found following 1 day. Osteopontin and one of its receptors, CD-44, were both upregulated showing a local mRNA- and immunoreactivity pattern in and around the injury site. Fewer genes had decreased expression both 1 and 4 days post injury and included genes implicated in transport, metabolism, signalling, and extra cellular matrix formation, e.g. vitronectin, neuroserpin and angiotensinogen. Conclusion The different patterns of gene expression, with little overlap in genes, 1 and 4 days post injury showed time dependence in genomic responses to trauma. An early induction of factors involved in transcription could lead to the later inflammatory response with strongly upregulated CD-44 and osteopontin expression. An increased knowledge of genes regulating the pathological mechanisms in trauma will help to find future treatment targets. Since trauma is a risk factor for development of neurodegenerative disease, this knowledge may also reduce late negative effects. PMID:16318630

The allostatic impact of chronic ethanol on gene expression: A genetic analysis of chronic intermittent ethanol treatment in the BXD cohort

PubMed Central

van der Vaart, Andrew D.; Wolstenholme, Jennifer T.; Smith, Maren L.; Harris, Guy M.; Lopez, Marcelo F.; Wolen, Aaron R.; Becker, Howard C.; Williams, Robert W.; Miles, Michael F.

2016-01-01

The transition from acute to chronic ethanol exposure leads to lasting behavioral and physiological changes such as increased consumption, dependence, and withdrawal. Changes in brain gene expression are hypothesized to underlie these adaptive responses to ethanol. Previous studies on acute ethanol identified genetic variation in brain gene expression networks and behavioral responses to ethanol across the BXD panel of recombinant inbred mice. In this work, we have performed the first joint genetic and genomic analysis of transcriptome shifts in response to chronic intermittent ethanol (CIE) by vapor chamber exposure in a BXD cohort. CIE treatment is known to produce significant and sustained changes in ethanol consumption with repeated cycles of ethanol vapor. Using Affymetrix microarray analysis of prefrontal cortex (PFC) and nucleus accumbens (NAC) RNA, we compared CIE expression responses to those seen following acute ethanol treatment, and to voluntary ethanol consumption. Gene expression changes in PFC and NAC after CIE overlapped significantly across brain regions and with previously published expression following acute ethanol. Genes highly modulated by CIE were enriched for specific biological processes including synaptic transmission, neuron ensheathment, intracellular signaling, and neuronal projection development. Expression quantitative trait locus (eQTL) analyses identified genomic loci associated with ethanol-induced transcriptional changes with largely distinct loci identified between brain regions. Correlating CIE-regulated genes to ethanol consumption data identified specific genes highly associated with variation in the increase in drinking seen with repeated cycles of CIE. In particular, multiple myelin-related genes were identified. Furthermore, genetic variance in or near dynamin3 (Dnm3) on Chr1 at ~164 Mb may have a major regulatory role in CIE-responsive gene expression. Dnm3 expression correlates significantly with ethanol consumption, is contained in a highly ranked functional group of CIE-regulated genes in the NAC, and has a cis-eQTL within a genomic region linked with multiple CIE-responsive genes. PMID:27838001

Microarray Meta-Analysis Focused on the Response of Genes Involved in Redox Homeostasis to Diverse Abiotic Stresses in Rice

PubMed Central

de Abreu Neto, Joao B.; Frei, Michael

2016-01-01

Plants are exposed to a wide range of abiotic stresses (AS), which often occur in combination. Because physiological investigations typically focus on one stress, our understanding of unspecific stress responses remains limited. The plant redox homeostasis, i.e., the production and removal of reactive oxygen species (ROS), may be involved in many environmental stress conditions. Therefore, this study intended to identify genes, which are activated in diverse AS, focusing on ROS-related pathways. We conducted a meta-analysis (MA) of microarray experiments, focusing on rice. Transcriptome data were mined from public databases and fellow researchers, which represented 36 different experiments and investigated diverse AS, including ozone stress, drought, heat, cold, salinity, and mineral deficiencies/toxicities. To overcome the inherent artifacts of different MA methods, data were processed using Fisher, rOP, REM, and product of rank (GeneSelector), and genes identified by most approaches were considered as shared differentially expressed genes (DEGs). Two MA strategies were adopted: first, datasets were separated into shoot, root, and seedling experiments, and these tissues were analyzed separately to identify shared DEGs. Second, shoot and seedling experiments were classed into oxidative stress (OS), i.e., ozone and hydrogen peroxide treatments directly producing ROS in plant tissue, and other AS, in which ROS production is indirect. In all tissues and stress conditions, genes a priori considered as ROS-related were overrepresented among the DEGs, as they represented 4% of all expressed genes but 7–10% of the DEGs. The combined MA approach was substantially more conservative than individual MA methods and identified 1001 shared DEGs in shoots, 837 shared DEGs in root, and 1172 shared DEGs in seedlings. Within the OS and AS groups, 990 and 1727 shared DEGs were identified, respectively. In total, 311 genes were shared between OS and AS, including many regulatory genes. Combined co-expression analysis identified among those a cluster of 42 genes, many involved in the photosynthetic apparatus and responsive to drought, iron deficiency, arsenic toxicity, and ozone. Our data demonstrate the importance of redox homeostasis in plant stress responses and the power of MA to identify candidate genes underlying unspecific signaling pathways. PMID:26793229

[Regulation of heat shock gene expression in response to stress].

PubMed

Garbuz, D G

2017-01-01

Heat shock (HS) genes, or stress genes, code for a number of proteins that collectively form the most ancient and universal stress defense system. The system determines the cell capability of adaptation to various adverse factors and performs a variety of auxiliary functions in normal physiological conditions. Common stress factors, such as higher temperatures, hypoxia, heavy metals, and others, suppress transcription and translation for the majority of genes, while HS genes are upregulated. Transcription of HS genes is controlled by transcription factors of the HS factor (HSF) family. Certain HSFs are activated on exposure to higher temperatures or other adverse factors to ensure stress-induced HS gene expression, while other HSFs are specifically activated at particular developmental stages. The regulation of the main mammalian stress-inducible factor HSF1 and Drosophila melanogaster HSF includes many components, such as a variety of early warning signals indicative of abnormal cell activity (e.g., increases in intracellular ceramide, cytosolic calcium ions, or partly denatured proteins); protein kinases, which phosphorylate HSFs at various Ser residues; acetyltransferases; and regulatory proteins, such as SUMO and HSBP1. Transcription factors other than HSFs are also involved in activating HS gene transcription; the set includes D. melanogaster GAF, mammalian Sp1 and NF-Y, and other factors. Transcription of several stress genes coding for molecular chaperones of the glucose-regulated protein (GRP) family is predominantly regulated by another stress-detecting system, which is known as the unfolded protein response (UPR) system and is activated in response to massive protein misfolding in the endoplasmic reticulum and mitochondrial matrix. A translational fine tuning of HS protein expression occurs via changing the phosphorylation status of several proteins involved in translation initiation. In addition, specific signal sequences in the 5'-UTRs of some HS protein mRNAs ensure their preferential translation in stress.

RNA-Seq analysis of salinity stress-responsive transcriptome in the liver of spotted sea bass (Lateolabrax maculatus).

PubMed

Zhang, Xiaoyan; Wen, Haishen; Wang, Hailiang; Ren, Yuanyuan; Zhao, Ji; Li, Yun

2017-01-01

Salinity is one of the most prominent abiotic factors, which greatly influence reproduction, development, growth, physiological and metabolic activities of fishes. Spotted sea bass (Lateolabrax maculatus), as a euryhaline marine teleost, has extraordinary ability to deal with a wide range of salinity changes. However, this species is devoid of genomic resources, and no study has been conducted at the transcriptomic level to determine genes responsible for salinity regulation, which impedes the understanding of the fundamental mechanism conferring tolerance to salinity fluctuations. Liver, as the major metabolic organ, is the key source supplying energy for iono- and osmoregulation in fish, however, little attention has been paid to its salinity-related functions but which should not be ignored. In this study, we perform RNA-Seq analysis to identify genes involved in salinity adaptation and osmoregulation in liver of spotted sea bass, generating from the fishes exposed to low and high salinity water (5 vs 30ppt). After de novo assembly, annotation and differential gene expression analysis, a total of 455 genes were differentially expressed, including 184 up-regulated and 271 down-regulated transcripts in low salinity-acclimated fish group compared with that in high salinity-acclimated group. A number of genes with a potential role in salinity adaptation for spotted sea bass were classified into five functional categories based on the gene ontology (GO) and enrichment analysis, which include genes involved in metabolites and ion transporters, energy metabolism, signal transduction, immune response and structure reorganization. The candidate genes identified in L. maculates liver provide valuable information to explore new pathways related to fish salinity and osmotic regulation. Besides, the transcriptomic sequencing data supplies significant resources for identification of novel genes and further studying biological questions in spotted sea bass.

RNA-Seq analysis of salinity stress–responsive transcriptome in the liver of spotted sea bass (Lateolabrax maculatus)

PubMed Central

Zhang, Xiaoyan; Wen, Haishen; Wang, Hailiang; Ren, Yuanyuan; Zhao, Ji; Li, Yun

2017-01-01

Salinity is one of the most prominent abiotic factors, which greatly influence reproduction, development, growth, physiological and metabolic activities of fishes. Spotted sea bass (Lateolabrax maculatus), as a euryhaline marine teleost, has extraordinary ability to deal with a wide range of salinity changes. However, this species is devoid of genomic resources, and no study has been conducted at the transcriptomic level to determine genes responsible for salinity regulation, which impedes the understanding of the fundamental mechanism conferring tolerance to salinity fluctuations. Liver, as the major metabolic organ, is the key source supplying energy for iono- and osmoregulation in fish, however, little attention has been paid to its salinity-related functions but which should not be ignored. In this study, we perform RNA-Seq analysis to identify genes involved in salinity adaptation and osmoregulation in liver of spotted sea bass, generating from the fishes exposed to low and high salinity water (5 vs 30ppt). After de novo assembly, annotation and differential gene expression analysis, a total of 455 genes were differentially expressed, including 184 up-regulated and 271 down-regulated transcripts in low salinity-acclimated fish group compared with that in high salinity-acclimated group. A number of genes with a potential role in salinity adaptation for spotted sea bass were classified into five functional categories based on the gene ontology (GO) and enrichment analysis, which include genes involved in metabolites and ion transporters, energy metabolism, signal transduction, immune response and structure reorganization. The candidate genes identified in L. maculates liver provide valuable information to explore new pathways related to fish salinity and osmotic regulation. Besides, the transcriptomic sequencing data supplies significant resources for identification of novel genes and further studying biological questions in spotted sea bass. PMID:28253338

Genome-wide identification and characterization of auxin response factor (ARF) family genes related to flower and fruit development in papaya (Carica papaya L.).

PubMed

Liu, Kaidong; Yuan, Changchun; Li, Haili; Lin, Wanhuang; Yang, Yanjun; Shen, Chenjia; Zheng, Xiaolin

2015-11-05

Auxin and auxin signaling are involved in a series of developmental processes in plants. Auxin Response Factors (ARFs) is reported to modulate the expression of target genes by binding to auxin response elements (AuxREs) and influence the transcriptional activation of down-stream target genes. However, how ARF genes function in flower development and fruit ripening of papaya (Carica papaya L.) is largely unknown. In this study, a comprehensive characterization and expression profiling analysis of 11 C. papaya ARF (CpARF) genes was performed using the newly updated papaya reference genome data. We analyzed CpARF expression patterns at different developmental stages. CpARF1, CpARF2, CpARF4, CpARF5, and CpARF10 showed the highest expression at the initial stage of flower development, but decreased during the following developmental stages. CpARF6 expression increased during the developmental process and reached its peak level at the final stage of flower development. The expression of CpARF1 increased significantly during the fruit ripening stages. Many AuxREs were included in the promoters of two ethylene signaling genes (CpETR1 and CpETR2) and three ethylene-synthesis-related genes (CpACS1, CpACS2, and CpACO1), suggesting that CpARFs might be involved in fruit ripening via the regulation of ethylene signaling. Our study provided comprehensive information on ARF family in papaya, including gene structures, chromosome locations, phylogenetic relationships, and expression patterns. The involvement of CpARF gene expression changes in flower and fruit development allowed us to understand the role of ARF-mediated auxin signaling in the maturation of reproductive organs in papaya.

Differences in innate immune response gene regulation in the middle ear of children who are otitis prone and in those not otitis prone

PubMed Central

Casey, Janet; Pichichero, Michael

2016-01-01

Objective: Acute otitis media (AOM) causes an inflammatory response in the middle ear. We assessed differences in innate immune responses involved in bacterial defense at onset of AOM in children who were stringently defined as otitis prone (sOP) and children not otitis prone (NOP). Study Design: Innate immune genes analysis from middle ear fluid (MEF) samples of children. Methods: Genes of toll-like receptors (TLR), nod-like and retinoic acid-inducible gene-I-like receptors, downstream effectors important for inflammation and apoptosis, including cytokines and chemokines, were studied from MEF samples by using a real-time polymerase chain reaction array. Protein levels of differentially regulated genes were measured by Luminex. Results: Gene expression in MEF among children who were sOP was significantly different in upregulation of interleukin 8, secretory leukocyte peptidase inhibitor, and chemokine (C-C motif) ligand 3, and in downregulation of interferon regulatory factor 7 and its related signaling molecules interferon alpha, Toll-like receptor adaptor molecule 2, chemokine (C-C motif) ligand 5, and mitogen-activated protein kinase 8 compared with children who were NOP. Differences in innate gene regulation were similar when AOM was caused by Streptococcus pneumoniae or nontypeable Haemophilus influenzae. Conclusion: Innate-immune response genes are differentially regulated in children who were sOP compared with children with NOP. PMID:28124644

Identification and expression analysis of WRKY transcription factor genes in canola (Brassica napus L.) in response to fungal pathogens and hormone treatments.

PubMed

Yang, Bo; Jiang, Yuanqing; Rahman, Muhammad H; Deyholos, Michael K; Kav, Nat N V

2009-06-03

Members of plant WRKY transcription factor families are widely implicated in defense responses and various other physiological processes. For canola (Brassica napus L.), no WRKY genes have been described in detail. Because of the economic importance of this crop, and its evolutionary relationship to Arabidopsis thaliana, we sought to characterize a subset of canola WRKY genes in the context of pathogen and hormone responses. In this study, we identified 46 WRKY genes from canola by mining the expressed sequence tag (EST) database and cloned cDNA sequences of 38 BnWRKYs. A phylogenetic tree was constructed using the conserved WRKY domain amino acid sequences, which demonstrated that BnWRKYs can be divided into three major groups. We further compared BnWRKYs to the 72 WRKY genes from Arabidopsis and 91 WRKY from rice, and we identified 46 presumptive orthologs of AtWRKY genes. We examined the subcellular localization of four BnWRKY proteins using green fluorescent protein (GFP) and we observed the fluorescent green signals in the nucleus only.The responses of 16 selected BnWRKY genes to two fungal pathogens, Sclerotinia sclerotiorum and Alternaria brassicae, were analyzed by quantitative real time-PCR (qRT-PCR). Transcript abundance of 13 BnWRKY genes changed significantly following pathogen challenge: transcripts of 10 WRKYs increased in abundance, two WRKY transcripts decreased after infection, and one decreased at 12 h post-infection but increased later on (72 h). We also observed that transcript abundance of 13/16 BnWRKY genes was responsive to one or more hormones, including abscisic acid (ABA), and cytokinin (6-benzylaminopurine, BAP) and the defense signaling molecules jasmonic acid (JA), salicylic acid (SA), and ethylene (ET). We compared these transcript expression patterns to those previously described for presumptive orthologs of these genes in Arabidopsis and rice, and observed both similarities and differences in expression patterns. We identified a set of 13 BnWRKY genes from among 16 BnWRKY genes assayed, that are responsive to both fungal pathogens and hormone treatments, suggesting shared signaling mechanisms for these responses. This study suggests that a large number of BnWRKY proteins are involved in the transcriptional regulation of defense-related genes in response to fungal pathogens and hormone stimuli.

Gene Expression Profiling of Bronchoalveolar Lavage Cells During Aspergillus Colonization of the Lung Allograft.

PubMed

Weigt, S Samuel; Wang, Xiaoyan; Palchevskiy, Vyacheslav; Patel, Naman; Derhovanessian, Ariss; Shino, Michael Y; Sayah, David M; Lynch, Joseph P; Saggar, Rajan; Ross, David J; Kubak, Bernie M; Ardehali, Abbas; Palmer, Scott; Husain, Shahid; Belperio, John A

2018-06-01

Aspergillus colonization after lung transplant is associated with an increased risk of chronic lung allograft dysfunction (CLAD). We hypothesized that gene expression during Aspergillus colonization could provide clues to CLAD pathogenesis. We examined transcriptional profiles in 3- or 6-month surveillance bronchoalveolar lavage fluid cell pellets from recipients with Aspergillus fumigatus colonization (n = 12) and without colonization (n = 10). Among the Aspergillus colonized, we also explored profiles in those who developed CLAD (n = 6) or remained CLAD-free (n = 6). Transcription profiles were assayed with the HG-U133 Plus 2.0 microarray (Affymetrix). Differential gene expression was based on an absolute fold difference of 2.0 or greater and unadjusted P value less than 0.05. We used NIH Database for Annotation, Visualization and Integrated Discovery for functional analyses, with false discovery rates less than 5% considered significant. Aspergillus colonization was associated with differential expression of 489 probe sets, representing 404 unique genes. "Defense response" genes and genes in the "cytokine-cytokine receptor" Kyoto Encyclopedia of Genes and Genomes pathway were notably enriched in this list. Among Aspergillus colonized patients, CLAD development was associated with differential expression of 69 probe sets, representing 64 unique genes. This list was enriched for genes involved in "immune response" and "response to wounding", among others. Notably, both chitinase 3-like-1 and chitotriosidase were associated with progression to CLAD. Aspergillus colonization is associated with gene expression profiles related to defense responses including cytokine signaling. Epithelial wounding, as well as the innate immune response to chitin that is present in the fungal cell wall, may be key in the link between Aspergillus colonization and CLAD.

Coordinate Intracellular Expression of Salmonella Genes Induced during Infection

PubMed Central

Heithoff, Douglas M.; Conner, Christopher P.; Hentschel, Ute; Govantes, Fernando; Hanna, Philip C.; Mahan, Michael J.

1999-01-01

Salmonella typhimurium in vivo-induced (ivi) genes were grouped by their coordinate behavior in response to a wide variety of environmental and genetic signals, including pH, Mg2+, Fe2+, and PhoPQ. All of the seven ivi fusions that are induced by both low pH and low Mg2+ (e.g., iviVI-A) are activated by the PhoPQ regulatory system. Iron-responsive ivi fusions include those induced under iron limitation (e.g., entF) as well as one induced by iron excess but only in the absence of PhoP (pdu). Intracellular expression studies showed that each of the pH- and Mg2+-responsive fusions is induced upon entry into and growth within three distinct mammalian cell lines: RAW 264.7 murine macrophages and two cultured human epithelial cell lines: HEp-2 and Henle-407. Each ivi fusion has a characteristic level of induction consistent within all three cell types, suggesting that this class of coordinately expressed ivi genes responds to general intracellular signals that are present both in initial and in progressive stages of infection and may reflect their responses to similar vacuolar microenvironments in these cell types. Investigation of ivi expression patterns reveals not only the inherent versatility of pathogens to express a given gene(s) at various host sites but also the ability to modify their expression within the context of different animal hosts, tissues, cell types, or subcellular compartments. PMID:9922242

Inheritance of partial resistance against Colletotrichum lindemuthianum in Phaseolus vulgaris and co-localization of quantitative trait loci with genes involved in specific resistance.

PubMed

Geffroy, V; Sévignac, M; De Oliveira, J C; Fouilloux, G; Skroch, P; Thoquet, P; Gepts, P; Langin, T; Dron, M

2000-03-01

Anthracnose, one of the most important diseases of common bean (Phaseolus vulgaris), is caused by the fungus Colletotrichum lindemuthianum. A "candidate gene" approach was used to map anthracnose resistance quantitative trait loci (QTL). Candidate genes included genes for both pathogen recognition (resistance genes and resistance gene analogs [RGAs]) and general plant defense (defense response genes). Two strains of C. lindemuthianum, identified in a world collection of 177 strains, displayed a reproducible and differential aggressiveness toward BAT93 and JaloEEP558, two parental lines of P. vulgaris representing the two major gene pools of this crop. A reliable test was developed to score partial resistance in aerial organs of the plant (stem, leaf, petiole) under controlled growth chamber conditions. BAT93 was more resistant than JaloEEP558 regardless of the organ or strain tested. With a recombinant inbred line (RIL) population derived from a cross between these two parental lines, 10 QTL were located on a genetic map harboring 143 markers, including known defense response genes, anthracnose-specific resistance genes, and RGAs. Eight of the QTL displayed isolate specificity. Two were co-localized with known defense genes (phenylalanine ammonia-lyase and hydroxyproline-rich glycoprotein) and three with anthracnose-specific resistance genes and/or RGAs. Interestingly, two QTL, with different allelic contribution, mapped on linkage group B4 in a 5.0 cM interval containing Andean and Mesoamerican specific resistance genes against C. lindemuthianum and 11 polymorphic fragments revealed with a RGA probe. The possible relationship between genes underlying specific and partial resistance is discussed.

Integrative analysis of DNA methylation and gene expression data identifies EPAS1 as a key regulator of COPD.

PubMed

Yoo, Seungyeul; Takikawa, Sachiko; Geraghty, Patrick; Argmann, Carmen; Campbell, Joshua; Lin, Luan; Huang, Tao; Tu, Zhidong; Foronjy, Robert F; Feronjy, Robert; Spira, Avrum; Schadt, Eric E; Powell, Charles A; Zhu, Jun

2015-01-01

Chronic Obstructive Pulmonary Disease (COPD) is a complex disease. Genetic, epigenetic, and environmental factors are known to contribute to COPD risk and disease progression. Therefore we developed a systematic approach to identify key regulators of COPD that integrates genome-wide DNA methylation, gene expression, and phenotype data in lung tissue from COPD and control samples. Our integrative analysis identified 126 key regulators of COPD. We identified EPAS1 as the only key regulator whose downstream genes significantly overlapped with multiple genes sets associated with COPD disease severity. EPAS1 is distinct in comparison with other key regulators in terms of methylation profile and downstream target genes. Genes predicted to be regulated by EPAS1 were enriched for biological processes including signaling, cell communications, and system development. We confirmed that EPAS1 protein levels are lower in human COPD lung tissue compared to non-disease controls and that Epas1 gene expression is reduced in mice chronically exposed to cigarette smoke. As EPAS1 downstream genes were significantly enriched for hypoxia responsive genes in endothelial cells, we tested EPAS1 function in human endothelial cells. EPAS1 knockdown by siRNA in endothelial cells impacted genes that significantly overlapped with EPAS1 downstream genes in lung tissue including hypoxia responsive genes, and genes associated with emphysema severity. Our first integrative analysis of genome-wide DNA methylation and gene expression profiles illustrates that not only does DNA methylation play a 'causal' role in the molecular pathophysiology of COPD, but it can be leveraged to directly identify novel key mediators of this pathophysiology.

Transcriptome Analysis of the Response to NaCl in Suaeda maritima Provides an Insight into Salt Tolerance Mechanisms in Halophytes

PubMed Central

Tambat, Subodh; Vasudevan, Madavan

2016-01-01

Although salt tolerance is a feature representative of halophytes, most studies on this topic in plants have been conducted on glycophytes. Transcriptome profiles are also available for only a limited number of halophytes. Hence, the present study was conducted to understand the molecular basis of salt tolerance through the transcriptome profiling of the halophyte Suaeda maritima, which is an emerging plant model for research on salt tolerance. Illumina sequencing revealed 72,588 clustered transcripts, including 27,434 that were annotated using BLASTX. Salt application resulted in the 2-fold or greater upregulation of 647 genes and downregulation of 735 genes. Of these, 391 proteins were homologous to proteins in the COGs (cluster of orthologous groups) database, and the majorities were grouped into the poorly characterized category. Approximately 50% of the genes assigned to MapMan pathways showed homology to S. maritima. The majority of such genes represented transcription factors. Several genes also contributed to cell wall and carbohydrate metabolism, ion relation, redox responses and G protein, phosphoinositide and hormone signaling. Real-time PCR was used to validate the results of the deep sequencing for the most of the genes. This study demonstrates the expression of protein kinase C, the target of diacylglycerol in phosphoinositide signaling, for the first time in plants. This study further reveals that the biochemical and molecular responses occurring at several levels are associated with salt tolerance in S. maritima. At the structural level, adaptations to high salinity levels include the remodeling of cell walls and the modification of membrane lipids. At the cellular level, the accumulation of glycinebetaine and the sequestration and exclusion of Na+ appear to be important. Moreover, this study also shows that the processes related to salt tolerance might be highly complex, as reflected by the salt-induced enhancement of transcription factor expression, including hormone-responsive factors, and that this process might be initially triggered by G protein and phosphoinositide signaling. PMID:27682829

Transcriptome Analysis of the Role of GlnD/GlnBK in Nitrogen Stress Adaptation by Sinorhizobium meliloti Rm1021

PubMed Central

Yurgel, Svetlana N.; Rice, Jennifer; Kahn, Michael L.

2013-01-01

Transcriptional changes in the nitrogen stress response (NSR) of wild type S. meliloti Rm1021, and isogenic strains missing both PII proteins, GlnB and GlnK, or carrying a ΔglnD-sm2 mutation were analyzed using whole-genome microarrays. This approach allowed us to identify a number of new genes involved in the NSR and showed that the response of these bacteria to nitrogen stress overlaps with other stress responses, including induction of the fixK2 transcriptional activator and genes that are part of the phosphate stress response. Our data also show that GlnD and GlnBK proteins may regulate many genes that are not part of the NSR. Analysis of transcriptome profiles of the Rm1021 ΔglnD-sm2 strain allowed us to identify several genes that appear to be regulated by GlnD without the participation of the PII proteins. PMID:23516427

Shared and novel molecular responses of mandarin to drought.

PubMed

Gimeno, Jacinta; Gadea, José; Forment, Javier; Pérez-Valle, Jorge; Santiago, Julia; Martínez-Godoy, María A; Yenush, Lynne; Bellés, José M; Brumós, Javier; Colmenero-Flores, José M; Talón, Manuel; Serrano, Ramón

2009-07-01

Drought is the most important stress experienced by citrus crops. A citrus cDNA microarray of about 6.000 genes has been utilized to identify transcriptomic responses of mandarin to water stress. As observed in other plant species challenged with drought stress, key genes for lysine catabolism, proline and raffinose synthesis, hydrogen peroxide reduction, vacuolar malate transport, RCI2 proteolipids and defence proteins such as osmotin, dehydrins and heat-shock proteins are induced in mandarin. Also, some aquaporin genes are repressed. The osmolyte raffinose could be detected in stressed roots while the dehydrin COR15 protein only accumulated in stressed leaves but not in roots. Novel drought responses in mandarin include the induction of genes encoding a new miraculin isoform, chloroplast beta-carotene hydroxylase, oleoyl desaturase, ribosomal protein RPS13A and protein kinase CTR1. These results suggest that drought tolerance in citrus may benefit from inhibition of proteolysis, activation of zeaxanthin and linolenoyl synthesis, reinforcement of ribosomal structure and down-regulation of the ethylene response.

Circadian genes, the stress axis, and alcoholism.

PubMed

Sarkar, Dipak K

2012-01-01

The body's internal system to control the daily rhythm of the body's functions (i.e., the circadian system), the body's stress response, and the body's neurobiology are highly interconnected. Thus, the rhythm of the circadian system impacts alcohol use patterns; at the same time, alcohol drinking also can alter circadian functions. The sensitivity of the circadian system to alcohol may result from alcohol's effects on the expression of several of the clock genes that regulate circadian function. The stress response system involves the hypothalamus and pituitary gland in the brain and the adrenal glands, as well as the hormones they secrete, including corticotrophin-releasing hormone, adrenocorticotrophic hormone, and glucocorticoids. It is controlled by brain-signaling molecules, including endogenous opioids such as β-endorphin. Alcohol consumption influences the activity of this system and vice versa. Finally, interactions exist between the circadian system, the hypothalamic-pituitary-adrenal axis, and alcohol consumption. Thus, it seems that certain clock genes may control functions of the stress response system and that these interactions are affected by alcohol.

Global differential gene expression in response to growth temperature alteration in group A Streptococcus.

PubMed

Smoot, L M; Smoot, J C; Graham, M R; Somerville, G A; Sturdevant, D E; Migliaccio, C A; Sylva, G L; Musser, J M

2001-08-28

Pathogens are exposed to different temperatures during an infection cycle and must regulate gene expression accordingly. However, the extent to which virulent bacteria alter gene expression in response to temperatures encountered in the host is unknown. Group A Streptococcus (GAS) is a human-specific pathogen that is responsible for illnesses ranging from superficial skin infections and pharyngitis to severe invasive infections such as necrotizing fasciitis and streptococcal toxic shock syndrome. GAS survives and multiplies at different temperatures during human infection. DNA microarray analysis was used to investigate the influence of temperature on global gene expression in a serotype M1 strain grown to exponential phase at 29 degrees C and 37 degrees C. Approximately 9% of genes were differentially expressed by at least 1.5-fold at 29 degrees C relative to 37 degrees C, including genes encoding transporter proteins, proteins involved in iron homeostasis, transcriptional regulators, phage-associated proteins, and proteins with no known homologue. Relatively few known virulence genes were differentially expressed at this threshold. However, transcription of 28 genes encoding proteins with predicted secretion signal sequences was altered, indicating that growth temperature substantially influences the extracellular proteome. TaqMan real-time reverse transcription-PCR assays confirmed the microarray data. We also discovered that transcription of genes encoding hemolysins, and proteins with inferred roles in iron regulation, transport, and homeostasis, was influenced by growth at 40 degrees C. Thus, GAS profoundly alters gene expression in response to temperature. The data delineate the spectrum of temperature-regulated gene expression in an important human pathogen and provide many unforeseen lines of pathogenesis investigation.

Pervasive and opposing effects of Unpredictable Chronic Mild Stress (UCMS) on hippocampal gene expression in BALB/cJ and C57BL/6J mouse strains.

PubMed

Malki, Karim; Mineur, Yann S; Tosto, Maria Grazia; Campbell, James; Karia, Priya; Jumabhoy, Irfan; Sluyter, Frans; Crusio, Wim E; Schalkwyk, Leonard C

2015-04-03

BALB/cJ is a strain susceptible to stress and extremely susceptible to a defective hedonic impact in response to chronic stressors. The strain offers much promise as an animal model for the study of stress related disorders. We present a comparative hippocampal gene expression study on the effects of unpredictable chronic mild stress on BALB/cJ and C57BL/6J mice. Affymetrix MOE 430 was used to measure hippocampal gene expression from 16 animals of two different strains (BALB/cJ and C57BL/6J) of both sexes and subjected to either unpredictable chronic mild stress (UCMS) or no stress. Differences were statistically evaluated through supervised and unsupervised linear modelling and using Weighted Gene Coexpression Network Analysis (WGCNA). In order to gain further understanding into mechanisms related to stress response, we cross-validated our results with a parallel study from the GENDEP project using WGCNA in a meta-analysis design. The effects of UCMS are visible through Principal Component Analysis which highlights the stress sensitivity of the BALB/cJ strain. A number of genes and gene networks related to stress response were uncovered including the Creb1 gene. WGCNA and pathway analysis revealed a gene network centered on Nfkb1. Results from the meta-analysis revealed a highly significant gene pathway centred on the Ubiquitin C (Ubc) gene. All pathways uncovered are associated with inflammation and immune response. The study investigated the molecular mechanisms underlying the response to adverse environment in an animal model using a GxE design. Stress-related differences were visible at the genomic level through PCA analysis highlighting the high sensitivity of BALB/cJ animals to environmental stressors. Several candidate genes and gene networks reported are associated with inflammation and neurogenesis and could serve to inform candidate gene selection in human studies and provide additional insight into the pathology of Major Depressive Disorder.

DNA Damage Response Genes and the Development of Cancer Metastasis

PubMed Central

Broustas, Constantinos G.; Lieberman, Howard B.

2014-01-01

DNA damage response genes play vital roles in the maintenance of a healthy genome. Defects in cell cycle checkpoint and DNA repair genes, especially mutation or aberrant downregulation, are associated with a wide spectrum of human disease, including a predisposition to the development of neurodegenerative conditions and cancer. On the other hand, upregulation of DNA damage response and repair genes can also cause cancer, as well as increase resistance of cancer cells to DNA damaging therapy. In recent years, it has become evident that many of the genes involved in DNA damage repair have additional roles in tumorigenesis, most prominently by acting as transcriptional (co-) factors. Although defects in these genes are causally connected to tumor initiation, their role in tumor progression is more controversial and it seems to depend on tumor type. In some tumors like melanoma, cell cycle checkpoint/DNA repair gene upregulation is associated with tumor metastasis, whereas in a number of other cancers the opposite has been observed. Several genes that participate in the DNA damage response, such as RAD9, PARP1, BRCA1, ATM and TP53 have been associated with metastasis by a number of in vitro biochemical and cellular assays, by examining human tumor specimens by immunohistochemistry or by DNA genomewide gene expression profiling. Many of these genes act as transcriptional effectors to regulate other genes implicated in the pathogenesis of cancer. Furthermore, they are aberrantly expressed in numerous human tumors and are causally related to tumorigenesis. However, whether the DNA damage repair function of these genes is required to promote metastasis or another activity is responsible (e.g., transcription control) has not been determined. Importantly, despite some compelling in vitro evidence, investigations are still needed to demonstrate the role of cell cycle checkpoint and DNA repair genes in regulating metastatic phenotypes in vivo. PMID:24397478

Expression profile of genes associated with mastitis in dairy cattle

PubMed Central

2009-01-01

In order to characterize the expression of genes associated with immune response mechanisms to mastitis, we quantified the relative expression of the IL-2, IL-4, IL-6, IL-8, IL-10, IFN-γ and TNF- α genes in milk cells of healthy cows and cows with clinical mastitis. Total RNA was extracted from milk cells of six Black and White Holstein (BW) cows and six Gyr cows, including three animals with and three without mastitis per breed. Gene expression was analyzed by real-time PCR. IL-10 gene expression was higher in the group of BW and Gyr cows with mastitis compared to animals free of infection from both breeds (p < 0.05). It was also higher in BW Holstein animals with clinical mastitis (p < 0.001), but it was not significant when Gyr cows with and without mastitis were compared (0.05 < p < 0.10). Among healthy cows, BW Holstein animals tended to present a higher expression of all genes studied, with a significant difference for the IL-2 and IFN- γ genes (p < 0.001). For animals with mastitis no significant difference in gene expression was observed between the two breeds. These findings suggest that animals with mastitis develop a preferentially cell-mediated immune response. Further studies including larger samples are necessary to better characterize the gene expression profile in cows with mastitis. PMID:21637453

Physiological Responses in Chinese Rare Minnow Larvae Following Exposure to Low-Dose Tributyltin.

PubMed

Li, Ping; Li, Zhi-Hua

2015-11-01

In the present study, the antioxidant response and acetylcholinesterase (AChE) activity were measured in Chinese rare minnow larvae (Gobiocypris rarus) after exposure to tributyltin (TBT) (0, 100, 400 and 800 ngL(-1)) for 7 days, as well as the expression of a series of genes, including cr, aptase and prl genes involved in the ion-regulatory process and igfbp3 and gh related to growth rate. Results shows that oxidative stress was generated in fish exposed to TBT, as evidenced by elevated malondialdehyde levels and the inhibition of antioxidant parameters. The activity of acetylcholinesterase (AChE) was also inhibited in fish under higher TBT stress. Moreover, genes involved in ion regulation and growth were affected, based on the regulated transcription of the cr, atpase, gh, prl and igfbp3 genes in the treated groups. The observed effects of TBT upon antioxidant responses and altered expression of genes provides insight into the use of these molecular biomarkers in evaluating mechanisms of TBT toxicity in fish.

Identification of early target genes of aflatoxin B1 in human hepatocytes, inter-individual variability and comparison with other genotoxic compounds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Josse, Rozenn; Dumont, Julie; Fautrel, Alain

Gene expression profiling has recently emerged as a promising approach to identify early target genes and discriminate genotoxic carcinogens from non-genotoxic carcinogens and non-carcinogens. However, early gene changes induced by genotoxic compounds in human liver remain largely unknown. Primary human hepatocytes and differentiated HepaRG cells were exposed to aflatoxin B1 (AFB1) that induces DNA damage following enzyme-mediated bioactivation. Gene expression profile changes induced by a 24 h exposure of these hepatocyte models to 0.05 and 0.25 μM AFB1 were analyzed by using oligonucleotide pangenomic microarrays. The main altered signaling pathway was the p53 pathway and related functions such as cellmore » cycle, apoptosis and DNA repair. Direct involvement of the p53 protein in response to AFB1 was verified by using siRNA directed against p53. Among the 83 well-annotated genes commonly modulated in two pools of three human hepatocyte populations and HepaRG cells, several genes were identified as altered by AFB1 for the first time. In addition, a subset of 10 AFB1-altered genes, selected upon basis of their function or tumor suppressor role, was tested in four human hepatocyte populations and in response to other chemicals. Although they exhibited large variable inter-donor fold-changes, several of these genes, particularly FHIT, BCAS3 and SMYD3, were found to be altered by various direct and other indirect genotoxic compounds and unaffected by non-genotoxic compounds. Overall, this comprehensive analysis of early gene expression changes induced by AFB1 in human hepatocytes identified a gene subset that included several genes representing potential biomarkers of genotoxic compounds. -- Highlights: ► Gene expression profile changes induced by aflatoxin B1 in human hepatocytes. ► AFB1 modulates various genes including tumor suppressor genes and proto-oncogenes. ► Important inter-individual variations in the response to AFB1. ► Some genes also altered by other genotoxic compounds requiring or not bioactivation.« less

Genes related to sex steroids, neural growth, and social-emotional behavior are associated with autistic traits, empathy, and Asperger syndrome.

PubMed

Chakrabarti, B; Dudbridge, F; Kent, L; Wheelwright, S; Hill-Cawthorne, G; Allison, C; Banerjee-Basu, S; Baron-Cohen, S

2009-06-01

Genetic studies of autism spectrum conditions (ASC) have mostly focused on the "low functioning" severe clinical subgroup, treating it as a rare disorder. However, ASC is now thought to be relatively common ( approximately 1%), and representing one end of a quasi-normal distribution of autistic traits in the general population. Here we report a study of common genetic variation in candidate genes associated with autistic traits and Asperger syndrome (AS). We tested single nucleotide polymorphisms in 68 candidate genes in three functional groups (sex steroid synthesis/transport, neural connectivity, and social-emotional responsivity) in two experiments. These were (a) an association study of relevant behavioral traits (the Empathy Quotient (EQ), the Autism Spectrum Quotient (AQ)) in a population sample (n=349); and (b) a case-control association study on a sample of people with AS, a "high-functioning" subgroup of ASC (n=174). 27 genes showed a nominally significant association with autistic traits and/or ASC diagnosis. Of these, 19 genes showed nominally significant association with AQ/EQ. In the sex steroid group, this included ESR2 and CYP11B1. In the neural connectivity group, this included HOXA1, NTRK1, and NLGN4X. In the socio-responsivity behavior group, this included MAOB, AVPR1B, and WFS1. Fourteen genes showed nominally significant association with AS. In the sex steroid group, this included CYP17A1 and CYP19A1. In the socio-emotional behavior group, this included OXT. Six genes were nominally associated in both experiments, providing a partial replication. Eleven genes survived family wise error rate (FWER) correction using permutations across both experiments, which is greater than would be expected by chance. CYP11B1 and NTRK1 emerged as significantly associated genes in both experiments, after FWER correction (P<0.05). This is the first candidate-gene association study of AS and of autistic traits. The most promising candidate genes require independent replication and fine mapping.

Autotoxicity mechanism of Oryza sativa: transcriptome response in rice roots exposed to ferulic acid

PubMed Central

2013-01-01

Background Autotoxicity plays an important role in regulating crop yield and quality. To help characterize the autotoxicity mechanism of rice, we performed a large-scale, transcriptomic analysis of the rice root response to ferulic acid, an autotoxin from rice straw. Results Root growth rate was decreased and reactive oxygen species, calcium content and lipoxygenase activity were increased with increasing ferulic acid concentration in roots. Transcriptome analysis revealed more transcripts responsive to short ferulic-acid exposure (1- and 3-h treatments, 1,204 genes) than long exposure (24 h, 176 genes). Induced genes were involved in cell wall formation, chemical detoxification, secondary metabolism, signal transduction, and abiotic stress response. Genes associated with signaling and biosynthesis for ethylene and jasmonic acid were upregulated with ferulic acid. Ferulic acid upregulated ATP-binding cassette and amino acid/auxin permease transporters as well as genes encoding signaling components such as leucine-rich repeat VIII and receptor-like cytoplasmic kinases VII protein kinases, APETALA2/ethylene response factor, WRKY, MYB and Zinc-finger protein expressed in inflorescence meristem transcription factors. Conclusions The results of a transcriptome analysis suggest the molecular mechanisms of plants in response to FA, including toxicity, detoxicification and signaling machinery. FA may have a significant effect on inhibiting rice root elongation through modulating ET and JA hormone homeostasis. FA-induced gene expression of AAAP transporters may contribute to detoxicification of the autotoxin. Moreover, the WRKY and Myb TFs and LRR-VIII and SD-2b kinases might regulate downstream genes under FA stress but not general allelochemical stress. This comprehensive description of gene expression information could greatly facilitate our understanding of the mechanisms of autotoxicity in plants. PMID:23705659

Changes in the Transcriptome of the Human Endometrial Ishikawa Cancer Cell Line Induced by Estrogen, Progesterone, Tamoxifen, and Mifepristone (RU486) as Detected by RNA-Sequencing

PubMed Central

Tamm-Rosenstein, Karin; Simm, Jaak; Suhorutshenko, Marina; Salumets, Andres; Metsis, Madis

2013-01-01

Background Estrogen (E2) and progesterone (P4) are key players in the maturation of the human endometrium. The corresponding steroid hormone modulators, tamoxifen (TAM) and mifepristone (RU486) are widely used in breast cancer therapy and for contraception purposes, respectively. Methodology/Principal findings Gene expression profiling of the human endometrial Ishikawa cancer cell line treated with E2 and P4 for 3 h and 12 h, and TAM and RU486 for 12 h, was performed using RNA-sequencing. High levels of mRNA were detected for genes, including PSAP, ATP5G2, ATP5H, and GNB2L1 following E2 or P4 treatment. A total of 82 biomarkers for endometrial biology were identified among E2 induced genes, and 93 among P4 responsive genes. Identified biomarkers included: EZH2, MDK, MUC1, SLIT2, and IL6ST, which are genes previously associated with endometrial receptivity. Moreover, 98.8% and 98.6% of E2 and P4 responsive genes in Ishikawa cells, respectively, were also detected in two human mid-secretory endometrial biopsy samples. TAM treatment exhibited both antagonistic and agonistic effects of E2, and also regulated a subset of genes independently. The cell cycle regulator cyclin D1 (CCND1) showed significant up-regulation following treatment with TAM. RU486 did not appear to act as a pure antagonist of P4 and a functional analysis of RU486 response identified genes related to adhesion and apoptosis, including down-regulated genes associated with cell-cell contacts and adhesion as CTNND1, JUP, CDH2, IQGAP1, and COL2A1. Conclusions Significant changes in gene expression by the Ishikawa cell line were detected after treatments with E2, P4, TAM, and RU486. These transcriptome data provide valuable insight into potential biomarkers related to endometrial receptivity, and also facilitate an understanding of the molecular changes that take place in the endometrium in the early stages of breast cancer treatment and contraception usage. PMID:23874806

Genome-wide identification, isolation and expression analysis of auxin response factor (ARF) gene family in sweet orange (Citrus sinensis)

PubMed Central

Li, Si-Bei; OuYang, Wei-Zhi; Hou, Xiao-Jin; Xie, Liang-Liang; Hu, Chun-Gen; Zhang, Jin-Zhi

2015-01-01

Auxin response factors (ARFs) are an important family of proteins in auxin-mediated response, with key roles in various physiological and biochemical processes. To date, a genome-wide overview of the ARF gene family in citrus was not available. A systematic analysis of this gene family in citrus was begun by carrying out a genome-wide search for the homologs of ARFs. A total of 19 nonredundant ARF genes (CiARF) were found and validated from the sweet orange. A comprehensive overview of the CiARFs was undertaken, including the gene structures, phylogenetic analysis, chromosome locations, conserved motifs of proteins, and cis-elements in promoters of CiARF. Furthermore, expression profiling using real-time PCR revealed many CiARF genes, albeit with different patterns depending on types of tissues and/or developmental stages. Comprehensive expression analysis of these genes was also performed under two hormone treatments using real-time PCR. Indole-3-acetic acid (IAA) and N-1-napthylphthalamic acid (NPA) treatment experiments revealed differential up-regulation and down-regulation, respectively, of the 19 citrus ARF genes in the callus of sweet orange. Our comprehensive analysis of ARF genes further elucidates the roles of CiARF family members during citrus growth and development process. PMID:25870601

Heterogeneous activation of the TGFβ pathway in glioblastomas identified by gene expression-based classification using TGFβ-responsive genes

PubMed Central

Xu, Xie L; Kapoun, Ann M

2009-01-01

Background TGFβ has emerged as an attractive target for the therapeutic intervention of glioblastomas. Aberrant TGFβ overproduction in glioblastoma and other high-grade gliomas has been reported, however, to date, none of these reports has systematically examined the components of TGFβ signaling to gain a comprehensive view of TGFβ activation in large cohorts of human glioma patients. Methods TGFβ activation in mammalian cells leads to a transcriptional program that typically affects 5–10% of the genes in the genome. To systematically examine the status of TGFβ activation in high-grade glial tumors, we compiled a gene set of transcriptional response to TGFβ stimulation from tissue culture and in vivo animal studies. These genes were used to examine the status of TGFβ activation in high-grade gliomas including a large cohort of glioblastomas. Unsupervised and supervised classification analysis was performed in two independent, publicly available glioma microarray datasets. Results Unsupervised and supervised classification using the TGFβ-responsive gene list in two independent glial tumor gene expression data sets revealed various levels of TGFβ activation in these tumors. Among glioblastomas, one of the most devastating human cancers, two subgroups were identified that showed distinct TGFβ activation patterns as measured from transcriptional responses. Approximately 62% of glioblastoma samples analyzed showed strong TGFβ activation, while the rest showed a weak TGFβ transcriptional response. Conclusion Our findings suggest heterogeneous TGFβ activation in glioblastomas, which may cause potential differences in responses to anti-TGFβ therapies in these two distinct subgroups of glioblastomas patients. PMID:19192267

Metabolomic analysis of the selection response of Drosophila melanogaster to environmental stress: are there links to gene expression and phenotypic traits?

NASA Astrophysics Data System (ADS)

Malmendal, Anders; Sørensen, Jesper Givskov; Overgaard, Johannes; Holmstrup, Martin; Nielsen, Niels Chr.; Loeschcke, Volker

2013-05-01

We investigated the global metabolite response to artificial selection for tolerance to stressful conditions such as cold, heat, starvation, and desiccation, and for longevity in Drosophila melanogaster. Our findings were compared to data from other levels of biological organization, including gene expression, physiological traits, and organismal stress tolerance phenotype. Overall, we found that selection for environmental stress tolerance changes the metabolomic 1H NMR fingerprint largely in a similar manner independent of the trait selected for, indicating that experimental evolution led to a general stress selection response at the metabolomic level. Integrative analyses across data sets showed little similarity when general correlations between selection effects at the level of the metabolome and gene expression were compared. This is likely due to the fact that the changes caused by these selection regimes were rather mild and/or that the dominating determinants for gene expression and metabolite levels were different. However, expression of a number of genes was correlated with the metabolite data. Many of the identified genes were general stress response genes that are down-regulated in response to selection for some of the stresses in this study. Overall, the results illustrate that selection markedly alters the metabolite profile and that the coupling between different levels of biological organization indeed is present though not very strong for stress selection at this level. The results highlight the extreme complexity of environmental stress adaptation and the difficulty of extrapolating and interpreting responses across levels of biological organization.

Variation analysis of transcriptome changes reveals cochlear genes and their associated functions in cochlear susceptibility to acoustic overstimulation.

PubMed

Yang, Shuzhi; Cai, Qunfeng; Bard, Jonathan; Jamison, Jennifer; Wang, Jianmin; Yang, Weiping; Hu, Bo Hua

2015-12-01

Individual variation in the susceptibility of the auditory system to acoustic overstimulation has been well-documented at both the functional and structural levels. However, the molecular mechanism responsible for this variation is unclear. The current investigation was designed to examine the variation patterns of cochlear gene expression using RNA-seq data and to identify the genes with expression variation that increased following acoustic trauma. This study revealed that the constitutive expressions of cochlear genes displayed diverse levels of gene-specific variation. These variation patterns were altered by acoustic trauma; approximately one-third of the examined genes displayed marked increases in their expression variation. Bioinformatics analyses revealed that the genes that exhibited increased variation were functionally related to cell death, biomolecule metabolism, and membrane function. In contrast, the stable genes were primarily related to basic cellular processes, including protein and macromolecular syntheses and transport. There was no functional overlap between the stable and variable genes. Importantly, we demonstrated that glutamate metabolism is related to the variation in the functional response of the cochlea to acoustic overstimulation. Taken together, the results indicate that our analyses of the individual variations in transcriptome changes of cochlear genes provide important information for the identification of genes that potentially contribute to the generation of individual variation in cochlear responses to acoustic overstimulation. Copyright © 2015 Elsevier B.V. All rights reserved.

Inactivation of DNA-Binding Response Regulator Sak189 Abrogates β-Antigen Expression and Affects Virulence of Streptococcus agalactiae

PubMed Central

Rozhdestvenskaya, Anastasia S.; Totolian, Artem A.; Dmitriev, Alexander V.

2010-01-01

Background Streptococcus agalactiae is able to colonize numerous tissues employing different mechanisms of gene regulation, particularly via two-component regulatory systems. These systems sense the environmental stimuli and regulate expression of the genes including virulence genes. Recently, the novel two-component regulatory system Sak188/Sak189 was identified. In S. agalactiae genome, it was adjacent to the bac gene encoding for β-antigen, an important virulence factor. Methodology/Principal Findings In this study, the sak188 and sak189 genes were inactivated, and the functional role of Sak188/Sak189 two-component system in regulation of the β-antigen expression was investigated. It was demonstrated that both transcription of bac gene and expression of encoded β-antigen were controlled by Sak189 response regulator, but not Sak188 histidine kinase. It was also found that the regulation occurred at transcriptional level. Finally, insertional inactivation of sak189 gene, but not sak188 gene, significantly affected virulent properties of S. agalactiae. Conclusions/Significance Sak189 response regulator is necessary for activation of bac gene transcription. It also controls the virulent properties of S. agalactiae. Given that the primary functional role of Sak188/Sak189 two-component systems is a control of bac gene transcription, this system can be annotated as BgrR/S (bac gene regulatory system). PMID:20419089

Disease-modifying genetic factors in cystic fibrosis.

PubMed

Marson, Fernando A L

2018-05-01

To compile data from the past 10 years regarding the role of modifying genes in cystic fibrosis (CF). CF is a model disease for understanding of the action of modifying genes. Although it is a monogenic (CFTR) autosomal recessive disease, CF presents with wide phenotypic variability. In CF, variability occurs with different intensity among patients by each organ, being organ-specific, resulting from the mutual interaction of environmental and genetic factors, including CFTR mutations and various other genes, most of which are associated with inflammatory processes. In individuals, using precision medicine, gene modification studies have revealed individualized responses to drugs depending on particular CFTR mutations and modifying genes, most of which are alternative ion channels. Studies of modifying genes in CF allow: understanding of clinical variability among patients with the same CFTR genotype; evaluation of precision medicine; understanding of environmental and genetic effects at the organ level; understanding the involvement of genetic variants in inflammatory responses; improvements in genetic counseling; understanding the involvement of genetic variants in inflammatory responses in lung diseases, such as asthma; and understanding the individuality of the person with the disease.

Functional pathway analysis of genes associated with response to treatment for chronic hepatitis C.

PubMed

Birerdinc, A; Afendy, A; Stepanova, M; Younossi, I; Manyam, G; Baranova, A; Younossi, Z M

2010-10-01

Chronic hepatitis C (CH-C) is among the most common causes of chronic liver disease. Approximately 50% of patients with CH-C treated with pegylated interferon-α and ribavirin (PEG-IFN-α + RBV) achieve a sustained virological response (SVR). Several factors such as genotype 1, African American (AA) race, obesity and the absence of an early virological response (EVR) are associated with low SVR. This study elucidates molecular pathways deregulated in patients with CH-C with negative predictors of response to antiviral therapy. Sixty-eight patients with CH-C who underwent a full course of treatment with PEG-IFN-α + RBV were included in the study. Pretreatment blood samples were collected in PAXgene™ RNA tubes. EVR, complete EVR (cEVR), and SVR rates were 76%, 57% and 41%, respectively. Total RNA was extracted from pretreatment peripheral blood mononuclear cells, quantified and used for one-step RT-PCR to profile 154 mRNAs. The expression of mRNAs was normalized with six 'housekeeping' genes. Differentially expressed genes were separated into up and downregulated gene lists according to the presence or absence of a risk factor and subjected to KEGG Pathway Painter which allows high-throughput visualization of the pathway-specific changes in expression profiles. The genes were consolidated into the networks associated with known predictors of response. Before treatment, various genes associated with core components of the JAK/STAT pathway were activated in the cohorts least likely to achieve SVR. Genes related to focal adhesion and TGF-β pathways were activated in some patients with negative predictors of response. Pathway-centred analysis of gene expression profiles from treated patients with CH-C points to the Janus kinase-signal transducers and activators of transcription signalling cascade as the major pathogenetic component responsible for not achieving SVR. In addition, focal adhesion and TGF-β pathways are associated with some predictors of response. © 2009 Blackwell Publishing Ltd.

Systems analysis of sex differences reveals an immunosuppressive role for testosterone in the response to influenza vaccination

PubMed Central

Furman, David; Hejblum, Boris P.; Simon, Noah; Jojic, Vladimir; Dekker, Cornelia L.; Thiébaut, Rodolphe; Tibshirani, Robert J.; Davis, Mark M.

2014-01-01

Females have generally more robust immune responses than males for reasons that are not well-understood. Here we used a systems analysis to investigate these differences by analyzing the neutralizing antibody response to a trivalent inactivated seasonal influenza vaccine (TIV) and a large number of immune system components, including serum cytokines and chemokines, blood cell subset frequencies, genome-wide gene expression, and cellular responses to diverse in vitro stimuli, in 53 females and 34 males of different ages. We found elevated antibody responses to TIV and expression of inflammatory cytokines in the serum of females compared with males regardless of age. This inflammatory profile correlated with the levels of phosphorylated STAT3 proteins in monocytes but not with the serological response to the vaccine. In contrast, using a machine learning approach, we identified a cluster of genes involved in lipid biosynthesis and previously shown to be up-regulated by testosterone that correlated with poor virus-neutralizing activity in men. Moreover, men with elevated serum testosterone levels and associated gene signatures exhibited the lowest antibody responses to TIV. These results demonstrate a strong association between androgens and genes involved in lipid metabolism, suggesting that these could be important drivers of the differences in immune responses between males and females. PMID:24367114

Changes in gene expression in lungs of mice exposed to traffic-related air pollution.

PubMed

Yang, Jie; Chen, Yi; Yu, Zhi; Ding, Hui; Ma, Zhongfu

2018-06-01

Long-term exposure to traffic-related pollutants can lead to a variety of respiratory diseases, including inflammation, asthma, and lung cancer; however, the underlying biological mechanisms are not fully understood. We focused on the effects of exposure to different air pollutants on the expression of genes associated with inflammatory immune responses, allergic reactions and asthma, and lung cancer. In order to understand the cellular responses induced by exposure to different traffic-related pollutants, we performed PCR array to evaluate the mRNA expression of genes associated with inflammatory immune responses, allergic reactions and asthma, and lung cancer in the lungs of mice exposed to three different environments, including the laboratory (clean air), and polluted parking garages in Foshan and Guangzhou for four weeks. Cytokines (IFN-γ, IL-4, and IL-17A) were analyzed by Flow cytometry; the morphological structures were detected by Haematoxylin and eosin (H&E) staining. Our results revealed that the main pollutant in Guangzhou was PM2.5, the main pollutants in Foshan were gaseous pollutants including CO, NO x and SO 2. IFN-γ was significantly lower, and IL-4, and IL-17A were significantly higher in mice in the Guangzhou and Foshan groups compared with laboratory group. The morphological structures were damaged in Guangzhou and Foshan groups. In addition, we found that exposure to traffic-related pollutants triggered the expression of inflammatory genes (Cxcl11 and Tnfs4), allergy and asthma genes (Clca3 and Prg2), and lung cancer genes (Agr2, Col11a1, and Sostdc1). As such, our results demonstrate that persistent exposure to traffic-related pollutants may elevate the incidence of immune disorders and asthma, and may be as a risk factor for lung cancer. Copyright © 2018. Published by Elsevier Ltd.

Chilling-induced tomato flavor loss is associated with altered volatile synthesis and transient changes in DNA methylation.

PubMed

Zhang, Bo; Tieman, Denise M; Jiao, Chen; Xu, Yimin; Chen, Kunsong; Fei, Zhangjun; Giovannoni, James J; Klee, Harry J

2016-11-01

Commercial tomatoes are widely perceived by consumers as lacking flavor. A major part of that problem is a postharvest handling system that chills fruit. Low-temperature storage is widely used to slow ripening and reduce decay. However, chilling results in loss of flavor. Flavor-associated volatiles are sensitive to temperatures below 12 °C, and their loss greatly reduces flavor quality. Here, we provide a comprehensive view of the effects of chilling on flavor and volatiles associated with consumer liking. Reduced levels of specific volatiles are associated with significant reductions in transcripts encoding key volatile synthesis enzymes. Although expression of some genes critical to volatile synthesis recovers after a return to 20 °C, some genes do not. RNAs encoding transcription factors essential for ripening, including RIPENING INHIBITOR (RIN), NONRIPENING, and COLORLESS NONRIPENING are reduced in response to chilling and may be responsible for reduced transcript levels in many downstream genes during chilling. Those reductions are accompanied by major changes in the methylation status of promoters, including RIN Methylation changes are transient and may contribute to the fidelity of gene expression required to provide maximal beneficial environmental response with minimal tangential influence on broader fruit developmental biology.

Genetic association of impulsivity in young adults: a multivariate study

PubMed Central

Khadka, S; Narayanan, B; Meda, S A; Gelernter, J; Han, S; Sawyer, B; Aslanzadeh, F; Stevens, M C; Hawkins, K A; Anticevic, A; Potenza, M N; Pearlson, G D

2014-01-01

Impulsivity is a heritable, multifaceted construct with clinically relevant links to multiple psychopathologies. We assessed impulsivity in young adult (N~2100) participants in a longitudinal study, using self-report questionnaires and computer-based behavioral tasks. Analysis was restricted to the subset (N=426) who underwent genotyping. Multivariate association between impulsivity measures and single-nucleotide polymorphism data was implemented using parallel independent component analysis (Para-ICA). Pathways associated with multiple genes in components that correlated significantly with impulsivity phenotypes were then identified using a pathway enrichment analysis. Para-ICA revealed two significantly correlated genotype–phenotype component pairs. One impulsivity component included the reward responsiveness subscale and behavioral inhibition scale of the Behavioral-Inhibition System/Behavioral-Activation System scale, and the second impulsivity component included the non-planning subscale of the Barratt Impulsiveness Scale and the Experiential Discounting Task. Pathway analysis identified processes related to neurogenesis, nervous system signal generation/amplification, neurotransmission and immune response. We identified various genes and gene regulatory pathways associated with empirically derived impulsivity components. Our study suggests that gene networks implicated previously in brain development, neurotransmission and immune response are related to impulsive tendencies and behaviors. PMID:25268255

Antagonistic, overlapping and distinct responses to biotic stress in rice (Oryza sativa) and interactions with abiotic stress

PubMed Central

2013-01-01

Background Every year, substantial crop loss occurs globally, as a result of bacterial, fungal, parasite and viral infections in rice. Here, we present an in-depth investigation of the transcriptomic response to infection with the destructive bacterial pathogen Xanthomonas oryzae pv. oryzae(Xoo) in both resistant and susceptible varieties of Oryza sativa. A comparative analysis to fungal, parasite and viral infection in rice is also presented. Results Within 24 h of Xoo inoculation, significant reduction of cell wall components and induction of several signalling components, membrane bound receptor kinases and specific WRKY and NAC transcription factors was prominent, providing a framework for how the presence of this pathogen was signalled and response mounted. Extensive comparative analyses of various other pathogen responses, including in response to infection with another bacterium (Xoc), resistant and susceptible parasite infection, fungal, and viral infections, led to a proposed model for the rice biotic stress response. In this way, a conserved induction of calcium signalling functions, and specific WRKY and NAC transcription factors, was identified in response to all biotic stresses. Comparison of these responses to abiotic stress (cold, drought, salt, heat), enabled the identification of unique genes responsive only to bacterial infection, 240 genes responsive to both abiotic and biotic stress, and 135 genes responsive to biotic, but not abiotic stresses. Functional significance of a number of these genes, using genetic inactivation or over-expression, has revealed significant stress-associated phenotypes. While only a few antagonistic responses were observed between biotic and abiotic stresses, e.g. for a number of endochitinases and kinase encoding genes, some of these may be crucial in explaining greater pathogen infection and damage under abiotic stresses. Conclusions The analyses presented here provides a global view of the responses to multiple stresses, further validates known resistance-associated genes, and highlights new potential target genes, some lineage specific to rice, that play important roles in response to stress, providing a roadmap to develop varieties of rice that are more resistant to multiple biotic and abiotic stresses, as encountered in nature. PMID:23398910

Blood and Bones: The Influence of the Mass Media on Australian Primary School Children's Understandings of Genes and DNA

ERIC Educational Resources Information Center

Donovan, Jenny; Venville, Grady

2014-01-01

Previous research showed that primary school children held several misconceptions about genetics of concern for their future lives. Included were beliefs that genes and DNA are separate substances, with genes causing family resemblance and DNA identifying suspects at crime scenes. Responses to this work "blamed" the mass media for these…

Meta-analysis of human gene expression in response to Mycobacterium tuberculosis infection reveals potential therapeutic targets.

PubMed

Wang, Zhang; Arat, Seda; Magid-Slav, Michal; Brown, James R

2018-01-10

With the global emergence of multi-drug resistant strains of Mycobacterium tuberculosis, new strategies to treat tuberculosis are urgently needed such as therapeutics targeting potential human host factors. Here we performed a statistical meta-analysis of human gene expression in response to both latent and active pulmonary tuberculosis infections from nine published datasets. We found 1655 genes that were significantly differentially expressed during active tuberculosis infection. In contrast, no gene was significant for latent tuberculosis. Pathway enrichment analysis identified 90 significant canonical human pathways, including several pathways more commonly related to non-infectious diseases such as the LRRK2 pathway in Parkinson's disease, and PD-1/PD-L1 signaling pathway important for new immuno-oncology therapies. The analysis of human genome-wide association studies datasets revealed tuberculosis-associated genetic variants proximal to several genes in major histocompatibility complex for antigen presentation. We propose several new targets and drug-repurposing opportunities including intravenous immunoglobulin, ion-channel blockers and cancer immuno-therapeutics for development as combination therapeutics with anti-mycobacterial agents. Our meta-analysis provides novel insights into host genes and pathways important for tuberculosis and brings forth potential drug repurposing opportunities for host-directed therapies.

Gene Expression Ratios Lead to Accurate and Translatable Predictors of DR5 Agonism across Multiple Tumor Lineages.

PubMed

Reddy, Anupama; Growney, Joseph D; Wilson, Nick S; Emery, Caroline M; Johnson, Jennifer A; Ward, Rebecca; Monaco, Kelli A; Korn, Joshua; Monahan, John E; Stump, Mark D; Mapa, Felipa A; Wilson, Christopher J; Steiger, Janine; Ledell, Jebediah; Rickles, Richard J; Myer, Vic E; Ettenberg, Seth A; Schlegel, Robert; Sellers, William R; Huet, Heather A; Lehár, Joseph

2015-01-01

Death Receptor 5 (DR5) agonists demonstrate anti-tumor activity in preclinical models but have yet to demonstrate robust clinical responses. A key limitation may be the lack of patient selection strategies to identify those most likely to respond to treatment. To overcome this limitation, we screened a DR5 agonist Nanobody across >600 cell lines representing 21 tumor lineages and assessed molecular features associated with response. High expression of DR5 and Casp8 were significantly associated with sensitivity, but their expression thresholds were difficult to translate due to low dynamic ranges. To address the translational challenge of establishing thresholds of gene expression, we developed a classifier based on ratios of genes that predicted response across lineages. The ratio classifier outperformed the DR5+Casp8 classifier, as well as standard approaches for feature selection and classification using genes, instead of ratios. This classifier was independently validated using 11 primary patient-derived pancreatic xenograft models showing perfect predictions as well as a striking linearity between prediction probability and anti-tumor response. A network analysis of the genes in the ratio classifier captured important biological relationships mediating drug response, specifically identifying key positive and negative regulators of DR5 mediated apoptosis, including DR5, CASP8, BID, cFLIP, XIAP and PEA15. Importantly, the ratio classifier shows translatability across gene expression platforms (from Affymetrix microarrays to RNA-seq) and across model systems (in vitro to in vivo). Our approach of using gene expression ratios presents a robust and novel method for constructing translatable biomarkers of compound response, which can also probe the underlying biology of treatment response.

Gene Expression Ratios Lead to Accurate and Translatable Predictors of DR5 Agonism across Multiple Tumor Lineages

PubMed Central

Reddy, Anupama; Growney, Joseph D.; Wilson, Nick S.; Emery, Caroline M.; Johnson, Jennifer A.; Ward, Rebecca; Monaco, Kelli A.; Korn, Joshua; Monahan, John E.; Stump, Mark D.; Mapa, Felipa A.; Wilson, Christopher J.; Steiger, Janine; Ledell, Jebediah; Rickles, Richard J.; Myer, Vic E.; Ettenberg, Seth A.; Schlegel, Robert; Sellers, William R.

2015-01-01

Death Receptor 5 (DR5) agonists demonstrate anti-tumor activity in preclinical models but have yet to demonstrate robust clinical responses. A key limitation may be the lack of patient selection strategies to identify those most likely to respond to treatment. To overcome this limitation, we screened a DR5 agonist Nanobody across >600 cell lines representing 21 tumor lineages and assessed molecular features associated with response. High expression of DR5 and Casp8 were significantly associated with sensitivity, but their expression thresholds were difficult to translate due to low dynamic ranges. To address the translational challenge of establishing thresholds of gene expression, we developed a classifier based on ratios of genes that predicted response across lineages. The ratio classifier outperformed the DR5+Casp8 classifier, as well as standard approaches for feature selection and classification using genes, instead of ratios. This classifier was independently validated using 11 primary patient-derived pancreatic xenograft models showing perfect predictions as well as a striking linearity between prediction probability and anti-tumor response. A network analysis of the genes in the ratio classifier captured important biological relationships mediating drug response, specifically identifying key positive and negative regulators of DR5 mediated apoptosis, including DR5, CASP8, BID, cFLIP, XIAP and PEA15. Importantly, the ratio classifier shows translatability across gene expression platforms (from Affymetrix microarrays to RNA-seq) and across model systems (in vitro to in vivo). Our approach of using gene expression ratios presents a robust and novel method for constructing translatable biomarkers of compound response, which can also probe the underlying biology of treatment response. PMID:26378449

Changes in DnaA-dependent gene expression contribute to the transcriptional and developmental response of Bacillus subtilis to manganese limitation in Luria-Bertani medium.

PubMed

Hoover, Sharon E; Xu, Weihong; Xiao, Wenzhong; Burkholder, William F

2010-08-01

The SOS response to DNA damage in bacteria is a well-known component of the complex transcriptional responses to genotoxic environmental stresses such as exposure to reactive oxygen species, alkylating agents, and many of the antibiotics targeting DNA replication. However, bacteria such as Bacillus subtilis also respond to conditions that perturb DNA replication via a transcriptional response mediated by the replication initiation protein DnaA. In addition to regulating the initiation of DNA replication, DnaA directly regulates the transcription of specific genes. Conditions that perturb DNA replication can trigger the accumulation of active DnaA, activating or repressing the transcription of genes in the DnaA regulon. We report here that simply growing B. subtilis in LB medium altered DnaA-dependent gene expression in a manner consistent with the accumulation of active DnaA and that this was part of a general transcriptional response to manganese limitation. The SOS response to DNA damage was not induced under these conditions. One of the genes positively regulated by DnaA in Bacillus subtilis encodes a protein that inhibits the initiation of sporulation, Sda. Sda expression was induced as cells entered stationary phase in LB medium but not in LB medium supplemented with manganese, and the induction of Sda inhibited sporulation-specific gene expression and the onset of spore morphogenesis. In the absence of Sda, manganese-limited cells initiated spore development but failed to form mature spores. These data highlight that DnaA-dependent gene expression may influence the response of bacteria to a range of environmental conditions, including conditions that are not obviously associated with genotoxic stress.

Changes in DnaA-Dependent Gene Expression Contribute to the Transcriptional and Developmental Response of Bacillus subtilis to Manganese Limitation in Luria-Bertani Medium▿ †

PubMed Central

Hoover, Sharon E.; Xu, Weihong; Xiao, Wenzhong; Burkholder, William F.

2010-01-01

The SOS response to DNA damage in bacteria is a well-known component of the complex transcriptional responses to genotoxic environmental stresses such as exposure to reactive oxygen species, alkylating agents, and many of the antibiotics targeting DNA replication. However, bacteria such as Bacillus subtilis also respond to conditions that perturb DNA replication via a transcriptional response mediated by the replication initiation protein DnaA. In addition to regulating the initiation of DNA replication, DnaA directly regulates the transcription of specific genes. Conditions that perturb DNA replication can trigger the accumulation of active DnaA, activating or repressing the transcription of genes in the DnaA regulon. We report here that simply growing B. subtilis in LB medium altered DnaA-dependent gene expression in a manner consistent with the accumulation of active DnaA and that this was part of a general transcriptional response to manganese limitation. The SOS response to DNA damage was not induced under these conditions. One of the genes positively regulated by DnaA in Bacillus subtilis encodes a protein that inhibits the initiation of sporulation, Sda. Sda expression was induced as cells entered stationary phase in LB medium but not in LB medium supplemented with manganese, and the induction of Sda inhibited sporulation-specific gene expression and the onset of spore morphogenesis. In the absence of Sda, manganese-limited cells initiated spore development but failed to form mature spores. These data highlight that DnaA-dependent gene expression may influence the response of bacteria to a range of environmental conditions, including conditions that are not obviously associated with genotoxic stress. PMID:20511500

Pre-silencing of genes involved in the electron transport chain (ETC) pathway is associated with responsiveness to abatacept in rheumatoid arthritis.

PubMed

Derambure, C; Dzangue-Tchoupou, G; Berard, C; Vergne, N; Hiron, M; D'Agostino, M A; Musette, P; Vittecoq, O; Lequerré, T

2017-05-25

In the current context of personalized medicine, one of the major challenges in the management of rheumatoid arthritis (RA) is to identify biomarkers that predict drug responsiveness. From the European APPRAISE trial, our main objective was to identify a gene expression profile associated with responsiveness to abatacept (ABA) + methotrexate (MTX) and to understand the involvement of this signature in the pathophysiology of RA. Whole human genome microarrays (4 × 44 K) were performed from a first subset of 36 patients with RA. Data validation by quantitative reverse-transcription (qRT)-PCR was performed from a second independent subset of 32 patients with RA. Gene Ontology and WikiPathways database allowed us to highlight the specific biological mechanisms involved in predicting response to ABA/MTX. From the first subset of 36 patients with RA, a combination including 87 transcripts allowed almost perfect separation between responders and non-responders to ABA/MTX. Next, the second subset of patients 32 with RA allowed validation by qRT-PCR of a minimal signature with only four genes. This latter signature categorized 81% of patients with RA with 75% sensitivity, 85% specificity and 85% negative predictive value. This combination showed a significant enrichment of genes involved in electron transport chain (ETC) pathways. Seven transcripts from ETC pathways (NDUFA6, NDUFA4, UQCRQ, ATP5J, COX7A2, COX7B, COX6A1) were significantly downregulated in responders versus non-responders to ABA/MTX. Moreover, dysregulation of these genes was independent of inflammation and was specific to ABA response. Pre-silencing of ETC genes is associated with future response to ABA/MTX and might be a crucial key to susceptibility to ABA response.

RNA-Seq Reveals Extensive Transcriptional Response to Heat Stress in the Stony Coral Galaxea fascicularis

PubMed Central

Hou, Jing; Xu, Tao; Su, Dingjia; Wu, Ying; Cheng, Li; Wang, Jun; Zhou, Zhi; Wang, Yan

2018-01-01

Galaxea fascicularis, a stony coral belonging to family Oculinidae, is widely distributed in Red Sea, the Gulf of Aden and large areas of the Indo-Pacific oceans. So far there is a lack of gene expression knowledge concerning this massive coral. In the present study, G. fascicularis was subjected to heat stress at 32.0 ± 0.5°C in the lab, we found that the density of symbiotic zooxanthellae decreased significantly; meanwhile apparent bleaching and tissue lysing were observed at 10 h and 18 h after heat stress. The transcriptome responses were investigated in the stony coral G. fascicularis during heat bleaching using RNA-seq. A total of 42,028 coral genes were assembled from over 439 million reads. Gene expressions were compared at 10 and 18 h after heat stress. The significantly upregulated genes found in the Control_10h vs. Heat_10h comparison, presented mainly in GO terms related with DNA integration and unfolded protein response; and for the Control_18h vs. Heat_18h comparison, the GO terms include DNA integration. In addition, comparison between groups of Control_10h vs. Heat_10h and Control_18h vs. Heat_18h revealed that 125 genes were significantly upregulated in common between the two groups, whereas 21 genes were significantly downregulated in common, all these differentially expressed genes were found to be involved in stress response, DNA integration and unfolded protein response. Taken together, our results suggest that high temperature could activate the stress response at the early stage, and subsequently induce the bleaching and lysing through DNA integration and unfolded protein response, which are able to disrupt the balance of coral-zooxanthella symbiosis in the stony coral G. fascicularis. PMID:29487614

Arabidopsis GLUTATHIONE REDUCTASE1 Plays a Crucial Role in Leaf Responses to Intracellular Hydrogen Peroxide and in Ensuring Appropriate Gene Expression through Both Salicylic Acid and Jasmonic Acid Signaling Pathways1[C][W][OA

PubMed Central

Mhamdi, Amna; Hager, Jutta; Chaouch, Sejir; Queval, Guillaume; Han, Yi; Taconnat, Ludivine; Saindrenan, Patrick; Gouia, Houda; Issakidis-Bourguet, Emmanuelle; Renou, Jean-Pierre; Noctor, Graham

2010-01-01

Glutathione is a major cellular thiol that is maintained in the reduced state by glutathione reductase (GR), which is encoded by two genes in Arabidopsis (Arabidopsis thaliana; GR1 and GR2). This study addressed the role of GR1 in hydrogen peroxide (H2O2) responses through a combined genetic, transcriptomic, and redox profiling approach. To identify the potential role of changes in glutathione status in H2O2 signaling, gr1 mutants, which show a constitutive increase in oxidized glutathione (GSSG), were compared with a catalase-deficient background (cat2), in which GSSG accumulation is conditionally driven by H2O2. Parallel transcriptomics analysis of gr1 and cat2 identified overlapping gene expression profiles that in both lines were dependent on growth daylength. Overlapping genes included phytohormone-associated genes, in particular implicating glutathione oxidation state in the regulation of jasmonic acid signaling. Direct analysis of H2O2-glutathione interactions in cat2 gr1 double mutants established that GR1-dependent glutathione status is required for multiple responses to increased H2O2 availability, including limitation of lesion formation, accumulation of salicylic acid, induction of pathogenesis-related genes, and signaling through jasmonic acid pathways. Modulation of these responses in cat2 gr1 was linked to dramatic GSSG accumulation and modified expression of specific glutaredoxins and glutathione S-transferases, but there is little or no evidence of generalized oxidative stress or changes in thioredoxin-associated gene expression. We conclude that GR1 plays a crucial role in daylength-dependent redox signaling and that this function cannot be replaced by the second Arabidopsis GR gene or by thiol systems such as the thioredoxin system. PMID:20488891

Arabidopsis GLUTATHIONE REDUCTASE1 plays a crucial role in leaf responses to intracellular hydrogen peroxide and in ensuring appropriate gene expression through both salicylic acid and jasmonic acid signaling pathways.

PubMed

Mhamdi, Amna; Hager, Jutta; Chaouch, Sejir; Queval, Guillaume; Han, Yi; Taconnat, Ludivine; Saindrenan, Patrick; Gouia, Houda; Issakidis-Bourguet, Emmanuelle; Renou, Jean-Pierre; Noctor, Graham

2010-07-01

Glutathione is a major cellular thiol that is maintained in the reduced state by glutathione reductase (GR), which is encoded by two genes in Arabidopsis (Arabidopsis thaliana; GR1 and GR2). This study addressed the role of GR1 in hydrogen peroxide (H(2)O(2)) responses through a combined genetic, transcriptomic, and redox profiling approach. To identify the potential role of changes in glutathione status in H(2)O(2) signaling, gr1 mutants, which show a constitutive increase in oxidized glutathione (GSSG), were compared with a catalase-deficient background (cat2), in which GSSG accumulation is conditionally driven by H(2)O(2). Parallel transcriptomics analysis of gr1 and cat2 identified overlapping gene expression profiles that in both lines were dependent on growth daylength. Overlapping genes included phytohormone-associated genes, in particular implicating glutathione oxidation state in the regulation of jasmonic acid signaling. Direct analysis of H(2)O(2)-glutathione interactions in cat2 gr1 double mutants established that GR1-dependent glutathione status is required for multiple responses to increased H(2)O(2) availability, including limitation of lesion formation, accumulation of salicylic acid, induction of pathogenesis-related genes, and signaling through jasmonic acid pathways. Modulation of these responses in cat2 gr1 was linked to dramatic GSSG accumulation and modified expression of specific glutaredoxins and glutathione S-transferases, but there is little or no evidence of generalized oxidative stress or changes in thioredoxin-associated gene expression. We conclude that GR1 plays a crucial role in daylength-dependent redox signaling and that this function cannot be replaced by the second Arabidopsis GR gene or by thiol systems such as the thioredoxin system.

FAS Death Receptor: A Breast Cancer Subtype-Specific Radiation Response Biomarker and Potential Therapeutic Target

PubMed Central

Horton, Janet K.; Siamakpour-Reihani, Sharareh; Lee, Chen-Ting; Zhou, Ying; Chen, Wei; Geradts, Joseph; Fels, Diane R.; Hoang, Peter; Ashcraft, Kathleen A.; Groth, Jeff; Kung, Hsiu-Ni; Dewhirst, Mark W.; Chi, Jen-Tsan A.

2015-01-01

Although a standardized approach to radiotherapy has been used to treat breast cancer, regardless of subtype (e.g., luminal, basal), recent clinical data suggest that radiation response may vary significantly among subtypes. We hypothesized that this clinical variability may be due, in part, to differences in cellular radiation response. In this study, we utilized RNA samples for microarray analysis from two sources: 1. Paired pre- and postirradiation breast tumor tissue from 32 early-stage breast cancer patients treated in our unique preoperative radiation Phase I trial; and 2. Sixteen biologically diverse breast tumor cell lines exposed to 0 and 5 Gy irradiation. The transcriptome response to radiation exposure was derived by comparing gene expression in samples before and after irradiation. Genes with the highest coefficient of variation were selected for further evaluation and validated at the RNA and protein level. Gene editing and agonistic antibody treatment were performed to assess the impact of gene modulation on radiation response. Gene expression in our cohort of luminal breast cancer patients was distinctly different before and after irradiation. Further, two distinct patterns of gene expression were observed in our biologically diverse group of breast cancer cell lines pre- versus postirradiation. Cell lines that showed significant change after irradiation were largely luminal subtype, while gene expression in the basal and HER2+ cell lines was minimally impacted. The 100 genes with the most significant response to radiation in patients were identified and analyzed for differential patterns of expression in the radiation-responsive versus nonresponsive cell lines. Fourteen genes were identified as significant, including FAS, a member of the tumor necrosis factor receptor family known to play a critical role in programed cell death. Modulation of FAS in breast cancer cell lines altered radiation response phenotype and enhanced radiation sensitivity in radioresistant basal cell lines. Our findings suggest that cell-type-specific, radiation-induced FAS contributes to subtype-specific breast cancer radiation response and that activation of FAS pathways may be exploited for biologically tailored radiotherapy. PMID:26488758

Transcriptome analysis uncovers Arabidopsis F-BOX STRESS INDUCED 1 as a regulator of jasmonic acid and abscisic acid stress gene expression.

PubMed

Gonzalez, Lauren E; Keller, Kristen; Chan, Karen X; Gessel, Megan M; Thines, Bryan C

2017-07-17

The ubiquitin 26S proteasome system (UPS) selectively degrades cellular proteins, which results in physiological changes to eukaryotic cells. F-box proteins are substrate adaptors within the UPS and are responsible for the diversity of potential protein targets. Plant genomes are enriched in F-box genes, but the vast majority of these have unknown roles. This work investigated the Arabidopsis F-box gene F-BOX STRESS INDUCED 1 (FBS1) for its effects on gene expression in order elucidate its previously unknown biological function. Using publically available Affymetrix ATH1 microarray data, we show that FBS1 is significantly co-expressed in abiotic stresses with other well-characterized stress response genes, including important stress-related transcriptional regulators. This gene suite is most highly expressed in roots under cold and salt stresses. Transcriptome analysis of fbs1-1 knock-out plants grown at a chilling temperature shows that hundreds of genes require FBS1 for appropriate expression, and that these genes are enriched in those having roles in both abiotic and biotic stress responses. Based on both this genome-wide expression data set and quantitative real-time PCR (qPCR) analysis, it is apparent that FBS1 is required for elevated expression of many jasmonic acid (JA) genes that have established roles in combatting environmental stresses, and that it also controls a subset of JA biosynthesis genes. FBS1 also significantly impacts abscisic acid (ABA) regulated genes, but this interaction is more complex, as FBS1 has both positive and negative effects on ABA-inducible and ABA-repressible gene modules. One noteworthy effect of FBS1 on ABA-related stress processes, however, is the restraint it imposes on the expression of multiple class I LIPID TRANSFER PROTEIN (LTP) gene family members that have demonstrated protective effects in water deficit-related stresses. FBS1 impacts plant stress responses by regulating hundreds of genes that respond to the plant stress hormones JA and ABA. The positive effect that FBS1 has on JA processes and the negative effect it has on at least some ABA processes indicates that it in part regulates cellular responses balanced between these two important stress hormones. More broadly then, FBS1 may aid plant cells in switching between certain biotic (JA) and abiotic (ABA) stress responses. Finally, because FBS1 regulates a subset of JA biosynthesis and response genes, we conclude that it might have a role in tuning hormone responses to particular circumstances at the transcriptional level.

Engineering Values into Genetic Engineering: A Proposed Analytic Framework for Scientific Social Responsibility

PubMed Central

Cho, Mildred K.

2016-01-01

Recent experiments have been used to “edit” genomes of various plant, animal and other species, including humans, with unprecedented precision. Furthermore, editing Cas9 endonuclease gene with a gene encoding the desired guide RNA into an organism, adjacent to an altered gene, could create a “gene drive” that could spread a trait through an entire population of organisms. These experiments represent advances along a spectrum of technological abilities that genetic engineers have been working on since the advent of recombinant DNA techniques. The scientific and bioethics communities have built substantial literatures about the ethical and policy implications of genetic engineering, especially in the age of bioterrorism. However, recent CRISPr/Cas experiments have triggered a rehashing of previous policy discussions, suggesting that the scientific community requires guidance on how to think about social responsibility. We propose a framework to enable analysis of social responsibility, using two examples of genetic engineering experiments. PMID:26632356

Engineering Values Into Genetic Engineering: A Proposed Analytic Framework for Scientific Social Responsibility.

PubMed

Sankar, Pamela L; Cho, Mildred K

2015-01-01

Recent experiments have been used to "edit" genomes of various plant, animal and other species, including humans, with unprecedented precision. Furthermore, editing the Cas9 endonuclease gene with a gene encoding the desired guide RNA into an organism, adjacent to an altered gene, could create a "gene drive" that could spread a trait through an entire population of organisms. These experiments represent advances along a spectrum of technological abilities that genetic engineers have been working on since the advent of recombinant DNA techniques. The scientific and bioethics communities have built substantial literatures about the ethical and policy implications of genetic engineering, especially in the age of bioterrorism. However, recent CRISPr/Cas experiments have triggered a rehashing of previous policy discussions, suggesting that the scientific community requires guidance on how to think about social responsibility. We propose a framework to enable analysis of social responsibility, using two examples of genetic engineering experiments.

Screening for modulators of cisplatin sensitivity: unbiased screens reveal common themes.

PubMed

Nijwening, Jeroen H; Kuiken, Hendrik J; Beijersbergen, Roderick L

2011-02-01

Cisplatin is a widely used chemotherapeutic agent to treat a variety of solid tumors. The cytotoxic mode of action of cisplatin is mediated by inducing conformational changes in DNA including intra- and inter-strand crosslink adducts. Recognition of these adducts results in the activation of the DNA damage response resulting in cell cycle arrest, repair, and potentially, apoptosis. Despite the clinical efficacy of cisplatin, many tumors are either intrinsically resistant or acquire resistance during treatment. The identification of cisplatin drug response modulators can help us understand these resistance mechanisms, provide biomarkers for treatment strategies, or provide drug targets for combination therapy. Here we discuss functional genetic screens, including one performed by us, set up to identify genes whose inhibition results in increased sensitivity to cisplatin. In summary, the validated genes identified in these screens mainly operate in DNA damage response including nucleotide excision repair, translesion synthesis, and homologous recombination.

Norepinephrine genes predict response time variability and methylphenidate-induced changes in neuropsychological function in attention deficit hyperactivity disorder.

PubMed

Kim, Bung-Nyun; Kim, Jae-Won; Cummins, Tarrant D R; Bellgrove, Mark A; Hawi, Ziarih; Hong, Soon-Beom; Yang, Young-Hui; Kim, Hyo-Jin; Shin, Min-Sup; Cho, Soo-Churl; Kim, Ji-Hoon; Son, Jung-Woo; Shin, Yun-Mi; Chung, Un-Sun; Han, Doug-Hyun

2013-06-01

Noradrenergic dysfunction may be associated with cognitive impairments in attention-deficit/hyperactivity disorder (ADHD), including increased response time variability, which has been proposed as a leading endophenotype for ADHD. The aim of this study was to examine the relationship between polymorphisms in the α-2A-adrenergic receptor (ADRA2A) and norepinephrine transporter (SLC6A2) genes and attentional performance in ADHD children before and after pharmacological treatment.One hundred one medication-naive ADHD children were included. All subjects were administered methylphenidate (MPH)-OROS for 12 weeks. The subjects underwent a computerized comprehensive attention test to measure the response time variability at baseline before MPH treatment and after 12 weeks. Additive regression analyses controlling for ADHD symptom severity, age, sex, IQ, and final dose of MPH examined the association between response time variability on the comprehensive attention test measures and allelic variations in single-nucleotide polymorphisms of the ADRA2A and SLC6A2 before and after MPH treatment.Increasing possession of an A allele at the G1287A polymorphism of SLC6A2 was significantly related to heightened response time variability at baseline in the sustained (P = 2.0 × 10) and auditory selective attention (P = 1.0 × 10) tasks. Response time variability at baseline increased additively with possession of the T allele at the DraI polymorphism of the ADRA2A gene in the auditory selective attention task (P = 2.0 × 10). After medication, increasing possession of a G allele at the MspI polymorphism of the ADRA2A gene was associated with increased MPH-related change in response time variability in the flanker task (P = 1.0 × 10).Our study suggested an association between norepinephrine gene variants and response time variability measured at baseline and after MPH treatment in children with ADHD. Our results add to a growing body of evidence, suggesting that response time variability is a viable endophenotype for ADHD and suggesting its utility as a surrogate end point for measuring stimulant response in pharmacogenetic studies.

The homeodomain-leucine zipper (HD-Zip) class I transcription factors ATHB7 and ATHB12 modulate abscisic acid signalling by regulating protein phosphatase 2C and abscisic acid receptor gene activities.

PubMed

Valdés, Ana Elisa; Overnäs, Elin; Johansson, Henrik; Rada-Iglesias, Alvaro; Engström, Peter

2012-11-01

Plants perceiving drought activate multiple responses to improve survival, including large-scale alterations in gene expression. This article reports on the roles in the drought response of two Arabidopsis thaliana homeodomain-leucine zipper class I genes; ATHB7 and ATHB12, both strongly induced by water-deficit and abscisic acid (ABA). ABA-mediated transcriptional regulation of both genes is shown to depend on the activity of protein phosphatases type 2C (PP2C). ATHB7 and ATHB12 are, thus, targets of the ABA signalling mechanism defined by the PP2Cs and the PYR/PYL family of ABA receptors, with which the PP2C proteins interact. Our results from chromatin immunoprecipitation and gene expression analyses demonstrate that ATHB7 and ATHB12 act as positive transcriptional regulators of PP2C genes, and thereby as negative regulators of abscisic acid signalling. In support of this notion, our results also show that ATHB7 and ATHB12 act to repress the transcription of genes encoding the ABA receptors PYL5 and PYL8 in response to an ABA stimulus. In summary, we demonstrate that ATHB7 and ATHB12 have essential functions in the primary response to drought, as mediators of a negative feedback effect on ABA signalling in the plant response to water deficit.

Salt and drought stress and ABA responses related to bZIP genes from V. radiata and V. angularis.

PubMed

Wang, Lanfen; Zhu, Jifeng; Li, Xiaoming; Wang, Shumin; Wu, Jing

2018-04-20

Mung bean and adzuki bean are warm-season legumes widely cultivated in China. However, bean production in major producing regions is limited by biotic and abiotic stress, such as drought and salt stress. Basic leucine zipper (bZIP) genes play key roles in responses to various biotic and abiotic stresses. However, only several bZIP genes involved in drought and salt stress in legumes, especially Vigna radiata and Vigna angularis, have been identified. In this study, we identified 54 and 50 bZIP proteins from whole-genome sequences of V. radiata and V. angularis, respectively. First, we comprehensively surveyed the characteristics of all bZIP genes, including their gene structure, chromosome distribution and motif composition. Phylogenetic trees showed that VrbZIP and VabZIP proteins were divided into ten clades comprising nine known and one unknown subgroup. The results of the nucleotide substitution rate of the orthologous gene pairs showed that bZIP proteins have undergone strong purifying selection: V. radiata and V. angularis diverged 1.25 million years ago (mya) to 9.20 mya (average of 4.95 mya). We also found that many cis-acting regulatory elements (CAREs) involved in abiotic stress and plant hormone responses were detected in the putative promoter regions of the bZIP genes. Finally, using the quantitative real-time PCR (qRT-PCR) method, we performed expression profiling of the bZIP genes in response to drought, salt and abscisic acid (ABA). We identified several bZIP genes that may be involved in drought and salt responses. Generally, our results provided useful and rich resources of VrbZIP and VabZIP genes for the functional characterization and understanding of bZIP transcription factors (TFs) in warm-season legumes. In addition, our results revealed important and interesting data - a subset of VrbZIP and VabZIP gene expression profiles in response to drought, salt and ABA stress. These results provide gene expression evidence for the selection of candidate genes under drought and salt stress for future study. Copyright © 2018 Elsevier B.V. All rights reserved.

Drought response in wheat: key genes and regulatory mechanisms controlling root system architecture and transpiration efficiency

NASA Astrophysics Data System (ADS)

Kulkarni, Manoj; Soolanayakanahally, Raju; Ogawa, Satoshi; Uga, Yusaku; Selvaraj, Michael G.; Kagale, Sateesh

2017-12-01

Abiotic stresses such as drought, heat, salinity and flooding threaten global food security. Crop genetic improvement with increased resilience to abiotic stresses is a critical component of crop breeding strategies. Wheat is an important cereal crop and a staple food source globally. Enhanced drought tolerance in wheat is critical for sustainable food production and global food security. Recent advances in drought tolerance research have uncovered many key genes and transcription regulators governing morpho-physiological traits. Genes controlling root architecture and stomatal development play an important role in soil moisture extraction and its retention, and therefore have been targets of molecular breeding strategies for improving drought tolerance. In this systematic review, we have summarized evidence of beneficial contributions of root and stomatal traits to plant adaptation to drought stress. Specifically, we discuss a few key genes such as DRO1 in rice and ERECTA in Arabidopsis and rice that were identified to be the enhancers of drought tolerance via regulation of root traits and transpiration efficiency. Additionally, we highlight several transcription factor families, such as ERF (ethylene response factors), DREB (dehydration responsive element binding), ZFP (zinc finger proteins), WRKY and MYB that were identified to be both positive and negative regulators of drought responses in wheat, rice, maize and/or Arabidopsis. The overall aim of this review was to provide an overview of candidate genes that have been tested as regulators of drought response in plants. The lack of a reference genome sequence for wheat and nontransgenic approaches for manipulation of gene functions in the past had impeded high-resolution interrogation of functional elements, including genes and QTLs, and their application in cultivar improvement. The recent developments in wheat genomics and reverse genetics, including the availability of a gold-standard reference genome sequence and advent genome editing technologies, are expected to aid in deciphering of the functional roles of genes and regulatory networks underlying adaptive phenological traits, and utilizing the outcomes of such studies in developing drought tolerance cultivars.

Drought Response in Wheat: Key Genes and Regulatory Mechanisms Controlling Root System Architecture and Transpiration Efficiency.

PubMed

Kulkarni, Manoj; Soolanayakanahally, Raju; Ogawa, Satoshi; Uga, Yusaku; Selvaraj, Michael G; Kagale, Sateesh

2017-01-01

Abiotic stresses such as, drought, heat, salinity, and flooding threaten global food security. Crop genetic improvement with increased resilience to abiotic stresses is a critical component of crop breeding strategies. Wheat is an important cereal crop and a staple food source globally. Enhanced drought tolerance in wheat is critical for sustainable food production and global food security. Recent advances in drought tolerance research have uncovered many key genes and transcription regulators governing morpho-physiological traits. Genes controlling root architecture and stomatal development play an important role in soil moisture extraction and its retention, and therefore have been targets of molecular breeding strategies for improving drought tolerance. In this systematic review, we have summarized evidence of beneficial contributions of root and stomatal traits to plant adaptation to drought stress. Specifically, we discuss a few key genes such as, DRO1 in rice and ERECTA in Arabidopsis and rice that were identified to be the enhancers of drought tolerance via regulation of root traits and transpiration efficiency. Additionally, we highlight several transcription factor families, such as, ERF (ethylene response factors), DREB (dehydration responsive element binding), ZFP (zinc finger proteins), WRKY, and MYB that were identified to be both positive and negative regulators of drought responses in wheat, rice, maize, and/or Arabidopsis. The overall aim of this review is to provide an overview of candidate genes that have been identified as regulators of drought response in plants. The lack of a reference genome sequence for wheat and non-transgenic approaches for manipulation of gene functions in wheat in the past had impeded high-resolution interrogation of functional elements, including genes and QTLs, and their application in cultivar improvement. The recent developments in wheat genomics and reverse genetics, including the availability of a gold-standard reference genome sequence and advent of genome editing technologies, are expected to aid in deciphering of the functional roles of genes and regulatory networks underlying adaptive phenological traits, and utilizing the outcomes of such studies in developing drought tolerant cultivars.

Clinical response to chemotherapy in locally advanced breast cancer was not associated with several polymorphisms in detoxification enzymes and DNA repair genes.

PubMed

Saadat, Mostafa; Khalili, Maryam; Nasiri, Meysam; Rajaei, Mehrdad; Omidvari, Shahpour; Saadat, Iraj

2012-03-02

The main aim of the present study was to investigate the association between several genetic polymorphisms (in glutathione S-transferase members and DNA repair genes) and clinical response to chemotherapy in locally advanced breast cancer. A sequential series of 101 patients were prospectively included in this study. Clinical assessment of treatment was accomplished by comparing initial tumor size with preoperative tumor size using revised RECIST guideline (version 1.1). Clinical response was regarded as a response or no response. There was no difference between non-responders and responders for the prevalence of genotypes of the study polymorphisms. Copyright © 2012 Elsevier Inc. All rights reserved.

The Arabidopsis endoplasmic reticulum associated degradation pathways are involved in the regulation of heat stress response

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Lin-Mao; University of Chinese Academy of Sciences, Beijing; Lü, Shi-You

Abstracts: The Cytosolic Protein Response (CPR) in the cytosol and the Unfolded Protein Response (UPR) and ER-associated degradation (ERAD) in the endoplasmic reticulum are major pathways of the cellular proteostasis network. However, despite years of effort, how these protein quality control systems coordinated in vivo remains largely unknown, particularly in plants. In this study, the roles of two evolutionarily conserved ERAD pathways (DOA10 and HRD1) in heat stress response were investigated through reverse genetic approaches in Arabidopsis. Phenotypic analysis of the mutants showed that the two ERAD pathways additively play negative roles in heat tolerance, which was demonstrated by higher survivalmore » rate and lower electrolyte leakage in the loss of function mutants compared to the wild type plants. Importantly, gene expression analysis revealed that the mutant plants showed elevated transcriptional regulation of several downstream genes, including those encoding CPR and UPR marker genes, under both basal and heat stress conditions. Finally, multiple components of ERAD genes exhibited rapid response to increasing temperature. Taken together, our data not only unravels key insights into the crosstalk between different protein quality control processes, but also provides candidate genes to genetically improve plant heat tolerance in the future. - Highlights: • ERAD pathways cooperatively regulate plant thermotolerance. • ERAD pathways cooperatively regulate UPR and CPR. • ERAD components gene expression are upregulated by heat stress.« less

Disrupting effects of antibiotic sulfathiazole on developmental process during sensitive life-cycle stage of Chironomus riparius.

PubMed

Park, Kiyun; Kwak, Ihn-Sil

2018-01-01

Antibiotics in the environment are a concern due to their potential to harm humans and interrupt ecosystems. Sulfathiazole (STZ), a sulfonamide antibiotic, is commonly used in aquaculture and is typically found in aquatic ecosystems. We evaluated the ecological risk of STZ by examining biological, molecular and biochemical response in Chironomus riparius. Samples were exposed to STZ for 12, 24 and 96 h, and effects of STZ were evaluated at the molecular level by analyzing changes in gene expression related to the endocrine system, cellular stress response and enzyme activity of genes on antioxidant and detoxification pathways. STZ exposure induced significant effects on survival, growth and sex ratio of emergent adults and mouthpart deformity in C. riparius. STZ caused concentration and time-dependent toxicity in most of the selected biomarkers. STZ exposure leads to significant heat-shock response of protein genes (HSP70, HSP40, HSP90 and HSP27) and to disruption by up-regulating selected genes, including the ecdysone receptor gene, estrogen-related receptors, ultraspiracle and E74 early ecdysone-responsive gene. Furthermore, STZ induced alteration of enzyme activities on antioxidant and detoxification responses (catalase, superoxide dismutase, glutathione peroxidase and peroxidase) in C. riparius. By inducing oxidative stress, antibiotic STZ disturbs the endocrine system and produces adverse effects in growth processes of invertebrates. Copyright © 2017 Elsevier Ltd. All rights reserved.

Comparative Analysis of Toxic Responses of Organic Extracts from Diesel and Selected Alternative Fuels Engine Emissions in Human Lung BEAS-2B Cells.

PubMed

Libalova, Helena; Rossner, Pavel; Vrbova, Kristyna; Brzicova, Tana; Sikorova, Jitka; Vojtisek-Lom, Michal; Beranek, Vit; Klema, Jiri; Ciganek, Miroslav; Neca, Jiri; Pencikova, Katerina; Machala, Miroslav; Topinka, Jan

2016-11-03

This study used toxicogenomics to identify the complex biological response of human lung BEAS-2B cells treated with organic components of particulate matter in the exhaust of a diesel engine. First, we characterized particles from standard diesel (B0), biodiesel (methylesters of rapeseed oil) in its neat form (B100) and 30% by volume blend with diesel fuel (B30), and neat hydrotreated vegetable oil (NEXBTL100). The concentration of polycyclic aromatic hydrocarbons (PAHs) and their derivatives in organic extracts was the lowest for NEXBTL100 and higher for biodiesel. We further analyzed global gene expression changes in BEAS-2B cells following 4 h and 24 h treatment with extracts. The concentrations of 50 µg extract/mL induced a similar molecular response. The common processes induced after 4 h treatment included antioxidant defense, metabolism of xenobiotics and lipids, suppression of pro-apoptotic stimuli, or induction of plasminogen activating cascade; 24 h treatment affected fewer processes, particularly those involved in detoxification of xenobiotics, including PAHs. The majority of distinctively deregulated genes detected after both 4 h and 24 h treatment were induced by NEXBTL100; the deregulated genes included, e.g., those involved in antioxidant defense and cell cycle regulation and proliferation. B100 extract, with the highest PAH concentrations, additionally affected several cell cycle regulatory genes and p38 signaling.

Molecular Adaptations to Social Defeat Stress and Induced Depression in Mice.

PubMed

Bondar, Natalya; Bryzgalov, Leonid; Ershov, Nikita; Gusev, Fedor; Reshetnikov, Vasiliy; Avgustinovich, Damira; Tenditnik, Mikhail; Rogaev, Evgeny; Merkulova, Tatiana

2018-04-01

Chronic stress is a risk factor for major depression. Social defeat stress is a well-validated murine model of depression. However, little is known about the gene activity dynamics during the development of a depression-like state. We analyzed the effects of social defeat stress of varying duration (10 and 30 days) on the behavioral patterns and prefrontal-cortex transcriptome of C57BL/6 mice. The 10-day exposure to social defeat stress resulted in a high level of social avoidance with no signs of depression-associated behavior. Most animals exposed to 30 days of social defeat stress demonstrated clear hallmarks of depression, including a higher level of social avoidance, increased immobility in the forced swimming test, and anhedonic behavior. The monitoring of transcriptome changes revealed widespread alterations in gene expression on the 10th day. Surprisingly, the expression of only a few genes were affected by the 30th day of stress, apparently due to a reversal of the majority of the early stress-induced changes to the original basal state. Moreover, we have found that glucocorticoid-sensitive genes are clearly stimulated targets on the 10th day of stress, but these genes stop responding to the elevated corticosterone level by the 30th day of stress. The majority of genes altered by the 30-day stress were downregulated, with the most relevant ones participating in chromatin modifications and neuroplasticity (e.g., guanine nucleotide exchange factors of the Rho-family of GTPases). Very different molecular responses occur during short-term and long-term social stress in mice. The early-stress response is associated with social avoidance and with upregulation and downregulation of many genes, including those related to signal transduction and cell adhesion pathways. Downregulation of a few genes, in particular, genes for histone-modifying methyltransferases, is a signature response to prolonged stress that induces symptoms of depression. Altogether, our data show that the development of depression under social stress conditions is correlated with suppression of the overactive molecular response to induced stress, involving gene regulatory resistance to glucocorticoid molecules, potentially via a chromatin remodeling mechanism.

Hemocyanins Stimulate Innate Immunity by Inducing Different Temporal Patterns of Proinflammatory Cytokine Expression in Macrophages.

PubMed

Zhong, Ta-Ying; Arancibia, Sergio; Born, Raimundo; Tampe, Ricardo; Villar, Javiera; Del Campo, Miguel; Manubens, Augusto; Becker, María Inés

2016-06-01

Hemocyanins induce a potent Th1-dominant immune response with beneficial clinical outcomes when used as a carrier/adjuvant in vaccines and nonspecific immunostimulant in cancer. However, the mechanisms by which hemocyanins trigger innate immune responses, leading to beneficial adaptive immune responses, are unknown. This response is triggered by a proinflammatory signal from various components, of which macrophages are an essential part. To understand how these proteins influence macrophage response, we investigated the effects of mollusks hemocyanins with varying structural and immunological properties, including hemocyanins from Concholepas concholepas, Fissurella latimarginata, and Megathura crenulata (keyhole limpet hemocyanin), on cultures of peritoneal macrophages. Hemocyanins were phagocytosed and slowly processed. Analysis of this process showed differential gene expression along with protein levels of proinflammatory markers, including IL-1β, IL-6, IL-12p40, and TNF-α. An extended expression analysis of 84 cytokines during a 24-h period showed a robust proinflammatory response for F. latimarginata hemocyanin in comparison with keyhole limpet hemocyanin and C. concholepas hemocyanin, which was characterized by an increase in the transcript levels of M1 cytokines involved in leukocyte recruitment. These cytokine genes included chemokines (Cxcl1, Cxcl3, Cxcl5, Ccl2, and Ccl3), ILs (Il1b and Ifng), growth factors (Csf2 and Csf3), and TNF family members (Cd40lg). The protein levels of certain cytokines were increased. However, every hemocyanin maintains downregulated key M2 cytokine genes, including Il4 and Il5 Collectively, our data demonstrate that hemocyanins are able to trigger the release of proinflammatory factors with different patterns of cytokine expression, suggesting differential signaling pathways and transcriptional network mechanisms that lead to the activation of M1-polarized macrophages. Copyright © 2016 by The American Association of Immunologists, Inc.

Hemocyanins Stimulate Innate Immunity by Inducing Different Temporal Patterns of Proinflammatory Cytokine Expression in Macrophages

PubMed Central

Zhong, Ta-Ying; Arancibia, Sergio; Born, Raimundo; Tampe, Ricardo; Villar, Javiera; Del Campo, Miguel; Manubens, Augusto

2016-01-01

Hemocyanins induce a potent Th1-dominant immune response with beneficial clinical outcomes when used as a carrier/adjuvant in vaccines and nonspecific immunostimulant in cancer. However, the mechanisms by which hemocyanins trigger innate immune responses, leading to beneficial adaptive immune responses, are unknown. This response is triggered by a proinflammatory signal from various components, of which macrophages are an essential part. To understand how these proteins influence macrophage response, we investigated the effects of mollusks hemocyanins with varying structural and immunological properties, including hemocyanins from Concholepas concholepas, Fissurella latimarginata, and Megathura crenulata (keyhole limpet hemocyanin), on cultures of peritoneal macrophages. Hemocyanins were phagocytosed and slowly processed. Analysis of this process showed differential gene expression along with protein levels of proinflammatory markers, including IL-1β, IL-6, IL-12p40, and TNF-α. An extended expression analysis of 84 cytokines during a 24-h period showed a robust proinflammatory response for F. latimarginata hemocyanin in comparison with keyhole limpet hemocyanin and C. concholepas hemocyanin, which was characterized by an increase in the transcript levels of M1 cytokines involved in leukocyte recruitment. These cytokine genes included chemokines (Cxcl1, Cxcl3, Cxcl5, Ccl2, and Ccl3), ILs (Il1b and Ifng), growth factors (Csf2 and Csf3), and TNF family members (Cd40lg). The protein levels of certain cytokines were increased. However, every hemocyanin maintains downregulated key M2 cytokine genes, including Il4 and Il5. Collectively, our data demonstrate that hemocyanins are able to trigger the release of proinflammatory factors with different patterns of cytokine expression, suggesting differential signaling pathways and transcriptional network mechanisms that lead to the activation of M1-polarized macrophages. PMID:27183578

Mechanism of Gene Expression of Arabidopsis Glutathione S-Transferase, AtGST1, and AtGST11 in Response to Aluminum Stress1

PubMed Central

Ezaki, Bunichi; Suzuki, Masakatsu; Motoda, Hirotoshi; Kawamura, Masako; Nakashima, Susumu; Matsumoto, Hideaki

2004-01-01

The gene expression of two Al-induced Arabidopsis glutathione S-transferase genes, AtGST1 and AtGST11, was analyzed to investigate the mechanism underlying the response to Al stress. An approximately 1-kb DNA fragment of the 5′-upstream region of each gene was fused to a β-glucuronidase (GUS) reporter gene (pAtGST1::GUS and pAtGST11::GUS) and introduced into Arabidopsis ecotype Landsberg erecta. The constructed transgenic lines showed a time-dependent gene expression to a different degree in the root and/or leaf by Al stress. The pAtGST1::GUS gene was induced after a short Al treatment (maximum expression after a 2-h exposure), while the pAtGST11::GUS gene was induced by a longer Al treatment (approximately 8 h for maximum expression). Since the gene expression was observed in the leaf when only the root was exposed to Al stress, a signaling system between the root and shoot was suggested in Al stress. A GUS staining experiment using an adult transgenic line carrying the pAtGST11::GUS gene supported this suggestion. Furthermore, Al treatment simultaneously with various Ca depleted conditions in root region enhanced the gene expression of the pAtGST11::GUS in the shoot region. This result suggested that the degree of Al toxicity in the root reflects the gene response of pAtGST11::GUS in the shoot via the deduced signaling system. Both transgenic lines also showed an increase of GUS activity after cold stress, heat stress, metal toxicity, and oxidative damages, suggesting a common induction mechanism in response to the tested stresses including Al stress. PMID:15047894

Estradiol-induced gene expression in largemouth bass (Micropterus salmoides)

USGS Publications Warehouse

Bowman, C.J.; Kroll, K.J.; Gross, T.G.; Denslow, N.D.

2002-01-01

Vitellogenin (Vtg) and estrogen receptor (ER) gene expression levels were measured in largemouth bass to evaluate the activation of the ER-mediated pathway by estradiol (E2). Single injections of E2 ranging from 0.0005 to 5 mg/kg up-regulated plasma Vtg in a dose-dependent manner. Vtg and ER mRNAs were measured using partial cDNA sequences corresponding to the C-terminal domain for Vtg and the ligand-binding domain of ER?? sequences. After acute E2-exposures (2 mg/kg), Vtg and ER mRNAs and plasma Vtg levels peaked after 2 days. The rate of ER mRNA accumulation peaked 36-42 h earlier than Vtg mRNA. The expression window for ER defines the primary response to E2 in largemouth bass and that for Vtg a delayed primary response. The specific effect of E2 on other estrogen-regulated genes was tested during these same time windows using differential display RT-PCR. Specific up-regulated genes that are expressed in the same time window as Vtg were ERp72 (a membrane-bound disulfide isomerase) and a gene with homology to an expressed gene identified in zebrafish. Genes that were expressed in a pattern that mimics the ER include the gene for zona radiata protein ZP2, and a gene with homology to an expressed gene found in winter flounder. One gene for fibrinogen ?? was down-regulated and an unidentified gene was transiently up-regulated after 12 h of exposure and returned to basal levels by 48 h. Taken together these studies indicate that the acute molecular response to E2 involves a complex network of responses over time. ?? 2002 Elsevier Science Ireland Ltd. All rights reserved.

Quantitative statistical analysis of cis-regulatory sequences in ABA/VP1- and CBF/DREB1-regulated genes of Arabidopsis.

PubMed

Suzuki, Masaharu; Ketterling, Matthew G; McCarty, Donald R

2005-09-01

We have developed a simple quantitative computational approach for objective analysis of cis-regulatory sequences in promoters of coregulated genes. The program, designated MotifFinder, identifies oligo sequences that are overrepresented in promoters of coregulated genes. We used this approach to analyze promoter sequences of Viviparous1 (VP1)/abscisic acid (ABA)-regulated genes and cold-regulated genes, respectively, of Arabidopsis (Arabidopsis thaliana). We detected significantly enriched sequences in up-regulated genes but not in down-regulated genes. This result suggests that gene activation but not repression is mediated by specific and common sequence elements in promoters. The enriched motifs include several known cis-regulatory sequences as well as previously unidentified motifs. With respect to known cis-elements, we dissected the flanking nucleotides of the core sequences of Sph element, ABA response elements (ABREs), and the C repeat/dehydration-responsive element. This analysis identified the motif variants that may correlate with qualitative and quantitative differences in gene expression. While both VP1 and cold responses are mediated in part by ABA signaling via ABREs, these responses correlate with unique ABRE variants distinguished by nucleotides flanking the ACGT core. ABRE and Sph motifs are tightly associated uniquely in the coregulated set of genes showing a strict dependence on VP1 and ABA signaling. Finally, analysis of distribution of the enriched sequences revealed a striking concentration of enriched motifs in a proximal 200-base region of VP1/ABA and cold-regulated promoters. Overall, each class of coregulated genes possesses a discrete set of the enriched motifs with unique distributions in their promoters that may account for the specificity of gene regulation.

Systems approach identifies an organic nitrogen-responsive gene network that is regulated by the master clock control gene CCA1.

PubMed

Gutiérrez, Rodrigo A; Stokes, Trevor L; Thum, Karen; Xu, Xiaodong; Obertello, Mariana; Katari, Manpreet S; Tanurdzic, Milos; Dean, Alexis; Nero, Damion C; McClung, C Robertson; Coruzzi, Gloria M

2008-03-25

Understanding how nutrients affect gene expression will help us to understand the mechanisms controlling plant growth and development as a function of nutrient availability. Nitrate has been shown to serve as a signal for the control of gene expression in Arabidopsis. There is also evidence, on a gene-by-gene basis, that downstream products of nitrogen (N) assimilation such as glutamate (Glu) or glutamine (Gln) might serve as signals of organic N status that in turn regulate gene expression. To identify genome-wide responses to such organic N signals, Arabidopsis seedlings were transiently treated with ammonium nitrate in the presence or absence of MSX, an inhibitor of glutamine synthetase, resulting in a block of Glu/Gln synthesis. Genes that responded to organic N were identified as those whose response to ammonium nitrate treatment was blocked in the presence of MSX. We showed that some genes previously identified to be regulated by nitrate are under the control of an organic N-metabolite. Using an integrated network model of molecular interactions, we uncovered a subnetwork regulated by organic N that included CCA1 and target genes involved in N-assimilation. We validated some of the predicted interactions and showed that regulation of the master clock control gene CCA1 by Glu or a Glu-derived metabolite in turn regulates the expression of key N-assimilatory genes. Phase response curve analysis shows that distinct N-metabolites can advance or delay the CCA1 phase. Regulation of CCA1 by organic N signals may represent a novel input mechanism for N-nutrients to affect plant circadian clock function.

Quantitative expression profiling of immune response genes in rainbow trout following infectious haematopoietic necrosis virus (IHNV) infection or DNA vaccination

USGS Publications Warehouse

Purcell, Maureen K.; Kurath, Gael; Garver, Kyle A.; Herwig, Russell P.; Winton, James R.

2004-01-01

Infectious haematopoietic necrosis virus (IHNV) is a well-studied virus of salmonid fishes. A highly efficacious DNA vaccine has been developed against this virus and studies have demonstrated that this vaccine induces both an early and transient non-specific anti-viral phase as well as long-term specific protection. The mechanisms of the early anti-viral phase are not known, but previous studies noted changes in Mx gene expression, suggesting a role for type I interferon. This study used quantitative real-time reverse transcriptase PCR methodology to compare expression changes over time of a number of cytokine or cytokine-related genes in the spleen of rainbow trout following injection with poly I:C, live IHNV, the IHNV DNA vaccine or a control plasmid encoding the non-antigenic luciferase gene. The target genes included Mx-1, viral haemorrhagic septicaemia virus induced gene 8 (Vig-8), TNF-α1, TNF-α2, IL-1β1, IL-8, TGF-β1 and Hsp70. Poly I:C stimulation induced several genes but the strongest and significant response was observed in the Mx-1 and Vig-8 genes. The live IHN virus induced a significant response in all genes examined except TGF-β1. The control plasmid construct and the IHNV DNA vaccine marginally induced a number of genes, but the main difference between these two groups was a statistically significant induction of the Mx-1 and Vig-8 genes by the IHNV vaccine only. The gene expression profiles elicited by the live virus and the IHNV DNA vaccine differed in a number of aspects but this study confirms the clear role for a type I interferon-like response in early anti-viral defence.

Meta-type analysis of dopaminergic effects on gene expression in the neuroendocrine brain of female goldfish.

PubMed

Popesku, Jason T; Martyniuk, Christopher J; Trudeau, Vance L

2012-01-01

Dopamine (DA) is a major neurotransmitter important for neuroendocrine control and recent studies have described genomic signaling pathways activated and inhibited by DA agonists and antagonists in the goldfish brain. Here we perform a meta-type analysis using microarray datasets from experiments conducted with female goldfish to characterize the gene expression responses that underlie dopaminergic signaling. Sexually mature, pre-spawning [gonadosomatic index (GSI) = 4.5 ± 1.3%] or sexually regressing (GSI = 3 ± 0.4%) female goldfish (15-40 g) injected intraperitoneally with either SKF 38393, LY 171555, SCH 23390, sulpiride, or a combination of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine and α-methyl-p-tyrosine. Microarray meta-type analysis identified 268 genes in the telencephalon and hypothalamus as having reciprocal (i.e., opposite between agonism and antagonism/depletion) fold change responses, suggesting that these transcripts are likely targets for DA-mediated regulation. Noteworthy genes included ependymin, vimentin, and aromatase, genes that support the significance of DA in neuronal plasticity and tissue remodeling. Sub-network enrichment analysis (SNEA) was used to identify common gene regulators and binding proteins associated with the differentially expressed genes mediated by DA. SNEA analysis identified gene expression targets that were related to three major categories that included cell signaling (STAT3, SP1, SMAD, Jun/Fos), immune response (IL-6, IL-1β, TNFs, cytokine, NF-κB), and cell proliferation and growth (IGF1, TGFβ1). These gene networks are also known to be associated with neurodegenerative disorders such as Parkinsons' disease, well-known to be associated with loss of dopaminergic neurons. This study identifies genes and networks that underlie DA signaling in the vertebrate CNS and provides targets that may be key neuroendocrine regulators. The results provide a foundation for future work on dopaminergic regulation of gene expression in fish model systems.

Meta-Type Analysis of Dopaminergic Effects on Gene Expression in the Neuroendocrine Brain of Female Goldfish

PubMed Central

Popesku, Jason T.; Martyniuk, Christopher J.; Trudeau, Vance L.

2012-01-01

Dopamine (DA) is a major neurotransmitter important for neuroendocrine control and recent studies have described genomic signaling pathways activated and inhibited by DA agonists and antagonists in the goldfish brain. Here we perform a meta-type analysis using microarray datasets from experiments conducted with female goldfish to characterize the gene expression responses that underlie dopaminergic signaling. Sexually mature, pre-spawning [gonadosomatic index (GSI) = 4.5 ± 1.3%] or sexually regressing (GSI = 3 ± 0.4%) female goldfish (15–40 g) injected intraperitoneally with either SKF 38393, LY 171555, SCH 23390, sulpiride, or a combination of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine and α-methyl-p-tyrosine. Microarray meta-type analysis identified 268 genes in the telencephalon and hypothalamus as having reciprocal (i.e., opposite between agonism and antagonism/depletion) fold change responses, suggesting that these transcripts are likely targets for DA-mediated regulation. Noteworthy genes included ependymin, vimentin, and aromatase, genes that support the significance of DA in neuronal plasticity and tissue remodeling. Sub-network enrichment analysis (SNEA) was used to identify common gene regulators and binding proteins associated with the differentially expressed genes mediated by DA. SNEA analysis identified gene expression targets that were related to three major categories that included cell signaling (STAT3, SP1, SMAD, Jun/Fos), immune response (IL-6, IL-1β, TNFs, cytokine, NF-κB), and cell proliferation and growth (IGF1, TGFβ1). These gene networks are also known to be associated with neurodegenerative disorders such as Parkinsons’ disease, well-known to be associated with loss of dopaminergic neurons. This study identifies genes and networks that underlie DA signaling in the vertebrate CNS and provides targets that may be key neuroendocrine regulators. The results provide a foundation for future work on dopaminergic regulation of gene expression in fish model systems. PMID:23130016

Mannosyltransferase is required for cell wall biosynthesis, morphology and control of asexual development in Neurospora crassa.

PubMed

Bowman, Shaun M; Piwowar, Amy; Ciocca, Maria; Free, Stephen J

2005-01-01

Two Neurospora mutants with a phenotype that includes a tight colonial growth pattern, an inability to form conidia and an inability to form protoperithecia have been isolated and characterized. The relevant mutations were mapped to the same locus on the sequenced Neurospora genome. The mutations responsible for the mutant phenotype then were identified by examining likely candidate genes from the mutant genomes at the mapped locus with PCR amplification and a sequencing assay. The results demonstrate that a map and sequence strategy is a feasible way to identify mutant genes in Neurospora. The gene responsible for the phenotype is a putative alpha-1,2-mannosyltransferase gene. The mutant cell wall has an altered composition demonstrating that the gene functions in cell wall biosynthesis. The results demonstrate that the mnt-1 gene is required for normal cell wall biosynthesis, morphology and for the regulation of asexual development.

Signaling events in pathogen-induced macrophage foam cell formation.

PubMed

Shaik-Dasthagirisaheb, Yazdani B; Mekasha, Samrawit; He, Xianbao; Gibson, Frank C; Ingalls, Robin R

2016-08-01

Macrophage foam cell formation is a key event in atherosclerosis. Several triggers induce low-density lipoprotein (LDL) uptake by macrophages to create foam cells, including infections with Porphyromonas gingivalis and Chlamydia pneumoniae, two pathogens that have been linked to atherosclerosis. While gene regulation during foam cell formation has been examined, comparative investigations to identify shared and specific pathogen-elicited molecular events relevant to foam cell formation are not well documented. We infected mouse bone marrow-derived macrophages with P. gingivalis or C. pneumoniae in the presence of LDL to induce foam cell formation, and examined gene expression using an atherosclerosis pathway targeted plate array. We found over 30 genes were significantly induced in response to both pathogens, including PPAR family members that are broadly important in atherosclerosis and matrix remodeling genes that may play a role in plaque development and stability. Six genes mainly involved in lipid transport were significantly downregulated. The response overall was remarkably similar and few genes were regulated in a pathogen-specific manner. Despite very divergent lifestyles, P. gingivalis and C. pneumoniae activate similar gene expression profiles during foam cell formation that may ultimately serve as targets for modulating infection-elicited foam cell burden, and progression of atherosclerosis. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Transcriptome analysis reveals mucin 4 to be highly associated with periodontitis and identifies pleckstrin as a link to systemic diseases

PubMed Central

Lundmark, Anna; Davanian, Haleh; Båge, Tove; Johannsen, Gunnar; Koro, Catalin; Lundeberg, Joakim; Yucel-Lindberg, Tülay

2015-01-01

The multifactorial chronic inflammatory disease periodontitis, which is characterized by destruction of tooth-supporting tissues, has also been implicated as a risk factor for various systemic diseases. Although periodontitis has been studied extensively, neither disease-specific biomarkers nor therapeutic targets have been identified, nor its link with systemic diseases. Here, we analyzed the global transcriptome of periodontitis and compared its gene expression profile with those of other inflammatory conditions, including cardiovascular disease (CVD), rheumatoid arthritis (RA), and ulcerative colitis (UC). Gingival biopsies from 62 patients with periodontitis and 62 healthy subjects were subjected to RNA sequencing. The up-regulated genes in periodontitis were related to inflammation, wounding and defense response, and apoptosis, whereas down-regulated genes were related to extracellular matrix organization and structural support. The most highly up-regulated gene was mucin 4 (MUC4), and its protein product was confirmed to be over-expressed in periodontitis. When comparing the expression profile of periodontitis with other inflammatory diseases, several gene ontology categories, including inflammatory response, cell death, cell motion, and homeostatic processes, were identified as common to all diseases. Only one gene, pleckstrin (PLEK), was significantly overexpressed in periodontitis, CVD, RA, and UC, implicating this gene as an important networking link between these chronic inflammatory diseases. PMID:26686060

Identification of defense-related genes newly-associated with tomato flower abscission.

PubMed

Meir, Shimon; Philosoph-Hadas, Sonia; Sundaresan, Srivignesh; Selvaraj, K S Vijay; Burd, Shaul; Ophir, Ron; Kochanek, K S Bettina; Reid, Michael S; Jiang, Cai-Zhong; Lers, Amnon

2011-04-01

The current abscission model suggests the formation of a post-abscission trans-differentiation of a protective layer as the last step of the process. The present report expands the repertoire of genes activated in the tomato flower abscission zone (AZ), which are likely to be involved in defense responses. We identified four different defense-related genes, including: Cysteine-type endopeptidase, α-Dioxygenase 1 (α-DOX1), HopW-1-1-Interacting protein2 (WIN2), and Stomatal-derived factor-2 (SDF2), that are newly-associated with the late stage of the abscission process. The late expression of these genes, induced at 8-14 h after flower removal when pedicel abscission was already in progress, was AZ-specific, and was inhibited by treatments that prevented pedicel abscission, including 1-methylcyclopropene pretreatment or IAA application. This information supports the activation of different defense responses and strategies at the late abscission stages, which may enable efficient protection of the exposed tissue toward different environmental stresses.

RecA Inhibitors Potentiate Antibiotic Activity and Block Evolution of Antibiotic Resistance.

PubMed

Alam, Md Kausar; Alhhazmi, Areej; DeCoteau, John F; Luo, Yu; Geyer, C Ronald

2016-03-17

Antibiotic resistance arises from the maintenance of resistance mutations or genes acquired from the acquisition of adaptive de novo mutations or the transfer of resistance genes. Antibiotic resistance is acquired in response to antibiotic therapy by activating SOS-mediated DNA repair and mutagenesis and horizontal gene transfer pathways. Initiation of the SOS pathway promotes activation of RecA, inactivation of LexA repressor, and induction of SOS genes. Here, we have identified and characterized phthalocyanine tetrasulfonic acid RecA inhibitors that block antibiotic-induced activation of the SOS response. These inhibitors potentiate the activity of bactericidal antibiotics, including members of the quinolone, β-lactam, and aminoglycoside families in both Gram-negative and Gram-positive bacteria. They reduce the ability of bacteria to acquire antibiotic resistance mutations and to transfer mobile genetic elements conferring resistance. This study highlights the advantage of including RecA inhibitors in bactericidal antibiotic therapies and provides a new strategy for prolonging antibiotic shelf life. Copyright © 2016 Elsevier Ltd. All rights reserved.

Soybean defense responses to the soybean aphid.

PubMed

Li, Yan; Zou, Jijun; Li, Min; Bilgin, Damla D; Vodkin, Lila O; Hartman, Glen L; Clough, Steven J

2008-01-01

Transcript profiles in aphid (Aphis glycines)-resistant (cv. Dowling) and -susceptible (cv. Williams 82) soybean (Glycine max) cultivars using soybean cDNA microarrays were investigated. Large-scale soybean cDNA microarrays representing approx. 18 000 genes or c. 30% of the soybean genome were compared at 6 and 12 h post-application of aphids. In a separate experiment utilizing clip cages, expression of three defense-related genes were examined at 6, 12, 24, 48, and 72 h in both cultivars by quantitative real-time PCR. One hundred and forty genes showed specific responses for resistance; these included genes related to cell wall, defense, DNA/RNA, secondary metabolism, signaling and other processes. When an extended time period of sampling was investigated, earlier and greater induction of three defense-related genes was observed in the resistant cultivar; however, the induction declined after 24 or 48 h in the resistant cultivar but continued to increase in the susceptible cultivar after 24 h. Aphid-challenged resistant plants showed rapid differential gene expression patterns similar to the incompatible response induced by avirulent Pseudomonas syringae. Five genes were identified as differentially expressed between the two genotypes in the absence of aphids.

Predictors of response to intra-articular steroid injection in psoriatic arthritis.

PubMed

Eder, Lihi; Chandran, Vinod; Ueng, Joanna; Bhella, Sita; Lee, Ker-Ai; Rahman, Proton; Pope, Angela; Cook, Richard J; Gladman, Dafna D

2010-07-01

To assess the effectiveness of IA corticosteroid (IAS) injections in PsA and to determine the association between macrophage migration inhibition factor (MIF) gene polymorphism and response to IAS injections. A cohort analysis of PsA patients who were followed prospectively was performed. Clinical response was defined as no tenderness or effusion in the injected joint at 3 months. Relapse was defined as re-occurrence of joint pain or effusion. MIF 173C > G genotyping (rs755622) was performed. Two hundred and twenty patients with 245 IAS injections were included in the study. The probability of responding at 3 months was 41.6%. Within 12 months, 25.5% of the joints relapsed. Clinical factors that were associated with response included duration of psoriasis [Odds ratio (OR) 1.03] and the use of MTX or anti-TNF agents at the time of injection (OR 2.68). Factors that were associated with relapse included injection into large joints (OR 4.58) and elevated sedimentation rate (OR 15.0), whereas absence of clinical and/or radiographic damage (OR 0.23) and duration of PsA (OR 0.92) reduced risk of relapse. MIF polymorphism was not associated with clinical response, but was associated with relapse (OR 3.2). On multivariate analysis including clinical covariates, the association between MIF polymorphism and relapse was lost. IAS injections are effective in PsA. MIF gene polymorphism is associated with relapse. However, this effect is explained by clinical variables that reflect disease activity, suggesting that MIF gene polymorphism influences inflammatory activity.

Oxygen- and NssR-dependent Globin Expression and Enhanced Iron Acquisition in the Response of Campylobacter to Nitrosative Stress*S⃞

PubMed Central

Monk, Claire E.; Pearson, Bruce M.; Mulholland, Francis; Smith, Holly K.; Poole, Robert K.

2008-01-01

Pathogenic bacteria experience nitrosative stress from NO generated in the host and from nitrosating species such as S-nitrosoglutathione. The food-borne pathogen Campylobacter jejuni responds by activating gene expression from a small regulon under the control of the NO-sensitive regulator, NssR. Here, we describe the full extent of the S-nitrosoglutathione response using transcriptomic and proteomic analysis of batch- and chemostat-cultured C. jejuni. In addition to the NssR regulon, which includes two hemoglobins (Cgb and Ctb), we identify more than 90 other up-regulated genes, notably those encoding heat shock proteins and proteins involved in oxidative stress tolerance and iron metabolism/transport. Up-regulation of a subset of these genes, including cgb, is also elicited by NO-releasing compounds. Mutation of the iron-responsive regulator Fur results in insensitivity of growth to NO, suggesting that derepression of iron-regulated genes and augmentation of iron acquisition is a physiological response to nitrosative damage. We describe the effect of oxygen availability on nitrosative stress tolerance; cells cultured at higher rates of oxygen diffusion have elevated levels of hemoglobins, are more resistant to inhibition by NO of both growth and respiration, and consume NO more rapidly. The oxygen response is mediated by NssR. Thus, in addition to NO detoxification catalyzed by the hemoglobins Cgb and possibly Ctb, C. jejuni mounts an extensive stress response. We suggest that inhibition of respiration by NO may increase availability of oxygen for Cgb synthesis and function. PMID:18682395

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wuddineh, Wegi A.; Mazarei, Mitra; Turner, Geoffry B.

The APETALA2/ethylene response factor (AP2/ERF) superfamily of transcription factors (TFs) plays essential roles in the regulation of various growth and developmental programs including stress responses. Members of these TFs in other plant species have been implicated to play a role in the regulation of cell wall biosynthesis. Here, we identified a total of 207 AP2/ERF TF genes in the switchgrass genome and grouped into four gene families comprised of 25 AP2-, 121 ERF-, 55 DREB (dehydration responsive element binding)-, and 5 RAV (related to API3/VP) genes, as well as a singleton gene not fitting any of the above families. Themore » ERF and DREB subfamilies comprised seven and four distinct groups, respectively. Analysis of exon/intron structures of switchgrass AP2/ERF genes showed high diversity in the distribution of introns in AP2 genes versus a single or no intron in most genes in the ERF and RAV families. The majority of the subfamilies or groups within it were characterized by the presence of one or more specific conserved protein motifs. In silico functional analysis revealed that many genes in these families might be associated with the regulation of responses to environmental stimuli via transcriptional regulation of the response genes. Moreover, these genes had diverse endogenous expression patterns in switchgrass during seed germination, vegetative growth, flower development, and seed formation. Interestingly, several members of the ERF and DREB families were found to be highly expressed in plant tissues where active lignification occurs. These results provide vital resources to select candidate genes to potentially impart tolerance to environmental stress as well as reduced recalcitrance. Furthermore, overexpression of one of the ERF genes ( PvERF001) in switchgrass was associated with increased biomass yield and sugar release efficiency in transgenic lines, exemplifying the potential of these TFs in the development of lignocellulosic feedstocks with improved biomass characteristics for biofuels.« less

RNA-Seq study reveals genetic responses of diverse wild soybean accessions to increased ozone levels.

PubMed

Waldeck, Nathan; Burkey, Kent; Carter, Thomas; Dickey, David; Song, Qijian; Taliercio, Earl

2017-06-29

Ozone is an air pollutant widely known to cause a decrease in productivity in many plant species, including soybean (Glycine max (L.) Merr). While the response of cultivated soybean to ozone has been studied, very little information is available regarding the ozone response of its wild relatives. Ozone-resistant wild soybean accessions were identified by measuring the response of a genetically diverse group of 66 wild soybean (Glycine soja Zucc. and Sieb.) accessions to elevated ozone levels. RNA-Seq analyses were performed on leaves of different ages from selected ozone-sensitive and ozone-resistant accessions that were subjected to treatment with an environmentally relevant level of ozone. Many more genes responded to elevated ozone in the two ozone-sensitive accessions than in the ozone-resistant accessions. Analyses of the ozone response genes indicated that leaves of different ages responded differently to ozone. Older leaves displayed a consistent reduction in expression of genes involved in photosynthesis in response to ozone, while changes in expression of defense genes dominated younger leaf tissue in response to ozone. As expected, there is a substantial difference between the response of ozone-sensitive and ozone-resistant accessions. Genes associated with photosystem 2 were substantially reduced in expression in response to ozone in the ozone-resistant accessions. A decrease in peptidase inhibitors was one of several responses specific to one of the ozone resistant accessions. The decrease in expression in genes associated with photosynthesis confirms that the photosynthetic apparatus may be an early casualty in response to moderate levels of ozone. A compromise of photosynthesis would substantially impact plant growth and seed production. However, the resistant accessions may preserve their photosynthetic apparatus in response to the ozone levels used in this study. Older leaf tissue of the ozone-resistant accessions showed a unique down-regulation of genes associated with endopeptidase inhibitor activity. This study demonstrates the existence of significant diversity in wild soybean for ozone response. Wild soybean accessions characterized in this study can be used by soybean breeders to enhance ozone tolerance of this important food crop.

Sequencing analysis of 20,000 full-length cDNA clones from cassava reveals lineage specific expansions in gene families related to stress response

PubMed Central

Sakurai, Tetsuya; Plata, Germán; Rodríguez-Zapata, Fausto; Seki, Motoaki; Salcedo, Andrés; Toyoda, Atsushi; Ishiwata, Atsushi; Tohme, Joe; Sakaki, Yoshiyuki; Shinozaki, Kazuo; Ishitani, Manabu

2007-01-01

Background Cassava, an allotetraploid known for its remarkable tolerance to abiotic stresses is an important source of energy for humans and animals and a raw material for many industrial processes. A full-length cDNA library of cassava plants under normal, heat, drought, aluminum and post harvest physiological deterioration conditions was built; 19968 clones were sequence-characterized using expressed sequence tags (ESTs). Results The ESTs were assembled into 6355 contigs and 9026 singletons that were further grouped into 10577 scaffolds; we found 4621 new cassava sequences and 1521 sequences with no significant similarity to plant protein databases. Transcripts of 7796 distinct genes were captured and we were able to assign a functional classification to 78% of them while finding more than half of the enzymes annotated in metabolic pathways in Arabidopsis. The annotation of sequences that were not paired to transcripts of other species included many stress-related functional categories showing that our library is enriched with stress-induced genes. Finally, we detected 230 putative gene duplications that include key enzymes in reactive oxygen species signaling pathways and could play a role in cassava stress response features. Conclusion The cassava full-length cDNA library here presented contains transcripts of genes involved in stress response as well as genes important for different areas of cassava research. This library will be an important resource for gene discovery, characterization and cloning; in the near future it will aid the annotation of the cassava genome. PMID:18096061

Effect of cadmium exposure on hepatopancreas and gills of the estuary mud crab (Scylla paramamosain): Histopathological changes and expression characterization of stress response genes.

PubMed

Zhu, Qi-Hui; Zhou, Zhong-Kai; Tu, Dan-Dan; Zhou, Yi-Lian; Wang, Cong; Liu, Ze-Peng; Gu, Wen-Bin; Chen, Yu-Yin; Shu, Miao-An

2018-02-01

Cadmium (Cd) is a heavy metal that accumulates easily in organisms and causes several detrimental effects, including tissue damage. Cd contamination from anthropogenic terrestrial sources flows into rivers, and through estuaries to the ocean. To evaluate the toxic effects of Cd on estuary crustaceans, we exposed the mud crab Scylla paramamosain to various Cd concentrations (0, 10.0, 20.0, and 40.0mg/L) for 24h. We also exposed mud crabs to a fixed Cd concentration (20.0mg/L) for various periods of time (0, 6, 12, 24, 48, and 72h). We observed that after exposure to Cd, the surfaces of the gill lamellae were wrinkled, and the morphologies of the nuclei and mitochondria in the hepatopancreas were altered. We analyzed the expression profiles of 36 stress-related genes after Cd exposure, including those encoding metallothioneins, heat shock proteins, apoptosis-related proteins, and antioxidant proteins, with quantitative reverse transcription PCR. We found that exposure to Cd altered gene expression, and that some genes might be suitable bioindicators of Cd stress. Gene expression profiles were organ-, duration-, and concentration-dependent, suggesting that stress-response genes might be involved in an innate defense system for handling heavy metal exposure. To the best of our knowledge, this study is the first one of histopathology and stress-response gene expression pattern of Scylla paramamosain after Cd exposure. Our work could increase our understanding of the effect of environmental toxins on estuary crustaceans. Copyright © 2017 Elsevier B.V. All rights reserved.

Molecular dissection of the roles of the SOD genes in mammalian response to low dose irradiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eric Y. Chuang

2006-08-31

It has been long recognized that a significant fraction of the radiation-induced genetic damage to cells are caused by secondary oxidative species. Internal cellular defense systems against oxidative stress play significant roles in countering genetic damage induced by ionizing radiation. The role of the detoxifying enzymes may be even more prominent in the case of low-dose, low-LET irradiation, as the majority of genetic damage may be caused by secondary oxidative species. In this study we have attempted to decipher the roles of the superoxide dismutase (SOD) genes, which are responsible for detoxifying the superoxide anions. We used adenovirus vectors tomore » deliver RNA interference (RNAi or siRNA) technology to down-regulate the expression levels of the SOD genes. We have also over-expressed the SOD genes by use of recombinant adenovirus vectors. Cells infected with the vectors were then subjected to low dose γ-irradiation. Total RNA were extracted from the exposed cells and the expression of 9000 genes were profiled by use of cDNA microarrays. The result showed that low dose radiation had clear effects on gene expression in HCT116 cells. Both over-expression and down-regulation of the SOD1 gene can change the expression profiles of sub-groups of genes. Close to 200 of the 9000 genes examined showed over two-fold difference in expression under various conditions. Genes with changed expression pattern belong to many categories that include: early growth response, DNA-repair, ion transport, apoptosis, and cytokine response.« less

Epigenetic Alteration by DNA Methylation of ESR1, MYOD1 and hTERT Gene Promoters is Useful for Prediction of Response in Patients of Locally Advanced Invasive Cervical Carcinoma Treated by Chemoradiation.

PubMed

Sood, S; Patel, F D; Ghosh, S; Arora, A; Dhaliwal, L K; Srinivasan, R

2015-12-01

Locally advanced invasive cervical cancer [International Federation of Gynecology and Obstetrics (FIGO) IIB/III] is treated by chemoradiation. The response to treatment is variable within a given FIGO stage. Therefore, the aim of the present study was to evaluate the gene promoter methylation profile and corresponding transcript expression of a panel of six genes to identify genes which could predict the response of patients treated by chemoradiation. In total, 100 patients with invasive cervical cancer in FIGO stage IIB/III who underwent chemoradiation treatment were evaluated. Ten patients developed systemic metastases during therapy and were excluded. On the basis of patient follow-up, 69 patients were chemoradiation-sensitive, whereas 21 were chemoradiation-resistant. Gene promoter methylation and gene expression was determined by TaqMan assay and quantitative real-time PCR, respectively, in tissue samples. The methylation frequency of ESR1, BRCA1, RASSF1A, MLH1, MYOD1 and hTERT genes ranged from 40 to 70%. Univariate and hierarchical cluster analysis revealed that gene promoter methylation of MYOD1, ESR1 and hTERT could predict for chemoradiation response. A pattern of unmethylated MYOD1, unmethylated ESR1 and methylated hTERT promoter as well as lower ESR1 transcript levels predicted for chemoradiation resistance. Methylation profiling of a panel of three genes that includes MYOD1, ESR1 and hTERT may be useful to predict the response of invasive cervical carcinoma patients treated with standard chemoradiation therapy. Copyright © 2015 The Royal College of Radiologists. Published by Elsevier Ltd. All rights reserved.

Transient exposure to low levels of insecticide affects metabolic networks of honeybee larvae.

PubMed

Derecka, Kamila; Blythe, Martin J; Malla, Sunir; Genereux, Diane P; Guffanti, Alessandro; Pavan, Paolo; Moles, Anna; Snart, Charles; Ryder, Thomas; Ortori, Catharine A; Barrett, David A; Schuster, Eugene; Stöger, Reinhard

2013-01-01

The survival of a species depends on its capacity to adjust to changing environmental conditions, and new stressors. Such new, anthropogenic stressors include the neonicotinoid class of crop-protecting agents, which have been implicated in the population declines of pollinating insects, including honeybees (Apis mellifera). The low-dose effects of these compounds on larval development and physiological responses have remained largely unknown. Over a period of 15 days, we provided syrup tainted with low levels (2 µg/L(-1)) of the neonicotinoid insecticide imidacloprid to beehives located in the field. We measured transcript levels by RNA sequencing and established lipid profiles using liquid chromatography coupled with mass spectrometry from worker-bee larvae of imidacloprid-exposed (IE) and unexposed, control (C) hives. Within a catalogue of 300 differentially expressed transcripts in larvae from IE hives, we detect significant enrichment of genes functioning in lipid-carbohydrate-mitochondrial metabolic networks. Myc-involved transcriptional response to exposure of this neonicotinoid is indicated by overrepresentation of E-box elements in the promoter regions of genes with altered expression. RNA levels for a cluster of genes encoding detoxifying P450 enzymes are elevated, with coordinated downregulation of genes in glycolytic and sugar-metabolising pathways. Expression of the environmentally responsive Hsp90 gene is also reduced, suggesting diminished buffering and stability of the developmental program. The multifaceted, physiological response described here may be of importance to our general understanding of pollinator health. Muscles, for instance, work at high glycolytic rates and flight performance could be impacted should low levels of this evolutionarily novel stressor likewise induce downregulation of energy metabolising genes in adult pollinators.

Distinctive roles of age, sex, and genetics in shaping transcriptional variation of human immune responses to microbial challenges.

PubMed

Piasecka, Barbara; Duffy, Darragh; Urrutia, Alejandra; Quach, Hélène; Patin, Etienne; Posseme, Céline; Bergstedt, Jacob; Charbit, Bruno; Rouilly, Vincent; MacPherson, Cameron R; Hasan, Milena; Albaud, Benoit; Gentien, David; Fellay, Jacques; Albert, Matthew L; Quintana-Murci, Lluis

2018-01-16

The contribution of host genetic and nongenetic factors to immunological differences in humans remains largely undefined. Here, we generated bacterial-, fungal-, and viral-induced immune transcriptional profiles in an age- and sex-balanced cohort of 1,000 healthy individuals and searched for the determinants of immune response variation. We found that age and sex affected the transcriptional response of most immune-related genes, with age effects being more stimulus-specific relative to sex effects, which were largely shared across conditions. Although specific cell populations mediated the effects of age and sex on gene expression, including CD8 + T cells for age and CD4 + T cells and monocytes for sex, we detected a direct effect of these intrinsic factors for the majority of immune genes. The mapping of expression quantitative trait loci (eQTLs) revealed that genetic factors had a stronger effect on immune gene regulation than age and sex, yet they affected a smaller number of genes. Importantly, we identified numerous genetic variants that manifested their regulatory effects exclusively on immune stimulation, including a Candida albicans -specific master regulator at the CR1 locus. These response eQTLs were enriched in disease-associated variants, particularly for autoimmune and inflammatory disorders, indicating that differences in disease risk may result from regulatory variants exerting their effects only in the presence of immune stress. Together, this study quantifies the respective effects of age, sex, genetics, and cellular heterogeneity on the interindividual variability of immune responses and constitutes a valuable resource for further exploration in the context of different infection risks or disease outcomes. Copyright © 2018 the Author(s). Published by PNAS.

Impairment of organ-specific T cell negative selection by diabetes susceptibility genes: genomic analysis by mRNA profiling.

PubMed

Liston, Adrian; Hardy, Kristine; Pittelkow, Yvonne; Wilson, Susan R; Makaroff, Lydia E; Fahrer, Aude M; Goodnow, Christopher C

2007-01-01

T cells in the thymus undergo opposing positive and negative selection processes so that the only T cells entering circulation are those bearing a T cell receptor (TCR) with a low affinity for self. The mechanism differentiating negative from positive selection is poorly understood, despite the fact that inherited defects in negative selection underlie organ-specific autoimmune disease in AIRE-deficient people and the non-obese diabetic (NOD) mouse strain Here we use homogeneous populations of T cells undergoing either positive or negative selection in vivo together with genome-wide transcription profiling on microarrays to identify the gene expression differences underlying negative selection to an Aire-dependent organ-specific antigen, including the upregulation of a genomic cluster in the cytogenetic band 2F. Analysis of defective negative selection in the autoimmune-prone NOD strain demonstrates a global impairment in the induction of the negative selection response gene set, but little difference in positive selection response genes. Combining expression differences with genetic linkage data, we identify differentially expressed candidate genes, including Bim, Bnip3, Smox, Pdrg1, Id1, Pdcd1, Ly6c, Pdia3, Trim30 and Trim12. The data provide a molecular map of the negative selection response in vivo and, by analysis of deviations from this pathway in the autoimmune susceptible NOD strain, suggest that susceptibility arises from small expression differences in genes acting at multiple points in the pathway between the TCR and cell death.

Impairment of organ-specific T cell negative selection by diabetes susceptibility genes: genomic analysis by mRNA profiling

PubMed Central

Liston, Adrian; Hardy, Kristine; Pittelkow, Yvonne; Wilson, Susan R; Makaroff, Lydia E; Fahrer, Aude M; Goodnow, Christopher C

2007-01-01

Background T cells in the thymus undergo opposing positive and negative selection processes so that the only T cells entering circulation are those bearing a T cell receptor (TCR) with a low affinity for self. The mechanism differentiating negative from positive selection is poorly understood, despite the fact that inherited defects in negative selection underlie organ-specific autoimmune disease in AIRE-deficient people and the non-obese diabetic (NOD) mouse strain Results Here we use homogeneous populations of T cells undergoing either positive or negative selection in vivo together with genome-wide transcription profiling on microarrays to identify the gene expression differences underlying negative selection to an Aire-dependent organ-specific antigen, including the upregulation of a genomic cluster in the cytogenetic band 2F. Analysis of defective negative selection in the autoimmune-prone NOD strain demonstrates a global impairment in the induction of the negative selection response gene set, but little difference in positive selection response genes. Combining expression differences with genetic linkage data, we identify differentially expressed candidate genes, including Bim, Bnip3, Smox, Pdrg1, Id1, Pdcd1, Ly6c, Pdia3, Trim30 and Trim12. Conclusion The data provide a molecular map of the negative selection response in vivo and, by analysis of deviations from this pathway in the autoimmune susceptible NOD strain, suggest that susceptibility arises from small expression differences in genes acting at multiple points in the pathway between the TCR and cell death. PMID:17239257

Extensive innate immune gene activation accompanies brain aging, increasing vulnerability to cognitive decline and neurodegeneration: a microarray study.

PubMed

Cribbs, David H; Berchtold, Nicole C; Perreau, Victoria; Coleman, Paul D; Rogers, Joseph; Tenner, Andrea J; Cotman, Carl W

2012-07-23

This study undertakes a systematic and comprehensive analysis of brain gene expression profiles of immune/inflammation-related genes in aging and Alzheimer's disease (AD). In a well-powered microarray study of young (20 to 59 years), aged (60 to 99 years), and AD (74 to 95 years) cases, gene responses were assessed in the hippocampus, entorhinal cortex, superior frontal gyrus, and post-central gyrus. Several novel concepts emerge. First, immune/inflammation-related genes showed major changes in gene expression over the course of cognitively normal aging, with the extent of gene response far greater in aging than in AD. Of the 759 immune-related probesets interrogated on the microarray, approximately 40% were significantly altered in the SFG, PCG and HC with increasing age, with the majority upregulated (64 to 86%). In contrast, far fewer immune/inflammation genes were significantly changed in the transition to AD (approximately 6% of immune-related probesets), with gene responses primarily restricted to the SFG and HC. Second, relatively few significant changes in immune/inflammation genes were detected in the EC either in aging or AD, although many genes in the EC showed similar trends in responses as in the other brain regions. Third, immune/inflammation genes undergo gender-specific patterns of response in aging and AD, with the most pronounced differences emerging in aging. Finally, there was widespread upregulation of genes reflecting activation of microglia and perivascular macrophages in the aging brain, coupled with a downregulation of select factors (TOLLIP, fractalkine) that when present curtail microglial/macrophage activation. Notably, essentially all pathways of the innate immune system were upregulated in aging, including numerous complement components, genes involved in toll-like receptor signaling and inflammasome signaling, as well as genes coding for immunoglobulin (Fc) receptors and human leukocyte antigens I and II. Unexpectedly, the extent of innate immune gene upregulation in AD was modest relative to the robust response apparent in the aged brain, consistent with the emerging idea of a critical involvement of inflammation in the earliest stages, perhaps even in the preclinical stage, of AD. Ultimately, our data suggest that an important strategy to maintain cognitive health and resilience involves reducing chronic innate immune activation that should be initiated in late midlife.

Extensive innate immune gene activation accompanies brain aging, increasing vulnerability to cognitive decline and neurodegeneration: a microarray study

PubMed Central

2012-01-01

Background This study undertakes a systematic and comprehensive analysis of brain gene expression profiles of immune/inflammation-related genes in aging and Alzheimer’s disease (AD). Methods In a well-powered microarray study of young (20 to 59 years), aged (60 to 99 years), and AD (74 to 95 years) cases, gene responses were assessed in the hippocampus, entorhinal cortex, superior frontal gyrus, and post-central gyrus. Results Several novel concepts emerge. First, immune/inflammation-related genes showed major changes in gene expression over the course of cognitively normal aging, with the extent of gene response far greater in aging than in AD. Of the 759 immune-related probesets interrogated on the microarray, approximately 40% were significantly altered in the SFG, PCG and HC with increasing age, with the majority upregulated (64 to 86%). In contrast, far fewer immune/inflammation genes were significantly changed in the transition to AD (approximately 6% of immune-related probesets), with gene responses primarily restricted to the SFG and HC. Second, relatively few significant changes in immune/inflammation genes were detected in the EC either in aging or AD, although many genes in the EC showed similar trends in responses as in the other brain regions. Third, immune/inflammation genes undergo gender-specific patterns of response in aging and AD, with the most pronounced differences emerging in aging. Finally, there was widespread upregulation of genes reflecting activation of microglia and perivascular macrophages in the aging brain, coupled with a downregulation of select factors (TOLLIP, fractalkine) that when present curtail microglial/macrophage activation. Notably, essentially all pathways of the innate immune system were upregulated in aging, including numerous complement components, genes involved in toll-like receptor signaling and inflammasome signaling, as well as genes coding for immunoglobulin (Fc) receptors and human leukocyte antigens I and II. Conclusions Unexpectedly, the extent of innate immune gene upregulation in AD was modest relative to the robust response apparent in the aged brain, consistent with the emerging idea of a critical involvement of inflammation in the earliest stages, perhaps even in the preclinical stage, of AD. Ultimately, our data suggest that an important strategy to maintain cognitive health and resilience involves reducing chronic innate immune activation that should be initiated in late midlife. PMID:22824372

Molecular mechanisms of OLIG2 transcription factor in brain cancer

PubMed Central

Lian, Nathan; Kesari, Santosh

2016-01-01

Oligodendrocyte lineage transcription factor 2 (OLIG2) plays a pivotal role in glioma development. Here we conducted a comprehensive study of the critical gene regulatory networks involving OLIG2. These include the networks responsible for OLIG2 expression, its translocation to nucleus, cell cycle, epigenetic regulation, and Rho-pathway interactions. We described positive feedback loops including OLIG2: loops of epigenetic regulation and loops involving receptor tyrosine kinases. These loops may be responsible for the prolonged oncogenic activity of OLIG2. The proposed schemes for epigenetic regulation of the gene networks involving OLIG2 are confirmed by patient survival (Kaplan–Meier) curves based on the cancer genome atlas (TCGA) datasets. Finally, we elucidate the Coherent-Gene Modules (CGMs) networks—framework of OLIG2 involvement in cancer. We showed that genes interacting with OLIG2 formed eight CGMs having a set of intermodular connections. We showed also that among the genes involved in these modules the most connected hub is EGFR, then, on lower level, HSP90 and CALM1, followed by three lower levels including epigenetic genes KDM1A and NCOR1. The genes on the six upper levels of the hierarchy are involved in interconnections of all eight CGMs and organize functionally defined gene-signaling subnetworks having specific functions. For example, CGM1 is involved in epigenetic control. CGM2 is significantly related to cell proliferation and differentiation. CGM3 includes a number of interconnected helix–loop–helix transcription factors (bHLH) including OLIG2. Many of these TFs are partially controlled by OLIG2. The CGM4 is involved in PDGF-related: angiogenesis, tumor cell proliferation and differentiation. These analyses provide testable hypotheses and approaches to inhibit OLIG2 pathway and relevant feed-forward and feedback loops to be interrogated. This broad approach can be applied to other TFs. PMID:27447975

Characterization of a gene cluster responsible for the biosynthesis of anticancer agent FK228 in Chromobacterium violaceum No. 968.

PubMed

Cheng, Yi-Qiang; Yang, Min; Matter, Andrea M

2007-06-01

A gene cluster responsible for the biosynthesis of anticancer agent FK228 has been identified, cloned, and partially characterized in Chromobacterium violaceum no. 968. First, a genome-scanning approach was applied to identify three distinctive C. violaceum no. 968 genomic DNA clones that code for portions of nonribosomal peptide synthetase and polyketide synthase. Next, a gene replacement system developed originally for Pseudomonas aeruginosa was adapted to inactivate the genomic DNA-associated candidate natural product biosynthetic genes in vivo with high efficiency. Inactivation of a nonribosomal peptide synthetase-encoding gene completely abolished FK228 production in mutant strains. Subsequently, the entire FK228 biosynthetic gene cluster was cloned and sequenced. This gene cluster is predicted to encompass a 36.4-kb DNA region that includes 14 genes. The products of nine biosynthetic genes are proposed to constitute an unusual hybrid nonribosomal peptide synthetase-polyketide synthase-nonribosomal peptide synthetase assembly line including accessory activities for the biosynthesis of FK228. In particular, a putative flavin adenine dinucleotide-dependent pyridine nucleotide-disulfide oxidoreductase is proposed to catalyze disulfide bond formation between two sulfhydryl groups of cysteine residues as the final step in FK228 biosynthesis. Acquisition of the FK228 biosynthetic gene cluster and acclimation of an efficient genetic system should enable genetic engineering of the FK228 biosynthetic pathway in C. violaceum no. 968 for the generation of structural analogs as anticancer drug candidates.

General theory for integrated analysis of growth, gene, and protein expression in biofilms.

PubMed

Zhang, Tianyu; Pabst, Breana; Klapper, Isaac; Stewart, Philip S

2013-01-01

A theory for analysis and prediction of spatial and temporal patterns of gene and protein expression within microbial biofilms is derived. The theory integrates phenomena of solute reaction and diffusion, microbial growth, mRNA or protein synthesis, biomass advection, and gene transcript or protein turnover. Case studies illustrate the capacity of the theory to simulate heterogeneous spatial patterns and predict microbial activities in biofilms that are qualitatively different from those of planktonic cells. Specific scenarios analyzed include an inducible GFP or fluorescent protein reporter, a denitrification gene repressed by oxygen, an acid stress response gene, and a quorum sensing circuit. It is shown that the patterns of activity revealed by inducible stable fluorescent proteins or reporter unstable proteins overestimate the region of activity. This is due to advective spreading and finite protein turnover rates. In the cases of a gene induced by either limitation for a metabolic substrate or accumulation of a metabolic product, maximal expression is predicted in an internal stratum of the biofilm. A quorum sensing system that includes an oxygen-responsive negative regulator exhibits behavior that is distinct from any stage of a batch planktonic culture. Though here the analyses have been limited to simultaneous interactions of up to two substrates and two genes, the framework applies to arbitrarily large networks of genes and metabolites. Extension of reaction-diffusion modeling in biofilms to the analysis of individual genes and gene networks is an important advance that dovetails with the growing toolkit of molecular and genetic experimental techniques.

Novel candidate genes for alcoholism--transcriptomic analysis of prefrontal medial cortex, hippocampus and nucleus accumbens of Warsaw alcohol-preferring and non-preferring rats.

PubMed

Stankiewicz, Adrian M; Goscik, Joanna; Dyr, Wanda; Juszczak, Grzegorz R; Ryglewicz, Danuta; Swiergiel, Artur H; Wieczorek, Marek; Stefanski, Roman

2015-12-01

Animal models provide opportunity to study neurobiological aspects of human alcoholism. Changes in gene expression have been implicated in mediating brain functions, including reward system and addiction. The current study aimed to identify genes that may underlie differential ethanol preference in Warsaw High Preferring (WHP) and Warsaw Low Preferring (WLP) rats. Microarray analysis comparing gene expression in nucleus accumbens (NAc), hippocampus (HP) and medial prefrontal cortex (mPFC) was performed in male WHP and WLP rats bred for differences in ethanol preference. Differential and stable between biological repeats expression of 345, 254 and 129 transcripts in NAc, HP and mPFC was detected. Identified genes and processes included known mediators of ethanol response (Mx2, Fam111a, Itpr1, Gabra4, Agtr1a, LTP/LTD, renin-angiotensin signaling pathway), toxicity (Sult1c2a, Ces1, inflammatory response), as well as genes involved in regulation of important addiction-related brain systems such as dopamine, tachykinin or acetylcholine (Gng7, Tac4, Slc5a7). The identified candidate genes may underlie differential ethanol preference in an animal model of alcoholism. Names of genes are written in italics, while names of proteins are written in standard font. Names of human genes/proteins are written in all capital letters. Names of rodent genes/proteins are written in capital letter followed by small letters. Copyright © 2015 Elsevier Inc. All rights reserved.

The Persimmon 9-lipoxygenase Gene DkLOX3 Plays Positive Roles in Both Promoting Senescence and Enhancing Tolerance to Abiotic Stress

PubMed Central

Hou, Yali; Meng, Kun; Han, Ye; Ban, Qiuyan; Wang, Biao; Suo, Jiangtao; Lv, Jingyi; Rao, Jingping

2015-01-01

The lipoxygenase (LOX) pathway is a key regulator for lipid peroxidation, which is crucial for plant senescence and defense pathways. In this study, the transcriptional expression patterns of three persimmon (Diospyros kaki L. ‘Fupingjianshi’) 9-lipoxygenase genes (DkLOX1, DkLOX3, and DkLOX4) were investigated. DkLOX1 was specifically expressed in fruit, particularly in young fruit, and showed little response to the postharvest environments. DkLOX4 was expressed in all tissues and slightly stimulated by mechanical damage and low temperature. DkLOX3 was expressed mainly in mature fruit, and the expression was extremely high throughout the storage period, apparently up-regulated by mechanical damage and high carbon dioxide treatments. Further functional analysis showed that overexpression of DkLOX3 in tomato (Solanum lycopersicum cv. Micro-Tom) accelerated fruit ripening and softening. This was accompanied by higher malondialdehyde (MDA) content and lycopene accumulation, advanced ethylene release peak and elevated expression of ethylene synthesis genes, including ACS2, ACO1, and ACO3. In addition, DkLOX3 overexpression promoted dark induced transgenic Arabidopsis leaf senescence with more chlorophyll loss, increased electrolyte leakage and MDA content. Furthermore, the functions of DkLOX3 in response to abiotic stresses, including osmotic stress, high salinity and drought were investigated. Arabidopsis DkLOX3 overexpression (DkLOX3-OX) transgenic lines were found to be more tolerant to osmotic stress with higher germination rate and root growth than wild-type. Moreover, DkLOX3-OX Arabidopsis plants also exhibited enhanced resistance to high salinity and drought, with similar decreased O2- and H2O2 accumulation and upregulation of stress-responsive genes expression, including RD22, RD29A, RD29B, and NCED3, except for FRY1, which plays a negative role in stress response. Overall, these results suggested that DkLOX3 plays positive roles both in promoting ripening and senescence through lipid peroxidation and accelerated ethylene production and in stress response via regulating reactive oxygen species accumulation and stress responsive genes expression. PMID:26697033

Genetic Analyses of Interferon Pathway-Related Genes Reveals Multiple New Loci Associated with Systemic Lupus Erythematosus (SLE)

PubMed Central

Ramos, Paula S.; Williams, Adrienne H.; Ziegler, Julie T.; Comeau, Mary E.; Guy, Richard T.; Lessard, Christopher J.; Li, He; Edberg, Jeffrey C.; Zidovetzki, Raphael; Criswell, Lindsey A.; Gaffney, Patrick M.; Graham, Deborah Cunninghame; Graham, Robert R.; Kelly, Jennifer A.; Kaufman, Kenneth M.; Brown, Elizabeth E.; Alarcón, Graciela S.; Petri, Michelle A.; Reveille, John D.; McGwin, Gerald; Vilá, Luis M.; Ramsey-Goldman, Rosalind; Jacob, Chaim O.; Vyse, Timothy J.; Tsao, Betty P.; Harley, John B.; Kimberly, Robert P.; Alarcón-Riquelme, Marta E.; Langefeld, Carl D.; Moser, Kathy L.

2011-01-01

Objective The overexpression of interferon (IFN)-inducible genes is a prominent feature of SLE, serves as a marker for active and more severe disease, and is also observed in other autoimmune and inflammatory conditions. The genetic variations responsible for sustained activation of IFN responsive genes are unknown. Methods We systematically evaluated association of SLE with a total of 1,754 IFN-pathway related genes, including IFN-inducible genes known to be differentially expressed in SLE patients and their direct regulators. We performed a three-stage design where two cohorts (total n=939 SLE cases, 3,398 controls) were analyzed independently and jointly for association with SLE, and the results were adjusted for the number of comparisons. Results A total of 16,137 SNPs passed all quality control filters of which 316 demonstrated replicated association with SLE in both cohorts. Nine variants were further genotyped for confirmation in an average of 1,316 independent SLE cases and 3,215 independent controls. Association with SLE was confirmed for several genes, including the transmembrane receptor CD44 (rs507230, P = 3.98×10−12), cytokine pleiotrophin (PTN) (rs919581, P = 5.38×10−04), the heat-shock DNAJA1 (rs10971259, P = 6.31×10−03), and the nuclear import protein karyopherin alpha 1 (KPNA1) (rs6810306, P = 4.91×10−02). Conclusion This study expands the number of candidate genes associated with SLE and highlights the potential of pathway-based approaches for gene discovery. Identification of the causal alleles will help elucidate the molecular mechanisms responsible for activation of the IFN system in SLE. PMID:21437871

Gene response in rice plants treated with continuous fog influenced by pH, was similar to that treated with biotic stress

PubMed Central

2014-01-01

Background Throughout Asia, including Japan, rice plants are cultivated in a wide range of areas from lowlands to highlands and are frequently exposed to fog, including acid fog. Some physiological studies have shown that acid fog can be a stress factor for plants. We analyzed the gene expression profiles of rice plants treated with artificially prepared simulated acid fog (SiAF) or simulated neutral fog (SiNF) for 1 or 7 days. Results Microarray analysis results suggested that both the SiAF and the SiNF treatments induced the expression of genes involved in the defense and stress responses in rice plants. Induction of such genes was detected in plants treated with SiAF for 1 day, and the number of induced genes increased in plants treated with SiAF for 7 days. The genes for defense and stress responses were also induced by SiNF for 7 days, although they were not induced by SiNF for 1 day. The gene expression profiles of the SiAF-treated and the SiNF-treated plants were compared to those of plants treated with other stress factors. The comparison revealed that both SiAF and SiNF treatments have similar effects to biotic stresses and ozone stress. The genes encoding NADPH oxidase and germin, which function in apoplasts, were also induced by SiAF, SiNF and biotic stresses. Conclusions These findings suggest that both the SiAF and the SiNF treatments may result in oxidative stress through the apoplastic production of reactive oxygen species. PMID:24987489

The ethylene response pathway in Arabidopsis

NASA Technical Reports Server (NTRS)

Kieber, J. J.; Evans, M. L. (Principal Investigator)

1997-01-01

The simple gas ethylene influences a diverse array of plant growth and developmental processes including germination, senescence, cell elongation, and fruit ripening. This review focuses on recent molecular genetic studies, principally in Arabidopsis, in which components of the ethylene response pathway have been identified. The isolation and characterization of two of these genes has revealed that ethylene sensing involves a protein kinase cascade. One of these genes encodes a protein with similarity to the ubiquitous Raf family of Ser/Thr protein kinases. A second gene shows similarity to the prokaryotic two-component histidine kinases and most likely encodes an ethylene receptor. Additional elements involved in ethylene signaling have only been identified genetically. The characterization of these genes and mutants will be discussed.

A single-molecule view of gene regulation in cancer

NASA Astrophysics Data System (ADS)

Larson, Daniel

2013-03-01

Single-cell analysis has revealed that transcription is dynamic and stochastic, but tools are lacking that can determine the mechanism operating at a single gene. Here we utilize single-molecule observations of RNA in fixed and living cells to develop a single-cell model of steroid-receptor mediated gene activation. Steroid receptors coordinate a diverse range of responses in higher eukaryotes and are involved in a wide range of human diseases, including cancer. Steroid receptor response elements are present throughout the human genome and modulate chromatin remodeling and transcription in both a local and long-range fashion. As such, steroid receptor-mediated transcription is a paradigm of genetic control in the metazoan nucleus. Moreover, the ligand-dependent nature of these transcription factors makes them appealing targets for therapeutic intervention, necessitating a quantitative understanding of how receptors control output from target genes. We determine that steroids drive mRNA synthesis by frequency modulation of transcription. This digital behavior in single cells gives rise to the well-known analog dose response across the population. To test this model, we developed a light-activation technology to turn on a single gene and follow dynamic synthesis of RNA from the activated locus. The response delay is a measure of time required for chromatin remodeling at a single gene.

Genome-Wide Characterization and Expression Profiling of the AUXIN RESPONSE FACTOR (ARF) Gene Family in Eucalyptus grandis

PubMed Central

Yu, Hong; Soler, Marçal; Mila, Isabelle; San Clemente, Hélène; Savelli, Bruno; Dunand, Christophe; Paiva, Jorge A. P.; Myburg, Alexander A.; Bouzayen, Mondher; Grima-Pettenati, Jacqueline; Cassan-Wang, Hua

2014-01-01

Auxin is a central hormone involved in a wide range of developmental processes including the specification of vascular stem cells. Auxin Response Factors (ARF) are important actors of the auxin signalling pathway, regulating the transcription of auxin-responsive genes through direct binding to their promoters. The recent availability of the Eucalyptus grandis genome sequence allowed us to examine the characteristics and evolutionary history of this gene family in a woody plant of high economic importance. With 17 members, the E. grandis ARF gene family is slightly contracted, as compared to those of most angiosperms studied hitherto, lacking traces of duplication events. In silico analysis of alternative transcripts and gene truncation suggested that these two mechanisms were preeminent in shaping the functional diversity of the ARF family in Eucalyptus. Comparative phylogenetic analyses with genomes of other taxonomic lineages revealed the presence of a new ARF clade found preferentially in woody and/or perennial plants. High-throughput expression profiling among different organs and tissues and in response to environmental cues highlighted genes expressed in vascular cambium and/or developing xylem, responding dynamically to various environmental stimuli. Finally, this study allowed identification of three ARF candidates potentially involved in the auxin-regulated transcriptional program underlying wood formation. PMID:25269088

Gene expression responses of HeLa cells to chemical species generated by an atmospheric plasma flow

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yokoyama, Mayo, E-mail: yokoyama@plasma.ifs.tohoku.ac.jp; Johkura, Kohei, E-mail: kohei@shinshu-u.ac.jp; Sato, Takehiko, E-mail: sato@ifs.tohoku.ac.jp

2014-08-08

Highlights: • Response of HeLa cells to a plasma-irradiated medium was revealed by DNA microarray. • Gene expression pattern was basically different from that in a H{sub 2}O{sub 2}-added medium. • Prominently up-/down-regulated genes were partly shared by the two media. • Gene ontology analysis showed both similar and different responses in the two media. • Candidate genes involved in response to ROS were detected in each medium. - Abstract: Plasma irradiation generates many factors able to affect the cellular condition, and this feature has been studied for its application in the field of medicine. We previously reported that hydrogenmore » peroxide (H{sub 2}O{sub 2}) was the major cause of HeLa cell death among the chemical species generated by high level irradiation of a culture medium by atmospheric plasma. To assess the effect of plasma-induced factors on the response of live cells, HeLa cells were exposed to a medium irradiated by a non-lethal plasma flow level, and their gene expression was broadly analyzed by DNA microarray in comparison with that in a corresponding concentration of 51 μM H{sub 2}O{sub 2}. As a result, though the cell viability was sufficiently maintained at more than 90% in both cases, the plasma-medium had a greater impact on it than the H{sub 2}O{sub 2}-medium. Hierarchical clustering analysis revealed fundamentally different cellular responses between these two media. A larger population of genes was upregulated in the plasma-medium, whereas genes were downregulated in the H{sub 2}O{sub 2}-medium. However, a part of the genes that showed prominent differential expression was shared by them, including an immediate early gene ID2. In gene ontology analysis of upregulated genes, the plasma-medium showed more diverse ontologies than the H{sub 2}O{sub 2}-medium, whereas ontologies such as “response to stimulus” were common, and several genes corresponded to “response to reactive oxygen species.” Genes of AP-1 proteins, e.g., JUN and FOS, were detected and notably elevated in the plasma-medium. These results showed that the medium irradiated with a non-lethal level of plasma flow altered various gene expressions of HeLa cells by giving not only common effects with H{sub 2}O{sub 2} but also some distinctive actions. This study suggests that in addition to H{sub 2}O{sub 2}, other chemical species able to affect the cellular responses exist in the plasma-irradiated medium and provide unique features for it, probably increasing the oxidative stress level.« less

Mechanism of the Synergistic Effect of Amiodarone and Fluconazole in Candida albicans▿ †

PubMed Central

Gamarra, Soledad; Rocha, Elousa Maria F.; Zhang, Yong-Qiang; Park, Steven; Rao, Rajini; Perlin, David S.

2010-01-01

The antiarrhythmic drug amiodarone has been found to have fungicidal activity. In Saccharomyces cerevisiae, its antifungal activity is mediated by calcium overload stress, which leads to a rapid nuclear accumulation of the calcineurin-regulated transcription factor CRZ1. In addition, low doses of amiodarone have been reported to be synergistic with fluconazole in fluconazole-resistant Candida albicans. To establish its mechanism of toxicity in C. albicans, we used expression profiling of key pathway genes to examine cellular responses to amiodarone alone and in combination with fluconazole. Gene expression profiling of 59 genes was done in five C. albicans strains (three fluconazole-susceptible strains and two fluconazole-resistant strains) after amiodarone and/or fluconazole exposure. Of the 59 genes, 27 analyzed showed a significant change (>2-fold) in expression levels after amiodarone exposure. The up- or downregulated genes included genes involved in Ca2+ homeostasis, cell wall synthesis, vacuolar/lysosomal transport, diverse pathway regulation, stress response, and pseudohyphal morphogenesis. As expected, fluconazole induces an increase in ergosterol pathway genes expression levels. The combination treatment significantly dampened the transcriptional response to either drug, suggesting that synergism was due to an inhibition of compensatory response pathways. This dampening resulted in a decrease in total ergosterol levels and decreased pseudohyphal formation, a finding consistent with decreased virulence in a murine candidiasis model. PMID:20194694

Transcriptome Analysis of Early Responsive Genes in Rice during Magnaporthe oryzae Infection.

PubMed

Wang, Yiming; Kwon, Soon Jae; Wu, Jingni; Choi, Jaeyoung; Lee, Yong-Hwan; Agrawal, Ganesh Kumar; Tamogami, Shigeru; Rakwal, Randeep; Park, Sang-Ryeol; Kim, Beom-Gi; Jung, Ki-Hong; Kang, Kyu Young; Kim, Sang Gon; Kim, Sun Tae

2014-12-01

Rice blast disease caused by Magnaporthe oryzae is one of the most serious diseases of cultivated rice (Oryza sativa L.) in most rice-growing regions of the world. In order to investigate early response genes in rice, we utilized the transcriptome analysis approach using a 300 K tilling microarray to rice leaves infected with compatible and incompatible M. oryzae strains. Prior to the microarray experiment, total RNA was validated by measuring the differential expression of rice defense-related marker genes (chitinase 2, barwin, PBZ1, and PR-10) by RT-PCR, and phytoalexins (sakuranetin and momilactone A) with HPLC. Microarray analysis revealed that 231 genes were up-regulated (>2 fold change, p < 0.05) in the incompatible interaction compared to the compatible one. Highly expressed genes were functionally characterized into metabolic processes and oxidation-reduction categories. The oxidative stress response was induced in both early and later infection stages. Biotic stress overview from MapMan analysis revealed that the phytohormone ethylene as well as signaling molecules jasmonic acid and salicylic acid is important for defense gene regulation. WRKY and Myb transcription factors were also involved in signal transduction processes. Additionally, receptor-like kinases were more likely associated with the defense response, and their expression patterns were validated by RT-PCR. Our results suggest that candidate genes, including receptor-like protein kinases, may play a key role in disease resistance against M. oryzae attack.

Role of the Talaromyces marneffei (Penicillium marneffei) sakA gene in nitrosative stress response, conidiation and red pigment production.

PubMed

Nimmanee, Panjaphorn; Tam, Emily W T; Woo, Patrick C Y; Vanittanakom, Pramote; Vanittanakom, Nongnuch

2017-04-01

Stress-activated MAPK pathways are systems used to regulate the stress adaptation of most fungi. It has been shown that in Talaromyces marneffei (Penicillium marneffei), a pathogenic dimorphic fungus, the sakA gene is involved, not only in tolerance against oxidative and heat stresses, but also in playing a role in asexual development, yeast cell generation in vitro and survival inside macrophage cell lines. In this study, the role of the T. marneffei sakA gene on the nitrosative stress response and the regulation of gene expression were investigated. The susceptibility of the sakA mutant to NaNO2 was investigated using drop dilution assay and the expression of genes of interest were determined by RT-PCR, comparing them to the wild-type and complemented strains. The results demonstrated that the T. marneffei sakA gene played a role in the stress response to NaNO2, the expression of genes functioning in conidial development (brlA, abaA and wetA) and red pigment biosynthesis (pks3, rp1, rp2 and rp3). These findings suggest that T. marneffei sakA is broadly involved in a wide variety of cell activities, including stress response, cell morphogenesis, asexual development and pigmentation. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Transcriptome Profiling of Chironomus kiinensis under Phenol Stress Using Solexa Sequencing Technology

PubMed Central

Cao, Chuanwang; Wang, Zhiying; Niu, Changying; Desneux, Nicolas; Gao, Xiwu

2013-01-01

Phenol is a major pollutant in aquatic ecosystems due to its chemical stability, water solubility and environmental mobility. To date, little is known about the molecular modifications of invertebrates under phenol stress. In the present study, we used Solexa sequencing technology to investigate the transcriptome and differentially expressed genes (DEGs) of midges (Chironomus kiinensis) in response to phenol stress. A total of 51,518,972 and 51,150,832 clean reads in the phenol-treated and control libraries, respectively, were obtained and assembled into 51,014 non-redundant (Nr) consensus sequences. A total of 6,032 unigenes were classified by Gene Ontology (GO), and 18,366 unigenes were categorized into 238 Kyoto Encyclopedia of Genes and Genomes (KEGG) categories. These genes included representatives from almost all functional categories. A total of 10,724 differentially expressed genes (P value <0.05) were detected in a comparative analysis of the expression profiles between phenol-treated and control C. kiinensis including 8,390 upregulated and 2,334 downregulated genes. The expression levels of 20 differentially expressed genes were confirmed by real-time RT-PCR, and the trends in gene expression that were observed matched the Solexa expression profiles, although the magnitude of the variations was different. Through pathway enrichment analysis, significantly enriched pathways were identified for the DEGs, including metabolic pathways, aryl hydrocarbon receptor (AhR), pancreatic secretion and neuroactive ligand-receptor interaction pathways, which may be associated with the phenol responses of C. kiinensis. Using Solexa sequencing technology, we identified several groups of key candidate genes as well as important biological pathways involved in the molecular modifications of chironomids under phenol stress. PMID:23527048

Transferrin Level Before Treatment and Genetic Polymorphism in HFE Gene as Predictive Markers for Response to Adalimumab in Crohn's Disease Patients.

PubMed

Repnik, Katja; Koder, Silvo; Skok, Pavel; Ferkolj, Ivan; Potočnik, Uroš

2016-08-01

Tumor necrosis factor α inhibitors (anti-TNF) have improved treatment of several complex diseases, including Crohn's disease (CD). However, the effect varies and approximately one-third of the patients do not respond. Since blood parameters as well as genetic factors have shown a great potential to predict response during treatment, the aim of the study was to evaluate response to anti-TNF treatment with adalimumab (ADA) between genes HFE and TF and haematological parameters in Slovenian refractory CD patients. Single nucleotide polymorphisms (SNPs) rs1799852 in gene TF and rs2071303 in gene HFE were genotyped in 68 refractory CD patients for which response has been measured using inflammatory bowel disease questionnaire (IBDQ) index. Haematological parameters and IBDQ index were determined before therapy and after 4, 12, 20 and 30 weeks. We found novel strong association between SNP rs2071303 in gene HFE and response to ADA treatment, particularly patients with G allele comparing to A allele had better response after 20 weeks (p = 0.008). Further, we found strong association between transferrin level at baseline and treatment response after 12, 20 and 30 weeks, where average transferrin level before therapy was lower in responders (2.38 g/L) compared to non-responders (2.89 g/L, p = 0.005). Association was found between transferrin level in week 30 and SNP rs1799852 (p = 0.023), and between MCHC level before treatment and SNP rs2071303 (p = 0.007). Our results suggest that SNP in gene HFE as well as haematological markers serve as promising prognostic markers of response to anti-TNF treatment in CD patients.

Genome-wide transcriptomic analysis of BR-deficient Micro-Tom reveals correlations between drought stress tolerance and brassinosteroid signaling in tomato.

PubMed

Lee, Jinsu; Shim, Donghwan; Moon, Suyun; Kim, Hyemin; Bae, Wonsil; Kim, Kyunghwan; Kim, Yang-Hoon; Rhee, Sung-Keun; Hong, Chang Pyo; Hong, Suk-Young; Lee, Ye-Jin; Sung, Jwakyung; Ryu, Hojin

2018-06-01

Brassinosteroids (BRs) are plant steroid hormones that play crucial roles in a range of growth and developmental processes. Although BR signal transduction and biosynthetic pathways have been well characterized in model plants, their biological roles in an important crop, tomato (Solanum lycopersicum), remain unknown. Here, cultivated tomato (WT) and a BR synthesis mutant, Micro-Tom (MT), were compared using physiological and transcriptomic approaches. The cultivated tomato showed higher tolerance to drought and osmotic stresses than the MT tomato. However, BR-defective phenotypes of MT, including plant growth and stomatal closure defects, were completely recovered by application of exogenous BR or complementation with a SlDWARF gene. Using genome-wide transcriptome analysis, 619 significantly differentially expressed genes (DEGs) were identified between WT and MT plants. Several DEGs were linked to known signaling networks, including those related to biotic/abiotic stress responses, lignification, cell wall development, and hormone responses. Consistent with the higher susceptibility of MT to drought stress, several gene sets involved in responses to drought and osmotic stress were differentially regulated between the WT and MT tomato plants. Our data suggest that BR signaling pathways are involved in mediating the response to abiotic stress via fine-tuning of abiotic stress-related gene networks in tomato plants. Copyright © 2018. Published by Elsevier Masson SAS.

Suppressors of systemin signaling identify genes in the tomato wound response pathway.

PubMed Central

Howe, G A; Ryan, C A

1999-01-01

In tomato plants, systemic induction of defense genes in response to herbivory or mechanical wounding is regulated by an 18-amino-acid peptide signal called systemin. Transgenic plants that overexpress prosystemin, the systemin precursor, from a 35S::prosystemin (35S::prosys) transgene exhibit constitutive expression of wound-inducible defense proteins including proteinase inhibitors and polyphenol oxidase. To study further the role of (pro)systemin in the wound response pathway, we isolated and characterized mutations that suppress 35S::prosys-mediated phenotypes. Ten recessive, extragenic suppressors were identified. Two of these define new alleles of def-1, a previously identified mutation that blocks both wound- and systemin-induced gene expression and renders plants susceptible to herbivory. The remaining mutants defined four loci designated Spr-1, Spr-2, Spr-3, and Spr-4 (for Suppressed in 35S::prosystemin-mediated responses). spr-3 and spr-4 mutants were not significantly affected in their response to either systemin or mechanical wounding. In contrast, spr-1 and spr-2 plants lacked systemic wound responses and were insensitive to systemin. These results confirm the function of (pro)systemin in the transduction of systemic wound signals and further establish that wounding, systemin, and 35S::prosys induce defensive gene expression through a common signaling pathway defined by at least three genes (Def-1, Spr-1, and Spr-2). PMID:10545469

Transcriptional profiling of rat white adipose tissue response to 2,3,7,8-tetrachlorodibenzo-ρ-dioxin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Houlahan, Kathleen E.; Prokopec, Stephenie D.; Sun, Ren X.

Polychlorinated dibenzodioxins are environmental contaminants commonly produced as a by-product of industrial processes. The most potent of these, 2,3,7,8-tetrachlorodibenzo-ρ-dioxin (TCDD), is highly lipophilic, leading to bioaccumulation. White adipose tissue (WAT) is a major site for energy storage, and is one of the organs in which TCDD accumulates. In laboratory animals, exposure to TCDD causes numerous metabolic abnormalities, including a wasting syndrome. We therefore investigated the molecular effects of TCDD exposure on WAT by profiling the transcriptomic response of WAT to 100 μg/kg of TCDD at 1 or 4 days in TCDD-sensitive Long-Evans (Turku/AB; L-E) rats. A comparative analysis was conductedmore » simultaneously in identically treated TCDD-resistant Han/Wistar (Kuopio; H/W) rats one day after exposure to the same dose. We sought to identify transcriptomic changes coinciding with the onset of toxicity, while gaining additional insight into later responses. More transcriptional responses to TCDD were observed at 4 days than at 1 day post-exposure, suggesting WAT shows mostly secondary responses. Two classic AHR-regulated genes, Cyp1a1 and Nqo1, were significantly induced by TCDD in both strains, while several genes involved in the immune response, including Ms4a7 and F13a1 were altered in L-E rats alone. We compared genes affected by TCDD in rat WAT and human adipose cells, and observed little overlap. Interestingly, very few genes involved in lipid metabolism exhibited altered expression levels despite the pronounced lipid mobilization from peripheral fat pads by TCDD in L-E rats. Of these genes, the lipolysis-associated Lpin1 was induced slightly over 2-fold in L-E rat WAT on day 4. - Highlights: • Exposure to TCDD causes wasting syndrome in L-E rats but not in H/W rats. • We examined the transcriptome of TCDD-treated L-E and H/W rat white adipose tissue. • L-E WAT demonstrated altered abundance of several genes involved in immune response. • Few genes had altered abundance in both L-E rat WAT and human adipocytes (hMADS). • Pmepa1 was induced in both L-E WAT and differentiated hMADS cells.« less

Natural selection in avian protein-coding genes expressed in brain.

PubMed

Axelsson, Erik; Hultin-Rosenberg, Lina; Brandström, Mikael; Zwahlén, Martin; Clayton, David F; Ellegren, Hans

2008-06-01

The evolution of birds from theropod dinosaurs took place approximately 150 million years ago, and was associated with a number of specific adaptations that are still evident among extant birds, including feathers, song and extravagant secondary sexual characteristics. Knowledge about the molecular evolutionary background to such adaptations is lacking. Here, we analyse the evolution of > 5000 protein-coding gene sequences expressed in zebra finch brain by comparison to orthologous sequences in chicken. Mean d(N)/d(S) is 0.085 and genes with their maximal expression in the eye and central nervous system have the lowest mean d(N)/d(S) value, while those expressed in digestive and reproductive tissues exhibit the highest. We find that fast-evolving genes (those which have higher than expected rate of nonsynonymous substitution, indicative of adaptive evolution) are enriched for biological functions such as fertilization, muscle contraction, defence response, response to stress, wounding and endogenous stimulus, and cell death. After alignment to mammalian orthologues, we identify a catalogue of 228 genes that show a significantly higher rate of protein evolution in the two bird lineages than in mammals. These accelerated bird genes, representing candidates for avian-specific adaptations, include genes implicated in vocal learning and other cognitive processes. Moreover, colouration genes evolve faster in birds than in mammals, which may have been driven by sexual selection for extravagant plumage characteristics.

Concerted Changes in Gene Expression and Cell Physiology of the Cyanobacterium Synechocystis sp. Strain PCC 6803 during Transitions between Nitrogen and Light-Limited Growth1[W][OA

PubMed Central

Aguirre von Wobeser, Eneas; Ibelings, Bas W.; Bok, Jasper; Krasikov, Vladimir; Huisman, Jef; Matthijs, Hans C.P.

2011-01-01

Physiological adaptation and genome-wide expression profiles of the cyanobacterium Synechocystis sp. strain PCC 6803 in response to gradual transitions between nitrogen-limited and light-limited growth conditions were measured in continuous cultures. Transitions induced changes in pigment composition, light absorption coefficient, photosynthetic electron transport, and specific growth rate. Physiological changes were accompanied by reproducible changes in the expression of several hundred open reading frames, genes with functions in photosynthesis and respiration, carbon and nitrogen assimilation, protein synthesis, phosphorus metabolism, and overall regulation of cell function and proliferation. Cluster analysis of the nearly 1,600 regulated open reading frames identified eight clusters, each showing a different temporal response during the transitions. Two large clusters mirrored each other. One cluster included genes involved in photosynthesis, which were up-regulated during light-limited growth but down-regulated during nitrogen-limited growth. Conversely, genes in the other cluster were down-regulated during light-limited growth but up-regulated during nitrogen-limited growth; this cluster included several genes involved in nitrogen uptake and assimilation. These results demonstrate complementary regulation of gene expression for two major metabolic activities of cyanobacteria. Comparison with batch-culture experiments revealed interesting differences in gene expression between batch and continuous culture and illustrates that continuous-culture experiments can pick up subtle changes in cell physiology and gene expression. PMID:21205618

Concurrent Host-Pathogen Transcriptional Responses in a Clostridium perfringens Murine Myonecrosis Infection

PubMed Central

2018-01-01

ABSTRACT To obtain an insight into host-pathogen interactions in clostridial myonecrosis, we carried out comparative transcriptome analysis of both the bacterium and the host in a murine Clostridium perfringens infection model, which is the first time that such an investigation has been conducted. Analysis of the host transcriptome from infected muscle tissues indicated that many genes were upregulated compared to the results seen with mock-infected mice. These genes were enriched for host defense pathways, including Toll-like receptor (TLR) and Nod-like receptor (NLR) signaling components. Real-time PCR confirmed that host TLR2 and NLRP3 inflammasome genes were induced in response to C. perfringens infection. Comparison of the transcriptome of C. perfringens cells from the infected tissues with that from broth cultures showed that host selective pressure induced a global change in C. perfringens gene expression. A total of 33% (923) of C. perfringens genes were differentially regulated, including 10 potential virulence genes that were upregulated relative to their expression in vitro. These genes encoded putative proteins that may be involved in the synthesis of cell wall-associated macromolecules, in adhesion to host cells, or in protection from host cationic antimicrobial peptides. This report presents the first successful expression profiling of coregulated transcriptomes of bacterial and host genes during a clostridial myonecrosis infection and provides new insights into disease pathogenesis and host-pathogen interactions. PMID:29588405

Acclimatization to long-term hypoxia: gene expression in ovine carotid arteries.

PubMed

Goyal, Ravi; Longo, Lawrence D

2014-10-01

Exposure to acute high-altitude hypoxia is associated with an increase in cerebral blood flow (CBF) as a consequence of low arterial O2 tension. However, in response to high altitude acclimatization, CBF returns to levels similar to those at sea level, and tissue blood flow is maintained by an increase in angiogenesis. Of consequence, dysregulation of the acclimatization responses and CBF can result in acute mountain sickness, acute cerebral and/or pulmonary edema. To elucidate the signal transduction pathways involved in successful acclimatization to high altitude, in ovine carotid arteries, we tested the hypothesis that high altitude-associated long-term hypoxia results in changes in gene expression of critical signaling pathways. We acclimatized nonpregnant adult sheep to 3,801 m altitude for ∼110 days and conducted oligonucleotide microarray experiments on carotid arteries. Of a total of 116 regulated genes, 58 genes were significantly upregulated and 58 genes were significantly downregulated (each >2-fold, P < 0.05). Major upregulated genes included suprabasin and myelin basic protein, whereas downregulated genes included BAG2. Several of these genes are known to activate the ERK canonical signal transduction pathway and the process of angiogenesis. We conclude that among other changes, the altered signal transduction molecules involved in high-altitude acclimatization are associated ERK activation and angiogenesis. Copyright © 2014 the American Physiological Society.

Role for Human Mediator Subunit MED25 in Recruitment of Mediator to Promoters by Endoplasmic Reticulum Stress-responsive Transcription Factor ATF6α*

PubMed Central

Sela, Dotan; Conkright, Juliana J.; Chen, Lu; Gilmore, Joshua; Washburn, Michael P.; Florens, Laurence; Conaway, Ronald C.; Conaway, Joan Weliky

2013-01-01

Transcription factor ATF6α functions as a master regulator of endoplasmic reticulum (ER) stress response genes. In response to ER stress, ATF6α translocates from its site of latency in the ER membrane to the nucleus, where it activates RNA polymerase II transcription of ER stress response genes upon binding sequence-specifically to ER stress response enhancer elements (ERSEs) in their promoter-regulatory regions. In a recent study, we demonstrated that ATF6α activates transcription of ER stress response genes by a mechanism involving recruitment to ERSEs of the multisubunit Mediator and several histone acetyltransferase (HAT) complexes, including Spt-Ada-Gcn5 (SAGA) and Ada-Two-A-containing (ATAC) (Sela, D., Chen, L., Martin-Brown, S., Washburn, M.P., Florens, L., Conaway, J.W., and Conaway, R.C. (2012) J. Biol. Chem. 287, 23035–23045). In this study, we extend our investigation of the mechanism by which ATF6α supports recruitment of Mediator to ER stress response genes. We present findings arguing that Mediator subunit MED25 plays a critical role in this process and identify a MED25 domain that serves as a docking site on Mediator for the ATF6α transcription activation domain. PMID:23864652

Aging-dependent alterations in gene expression and a mitochondrial signature of responsiveness to human influenza vaccination.

PubMed

Thakar, Juilee; Mohanty, Subhasis; West, A Phillip; Joshi, Samit R; Ueda, Ikuyo; Wilson, Jean; Meng, Hailong; Blevins, Tamara P; Tsang, Sui; Trentalange, Mark; Siconolfi, Barbara; Park, Koonam; Gill, Thomas M; Belshe, Robert B; Kaech, Susan M; Shadel, Gerald S; Kleinstein, Steven H; Shaw, Albert C

2015-01-01

To elucidate gene expression pathways underlying age-associated impairment in influenza vaccine response, we screened young (age 21-30) and older (age≥65) adults receiving influenza vaccine in two consecutive seasons and identified those with strong or absent response to vaccine, including a subset of older adults meeting criteria for frailty. PBMCs obtained prior to vaccination (Day 0) and at day 2 or 4, day 7 and day 28 post-vaccine were subjected to gene expression microarray analysis. We defined a response signature and also detected induction of a type I interferon response at day 2 and a plasma cell signature at day 7 post-vaccine in young responders. The response signature was dysregulated in older adults, with the plasma cell signature induced at day 2, and was never induced in frail subjects (who were all non-responders). We also identified a mitochondrial signature in young vaccine responders containing genes mediating mitochondrial biogenesis and oxidative phosphorylation that was consistent in two different vaccine seasons and verified by analyses of mitochondrial content and protein expression. These results represent the first genome-wide transcriptional profiling analysis of age-associated dynamics following influenza vaccination, and implicate changes in mitochondrial biogenesis and function as a critical factor in human vaccine responsiveness.

Gene Expression Profiles of Human Dendritic Cells Interacting with Aspergillus fumigatus in a Bilayer Model of the Alveolar Epithelium/Endothelium Interface

PubMed Central

Morton, Charles Oliver; Fliesser, Mirjam; Dittrich, Marcus; Mueller, Tobias; Bauer, Ruth; Kneitz, Susanne; Hope, William; Rogers, Thomas Richard; Einsele, Hermann; Loeffler, Juergen

2014-01-01

The initial stages of the interaction between the host and Aspergillus fumigatus at the alveolar surface of the human lung are critical in the establishment of aspergillosis. Using an in vitro bilayer model of the alveolus, including both the epithelium (human lung adenocarcinoma epithelial cell line, A549) and endothelium (human pulmonary artery epithelial cells, HPAEC) on transwell membranes, it was possible to closely replicate the in vivo conditions. Two distinct sub-groups of dendritic cells (DC), monocyte-derived DC (moDC) and myeloid DC (mDC), were included in the model to examine immune responses to fungal infection at the alveolar surface. RNA in high quantity and quality was extracted from the cell layers on the transwell membrane to allow gene expression analysis using tailored custom-made microarrays, containing probes for 117 immune-relevant genes. This microarray data indicated minimal induction of immune gene expression in A549 alveolar epithelial cells in response to germ tubes of A. fumigatus. In contrast, the addition of DC to the system greatly increased the number of differentially expressed immune genes. moDC exhibited increased expression of genes including CLEC7A, CD209 and CCL18 in the absence of A. fumigatus compared to mDC. In the presence of A. fumigatus, both DC subgroups exhibited up-regulation of genes identified in previous studies as being associated with the exposure of DC to A. fumigatus and exhibiting chemotactic properties for neutrophils, including CXCL2, CXCL5, CCL20, and IL1B. This model closely approximated the human alveolus allowing for an analysis of the host pathogen interface that complements existing animal models of IA. PMID:24870357

Use of the Aspergillus oryzae actin gene promoter in a novel reporter system for exploring antifungal compounds and their target genes.

PubMed

Marui, Junichiro; Yoshimi, Akira; Hagiwara, Daisuke; Fujii-Watanabe, Yoshimi; Oda, Ken; Koike, Hideaki; Tamano, Koichi; Ishii, Tomoko; Sano, Motoaki; Machida, Masayuki; Abe, Keietsu

2010-08-01

Demand for novel antifungal drugs for medical and agricultural uses has been increasing because of the diversity of pathogenic fungi and the emergence of drug-resistant strains. Genomic resources for various living species, including pathogenic fungi, can be utilized to develop novel and effective antifungal compounds. We used Aspergillus oryzae as a model to construct a reporter system for exploring novel antifungal compounds and their target genes. The comprehensive gene expression analysis showed that the actin-encoding actB gene was transcriptionally highly induced by benomyl treatment. We therefore used the actB gene to construct a novel reporter system for monitoring responses to cytoskeletal stress in A. oryzae by introducing the actB promoter::EGFP fusion gene. Distinct fluorescence was observed in the reporter strain with minimum background noise in response to not only benomyl but also compounds inhibiting lipid metabolism that is closely related to cell membrane integrity. The fluorescent responses indicated that the reporter strain can be used to screen for lead compounds affecting fungal microtubule and cell membrane integrity, both of which are attractive antifungal targets. Furthermore, the reporter strain was shown to be technically applicable for identifying novel target genes of antifungal drugs triggering perturbation of fungal microtubules or membrane integrity.

Reciprocal osmotic challenges reveal mechanisms of divergence in phenotypic plasticity in the killifish Fundulus heteroclitus.

PubMed

Brennan, Reid S; Galvez, Fernando; Whitehead, Andrew

2015-04-15

The killifish Fundulus heteroclitus is an estuarine species with broad physiological plasticity, enabling acclimation to diverse stressors. Previous work suggests that freshwater populations expanded their physiology to accommodate low salinity environments; however, it is unknown whether this compromises their tolerance to high salinity. We used a comparative approach to investigate the mechanisms of a derived freshwater phenotype and the fate of an ancestral euryhaline phenotype after invasion of a freshwater environment. We compared physiological and transcriptomic responses to high- and low-salinity stress in fresh and brackish water populations and found an enhanced plasticity to low salinity in the freshwater population coupled with a reduced ability to acclimate to high salinity. Transcriptomic data identified genes with a conserved common response, a conserved salinity-dependent response and responses associated with population divergence. Conserved common acclimation responses revealed stress responses and alterations in cell-cycle regulation as important mechanisms in the general osmotic response. Salinity-specific responses included the regulation of genes involved in ion transport, intracellular calcium, energetic processes and cellular remodeling. Genes diverged between populations were primarily those showing salinity-specific expression and included those regulating polyamine homeostasis and the cell cycle. Additionally, when populations were matched with their native salinity, expression patterns were consistent with the concept of 'transcriptomic resilience', suggesting local adaptation. These findings provide insight into the fate of a plastic phenotype after a shift in environmental salinity and help to reveal mechanisms allowing for euryhalinity. © 2015. Published by The Company of Biologists Ltd.

Genome-wide Analysis of Phosphoenolpyruvate Carboxylase Gene Family and Their Response to Abiotic Stresses in Soybean

PubMed Central

Wang, Ning; Zhong, Xiujuan; Cong, Yahui; Wang, Tingting; Yang, Songnan; Li, Yan; Gai, Junyi

2016-01-01

Phosphoenolpyruvate carboxylase (PEPC) plays an important role in assimilating atmospheric CO2 during C4 and crassulacean acid metabolism photosynthesis, and also participates in various non-photosynthetic processes, including fruit ripening, stomatal opening, supporting carbon–nitrogen interactions, seed formation and germination, and regulation of plant tolerance to stresses. However, a comprehensive analysis of PEPC family in Glycine max has not been reported. Here, a total of ten PEPC genes were identified in soybean and denominated as GmPEPC1-GmPEPC10. Based on the phylogenetic analysis of the PEPC proteins from 13 higher plant species including soybean, PEPC family could be classified into two subfamilies, which was further supported by analyses of their conserved motifs and gene structures. Nineteen cis-regulatory elements related to phytohormones, abiotic and biotic stresses were identified in the promoter regions of GmPEPC genes, indicating their roles in soybean development and stress responses. GmPEPC genes were expressed in various soybean tissues and most of them responded to the exogenously applied phytohormones. GmPEPC6, GmPEPC8 and GmPEPC9 were significantly induced by aluminum toxicity, cold, osmotic and salt stresses. In addition, the enzyme activities of soybean PEPCs were also up-regulated by these treatments, suggesting their potential roles in soybean response to abiotic stresses. PMID:27924923

Integrative Analysis of DNA Methylation and Gene Expression Data Identifies EPAS1 as a Key Regulator of COPD

PubMed Central

Yoo, Seungyeul; Takikawa, Sachiko; Geraghty, Patrick; Argmann, Carmen; Campbell, Joshua; Lin, Luan; Huang, Tao; Tu, Zhidong; Feronjy, Robert; Spira, Avrum; Schadt, Eric E.; Powell, Charles A.; Zhu, Jun

2015-01-01

Chronic Obstructive Pulmonary Disease (COPD) is a complex disease. Genetic, epigenetic, and environmental factors are known to contribute to COPD risk and disease progression. Therefore we developed a systematic approach to identify key regulators of COPD that integrates genome-wide DNA methylation, gene expression, and phenotype data in lung tissue from COPD and control samples. Our integrative analysis identified 126 key regulators of COPD. We identified EPAS1 as the only key regulator whose downstream genes significantly overlapped with multiple genes sets associated with COPD disease severity. EPAS1 is distinct in comparison with other key regulators in terms of methylation profile and downstream target genes. Genes predicted to be regulated by EPAS1 were enriched for biological processes including signaling, cell communications, and system development. We confirmed that EPAS1 protein levels are lower in human COPD lung tissue compared to non-disease controls and that Epas1 gene expression is reduced in mice chronically exposed to cigarette smoke. As EPAS1 downstream genes were significantly enriched for hypoxia responsive genes in endothelial cells, we tested EPAS1 function in human endothelial cells. EPAS1 knockdown by siRNA in endothelial cells impacted genes that significantly overlapped with EPAS1 downstream genes in lung tissue including hypoxia responsive genes, and genes associated with emphysema severity. Our first integrative analysis of genome-wide DNA methylation and gene expression profiles illustrates that not only does DNA methylation play a ‘causal’ role in the molecular pathophysiology of COPD, but it can be leveraged to directly identify novel key mediators of this pathophysiology. PMID:25569234

Identification of key microRNAs and genes in preeclampsia by bioinformatics analysis

PubMed Central

Luo, Shouling; Cao, Nannan; Tang, Yao; Gu, Weirong

2017-01-01

Preeclampsia is a leading cause of perinatal maternal–foetal mortality and morbidity. The aim of this study is to identify the key microRNAs and genes in preeclampsia and uncover their potential functions. We downloaded the miRNA expression profile of GSE84260 and the gene expression profile of GSE73374 from the Gene Expression Omnibus database. Differentially expressed miRNAs and genes were identified and compared to miRNA-target information from MiRWalk 2.0, and a total of 65 differentially expressed miRNAs (DEMIs), including 32 up-regulated miRNAs and 33 down-regulated miRNAs, and 91 differentially expressed genes (DEGs), including 83 up-regulated genes and 8 down-regulated genes, were identified. The pathway enrichment analyses of the DEMIs showed that the up-regulated DEMIs were enriched in the Hippo signalling pathway and MAPK signalling pathway, and the down-regulated DEMIs were enriched in HTLV-I infection and miRNAs in cancers. The gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes pathway (KEGG) enrichment analyses of the DEGs were performed using Multifaceted Analysis Tool for Human Transcriptome. The up-regulated DEGs were enriched in biological processes (BPs), including the response to cAMP, response to hydrogen peroxide and cell-cell adhesion mediated by integrin; no enrichment of down-regulated DEGs was identified. KEGG analysis showed that the up-regulated DEGs were enriched in the Hippo signalling pathway and pathways in cancer. A PPI network of the DEGs was constructed by using Cytoscape software, and FOS, STAT1, MMP14, ITGB1, VCAN, DUSP1, LDHA, MCL1, MET, and ZFP36 were identified as the hub genes. The current study illustrates a characteristic microRNA profile and gene profile in preeclampsia, which may contribute to the interpretation of the progression of preeclampsia and provide novel biomarkers and therapeutic targets for preeclampsia. PMID:28594854

Gene promoter DNA methylation patterns have a limited role in orchestrating transcriptional changes in the fetal liver in response to maternal folate depletion during pregnancy.

PubMed

McKay, Jill A; Adriaens, Michiel; Evelo, Chris T; Ford, Dianne; Mathers, John C

2016-09-01

Early-life exposures are critical in fetal programming and may influence function and health in later life. Adequate maternal folate consumption during pregnancy is essential for healthy fetal development and long-term offspring health. The mechanisms underlying fetal programming are poorly understood, but are likely to involve gene regulation. Epigenetic marks, including DNA methylation, regulate gene expression and are modifiable by folate supply. We observed transcriptional changes in fetal liver in response to maternal folate depletion and hypothesized that these changes are concomitant with altered gene promoter methylation. Female C57BL/6J mice were fed diets containing 2 or 0.4 mg folic acid/kg for 4 wk before mating and throughout pregnancy. At 17.5-day gestation, genome-wide gene expression and promoter methylation were measured by microarray analysis in male fetal livers. While 989 genes were differentially expressed, 333 promoters had altered methylation (247 hypermethylated, 86 hypomethylated) in response to maternal folate depletion. Only 16 genes had both expression and methylation changes. However, most methylation changes occurred in genomic regions neighboring expression changes. In response to maternal folate depletion, altered expression at the mRNA level was not associated with altered promoter methylation of the same gene in fetal liver. © 2016 The Authors. Molecular Nutrition & Food Research Published by Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Computational Analysis of Candidate Disease Genes and Variants for Salt-Sensitive Hypertension in Indigenous Southern Africans

PubMed Central

Tiffin, Nicki; Meintjes, Ayton; Ramesar, Rajkumar; Bajic, Vladimir B.; Rayner, Brian

2010-01-01

Multiple factors underlie susceptibility to essential hypertension, including a significant genetic and ethnic component, and environmental effects. Blood pressure response of hypertensive individuals to salt is heterogeneous, but salt sensitivity appears more prevalent in people of indigenous African origin. The underlying genetics of salt-sensitive hypertension, however, are poorly understood. In this study, computational methods including text- and data-mining have been used to select and prioritize candidate aetiological genes for salt-sensitive hypertension. Additionally, we have compared allele frequencies and copy number variation for single nucleotide polymorphisms in candidate genes between indigenous Southern African and Caucasian populations, with the aim of identifying candidate genes with significant variability between the population groups: identifying genetic variability between population groups can exploit ethnic differences in disease prevalence to aid with prioritisation of good candidate genes. Our top-ranking candidate genes include parathyroid hormone precursor (PTH) and type-1angiotensin II receptor (AGTR1). We propose that the candidate genes identified in this study warrant further investigation as potential aetiological genes for salt-sensitive hypertension. PMID:20886000

A Temperature-Responsive Network Links Cell Shape and Virulence Traits in a Primary Fungal Pathogen

PubMed Central

Beyhan, Sinem; Gutierrez, Matias; Voorhies, Mark; Sil, Anita

2013-01-01

Survival at host temperature is a critical trait for pathogenic microbes of humans. Thermally dimorphic fungal pathogens, including Histoplasma capsulatum, are soil fungi that undergo dramatic changes in cell shape and virulence gene expression in response to host temperature. How these organisms link changes in temperature to both morphologic development and expression of virulence traits is unknown. Here we elucidate a temperature-responsive transcriptional network in H. capsulatum, which switches from a filamentous form in the environment to a pathogenic yeast form at body temperature. The circuit is driven by three highly conserved factors, Ryp1, Ryp2, and Ryp3, that are required for yeast-phase growth at 37°C. Ryp factors belong to distinct families of proteins that control developmental transitions in fungi: Ryp1 is a member of the WOPR family of transcription factors, and Ryp2 and Ryp3 are both members of the Velvet family of proteins whose molecular function is unknown. Here we provide the first evidence that these WOPR and Velvet proteins interact, and that Velvet proteins associate with DNA to drive gene expression. Using genome-wide chromatin immunoprecipitation studies, we determine that Ryp1, Ryp2, and Ryp3 associate with a large common set of genomic loci that includes known virulence genes, indicating that the Ryp factors directly control genes required for pathogenicity in addition to their role in regulating cell morphology. We further dissect the Ryp regulatory circuit by determining that a fourth transcription factor, which we name Ryp4, is required for yeast-phase growth and gene expression, associates with DNA, and displays interdependent regulation with Ryp1, Ryp2, and Ryp3. Finally, we define cis-acting motifs that recruit the Ryp factors to their interwoven network of temperature-responsive target genes. Taken together, our results reveal a positive feedback circuit that directs a broad transcriptional switch between environmental and pathogenic states in response to temperature. PMID:23935449

A Systems Biology Study in Tomato Fruit Reveals Correlations between the Ascorbate Pool and Genes Involved in Ribosome Biogenesis, Translation, and the Heat-Shock Response

PubMed Central

Stevens, Rebecca G.; Baldet, Pierre; Bouchet, Jean-Paul; Causse, Mathilde; Deborde, Catherine; Deschodt, Claire; Faurobert, Mireille; Garchery, Cécile; Garcia, Virginie; Gautier, Hélène; Gouble, Barbara; Maucourt, Mickaël; Moing, Annick; Page, David; Petit, Johann; Poëssel, Jean-Luc; Truffault, Vincent; Rothan, Christophe

2018-01-01

Changing the balance between ascorbate, monodehydroascorbate, and dehydroascorbate in plant cells by manipulating the activity of enzymes involved in ascorbate synthesis or recycling of oxidized and reduced forms leads to multiple phenotypes. A systems biology approach including network analysis of the transcriptome, proteome and metabolites of RNAi lines for ascorbate oxidase, monodehydroascorbate reductase and galactonolactone dehydrogenase has been carried out in orange fruit pericarp of tomato (Solanum lycopersicum). The transcriptome of the RNAi ascorbate oxidase lines is inversed compared to the monodehydroascorbate reductase and galactonolactone dehydrogenase lines. Differentially expressed genes are involved in ribosome biogenesis and translation. This transcriptome inversion is also seen in response to different stresses in Arabidopsis. The transcriptome response is not well correlated with the proteome which, with the metabolites, are correlated to the activity of the ascorbate redox enzymes—ascorbate oxidase and monodehydroascorbate reductase. Differentially accumulated proteins include metacaspase, protein disulphide isomerase, chaperone DnaK and carbonic anhydrase and the metabolites chlorogenic acid, dehydroascorbate and alanine. The hub genes identified from the network analysis are involved in signaling, the heat-shock response and ribosome biogenesis. The results from this study therefore reveal one or several putative signals from the ascorbate pool which modify the transcriptional response and elements downstream. PMID:29491875

Pharmacogenetics of the β2-Adrenergic Receptor Gene

PubMed Central

Ortega, Victor E.; Hawkins, Gregory A.; Peters, Stephen P.; Bleecker, Eugene R.

2009-01-01

Asthma is a complex genetic disease with multiple genetic and environmental determinants contributing to the observed variability in response to common anti-asthma therapies. Asthma pharmacogenetic research has focused on multiple candidate genes including the β2-adrenergic receptor gene (ADRβ2) and its effect on individual responses to beta agonist therapy. At present, knowledge about the effects of ADRβ2 variation on therapeutic responses is evolving and should not alter current Asthma Guideline approaches consisting of the use of short acting beta agonists for as-needed symptom based therapy and the use of a regular long-acting beta agonist in combination with inhaled corticosteroid therapy for optimal control of asthma symptoms in those asthmatics who are not controlled on inhaled corticosteroid alone. This approach is based upon studies showing a consistent pharmacogenetic response to regular use of short acting beta agonists (SABA) and less consistent findings in studies evaluating long acting beta agonist (LABA). While emerging pharmacogenetic studies are provocative and should lead to functional approaches, conflicting data with responses to LABA therapy may be caused by factors that include small sample sizes of study populations and differences in experimental design that may limit the conclusions that may be drawn from these clinical trials at the present time. PMID:17996583

Feedback inhibition by thiols outranks glutathione depletion: a luciferase-based screen reveals glutathione-deficient γ-ECS and glutathione synthetase mutants impaired in cadmium-induced sulfate assimilation.

PubMed

Jobe, Timothy O; Sung, Dong-Yul; Akmakjian, Garo; Pham, Allis; Komives, Elizabeth A; Mendoza-Cózatl, David G; Schroeder, Julian I

2012-06-01

Plants exposed to heavy metals rapidly induce changes in gene expression that activate and enhance detoxification mechanisms, including toxic-metal chelation and the scavenging of reactive oxygen species. However, the mechanisms mediating toxic heavy metal-induced gene expression remain largely unknown. To genetically elucidate cadmium-specific transcriptional responses in Arabidopsis, we designed a genetic screen based on the activation of a cadmium-inducible reporter gene. Microarray studies identified a high-affinity sulfate transporter (SULTR1;2) among the most robust and rapid cadmium-inducible transcripts. The SULTR1;2 promoter (2.2 kb) was fused with the firefly luciferase reporter gene to quantitatively report the transcriptional response of plants exposed to cadmium. Stably transformed luciferase reporter lines were ethyl methanesulfonate (EMS) mutagenized, and stable M(2) seedlings were screened for an abnormal luciferase response during exposure to cadmium. The screen identified non-allelic mutant lines that fell into one of three categories: (i) super response to cadmium (SRC) mutants; (ii) constitutive response to cadmium (CRC) mutants; or (iii) non-response and reduced response to cadmium (NRC) mutants. Two nrc mutants, nrc1 and nrc2, were mapped, cloned and further characterized. The nrc1 mutation was mapped to the γ-glutamylcysteine synthetase gene and the nrc2 mutation was identified as the first viable recessive mutant allele in the glutathione synthetase gene. Moreover, genetic, HPLC mass spectrometry, and gene expression analysis of the nrc1 and nrc2 mutants, revealed that intracellular glutathione depletion alone would be insufficient to induce gene expression of sulfate uptake and assimilation mechanisms. Our results modify the glutathione-depletion driven model for sulfate assimilation gene induction during cadmium stress, and suggest that an enhanced oxidative state and depletion of upstream thiols, in addition to glutathione depletion, are necessary to induce the transcription of sulfate assimilation genes during early cadmium stress. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

Combined Chromatin and Expression Analysis Reveals Specific Regulatory Mechanisms within Cytokine Genes in the Macrophage Early Immune Response

PubMed Central

Emanuelsson, Olof; Sennblad, Bengt; Pirmoradian Najafabadi, Mohammad; Folkersen, Lasse; Mälarstig, Anders; Lagergren, Jens; Eriksson, Per; Hamsten, Anders; Odeberg, Jacob

2012-01-01

Macrophages play a critical role in innate immunity, and the expression of early response genes orchestrate much of the initial response of the immune system. Macrophages undergo extensive transcriptional reprogramming in response to inflammatory stimuli such as Lipopolysaccharide (LPS). To identify gene transcription regulation patterns involved in early innate immune responses, we used two genome-wide approaches - gene expression profiling and chromatin immunoprecipitation-sequencing (ChIP-seq) analysis. We examined the effect of 2 hrs LPS stimulation on early gene expression and its relation to chromatin remodeling (H3 acetylation; H3Ac) and promoter binding of Sp1 and RNA polymerase II phosphorylated at serine 5 (S5P RNAPII), which is a marker for transcriptional initiation. Our results indicate novel and alternative gene regulatory mechanisms for certain proinflammatory genes. We identified two groups of up-regulated inflammatory genes with respect to chromatin modification and promoter features. One group, including highly up-regulated genes such as tumor necrosis factor (TNF), was characterized by H3Ac, high CpG content and lack of TATA boxes. The second group, containing inflammatory mediators (interleukins and CCL chemokines), was up-regulated upon LPS stimulation despite lacking H3Ac in their annotated promoters, which were low in CpG content but did contain TATA boxes. Genome-wide analysis showed that few H3Ac peaks were unique to either +/−LPS condition. However, within these, an unpacking/expansion of already existing H3Ac peaks was observed upon LPS stimulation. In contrast, a significant proportion of S5P RNAPII peaks (approx 40%) was unique to either condition. Furthermore, data indicated a large portion of previously unannotated TSSs, particularly in LPS-stimulated macrophages, where only 28% of unique S5P RNAPII peaks overlap annotated promoters. The regulation of the inflammatory response appears to occur in a very specific manner at the chromatin level for specific genes and this study highlights the level of fine-tuning that occurs in the immune response. PMID:22384210

Rates of evolution in stress-related genes are associated with habitat preference in two Cardamine lineages

PubMed Central

2012-01-01

Background Elucidating the selective and neutral forces underlying molecular evolution is fundamental to understanding the genetic basis of adaptation. Plants have evolved a suite of adaptive responses to cope with variable environmental conditions, but relatively little is known about which genes are involved in such responses. Here we studied molecular evolution on a genome-wide scale in two species of Cardamine with distinct habitat preferences: C. resedifolia, found at high altitudes, and C. impatiens, found at low altitudes. Our analyses focussed on genes that are involved in stress responses to two factors that differentiate the high- and low-altitude habitats, namely temperature and irradiation. Results High-throughput sequencing was used to obtain gene sequences from C. resedifolia and C. impatiens. Using the available A. thaliana gene sequences and annotation, we identified nearly 3,000 triplets of putative orthologues, including genes involved in cold response, photosynthesis or in general stress responses. By comparing estimated rates of molecular substitution, codon usage, and gene expression in these species with those of Arabidopsis, we were able to evaluate the role of positive and relaxed selection in driving the evolution of Cardamine genes. Our analyses revealed a statistically significant higher rate of molecular substitution in C. resedifolia than in C. impatiens, compatible with more efficient positive selection in the former. Conversely, the genome-wide level of selective pressure is compatible with more relaxed selection in C. impatiens. Moreover, levels of selective pressure were heterogeneous between functional classes and between species, with cold responsive genes evolving particularly fast in C. resedifolia, but not in C. impatiens. Conclusions Overall, our comparative genomic analyses revealed that differences in effective population size might contribute to the differences in the rate of protein evolution and in the levels of selective pressure between the C. impatiens and C. resedifolia lineages. The within-species analyses also revealed evolutionary patterns associated with habitat preference of two Cardamine species. We conclude that the selective pressures associated with the habitats typical of C. resedifolia may have caused the rapid evolution of genes involved in cold response. PMID:22257588

Expression of Multiple Stress Response Genes by Escherichia Coli Under Modeled Reduced Gravity

NASA Astrophysics Data System (ADS)

Vukanti, Raja; Leff, Laura G.

2012-09-01

Bacteria, in response to changes in their environment, quickly regulate gene expression; hence, transcriptional profiling has been widely used to characterize bacterial responses to various environmental conditions. In this study, we used clinorotation to grow bacteria under low-sedimentation, -shear, and -turbulence conditions (referred to as modeled reduced gravity, MRG, below) which profoundly impacts bacteria including causing elevated resistance to multiple environmental stresses. To explore potential mechanisms behind the multiple stress resistance response to MRG, we assessed expression levels of E. coli genes, using reverse transcription followed by real-time-PCR, involved in specific stress and general stress responses under MRG and normal gravity (NG) in nutritionally rich and minimal media, and during exponential and stationary phases of growth. In addition, growth rates as well as physico-chemical parameters of culture media were examined. Over-expression of stress response genes (csiD, cstA, katE, otsA, treA) occurred under MRG compared to NG controls, but only during the later stages of growth in rich medium demonstrating that bacterial response to MRG varies with growth-medium and -phase. At stationary phase in rich medium under MRG and NG, E. coli had similar growth rates (based on rRNA-leader abundance) and yields (cell mass and numbers); this coupled, with observations of simultaneous induction of starvation response genes (csiD and cstA) suggests the multiple stress resistance phenotype under MRG could be attributable to microzones of nutrient unavailability around cells. Overall, in rich medium, the response resembled the general stress response (GSR) that E. coli develops during stationary phase of growth. Along these same lines, induction of genes coding for GSR was reversed by improving nutritional conditions under MRG. The reversal of GSR under MRG suggests that the multiple stress response exhibited is not specific to MRG but may result from nutrient limitation experienced by bacteria after incubation in nutrient-rich media under these conditions.

Systems Biology Analysis of Gene Expression during In Vivo Mycobacterium avium paratuberculosis Enteric Colonization Reveals Role for Immune Tolerance

PubMed Central

Khare, Sangeeta; Lawhon, Sara D.; Drake, Kenneth L.; Nunes, Jairo E. S.; Figueiredo, Josely F.; Rossetti, Carlos A.; Gull, Tamara; Everts, Robin E.; Lewin, Harris A.; Galindo, Cristi L.; Garner, Harold R.; Adams, Leslie Garry

2012-01-01

Survival and persistence of Mycobacterium avium subsp. paratuberculosis (MAP) in the intestinal mucosa is associated with host immune tolerance. However, the initial events during MAP interaction with its host that lead to pathogen survival, granulomatous inflammation, and clinical disease progression are poorly defined. We hypothesize that immune tolerance is initiated upon initial contact of MAP with the intestinal Peyer's patch. To test our hypothesis, ligated ileal loops in neonatal calves were infected with MAP. Intestinal tissue RNAs were collected (0.5, 1, 2, 4, 8 and 12 hrs post-infection), processed, and hybridized to bovine gene expression microarrays. By comparing the gene transcription responses of calves infected with the MAP, informative complex patterns of expression were clearly visible. To interpret these complex data, changes in the gene expression were further analyzed by dynamic Bayesian analysis, and genes were grouped into the specific pathways and gene ontology categories to create a holistic model. This model revealed three different phases of responses: i) early (30 min and 1 hr post-infection), ii) intermediate (2, 4 and 8 hrs post-infection), and iii) late (12 hrs post-infection). We describe here the data that include expression profiles for perturbed pathways, as well as, mechanistic genes (genes predicted to have regulatory influence) that are associated with immune tolerance. In the Early Phase of MAP infection, multiple pathways were initiated in response to MAP invasion via receptor mediated endocytosis and changes in intestinal permeability. During the Intermediate Phase, perturbed pathways involved the inflammatory responses, cytokine-cytokine receptor interaction, and cell-cell signaling. During the Late Phase of infection, gene responses associated with immune tolerance were initiated at the level of T-cell signaling. Our study provides evidence that MAP infection resulted in differentially regulated genes, perturbed pathways and specifically modified mechanistic genes contributing to the colonization of Peyer's patch. PMID:22912686

Transcriptional Response of Honey Bee Larvae Infected with the Bacterial Pathogen Paenibacillus larvae

PubMed Central

Cornman, Robert Scott; Lopez, Dawn; Evans, Jay D.

2013-01-01

American foulbrood disease of honey bees is caused by the bacterium Paenibacillus larvae. Infection occurs per os in larvae and systemic infection requires a breaching of the host peritrophic matrix and midgut epithelium. Genetic variation exists for both bacterial virulence and host resistance, and a general immunity is achieved by larvae as they age, the basis of which has not been identified. To quickly identify a pool of candidate genes responsive to P. larvae infection, we sequenced transcripts from larvae inoculated with P. larvae at 12 hours post-emergence and incubated for 72 hours, and compared expression levels to a control cohort. We identified 75 genes with significantly higher expression and six genes with significantly lower expression. In addition to several antimicrobial peptides, two genes encoding peritrophic-matrix domains were also up-regulated. Extracellular matrix proteins, proteases/protease inhibitors, and members of the Osiris gene family were prevalent among differentially regulated genes. However, analysis of Drosophila homologs of differentially expressed genes revealed spatial and temporal patterns consistent with developmental asynchrony as a likely confounder of our results. We therefore used qPCR to measure the consistency of gene expression changes for a subset of differentially expressed genes. A replicate experiment sampled at both 48 and 72 hours post infection allowed further discrimination of genes likely to be involved in host response. The consistently responsive genes in our test set included a hymenopteran-specific protein tyrosine kinase, a hymenopteran specific serine endopeptidase, a cytochrome P450 (CYP9Q1), and a homolog of trynity, a zona pellucida domain protein. Of the known honey bee antimicrobial peptides, apidaecin was responsive at both time-points studied whereas hymenoptaecin was more consistent in its level of change between biological replicates and had the greatest increase in expression by RNA-seq analysis. PMID:23762370

Retinal Determination genes function along with cell-cell signals to regulate Drosophila eye development: examples of multi-layered regulation by Master Regulators

PubMed Central

Baker, Nicholas E.; Firth, Lucy C.

2015-01-01

It is thought that Retinal Determination gene products define the response made to cell-cell signals within the eye developmental field by binding to enhancers of genes that are also regulated by cell-cell signaling pathways. In Drosophila, Retinal Determination genes including Eyeless, teashirt, eyes absent, dachsous and sine oculis, are required for normal eye development and can induce ectopic eyes when mis-expressed. Characterization of the enhancers responsible for eye expression of the hedgehog, shaven, and atonal genes, as well as the dynamics of Retinal Determination gene expression themselves, now suggest a multilayered network whereby transcriptional regulation by either Retinal Determination genes or cell-cell signaling pathways can sometimes be indirect and mediated by other transcription factor intermediates. In this updated view of the interaction between extracellular information and cell intrinsic programs during development, regulation of individual genes might sometimes be several steps removed from either the Retinal Determination genes or cell-cell signaling pathways that nevertheless govern their expression. PMID:21607995

Genome-wide protective response used by group A Streptococcus to evade destruction by human polymorphonuclear leukocytes.

PubMed

Voyich, Jovanka M; Sturdevant, Daniel E; Braughton, Kevin R; Kobayashi, Scott D; Lei, Benfang; Virtaneva, Kimmo; Dorward, David W; Musser, James M; DeLeo, Frank R

2003-02-18

Group A Streptococcus (GAS) evades polymorphonuclear leukocyte (PMN) phagocytosis and killing to cause human disease, including pharyngitis and necrotizing fasciitis (flesh-eating syndrome). We show that GAS genes differentially regulated during phagocytic interaction with human PMNs comprise a global pathogen-protective response to innate immunity. GAS prophage genes and genes involved in virulence, oxidative stress, cell wall biosynthesis, and gene regulation were up-regulated during PMN phagocytosis. Genes encoding novel secreted proteins were up-regulated, and the proteins were produced during human GAS infections. We discovered an essential role for the Ihk-Irr two-component regulatory system in evading PMN-mediated killing and promoting host-cell lysis, processes that would facilitate GAS pathogenesis. Importantly, the irr gene was highly expressed during human GAS pharyngitis. We conclude that a complex pathogen genetic program circumvents human innate immunity to promote disease. The gene regulatory program revealed by our studies identifies previously undescribed potential vaccine antigens and targets for therapeutic interventions designed to control GAS infections.

The immune gene repertoire of an important viral reservoir, the Australian black flying fox

PubMed Central

2012-01-01

Background Bats are the natural reservoir host for a range of emerging and re-emerging viruses, including SARS-like coronaviruses, Ebola viruses, henipaviruses and Rabies viruses. However, the mechanisms responsible for the control of viral replication in bats are not understood and there is little information available on any aspect of antiviral immunity in bats. Massively parallel sequencing of the bat transcriptome provides the opportunity for rapid gene discovery. Although the genomes of one megabat and one microbat have now been sequenced to low coverage, no transcriptomic datasets have been reported from any bat species. In this study, we describe the immune transcriptome of the Australian flying fox, Pteropus alecto, providing an important resource for identification of genes involved in a range of activities including antiviral immunity. Results Towards understanding the adaptations that have allowed bats to coexist with viruses, we have de novo assembled transcriptome sequence from immune tissues and stimulated cells from P. alecto. We identified about 18,600 genes involved in a broad range of activities with the most highly expressed genes involved in cell growth and maintenance, enzyme activity, cellular components and metabolism and energy pathways. 3.5% of the bat transcribed genes corresponded to immune genes and a total of about 500 immune genes were identified, providing an overview of both innate and adaptive immunity. A small proportion of transcripts found no match with annotated sequences in any of the public databases and may represent bat-specific transcripts. Conclusions This study represents the first reported bat transcriptome dataset and provides a survey of expressed bat genes that complement existing bat genomic data. In addition, these data provide insight into genes relevant to the antiviral responses of bats, and form a basis for examining the roles of these molecules in immune response to viral infection. PMID:22716473

NHR-49/HNF4 integrates regulation of fatty acid metabolism with a protective transcriptional response to oxidative stress and fasting.

PubMed

Goh, Grace Y S; Winter, Johnathan J; Bhanshali, Forum; Doering, Kelsie R S; Lai, Regina; Lee, Kayoung; Veal, Elizabeth A; Taubert, Stefan

2018-06-01

Endogenous and exogenous stresses elicit transcriptional responses that limit damage and promote cell/organismal survival. Like its mammalian counterparts, hepatocyte nuclear factor 4 (HNF4) and peroxisome proliferator-activated receptor α (PPARα), Caenorhabditis elegans NHR-49 is a well-established regulator of lipid metabolism. Here, we reveal that NHR-49 is essential to activate a transcriptional response common to organic peroxide and fasting, which includes the pro-longevity gene fmo-2/flavin-containing monooxygenase. These NHR-49-dependent, stress-responsive genes are also upregulated in long-lived glp-1/notch receptor mutants, with two of them making critical contributions to the oxidative stress resistance of wild-type and long-lived glp-1 mutants worms. Similar to its role in lipid metabolism, NHR-49 requires the mediator subunit mdt-15 to promote stress-induced gene expression. However, NHR-49 acts independently from the transcription factor hlh-30/TFEB that also promotes fmo-2 expression. We show that activation of the p38 MAPK, PMK-1, which is important for adaptation to a variety of stresses, is also important for peroxide-induced expression of a subset of NHR-49-dependent genes that includes fmo-2. However, organic peroxide increases NHR-49 protein levels, by a posttranscriptional mechanism that does not require PMK-1 activation. Together, these findings establish a new role for the HNF4/PPARα-related NHR-49 as a stress-activated regulator of cytoprotective gene expression. © 2018 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

Serrated colorectal cancer: Molecular classification, prognosis, and response to chemotherapy

PubMed Central

Murcia, Oscar; Juárez, Miriam; Hernández-Illán, Eva; Egoavil, Cecilia; Giner-Calabuig, Mar; Rodríguez-Soler, María; Jover, Rodrigo

2016-01-01

Molecular advances support the existence of an alternative pathway of colorectal carcinogenesis that is based on the hypermethylation of specific DNA regions that silences tumor suppressor genes. This alternative pathway has been called the serrated pathway due to the serrated appearance of tumors in histological analysis. New classifications for colorectal cancer (CRC) were proposed recently based on genetic profiles that show four types of molecular alterations: BRAF gene mutations, KRAS gene mutations, microsatellite instability, and hypermethylation of CpG islands. This review summarizes what is known about the serrated pathway of CRC, including CRC molecular and clinical features, prognosis, and response to chemotherapy. PMID:27053844

A critical role for topoisomerase IIb and DNA double strand breaks in transcription

PubMed Central

Calderwood, Stuart K.

2016-01-01

ABSTRACT Recent studies have indicated a novel role for topoisomerase IIb in transcription. Transcription of heat shock genes, serum-induced immediate early genes and nuclear receptor-activated genes, each required DNA double strands generated by topoisomerase IIb. Such strand breaks seemed both necessary and sufficient for transcriptional activation. In addition, such transcription was associated with initiation of the DNA damage response pathways, including the activation of the enzymes: ataxia-telangiectasia mutated (ATM), DNA-dependent protein kinase and poly (ADP ribose) polymerase 1. DNA damage response signaling was involved both in transcription and in repair of DNA breaks generated by topoisomerase IIb. PMID:27100743

A critical role for topoisomerase IIb and DNA double strand breaks in transcription.

PubMed

Calderwood, Stuart K

2016-05-26

Recent studies have indicated a novel role for topoisomerase IIb in transcription. Transcription of heat shock genes, serum-induced immediate early genes and nuclear receptor-activated genes, each required DNA double strands generated by topoisomerase IIb. Such strand breaks seemed both necessary and sufficient for transcriptional activation. In addition, such transcription was associated with initiation of the DNA damage response pathways, including the activation of the enzymes: ataxia-telangiectasia mutated (ATM), DNA-dependent protein kinase and poly (ADP ribose) polymerase 1. DNA damage response signaling was involved both in transcription and in repair of DNA breaks generated by topoisomerase IIb.

Landscape of post-transcriptional gene regulation during hepatitis C virus infection

PubMed Central

Schwerk, Johannes; Jarret, Abigail P.; Joslyn, Rochelle C.; Savan, Ram

2015-01-01

Post-transcriptional regulation of gene expression plays a pivotal role in various gene regulatory networks including, but not limited to metabolism, embryogenesis and immune responses. Different mechanisms of post-transcriptional regulation, which can act individually, synergistically, or even in an antagonistic manner have been described. Hepatitis C virus (HCV) is notorious for subverting host immune responses and indeed exploits several components of the host’s post-transcriptional regulatory machinery for its own benefit. At the same time, HCV replication is post-transcriptionally targeted by host cell components to blunt viral propagation. This review discusses the interplay of post-transcriptional mechanisms that affect host immune responses in the setting of HCV infection and highlights the sophisticated mechanisms both host and virus have evolved in the race for superiority. PMID:25890065

Genome-wide identification of 52 cytochrome P450 (CYP) genes in the copepod Tigriopus japonicus and their B[α]P-induced expression patterns.

PubMed

Han, Jeonghoon; Kim, Duck-Hyun; Kim, Hui-Su; Nelson, David R; Lee, Jae-Seong

2017-09-01

Cytochrome P450s (CYPs) are enzymes with a heme-binding domain that are found in all living organisms. CYP enzymes have important roles associated with detoxification of xenobiotics and endogenous compounds (e.g. steroids, fatty acids, and hormones). Although CYP enzymes have been reported in several invertebrates, including insects, little is known about copepod CYPs. Here, we identified the entire repertoire of CYP genes (n=52) from whole genome and transcriptome sequences of the benthic copepod Tigriopus japonicus, including a tandem duplication (CYP3026A3, CYP3026A4, CYP3026A5), and examined patterns of gene expression over various developmental stages and in response to benzo[α]pyrene (B[α]P) exposure. Through phylogenetic analysis, the 52 T. japonicus CYP genes were assigned to five distinct clans: CYP2 (22 genes), CYP3 (19 genes), CYP4 (two genes), CYP20 (one gene), and mitochondrial (eight genes). Developmental stage and gender-specific expression patterns of the 52 T. japonicus CYPs were analyzed. CYP3022A1 was constitutively expressed during all developmental stages. CYP genes in clans 2 and 3 were induced in response to B[α]P, suggesting that these differentially modulated CYP transcripts are likely involved in defense against exposure to B[α]P and other pollutants. This study enhances our understanding of the repertoire of CYP genes in copepods and of their potential role in development and detoxification in copepods. Copyright © 2017 Elsevier Inc. All rights reserved.

Analysis of gene mutations in Chinese patients with maple syrup urine disease.

PubMed

Yang, Nan; Han, Lianshu; Gu, Xuefan; Ye, Jun; Qiu, Wenjuan; Zhang, Huiwen; Gong, Zhuwen; Zhang, Yafen

2012-08-01

Maple syrup urine disease (MSUD) is predominantly caused by mutations in the BCKDHA, BCKDHB and DBT genes, which encode for the E1α, E1β and E2 subunits of the branched-chain α-keto acid dehydrogenase complex, respectively. The aim of this study was to screen DNA samples from 16 Chinese MSUD patients and assess a potential correlation between genotype and phenotype. BCKDHA, BCKDHB and DBT genes were analyzed by polymerase chain reaction (PCR) and direct sequencing. Segments bearing novel mutations were identified by PCR-restriction fragment length polymorphism (PCR-RFLP) analysis. Within the variant alleles, 28 mutations (28/32, 87.5%), were detected in 15 patients, while one patient displayed no mutations. Mutations were comprised of 20 different: 6 BCKDHA gene mutations in 4 cases, 10 BCKDHB gene mutations in 8 cases and 4 DBT gene mutations in 3 cases. From these, 14 were novel, which included 3 mutations in the BCKDHA gene, 7 in the BCKDHB gene and 4 in the DBT gene. Only two patients with mutations in the BCKDHB and DBT genes were thiamine-responsive and presented a better clinical outcome. We identified 20 different mutations within the BCKDHA, BCKDHB and DBT genes among 16 Chinese MSUD patients, including 14 novel mutations. The majority were non-responsive to thiamine, associating with a worse clinical outcome. Our data provide the basis for further genotype-phenotype correlation studies in these patients, which will be beneficial for early diagnosis and in directing the approach to clinical intervention. Copyright © 2012 Elsevier Inc. All rights reserved.

Genome-wide transcriptomic analysis of response to low temperature reveals candidate genes determining divergent cold-sensitivity of maize inbred lines.

PubMed

Sobkowiak, Alicja; Jończyk, Maciej; Jarochowska, Emilia; Biecek, Przemysław; Trzcinska-Danielewicz, Joanna; Leipner, Jörg; Fronk, Jan; Sowiński, Paweł

2014-06-01

Maize, despite being thermophyllic due to its tropical origin, demonstrates high intraspecific diversity in cold-tolerance. To search for molecular mechanisms of this diversity, transcriptomic response to cold was studied in two inbred lines of contrasting cold-tolerance. Microarray analysis was followed by extensive statistical elaboration of data, literature data mining, and gene ontology-based classification. The lines used had been bred earlier specifically for determination of QTLs for cold-performance of photosynthesis. This allowed direct comparison of present transcriptomic data with the earlier QTL mapping results. Cold-treated (14 h at 8/6 °C) maize seedlings of cold-tolerant ETH-DH7 and cold-sensitive ETH-DL3 lines at V3 stage showed strong, consistent response of the third leaf transcriptome: several thousand probes showed similar, statistically significant change in both lines, while only tens responded differently in the two lines. The most striking difference between the responses of the two lines to cold was the induction of expression of ca. twenty genes encoding membrane/cell wall proteins exclusively in the cold-tolerant ETH-DH7 line. The common response comprised mainly repression of numerous genes related to photosynthesis and induction of genes related to basic biological activity: transcription, regulation of gene expression, protein phosphorylation, cell wall organization. Among the genes showing differential response, several were close to the QTL regions identified in earlier studies with the same inbred lines and associated with biometrical, physiological or biochemical parameters. These transcripts, including two apparently non-protein-coding ones, are particularly attractive candidates for future studies on mechanisms determining divergent cold-tolerance of inbred maize lines.

Transcriptome analysis of trichothecene-induced gene expression in barley.

PubMed

Boddu, Jayanand; Cho, Seungho; Muehlbauer, Gary J

2007-11-01

Fusarium head blight, caused primarily by Fusarium graminearum, is a major disease problem on barley (Hordeum vulgare L.). Trichothecene mycotoxins produced by the fungus during infection increase the aggressiveness of the fungus and promote infection in wheat (Triticum aestivum L.). Loss-of-function mutations in the TRI5 gene in F. graminearum result in the inability to synthesize trichothecenes and in reduced virulence on wheat. We examined the impact of pathogen-derived trichothecenes on virulence and the transcriptional differences in barley spikes infected with a trichothecene-producing wild-type strain and a loss-of-function tri5 trichothecene nonproducing mutant. Disease severity, fungal biomass, and floret necrosis and bleaching were reduced in spikes inoculated with the tri5 mutant strain compared with the wild-type strain, indicating that the inability to synthesize trichothecenes results in reduced virulence in barley. We detected 63 transcripts that were induced during trichothecene accumulation, including genes encoding putative trichothecene detoxification and transport proteins, ubiquitination-related proteins, programmed cell death-related proteins, transcription factors, and cytochrome P450s. We also detected 414 gene transcripts that were designated as basal defense response genes largely independent of trichothecene accumulation. Our results show that barley exhibits a specific response to trichothecene accumulation that can be separated from the basal defense response. We propose that barley responds to trichothecene accumulation by inducing at least two general responses. One response is the induction of genes encoding trichothecene detoxification and transport activities that may reduce the impact of trichothecenes. The other response is to induce genes encoding proteins associated with ubiquitination and cell death which may promote successful establishment of the disease.

Whole Body Melanoma Transcriptome Response in Medaka

PubMed Central

Schartl, Manfred; Shen, Yingjia; Maurus, Katja; Walter, Ron; Tomlinson, Chad; Wilson, Richard K.; Postlethwait, John; Warren, Wesley C.

2015-01-01

The incidence of malignant melanoma continues to increase each year with poor prognosis for survival in many relapse cases. To reverse this trend, whole body response measures are needed to discover collaborative paths to primary and secondary malignancy. Several species of fish provide excellent melanoma models because fish and human melanocytes both appear in the epidermis, and fish and human pigment cell tumors share conserved gene expression signatures. For the first time, we have examined the whole body transcriptome response to invasive melanoma as a prelude to using transcriptome profiling to screen for drugs in a medaka (Oryzias latipes) model. We generated RNA-seq data from whole body RNA isolates for controls and melanoma fish. After testing for differential expression, 396 genes had significantly different expression (adjusted p-value <0.02) in the whole body transcriptome between melanoma and control fish; 379 of these genes were matched to human orthologs with 233 having annotated human gene symbols and 14 matched genes that contain putative deleterious variants in human melanoma at varying levels of recurrence. A detailed canonical pathway evaluation for significant enrichment showed the top scoring pathway to be antigen presentation but also included the expected melanocyte development and pigmentation signaling pathway. Results revealed a profound down-regulation of genes involved in the immune response, especially the innate immune system. We hypothesize that the developing melanoma actively suppresses the immune system responses of the body in reacting to the invasive malignancy, and that this mal-adaptive response contributes to disease progression, a result that suggests our whole-body transcriptomic approach merits further use. In these findings, we also observed novel genes not yet identified in human melanoma expression studies and uncovered known and new candidate drug targets for further testing in this malignant melanoma medaka model. PMID:26714172

Whole Body Melanoma Transcriptome Response in Medaka.

PubMed

Schartl, Manfred; Shen, Yingjia; Maurus, Katja; Walter, Ron; Tomlinson, Chad; Wilson, Richard K; Postlethwait, John; Warren, Wesley C

2015-01-01

The incidence of malignant melanoma continues to increase each year with poor prognosis for survival in many relapse cases. To reverse this trend, whole body response measures are needed to discover collaborative paths to primary and secondary malignancy. Several species of fish provide excellent melanoma models because fish and human melanocytes both appear in the epidermis, and fish and human pigment cell tumors share conserved gene expression signatures. For the first time, we have examined the whole body transcriptome response to invasive melanoma as a prelude to using transcriptome profiling to screen for drugs in a medaka (Oryzias latipes) model. We generated RNA-seq data from whole body RNA isolates for controls and melanoma fish. After testing for differential expression, 396 genes had significantly different expression (adjusted p-value <0.02) in the whole body transcriptome between melanoma and control fish; 379 of these genes were matched to human orthologs with 233 having annotated human gene symbols and 14 matched genes that contain putative deleterious variants in human melanoma at varying levels of recurrence. A detailed canonical pathway evaluation for significant enrichment showed the top scoring pathway to be antigen presentation but also included the expected melanocyte development and pigmentation signaling pathway. Results revealed a profound down-regulation of genes involved in the immune response, especially the innate immune system. We hypothesize that the developing melanoma actively suppresses the immune system responses of the body in reacting to the invasive malignancy, and that this mal-adaptive response contributes to disease progression, a result that suggests our whole-body transcriptomic approach merits further use. In these findings, we also observed novel genes not yet identified in human melanoma expression studies and uncovered known and new candidate drug targets for further testing in this malignant melanoma medaka model.

The endogenous and reactive depression subtypes revisited: integrative animal and human studies implicate multiple distinct molecular mechanisms underlying major depressive disorder.

PubMed

Malki, Karim; Keers, Robert; Tosto, Maria Grazia; Lourdusamy, Anbarasu; Carboni, Lucia; Domenici, Enrico; Uher, Rudolf; McGuffin, Peter; Schalkwyk, Leonard C

2014-05-07

Traditional diagnoses of major depressive disorder (MDD) suggested that the presence or absence of stress prior to onset results in either 'reactive' or 'endogenous' subtypes of the disorder, respectively. Several lines of research suggest that the biological underpinnings of 'reactive' or 'endogenous' subtypes may also differ, resulting in differential response to treatment. We investigated this hypothesis by comparing the gene-expression profiles of three animal models of 'reactive' and 'endogenous' depression. We then translated these findings to clinical samples using a human post-mortem mRNA study. Affymetrix mouse whole-genome oligonucleotide arrays were used to measure gene expression from hippocampal tissues of 144 mice from the Genome-based Therapeutic Drugs for Depression (GENDEP) project. The study used four inbred mouse strains and two depressogenic 'stress' protocols (maternal separation and Unpredictable Chronic Mild Stress) to model 'reactive' depression. Stress-related mRNA differences in mouse were compared with a parallel mRNA study using Flinders Sensitive and Resistant rat lines as a model of 'endogenous' depression. Convergent genes differentially expressed across the animal studies were used to inform candidate gene selection in a human mRNA post-mortem case control study from the Stanley Brain Consortium. In the mouse 'reactive' model, the expression of 350 genes changed in response to early stresses and 370 in response to late stresses. A minimal genetic overlap (less than 8.8%) was detected in response to both stress protocols, but 30% of these genes (21) were also differentially regulated in the 'endogenous' rat study. This overlap is significantly greater than expected by chance. The VAMP-2 gene, differentially expressed across the rodent studies, was also significantly altered in the human study after correcting for multiple testing. Our results suggest that 'endogenous' and 'reactive' subtypes of depression are associated with largely distinct changes in gene-expression. However, they also suggest that the molecular signature of 'reactive' depression caused by early stressors differs considerably from that of 'reactive' depression caused by late stressors. A small set of genes was consistently dysregulated across each paradigm and in post-mortem brain tissue of depressed patients suggesting a final common pathway to the disorder. These genes included the VAMP-2 gene, which has previously been associated with Axis-I disorders including MDD, bipolar depression, schizophrenia and with antidepressant treatment response. We also discuss the implications of our findings for disease classification, personalized medicine and case-control studies of MDD.

Transcriptome sequencing of rhizome tissue of Sinopodophyllum hexandrum at two temperatures.

PubMed

Kumari, Anita; Singh, Heikham Russiachand; Jha, Ashwani; Swarnkar, Mohit Kumar; Shankar, Ravi; Kumar, Sanjay

2014-10-07

Sinopodophyllum hexandrum is an endangered medicinal herb, which is commonly present in elevations ranging between 2,400-4,500 m and is sensitive to temperature. Medicinal property of the species is attributed to the presence of podophyllotoxin in the rhizome tissue. The present work analyzed transcriptome of rhizome tissue of S. hexandrum exposed to 15°C and 25°C to understand the temperature mediated molecular responses including those associated with podophyllotoxin biosynthesis. Deep sequencing of transcriptome with an average coverage of 88.34X yielded 60,089 assembled transcript sequences representing 20,387 unique genes having homology to known genes. Fragments per kilobase of exon per million fragments mapped (FPKM) based expression analysis revealed genes related to growth and development were over-expressed at 15°C, whereas genes involved in stress response were over-expressed at 25°C. There was a decreasing trend of podophyllotoxin accumulation at 25°C; data was well supported by the expression of corresponding genes of the pathway. FPKM data was validated by quantitative real-time polymerase chain reaction data using a total of thirty four genes and a positive correlation between the two platforms of gene expression was obtained. Also, detailed analyses yielded cytochrome P450s, methyltransferases and glycosyltransferases which could be the potential candidate hitherto unidentified genes of podophyllotoxin biosynthesis pathway. The present work revealed temperature responsive transcriptome of S. hexandrum on Illumina platform. Data suggested expression of genes for growth and development and podophyllotoxin biosynthesis at 15°C, and prevalence of those associated with stress response at 25°C.

Unravelling the cross-talk between iron starvation and oxidative stress responses highlights the key role of PerR (alr0957) in peroxide signalling in the cyanobacterium Nostoc PCC 7120.

PubMed

Yingping, Fan; Lemeille, Sylvain; Talla, Emmanuel; Janicki, Annick; Denis, Yann; Zhang, Cheng-Cai; Latifi, Amel

2014-10-01

The cyanobacterial phylum includes oxygenic photosynthetic prokaryotes of a wide variety of morphologies, metabolisms and ecologies. Their adaptation to their various ecological niches is mainly achieved by sophisticated regulatory mechanisms and depends on a fine cross-talk between them. We assessed the global transcriptomic response of the filamentous cyanobacterium Nostoc PCC 7120 to iron starvation and oxidative stress. More than 20% of the differentially expressed genes in response to iron stress were also responsive to oxidative stress. These transcripts include antioxidant proteins-encoding genes that confirms that iron depletion leads to reactive oxygen accumulation. The activity of the Fe-superoxide dismutase was not significantly decreased under iron starvation, indicating that the oxidative stress generated under iron deficiency is not a consequence of (SOD) deficiency. The transcriptional data indicate that the adaptation of Nostoc to iron-depleted conditions displays important differences with what has been shown in unicellular cyanobacteria. While the FurA protein that regulates the response to iron deprivation has been well characterized in Nostoc, the regulators in charge of the oxidative stress response are unknown. Our study indicates that the alr0957 (perR) gene encodes the master regulator of the peroxide stress. PerR is a peroxide-sensor repressor that senses peroxide by metal-catalysed oxidation.

Solar ultraviolet radiation is necessary to enhance grapevine fruit ripening transcriptional and phenolic responses.

PubMed

Carbonell-Bejerano, Pablo; Diago, Maria-Paz; Martínez-Abaigar, Javier; Martínez-Zapater, José M; Tardáguila, Javier; Núñez-Olivera, Encarnación

2014-07-09

Ultraviolet (UV) radiation modulates secondary metabolism in the skin of Vitis vinifera L. berries, which affects the final composition of both grapes and wines. The expression of several phenylpropanoid biosynthesis-related genes is regulated by UV radiation in grape berries. However, the complete portion of transcriptome and ripening processes influenced by solar UV radiation in grapes remains unknown. Whole genome arrays were used to identify the berry skin transcriptome modulated by the UV radiation received naturally in a mid-altitude Tempranillo vineyard. UV radiation-blocking and transmitting filters were used to generate the experimental conditions. The expression of 121 genes was significantly altered by solar UV radiation. Functional enrichment analysis of altered transcripts mainly pointed out that secondary metabolism-related transcripts were induced by UV radiation including VvFLS1, VvGT5 and VvGT6 flavonol biosynthetic genes and monoterpenoid biosynthetic genes. Berry skin phenolic composition was also analysed to search for correlation with gene expression changes and UV-increased flavonols accumulation was the most evident impact. Among regulatory genes, novel UV radiation-responsive transcription factors including VvMYB24 and three bHLH, together with known grapevine UV-responsive genes such as VvMYBF1, were identified. A transcriptomic meta-analysis revealed that genes up-regulated by UV radiation in the berry skin were also enriched in homologs of Arabidopsis UVR8 UV-B photoreceptor-dependent UV-B -responsive genes. Indeed, a search of the grapevine reference genomic sequence identified UV-B signalling pathway homologs and among them, VvHY5-1, VvHY5-2 and VvRUP were up-regulated by UV radiation in the berry skin. Results suggest that the UV-B radiation-specific signalling pathway is activated in the skin of grapes grown at mid-altitudes. The biosynthesis and accumulation of secondary metabolites, which are appreciated in winemaking and potentially confer cross-tolerance, were almost specifically triggered. This draws attention to viticultural practices that increase solar UV radiation on vineyards as they may improve grape features.

Molecular cloning, structure, phylogeny and expression analysis of the invertase gene family in sugarcane.

PubMed

Wang, Liming; Zheng, Yuexia; Ding, Shihui; Zhang, Qing; Chen, Youqiang; Zhang, Jisen

2017-06-23

Invertases (INVs) are key enzymes regulating sucrose metabolism and are here revealed to be involved in responses to environmental stress in plants. To date, individual members of the invertase gene family and their expression patterns are unknown in sugarcane due to its complex genome despite their significance in sucrose metabolism. In this study, based on comparative genomics, eleven cDNA and twelve DNA sequences belonging to 14 non-redundant members of the invertase gene family were successfully cloned from sugarcane. A comprehensive analysis of the invertase gene family was carried out, including gene structures, phylogenetic relationships, functional domains, conserved motifs of proteins. The results revealed that the 14 invertase members from sugarcane could be clustered into three subfamilies, including 6 neutral/alkaline invertases (ShN/AINVs), and 8 acid invertases (ShAINVs). Faster divergence occurred in acid INVs than in neutral/alkaline INVs after the split of sugarcane and sorghum. At least a one-time gene duplication event was observed to have occurred in the four groups of acid INVs, whereas ShN/AINV1 and ShN/AINV2 in the β8 lineage were revealed to be the most recently duplicated genes among their paralogous genes in the β group of N/AINVs. Furthermore, comprehensive expression analysis of these genes was performed in sugarcane seedlings subjected to five abiotic stresses (drought, low temperature, glucose, fructose, and sucrose) using Quantitative Real-time PCR. The results suggested a functional divergence of INVs and their potential role in response to the five different treatments. Enzymatic activity in sugarcane seedlings was detected under five abiotic stresses treatments, and showed that the activities of all INVs were significantly inhibited in response to five different abiotic stresses, and that the neutral/alkaline INVs played a more prominent role in abiotic stresses than the acid INVs. In this study, we determined the INV gene family members of sugarcane by PCR cloning using sorghum as a reference, providing the first study of the INV gene family in sugarcane. Combining existing INV gene data from 7 plants with a comparative approach including a series of comprehensive analyses to isolate and identify INV gene family members proved to be highly successful. Moreover, the expression levels of INV genes and the variation of enzymatic activities associated with drought, low temperature, glucose, fructose, and sucrose are reported in sugarcane for the first time. The results offered useful foundation and framework for future research for understanding the physiological roles of INVs for sucrose accumulation in sugarcane.

Developmental regulation of diacylglycerol acyltransferase family gene expression in tung tree tissues

USDA-ARS?s Scientific Manuscript database

Diacylglycerol acyltransferases (DGAT) are responsible for the final and rate-limiting step of triacylglycerol (TAG) biosynthesis in eukaryotic organisms. DGAT genes have been identified in numerous organisms. Multiple isoforms of DGAT are present in eukaryotes, including DGAT1 and DGAT2 of tung tre...

Conditioned medium from persistently RSV-infected macrophages alters transcriptional profile and inflammatory response of non-infected macrophages.

PubMed

Rivera-Toledo, Evelyn; Salido-Guadarrama, Iván; Rodríguez-Dorantes, Mauricio; Torres-González, Laura; Santiago-Olivares, Carlos; Gómez, Beatriz

2017-02-15

Cells susceptible to persistent viral infections undergo important changes in their biological functions as a consequence of the expression of viral gene products that are capable of altering the gene expression profile of the host cell. Previously, we reported that persistence of the RSV genome in a mouse macrophage cell line induces important alterations in cell homeostasis, including constitutive expression of IFN-β and other pro-inflammatory cytokines. Here, we postulated that changes in the homeostasis of non-infected macrophages could be induced by soluble factors secreted by persistently RSV- infected macrophages. To test this hypothesis, non-infected mouse macrophages were treated with conditioned medium (CM) collected from cultures of persistently RSV-infected macrophages. Total RNA was extracted and a microarray-based gene expression analysis was performed. Non-infected macrophages, treated under similar conditions with CM obtained from cultures of non-infected macrophages, were used as a control to establish differential gene expression between the two conditions. Results showed that CM from the persistently RSV-infected cultures altered expression of a total of 95 genes in non-infected macrophages, resulting in an antiviral gene-transcription profile along with inhibition of the inflammatory response, since some inflammatory genes were down-regulated, including Nlrp3 and Il-1 β, both related to the inflammasome pathway. However, down-regulation of Nlrp3 and Il-1 β was reversible upon acute RSV infection. Additionally, we observed that the inflammatory response, evaluated by secreted IL-1 β, a final product of the inflammasome activity, was enhanced during acute RSV infection in macrophages treated with CM from persistently RSV-infected cultures, compared to that in macrophages treated with the control CM. This suggests that soluble factors secreted during RSV persistence may induce an exacerbated inflammatory response in non-infected cells. Copyright © 2017 Elsevier B.V. All rights reserved.

Profiles of Global Gene Expression in Ionizing-Radiation–Damaged Human Diploid Fibroblasts Reveal Synchronization behind the G1 Checkpoint in a G0-like State of Quiescence

PubMed Central

Zhou, Tong; Chou, Jeff W.; Simpson, Dennis A.; Zhou, Yingchun; Mullen, Thomas E.; Medeiros, Margarida; Bushel, Pierre R.; Paules, Richard S.; Yang, Xuebin; Hurban, Patrick; Lobenhofer, Edward K.; Kaufmann, William K.

2006-01-01

Cell cycle arrest and stereotypic transcriptional responses to DNA damage induced by ionizing radiation (IR) were quantified in telomerase-expressing human diploid fibroblasts. Analysis of cytotoxicity demonstrated that 1.5 Gy IR inactivated colony formation by 40–45% in three fibroblast lines; this dose was used in all subsequent analyses. Fibroblasts exhibited > 90% arrest of progression from G2 to M at 2 hr post-IR and a similarly severe arrest of progression from G1 to S at 6 and 12 hr post-IR. Normal rates of DNA synthesis and mitosis 6 and 12 hr post-IR caused the S and M compartments to empty by > 70% at 24 hr. Global gene expression was analyzed in IR-treated cells. A microarray analysis algorithm, EPIG, identified nine IR-responsive patterns of gene expression that were common to the three fibroblast lines, including a dominant p53-dependent G1 checkpoint response. Many p53 target genes, such as CDKN1A, GADD45, BTG2, and PLK3, were significantly up-regulated at 2 hr post-IR. Many genes whose expression is regulated by E2F family transcription factors, including CDK2, CCNE1, CDC6, CDC2, MCM2, were significantly down-regulated at 24 hr post-IR. Numerous genes that participate in DNA metabolism were also markedly repressed in arrested fibroblasts apparently as a result of cell synchronization behind the G1 checkpoint. However, cluster and principal component analyses of gene expression revealed a profile 24 hr post-IR with similarity to that of G0 growth quiescence. The results reveal a highly stereotypic pattern of response to IR in human diploid fibroblasts that reflects primarily synchronization behind the G1 checkpoint but with prominent induction of additional markers of G0 quiescence such as GAS1. PMID:16581545

Overlapping Yet Response-Specific Transcriptome Alterations Characterize the Nature of Tobacco-Pseudomonas syringae Interactions.

PubMed

Bozsó, Zoltán; Ott, Péter G; Kámán-Tóth, Evelin; Bognár, Gábor F; Pogány, Miklós; Szatmári, Ágnes

2016-01-01

In this study transcriptomic alterations of bacterially induced pattern triggered immunity (PTI) were compared with other types of tobacco-Pseudomonas interactions. In addition, using pharmacological agents we blocked some signal transduction pathways (Ca(2+) influx, kinases, phospholipases, proteasomic protein degradation) to find out how they contribute to gene expression during PTI. PTI is the first defense response of plant cells to microbes, elicited by their widely conserved molecular patterns. Tobacco is an important model of Solanaceae to study resistance responses, including defense mechanisms against bacteria. In spite of these facts the transcription regulation of tobacco genes during different types of plant bacterial interactions is not well-described. In this paper we compared the tobacco transcriptomic alterations in microarray experiments induced by (i) PTI inducer Pseudomonas syringae pv. syringae type III secretion mutant (hrcC) at earlier (6 h post inoculation) and later (48 hpi) stages of defense, (ii) wild type P. syringae (6 hpi) that causes effector triggered immunity (ETI) and cell death (HR), and (iii) disease-causing P. syringae pv. tabaci (6 hpi). Among the different treatments the highest overlap was between the PTI and ETI at 6 hpi, however, there were groups of genes with specifically altered activity for either type of defenses. Instead of quantitative effects of the virulent P. tabaci on PTI-related genes it influenced transcription qualitatively and blocked the expression changes of a special set of genes including ones involved in signal transduction and transcription regulation. P. tabaci specifically activated or repressed other groups of genes seemingly not related to either PTI or ETI. Kinase and phospholipase A inhibitors had highest impacts on the PTI response and effects of these signal inhibitors on transcription greatly overlapped. Remarkable interactions of phospholipase C-related pathways with the proteasomal system were also observable. Genes specifically affected by virulent P. tabaci belonged to various previously identified signaling routes, suggesting that compatible pathogens may modulate diverse signaling pathways of PTI to overcome plant defense.

Conserved and Differential Effects of Dietary Energy Intake on the Hippocampal Transcriptomes of Females and Males

PubMed Central

Martin, Bronwen; Pearson, Michele; Brenneman, Randall; Golden, Erin; Keselman, Alex; Iyun, Titilola; Carlson, Olga D.; Egan, Josephine M.; Becker, Kevin G.; Wood, William; Prabhu, Vinayakumar; de Cabo, Rafael

2008-01-01

The level of dietary energy intake influences metabolism, reproductive function, the development of age-related diseases, and even cognitive behavior. Because males and females typically play different roles in the acquisition and allocation of energy resources, we reasoned that dietary energy intake might differentially affect the brains of males and females at the molecular level. To test this hypothesis, we performed a gene array analysis of the hippocampus in male and female rats that had been maintained for 6 months on either ad libitum (control), 20% caloric restriction (CR), 40% CR, intermittent fasting (IF) or high fat/high glucose (HFG) diets. These diets resulted in expected changes in body weight, and circulating levels of glucose, insulin and leptin. However, the CR diets significantly increased the size of the hippocampus of females, but not males. Multiple genes were regulated coherently in response to energy restriction diets in females, but not in males. Functional physiological pathway analyses showed that the 20% CR diet down-regulated genes involved in glycolysis and mitochondrial ATP production in males, whereas these metabolic pathways were up-regulated in females. The 40% CR diet up-regulated genes involved in glycolysis, protein deacetylation, PGC-1α and mTor pathways in both sexes. IF down-regulated many genes in males including those involved in protein degradation and apoptosis, but up-regulated many genes in females including those involved in cellular energy metabolism, cell cycle regulation and protein deacetylation. Genes involved in energy metabolism, oxidative stress responses and cell death were affected by the HFG diet in both males and females. The gender-specific molecular genetic responses of hippocampal cells to variations in dietary energy intake identified in this study may mediate differential behavioral responses of males and females to differences in energy availability. PMID:18545695

Analysis of LexA binding sites and transcriptomics in response to genotoxic stress in Leptospira interrogans.

PubMed

Schons-Fonseca, Luciane; da Silva, Josefa B; Milanez, Juliana S; Domingos, Renan H; Smith, Janet L; Nakaya, Helder I; Grossman, Alan D; Ho, Paulo L; da Costa, Renata M A

2016-02-18

We determined the effects of DNA damage caused by ultraviolet radiation on gene expression in Leptospira interrogans using DNA microarrays. These data were integrated with DNA binding in vivo of LexA1, a regulator of the DNA damage response, assessed by chromatin immunoprecipitation and massively parallel DNA sequencing (ChIP-seq). In response to DNA damage, Leptospira induced expression of genes involved in DNA metabolism, in mobile genetic elements and defective prophages. The DNA repair genes involved in removal of photo-damage (e.g. nucleotide excision repair uvrABC, recombinases recBCD and resolvases ruvABC) were not induced. Genes involved in various metabolic pathways were down regulated, including genes involved in cell growth, RNA metabolism and the tricarboxylic acid cycle. From ChIP-seq data, we observed 24 LexA1 binding sites located throughout chromosome 1 and one binding site in chromosome 2. Expression of many, but not all, genes near those sites was increased following DNA damage. Binding sites were found as far as 550 bp upstream from the start codon, or 1 kb into the coding sequence. Our findings indicate that there is a shift in gene expression following DNA damage that represses genes involved in cell growth and virulence, and induces genes involved in mutagenesis and recombination. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Molecular genetic responses to lysergic acid diethylamide include transcriptional activation of MAP kinase phosphatase-1, C/EBP-beta and ILAD-1, a novel gene with homology to arrestins.

PubMed

Nichols, Charles D; Sanders-Bush, Elaine

2004-08-01

We recently demonstrated that the potent hallucinogenic drug lysergic acid diethylamide (LSD) dynamically influences the expression of a small collection of genes within the mammalian prefrontal cortex. Towards generating a greater understanding of the molecular genetic effects of hallucinogens and how they may relate to alterations in behavior, we have identified and characterized expression patterns of a new collection of three genes increased in expression by acute LSD administration. These genes were identified through additional screens of Affymetrix DNA microarrays and examined in experiments to assess dose-response, time course and the receptor mediating the expression changes. The first induced gene, C/EBP-beta, is a transcription factor. The second gene, MKP-1, suggests that LSD activates the MAP (mitogen activated protein) kinase pathway. The third gene, ILAD-1, demonstrates sequence similarity to the arrestins. The increase in expression of each gene was partially mediated through LSD interactions at 5-HT2A (serotonin) receptors. There is evidence of alternative splicing at the ILAD-1 locus. Furthermore, data suggests that various splice isoforms of ILAD-1 respond differently at the transcriptional level to LSD. The genes thus far found to be responsive to LSD are beginning to give a more complete picture of the complex intracellular events initiated by hallucinogens.

Integrated Module and Gene-Specific Regulatory Inference Implicates Upstream Signaling Networks

PubMed Central

Roy, Sushmita; Lagree, Stephen; Hou, Zhonggang; Thomson, James A.; Stewart, Ron; Gasch, Audrey P.

2013-01-01

Regulatory networks that control gene expression are important in diverse biological contexts including stress response and development. Each gene's regulatory program is determined by module-level regulation (e.g. co-regulation via the same signaling system), as well as gene-specific determinants that can fine-tune expression. We present a novel approach, Modular regulatory network learning with per gene information (MERLIN), that infers regulatory programs for individual genes while probabilistically constraining these programs to reveal module-level organization of regulatory networks. Using edge-, regulator- and module-based comparisons of simulated networks of known ground truth, we find MERLIN reconstructs regulatory programs of individual genes as well or better than existing approaches of network reconstruction, while additionally identifying modular organization of the regulatory networks. We use MERLIN to dissect global transcriptional behavior in two biological contexts: yeast stress response and human embryonic stem cell differentiation. Regulatory modules inferred by MERLIN capture co-regulatory relationships between signaling proteins and downstream transcription factors thereby revealing the upstream signaling systems controlling transcriptional responses. The inferred networks are enriched for regulators with genetic or physical interactions, supporting the inference, and identify modules of functionally related genes bound by the same transcriptional regulators. Our method combines the strengths of per-gene and per-module methods to reveal new insights into transcriptional regulation in stress and development. PMID:24146602

Molecular responses in root-associative rhizospheric bacteria to variations in plant exudates

NASA Astrophysics Data System (ADS)

Abdoun, Hamid; McMillan, Mary; Pereg, Lily

2015-04-01

Plant exudates are a major factor in the interface of plant-soil-microbe interactions and it is well documented that the microbial community structure in the rhizosphere is largely influenced by the particular exudates excreted by various plants. Azospirillum brasilense is a plant growth promoting rhizobacterium that is known to interact with a large number of plants, including important food crops. The regulatory gene flcA has an important role in this interaction as it controls morphological differentiation of the bacterium that is essential for attachment to root surfaces. Being a response regulatory gene, flcA mediates the response of the bacterial cell to signals from the surrounding rhizosphere. This makes this regulatory gene a good candidate for analysis of the response of bacteria to rhizospheric alterations, in this case, variations in root exudates. We will report on our studies on the response of Azospirillum, an ecologically, scientifically and agriculturally important bacterial genus, to variations in the rhizosphere.

My genes made me do it? The implications of behavioural genetics for responsibility and blame.

PubMed

Levitt, Mairi; Manson, Neil

2007-03-01

The idea of individual responsibility for action is central to our conception of what it is to be a person. Behavioural genetic research may seem to call into question the idea of individual responsibility with possible implications for the criminal justice system. These implications will depend on the understandings of the various agencies and professional groups involved in responding to violent and anti-social behaviour, and, the result of negotiations between them over resulting practice. The paper considers two kinds of approaches to the question of responsibility and 'criminal genes' arising from a sociological and philosophical perspective respectively. One is to consider the social context and possible practical implications of research into 'criminal genes' which will later be examined through interviews and discussions with a range of experts including lawyers and social workers. A second and different kind of approach is to ask whether the findings of behavioural genetics ought to have implications for attributions of responsibility. Issues of genetic influence are central to both approaches.

Differential gene expression responses distinguish contact and respiratory sensitizers and nonsensitizing irritants in the local lymph node assay.

PubMed

Adenuga, David; Woolhiser, Michael R; Gollapudi, B Bhaskar; Boverhof, Darrell R

2012-04-01

Genomic approaches have the potential to enhance the specificity and predictive accuracy of existing toxicology endpoints, including those for chemical sensitization. The present study was conducted to determine whether gene expression responses can distinguish contact sensitizers (1-chloro-2,4-dinitrobenzene [DNCB] and hexyl cinnamic aldehyde [HCA]), respiratory sensitizers (ortho-phthalaldehyde and trimellitic anhydride [TMA]), and nonsensitizing irritants (methyl salicylate [MS] and nonanoic acid [NA]) in the local lymph node assay (LLNA). Female Balb/c mice received doses of each chemical as per the standard LLNA dosing regimen on days 1, 2, and 3. Auricular lymph nodes were analyzed for tritiated thymidine ((3)HTdR) incorporation on day 6 and for gene expression responses on days 6 and 10. All chemicals induced dose-dependent increases in stimulation index, which correlated strongly with the number of differentially expressed genes. A majority of genes modulated by the irritants were similarly altered by the sensitizers, consistent with the irritating effects of the sensitizers. However, a select number of responses involved with immune-specific functions, such as dendritic cell activation, were unique to the sensitizers and may offer the ability to distinguish sensitizers from irritants. Genes for the mast cell proteases 1 and 8, Lgals7, Tim2, Aicda, Il4, and Akr1c18 were more strongly regulated by respiratory sensitizers compared with contact sensitizers and may represent potential biomarkers for discriminating between contact and respiratory sensitizers. Collectively, these data suggest that gene expression responses may serve as useful biomarkers to distinguish between respiratory and contact sensitizers and nonsensitizing irritants in the LLNA.

Unraveling the Tissue-Specific Gene Signatures of Gilthead Sea Bream (Sparus aurata L.) after Hyper- and Hypo-Osmotic Challenges

PubMed Central

Martos-Sitcha, Juan Antonio; Mancera, Juan Miguel; Calduch-Giner, Josep Alvar; Yúfera, Manuel; Martínez-Rodríguez, Gonzalo; Pérez-Sánchez, Jaume

2016-01-01

A custom microarray was used for the transcriptomic profiling of liver, gills and hypothalamus in response to hypo- (38‰ → 5‰) or hyper- (38‰ → 55‰) osmotic challenges (7 days after salinity transfer) in gilthead sea bream (Sparus aurata) juveniles. The total number of differentially expressed genes was 777. Among them, 341 and 310 were differentially expressed in liver after hypo- and hyper-osmotic challenges, respectively. The magnitude of changes was lower in gills and hypothalamus with around 131 and 160 responsive genes in at least one osmotic stress condition, respectively. Regardless of tissue, a number of genes were equally regulated in either hypo- and hyper-osmotic challenges: 127 out of 524 in liver, 11 out of 131 in gills and 19 out of 160 in hypothalamus. In liver and gills, functional analysis of differentially expressed genes recognized two major clusters of overlapping canonical pathways that were mostly related to “Energy Metabolism” and “Oxidative Stress”. The later cluster was represented in all the analyzed tissues, including the hypothalamus, where differentially expressed genes related to “Cell and tissue architecture” were also over-represented. Overall the response for “Energy Metabolism” was the up-regulation, whereas for oxidative stress-related genes the type of response was highly dependent of tissue. These results support common and different osmoregulatory responses in the three analyzed tissues, helping to load new allostatic conditions or even to return to basal levels after hypo- or hyper-osmotic challenges according to the different physiological role of each tissue. PMID:26828928

Association between the oxytocin receptor (OXTR) gene and mesolimbic responses to rewards.

PubMed

Damiano, Cara R; Aloi, Joseph; Dunlap, Kaitlyn; Burrus, Caley J; Mosner, Maya G; Kozink, Rachel V; McLaurin, Ralph Edward; Mullette-Gillman, O'Dhaniel A; Carter, Ronald McKell; Huettel, Scott A; McClernon, Francis Joseph; Ashley-Koch, Allison; Dichter, Gabriel S

2014-01-31

There has been significant progress in identifying genes that confer risk for autism spectrum disorders (ASDs). However, the heterogeneity of symptom presentation in ASDs impedes the detection of ASD risk genes. One approach to understanding genetic influences on ASD symptom expression is to evaluate relations between variants of ASD candidate genes and neural endophenotypes in unaffected samples. Allelic variations in the oxytocin receptor (OXTR) gene confer small but significant risk for ASDs for which the underlying mechanisms may involve associations between variability in oxytocin signaling pathways and neural response to rewards. The purpose of this preliminary study was to investigate the influence of allelic variability in the OXTR gene on neural responses to monetary rewards in healthy adults using functional magnetic resonance imaging (fMRI). The moderating effects of three single nucleotide polymorphisms (SNPs) (rs1042778, rs2268493 and rs237887) of the OXTR gene on mesolimbic responses to rewards were evaluated using a monetary incentive delay fMRI task. T homozygotes of the rs2268493 SNP demonstrated relatively decreased activation in mesolimbic reward circuitry (including the nucleus accumbens, amygdala, insula, thalamus and prefrontal cortical regions) during the anticipation of rewards but not during the outcome phase of the task. Allelic variation of the rs1042778 and rs237887 SNPs did not moderate mesolimbic activation during either reward anticipation or outcomes. This preliminary study suggests that the OXTR SNP rs2268493, which has been previously identified as an ASD risk gene, moderates mesolimbic responses during reward anticipation. Given previous findings of decreased mesolimbic activation during reward anticipation in ASD, the present results suggest that OXTR may confer ASD risk via influences on the neural systems that support reward anticipation.

Characterization of CpSte11, a MAPKKK gene of Cryphonectria parasitica, and initial evidence of its involvement in the pheromone response pathway.

PubMed

Park, Jin-Ah; Kim, Jung-Mi; Park, Seung-Moon; Kim, Dae-Hyuk

2012-04-01

The gene CpSte11 of Cryphonectria parasitica, which encodes a yeast Ste11 homologue, was cloned and characterized. Gene replacement analysis revealed a high frequency of CpSte11 null mutants. When compared with the wild-type parent strain, CpSte11 null mutants showed no difference in terms of growth rate or pigmentation. However, CpSte11 null mutants showed a marked decrease in both the number and size of stromal pustules on chestnut twigs. The virulence test showed that, in comparison with those of the wild-type and virus-infected hypovirulent strains, CpSte11 null mutants produced necrotic areas of intermediate size. Disruption of the CpSte11 gene also resulted in defects in female fertility. Down-regulation of transcripts for the mating pheromone precursor gene, Mf2/2, and mating response transcription factors, such as cpst12 and pro1, was observed in CpSte11 null mutants. The down-regulation of Mf2/2, cpst12 and pro1 was also observed in the mutant phenotype of Cpmk2, a mating response Fus3-like mitogen-activated protein kinase (MAPK) gene, but not in the mutant of Cpmk1, a high-osmolarity glycerol Hog1-like MAPK gene. These results indicate that the cloned CpSte11 gene is functionally involved in the mating response pathway and acts through downstream targets, including Cpmk2, cpst12, pro1 and Mf2/2. However, the characteristics of the CpSte11 null mutant were fully phenocopied only in the cpst12 null mutant, but not in other studied null mutants of components of the putative mating response pathway. © 2011 THE AUTHORS. MOLECULAR PLANT PATHOLOGY © 2011 BSPP AND BLACKWELL PUBLISHING LTD.

Transcriptional Profiling of the Oral Pathogen Streptococcus mutans in Response to Competence Signaling Peptide XIP.

PubMed

Wenderska, Iwona B; Latos, Andrew; Pruitt, Benjamin; Palmer, Sara; Spatafora, Grace; Senadheera, Dilani B; Cvitkovitch, Dennis G

2017-01-01

In the cariogenic Streptococcus mutans , competence development is regulated by the ComRS signaling system comprised of the ComR regulator and the ComS prepeptide to the competence signaling peptide XIP (ComX-inducing peptide). Aside from competence development, XIP signaling has been demonstrated to regulate cell lysis, and recently, the expression of bacteriocins, small antimicrobial peptides used by bacteria to inhibit closely related species. Our study further explores the effect of XIP signaling on the S. mutans transcriptome. RNA sequencing revealed that XIP induction resulted in a global change in gene expression that was consistent with a stress response. An increase in several membrane-bound regulators, including HdrRM and BrsRM, involved in bacteriocin production, and the VicRKX system, involved in acid tolerance and biofilm formation, was observed. Furthermore, global changes in gene expression corresponded to changes observed during the stringent response to amino acid starvation. Effects were also observed on genes involved in sugar transport and carbon catabolite repression and included the levQRST and levDEFG operons. Finally, our work identified a novel heat shock-responsive intergenic region, encoding a small RNA, with a potential role in competence shutoff. IMPORTANCE Genetic competence provides bacteria with an opportunity to increase genetic diversity or acquire novel traits conferring a survival advantage. In the cariogenic pathogen Streptococcus mutans , DNA transformation is regulated by the competence stimulating peptide XIP (ComX-inducing peptide). The present study utilizes high-throughput RNA sequencing (RNAseq) to provide a greater understanding of how global gene expression patterns change in response to XIP. Overall, our work demonstrates that in S. mutans , XIP signaling induces a response that resembles the stringent response to amino acid starvation. We further identify a novel heat shock-responsive intergenic region with a potential role in competence shutoff. Together, our results provide further evidence that multiple stress response mechanisms are linked through the genetic competence signaling pathway in S. mutans .

Genome-wide identification and expression analysis of SBP-like transcription factor genes in Moso Bamboo (Phyllostachys edulis).

PubMed

Pan, Feng; Wang, Yue; Liu, Huanglong; Wu, Min; Chu, Wenyuan; Chen, Danmei; Xiang, Yan

2017-06-27

The SQUAMOSA promoter binding protein-like (SPL) proteins are plant-specific transcription factors (TFs) that function in a variety of developmental processes including growth, flower development, and signal transduction. SPL proteins are encoded by a gene family, and these genes have been characterized in two model grass species, Zea mays and Oryza sativa. The SPL gene family has not been well studied in moso bamboo (Phyllostachys edulis), a woody grass species. We identified 32 putative PeSPL genes in the P. edulis genome. Phylogenetic analysis arranged the PeSPL protein sequences in eight groups. Similarly, phylogenetic analysis of the SBP-like and SBP proteins from rice and maize clustered them into eight groups analogous to those from P. edulis. Furthermore, the deduced PeSPL proteins in each group contained very similar conserved sequence motifs. Our analyses indicate that the PeSPL genes experienced a large-scale duplication event ~15 million years ago (MYA), and that divergence between the PeSPL and OsSPL genes occurred 34 MYA. The stress-response expression profiles and tissue-specificity of the putative PeSPL gene promoter regions showed that SPL genes in moso bamboo have potential biological functions in stress resistance as well as in growth and development. We therefore examined PeSPL gene expression in response to different plant hormone and drought (polyethylene glycol-6000; PEG) treatments to mimic biotic and abiotic stresses. Expression of three (PeSPL10, -12, -17), six (PeSPL1, -10, -12, -17, -20, -31), and nine (PeSPL5, -8, -9, -14, -15, -19, -20, -31, -32) genes remained relatively stable after treating with salicylic acid (SA), gibberellic acid (GA), and PEG, respectively, while the expression patterns of other genes changed. In addition, analysis of tissue-specific expression of the moso bamboo SPL genes during development showed differences in their spatiotemporal expression patterns, and many were expressed at high levels in flowers and leaves. The PeSPL genes play important roles in plant growth and development, including responses to stresses, and most of the genes are expressed in different tissues. Our study provides a comprehensive understanding of the PeSPL gene family and may enable future studies on the function and evolution of SPL genes in moso bamboo.

Genome-wide analysis and expression profiling suggest diverse roles of GH3 genes during development and abiotic stress responses in legumes

PubMed Central

Singh, Vikash K.; Jain, Mukesh; Garg, Rohini

2014-01-01

Growth hormone auxin regulates various cellular processes by altering the expression of diverse genes in plants. Among various auxin-responsive genes, GH3 genes maintain endogenous auxin homeostasis by conjugating excess of auxin with amino acids. GH3 genes have been characterized in many plant species, but not in legumes. In the present work, we identified members of GH3 gene family and analyzed their chromosomal distribution, gene structure, gene duplication and phylogenetic analysis in different legumes, including chickpea, soybean, Medicago, and Lotus. A comprehensive expression analysis in different vegetative and reproductive tissues/stages revealed that many of GH3 genes were expressed in a tissue-specific manner. Notably, chickpea CaGH3-3, soybean GmGH3-8 and -25, and Lotus LjGH3-4, -5, -9 and -18 genes were up-regulated in root, indicating their putative role in root development. In addition, chickpea CaGH3-1 and -7, and Medicago MtGH3-7, -8, and -9 were found to be highly induced under drought and/or salt stresses, suggesting their role in abiotic stress responses. We also observed the examples of differential expression pattern of duplicated GH3 genes in soybean, indicating their functional diversification. Furthermore, analyses of three-dimensional structures, active site residues and ligand preferences provided molecular insights into function of GH3 genes in legumes. The analysis presented here would help in investigation of precise function of GH3 genes in legumes during development and stress conditions. PMID:25642236

EGFR Gene Amplification and KRAS Mutation Predict Response to Combination Targeted Therapy in Metastatic Colorectal Cancer.

PubMed

Khan, Sajid A; Zeng, Zhaoshi; Shia, Jinru; Paty, Philip B

2017-07-01

Genetic variability in KRAS and EGFR predicts response to cetuximab in irinotecan refractory colorectal cancer. Whether these markers or others remain predictive in combination biologic therapies including bevacizumab is unknown. We identified predictive biomarkers from patients with irinotecan refractory metastatic colorectal cancer treated with cetuximab plus bevacizumab. Patients who received cetuximab plus bevacizumab for irinotecan refractory colorectal cancer in either of two Phase II trials conducted were identified. Tumor tissue was available for 33 patients. Genomic DNA was extracted and used for mutational analysis of KRAS, BRAF, and p53 genes. Fluorescence in situ hybridization was performed to assess EGFR copy number. The status of single genes and various combinations were tested for association with response. Seven of 33 patients responded to treatment. KRAS mutations were found in 14/33 cases, and 0 responded to treatment (p = 0.01). EGFR gene amplification was seen in 3/33 of tumors and in every case was associated with response to treatment (p < 0.001). TP53 and BRAF mutations were found in 18/33 and 0/33 tumors, respectively, and there were no associations with response to either gene. EGFR gene amplification and KRAS mutations are predictive markers for patients receiving combination biologic therapy of cetuximab plus bevacizumab for metastatic colorectal cancer. One marker or the other is present in the tumor of half of all patients allowing treatment response to be predicted with a high degree of certainty. The role for molecular markers in combination biologic therapy seems promising.

Analysis of plant hormone profiles in response to moderate dehydration stress.

PubMed

Urano, Kaoru; Maruyama, Kyonoshin; Jikumaru, Yusuke; Kamiya, Yuji; Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

2017-04-01

Plant responses to dehydration stress are mediated by highly complex molecular systems involving hormone signaling and metabolism, particularly the major stress hormone abscisic acid (ABA) and ABA-dependent gene expression. To understand the roles of plant hormones and their interactions during dehydration, we analyzed the plant hormone profiles with respect to dehydration responses in Arabidopsis thaliana wild-type (WT) plants and ABA biosynthesis mutants (nced3-2). We developed a procedure for moderate dehydration stress, and then investigated temporal changes in the profiles of ABA, jasmonic acid isoleucine (JA-Ile), salicylic acid (SA), cytokinin (trans-zeatin, tZ), auxin (indole-acetic acid, IAA), and gibberellin (GA 4 ), along with temporal changes in the expression of key genes involved in hormone biosynthesis. ABA levels increased in a bi-phasic pattern (at the early and late phases) in response to moderate dehydration stress. JA-Ile levels increased slightly in WT plants and strongly increased in nced3-2 mutant plants at 72 h after the onset of dehydration. The expression profiles of dehydration-inducible genes displayed temporal responses in an ABA-dependent manner. The early phase of ABA accumulation correlated with the expression of touch-inducible genes and was independent of factors involved in the major ABA regulatory pathway, including the ABA-responsive element-binding (AREB/ABF) transcription factor. JA-Ile, SA, and tZ were negatively regulated during the late dehydration response phase. Transcriptome analysis revealed important roles for hormone-related genes in metabolism and signaling during dehydration-induced plant responses. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Strand specific RNA-sequencing and membrane lipid profiling reveals growth phase-dependent cold stress response mechanisms in Listeria monocytogenes

PubMed Central

Hingston, Patricia; Chen, Jessica; Allen, Kevin; Truelstrup Hansen, Lisbeth

2017-01-01

The human pathogen Listeria monocytogenes continues to pose a challenge in the food industry, where it is known to contaminate ready-to-eat foods and grow during refrigerated storage. Increased knowledge of the cold-stress response of this pathogen will enhance the ability to control it in the food-supply-chain. This study utilized strand-specific RNA sequencing and whole cell fatty acid (FA) profiling to characterize the bacterium’s cold stress response. RNA and FAs were extracted from a cold-tolerant strain at five time points between early lag phase and late stationary-phase, both at 4°C and 20°C. Overall, more genes (1.3×) were suppressed than induced at 4°C. Late stationary-phase cells exhibited the greatest number (n = 1,431) and magnitude (>1,000-fold) of differentially expressed genes (>2-fold, p<0.05) in response to cold. A core set of 22 genes was upregulated at all growth phases, including nine genes required for branched-chain fatty acid (BCFA) synthesis, the osmolyte transporter genes opuCBCD, and the internalin A and D genes. Genes suppressed at 4°C were largely associated with cobalamin (B12) biosynthesis or the production/export of cell wall components. Antisense transcription accounted for up to 1.6% of total mapped reads with higher levels (2.5×) observed at 4°C than 20°C. The greatest number of upregulated antisense transcripts at 4°C occurred in early lag phase, however, at both temperatures, antisense expression levels were highest in late stationary-phase cells. Cold-induced FA membrane changes included a 15% increase in the proportion of BCFAs and a 15% transient increase in unsaturated FAs between lag and exponential phase. These increases probably reduced the membrane phase transition temperature until optimal levels of BCFAs could be produced. Collectively, this research provides new information regarding cold-induced membrane composition changes in L. monocytogenes, the growth-phase dependency of its cold-stress regulon, and the active roles of antisense transcripts in regulating its cold stress response. PMID:28662112

Strand specific RNA-sequencing and membrane lipid profiling reveals growth phase-dependent cold stress response mechanisms in Listeria monocytogenes.

PubMed

Hingston, Patricia; Chen, Jessica; Allen, Kevin; Truelstrup Hansen, Lisbeth; Wang, Siyun

2017-01-01

The human pathogen Listeria monocytogenes continues to pose a challenge in the food industry, where it is known to contaminate ready-to-eat foods and grow during refrigerated storage. Increased knowledge of the cold-stress response of this pathogen will enhance the ability to control it in the food-supply-chain. This study utilized strand-specific RNA sequencing and whole cell fatty acid (FA) profiling to characterize the bacterium's cold stress response. RNA and FAs were extracted from a cold-tolerant strain at five time points between early lag phase and late stationary-phase, both at 4°C and 20°C. Overall, more genes (1.3×) were suppressed than induced at 4°C. Late stationary-phase cells exhibited the greatest number (n = 1,431) and magnitude (>1,000-fold) of differentially expressed genes (>2-fold, p<0.05) in response to cold. A core set of 22 genes was upregulated at all growth phases, including nine genes required for branched-chain fatty acid (BCFA) synthesis, the osmolyte transporter genes opuCBCD, and the internalin A and D genes. Genes suppressed at 4°C were largely associated with cobalamin (B12) biosynthesis or the production/export of cell wall components. Antisense transcription accounted for up to 1.6% of total mapped reads with higher levels (2.5×) observed at 4°C than 20°C. The greatest number of upregulated antisense transcripts at 4°C occurred in early lag phase, however, at both temperatures, antisense expression levels were highest in late stationary-phase cells. Cold-induced FA membrane changes included a 15% increase in the proportion of BCFAs and a 15% transient increase in unsaturated FAs between lag and exponential phase. These increases probably reduced the membrane phase transition temperature until optimal levels of BCFAs could be produced. Collectively, this research provides new information regarding cold-induced membrane composition changes in L. monocytogenes, the growth-phase dependency of its cold-stress regulon, and the active roles of antisense transcripts in regulating its cold stress response.

HPA Axis Genes, and Their Interaction with Childhood Maltreatment, are Related to Cortisol Levels and Stress-Related Phenotypes.

PubMed

Gerritsen, Lotte; Milaneschi, Yuri; Vinkers, Christiaan H; van Hemert, Albert M; van Velzen, Laura; Schmaal, Lianne; Penninx, Brenda Wjh

2017-11-01

Stress responses are controlled by the hypothalamus pituitary adrenal (HPA)-axis and maladaptive stress responses are associated with the onset and maintenance of stress-related disorders such as major depressive disorder (MDD). Genes that play a role in the HPA-axis regulation may likely contribute to the relation between relevant neurobiological substrates and stress-related disorders. Therefore, we performed gene-wide analyses for 30 a priori literature-based genes involved in HPA-axis regulation in 2014 subjects (34% male; mean age: 42.5) to study the relations with lifetime MDD diagnosis, cortisol awakening response, and dexamethasone suppression test (DST) levels (subsample N=1472) and hippocampal and amygdala volume (3T MR images; subsample N=225). Additionally, gene by childhood maltreatment (CM) interactions were investigated. Gene-wide significant results were found for dexamethasone suppression (CYP11A1, CYP17A1, POU1F1, AKR1D1), hippocampal volume (CYP17A1, CYP11A1, HSD3B2, PROP1, AVPRA1, SRD5A1), amygdala volume (POMC, CRH, HSD3B2), and lifetime MDD diagnosis (FKBP5 and CRH), all permutation p-values<0.05. Interactions with CM were found for several genes; the strongest interactions were found for NR3C2, where the minor allele of SNP rs17581262 was related to smaller hippocampal volume, smaller amygdala volume, higher DST levels, and higher odds of MDD diagnosis only in participants with CM. As hypothesized, several HPA-axis genes are associated with stress-related endophenotypes including cortisol response and reduced brain volumes. Furthermore, we found a pleiotropic interaction between CM and the mineralocorticoid receptor gene, suggesting that this gene plays an important moderating role in stress and stress-related disorders.

Transcriptional Profiling of Sorghum Induced by Methyl Jasmonate, Salicylic Acid, and Aminocyclopropane Carboxylic Acid Reveals Cooperative Regulation and Novel Gene Responses1[w

PubMed Central

Salzman, Ron A.; Brady, Jeff A.; Finlayson, Scott A.; Buchanan, Christina D.; Summer, Elizabeth J.; Sun, Feng; Klein, Patricia E.; Klein, Robert R.; Pratt, Lee H.; Cordonnier-Pratt, Marie-Michèle; Mullet, John E.

2005-01-01

We have conducted a large-scale study of gene expression in the C4 monocot sorghum (Sorghum bicolor) L. Moench cv BTx623 in response to the signaling compounds salicylic acid (SA), methyl jasmonate (MeJA), and the ethylene precursor aminocyclopropane carboxylic acid. Expression profiles were generated from seedling root and shoot tissue at 3 and 27 h, using a microarray containing 12,982 nonredundant elements. Data from 102 slides and quantitative reverse transcription-PCR data on mRNA abundance from 171 genes were collected and analyzed and are here made publicly available. Numerous gene clusters were identified in which expression was correlated with particular signaling compound and tissue combinations. Many genes previously implicated in defense responded to the treatments, including numerous pathogenesis-related genes and most members of the phenylpropanoid pathway, and several other genes that may represent novel activities or pathways. Genes of the octadecanoic acid pathway of jasmonic acid (JA) synthesis were induced by SA as well as by MeJA. The resulting hypothesis that increased SA could lead to increased endogenous JA production was confirmed by measurement of JA content. Comparison of responses to SA, MeJA, and combined SA+MeJA revealed patterns of one-way and mutual antagonisms, as well as synergistic effects on regulation of some genes. These experiments thus help further define the transcriptional results of cross talk between the SA and JA pathways and suggest that a subset of genes coregulated by SA and JA may comprise a uniquely evolved sector of plant signaling responsive cascades. PMID:15863699

Characterization of the Burkholderia thailandensis SOS Response by Using Whole-Transcriptome Shotgun Sequencing

PubMed Central

Ulrich, Ricky L.; DeShazer, David; Kenny, Tara A.; Ulrich, Melanie P.; Moravusova, Anna; Opperman, Timothy; Bavari, Sina; Bowlin, Terry L.; Moir, Donald T.

2013-01-01

The bacterial SOS response is a well-characterized regulatory network encoded by most prokaryotic bacterial species and is involved in DNA repair. In addition to nucleic acid repair, the SOS response is involved in pathogenicity, stress-induced mutagenesis, and the emergence and dissemination of antibiotic resistance. Using high-throughput sequencing technology (SOLiD RNA-Seq), we analyzed the Burkholderia thailandensis global SOS response to the fluoroquinolone antibiotic, ciprofloxacin (CIP), and the DNA-damaging chemical, mitomycin C (MMC). We demonstrate that a B. thailandensis recA mutant (RU0643) is ∼4-fold more sensitive to CIP in contrast to the parental strain B. thailandensis DW503. Our RNA-Seq results show that CIP and MMC treatment (P < 0.01) resulted in the differential expression of 344 genes in B. thailandensis and 210 genes in RU0643. Several genes associated with the SOS response were induced and include lexA, uvrA, dnaE, dinB, recX, and recA. At the genome-wide level, we found an overall decrease in gene expression, especially for genes involved in amino acid and carbohydrate transport and metabolism, following both CIP and MMC exposure. Interestingly, we observed the upregulation of several genes involved in bacterial motility and enhanced transcription of a B. thailandensis genomic island encoding a Siphoviridae bacteriophage designated ϕE264. Using B. thailandensis plaque assays and PCR with B. mallei ATCC 23344 as the host, we demonstrate that CIP and MMC exposure in B. thailandensis DW503 induces the transcription and translation of viable bacteriophage in a RecA-dependent manner. This is the first report of the SOS response in Burkholderia spp. to DNA-damaging agents. We have identified both common and unique adaptive responses of B. thailandensis to chemical stress and DNA damage. PMID:23872555

Divergent transcriptional response to thermal stress by Anopheles gambiae larvae carrying alternative arrangements of inversion 2La.

PubMed

Cassone, Bryan J; Molloy, Matthew J; Cheng, Changde; Tan, John C; Hahn, Matthew W; Besansky, Nora J

2011-06-01

The African malaria mosquito Anopheles gambiae is polymorphic for chromosomal inversion 2La, whose frequency strongly correlates with degree of aridity across environmental gradients. Recent physiological studies have associated 2La with resistance to desiccation in adults and thermal stress in larvae, consistent with its proposed role in aridity tolerance. However, the genetic basis of these traits remains unknown. To identify genes that could be involved in the differential response to thermal stress, we compared global gene expression profiles of heat-hardened 2La or 2L+(a) larvae at three time points, for up to eight hours following exposure to the heat stress. Treatment and control time series, replicated four times, revealed a common and massive induction of a core set of heat-shock genes regardless of 2La orientation. However, clear differences between the 2La and 2L+(a) arrangements emerged at the earliest (0.25 h) time point, in the intensity and nature of the stress response. Overall, 2La was associated with the more aggressive response: larger numbers of genes were heat responsive and up-regulated. Transcriptionally induced genes were enriched for functions related to ubiquitin-proteasomal degradation, chaperoning and energy metabolism. The more muted transcriptional response of 2L+(a) was largely repressive, including genes involved in proteolysis and energy metabolism. These results may help explain the maintenance of the 2La inversion polymorphism in An. gambiae, as the survival benefits offered by high thermal sensitivity in harsh climates could be offset by the metabolic costs of such a drastic response in more equable climates. © 2011 Blackwell Publishing Ltd.

Characterization of the Burkholderia thailandensis SOS response by using whole-transcriptome shotgun sequencing.

PubMed

Ulrich, Ricky L; Deshazer, David; Kenny, Tara A; Ulrich, Melanie P; Moravusova, Anna; Opperman, Timothy; Bavari, Sina; Bowlin, Terry L; Moir, Donald T; Panchal, Rekha G

2013-10-01

The bacterial SOS response is a well-characterized regulatory network encoded by most prokaryotic bacterial species and is involved in DNA repair. In addition to nucleic acid repair, the SOS response is involved in pathogenicity, stress-induced mutagenesis, and the emergence and dissemination of antibiotic resistance. Using high-throughput sequencing technology (SOLiD RNA-Seq), we analyzed the Burkholderia thailandensis global SOS response to the fluoroquinolone antibiotic, ciprofloxacin (CIP), and the DNA-damaging chemical, mitomycin C (MMC). We demonstrate that a B. thailandensis recA mutant (RU0643) is ∼4-fold more sensitive to CIP in contrast to the parental strain B. thailandensis DW503. Our RNA-Seq results show that CIP and MMC treatment (P < 0.01) resulted in the differential expression of 344 genes in B. thailandensis and 210 genes in RU0643. Several genes associated with the SOS response were induced and include lexA, uvrA, dnaE, dinB, recX, and recA. At the genome-wide level, we found an overall decrease in gene expression, especially for genes involved in amino acid and carbohydrate transport and metabolism, following both CIP and MMC exposure. Interestingly, we observed the upregulation of several genes involved in bacterial motility and enhanced transcription of a B. thailandensis genomic island encoding a Siphoviridae bacteriophage designated E264. Using B. thailandensis plaque assays and PCR with B. mallei ATCC 23344 as the host, we demonstrate that CIP and MMC exposure in B. thailandensis DW503 induces the transcription and translation of viable bacteriophage in a RecA-dependent manner. This is the first report of the SOS response in Burkholderia spp. to DNA-damaging agents. We have identified both common and unique adaptive responses of B. thailandensis to chemical stress and DNA damage.

The rec A operon: a novel stress response gene cluster in Bacteroides fragilis

PubMed Central

Nicholson, Samantha A; Smalley, Darren; Smith, C. Jeffrey; Abratt, Valerie R

2014-01-01

Bacteroides fragilis, an opportunistic pathogen of humans, is a leading cause of bacteraemias and anaerobic abscesses which are often treated with metronidazole, a drug which damages DNA. This study investigated the responses of the B. fragilis recA three gene operon to the stress experienced during metronidazole treatment and exposure to reactive oxygen species simulating those generated by the host immune system during infection. A transcriptionally regulated response was observed using quantitative RT-PCR after metronidazole and hydrogen peroxide treatment, with all three genes being upregulated under stress conditions. In vivo and in vitro analysis of the functional role of the second gene of the operon was done using heterologous complementation and protein expression (in Escherichia coli), with subsequent biochemical assay. This gene encoded a functional bacterioferritin co-migratory protein (BCP) which was thiol-specific and had antioxidant properties, including protection of the glutamine synthetase III enzyme. This in vitro data supports the hypothesis that the genes of the operon may be involved in protection of the bacteria from the oxidative burst during tissue invasion and may play a significant role in bacterial survival and metronidazole resistance during treatment of B. fragilis infections. PMID:24703997

Genome-wide analyses of the bZIP family reveal their involvement in the development, ripening and abiotic stress response in banana

PubMed Central

Hu, Wei; Wang, Lianzhe; Tie, Weiwei; Yan, Yan; Ding, Zehong; Liu, Juhua; Li, Meiying; Peng, Ming; Xu, Biyu; Jin, Zhiqiang

2016-01-01

The leucine zipper (bZIP) transcription factors play important roles in multiple biological processes. However, less information is available regarding the bZIP family in the important fruit crop banana. In this study, 121 bZIP transcription factor genes were identified in the banana genome. Phylogenetic analysis showed that MabZIPs were classified into 11 subfamilies. The majority of MabZIP genes in the same subfamily shared similar gene structures and conserved motifs. The comprehensive transcriptome analysis of two banana genotypes revealed the differential expression patterns of MabZIP genes in different organs, in various stages of fruit development and ripening, and in responses to abiotic stresses, including drought, cold, and salt. Interaction networks and co-expression assays showed that group A MabZIP-mediated networks participated in various stress signaling, which was strongly activated in Musa ABB Pisang Awak. This study provided new insights into the complicated transcriptional control of MabZIP genes and provided robust tissue-specific, development-dependent, and abiotic stress-responsive candidate MabZIP genes for potential applications in the genetic improvement of banana cultivars. PMID:27445085

The transcription factor MTF-1 is essential for basal and heavy metal-induced metallothionein gene expression.

PubMed

Heuchel, R; Radtke, F; Georgiev, O; Stark, G; Aguet, M; Schaffner, W

1994-06-15

We have described and cloned previously a factor (MTF-1) that binds specifically to heavy metal-responsive DNA sequence elements in the enhancer/promoter region of metallothionein genes. MTF-1 is a protein of 72.5 kDa that contains six zinc fingers and multiple domains for transcriptional activation. Here we report the disruption of both alleles of the MTF-1 gene in mouse embryonic stem cells by homologous recombination. The resulting null mutant cell line fails to produce detectable amounts of MTF-1. Moreover, due to the loss of MTF-1, the endogenous metallothionein I and II genes are silent, indicating that MTF-1 is required for both their basal and zinc-induced transcription. In addition to zinc, other heavy metals, including cadmium, copper, nickel and lead, also fail to activate metal-responsive promoters in null mutant cells. However, cotransfection of an MTF-1 expression vector and metal-responsive reporter genes yields strong basal transcription that can be further boosted by zinc treatment of cells. These results demonstrate that MTF-1 is essential for metallothionein gene regulation. Finally, we present evidence that MTF-1 itself is a zinc sensor, which exhibits increased DNA binding activity upon zinc treatment.

The two-component signal system in rice (Oryza sativa L.): a genome-wide study of cytokinin signal perception and transduction.

PubMed

Du, Liming; Jiao, Fangchan; Chu, Jun; Jin, Gulei; Chen, Ming; Wu, Ping

2007-06-01

In this report we define the genes of two-component regulatory systems in rice through a comprehensive computational analysis of rice (Oryza sativa L.) genome sequence databases. Thirty-seven genes were identified, including 5 HKs (cytokinin-response histidine protein kinase) (OsHK1-4, OsHKL1), 5 HPs (histidine phosphotransfer proteins) (OsHP1-5), 15 type-A RRs (response regulators) (OsRR1-15), 7 type B RR genes (OsRR16-22), and 5 predicted pseudo-response regulators (OsPRR1-5). Protein motif organization, gene structure, phylogenetic analysis, chromosomal location, and comparative analysis between rice, maize, and Arabidopsis are described. Full-length cDNA clones of each gene were isolated from rice. Heterologous expression of each of the OsHKs in yeast mutants conferred histidine kinase function in a cytokinin-dependent manner. Nonconserved regions of individual cDNAs were used as probes in expression profiling experiments. This work provides a foundation for future functional dissection of the rice cytokinin two-component signaling pathway.

Sampling Daphnia's expressed genes: preservation, expansion and invention of crustacean genes with reference to insect genomes

PubMed Central

Colbourne, John K; Eads, Brian D; Shaw, Joseph; Bohuski, Elizabeth; Bauer, Darren J; Andrews, Justen

2007-01-01

Background Functional and comparative studies of insect genomes have shed light on the complement of genes, which in part, account for shared morphologies, developmental programs and life-histories. Contrasting the gene inventories of insects to those of the nematodes provides insight into the genomic changes responsible for their diversification. However, nematodes have weak relationships to insects, as each belongs to separate animal phyla. A better outgroup to distinguish lineage specific novelties would include other members of Arthropoda. For example, crustaceans are close allies to the insects (together forming Pancrustacea) and their fascinating aquatic lifestyle provides an important comparison for understanding the genetic basis of adaptations to life on land versus life in water. Results This study reports on the first characterization of cDNA libraries and sequences for the model crustacean Daphnia pulex. We analyzed 1,546 ESTs of which 1,414 represent approximately 787 nuclear genes, by measuring their sequence similarities with insect and nematode proteomes. The provisional annotation of genes is supported by expression data from microarray studies described in companion papers. Loci expected to be shared between crustaceans and insects because of their mutual biological features are identified, including genes for reproduction, regulation and cellular processes. We identify genes that are likely derived within Pancrustacea or lost within the nematodes. Moreover, lineage specific gene family expansions are identified, which suggest certain biological demands associated with their ecological setting. In particular, up to seven distinct ferritin loci are found in Daphnia compared to three in most insects. Finally, a substantial fraction of the sampled gene transcripts shares no sequence similarity with those from other arthropods. Genes functioning during development and reproduction are comparatively well conserved between crustaceans and insects. By contrast, genes that were responsive to environmental conditions (metal stress) and not sex-biased included the greatest proportion of genes with no matches to insect proteomes. Conclusion This study along with associated microarray experiments are the initial steps in a coordinated effort by the Daphnia Genomics Consortium to build the necessary genomic platform needed to discover genes that account for the phenotypic diversity within the genus and to gain new insights into crustacean biology. This effort will soon include the first crustacean genome sequence. PMID:17612412

From root to fruit: RNA-Seq analysis shows that arbuscular mycorrhizal symbiosis may affect tomato fruit metabolism.

PubMed

Zouari, Inès; Salvioli, Alessandra; Chialva, Matteo; Novero, Mara; Miozzi, Laura; Tenore, Gian Carlo; Bagnaresi, Paolo; Bonfante, Paola

2014-03-21

Tomato (Solanum lycopersicum) establishes a beneficial symbiosis with arbuscular mycorrhizal (AM) fungi. The formation of the mycorrhizal association in the roots leads to plant-wide modulation of gene expression. To understand the systemic effect of the fungal symbiosis on the tomato fruit, we used RNA-Seq to perform global transcriptome profiling on Moneymaker tomato fruits at the turning ripening stage. Fruits were collected at 55 days after flowering, from plants colonized with Funneliformis mosseae and from control plants, which were fertilized to avoid responses related to nutrient deficiency. Transcriptome analysis identified 712 genes that are differentially expressed in fruits from mycorrhizal and control plants. Gene Ontology (GO) enrichment analysis of these genes showed 81 overrepresented functional GO classes. Up-regulated GO classes include photosynthesis, stress response, transport, amino acid synthesis and carbohydrate metabolism functions, suggesting a general impact of fungal symbiosis on primary metabolisms and, particularly, on mineral nutrition. Down-regulated GO classes include cell wall, metabolism and ethylene response pathways. Quantitative RT-PCR validated the RNA-Seq results for 12 genes out of 14 when tested at three fruit ripening stages, mature green, breaker and turning. Quantification of fruit nutraceutical and mineral contents produced values consistent with the expression changes observed by RNA-Seq analysis. This RNA-Seq profiling produced a novel data set that explores the intersection of mycorrhization and fruit development. We found that the fruits of mycorrhizal plants show two transcriptomic "signatures": genes characteristic of a climacteric fleshy fruit, and genes characteristic of mycorrhizal status, like phosphate and sulphate transporters. Moreover, mycorrhizal plants under low nutrient conditions produce fruits with a nutrient content similar to those from non-mycorrhizal plants under high nutrient conditions, indicating that AM fungi can help replace exogenous fertilizer for fruit crops.

Chilling-induced tomato flavor loss is associated with altered volatile synthesis and transient changes in DNA methylation

PubMed Central

Zhang, Bo; Tieman, Denise M.; Jiao, Chen; Xu, Yimin; Chen, Kunsong; Fei, Zhangjun; Giovannoni, James J.; Klee, Harry J.

2016-01-01

Commercial tomatoes are widely perceived by consumers as lacking flavor. A major part of that problem is a postharvest handling system that chills fruit. Low-temperature storage is widely used to slow ripening and reduce decay. However, chilling results in loss of flavor. Flavor-associated volatiles are sensitive to temperatures below 12 °C, and their loss greatly reduces flavor quality. Here, we provide a comprehensive view of the effects of chilling on flavor and volatiles associated with consumer liking. Reduced levels of specific volatiles are associated with significant reductions in transcripts encoding key volatile synthesis enzymes. Although expression of some genes critical to volatile synthesis recovers after a return to 20 °C, some genes do not. RNAs encoding transcription factors essential for ripening, including RIPENING INHIBITOR (RIN), NONRIPENING, and COLORLESS NONRIPENING are reduced in response to chilling and may be responsible for reduced transcript levels in many downstream genes during chilling. Those reductions are accompanied by major changes in the methylation status of promoters, including RIN. Methylation changes are transient and may contribute to the fidelity of gene expression required to provide maximal beneficial environmental response with minimal tangential influence on broader fruit developmental biology. PMID:27791156

Genome-wide transcription responses to synchrotron microbeam radiotherapy.

PubMed

Sprung, Carl N; Yang, Yuqing; Forrester, Helen B; Li, Jason; Zaitseva, Marina; Cann, Leonie; Restall, Tina; Anderson, Robin L; Crosbie, Jeffrey C; Rogers, Peter A W

2012-10-01

The majority of cancer patients achieve benefit from radiotherapy. A significant limitation of radiotherapy is its relatively low therapeutic index, defined as the maximum radiation dose that causes acceptable normal tissue damage to the minimum dose required to achieve tumor control. Recently, a new radiotherapy modality using synchrotron-generated X-ray microbeam radiotherapy has been demonstrated in animal models to ablate tumors with concurrent sparing of normal tissue. Very little work has been undertaken into the cellular and molecular mechanisms that differentiate microbeam radiotherapy from broad beam. The purpose of this study was to investigate and compare the whole genome transcriptional response of in vivo microbeam radiotherapy versus broad beam irradiated tumors. We hypothesized that gene expression changes after microbeam radiotherapy are different from those seen after broad beam. We found that in EMT6.5 tumors at 4-48 h postirradiation, microbeam radiotherapy differentially regulates a number of genes, including major histocompatibility complex (MHC) class II antigen gene family members, and other immunity-related genes including Ciita, Ifng, Cxcl1, Cxcl9, Indo and Ubd when compared to broad beam. Our findings demonstrate molecular differences in the tumor response to microbeam versus broad beam irradiation and these differences provide insight into the underlying mechanisms of microbeam radiotherapy and broad beam.

Fire blight disease reactome: RNA-seq transcriptional profile of apple host plant defense responses to Erwinia amylovora pathogen infection.

PubMed

Kamber, Tim; Buchmann, Jan P; Pothier, Joël F; Smits, Theo H M; Wicker, Thomas; Duffy, Brion

2016-02-17

The molecular basis of resistance and susceptibility of host plants to fire blight, a major disease threat to pome fruit production globally, is largely unknown. RNA-sequencing data from challenged and mock-inoculated flowers were analyzed to assess the susceptible response of apple to the fire blight pathogen Erwinia amylovora. In presence of the pathogen 1,080 transcripts were differentially expressed at 48 h post inoculation. These included putative disease resistance, stress, pathogen related, general metabolic, and phytohormone related genes. Reads, mapped to regions on the apple genome where no genes were assigned, were used to identify potential novel genes and open reading frames. To identify transcripts specifically expressed in response to E. amylovora, RT-PCRs were conducted and compared to the expression patterns of the fire blight biocontrol agent Pantoea vagans strain C9-1, another apple pathogen Pseudomonas syringae pv. papulans, and mock inoculated apple flowers. This led to the identification of a peroxidase superfamily gene that was lower expressed in response to E. amylovora suggesting a potential role in the susceptibility response. Overall, this study provides the first transcriptional profile by RNA-seq of the host plant during fire blight disease and insights into the response of susceptible apple plants to E. amylovora.

Fire blight disease reactome: RNA-seq transcriptional profile of apple host plant defense responses to Erwinia amylovora pathogen infection

PubMed Central

Kamber, Tim; Buchmann, Jan P.; Pothier, Joël F.; Smits, Theo H. M.; Wicker, Thomas; Duffy, Brion

2016-01-01

The molecular basis of resistance and susceptibility of host plants to fire blight, a major disease threat to pome fruit production globally, is largely unknown. RNA-sequencing data from challenged and mock-inoculated flowers were analyzed to assess the susceptible response of apple to the fire blight pathogen Erwinia amylovora. In presence of the pathogen 1,080 transcripts were differentially expressed at 48 h post inoculation. These included putative disease resistance, stress, pathogen related, general metabolic, and phytohormone related genes. Reads, mapped to regions on the apple genome where no genes were assigned, were used to identify potential novel genes and open reading frames. To identify transcripts specifically expressed in response to E. amylovora, RT-PCRs were conducted and compared to the expression patterns of the fire blight biocontrol agent Pantoea vagans strain C9-1, another apple pathogen Pseudomonas syringae pv. papulans, and mock inoculated apple flowers. This led to the identification of a peroxidase superfamily gene that was lower expressed in response to E. amylovora suggesting a potential role in the susceptibility response. Overall, this study provides the first transcriptional profile by RNA-seq of the host plant during fire blight disease and insights into the response of susceptible apple plants to E. amylovora. PMID:26883568

Identification and functional characterization of the pepper CaDRT1 gene involved in the ABA-mediated drought stress response.

PubMed

Baek, Woonhee; Lim, Sohee; Lee, Sung Chul

2016-05-01

Plants are constantly challenged by various environmental stresses, including high salinity and drought, and they have evolved defense mechanisms to counteract the deleterious effects of these stresses. The plant hormone abscisic acid (ABA) regulates plant growth and developmental processes and mediates abiotic stress responses. Here, we identified the Capsicum annuum DRought Tolerance 1 (CaDRT1) gene from pepper leaves treated with ABA. CaDRT1 was strongly expressed in pepper leaves in response to environmental stresses and after ABA treatment, suggesting that the CaDRT1 protein functions in the abiotic stress response. Knockdown expression of CaDRT1 via virus-induced gene silencing resulted in a high level of drought susceptibility, and this was characterized by increased transpirational water loss via decreased stomatal closure. CaDRT1-overexpressing (OX) Arabidopsis plants exhibited an ABA-hypersensitive phenotype during the germinative, seedling, and adult stages. Additionally, these CaDRT1-OX plants exhibited a drought-tolerant phenotype characterized by low levels of transpirational water loss, high leaf temperatures, increased stomatal closure, and enhanced expression levels of drought-responsive genes. Taken together, our results suggest that CaDRT1 is a positive regulator of the ABA-mediated drought stress response.

Dynamic transcription profiles of “Qinguan” apple (Malus × domestica) leaves in response to Marssonina coronaria inoculation

PubMed Central

Xu, Jianhua; Li, Miaomiao; Jiao, Peng; Tao, Hongxia; Wei, Ningning; Ma, Fengwang; Zhang, Junke

2015-01-01

Marssonina apple blotch, caused by the fungus Marssonina coronaria, is one of the most destructive apple diseases in China and East Asia. A better understanding of the plant's response to fungi during pathogenesis is urgently needed to improve plant resistance and to breed resistant cultivars. To address this, the transcriptomes of “Qinguan” (a cultivar with high resistance to M. coronaria) apple leaves were sequenced at 12, 24, 48, and 72 h post-inoculation (hpi) with Marssonina coronaria. The comparative results showed that a total of 1956 genes were differentially expressed between the inoculated and control samples at the 4 time points. Gene ontology (GO) term enrichment analysis of differentially expressed genes (DEGs) revealed changes in cellular component, secondary metabolism including chalcone isomerase activity, phytoalexin biosynthetic process, anthocyanin-containing compound biosynthetic process, lignin biosynthetic process, positive regulation of flavonoid biosynthetic process; and molecular functions or biological processes related to the defense response, biotic stimulus response, wounding response and fungus response. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis showed that DEGs were significantly enriched in flavonoid biosynthesis, vitamin B6 metabolism, phenylpropanoid biosynthesis, and the stilbenoid, diarylheptanoid and gingerol biosynthesis pathways. Furthermore, the importance of changes in cellular components and partial polyphenol compounds when encountering M. coronaria are discussed. PMID:26528306

Root defense analysis against Fusarium oxysporum reveals new regulators to confer resistance

PubMed Central

Chen, Yi Chung; Wong, Chin Lin; Muzzi, Frederico; Vlaardingerbroek, Ido; Kidd, Brendan N.; Schenk, Peer M.

2014-01-01

Fusarium oxysporum is a root-infecting fungal pathogen that causes wilt disease on a broad range of plant species, including Arabidopsis thaliana. Investigation of the defense response against this pathogen had primarily been conducted using leaf tissue and little was known about the root defense response. In this study, we profiled the expression of root genes after infection with F. oxysporum by microarray analysis. In contrast to the leaf response, root tissue did not show a strong induction of defense-associated gene expression and instead showed a greater proportion of repressed genes. Screening insertion mutants from differentially expressed genes in the microarray uncovered a role for the transcription factor ETHYLENE RESPONSE FACTOR72 (ERF72) in susceptibility to F. oxysporum. Due to the role of ERF72 in suppressing programmed cell death and detoxifying reactive oxygen species (ROS), we examined the pub22/pub23/pub24 U-box type E3 ubiquitin ligase triple mutant which is known to possess enhanced ROS production in response to pathogen challenge. We found that the pub22/23/24 mutant is more resistant to F. oxysporum infection, suggesting that a heightened innate immune response provides protection against F. oxysporum. We conclude that root-mediated defenses against soil-borne pathogens can be provided at multiple levels. PMID:24998294

Age Dependent Variability in Gene Expression in Fischer 344 ...

EPA Pesticide Factsheets

Recent evidence suggests older adults may be a sensitive population with regard to environmental exposure to toxic compounds. One source of this sensitivity could be an enhanced variability in response. Studies on phenotypic differences have suggested that variation in response does increase with age. However, few reports address the question of variation in gene expression as an underlying cause for increased variability of phenotypic response in the aged. In this study, we utilized global analysis to compare variation in constitutive gene expression in the retinae of young (4 mos), middle-aged (11 mos) and aged (23 mos) Fischer 344 rats. Three hundred and forty transcripts were identified in which variance in expression increased from 4 to 23 mos of age, while only twelve transcripts were found for which it decreased. Functional roles for identified genes were clustered in basic biological categories including cell communication, function, metabolism and response to stimuli. Our data suggest that population stochastically-induced variability should be considered in assessing sensitivity due to old age. Recent evidence suggests older adults may be a sensitive population with regard to environmental exposure to toxic compounds. One source of this sensitivity could be an enhanced variability in response. Studies on phenotypic differences have suggested that variation in response does increase with age. However, few reports address the question of variation in

Regulation of drought tolerance by the F-box protein MAX2 in Arabidopsis.

PubMed

Bu, Qingyun; Lv, Tianxiao; Shen, Hui; Luong, Phi; Wang, Jimmy; Wang, Zhenyu; Huang, Zhigang; Xiao, Langtao; Engineer, Cawas; Kim, Tae Houn; Schroeder, Julian I; Huq, Enamul

2014-01-01

MAX2 (for MORE AXILLARY GROWTH2) has been shown to regulate diverse biological processes, including plant architecture, photomorphogenesis, senescence, and karrikin signaling. Although karrikin is a smoke-derived abiotic signal, a role for MAX2 in abiotic stress response pathways is least investigated. Here, we show that the max2 mutant is strongly hypersensitive to drought stress compared with wild-type Arabidopsis (Arabidopsis thaliana). Stomatal closure of max2 was less sensitive to abscisic acid (ABA) than that of the wild type. Cuticle thickness of max2 was significantly thinner than that of the wild type. Both of these phenotypes of max2 mutant plants correlate with the increased water loss and drought-sensitive phenotype. Quantitative real-time reverse transcription-polymerase chain reaction analyses showed that the expression of stress-responsive genes and ABA biosynthesis, catabolism, transport, and signaling genes was impaired in max2 compared with wild-type seedlings in response to drought stress. Double mutant analysis of max2 with the ABA-insensitive mutants abi3 and abi5 indicated that MAX2 may function upstream of these genes. The expression of ABA-regulated genes was enhanced in imbibed max2 seeds. In addition, max2 mutant seedlings were hypersensitive to ABA and osmotic stress, including NaCl, mannitol, and glucose. Interestingly, ABA, osmotic stress, and drought-sensitive phenotypes were restricted to max2, and the strigolactone biosynthetic pathway mutants max1, max3, and max4 did not display any defects in these responses. Taken together, these results uncover an important role for MAX2 in plant responses to abiotic stress conditions.

Comparative ovarian microarray analysis of juvenile hormone-responsive genes in water flea Daphnia magna: potential targets for toxicity.

PubMed

Toyota, Kenji; Williams, Timothy D; Sato, Tomomi; Tatarazako, Norihisa; Iguchi, Taisen

2017-03-01

The freshwater zooplankton Daphnia magna has been extensively employed in chemical toxicity tests such as OECD Test Guidelines 202 and 211. Previously, it has been demonstrated that the treatment of juvenile hormones (JHs) or their analogues to female daphnids can induce male offspring production. Based on this finding, a rapid screening method for detection of chemicals with JH-activity was recently developed using adult D. magna. This screening system determines whether a chemical has JH-activity by investigating the male offspring inducibility. Although this is an efficient high-throughput short-term screening system, much remains to be discovered about JH-responsive pathways in the ovary, and whether different JH-activators act via the same mechanism. JH-responsive genes in the ovary including developing oocytes are still largely undescribed. Here, we conducted comparative microarray analyses using ovaries from Daphnia magna treated with fenoxycarb (Fx; artificial JH agonist) or methyl farnesoate (MF; a putative innate JH in daphnids) to elucidate responses to JH agonists in the ovary, including developing oocytes, at a JH-sensitive period for male sex determination. We demonstrate that induction of hemoglobin genes is a well-conserved response to JH even in the ovary, and a potential adverse effect of JH agonist is suppression of vitellogenin gene expression, that might cause reduction of offspring number. This is the first report demonstrating different transcriptomics profiles from MF and an artificial JH agonist in D. magna ovary, improving understanding the tissue-specific mode-of-action of JH. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Comparative Analysis of Toxic Responses of Organic Extracts from Diesel and Selected Alternative Fuels Engine Emissions in Human Lung BEAS-2B Cells

PubMed Central

Libalova, Helena; Rossner,, Pavel; Vrbova, Kristyna; Brzicova, Tana; Sikorova, Jitka; Vojtisek-Lom, Michal; Beranek, Vit; Klema, Jiri; Ciganek, Miroslav; Neca, Jiri; Pencikova, Katerina; Machala, Miroslav; Topinka, Jan

2016-01-01

This study used toxicogenomics to identify the complex biological response of human lung BEAS-2B cells treated with organic components of particulate matter in the exhaust of a diesel engine. First, we characterized particles from standard diesel (B0), biodiesel (methylesters of rapeseed oil) in its neat form (B100) and 30% by volume blend with diesel fuel (B30), and neat hydrotreated vegetable oil (NEXBTL100). The concentration of polycyclic aromatic hydrocarbons (PAHs) and their derivatives in organic extracts was the lowest for NEXBTL100 and higher for biodiesel. We further analyzed global gene expression changes in BEAS-2B cells following 4 h and 24 h treatment with extracts. The concentrations of 50 µg extract/mL induced a similar molecular response. The common processes induced after 4 h treatment included antioxidant defense, metabolism of xenobiotics and lipids, suppression of pro-apoptotic stimuli, or induction of plasminogen activating cascade; 24 h treatment affected fewer processes, particularly those involved in detoxification of xenobiotics, including PAHs. The majority of distinctively deregulated genes detected after both 4 h and 24 h treatment were induced by NEXBTL100; the deregulated genes included, e.g., those involved in antioxidant defense and cell cycle regulation and proliferation. B100 extract, with the highest PAH concentrations, additionally affected several cell cycle regulatory genes and p38 signaling. PMID:27827897

Analytical workflow profiling gene expression in murine macrophages

PubMed Central

Nixon, Scott E.; González-Peña, Dianelys; Lawson, Marcus A.; McCusker, Robert H.; Hernandez, Alvaro G.; O’Connor, Jason C.; Dantzer, Robert; Kelley, Keith W.

2015-01-01

Comprehensive and simultaneous analysis of all genes in a biological sample is a capability of RNA-Seq technology. Analysis of the entire transcriptome benefits from summarization of genes at the functional level. As a cellular response of interest not previously explored with RNA-Seq, peritoneal macrophages from mice under two conditions (control and immunologically challenged) were analyzed for gene expression differences. Quantification of individual transcripts modeled RNA-Seq read distribution and uncertainty (using a Beta Negative Binomial distribution), then tested for differential transcript expression (False Discovery Rate-adjusted p-value < 0.05). Enrichment of functional categories utilized the list of differentially expressed genes. A total of 2079 differentially expressed transcripts representing 1884 genes were detected. Enrichment of 92 categories from Gene Ontology Biological Processes and Molecular Functions, and KEGG pathways were grouped into 6 clusters. Clusters included defense and inflammatory response (Enrichment Score = 11.24) and ribosomal activity (Enrichment Score = 17.89). Our work provides a context to the fine detail of individual gene expression differences in murine peritoneal macrophages during immunological challenge with high throughput RNA-Seq. PMID:25708305

Gene expression profiles characterize early graft response in living donor small bowel transplantation: a case report.

PubMed

Bradley, S P; Pahari, M; Uknis, M E; Rastellini, C; Cicalese, L

2006-01-01

The cellular and histological events that occur during the regeneration process in invertebrates have been studied in the field of visceral regeneration. We would like to explore the molecular aspects of the regeneration process in the small intestine. The aim of this study was to characterize the gene expression profiles of the intestinal graft to identify which genes may have a role in regeneration of graft tissue posttransplant. In a patient undergoing living related small bowel transplantation (LRSBTx) in our institution, mucosal biopsies were obtained from the recipient intestine and donor graft at the time of transplant and at weeks 1, 2, 3, and 6 posttransplant. Total RNA was isolated from sample biopsies followed by gene expression profiles determined from the replicate samples (n = 3) for each biopsy using the Affymetrix U133 Plus 2.0 Human GeneChip set. Two profiles were obtained from the data. One profile showed rapid increase of 45 genes immediately after transplant by week 1 with significant changes (P < .05) greater than threefold including the chemokine CXC9 and glutathione-related stress factors, GPX2 and GSTA4. The second profile identified 133 genes that were significantly decreased by threefold or greater immediately after transplant week 1, including UCC1, the human homolog of the Ependymin gene. We have identified two gene expression profiles representing early graft responses to small bowel transplantation. These profiles will serve to identify and study those genes whose products may play a role in accelerating tissue regeneration following segmental LRSBTx.

Bovine mammary gene expression profiling during the onset of lactation.

PubMed

Gao, Yuanyuan; Lin, Xueyan; Shi, Kerong; Yan, Zhengui; Wang, Zhonghua

2013-01-01

Lactogenesis includes two stages. Stage I begins a few weeks before parturition. Stage II is initiated around the time of parturition and extends for several days afterwards. To better understand the molecular events underlying these changes, genome-wide gene expression profiling was conducted using digital gene expression (DGE) on bovine mammary tissue at three time points (on approximately day 35 before parturition (-35 d), day 7 before parturition (-7 d) and day 3 after parturition (+3 d)). Approximately 6.2 million (M), 5.8 million (M) and 6.1 million (M) 21-nt cDNA tags were sequenced in the three cDNA libraries (-35 d, -7 d and +3 d), respectively. After aligning to the reference sequences, the three cDNA libraries included 8,662, 8,363 and 8,359 genes, respectively. With a fold change cutoff criteria of ≥ 2 or ≤-2 and a false discovery rate (FDR) of ≤ 0.001, a total of 812 genes were significantly differentially expressed at -7 d compared with -35 d (stage I). Gene ontology analysis showed that those significantly differentially expressed genes were mainly associated with cell cycle, lipid metabolism, immune response and biological adhesion. A total of 1,189 genes were significantly differentially expressed at +3 d compared with -7 d (stage II), and these genes were mainly associated with the immune response and cell cycle. Moreover, there were 1,672 genes significantly differentially expressed at +3 d compared with -35 d. Gene ontology analysis showed that the main differentially expressed genes were those associated with metabolic processes. The results suggest that the mammary gland begins to lactate not only by a gain of function but also by a broad suppression of function to effectively push most of the cell's resources towards lactation.

Linkage analysis of schizophrenia with five dopamine receptor genes in nine pedigrees

DOE Office of Scientific and Technical Information (OSTI.GOV)

Coon, H.; Byerley, W.; Holik, J.

Alterations in dopamine neurotransmission have been strongly implicated in the pathogenesis of schizophrenia for nearly 2 decades. Recently, the genes for five dopamine receptors have been cloned and characterized, and genetic and physical map information has become available. Using these five loci as candidate genes, the authors have tested for genetic linkage to schizophrenia in nine multigenerational families which include multiple affected individuals. In addition to testing conservative disease models, the have used a neurophysiological indicator variable, the P50 auditory evoked response. Deficits in gating of the P50 response have been shown to segregate with schizophrenia in this sample andmore » may identify carriers of gene(s) predisposing for schizophrenia. Linkage results were consistently negative, indicating that a defect at any of the actual receptor sites is unlikely to be a major contributor to schizophrenia in the nine families studied. 47 refs., 1 fig., 4 tabs.« less

Identification of genes and pathways associated with aluminum stress and tolerance using transcriptome profiling of wheat near-isogenic lines.

PubMed

Houde, Mario; Diallo, Amadou Oury

2008-08-27

Aluminum is considered the most limiting factor for plant productivity in acidic soils, which cover large areas of the world's potential arable lands. The inhibition of root growth is recognized as the primary effect of Al toxicity. To identify genes associated with Al stress and tolerance, transcriptome analyses of four different wheat lines (2 Al-tolerant and 2 Al sensitive) that differ in their response to Al were performed. Microarray expression profiling revealed that 83 candidate genes are associated with Al stress and 25 are associated with tolerance. The stress-associated genes include important enzymes such as pyruvate dehydrogenase, alternative oxidase, and galactonolactone oxidase, ABC transporter and ascorbate oxido-reducatase. The Al tolerance-associated genes include the ALMT-1 malate transporter, glutathione S-transferase, germin/oxalate oxidase, fructose 1,6-bisphosphatase, cysteine-rich proteins, cytochrome P450 monooxygenase, cellulose synthase, zinc finger transcription factor, disease resistance response protein and F-box containing domain protein. In this survey, we identified stress- and tolerance-associated genes that may be involved in the detoxification of Al and reactive oxygen species. Alternative pathways could help maintain the supply of important metabolites (H2O2, ascorbate, NADH, and phosphate) needed for Al tolerance and root growth. The Al tolerance-associated genes may be key factors that regulate these pathways.

Global transcriptome analysis of eukaryotic genes affected by gromwell extract.

PubMed

Bang, Soohyun; Lee, Dohyun; Kim, Hanhe; Park, Jiyong; Bahn, Yong-Sun

2014-02-01

Gromwell is known to have diverse pharmacological, cosmetic and nutritional benefits for humans. Nevertheless, the biological influence of gromwell extract (GE) on the general physiology of eukaryotic cells remains unknown. In this study a global transcriptome analysis was performed to identify genes affected by the addition of GE with Cryptococcus neoformans as the model system. In response to GE treatment, genes involved in signal transduction were immediately regulated, and the evolutionarily conserved sets of genes involved in the core cellular functions, including DNA replication, RNA transcription/processing and protein translation/processing, were generally up-regulated. In contrast, a number of genes involved in carbohydrate metabolism and transport, inorganic ion transport and metabolism, post-translational modification/protein turnover/chaperone functions and signal transduction were down-regulated. Among the GE-responsive genes that are also evolutionarily conserved in the human genome, the expression patterns of YSA1, TPO2, CFO1 and PZF1 were confirmed by northern blot analysis. Based on the functional characterization of some GE-responsive genes, it was found that GE treatment may promote cellular tolerance against a variety of environmental stresses in eukaryotes. GE treatment affects the expression levels of a significant portion of the Cryptococcus genome, implying that GE significantly affects the general physiology of eukaryotic cells. © 2013 Society of Chemical Industry.

De novo transcriptome assembly and analysis of differential gene expression following peptidoglycan (PGN) challenge in Antheraea pernyi.

PubMed

Liu, Yu; Xin, Zhao-Zhe; Zhang, Dai-Zhen; Zhu, Xiao-Yu; Wang, Ying; Chen, Li; Tang, Bo-Ping; Zhou, Chun-Lin; Chai, Xin-Yue; Tian, Ji-Wu; Liu, Qiu-Ning

2018-06-01

Antheraea pernyi is not only an important economic insect, it is increasingly employed as a model organism due to a variety of advantages, including ease of rearing and experimental manipulation compared with other Lepidoptera. Peptidoglycan (PGN) is a major component of the bacterial cell wall, and interactions between PGN and A. pernyi cause a series of physiological changes in the insect. In the present study, we constructed cDNA libraries from a A. pernyi PGN-infected group and a control group stimulated with phosphate-buffered saline (PBS). The transcriptome was de novo assembled using the Trinity platform, and 1698 differentially expressed genes (DEGs) were identified, comprising 894 up-regulated and 804 down-regulated genes. To further investigate immune-related DEGs, gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment were performed. GO analysis identified major immune-related GO terms and KEGG enrichment indicated gene responses to three pathways related to the insect immune system. Several homologous genes related to the immune response of the A. pernyi fat body post-PGN infection were identified and categorised. Taken together, the results provide insight into the complex molecular mechanisms of the responses to bacterial infection at the transcriptional level. Copyright © 2018 Elsevier B.V. All rights reserved.

Suboptimal evolutionary novel environments promote singular altered gravity responses of transcriptome during Drosophila metamorphosis

PubMed Central

2013-01-01

Background Previous experiments have shown that the reduced gravity aboard the International Space Station (ISS) causes important alterations in Drosophila gene expression. These changes were shown to be intimately linked to environmental space-flight related constraints. Results Here, we use an array of different techniques for ground-based simulation of microgravity effects to assess the effect of suboptimal environmental conditions on the gene expression of Drosophila in reduced gravity. A global and integrative analysis, using “gene expression dynamics inspector” (GEDI) self-organizing maps, reveals different degrees in the responses of the transcriptome when using different environmental conditions or microgravity/hypergravity simulation devices. Although the genes that are affected are different in each simulation technique, we find that the same gene ontology groups, including at least one large multigene family related with behavior, stress response or organogenesis, are over represented in each case. Conclusions These results suggest that the transcriptome as a whole can be finely tuned to gravity force. In optimum environmental conditions, the alteration of gravity has only mild effects on gene expression but when environmental conditions are far from optimal, the gene expression must be tuned greatly and effects become more robust, probably linked to the lack of experience of organisms exposed to evolutionary novel environments such as a gravitational free one. PMID:23806134

Genome-Wide Analyses of the NAC Transcription Factor Gene Family in Pepper (Capsicum annuum L.): Chromosome Location, Phylogeny, Structure, Expression Patterns, Cis-Elements in the Promoter, and Interaction Network

PubMed Central

Diao, Weiping; Snyder, John C.; Liu, Jinbing; Pan, Baogui; Guo, Guangjun; Ge, Wei; Dawood, Mohammad Hasan Salman Ali

2018-01-01

The NAM, ATAF1/2, and CUC2 (NAC) transcription factors form a large plant-specific gene family, which is involved in the regulation of tissue development in response to biotic and abiotic stress. To date, there have been no comprehensive studies investigating chromosomal location, gene structure, gene phylogeny, conserved motifs, or gene expression of NAC in pepper (Capsicum annuum L.). The recent release of the complete genome sequence of pepper allowed us to perform a genome-wide investigation of Capsicum annuum L. NAC (CaNAC) proteins. In the present study, a comprehensive analysis of the CaNAC gene family in pepper was performed, and a total of 104 CaNAC genes were identified. Genome mapping analysis revealed that CaNAC genes were enriched on four chromosomes (chromosomes 1, 2, 3, and 6). In addition, phylogenetic analysis of the NAC domains from pepper, potato, Arabidopsis, and rice showed that CaNAC genes could be clustered into three groups (I, II, and III). Group III, which contained 24 CaNAC genes, was exclusive to the Solanaceae plant family. Gene structure and protein motif analyses showed that these genes were relatively conserved within each subgroup. The number of introns in CaNAC genes varied from 0 to 8, with 83 (78.9%) of CaNAC genes containing two or less introns. Promoter analysis confirmed that CaNAC genes are involved in pepper growth, development, and biotic or abiotic stress responses. Further, the expression of 22 selected CaNAC genes in response to seven different biotic and abiotic stresses [salt, heat shock, drought, Phytophthora capsici, abscisic acid, salicylic acid (SA), and methyl jasmonate (MeJA)] was evaluated by quantitative RT-PCR to determine their stress-related expression patterns. Several putative stress-responsive CaNAC genes, including CaNAC72 and CaNAC27, which are orthologs of the known stress-responsive Arabidopsis gene ANAC055 and potato gene StNAC30, respectively, were highly regulated by treatment with different types of stress. Our results also showed that CaNAC36 plays an important role in the interaction network, interacting with 48 genes. Most of these genes are in the mitogen-activated protein kinase (MAPK) family. Taken together, our results provide a platform for further studies to identify the biological functions of CaNAC genes. PMID:29596349

Characterization of a Gene Encoding Clathrin Heavy Chain in Maize Up-Regulated by Salicylic Acid, Abscisic Acid and High Boron Supply

PubMed Central

Zeng, Mu-Heng; Liu, Sheng-Hong; Yang, Miao-Xian; Zhang, Ya-Jun; Liang, Jia-Yong; Wan, Xiao-Rong; Liang, Hong

2013-01-01

Clathrin, a three-legged triskelion composed of three clathrin heavy chains (CHCs) and three light chains (CLCs), plays a critical role in clathrin-mediated endocytosis (CME) in eukaryotic cells. In this study, the genes ZmCHC1 and ZmCHC2 encoding clathrin heavy chain in maize were cloned and characterized for the first time in monocots. ZmCHC1 encodes a 1693-amino acid-protein including 29 exons and 28 introns, and ZmCHC2 encodes a 1746-amino acid-protein including 28 exons and 27 introns. The high similarities of gene structure, protein sequences and 3D models among ZmCHC1, and Arabidopsis AtCHC1 and AtCHC2 suggest their similar functions in CME. ZmCHC1 gene is predominantly expressed in maize roots instead of ubiquitous expression of ZmCHC2. Consistent with a typical predicted salicylic acid (SA)-responsive element and four predicted ABA-responsive elements (ABREs) in the promoter sequence of ZmCHC1, the expression of ZmCHC1 instead of ZmCHC2 in maize roots is significantly up-regulated by SA or ABA, suggesting that ZmCHC1 gene may be involved in the SA signaling pathway in maize defense responses. The expressions of ZmCHC1 and ZmCHC2 genes in maize are down-regulated by azide or cold treatment, further revealing the energy requirement of CME and suggesting that CME in plants is sensitive to low temperatures. PMID:23880865

Genome-Wide Profiling of Histone Modifications (H3K9me2 and H4K12ac) and Gene Expression in Rust (Uromyces appendiculatus) Inoculated Common Bean (Phaseolus vulgaris L.).

PubMed

Ayyappan, Vasudevan; Kalavacharla, Venu; Thimmapuram, Jyothi; Bhide, Ketaki P; Sripathi, Venkateswara R; Smolinski, Tomasz G; Manoharan, Muthusamy; Thurston, Yaqoob; Todd, Antonette; Kingham, Bruce

2015-01-01

Histone modifications such as methylation and acetylation play a significant role in controlling gene expression in unstressed and stressed plants. Genome-wide analysis of such stress-responsive modifications and genes in non-model crops is limited. We report the genome-wide profiling of histone methylation (H3K9me2) and acetylation (H4K12ac) in common bean (Phaseolus vulgaris L.) under rust (Uromyces appendiculatus) stress using two high-throughput approaches, chromatin immunoprecipitation sequencing (ChIP-Seq) and RNA sequencing (RNA-Seq). ChIP-Seq analysis revealed 1,235 and 556 histone methylation and acetylation responsive genes from common bean leaves treated with the rust pathogen at 0, 12 and 84 hour-after-inoculation (hai), while RNA-Seq analysis identified 145 and 1,763 genes differentially expressed between mock-inoculated and inoculated plants. The combined ChIP-Seq and RNA-Seq analyses identified some key defense responsive genes (calmodulin, cytochrome p450, chitinase, DNA Pol II, and LRR) and transcription factors (WRKY, bZIP, MYB, HSFB3, GRAS, NAC, and NMRA) in bean-rust interaction. Differential methylation and acetylation affected a large proportion of stress-responsive genes including resistant (R) proteins, detoxifying enzymes, and genes involved in ion flux and cell death. The genes identified were functionally classified using Gene Ontology (GO) and EuKaryotic Orthologous Groups (KOGs). The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis identified a putative pathway with ten key genes involved in plant-pathogen interactions. This first report of an integrated analysis of histone modifications and gene expression involved in the bean-rust interaction as reported here provides a comprehensive resource for other epigenomic regulation studies in non-model species under stress.

Genome-Wide Profiling of Histone Modifications (H3K9me2 and H4K12ac) and Gene Expression in Rust (Uromyces appendiculatus) Inoculated Common Bean (Phaseolus vulgaris L.)

PubMed Central

Thimmapuram, Jyothi; Bhide, Ketaki P.; Sripathi, Venkateswara R.; Smolinski, Tomasz G.; Manoharan, Muthusamy; Thurston, Yaqoob; Todd, Antonette; Kingham, Bruce

2015-01-01

Histone modifications such as methylation and acetylation play a significant role in controlling gene expression in unstressed and stressed plants. Genome-wide analysis of such stress-responsive modifications and genes in non-model crops is limited. We report the genome-wide profiling of histone methylation (H3K9me2) and acetylation (H4K12ac) in common bean (Phaseolus vulgaris L.) under rust (Uromyces appendiculatus) stress using two high-throughput approaches, chromatin immunoprecipitation sequencing (ChIP-Seq) and RNA sequencing (RNA-Seq). ChIP-Seq analysis revealed 1,235 and 556 histone methylation and acetylation responsive genes from common bean leaves treated with the rust pathogen at 0, 12 and 84 hour-after-inoculation (hai), while RNA-Seq analysis identified 145 and 1,763 genes differentially expressed between mock-inoculated and inoculated plants. The combined ChIP-Seq and RNA-Seq analyses identified some key defense responsive genes (calmodulin, cytochrome p450, chitinase, DNA Pol II, and LRR) and transcription factors (WRKY, bZIP, MYB, HSFB3, GRAS, NAC, and NMRA) in bean-rust interaction. Differential methylation and acetylation affected a large proportion of stress-responsive genes including resistant (R) proteins, detoxifying enzymes, and genes involved in ion flux and cell death. The genes identified were functionally classified using Gene Ontology (GO) and EuKaryotic Orthologous Groups (KOGs). The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis identified a putative pathway with ten key genes involved in plant-pathogen interactions. This first report of an integrated analysis of histone modifications and gene expression involved in the bean-rust interaction as reported here provides a comprehensive resource for other epigenomic regulation studies in non-model species under stress. PMID:26167691

Multitissue Transcriptomics Delineates the Diversity of Airway T Cell Functions in Asthma.

PubMed

Singhania, Akul; Wallington, Joshua C; Smith, Caroline G; Horowitz, Daniel; Staples, Karl J; Howarth, Peter H; Gadola, Stephan D; Djukanović, Ratko; Woelk, Christopher H; Hinks, Timothy S C

2018-02-01

Asthma arises from the complex interplay of inflammatory pathways in diverse cell types and tissues. We sought to undertake a comprehensive transcriptomic assessment of the epithelium and airway T cells that remain understudied in asthma and investigate interactions between multiple cells and tissues. Epithelial brushings and flow-sorted CD3 + T cells from sputum and BAL were obtained from healthy subjects (n = 19) and patients with asthma (mild, moderate, and severe asthma; n = 46). Gene expression was assessed using Affymetrix HT HG-U133 + PM GeneChips, and results were validated by real-time quantitative PCR. In the epithelium, IL-13 response genes (POSTN, SERPINB2, and CLCA1), mast cell mediators (CPA3 and TPSAB1), inducible nitric oxide synthase, and cystatins (CST1, CST2, and CST4) were upregulated in mild asthma, but, except for cystatins, were suppressed by corticosteroids in moderate asthma. In severe asthma-with predominantly neutrophilic phenotype-several distinct processes were upregulated, including neutrophilia (TCN1 and MMP9), mucins, and oxidative stress responses. The majority of the disease signature was evident in sputum T cells in severe asthma, where 267 genes were differentially regulated compared with health, highlighting compartmentalization of inflammation. This signature included IL-17-inducible chemokines (CXCL1, CXCL2, CXCL3, IL8, and CSF3) and chemoattractants for neutrophils (IL8, CCL3, and LGALS3), T cells, and monocytes. A protein interaction network in severe asthma highlighted signatures of responses to bacterial infections across tissues (CEACAM5, CD14, and TLR2), including Toll-like receptor signaling. In conclusion, the activation of innate immune pathways in the airways suggests that activated T cells may be driving neutrophilic inflammation and steroid-insensitive IL-17 response in severe asthma.

Uncoupling of oxidative stress resistance and lifespan in long-lived isp-1 mitochondrial mutants in Caenorhabditis elegans.

PubMed

Dues, Dylan J; Schaar, Claire E; Johnson, Benjamin K; Bowman, Megan J; Winn, Mary E; Senchuk, Megan M; Van Raamsdonk, Jeremy M

2017-07-01

Mutations affecting components of the mitochondrial electron transport chain have been shown to increase lifespan in multiple species including the worm Caenorhabditis elegans. While it was originally proposed that decreased generation of reactive oxygen species (ROS) resulting from lower rates of electron transport could account for the observed increase in lifespan, recent evidence indicates that ROS levels are increased in at least some of these long-lived mitochondrial mutants. Here, we show that the long-lived mitochondrial mutant isp-1 worms have increased resistance to oxidative stress. Our results suggest that elevated ROS levels in isp-1 worms cause the activation of multiple stress-response pathways including the mitochondrial unfolded protein response, the SKN-1-mediated stress response, and the hypoxia response. In addition, these worms have increased expression of specific antioxidant enzymes, including a marked upregulation of the inducible superoxide dismutase genes sod-3 and sod-5. Examining the contribution of sod-3 and sod-5 to the oxidative stress resistance in isp-1 worms revealed that loss of either of these genes increased resistance to oxidative stress, but not other forms of stress. Deletion of sod-3 or sod-5 decreased the lifespan of isp-1 worms and further exacerbated their slow physiologic rates. Thus, while deletion of sod-3 and sod-5 genes has little impact on stress resistance, physiologic rates or lifespan in wild-type worms, these genes are required for the longevity of isp-1 worms. Overall, this work shows that the increased resistance to oxidative stress in isp-1 worms does not account for their longevity, and that resistance to oxidative stress can be experimentally dissociated from lifespan. Copyright © 2017 Elsevier Inc. All rights reserved.

Msn2p and Msn4p Control a Large Number of Genes Induced at the Diauxic Transition Which Are Repressed by Cyclic AMP in Saccharomyces cerevisiae

PubMed Central

Boy-Marcotte, Emmanuelle; Perrot, Michel; Bussereau, Françoise; Boucherie, Hélian; Jacquet, Michel

1998-01-01

The multicopy suppressors of the snf1 defect, Msn2p and Msn4p transcription factors (Msn2/4p), activate genes through the stress-responsive cis element (CCCCT) in response to various stresses. This cis element is also the target for repression by the cyclic AMP (cAMP)-signaling pathway. We analyzed the two-dimensional gel electrophoresis pattern of protein synthesis of the msn2 msn4 double mutant and compared it with that of the wild-type strain during exponential growth phase and at the diauxic transition. Thirty-nine gene products (including those of ALD3, GDH3, GLK1, GPP2, HSP104, HXK1, PGM2, SOD2, SSA3, SSA4, TKL2, TPS1, and YBR149W) are dependent upon Msn2/4p for their induction at the diauxic transition. The expression of all these genes is repressed by cAMP. Thirty other genes identified during this study are still inducible in the mutant. A subset of these genes were found to be superinduced at the diauxic transition, and others were subject to cAMP repression (including ACH1, ADH2, ALD6, ATP2, GPD1, ICL1, and KGD2). We conclude from this analysis that Msn2/4p control a large number of genes induced at the diauxic transition but that other, as-yet-uncharacterized regulators, also contribute to this response. In addition, we show here that cAMP repression applies to both Msn2/4p-dependent and -independent control of gene expression at the diauxic shift. Furthermore, the fact that all the Msn2/4p gene targets are subject to cAMP repression suggests that these regulators could be targets for the cAMP-signaling pathway. PMID:9495741

Tea plant SWEET transporters: expression profiling, sugar transport, and the involvement of CsSWEET16 in modifying cold tolerance in Arabidopsis.

PubMed

Wang, Lu; Yao, Lina; Hao, Xinyuan; Li, Nana; Qian, Wenjun; Yue, Chuan; Ding, Changqing; Zeng, Jianming; Yang, Yajun; Wang, Xinchao

2018-04-01

Thirteen SWEET transporters were identified in Camellia sinensis and the cold-suppression gene CsSWEET16 contributed to sugar compartmentation across the vacuole and function in modifying cold tolerance in Arabidopsis. The sugars will eventually be exported transporters (SWEET) family of sugar transporters in plants is a recently identified protein family of sugar uniporters that contain seven transmembrane helices harbouring two MtN3 motifs. SWEETs play important roles in various biological processes, including plant responses to environmental stimuli. In this study, 13 SWEET transporters were identified in Camellia sinensis and were divided into four clades. Transcript abundances of CsSWEET genes were detected in various tissues. CsSWEET1a/1b/2a/2b/2c/3/9b/16/17 were expressed in all of the selected tissues, whereas the expression of CsSWEET5/7/9a/15 was not detected in some tissues, including those of mature leaves. Expression analysis of nine CsSWEET genes in leaves in response to abiotic stresses, natural cold acclimation and Colletotrichum camelliae infection revealed that eight CsSWEET genes responded to abiotic stress, while CsSWEET3 responded to C. camelliae infection. Functional analysis of 13 CsSWEET activities in yeast revealed that CsSWEET1a/1b/7/17 exhibit transport activity for glucose analogues and other types of hexose molecules. Further characterization of the cold-suppression gene CsSWEET16 revealed that this gene is localized in the vacuolar membrane. CsSWEET16 contributed to sugar compartmentation across the vacuole and function in modifying cold tolerance in Arabidopsis. Together, these findings demonstrate that CsSWEET genes play important roles in the response to abiotic and biotic stresses in tea plants and provide insights into the characteristics of SWEET genes in tea plants, which could serve as the basis for further functional identification of such genes.

Patterns of gene expression in a scleractinian coral undergoing natural bleaching.

PubMed

Seneca, Francois O; Forêt, Sylvain; Ball, Eldon E; Smith-Keune, Carolyn; Miller, David J; van Oppen, Madeleine J H

2010-10-01

Coral bleaching is a major threat to coral reefs worldwide and is predicted to intensify with increasing global temperature. This study represents the first investigation of gene expression in an Indo-Pacific coral species undergoing natural bleaching which involved the loss of algal symbionts. Quantitative real-time polymerase chain reaction experiments were conducted to select and evaluate coral internal control genes (ICGs), and to investigate selected coral genes of interest (GOIs) for changes in gene expression in nine colonies of the scleractinian coral Acropora millepora undergoing bleaching at Magnetic Island, Great Barrier Reef, Australia. Among the six ICGs tested, glyceraldehyde 3-phosphate dehydrogenase and the ribosomal protein genes S7 and L9 exhibited the most constant expression levels between samples from healthy-looking colonies and samples from the same colonies when severely bleached a year later. These ICGs were therefore utilised for normalisation of expression data for seven selected GOIs. Of the seven GOIs, homologues of catalase, C-type lectin and chromoprotein genes were significantly up-regulated as a result of bleaching by factors of 1.81, 1.46 and 1.61 (linear mixed models analysis of variance, P < 0.05), respectively. We present these genes as potential coral bleaching response genes. In contrast, three genes, including one putative ICG, showed highly variable levels of expression between coral colonies. Potential variation in microhabitat, gene function unrelated to the stress response and individualised stress responses may influence such differences between colonies and need to be better understood when designing and interpreting future studies of gene expression in natural coral populations.

Discovering novel pharmacogenomic biomarkers by imputing drug response in cancer patients from large genomics studies.

PubMed

Geeleher, Paul; Zhang, Zhenyu; Wang, Fan; Gruener, Robert F; Nath, Aritro; Morrison, Gladys; Bhutra, Steven; Grossman, Robert L; Huang, R Stephanie

2017-10-01

Obtaining accurate drug response data in large cohorts of cancer patients is very challenging; thus, most cancer pharmacogenomics discovery is conducted in preclinical studies, typically using cell lines and mouse models. However, these platforms suffer from serious limitations, including small sample sizes. Here, we have developed a novel computational method that allows us to impute drug response in very large clinical cancer genomics data sets, such as The Cancer Genome Atlas (TCGA). The approach works by creating statistical models relating gene expression to drug response in large panels of cancer cell lines and applying these models to tumor gene expression data in the clinical data sets (e.g., TCGA). This yields an imputed drug response for every drug in each patient. These imputed drug response data are then associated with somatic genetic variants measured in the clinical cohort, such as copy number changes or mutations in protein coding genes. These analyses recapitulated drug associations for known clinically actionable somatic genetic alterations and identified new predictive biomarkers for existing drugs. © 2017 Geeleher et al.; Published by Cold Spring Harbor Laboratory Press.

The Transcriptional Response of Listeria monocytogenes during Adaptation to Growth on Lactate and Diacetate Includes Synergistic Changes That Increase Fermentative Acetoin Production▿†

PubMed Central

Stasiewicz, Matthew J.; Wiedmann, Martin; Bergholz, Teresa M.

2011-01-01

The organic acids lactate and diacetate are commonly used in combination in ready-to-eat foods because they show synergistic ability to inhibit the growth of Listeria monocytogenes. Full-genome microarrays were used to investigate the synergistic transcriptomic responses of two L. monocytogenes strains, H7858 (serotype 4b) and F6854 (serotype 1/2a), to these two organic acids under conditions representing osmotic and cold stress encountered in foods. Strains were exposed to brain heart infusion (BHI) broth at 7°C with 4.65% water-phase (w.p.) NaCl at pH 6.1 with (i) 2% w.p. potassium lactate, (ii) 0.14% w.p. sodium diacetate, (iii) the combination of both at the same levels, or (iv) no organic acids as a control. RNA was extracted 8 h after exposure, during lag phase, to capture gene transcription changes during adaptation to the organic acid stress. Significant differential transcription of 1,041 genes in H7858 and 640 genes in F6854 was observed in at least one pair of the 4 different treatments. The effects of combined treatment with lactate and diacetate included (i) synergistic transcription differences for 474 and 209 genes in H7858 and F6854, respectively, (ii) differential transcription of genes encoding cation transporters and ABC transporters of metals, and (iii) altered metabolism, including induction of a nutrient-limiting stress response, reduction of menaquinone biosynthesis, and a shift from fermentative production of acetate and lactate to energetically less favorable, neutral acetoin. These data suggest that additional treatments that interfere with cellular energy generation processes could more efficiently inhibit the growth of L. monocytogenes. PMID:21666015

The Ectopic Overexpression of the Cotton Ve1 and Ve2-Homolog Sequences Leads to Resistance Response to Verticillium Wilt in Arabidopsis

PubMed Central

Chen, Jieyin; Li, Nanyang; Ma, Xuefeng; Gupta, Vijai K.; Zhang, Dandan; Li, Tinggang; Dai, Xiaofeng

2017-01-01

Verticillium wilt, caused by the Verticillium dahliae phytopathogen, is a devastating disease affecting many economically important crops. A receptor-like protein (RLP) gene, Ve1, has been reported to confer resistance to V. dahliae in tomato plants, but few genes have been found to be involved in cotton Verticillium wilt resistance. Here, we cloned two RLP gene homologs, Gossypium barbadense resistance gene to Verticillium dahliae 1 (GbaVd1) and GbaVd2, from the Verticillium wilt-resistant cultivar G. barbadense cv. Hai7124. GbaVd1 and GbaVd2 display sequence divergence, but both encode typical RLPs. Virus-induced gene silencing of GbaVd1 or GbaVd2 compromised the resistance of cotton to V. dahliae, and both genes conferred Verticillium wilt resistance after interfamily transfer into Arabidopsis. Microarray analysis revealed that GbaVd1 and GbaVd2 participate in Verticillium wilt resistance in Arabidopsis through activation of defense responses, including the endocytosis process, signaling factors, transcription factors and reinforcement of the cell wall, as demonstrated by lignification in Arabidopsis transgenic plants. In addition, microarray analysis showed that GbaVd1 and GbaVd2 differentially mediate resistance signaling and activation of defense responses after overexpression in Arabidopsis. Thus, GbaVd1 and GbaVd2 encode RLPs and act as disease resistance genes that mediate the defense response against V. dahliae in cotton. PMID:28611793

Induction of Cytoprotective Pathways Is Central to the Extension of Lifespan Conferred by Multiple Longevity Pathways

PubMed Central

Shore, David E.; Carr, Christopher E.; Ruvkun, Gary

2012-01-01

Many genetic and physiological treatments that extend lifespan also confer resistance to a variety of stressors, suggesting that cytoprotective mechanisms underpin the regulation of longevity. It has not been established, however, whether the induction of cytoprotective pathways is essential for lifespan extension or merely correlated. Using a panel of GFP-fused stress response genes, we identified the suites of cytoprotective pathways upregulated by 160 gene inactivations known to increase Caenorhabditis elegans longevity, including the mitochondrial UPR (hsp-6, hsp-60), the ER UPR (hsp-4), ROS response (sod-3, gst-4), and xenobiotic detoxification (gst-4). We then screened for other gene inactivations that disrupt the induction of these responses by xenobiotic or genetic triggers, identifying 29 gene inactivations required for cytoprotective gene expression. If cytoprotective responses contribute directly to lifespan extension, inactivation of these genes would be expected to compromise the extension of lifespan conferred by decreased insulin/IGF-1 signaling, caloric restriction, or the inhibition of mitochondrial function. We find that inactivation of 25 of 29 cytoprotection-regulatory genes shortens the extension of longevity normally induced by decreased insulin/IGF-1 signaling, disruption of mitochondrial function, or caloric restriction, without disrupting normal longevity nearly as dramatically. These data demonstrate that induction of cytoprotective pathways is central to longevity extension and identify a large set of new genetic components of the pathways that detect cellular damage and couple that detection to downstream cytoprotective effectors. PMID:22829775

Involvement of specific calmodulin isoforms in salicylic acid-independent activation of plant disease resistance responses.

PubMed

Heo, W D; Lee, S H; Kim, M C; Kim, J C; Chung, W S; Chun, H J; Lee, K J; Park, C Y; Park, H C; Choi, J Y; Cho, M J

1999-01-19

The Ca2+ signal is essential for the activation of plant defense responses, but downstream components of the signaling pathway are still poorly defined. Here we demonstrate that specific calmodulin (CaM) isoforms are activated by infection or pathogen-derived elicitors and participate in Ca2+-mediated induction of plant disease resistance responses. Soybean CaM (SCaM)-4 and SCaM-5 genes, which encode for divergent CaM isoforms, were induced within 30 min by a fungal elicitor or pathogen, whereas other SCaM genes encoding highly conserved CaM isoforms did not show such response. This pathogen-triggered induction of these genes specifically depended on the increase of intracellular Ca2+ level. Constitutive expression of SCaM-4 and SCaM-5 in transgenic tobacco plants triggered spontaneous induction of lesions and induces an array of systemic acquired resistance (SAR)-associated genes. Surprisingly, these transgenic plants have normal levels of endogenous salicylic acid (SA). Furthermore, coexpression of nahG gene did not block the induction of SAR-associated genes in these transgenic plants, indicating that SA is not involved in the SAR gene induction mediated by SCaM-4 or SCaM-5. The transgenic plants exhibit enhanced resistance to a wide spectrum of virulent and avirulent pathogens, including bacteria, fungi, and virus. These results suggest that specific CaM isoforms are components of a SA-independent signal transduction chain leading to disease resistance.

Graph-based semi-supervised learning with genomic data integration using condition-responsive genes applied to phenotype classification.

PubMed

Doostparast Torshizi, Abolfazl; Petzold, Linda R

2018-01-01

Data integration methods that combine data from different molecular levels such as genome, epigenome, transcriptome, etc., have received a great deal of interest in the past few years. It has been demonstrated that the synergistic effects of different biological data types can boost learning capabilities and lead to a better understanding of the underlying interactions among molecular levels. In this paper we present a graph-based semi-supervised classification algorithm that incorporates latent biological knowledge in the form of biological pathways with gene expression and DNA methylation data. The process of graph construction from biological pathways is based on detecting condition-responsive genes, where 3 sets of genes are finally extracted: all condition responsive genes, high-frequency condition-responsive genes, and P-value-filtered genes. The proposed approach is applied to ovarian cancer data downloaded from the Human Genome Atlas. Extensive numerical experiments demonstrate superior performance of the proposed approach compared to other state-of-the-art algorithms, including the latest graph-based classification techniques. Simulation results demonstrate that integrating various data types enhances classification performance and leads to a better understanding of interrelations between diverse omics data types. The proposed approach outperforms many of the state-of-the-art data integration algorithms. © The Author 2017. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Inflammatory gene networks in term human decidual cells define a potential signature for cytokine-mediated parturition.

PubMed

Ibrahim, Sherrine A; Ackerman, William E; Summerfield, Taryn L; Lockwood, Charles J; Schatz, Frederick; Kniss, Douglas A

2016-02-01

Inflammation is a proximate mediator of preterm birth and fetal injury. During inflammation several microRNAs (22 nucleotide noncoding ribonucleic acid (RNA) molecules) are up-regulated in response to cytokines such as interleukin-1β. MicroRNAs, in most cases, fine-tune gene expression, including both up-regulation and down-regulation of their target genes. However, the role of pro- and antiinflammatory microRNAs in this process is poorly understood. The principal goal of the work was to examine the inflammatory genomic profile of human decidual cells challenged with a proinflammatory cytokine known to be present in the setting of preterm parturition. We determined the coding (messenger RNA) and noncoding (microRNA) sequences to construct a network of interacting genes during inflammation using an in vitro model of decidual stromal cells. The effects of interleukin-1β exposure on mature microRNA expression were tested in human decidual cell cultures using the multiplexed NanoString platform, whereas the global inflammatory transcriptional response was measured using oligonucleotide microarrays. Differential expression of select transcripts was confirmed by quantitative real time-polymerase chain reaction. Bioinformatics tools were used to infer transcription factor activation and regulatory interactions. Interleukin-1β elicited up- and down-regulation of 350 and 78 nonredundant transcripts (false discovery rate < 0.1), respectively, including induction of numerous cytokines, chemokines, and other inflammatory mediators. Whereas this transcriptional response included marked changes in several microRNA gene loci, the pool of fully processed, mature microRNA was comparatively stable following a cytokine challenge. Of a total of 6 mature microRNAs identified as being differentially expressed by NanoString profiling, 2 (miR-146a and miR-155) were validated by quantitative real time-polymerase chain reaction. Using complementary bioinformatics approaches, activation of several inflammatory transcription factors could be inferred downstream of interleukin-1β based on the overall transcriptional response. Further analysis revealed that miR-146a and miR-155 both target genes involved in inflammatory signaling, including Toll-like receptor and mitogen-activated protein kinase pathways. Stimulation of decidual cells with interleukin-1β alters the expression of microRNAs that function to temper proinflammatory signaling. In this setting, some microRNAs may be involved in tissue-level inflammation during the bulk of gestation and assist in pregnancy maintenance. Copyright © 2016 Elsevier Inc. All rights reserved.