Science.gov

Sample records for restriction site map

  1. FRAGMAP--a program for restriction site map comparison.

    PubMed Central

    Gershon, P D; Knowles, N J

    1988-01-01

    A program is described which aligns pairs of linear restriction site maps using an algorithm which maximizes the number of coincident sites through the addition of extra 'padding' fragments; and makes maps of the non-conserved sites between pairs and triplets of input maps. A range of display facilities, hardcopy functions and database management routines are also included. The program runs on a stand-alone microcomputer, and is stored along with a database of several hundred files on a single floppy disc. PMID:2832828

  2. Comparison of canine parvovirus with mink enteritis virus by restriction site mapping.

    PubMed Central

    McMaster, G K; Tratschin, J D; Siegl, G

    1981-01-01

    The genomes of canine parvovirus and mink enteritis virus were compared by restriction enzyme analysis of their replicative-form DNAs. Of 79 mapped sites, 68, or 86%, were found to be common for both types of DNA, indicating that canine parvovirus and mink enteritis virus are closely related viruses. Whether they evolved from a common precursor or whether canine parvovirus is derived from mink enteritis virus, however, cannot be deduced from our present data. Images PMID:6264109

  3. Optical mapping of site-directed cleavages on single DNA molecules by the RecA-assisted restriction endonuclease technique.

    PubMed Central

    Wang, Y K; Huff, E J; Schwartz, D C

    1995-01-01

    Fluorescence in situ hybridization (FISH) resolution has advanced because newer techniques use increasingly decondensed chromatin. FISH cannot analyze restriction enzyme cutting sites due to limitations of the hybridization and detection technologies. The RecA-assisted restriction endonuclease (RARE) technique cleaves chromosomal DNA at a single EcoRI site within a given gene or selected sequence. We recently described a mapping technique, optical mapping, which uses fluorescence microscopy to produce high-resolution restriction maps rapidly by directly imaging restriction digestion cleavage events occurring on single deproteinized DNA molecules. Ordered maps are then constructed by noting fragment order and size, using several optically based techniques. Since we also wanted to map arbitrary sequences and gene locations, we combined RARE with optical mapping to produce site-specific visible EcoRI restriction cleavage sites on single DNA molecules. Here we describe this combined method, named optical RARE, and its initial application to mapping gene locations on yeast chromosomes. Images Fig. 2 Fig. 3 PMID:7816810

  4. Construction of a high-density genetic map for grape using next generation restriction-site associated DNA sequencing

    PubMed Central

    2012-01-01

    Background Genetic mapping and QTL detection are powerful methodologies in plant improvement and breeding. Construction of a high-density and high-quality genetic map would be of great benefit in the production of superior grapes to meet human demand. High throughput and low cost of the recently developed next generation sequencing (NGS) technology have resulted in its wide application in genome research. Sequencing restriction-site associated DNA (RAD) might be an efficient strategy to simplify genotyping. Combining NGS with RAD has proven to be powerful for single nucleotide polymorphism (SNP) marker development. Results An F1 population of 100 individual plants was developed. In-silico digestion-site prediction was used to select an appropriate restriction enzyme for construction of a RAD sequencing library. Next generation RAD sequencing was applied to genotype the F1 population and its parents. Applying a cluster strategy for SNP modulation, a total of 1,814 high-quality SNP markers were developed: 1,121 of these were mapped to the female genetic map, 759 to the male map, and 1,646 to the integrated map. A comparison of the genetic maps to the published Vitis vinifera genome revealed both conservation and variations. Conclusions The applicability of next generation RAD sequencing for genotyping a grape F1 population was demonstrated, leading to the successful development of a genetic map with high density and quality using our designed SNP markers. Detailed analysis revealed that this newly developed genetic map can be used for a variety of genome investigations, such as QTL detection, sequence assembly and genome comparison. PMID:22908993

  5. Problem-Solving Test: Restriction Endonuclease Mapping

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2011-01-01

    The term "restriction endonuclease mapping" covers a number of related techniques used to identify specific restriction enzyme recognition sites on small DNA molecules. A method for restriction endonuclease mapping of a 1,000-basepair (bp)-long DNA molecule is described in the fictitious experiment of this test. The most important fact needed to…

  6. Problem-Solving Test: Restriction Endonuclease Mapping

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2011-01-01

    The term "restriction endonuclease mapping" covers a number of related techniques used to identify specific restriction enzyme recognition sites on small DNA molecules. A method for restriction endonuclease mapping of a 1,000-basepair (bp)-long DNA molecule is described in the fictitious experiment of this test. The most important fact needed to…

  7. Association mapping of disease resistance traits in rainbow trout using restriction site associated DNA sequencing.

    PubMed

    Campbell, Nathan R; LaPatra, Scott E; Overturf, Ken; Towner, Richard; Narum, Shawn R

    2014-10-28

    Recent advances in genotyping-by-sequencing have enabled genome-wide association studies in nonmodel species including those in aquaculture programs. As with other aquaculture species, rainbow trout and steelhead (Oncorhynchus mykiss) are susceptible to disease and outbreaks can lead to significant losses. Fish culturists have therefore been pursuing strategies to prevent losses to common pathogens such as Flavobacterium psychrophilum (the etiological agent for bacterial cold water disease [CWD]) and infectious hematopoietic necrosis virus (IHNV) by adjusting feed formulations, vaccine development, and selective breeding. However, discovery of genetic markers linked to disease resistance offers the potential to use marker-assisted selection to increase resistance and reduce outbreaks. For this study we sampled juvenile fish from 40 families from 2-yr classes that either survived or died after controlled exposure to either CWD or IHNV. Restriction site-associated DNA sequencing produced 4661 polymorphic single-nucleotide polymorphism loci after strict filtering. Genotypes from individual survivors and mortalities were then used to test for association between disease resistance and genotype at each locus using the program TASSEL. After we accounted for kinship and stratification of the samples, tests revealed 12 single-nucleotide polymorphism markers that were highly associated with resistance to CWD and 19 markers associated with resistance to IHNV. These markers are candidates for further investigation and are expected to be useful for marker assisted selection in future broodstock selection for various aquaculture programs.

  8. Construction of High-Density Linkage Maps of Populus deltoides × P. simonii Using Restriction-Site Associated DNA Sequencing

    PubMed Central

    Tong, Chunfa; Li, Huogen; Wang, Ying; Li, Xuran; Ou, Jiajia; Wang, Deyuan; Xu, Houxi; Ma, Chao; Lang, Xianye; Liu, Guangxin; Zhang, Bo; Shi, Jisen

    2016-01-01

    Although numerous linkage maps have been constructed in the genus Populus, they are typically sparse and thus have limited applications due to low throughput of traditional molecular markers. Restriction-site associated DNA sequencing (RADSeq) technology allows us to identify a large number of single nucleotide polymorphisms (SNP) across genomes of many individuals in a fast and cost-effective way, and makes it possible to construct high-density genetic linkage maps. We performed RADSeq for 299 progeny and their two parents in an F1 hybrid population generated by crossing the female Populus deltoides ‘I-69’ and male Populus simonii ‘L3’. A total of 2,545 high quality SNP markers were obtained and two parent-specific linkage maps were constructed. The female genetic map contained 1601 SNPs and 20 linkage groups, spanning 4,249.12 cM of the genome with an average distance of 2.69 cM between adjacent markers, while the male map consisted of 940 SNPs and also 20 linkage groups with a total length of 3,816.24 cM and an average marker interval distance of 4.15 cM. Finally, our analysis revealed that synteny and collinearity are highly conserved between the parental linkage maps and the reference genome of P. trichocarpa. We demonstrated that RAD sequencing is a powerful technique capable of rapidly generating a large number of SNPs for constructing genetic maps in outbred forest trees. The high-quality linkage maps constructed here provided reliable genetic resources to facilitate locating quantitative trait loci (QTLs) that control growth and wood quality traits in the hybrid population. PMID:26964097

  9. Construction of High-Density Linkage Maps of Populus deltoides × P. simonii Using Restriction-Site Associated DNA Sequencing.

    PubMed

    Tong, Chunfa; Li, Huogen; Wang, Ying; Li, Xuran; Ou, Jiajia; Wang, Deyuan; Xu, Houxi; Ma, Chao; Lang, Xianye; Liu, Guangxin; Zhang, Bo; Shi, Jisen

    2016-01-01

    Although numerous linkage maps have been constructed in the genus Populus, they are typically sparse and thus have limited applications due to low throughput of traditional molecular markers. Restriction-site associated DNA sequencing (RADSeq) technology allows us to identify a large number of single nucleotide polymorphisms (SNP) across genomes of many individuals in a fast and cost-effective way, and makes it possible to construct high-density genetic linkage maps. We performed RADSeq for 299 progeny and their two parents in an F1 hybrid population generated by crossing the female Populus deltoides 'I-69' and male Populus simonii 'L3'. A total of 2,545 high quality SNP markers were obtained and two parent-specific linkage maps were constructed. The female genetic map contained 1601 SNPs and 20 linkage groups, spanning 4,249.12 cM of the genome with an average distance of 2.69 cM between adjacent markers, while the male map consisted of 940 SNPs and also 20 linkage groups with a total length of 3,816.24 cM and an average marker interval distance of 4.15 cM. Finally, our analysis revealed that synteny and collinearity are highly conserved between the parental linkage maps and the reference genome of P. trichocarpa. We demonstrated that RAD sequencing is a powerful technique capable of rapidly generating a large number of SNPs for constructing genetic maps in outbred forest trees. The high-quality linkage maps constructed here provided reliable genetic resources to facilitate locating quantitative trait loci (QTLs) that control growth and wood quality traits in the hybrid population.

  10. Frequencies of restriction sites.

    PubMed Central

    Waterman, M S

    1983-01-01

    Restriction sites or other sequence patterns are usually assumed to occur according to a Poisson distribution with mean equal to the reciprocal of the probability of the given site or pattern. For situations where non-overlapping occurrences of patterns, such as restriction sites, are the objects of interest, this note shows that the Poisson assumption is frequently misleading. Both the case of base composition (independent bases) and of dinucleotide frequencies (Markov chains) are treated. Moreover, a new technique is presented which allows treatment of collections of patterns, where the departure from the Poisson assumption is even more striking. This later case includes double digests, and an example of a five enzyme digest is included. PMID:6324109

  11. Restriction site polymorphism-based candidate gene mapping for seedling drought tolerance in cowpea [Vigna unguiculata (L.) Walp.].

    PubMed

    Muchero, Wellington; Ehlers, Jeffrey D; Roberts, Philip A

    2010-02-01

    Quantitative trait loci (QTL) studies provide insight into the complexity of drought tolerance mechanisms. Molecular markers used in these studies also allow for marker-assisted selection (MAS) in breeding programs, enabling transfer of genetic factors between breeding lines without complete knowledge of their exact nature. However, potential for recombination between markers and target genes limit the utility of MAS-based strategies. Candidate gene mapping offers an alternative solution to identify trait determinants underlying QTL of interest. Here, we used restriction site polymorphisms to investigate co-location of candidate genes with QTL for seedling drought stress-induced premature senescence identified previously in cowpea. Genomic DNA isolated from 113 F(2:8) RILs of drought-tolerant IT93K503-1 and drought susceptible CB46 genotypes was digested with combinations of EcoR1 and HpaII, Mse1, or Msp1 restriction enzymes and amplified with primers designed from 13 drought-responsive cDNAs. JoinMap 3.0 and MapQTL 4.0 software were used to incorporate polymorphic markers onto the AFLP map and to analyze their association with the drought response QTL. Seven markers co-located with peaks of previously identified QTL. Isolation, sequencing, and blast analysis of these markers confirmed their significant homology with drought or other abiotic stress-induced expressed sequence tags (EST) from cowpea and other plant systems. Further, homology with coding sequences for a multidrug resistance protein 3 and a photosystem I assembly protein ycf3 was revealed in two of these candidates. These results provide a platform for the identification and characterization of genetic trait determinants underlying seedling drought tolerance in cowpea.

  12. A User-Friendly Method for Teaching Restriction Enzyme Mapping.

    ERIC Educational Resources Information Center

    Ehrman, Patrick

    1990-01-01

    Presented is a teaching progression that enhances learning through low-cost, manipulative transparencies. Discussed is instruction about restriction enzymes, plasmids, cutting plasmids, plasmid maps, recording data, and mapping restriction sites. Mapping wheels for student use is included. (CW)

  13. A User-Friendly Method for Teaching Restriction Enzyme Mapping.

    ERIC Educational Resources Information Center

    Ehrman, Patrick

    1990-01-01

    Presented is a teaching progression that enhances learning through low-cost, manipulative transparencies. Discussed is instruction about restriction enzymes, plasmids, cutting plasmids, plasmid maps, recording data, and mapping restriction sites. Mapping wheels for student use is included. (CW)

  14. Genetic Mapping and QTL Analysis of Growth-Related Traits in Pinctada fucata Using Restriction-Site Associated DNA Sequencing

    PubMed Central

    Li, Yaoguo; He, Maoxian

    2014-01-01

    The pearl oyster, Pinctada fucata (P. fucata), is one of the marine bivalves that is predominantly cultured for pearl production. To obtain more genetic information for breeding purposes, we constructed a high-density linkage map of P. fucata and identified quantitative trait loci (QTL) for growth-related traits. One F1 family, which included the two parents, 48 largest progeny and 50 smallest progeny, was sampled to construct a linkage map using restriction site-associated DNA sequencing (RAD-Seq). With low coverage data, 1956.53 million clean reads and 86,342 candidate RAD loci were generated. A total of 1373 segregating SNPs were used to construct a sex-average linkage map. This spanned 1091.81 centimorgans (cM), with 14 linkage groups and an average marker interval of 1.41 cM. The genetic linkage map coverage, Coa, was 97.24%. Thirty-nine QTL-peak loci, for seven growth-related traits, were identified using the single-marker analysis, nonparametric mapping Kruskal-Wallis (KW) test. Parameters included three for shell height, six for shell length, five for shell width, four for hinge length, 11 for total weight, eight for soft tissue weight and two for shell weight. The QTL peak loci for shell height, shell length and shell weight were all located in linkage group 6. The genotype frequencies of most QTL peak loci showed significant differences between the large subpopulation and the small subpopulation (P<0.05). These results highlight the effectiveness of RAD-Seq as a tool for generation of QTL-targeted and genome-wide marker data in the non-model animal, P. fucata, and its possible utility in marker-assisted selection (MAS). PMID:25369421

  15. Mapping with RAD (restriction-site associated DNA) markers to rapidly identify QTL for stem rust resistance in Lolium perenne.

    PubMed

    Pfender, W F; Saha, M C; Johnson, E A; Slabaugh, M B

    2011-05-01

    A mapping population was created to detect quantitative trait loci (QTL) for resistance to stem rust caused by Puccinia graminis subsp. graminicola in Lolium perenne. A susceptible and a resistant plant were crossed to produce a pseudo-testcross population of 193 F(1) individuals. Markers were produced by the restriction-site associated DNA (RAD) process, which uses massively parallel and multiplexed sequencing of reduced-representation libraries. Additional simple sequence repeat (SSR) and sequence-tagged site (STS) markers were combined with the RAD markers to produce maps for the female (738 cM) and male (721 cM) parents. Stem rust phenotypes (number of pustules per plant) were determined in replicated greenhouse trials by inoculation with a field-collected, genetically heterogeneous population of urediniospores. The F(1) progeny displayed continuous distribution of phenotypes and transgressive segregation. We detected three resistance QTL. The most prominent QTL (qLpPg1) is located near 41 cM on linkage group (LG) 7 with a 2-LOD interval of 8 cM, and accounts for 30-38% of the stem rust phenotypic variance. QTL were detected also on LG1 (qLpPg2) and LG6 (qLpPg3), each accounting for approximately 10% of phenotypic variance. Alleles of loci closely linked to these QTL originated from the resistant parent for qLpPg1 and from both parents for qLpPg2 and qLpPg3. Observed quantitative nature of the resistance may be due to partial-resistance effects against all pathogen genotypes, or qualitative effects completely preventing infection by only some genotypes in the genetically mixed inoculum. RAD markers facilitated rapid construction of new genetic maps in this outcrossing species and will enable development of sequence-based markers linked to stem rust resistance in L. perenne.

  16. Characterization of Leptospira isolates from serovar hardjo by ribotyping, arbitrarily primed PCR, and mapped restriction site polymorphisms.

    PubMed

    Perolat, P; Merien, F; Ellis, W A; Baranton, G

    1994-08-01

    Leptospira serovar hardjo isolates of the hardjoprajitno and hardjobovis genotypes were characterized by ribotyping, arbitrarily primed PCR (AP-PCR) fingerprinting, and the study of mapped restriction site polymorphisms (MRSPs) in rrs and rrl genes. After restriction of chromosomal DNA with BglII, EcoRI, or HindIII, each genotype was individualized with a distinct ribotype. The fingerprints produced by AP-PCR with seven primers clearly separated the two groups; primers KF and RSP produced species-specific products which assigned hardjoprajitno and hardjobovis isolates to the species L. interrogans sensu stricto and L. borgpetersenii, respectively. Furthermore, AP-PCR fingerprints gave evidence of a considerable genomic heterogeneity at the strain level among the hardjobovis group. Conversely, the hardjoprajitno group was homogeneous. MRSP profiles in ribosomal genes indicated that hardjoprajitno and hardjobovis isolates belonged to L. interrogans MRSP group B and L. borgpetersenii group C, respectively. AP-PCR and determination of MRSPs in ribosomal genes proved to be quick and reliable methods for typing Leptospira strains and for studying intraspecific population structures.

  17. Physical Map of the Channel Catfish Virus Genome: Location of Sites for Restriction Endonucleases EcoRI, HindIII, HpaI, and XbaI

    PubMed Central

    Chousterman, Suzanne; Lacasa, Michel; Sheldrick, Peter

    1979-01-01

    The overall arrangement of nucleotide sequences in the DNA of channel catfish virus has been studied by cleavage with four restriction endonucleases. Physical maps have been developed for the location of sites for EcoRI, HindIII, HpaI, and XbaI. The sum of the molecular weights of fragments generated by each restriction enzyme indicates a molecular weight of approximately 86 × 106 for the channel catfish virus genome. Fragments corresponding to the molecular ends of channel catfish virus DNA have been identified by their sensitivity to exonuclease treatment. The distribution of restriction sites in the genome shows that sequences included in a 12 × 106-molecular weight region at one end are repeated with direct polarity at the other end, and that the overall genomic sequence order is nonpermuted. Images PMID:16789182

  18. Mapping Lifetime Brain Volumetry with Covariate-Adjusted Restricted Cubic Spline Regression from Cross-sectional Multi-site MRI

    PubMed Central

    Huo, Yuankai; Aboud, Katherine; Kang, Hakmook; Cutting, Laurie E.; Landman, Bennett A.

    2016-01-01

    Understanding brain volumetry is essential to understand neurodevelopment and disease. Historically, age-related changes have been studied in detail for specific age ranges (e.g., early childhood, teen, young adults, elderly, etc.) or more sparsely sampled for wider considerations of lifetime aging. Recent advancements in data sharing and robust processing have made available considerable quantities of brain images from normal, healthy volunteers. However, existing analysis approaches have had difficulty addressing (1) complex volumetric developments on the large cohort across the life time (e.g., beyond cubic age trends), (2) accounting for confound effects, and (3) maintaining an analysis framework consistent with the general linear model (GLM) approach pervasive in neuroscience. To address these challenges, we propose to use covariate-adjusted restricted cubic spline (C-RCS) regression within a multi-site cross-sectional framework. This model allows for flexible consideration of non-linear age-associated patterns while accounting for traditional covariates and interaction effects. As a demonstration of this approach on lifetime brain aging, we derive normative volumetric trajectories and 95% confidence intervals from 5111 healthy patients from 64 sites while accounting for confounding sex, intracranial volume and field strength effects. The volumetric results are shown to be consistent with traditional studies that have explored more limited age ranges using single-site analyses. This work represents the first integration of C-RCS with neuroimaging and the derivation of structural covariance networks (SCNs) from a large study of multi-site, cross-sectional data. PMID:28191550

  19. Mapping Lifetime Brain Volumetry with Covariate-Adjusted Restricted Cubic Spline Regression from Cross-sectional Multi-site MRI.

    PubMed

    Huo, Yuankai; Aboud, Katherine; Kang, Hakmook; Cutting, Laurie E; Landman, Bennett A

    2016-10-01

    Understanding brain volumetry is essential to understand neurodevelopment and disease. Historically, age-related changes have been studied in detail for specific age ranges (e.g., early childhood, teen, young adults, elderly, etc.) or more sparsely sampled for wider considerations of lifetime aging. Recent advancements in data sharing and robust processing have made available considerable quantities of brain images from normal, healthy volunteers. However, existing analysis approaches have had difficulty addressing (1) complex volumetric developments on the large cohort across the life time (e.g., beyond cubic age trends), (2) accounting for confound effects, and (3) maintaining an analysis framework consistent with the general linear model (GLM) approach pervasive in neuroscience. To address these challenges, we propose to use covariate-adjusted restricted cubic spline (C-RCS) regression within a multi-site cross-sectional framework. This model allows for flexible consideration of non-linear age-associated patterns while accounting for traditional covariates and interaction effects. As a demonstration of this approach on lifetime brain aging, we derive normative volumetric trajectories and 95% confidence intervals from 5111 healthy patients from 64 sites while accounting for confounding sex, intracranial volume and field strength effects. The volumetric results are shown to be consistent with traditional studies that have explored more limited age ranges using single-site analyses. This work represents the first integration of C-RCS with neuroimaging and the derivation of structural covariance networks (SCNs) from a large study of multi-site, cross-sectional data.

  20. A dense SNP genetic map constructed using restriction site-associated DNA sequencing enables detection of QTLs controlling apple fruit quality.

    PubMed

    Sun, Rui; Chang, Yuansheng; Yang, Fengqiu; Wang, Yi; Li, Hui; Zhao, Yongbo; Chen, Dongmei; Wu, Ting; Zhang, Xinzhong; Han, Zhenhai

    2015-10-05

    Genetic map based quantitative trait locus (QTL) analysis is an important method for studying important horticultural traits in apple. To facilitate molecular breeding studies of fruit quality traits in apple, we aim to construct a high density map which was efficient for QTL mapping and possible to search for candidate genes directly in mapped QTLs regions. A total of 1733 F1 seedlings derived from 'Jonathan' × 'Golden Delicious' was used for the map constructionand QTL analysis. The SNP markers were developed by restriction site-associated DNA sequencing (RADseq). Phenotyping data of fruit quality traits were calculated in 2008-2011. Once QTLs were mapped, candidate genes were searched for in the corresponding regions of the apple genome sequence underlying the QTLs. Then some of the candidate genes were validated using real-time PCR. A high-density genetic map with 3441 SNP markers from 297 individuals was generated. Of the 3441 markers, 2017 were mapped to 'Jonathan' with a length of 1343.4 cM and the average distance between markers was 0.67 cM, 1932 were mapped to 'Golden Delicious' with a length of 1516.0 cM and the average distance between markers was 0.78 cM. Twelve significant QTLs linked to the control of fruit weight, fruit firmness, sugar content and fruit acidity were mapped to seven linkage groups. Based on gene annotation, 80, 64 and 17 genes related to fruit weight, fruit firmness and fruit acidity, respectively, were analyzed.Among the 17 candidate genes associated with control of fruit acidity, changes in the expression of MDP0000582174 (MdMYB4) were in agreement with the pattern of changes in malic acid content in apple during ripening, and the relative expression of MDP0000239624 (MdME) was significantly correlated withfruit acidity. We demonstrated the construction of a dense SNP genetic map in apple using next generation sequencing and that the increased resolution enabled the detection of narrow interval QTLs linked to the three fruit

  1. De novo SNP discovery and genetic linkage mapping in poplar using restriction site associated DNA and whole-genome sequencing technologies.

    PubMed

    Mousavi, Mohaddeseh; Tong, Chunfa; Liu, Fenxiang; Tao, Shentong; Wu, Jiyan; Li, Huogen; Shi, Jisen

    2016-08-18

    Restriction site associated DNA sequencing (RAD-seq), a next-generation sequencing technology, has greatly facilitated genetic linkage mapping studies in outbred species. RAD-seq is capable of discovering thousands of genetic markers for linkage mapping across many individuals, and can be applied in species with or without a reference genome. Although several analytical tools are available for RAD-seq data, alternative strategies are necessary for improving the marker quality and hence the genetic mapping accuracy. We demonstrate a strategy for constructing dense genetic linkage maps in hybrid forest trees by combining RAD-seq and whole-genome sequencing technologies. We performed RAD-seq of 150 progeny and whole-genome sequencing of the two parents in an F1 hybrid population of Populus deltoides × P. simonii. Two rough references were assembled from the whole-genome sequencing reads of the two parents separately. Based on the parental reference sequences, 3442 high-quality single nucleotide polymorphisms (SNPs) were identified that segregate in the ratio of 1:1. The maternal linkage map of P. deltoides was constructed with 2012 SNPs, containing 19 linkage groups and spanning 4067.16 cM of the genome with an average distance of 2.04 cM between adjacent markers, while the male map of P. simonii consisted of 1430 SNPs and the same number of linkage groups with a total length of 4356.04 cM and an average interval distance of 3.09 cM. Collinearity between the parental linkage maps and the reference genome of P. trichocarpa was also investigated. Compared with the result on the basis of the existing reference genome, our strategy identified more high-quality SNPs and generated parental linkage groups that nicely match the karyotype of Populus. The strategy of simultaneously using RAD and whole-genome sequencing technologies can be applied to constructing high-density genetic maps in forest trees regardless of whether a reference genome exists. The two parental

  2. A first linkage map and downy mildew resistance QTL discovery for sweet basil (Ocimum basilicum) facilitated by double digestion restriction site associated DNA sequencing (ddRADseq).

    PubMed

    Pyne, Robert; Honig, Josh; Vaiciunas, Jennifer; Koroch, Adolfina; Wyenandt, Christian; Bonos, Stacy; Simon, James

    2017-01-01

    Limited understanding of sweet basil (Ocimum basilicum L.) genetics and genome structure has reduced efficiency of breeding strategies. This is evidenced by the rapid, worldwide dissemination of basil downy mildew (Peronospora belbahrii) in the absence of resistant cultivars. In an effort to improve available genetic resources, expressed sequence tag simple sequence repeat (EST-SSR) and single nucleotide polymorphism (SNP) markers were developed and used to genotype the MRI x SB22 F2 mapping population, which segregates for response to downy mildew. SNP markers were generated from genomic sequences derived from double digestion restriction site associated DNA sequencing (ddRADseq). Disomic segregation was observed in both SNP and EST-SSR markers providing evidence of an O. basilicum allotetraploid genome structure and allowing for subsequent analysis of the mapping population as a diploid intercross. A dense linkage map was constructed using 42 EST-SSR and 1,847 SNP markers spanning 3,030.9 cM. Multiple quantitative trait loci (QTL) model (MQM) analysis identified three QTL that explained 37-55% of phenotypic variance associated with downy mildew response across three environments. A single major QTL, dm11.1 explained 21-28% of phenotypic variance and demonstrated dominant gene action. Two minor QTL dm9.1 and dm14.1 explained 5-16% and 4-18% of phenotypic variance, respectively. Evidence is provided for an additive effect between the two minor QTL and the major QTL dm11.1 increasing downy mildew susceptibility. Results indicate that ddRADseq-facilitated SNP and SSR marker genotyping is an effective approach for mapping the sweet basil genome.

  3. A first linkage map and downy mildew resistance QTL discovery for sweet basil (Ocimum basilicum) facilitated by double digestion restriction site associated DNA sequencing (ddRADseq)

    PubMed Central

    Honig, Josh; Vaiciunas, Jennifer; Koroch, Adolfina; Wyenandt, Christian; Bonos, Stacy; Simon, James

    2017-01-01

    Limited understanding of sweet basil (Ocimum basilicum L.) genetics and genome structure has reduced efficiency of breeding strategies. This is evidenced by the rapid, worldwide dissemination of basil downy mildew (Peronospora belbahrii) in the absence of resistant cultivars. In an effort to improve available genetic resources, expressed sequence tag simple sequence repeat (EST-SSR) and single nucleotide polymorphism (SNP) markers were developed and used to genotype the MRI x SB22 F2 mapping population, which segregates for response to downy mildew. SNP markers were generated from genomic sequences derived from double digestion restriction site associated DNA sequencing (ddRADseq). Disomic segregation was observed in both SNP and EST-SSR markers providing evidence of an O. basilicum allotetraploid genome structure and allowing for subsequent analysis of the mapping population as a diploid intercross. A dense linkage map was constructed using 42 EST-SSR and 1,847 SNP markers spanning 3,030.9 cM. Multiple quantitative trait loci (QTL) model (MQM) analysis identified three QTL that explained 37–55% of phenotypic variance associated with downy mildew response across three environments. A single major QTL, dm11.1 explained 21–28% of phenotypic variance and demonstrated dominant gene action. Two minor QTL dm9.1 and dm14.1 explained 5–16% and 4–18% of phenotypic variance, respectively. Evidence is provided for an additive effect between the two minor QTL and the major QTL dm11.1 increasing downy mildew susceptibility. Results indicate that ddRADseq-facilitated SNP and SSR marker genotyping is an effective approach for mapping the sweet basil genome. PMID:28922359

  4. Restriction Enzyme Mapping: A Simple Student Practical.

    ERIC Educational Resources Information Center

    Higgins, Stephen J.; And Others

    1990-01-01

    An experiment that uses the recombinant plasmid pX1108 to illustrate restriction mapping is described. The experiment involves three restriction enzymes and employs single and double restriction enzyme digestions. A list of needed materials, procedures, safety precautions, results, and discussion are included. (KR)

  5. Restriction Enzyme Mapping: A Simple Student Practical.

    ERIC Educational Resources Information Center

    Higgins, Stephen J.; And Others

    1990-01-01

    An experiment that uses the recombinant plasmid pX1108 to illustrate restriction mapping is described. The experiment involves three restriction enzymes and employs single and double restriction enzyme digestions. A list of needed materials, procedures, safety precautions, results, and discussion are included. (KR)

  6. Mapping DNA cleavage by the Type ISP restriction-modification enzymes following long-range communication between DNA sites in different orientations

    PubMed Central

    van Aelst, Kara; Saikrishnan, Kayarat; Szczelkun, Mark D.

    2015-01-01

    The prokaryotic Type ISP restriction-modification enzymes are single-chain proteins comprising an Mrr-family nuclease, a superfamily 2 helicase-like ATPase, a coupler domain, a methyltransferase, and a DNA-recognition domain. Upon recognising an unmodified DNA target site, the helicase-like domain hydrolyzes ATP to cause site release (remodeling activity) and to then drive downstream translocation consuming 1–2 ATP per base pair (motor activity). On an invading foreign DNA, double-strand breaks are introduced at random wherever two translocating enzymes form a so-called collision complex following long-range communication between a pair of target sites in inverted (head-to-head) repeat. Paradoxically, structural models for collision suggest that the nuclease domains are too far apart (>30 bp) to dimerise and produce a double-strand DNA break using just two strand-cleavage events. Here, we examined the organisation of different collision complexes and how these lead to nuclease activation. We mapped DNA cleavage when a translocating enzyme collides with a static enzyme bound to its site. By following communication between sites in both head-to-head and head-to-tail orientations, we could show that motor activity leads to activation of the nuclease domains via distant interactions of the helicase or MTase-TRD. Direct nuclease dimerization is not required. To help explain the observed cleavage patterns, we also used exonuclease footprinting to demonstrate that individual Type ISP domains can swing off the DNA. This study lends further support to a model where DNA breaks are generated by multiple random nicks due to mobility of a collision complex with an overall DNA-binding footprint of ∼30 bp. PMID:26507855

  7. Near BPS skyrmions and restricted harmonic maps

    NASA Astrophysics Data System (ADS)

    Speight, J. M.

    2015-06-01

    Motivated by a class of near BPS Skyrme models introduced by Adam, Sánchez-Guillén and Wereszczyński, the following variant of the harmonic map problem is introduced: a map φ :(M, g) →(N, h) between Riemannian manifolds is restricted harmonic if it locally extremizes E2 on its SDiff(M) orbit, where SDiff(M) denotes the group of volume preserving diffeomorphisms of (M, g), and E2 denotes the Dirichlet energy. It is conjectured that near BPS skyrmions tend to restricted harmonic maps in the BPS limit. It is shown that φ is restricted harmonic if and only if φ∗ h has exact divergence, and a linear stability theory of restricted harmonic maps is developed, from which it follows that all weakly conformal maps are stable restricted harmonic. Examples of restricted harmonic maps in every degree class R3 → SU(2) and R2 →S2 are constructed. It is shown that the axially symmetric BPS skyrmions on which all previous analytic studies of near BPS Skyrme models have been based, are not restricted harmonic, casting doubt on the phenomenological predictions of such studies. The problem of minimizing E2 for φ :Rk → N over all linear volume preserving diffeomorphisms is solved explicitly, and a deformed axially symmetric family of Skyrme fields constructed which are candidates for approximate near BPS skyrmions at low baryon number. The notion of restricted harmonicity is generalized to restricted F-criticality where F is any functional on maps (M, g) →(N, h) which is, in a precise sense, geometrically natural. The case where F is a linear combination of E2 and E4, the usual Skyrme term, is studied in detail, and it is shown that inverse stereographic projection R3 →S3 ≡ SU(2) is stable restricted F-critical for every such F.

  8. Map of restriction sites on bacteriophage T4 cytosine-containing DNA for endonucleases bamHI, BglII, KpnI, PvuI, SalI, and XbaI.

    PubMed Central

    Marsh, R C; Hepburn, M L

    1981-01-01

    A complete map of the cleavage sites of restriction endonucleases BamHI, BglII, KpnI, PvuI, SalI, and XbaI was determined for the cytosine-containing DNA of a bacteriophage T4 alc mutant. The 56 sequence-specific sites were assigned map coordinates based on a least-squares analysis of measured fragment lengths. Altogether, the lengths of 118 fragments from single and double enzyme digestions were measured by electrophoresis of the fragments in agarose gels. DNA fragments of known sequence or DNA fragments calibrated with fragments of known sequence were used as standards. The greatest deviation between an experimentally measured fragment length and its computed map coordinates was 3.0%; the average deviation was 0.8%. The total length of the wild-type T4 genome was calculated to be 166,200 base pairs. Images PMID:6264096

  9. Optimizing Restriction Site Placement for Synthetic Genomes

    NASA Astrophysics Data System (ADS)

    Montes, Pablo; Memelli, Heraldo; Ward, Charles; Kim, Joondong; Mitchell, Joseph S. B.; Skiena, Steven

    Restriction enzymes are the workhorses of molecular biology. We introduce a new problem that arises in the course of our project to design virus variants to serve as potential vaccines: we wish to modify virus-length genomes to introduce large numbers of unique restriction enzyme recognition sites while preserving wild-type function by substitution of synonymous codons. We show that the resulting problem is NP-Complete, give an exponential-time algorithm, and propose effective heuristics, which we show give excellent results for five sample viral genomes. Our resulting modified genomes have several times more unique restriction sites and reduce the maximum gap between adjacent sites by three to nine-fold.

  10. Reassessment of QTLs for late blight resistance in the tomato accession L3708 using a restriction site associated DNA (RAD) linkage map and highly aggressive isolates of Phytophthora infestans.

    PubMed

    Chen, Ai-Lin; Liu, Chu-Yin; Chen, Chien-Hua; Wang, Jaw-Fen; Liao, Yu-Chen; Chang, Chia-Hui; Tsai, Mong-Hsun; Hwu, Kae-Kang; Chen, Kai-Yi

    2014-01-01

    Tomato late blight caused by the oomycete pathogen Phytophthora infestans (Mont.) de Bary is a major threat to tomato production in cool and wet environments. Intensified outbreaks of late blight have been observed globally from the 1980s, and are associated with migration of new and more aggressive populations of P. infestans in the field. The objective of this study was to reassess late blight resistance in the wild tomato accession L3708 (Solanum pimpinellifolium L.) against pathogens of different aggressiveness. An F2:3 genetic mapping population was developed using L3708 as the paternal parent. Two isolates of P. infestans, Pi39A and Pi733, were used for inoculation. Pi733 is a highly aggressive genotype that defeats three known late blight resistance genes, Ph-1, Ph-2, and Ph-5t in tomato. In contrast, Pi39A is a less aggressive genotype that defeats only Ph-1. Restriction site Associated DNA Sequencing (RAD-Seq) technology was used to massively sequence 90 bp nucleotides adjacent to both sides of PstI restriction enzyme cutting sites in the genome for all individuals in the genetic mapping population. The RAD-seq data were used to construct a genetic linkage map containing 440 single nucleotide polymorphism markers. Quantitative trait locus (QTL) analysis identified a new disease-resistant QTL specific to Pi733 on chromosome 2. The Ph-3 gene located on chromosome 9 could be detected whichever isolates were used. This study demonstrated the feasibility and efficiency of RAD-Seq technology for conducting a QTL mapping experiment using an F2:3 mapping population, which allowed the identification of a new late blight resistant QTL in tomato.

  11. Reassessment of QTLs for Late Blight Resistance in the Tomato Accession L3708 Using a Restriction Site Associated DNA (RAD) Linkage Map and Highly Aggressive Isolates of Phytophthora infestans

    PubMed Central

    Chen, Ai-Lin; Liu, Chu-Yin; Chen, Chien-Hua; Wang, Jaw-Fen; Liao, Yu-Chen; Chang, Chia-Hui; Tsai, Mong-Hsun; Hwu, Kae-Kang; Chen, Kai-Yi

    2014-01-01

    Tomato late blight caused by the oomycete pathogen Phytophthora infestans (Mont.) de Bary is a major threat to tomato production in cool and wet environments. Intensified outbreaks of late blight have been observed globally from the 1980s, and are associated with migration of new and more aggressive populations of P. infestans in the field. The objective of this study was to reassess late blight resistance in the wild tomato accession L3708 (Solanum pimpinellifolium L.) against pathogens of different aggressiveness. An F2:3 genetic mapping population was developed using L3708 as the paternal parent. Two isolates of P. infestans, Pi39A and Pi733, were used for inoculation. Pi733 is a highly aggressive genotype that defeats three known late blight resistance genes, Ph-1, Ph-2, and Ph-5t in tomato. In contrast, Pi39A is a less aggressive genotype that defeats only Ph-1. Restriction site Associated DNA Sequencing (RAD-Seq) technology was used to massively sequence 90 bp nucleotides adjacent to both sides of PstI restriction enzyme cutting sites in the genome for all individuals in the genetic mapping population. The RAD-seq data were used to construct a genetic linkage map containing 440 single nucleotide polymorphism markers. Quantitative trait locus (QTL) analysis identified a new disease-resistant QTL specific to Pi733 on chromosome 2. The Ph-3 gene located on chromosome 9 could be detected whichever isolates were used. This study demonstrated the feasibility and efficiency of RAD-Seq technology for conducting a QTL mapping experiment using an F2:3 mapping population, which allowed the identification of a new late blight resistant QTL in tomato. PMID:24788810

  12. Genome-Wide Mapping of Growth-Related Quantitative Trait Loci in Orange-Spotted Grouper (Epinephelus coioides) Using Double Digest Restriction-Site Associated DNA Sequencing (ddRADseq)

    PubMed Central

    Yu, Hui; You, Xinxin; Li, Jia; Liu, Hankui; Meng, Zining; Xiao, Ling; Zhang, Haifa; Lin, Hao-Ran; Zhang, Yong; Shi, Qiong

    2016-01-01

    Mapping of quantitative trait loci (QTL) is essential for the discovery of genetic structures that related to complex quantitative traits. In this study, we identified 264,072 raw SNPs (single-nucleotide polymorphisms) by double digest restriction site associated DNA sequencing (ddRADseq), and utilized 3029 of these SNPs to construct a genetic linkage map in orange-spotted grouper (Epinephelus coioides) using a regression mapping algorithm. The genetic map contained 24 linkage groups (LGs) spanning a total genetic distance of 1231.98 cM. Twenty-seven significant growth-related QTLs were identified. Furthermore, we identified 17 genes (fez2, alg3, ece2, arvcf, sla27a4, sgk223, camk2, prrc2b, mchr1, sardh, pappa, syk, tert, wdrcp91, ftz-f1, mate1 and notch1) including three (tert, ftz-f1 and notch1) that have been reported to be involved in fish growth. To summarize, we mapped growth-related QTLs in the orange-spotted grouper. These QTLs will be useful in marker-assisted selection (MAS) efforts to improve growth-related traits in this economically important fish. PMID:27058532

  13. Waste Site Mapping

    NASA Technical Reports Server (NTRS)

    1994-01-01

    Old aircraft considered not restorable are melted down in on-site furnaces to reclaim the aluminum in their airframes. The process produces aluminum ingots and leaves a residue known as "dross." Because dross contains contaminants like lead silver cadmium and copper, Pima County, the dross dumping site, wanted to locate areas where dross had been dumped. Dr. Larry Lepley and Sandra L. Perry used the Landsat Thematic Mapper to screen for dross. A special two-step procedure was developed to separate the dross dumps (typically no larger than 50 meters across) from the desert background. The project has opened the door for similar applications.

  14. Derivation of a restriction map of bacteriophage T3 DNA and comparison with the map of bacteriophage T7 DNA.

    PubMed Central

    Bailey, J N; Dembinski, D R; McAllister, W T

    1980-01-01

    The DNA of bacteriophage T3 was characterized by cleavage with seven restriction endonucleases. AvaI, XbaI, BglII, and HindIII each cut T3 DNA at 1 site, KpnI cleaved it at 2 sites, MboI cleaved it at 9 sites, and HpaI cleaved it at 17 sites. The sizes of the fragments produced by digestion with these enzymes were determined by using restriction fragments of T7 DNA as molecular weight standards. As a result of this analysis, the size of T3 DNA was estimated to be 38.74 kilobases. The fragments were ordered with respect to each other and to the genetic map to produce a restriction map of T3 DNA. The location and occurrence of the restriction sites in T3 DNA are compared with those in the DNA of the closely related bacteriophage T7. Images PMID:6251266

  15. A restriction mapping engine using constraint logic programming

    SciTech Connect

    Dix, T.I.; Yee, C.N.

    1994-12-31

    Restriction mapping generally requires the application of information from various digestions by restriction enzymes to find solution sets. We use both the predicate calculus and constraint solving capabilities of CLP(R) to develop an engine for restriction mapping. Many of the techniques employed by biologists to manually find solutions are supported by the engine in a consistent manner. We provide generalized pipeline and cross-multiply operators for combining sub-maps. Our approach encourages the building of maps iteratively. We show how other techniques can be readily incorporated.

  16. [Studies on mtDNA of Ustilago maydis. II. Restriction mapping].

    PubMed

    Feng, G H; Cheng, W; Lu, S Y

    1991-01-01

    A restriction map was constructed for mtDNA of Ustilago maydis. The fragment order for each restriction enzyme was determined by DNA hybridization and fragment overlapping. The restriction sites were located by analysing the secondary digestions of the cloned mtDNA fragments. It was also found that the mtDNA of U. maydis was a circle molecule (60.7 kb), without recognizable repeat sequence.

  17. A restriction map of Xenopus laevis mitochondrial DNA.

    PubMed

    Cordonnier, A M; Vannier, P A; Brun, G M

    1982-08-01

    The mitochondrial DNA from Xenopus laevis is a 17.4 x 10(3)-base-pair circular DNA molecule. The mapping of this DNA, using 19 different restriction endonucleases is reported here. The sites are as follows: 1 for BamHI, PstI, SacI, SalI, BalI; 2 for BglII, SacII, EcoRI, ClaI, 3 for XhoI, 4 for AvaI, XbaI, PvuII, 5 for HindIII, 6 for HhaI, BclI, HpaI, 10 for AvaII and 11 for HincII. The same sites (except for one of the two ClaI sites) are observed in the molecule cloned in pBR322 DNA. The fragments corresponding to 62 cleavage sites have all been ordered and precisely located. They provide suitable conditions for further investigations connected with the study of replication and nucleotide sequence determination of this molecule.

  18. Structure of the cauliflower mosaic virus genome. III. Restriction endonuclease mapping of thirty-three isolates.

    PubMed

    Hull, R

    1980-01-15

    The sites of various restriction endonucleases were mapped on the DNA of cauliflower mosaic virus isolate Cabb B-JI.FspAI,HgiAI,HhaI, andXhoI each cut at one site,PstI andPvuII each at two sites,BglII at five sites, andHindIII at nine sites;SacP,SmaI, andXbaI did not cut this DNA. These sites and those ofBamHI,EcoRI, andSalGI were compared with the sites of these enzymes on the DNAs of 32 other CaMV isolates. Considerable variations were found both in numbers and map positions of the sites of the restriction enzymes. The significance of this variation is discussed.

  19. QTL for resistance in Lolium perenne to a mixed population of Puccinia graminis subsp. graminicola: use of RAD (restriction site associated DNA) markers to rapidly populate a new linkage map

    USDA-ARS?s Scientific Manuscript database

    A mapping population was created to detect quantitative trait loci (QTL) for resistance to stem rust caused by Puccinia graminis subsp. graminicola in Lolium perenne. Susceptible and resistant plants were crossed to produce a pseudo-testcross population. Markers were produced by the Restriction-sit...

  20. statement of significance, location map, site plan, landscape plan, site ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    statement of significance, location map, site plan, landscape plan, site sections, evolution of cemetery landscape. - San Francisco National Cemetery, 1 Lincoln Boulevard, San Francisco, San Francisco County, CA

  1. Chloroplast DNA restriction site variation and phylogeny of the Berberidaceae.

    PubMed

    Kim, Y D; Jansen, R K

    1998-12-01

    Comparative restriction site mapping of the chloroplast genome was performed to examine phylogenetic relationships among 27 species representing 16 genera of the Berberidaceae and two outgroups. Chloroplast genomes of the species included in this study showed no major structural rearrangements (i.e., they are collinear to tobacco cpDNA) except for the extension of the inverted repeat in species of Berberis and Mahonia. Excluding several regions that exhibited severe length variation, a total of 501 phylogenetically informative sites was mapped for ten restriction enzymes. The strict consensus tree of 14 equally parsimonious trees indicated that some berberidaceous genera (Berberis, Mahonia, Diphylleia) are not monophyletic. To explore phylogenetic utility of different parsimony methods phylogenetic trees were generated using Wagner, Dollo, and weighted parsimony for a reduced data set that included 18 species. One of the most significant results was the recognition of the four chromosomal groups, which were strongly supported regardless of the parsimony method used. The most notable difference among the trees produced by the three parsimony methods was the relationships among the four chromosomal groups. The cpDNA trees also strongly supported a close relationship of several generic pairs (e.g., Berberis-Mahonia, Epimedium-Vancouveria, etc.). Maximum likelihood values were computed for the four different tree topologies of the chromosomal groups, two Wagner, one Dollo, and one weighted topology. The results indicate that the weighted tree has the highest likelihood value. The lowest likelihood value was obtained for the Dollo tree, which had the highest bootstrap and decay values. Separate analyses using only the Inverted Repeat (IR) region resulted in a tree that is identical to the weighted tree. Poor resolution and/or support for the relationships among the four chromosomal lineages of the Berberidaceae indicate that they may have radiated from an ancestral

  2. Rapid restriction mapping of cosmids by sequence-specific triple-helix-mediated affinity capture

    SciTech Connect

    Ji, Huamin; Francisco, T.; Smith, L.M.; Guilfoyle, R.A.

    1996-01-15

    A simple and rapid strategy for restriction mapping based on sequence-specific triple-helix affinity capture (TAC) was developed. The strategy was applied to the analysis of cosmid clones by the construction of a new cosmid vector, ScosTriplex-II, containing two different triple-helix-forming sequences flanking the cloning site of the original SuperCos-1 cosmid vector. For restriction mapping, the recombinant cosmid DNA is digested with NotI restriction enzyme or with one of four intron-encoded endonucleases for excision of intact inserts followed by controlled partial digestion with a mapping enzyme used in conjunction with the corresponding methyltransferase. The partial digestion products are combined with biotinylated triple-helix-forming oligonucleotides to form a triple-helical complex. The triple-helix complexes are immobilized on streptavidin-coated magnetic beads, washed, and eluted with pH 9 buffer solution. The fragments are separated and directly sized by agarose gel electrophoresis. Bidirectional maps are obtained simultaneously by binding to the two different triple-helix-forming oligonucleotides. No probe labeling, gel drying, blotting to membranes, hybridization, or autoradiography is necessary. Also, TAC conditions that permit gel-free isolation of the terminal restriction fragments from cosmid inserts were found. These advantages afforded by ScosTriplex-II should facilitate the automation of cosmid restriction site fingerprinting needed for large-scale mapping and sequencing projects. 24 refs., 5 figs.

  3. Ordered restriction maps of saccharomyces cerevisiae chromosomes constructed by optical mapping

    SciTech Connect

    Schwartz, D.C.; Li, Xiaojun; Hernandez, L.I.; Ramnarain, S.P.; Huff, E.J.; Wang, Y.K. )

    1993-10-01

    A light-microscope-based technique for rapidly constructing ordered physical maps of chromosomes has been developed. Restriction enzyme digestion of elongated individual DNA molecules (about 0.2 to 1.0 megabases in size) was imaged by fluorescence microscopy after fixation in agarose gel. The size of the resulting individual restriction fragments was determined by relative fluorescence intensity and apparent molecular contour length. Ordered restriction maps were then created from genomic DNA without reliance on cloned or amplified sequences for hybridization or analytical gel electrophoresis. Initial application of optical mapping is described for Saaccharomyces cerevisiae chromosomes.

  4. Random-clone strategy for genomic restriction mapping in yeast

    SciTech Connect

    Olson, M.V.; Dutchik, J.E.; Graham, M.Y.; Brodeur, G.M.; Helms, C.; Frank, M.; MacCollin, M.; Scheinman, R.; Frank, T.

    1986-10-01

    An approach to global restriction mapping is described that is applicable to any complex source DNA. By analyzing a single restriction digest for each member of a redundant set of lambda clones, a data base in constructed that contains fragment-size lists for all the clones. The clones are then grouped into subsets, each member of which is related to at least one other member by a significant overlap. Finally, a tree-searching algorithm seeks restriction maps that are consistent with the fragment-size lists for all the clones in each subset. The feasibility of the approach has been demonstrated by collecting data on 5000 lambda clones containing random 15-kilobase inserts of yeast DNA. It is shown that these data can be analyzed to produce regional maps of the yeast genome, extending in some cases for over 100 kilobases. In combination with hybridization probes to previously cloned genes, these local maps are already useful for defining the physical arrangement of closely linked genes. They may in the future serve as building blocks for the construction of a continuous global map.

  5. Linkage map for Aedes aegypti using restriction fragment length polymorphisms.

    PubMed

    Severson, D W; Mori, A; Zhang, Y; Christensen, B M

    1993-01-01

    We report construction of a genetic linkage map for the mosquito, Aedes aegypti, based on restriction fragment length polymorphisms (RFLPs). The map consists of 50 DNA markers that identify 53 loci covering 134 map units across three linkage groups. Determination of linkage associations between RFLP markers and several mutant marker loci allowed for partial integration of the RFLP markers with an existing classical genetic linkage map for A. aegypti. The RFLP markers include 42 random cDNA clones, three random genomic DNA clones, and five cDNA clones of known genes. We discuss the influence of autosomal sex determination, characteristic of culicine mosquitoes, in relation to its observed influence on segregation ratios. This has important ramifications for future efforts to identify quantitative trait loci associated with the ability of these mosquitoes to transmit various pathogens and parasites to man and other animals.

  6. Usability Evaluation of Public Web Mapping Sites

    NASA Astrophysics Data System (ADS)

    Wang, C.

    2014-04-01

    Web mapping sites are interactive maps that are accessed via Webpages. With the rapid development of Internet and Geographic Information System (GIS) field, public web mapping sites are not foreign to people. Nowadays, people use these web mapping sites for various reasons, in that increasing maps and related map services of web mapping sites are freely available for end users. Thus, increased users of web mapping sites led to more usability studies. Usability Engineering (UE), for instance, is an approach for analyzing and improving the usability of websites through examining and evaluating an interface. In this research, UE method was employed to explore usability problems of four public web mapping sites, analyze the problems quantitatively and provide guidelines for future design based on the test results. Firstly, the development progress for usability studies were described, and simultaneously several usability evaluation methods such as Usability Engineering (UE), User-Centered Design (UCD) and Human-Computer Interaction (HCI) were generally introduced. Then the method and procedure of experiments for the usability test were presented in detail. In this usability evaluation experiment, four public web mapping sites (Google Maps, Bing maps, Mapquest, Yahoo Maps) were chosen as the testing websites. And 42 people, who having different GIS skills (test users or experts), gender (male or female), age and nationality, participated in this test to complete the several test tasks in different teams. The test comprised three parts: a pretest background information questionnaire, several test tasks for quantitative statistics and progress analysis, and a posttest questionnaire. The pretest and posttest questionnaires focused on gaining the verbal explanation of their actions qualitatively. And the design for test tasks targeted at gathering quantitative data for the errors and problems of the websites. Then, the results mainly from the test part were analyzed. The

  7. Detection of possible restriction sites for type II restriction enzymes in DNA sequences.

    PubMed

    Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L

    2011-01-01

    In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.

  8. Site-specific DNA transesterification catalyzed by a restriction enzyme

    PubMed Central

    Sasnauskas, Giedrius; Connolly, Bernard A.; Halford, Stephen E.; Siksnys, Virginijus

    2007-01-01

    Most restriction endonucleases use Mg2+ to hydrolyze phosphodiester bonds at specific DNA sites. We show here that BfiI, a metal-independent restriction enzyme from the phospholipase D superfamily, catalyzes both DNA hydrolysis and transesterification reactions at its recognition site. In the presence of alcohols such as ethanol or glycerol, it attaches the alcohol covalently to the 5′ terminus of the cleaved DNA. Under certain conditions, the terminal 3′-OH of one DNA strand can attack the target phosphodiester bond in the other strand to create a DNA hairpin. Transesterification reactions on DNA with phosphorothioate linkages at the target bond proceed with retention of stereoconfiguration at the phosphorus, indicating, uniquely for a restriction enzyme, a two-step mechanism. We propose that BfiI first makes a covalent enzyme–DNA intermediate, and then it resolves it by a nucleophilic attack of water or an alcohol, to yield hydrolysis or transesterification products, respectively. PMID:17267608

  9. Site-specific DNA transesterification catalyzed by a restriction enzyme.

    PubMed

    Sasnauskas, Giedrius; Connolly, Bernard A; Halford, Stephen E; Siksnys, Virginijus

    2007-02-13

    Most restriction endonucleases use Mg2+ to hydrolyze phosphodiester bonds at specific DNA sites. We show here that BfiI, a metal-independent restriction enzyme from the phospholipase D superfamily, catalyzes both DNA hydrolysis and transesterification reactions at its recognition site. In the presence of alcohols such as ethanol or glycerol, it attaches the alcohol covalently to the 5' terminus of the cleaved DNA. Under certain conditions, the terminal 3'-OH of one DNA strand can attack the target phosphodiester bond in the other strand to create a DNA hairpin. Transesterification reactions on DNA with phosphorothioate linkages at the target bond proceed with retention of stereoconfiguration at the phosphorus, indicating, uniquely for a restriction enzyme, a two-step mechanism. We propose that BfiI first makes a covalent enzyme-DNA intermediate, and then it resolves it by a nucleophilic attack of water or an alcohol, to yield hydrolysis or transesterification products, respectively.

  10. 1884, 1889 & 1893 Site Maps Brookland Site Development ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1884, 1889 & 1893 Site Maps - Brookland Site Development Study, Brookland, bounded by B&O Railroad Tracks, Rhode Island & Brentwood Avenues on the south, 18th Street & South Dakota Avenue on the east, and Michigan Avenue on the North, Washington, District of Columbia, DC

  11. 1863, 1880 & 1884 Site Maps Brookland Site Development ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1863, 1880 & 1884 Site Maps - Brookland Site Development Study, Brookland, bounded by B&O Railroad Tracks, Rhode Island & Brentwood Avenues on the south, 18th Street & South Dakota Avenue on the east, and Michigan Avenue on the North, Washington, District of Columbia, DC

  12. Mapping NEHRP VS30 site classes

    USGS Publications Warehouse

    Holzer, T.L.; Padovani, A.C.; Bennett, M.J.; Noce, T.E.; Tinsley, J. C.

    2005-01-01

    Site-amplification potential in a 140-km2 area on the eastern shore of San Francisco Bay, California, was mapped with data from 210 seismic cone penetration test (SCPT) soundings. NEHRP VS30 values were computed on a 50-m grid by both taking into account the thickness and using mean values of locally measured shear-wave velocities of shallow geologic units. The resulting map of NEHRP VS30 site classes differs from other published maps that (1) do not include unit thickness and (2) are based on regional compilations of velocity. Although much of the area in the new map is now classified as NEHRP Site Class D, the velocities of the geologic deposits within this area are either near the upper or lower VS30 boundary of Class D. If maps of NEHRP site classes are to be based on geologic maps, velocity distributions of geologic units may need to be considered in the definition of VS30 boundaries of NEHRP site classes. ?? 2005, Earthquake Engineering Research Institute.

  13. Site maps and facilities listings

    SciTech Connect

    Not Available

    1993-11-01

    In September 1989, a Memorandum of Agreement among DOE offices regarding the environmental management of DOE facilities was signed by appropriate Assistant Secretaries and Directors. This Memorandum of Agreement established the criteria for EM line responsibility. It stated that EM would be responsible for all DOE facilities, operations, or sites (1) that have been assigned to DOE for environmental restoration and serve or will serve no future production need; (2) that are used for the storage, treatment, or disposal of hazardous, radioactive, and mixed hazardous waste materials that have been properly characterized, packaged, and labelled, but are not used for production; (3) that have been formally transferred to EM by another DOE office for the purpose of environmental restoration and the eventual return to service as a DOE production facility; or (4) that are used exclusively for long-term storage of DOE waste material and are not actively used for production, with the exception of facilities, operations, or sites under the direction of the DOE Office of Civilian Radioactive Waste Management. As part of the implementation of the Memorandum of Agreement, Field Offices within DOE submitted their listings of facilities, systems, operation, and sites for which EM would have line responsibility. It is intended that EM facility listings will be revised on a yearly basis so that managers at all levels will have a valid reference for the planning, programming, budgeting and execution of EM activities.

  14. Restriction Site Variation in the Zea Chloroplast Genome

    PubMed Central

    Doebley, J.; Renfroe, W.; Blanton, A.

    1987-01-01

    Nineteen accessions selected from the four species and three subspecies of the genus Zea and one accession from the related genus Tripsacum were surveyed for variation with 21 restriction endonucleases. In all, 580 restriction sites were assayed in each chloroplast (cp)DNA, this representing 2.2% of the genome. Twenty-four of the 580 sites were variable in one or more of the cpDNAs. The number of nucleotide substitutions per site (p) between Zea and Tripsacum (0.0056) approximates that between other closely related angiosperm genera. The range in values of p among Zea species (0.0003-0.0024) is on the lower end of the range reported for other angiosperm genera. Analysis of the distribution of restriction site mutations throughout the genome indicated that the inverted repeat evolves more slowly than either the small or large unique sequence regions. Parsimony phylogenetic analysis of the restriction site data produced a tree consistent with isoenzymatic and morphological measures of affinity among the species. Chloroplast DNA analysis was not useful in discriminating the subspecies within Zea mays. The lack of any detectable differences between the cpDNA of maize (Z. mays subsp. mays) and some teosintes (Z. mays subsps. mexicana and parviglumis ) is consistent with the hypothesis that maize is a domesticated form of teosinte. Comparison of the degree of sequence divergence for Z. mays cpDNA and the Adh1 locus suggests the latter may be evolving at 10 times the rate of the former. Comparison of rates of sequence evolution for the mitochondrial and chloroplast genomes was inconclusive and could not clarify whether these two genomes have dissimilar rates of sequence evolution. PMID:17246395

  15. Validated ligand mapping of ACE active site

    NASA Astrophysics Data System (ADS)

    Kuster, Daniel J.; Marshall, Garland R.

    2005-08-01

    Crystal structures of angiotensin-converting enzyme (ACE) complexed with three inhibitors (lisinopril, captopril, enalapril) provided experimental data for testing the validity of a prior active site model predicting the bound conformation of the inhibitors. The ACE active site model - predicted over 18 years ago using a series of potent ACE inhibitors of diverse chemical structure - was recreated using published data and commercial software. Comparison between the predicted structures of the three inhibitors bound to the active site of ACE and those determined experimentally yielded root mean square deviation (RMSD) values of 0.43-0.81 Å, among the distances defining the active site map. The bound conformations of the chemically relevant atoms were accurately deduced from the geometry of ligands, applying the assumption that the geometry of the active site groups responsible for binding and catalysis of amide hydrolysis was constrained. The mapping of bound inhibitors at the ACE active site was validated for known experimental compounds, so that the constrained conformational search methodology may be applied with confidence when no experimentally determined structure of the enzyme yet exists, but potent, diverse inhibitors are available.

  16. Site characterization and petroleum hydrocarbon plume mapping

    SciTech Connect

    Ravishankar, K.

    1996-12-31

    This paper presents a case study of site characterization and hydrocarbon contamination plume mapping/delineation in a gas processing plant in southern Mexico. The paper describes innovative and cost-effective use of passive (non-intrusive) and active (intrusive) techniques, including the use of compound-specific analytical methods for site characterization. The techniques used, on a demonstrative basis, include geophysical, geochemical, and borehole drilling. Geochemical techniques used to delineate the horizontal extent of hydrocarbon contamination at the site include soil gas surveys. The borehole drilling technique used to assess the vertical extent of contamination and confirm geophysical and geochemical data combines conventional hollow-stem auguring with direct push-probe using Geoprobe. Compound-specific analytical methods, such as hydrocarbon fingerprinting and a modified method for gasoline range organics, demonstrate the inherent merit and need for such analyses to properly characterize a site, while revealing the limitations of noncompound-specific total petroleum hydrocarbon analysis. The results indicate that the techniques used in tandem can properly delineate the nature and extent of contamination at a site; often supplement or complement data, while reducing the risk of errors and omissions during the assessment phase; and provide data constructively to focus site-specific remediation efforts. 7 figs.

  17. 24. Site plan, 1924 Photocopied from Sanborn Map Company, Insurance ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    24. Site plan, 1924 Photocopied from Sanborn Map Company, Insurance Maps of New Haven, v. 5, map no. 540, 1924 - Eli Whitney Armory, West of Whitney Avenue, Armory Street Vicinity, Hamden, New Haven County, CT

  18. 23. Site plan, 1931 Photocopied from Sanborn Map Company, Insurance ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    23. Site plan, 1931 Photocopied from Sanborn Map Company, Insurance Maps of New Haven, v. 5, map no. 540, 1924 updated to 1931. - Eli Whitney Armory, West of Whitney Avenue, Armory Street Vicinity, Hamden, New Haven County, CT

  19. 25 CFR 247.11 - What other restrictions apply to use of the sites?

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false What other restrictions apply to use of the sites? 247.11... COLUMBIA RIVER TREATY FISHING ACCESS SITES § 247.11 What other restrictions apply to use of the sites? The Area Director may prescribe and post at the sites regulations covering: (a) Camping; (b) Picnicking;...

  20. 25 CFR 247.11 - What other restrictions apply to use of the sites?

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 25 Indians 1 2011-04-01 2011-04-01 false What other restrictions apply to use of the sites? 247.11... COLUMBIA RIVER TREATY FISHING ACCESS SITES § 247.11 What other restrictions apply to use of the sites? The Area Director may prescribe and post at the sites regulations covering: (a) Camping; (b) Picnicking;...

  1. DNA restriction-site polymorphisms associated with the alpha 1-antitrypsin gene.

    PubMed Central

    Cox, D W; Billingsley, G D; Mansfield, T

    1987-01-01

    Restriction-site variation in and around the alpha 1-antitrypsin gene has been studied using two genomic probes. With use of restriction enzymes SstI, MspI, and AvaII, three polymorphic sites have been described with a 4.6-kb probe in the 5' portion of the gene. With use of a 6.5-kb probe, polymorphisms in the coding and 3' regions of the gene have been detected with AvaII, MaeIII, and TaqI. All of these polymorphisms are of sufficiently high frequency to be useful in genetic mapping studies. The polymorphisms with AvaII and MaeIII (6.5-kb probe) are particularly useful for prenatal diagnosis. PI types and M subtypes tend to be associated with specific DNA haplotypes; there are two different types of DNA haplotypes associated with PI M1. The extent of linkage disequilibrium differs throughout the region of the alpha 1-antitrypsin gene. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:2890296

  2. Effect of site-specific modification on restriction endonucleases and DNA modification methyltransferases.

    PubMed Central

    McClelland, M; Nelson, M; Raschke, E

    1994-01-01

    Restriction endonucleases have site-specific interactions with DNA that can often be inhibited by site-specific DNA methylation and other site-specific DNA modifications. However, such inhibition cannot generally be predicted. The empirically acquired data on these effects are tabulated for over 320 restriction endonucleases. In addition, a table of known site-specific DNA modification methyltransferases and their specificities is presented along with EMBL database accession numbers for cloned genes. PMID:7937074

  3. Whole-Genome Restriction Mapping by "Subhaploid"-Based RAD Sequencing: An Efficient and Flexible Approach for Physical Mapping and Genome Scaffolding.

    PubMed

    Dou, Jinzhuang; Dou, Huaiqian; Mu, Chuang; Zhang, Lingling; Li, Yangping; Wang, Jia; Li, Tianqi; Li, Yuli; Hu, Xiaoli; Wang, Shi; Bao, Zhenmin

    2017-07-01

    Assembly of complex genomes using short reads remains a major challenge, which usually yields highly fragmented assemblies. Generation of ultradense linkage maps is promising for anchoring such assemblies, but traditional linkage mapping methods are hindered by the infrequency and unevenness of meiotic recombination that limit attainable map resolution. Here we develop a sequencing-based "in vitro" linkage mapping approach (called RadMap), where chromosome breakage and segregation are realized by generating hundreds of "subhaploid" fosmid/bacterial-artificial-chromosome clone pools, and by restriction site-associated DNA sequencing of these clone pools to produce an ultradense whole-genome restriction map to facilitate genome scaffolding. A bootstrap-based minimum spanning tree algorithm is developed for grouping and ordering of genome-wide markers and is implemented in a user-friendly, integrated software package (AMMO). We perform extensive analyses to validate the power and accuracy of our approach in the model plant Arabidopsis thaliana and human. We also demonstrate the utility of RadMap for enhancing the contiguity of a variety of whole-genome shotgun assemblies generated using either short Illumina reads (300 bp) or long PacBio reads (6-14 kb), with up to 15-fold improvement of N50 (∼816 kb-3.7 Mb) and high scaffolding accuracy (98.1-98.5%). RadMap outperforms BioNano and Hi-C when input assembly is highly fragmented (contig N50 = 54 kb). RadMap can capture wide-range contiguity information and provide an efficient and flexible tool for high-resolution physical mapping and scaffolding of highly fragmented assemblies. Copyright © 2017 Dou et al.

  4. Whole-Genome Restriction Mapping by “Subhaploid”-Based RAD Sequencing: An Efficient and Flexible Approach for Physical Mapping and Genome Scaffolding

    PubMed Central

    Dou, Jinzhuang; Dou, Huaiqian; Mu, Chuang; Zhang, Lingling; Li, Yangping; Wang, Jia; Li, Tianqi; Li, Yuli; Hu, Xiaoli; Wang, Shi; Bao, Zhenmin

    2017-01-01

    Assembly of complex genomes using short reads remains a major challenge, which usually yields highly fragmented assemblies. Generation of ultradense linkage maps is promising for anchoring such assemblies, but traditional linkage mapping methods are hindered by the infrequency and unevenness of meiotic recombination that limit attainable map resolution. Here we develop a sequencing-based “in vitro” linkage mapping approach (called RadMap), where chromosome breakage and segregation are realized by generating hundreds of “subhaploid” fosmid/bacterial-artificial-chromosome clone pools, and by restriction site-associated DNA sequencing of these clone pools to produce an ultradense whole-genome restriction map to facilitate genome scaffolding. A bootstrap-based minimum spanning tree algorithm is developed for grouping and ordering of genome-wide markers and is implemented in a user-friendly, integrated software package (AMMO). We perform extensive analyses to validate the power and accuracy of our approach in the model plant Arabidopsis thaliana and human. We also demonstrate the utility of RadMap for enhancing the contiguity of a variety of whole-genome shotgun assemblies generated using either short Illumina reads (300 bp) or long PacBio reads (6–14 kb), with up to 15-fold improvement of N50 (∼816 kb-3.7 Mb) and high scaffolding accuracy (98.1–98.5%). RadMap outperforms BioNano and Hi-C when input assembly is highly fragmented (contig N50 = 54 kb). RadMap can capture wide-range contiguity information and provide an efficient and flexible tool for high-resolution physical mapping and scaffolding of highly fragmented assemblies. PMID:28468906

  5. Single nucleotide polymorphisms in chum salmon (Oncorhynchus keta) mitochondrial DNA derived from restriction site haplotype information.

    PubMed

    Garvin, M R; Saitoh, K; Churikov, D Y; Brykov, V A; Gharrett, A J

    2010-07-01

    Single nucleotide polymorphisms (SNPs) are useful genetic markers for the management and conservation of commercially important species such as salmon. Informative markers can be derived from data obtained for other purposes. We used restriction endonuclease data from earlier work to identify potentially useful restriction sites in chum salmon (Oncorhynchus keta). With the aid of a newly generated complete mitochondrial DNA sequence (accession number AP010773), we identified the SNP responsible for each restriction site variant, designed rapid genotyping assays, and surveyed the SNPs in more than 400 individuals. The restriction site analysis and the SNP genotyping assays were almost perfectly concordant. Some reasons for the non-concordance were identified and discussed.

  6. SDM-Assist software to design site-directed mutagenesis primers introducing "silent" restriction sites.

    PubMed

    Karnik, Abhijit; Karnik, Rucha; Grefen, Christopher

    2013-03-22

    Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. We have developed a program - 'SDM-Assist' which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of 'mutated clones' by a simple restriction digest. The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs.

  7. Determining the Optimal Number of Stimuli per Cranial Site during Transcranial Magnetic Stimulation Mapping

    PubMed Central

    Schabrun, Siobhan M.

    2017-01-01

    The delivery of five stimuli to each cranial site is recommended during transcranial magnetic stimulation (TMS) mapping. However, this time-consuming practice restricts the use of TMS mapping beyond the research environment. While reducing the number of stimuli administered to each cranial site may improve efficiency and decrease physiological demand, doing so may also compromise the procedure's validity. Therefore, the aim of this study was to determine the minimum number of stimuli per cranial site required to obtain valid outcomes during TMS mapping. Map volume and centre of gravity (CoG) recordings obtained using five stimuli per cranial site were retrospectively compared to those obtained using one, two, three, and four stimuli per cranial site. For CoG longitude, one stimulus per cranial site produced valid recordings (ICC = 0.91, 95% CI 0.82 to 0.95). However, this outcome is rarely explored in isolation. As two stimuli per cranial site were required to obtain valid CoG latitude (ICC = 0.99, 95% CI 0.99 to 0.99) and map volume (ICC = 0.99, 95% CI 0.99 to 0.99) recordings, it is recommended that a minimum of two stimuli be delivered to each cranial site during TMS mapping in order to obtain valid outcomes. PMID:28331848

  8. Determining the Optimal Number of Stimuli per Cranial Site during Transcranial Magnetic Stimulation Mapping.

    PubMed

    Cavaleri, Rocco; Schabrun, Siobhan M; Chipchase, Lucy S

    2017-01-01

    The delivery of five stimuli to each cranial site is recommended during transcranial magnetic stimulation (TMS) mapping. However, this time-consuming practice restricts the use of TMS mapping beyond the research environment. While reducing the number of stimuli administered to each cranial site may improve efficiency and decrease physiological demand, doing so may also compromise the procedure's validity. Therefore, the aim of this study was to determine the minimum number of stimuli per cranial site required to obtain valid outcomes during TMS mapping. Map volume and centre of gravity (CoG) recordings obtained using five stimuli per cranial site were retrospectively compared to those obtained using one, two, three, and four stimuli per cranial site. For CoG longitude, one stimulus per cranial site produced valid recordings (ICC = 0.91, 95% CI 0.82 to 0.95). However, this outcome is rarely explored in isolation. As two stimuli per cranial site were required to obtain valid CoG latitude (ICC = 0.99, 95% CI 0.99 to 0.99) and map volume (ICC = 0.99, 95% CI 0.99 to 0.99) recordings, it is recommended that a minimum of two stimuli be delivered to each cranial site during TMS mapping in order to obtain valid outcomes.

  9. 14 CFR 433.5 - Operational restrictions on a reentry site.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION LICENSING LICENSE TO OPERATE A REENTRY SITE § 433.5 Operational restrictions on a reentry site. A license to operate a reentry site authorizes the licensee to offer use of the site to support reentry of a reentry vehicle for which the three-sigma footprint of the vehicle...

  10. ICRPfinder: a fast pattern design algorithm for coding sequences and its application in finding potential restriction enzyme recognition sites

    PubMed Central

    Li, Chao; Li, Yuhua; Zhang, Xiangmin; Stafford, Phillip; Dinu, Valentin

    2009-01-01

    Background Restriction enzymes can produce easily definable segments from DNA sequences by using a variety of cut patterns. There are, however, no software tools that can aid in gene building -- that is, modifying wild-type DNA sequences to express the same wild-type amino acid sequences but with enhanced codons, specific cut sites, unique post-translational modifications, and other engineered-in components for recombinant applications. A fast DNA pattern design algorithm, ICRPfinder, is provided in this paper and applied to find or create potential recognition sites in target coding sequences. Results ICRPfinder is applied to find or create restriction enzyme recognition sites by introducing silent mutations. The algorithm is shown capable of mapping existing cut-sites but importantly it also can generate specified new unique cut-sites within a specified region that are guaranteed not to be present elsewhere in the DNA sequence. Conclusion ICRPfinder is a powerful tool for finding or creating specific DNA patterns in a given target coding sequence. ICRPfinder finds or creates patterns, which can include restriction enzyme recognition sites, without changing the translated protein sequence. ICRPfinder is a browser-based JavaScript application and it can run on any platform, in on-line or off-line mode. PMID:19747395

  11. Restriction site heteroplasmy in the mitochondrial DNA of the marine fish Sciaenops ocellatus (L.).

    PubMed

    Gold, J R; Richardson, L R

    1990-01-01

    Restriction site heteroplasmy involving the enzymes NcoI and XbaI was detected in the mitochondrial DNAs of two individuals of the marine fish Sciaenops ocellatus. This represents only the sixth documented example of mitochondrial DNA restriction site heteroplasmy in animals. Two heteroplasmic individuals were found in a survey of nearly 750 individuals, suggesting that in most studies the incidence of mitochondrial DNA site heteroplasmy may be too low to be routinely detected.

  12. 47 CFR 73.4108 - FM transmitter site map submissions.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 47 Telecommunication 4 2013-10-01 2013-10-01 false FM transmitter site map submissions. 73.4108 Section 73.4108 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES RADIO BROADCAST SERVICES Rules Applicable to All Broadcast Stations § 73.4108 FM transmitter site map...

  13. 47 CFR 73.4108 - FM transmitter site map submissions.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 47 Telecommunication 4 2012-10-01 2012-10-01 false FM transmitter site map submissions. 73.4108 Section 73.4108 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES RADIO BROADCAST SERVICES Rules Applicable to All Broadcast Stations § 73.4108 FM transmitter site map...

  14. 47 CFR 73.4108 - FM transmitter site map submissions.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 47 Telecommunication 4 2011-10-01 2011-10-01 false FM transmitter site map submissions. 73.4108 Section 73.4108 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES RADIO BROADCAST SERVICES Rules Applicable to All Broadcast Stations § 73.4108 FM transmitter site map...

  15. 47 CFR 73.4108 - FM transmitter site map submissions.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 47 Telecommunication 4 2010-10-01 2010-10-01 false FM transmitter site map submissions. 73.4108 Section 73.4108 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES RADIO BROADCAST SERVICES Rules Applicable to All Broadcast Stations § 73.4108 FM transmitter site map...

  16. 47 CFR 73.4108 - FM transmitter site map submissions.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 47 Telecommunication 4 2014-10-01 2014-10-01 false FM transmitter site map submissions. 73.4108 Section 73.4108 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES RADIO BROADCAST SERVICES Rules Applicable to All Broadcast Stations § 73.4108 FM transmitter site map...

  17. Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

    Treesearch

    M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

    1994-01-01

    A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

  18. Error checking and graphical representation of multiple-complete-digest (MCD) restriction-fragment maps.

    PubMed

    Thayer, E C; Olson, M V; Karp, R M

    1999-01-01

    Genetic and physical maps display the relative positions of objects or markers occurring within a target DNA molecule. In constructing maps, the primary objective is to determine the ordering of these objects. A further objective is to assign a coordinate to each object, indicating its distance from a reference end of the target molecule. This paper describes a computational method and a body of software for assigning coordinates to map objects, given a solution or partial solution to the ordering problem. We describe our method in the context of multiple-complete-digest (MCD) mapping, but it should be applicable to a variety of other mapping problems. Because of errors in the data or insufficient clone coverage to uniquely identify the true ordering of the map objects, a partial ordering is typically the best one can hope for. Once a partial ordering has been established, one often seeks to overlay a metric along the map to assess the distances between the map objects. This problem often proves intractable because of data errors such as erroneous local length measurements (e.g., large clone lengths on low-resolution physical maps). We present a solution to the coordinate assignment problem for MCD restriction-fragment mapping, in which a coordinated set of single-enzyme restriction maps are simultaneously constructed. We show that the coordinate assignment problem can be expressed as the solution of a system of linear constraints. If the linear system is free of inconsistencies, it can be solved using the standard Bellman-Ford algorithm. In the more typical case where the system is inconsistent, our program perturbs it to find a new consistent system of linear constraints, close to those of the given inconsistent system, using a modified Bellman-Ford algorithm. Examples are provided of simple map inconsistencies and the methods by which our program detects candidate data errors and directs the user to potential suspect regions of the map.

  19. A Genetic Linkage Map of the Mouse Using Restriction Landmark Genomic Scanning (Rlgs)

    PubMed Central

    Hayashizaki, Y.; Hirotsune, S.; Okazaki, Y.; Shibata, H.; Akasako, A.; Muramatsu, M.; Kawai, J.; Hirasawa, T.; Watanabe, S.; Shiroishi, T.; Moriwaki, K.; Taylor, B. A.; Matsuda, Y.; Elliott, R. W.; Manly, K. F.; Chapman, V. M.

    1994-01-01

    We have developed a multiplex method of genome analysis, restriction landmark genomic scanning (RLGS) that has been used to construct genetic maps in mice. Restriction landmarks are end-labeled restriction fragments of genomic DNA that are separated by using high resolution, two-dimensional gel electrophoresis identifying as many as two thousand landmark loci in a single gel. Variation for several hundred of these loci has been identified between laboratory strains and between these strains and Mus spretus. The segregation of more than 1100 RLGS loci has been analyxed in recombinant inbred (RI) strains and in two separate interspecific genetic crosses. Genetic maps have been derived that link 1045 RLGS loci to reference loci on all of the autosomes and the X chromosome of the mouse genome. The RLGS method can be applied to genome analysis in many different organisms to identify genomic loci because it used end-labeling of restriction landmarks rather than probe hybridization. Different combinations of restriction enzymes yield different sets of RLGS loci providing expanded power for genetic mapping. PMID:7896102

  20. Seismic hazard mapping of California considering site effects

    USGS Publications Warehouse

    Kalkan, E.; Wills, C.J.; Branum, D.M.

    2010-01-01

    In this paper, we have combined the U.S. Geological Survey's National Seismic Hazard Maps model with the California geologic map showing 17 generalized geologic units that can be defined by their VS30. We regrouped these units into seven VS30 values and calculated a probabilistic seismic hazard map for the entire state for each VS30 value. By merging seismic hazard maps based on the seven different V S30 values, a suite of seismic hazard maps was computed for 0.2 and 1.0 s spectral ordinates at 2% probability of exceedance (PE) in 50 years. The improved hazards maps explicitly incorporate the site effects and their spatial variability on ground motion estimates. The spectral acceleration (SA) at 1.0 s map of seismic shaking potential for California has now been published as California Geological Survey Map Sheet 48.

  1. Ground water maps of Hanford Site Separations Areas, December 1989

    SciTech Connect

    Kasza, G.L.

    1990-06-01

    The Separations Areas consist of the 200 East and 200 West areas and the surrounding vicinity on the Hanford Site. Chemical processing operations are carried out in the Separations Areas by Westinghouse Hanford Company for the US Department of Energy-Richland Operations Office. This set of ground water maps consists of: (1) Separations Areas depth-to-water map, (2) Separations Areas water table map, and (3) a map comparing the potentiometric surface of the Rattlesnake Ridge confined aquifer with the water table of the unconfined aquifer. The field measurements for these maps were collected during December 1989. 3 figs., 1 tab.

  2. Optimizing landfill site selection by using land classification maps.

    PubMed

    Eskandari, M; Homaee, M; Mahmoodi, S; Pazira, E; Van Genuchten, M Th

    2015-05-01

    Municipal solid waste disposal is a major environmental concern throughout the world. Proper landfill siting involves many environmental, economic, technical, and sociocultural challenges. In this study, a new quantitative method for landfill siting that reduces the number of evaluation criteria, simplifies siting procedures, and enhances the utility of available land evaluation maps was proposed. The method is demonstrated by selecting a suitable landfill site near the city of Marvdasht in Iran. The approach involves two separate stages. First, necessary criteria for preliminary landfill siting using four constraints and eight factors were obtained from a land classification map initially prepared for irrigation purposes. Thereafter, the criteria were standardized using a rating approach and then weighted to obtain a suitability map for landfill siting, with ratings in a 0-1 domain and divided into five suitability classes. Results were almost identical to those obtained with a more traditional environmental landfill siting approach. Because of far fewer evaluation criteria, the proposed weighting method was much easier to implement while producing a more convincing database for landfill siting. The classification map also considered land productivity. In the second stage, the six best alternative sites were evaluated for final landfill siting using four additional criteria. Sensitivity analyses were furthermore conducted to assess the stability of the obtained ranking. Results indicate that the method provides a precise siting procedure that should convince all pertinent stakeholders.

  3. Disaggregation of Soil Map Units for Improved Ecological Site Mapping in Rangelands

    USDA-ARS?s Scientific Manuscript database

    Rangeland soils are often mapped with soil map units consisting of associations, complexes, and undifferentiated groups composed of varied soil components. Because different components may be related to different ecological sites, the unmapped heterogeneity within map units limits the potential uses...

  4. Disaggregation of soil map units for improved ecological site mapping in rangelands

    USDA-ARS?s Scientific Manuscript database

    Rangeland soils are often mapped with soil map units consisting of associations, complexes, and undifferentiated groups composed of varied soil components. Because different components may be related to different ecological sites, the unmapped heterogeneity within map units limits the potential uses...

  5. Transcript identification by analysis of short sequence tags--influence of tag length, restriction site and transcript database.

    PubMed

    Unneberg, Per; Wennborg, Anders; Larsson, Magnus

    2003-04-15

    There exist a number of gene expression profiling techniques that utilize restriction enzymes for generation of short expressed sequence tags. We have studied how the choice of restriction enzyme influences various characteristics of tags generated in an experiment. We have also investigated various aspects of in silico transcript identification that these profiling methods rely on. First, analysis of 14 248 mRNA sequences derived from the RefSeq transcript database showed that 1-30% of the sequences lack a given restriction enzyme recognition site. Moreover, 1-5% of the transcripts have recognition sites located less than 10 bases from the poly(A) tail. The uniqueness of 10 bp tags lies in the range 90-95%, which increases only slightly with longer tags, due to the existence of closely related transcripts. Furthermore, 3-30% of upstream 10 bp tags are identical to 3' tags, introducing a risk of misclassification if upstream tags are present in a sample. Second, we found that a sequence length of 16-17 bp, including the recognition site, is sufficient for unique transcript identification by BLAST based sequence alignment to the UniGene Human non-redundant database. Third, we constructed a tag-to-gene mapping for UniGene and compared it to an existing mapping database. The mappings agreed to 79-83%, where the selection of representative sequences in the UniGene clusters is the main cause of the disagreement. The results of this study may serve to improve the interpretation of sequence-based expression studies and the design of hybridization arrays, by identifying short tags that have a high reliability and separating them from tags that carry an inherent ambiguity in their capacity to discriminate between genes. To this end, supplementary information in the form of a web companion to this paper is located at http:// biobase.biotech.kth.se/tagseq.

  6. Coordinate Map of Rocks at Pathfinder Landing Site

    NASA Technical Reports Server (NTRS)

    1997-01-01

    Mars-local-level (LL frame) coordinate map of rocks counted at the Mars Pathfinder landing site. Positions, apparent diameters (D), and heights (H) were measured to the nearest centimeter in the Mars map virtual reality environment constructed from the 'Monster Pan'

  7. Coordinate Map of Rocks at Pathfinder Landing Site

    NASA Technical Reports Server (NTRS)

    1997-01-01

    Mars-local-level (LL frame) coordinate map of rocks counted at the Mars Pathfinder landing site. Positions, apparent diameters (D), and heights (H) were measured to the nearest centimeter in the Mars map virtual reality environment constructed from the 'Monster Pan'

  8. Groundwater maps of the Hanford Site Separations Area, January 1989

    SciTech Connect

    Kasza, G.L.; Schatz, A.L.

    1989-03-01

    The groundwater maps of the Hanford Site Separations Area, dated January 1989, are prepared by the Environmental Engineering and Technology Function, Environmental Division, Westinghouse Hanford Company. The groundwater maps are updated on a semiannual basis and are complementary to the Hanford Site water table map prepared by Pacific Northwest Laboratory. The Separations Area consists of the 200 East and 200 West areas and the surrounding vicinity on the Hanford Site. Chemical processing operations are carried out in the Separations Area by Westinghouse Hanford for the US Department of Energy - Richland Operations Office. This set of groundwater maps consists of: (1) Separations Area depth-to-water map, (2) Separations Area water table map, and (3) a map comparing the potentiometric surface of the Rattlesnake Ridge confined aquifer with the water table of the unconfined aquifer. The field measurements for these maps were collected during the period January 19 to February 8, 1989, and are listed in Table 1. For clarity, the locating prefixes have been omitted from all well numbers shown on the maps. Wells in the 200 Areas have the prefix 299, and the wells outside of these areas have the prefix 699.

  9. Mapping Gnss Restricted Environments with a Drone Tandem and Indirect Position Control

    NASA Astrophysics Data System (ADS)

    Cledat, E.; Cucci, D. A.

    2017-08-01

    The problem of autonomously mapping highly cluttered environments, such as urban and natural canyons, is intractable with the current UAV technology. The reason lies in the absence or unreliability of GNSS signals due to partial sky occlusion or multi-path effects. High quality carrier-phase observations are also required in efficient mapping paradigms, such as Assisted Aerial Triangulation, to achieve high ground accuracy without the need of dense networks of ground control points. In this work we consider a drone tandem in which the first drone flies outside the canyon, where GNSS constellation is ideal, visually tracks the second drone and provides an indirect position control for it. This enables both autonomous guidance and accurate mapping of GNSS restricted environments without the need of ground control points. We address the technical feasibility of this concept considering preliminary real-world experiments in comparable conditions and we perform a mapping accuracy prediction based on a simulation scenario.

  10. A quantitative study of optical mapping surfaces by atomic force microscopy and restriction endonuclease digestion assays.

    PubMed

    Reed, J; Singer, E; Kresbach, G; Schwartz, D C

    1998-05-15

    Many new techniques in biomolecular chemistry and genomic analysis require the immobilization of molecular reagents on specially prepared surfaces. However, the process of molecular fixation often interferes with or precludes the use of standard in vitro biochemical assays. Optical mapping is an emergent technology for genomic analysis which relies on the biochemical activity of DNA fixed to silanized glass surfaces. Optical mapping surfaces have been shown to be compatible with restriction endonucleases and a variety of DNA polymerases. The essential properties of biochemically active surfaces are poorly understood in most of the current technologies which utilize molecular fixation, including optical mapping. The purpose of this study is to use the powerful technique of atomic force microscopy, in combination with informative enzymatic assays, to correlate biochemical activity with microscopic surface structure. The results presented provide meaningful insight into the effect of surface preparation on the biochemical accessibility of surface-bound molecules. Novel analysis which may facilitate the automation of optical mapping is presented.

  11. Pulsed-field gel electrophoresis for long-range restriction mapping.

    PubMed

    Gemmill, Robert M; Bolin, Richard; Albertsen, Hans; Tomkins, Jeff P; Wing, Rod A

    2002-02-01

    This unit describes procedures for generating long-range restriction maps of genomic DNA and for analysis of large insert clones. The basic protocol details restriction digestion of agarose-embedded DNA, PFGE separation, Southern transfer, and hybridization. Support protocols describe the preparation of high-molecular-weight genomic DNA samples in agarose blocks and in agarose microbeads, respectively. Additional support protocols describe the preparation of DNA size standards from l phage and two yeast species, Saccharomyces cerevisiae and Schizosaccharomyces pombe. An alternative method of preparing S. cerevisiae size standards using lithium dodecyl sulfate (LiDS) solubilization is provided. The final protocol details the preparation of BAC DNA suitable for digestion, mapping, and sequencing.

  12. Groudwater maps of the Hanford Site Separations Area, June 1989

    SciTech Connect

    Kasza, G.L.; Reidel, S.P.; Schatz, A.L.

    1989-09-01

    The groundwater maps of the Hanford Site Separations Area, recorded June 1989, are prepared by the Environmental Engineering and Technology Function, Environmental Division, Westinghouse Hanford Company. This set of groundwater maps consists of Separations Area depth-to-water map, Separations Area water table map, and a map comparing the potentiometric surface of the Rattlesnake Ridge confined aquifer with the water table of the unconfined aquifer. The field measurements for these maps were collected during June 1989. The Separations Area depth-to-water map depicts the measurement well locations and the depths to the water table at these locations. This map supports engineering or environmental studies which may require the approximate depth from the ground surface to the water table. On the third map, the potentiometric surface of the Rattlesnake Ridge confined aquifer is compared with the water table of the unconfined aquifer in the vicinity of West Lake, Gable Mountain Pond, and the B Pond system. The purpose of this map is to monitor the potential for aquifer intercommunication in this area. 3 figs., 1 tab.

  13. Mapped DNA probes from loblolly pine can be used for restriction fragment length polymorphism mapping in other conifers.

    PubMed

    Ahuja, M R; Devey, M E; Groover, A T; Jermstad, K D; Neale, D B

    1994-06-01

    A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm. Thirty complementary DNA and two genomic DNA probes from loblolly pine were hybridized to Southern blots containing DNA from five species of Pinus (P. elliottii, P. lambertiana, P. radiata, P. sylvestris, and P. taeda), one species from each of four other genera of Pinaceae (Abies concolor, Larix laricina, Picea abies, and Pseudotsuga menziesii), one species from each of three other families of Coniferales [Sequoia sempervirens (Taxodiaceae), Torreya californica (Taxaceae) and Calocedrus decurrens (Cupressaceae)], and to one angiosperm species (Populus nigra). Results showed that mapped DNA probes from lobolly pine will cross-hybridize to genomic DNA of other species of Pinus and some other genera of the Pinaceae. Only a small proportion of the probes hybridized to genomic DNA from three other families of the Coniferales and the one angiosperm examined. This study demonstrates that mapped DNA probes from loblolly pine can be used to construct RFLP maps for related species, thus enabling the opportunity for comparative genome mapping in conifers.

  14. Restriction mapping of a YAC contig in the hemochromatosis gene region

    SciTech Connect

    Burt, M.J.; Smit, D.J.; Pyper, W.R.

    1994-09-01

    Hemochromatosis is a common inherited disorder of iron metabolism that can lead to cirrhosis, hepatocellular carcinoma, cardiomyopathy, diabetes and anthropathy. We have mapped the hemochromatosis gene to within 1 cM of HLA-A and the microsatellite D6S105, and our allele association studies have shown that D6S105 is the marker most closely associated with the hemochromatosis gene. We are currently constructing a YAC contig and restriction map of this region as part of a positional cloning strategy to identify the hemochromatosis gene. YACs containing HLA-A or D6S105 were selected, and fluorescent-in-situ-hybridization (FISH) was performed to confirm chromosomal location and exclude chimerism. YAC DNA was digested with a panel of rare cutters, separated by pulsed field gel electrophoresis, Southern blotted and probed with the vector arms to create restriction maps. YAC insert terminal ends were isolated using vectorette methodology. A contig extending 600 kb centromeric and 350 kb telomeric of HLA-A has been established. HLA-A, HLA-F and the microsatellite D6S265 have been positioned on this map. The contig does not yet overlap any D6S105 positive YACs but the telomeric end of the contig has been sequenced and is being used to identify additional YACs to bridge this interval. Restriction mapping of three D6S105 YACs has shown the presence of several CpG islands in this region. As these CpG islands are in close proximity to D6S105, they are being used to isolate coding sequences to determine whether any of these mark the position of the hemochromatosis gene.

  15. malB region in Escherichia coli K-12: specialized transducing bacteriophages and first restriction map.

    PubMed Central

    Marchal, C; Greenblatt, J; Hofnung, M

    1978-01-01

    By starting from an Escherichia coli K-12 strain with a lambda phage integrated in the malB region, series of transducing phages carrying part or all of the malB region have been isolated. Genetic mapping of the transduced malB fragments was accomplished by complementation and recombination with known mutations in the region. By using the DNA of these phages, it was found that the malB region is cleaved by the restriction enzymes BglII, EcoRI, HaeII, HincII, SalI, and SstI, but not BamHI, HindIII, KpnI, PstI, XbaI, or XhoI. A physical map was constructed and tentatively correlated with the genetic map. Images PMID:363689

  16. Reactions of BglI and other type II restriction endonucleases with discontinuous recognition sites.

    PubMed

    Gormley, N A; Bath, A J; Halford, S E

    2000-03-10

    Type II restriction enzymes generally recognize continuous sequences of 4-8 consecutive base pairs on DNA, but some recognize discontinuous sites where the specified sequence is interrupted by a defined length of nonspecific DNA. To date, a mechanism has been established for only one type II endonuclease with a discontinuous site, SfiI at GGCCNNNNNGGCC (where N is any base). In contrast to orthodox enzymes such as EcoRV, dimeric proteins that act at a single site, SfiI is a tetramer that interacts with two sites before cleaving DNA. BglI has a similar recognition sequence (GCCNNNNNGGC) to SfiI but a crystal structure like EcoRV. BglI and several other endonucleases with discontinuous sites were examined to see if they need two sites for their DNA cleavage reactions. The enzymes included some with sites containing lengthy segments of nonspecific DNA, such as XcmI (CCANNNNNNNNNTGG). In all cases, they acted at individual sites. Elongated recognition sites do not necessitate unusual reaction mechanisms. Other experiments on BglI showed that it bound to and cleaved DNA in the same manner as EcoRV, thus further delineating a distinct group of restriction enzymes with similar structures and a common reaction mechanism.

  17. 1996 Hanford site report on land disposal restrictions for mixed waste

    SciTech Connect

    Black, D.G.

    1996-04-01

    This report was submitted to meet the requirements of Hanford Federal Facility Agreement and Consent Order milestone M-26-OIF. This milestone requires the preparation of an annual report that covers characterization, treatment, storage, minimization, and other aspects of land disposal-restricted mixed waste management at the Hanford Site.

  18. Genome filtering using methylation-sensitive restriction enzymes with six-base pair recognition sites

    USDA-ARS?s Scientific Manuscript database

    The large fraction of repetitive DNA in many plant genomes has complicated all aspects of DNA sequencing and assembly, and thus techniques that enrich for genes and low-copy sequences have been employed to isolate gene space. Methyl sensitive restriction enzymes with six base pair recognition sites...

  19. 13. "CIVIL, SITE PLAN AND VICINITY MAP, AREA LOCATIONS." Test ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    13. "CIVIL, SITE PLAN AND VICINITY MAP, AREA LOCATIONS." Test Area 1-125. Specifications No. ENG (NASA)-04-35363-1; Drawing No. 60-09-34; sheet 11. Ref. No. C-l. D.O. SERIES 1597/1. Approved for siting on 24 April 1962. - Edwards Air Force Base, Air Force Rocket Propulsion Laboratory, Leuhman Ridge near Highways 58 & 395, Boron, Kern County, CA

  20. An integrated restriction fragment length polymorphism--amplified fragment length polymorphism linkage map for cultivated sunflower.

    PubMed

    Gedil, M A; Wye, C; Berry, S; Segers, B; Peleman, J; Jones, R; Leon, A; Slabaugh, M B; Knapp, S J

    2001-04-01

    Restriction fragment length polymorphism (RFLP) maps have been constructed for cultivated sunflower (Helianthus annuus L.) using three independent sets of RFLP probes. The aim of this research was to integrate RFLP markers from two sets with RFLP markers for resistance gene candidate (RGC) and amplified fragment length polymorphism (AFLP) markers. Genomic DNA samples of HA370 and HA372, the parents of the F2 population used to build the map, were screened for AFLPs using 42 primer combinations and RFLPs using 136 cDNA probes (RFLP analyses were performed on DNA digested with EcoRI, HindIII, EcoRV, or DraI). The AFLP primers produced 446 polymorphic and 1101 monomorphic bands between HA370 and HA372. The integrated map was built by genotyping 296 AFLP and 104 RFLP markers on 180 HA370 x HA372 F2 progeny (the AFLP marker assays were performed using 18 primer combinations). The HA370 x HA372 map comprised 17 linkage groups, presumably corresponding to the 17 haploid chromosomes of sunflower, had a mean density of 3.3 cM, and was 1326 cM long. Six RGC RFLP loci were polymorphic and mapped to three linkage groups (LG8, LG13, and LG15). AFLP markers were densely clustered on several linkage groups, and presumably reside in centromeric regions where recombination is reduced and the ratio of genetic to physical distance is low. Strategies for targeting markers to euchromatic DNA need to be tested in sunflower. The HA370 x HA372 map integrated 14 of 17 linkage groups from two independent RFLP maps. Three linkage groups were devoid of RFLP markers from one of the two maps.

  1. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.

    PubMed

    Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo

    2017-06-25

    Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.

  2. Considerations for applying digital soil mapping to ecological sites

    USDA-ARS?s Scientific Manuscript database

    Recent advancements in the spatial prediction of soil properties are not currently being fully utilized for ecological studies. Linking digital soil mapping (DSM) with ecological sites (ES) has the potential to better land management decisions by improving spatial resolution and precision as well as...

  3. Photocopy: Composite Map of Crossing Site by Daniel J. Mordell ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Photocopy: Composite Map of Crossing Site by Daniel J. Mordell from Canal Society of New York State. Bottoming Out: Useful and Interesting Notes Collected for Members of the Canal Society of New York State. Vol. 18-19. Syracuse, 1962. - Erie Canal (Enlarged), Schoharie Creek Aqueduct, Spanning Schoharie Creek, Fort Hunter, Montgomery County, NY

  4. DNA translocation blockage, a general mechanism of cleavage site selection by type I restriction enzymes.

    PubMed Central

    Janscak, P; MacWilliams, M P; Sandmeier, U; Nagaraja, V; Bickle, T A

    1999-01-01

    Type I restriction enzymes bind to a specific DNA sequence and subsequently translocate DNA past the complex to reach a non-specific cleavage site. We have examined several potential blocks to DNA translocation, such as positive supercoiling or a Holliday junction, for their ability to trigger DNA cleavage by type I restriction enzymes. Introduction of positive supercoiling into plasmid DNA did not have a significant effect on the rate of DNA cleavage by EcoAI endonuclease nor on the enzyme's ability to select cleavage sites randomly throughout the DNA molecule. Thus, positive supercoiling does not prevent DNA translocation. EcoR124II endonuclease cleaved DNA at Holliday junctions present on both linear and negatively supercoiled substrates. The latter substrate was cleaved by a single enzyme molecule at two sites, one on either side of the junction, consistent with a bi-directional translocation model. Linear DNA molecules with two recognition sites for endonucleases from different type I families were cut between the sites when both enzymes were added simultaneously but not when a single enzyme was added. We propose that type I restriction enzymes can track along a DNA substrate irrespective of its topology and cleave DNA at any barrier that is able to halt the translocation process. PMID:10228175

  5. S.M.A.R.T. map: Site map attribute retrieval technique

    SciTech Connect

    Brown-Rall, M.

    1995-03-29

    Plant Engineering`s Space and Site Planning (S&SP) organization at Lawrence Livermore National Laboratory (LLNL) has developed a new tool, which is a computerized mapping system that can graphically illustrate facility characteristics. The current ``base`` map being used is the LLNL Site Map prepared by Plant Engineering`s CADD Support group. Using current information in the Facility Information Tracking System (FITS) database, a Microsoft Excel spreadsheet, an electronic sort can be made, tying in the AutoCAD-generated site map to specific database fields. This link is accomplished by using a software overlay called the CadPLUS InfoEngine. The fields in the database include such things as, facility number, occupant program, population, facility age, facility quality, security level, etc. By selecting one or a combination of the fields, a map is generated, illustrating in color and hatch patterns the facilities or entities that are associated with the chosen fields. This process can be very useful for seeing the LLNL site at a glance, with highlighted characteristics for particular areas of interest. The generation of large complex graphics, using large-scale databases selectively, can be accomplished quickly. These extractions and links between data and graphics create a S.M.A.R.T. Map.

  6. Identification of a single HNH active site in type IIS restriction endonuclease Eco31I.

    PubMed

    Jakubauskas, Arturas; Giedriene, Jolanta; Bujnicki, Janusz M; Janulaitis, Arvydas

    2007-06-29

    Type IIS restriction endonuclease Eco31I is a "short-distance cutter", which cleaves DNA strands close to its recognition sequence, 5'-GGTCTC(1/5). Previously, it has been proposed that related endonucleases recognizing a common sequence core GTCTC possess two active sites for cleavage of both strands in the DNA substrate. Here, we present bioinformatic identification and experimental evidence for a single nuclease active site. We identified a short region of homology between Eco31I and HNH nucleases, constructed a three-dimensional model of the putative catalytic domain and validated our predictions by random and site-specific mutagenesis. The restriction mechanism of Eco31I is suggested by analogy to the mechanisms of phage T4 endonuclease VII and homing endonuclease I-PpoI. We propose that residues D311 and N334 coordinate the cofactor. H312 acts as a general base-activating water molecule for the nucleophilic attack. K337 together with R340 and D345 are located in close proximity to the active center and are essential for correct folding of catalytic motif, while D345 together with R264 and D273 could be directly involved in DNA binding. We also predict that the Eco31I catalytic domain contains a putative Zn-binding site, which is essential for its structural integrity. Our results suggest that the HNH-like active site is involved in the cleavage of both strands in the DNA substrate. On the other hand, analysis of site-specific mutants in the region, previously suggested to harbor the second active site, revealed its irrelevance to the nuclease activity. Thus, our data argue against the earlier prediction and indicate the presence of a single conserved active site in type IIS restriction endonucleases that recognize common sequence core GTCTC.

  7. Type III restriction endonucleases translocate DNA in a reaction driven by recognition site-specific ATP hydrolysis.

    PubMed

    Meisel, A; Mackeldanz, P; Bickle, T A; Krüger, D H; Schroeder, C

    1995-06-15

    Type III restriction/modification systems recognize short non-palindromic sequences, only one strand of which can be methylated. Replication of type III-modified DNA produces completely unmethylated recognition sites which, according to classical mechanisms of restriction, should be signals for restriction. We have shown previously that suicidal restriction by the type III enzyme EcoP15I is prevented if all the unmodified sites are in the same orientation: restriction by EcoP15I requires a pair of unmethylated, inversely oriented recognition sites. We have now addressed the molecular mechanism of site orientation-specific DNA restriction. EcoP15I is demonstrated to possess an intrinsic ATPase activity, the potential driving force of DNA translocation. The ATPase activity is uniquely recognition site-specific, but EcoP15I-modified sites also support the reaction. EcoP15I DNA restriction patterns are shown to be predetermined by the enzyme-to-site ratio, in that site-saturating enzyme levels elicit cleavage exclusively between the closest pair of head-to-head oriented sites. DNA restriction is blocked by Lac repressor bound in the intervening sequence between the two EcoP15I sites. These results rule out DNA looping and strongly suggest that cleavage is triggered by the close proximity of two convergently tracking EcoP15I-DNA complexes.

  8. Restriction mapping of synthetic thyroglobulin structural gene as a means of investigating thyroglobulin structure.

    PubMed

    Vassart, G; Brocas, H

    1980-11-14

    Bovine 33 S thyroglobulin mRNA was reverse transcribed into double-stranded DNA under conditions allowing the synthesis of a complete 8 kilobase pair copy. A physical map of the resulting synthetic thyroglobulin structural gene was constructed using six restriction endonucleases. The following conclusions could be drawn: (i) the polypeptide chains in thyroglobulin subunits are identical; (ii) thyroglobulin is composed of a major class of molecules sharing the same primary structure; (iii) there is no evidence for precise internal repetition in the structure of thyroglobulin subunits.

  9. Protection of particular cleavage sites of restriction endonucleases by distamycin A and actinomycin D.

    PubMed Central

    Nosikov, V V; Braga, E A; Karlishev, A V; Zhuze, A L; Polyanovsky, O L

    1976-01-01

    It is shown here that distamycin A and actinomycin D can protect the recognition sites of endo R.EcoRI, EcoRII, HindII, HindIII, HpaI and HpaII from the attack of these restriction endonucleases. At proper distamycin concentrations only two endo R.EcoRI sites of phage lambda DNA are available for the restriction enzyme--sRI1 and sRI4. This phenomenon results in the appearance of larger DNA fragments comprising several consecutive fragments of endo R.EcoRI complete cleavage. The distamycin fragments isolated from the agarose gels can be subsequently cleaved by endo R.EcoRI with the yield of the fragments of complete digestion. We have compared the effect of distamycin A and actinomycin D on a number of restriction endonucleases having different nucleotide sequences in the recognition sites and established that antibiotic action depends on the nucleotide sequences of the recognition sites and their closest environment Images PMID:967694

  10. Leaf margin phenotype-specific restriction-site-associated DNA-derived markers for pineapple (Ananas comosus L.).

    PubMed

    Urasaki, Naoya; Goeku, Satoko; Kaneshima, Risa; Takamine, Tomonori; Tarora, Kazuhiko; Takeuchi, Makoto; Moromizato, Chie; Yonamine, Kaname; Hosaka, Fumiko; Terakami, Shingo; Matsumura, Hideo; Yamamoto, Toshiya; Shoda, Moriyuki

    2015-06-01

    To explore genome-wide DNA polymorphisms and identify DNA markers for leaf margin phenotypes, a restriction-site-associated DNA sequencing analysis was employed to analyze three bulked DNAs of F1 progeny from a cross between a 'piping-leaf-type' cultivar, 'Yugafu', and a 'spiny-tip-leaf-type' variety, 'Yonekura'. The parents were both Ananas comosus var. comosus. From the analysis, piping-leaf and spiny-tip-leaf gene-specific restriction-site-associated DNA sequencing tags were obtained and designated as PLSTs and STLSTs, respectively. The five PLSTs and two STSLTs were successfully converted to cleaved amplified polymorphic sequence (CAPS) or simple sequence repeat (SSR) markers using the sequence differences between alleles. Based on the genotyping of the F1 with two SSR and three CAPS markers, the five PLST markers were mapped in the vicinity of the P locus, with the closest marker, PLST1_SSR, being located 1.5 cM from the P locus. The two CAPS markers from STLST1 and STLST3 perfectly assessed the 'spiny-leaf type' as homozygotes of the recessive s allele of the S gene. The recombination value between the S locus and STLST loci was 2.4, and STLSTs were located 2.2 cM from the S locus. SSR and CAPS markers are applicable to marker-assisted selection of leaf margin phenotypes in pineapple breeding.

  11. Leaf margin phenotype-specific restriction-site-associated DNA-derived markers for pineapple (Ananas comosus L.)

    PubMed Central

    Urasaki, Naoya; Goeku, Satoko; Kaneshima, Risa; Takamine, Tomonori; Tarora, Kazuhiko; Takeuchi, Makoto; Moromizato, Chie; Yonamine, Kaname; Hosaka, Fumiko; Terakami, Shingo; Matsumura, Hideo; Yamamoto, Toshiya; Shoda, Moriyuki

    2015-01-01

    To explore genome-wide DNA polymorphisms and identify DNA markers for leaf margin phenotypes, a restriction-site-associated DNA sequencing analysis was employed to analyze three bulked DNAs of F1 progeny from a cross between a ‘piping-leaf-type’ cultivar, ‘Yugafu’, and a ‘spiny-tip-leaf-type’ variety, ‘Yonekura’. The parents were both Ananas comosus var. comosus. From the analysis, piping-leaf and spiny-tip-leaf gene-specific restriction-site-associated DNA sequencing tags were obtained and designated as PLSTs and STLSTs, respectively. The five PLSTs and two STSLTs were successfully converted to cleaved amplified polymorphic sequence (CAPS) or simple sequence repeat (SSR) markers using the sequence differences between alleles. Based on the genotyping of the F1 with two SSR and three CAPS markers, the five PLST markers were mapped in the vicinity of the P locus, with the closest marker, PLST1_SSR, being located 1.5 cM from the P locus. The two CAPS markers from STLST1 and STLST3 perfectly assessed the ‘spiny-leaf type’ as homozygotes of the recessive s allele of the S gene. The recombination value between the S locus and STLST loci was 2.4, and STLSTs were located 2.2 cM from the S locus. SSR and CAPS markers are applicable to marker-assisted selection of leaf margin phenotypes in pineapple breeding. PMID:26175625

  12. Global Land Survey Impervious Mapping Project Web Site

    NASA Technical Reports Server (NTRS)

    DeColstoun, Eric Brown; Phillips, Jacqueline

    2014-01-01

    The Global Land Survey Impervious Mapping Project (GLS-IMP) aims to produce the first global maps of impervious cover at the 30m spatial resolution of Landsat. The project uses Global Land Survey (GLS) Landsat data as its base but incorporates training data generated from very high resolution commercial satellite data and using a Hierarchical segmentation program called Hseg. The web site contains general project information, a high level description of the science, examples of input and output data, as well as links to other relevant projects.

  13. A Restriction Fragment Length Polymorphism Map and Electrophoretic Karyotype of the Fungal Maize Pathogen Cochliobolus Heterostrophus

    PubMed Central

    Tzeng, T. H.; Lyngholm, L. K.; Ford, C. F.; Bronson, C. R.

    1992-01-01

    A restriction fragment length polymorphism (RFLP) map has been constructed of the nuclear genome of the plant pathogenic ascomycete Cochliobolus heterostrophus. The segregation of 128 RFLP and 4 phenotypic markers was analyzed among 91 random progeny of a single cross; linkages were detected among 126 of the markers. The intact chromosomal DNAs of the parents and certain progeny were separated using pulsed field gel electrophoresis and hybridized with probes used to detect the RFLPs. In this way, 125 markers were assigned to specific chromosomes and linkages among 120 of the markers were confirmed. These linkages totalled 941 centimorgans (cM). Several RFLPs and a reciprocal translocation were identified tightly linked to Tox1, a locus controlling host-specific virulence. Other differences in chromosome arrangement between the parents were also detected. Fourteen gaps of at least 40 cM were identified between linkage groups on the same chromosomes; the total map length was therefore estimated to be, at a minimum, 1501 cM. Fifteen A chromosomes ranging from about 1.3 megabases (Mb) to about 3.7 Mb were identified; one of the strains also has an apparent B chromosome. This chromosome appears to be completely dispensable; in some progeny, all of 15 markers that mapped to this chromosome were absent. The total genome size was estimated to be roughly 35 Mb. Based on these estimates of map length and physical genome size, the average kb/cM ratio in this cross was calculated to be approximately 23. This low ratio of physical to map distance should make this RFLP map a useful tool for cloning genes. PMID:1346261

  14. Genetic fate mapping using site-specific recombinases.

    PubMed

    Legué, Emilie; Joyner, Alexandra L

    2010-01-01

    Understanding how cells are assembled in three dimensions to generate an organ, or a whole organism, is a pivotal question in developmental biology. Similarly, it is critical to understand how adult stem cells integrate into an existing organ during regeneration or in response to injury. Key to discovering the answers to these questions is being able to study the various behaviors of distinct cell types during development or regeneration. Fate mapping techniques are fundamental to studying cell behaviors such as proliferation, movement, and lineage segregation, as the techniques allow precursor cells to be marked and their descendants followed and characterized over time. The generation of transgenic mice, combined with the use of site-specific recombinases (SSR) in the mouse genome, has provided a means to develop powerful genetic fate mapping approaches. A key advantage of genetic fate mapping is that it allows cells to be genetically marked, and therefore the mark is transmitted to all the descendants of the initially marked cells. By making modifications to the SSRs that render their enzymatic activity inducible, and the development of an assortment of reporter alleles for marking cells, increasingly sophisticated genetic fate mapping studies can be performed. In this chapter, we review the four main genetic fate mapping methods that utilize intrachromosomal recombination to mark cells (cumulative, inducible, clonal, and intersectional) and one interchromosomal method, the tools required to carry out each approach, and the practical considerations that have to be taken into account before embarking on each type of genetic fate mapping study.

  15. Discrimination of SHV β-Lactamase Genes by Restriction Site Insertion-PCR

    PubMed Central

    Chanawong, Aroonwadee; M'Zali, Fatima Hannachi; Heritage, John; Lulitanond, Aroonlug; Hawkey, Peter Michael

    2001-01-01

    Restriction site insertion-PCR (RSI-PCR) is a simple, rapid technique for detection of point mutations. This technique exploits primers with one to three base mismatches near the 3′ end to modulate a restriction site. We have developed this technique to identify described mutations of the blaSHV genes for differentiation of SHV variants that cannot be distinguished easily by other techniques. To validate this method, eight standard strains were used, each producing a different SHV β-lactamase: SHV-1, SHV-2, SHV-3, SHV-4, SHV-5, SHV-6, SHV-8, and SHV-18. Mismatch primers were designed to detect mutations affecting amino acids at positions 8 (SspI), 179 (HinfI), 205 (PstI), 238 (Gly→Ala) (BsrI), and 240 (NruI) of blaSHV genes. All amplimers of the blaSHV genes used in this study yielded the predicted restriction endonuclease digestion products. In addition, this study also makes theoretical identification of blaSHV-6, blaSHV-8, and 12 novel blaSHV variants using the PCR-restriction fragment length polymorphism (RFLP) technique possible. By using a combination of PCR-RFLP and RSI-PCR techniques, up to 27 SHV variants can now be distinguished rapidly and reliably. These simple techniques are readily applied to epidemiological studies of the SHV β-lactamases and may be extended to the characterisation of other resistance determinants. PMID:11408231

  16. Application of natural and amplification created restriction sites for the diagnosis of PKU mutations.

    PubMed Central

    Eiken, H G; Odland, E; Boman, H; Skjelkvåle, L; Engebretsen, L F; Apold, J

    1991-01-01

    PCR amplification, either conventional, or as site directed mutagenesis using primers with mismatched 3'-ends, followed by restriction endonuclease digestion, provides rapid, non-isotope assays of known mutations in the human phenylalanine hydroxylase gene. Such assays were shown to have the potential to detect all of the 18 presently reported phenylketonuria mutations. The practical applicability of this approach was demonstrated for eight mutations in Norwegian phenylketonuria patients, among them the most common ones. Images PMID:1851292

  17. Optical Whole-Genome Restriction Mapping as a Tool for Rapidly Distinguishing and Identifying Bacterial Contaminants in Clinical Samples

    PubMed Central

    Baldwin, James C.

    2015-01-01

    Introduction Optical restriction genome mapping is a technology in which a genome is linearized on a surface and digested with specific restriction enzymes, giving an arrangement of the genome with gaps whose order and size are unique for a given organism. Current applications of this technology include assisting with the correct scaffolding and ordering of genomes in conjunction with whole-genome sequencing, observation of genetic drift and evolution using comparative genomics and epidemiological monitoring of the spread of infections. Here, we investigated the suitability of genome mapping for use in clinical labs as a potential diagnostic tool. Materials and Methods Using whole genome mapping, we investigated the basic performance of the technology for identifying two bacteria of interest for food-safety (Lactobacilli spp. and Enterohemorrhagic Escherichia coli). We further evaluated the performance for identifying multiple organisms from both simple and complex mixtures. Results We were able to successfully generate optical restriction maps of four Lactobacillus species as well as a strain of Enterohemorrhagic Escherichia coli from within a mixed solution, each distinguished using a common compatible restriction enzyme. Finally, we demonstrated that optical restriction maps were successfully obtained and the correct organism identified within a clinical matrix. Conclusion With additional development, whole genome mapping may be a useful clinical tool for rapid invitro diagnostics. PMID:26435946

  18. Optical Whole-Genome Restriction Mapping as a Tool for Rapidly Distinguishing and Identifying Bacterial Contaminants in Clinical Samples.

    PubMed

    Chapleau, Richard R; Baldwin, James C

    2015-08-01

    Optical restriction genome mapping is a technology in which a genome is linearized on a surface and digested with specific restriction enzymes, giving an arrangement of the genome with gaps whose order and size are unique for a given organism. Current applications of this technology include assisting with the correct scaffolding and ordering of genomes in conjunction with whole-genome sequencing, observation of genetic drift and evolution using comparative genomics and epidemiological monitoring of the spread of infections. Here, we investigated the suitability of genome mapping for use in clinical labs as a potential diagnostic tool. Using whole genome mapping, we investigated the basic performance of the technology for identifying two bacteria of interest for food-safety (Lactobacilli spp. and Enterohemorrhagic Escherichia coli). We further evaluated the performance for identifying multiple organisms from both simple and complex mixtures. We were able to successfully generate optical restriction maps of four Lactobacillus species as well as a strain of Enterohemorrhagic Escherichia coli from within a mixed solution, each distinguished using a common compatible restriction enzyme. Finally, we demonstrated that optical restriction maps were successfully obtained and the correct organism identified within a clinical matrix. With additional development, whole genome mapping may be a useful clinical tool for rapid invitro diagnostics.

  19. Long-distance restriction mapping of the proximal long arm of human chromosome 21 with Not I linking clones

    SciTech Connect

    Ichikawa, Hitoshi; Shimizu, Kimiko; Saito, Akihiko; Miyoshi, Hiroyuki; Ohki, Misao ); Wang, Denan; Oliva, R.; Smith, C.L.; Cantor, C.R. Lawrence Berkeley Lab., CA ); Kobayashi, Hirofumi; Keneko, Yasuhiko )

    1992-01-01

    Human chromosome 21 is the smallest of the 22 autosomes and 2 sex chromosomes. Hybridization of the human repetitive sequence Alu to pulsed-field gel-fractionated Not I-digested genomic DNA from a human-mouse hybrid cell line containing chromosome 21 as the sole human component identified chromosome 21 Not I restriction fragments. A Not I restriction map of regions of the chromosome was constructed, by identifying neighboring Alu bands with Not I linking clones. This approach simplifies the task of physical mapping and avoids ambiguities in Not I fragment assignments that arise from gel-to-gel mobility variations. A contiguous map was constructed with six Not I linking clones that covers at least the proximal one-third of the long arm of chromosome 21 and spans 20 megabases. A more detailed restriction map revealed 11 likely CpG islands in this region and localized 11 additional DNA markers.

  20. An in-depth map of polyadenylation sites in cancer.

    PubMed

    Lin, Yuefeng; Li, Zhihua; Ozsolak, Fatih; Kim, Sang Woo; Arango-Argoty, Gustavo; Liu, Teresa T; Tenenbaum, Scott A; Bailey, Timothy; Monaghan, A Paula; Milos, Patrice M; John, Bino

    2012-09-01

    We present a comprehensive map of over 1 million polyadenylation sites and quantify their usage in major cancers and tumor cell lines using direct RNA sequencing. We built the Expression and Polyadenylation Database to enable the visualization of the polyadenylation maps in various cancers and to facilitate the discovery of novel genes and gene isoforms that are potentially important to tumorigenesis. Analyses of polyadenylation sites indicate that a large fraction (∼30%) of mRNAs contain alternative polyadenylation sites in their 3' untranslated regions, independent of the cell type. The shortest 3' untranslated region isoforms are preferentially upregulated in cancer tissues, genome-wide. Candidate targets of alternative polyadenylation-mediated upregulation of short isoforms include POLR2K, and signaling cascades of cell-cell and cell-extracellular matrix contact, particularly involving regulators of Rho GTPases. Polyadenylation maps also helped to improve 3' untranslated region annotations and identify candidate regulatory marks such as sequence motifs, H3K36Me3 and Pabpc1 that are isoform dependent and occur in a position-specific manner. In summary, these results highlight the need to go beyond monitoring only the cumulative transcript levels for a gene, to separately analysing the expression of its RNA isoforms.

  1. Nonrandom association of polymorphic restriction sites in the beta-globin gene cluster.

    PubMed

    Antonarakis, S E; Boehm, C D; Giardina, P J; Kazazian, H H

    1982-01-01

    By using probes for epsilon-, Psibeta(1)-, and beta-globin genes, we found four additional polymorphic restriction sites that have frequencies >0.1 in persons of Mediterranean area origin, Asian Indians, and American Blacks. Three of these (HincII sites) and the two previously described polymorphic HindIII sites [one in intervening sequence (IVS) II of each gamma-globin gene] are distributed over 32 kilobases (kb) of DNA located 5' to the delta-globin gene. This region of DNA comprises two-thirds of the beta-globin gene cluster. Since each of these five polymorphic sites can be present (+) or absent (-), in theory there exist 32 possible combinations of sites (haplotypes). However, in Italians, Greeks, Indians, and Turks, 3 of the 32 haplotypes, (+----), (-+-++), and (-++-+), account for 92% of 89 beta(A) chromosomes examined. The observed frequencies for these haplotypes are 0.64, 0.15, and 0.13 in the populations studied, in contrast to expected frequencies (based on the observed gene frequencies at each of the five sites) of 0.20, 0.006, and 0.005, respectively. In American Blacks, a fourth haplotype, (----+), which is rare in non-Black populations, has a frequency of 0.37 in contrast to its expected frequency of 0.05. These results suggest a nonrandom association of DNA sequences over 32 kb 5' to the delta-globin gene in all populations studied. Two other polymorphic sites 3' to the delta gene (the newly discovered Ava II site in IVS II of the beta-globin gene and the BamHI site 3' to it) are nonrandomly associated with each other but randomly distributed with respect to the above haplotypes. This suggests that randomization of sequences has occurred within 12 kb of DNA between these two nonrandomly associated sequence clusters. Nonrandom association of polymorphic restriction sites has practical consequences in that it limits the usefulness of these additional HincII sites for prenatal diagnosis of hemoglobinopathies by linkage analysis. These sites provide

  2. Restriction-Modification systems interplay causes avoidance of GATC site in prokaryotic genomes.

    PubMed

    Ershova, Anna; Rusinov, Ivan; Vasiliev, Mikhail; Spirin, Sergey; Karyagina, Anna

    2016-04-01

    Palindromes are frequently underrepresented in prokaryotic genomes. Palindromic 5[Formula: see text]-GATC-3[Formula: see text] site is a recognition site of different Restriction-Modification (R-M) systems, as well as solitary methyltransferase Dam. Classical GATC-specific R-M systems methylate GATC and cleave unmethylated GATC. On the contrary, methyl-directed Type II restriction endonucleases cleave methylated GATC. Methylation of GATC by Dam methyltransferase is involved in the regulation of different cellular processes. The diversity of functions of GATC-recognizing proteins makes GATC sequence a good model for studying the reasons of palindrome avoidance in prokaryotic genomes. In this work, the influence of R-M systems and solitary proteins on the GATC site avoidance is described by a mathematical model. GATC avoidance is strongly associated with the presence of alternate (methyl-directed or classical Type II R-M system) genes in different strains of the same species, as we have shown for Streptococcus pneumoniae, Neisseria meningitidis, Eubacterium rectale, and Moraxella catarrhalis. We hypothesize that GATC avoidance can result from a DNA exchange between strains with different methylation status of GATC site within the process of natural transformation. If this hypothesis is correct, the GATC avoidance is a sign of a DNA exchange between bacteria with different methylation status in a mixed population.

  3. SDM-Assist software to design site-directed mutagenesis primers introducing “silent” restriction sites

    PubMed Central

    2013-01-01

    Background Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. Results We have developed a program – ‘SDM-Assist’ which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of ‘mutated clones’ by a simple restriction digest. Conclusions The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs. PMID:23522286

  4. Cartographic Mapping of Mars Landing Sites: A Historical Perspective

    NASA Technical Reports Server (NTRS)

    Duxbury, Thomas C.

    2007-01-01

    Initial mapping of Mars began with the early Mariner 4, 6 and 7 flybys in the 1960's. Mariner 9 obtained the first global coverage of Mars in 1971. Viking Orbiters 1 and 2 added new and higher resolution global coverage. The US Geological Survey produced the first digital global cartographic map products in black and white and in color, the mosaicked digital image models (MDIMs). In 1989, the Phobos 88 mission added imaging as well as multispectral mapping of Mars in the equatorial region. The Mars Global Surveyor (MGS) added to the black and white and color global coverage. The most important development for Mars cartography occurred on MGS with its global coverage of Mars using the Mars Observer Laser Altimeter (MOL A) producing precision ground control in latitude, longitude and radius. The next version of the MDIM was produced at 230 m spatial resolution using MOLA precision cartographic control. The Mars Odyssey mission THEMIS instrument has completed its global infrared mapping of Mars at 100 m spatial resolution. The Mars Express mission is completing its global coverage of Mars in stereo at 100 m spatial resolution or better. MGS, Odyssey and Mars Express continue to provide limited surface coverage at the 1 to 20 m resolution. Currently the new Mars Reconnaissance Orbiter is producing images at the 10's of cm level. All of these datasets provide a rich and historic perspective of Mars covering nearly five decades and allow global cartographic map products to be produced in visual and infrared at the 100 m level with specialized cartographic maps being produced for landing sites at the meter or sub-meter spatial resolution level. This work was produced at the Jet Propulsion Laboratory, California Institute of Technology under contract to the National Aeronautics and Space Administration, NAS 7-7120.5d, within the NASA Mars Data Analysis Program and the MGS, Odyssey, Mars Express and MRO Participating Scientist Programs.

  5. Cartographic Mapping of Mars Landing Sites: A Historical Perspective

    NASA Technical Reports Server (NTRS)

    Duxbury, Thomas C.

    2007-01-01

    Initial mapping of Mars began with the early Mariner 4, 6 and 7 flybys in the 1960's. Mariner 9 obtained the first global coverage of Mars in 1971. Viking Orbiters 1 and 2 added new and higher resolution global coverage. The US Geological Survey produced the first digital global cartographic map products in black and white and in color, the mosaicked digital image models (MDIMs). In 1989, the Phobos 88 mission added imaging as well as multispectral mapping of Mars in the equatorial region. The Mars Global Surveyor (MGS) added to the black and white and color global coverage. The most important development for Mars cartography occurred on MGS with its global coverage of Mars using the Mars Observer Laser Altimeter (MOL A) producing precision ground control in latitude, longitude and radius. The next version of the MDIM was produced at 230 m spatial resolution using MOLA precision cartographic control. The Mars Odyssey mission THEMIS instrument has completed its global infrared mapping of Mars at 100 m spatial resolution. The Mars Express mission is completing its global coverage of Mars in stereo at 100 m spatial resolution or better. MGS, Odyssey and Mars Express continue to provide limited surface coverage at the 1 to 20 m resolution. Currently the new Mars Reconnaissance Orbiter is producing images at the 10's of cm level. All of these datasets provide a rich and historic perspective of Mars covering nearly five decades and allow global cartographic map products to be produced in visual and infrared at the 100 m level with specialized cartographic maps being produced for landing sites at the meter or sub-meter spatial resolution level. This work was produced at the Jet Propulsion Laboratory, California Institute of Technology under contract to the National Aeronautics and Space Administration, NAS 7-7120.5d, within the NASA Mars Data Analysis Program and the MGS, Odyssey, Mars Express and MRO Participating Scientist Programs.

  6. Maps of open chromatin highlight cell type-restricted patterns of regulatory sequence variation at hematological trait loci.

    PubMed

    Paul, Dirk S; Albers, Cornelis A; Rendon, Augusto; Voss, Katrin; Stephens, Jonathan; van der Harst, Pim; Chambers, John C; Soranzo, Nicole; Ouwehand, Willem H; Deloukas, Panos

    2013-07-01

    Nearly three-quarters of the 143 genetic signals associated with platelet and erythrocyte phenotypes identified by meta-analyses of genome-wide association (GWA) studies are located at non-protein-coding regions. Here, we assessed the role of candidate regulatory variants associated with cell type-restricted, closely related hematological quantitative traits in biologically relevant hematopoietic cell types. We used formaldehyde-assisted isolation of regulatory elements followed by next-generation sequencing (FAIRE-seq) to map regions of open chromatin in three primary human blood cells of the myeloid lineage. In the precursors of platelets and erythrocytes, as well as in monocytes, we found that open chromatin signatures reflect the corresponding hematopoietic lineages of the studied cell types and associate with the cell type-specific gene expression patterns. Dependent on their signal strength, open chromatin regions showed correlation with promoter and enhancer histone marks, distance to the transcription start site, and ontology classes of nearby genes. Cell type-restricted regions of open chromatin were enriched in sequence variants associated with hematological indices. The majority (63.6%) of such candidate functional variants at platelet quantitative trait loci (QTLs) coincided with binding sites of five transcription factors key in regulating megakaryopoiesis. We experimentally tested 13 candidate regulatory variants at 10 platelet QTLs and found that 10 (76.9%) affected protein binding, suggesting that this is a frequent mechanism by which regulatory variants influence quantitative trait levels. Our findings demonstrate that combining large-scale GWA data with open chromatin profiles of relevant cell types can be a powerful means of dissecting the genetic architecture of closely related quantitative traits.

  7. Restriction endonuclease mapping of ribosomal RNA genes: sequence divergence and the origin of the tetraploid treefrog Hyla versicolor.

    PubMed

    Romano, P R; Vaughn, J C

    1986-06-01

    Hyla chrysoscelis (2n = 24) and H. versicolor (2n = 48) are a diploid-tetraploid species pair of treefrogs. Restriction endonuclease mapping of ribosomal RNA (rRNA) gene repeat units of diploids collected from eastern and western populations reveals no differences within rRNA gene coding regions but distinctive differences within the nontranscribed spacers. A minimum of two physical maps is required to construct an rRNA gene map for the tetraploid, whose repeat units appear to be a composite, with about 50% of the elements resembling the "western" diploid population and about 50% resembling the "eastern" population. These results imply that this population of the tetraploid species may have arisen from a genetically hybrid diploid. Alternatively, the dual level of sequence heterogeneity in H. versicolor may reflect some type of gene flow between the two species. The coding region of the rRNA genes in the tetraploid differs from that in either diploid in about 20% of all repeat units, as exemplified by a BamHI site located near the 5' terminus of the 28 S rRNA gene. If the 20% variant class of 28 S rRNA gene coding sequences is expressed, then there must be two structural classes of ribosomes; if only the 80% sequence class is expressed, then a genetic control mechanism must be capable of distinguishing between the two different sequence variants. It is postulated that the 20% variant sequence class may be correlated with a partial functional diploidization of rRNA genes in the tetraploid species.

  8. Site classification map for Tbilisi using seismic prospecting methods

    NASA Astrophysics Data System (ADS)

    Goguadze, Nino; Gventcadze, Aleko; Arabidze, Vakhtang; Tsereteli, Emil; Gaphrindashvili, Giorgi

    2013-04-01

    This aspect deserves major attention since it plays considerable role in the definition of the seismic impact to be considered in the design and retrofitting of structures. The most important parameter of soil maps of seismic site conditions, the shear wave velocity in the upper 30 m section of the ground (VS30) on regional scales are relatively rare since they require substantial investment in geological and geotechnical data acquisition and interpretation. Work presented here was initiated by working package wp5 of regional projects EMME (Earthquake Model for Middle East Region). In the frame of the project geophysical field work were done in some parts of Tbilisi. Seismic prospecting measurements were done along some profiles. In seismic= prospecting RAS-24 was used and obtained data is processed by Winsism V.12 (refraction analysis ). Second version of soil classification for Tbilisi city was done on the basis of new geo-engineering map of 1: 25 000 scales. For this the number of engineering-geological researches and generalization on the territory of Tbilisi were processed, All the Geological and Engineer-geological reports, that were collected and processed. Since in the geological reports less attention is paid to the genesis of the quaternary sediments and their lithological description, and in this regard the territory of Tbilisi is very difficult and multi-spectrum, it was necessary to conduct additional field surveys in 10 districts to specify information. Finely combining information that comes from seismoprospecting measurements and geo-engineering map the new site classification map expressed in Vs30 were derived for Tbilisi city.

  9. Evaluation of Mapping Methodologies at a Legacy Test Site

    NASA Astrophysics Data System (ADS)

    Sussman, A. J.; Schultz-Fellenz, E. S.; Roback, R. C.; Kelley, R. E.; Drellack, S.; Reed, D.; Miller, E.; Cooper, D. I.; Sandoval, M.; Wang, R.

    2013-12-01

    On June 12th, 1985, a nuclear test with an announced yield between 20-150kt was detonated in rhyolitic lava in a vertical emplacement borehole at a depth of 608m below the surface. This test did not collapse to the surface and form a crater, but rather resulted in a subsurface collapse with more subtle surface expressions of deformation, providing an opportunity to evaluate the site using a number of surface mapping methodologies. The site was investigated over a two-year time span by several mapping teams. In order to determine the most time efficient and accurate approach for mapping post-shot surface features at a legacy test site, a number of different techniques were employed. The site was initially divided into four quarters, with teams applying various methodologies, techniques, and instrumentations to each quarter. Early methods included transect lines and site gridding with a Brunton pocket transit, flagging tape, measuring tape, and stakes; surveying using a hand-held personal GPS to locate observed features with an accuracy of × 5-10m; and extensive photo-documentation. More recent methods have incorporated the use of near survey grade GPS devices to allow careful location and mapping of surface features. Initially, gridding was employed along with the high resolution GPS surveys, but this was found to be time consuming and of little observational value. Raw visual observation (VOB) data included GPS coordinates for artifacts or features of interest, field notes, and photographs. A categorization system was used to organize the myriad of items, in order to aid in database searches and for visual presentation of findings. The collected data set was imported into a geographic information system (GIS) as points, lines, or polygons and overlain onto a digital color orthophoto map of the test site. Once these data were mapped, spectral data were collected using a high resolution field spectrometer. In addition to geo-locating the field observations with 10cm

  10. Gaussian mapping of chemical fragments in ligand binding sites

    NASA Astrophysics Data System (ADS)

    Wang, Kun; Murcia, Marta; Constans, Pere; Pérez, Carlos; Ortiz, Angel R.

    2004-02-01

    We present a new approach to automatically define a quasi-optimal minimal set of pharmacophoric points mapping the interaction properties of a user-defined ligand binding site. The method is based on a fitting algorithm where a grid of sampled interaction energies of the target protein with small chemical fragments in the binding site is approximated by a linear expansion of Gaussian functions. A heuristic approximation selects from this expansion the smallest possible set of Gaussians required to describe the interaction properties of the binding site within a prespecified accuracy. We have evaluated the performance of the approach by comparing the computed Gaussians with the positions of aromatic sites found in experimental protein-ligand complexes. For a set of 53 complexes, good correspondence is found in general. At a 95% significance level, ˜65% of the predicted interaction points have an aromatic binding site within 1.5 Å. We then studied the utility of these points in docking using the program DOCK. Short docking times, with an average of ˜0.18 s per conformer, are obtained, while retaining, both for rigid and flexible docking, the ability to sample native-like binding modes for the ligand. An average 4-5-fold speed-up in docking times and a similar success rate is estimated with respect to the standard DOCK protocol. Abbreviations: RMSD - root mean square deviation; ASA - Atomic Shell Approximation; LSF - Least-Squares Fitting; 3D - three-dimensional; VDW - Van der Waals.

  11. Activation of geminivirus V-sense promoters in roots is restricted to nematode feeding sites.

    PubMed

    Escobar, Carolina; García, Alejandra; Aristizábal, Fabio; Portillo, Mary; Herreros, Esther; Munoz-Martín, M Angeles; Grundler, Florian; Mullineaux, Phillip M; Fenoll, Carmen

    2010-05-01

    Obligate sedentary endoparasitic nematodes, such as the root-knot and cyst nematodes, elicit the differentiation of specialized nematode nurse or feeding cells [nematode feeding sites (NFS), giant cells and syncytia, respectively]. During NFS differentiation, marked changes in cell cycle progression occur, partly similar to those induced by some geminiviruses. In this work, we describe the activation of V-sense promoters from the Maize streak virus (MSV) and Wheat dwarf virus (WDV) in NFS formed by root-knot and cyst nematodes. Both promoters were transiently active in microinjection experiments. In tobacco and Arabidopsis transgenic lines carrying promoter-beta-glucuronidase fusions, the MSV V-sense promoter was activated in the vascular tissues of aerial plant parts, primarily leaf and cotyledon phloem tissue and some floral structures. Interestingly, in roots, promoter activation was restricted to syncytia and giant cells tested with four different nematode populations, but undetectable in the rest of the root system. As the activity of the promoter in transgenic rootstocks should be restricted to NFS only, the MSV promoter may have utility in engineering grafted crops for nematode control. Therefore, this study represents a step in the provision of some of the much needed additional data on promoters with restricted activation in NFS useful in biotechnological nematode control strategies.

  12. Familial hyperproinsulinaemia due to a mutation substituting histidine for arginine at position 65 in proinsulin: identification of the mutation by restriction enzyme mapping.

    PubMed

    Collinet, M; Berthelon, M; Bénit, P; Laborde, K; Desbuquois, B; Munnich, A; Robert, J J

    1998-06-01

    Familial hyperproinsulinaemia is a rare genetic disorder characterized by point mutations in the insulin gene which impair the conversion of proinsulin to insulin. We report here three members of a two-generation Caucasian family in whom this syndrome was identified by unexplained hyperinsulinism associated with normal glucose tolerance and normal insulin sensitivity. Plasma insulin immunoreactivity showed a reduced affinity for the insulin receptor and eluted mainly, on Biogel chromatography, at the position of proinsulin. Analysis of the PCR-amplified insulin gene by restriction enzyme mapping revealed a new recognition site for the enzyme Nla III, indicating a Arg65 to His mutation. Sequence analysis of exon 3 confirmed this mutation in one allele of the gene. This study reports a two-generation European-Caucasian family with hyperproinsulinaemia due to a substitution of His for Arg at position 65 in proinsulin, the seventh now identified worldwide and the second from Europe. The mutation generated a new restriction site on the insulin gene suggesting the usefulness of restriction enzyme mapping as a screening procedure.

  13. Site and Orbit Repeatabilities using Adaptive Mapping Functions

    NASA Astrophysics Data System (ADS)

    Desjardins, Camille; Gegout, Pascal; Soudarin, Laurent; Biancale, Richard; Perosanz, Felix

    2015-04-01

    The electromagnetic signals emitted by the satellite positioning systems travel at the speed of light in a straight line in a vacuum but are modified in their propagation through the neutral atmosphere by temporal and spatial changes of density, and composition and refractivity. These waves are slowed down and their trajectories are bent. This presentation summarizes the performances of the modeling of the tropospheric propagation by the ray tracing technique through the assimilations of the European Meteorological Centre (ECMWF) in the framework of realizing the geodetic reference frame. This goal is achieved by modeling the spatial variability of the propagation using the time variable three-dimensional physical parameters of the atmosphere. The tropospheric delays obtained by ray tracing in all directions throughout the meteorological model surrounding the geodetic site, are fitted by Adaptive Mapping Functions (AMF) parameterized by several tens of coefficients. The delays produced by the Horizon software are then experimented, kept unchanged or adjusted, when recovering a reference frame based on hundred sites using the GINS software. Without any adjustments of the tropospheric modeling, the subcentimetric performances of the AMF are demonstrated by the repeatability of sites positions and GPS satellites orbits. When some AMF coefficients are adjusted, the accuracy of orbits recovery in term of quadratic mean is 7 to 8 millimeters. This limit is imposed by the lack or deficiency of other models, such as non-tidal and tidal loading respectively. Hence the repeatability of the vertical position is not enhanced by changing the propagation model. At the contrary, the repeatability of the horizontal position of geodetic sites is greatly enhanced by accounting for the azimuthal variability provided by the realistic 3D shapes of the Atmosphere and the Earth and the rigorous interpolations of atmospheric parameters included in Adaptive Mapping Functions with respect

  14. A geostatistical approach to mapping site response spectral amplifications

    USGS Publications Warehouse

    Thompson, E.M.; Baise, L.G.; Kayen, R.E.; Tanaka, Y.; Tanaka, H.

    2010-01-01

    If quantitative estimates of the seismic properties do not exist at a location of interest then the site response spectral amplifications must be estimated from data collected at other locations. Currently, the most common approach employs correlations of site class with maps of surficial geology. Analogously, correlations of site class with topographic slope can be employed where the surficial geology is unknown. Our goal is to identify and validate a method to estimate site response with greater spatial resolution and accuracy for regions where additional effort is warranted. This method consists of three components: region-specific data collection, a spatial model for interpolating seismic properties, and a theoretical method for computing spectral amplifications from the interpolated seismic properties. We consider three spatial interpolation schemes: correlations with surficial geology, termed the geologic trend (GT), ordinary kriging (OK), and kriging with a trend (KT). We estimate the spectral amplifications from seismic properties using the square root of impedance method, thereby linking the frequency-dependent spectral amplifications to the depth-dependent seismic properties. Thus, the range of periods for which this method is applicable is limited by the depth of exploration. A dense survey of near-surface S-wave slowness (Ss) throughout Kobe, Japan shows that the geostatistical methods give more accurate estimates of Ss than the topographic slope and GT methods, and the OK and KT methods perform equally well. We prefer the KT model because it can be seamlessly integrated with geologic maps that cover larger regions. Empirical spectral amplifications show that the region-specific data achieve more accurate estimates of observed median short-period amplifications than the topographic slope method. ?? 2010 Elsevier B.V.

  15. Unusual target site disruption by the rare-cutting HNH restriction endonuclease PacI.

    PubMed

    Shen, Betty W; Heiter, Daniel F; Chan, Siu-Hong; Wang, Hua; Xu, Shuang-Yong; Morgan, Richard D; Wilson, Geoffrey G; Stoddard, Barry L

    2010-06-09

    The crystal structure of the rare-cutting HNH restriction endonuclease PacI in complex with its eight-base-pair target recognition sequence 5'-TTAATTAA-3' has been determined to 1.9 A resolution. The enzyme forms an extended homodimer, with each subunit containing two zinc-bound motifs surrounding a betabetaalpha-metal catalytic site. The latter is unusual in that a tyrosine residue likely initiates strand cleavage. PacI dramatically distorts its target sequence from Watson-Crick duplex DNA base pairing, with every base separated from its original partner. Two bases on each strand are unpaired, four are engaged in noncanonical A:A and T:T base pairs, and the remaining two bases are matched with new Watson-Crick partners. This represents a highly unusual DNA binding mechanism for a restriction endonuclease, and implies that initial recognition of the target site might involve significantly different contacts from those visualized in the DNA-bound cocrystal structures.

  16. CisSERS: Customizable in silico sequence evaluation for restriction sites

    DOE PAGES

    Sharpe, Richard M.; Koepke, Tyson; Harper, Artemus; ...

    2016-04-12

    High-throughput sequencing continues to produce an immense volume of information that is processed and assembled into mature sequence data. Here, data analysis tools are urgently needed that leverage the embedded DNA sequence polymorphisms and consequent changes to restriction sites or sequence motifs in a high-throughput manner to enable biological experimentation. CisSERS was developed as a standalone open source tool to analyze sequence datasets and provide biologists with individual or comparative genome organization information in terms of presence and frequency of patterns or motifs such as restriction enzymes. Predicted agarose gel visualization of the custom analyses results was also integrated tomore » enhance the usefulness of the software. CisSERS offers several novel functionalities, such as handling of large and multiple datasets in parallel, multiple restriction enzyme site detection and custom motif detection features, which are seamlessly integrated with real time agarose gel visualization. Using a simple fasta-formatted file as input, CisSERS utilizes the REBASE enzyme database. Results from CisSERSenable the user to make decisions for designing genotyping by sequencing experiments, reduced representation sequencing, 3’UTR sequencing, and cleaved amplified polymorphic sequence (CAPS) molecular markers for large sample sets. CisSERS is a java based graphical user interface built around a perl backbone. Several of the applications of CisSERS including CAPS molecular marker development were successfully validated using wet-lab experimentation. Here, we present the tool CisSERSand results from in-silico and corresponding wet-lab analyses demonstrating that CisSERS is a technology platform solution that facilitates efficient data utilization in genomics and genetics studies.« less

  17. CisSERS: Customizable in silico sequence evaluation for restriction sites

    DOE PAGES

    Sharpe, Richard M.; Koepke, Tyson; Harper, Artemus; ...

    2016-04-12

    High-throughput sequencing continues to produce an immense volume of information that is processed and assembled into mature sequence data. Here, data analysis tools are urgently needed that leverage the embedded DNA sequence polymorphisms and consequent changes to restriction sites or sequence motifs in a high-throughput manner to enable biological experimentation. CisSERS was developed as a standalone open source tool to analyze sequence datasets and provide biologists with individual or comparative genome organization information in terms of presence and frequency of patterns or motifs such as restriction enzymes. Predicted agarose gel visualization of the custom analyses results was also integrated tomore » enhance the usefulness of the software. CisSERS offers several novel functionalities, such as handling of large and multiple datasets in parallel, multiple restriction enzyme site detection and custom motif detection features, which are seamlessly integrated with real time agarose gel visualization. Using a simple fasta-formatted file as input, CisSERS utilizes the REBASE enzyme database. Results from CisSERSenable the user to make decisions for designing genotyping by sequencing experiments, reduced representation sequencing, 3’UTR sequencing, and cleaved amplified polymorphic sequence (CAPS) molecular markers for large sample sets. CisSERS is a java based graphical user interface built around a perl backbone. Several of the applications of CisSERS including CAPS molecular marker development were successfully validated using wet-lab experimentation. Here, we present the tool CisSERSand results from in-silico and corresponding wet-lab analyses demonstrating that CisSERS is a technology platform solution that facilitates efficient data utilization in genomics and genetics studies.« less

  18. CisSERS: Customizable In Silico Sequence Evaluation for Restriction Sites.

    PubMed

    Sharpe, Richard M; Koepke, Tyson; Harper, Artemus; Grimes, John; Galli, Marco; Satoh-Cruz, Mio; Kalyanaraman, Ananth; Evans, Katherine; Kramer, David; Dhingra, Amit

    2016-01-01

    High-throughput sequencing continues to produce an immense volume of information that is processed and assembled into mature sequence data. Data analysis tools are urgently needed that leverage the embedded DNA sequence polymorphisms and consequent changes to restriction sites or sequence motifs in a high-throughput manner to enable biological experimentation. CisSERS was developed as a standalone open source tool to analyze sequence datasets and provide biologists with individual or comparative genome organization information in terms of presence and frequency of patterns or motifs such as restriction enzymes. Predicted agarose gel visualization of the custom analyses results was also integrated to enhance the usefulness of the software. CisSERS offers several novel functionalities, such as handling of large and multiple datasets in parallel, multiple restriction enzyme site detection and custom motif detection features, which are seamlessly integrated with real time agarose gel visualization. Using a simple fasta-formatted file as input, CisSERS utilizes the REBASE enzyme database. Results from CisSERS enable the user to make decisions for designing genotyping by sequencing experiments, reduced representation sequencing, 3'UTR sequencing, and cleaved amplified polymorphic sequence (CAPS) molecular markers for large sample sets. CisSERS is a java based graphical user interface built around a perl backbone. Several of the applications of CisSERS including CAPS molecular marker development were successfully validated using wet-lab experimentation. Here, we present the tool CisSERS and results from in-silico and corresponding wet-lab analyses demonstrating that CisSERS is a technology platform solution that facilitates efficient data utilization in genomics and genetics studies.

  19. Spacecraft orbit design in the circular restricted three-body problem using higher-dimensional Poincare maps

    NASA Astrophysics Data System (ADS)

    Geisel, Christopher D.

    Strategies for designing three-dimensional spacecraft trajectories in a multi-body dynamical environment are investigated using four-dimensional Poincare maps. Unlike the planar circular restricted three-body problem, where a two-dimensional map provides a simplified view of a portion of the vast and often chaotic design space, the spatial problem requires a four-dimensional map to achieve an equivalent perspective. Such higher-dimensional maps present a visualization challenge. Furthermore, a spacecraft in the spatial problem can exhibit fundamentally more diverse and complex behavior than in the planar problem. A novel approach to four-dimensional-map-based design in the spatial circular restricted three-body problem is developed and applied to practical examples with real-world spaceflight applications involving three-dimensional trajectories in the Earth-Moon, Sun-Earth, and Uranus-Titania systems. Included in the approach is a method for representing, interpreting, and manipulating four-dimensional Poincare maps in an interactive, three-dimensional visual environment in which the fourth dimension is displayed using color. This "space-plus-color" method expands on the "color and rotation" method of Patsis and Zachilas (used for the study of motion in a galaxy) by applying additional tools and techniques enabling design in the circular restricted three-body problem. Design is often based on maps generated by many trajectories. Image manipulation in both spatial and color dimensions is accomplished iteratively using MATLABRTM and AvizoRTM. Four-dimensional-map-based design in the spatial circular restricted three-body problem is practical, and success is enabled by interactive tools and techniques in a visual environment. The design strategy is methodical and not restricted to any particular map formulation. Human insight is leveraged to determine reference solutions in a problem without a closed-form analytical solution. Estimates obtained through visual

  20. Seismic site classification and site period mapping of Chennai City using geophysical and geotechnical data

    NASA Astrophysics Data System (ADS)

    Maheswari, R. Uma; Boominathan, A.; Dodagoudar, G. R.

    2010-11-01

    Subsurface conditions play a major role in the damage potential of earthquakes and the seismic soil amplification of a site which is a critical factor affecting the level of ground shaking. Shear wave velocity ( Vs) of the soil layer is an important parameter influencing the amplification behaviour of the site. Site characterization in calculating seismic hazards is usually based on the near-surface shear wave velocity values. The average shear wave velocity of the top 30 m of the soil, referred to as ( Vs) 30 is commonly adopted by competent building codes to classify the sites for earthquake resistant design of structures and in general it is widely used in microzonation studies. In the present study, the shear wave velocity of soil layers was measured at 30 locations in Chennai City by Multichannel Analysis of Surface Waves (MASW) test. In addition, nearly 300 borehole data were used to estimate Vs based on the correlations between Vs and SPT-N values for Chennai developed by authors earlier. Merging of MASW test results with borehole data yields sufficient coverage of Vs to develop a new site classification map for Chennai based on the NEHRP standard. It is found that part of the city belong to site D category (stiff soil). The developed site period map reveals that the fundamental site period varies in the range of 0.03 to 0.6 s, thus the soil conditions in Chennai pose a potential threat during earthquakes to low rise buildings (less than 6 storeys) which are densely distributed throughout the city.

  1. Dysbiotic Bacterial and Fungal Communities Not Restricted to Clinically Affected Skin Sites in Dandruff.

    PubMed

    Soares, Renan C; Camargo-Penna, Pedro H; de Moraes, Vanessa C S; De Vecchi, Rodrigo; Clavaud, Cécile; Breton, Lionel; Braz, Antonio S K; Paulino, Luciana C

    2016-01-01

    Dandruff is a prevalent chronic inflammatory skin condition of the scalp that has been associated with Malassezia yeasts. However, the microbial role has not been elucidated yet, and the etiology of the disorder remains poorly understood. Using high-throughput 16S rDNA and ITS1 sequencing, we characterized cutaneous bacterial and fungal microbiotas from healthy and dandruff subjects, comparing scalp and forehead (lesional and non-lesional skin sites). Bacterial and fungal communities from dandruff analyzed at genus level differed in comparison with healthy ones, presenting higher diversity and greater intragroup variation. The microbial shift was observed also in non-lesional sites from dandruff subjects, suggesting that dandruff is related to a systemic process that is not restricted to the site exhibiting clinical symptoms. In contrast, Malassezia microbiota analyzed at species level did not differ according to health status. A 2-step OTU assignment using combined databases substantially increased fungal assigned sequences, and revealed the presence of highly prevalent uncharacterized Malassezia organisms (>37% of the reads). Although clinical symptoms of dandruff manifest locally, microbial dysbiosis beyond clinically affected skin sites suggests that subjects undergo systemic alterations, which could be considered for redefining therapeutic approaches.

  2. Dysbiotic Bacterial and Fungal Communities Not Restricted to Clinically Affected Skin Sites in Dandruff

    PubMed Central

    Soares, Renan C.; Camargo-Penna, Pedro H.; de Moraes, Vanessa C. S.; De Vecchi, Rodrigo; Clavaud, Cécile; Breton, Lionel; Braz, Antonio S. K.; Paulino, Luciana C.

    2016-01-01

    Dandruff is a prevalent chronic inflammatory skin condition of the scalp that has been associated with Malassezia yeasts. However, the microbial role has not been elucidated yet, and the etiology of the disorder remains poorly understood. Using high-throughput 16S rDNA and ITS1 sequencing, we characterized cutaneous bacterial and fungal microbiotas from healthy and dandruff subjects, comparing scalp and forehead (lesional and non-lesional skin sites). Bacterial and fungal communities from dandruff analyzed at genus level differed in comparison with healthy ones, presenting higher diversity and greater intragroup variation. The microbial shift was observed also in non-lesional sites from dandruff subjects, suggesting that dandruff is related to a systemic process that is not restricted to the site exhibiting clinical symptoms. In contrast, Malassezia microbiota analyzed at species level did not differ according to health status. A 2-step OTU assignment using combined databases substantially increased fungal assigned sequences, and revealed the presence of highly prevalent uncharacterized Malassezia organisms (>37% of the reads). Although clinical symptoms of dandruff manifest locally, microbial dysbiosis beyond clinically affected skin sites suggests that subjects undergo systemic alterations, which could be considered for redefining therapeutic approaches. PMID:27909689

  3. Salivary glands act as mucosal inductive sites via the formation of ectopic germinal centers after site-restricted MCMV infection

    PubMed Central

    Grewal, Jasvir S.; Pilgrim, Mark J.; Grewal, Suman; Kasman, Laura; Werner, Phillip; Bruorton, Mary E.; London, Steven D.; London, Lucille

    2011-01-01

    We investigated the hypothesis that salivary gland inoculation stimulates formation of ectopic germinal centers (GCs), transforming the gland into a mucosal inductive site. Intraglandular infection of mice with murine cytomegalovirus (MCMV; control: UV-inactivated MCMV) induces salivary gland ectopic follicles comprising cognate interactions between CD4+ and B220+ lymphocytes, IgM+ and isotype-switched IgG+ and IgA+ B cells, antigen presenting cells, and follicular dendritic cells. B cells coexpressed the GC markers GCT (57%) and GL7 (52%), and bound the lectin peanut agglutinin. Lymphoid follicles were characterized by a 2- to 3-fold increase in mRNA for CXCL13 (lymphoid neogenesis), syndecan-1 (plasma cells), Blimp-1 (plasma cell development/differentiation), and a 2- to 6-fold increase for activation-induced cytidine deaminase, PAX5, and the nonexcised rearranged DNA of an IgA class-switch event, supporting somatic hypermutation and class-switch recombination within the salivary follicles. Intraglandular inoculation also provided protection against a systemic MCMV challenge, as evidenced by decreased viral titers (105 plaque-forming units to undetectable), and restoration of normal salivary flow rates from a 6-fold decrease. Therefore, these features suggest that the salivary gland participates in oral mucosal immunity via generation of ectopic GCs, which function as ectopic mucosal inductive sites.—Grewal, J. S., Pilgrim, M. J., Grewal, S., Kasman, L., Werner, P., Bruorton, M. E., London, S. D., London, L. Salivary glands act as mucosal inductive sites via the formation of ectopic germinal centers after site-restricted MCMV infection. PMID:21307334

  4. 1995 Report on Hanford site land disposal restrictions for mixed waste

    SciTech Connect

    Black, D.G.

    1995-04-01

    This report was submitted to meet the requirements of Hanford Federal Facility Agreement and Consent Order Milestone M-26-01E. This milestone requires the preparation of an annual report that covers characterization, treatment, storage, minimization, and other aspects of land disposal restricted mixed waste at the Hanford Site. The U.S. Department of Energy, its predecessors, and contractors at the Hanford Site were involved in the production and purification of nuclear defense materials from the early 1940s to the late 1980s. These production activities have generated large quantities of liquid and solid radioactive mixed waste. This waste is subject to regulation under authority of both the Resource Conservation and Recovery Act of 1976 and Atomic Energy Act of 1954. This report covers mixed waste only. The Washington State Department of Ecology, U.S. Environmental Protection Agency, and U.S. Department of Energy have entered into an agreement, the Hanford Federal Facility Agreement and Consent Order (commonly referred to as the Tri-Party Agreement) to bring the Hanford Site operations into compliance with dangerous waste regulations. The Tri-Party Agreement required development of the original land disposal restrictions (LDRs) plan and its annual updates to comply with LDR requirements for radioactive mixed waste. This report is the fifth update of the plan first issued in 1990. Tri-Party Agreement negotiations completed in 1993 and approved in January 1994 changed and added many new milestones. Most of the changes were related to the Tank Waste Remediation System and these changes are incorporated into this report.

  5. Phylogenomics of Phrynosomatid Lizards: Conflicting Signals from Sequence Capture versus Restriction Site Associated DNA Sequencing

    PubMed Central

    Leaché, Adam D.; Chavez, Andreas S.; Jones, Leonard N.; Grummer, Jared A.; Gottscho, Andrew D.; Linkem, Charles W.

    2015-01-01

    Sequence capture and restriction site associated DNA sequencing (RADseq) are popular methods for obtaining large numbers of loci for phylogenetic analysis. These methods are typically used to collect data at different evolutionary timescales; sequence capture is primarily used for obtaining conserved loci, whereas RADseq is designed for discovering single nucleotide polymorphisms (SNPs) suitable for population genetic or phylogeographic analyses. Phylogenetic questions that span both “recent” and “deep” timescales could benefit from either type of data, but studies that directly compare the two approaches are lacking. We compared phylogenies estimated from sequence capture and double digest RADseq (ddRADseq) data for North American phrynosomatid lizards, a species-rich and diverse group containing nine genera that began diversifying approximately 55 Ma. Sequence capture resulted in 584 loci that provided a consistent and strong phylogeny using concatenation and species tree inference. However, the phylogeny estimated from the ddRADseq data was sensitive to the bioinformatics steps used for determining homology, detecting paralogs, and filtering missing data. The topological conflicts among the SNP trees were not restricted to any particular timescale, but instead were associated with short internal branches. Species tree analysis of the largest SNP assembly, which also included the most missing data, supported a topology that matched the sequence capture tree. This preferred phylogeny provides strong support for the paraphyly of the earless lizard genera Holbrookia and Cophosaurus, suggesting that the earless morphology either evolved twice or evolved once and was subsequently lost in Callisaurus. PMID:25663487

  6. Patterns of Naturally Occurring Restriction Map Variation, Dopa Decarboxylase Activity Variation and Linkage Disequilibrium in the Ddc Gene Region of Drosophila Melanogaster

    PubMed Central

    Aquadro, C. F.; Jennings-Jr, R. M.; Bland, M. M.; Laurie, C. C.; Langley, C. H.

    1992-01-01

    Forty-six second-chromosome lines of Drosophila melanogaster isolated from five natural populations were surveyed for restriction map variation in a 65-kb region surrounding the gene (Ddc) encoding dopa decarboxylase (DDC). Sixty-nine restriction sites were scored, 13 of which were polymorphic. Average heterozygosity per nucleotide was estimated to be 0.005. Eight large (0.7-5.0 kb) inserts, two small inserts (100 and 200 bp) and three small deletions (100-300 bp) were also observed across the 65-kb region. We see no evidence for a reduction in either nucleotide heterozygosity or insertion/deletion variation in the central 26-kb segment containing Ddc and a dense cluster of lethal complementation groups and transcripts (>/=9 genes) compared to that seen in the adjacent regions (totaling 39 kb) in which only a single gene and transcript has been detected, or to that observed for other gene regions in D. melanogaster. The distribution of restriction site variation shows no significant departure from that expected under an equilibrium neutral model. However insertions and deletions show a significant departure from neutrality in that they are too rare in frequency, consistent with them being deleterious on average. Significant linkage disequilibrium among variants exists across much of the 65-kb region. Lower regional rates of recombination combined with the influence of polymorphic chromosomal inversions, rather than epistatic selection among genes in the dense cluster, probably are sufficient explanations for the creation and/or maintenance of the linkage disequilibrium observed in the Ddc region. We have also assayed adult DDC enzyme activity in these same lines. Twofold variation in activity among lines is observed within our sample. Significant associations are observed between level of DDC enzyme activity and restriction map variants. Surprisingly, one line with a 5.0-kb insert within an intron and one line with a 1.5-kb insert near the 5' end of Ddc each show

  7. Simultaneous binding of three recognition sites is necessary for a concerted plasmid DNA cleavage by EcoRII restriction endonuclease.

    PubMed

    Tamulaitis, Gintautas; Sasnauskas, Giedrius; Mucke, Merlind; Siksnys, Virginijus

    2006-04-28

    According to the current paradigm type IIE restriction endonucleases are homodimeric proteins that simultaneously bind to two recognition sites but cleave DNA at only one site per turnover: the other site acts as an allosteric locus, activating the enzyme to cleave DNA at the first. Structural and biochemical analysis of the archetypal type IIE restriction enzyme EcoRII suggests that it has three possible DNA binding interfaces enabling simultaneous binding of three recognition sites. To test if putative synapsis of three binding sites has any functional significance, we have studied EcoRII cleavage of plasmids containing a single, two and three recognition sites under both single turnover and steady state conditions. EcoRII displays distinct reaction patterns on different substrates: (i) it shows virtually no activity on a single site plasmid; (ii) it yields open-circular DNA form nicked at one strand as an obligatory intermediate acting on a two-site plasmid; (iii) it cleaves concertedly both DNA strands at a single site during a single turnover on a three site plasmid to yield linear DNA. Cognate oligonucleotide added in trans increases the reaction velocity and changes the reaction pattern for the EcoRII cleavage of one and two-site plasmids but has little effect on the three-site plasmid. Taken together the data indicate that EcoRII requires simultaneous binding of three rather than two recognition sites in cis to achieve concerted DNA cleavage at a single site. We show that the orthodox type IIP enzyme PspGI which is an isoschisomer of EcoRII, cleaves different plasmid substrates with equal rates. Data provided here indicate that type IIE restriction enzymes EcoRII and NaeI follow different mechanisms. We propose that other type IIE restriction enzymes may employ the mechanism suggested here for EcoRII.

  8. Random Tagging Genotyping by Sequencing (rtGBS), an Unbiased Approach to Locate Restriction Enzyme Sites across the Target Genome

    PubMed Central

    Hilario, Elena; Barron, Lorna; Deng, Cecilia H.; Datson, Paul M.; Davy, Marcus W.; Storey, Roy D.

    2015-01-01

    Genotyping by sequencing (GBS) is a restriction enzyme based targeted approach developed to reduce the genome complexity and discover genetic markers when a priori sequence information is unavailable. Sufficient coverage at each locus is essential to distinguish heterozygous from homozygous sites accurately. The number of GBS samples able to be pooled in one sequencing lane is limited by the number of restriction sites present in the genome and the read depth required at each site per sample for accurate calling of single-nucleotide polymorphisms. Loci bias was observed using a slight modification of the Elshire et al. method: some restriction enzyme sites were represented in higher proportions while others were poorly represented or absent. This bias could be due to the quality of genomic DNA, the endonuclease and ligase reaction efficiency, the distance between restriction sites, the preferential amplification of small library restriction fragments, or bias towards cluster formation of small amplicons during the sequencing process. To overcome these issues, we have developed a GBS method based on randomly tagging genomic DNA (rtGBS). By randomly landing on the genome, we can, with less bias, find restriction sites that are far apart, and undetected by the standard GBS (stdGBS) method. The study comprises two types of biological replicates: six different kiwifruit plants and two independent DNA extractions per plant; and three types of technical replicates: four samples of each DNA extraction, stdGBS vs. rtGBS methods, and two independent library amplifications, each sequenced in separate lanes. A statistically significant unbiased distribution of restriction fragment size by rtGBS showed that this method targeted 49% (39,145) of BamH I sites shared with the reference genome, compared to only 14% (11,513) by stdGBS. PMID:26633193

  9. 24 CFR 3285.103 - Site suitability with design zone maps.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... maps. 3285.103 Section 3285.103 Housing and Urban Development Regulations Relating to Housing and Urban... Considerations § 3285.103 Site suitability with design zone maps. Prior to the initial installation of a new... indicated on the design zone maps provided with the home, are suitable for the site location where the...

  10. 24 CFR 3285.103 - Site suitability with design zone maps.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... maps. 3285.103 Section 3285.103 Housing and Urban Development Regulations Relating to Housing and Urban... Considerations § 3285.103 Site suitability with design zone maps. Prior to the initial installation of a new... indicated on the design zone maps provided with the home, are suitable for the site location where the home...

  11. 24 CFR 3285.103 - Site suitability with design zone maps.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... maps. 3285.103 Section 3285.103 Housing and Urban Development Regulations Relating to Housing and Urban... Considerations § 3285.103 Site suitability with design zone maps. Prior to the initial installation of a new... indicated on the design zone maps provided with the home, are suitable for the site location where the home...

  12. 24 CFR 3285.103 - Site suitability with design zone maps.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... maps. 3285.103 Section 3285.103 Housing and Urban Development Regulations Relating to Housing and Urban... Considerations § 3285.103 Site suitability with design zone maps. Prior to the initial installation of a new... indicated on the design zone maps provided with the home, are suitable for the site location where the home...

  13. Mapping Region of Human Restriction Factor APOBEC3H Critical for Interaction with HIV-1 Vif.

    PubMed

    Nakashima, Masaaki; Tsuzuki, Shinya; Awazu, Hiroaki; Hamano, Akiko; Okada, Ayaka; Ode, Hirotaka; Maejima, Masami; Hachiya, Atsuko; Yokomaku, Yoshiyuki; Watanabe, Nobuhisa; Akari, Hirofumi; Iwatani, Yasumasa

    2017-04-21

    The APOBEC3 (A3) family of cellular cytidine deaminases comprises seven members (A, B, C, D, F, G, and H) that potently inhibit retroviral replication. Human immunodeficiency virus type 1 (HIV-1) Vif is a small pleiotropic protein that specifically inactivates these enzymes, targeting them for ubiquitin-mediated proteasomal degradation. A3 Vif-interaction sites are presumed to fall into three distinct types: A3C/D/F, A3G, and A3H. To date, two types of A3G and A3C/D/F sites have been well characterized, whereas the A3H Vif-binding site remains poorly defined. Here, we explore the residues critical for the A3H-type Vif interaction. To avoid technical difficulties in performing experiments with human A3H haplotype II (hapII), which is relatively resistant to HIV-1 Vif, we employed its ortholog chimpanzee A3H (cA3H), which displays high Vif sensitivity, for a comparison of sensitivity with that of A3H hapII. The Vif susceptibility of A3H hapII-cA3H chimeras and their substitution mutants revealed a single residue at position 97 as a major determinant for the difference in their Vif sensitivities. We further surveyed critical residues by structure-guided mutagenesis using an A3H structural model and thus identified eight additional residues important for Vif sensitivity, which mapped to the α3 and α4 helices of A3H. Interestingly, this area is located on a surface adjacent to the A3G and A3C/D/F interfaces and is composed of negatively charged and hydrophobic patches. These findings suggest that HIV-1 Vif has evolved to utilize three dispersed surfaces for recognizing three types of interfaces on A3 proteins under certain structural constraints.

  14. 1993 report on Hanford Site land disposal restrictions for mixed wastes

    SciTech Connect

    Black, D.

    1993-04-01

    Since the early 1940s, the contractors at the Hanford Site have been involved in the production and purification of nuclear defense materials. These production activities have resulted in the generation of large quantities of liquid and solid radioactive mixed waste (RMW). This waste is subject to regulation under authority of both the Resource Conservation and Recovery Act of 1976{sup 2}(RCRA) and Atomic Energy Act{sup 3}. This report covers mixed waste only. Hazardous waste that is not contaminated with radionuclides is not addressed in this report. The Washington State Department of Ecology, US Environmental Protection Agency, and US Department of Energy have entered into an agreement, the Hanford Federal Facility Agreement and Consent Order{sup 1} (commonly referred to as the Tri-Party Agreement) to bring the Hanford Site operations into compliance with dangerous waste regulations. The Tri-Party Agreement required development of the original land disposal restrictions (LDR) plan and its annual updates to comply with LDR requirements for RMW. This report is the third update of the plan first issued in 1990. The Tri-Party Agreement requires, and the baseline plan and annual update reports provide, the information that follows: Waste characterization information; storage data; treatment information; waste reduction information; schedule; and progress.

  15. Interactive NCORP Map Details Community Research Sites | Division of Cancer Prevention

    Cancer.gov

    An interactive map of the NCI Community Oncology Research Program (NCORP) with detailed information on hundreds of community sites that take part in clinical trials is available on the NCORP website. NCORP Map NCORP Community Sites, Minority/Underserved Community Sites, and Research Bases |

  16. Cloning of flanking sequence in transgenic plants by restriction site-anchored single-primer polymerase chain reaction.

    PubMed

    Ma, J; Wang, N N; Ren, S; Fu, Y P; Lu, S; Wang, Y P; Wang, P W

    2014-12-12

    Determining the insertion position of an exogenous gene in the target plant genome is one of the main issues in the transgenic plant field. This study introduced a simple, rapid, and accurate method to clone the flanking sequences of the transgenic bar gene as the anchoring gene in the transgenic maize genome using single-primer polymerase chain reaction (PCR). This method was based on the distribution of restriction sites in the maize genome and adopted the single-primer PCR method. Cloning the flanking sequences with the restriction site-anchored single-primer PCR simplified the experimental procedures by about 70% and reduced the experimental time by more than 80%. In conclusion, the restriction site-anchored single-primer PCR was a simple, rapid method to obtain the unknown flanking sequences in the transgenic plants.

  17. AFSM sequencing approach: a simple and rapid method for genome-wide SNP and methylation site discovery and genetic mapping

    PubMed Central

    Xia, Zhiqiang; Zou, Meiling; Zhang, Shengkui; Feng, Binxiao; Wang, Wenquan

    2014-01-01

    We describe methods for the assessment of amplified-fragment single nucleotide polymorphism and methylation (AFSM) sites using a quick and simple molecular marker-assisted breeding strategy based on the use of two restriction enzyme pairs (EcoRI-MspI and EcoRI-HpaII) and a next-generation sequencing platform. Two sets of 85 adapter pairs were developed to concurrently identify SNPs, indels and methylation sites for 85 lines of cassava population in this study. In addition to SNPs and indels, the simplicity of the AFSM protocol makes it particularly suitable for high-throughput full methylation and hemi-methylation analyses. To further demonstrate the ease of this approach, a cassava genetic linkage map was constructed. This approach should be widely applicable for genetic mapping in a variety of organisms and will improve the application of crop genomics in assisted breeding. PMID:25466435

  18. Initial recommendations for restricting gamma-ray spectrometry measurements of radionuclides for on-site inspections

    SciTech Connect

    Buckley, W F; Kreek, S A; Wild, J F

    1998-11-06

    The US paper "Radionuclide Sampling, Sample Handling and Analytical Laboratory Equipment for Comprehensive Test Ban Treaty On-Site Inspections," CTBT/PC/V/OSI/WSII/PR/29 identified the radionuclides of interest to an OS1 as 144Ce, 147Nd, 141Ce, 149Ba140La), 95 Zr(95Nb), 131mXe, 133mXe, 133gXe, 135gXe, and 37Ar. All of these nuclides (except 37Ar) can be measured via some form of conventional or coincidence-based gamma-ray spectrometry. The non-gaseous radionuclides [144Ce, 147Nd, 141Ce, 140Ba(140La), and 95Zr(95Nb)] can be measured via conventional high-resolution gamma-ray spectrometry using a shielded, high-purity germanium (HPGe) detector. The gaseous radionuclides 131mXe, 133mXe, 133gXe, and 135gXe are best measured (after separation from their homologous elements) via a gamma & beta/electron coincidence technique such as that described in CTBT/WGB/TL-11/5 which could utilize either a HPGe or low-resolution (NaI(TI)) gamma-ray spectrometer to detect the gamma-ray/x-ray and a plastic scintillator to detect the beta particle/electron from the decay of the various Xe isotopes. The US paper CTBT/PC/V/IOSI/WSII/PR/29 (and other papers) identified a need to limit the information that can be extracted from high-resolution gamma-ray spectra to ensure that only information relevant to an OSI is accessible. The term "blinding" has been used to describe the need to limit the information available to the Inspection Team from the high-resolution gamma-ray measurement. A better term is "measurement restriction"; the need for restricting the information is particularly relevant to conventional high-resolution gamma-ray spectrometry measurements, but not to the gamma & beta/electron coincidence-type measurements

  19. Comparison of ribosomal DNA length and restriction site polymorphisms in Gremmeniella and Ascocalyx isolates.

    PubMed

    Bernier, L; Hamelin, R C; Ouellette, G B

    1994-04-01

    The small subunit (SSU) and the internal transcribed spacer (ITS) of nuclear ribosomal DNA genes from 27 specimens of the fungal genera Gremmeniella and Ascocalyx were amplified by PCR. Length polymorphisms were observed in the SSU and allowed the differentiation of four groups among the isolates tested: (i) Ascocalyx abietis; (ii) Gremmeniella isolates from Picea spp.; (iii) Gremmeniella isolates from Abies balsamea; and (iv) Gremmeniella isolates from Abies sacchalinensis, Larix spp., and Pinus spp. The amplified ITS was the same length for all Gremmeniella specimens and was 60 bp longer in A. abietis. Phylogenetic analysis of length polymorphisms and of 24 restriction sites in the SSU and ITS showed that Gremmeniella isolates were more related to each other than to the Ascocalyx isolate. Furthermore, seven groups were evident within the genus Gremmeniella. Our results confirm that Gremmeniella and Ascocalyx should be kept as different taxa and suggest that the taxonomy of the former could be revised to consider isolates from Abies balsamea and from Picea spp. to be two different varieties while incorporating Gremmeniella laricina into G. abietina, as a new variety.

  20. Comparison of ribosomal DNA length and restriction site polymorphisms in Gremmeniella and Ascocalyx isolates.

    PubMed Central

    Bernier, L; Hamelin, R C; Ouellette, G B

    1994-01-01

    The small subunit (SSU) and the internal transcribed spacer (ITS) of nuclear ribosomal DNA genes from 27 specimens of the fungal genera Gremmeniella and Ascocalyx were amplified by PCR. Length polymorphisms were observed in the SSU and allowed the differentiation of four groups among the isolates tested: (i) Ascocalyx abietis; (ii) Gremmeniella isolates from Picea spp.; (iii) Gremmeniella isolates from Abies balsamea; and (iv) Gremmeniella isolates from Abies sacchalinensis, Larix spp., and Pinus spp. The amplified ITS was the same length for all Gremmeniella specimens and was 60 bp longer in A. abietis. Phylogenetic analysis of length polymorphisms and of 24 restriction sites in the SSU and ITS showed that Gremmeniella isolates were more related to each other than to the Ascocalyx isolate. Furthermore, seven groups were evident within the genus Gremmeniella. Our results confirm that Gremmeniella and Ascocalyx should be kept as different taxa and suggest that the taxonomy of the former could be revised to consider isolates from Abies balsamea and from Picea spp. to be two different varieties while incorporating Gremmeniella laricina into G. abietina, as a new variety. Images PMID:7912501

  1. 1997 Hanford site report on land disposal restrictions for mixed waste

    SciTech Connect

    Black, D.G.

    1997-04-07

    The baseline land disposal restrictions (LDR) plan was prepared in 1990 in accordance with the Hanford Federal Facility Agreement and Consent Order (commonly referred to as the Tn-Party Agreement) Milestone M-26-00 (Ecology et al, 1989). The text of this milestone is below. ''LDR requirements include limitations on storage of specified hazardous wastes (including mixed wastes). In accordance with approved plans and schedules, the U.S. Department of Energy (DOE) shall develop and implement technologies necessary to achieve full compliance with LDR requirements for mixed wastes at the Hanford Site. LDR plans and schedules shall be developed with consideration of other action plan milestones and will not become effective until approved by the U.S. Environmental Protection Agency (EPA) (or Washington State Department of Ecology [Ecology]) upon authorization to administer LDRs pursuant to Section 3006 of the Resource Conservation and Recovery Act of 1976 (RCRA). Disposal of LDR wastes at any time is prohibited except in accordance with applicable LDR requirements for nonradioactive wastes at all times. The plan will include, but not be limited to, the following: Waste characterization plan; Storage report; Treatment report; Treatment plan; Waste minimization plan; A schedule depicting the events necessary to achieve full compliance with LDR requirements; and A process for establishing interim milestones.

  2. Identification of sex-specific molecular markers using restriction site-associated DNA sequencing.

    PubMed

    Gamble, Tony; Zarkower, David

    2014-09-01

    A major barrier to evolutionary studies of sex determination and sex chromosomes has been a lack of information on the types of sex-determining mechanisms that occur among different species. This is particularly problematic in groups where most species lack visually heteromorphic sex chromosomes, such as fish, amphibians and reptiles, because cytogenetic analyses will fail to identify the sex chromosomes in these species. We describe the use of restriction site-associated DNA (RAD) sequencing, or RAD-seq, to identify sex-specific molecular markers and subsequently determine whether a species has male or female heterogamety. To test the accuracy of this technique, we examined the lizard Anolis carolinensis. We performed RAD-seq on seven male and ten female A. carolinensis and found one male-specific molecular marker. Anolis carolinensis has previously been shown to possess male heterogamety and the recently published A. carolinensis genome facilitated the characterization of the sex-specific RAD-seq marker. We validated the male specificity of the new marker using PCR on additional individuals and also found that it is conserved in some other Anolis species. We discuss the utility of using RAD-seq to identify sex-determining mechanisms in other species with cryptic or homomorphic sex chromosomes and the implications for the evolution of male heterogamety in Anolis.

  3. Application of restriction site amplified polymorphism (RSAP) to genetic diversity in Saccharina japonica

    NASA Astrophysics Data System (ADS)

    Zhao, Cui; Liu, Cui; Li, Wei; Chi, Shan; Feng, Rongfang; Liu, Tao

    2013-07-01

    Restriction site amplified polymorphism (RSAP) was used, for the first time, to analyze the genetic structure and diversity of four, mainly cultivated, varieties of the brown alga, Saccharina japonica. Eighty-eight samples from varieties " Rongfu ", " Fujian ", " Ailunwan " and " Shengchanzhong " were used for the genetic analyses. One hundred and ninety-eight bands were obtained using eight combinations of primers. One hundred and ninety-one (96.46%) were polymorphic bands. Nei's genetic diversity was 0.360, and the coefficient of genetic differentiation was 0.357. No inbreeding-type recession was found in the four brown alga varieties and the results of the " Ailunwan " variety using samples from 2 years showed that the variety was becoming less diverse during the selection inherent in the breeding program. Genetic diversity and cluster analyses results were consistent with these genetic relationships. The results show the RSAP method is suitable for genetic analysis. Continuous inbreeding and selection could reduce the genetic diversity effectively; therefore periodical supervision is required.

  4. Mapping and analysis of phosphorylation sites: a quick guide for cell biologists.

    PubMed

    Dephoure, Noah; Gould, Kathleen L; Gygi, Steven P; Kellogg, Douglas R

    2013-03-01

    A mechanistic understanding of signaling networks requires identification and analysis of phosphorylation sites. Mass spectrometry offers a rapid and highly sensitive approach to mapping phosphorylation sites. However, mass spectrometry has significant limitations that must be considered when planning to carry out phosphorylation-site mapping. Here we provide an overview of key information that should be taken into consideration before beginning phosphorylation-site analysis, as well as a step-by-step guide for carrying out successful experiments.

  5. A Site Response Map of the Continental U.S

    NASA Astrophysics Data System (ADS)

    Magistrale, H.; Rong, Y.; Thompson, E.; Silva, W. J.

    2012-12-01

    We create a site response map of the continental U.S. using the topographic slope methodology, which uses correlations between slope and Vs30 (Wald and Allen, 2007). We determine new regional correlations for the central and eastern U.S. (CEUS) and western U.S. (WUS) calibrated to the Vs30 observation database of Pacific Engineering and Analysis, and introduce a novel correlation for areas of the WUS that hosted Pleistocene and younger lakes. In the WUS we develop a new correlation by first removing Vs30 observations from Utah basins and the Imperial Valley, California, from the database, and second using a stochastic simulation to choose slope and Vs30 bins and calculate standard deviation and bias. We select the best model based on three criteria: (i) bias and standard deviation is among the smallest; (ii) the correlations will not change dramatically for neighboring bins; and (iii) the Vs30 bin boundaries can be matched to NEHRP categories. Relative to WUS, the Utah and Imperial Valley Vs30 values are low for a given slope. We fit a separate correlation in the manner described above. We attribute the low values to the occupation of these areas by Pleistocene and younger lakes. We posit that when sediment-laden streams entered these lakes, the flow velocity was reduced so that all coarse sediments were deposited at the lake margin, and only very fine grained (and seismically slow) material was distributed over the lake bed. This model is confirmed by: (i) relatively high Vs30 values in the geologically similar Las Vegas Valley that was not occupied by a lake; (ii) ordinary Vs30 values in Utah and Imperial Valley locations above the high lake stands; and (iii) a consistent pattern of Vs30 values in the Reno, Nevada, basin across a paleo-lake boundary. In the CEUS, we use the recent correlation of Silva et al. (2011) that includes better constraints on the correlation at rock sites. In all regions the slopes are determined from SRTM digital elevation data (Jarvis

  6. Mapping in vivo topoisomerase I sites on simian virus 40 DNA: asymmetric distribution of sites on replicating molecules.

    PubMed Central

    Porter, S E; Champoux, J J

    1989-01-01

    Complexes between simian virus 40 DNA and topoisomerase I (topo I) were isolated from infected cells treated with camptothecin. The topo I break sites were precisely mapped by primer extension from defined oligonucleotides. Of the 56 sites, 40 conform to the in vitro consensus sequence previously determined for topo I. The remaining 16 sites have an unknown origin and were detectable even in the absence of camptothecin. Only 11% of the potential break sites were actually broken in vivo. In the regions mapped, the pattern of break sites was asymmetric. Most notable are the clustering of sites near the terminus for DNA replication and the confinement of sites to the strand that is the template for discontinuous DNA synthesis. These asymmetries could reflect the role of topo I in simian virus 40 DNA replication and suggest that topo I action is coordinated spatially with that of the replication complex. Images PMID:2540421

  7. 1994 Report on Hanford Site land disposal restrictions for mixed waste

    SciTech Connect

    Black, D.G.

    1994-04-01

    The baseline land disposal restrictions (LDR) plan was prepared in 1990 in accordance with the Hanford Federal Facility Agreement and Consent Order (commonly referred to as the Tri-Party Agreement) Milestone M-26-00 (Ecology et al. 1992). The text of this milestone is below. LDR requirements include limitations on storage of specified hazardous wastes (including mixed wastes). In accordance with approved plans and schedules, the US Department of Energy (DOE) shall develop and implement technologies necessary to achieve full compliance with LDR requirements for mixed wastes at the Hanford Site. LDR plans and schedules shall be developed with consideration at other action plan milestones and will not become effective until approved by the US Environmental Protection Agency (EPA) (or Washington State Department of Ecology [Ecology]) upon authorization to administer LDRs pursuant to Section 3006 of the Resource Conservation and Recovery Act of 1976 (RCRA). Disposal of LDR wastes at any time is prohibited except in accordance with applicable LDR requirements for nonradioactive wastes at all times. The plan will include, but not be limited to, the following: waste characterization plan; storage report; treatment report; treatment plan; waste minimization plan; a schedule depicting the events necessary to achieve full compliance with LDR requirements; a process for establishing interim milestones. The original plan was published in October 1990. This is the fourth of a series of annual updates required by Tri-Party Agreement Milestone M-26-01. A Tri-Party Agreement change request approved in March 1992 changed the annual due date from October to April and consolidated this report with a similar one prepared under Milestone M-25-00. The reporting period for this report is from April 1, 1993, to March 31, 1994.

  8. Virtual reality mapping system for Chernobyl accident site assessment

    NASA Astrophysics Data System (ADS)

    Blackmon, Theodore T.; Ngyuen, Laurent; Neveu, Charles F.; Rasmussen, Daryl; Zbinden, Eric; Maimone, Mark; Matthies, Larry H.; Thayer, Scott M.; Teza, James; Broz, Vince; Osborn, James; Hebert, Martial; Steele, Jerry; Thomas, Geb

    1999-05-01

    Initiated by the Department of Energy's International Nuclear Safety Program, an effort in underway to deliver and employ a telerobotic diagnostic system for structural evaluation and monitoring within the Chornobyl Unit-4 shelter. A mobile robot, named Pioneer, will enter the damaged Chornobyl structure and employ devices to measure radiation, temperature and humidity; acquire core samples of concrete structures for subsequent engineering analysis; and make photo-realistic 3D maps of the building interior. This paper details the latter element, dubbed 'C-Map', the Chornobyl Mapping System. C-Map consists of an automated 3D modeling system using stereo computer vision along with an interactive, virtual reality software program to acquire and analyze the photo-realistic 3D maps of the damaged building interior.

  9. Tactile impoverishment and sensorimotor restriction deteriorate the forepaw cutaneous map in the primary somatosensory cortex of adult rats.

    PubMed

    Coq, J O; Xerri, C

    1999-12-01

    We investigated the effects of sensory deprivation on the forepaw representation in the primary somatosensory cortex (SI) in the adult rat. Cortical maps were constructed from high-resolution multiunit recordings of the response of layer IV neurons to somatosensory stimuli. The main features of the forepaw representation were described in terms of areal extent and topography of the cortical map, and sensory submodality, size, and location of the receptive field (RF) of small clusters of the cortical neurons. After being weaned, two groups of Long-Evans rats were housed in a standard (SE) or impoverished (IE) environment for 65-115 days. A third group of SE rats was subjected to severe sensorimotor restriction (SR) of one forepaw for 7 days or 14 days, by using a one-sleeved cast. A concomitant effect of unilateral forelimb immobilization was a forced use of the nonrestricted forelimb in postural balance. The maps of both forepaws were derived 24 h after the cast was removed and the animal was allowed normal limb use. In a fourth group, SE rats experienced a 7-day immobilization followed by symmetrical limb use for 7 days before we mapped the hemisphere contralateral to the casted limb. For the SE and IE rats, the total areal extent of the cutaneous forepaw representation was similar, but IE rats exhibited a significant expansion of cortical islets serving high-threshold, presumably noncutaneous inputs, which were included in the cutaneous maps. In addition, SI neurons of IE rats had greatly enlarged glabrous, but not hairy, skin RFs. For the SR rats, the areal extent of the cutaneous map of the casted forepaw decreased by about 50%, after both 7- and 14-day forelimb immobilization. Large cortical sectors presumed to be formerly activated by cutaneous inputs were driven by high-threshold inputs that disrupted the somatotopic representation of the forepaw skin surfaces. These "emergent" representational sectors were topographically organized. By contrast, the areal

  10. QuickMap: a public tool for large-scale gene therapy vector insertion site mapping and analysis.

    PubMed

    Appelt, J-U; Giordano, F A; Ecker, M; Roeder, I; Grund, N; Hotz-Wagenblatt, A; Opelz, G; Zeller, W J; Allgayer, H; Fruehauf, S; Laufs, S

    2009-07-01

    Several events of insertional mutagenesis in pre-clinical and clinical gene therapy studies have created intense interest in assessing the genomic insertion profiles of gene therapy vectors. For the construction of such profiles, vector-flanking sequences detected by inverse PCR, linear amplification-mediated-PCR or ligation-mediated-PCR need to be mapped to the host cell's genome and compared to a reference set. Although remarkable progress has been achieved in mapping gene therapy vector insertion sites, public reference sets are lacking, as are the possibilities to quickly detect non-random patterns in experimental data. We developed a tool termed QuickMap, which uniformly maps and analyzes human and murine vector-flanking sequences within seconds (available at www.gtsg.org). Besides information about hits in chromosomes and fragile sites, QuickMap automatically determines insertion frequencies in +/- 250 kb adjacency to genes, cancer genes, pseudogenes, transcription factor and (post-transcriptional) miRNA binding sites, CpG islands and repetitive elements (short interspersed nuclear elements (SINE), long interspersed nuclear elements (LINE), Type II elements and LTR elements). Additionally, all experimental frequencies are compared with the data obtained from a reference set, containing 1 000 000 random integrations ('random set'). Thus, for the first time a tool allowing high-throughput profiling of gene therapy vector insertion sites is available. It provides a basis for large-scale insertion site analyses, which is now urgently needed to discover novel gene therapy vectors with 'safe' insertion profiles.

  11. Using Restriction Mapping to Teach Basic Skills in the Molecular Biology Lab

    ERIC Educational Resources Information Center

    Walsh, Lauren; Shaker, Elizabeth; De Stasio, Elizabeth A.

    2007-01-01

    Digestion of DNA with restriction enzymes, calculation of volumes and concentrations of reagents for reactions, and the separation of DNA fragments by agarose gel electrophoresis are common molecular biology techniques that are best taught through repetition. The following open-ended, investigative laboratory exercise in plasmid restriction…

  12. Using Restriction Mapping to Teach Basic Skills in the Molecular Biology Lab

    ERIC Educational Resources Information Center

    Walsh, Lauren; Shaker, Elizabeth; De Stasio, Elizabeth A.

    2007-01-01

    Digestion of DNA with restriction enzymes, calculation of volumes and concentrations of reagents for reactions, and the separation of DNA fragments by agarose gel electrophoresis are common molecular biology techniques that are best taught through repetition. The following open-ended, investigative laboratory exercise in plasmid restriction…

  13. Solving large double digestion problems for DNA restriction mapping by using branch-and-bound integer linear programming.

    PubMed

    Wu, Z; Zhang, Y

    2008-01-01

    The double digestion problem for DNA restriction mapping has been proved to be NP-complete and intractable if the numbers of the DNA fragments become large. Several approaches to the problem have been tested and proved to be effective only for small problems. In this paper, we formulate the problem as a mixed-integer linear program (MIP) by following (Waterman, 1995) in a slightly different form. With this formulation and using state-of-the-art integer programming techniques, we can solve randomly generated problems whose search space sizes are many-magnitude larger than previously reported testing sizes.

  14. Improvement in HLA-DQB typing by PCR-RFLP: introduction of a constant restriction site in one of the primers for digestion control.

    PubMed

    Mercier, B; Ferec, C; Dufosse, F; Huart, J J

    1992-08-01

    The PCR-RFLP method previously reported by Inoko is a powerful technique for HLA class II typing. The reliability of RFLP interpretation depends on complete digestion by restriction endonucleases using a modified primer with restriction sites as an internal digestion control. The use of restriction enzymes which recognize specific HLA DQB allelic variations makes HLA DQB genotyping possible.

  15. Genetic mapping of a food preference gene in the silkworm, Bombyx mori, using restriction fragment length polymorphisms (RFLPs).

    PubMed

    Mase, Keisuke; Iizuka, Tetsuya; Yamamoto, Toshio; Okada, Eiji; Hara, Wajirou

    2007-06-01

    The domesticated silkworm, Bombyx mori, has strict food preferences and grows by feeding on mulberry leaves. However, "Sawa-J", an abnormal feeding habit strain selected from the genetic stock, feeds on an artificial diet without mulberry leaf powder. In this study, the food preference gene in Sawa-J was genetically identified using restriction fragment length polymorphisms (RFLPs) of a cDNA clone on each linkage group. Taking advantage of a lack of genetic recombination in females, reciprocal backcrossed F1 (BC1) progenies were independently prepared using a non-feeding strain, C108, as a mating partner of Sawa-J. Our results of linkage analysis and mapping proved that the feeding behavior is primarily controlled by a major recessive gene mapped at 20.2 cM on RFLP linkage group 9 (RFLG9), and clone e73 at a distance of 4.2 cM was found as the first linked molecular marker.

  16. Developing a map of geologically defined site-condition categories for California

    USGS Publications Warehouse

    Wills, C.J.; Clahan, K.B.

    2006-01-01

    Consideration of site conditions is a vital step in analyzing and predicting earthquake ground motion. The importance of amplification by soil conditions has long been recognized, but though many seismic-instrument sites have been characterized by their geologic conditions, there has been no consistent, simple classification applied to all sites. As classification of sites by shear-wave velocity has become more common, the need to go back and provide a simple uniform classification for all stations has become apparent. Within the Pacific Earthquake Engineering Research Center's Next Generation Attenuation equation project, developers of attenuation equations recognized the need to consider site conditions and asked that the California Geological Survey provide site conditions information for all stations that have recorded earthquake ground motion in California. To provide these estimates, we sorted the available shear-wave velocity data by geologic unit, generalized the geologic units, and prepared a map so that we could use the extent of the map units to transfer the velocity characteristics from the sites where they were measured to sites on the same or similar materials. This new map is different from the California Geological Survey "preliminary site-conditions map of California" in that 19 geologically defined categories are used, rather than National Earthquake Hazards Reduction Program categories. Although this map does not yet cover all of California, when completed it may provide a basis for more precise consideration of site conditions in ground-motion calculations.

  17. Restriction site detection in repetitive nuclear DNA sequences of Trypanosoma evansi for strain differentiation among different isolates.

    PubMed

    Shyma, K P; Gupta, S K; Gupta, J P; Singh, Ajit; Chaudhari, S S; Singh, Veer

    2016-09-01

    The differences or similarities among different isolates of Trypanosoma evansi through endonuclease profile was identified in the present study. The repetitive nuclear DNA of T. evansi isolated from infected cattle, buffalo and equine blood was initially amplified by PCR using specific primers. A panel of restriction enzymes, EcoRI, Eco91l, HindIII and PstI were for complete digestion of PCR products. Agarose gel electrophoresis of digested product did not show cleavage fragments and only single DNA band of the original size was visible in the ethidium bromide stained agarose gel. This indicated that the 227 bp PCR product from repetitive sequence had no site-specific cleavage sites for the REs used in this study. No heterogeneity in the repetitive nuclear DNA restriction endonuclease profile among the different isolates was recorded.

  18. M-ORBIS: mapping of molecular binding sites and surfaces.

    PubMed

    Albou, Laurent-Philippe; Poch, Olivier; Moras, Dino

    2011-01-01

    M-ORBIS is a Molecular Cartography approach that performs integrative high-throughput analysis of structural data to localize all types of binding sites and associated partners by homology and to characterize their properties and behaviors in a systemic way. The robustness of our binding site inferences was compared to four curated datasets corresponding to protein heterodimers and homodimers and protein-DNA/RNA assemblies. The Molecular Cartographies of structurally well-detailed proteins shows that 44% of their surfaces interact with non-solvent partners. Residue contact frequencies with water suggest that ∼86% of their surfaces are transiently solvated, whereas only 15% are specifically solvated. Our analysis also reveals the existence of two major binding site families: specific binding sites which can only bind one type of molecule (protein, DNA, RNA, etc.) and polyvalent binding sites that can bind several distinct types of molecule. Specific homodimer binding sites are for instance nearly twice as hydrophobic than previously described and more closely resemble the protein core, while polyvalent binding sites able to form homo and heterodimers more closely resemble the surfaces involved in crystal packing. Similarly, the regions able to bind DNA and to alternatively form homodimers, are more hydrophobic and less polar than previously described DNA binding sites.

  19. Metal-binding sites at the active site of restriction endonuclease BamHI can conform to a one-ion mechanism.

    PubMed

    Mones, Letif; Simon, István; Fuxreiter, Monika

    2007-01-01

    The number of metal ions required for phosphoryl transfer in restriction endonucleases is still an unresolved question in molecular biology. The two Ca(2+) and Mn(2+) ions observed in the pre- and post-reactive complexes of BamHI conform to the classical two-metal ion choreography. We probed the Mg(2+) cofactor positions at the active site of BamHI by molecular dynamics simulations with one and two metal ions present and identified several catalytically relevant sites. These can mark the pathway of a single ion during catalysis, suggesting its critical role, while a regulatory function is proposed for a possible second ion.

  20. Categoric prediction of metal ion mechanisms in the active sites of 17 select type II restriction endonucleases.

    PubMed

    Advani, Sonia; Mishra, Puneet; Dubey, Shraddha; Thakur, Samridhi

    2010-11-12

    Recently determined crystal structures of type II restriction endonucleases have produced a plethora of information on the basis for target site sequence selectivity. The positioning and role of metal ions in DNA recognition sites might reflect important properties of protein-DNA interaction. Although acidic and basic groups in the active sites can be identified, and in some cases divalent-metal binding sites delineated, a convincing picture clarifying the way in which the attacking hydroxide ion is generated, and the leaving group stabilized, has not been elucidated for any of the enzymes. We have examined the interatomic distances between metal ions and proposed key catalytic residues in the binding sites of seventeen type II restriction endonucleases whose crystal structures are documented in literature. The summary and critical evaluation of structural assignments and predictions made earlier have been useful to group these enzymes. All the enzymes used for this study have been categorized on the basis of the number of metal ions identified in their crystal structures. Among 17 experimentally characterized (not putative) type II REases, whose apparently full-length sequences are available in REBASE, we predict 8 (47%) to follow the single metal ion mechanism, 5 to follow the two metal ion mechanism, 2, the three metal ion mechanism, 1, the four metal ion mechanism and 1 the six metal ion mechanism. Copyright © 2010 Elsevier Inc. All rights reserved.

  1. Segregation patterns of polymorphic restriction sites of the gene encoding the alpha subunit of human chorionic gonadotropin in trophoblastic disease.

    PubMed Central

    Hoshina, M; Boothby, M R; Hussa, R D; Pattillo, R A; Camel, H M; Boime, I

    1984-01-01

    The gene encoding the alpha subunit of human chorionic gonadotropin contains at least two polymorphic sites in its 3' flanking region detected by restriction enzymes HindIII and EcoRI. We used these polymorphic sites as markers of tissue genotype in normal placenta, hydatidiform mole, choriocarcinoma, and peripheral leukocytes. As expected, inheritance patterns of most hydatidiform moles showed only a paternal genetic contribution. However, one uncommon DNA polymorphism pattern, homozygosity for the absence of the EcoRI site and the presence of the HindIII site, predominated in choriocarcinoma. Thus, our results suggest that moles which have this uncommon polymorphism pattern appear particularly likely to develop into choriocarcinoma. Images PMID:6201859

  2. 1999 Report on Hanford Site land disposal restriction for mixed waste

    SciTech Connect

    BLACK, D.G.

    1999-03-25

    This report was submitted to meet the requirements of Hanford Federal Facility Agreement and Consent Order (Tri-Party Agreement) Milestone M-26-011. This milestone requires the preparation of an annual report that covers characterization, treatment, storage, minimization, and other aspects of managing land-disposal-restricted mixed waste at the Hanford Facility.

  3. Restriction map of the 125-kilobase plasmid of Bacillus thuringiensis subsp. israelensis carrying the genes that encode delta-endotoxins active against mosquito larvae.

    PubMed Central

    Ben-Dov, E; Einav, M; Peleg, N; Boussiba, S; Zaritsky, A

    1996-01-01

    A large plasmid containing all delta-endotoxin genes was isolated from Bacillus thuringiensis subsp. israelensis; restricted by BamHI, EcoRI, HindIII, KpnI, PstI, SacI, and SalI; and cloned as appropriate libraries in Escherichia coli. The libraries were screened for inserts containing recognition sites for BamHI, SacI, and SalI. Each was labeled with 32P and hybridized to Southern blots of gels with fragments generated by cleaving the plasmid with several restriction endonucleases, to align at least two fragments of the relevant enzymes. All nine BamHI fragments and all eight SacI fragments were mapped in two overlapping linkage groups (with total sizes of about 76 and 56 kb, respectively). The homology observed between some fragments is apparently a consequence of the presence of transposons and repeated insertion sequences. Four delta-endotoxin genes (cryIVB-D and cytA) and two genes for regulatory polypeptides (of 19 and 20 kDa) were localized on a 21-kb stretch of the plasmid; without cytA, they are placed on a single BamHI fragment. This convergence enables subcloning of delta-endotoxin genes (excluding cryIVA, localized on the other linkage group) as an intact natural fragment. PMID:8795201

  4. Spatial Data Mining Toolbox for Mapping Suitability of Landfill Sites Using Neural Networks

    NASA Astrophysics Data System (ADS)

    Abujayyab, S. K. M.; Ahamad, M. S. S.; Yahya, A. S.; Aziz, H. A.

    2016-09-01

    Mapping the suitability of landfill sites is a complex field and is involved with multidiscipline. The purpose of this research is to create an ArcGIS spatial data mining toolbox for mapping the suitability of landfill sites at a regional scale using neural networks. The toolbox is constructed from six sub-tools to prepare, train, and process data. The employment of the toolbox is straightforward. The multilayer perceptron (MLP) neural networks structure with a backpropagation learning algorithm is used. The dataset is mined from the north states in Malaysia. A total of 14 criteria are utilized to build the training dataset. The toolbox provides a platform for decision makers to implement neural networks for mapping the suitability of landfill sites in the ArcGIS environment. The result shows the ability of the toolbox to produce suitability maps for landfill sites.

  5. Brownfields Road Map to Understanding Options for Site Investigation and Cleanup, Fifth Edition

    EPA Pesticide Factsheets

    The Brownfields Road Map publication and companion website provide a general outline of how to assess and clean up a brownfields site and introduce stakeholders to a range of technology options and available resources.

  6. Preliminary Correlation Map of Geomorphic Surfaces in North-Central Frenchman Flat, Nevada Test Site

    SciTech Connect

    Bechtel Nevada

    2005-08-01

    This correlation map (scale = 1:12,000) presents the results of a mapping initiative that was part of the comprehensive site characterization required to operate the Area 5 Radioactive Waste Management Site, a low-level radioactive waste disposal facility located in northern Frenchman Flat at the Nevada Test Site. Eight primary map units are recognized for Quaternary surfaces: remnants of six alluvial fan or terrace surfaces, one unit that includes colluvial aprons associated with hill slopes, and one unit for anthropogenically disturbed surfaces. This surficial geology map provides fundamental data on natural processes for reconstruction of the Quaternary history of northern Frenchman Flat, which in turn will aid in the understanding of the natural processes that act to develop the landscape, and the time-frames involved in landscape development. The mapping was conducted using color and color-infrared aerial photographs and field verification of map unit composition and boundaries. Criteria for defining the map unit composition of geomorphic surface units are based on relative geomorphic position, landform morphology, and degree of preservation of surface morphology. The bedrock units identified on this map were derived from previous published mapping efforts and are included for completeness.

  7. Physical mapping of the restriction fragments obtained from bacteriophage T4 dC-DNA with the restriction endonucleases SmaI, KpnI and BglII.

    PubMed

    Kiko, H; Niggemann, E; Rüger, W

    1979-01-01

    The cytosine-containing DNA of a mutant of bacteriophage T4 was digested with restriction endonucleases SmaI, KpnI and BglII producing 5, 7 and 13 fragments respectively. Complete physical maps of the T4 genome were constructed with the enzymes SmaI and KpnI and an almost complete map with the enzyme BglII.

  8. Resolution of quantitative traits into Mendelian factors by using a complete linkage map of restriction fragment length polymorphisms.

    PubMed

    Paterson, A H; Lander, E S; Hewitt, J D; Peterson, S; Lincoln, S E; Tanksley, S D

    1988-10-20

    The conflict between the Mendelian theory of particulate inheritance and the observation of continuous variation for most traits in nature was resolved in the early 1900s by the concept that quantitative traits can result from segregation of multiple genes, modified by environmental effects. Although pioneering experiments showed that linkage could occasionally be detected to such quantitative trait loci (QTLs), accurate and systematic mapping of QTLs has not been possible because the inheritance of an entire genome could not be studied with genetic markers. The use of restriction fragment length polymorphisms (RFLPs) has made such investigations possible, at least in principle. Here, we report the first use of a complete RFLP linkage map to resolve quantitative traits into discrete Mendelian factors, in an interspecific back-cross of tomato. Applying new analytical methods, we mapped at least six QTLs controlling fruit mass, four QTLs for the concentration of soluble solids and five QTLs for fruit pH. This approach is broadly applicable to the genetic dissection of quantitative inheritance of physiological, morphological and behavioural traits in any higher plant or animal.

  9. Soils maps supplement to soil moisture ground truth, Lafayette, Indiana, site St. Charles, Missouri, site

    NASA Technical Reports Server (NTRS)

    Jones, E. B.; Olt, S. E.

    1975-01-01

    A compilation of soils information obtained as the result of a library search of data on the Lafayette, Indiana, site and St. Charles, Missouri, site is presented. Soils data for the Lafayette, Indiana, site are shown in Plates 1 and 2; and soils data for the St. Charles, Missouri, site are shown in Plates 3 and 4.

  10. [Cloning-idependent mapping technology for genomic fidelity, contig linking, C-DNA site analysis, and gene detection]. Final report

    SciTech Connect

    Lerman, L.S.

    1994-12-25

    The project was designed to develop and apply a novel unconventional approach to genome mapping based on physical properties of DNA that are a sensitive function of the base sequence, and so does not depend on the clonability of the sequences to be mapped nor on the presence of particular restriction sites. We have shown that a broad array of DNA fragments are retarded at nearly the same level in denaturing gradient gel electrophoresis (DGGE) if the segment with the lowest thermal stability has the same melting temperature, regardless of the length of the fragment. The retarded pattern remain steady in the gel, changing little with continued field exposure. Mapping proceeds by the analysis of two-dimensional patterns produced by random fragmentation of genomic DNA and denaturing gradient gel electrophoresis. Random fragments are first separated according to length by conventional agarose electrophoresis. The result is a two- dimensional pattern which can be idealized as an array of nearly parallel, mostly separated lines of DNA. The pattern is blotted onto a membrane and probed sequentially with oligos or relevant DNA or RNA fragments. The endpoints on the fragment length scale of each line hybridizing with each probe, the distribution along each line, and the depth in the gradient constitute specific map information.

  11. Mapping epitopes and antigenicity by site-directed masking

    PubMed Central

    Paus, Didrik; Winter, Greg

    2006-01-01

    Here we describe a method for mapping the binding of antibodies to the surface of a folded antigen. We first created a panel of mutant antigens (β-lactamase) in which single surface-exposed residues were mutated to cysteine. We then chemically tethered the cysteine residues to a solid phase, thereby masking a surface patch centered on each cysteine residue and blocking the binding of antibodies to this region of the surface. By these means we mapped the epitopes of several mAbs directed to β-lactamase. Furthermore, by depleting samples of polyclonal antisera to the masked antigens and measuring the binding of each depleted sample of antisera to unmasked antigen, we mapped the antigenicity of 23 different epitopes. After immunization of mice and rabbits with β-lactamase in Freund’s adjuvant, we found that the antisera reacted with both native and denatured antigen and that the antibody response was mainly directed to an exposed and flexible loop region of the native antigen. By contrast, after immunization in PBS, we found that the antisera reacted only weakly with denatured antigen and that the antibody response was more evenly distributed over the antigenic surface. We suggest that denatured antigen (created during emulsification in Freund’s adjuvant) elicits antibodies that bind mainly to the flexible regions of the native protein and that this explains the correlation between antigenicity and backbone flexibility. Denaturation of antigen during vaccination or natural infections would therefore be expected to focus the antibody response to the flexible loops. PMID:16754878

  12. Mapping I-Ag7 restricted epitopes in murine G6PC2

    PubMed Central

    Yang, Tao; Hohenstein, Anita C.; Lee, Catherine E.; Hutton, John C.; Davidson, Howard W.

    2013-01-01

    G6PC2, also known as islet specific glucose 6-phosphatase catalytic subunit related protein (IGRP), is a major target of autoreactive CD8+ T cells in both diabetic human subjects and the non-obese diabetic (NOD) mouse. However, in contrast to the abundant literature regarding the CD8+ response to this antigen, much less is known about the potential involvement of IGRP-reactive CD4+ T cells in diabetogenesis. The single previous study that examined this question in NOD mice was based upon a candidate epitope approach and identified three I-Ag7-restricted epitopes that each elicited spontaneous responses in these animals. However, given the known inaccuracies of MHC class II epitope prediction algorithms, we hypothesized that additional specificities might also be targeted. To address this issue we immunized NOD mice with membranes from insect cells overexpressing full-length recombinant mouse IGRP, and measured recall responses of purified CD4+ T cells using a library of overlapping peptides encompassing the entire 355aa primary sequence. Nine peptides representing 8 epitopes gave recall responses, only 1 of which corresponded to any of the previously reported sequences. In each case proliferation was blocked by a monoclonal antibody to I-Ag7, but not the appropriate isotype control. Consistent with a role in diabetogenesis, proliferative responses to 4 of the 9 peptides (3 epitopes) were also detected in CD4+ T cells purified from the pancreatic draining lymph nodes of pre-diabetic female animals, but not from peripheral lymph nodes or spleens of the same animals. Intriguingly, one of the newly identified spontaneously reactive epitopes (P8 [IGRP55–72]) is highly conserved between mice and man, suggesting that it might also be a target of HLA-DQ8-restricted T cells in diabetic human subjects, an hypothesis that we are currently testing. PMID:22983906

  13. 76 FR 19003 - Land Disposal Restrictions: Nevada and California; Site Specific Treatment Variances for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-06

    ...: Proposed rule. SUMMARY: EPA is proposing to issue both a site-specific treatment variance to U.S. Ecology... proposes to issue both a site-specific treatment variance to U.S. Ecology Nevada (USEN) located in Beatty... section of this document. II. Does this action apply to me? This proposal applies only to U. S. Ecology...

  14. Mapping of phosphorylation sites in polyomavirus large T antigen

    SciTech Connect

    Hassauer, M.; Scheidtmann, K.H.; Walter, G.

    1986-06-01

    The phosphorylation sites of polyomavirus large T antigen from infected or transformed cells were investigated. Tryptic digestion of large T antigen from infected, /sup 32/P/sub i/-labeled cells revealed seven major phosphopeptides. Five of these were phosphorylated only at serine residues, and two were phosphorylated at serine and threonine residues. The overall ratio of phosphoserine to phosphothreonine was 6:1. The transformed cell line B4 expressed two polyomavirus-specific phosphoproteins: large T antigen, which was only weakly phosphorylated, and a truncated form of large T antigen of 34,000 molecular weight which was heavily phosphorylated. Both showed phosphorylation patterns similar to that of large T antigen from infected cells. Peptide analyses of large T antigens encoded by the deletion mutants dl8 and dl23 or of specific fragments of wild-type large T antigen indicated that the phosphorylation sites are located in an amino-terminal region upstream of residue 194. The amino acid composition of the phosphopeptides as revealed by differential labeling with various amino acids indicated that several phosphopeptides contain overlapping sequences and that all phosphorylation sites are located in four tryptic peptides derived from a region between Met71 and Arg191. Two of the potential phosphorylation sites were identified as Ser81 and Thr187. The possible role of this modification of large T antigen is discussed.

  15. Digital geologic map database of the Nevada Test Site area, Nevada

    USGS Publications Warehouse

    Wahl, R.R.; Sawyer, D.A.; Minor, S.A.; Carr, M.D.; Cole, J.C.; Swadley, W.C.; Laczniak, R.J.; Warren, R.G.; Green, K.S.; Engle, C.M.

    1997-01-01

    Forty years of geologic investigations at the Nevada Test Site (NTS) have been digitized. These data include all geologic information that: (1) has been collected, and (2) can be represented on a map within the map borders at the map scale is included in the map digital coverages. The following coverages are included with this dataset: Coverage Type Description geolpoly Polygon Geologic outcrops geolflts line Fault traces geolatts Point Bedding attitudes, etc. geolcald line Caldera boundaries geollins line Interpreted lineaments geolmeta line Metamorphic gradients The above coverages are attributed with numeric values and interpreted information. The entity files documented below show the data associated with each coverage.

  16. Digital geologic map database of the Nevada Test Site area, Nevada

    SciTech Connect

    Wahl, Ronald R.; Sawyer, David A.; Minor, Scott A.; Carr, Michael D.; Cole, James C.; Swadley, W.C.; Laczniak, Randell J.; Warren, Richard G.; Green, Katryn S.; Engle, Colin M.

    1997-09-09

    Forty years of geologic investigations at the Nevada Test Site (NTS) have been digitized. These data include all geologic information that: (1) has been collected, and (2) can be represented on a map within the map borders at the map scale is included in the map digital coverages. The following coverages are included with this dataset: Coverage Type Description geolpoly Polygon Geologic outcrops geolflts line Fault traces geolatts Point Bedding attitudes, etc. geolcald line Caldera boundaries geollins line Interpreted lineaments geolmeta line Metamorphic gradients. The above coverages are attributed with numeric values and interpreted information. The entity files documented below show the data associated with each coverage.

  17. Halogenated naphthyl methoxy piperidines for mapping serotonin transporter sites

    DOEpatents

    Goodman, M.M.; Faraj, B.

    1999-07-06

    Halogenated naphthyl methoxy piperidines having a strong affinity for the serotonin transporter are disclosed. Those compounds can be labeled with positron-emitting and/or gamma emitting halogen isotopes by a late step synthesis that maximizes the useable lifeterm of the label. The labeled compounds are useful for localizing serotonin transporter sites by positron emission tomography and/or single photon emission computed tomography.

  18. Halogenated naphthyl methoxy piperidines for mapping serotonin transporter sites

    DOEpatents

    Goodman, Mark M.; Faraj, Bahjat

    1999-01-01

    Halogenated naphthyl methoxy piperidines having a strong affinity for the serotonin transporter are disclosed. Those compounds can be labeled with positron-emitting and/or gamma emitting halogen isotopes by a late step synthesis that maximizes the useable lifeterm of the label. The labeled compounds are useful for localizing serotonin transporter sites by positron emission tomography and/or single photon emission computed tomography.

  19. Structure of the cloned Locusta migratoria mitochondrial genome: restriction mapping and sequence of its ND-1 (URF-1) gene.

    PubMed

    McCracken, A; Uhlenbusch, I; Gellissen, G

    1987-01-01

    We have cloned the entire mitochondrial genome of Locusta migratoria in four fragments and characterised by restriction mapping. In addition, we have sequenced a 1,095 kb region containing the ND-1 (URF-1) gene. The inferred primary structure of the protein is highly homologous to its Drosophila counterpart (68%). The gene is flanked at the 5' end by the tRNA(CUNleu) gene, interrupted by the sequence TTG. The 3' end is flanked by the tRNA(UCNser) gene, followed by a sequence homologous to the 3' end of D. yakuba cytochrome b. The relative position of the genes is conserved between Locusta and Drosophila, thus indicating conservation of mitochondrial gene order in insects.

  20. Complete Bouguer gravity map of the Nevada Test Site and vicinity, Nevada

    SciTech Connect

    Healey, D.L.; Harris, R.N.; Ponce, D.A.; Oliver, H.W.

    1987-12-31

    About 15,000 gravity stations were used to create the gravity map. Gravity studies at the Nevada Test Site were undertaken to help locate geologically favorable areas for underground nuclear tests and to help characterize potential high-level nuclear waste storage sites. 48 refs. (TEM)

  1. Communication: Quantitative multi-site frequency maps for amide I vibrational spectroscopy

    NASA Astrophysics Data System (ADS)

    Reppert, Mike; Tokmakoff, Andrei

    2015-08-01

    An accurate method for predicting the amide I vibrational spectrum of a given protein structure has been sought for many years. Significant progress has been made recently by sampling structures from molecular dynamics simulations and mapping local electrostatic variables onto the frequencies of individual amide bonds. Agreement with experiment, however, has remained largely qualitative. Previously, we used dipeptide fragments and isotope-labeled constructs of the protein G mimic NuG2b as experimental standards for developing and testing amide I frequency maps. Here, we combine these datasets to test different frequency-map models and develop a novel method to produce an optimized four-site potential (4P) map based on the CHARMM27 force field. Together with a charge correction for glycine residues, the optimized map accurately describes both experimental datasets, with average frequency errors of 2-3 cm-1. This 4P map is shown to be convertible to a three-site field map which provides equivalent performance, highlighting the viability of both field- and potential-based maps for amide I spectral modeling. The use of multiple sampling points for local electrostatics is found to be essential for accurate map performance.

  2. Communication: Quantitative multi-site frequency maps for amide I vibrational spectroscopy

    SciTech Connect

    Reppert, Mike; Tokmakoff, Andrei

    2015-08-14

    An accurate method for predicting the amide I vibrational spectrum of a given protein structure has been sought for many years. Significant progress has been made recently by sampling structures from molecular dynamics simulations and mapping local electrostatic variables onto the frequencies of individual amide bonds. Agreement with experiment, however, has remained largely qualitative. Previously, we used dipeptide fragments and isotope-labeled constructs of the protein G mimic NuG2b as experimental standards for developing and testing amide I frequency maps. Here, we combine these datasets to test different frequency-map models and develop a novel method to produce an optimized four-site potential (4P) map based on the CHARMM27 force field. Together with a charge correction for glycine residues, the optimized map accurately describes both experimental datasets, with average frequency errors of 2–3 cm{sup −1}. This 4P map is shown to be convertible to a three-site field map which provides equivalent performance, highlighting the viability of both field- and potential-based maps for amide I spectral modeling. The use of multiple sampling points for local electrostatics is found to be essential for accurate map performance.

  3. Global Mapping of the Inc-Human Interactome Reveals that Retromer Restricts Chlamydia Infection.

    PubMed

    Mirrashidi, Kathleen M; Elwell, Cherilyn A; Verschueren, Erik; Johnson, Jeffrey R; Frando, Andrew; Von Dollen, John; Rosenberg, Oren; Gulbahce, Natali; Jang, Gwendolyn; Johnson, Tasha; Jäger, Stefanie; Gopalakrishnan, Anusha M; Sherry, Jessica; Dunn, Joe Dan; Olive, Andrew; Penn, Bennett; Shales, Michael; Cox, Jeffery S; Starnbach, Michael N; Derre, Isabelle; Valdivia, Raphael; Krogan, Nevan J; Engel, Joanne

    2015-07-08

    Chlamydia trachomatis is a leading cause of genital and ocular infections for which no vaccine exists. Upon entry into host cells, C. trachomatis resides within a membrane-bound compartment—the inclusion—and secretes inclusion membrane proteins (Incs) that are thought to modulate the host-bacterium interface. To expand our understanding of Inc function(s), we subjected putative C. trachomatis Incs to affinity purification-mass spectroscopy (AP-MS). We identified Inc-human interactions for 38/58 Incs with enrichment in host processes consistent with Chlamydia's intracellular life cycle. There is significant overlap between Inc targets and viral proteins, suggesting common pathogenic mechanisms among obligate intracellular microbes. IncE binds to sorting nexins (SNXs) 5/6, components of the retromer, which relocalizes SNX5/6 to the inclusion membrane and augments inclusion membrane tubulation. Depletion of retromer components enhances progeny production, revealing that retromer restricts Chlamydia infection. This study demonstrates the value of proteomics in unveiling host-pathogen interactions in genetically challenging microbes.

  4. Stable Positioning of Unc13 Restricts Synaptic Vesicle Fusion to Defined Release Sites to Promote Synchronous Neurotransmission.

    PubMed

    Reddy-Alla, Suneel; Böhme, Mathias A; Reynolds, Eric; Beis, Christina; Grasskamp, Andreas T; Mampell, Malou M; Maglione, Marta; Jusyte, Meida; Rey, Ulises; Babikir, Husam; McCarthy, Anthony W; Quentin, Christine; Matkovic, Tanja; Bergeron, Dominique Dufour; Mushtaq, Zeeshan; Göttfert, Fabian; Owald, David; Mielke, Thorsten; Hell, Stefan W; Sigrist, Stephan J; Walter, Alexander M

    2017-09-13

    Neural information processing depends on precisely timed, Ca(2+)-activated synaptic vesicle exocytosis from release sites within active zones (AZs), but molecular details are unknown. Here, we identify that the (M)Unc13-family member Unc13A generates release sites and show the physiological relevance of their restrictive AZ targeting. Super-resolution and intravital imaging of Drosophila neuromuscular junctions revealed that (unlike the other release factors Unc18 and Syntaxin-1A) Unc13A was stably and precisely positioned at AZs. Local Unc13A levels predicted single AZ activity. Different Unc13A portions selectively affected release site number, position, and functionality. An N-terminal fragment stably localized to AZs, displaced endogenous Unc13A, and reduced the number of release sites, while a C-terminal fragment generated excessive sites at atypical locations, resulting in reduced and delayed evoked transmission that displayed excessive facilitation. Thus, release site generation by the Unc13A C terminus and their specific AZ localization via the N terminus ensure efficient transmission and prevent ectopic, temporally imprecise release. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Classification and mapping forest sites using geographic information system (GIS): a case study in Artvin Province.

    PubMed

    Altun, Lokman; Baskent, Emin Zeki; Gunlu, Alkan; Kadiogullari, Ali Ihsan

    2008-02-01

    The productivity of forest sites has been indirectly determined with solo wood production objective in forest management. Forest site productivity should, however, be determined directly in order to implement ecosystem based multipurpose forest management philosophy. This article tackles the problem in distinguishing and mapping forest sites using both direct method and indirect method in Genya Mountain located in central of Artvin State Forest Enterprise. About 112 sample plots were designed and distributed over the area. In each sample plot, soil samples were collected and the classical timber inventory measurements were taken. According to direct method, Soil Moisture Regime (SMR) method is preferred due to a water deficiency in the study area. Water holding capacity was used as an essential criterion for the classification of the forest site. Forest site classifications were assigned regarding the physiographic factors such as landform, aspect, and slope. Five different forest sites classes; dry, moderate fresh, fresh, humid and hygric were determined. According to direct method, the guiding curve was used to generate anamorphic site index (SI) equations and three site index classes; good (SI=I-II), medium (SI=III) and low (SI=IV-V) were determined. Some important differences between the methods were realized. The forest sites determined with site index estimation method indicate that site index I and II is 505.99 ha, III 1095.79 ha and IV and V 992.95 ha, whereas forest sites determined with direct method related to dry site of 937.58 ha, moderate fresh site of 931.90 ha, fresh site of 1,797.71 ha, humid site of 80.48 ha and hygric site of 356.55 ha. The forest site maps of both methods were created using GIS functions. The forest sites of open and degraded areas should be determined according to direct method.

  6. Restriction Site Extension PCR: A Novel Method for High-Throughput Characterization of Tagged DNA Fragments and Genome Walking

    PubMed Central

    Ji, Jiabing; Braam, Janet

    2010-01-01

    Background Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. Methodology/Principal Findings We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR) to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3′ overhang of the endonuclease (KpnI, NsiI, PstI, or SacI) restricted DNA fragments, extends the 3′ end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR), touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. Conclusions/Significance RSE-PCR has high potential application in identifying tagged (T-DNA or transposon) sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well. PMID:20485508

  7. Comparison of Kriging and coKriging for soil contamination mapping in abandoned mine sites

    NASA Astrophysics Data System (ADS)

    Lee, Hyeongyu; Choi, Yosoon

    2015-04-01

    Soil contamination mapping around abandoned mines is an important task for the planning and design of mine reclamation. This study compared the ordinary Kriging and the co-Kriging methods for the soil contamination mapping in abandoned mine sites. Four approaches were conducted as follows: (1) soil contamination mapping using the ordinary Kriging and Inductively Coupled Plasma (ICP) data only; (2) soil contamination mapping using the ordinary Kriging and Portable X-Ray Fluorescence (PXRF) data only; (3) soil contamination mapping using the ordinary Kriging and integrated data from ICP and PXRF; and (4) soil contamination mapping using the co-Kriging and integrated data from ICP and PXRF. Results indicate that the approach 3 provides substantial improvements over other three approaches including a more reasonable spatial pattern of soil contamination and reduction in the error of its estimates.

  8. DNA fingerprinting of Ralstonia paucula by infrequent-restriction-site PCR and randomly amplified polymorphic DNA analysis.

    PubMed

    Moissenet, Didier; Vu-Thien, Hoang; Benzerara, Yahia; Arlet, Guillaume

    2003-12-01

    Ralstonia paucula (formerly CDC group IV c-2) is an environmental organism that can cause serious human infections, occasionally clusters of nosocomial infections. In the present work, 26 strains of R. paucula (4 from the American Centers for Disease Control and Prevention collection, 10 from the Belgian Laboratorium voor Microbiologie [LMG] collection, and 12 French clinical isolates) were analyzed with infrequent-restriction-site PCR and randomly amplified polymorphic DNA analysis. Both techniques accurately distinguished between collection strains. Two close patterns obtained for all the French isolates suggested a clonal strain. Two LMG collection strains originating from human sources in the United States also showed patterns close to those of French isolates.

  9. Restriction Site Tiling Analysis: accurate discovery and quantitative genotyping of genome-wide polymorphisms using nucleotide arrays

    PubMed Central

    2010-01-01

    High-throughput genotype data can be used to identify genes important for local adaptation in wild populations, phenotypes in lab stocks, or disease-related traits in human medicine. Here we advance microarray-based genotyping for population genomics with Restriction Site Tiling Analysis. The approach simultaneously discovers polymorphisms and provides quantitative genotype data at 10,000s of loci. It is highly accurate and free from ascertainment bias. We apply the approach to uncover genomic differentiation in the purple sea urchin. PMID:20403197

  10. Group analysis of self-organizing maps based on functional MRI using restricted Frechet means

    PubMed Central

    Fournel, Arnaud P.; Reynaud, Emanuelle; Brammer, Michael J.; Simmons, Andrew; Ginestet, Cedric E.

    2013-01-01

    Studies of functional MRI data are increasingly concerned with the estimation of differences in spatio-temporal networks across groups of subjects or experimental conditions. Unsupervised clustering and independent component analysis (ICA) have been used to identify such spatio-temporal networks. While these approaches have been useful for estimating these networks at the subject-level, comparisons over groups or experimental conditions require further methodological development. In this paper, we tackle this problem by showing how self-organizing maps (SOMs) can be compared within a Frechean inferential framework. Here, we summarize the mean SOM in each group as a Frechet mean with respect to a metric on the space of SOMs. The advantage of this approach is twofold. Firstly, it allows the visualization of the mean SOM in each experimental condition. Secondly, this Frechean approach permits one to draw inference on group differences, using permutation of the group labels. We consider the use of different distance functions, and introduce one extension of the classical sum of minimum distance (SMD) between two SOMs, which take into account the spatial pattern of the fMRI data. The validity of these methods is illustrated on synthetic data. Through these simulations, we show that the two distance functions of interest behave as expected, in the sense that the ones capturing temporal and spatial aspects of the SOMs are more likely to reach significance under simulated scenarios characterized by temporal, spatial [and spatio-temporal] differences, respectively. In addition, a re-analysis of a classical experiment on visually-triggered emotions demonstrates the usefulness of this methodology. In this study, the multivariate functional patterns typical of the subjects exposed to pleasant and unpleasant stimuli are found to be more similar than the ones of the subjects exposed to emotionally neutral stimuli. In this re-analysis, the group-level SOM output units with the

  11. Identifying ultrasonic scattering sites from three-dimensional impedance maps

    NASA Astrophysics Data System (ADS)

    Mamou, Jonathan; Oelze, Michael L.; O'Brien, William D.; Zachary, James F.

    2005-01-01

    Ultrasonic backscattered signals contain frequency-dependent information that is usually discarded to produce conventional B-mode images. It is hypothesized that parametrization of the quantitative ultrasound frequency-dependent information (i.e., estimating scatterer size and acoustic concentration) may be related to discrete scattering anatomic structures in tissues. Thus, an estimation technique is proposed to extract scatterer size and acoustic concentration from the power spectrum derived from a three-dimensional impedance map (3DZM) of a tissue volume. The 3DZM can be viewed as a computational phantom and is produced from a 3D histologic data set. The 3D histologic data set is constructed from tissue sections that have been appropriately stained to highlight specific tissue features. These tissue features are assigned acoustic impedance values to yield a 3DZM. From the power spectrum, scatterer size and acoustic concentration estimates were obtained by optimization. The 3DZM technique was validated by simulations that showed relative errors of less than 3% for all estimated parameters. Estimates using the 3DZM technique were obtained and compared against published ultrasonically derived estimates for two mammary tumors, a rat fibroadenoma and a 4T1 mouse mammary carcinoma. For both tumors, the relative difference between ultrasonic and 3DZM estimates was less than 10% for the average scatterer size. .

  12. 1998 report on Hanford Site land disposal restrictions for mixed waste

    SciTech Connect

    Black, D.G.

    1998-04-10

    This report was submitted to meet the requirements of Hanford Federal Facility Agreement and Consent Order (Tri-Party Agreement) Milestone M-26-01H. This milestone requires the preparation of an annual report that covers characterization, treatment, storage, minimization, and other aspects of managing land-disposal-restricted mixed waste at the Hanford Facility. The US Department of Energy, its predecessors, and contractors on the Hanford Facility were involved in the production and purification of nuclear defense materials from the early 1940s to the late 1980s. These production activities have generated large quantities of liquid and solid mixed waste. This waste is regulated under authority of both the Resource Conservation and Recovery Act of l976 and the Atomic Energy Act of 1954. This report covers only mixed waste. The Washington State Department of Ecology, US Environmental Protection Agency, and US Department of Energy have entered into the Tri-Party Agreement to bring the Hanford Facility operations into compliance with dangerous waste regulations. The Tri-Party Agreement required development of the original land disposal restrictions (LDR) plan and its annual updates to comply with LDR requirements for mixed waste. This report is the eighth update of the plan first issued in 1990. The Tri-Party Agreement requires and the baseline plan and annual update reports provide the following information: (1) Waste Characterization Information -- Provides information about characterizing each LDR mixed waste stream. The sampling and analysis methods and protocols, past characterization results, and, where available, a schedule for providing the characterization information are discussed. (2) Storage Data -- Identifies and describes the mixed waste on the Hanford Facility. Storage data include the Resource Conservation and Recovery Act of 1976 dangerous waste codes, generator process knowledge needed to identify the waste and to make LDR determinations, quantities

  13. Relationships in Ananas and other related genera using chloroplast DNA restriction site variation.

    PubMed

    Duval, M F; Buso, G S C; Ferreira, F R; Noyer, J L; Coppens d'Eeckenbrugge, G; Hamon, P; Ferreira, M E

    2003-12-01

    Chloroplast DNA (cpDNA) diversity was examined using PCR-RFLP to study phylogenetic relationships in Ananas and related genera. One hundred fifteen accessions representing the seven Ananas species and seven other Bromelioideae including the neighboring monospecific genus Pseudananas, two Pitcairnioideae, and one Tillandsioideae were included in the study. Eight primers designed from cpDNA were used for generating fragments. Restriction by 18 endonucleases generated 255 variable fragments. Dissimilarities were calculated from the resulting matrix using the Sokal and Michener index and the neighbor-joining method was used to reconstruct the diversity tree. Phylogenetic reconstruction was attempted using Wagner parsimony. Phenetic and cladistic analyses gave consistent results. They confirm the basal position of Bromelia in the Bromelioideae. Ananas and Pseudananas form a monophyletic group, with three strongly supported sub-groups, two of which are geographically consistent. The majority of Ananas parguazensis accessions constitute a northern group restricted to the Rio Negro and Orinoco basins in Brazil. The tetraploid Pseudananas sagenarius joins the diploid Ananas fritzmuelleri to constitute a southern group. The third and largest group, which includes all remaining species plus some accessions of A. parguazensis and intermediate phenotypes, is the most widespread and its distribution overlaps those of the northern and southern groups. Ananas ananassoides is dominant in this sub-group and highly variable. Its close relationship to all cultivated species supports the hypothesis that this species is the wild ancestor of the domesticated pineapple. The data indicate that gene flow is common within this group and scarcer with both the first and second groups. Comparison of cpDNA data with published genomic DNA data point to the hybrid origin of Ananas bracteatus and support the autopolyploidy of Pseudananas. The Ananas-Pseudananas group structure and distribution are

  14. Site, Sector, Scope: Mapping the Epistemological Landscape of Health Humanities.

    PubMed

    Charise, Andrea

    2017-05-17

    This essay presents a critical appraisal of the current state of baccalaureate Health Humanities, with a special focus on the contextual differences currently influencing the implementation of this field in Canada and, to a lesser extent, the United States and United Kingdom. I argue that the epistemological bedrock of Health Humanities goes beyond that generated by its written texts to include three external factors that are especially pertinent to undergraduate education: site (the setting of Health Humanities education), sector (the disciplinary eligibility for funding) and scope (the critical engagement with a program's local context alongside an emergent "core" of Health Humanities knowledge, learning, and practice). Drawing largely from the Canadian context, I discuss how these differences can inform or obstruct this field's development, and offer preliminary recommendations for encouraging the growth of baccalaureate Health Humanities-in Canada and elsewhere-in light of these factors.

  15. Mapping protein binding sites on the biomolecular corona of nanoparticles

    NASA Astrophysics Data System (ADS)

    Kelly, Philip M.; Åberg, Christoffer; Polo, Ester; O'Connell, Ann; Cookman, Jennifer; Fallon, Jonathan; Krpetić, Željka; Dawson, Kenneth A.

    2015-05-01

    Nanoparticles in a biological milieu are known to form a sufficiently long-lived and well-organized ‘corona’ of biomolecules to confer a biological identity to the particle. Because this nanoparticle-biomolecule complex interacts with cells and biological barriers, potentially engaging with different biological pathways, it is important to clarify the presentation of functional biomolecular motifs at its interface. Here, we demonstrate that by using antibody-labelled gold nanoparticles, differential centrifugal sedimentation and various imaging techniques it is possible to identify the spatial location of proteins, their functional motifs and their binding sites. We show that for transferrin-coated polystyrene nanoparticles only a minority of adsorbed proteins exhibit functional motifs and the spatial organization appears random, which is consistent, overall, with a stochastic and irreversible adsorption process. Our methods are applicable to a wide array of nanoparticles and can offer a microscopic molecular description of the biological identity of nanoparticles.

  16. Site assessment guidelines provide road map in due diligence

    SciTech Connect

    Not Available

    1994-03-01

    Buyers, sellers and lenders of commercial and industrial real estate since the 1980s have faced potential liability under CERCLA for property contamination. The law stipulates that buyers must exercise due diligence'', conducting all appropriate inquiry'' to determine past ownership and uses of a property, and whether contamination exists. Buyers of polluted property can avoid liability only by showing that contamination occurred before the property was transferred to them, and that they had no knowledge or reason to know'' about the contamination at the time of purchase. Owners or sellers of contaminated property, as well as buyers aware of the contamination at time of purchase, may be designated potentially responsible parties (PRPs) under CERCLA and held liable for site cleanup. Lenders that participate in managing a contaminated property also may be designated PRPs. EPA in 1992 provided a liability exemption for lenders with limited or no management responsibilities for a contaminated property.

  17. An A-T linker adapter polymerase chain reaction method for chromosome walking without restriction site cloning bias.

    PubMed

    Trinh, Quoclinh; Xu, Wentao; Shi, Hui; Luo, Yunbo; Huang, Kunlun

    2012-06-01

    A-T linker adapter polymerase chain reaction (PCR) was modified and employed for the isolation of genomic fragments adjacent to a known DNA sequence. The improvements in the method focus on two points. The first is the modification of the PO(4) and NH(2) groups in the adapter to inhibit the self-ligation of the adapter or the generation of nonspecific products. The second improvement is the use of the capacity of rTaq DNA polymerase to add an adenosine overhang at the 3' ends of digested DNA to suppress self-ligation in the digested DNA and simultaneously resolve restriction site clone bias. The combination of modifications in the adapter and in the digested DNA leads to T/A-specific ligation, which enhances the flexibility of this method and makes it feasible to use many different restriction enzymes with a single adapter. This novel A-T linker adapter PCR overcomes the inherent limitations of the original ligation-mediated PCR method such as low specificity and a lack of restriction enzyme choice. Moreover, this method also offers higher amplification efficiency, greater flexibility, and easier manipulation compared with other PCR methods for chromosome walking. Experimental results from 143 Arabidopsis mutants illustrate that this method is reliable and efficient in high-throughput experiments.

  18. Site specific endonucleases for human genome mapping. Final report, April 1, 1992--March 31, 1994

    SciTech Connect

    Knoche, K.; Selman, S.; Hung, L.

    1994-06-01

    Current large scale genome mapping methodology suffers from a lack of tools for generating specific DNA fragments in the megabase size range. While technology such as pulsed field gel electrophoresis can resolve DNA fragments greater than 10 megabases in size, current methods for cleaving mammalian DNA using bacterial restriction enzymes are incapable of producing such fragments. Though several multidimensional approaches are underway to overcome this limitation, there currently is no single step procedure to generate specific DNA fragments in the 2-100 megabase size range. In order to overcome these limitations, we proposed to develop a family of site-specific endonucleases capable of generating DNA fragments in the 2-100 megabase size range in a single step. Additionally, we proposed to accomplish this by relaxing the specificity of a very-rare cutting intron-encoded endonucleases, I-Ppo I, and potentially using the process as a model for development of other enzymes. Our research has uncovered a great deal of information about intron-encoded endonucleases. We have found that I-Ppo I has a remarkable ability to tolerate degeneracy within its recognition sequence, and we have shown that the recognition sequence is larger than 15 base pairs. These findings suggest that a detailed study of the mechanism by which intron-encoded endonucleases recognize their target sequences should provide new sights into DNA-protein interactions; this had led to a continuation of the study of I-Ppo I in Dr. Raines` laboratory and we expect a more detailed understanding of the mechanism of I-Ppo I action to result.

  19. 76 FR 18921 - Land Disposal Restrictions: Nevada and California; Site Specific Treatment Variances for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-06

    ... variance to U.S. Ecology Nevada (USEN) in Beatty, Nevada and to withdraw an existing site-specific.... Ecology Nevada located in Beatty, Nevada and to Chemical Waste Management, Inc. located in Kettleman Hills...-Bearing Waste II. Basis for This Determination III. Development of This Variance A. U.S. Ecology Nevada...

  20. Supplemental Investigation Plan for FFACO Use Restrictions, Nevada Test Site, Nevada, Revision 0

    SciTech Connect

    Lynn Kidman

    2008-02-01

    This document is part of an effort to re-evaluate all FFACO URs against the current RBCA criteria (referred to in this document as the Industrial Sites [IS] RBCA process) as defined in the Industrial Sites Project Establishment of Final Action Levels (NNSA/NSO, 2006a). After reviewing all of the existing FFACO URs, the 12 URs addressed in this Supplemental Investigation Plan (SIP) could not be evaluated against the current RBCA criteria as sufficient information about the contamination at each site was not available. This document presents the plan for conducting field investigations to obtain the needed information. This SIP includes URs from Corrective Action Units (CAUs) 326, 339, 358, 452, 454, 464, and 1010, located in Areas 2, 6, 12, 19, 25, and 29 of the Nevada Test Site, which is approximately 65 miles northwest of Las Vegas, Nevada; and CAU 403, located in Area 3 of the Tonopah Test Range, which is approximately 165 miles north of Las Vegas, Nevada.

  1. A hyper-temporal remote sensing protocol for high-resolution mapping of ecological sites

    PubMed Central

    Karl, Jason W.

    2017-01-01

    Ecological site classification has emerged as a highly effective land management framework, but its utility at a regional scale has been limited due to the spatial ambiguity of ecological site locations in the U.S. or the absence of ecological site maps in other regions of the world. In response to these shortcomings, this study evaluated the use of hyper-temporal remote sensing (i.e., hundreds of images) for high spatial resolution mapping of ecological sites. We posit that hyper-temporal remote sensing can provide novel insights into the spatial variability of ecological sites by quantifying the temporal response of land surface spectral properties. This temporal response provides a spectral ‘fingerprint’ of the soil-vegetation-climate relationship which is central to the concept of ecological sites. Consequently, the main objective of this study was to predict the spatial distribution of ecological sites in a semi-arid rangeland using a 28-year time series of normalized difference vegetation index from Landsat TM 5 data and modeled using support vector machine classification. Results from this study show that support vector machine classification using hyper-temporal remote sensing imagery was effective in modeling ecological site classes, with a 62% correct classification. These results were compared to Gridded Soil Survey Geographic database and expert delineated maps of ecological sites which had a 51 and 89% correct classification, respectively. An analysis of the effects of ecological state on ecological site misclassifications revealed that sites in degraded states (e.g., shrub-dominated/shrubland and bare/annuals) had a higher rate of misclassification due to their close spectral similarity with other ecological sites. This study identified three important factors that need to be addressed to improve future model predictions: 1) sampling designs need to fully represent the range of both within class (i.e., states) and between class (i.e., ecological

  2. A hyper-temporal remote sensing protocol for high-resolution mapping of ecological sites.

    PubMed

    Maynard, Jonathan J; Karl, Jason W

    2017-01-01

    Ecological site classification has emerged as a highly effective land management framework, but its utility at a regional scale has been limited due to the spatial ambiguity of ecological site locations in the U.S. or the absence of ecological site maps in other regions of the world. In response to these shortcomings, this study evaluated the use of hyper-temporal remote sensing (i.e., hundreds of images) for high spatial resolution mapping of ecological sites. We posit that hyper-temporal remote sensing can provide novel insights into the spatial variability of ecological sites by quantifying the temporal response of land surface spectral properties. This temporal response provides a spectral 'fingerprint' of the soil-vegetation-climate relationship which is central to the concept of ecological sites. Consequently, the main objective of this study was to predict the spatial distribution of ecological sites in a semi-arid rangeland using a 28-year time series of normalized difference vegetation index from Landsat TM 5 data and modeled using support vector machine classification. Results from this study show that support vector machine classification using hyper-temporal remote sensing imagery was effective in modeling ecological site classes, with a 62% correct classification. These results were compared to Gridded Soil Survey Geographic database and expert delineated maps of ecological sites which had a 51 and 89% correct classification, respectively. An analysis of the effects of ecological state on ecological site misclassifications revealed that sites in degraded states (e.g., shrub-dominated/shrubland and bare/annuals) had a higher rate of misclassification due to their close spectral similarity with other ecological sites. This study identified three important factors that need to be addressed to improve future model predictions: 1) sampling designs need to fully represent the range of both within class (i.e., states) and between class (i.e., ecological sites

  3. Post-Closure Strategy for Use-Restricted Sites on the Nevada National Security Site, Nevada Test and Training Range, and Tonopah Test Range, Nevada

    SciTech Connect

    Silvas, A. J.

    2014-03-26

    The purpose of this Post-Closure Strategy is to provide a consistent methodology for continual evaluation of post-closure requirements for use-restricted areas on the Nevada National Security Site (NNSS), Nevada Test and Training Range (NTTR), and Tonopah Test Range (TTR) to consolidate, modify, or streamline the program. In addition, this document stipulates the creation of a single consolidated Post-Closure Plan that will detail the current post-closure requirements for all active use restrictions (URs) and outlines its implementation and subsequent revision. This strategy will ensure effective management and control of the post-closure sites. There are currently over 200 URs located on the NNSS, NTTR, and TTR. Post-closure requirements were initially established in the Closure Report for each site. In some cases, changes to the post-closure requirements have been implemented through addenda, errata sheets, records of technical change, or letters. Post-closure requirements have been collected from these multiple sources and consolidated into several formats, such as summaries and databases. This structure increases the possibility of inconsistencies and uncertainty. As more URs are established and the post-closure program is expanded, the need for a comprehensive approach for managing the program will increase. Not only should the current requirements be obtainable from a single source that supersedes all previous requirements, but the strategy for modifying the requirements should be standardized. This will enable more effective management of the program into the future. This strategy document and the subsequent comprehensive plan are to be implemented under the assumption that the NNSS and outlying sites will be under the purview of the U.S. Department of Energy, National Nuclear Security Administration for the foreseeable future. This strategy was also developed assuming that regulatory control of the sites remains static. The comprehensive plan is not

  4. PFGE-resolved RFLP analysis and long range restriction mapping of the DNA of Arabidopsis thaliana using whole YAC clones as probes.

    PubMed Central

    Bancroft, I; Westphal, L; Schmidt, R; Dean, C

    1992-01-01

    The cleavage patterns of 23 rare-cutting restriction endonucleases (rcREs) on high molecular weight DNA, isolated from leaves of Arabidopsis thaliana (Arabidopsis), have been analysed using pulsed field gel electrophoresis (PFGE). The DNA digested with rcREs can be used for restriction fragment length polymorphism (RFLP) analysis. We show that RFLPs are more readily identified in restriction fragments that require resolution by PFGE than in smaller restriction fragments. Taking advantage of the low dispersed repetitive DNA content of the Arabidopsis genome, whole yeast artificial chromosomes (YACs) were used as probes to PFGE resolved genomic DNA. This enabled whole YAC clones to be used as RFLP markers and long range restriction maps to be constructed. These techniques should enhance the analysis of regions of the genome of Arabidopsis (and other organisms with low levels of dispersed repetitive DNA) that are the subject of chromosome walking strategies to isolate particular loci. Images PMID:1361981

  5. Geologic sketch map of the candidate Proclus Apollo landing site, part K

    NASA Technical Reports Server (NTRS)

    Lucchitta, B. K.

    1972-01-01

    An Apollo 15 panoramic camera frame was used as a base for a geologic sketch map of an area near Proclus Crater. The map was prepared to investigate the usefulness of the panoramic camera photography in large-scale geologic mapping and to assess the geologic value of the area as a potential Apollo landing site. The photographs, taken under high solar illumination, resulted in good definition of albedo features, and stereoscopic viewing provided extreme clarity of topographic relief with terrain units easily delineated. The geological characteristics of the area as evidenced by the high-resolution photographs is discussed. It is concluded that the panoramic camera photographs reveal a wealth of detail and are eminently suited for geologic mapping purposes. In addition, the Proclus area, as a potential landing site, offers relatively rough plains terrain.

  6. CisSERS: Customizable in silico sequence evaluation for restriction sites

    SciTech Connect

    Sharpe, Richard M.; Koepke, Tyson; Harper, Artemus; Grimes, John; Galli, Marco; Satoh-Cruz, Mio; Kalyanaraman, Ananth; Evans, Katherine; Kramer, David; Dhingra, Amit; Prasad, Manoj

    2016-04-12

    High-throughput sequencing continues to produce an immense volume of information that is processed and assembled into mature sequence data. Here, data analysis tools are urgently needed that leverage the embedded DNA sequence polymorphisms and consequent changes to restriction sites or sequence motifs in a high-throughput manner to enable biological experimentation. CisSERS was developed as a standalone open source tool to analyze sequence datasets and provide biologists with individual or comparative genome organization information in terms of presence and frequency of patterns or motifs such as restriction enzymes. Predicted agarose gel visualization of the custom analyses results was also integrated to enhance the usefulness of the software. CisSERS offers several novel functionalities, such as handling of large and multiple datasets in parallel, multiple restriction enzyme site detection and custom motif detection features, which are seamlessly integrated with real time agarose gel visualization. Using a simple fasta-formatted file as input, CisSERS utilizes the REBASE enzyme database. Results from CisSERSenable the user to make decisions for designing genotyping by sequencing experiments, reduced representation sequencing, 3’UTR sequencing, and cleaved amplified polymorphic sequence (CAPS) molecular markers for large sample sets. CisSERS is a java based graphical user interface built around a perl backbone. Several of the applications of CisSERS including CAPS molecular marker development were successfully validated using wet-lab experimentation. Here, we present the tool CisSERSand results from in-silico and corresponding wet-lab analyses demonstrating that CisSERS is a technology platform solution that facilitates efficient data utilization in genomics and genetics studies.

  7. Site-restricted plasminogen activation mediated by group A streptococcal streptokinase variants.

    PubMed

    Cook, Simon M; Skora, Amanda; Walker, Mark J; Sanderson-Smith, Martina L; McArthur, Jason D

    2014-02-15

    SK (streptokinase) is a secreted plasminogen activator and virulence factor of GAS (group A Streptococcus). Among GAS isolates, SK gene sequences are polymorphic and are grouped into two sequence clusters (cluster type-1 and cluster type-2) with cluster type-2 being further classified into subclusters (type-2a and type-2b). In the present study, we examined the role of bacterial and host-derived cofactors in SK-mediated plasminogen activation. All SK variants, apart from type-2b, can form an activator complex with Glu-Plg (Glu-plasminogen). Specific ligand-binding-induced conformational changes in Glu-Plg mediated by fibrinogen, PAM (plasminogen-binding group A streptococcal M protein), fibrinogen fragment D or fibrin, were required for type-2b SK to form a functional activator complex with Glu-Plg. In contrast with type-1 and type-2a SK, type-2b SK activator complexes were inhibited by α2-antiplasmin unless bound to fibrin or to the GAS cell-surface via PAM in combination with fibrinogen. Taken together, these data suggest that type-2b SK plasminogen activation may be restricted to specific microenvironments within the host such as fibrin deposits or the bacterial cell surface through the action of α2-antiplasmin. We conclude that phenotypic SK variation functionally underpins a pathogenic mechanism whereby SK variants differentially focus plasminogen activation, leading to specific niche adaption within the host.

  8. Seismic hazard mapping of California incorporating spatial variability of site conditions

    USGS Publications Warehouse

    Kalkan, Erol; Wills, Chris J.; Branum, David M.

    2008-01-01

    The U.S. Geological Survey has recently released a 2008 version of the probabilistic National Seismic Hazard Maps. These maps plot the peak ground acceleration (PGA) and spectral acceleration (SA) ordinates at 0.2 and 1.0 sec with 2% and 10% probabilities of being exceeded in 50 years, corresponding to earthquake return periods of about 2,475 and 475 years, respectively. These acceleration levels were computed for uniform “firm rock” site conditions, i.e., 760 m/sec average shear-wave velocity in the upper 30 m, and therefore these maps do not show the potential spatial variability of ground motion associated with different site conditions, so we have combined the USGS National Seismic Hazard model with the California showing 17 generalized geologic units geologic units that can be defined by their shear-wave velocity (Wills and Clahan 2006), we regrouped these units into to 7 shear-wave velocities. At each shear-wave velocity value, a probabilistic seismic hazard map was generated for the entire state. By combining seismic hazard maps based on the 7 different shear-wave velocity values, a suite of seismic hazard maps was computed for California for 0.2 and 1.0 sec spectral ordinates at 2% probability of being exceeded in 50 years. The improved maps thus explicitly incorporate the site effects and their spatial variability on ground motion estimates. The SA at 1.0 sec map of seismic shaking potential for California has been now published as California Geological Survey Map Sheet 48, which is intended to be accessible and understandable to the general public.

  9. Geomorphic Surface Maps of Northern Frenchman Flat, Nevada Test Site, Southern Nevada

    SciTech Connect

    Bechtel Nevada

    2005-08-01

    Large-scale (1:6000) surficial geology maps of northern Frenchman Flat were developed in 1995 as part of comprehensive site characterization required to operate a low-level radioactive waste disposal facility in that area. Seven surficial geology maps provide fundamental data on natural processes and are the platform needed to reconstruct the Quaternary history of northern Frenchman Flat. Reconstruction of the Quaternary history provides an understanding of the natural processes that act to develop the landscape, and the time-frames involved in landscape development. The mapping was conducted using color and color-infrared aerial photographs and field verification of map unit composition and boundaries. Criteria for defining the map unit composition of geomorphic surface units are based on relative geomorphic position, landform morphology, and degree of preservation of surface morphology. Seven geomorphic surfaces (Units 1 through 7) are recognized, spanning from the early Quaternary to present time.

  10. Prediction of Poly(A) Sites by Poly(A) Read Mapping

    PubMed Central

    Bonfert, Thomas; Friedel, Caroline C.

    2017-01-01

    RNA-seq reads containing part of the poly(A) tail of transcripts (denoted as poly(A) reads) provide the most direct evidence for the position of poly(A) sites in the genome. However, due to reduced coverage of poly(A) tails by reads, poly(A) reads are not routinely identified during RNA-seq mapping. Nevertheless, recent studies for several herpesviruses successfully employed mapping of poly(A) reads to identify herpesvirus poly(A) sites using different strategies and customized programs. To more easily allow such analyses without requiring additional programs, we integrated poly(A) read mapping and prediction of poly(A) sites into our RNA-seq mapping program ContextMap 2. The implemented approach essentially generalizes previously used poly(A) read mapping approaches and combines them with the context-based approach of ContextMap 2 to take into account information provided by other reads aligned to the same location. Poly(A) read mapping using ContextMap 2 was evaluated on real-life data from the ENCODE project and compared against a competing approach based on transcriptome assembly (KLEAT). This showed high positive predictive value for our approach, evidenced also by the presence of poly(A) signals, and considerably lower runtime than KLEAT. Although sensitivity is low for both methods, we show that this is in part due to a high extent of spurious results in the gold standard set derived from RNA-PET data. Sensitivity improves for poly(A) sites of known transcripts or determined with a more specific poly(A) sequencing protocol and increases with read coverage on transcript ends. Finally, we illustrate the usefulness of the approach in a high read coverage scenario by a re-analysis of published data for herpes simplex virus 1. Thus, with current trends towards increasing sequencing depth and read length, poly(A) read mapping will prove to be increasingly useful and can now be performed automatically during RNA-seq mapping with ContextMap 2. PMID:28135292

  11. Satellite Power System (SPS) mapping of exclusion areas for rectenna sites

    NASA Technical Reports Server (NTRS)

    Blackburn, J. B., Jr.; Bavinger, B. A.

    1978-01-01

    The areas of the United States that were not available as potential sites for receiving antennas that are an integral part of the Satellite Power System concept are presented. Thirty-six variables with the potential to exclude the rectenna were mapped and coded in a computer. Some of these variables exclude a rectenna from locating within the area of its spatial influence, and other variables potentially exclude the rectenna. These maps of variables were assembled from existing data and were mapped on a grid system.

  12. Frequent occurrence of recognition site-like sequences in the restriction endonucleases.

    PubMed

    Biro, Jan C; Biro, Josephine M K

    2004-03-16

    There are two different theories about the development of the genetic code. Woese suggested that it was developed in connection with the amino acid repertoire, while Crick argued that any connection between codons and amino acids is only the result of an "accident". This question is fundamental to understand the nature of specific protein-nucleic acid interactions. The nature of specific protein-nucleic acid interaction between restriction endonucleases (RE) and their recognition sequences (RS) was studied by bioinformatics methods. It was found that the frequency of 5-6 residue long RS-like oligonucleotides is unexpectedly high in the nucleic acid sequence of the corresponding RE (p < 0.05 and p < 0.001 respectively, n = 7). There is an extensive conservation of these RS-like sequences in RE isoschizomers. A review of the seven available crystallographic studies showed that the amino acids coded by codons that are subsets of recognition sequences were often closely located to the RS itself and they were in many cases directly adjacent to the codon-like triplets in the RS.Fifty-five examples of this codon-amino acid co-localization are found and analyzed, which represents 41.5% of total 132 amino acids which are localized within 8 A distance to the C1' atoms in the DNA. The average distance between the closest atoms in the codons and amino acids is 5.5 +/- 0.2 A (mean +/- S.E.M, n = 55), while the distance between the nitrogen and oxygen atoms of the co-localized molecules is significantly shorter, (3.4 +/- 0.2 A, p < 0.001, n = 15), when positively charged amino acids are involved. This is indicating that an interaction between the nucleic- and amino acids might occur. We interpret these results in favor of Woese and suggest that the genetic code is "rational" and there is a stereospecific relationship between the codes and the amino acids.

  13. Hazard maps of earthquake induced permanent displacements validated by site numerical simulation

    NASA Astrophysics Data System (ADS)

    Vessia, Giovanna; Pisano, Luca; Parise, Mario; Tromba, Giuseppe

    2016-04-01

    Hazard maps of seismically induced instability at the urban scale can be drawn by means of GIS spatial interpolation tools starting from (1) a Digital terrain model (DTM) and (2) geological and geotechnical hydro-mechanical site characterization. These maps are commonly related to a fixed return period of the natural phenomenon under study, or to a particular hazard scenario from the most significant past events. The maps could be used to guide the planning activity as well as the emergency actions, but the main limit of such maps is that typically no reliability analyses is performed. Spatial variability and uncertainties in subsoil properties, poor description of geomorphological evidence of active instability, and geometrical approximations and simplifications in DTMs, among the others, could be responsible for inaccurate maps. In this study, a possible method is proposed to control and increase the overall reliability of an hazard scenario map for earthquake-induced slope instability. The procedure can be summarized as follows: (1) GIS Statistical tools are used to improve the spatial distribution of the hydro-mechanical properties of the surface lithologies; (2) Hazard maps are drawn from the preceding information layer on both groundwater and mechanical properties of surficial deposits combined with seismic parameters propagated by means of Ground Motion Propagation Equations; (3) Point numerical stability analyses carried out by means of the Finite Element Method (e.g. Geostudio 2004) are performed to anchor hazard maps prediction to point quantitative analyses. These numerical analyses are used to generate a conversion scale from urban to point estimates in terms of permanent displacements. Although this conversion scale differs from case to case, it could be suggested as a general method to convert the results of large scale map analyses to site hazard assessment. In this study, the procedure is applied to the urban area of Castelfranci (Avellino province

  14. Tension-dependent DNA cleavage by restriction endonucleases: two-site enzymes are "switched off" at low force.

    PubMed

    Gemmen, Gregory J; Millin, Rachel; Smith, Douglas E

    2006-08-01

    DNA looping occurs in many important protein-DNA interactions, including those regulating replication, transcription, and recombination. Recent theoretical studies predict that tension of only a few piconewtons acting on DNA would almost completely inhibit DNA looping. Here, we study restriction endonucleases that require interaction at two separated sites for efficient cleavage. Using optical tweezers we measured the dependence of cleavage activity on DNA tension with 15 known or suspected two-site enzymes (BfiI, BpmI, BsgI, BspMI, Cfr9I, Cfr10I, Eco57I, EcoRII, FokI, HpaII, MboII, NarI, SacII, Sau3AI, and SgrAI) and six one-site enzymes (BamHI, EcoRI, EcoRV, HaeIII, HindIII, and DNaseI). All of the one-site enzymes were virtually unaffected by 5 pN of tension, whereas all of the two-site enzymes were completely inhibited. These enzymes thus constitute a remarkable example of a tension sensing "molecular switch." A detailed study of one enzyme, Sau3AI, indicated that the activity decreased exponentially with tension and the decrease was approximately 10-fold at 0.7 pN. At higher forces (approximately 20-40 pN) cleavage by the one-site enzymes EcoRV and HaeIII was partly inhibited and cleavage by HindIII was enhanced, whereas BamHI, EcoRI, and DNaseI were largely unaffected. These findings correlate with structural data showing that EcoRV bends DNA sharply, whereas BamHI, EcoRI, and DNaseI do not. Thus, DNA-directed enzyme activity involving either DNA looping or bending can be modulated by tension, a mechanism that could facilitate mechanosensory transduction in vivo.

  15. Multiscale site-response mapping: A case study of Parkfield, California

    USGS Publications Warehouse

    Thompson, E.M.; Baise, L.G.; Kayen, R.E.; Morgan, E.C.; Kaklamanos, J.

    2011-01-01

    The scale of previously proposed methods for mapping site-response ranges from global coverage down to individual urban regions. Typically, spatial coverage and accuracy are inversely related.We use the densely spaced strong-motion stations in Parkfield, California, to estimate the accuracy of different site-response mapping methods and demonstrate a method for integrating multiple site-response estimates from the site to the global scale. This method is simply a weighted mean of a suite of different estimates, where the weights are the inverse of the variance of the individual estimates. Thus, the dominant site-response model varies in space as a function of the accuracy of the different models. For mapping applications, site-response models should be judged in terms of both spatial coverage and the degree of correlation with observed amplifications. Performance varies with period, but in general the Parkfield data show that: (1) where a velocity profile is available, the square-rootof- impedance (SRI) method outperforms the measured VS30 (30 m divided by the S-wave travel time to 30 m depth) and (2) where velocity profiles are unavailable, the topographic slope method outperforms surficial geology for short periods, but geology outperforms slope at longer periods. We develop new equations to estimate site response from topographic slope, derived from the Next Generation Attenuation (NGA) database.

  16. Improving a Synechocystis-based photoautotrophic chassis through systematic genome mapping and validation of neutral sites

    PubMed Central

    Pinto, Filipe; Pacheco, Catarina C.; Oliveira, Paulo; Montagud, Arnau; Landels, Andrew; Couto, Narciso; Wright, Phillip C.; Urchueguía, Javier F.; Tamagnini, Paula

    2015-01-01

    The use of microorganisms as cell factories frequently requires extensive molecular manipulation. Therefore, the identification of genomic neutral sites for the stable integration of ectopic DNA is required to ensure a successful outcome. Here we describe the genome mapping and validation of five neutral sites in the chromosome of Synechocystis sp. PCC 6803, foreseeing the use of this cyanobacterium as a photoautotrophic chassis. To evaluate the neutrality of these loci, insertion/deletion mutants were produced, and to assess their functionality, a synthetic green fluorescent reporter module was introduced. The constructed integrative vectors include a BioBrick-compatible multiple cloning site insulated by transcription terminators, constituting robust cloning interfaces for synthetic biology approaches. Moreover, Synechocystis mutants (chassis) ready to receive purpose-built synthetic modules/circuits are also available. This work presents a systematic approach to map and validate chromosomal neutral sites in cyanobacteria, and that can be extended to other organisms. PMID:26490728

  17. Leptospira species categorized by arbitrarily primed polymerase chain reaction (PCR) and by mapped restriction polymorphisms in PCR-amplified rRNA genes.

    PubMed Central

    Ralph, D; McClelland, M; Welsh, J; Baranton, G; Perolat, P

    1993-01-01

    Reference strains from 48 selected serovars representing eight species of Leptospira were examined by two polymerase chain reaction (PCR)-based strategies. First, mapped restriction site polymorphisms (MRSP) were examined in PCR products from portions of rrs (16S rRNA gene) and rrl (23S rRNA gene). Twenty MRSP and 2 length polymorphisms were used to group reference strains into 16 MRSP profiles. Species assignments were consistent with those obtained by a second method, genomic fingerprinting with arbitrarily primed PCR, in which strains within a species were characterized by many shared arbitrarily primed PCR products. The results of both of these methods were in general agreement with those of previous studies that used DNA-DNA relatedness and confirmed the high level of divergence among the recognized species of Leptospira. However, Leptospira meyeri serovar ranarum and evansi strains were indistinguishable from some strains of Leptospira interrogans sensu stricto. Intervening sequences of about 485 to 740 bp were located near base 1230 in rrl of some strains. Images PMID:8094390

  18. Vegetation inventory, mapping, and classification report, Fort Bowie National Historic Site

    USGS Publications Warehouse

    Studd, Sarah; Fallon, Elizabeth; Crumbacher, Laura; Drake, Sam; Villarreal, Miguel

    2013-01-01

    A vegetation mapping and characterization effort was conducted at Fort Bowie National Historic Site in 2008-10 by the Sonoran Desert Network office in collaboration with researchers from the Office of Arid lands studies, Remote Sensing Center at the University of Arizona. This vegetation mapping effort was completed under the National Park Service Vegetation Inventory program which aims to complete baseline mapping inventories at over 270 national park units. The vegetation map data was collected to provide park managers with a digital map product that met national standards of spatial and thematic accuracy, while also placing the vegetation into a regional and even national context. Work comprised of three major field phases 1) concurrent field-based classification data collection and mapping (map unit delineation), 2) development of vegetation community types at the National Vegetation Classification alliance or association level and 3) map accuracy assessment. Phase 1 was completed in late 2008 and early 2009. Community type descriptions were drafted to meet the then-current hierarchy (version 1) of the National Vegetation Classification System (NVCS) and these were applied to each of the mapped areas. This classification was developed from both plot level data and censused polygon data (map units) as this project was conducted as a concurrent mapping and classification effort. The third stage of accuracy assessment completed in the fall of 2010 consisted of a complete census of each map unit and was conducted almost entirely by park staff. Following accuracy assessment the map was amended where needed and final products were developed including this report, a digital map and full vegetation descriptions. Fort Bowie National Historic Site covers only 1000 acres yet has a relatively complex landscape, topography and geology. A total of 16 distinct communities were described and mapped at Fort Bowie NHS. These ranged from lush riparian woodlands lining the

  19. A 405-kb cosmid contig and HindIII restriction map of the progressive myoclonus epilepsy type 1 (EPM1) candidate region in 21q22.3

    SciTech Connect

    Lafreniere, R.G.; Rouleau, G.A.; De Jong, P.J.

    1995-09-01

    As a step toward identifying the molecular defect in patients afflicted with progressive myoclonus epilepsy type 1 (EPM1), we have assembled a cosmid contig of the candidate EPM1 region in 21q22.3. The contig constitutes a collection of 87 different cosmids spanning 405 kb based on a derived HindIII restriction map. Potential CpG-rich islands have been identified based on the restriction map generated from eight different rare-cutting enzymes. This contig contains the genetic material required for the isolation of expressed sequences and the identification of the gene defective in EPM1 and possibly other disorders mapping to this region. 15 refs., 1 fig.

  20. Assembly of a 1-Mb restriction-mapped cosmid contig spanning the candidate region for Finnish congenital nephrosis (NPHS1) in 19q13.1

    SciTech Connect

    Olsen, A.S.; Georgescu, A.; Johnson, S.; Carrano, A.V.

    1996-06-01

    We describe the assembly of a 1-Mb cosmid contig and restriction map spanning the candidate region for Finnish congenital nephrosis (NPHS1) in 19q13.1. The map was constructed from 16 smaller contigs assembled by fingerprinting, a BAC and a PAC clone, and 42 previously unmapped cosmids. In most cases, single-step cosmid walks were sufficient to join two previously assembled contigs, and all but one gap was filled from this cosmid contig library. The remaining gap of about 19 kb was spanned with a single BAC and a single PAC clone. EcoRI mapping of a dense set of overlapping clones validated the assembly of the map and indicated a length of 1040 kb for the contig. This high-resolution clone map provides an ideal resource for gene identification through cDNA selection, exon trapping, and DNA sequencing. 10 refs., 1 fig.

  1. DNA Fingerprinting of Ralstonia paucula by Infrequent-Restriction-Site PCR and Randomly Amplified Polymorphic DNA Analysis

    PubMed Central

    Moissenet, Didier; Vu-Thien, Hoang; Benzerara, Yahia; Arlet, Guillaume

    2003-01-01

    Ralstonia paucula (formerly CDC group IV c-2) is an environmental organism that can cause serious human infections, occasionally clusters of nosocomial infections. In the present work, 26 strains of R. paucula (4 from the American Centers for Disease Control and Prevention collection, 10 from the Belgian Laboratorium voor Microbiologie [LMG] collection, and 12 French clinical isolates) were analyzed with infrequent-restriction-site PCR and randomly amplified polymorphic DNA analysis. Both techniques accurately distinguished between collection strains. Two close patterns obtained for all the French isolates suggested a clonal strain. Two LMG collection strains originating from human sources in the United States also showed patterns close to those of French isolates. PMID:14662974

  2. Mechanistic insight into site-restricted monoubiquitination of FANCD2 by Ube2t, FANCL, and FANCI.

    PubMed

    Alpi, Arno F; Pace, Paul E; Babu, M Madan; Patel, Ketan J

    2008-12-26

    A key step in the Fanconi anemia (FA) tumor suppressor pathway is the site-specific monoubiquitination of the FANCD2 protein. Genetic studies indicate that this crucial modification requires eight known FA gene products and the E2-conjugating enzyme Ube2t. Here, we minimally reconstitute this monoubiquitination reaction with Ube2t and the FANCL protein, revealing that monoubiquitination is stimulated by a conserved RWD-like domain in FANCL. Furthermore, addition of the FANCI protein enhances monoubiquitination and also restricts it to the in vivo substrate lysine residue on FANCD2. This work therefore establishes a system that provides mechanistic insight into the functions of FANCL and FANCI in the catalysis of FANCD2 monoubiquitination.

  3. Mapping the interaction sites of Mucin 1 and DNA aptamer by atomic force microscopy.

    PubMed

    Wang, Nan; Zhang, Miaomiao; Chen, Xuejuan; Ma, Xingxing; Li, Chen; Zhang, Zhe; Tang, Jilin

    2017-10-09

    Mucin 1 (MUC1) is an attractive tumor marker for cancer diagnosis. An advanced atomic force microscopy (AFM) mode, peak-force tapping AFM with an aptamer functionalized tip, was introduced to map the specific interaction sites of an aptamer and MUC1. Single molecular force spectroscopy (SMFS) was used to investigate dynamic parameters of the aptamer-MUC1.

  4. Oregon Magnetic and Gravity Maps and Data: A Web Site for Distribution of Data

    USGS Publications Warehouse

    Roberts, Carter W.; Kucks, Robert P.; Hill, Patricia L.

    2008-01-01

    This web site gives the results of a USGS project to acquire the best available, public-domain, aeromagnetic and gravity data in the United States and merge these data into uniform, composite grids for each State. The results for the State of Oregon are presented here on this site. Files of aeromagnetic and gravity grids and images are available for these States for downloading. In Oregon, 49 magnetic surveys have been knit together to form a single digital grid and map. Also, a complete Bouguer gravity anomaly grid and map was generated from 40,665 gravity station measurements in and adjacent to Oregon. In addition, a map shows the location of the aeromagnetic surveys, color-coded to the survey flight-line spacing. This project was supported by the Mineral Resource Program of the USGS.

  5. C.U.R.R.F. (Codon Usage regarding Restriction Finder): a free Java(®)-based tool to detect potential restriction sites in both coding and non-coding DNA sequences.

    PubMed

    Gatter, Michael; Gatter, Thomas; Matthäus, Falk

    2012-10-01

    The synthesis of complete genes is becoming a more and more popular approach in heterologous gene expression. Reasons for this are the decreasing prices and the numerous advantages in comparison to classic molecular cloning methods. Two of these advantages are the possibility to adapt the codon usage to the host organism and the option to introduce restriction enzyme target sites of choice. C.U.R.R.F. (Codon Usage regarding Restriction Finder) is a free Java(®)-based software program which is able to detect possible restriction sites in both coding and non-coding DNA sequences by introducing multiple silent or non-silent mutations, respectively. The deviation of an alternative sequence containing a desired restriction motive from the sequence with the optimal codon usage is considered during the search of potential restriction sites in coding DNA and mRNA sequences as well as protein sequences. C.U.R.R.F is available at http://www.zvm.tu-dresden.de/die_tu_dresden/fakultaeten/fakultaet_mathematik_und_naturwissenschaften/fachrichtung_biologie/mikrobiologie/allgemeine_mikrobiologie/currf.

  6. MX Siting Investigation. MX System Siting Summary Report. Land Acquisition Application Package Map Sheets. Volume III.

    DTIC Science & Technology

    1982-01-18

    Development FY Fiscal Year GBNP Great Basin National Park HDR Henningson, Durham, & Richardson, Inc. HSS Horizontal Shelter Site IOC Initial Operational...Capability KGRA Known Geothermal Resources Area MF Medium Frequency MMC Martin Marietta Company MOA Military Overflight Area MOB Main Operating Base... Geological Survey USPLS United States Public Land Survey UTM Universal Transverse Mercator V&H Vulnerability and Hardness iv .Erc . E-TR-58-III TABLE OF

  7. Mapping of anion binding sites on cytochrome c by differential chemical modification of lysine residues.

    PubMed Central

    Osheroff, N; Brautigan, D L; Margoliash, E

    1980-01-01

    The carbonate binding site on horse cytochrome c was mapped by comparing the yields of carboxydinitrophenyl-cytochromes c, each with a single carboxydinitrophenyl-substituted lysine residue per molecule, when the modification reaction was carried out in the presence and absence of carbonate. The site is located on the "left surface" of the protein and consists of lysine residues 72 and/or 73 as well as 86 and/or 87 (Carbonate Site). Although one of the binding sites for phosphate on cytochrome c (Phosphat Site I) is located near the carbonate site, the sites are distinctly different since carbonate does not displace bound phosphate, as monitored by 31P NMR. Furthermore, citrate interacts with Phosphate Site I with high affinity, whereas chloride, acetate, borate, and cacodylate have a much lower affinity for this site, if they bind to it at all. The affinity of phosphate for Phosphate Site I (KD = 2 X 10(-4) M) is at least 1 order of magnitude higher than it is for other sites of interaction. Images PMID:6254024

  8. Orthogonal electrode catheter array for mapping of endocardial focal site of ventricular activation

    SciTech Connect

    Desai, J.M.; Nyo, H.; Vera, Z.; Seibert, J.A.; Vogelsang, P.J. )

    1991-04-01

    Precise location of the endocardial site of origin of ventricular tachycardia may facilitate surgical and catheter ablation of this arrhythmia. The endocardial catheter mapping technique can locate the site of ventricular tachycardia within 4-8 cm2 of the earliest site recorded by the catheter. This report describes an orthogonal electrode catheter array (OECA) for mapping and radiofrequency ablation (RFA) of endocardial focal site of origin of a plunge electrode paced model of ventricular activation in dogs. The OECA is an 8 F five pole catheter with four peripheral electrodes and one central electrode (total surface area 0.8 cm{sup 2}). In eight mongrel dogs, mapping was performed by arbitrarily dividing the left ventricle (LV) into four segments. Each segment was mapped with OECA to find the earliest segment. Bipolar and unipolar electrograms were obtained. The plunge electrode (not visible on fluoroscopy) site was identified by the earliest wave front arrival times of -30 msec or earlier at two or more electrodes (unipolar electrograms) with reference to the earliest recorded surface ECG (I, AVF, and V1). Validation of the proximity of the five electrodes of the OECA to the plunge electrode was performed by digital radiography and RFA. Pathological examination was performed to document the proximity of the OECA to the plunge electrode and also for the width, depth, and microscopic changes of the ablation. To find the segment with the earliest LV activation a total of 10 {plus minus} 3 (mean {plus minus} SD) positions were mapped. Mean arrival times at the two earlier electrodes were -39 {plus minus} 4 msec and -35 {plus minus} 3 msec. Digital radiography showed the plunge electrode to be within the area covered by all five electrodes in all eight dogs. The plunge electrode was within 1 cm2 area of the region of RFA in all eight dogs.

  9. Developing Vs30 site-condition maps by combining observations with geologic and topographic constraints

    USGS Publications Warehouse

    Thompson, E.M.; Wald, D.J.

    2012-01-01

    Despite obvious limitations as a proxy for site amplification, the use of time-averaged shear-wave velocity over the top 30 m (VS30) remains widely practiced, most notably through its use as an explanatory variable in ground motion prediction equations (and thus hazard maps and ShakeMaps, among other applications). As such, we are developing an improved strategy for producing VS30 maps given the common observational constraints. Using the abundant VS30 measurements in Taiwan, we compare alternative mapping methods that combine topographic slope, surface geology, and spatial correlation structure. The different VS30 mapping algorithms are distinguished by the way that slope and geology are combined to define a spatial model of VS30. We consider the globally applicable slope-only model as a baseline to which we compare two methods of combining both slope and geology. For both hybrid approaches, we model spatial correlation structure of the residuals using the kriging-with-a-trend technique, which brings the map into closer agreement with the observations. Cross validation indicates that we can reduce the uncertainty of the VS30 map by up to 16% relative to the slope-only approach.

  10. A yeast artificial chromosome contig and NotI restriction map that spans the tumor suppressor gene(s) locus, 11q22.2-q23.3

    SciTech Connect

    Arai, Yasuhito; Hosoda, Fumie; Nakayama, Kyoko; Ohki, Misao

    1996-07-01

    Human chromosome 11q22-q23 is a pathologically important region in which a high level of loss of heterozygosity has been reported for breast, ovary, cervical, colon, and lung carcinomas, malignant melanomas, and hematologic malignancies. This strongly indicates that one or more tumor suppressor genes reside within the deleted region. In this report, we report the development of a contig map that covers most of the deleted regions found in these malignancies. The map comprises a contig of 66 overlapping yeast artificial chromosomes (YACs) and spans a region of 17 Mb from the PGR gene at 11q22.2 to the MLL gene at q23.3. In the process of screening the YACs, 50 new sequence-tagged site markers were developed from the termini of the YAC inserts. These markers were used for chromosome walking, and the data were then integrated into the contig map. NotI sites in the region. Using 22 of them, a NotI restriction map of the region from PGR to D11S939 was developed. This YAC contig will provide efficient tools for identification of the putative tumor suppressor gene(s). 49 refs., 3 figs., 2 tabs.

  11. Reproductive parameters in female yellow-blotched map turtles (Graptemys flavimaculata) from a historically contaminated site vs. a reference site.

    PubMed

    Shelby-Walker, Jennifer A; Ward, Chelsea K; Mendonça, Mary T

    2009-11-01

    Graptemys flavimaculata, the yellow-blotched map turtle, is a long-lived, threatened, species, endemic to the Pascagoula River drainage in Mississippi. During the 1980s, one branch of the drainage (i.e. the Leaf River) was impacted by effluent from a wood pulp processing plant known to contain endocrine disrupters. A decade later, we examined seasonal reproductive parameters (i.e. monthly plasma estradiol-17beta (E(2)), testosterone (T), vitellogenin (VTG) and follicular development) in adult female turtles from historically polluted and reference sites in the drainage to determine if legacy exposure to pollution impacts reproduction . We found no seasonal patterns in E(2) or T and these patterns did not differ between sites. However, E(2) differed significantly among ovarian stages for the reference, but not pollutant exposed females. A significantly greater percentage of reference site females were able to produce a second clutch than females from the historically polluted site (50% and 17%). Additionally, there was a significant positive correlation between E(2) with VTG levels for reference, but not pollutant exposed females. Body and yolk tissue contaminant analysis indicated that exposure to pollutants is presently minimal and unlikely the cause of the reproductive differences observed between sites; instead, differences are potentially due to exposure history.

  12. EttA regulates translation by binding to the ribosomal E site and restricting ribosome-tRNA dynamics

    PubMed Central

    Chen, Bo; Boël, Grégory; Hashem, Yaser; Ning, Wei; Fei, Jingyi; Wang, Chi; Gonzalez, Ruben L.; Hunt, John F.; Frank, Joachim

    2014-01-01

    Cells express many ribosome-interacting factors whose functions and molecular mechanisms remain unknown. Here, we elucidate the mechanism of a newly characterized regulatory translation factor, Energy-dependent Translational Throttle A (EttA), which is an Escherichia coli representative of the ATP-binding cassette F (ABC-F) protein family. Using cryo-EM, we demonstrate that the ATP-bound form of EttA binds to the ribosomal tRNA exit (E) site, where it forms bridging interactions between the ribosomal L1 stalk and the tRNA bound in the peptidyl-tRNA binding (P) site. Using single-molecule fluorescence resonance energy transfer (smFRET), we show that the ATP-bound form of EttA restricts ribosome and tRNA dynamics required for protein synthesis. This work represents the first example, to our knowledge, where the detailed molecular mechanism of any ABC-F family protein has been determined and establishes a framework for elucidating the mechanisms of other regulatory translation factors. PMID:24389465

  13. A restriction site to differentiate Plasmodium and Haemoproteus infections in birds: on the inefficiency of general primers for detection of mixed infections.

    PubMed

    Martínez, J; Martínez-DE LA Puente, J; Herrero, J; Del Cerro, S; Lobato, E; Rivero-DE Aguilar, J; Vásquez, R A; Merino, S

    2009-06-01

    Avian Plasmodium and Haemoproteus parasites are easily detected by DNA analyses of infected samples but only correctly assigned to each genus by sequencing and use of a phylogenetic approach. Here, we present a restriction site to differentiate between both parasite genera avoiding the use of those analyses. Alignments of 820 sequences currently listed in GenBank encoding a particular cytochrome B region of avian Plasmodium and Haemoproteus show a shared restriction site for both genera using the endonuclease Hpy CH4III. An additional restriction site is present in Plasmodium sequences that would initially allow differentiation of both genera by differential migration of digested products on gels. Overall 9 out of 326 sequences containing both potential restriction sites do not fit to the general rule. We used this differentiation of parasite genera based on Hpy CH4III restriction sites to evaluate the efficacy of 2 sets of general primers in detecting mixed infections. To do so, we used samples from hosts infected by parasites of both genera. The use of general primers was only able to detect 25% or less of the mixed infections. Therefore, parasite DNA amplification using general primers to determine the species composition of haemosporidian infections in individual hosts is not recommended. Specific primers for each species and study area should be designed until a new method can efficiently discriminate both parasites.

  14. Shear wave velocity mapping of Hat Yai district, southern Thailand: implication for seismic site classification

    NASA Astrophysics Data System (ADS)

    Yordkayhun, Sawasdee; Sujitapan, Chedtaporn; Chalermyanont, Tanit

    2015-02-01

    Soil characteristics play an important role in the degree of ground shaking due to local site amplification during an earthquake. The objectives of this work are to study shear wave velocity (Vs) distribution in the near surface, and to develop a seismic site classification map for soil effect characterization and seismic hazard assessment in Hat Yai district, southern Thailand. The Vs determination based on the multichannel analysis of surface waves technique, has been carried out and analyzed at 70 measuring sites throughout the district. On the basis of the weighted-average Vs in the upper 30 m depth (Vs30), a seismic site classification map, based on the National Earthquake Hazards Reduction Program (NEHRP) standard has been developed. It is found that the NEHRP site class in Hat Yai can be classified into four groups in accordance with the value of Vs30 within the range of about 150 to 1160 m s-1. Most parts of the study area are typically classified as site class C and D. Site class C is mostly found within the colluvial and terrace deposits in the western and eastern part of the area, whereas site class D is concentrated in the alluvial sediment of the middle and northern flood plain areas. A small portion of site class B is observed in the western mountain ranges, where there is a thin overburden on the firm rock. There is a remarkably low Vs30 value at only one site, located near the main stream in the northern part of the study area. The results imply that the soil characteristics in the central and northern Hat Yai district pose a medium to high amplification rate with respect to the other regions. Although Vs data alone are insufficient to verify the potential of the amplification of ground shaking, this study provides an initial attempt to understand seismic hazards in the study area.

  15. Repeated mapping of reefs constructed by Sabellaria spinulosa Leuckart 1849 at an offshore wind farm site

    NASA Astrophysics Data System (ADS)

    Pearce, Bryony; Fariñas-Franco, Jose M.; Wilson, Christian; Pitts, Jack; deBurgh, Angela; Somerfield, Paul J.

    2014-07-01

    Sabellaria spinulosa reefs are considered to be sensitive and of high conservation status. This article evaluates the feasibility of using remote sensing technology to delineate S. spinulosa reefs. S. spinulosa reef habitats associated with the Thanet Offshore Windfarm site were mapped using high resolution sidescan sonar (410 kHz) and multibeam echo sounder (<1 m2) data in 2005 (baseline), 2007 (pre-construction baseline) and 2012 (post-construction). The S. spinulosa reefs were identified in the acoustic data as areas of distinct irregular texturing. Maps created using acoustic data were validated using quantitative measures of reef quality, namely tube density (as a proxy for the density of live S. spinulosa), percentage cover of S. spinulosa structures (both living and dead) and associated macrofauna derived from seabed images taken across the development site. Statistically significant differences were observed in all physical measures of S. spinulosa as well the number (S) and diversity (H') of associated species, derived from seabed images classified according to the presence or absence of reef, validating the use of high resolution sidescan sonar to map these important biogenic habitats. High precision mapping in the early stages allowed for the micro-siting of wind turbines in a way that caused minimal damage to S. spinulosa reefs during construction. These habitats have since recovered and expanded in extent. The surveys undertaken at the Thanet Offshore Windfarm site demonstrate the importance of repeat mapping for this emerging industry, allowing habitat enhancement to be attributed to the development whilst preventing background habitat degradation from being wrongly attributed to the development.

  16. Geological mapping of the Oak Ridge K-25 Site, Oak Ridge, Tennessee

    SciTech Connect

    Lemiszki, P.J.

    1994-01-01

    The Oak Ridge K-25 Site (formerly known as the Oak Ridge Gaseous Diffusion Plant) is located in the southern Appalachian Valley and Ridge province of east Tennessee and overlies an area of folded and faulted Cambrian through Ordovician sedimentary rocks in the footwall of the Whiteoak Mountain fault. Environmental restoration plans for the area require that the geology of the site be well understood because various aspects of the groundwater system are directly influenced by stratigraphic and structural characteristics of the bedrock. This study involved mapping the bedrock geology of an 18-square mile area in and around the plant site. Field mapping focused on: (1) checking the accuracy of previously mapped stratigraphic and fault contacts, (2) dividing the bedrock into distinct stratigraphic units based on field criteria, (3) determining the geometry of map-scale folds and faults, and (4) documenting various aspects of the local fracture system. Besides accomplishing all of the above tasks, results from this study have led to a number of new hypotheses regarding various aspects of the site geology. First, faulting and folding within carbonates of the Chickamauga Supergroup in the plant area has repeated certain rock units, which requires that there be a thrust fault in the subsurface below them. This thrust fault may project to the surface with the Carters Limestone. Second, thrust slices of the Rome Formation that overlie the Chickamauga carbonates may be extremely thin and have a limited aerial extent. Third, part of the Knox Group on McKinney Ridge is folded into an anticline. Evaluating the above hypotheses will require information about the subsurface that can only be acquired through drilling and surface geophysical surveys. The geologic map produced from this study can be used to evaluate the location of coreholes that will more effectively intersect a combination of stratigraphic, structural, and hydrologic targets.

  17. Aptatope mapping of the binding site of a progesterone aptamer on the steroid ring structure.

    PubMed

    Skouridou, Vasso; Schubert, Thomas; Bashammakh, Abdulaziz S; El-Shahawi, Mohammad S; Alyoubi, Abdulrahman O; O'Sullivan, Ciara K

    2017-08-15

    In this work we report the mapping of the binding site of the only progesterone aptamer published to date, in an approach referred to as aptatope mapping. By linking the binding data obtained from microscale thermophoresis analysis to the structural differences on the ring structure of a range of steroids, we elucidated the moieties involved in aptamer-progesterone binding. This approach can be further exploited for the characterization of aptamer specificity and ultimately facilitate the development of aptamer-based assays depending on the desired specificity. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Testing a small UAS for mapping artisanal diamond mining sites in Africa

    USGS Publications Warehouse

    Malpeli, Katherine C.; Chirico, Peter G.

    2015-01-01

    Remote sensing technology is advancing at an unprecedented rate. At the forefront of the new technological developments are unmanned aircraft systems (UAS). The advent of small, lightweight, low-cost, and user-friendly UAS is greatly expanding the potential applications of remote sensing technology and improving the set of tools available to researchers seeking to map and monitor terrain from above. In this article, we explore the applications of a small UAS for mapping informal diamond mining sites in Africa. We found that this technology provides aerial imagery of unparalleled resolution in a data-sparse, difficult to access, and remote terrain.

  19. Long-range restriction map of human chromosome 22q11-22q12 between the lambda immunoglobulin locus and the Ewing sarcoma breakpoint

    SciTech Connect

    McDermid, H.E. ); Budarf, M.L.; Emanuel, B.S. Children's Hospital of Philadelphia, PA )

    1993-11-01

    A long-range restriction map of the region between the immunoglobulin lambda locus and the Ewing sarcoma breakpoint has been constructed using the rare-cutting enzymes NotI, NruI, AscI, and BsiWI. The map spans approximately 11,000 kb and represents about one-fifth of the long arm of chromosome 22. Thirty-nine markers, including seven NotI junction clones as well as numerous genes and anonymous sequences, were mapped to the region with a somatic cell hybrid panel. These probes were then used to produce the map. The seven NotI junction clones each identified a possible CpG island. The breakpoints of the RAJ5 hybrid and the Ewing sarcoma t(11;22) were also localized in the resulting map. This physical map will be useful in studying chromosomal rearrangements in the region, as well as providing the details to examine the fidelity of the YAC and cosmid contigs currently under construction. Comparisons of this physical map to genetic and radiation hybrid maps are discussed. 52 refs., 7 figs., 3 tabs.

  20. Mapping Site Response Parameters on Cal Poly Pomona Campus Using the Spectral Ratio Method

    NASA Astrophysics Data System (ADS)

    HO, K. Y. K.; Polet, J.

    2014-12-01

    Site characteristics are an important factor in earthquake hazard assessment. To better understand site response differences on a small scale, as well as the seismic hazard of the area, we develop site response parameter maps of Cal Poly Pomona campus. Cal Poly Pomona is located in southern California about 40 km east of Los Angeles, within 50 km of San Andreas Fault. The campus is situated on top of the San Jose Fault. With about twenty two thousand students on campus, it is important to know the site response in this area. To this end, we apply the Horizontal-to-Vertical (H/V) spectral ratio technique, which is an empirical method that can be used in an urban environment with no environmental impact. This well-established method is based on the computation of the ratio of vertical ambient noise ground motion over horizontal ambient noise ground motion as a function of frequency. By applying the spectral ratio method and the criteria from Site Effects Assessment Using Ambient Excitations (SESAME) guidelines, we can determine fundamental frequency and a minimum site amplification factor. We installed broadband seismometers throughout the Cal Poly Pomona campus, with an initial number of about 15 sites. The sites are approximately 50 to 150 meters apart and about two hours of waveforms were recorded at each site. We used the Geopsy software to make measurements of the peak frequency and the amplitude of the main peak from the spectral ratio. These two parameters have been determined to be estimates of fundamental frequency and a minimum site amplification factor, respectively. Based on the geological map from the U.S. Geological Survey (USGS) and our data collected from Cal Poly Pomona campus, our preliminary results suggest that the area of campus that is covered by alluvial fan material tends to have a single significant spectral peak with a fundamental frequency of ~1Hz and a minimum amplification factor of ~3.7. The minimum depth of the surface layer is about 56

  1. Breaking RAD: an evaluation of the utility of restriction site-associated DNA sequencing for genome scans of adaptation.

    PubMed

    Lowry, David B; Hoban, Sean; Kelley, Joanna L; Lotterhos, Katie E; Reed, Laura K; Antolin, Michael F; Storfer, Andrew

    2017-03-01

    Understanding how and why populations evolve is of fundamental importance to molecular ecology. Restriction site-associated DNA sequencing (RADseq), a popular reduced representation method, has ushered in a new era of genome-scale research for assessing population structure, hybridization, demographic history, phylogeography and migration. RADseq has also been widely used to conduct genome scans to detect loci involved in adaptive divergence among natural populations. Here, we examine the capacity of those RADseq-based genome scan studies to detect loci involved in local adaptation. To understand what proportion of the genome is missed by RADseq studies, we developed a simple model using different numbers of RAD-tags, genome sizes and extents of linkage disequilibrium (length of haplotype blocks). Under the best-case modelling scenario, we found that RADseq using six- or eight-base pair cutting restriction enzymes would fail to sample many regions of the genome, especially for species with short linkage disequilibrium. We then surveyed recent studies that have used RADseq for genome scans and found that the median density of markers across these studies was 4.08 RAD-tag markers per megabase (one marker per 245 kb). The length of linkage disequilibrium for many species is one to three orders of magnitude less than density of the typical recent RADseq study. Thus, we conclude that genome scans based on RADseq data alone, while useful for studies of neutral genetic variation and genetic population structure, will likely miss many loci under selection in studies of local adaptation. © 2016 John Wiley & Sons Ltd.

  2. Novel Electrophilic and Photoaffinity Covalent Probes for Mapping the Cannabinoid 1 Receptor Allosteric Site(s)

    PubMed Central

    2015-01-01

    Undesirable side effects associated with orthosteric agonists/antagonists of cannabinoid 1 receptor (CB1R), a tractable target for treating several pathologies affecting humans, have greatly limited their translational potential. Recent discovery of CB1R negative allosteric modulators (NAMs) has renewed interest in CB1R by offering a potentially safer therapeutic avenue. To elucidate the CB1R allosteric binding motif and thereby facilitate rational drug discovery, we report the synthesis and biochemical characterization of first covalent ligands designed to bind irreversibly to the CB1R allosteric site. Either an electrophilic or a photoactivatable group was introduced at key positions of two classical CB1R NAMs: Org27569 (1) and PSNCBAM-1 (2). Among these, 20 (GAT100) emerged as the most potent NAM in functional assays, did not exhibit inverse agonism, and behaved as a robust positive allosteric modulator of binding of orthosteric agonist CP55,940. This novel covalent probe can serve as a useful tool for characterizing CB1R allosteric ligand-binding motifs. PMID:26529344

  3. Peculiarities of the interaction of the restriction endonuclease BspD6I with DNA containing its recognition site.

    PubMed

    Abrosimova, Liudmila A; Kubareva, Elena A; Migur, Anzhela Yu; Gavshina, Aleksandra V; Ryazanova, Aleksandra Yu; Norkin, Maxim V; Perevyazova, Tatiana A; Wende, Wolfgang; Hianik, Tibor; Zheleznaya, Liudmila A; Oretskaya, Tatiana S

    2016-09-01

    Nicking endonucleases are enzymes that recognize specific sites in double-stranded DNA and cleave only one strand at a predetermined position. These enzymes are involved in DNA replication and repair; they can also function as subunits of bacterial heterodimeric restriction endonucleases. One example of such a proteins is the restriction endonuclease BspD6I (R.BspD6I) from Bacillus species strain D6, which consists of the large subunit - nicking endonuclease BspD6I (Nt.BspD6I), and the small subunit (ss.BspD6I). Nt.BspD6I can function independently. Similar enzymes are now widely used in numerous biotechnological applications. The aim of this study was to investigate the fundamental properties of two subunits of R.BspD6I and their interdependence in the course of R.BspD6I activity. The binding and hydrolysis of DNA duplexes by R.BspD6I are primary analyzed by gel electrophoresis. To elucidate the difference between Nt.BspD6I interaction with the substrate and product of hydrolysis, the thickness shear mode acoustic method is used. The thermodynamic and kinetic parameters of the Nt.BspD6I interaction with DNA are determined. For the first time we demonstrated that Nt.BspD6I bends the DNA during complex formation. Nt.BspD6I is able to form complexes with the product nicked in the top strand and ss.BspD6I cleaves the bottom strand of the DNA consecutively. Furthermore, the influence of dA methylation in the R.BspD6I recognition site on ss.BspD6I activity is analyzed. The obtained results provide evidence that Nt.BspD6I coordinates the activity of R.BspD6I by strictly coupling of the bottom strand cleavage by ss.BspD6I to the top strand cleavage. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. MapZ beacons the division sites and positions FtsZ-rings in Streptococcus pneumoniae

    PubMed Central

    Zhao, Chao; Cluzel, Caroline; Lavergne, Jean-Pierre; Franz-Wachtel, Mirita; Macek, Boris; Combet, Christophe; Kuru, Erkin; VanNieuwenhze, Michael S.; Brun, Yves V.; Sherratt, David; Grangeasse, Christophe

    2014-01-01

    In every living organism, cell division requires accurate identification of the division site and placement of the division machinery. In bacteria, this process is traditionally considered to begin with the polymerization of the highly conserved tubulin-like protein FtsZ into a ring that locates precisely at midcell1. Over the last decades, several systems have been reported to regulate the spatiotemporal assembly and placement of the FtsZ-ring2-5. However, the human pathogen Streptococcus pneumoniae, as many other organisms, is devoid of these canonical systems and the mechanisms of positioning of the division machinery remain unknown4,6. Here we characterize a novel factor that locates at the division site before FtsZ and guides septum positioning in the pneumococcus. MapZ (Midcell Anchored Protein Z) forms ring structures at the cell equator and moves apart as the cell elongates, therefore behaving as a permanent beacon of division sites. MapZ then positions the FtsZ-ring through direct protein-protein interactions. MapZ-mediated control differs from previously described systems mostly based on negative regulation of FtsZ assembly. Further, MapZ is an endogenous target of the ser/thr-kinase StkP, which was recently shown to play a central role in cytokinesis and morphogenesis of the pneumococcus7-9. We show that both phosphorylated and non-phosphorylated forms of MapZ are required for proper Z-ring formation and dynamics. Altogether, this work uncovers a new mechanism for bacterial cell division that is regulated by phosphorylation and illustrates that nature has evolved a diversity of cell division mechanisms adapted to the different bacterial clades. PMID:25470041

  5. MapZ marks the division sites and positions FtsZ rings in Streptococcus pneumoniae.

    PubMed

    Fleurie, Aurore; Lesterlin, Christian; Manuse, Sylvie; Zhao, Chao; Cluzel, Caroline; Lavergne, Jean-Pierre; Franz-Wachtel, Mirita; Macek, Boris; Combet, Christophe; Kuru, Erkin; VanNieuwenhze, Michael S; Brun, Yves V; Sherratt, David; Grangeasse, Christophe

    2014-12-11

    In every living organism, cell division requires accurate identification of the division site and placement of the division machinery. In bacteria, this process is traditionally considered to begin with the polymerization of the highly conserved tubulin-like protein FtsZ into a ring that locates precisely at mid-cell. Over the past decades, several systems have been reported to regulate the spatiotemporal assembly and placement of the FtsZ ring. However, the human pathogen Streptococcus pneumoniae, in common with many other organisms, is devoid of these canonical systems and the mechanisms of positioning the division machinery remain unknown. Here we characterize a novel factor that locates at the division site before FtsZ and guides septum positioning in pneumococcus. Mid-cell-anchored protein Z (MapZ) forms ring structures at the cell equator and moves apart as the cell elongates, therefore behaving as a permanent beacon of division sites. MapZ then positions the FtsZ ring through direct protein-protein interactions. MapZ-mediated control differs from previously described systems mostly on the basis of negative regulation of FtsZ assembly. Furthermore, MapZ is an endogenous target of the Ser/Thr kinase StkP, which was recently shown to have a central role in cytokinesis and morphogenesis of S. pneumoniae. We show that both phosphorylated and non-phosphorylated forms of MapZ are required for proper Z-ring formation and dynamics. Altogether, this work uncovers a new mechanism for bacterial cell division that is regulated by phosphorylation and illustrates that nature has evolved a diversity of cell division mechanisms adapted to the different bacterial clades.

  6. Carbene footprinting accurately maps binding sites in protein-ligand and protein-protein interactions

    NASA Astrophysics Data System (ADS)

    Manzi, Lucio; Barrow, Andrew S.; Scott, Daniel; Layfield, Robert; Wright, Timothy G.; Moses, John E.; Oldham, Neil J.

    2016-11-01

    Specific interactions between proteins and their binding partners are fundamental to life processes. The ability to detect protein complexes, and map their sites of binding, is crucial to understanding basic biology at the molecular level. Methods that employ sensitive analytical techniques such as mass spectrometry have the potential to provide valuable insights with very little material and on short time scales. Here we present a differential protein footprinting technique employing an efficient photo-activated probe for use with mass spectrometry. Using this methodology the location of a carbohydrate substrate was accurately mapped to the binding cleft of lysozyme, and in a more complex example, the interactions between a 100 kDa, multi-domain deubiquitinating enzyme, USP5 and a diubiquitin substrate were located to different functional domains. The much improved properties of this probe make carbene footprinting a viable method for rapid and accurate identification of protein binding sites utilizing benign, near-UV photoactivation.

  7. Training site statistics from Landsat and Seasat satellite imagery registered to a common map base

    NASA Technical Reports Server (NTRS)

    Clark, J.

    1981-01-01

    Landsat and Seasat satellite imagery and training site boundary coordinates were registered to a common Universal Transverse Mercator map base in the Newport Beach area of Orange County, California. The purpose was to establish a spatially-registered, multi-sensor data base which would test the use of Seasat synthetic aperture radar imagery to improve spectral separability of channels used for land use classification of an urban area. Digital image processing techniques originally developed for the digital mosaics of the California Desert and the State of Arizona were adapted to spatially register multispectral and radar data. Techniques included control point selection from imagery and USGS topographic quadrangle maps, control point cataloguing with the Image Based Information System, and spatial and spectral rectifications of the imagery. The radar imagery was pre-processed to reduce its tendency toward uniform data distributions, so that training site statistics for selected Landsat and pre-processed Seasat imagery indicated good spectral separation between channels.

  8. Carbene footprinting accurately maps binding sites in protein–ligand and protein–protein interactions

    PubMed Central

    Manzi, Lucio; Barrow, Andrew S.; Scott, Daniel; Layfield, Robert; Wright, Timothy G.; Moses, John E.; Oldham, Neil J.

    2016-01-01

    Specific interactions between proteins and their binding partners are fundamental to life processes. The ability to detect protein complexes, and map their sites of binding, is crucial to understanding basic biology at the molecular level. Methods that employ sensitive analytical techniques such as mass spectrometry have the potential to provide valuable insights with very little material and on short time scales. Here we present a differential protein footprinting technique employing an efficient photo-activated probe for use with mass spectrometry. Using this methodology the location of a carbohydrate substrate was accurately mapped to the binding cleft of lysozyme, and in a more complex example, the interactions between a 100 kDa, multi-domain deubiquitinating enzyme, USP5 and a diubiquitin substrate were located to different functional domains. The much improved properties of this probe make carbene footprinting a viable method for rapid and accurate identification of protein binding sites utilizing benign, near-UV photoactivation. PMID:27848959

  9. Carbene footprinting accurately maps binding sites in protein-ligand and protein-protein interactions.

    PubMed

    Manzi, Lucio; Barrow, Andrew S; Scott, Daniel; Layfield, Robert; Wright, Timothy G; Moses, John E; Oldham, Neil J

    2016-11-16

    Specific interactions between proteins and their binding partners are fundamental to life processes. The ability to detect protein complexes, and map their sites of binding, is crucial to understanding basic biology at the molecular level. Methods that employ sensitive analytical techniques such as mass spectrometry have the potential to provide valuable insights with very little material and on short time scales. Here we present a differential protein footprinting technique employing an efficient photo-activated probe for use with mass spectrometry. Using this methodology the location of a carbohydrate substrate was accurately mapped to the binding cleft of lysozyme, and in a more complex example, the interactions between a 100 kDa, multi-domain deubiquitinating enzyme, USP5 and a diubiquitin substrate were located to different functional domains. The much improved properties of this probe make carbene footprinting a viable method for rapid and accurate identification of protein binding sites utilizing benign, near-UV photoactivation.

  10. Covariance of biophysical data with digital topograpic and land use maps over the FIFE site

    NASA Technical Reports Server (NTRS)

    Davis, F. W.; Schimel, D. S.; Friedl, M. A.; Michaelsen, J. C.; Kittel, T. G. F.; Dubayah, R.; Dozier, J.

    1992-01-01

    This paper discusses the biophysical stratification of the FIFE site, implementation of the stratification utilizing geographic information system methods, and validation of the stratification with respect to field measurements of biomass, Bowen ratio, soil moisture, and the greenness vegetation index (GVI) derived from TM satellite data. Maps of burning and topographic position were significantly associated with variation in GVI, biomass, and Bowen ratio. The stratified design did not significantly alter the estimated site-wide means for surface climate parameters but accounted for between 25 and 45 percent of the sample variance depending on the variable.

  11. Salt Repository Project site study plan for surface geological mapping: Revision 1, December 22, 1987

    SciTech Connect

    Not Available

    1988-03-01

    This site study plan describes the Surface Geological Mapping field activities to be conducted during early stages of Site Characterization for the Deaf Smith County Site, Texas. The field program has been designed to provide data useful in addressing information and design data needs resulting from Federal/State/local regulatory requirements and repository program requirements. Air and ground surveys and an extensive literature search will be conducted to map areas within and hear proposed nuclear waste repository site in the Deaf Smith County. Findings from this study may identify additional areas requiring further investigation, for which a new site study plan will be prepared. The Salt Repository Project (SRP) Networks specify the schedule under which the program will operate. The Technical and Field Services Contractor (TFSC) is responsible for conducting the field program. Data will be handled and reported in accordance with established SRP procedures. A quality assurance program will be utilized to assure that activities affecting quality are performed correctly and the appropriate documentation is maintained. 27 refs., 13 figs., 5 tabs.

  12. New results for geologic units mapping of Utah test sites using Landsat TM data

    NASA Technical Reports Server (NTRS)

    Short, N. M.; Marcell, R.

    1986-01-01

    This paper continues a study on the accuracy of geological mapping using Landsat Thematic Mapper data (Short, 1984). In June 1976, both the White Mountain alteration zone and the Waterpocket Fold sedimentary rock sites in Utah were surveyed by the Bendix 24-band scanner on a NASA NC-130B aircraft. Mid-June 1984 TM data for these two sites have been processed like the 1976 data to test the quality of simulation of TM data. Principal-components (PC) color composite images for White Mountain show close correspondence to the Bendix PC images. At this site carbonate strata are uniquely discriminated in both Bendix and TM composites that use an inverted PC 3 image. Alunite/kaolinite and hematite/limonite alteration zones developed on volcanic flows are also sharply separated, but iron oxide and silicified zones are less so. The accuracy of rock-units mapping at the Waterpocket Fold site by supervised classification of the June TM data is significantly better, reaching 70 percent in the best case, than for January 1983 data for that site.

  13. Collaborative community hazard exposure mapping: Distant Early Warning radar sites in Alaska's North Slope

    NASA Astrophysics Data System (ADS)

    Brady, M.

    2015-12-01

    A method to produce hazard exposure maps that are developed in collaboration with local coastal communities is the focus of this research. Typically efforts to map community exposure to climate threats over large areas have limited consideration of local perspectives about associated risks, constraining their utility for local management. This problem is especially acute in remote locations such as the Arctic where there are unique vulnerabilities to coastal threats that can be fully understood only through inclusion of community stakeholders. Through collaboration with community members, this study identifies important coastal assets and places and surveys local perspectives of exposure to climate threats along Alaska's vast North Slope coastline spanning multiple municipalities. To model physical exposure, the study adapts the U.S. Geological Survey's (USGS) coastal vulnerability index (CVI) to the Arctic context by incorporating the effects of open water distance determined by sea ice extent, and assigning CVI values to coastal assets and places according to direction and proximity. The study found that in addition to concerns about exposed municipal and industrial assets, North Slope communities viewed exposure of traditional activity sites as presenting a particular risk for communities. Highly exposed legacy Cold War Distant Early Warning Line sites are of particular concern with impacts ranging from financial risk to contamination of sensitive coastal marine environments. This research demonstrates a method to collaboratively map community exposure to coastal climate threats to better understand local risks and produce locally usable exposure maps.

  14. NEHRP Site Classification and Preliminary Soil Amplification Maps of Lamphun City, Northern Thailand

    NASA Astrophysics Data System (ADS)

    Thitimakorn, Thanop; Raenak, Thanabodi

    2016-01-01

    The primary goal of this study is to generate the NEHRP soil classification map for Lamphun City using the average shear wave velocity values (Vs(30)) derived from the multi-channel analysis of surface wave (MASW) data. The secondary goal is to use the Vs(30) data to create the preliminary site amplification map of the city. For this work, multi-channel surface wave seismic data were acquired at 48 preselected sites in the Lamphun City area, northern Thailand. After generating the NEHRP map, soil class D is found to be present mostly in the northern part of the area, while soil class C is found mostly in the southern part. A major part of the Lamphun City is located on soil class D. The soil amplification map indicates higher amplification in the east, north and west of the city, where the soils consisted of mostly soft sediments from the alluvial plain and river terrace. The central and south eastern parts of Lamphun City had a relatively low amplification, perhaps because the sediment in this part is relatively thin or the bedrock is shallow. The results of study imply that the major part of Lamphun city may experience earthquake ground shaking due to amplification of the soft soils.

  15. Development and application of site mapping methods for the design of glycosaminoglycans.

    PubMed

    Agostino, Mark; Gandhi, Neha S; Mancera, Ricardo L

    2014-09-01

    Glycosaminoglycans (GAGs) are complex polysaccharides involved in a wide range of biological signaling events, as well as being important as biological structural materials. Despite the ubiquity and importance of GAG-protein interactions in biological systems and potentially as therapeutic targets, detailed structures of such interactions are sparse in availability. Computational methods can provide detailed structural knowledge of these interactions; however, they should be evaluated against suitable test systems prior to their widespread use. In this study, we have investigated the application of automated molecular docking and interaction mapping techniques to characterizing GAG-protein interactions. A series of high-resolution X-ray crystal structures of GAGs in complex with proteins was used to evaluate the approaches. Accurately scoring the pose fitting best with the crystal structure was a challenge for all docking programs evaluated. The site mapping technique offered excellent prediction of the key residues involved in ligand recognition, comparable to the best pose and improved over the top-ranked pose. A design protocol incorporating site- and ligand-based mapping techniques was developed and applied to identify GAGs capable of binding to acidic fibroblast growth factor (aFGF). The protocol was able to identify ligands known to bind to aFGF and accurately able to predict the binding modes of those ligands when using a known ligand-binding conformation of the protein. This study demonstrates the value of mapping-based techniques in identifying specific GAG epitopes recognized by proteins and for GAG-based drug design.

  16. Validation of Innovative Exploration Technologies for Newberry Volcano: Drill Site Location Map 2010

    DOE Data Explorer

    Jaffe, Todd

    2012-01-01

    Newberry seeks to explore "blind" (no surface evidence) convective hydrothermal systems associated with a young silicic pluton on the flanks of Newberry Volcano. This project will employ a combination of innovative and conventional techniques to identify the location of subsurface geothermal fluids associated with the hot pluton. Newberry project drill site location map 2010. Once the exploration mythology is validated, it can be applied throughout the Cascade Range and elsewhere to locate and develop “blind” geothermal resources.

  17. The population structure and recent colonization history of Oregon threespine stickleback determined using restriction-site associated DNA-sequencing.

    PubMed

    Catchen, Julian; Bassham, Susan; Wilson, Taylor; Currey, Mark; O'Brien, Conor; Yeates, Quick; Cresko, William A

    2013-06-01

    Understanding how genetic variation is partitioned across genomes within and among populations is a fundamental problem in ecological and evolutionary genetics. To address this problem, we studied the threespine stickleback fish, which has repeatedly undergone parallel phenotypic and genetic differentiation when oceanic fish have invaded freshwater habitats. While significant evolutionary genetic research has been performed using stickleback from geographic regions that have been deglaciated in the last 20 000 years, less research has focused on freshwater populations that predate the last glacial maximum. We performed restriction-site associated DNA-sequencing (RAD-seq) based population genomic analyses on stickleback from across Oregon, which was not glaciated during the last maximum. We sampled stickleback from coastal, Willamette Basin and central Oregon sites, analysed their genetic diversity using RAD-seq, performed structure analyses, reconstructed their phylogeographic history and tested the hypothesis of recent stickleback introduction into central Oregon, where incidence of this species was only recently documented. Our results showed a clear phylogeographic break between coastal and inland populations, with oceanic populations exhibiting the lowest levels of divergence from one another. Willamette Basin and central Oregon populations formed a clade of closely related populations, a finding consistent with a recent introduction of stickleback into central Oregon. Finally, genome-wide analysis of genetic diversity (π) and correlations of alleles within individuals in subpopulations (FIS) supported a role for introgressive hybridization in coastal populations and a recent expansion in central Oregon. Our results exhibit the power of next-generation sequencing genomic approaches such as RAD-seq to identify both historical population structure and recent colonization history.

  18. Mapping sites of reef vulnerability along lagoons of Lakshadweep archipelago, Indian Ocean.

    PubMed

    R, Ranith; L, Senthilnathan; M, Machendiranathan; T, Thangaradjou; S K, Sasamal; S B, Choudhury

    2017-09-08

    Tissue degradation and mediated mortality have turned into a major threat to coral reef systems around the world. Detailed knowledge on interactions of prime biological factors that mediate tissue loss and mortality is of paramount importance in understanding the prevailing reef health scenario and to trial management actions. In the present study, a series of benthic surveys were conducted in Lakshadweep islands to understand the interactions of plausible biological factors in causing tissue loss and mediated mortality. Interactions of biological scenarios were prioritized using hierarchical regression analysis. The hierarchical regression model analysis revealed black band disease (β = 0.59; p < 0.001) and algal interactions (β = 0.48; p < 0.001) as the major factors responsible for tissue-loss-mediated coral mortality in the region. The observations from the hierarchical analysis were used to derive vulnerability maps based on weighted overlay analysis. The vulnerability mapping revealed that lagoon of Kalpeni Island is very highly vulnerable to coral degradation with 683.5 ha followed by Kavaratti (70.2 ha), Bangaram (70 ha), and Amini (47 ha). Chethalath and Agatti lagoons were inferred as low vulnerable sites where coral reefs can sustain. The vulnerability maps derived can be used as a baseline observation to identify areas of very high vulnerability and specific stressor prevalent in those sites. This will be helpful in defining stressor and site-specific management plans.

  19. Breaking RAD: An evaluation of the utility of restriction site associated DNA sequencing for genome scans of adaptation.

    PubMed

    Lowry, David B; Hoban, Sean; Kelley, Joanna L; Lotterhos, Katie E; Reed, Laura K; Antolin, Michael F; Storfer, Andrew

    2016-09-12

    Understanding how and why populations evolve is of fundamental importance to molecular ecology. RADseq (Restriction site-Associated DNA sequencing), a popular reduced representation method, has ushered in a new era of genome-scale research for assessing population structure, hybridization, demographic history, phylogeography, and migration. RADseq has also been widely used to conduct genome scans to detect loci involved in adaptive divergence among natural populations. Here, we examine the capacity of those RADseq-based genome scan studies to detect loci involved in local adaptation. To understand what proportion of the genome is missed by RADseq studies, we developed a simple model using different numbers of RAD-tags, genome sizes, and extents of linkage disequilibrium (length of haplotype blocks). We then surveyed recent studies that have used RADseq for genome scans and found that that the median density of RADseq markers across these studies was one marker per 3.96 megabases. Given that the length of linkage disequilibrium is often orders of magnitude less than a megabase, we conclude that genome scans based on RADseq data alone are unlikely to advance our understanding of molecular ecology or evolutionary genetics for most systems. This article is protected by copyright. All rights reserved.

  20. Restriction site associated DNA (RAD) for de novo sequencing and marker discovery in sugarcane borer, Diatraea saccharalis Fab. (Lepidoptera: Crambidae).

    PubMed

    Pavinato, V A C; Margarido, G R A; Wijeratne, A J; Wijeratne, S; Meulia, T; Souza, A P; Michel, A P; Zucchi, M I

    2017-05-01

    We present the development of a genomic library using RADseq (restriction site associated DNA sequencing) protocol for marker discovery that can be applied on evolutionary studies of the sugarcane borer Diatraea saccharalis, an important South American insect pest. A RADtag protocol combined with Illumina paired-end sequencing allowed de novo discovery of 12 811 SNPs and a high-quality assembly of 122.8M paired-end reads from six individuals, representing 40 Gb of sequencing data. Approximately 1.7 Mb of the sugarcane borer genome distributed over 5289 minicontigs were obtained upon assembly of second reads from first reads RADtag loci where at least one SNP was discovered and genotyped. Minicontig lengths ranged from 200 to 611 bp and were used for functional annotation and microsatellite discovery. These markers will be used in future studies to understand gene flow and adaptation to host plants and control tactics. © 2016 John Wiley & Sons Ltd.

  1. Unidirectional diploid-tetraploid introgression among British birch trees with shifting ranges shown by restriction site-associated markers.

    PubMed

    Zohren, Jasmin; Wang, Nian; Kardailsky, Igor; Borrell, James S; Joecker, Anika; Nichols, Richard A; Buggs, Richard J A

    2016-06-01

    Hybridization may lead to introgression of genes among species. Introgression may be bidirectional or unidirectional, depending on factors such as the demography of the hybridizing species, or the nature of reproductive barriers between them. Previous microsatellite studies suggested bidirectional introgression between diploid Betula nana (dwarf birch) and tetraploid B. pubescens (downy birch) and also between B. pubescens and diploid B. pendula (silver birch) in Britain. Here, we analyse introgression among these species using 51 237 variants in restriction site-associated (RAD) markers in 194 individuals, called with allele dosages in the tetraploids. In contrast to the microsatellite study, we found unidirectional introgression into B. pubescens from both of the diploid species. This pattern fits better with the expected nature of the reproductive barrier between diploids and tetraploids. As in the microsatellite study, introgression into B. pubescens showed clear clines with increasing introgression from B. nana in the north and from B. pendula in the south. Unlike B. pendula alleles, introgression of B. nana alleles was found far from the current area of sympatry or allopatry between B. nana and B. pubescens. This pattern fits a shifting zone of hybridization due to Holocene reduction in the range of B. nana and expansion in the range of B. pubescens.

  2. BamI, KpnI, and SalI restriction enzyme maps of the DNAs of herpes simplex virus strains Justin and F: occurrence of heterogeneities in defined regions of the viral DNA.

    PubMed Central

    Locker, H; Frenkel, N

    1979-01-01

    We present the locations of the cleavage sites for the BamI, KpnI, and SalI restriction endonucleases within the DNA molecules of herpes simplex virus type 1 (HSV-1) strains Justin and F. These restriction enzymes cleave the HSV-1 DNA at many sites, producing relatively small fragments which should prove useful in future studies of HSV-1 gene structure and function. The mapping data revealed the occurrence of heterogeneity within three regions of the viral genome including (i) the region spanning map coordinates 0.74--0.76, (ii) the ends of the large (L) DNA component, and (iii) the junction between the large (L) and the small (S) components. The heterogeneity in the ends of L and the S-L junctions of HSV-1 (Justin) and HSV-1 (F) DNAs was grossly similar to that previously reported to occur in the ends of L and the S-L junctions of the HSV-1 (KOS) DNA (M. J. Wagner and W. C. Summers, J. Virol. 27:374--387, 1978). Thus, cleavage of these regions with restriction endonucleases yielded sets of minor fragments differing in size by constant increments. However, the various strains of HSV-1 differed with respect to the numbers, size increments, and relative molarities of the various minor fragments, suggesting that the parameters of the heterogeneity are inherited in the structural makeup of the HSV-1 genome. The strain dependence of the pattern of heterogeneity can be most easily explained in terms of variable sizes of the terminally reiterated a sequence, contained in the DNA molecules of these three strains of HSV-1. Images PMID:228068

  3. The map-1 gene family in root-knot nematodes, Meloidogyne spp.: a set of taxonomically restricted genes specific to clonal species.

    PubMed

    Tomalova, Iva; Iachia, Cathy; Mulet, Karine; Castagnone-Sereno, Philippe

    2012-01-01

    Taxonomically restricted genes (TRGs), i.e., genes that are restricted to a limited subset of phylogenetically related organisms, may be important in adaptation. In parasitic organisms, TRG-encoded proteins are possible determinants of the specificity of host-parasite interactions. In the root-knot nematode (RKN) Meloidogyne incognita, the map-1 gene family encodes expansin-like proteins that are secreted into plant tissues during parasitism, thought to act as effectors to promote successful root infection. MAP-1 proteins exhibit a modular architecture, with variable number and arrangement of 58 and 13-aa domains in their central part. Here, we address the evolutionary origins of this gene family using a combination of bioinformatics and molecular biology approaches. Map-1 genes were solely identified in one single member of the phylum Nematoda, i.e., the genus Meloidogyne, and not detected in any other nematode, thus indicating that the map-1 gene family is indeed a TRG family. A phylogenetic analysis of the distribution of map-1 genes in RKNs further showed that these genes are specifically present in species that reproduce by mitotic parthenogenesis, with the exception of M. floridensis, and could not be detected in RKNs reproducing by either meiotic parthenogenesis or amphimixis. These results highlight the divergence between mitotic and meiotic RKN species as a critical transition in the evolutionary history of these parasites. Analysis of the sequence conservation and organization of repeated domains in map-1 genes suggests that gene duplication(s) together with domain loss/duplication have contributed to the evolution of the map-1 family, and that some strong selection mechanism may be acting upon these genes to maintain their functional role(s) in the specificity of the plant-RKN interactions.

  4. The location of four fimbrin-encoding genes, agfA, fimA, sefA and sefD, on the Salmonella enteritidis and/or S. typhimurium XbaI-BlnI genomic restriction maps.

    PubMed

    Collinson, S K; Liu, S L; Clouthier, S C; Banser, P A; Doran, J L; Sanderson, K E; Kay, W W

    1996-02-22

    Four fimbrin-encoding genes, fimA (type-1 or SEF21 fimbriae), agfA (thin aggregative or SEF17 fimbriae), sefA (SEF14 fimbriae and sefD (SEF18 fimbriae) from Salmonella enteritidis (Se) 27655-3b were located onto the XbaI-BlnI genomic restriction maps of Salmonella typhimurium (St) LT2 and Se strains SSU7998 and 27655-3b. The XbaI or BlnI genomic fragments carrying these genes were identified by hybridization with labeled oligodeoxyribonucleotides or fimbrin-encoding genes. The fimbrin-encoding genes were not encoded by the virulence plasmids, but were located on chromosomal DNA fragments. The position of each gene on a given XbaI fragment was determined by hybridization of a series of XbaI-digested genomic DNA samples from previously characterized Tn10 mutants of Se and St with its respective probe. The fimA gene mapped near 13 centisomes (Cs) between purE884::Tn10 at 12.6 Cs (11.8 min) and apeE2::Tn10 at 12.8 Cs (12.3 min) beside the first XbaI site at 13.0 Cs in St or between purE884::Tn10 at 12.6 Cs and the XbaI site at 13.6 Cs in Se. The agfA gene mapped near 26 Cs between putA::Tn10 and pyrC691::Tn10 in St, but near 40 Cs between pncX::Tn10 and the XbaI site at 43.3 Cs in Se. This difference in map position was due to the location of agfA near one end of the 815-kb chromosomal fragment inverted between Se and St. The sefA and sefD genes mapped precisely at 97.6 Cs in Se, but were absent from the genome of St LT2. To verify the mapping procedures used herein, tctC was also mapped in both Salmonella serovars. As expected, tctC mapped near 60 Cs in both St and Se, thereby confirming previous studies.

  5. Mapping of mosquito breeding sites in malaria endemic areas in Pos Lenjang, Kuala Lipis, Pahang, Malaysia.

    PubMed

    Ahmad, Rohani; Ali, Wan N W M; Nor, Zurainee M; Ismail, Zamree; Hadi, Azahari A; Ibrahim, Mohd N; Lim, Lee H

    2011-12-13

    The application of the Geographic Information Systems (GIS) to the study of vector transmitted diseases considerably improves the management of the information obtained from the field survey and facilitates the study of the distribution patterns of the vector species. As part of a study to assess remote sensing data as a tool for vector mapping, geographical features like rivers, small streams, forest, roads and residential area were digitized from the satellite images and overlaid with entomological data. Map of larval breeding habitats distribution and map of malaria transmission risk area were developed using a combination of field data, satellite image analysis and GIS technique. All digital data in the GIS were displayed in the WGS 1984 coordinate system. Six occasions of larval surveillance were also conducted to determine the species of mosquitoes, their characteristics and the abundance of habitats. Larval survey studies showed that anopheline and culicine larvae were collected and mapped from 79 and 67 breeding sites respectively. Breeding habitats were located at 100-400 m from human settlement. Map of villages with 400 m buffer zone visualizes that more than 80% of Anopheles maculatus s.s. immature habitats were found within the buffer zone. This study amplifies the need for a broadening of the GIS approach which is emphasized with the aim of rejuvenating the dynamic aspect of entomological studies in Malaysia. In fact, the use of such basic GIS platforms promote a more rational basis for strategic planning and management in the control of endemic diseases at the national level.

  6. Operation and research at the Ithaca MAP3S regional precipitation chemistry site

    SciTech Connect

    Butler, T.J.; Likens, G.E.

    1991-07-01

    Annual precipitation chemistry data from network start-up through 1988 is presented for the nine MAP3S sites. Time trends show significant negative linear regressions (P < 0.10) for SO{sub 4}{sup 2-} at 2 sites, H{sup +} at 4 sites, Ca{sup ++} at 1 site, and Na{sup +} at 1 site. Significant positive regressions over time include: NH{sub 4}{sup +} at 2 sites, Ca{sup ++} at 1 site, K{sup +} at 4 sites, and Cl{sup {minus}} at 2 sites. The Ithaca site shows the highest number of significant trends, with positive trends for Cl{sup {minus}}, NH{sub 4}{sup +}, Ca{sup ++}, and K{sup +}, and a negative trend for H{sup +}. Linear regressions of annual SO{sub 4}{sup 2-} concentrations on SO2 emissions show a significant positive relationship for Whiteface, Illinois, and Ohio at p < 0.10, 0.02, and 0.05 respectively. Overall for all MAP3S sites, plus Hubbard Brook a 25% decline in SO2 emissions over the region has been accompanied by a 16.5% decline in annual precipitation concentrations of SO{sub 4}{sup 2-}. For the region as a whole, a 20% decline in combined emissions has been accompanied to a 20% decline in H{sup +} concentrations. Thus a linear relationship exists between combined emissions and precipitation H{sup +} concentrations. No strong relationship exists for NOx emissions and precipitation NO{sub 3}{sup {minus}} concentration at the annual, seasonal or monthly level. Removing the NOx transportation sector, removing high and low precipitation values, or high pH values also does little to improve the NOx -- NO{sub 3}{sup {minus}} concentration relationships. Dry deposition components such a PAN, NO2, gaseous HNO{sub 3}, or aerosol NO{sub 3}{sup {minus}} should be included in the future with precipitation NO{sub 3}{sup {minus}} to relate emissions of NOx to nitrogen deposition. 11 refs., 27 figs.,1 tab.

  7. Site-response maps for the Los Angeles region based on earthquake ground motions

    USGS Publications Warehouse

    Hartzell, Stephen H.; Harmsen, Stephen C.; Frankel, Arthur D.; Carver, David L.; Cranswick, Edward; Meremonte, Mark E.; Michael, John A.

    1996-01-01

    Ground-motion records from aftershocks of the 1994 Northridge earthquake and main-shock records from the 1971 San Fernando, 1987 Whittier Narrows, 1991 Sierra Madre, and 1994 Northridge earthquakes are used to estimate site response in the urban Los Angeles, California, area. Two frequency bands are considered, 0.5-1.5 Hz and 2.0-6.0 Hz. Instrument characteristics prevented going to lower frequencies, and frequencies above 6.0 Hz are less important to the building inventory. Site response determined at the instrumented locations is associated with the surficial geology and contoured to produce a continuous spatial estimation of site response. The maps in this report are preliminary and will evolve as more data become available and more analysis is done.

  8. Arabidopsis MAP65-4 plays a role in phragmoplast microtubule organization and marks the cortical cell division site.

    PubMed

    Li, Haoge; Sun, Baojuan; Sasabe, Michiko; Deng, Xingguang; Machida, Yasunori; Lin, Honghui; Julie Lee, Y-R; Liu, Bo

    2017-07-01

    The evolutionarily conserved MAP65 family proteins bundle anti-parallel microtubules (MTs). In Arabidopsis thaliana, mutations in the MAP65-3 gene lead to serious defects in MT organization in the phragmoplast and cause failures in cytokinesis. However, the functions of other ArabidopsisMAP65 isoforms are largely unknown. MAP65 functions were analyzed based on genetic interactions among different map65 mutations. Live-cell imaging and immunolocalization experiments revealed dynamic activities of two closely related MAP65 proteins in dividing cells. The map65-4 mutation caused synthetic lethality with map65-3 although map65-4 alone did not cause a noticeable phenotype. Furthermore, the introduction of an extra copy of the MAP65-4 gene significantly suppressed defects in cytokinesis and seedling growth caused by map65-3 because of restoring MT engagement in the spindle midzone. During mitosis, MAP65-4 first appeared at the preprophase band and persisted at the cortical division site afterwards. It was also concentrated on MTs in the spindle midzone and the phragmoplast. In the absence of MAP65-3, MAP65-4 exhibited greatly enhanced localization in the midzone of developing phragmoplast. Therefore, we have uncovered redundant but differential contributions of MAP65-3 and MAP65-4 to engaging and bundling anti-parallel MTs in the phragmoplast and disclosed a novel action of MAP65-4 at the cortical cell division site. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  9. Electron microscopic mapping of wheat germ RNA polymerase II binding sites on cloned CaMV DNA.

    PubMed Central

    Grellet, F; Cooke, R; Teissere, M; Delseny, M; Xech, J; Penon, P

    1981-01-01

    The binding sites of wheat germ RNA polymerase II were mapped on the cloned CaMV genome by observation of enzyme-linear DNA complexes by electron microscopy. Twelve sites are observed. Three of them are relatively stable in the presence of heparin and are found at positions 8-9, 21-23, and 41-44 map units on the physical map of the genome. These positions correspond to AT-rich regions of the viral genome which contain potential promoter sites. These results are discussed with reference to current information on the structure and expression of the CaMV genome. Images PMID:7301575

  10. Depth-to-Ice Map of an Arctic Site on Mars

    NASA Technical Reports Server (NTRS)

    2007-01-01

    Color coding in this map of a far-northern site on Mars indicates the change in nighttime ground-surface temperature between summer and fall. This site, like most of high-latitude Mars, has water ice mixed with soil near the surface. The ice is probably in a rock-hard frozen layer beneath a few centimeters or inches of looser, dry soil. The amount of temperature change at the surface likely corresponds to how close to the surface the icy material lies.

    The dense, icy layer retains heat better than the looser soil above it, so where the icy layer is closer to the surface, the surface temperature changes more slowly than where the icy layer is buried deeper. On the map, areas of the surface that cooled more slowly between summer and autumn (interpreted as having the ice closer to the surface) are coded blue and green. Areas that cooled more quickly (interpreted as having more distance to the ice) are coded red and yellow.

    The depth to the top of the icy layer estimated from these observations, as little as 5 centimeters (2 inches), matches modeling of where it would be if Mars has an active cycle of water being exchanged by diffusion between atmospheric water vapor and subsurface water ice.

    This map and its interpretation are in a May 3, 2007, report in the journal Nature by Joshua Bandfield of Arizona State University, Tempe. The Thermal Emission Imaging System camera on NASA's Mars Odyssey orbiter collected the data presented in the map. The site is centered near 67.5 degrees north latitude, 132 degrees east longitude, in the Martian arctic plains called Vastitas Borealis. It was formerly a candidate landing site for NASA's Phoenix Mars Lander mission. This site is within the portion of the planet where, in 2002, the Gamma Ray Spectrometer suite of instruments on Mars Odyssey found evidence for water ice lying just below the surface. The information from the Gamma Ray Spectrometer is averaged over patches of ground hundreds of kilometers

  11. Depth-to-Ice Map of an Arctic Site on Mars

    NASA Technical Reports Server (NTRS)

    2007-01-01

    Color coding in this map of a far-northern site on Mars indicates the change in nighttime ground-surface temperature between summer and fall. This site, like most of high-latitude Mars, has water ice mixed with soil near the surface. The ice is probably in a rock-hard frozen layer beneath a few centimeters or inches of looser, dry soil. The amount of temperature change at the surface likely corresponds to how close to the surface the icy material lies.

    The dense, icy layer retains heat better than the looser soil above it, so where the icy layer is closer to the surface, the surface temperature changes more slowly than where the icy layer is buried deeper. On the map, areas of the surface that cooled more slowly between summer and autumn (interpreted as having the ice closer to the surface) are coded blue and green. Areas that cooled more quickly (interpreted as having more distance to the ice) are coded red and yellow.

    The depth to the top of the icy layer estimated from these observations, as little as 5 centimeters (2 inches), matches modeling of where it would be if Mars has an active cycle of water being exchanged by diffusion between atmospheric water vapor and subsurface water ice.

    This map and its interpretation are in a May 3, 2007, report in the journal Nature by Joshua Bandfield of Arizona State University, Tempe. The Thermal Emission Imaging System camera on NASA's Mars Odyssey orbiter collected the data presented in the map. The site is centered near 67.5 degrees north latitude, 132 degrees east longitude, in the Martian arctic plains called Vastitas Borealis. It was formerly a candidate landing site for NASA's Phoenix Mars Lander mission. This site is within the portion of the planet where, in 2002, the Gamma Ray Spectrometer suite of instruments on Mars Odyssey found evidence for water ice lying just below the surface. The information from the Gamma Ray Spectrometer is averaged over patches of ground hundreds of kilometers

  12. Uncertainty in North America wet deposition isopleth maps: Effect of site selection and valid sample criteria

    SciTech Connect

    Simpson, J.C.; Olsen, A.R.

    1990-04-01

    This report considers several issues related to the preparation of isopleth maps for the display of spatial patterns of wet deposition. The valid sample criteria and data completeness rating used in the data summarization process are described. The data interpolation technique, kriging, is presented and it's derivation in terms of generalized least squares regression is given. Four different annual summaries for pH, sulfate concentration, and sulfate deposition in 1986 are prepared using either the Unified Deposition Database Committee (UDDC) definition of valid sample criteria or a relaxed valid sample criteria and the UDDC data completeness rating or a relaxed data completeness rating. The kriged estimates for the different annual summaries and the differences between these estimates are contoured. The effects of relaxing the valid sample criteria and data completeness rating are discussed. Conclusions are drawn about network operation, network design and the uncertainty of contour maps. It is recommended that in the case where the objective is contour maps to show regional patterns, the emphasis in most regions needs to be on the number of valid samples per site and the regional representativeness of the sites. 4 refs., 14 figs., 7 tabs.

  13. Intra-operative multi-site stimulation: Expanding methodology for cortical brain mapping of language functions

    PubMed Central

    Korn, Akiva; Kirschner, Adi; Perry, Daniella; Hendler, Talma; Ram, Zvi

    2017-01-01

    Direct cortical stimulation (DCS) is considered the gold-standard for functional cortical mapping during awake surgery for brain tumor resection. DCS is performed by stimulating one local cortical area at a time. We present a feasibility study using an intra-operative technique aimed at improving our ability to map brain functions which rely on activity in distributed cortical regions. Following standard DCS, Multi-Site Stimulation (MSS) was performed in 15 patients by applying simultaneous cortical stimulations at multiple locations. Language functioning was chosen as a case-cognitive domain due to its relatively well-known cortical organization. MSS, performed at sites that did not produce disruption when applied in a single stimulation point, revealed additional language dysfunction in 73% of the patients. Functional regions identified by this technique were presumed to be significant to language circuitry and were spared during surgery. No new neurological deficits were observed in any of the patients following surgery. Though the neuro-electrical effects of MSS need further investigation, this feasibility study may provide a first step towards sophistication of intra-operative cortical mapping. PMID:28700619

  14. Intra-operative multi-site stimulation: Expanding methodology for cortical brain mapping of language functions.

    PubMed

    Gonen, Tal; Gazit, Tomer; Korn, Akiva; Kirschner, Adi; Perry, Daniella; Hendler, Talma; Ram, Zvi

    2017-01-01

    Direct cortical stimulation (DCS) is considered the gold-standard for functional cortical mapping during awake surgery for brain tumor resection. DCS is performed by stimulating one local cortical area at a time. We present a feasibility study using an intra-operative technique aimed at improving our ability to map brain functions which rely on activity in distributed cortical regions. Following standard DCS, Multi-Site Stimulation (MSS) was performed in 15 patients by applying simultaneous cortical stimulations at multiple locations. Language functioning was chosen as a case-cognitive domain due to its relatively well-known cortical organization. MSS, performed at sites that did not produce disruption when applied in a single stimulation point, revealed additional language dysfunction in 73% of the patients. Functional regions identified by this technique were presumed to be significant to language circuitry and were spared during surgery. No new neurological deficits were observed in any of the patients following surgery. Though the neuro-electrical effects of MSS need further investigation, this feasibility study may provide a first step towards sophistication of intra-operative cortical mapping.

  15. Mapping impact indicators to link airborne ammonia emissions with nitrogen deposition in Natura 2000 sites

    NASA Astrophysics Data System (ADS)

    De Pue, David; Roet, David; Lefebvre, Wouter; Buysse, Jeroen

    2017-10-01

    Ammonia (NH3) deposition in natural areas is a pollution problem that is suited for spatially differentiated pollution control. The heterogeneous impact of nitrogen deposition from airborne ammonia emissions could serve as the basis for differentiated policy measures. Maps were developed that show the potential impact of ammonia emissions on protected Natura 2000 sites in Flanders, Belgium. These maps link the output of atmospheric dispersion and deposition models with data on the nitrogen sensitivity of protected habitats in the Natura 2000 network. The maps demonstrate that the indicator used for impact assessment is a crucial factor in the design of the spatially differentiated policy. The currently used impact indicator in Flanders, the Significance Score, was compared with the Aggregate Deposition Score, an alternative that is a better reflection of the total damage caused by airborne ammonia emissions in nearby Natura 2000 sites. Both indicators are based on the ratio of ammonia deposition to the critical load of nitrogen of the impacted habitat. Spatial effects related to the choice of impact indicator were evaluated. The results indicate that the choice of impact indicator has a decisive role in the geographical outcome of spatially differentiated policies.

  16. Applying nitrogen site-specifically using soil electrical conductivity maps and precision agriculture technology.

    PubMed

    Lund, E D; Wolcott, M C; Hanson, G P

    2001-10-16

    Soil texture varies significantly within many agricultural fields. The physical properties of soil, such as soil texture, have a direct effect on water holding capacity, cation exchange capacity, crop yield, production capability, and nitrogen (N) loss variations within a field. In short, mobile nutrients are used, lost, and stored differently as soil textures vary. A uniform application of N to varying soils results in a wide range of N availability to the crop. N applied in excess of crop usage results in a waste of the grower"s input expense, a potential negative effect on the environment, and in some crops a reduction of crop quality, yield, and harvestability. Inadequate N levels represent a lost opportunity for crop yield and profit. The global positioning system (GPS)-referenced mapping of bulk soil electrical conductivity (EC) has been shown to serve as an effective proxy for soil texture and other soil properties. Soils with a high clay content conduct more electricity than coarser textured soils, which results in higher EC values. This paper will describe the EC mapping process and provide case studies of site-specific N applications based on EC maps. Results of these case studies suggest that N can be managed site-specifically using a variety of management practices, including soil sampling, variable yield goals, and cropping history.

  17. High efficiency restriction enzyme-free linear amplification-mediated polymerase chain reaction approach for tracking lentiviral integration sites does not abrogate retrieval bias.

    PubMed

    Wu, Chuanfeng; Jares, Alexander; Winkler, Thomas; Xie, Jianjun; Metais, Jean-Yves; Dunbar, Cynthia E

    2013-01-01

    Retroviral vectors are an efficient and widely employed means of introducing an exogenous expression cassette into target cells. These vectors have been shown to integrate semi-randomly into the cellular genome, and can be associated with genotoxicity due to impact on expression of proximate genes. Therefore, efficient and accurate integration site analysis, while quantifying contributions of individual vector-containing clones, is desirable. Linear amplification-mediated polymerase chain reaction (LAM-PCR) is a widely used technique for identifying integrated proviral and host genomic DNA junctions. However, LAM-PCR is subject to selection bias inherent in the reliance of the assay on the presence of a restriction enzyme-cutting site adjacent to a retrievable integration site, and it is further limited by an inability to discriminate prior to sequencing between the flanking genomic DNA of interest and uninformative internal vector DNA. We report a modified restriction enzyme-free LAM-PCR (Re-free LAM-PCR) approach that is less time and labor intensive compared to conventional LAM-PCR, but in contrast to some other nonrestrictive methods, compares in efficiency and sensitivity, excludes retrieval of uninformative internal vector sequences, and allows retrieval of integration sites unbiased by the presence of nearby restriction sites. However, we report that Re-free LAM-PCR remains inaccurate for quantitation of the relative contributions of individual integration site-containing clones in a polyclonal setting, suggesting that bias in LAM-PCR retrieval of integration sites is not wholly explained by restriction enzyme-related factors.

  18. A physical map of the X chromosome of Drosophila melanogaster: Cosmid contigs and sequence tagged sites

    SciTech Connect

    Madueno, E.; Modolell, J.; Papagiannakis, G.

    1995-04-01

    A physical map of the euchromatic X chromosome of Drosophila melanogaster has been constructed by assembling contiguous arrays of cosmids that were selected by screening a library with DNA isolated from microamplified chromosomal divisions. This map, consisting of 893 cosmids, covers {approximately}64% of the euchromatic part of the chromosome. In addition, 568 sequence tagged sites (STS), in aggregate representing 120 kb of sequenced DNA, were derived from selected cosmids. Most of these STSs, spaced at an average distance of {approximately} 35 kb along the euchromatic region of the chromosome, represent DNA tags that can be used as entry points to the fruitfly genome. Furthermore, 42 genes have been placed on the physical map, either through the hybridization of specific probes to the cosmids or through the fact that they were represented among the STSs. These provide a link between the physical and the genetic maps of D. melanogaster. Nine novel genes have been tentatively identified in Drosophila on the basis of matches between STS sequences and sequences from other species. 32 refs., 3 figs., 4 tabs.

  19. A Physical Map of the X Chromosome of Drosophila Melanogaster: Cosmid Contigs and Sequence Tagged Sites

    PubMed Central

    Madueno, E.; Papagiannakis, G.; Rimmington, G.; Saunders, RDC.; Savakis, C.; Siden-Kiamos, I.; Skavdis, G.; Spanos, L.; Trenear, J.; Adam, P.; Ashburner, M.; Benos, P.; Bolshakov, V. N.; Coulson, D.; Glover, D. M.; Herrmann, S.; Kafatos, F. C.; Louis, C.; Majerus, T.; Modolell, J.

    1995-01-01

    A physical map of the euchromatic X chromosome of Drosophila melanogaster has been constructed by assembling contiguous arrays of cosmids that were selected by screening a library with DNA isolated from microamplified chromosomal divisions. This map, consisting of 893 cosmids, covers ~64% of the euchromatic part of the chromosome. In addition, 568 sequence tagged sites (STS), in aggregate representing 120 kb of sequenced DNA, were derived from selected cosmids. Most of these STSs, spaced at an average distance of ~35 kb along the euchromatic region of the chromosome, represent DNA tags that can be used as entry points to the fruitfly genome. Furthermore, 42 genes have been placed on the physical map, either through the hybridization of specific probes to the cosmids or through the fact that they were represented among the STSs. These provide a link between the physical and the genetic maps of D. melanogaster. Nine novel genes have been tentatively identified in Drosophila on the basis of matches between STS sequences and sequences from other species. PMID:7789765

  20. Phase variation of a Type IIG restriction-modification enzyme alters site-specific methylation patterns and gene expression in Campylobacter jejuni strain NCTC11168

    PubMed Central

    Anjum, Awais; Brathwaite, Kelly J.; Aidley, Jack; Connerton, Phillippa L.; Cummings, Nicola J.; Parkhill, Julian; Connerton, Ian; Bayliss, Christopher D.

    2016-01-01

    Phase-variable restriction-modification systems are a feature of a diverse range of bacterial species. Stochastic, reversible switches in expression of the methyltransferase produces variation in methylation of specific sequences. Phase-variable methylation by both Type I and Type III methyltransferases is associated with altered gene expression and phenotypic variation. One phase-variable gene of Campylobacter jejuni encodes a homologue of an unusual Type IIG restriction-modification system in which the endonuclease and methyltransferase are encoded by a single gene. Using both inhibition of restriction and PacBio-derived methylome analyses of mutants and phase-variants, the cj0031c allele in C. jejuni strain NCTC11168 was demonstrated to specifically methylate adenine in 5′CCCGA and 5′CCTGA sequences. Alterations in the levels of specific transcripts were detected using RNA-Seq in phase-variants and mutants of cj0031c but these changes did not correlate with observed differences in phenotypic behaviour. Alterations in restriction of phage growth were also associated with phase variation (PV) of cj0031c and correlated with presence of sites in the genomes of these phages. We conclude that PV of a Type IIG restriction-modification system causes changes in site-specific methylation patterns and gene expression patterns that may indirectly change adaptive traits. PMID:26786317

  1. Plume mapping and shipboard chemical data used to locate new vent sites in the Lau Basin

    NASA Astrophysics Data System (ADS)

    Edmonds, H. N.; German, C. R.; Breier, J. A.; Connelly, D. P.; Townsend-Small, A.; Resing, J. A.; Aumack, C.; Baker, E. T.; Langmuir, C. H.

    2004-12-01

    A central goal of the second Ridge2000 cruise (September-October 2004) to the Lau backarc basin in the southwest Pacific is to locate, map, and image new vent sites on the East Lau Spreading Center and the northern portion of the Valu Fa Ridge. Our primary tool for plume mapping and vent location is the Autonomous Benthic Explorer (ABE), including novel in situ chemical sensors (see abstracts by Yoerger et al. and German et al. in this session). In addition, we are using MAPRs (Miniature Autonomous Plume Recorders) to measure profiles of temperature and optical backscatter on dredge and rock core lowerings, and shipboard analysis of methane, hydrogen, pH, iron, and manganese from CTD casts, to locate and characterize the plumes. This presentation will focus on the profile data and chemical analyses, which we use to provide a preliminary comparison of chemical characteristics between vent fields.

  2. Detecting cell-adhesive sites in extracellular matrix using force spectroscopy mapping

    PubMed Central

    Chirasatitsin, Somyot; Engler, Adam J

    2010-01-01

    The cell microenvironment is composed of extracellular matrix (ECM), which contains specific binding sites that allow the cell to adhere to its surroundings. Cells employ focal adhesion proteins, which must be able to resist a variety of forces to bind to ECM. Current techniques for detecting the spatial arrangement of these adhesions, however, have limited resolution and those that detect adhesive forces lack sufficient spatial characterization or resolution. Using a unique application of force spectroscopy, we demonstrate here the ability to determine local changes in the adhesive property of a fibronectin substrate down to the resolution of the fibronectin antibody-functionalized tip diameter, ~20 nm. To verify the detection capabilities of force spectroscopy mapping (FSM), changes in loading rate and temperature were used to alter the bond dynamics and change the adhesion force. Microcontact printing was also used to pattern fluorescein isothiocyanate-conjugated fibronectin in order to mimic the discontinuous adhesion domains of native ECM. Fluorescent detection was used to identify the pattern while FSM was used to map cell adhesion sites in registry with the initial fluorescent image. The results show that FSM can be used to detect the adhesion domains at high resolution and may subsequently be applied to native ECM with randomly distributed cell adhesion sites. PMID:21152375

  3. Mapping of replication initiation sites in human ribosomal DNA by nascent-strand abundance analysis.

    PubMed Central

    Yoon, Y; Sanchez, J A; Brun, C; Huberman, J A

    1995-01-01

    New techniques for mapping mammalian DNA replication origins are needed. We have modified the existing nascent-strand size analysis technique (L. Vassilev and E.M. Johnson, Nucleic Acids Res. 17:7693-7705, 1989) to provide an independent means of studying replication initiation sites. We call the new method nascent-strand abundance analysis. We confirmed the validity of this method with replicating simian virus 40 DNA as a model. We then applied nascent-strand abundance and nascent-strand size analyses to mapping of initiation sites in human (HeLa) ribosomal DNA (rDNA), a region previously examined exclusively by two-dimensional gel electrophoresis methods (R.D. Little, T.H.K. Platt, and C.L. Schildkraut, Mol. Cell. Biol. 13:6600-6613, 1993). Our results partly confirm those obtained by two-dimensional gel electrophoresis techniques. Both studies suggest that replication initiates at relatively high frequency a few kilobase pairs upstream of the transcribed region and that many additional low-frequency initiation sites are distributed through most of the remainder of the ribosomal DNA repeat unit. PMID:7739533

  4. Depth-to-Ice Map of a Southern Mars Site Near Melea Planum

    NASA Technical Reports Server (NTRS)

    2007-01-01

    Color coding in this map of a far-southern site on Mars indicates the change in nighttime ground-surface temperature between summer and fall. This site, like most of high-latitude Mars, has water ice mixed with soil near the surface. The ice is probably in a rock-hard frozen layer beneath a few centimeters or inches of looser, dry soil. The amount of temperature change at the surface likely corresponds to how close to the surface the icy material lies.

    The dense, icy layer retains heat better than the looser soil above it, so where the icy layer is closer to the surface, the surface temperature changes more slowly than where the icy layer is buried deeper. On the map, areas of the surface that cooled more slowly between summer and autumn (interpreted as having the ice closer to the surface) are coded blue and green. Areas that cooled more quickly (interpreted as having more distance to the ice) are coded red and yellow.

    The depth to the top of the icy layer estimated from these observations suggests that in some areas, but not others, water is being exchanged by diffusion between atmospheric water vapor and subsurface water ice. Differences in what type of material lies above the ice appear to affect the depth to the ice. The area in this image with the greatest seasonal change in surface temperature corresponds to an area of sand dunes.

    This map and its interpretation are in a May 3, 2007, report in the journal Nature by Joshua Bandfield of Arizona State University, Tempe. The Thermal Emission Imaging System camera on NASA's Mars Odyssey orbiter collected the data presented in the map. The site is centered near 67 degrees south latitude, 36.5 degrees east longitude, near a plain named Melea Planum. This site is within the portion of the planet where, in 2002, the Gamma Ray Spectrometer suite of instruments on Mars Odyssey found evidence for water ice lying just below the surface. The information from the Gamma Ray Spectrometer is

  5. Depth-to-Ice Map of a Southern Mars Site Near Melea Planum

    NASA Technical Reports Server (NTRS)

    2007-01-01

    Color coding in this map of a far-southern site on Mars indicates the change in nighttime ground-surface temperature between summer and fall. This site, like most of high-latitude Mars, has water ice mixed with soil near the surface. The ice is probably in a rock-hard frozen layer beneath a few centimeters or inches of looser, dry soil. The amount of temperature change at the surface likely corresponds to how close to the surface the icy material lies.

    The dense, icy layer retains heat better than the looser soil above it, so where the icy layer is closer to the surface, the surface temperature changes more slowly than where the icy layer is buried deeper. On the map, areas of the surface that cooled more slowly between summer and autumn (interpreted as having the ice closer to the surface) are coded blue and green. Areas that cooled more quickly (interpreted as having more distance to the ice) are coded red and yellow.

    The depth to the top of the icy layer estimated from these observations suggests that in some areas, but not others, water is being exchanged by diffusion between atmospheric water vapor and subsurface water ice. Differences in what type of material lies above the ice appear to affect the depth to the ice. The area in this image with the greatest seasonal change in surface temperature corresponds to an area of sand dunes.

    This map and its interpretation are in a May 3, 2007, report in the journal Nature by Joshua Bandfield of Arizona State University, Tempe. The Thermal Emission Imaging System camera on NASA's Mars Odyssey orbiter collected the data presented in the map. The site is centered near 67 degrees south latitude, 36.5 degrees east longitude, near a plain named Melea Planum. This site is within the portion of the planet where, in 2002, the Gamma Ray Spectrometer suite of instruments on Mars Odyssey found evidence for water ice lying just below the surface. The information from the Gamma Ray Spectrometer is

  6. DNA cleavage site selection by Type III restriction enzymes provides evidence for head-on protein collisions following 1D bidirectional motion.

    PubMed

    Schwarz, Friedrich W; van Aelst, Kara; Tóth, Júlia; Seidel, Ralf; Szczelkun, Mark D

    2011-10-01

    DNA cleavage by the Type III Restriction-Modification enzymes requires communication in 1D between two distant indirectly-repeated recognitions sites, yet results in non-specific dsDNA cleavage close to only one of the two sites. To test a recently proposed ATP-triggered DNA sliding model, we addressed why one site is selected over another during cleavage. We examined the relative cleavage of a pair of identical sites on DNA substrates with different distances to a free or protein blocked end, and on a DNA substrate using different relative concentrations of protein. Under these conditions a bias can be induced in the cleavage of one site over the other. Monte-Carlo simulations based on the sliding model reproduce the experimentally observed behaviour. This suggests that cleavage site selection simply reflects the dynamics of the preceding stochastic enzyme events that are consistent with bidirectional motion in 1D and DNA cleavage following head-on protein collision.

  7. Seismic Hazard Maps for Seattle, Washington, Incorporating 3D Sedimentary Basin Effects, Nonlinear Site Response, and Rupture Directivity

    USGS Publications Warehouse

    Frankel, Arthur D.; Stephenson, William J.; Carver, David L.; Williams, Robert A.; Odum, Jack K.; Rhea, Susan

    2007-01-01

    This report presents probabilistic seismic hazard maps for Seattle, Washington, based on over 500 3D simulations of ground motions from scenario earthquakes. These maps include 3D sedimentary basin effects and rupture directivity. Nonlinear site response for soft-soil sites of fill and alluvium was also applied in the maps. The report describes the methodology for incorporating source and site dependent amplification factors into a probabilistic seismic hazard calculation. 3D simulations were conducted for the various earthquake sources that can affect Seattle: Seattle fault zone, Cascadia subduction zone, South Whidbey Island fault, and background shallow and deep earthquakes. The maps presented in this document used essentially the same set of faults and distributed-earthquake sources as in the 2002 national seismic hazard maps. The 3D velocity model utilized in the simulations was validated by modeling the amplitudes and waveforms of observed seismograms from five earthquakes in the region, including the 2001 M6.8 Nisqually earthquake. The probabilistic seismic hazard maps presented here depict 1 Hz response spectral accelerations with 10%, 5%, and 2% probabilities of exceedance in 50 years. The maps are based on determinations of seismic hazard for 7236 sites with a spacing of 280 m. The maps show that the most hazardous locations for this frequency band (around 1 Hz) are soft-soil sites (fill and alluvium) within the Seattle basin and along the inferred trace of the frontal fault of the Seattle fault zone. The next highest hazard is typically found for soft-soil sites in the Duwamish Valley south of the Seattle basin. In general, stiff-soil sites in the Seattle basin exhibit higher hazard than stiff-soil sites outside the basin. Sites with shallow bedrock outside the Seattle basin have the lowest estimated hazard for this frequency band.

  8. Subdivision of the Escherichia coli K-12 genome for sequencing: manipulation and DNA sequence of transposable elements introducing unique restriction sites.

    PubMed

    Mahillon, J; Kirkpatrick, H A; Kijenski, H L; Bloch, C A; Rode, C K; Mayhew, G F; Rose, D J; Plunkett, G; Burland, V; Blattner, F R

    1998-11-26

    A transposon-based method of introducing unique restriction sites was used for subdivision of the Escherichia coli genome into a contiguous series of large non-overlapping segments spanning 2.5Mb. The segments, sizes ranging from 150 to 250kb, were isolated from the chromosome using the inserted restriction sites and shotgun cloned into an M13 vector for DNA sequencing. These shotgun sizes proved easily manageable, allowing the genomic sequence of E. coli to be completed more efficiently and rapidly than was possible by previously available methods. The 9bp duplication generated during transposition was used as a tag for accurate splicing of the segments; no further sequence redundancy at the junction sites was needed. The system is applicable to larger genomes even if they are not already well-characterized. We present the technology for segment sequencing, results of applying this method to E. coli, and the sequences of the transposon cassettes.

  9. Success of the PCR-based replication assay depends on the number of methylation sensitive restriction sites in the PCR amplifying region.

    PubMed

    Metta, M K; Tantravahi, S; Kunaparaju, R

    2015-06-02

    The PCR—based replication assay is one of the most simple, quick and economical methods for the analysis of episomal replication. However, in spite of its advantages the method has not been able to replace the southern—based replication assay, the latter of which is a tedious and time—consuming process. This is due to the generation of spurious amplification products in the PCR—based replication assay. The replication assay is based on the use of methylation—sensitive restriction endonucleases (eg. DpnI, MboI) to distinguish bacterial replicated (adenosine methylated) and mammalian replicated plasmids (adenosine non—methylated). In this work we addressed the problem by evaluating (a) restriction enzyme digestion and (b) the minimum number of restriction sites that are required in the amplifying region. The efficiency of restriction digestion was tested by subjecting the plasmid to one and two rounds of digestion. Multiple rounds of digestions were found to be inefficient in preventing false positives when the number of DpnI sites in the amplifying region is less than 8. However, use of a minimum of 15 DpnI sites in the amplifying region was found to overcome the false positives.

  10. VS30 mapping and soil classification for seismic site effect evaluation in Dinar region, SW Turkey

    NASA Astrophysics Data System (ADS)

    Ismet Kanlı, Ali; Tildy, Péter; Prónay, Zsolt; Pınar, Ali; Hermann, László

    2006-04-01

    The Dinar earthquake (MS= 6.1) of 1995 October 1 killed 90 people and destroyed more than 4000 buildings. Despite the moderate size of the earthquake, the level of damage was extremely high, which led to many studies that were carried out in the region. The majority of these studies concluded that the main reasons for the damage were the construction errors and the poor soil conditions. However, at that time no appropriate soil condition map based on extended, high density measurements was available. Shear wave velocity is an important parameter for evaluating the dynamic behaviour of soil in the shallow subsurface. Thus site characterization in calculating seismic hazards is usually based on the near surface shear wave velocity values. The average shear wave velocity for the top 30 m of soil is referred to as VS30. For earthquake engineering design purposes, both the Uniform Building Code (UBC) and Eurocode 8 (EC8) codes use VS30 to classify sites according to the soil type. The Vs30 values calculated by using multichannel analysis of surface waves (MASW) were used to create a new soil classification map of the Dinar region. Surface seismic measurements were carried out at 50 locations mostly in Dinar city and its surroundings. The dispersion data of the recorded Rayleigh waves were inverted using a Genetic Algorithm (GA) method to obtain shear wave velocity profiles of the investigated sites. Thus the derived Vs30 map of the Dinar region was transformed to the UBC and EC8 standards. Soil classification results show that most parts of the region, located in alluvial basin, have low shear wave velocity values. These values are within the range of 160-240 m s-1 and thus fall into the SD and SE categories according to the UBC and the C and D categories according to EC8. Within the region, some parts located on the hill zone and the transition zone have better soil conditions [corresponding to SC (UBC) and B (EC8) categories] and have comparatively high shear wave

  11. High Efficiency Restriction Enzyme–Free Linear Amplification-Mediated Polymerase Chain Reaction Approach for Tracking Lentiviral Integration Sites Does Not Abrogate Retrieval Bias

    PubMed Central

    Wu, Chuanfeng; Jares, Alexander; Winkler, Thomas; Xie, Jianjun; Metais, Jean-Yves

    2013-01-01

    Abstract Retroviral vectors are an efficient and widely employed means of introducing an exogenous expression cassette into target cells. These vectors have been shown to integrate semi-randomly into the cellular genome, and can be associated with genotoxicity due to impact on expression of proximate genes. Therefore, efficient and accurate integration site analysis, while quantifying contributions of individual vector-containing clones, is desirable. Linear amplification-mediated polymerase chain reaction (LAM-PCR) is a widely used technique for identifying integrated proviral and host genomic DNA junctions. However, LAM-PCR is subject to selection bias inherent in the reliance of the assay on the presence of a restriction enzyme–cutting site adjacent to a retrievable integration site, and it is further limited by an inability to discriminate prior to sequencing between the flanking genomic DNA of interest and uninformative internal vector DNA. We report a modified restriction enzyme–free LAM-PCR (Re-free LAM-PCR) approach that is less time and labor intensive compared to conventional LAM-PCR, but in contrast to some other nonrestrictive methods, compares in efficiency and sensitivity, excludes retrieval of uninformative internal vector sequences, and allows retrieval of integration sites unbiased by the presence of nearby restriction sites. However, we report that Re-free LAM-PCR remains inaccurate for quantitation of the relative contributions of individual integration site–containing clones in a polyclonal setting, suggesting that bias in LAM-PCR retrieval of integration sites is not wholly explained by restriction enzyme–related factors. PMID:22992116

  12. A unique restriction site in the flaA gene allows rapid differentiation of group I and group II Clostridium botulinum strains by PCR-restriction fragment length polymorphism analysis.

    PubMed

    Paul, Catherine J; Tran, Shulin; Tam, Kevin J; Austin, John W

    2007-09-01

    Clostridium botulinum produces the potent botulinum neurotoxin, the causative agent of botulism. Based on distinctive physiological traits, strains of C. botulinum can be divided into four groups: however, only groups I and II are associated with human illness. Alignment of the flaA gene sequences from 40 group I and 40 group II strains identified a single BsrG1 restriction cut site that was present at base pair 283 in all group II flaA sequences and was not found in any group I sequence. The flaA gene was amplified by rapid colony PCR from 22 group I strains and 18 group II strains and digested with BsrGI restriction enzyme. Standard agarose gel electrophoresis with ethidium bromide staining showed two fragments, following restriction digestion of group II flaA gene amplicons with BsrGI, but only a single band of uncut flaA from group I strains. Combining rapid colony PCR with BsrGI restriction digest of the flaA gene at 60 degrees C is a significant improvement over current methods, such as meat digestion or amplified fragment length polymorphism, as a strain can be identified as either group I or group II in under 5 h when starting with a visible plated C. botulinum colony.

  13. Development of Historical Water Table Maps of the 200 West Area of the Hanford Site (1950-1970)

    SciTech Connect

    Kinney, Teena M.; McDonald, John P.

    2006-09-15

    A series of detailed historical water-table maps for the 200-West Area of the Hanford Site was made to aid interpretation of contaminant distribution in the upper aquifer. The contaminants are the result of disposal of large volumes of waste to the ground during Hanford Site operations, which began in 1944 and continued into the mid-1990s. Examination of the contaminant plumes that currently exist on site shows that the groundwater beneath the 200-West Area has deviated from its pre-Hanford west-to-east flow direction during the past 50 years. By using historical water-level measurements from wells around the 200-West Area, it was possible to create water-table contour maps that show probable historic flow directions. These maps are more detailed than previously published water-table maps that encompass the entire Hanford Site.

  14. Where to begin? Mapping transcription start sites genome-wide in Escherichia coli.

    PubMed

    Wade, Joseph T

    2015-01-01

    Recent genome-wide studies of bacterial transcription have revealed large numbers of promoters located inside genes. In this issue of the Journal of Bacteriology, Thomason and colleagues (J. Bacteriol. 197:18-28, 2015, doi:10.1128/JB.02096-14) map transcription start sites in Escherichia coli on an unprecedented scale. This work provides important insights into the regulation of transcripts that initiate inside genes and sources of variability between studies aimed at identifying these RNAs. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  15. The cleavage sites and localization of genes encoding the restriction endonucleases Eco1831I and EcoHI.

    PubMed

    Kravetz, A N; Zakharova, M V; Beletskaya, I V; Sineva, E V; Denjmuchametov, M M; Petrov, S I; Glatman, L I; Solonin, A S

    1993-07-15

    The restriction endonucleases Eco1831I and EcoHI cleave before the first 5'-cytosine in the recognition sequence 5'-decreases CCSGG--3'/3'--GGSCC increases-5' (where S = G or C), generate 5-base 5' cohesive ends, and are encoded by homologous plasmids that are restricted in McrA+ hosts. Thus, they differ in their cleavage specificity from that of the BcnI isoschizomer, which cleaves after the second 5' cytosine.

  16. Comprehensive polyadenylation site maps in yeast and human reveal pervasive alternative polyadenylation.

    PubMed

    Ozsolak, Fatih; Kapranov, Philipp; Foissac, Sylvain; Kim, Sang Woo; Fishilevich, Elane; Monaghan, A Paula; John, Bino; Milos, Patrice M

    2010-12-10

    The emerging discoveries on the link between polyadenylation and disease states underline the need to fully characterize genome-wide polyadenylation states. Here, we report comprehensive maps of global polyadenylation events in human and yeast generated using refinements to the Direct RNA Sequencing technology. This direct approach provides a quantitative view of genome-wide polyadenylation states in a strand-specific manner and requires only attomole RNA quantities. The polyadenylation profiles revealed an abundance of unannotated polyadenylation sites, alternative polyadenylation patterns, and regulatory element-associated poly(A)(+) RNAs. We observed differences in sequence composition surrounding canonical and noncanonical human polyadenylation sites, suggesting novel noncoding RNA-specific polyadenylation mechanisms in humans. Furthermore, we observed the correlation level between sense and antisense transcripts to depend on gene expression levels, supporting the view that overlapping transcription from opposite strands may play a regulatory role. Our data provide a comprehensive view of the polyadenylation state and overlapping transcription.

  17. Computer-aided mapping of stream channels beneath the Lawrence Livermore National Laboratory Super Fund Site

    SciTech Connect

    Sick, M.

    1994-12-01

    The Lawrence Livermore National Laboratory (LLNL) site rests upon 300-400 feet of highly heterogeneous braided stream sediments which have been contaminated by a plume of Volatile Organic Compounds (VOCs). The stream channels are filled with highly permeable coarse grained materials that provide quick avenues for contaminant transport. The plume of VOCs has migrated off site in the TFA area, making it the area of greatest concern. I mapped the paleo-stream channels in the TFA area using SLICE an LLNL Auto-CADD routine. SLICE constructed 2D cross sections and sub-horizontal views of chemical, geophysical, and lithologic data sets. I interpreted these 2D views as a braided stream environment, delineating the edges of stream channels. The interpretations were extracted from Auto-CADD and placed into Earth Vision`s 3D modeling and viewing routines. Several 3D correlations have been generated, but no model has yet been chosen as a best fit.

  18. Archaeological field survey automation: concurrent multisensor site mapping and automated analysis

    NASA Astrophysics Data System (ADS)

    Józefowicz, Mateusz; Sokolov, Oleksandr; Meszyński, Sebastian; Siemińska, Dominika; Kołosowski, Przemysław

    2016-04-01

    ABM SE develops mobile robots (rovers) used for analog research of Mars exploration missions. The rovers are all-terrain exploration platforms, carrying third-party payloads: scientific instrumentation. "Wisdom" ground penetrating radar for Exomars mission has been tested onboard, as well as electrical resistivity module and other devices. Robot has operated in various environments, such as Central European countryside, Dachstein ice caves or Sahara, Morocco (controlled remotely via satellite from Toruń, Poland. Currently ABM SE works on local and global positioning system for a Mars rover basing on image and IMU data. This is performed under a project from ESA. In the next Mars rover missions a Mars GIS model will be build, including an acquired GPR profile, DEM and regular image data, integrated into a concurrent 3D terrain model. It is proposed to use similar approach in surveys of archaeological sites, especially those, where solid architecture remains can be expected at shallow depths or being partially exposed. It is possible to deploy a rover that will concurrently map a selected site with GPR, 2D and 3D cameras to create a site model. The rover image processing algorithms are capable of automatic tracing of distinctive features (such as exposed structure remains on a desert ground, differences in color of the ground, etc.) and to mark regularities on a created map. It is also possible to correlate the 3D map with an aerial photo taken under any angle to achieve interpretation synergy. Currently the algorithms are an interpretation aid and their results must be confirmed by a human. The advantages of a rover over traditional approaches, such as a manual cart or a drone include: a) long hours of continuous work or work in unfavorable environment, such as high desert, frozen water pools or large areas, b) concurrent multisensory data acquisition, c) working from the ground level enables capturing of sites obstructed from the air (trees), d) it is possible to

  19. Discovery and Characterization of Non-ATP Site Inhibitors of the Mitogen Activated Protein (MAP) Kinases

    SciTech Connect

    Comess, Kenneth M.; Sun, Chaohong; Abad-Zapatero, Cele; Goedken, Eric R.; Gum, Rebecca J.; Borhani, David W.; Argiriadi, Maria; Groebe, Duncan R.; Jia, Yong; Clampit, Jill E.; Haasch, Deanna L.; Smith, Harriet T.; Wang, Sanyi; Song, Danying; Coen, Michael L.; Cloutier, Timothy E.; Tang, Hua; Cheng, Xueheng; Quinn, Christopher; Liu, Bo; Xin, Zhili; Liu, Gang; Fry, Elizabeth H.; Stoll, Vincent; Ng, Teresa I.; Banach, David; Marcotte, Doug; Burns, David J.; Calderwood, David J.; Hajduk, Philip J.

    2012-03-02

    Inhibition of protein kinases has validated therapeutic utility for cancer, with at least seven kinase inhibitor drugs on the market. Protein kinase inhibition also has significant potential for a variety of other diseases, including diabetes, pain, cognition, and chronic inflammatory and immunologic diseases. However, as the vast majority of current approaches to kinase inhibition target the highly conserved ATP-binding site, the use of kinase inhibitors in treating nononcology diseases may require great selectivity for the target kinase. As protein kinases are signal transducers that are involved in binding to a variety of other proteins, targeting alternative, less conserved sites on the protein may provide an avenue for greater selectivity. Here we report an affinity-based, high-throughput screening technique that allows nonbiased interrogation of small molecule libraries for binding to all exposed sites on a protein surface. This approach was used to screen both the c-Jun N-terminal protein kinase Jnk-1 (involved in insulin signaling) and p38{alpha} (involved in the formation of TNF{alpha} and other cytokines). In addition to canonical ATP-site ligands, compounds were identified that bind to novel allosteric sites. The nature, biological relevance, and mode of binding of these ligands were extensively characterized using two-dimensional {sup 1}H/{sup 13}C NMR spectroscopy, protein X-ray crystallography, surface plasmon resonance, and direct enzymatic activity and activation cascade assays. Jnk-1 and p38{alpha} both belong to the MAP kinase family, and the allosteric ligands for both targets bind similarly on a ledge of the protein surface exposed by the MAP insertion present in the CMGC family of protein kinases and distant from the active site. Medicinal chemistry studies resulted in an improved Jnk-1 ligand able to increase adiponectin secretion in human adipocytes and increase insulin-induced protein kinase PKB phosphorylation in human hepatocytes, in

  20. Discovery and characterization of non-ATP site inhibitors of the mitogen activated protein (MAP) kinases.

    PubMed

    Comess, Kenneth M; Sun, Chaohong; Abad-Zapatero, Cele; Goedken, Eric R; Gum, Rebecca J; Borhani, David W; Argiriadi, Maria; Groebe, Duncan R; Jia, Yong; Clampit, Jill E; Haasch, Deanna L; Smith, Harriet T; Wang, Sanyi; Song, Danying; Coen, Michael L; Cloutier, Timothy E; Tang, Hua; Cheng, Xueheng; Quinn, Christopher; Liu, Bo; Xin, Zhili; Liu, Gang; Fry, Elizabeth H; Stoll, Vincent; Ng, Teresa I; Banach, David; Marcotte, Doug; Burns, David J; Calderwood, David J; Hajduk, Philip J

    2011-03-18

    Inhibition of protein kinases has validated therapeutic utility for cancer, with at least seven kinase inhibitor drugs on the market. Protein kinase inhibition also has significant potential for a variety of other diseases, including diabetes, pain, cognition, and chronic inflammatory and immunologic diseases. However, as the vast majority of current approaches to kinase inhibition target the highly conserved ATP-binding site, the use of kinase inhibitors in treating nononcology diseases may require great selectivity for the target kinase. As protein kinases are signal transducers that are involved in binding to a variety of other proteins, targeting alternative, less conserved sites on the protein may provide an avenue for greater selectivity. Here we report an affinity-based, high-throughput screening technique that allows nonbiased interrogation of small molecule libraries for binding to all exposed sites on a protein surface. This approach was used to screen both the c-Jun N-terminal protein kinase Jnk-1 (involved in insulin signaling) and p38α (involved in the formation of TNFα and other cytokines). In addition to canonical ATP-site ligands, compounds were identified that bind to novel allosteric sites. The nature, biological relevance, and mode of binding of these ligands were extensively characterized using two-dimensional (1)H/(13)C NMR spectroscopy, protein X-ray crystallography, surface plasmon resonance, and direct enzymatic activity and activation cascade assays. Jnk-1 and p38α both belong to the MAP kinase family, and the allosteric ligands for both targets bind similarly on a ledge of the protein surface exposed by the MAP insertion present in the CMGC family of protein kinases and distant from the active site. Medicinal chemistry studies resulted in an improved Jnk-1 ligand able to increase adiponectin secretion in human adipocytes and increase insulin-induced protein kinase PKB phosphorylation in human hepatocytes, in similar fashion to Jnk-1 si

  1. 76 FR 30027 - Land Disposal Restrictions: Site-Specific Treatment Variance for Hazardous Selenium-Bearing Waste...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-24

    ... Selenium-Bearing Waste Treated by U.S. Ecology Nevada in Beatty, NV and Withdrawal of Site-Specific... site-specific treatment variance to U.S. Ecology Nevada in Beatty, Nevada and withdrew an existing site... variance to U.S. Ecology Nevada in Beatty, Nevada and withdrawing an existing site-specific treatment...

  2. Identification and mapping of natural vegetation on a coastal site using a Worldview-2 satellite image.

    PubMed

    Rapinel, Sébastien; Clément, Bernard; Magnanon, Sylvie; Sellin, Vanessa; Hubert-Moy, Laurence

    2014-11-01

    Identification and mapping of natural vegetation are major issues for biodiversity management and conservation. Remotely sensed data with very high spatial resolution are currently used to study vegetation, but most satellite sensors are limited to four spectral bands, which is insufficient to identify some natural vegetation formations. The study objectives are to discriminate natural vegetation and identify natural vegetation formations using a Worldview-2 satellite image. The classification of the Worldview-2 image and ancillary thematic data was performed using a hybrid pixel-based and object-oriented approach. A hierarchical scheme using three levels was implemented, from land cover at a field scale to vegetation formation. This method was applied on a 48 km² site located on the French Atlantic coast which includes a classified NATURA 2000 dune and marsh system. The classification accuracy was very high, the Kappa index varying between 0.90 and 0.74 at land cover and vegetation formation levels respectively. These results show that Wordlview-2 images are suitable to identify natural vegetation. Vegetation maps derived from Worldview-2 images are more detailed than existing ones. They provide a useful medium for environmental management of vulnerable areas. The approach used to map natural vegetation is reproducible for a wider application by environmental managers.

  3. An efficient targeted nuclease strategy for high-resolution mapping of DNA binding sites

    PubMed Central

    Skene, Peter J; Henikoff, Steven

    2017-01-01

    We describe Cleavage Under Targets and Release Using Nuclease (CUT&RUN), a chromatin profiling strategy in which antibody-targeted controlled cleavage by micrococcal nuclease releases specific protein-DNA complexes into the supernatant for paired-end DNA sequencing. Unlike Chromatin Immunoprecipitation (ChIP), which fragments and solubilizes total chromatin, CUT&RUN is performed in situ, allowing for both quantitative high-resolution chromatin mapping and probing of the local chromatin environment. When applied to yeast and human nuclei, CUT&RUN yielded precise transcription factor profiles while avoiding crosslinking and solubilization issues. CUT&RUN is simple to perform and is inherently robust, with extremely low backgrounds requiring only ~1/10th the sequencing depth as ChIP, making CUT&RUN especially cost-effective for transcription factor and chromatin profiling. When used in conjunction with native ChIP-seq and applied to human CTCF, CUT&RUN mapped directional long range contact sites at high resolution. We conclude that in situ mapping of protein-DNA interactions by CUT&RUN is an attractive alternative to ChIP-seq. DOI: http://dx.doi.org/10.7554/eLife.21856.001 PMID:28079019

  4. Mapping the Sea Floor of the Historic Area Remediation Site (HARS) Offshore of New York City

    USGS Publications Warehouse

    Butman, Bradford

    2002-01-01

    The area offshore of New York City has been used for the disposal of dredged material for over a century. The area has also been used for the disposal of other materials such as acid waste, industrial waste, municipal sewage sludge, cellar dirt, and wood. Between 1976 and 1995, the New York Bight Dredged Material Disposal Site, also known as the Mud Dump Site (MDS), received on average about 6 million cubic yards of dredged material annually. In September 1997 the MDS was closed as a disposal site, and it and the surrounding area were designated as the Historic Area Remediation Site (HARS). The sea floor of the HARS, approximately 9 square nautical miles in area, currently is being remediated by placing a minimum 1-m-thick cap of clean dredged material on top of the surficial sediments that are contaminated from previous disposal of dredged and other materials. The U.S. Geological Survey (USGS) is working cooperatively with the U.S. Army Corps of Engineers (USACE) to map the sea floor geology of the HARS and changes in the characteristics of the surficial sediments over time.

  5. Noninvasive Localization of Maximal Frequency Sites of Atrial Fibrillation by Body Surface Potential Mapping

    PubMed Central

    Guillem, Maria S.; Climent, Andreu M.; Millet, Jose; Arenal, Ángel; Fernández-Avilés, Francisco; Jalife, José; Atienza, Felipe; Berenfeld, Omer

    2014-01-01

    Background Ablation of high-frequency sources in patients with atrial fibrillation (AF) is an effective therapy to restore sinus rhythm. However, this strategy may be ineffective in patients without a significant dominant frequency (DF) gradient. The aim of this study was to investigate whether sites with high-frequency activity in human AF can be identified noninvasively, which should help intervention planning and therapy. Methods and Results In 14 patients with a history of AF, 67-lead body surface recordings were simultaneously registered with 15 endocardial electrograms from both atria including the highest DF site, which was predetermined by atrial-wide real-time frequency electroanatomical mapping. Power spectra of surface leads and the body surface location of the highest DF site were compared with intracardiac information. Highest DFs found on specific sites of the torso showed a significant correlation with DFs found in the nearest atrium (ρ=0.96 for right atrium and ρ=0.92 for left atrium) and the DF gradient between them (ρ=0.93). The spatial distribution of power on the surface showed an inverse relationship between the frequencies versus the power spread area, consistent with localized fast sources as the AF mechanism with fibrillatory conduction elsewhere. Conclusions Spectral analysis of body surface recordings during AF allows a noninvasive characterization of the global distribution of the atrial DFs and the identification of the atrium with the highest frequency, opening the possibility for improved noninvasive personalized diagnosis and treatment. PMID:23443619

  6. High throughput peptide mapping method for analysis of site specific monoclonal antibody oxidation.

    PubMed

    Li, Xiaojuan; Xu, Wei; Wang, Yi; Zhao, Jia; Liu, Yan-Hui; Richardson, Daisy; Li, Huijuan; Shameem, Mohammed; Yang, Xiaoyu

    2016-08-19

    Oxidation of therapeutic monoclonal antibodies (mAbs) often occurs on surface exposed methionine and tryptophan residues during their production in cell culture, purification, and storage, and can potentially impact the binding to their targets. Characterization of site specific oxidation is critical for antibody quality control. Antibody oxidation is commonly determined by peptide mapping/LC-MS methods, which normally require a long (up to 24h) digestion step. The prolonged sample preparation procedure could result in oxidation artifacts of susceptible methionine and tryptophan residues. In this paper, we developed a rapid and simple UV based peptide mapping method that incorporates an 8-min trypsin in-solution digestion protocol for analysis of oxidation. This method is able to determine oxidation levels at specific residues of a mAb based on the peptide UV traces within <1h, from either TBHP treated or UV light stressed samples. This is the simplest and fastest method reported thus far for site specific oxidation analysis, and can be applied for routine or high throughput analysis of mAb oxidation during various stability and degradation studies. By using the UV trace, the method allows more accurate measurement than mass spectrometry and can be potentially implemented as a release assay. It has been successfully used to monitor antibody oxidation in real time stability studies.

  7. Mapping of SPARC/BM-40/Osteonectin-binding Sites on Fibrillar Collagens*S⃞

    PubMed Central

    Giudici, Camilla; Raynal, Nicolas; Wiedemann, Hanna; Cabral, Wayne A.; Marini, Joan C.; Timpl, Rupert; Bächinger, Hans Peter; Farndale, Richard W.; Sasaki, Takako; Tenni, Ruggero

    2008-01-01

    The 33-kDa matrix protein SPARC (BM-40, osteonectin) binds several collagen types with moderate affinity. The collagen-binding site resides in helix αA of the extracellular calcium-binding domain of SPARC and is partially masked by helix αC. Previously, we found that the removal of helix αC caused a 10-fold increase in the affinity of SPARC for collagen, and we identified amino acids crucial for binding by site-directed mutagenesis. In this study, we used rotary shadowing, CNBr peptides, and synthetic peptides to map binding sites of SPARC onto collagens I, II, and III. Rotary shadowing and electron microscopy of SPARC-collagen complexes identified a major binding site ∼180 nm from the C terminus of collagen. SPARC binding was also detected with lower frequency near the matrix metalloproteinase cleavage site. These data fit well with our analysis of SPARC binding to CNBr peptides, denaturation of which abolished binding, indicating triple-helical conformation of collagen to be essential. SPARC binding was substantially decreased in two of seven α2(I) mutant procollagen I samples and after N-acetylation of Lys/Hyl side chains in wild-type collagen. Synthetic peptides of collagen III were used to locate the binding sites, and we found SPARC binding activity in a synthetic triple-helical peptide containing the sequence GPOGPSGPRGQOGVMGFOGPKGNDGAO (where O indicates 4-hydroxyproline), with affinity for SPARC comparable with that of procollagen III. This sequence is conserved among α chains of collagens I, II, III, and V. In vitro collagen fibrillogenesis was delayed in the presence of SPARC, suggesting that SPARC might modulate collagen fibril assembly in vivo. PMID:18487610

  8. Human uroporphyrinogen III synthase: NMR-based mapping of the active site.

    PubMed

    Cunha, Luis; Kuti, Miklos; Bishop, David F; Mezei, Mihaly; Zeng, Lei; Zhou, Ming-Ming; Desnick, Robert J

    2008-05-01

    Uroporphyrinogen III synthase (URO-synthase) catalyzes the cyclization and D-ring isomerization of hydroxymethylbilane (HMB) to uroporphyrinogen (URO'gen) III, the cyclic tetrapyrrole and physiologic precursor of heme, chlorophyl, and corrin. The deficient activity of human URO-synthase results in the autosomal recessive cutaneous disorder, congenital erythropoietic porphyria. Mapping of the structural determinants that specify catalysis and, potentially, protein-protein interactions is lacking. To map the active site and assess the enzyme's possible interaction in a complex with hydroxymethylbilane-synthase (HMB-synthase) and/or uroporphyrinogen-decarboxylase (URO-decarboxylase) by NMR, an efficient expression and purification procedure was developed for these cytosolic enzymes of heme biosynthesis that enabled preparation of special isotopically-labeled protein samples for NMR characterization. Using an 800 MHz instrument, assignment of the URO-synthase backbone (13)C(alpha) (100%), (1)H(alpha) (99.6%), and nonproline (1)H(N) and (15)N resonances (94%) was achieved as well as 85% of the side-chain (13)C and (1)H resonances. NMR analyses of URO-synthase titrated with competitive inhibitors N(D)-methyl-1-formylbilane (NMF-bilane) or URO'gen III, revealed resonance perturbations of specific residues lining the cleft between the two major domains of URO synthase that mapped the enzyme's active site. In silico docking of the URO-synthase crystal structure with NMF-bilane and URO'gen III was consistent with the perturbation results and provided a 3D model of the enzyme-inhibitor complex. The absence of chemical shift changes in the (15)N spectrum of URO-synthase mixed with the homogeneous HMB-synthase holoenzyme or URO-decarboxylase precluded occurrence of a stable cytosolic enzyme complex.

  9. Mapping shallow underground features that influence site-specific agricultural production

    NASA Astrophysics Data System (ADS)

    Freeland, Robert S.; Yoder, Ronald E.; Ammons, John T.

    1998-10-01

    Modern agricultural production practices are rapidly evolving in the United States of America (USA). These new production practices present significant applications for nonintrusive subsurface imaging. One such imaging technology is GPR, and it is now being incorporated within site-specific agriculture in the detection of soil horizons, perched water (episaturation), fragipans, hydrological preferential flow paths, and soil compaction. These features traditionally have been mapped by soil scientists using intrusive measurements (e.g., soil augers, soil pits, coring tools). Rather than developing a tool for soil mapping, our studies are targeting the identification, dimensioning, and position of subsurface features that directly influence agricultural productivity. It is foreseen that this information will allow for an increase in agricultural efficiency through infield machinery automation, and it will also greatly enhance development of highly efficient crop production strategies. The field sensing methodologies that we have developed using existing geophysical technologies are highly dependent upon both the soil and site characteristics due to seasonal variations. The GPR applications presented herein were conducted primarily in a region of loess soil that extends east of the Mississippi River into western Tennessee. GPR studies were also conducted in central Tennessee on the Cumberland Plateau within a region of shallow, sandy loam soils. Additional studies were conducted on the karst area of central Kentucky. Although targeting site-specific agriculture, our results and procedures may benefit the traditional users of GPR technology. We suggest that large-scale agricultural applications of the technology would be enhanced by integrating global positioning (GPS) technology in future hardware and software products.

  10. New polymorphic mtDNA restriction site in the 12S rRNA gene detected in Tunisian patients with non-syndromic hearing loss

    SciTech Connect

    Mkaouar-Rebai, Emna Tlili, Abdelaziz; Masmoudi, Saber; Charfeddine, Ilhem; Fakhfakh, Faiza

    2008-05-09

    The 12S rRNA gene was shown to be a hot spot for aminoglycoside-induced and non-syndromic hearing loss since several deafness-associated mtDNA mutations were identified in this gene. Among them, we distinguished the A1555G, the C1494T and the T1095C mutations and C-insertion or deletion at position 961. One hundred Tunisian patients with non-syndromic hearing loss and 100 hearing individuals were analysed in this study. A PCR-RFLP analysis with HaeIII restriction enzyme showed the presence of the A1555G mutation in the 12S rRNA gene in only one out of the 100 patients. In addition, PCR-RFLP and radioactive PCR revealed the presence of a new HaeIII polymorphic restriction site in the same gene of 12S rRNA site in 4 patients with non-syndromic hearing loss. UVIDOC-008-XD analyses showed the presence of this new polymorphic restriction site with a variable heteroplasmic rates at position +1517 of the human mitochondrial genome. On the other hand, direct sequencing of the entire mitochondrial 12S rRNA gene in the 100 patients and in 100 hearing individuals revealed the presence of the A750G and A1438G polymorphisms and the absence of the C1494T, T1095C and 961insC mutations in all the tested individuals. Sequencing of the whole mitochondrial genome in the 4 patients showing the new HaeIII polymorphic restriction site revealed only the presence of the A8860G transition in the MT-ATP6 gene and the A4769G polymorphism in the ND2 gene.

  11. Acoustic mapping of the regional seafloor geology in and around Hawaiian ocean dredged-material disposal sites

    USGS Publications Warehouse

    Torresan, Michael E.; Gardner, James V.

    2000-01-01

    During January and February 1998 the U.S. Geological Survey Coastal and Marine Geology Team (USGS) conducted regional high-resolution multibeam mapping surveys of the area surrounding EPA-designated ocean disposal sites located offshore of the Hawaiian Islands of Oahu, Kauai, Maui, and Hawaii. The sites are all located within 5 nautical miles of shore on insular shelves or slopes. Regional maps were required of areas much larger than the disposal sites themselves to assess both the regional seafloor geology and the immediate vicinity of the disposal sites. The purpose of the disposal site surveys was to delimit the extent of disposal material by producing detailed bathymetric and backscatter maps of the seafloor with a ± 1 m spatial accuracy and <1% depth error. The advantage of using multibeam over conventional towed, single-beam sidescan sonar is that the multibeam data are accurately georeferenced for precise location of all imaged features. The multibeam produces a coregistered acoustic-backscatter map that is often required to locate individual disposal deposits. These data were collected by the USGS as part of its regional seafloor mapping and in support of ocean disposal site monitoring studies conducted in cooperation with the US Environmental Protection Agency (EPA) and the US Army Corps of Engineers (COE).

  12. Quantitative analysis of anthropogenic relief features: automated mapping of charcoal kiln sites from high-resolution ALS data

    NASA Astrophysics Data System (ADS)

    Schneider, Anna; Takla, Melanie; Nicolay, Alexander; Raab, Alexandra; Raab, Thomas

    2014-05-01

    High-resolution digital elevation data from airborne laser scanning (ALS) allow for identification and mapping of so far unknown small-scale relief features that are hidden by forest cover. Especially as a result of historic land use, small anthropogenic landforms can occur, e.g., remains of charcoal kilns on sites that were used for charcoal production or ridge and furrow systems in former farmland areas. Mapping such relief features and analyzing their spatial distribution patterns can help to understand past land-use systems and their effects on landscapes. To efficiently detect and quantify small-scale relief features from high-resolution DEMs for larger areas, (semi-) automated mapping routines are required. In order to describe the number and spatial distribution of historic charcoal kiln sites in the area around Cottbus, Germany, we developed a GIS-based routine for the detection and mapping of kiln remnants from ALS elevation models with a resolution of 1 or 2 meters. The method is based on a template matching algorithm, using a combination of morphometric parameters, and is implemented within ArcGIS. The mapping results could be validated against a comprehensive database of kiln sites and diameters recorded from archaeological excavations in the forefield of the opencast mine Jänschwalde and from manual digitization of kiln remnants from Shaded Relief maps for the Jänschwalder Heide and the Tauersche Forst, north of Cottbus. A considerably high number of charcoal kiln sites could be detected in ALS data, and the diameters of the identified charcoal kilns are remarkable large in the area. For the Jänschwalder Heide, more than 5000 kiln sites in an area of 32 km2 were detected by manual digitization, with 1355 kiln sites that are wider than 12 m. These relatively large kiln sites could be mapped with detection rates that are close to those of manual digitization using the automated mapping routine. Detection quality was improved by the combination of

  13. Appliation of rad-sequencing to linkage mapping in citrus

    USDA-ARS?s Scientific Manuscript database

    High density linkage maps can be developed for modest cost using high-throughput DNA sequencing to genotype a defined fraction (representation) of the genome. We developed linkage maps in two citrus populations using the RAD (Restriction site Associated DNA) genotyping method which involves restrict...

  14. Genome-wide mapping of ZNF652 promoter binding sites in breast cancer cells.

    PubMed

    Kumar, Raman; Selth, Luke A; Schulz, Renee B; Tay, Bee Suan; Neilsen, Paul M; Callen, David F

    2011-10-01

    A significant proportion of transcription factors encoded by the human genome are classical C(2) H(2) zinc finger proteins that regulate gene expression by directly interacting with their cognate DNA binding motifs. We previously showed that one such C(2) H(2) zinc finger DNA binding protein, ZNF652 (zinc finger protein 652), specifically and functionally interacts with CBFA2T3 to repress transcription of genes involved in breast oncogenesis. To identify potential targets by which ZNF652 exerts its putative tumour suppressive function, its promoter-specific cistrome was mapped by ChIP-chip. De novo motif scanning of the ZNF652 binding sites identified a novel ZNF652 recognition motif that closely resembles the previously characterised in vitro binding site, being a 10 nucleotide core of that 13 nucleotide sequence. Genes with ZNF652 binding sites function in diverse cellular pathways, and many are involved in cancer development and progression. Characterisation of the in vivo ZNF652 DNA binding motif and identification of potential ZNF652 target genes are key steps towards elucidating the function(s) of this transcription factor in the normal and malignant breast cell.

  15. Mapping cocaine binding sites in human and baboon brain in vivo.

    PubMed

    Fowler, J S; Volkow, N D; Wolf, A P; Dewey, S L; Schlyer, D J; Macgregor, R R; Hitzemann, R; Logan, J; Bendriem, B; Gatley, S J

    1989-01-01

    The first direct measurements of cocaine binding in the brain of normal human volunteers and baboons have been made by using positron emission tomography (PET) and tracer doses of [N-11C-methyl]-(-)-cocaine ([11C]cocaine). Cocaine's binding and release from brain are rapid with the highest regional uptake of carbon-11 occurring in the corpus striatum at 4-10 minutes after intravenous injection of labeled cocaine. This was followed by a clearance to half the peak value at about 25 minutes with the overall time course paralleling the previously documented time course of the euphoria experienced after intravenous cocaine administration. Blockade of the dopamine reuptake sites with nomifensine reduced the striatal but not the cerebellar uptake of [11C]cocaine in baboons indicating that cocaine binding is associated with the dopamine reuptake site in the corpus striatum. A comparison of labeled metabolites of cocaine in human and baboon plasma showed that while cocaine is rapidly metabolized in both species, the profile of labeled metabolites is different, with baboon plasma containing significant amounts of labeled carbon dioxide, and human plasma containing no significant labeled carbon dioxide. These studies demonstrate the feasibility of using [11C]cocaine and PET to map binding sites for cocaine in human brain, to monitor its kinetics, and to characterize its binding mechanism by using appropriate pharmacological challenges.

  16. Mapping the heparin-binding site on the 13-14F3 fragment of fibronectin.

    PubMed

    Sachchidanand; Lequin, Olivier; Staunton, David; Mulloy, Barbara; Forster, Mark J; Yoshida, Keiichi; Campbell, Iain D

    2002-12-27

    Fibronectin, a multifunctional glycoprotein of the extracellular matrix, plays a major role in cell adhesion. Various studies have revealed that the human 13th and 14th fibronectin type III domains (labeled (13)F3 and (14)F3 here) contain a heparin-binding site. Mapping of the heparin-binding sites of (13-14)F3, (13)F3, and (14)F3 by NMR chemical shift perturbation, isothermal titration calorimetry, and molecular modeling show that (13)F3 provides the dominant heparin-binding site and that the residues involved are within the first 29 amino acids of (13)F3. Predictions from earlier biochemical and modeling studies as well as the x-ray structure of (12-14)F3 were tested. It was shown that the positively charged residues that project into the solvent from the ABE face of the triple-stranded beta sheet on (13)F3 are involved in binding, but (14)F3 does not appear to contribute significantly to heparin binding.

  17. Concept Mapping as a Support for Mars Landing-Site Selection

    NASA Technical Reports Server (NTRS)

    Cabrol, Nathalie A.; Briggs, Geoffrey A.

    1999-01-01

    The NASA Ames' Center for Mars Exploration (CMEX) serves to coordinate Mars programmatic research at ARC in the sciences, in information technology and in aero-assist and other technologies. Most recently, CMEX has been working with the Institute for Human and Machine Cognition at the University of West Florida to develop a new kind of web browser based on the application of concept maps. These Cmaps, which are demonstrably effective in science teaching, can be used to provide a new kind of information navigation tool that can make web or CD based information more meaningful and more easily navigable. CMEX expects that its 1999 CD-ROM will have this new user interface. CMEX is also engaged with the Mars Surveyor Project Office at JPL in developing an Internet-based source of materials to support the process of selecting landing sites for the next series of Mars landers. This activity -- identifying the most promising sites from which to return samples relevant to the search for evidence of life -- is one that is expected to engage the general public as well as the science community. To make the landing site data easily accessible and meaningful to the public, CMEX is planning to use the IHMC Cmap browser as its user interface.

  18. 77 FR 50622 - Land Disposal Restrictions: Site-Specific Treatment Variance for Hazardous Selenium-Bearing Waste...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-22

    ... Selenium-Bearing Waste Treated by U.S. Ecology Nevada in Beatty, NV AGENCY: Environmental Protection Agency..., under the Land Disposal Restrictions program, to U.S. Ecology Nevada in Beatty, Nevada for the treatment... applies only to U.S. Ecology Nevada located in Beatty, Nevada. B. Table of Contents I. Background ] A...

  19. Detection and Validation of QTL Affecting Bacterial Cold Water Disease Resistance in Rainbow Trout Using Restriction-Site Associated DNA Sequencing

    PubMed Central

    Gao, Guangtu; Liu, Sixin; Hernandez, Alvaro G.; Rexroad, Caird E.

    2015-01-01

    Bacterial cold water disease (BCWD) causes significant economic loss in salmonid aquaculture. Using microsatellite markers in a genome scan, we previously detected significant and suggestive QTL affecting phenotypic variation in survival following challenge with Flavobacterium psychrophilum, the causative agent of BCWD in rainbow trout. In this study, we performed selective genotyping of SNPs from restriction-site associated DNA (RAD) sequence data from two pedigreed families (2009070 and 2009196) to validate the major QTL from the previous work and to detect new QTL. The use of RAD SNPs in the genome scans increased the number of mapped markers from ~300 to ~5,000 per family. The significant QTL detected in the microsatellites scan on chromosome Omy8 in family 2009070 was validated explaining up to 58% of the phenotypic variance in that family, and in addition, a second QTL was also detected on Omy8. Two novel QTL on Omy11 and 14 were also detected, and the previously suggestive QTL on Omy1, 7 and 25 were also validated in family 2009070. In family 2009196, the microsatellite significant QTL on Omy6 and 12 were validated and a new QTL on Omy8 was detected, but none of the previously detected suggestive QTL were validated. The two Omy8 QTL from family 2009070 and the Omy12 QTL from family 2009196 were found to be co-localized with handling and confinement stress response QTL that our group has previously identified in a separate pedigreed family. With the currently available data we cannot determine if the co-localized QTL are the result of genes with pleiotropic effects or a mere physical proximity on the same chromosome segment. The genetic markers linked to BCWD resistance QTL were used to query the scaffolds of the rainbow trout reference genome assembly and the QTL-positive scaffold sequences were found to include 100 positional candidate genes. Several of the candidate genes located on or near the two Omy8 QTL detected in family 2009070 suggest potential

  20. Sequence-specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study.

    PubMed

    Kittler, L; Baguley, B C; Löber, G; Waring, M J

    1999-01-01

    A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis-diammine platinum(II)-bridged bis-netropsin, cis-diammine platinum(II)-bridged bis-distamycin and bis-glycine-linked bis-distamycin were investigated for sequence-specific interactions. The oligonucleotides used were the 154 base pair HindIII-RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI-PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134-1139 (5'AATCTT3'), 1152-1156 (5'ATATT3') and 1178-1194 (5'TTTCAATCTTTTTATTT3') for the former and 720-726 (5'TATTCTT3'), 751-771 (5'AATTGTATAATAAATTTAAAA3') and 781-785 (5'TATTT3') for the latter. The AT-preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (Ka) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 approximately SN 6570>platinum-bridged netropsin or distamycin approximately bis-glycine-bridged distamycin and was found independently of the binding sites examined. GC-base pairs interspersed in short AT-tracts reduced the Ka-values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT-stretches has been discussed.

  1. CLIP-seq analysis of multi-mapped reads discovers novel functional RNA regulatory sites in the human transcriptome.

    PubMed

    Zhang, Zijun; Xing, Yi

    2017-09-19

    Crosslinking or RNA immunoprecipitation followed by sequencing (CLIP-seq or RIP-seq) allows transcriptome-wide discovery of RNA regulatory sites. As CLIP-seq/RIP-seq reads are short, existing computational tools focus on uniquely mapped reads, while reads mapped to multiple loci are discarded. We present CLAM (CLIP-seq Analysis of Multi-mapped reads). CLAM uses an expectation-maximization algorithm to assign multi-mapped reads and calls peaks combining uniquely and multi-mapped reads. To demonstrate the utility of CLAM, we applied it to a wide range of public CLIP-seq/RIP-seq datasets involving numerous splicing factors, microRNAs and m6A RNA methylation. CLAM recovered a large number of novel RNA regulatory sites inaccessible by uniquely mapped reads. The functional significance of these sites was demonstrated by consensus motif patterns and association with alternative splicing (splicing factors), transcript abundance (AGO2) and mRNA half-life (m6A). CLAM provides a useful tool to discover novel protein-RNA interactions and RNA modification sites from CLIP-seq and RIP-seq data, and reveals the significant contribution of repetitive elements to the RNA regulatory landscape of the human transcriptome. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Digital Geologic Map of the Nevada Test Site and Vicinity, Nye, Lincoln, and Clark Counties, Nevada, and Inyo County, California

    USGS Publications Warehouse

    Slate, Janet L.; Berry, Margaret E.; Rowley, Peter D.; Fridrich, Christopher J.; Morgan, Karen S.; Workman, Jeremiah B.; Young, Owen D.; Dixon, Gary L.; Williams, Van S.; McKee, Edwin H.; Ponce, David A.; Hildenbrand, Thomas G.; Swadley, W.C.; Lundstrom, Scott C.; Ekren, E. Bartlett; Warren, Richard G.; Cole, James C.; Fleck, Robert J.; Lanphere, Marvin A.; Sawyer, David A.; Minor, Scott A.; Grunwald, Daniel J.; Laczniak, Randell J.; Menges, Christopher M.; Yount, James C.; Jayko, Angela S.

    1999-01-01

    This digital geologic map of the Nevada Test Site (NTS) and vicinity, as well as its accompanying digital geophysical maps, are compiled at 1:100,000 scale. The map compilation presents new polygon (geologic map unit contacts), line (fault, fold axis, metamorphic isograd, dike, and caldera wall) and point (structural attitude) vector data for the NTS and vicinity, Nye, Lincoln, and Clark Counties, Nevada, and Inyo County, California. The map area covers two 30 x 60-minute quadrangles-the Pahute Mesa quadrangle to the north and the Beatty quadrangle to the south-plus a strip of 7.5-minute quadrangles on the east side-72 quadrangles in all. In addition to the NTS, the map area includes the rest of the southwest Nevada volcanic field, part of the Walker Lane, most of the Amargosa Desert, part of the Funeral and Grapevine Mountains, some of Death Valley, and the northern Spring Mountains. This geologic map improves on previous geologic mapping of the same area (Wahl and others, 1997) by providing new and updated Quaternary and bedrock geology, new geophysical interpretations of faults beneath the basins, and improved GIS coverages. Concurrent publications to this one include a new isostatic gravity map (Ponce and others, 1999) and a new aeromagnetic map (Ponce, 1999).

  3. Keyword and Event Extraction for Thematic Map Retrieval from Indonesian Online News Site

    NASA Astrophysics Data System (ADS)

    Dewandaru, A.; Supriana, I.; Akbar, S.

    2017-01-01

    Online news sites provide great deal of information that may be extracted and mined to create Geographical Information Retrieval (GIR) system that provides thematic map based on user query. The task requires extracting generic events and its attributes from the news corpus. This event extraction requires the keywords and topics that can help increase the accuracy of the extraction and retrieval process. We prepare a large online news corpus and compared the Latent Dirichlet Allocation (LDA) and CBOW and skip-gram model to help providing base thematic keywords which can assist the extraction process on the intended GIR system. LDA is better in terms of semantic relatedness and the CBOW and skip-gram is useful for providing semantic similarity.

  4. Using Hadoop File System and MapReduce in a small/medium Grid site

    NASA Astrophysics Data System (ADS)

    Riahi, H.; Donvito, G.; Fanò, L.; Fasi, M.; Marzulli, G.; Spiga, D.; Valentini, A.

    2012-12-01

    Data storage and data access represent the key of CPU-intensive and data-intensive high performance Grid computing. Hadoop is an open-source data processing framework that includes fault-tolerant and scalable distributed data processing model and execution environment, named MapReduce, and distributed File System, named Hadoop distributed File System (HDFS). HDFS was deployed and tested within the Open Science Grid (OSG) middleware stack. Efforts have been taken to integrate HDFS with gLite middleware. We have tested the File System thoroughly in order to understand its scalability and fault-tolerance while dealing with small/medium site environment constraints. To benefit entirely from this File System, we made it working in conjunction with Hadoop Job scheduler to optimize the executions of the local physics analysis workflows. The performance of the analysis jobs which used such architecture seems to be promising, making it useful to follow up in the future.

  5. Site-specific Probabilistic Seismic Hazard Map of Himachal Pradesh, India. Part II. Hazard Estimation

    NASA Astrophysics Data System (ADS)

    Muthuganeisan, Prabhu; Raghukanth, S. T. G.

    2016-08-01

    This article presents site-specific probable seismic hazard of the Himachal Pradesh province, situated in a seismically active region of northwest Himalaya, using the ground motion relations presented in a companion article. Seismic recurrence parameters for all the documented probable sources are established from an updated earthquake catalogue. The contour maps of probable spectral acceleration at 0, 0.2, and 1 s (5% damping) are presented for 475 and 2475 years return periods. Also, the hazard curves and uniform hazard response spectrums are presented for all the important cities in this province. Results indicate that the present codal provision underestimates the seismic hazard at cities of Bilaspur, Shimla, Hamirpur, Chamba, Mandi, and Solan. In addition, regions near Bilaspur and Chamba exhibit higher hazard levels than what is reported in literature.

  6. Global transcriptional start site mapping in Geobacter sulfurreducens during growth with two different electron acceptors.

    PubMed

    González, Getzabeth; Labastida, Aurora; Jímenez-Jacinto, Verónica; Vega-Alvarado, Leticia; Olvera, Maricela; Morett, Enrique; Juárez, Katy

    2016-09-01

    Geobacter sulfurreducens is an anaerobic soil bacterium that is involved in biogeochemical cycles of elements such as Fe and Mn. Although significant progress has been made in the understanding of the electron transfer processes in G. sulfurreducens, little is known about the regulatory mechanisms involved in their control. To expand the study of gene regulation in G. sulfurreducens, we carried out a genome-wide identification of transcription start sites (TSS) by 5'RACE and by deep RNA sequencing of primary mRNAs in two growth conditions. TSSs were identified along G. sulfurreducens genome and over 50% of them were located in the upstream region of the associated gene, and in some cases we detected genes with more than one TSS. Our global mapping of TSSs contributes with valuable information, which is needed for the study of transcript structure and transcription regulation signals and can ultimately contribute to the understanding of transcription initiation phenomena in G. sulfurreducens.

  7. Geologic map of the Mine Mountain area, Nevada Test Site, southern Nevada

    SciTech Connect

    Cashman, P.H.; Cole, J.C.

    1998-10-05

    The Mine Mountain area is a small range of hills on the west side of the central Yucca Flat basin on the Nevada Test Site, Nye County, Nevada. This map portrays the very complex relationships among the pre-Tertiary stratigraphic units of the region. Rocks and structures of the Mine Mountain area record the compounded effects of: (1) eastward-directed, foreland-vergent thrusting; (2) younger folds and thrusts formed by hinterland vergence in a general westerly direction; and (3) low-angle normal faulting formed by extension along a northeast-southwest trend. All of these structures are older than the oldest middle Miocene volcanic rocks that were deposited on the flanks of the Mine Mountain terrane. High-angle faults that post-date these volcanic rocks locally show displacements of several hundred meters, but do not strongly affect patterns in the pre-Tertiary rocks.

  8. Spacecraft Orbit Design in the Circular Restricted Three-Body Problem Using Higher-Dimensional Poincare Maps

    DTIC Science & Technology

    2013-12-01

    Uranus -Titania CR3BP model parameters .................................................... 166  Table 4.2 S/C osculating orbital elements one month...276  Figure 5.40 STK® 3-D view of the five major moons of Uranus in higher-fidelity model at capture maneuver epoch... Uranus -Titania systems. Included in the approach is a method for representing, interpreting, and manipulating four-dimensional Poincaré maps in an

  9. Mapping of noise impact provoked by the execution of foundation piles at high rise building sites.

    PubMed

    de Araújo, Adolpho Guido; Gusmão, Alexandre Duarte; Rabbani, Emilia Rahnemay Kohman; Fucale, Stela Paulino

    2012-01-01

    The objective of this work is to map, in a limited area inside and outside of the worksite, the environmental impact generated by sound pollution coming from the driving of foundation piles for high rise buildings, as well as to observe and check if the noise levels produced by the emitting source are tolerable in the urban environment. The methodology of the work includes a survey of technical references about the subject; measurement of noises surrounding the worksite during the foundation phase for four distinct buildings, with different types of piles: prefabricated piles, continuous helical displacement piles , traditional compaction piles and Terra Probe compaction piles. A grid of points was built due to the time of driving and after that the measurements of environmental noises were performed emitted by the execution of each type of pile using a sound level meter. The interpretation of the measurements and their impacts on the neighborhood of the building were performed using the computational tool Suffer for creating noise level contours. The X and Y axes of the grid represent the distances in meters of the area studied and the Z axis represents the noise measured in dB. The contours developed represent the mapping of the noise at the worksites and their surroundings. The mapping of the urban impact of noise, the measurement of its dimensions, and the examination of its propagation around the building are important subsides to adequate individual and collective protection procedures. Seventy one points were measured at four building sites with different types of piles, and the results showed that at only three points was the noise within the limits of the Municipal Law of Recife of 70 dB, which proves the relevance of the research. Finally, the comparative analysis between the four types of piles shows that the continuous helical displacement pile emits the lowest noise level among the four pile types studied.

  10. Site-conditions map for Portugal based on VS measurements: methodology and final model

    NASA Astrophysics Data System (ADS)

    Vilanova, Susana; Narciso, João; Carvalho, João; Lopes, Isabel; Quinta Ferreira, Mario; Moura, Rui; Borges, José; Nemser, Eliza; Pinto, carlos

    2017-04-01

    In this paper we present a statistically significant site-condition model for Portugal based on shear-wave velocity (VS) data and surface geology. We also evaluate the performance of commonly used Vs30 proxies based on exogenous data and analyze the implications of using those proxies for calculating site amplification in seismic hazard assessment. The dataset contains 161 Vs profiles acquired in Portugal in the context of research projects, technical reports, academic thesis and academic papers. The methodologies involved in characterizing the Vs structure at the sites in the database include seismic refraction, multichannel analysis of seismic waves and refraction microtremor. Invasive measurements were performed in selected locations in order to compare the Vs profiles obtained from both invasive and non-invasive techniques. In general there was good agreement in the subsurface structure of Vs30 obtained from the different methodologies. The database flat-file includes information on Vs30, surface geology at 1:50.000 and 1:500.000 scales, elevation and topographic slope and based on SRTM30 topographic dataset. The procedure used to develop the site-conditions map is based on a three-step process that includes defining a preliminary set of geological units based on the literature, performing statistical tests to assess whether or not the differences in the distributions of Vs30 are statistically significant, and merging of the geological units accordingly. The dataset was, to some extent, affected by clustering and/or preferential sampling and therefore a declustering algorithm was applied. The final model includes three geological units: 1) Igneous, metamorphic and old (Paleogene and Mesozoic) sedimentary rocks; 2) Neogene and Pleistocene formations, and 3) Holocene formations. The evaluation of proxies indicates that although geological analogues and topographic slope are in general unbiased, the latter shows significant bias for particular geological units and

  11. Landing Site Selection and Surface Traverse Planning using the Lunar Mapping & Modeling Portal

    NASA Astrophysics Data System (ADS)

    Law, E.; Chang, G.; Bui, B.; Sadaqathullah, S.; Kim, R.; Dodge, K.; Malhotra, S.

    2013-12-01

    Introduction: The Lunar Mapping and Modeling Portal (LMMP), is a web-based Portal and a suite of interactive visualization and analysis tools for users to access mapped lunar data products (including image mosaics, digital elevation models, etc.) from past and current lunar missions (e.g., Lunar Reconnaissance Orbiter, Apollo, etc.), and to perform in-depth analyses to support lunar surface mission planning and system design for future lunar exploration and science missions. It has been widely used by many scientists mission planners, as well as educators and public outreach (e.g., Google Lunar XPRICE teams, RESOLVE project, museums etc.) This year, LMMP was used by the Lunar and Planetary Institute (LPI)'s Lunar Exploration internship program to perform lighting analysis and local hazard assessments, such as, slope, surface roughness and crater/boulder distribution to research landing sites and surface pathfinding and traversal. Our talk will include an overview of LMMP, a demonstration of the tools as well as a summary of the LPI Lunar Exploration summer interns' experience in using those tools.

  12. DNA Mapping Using Microfluidic Stretching and Single-Molecule Detection of Fluorescent Site-Specific Tags

    PubMed Central

    Chan, Eugene Y.; Goncalves, Nuno M.; Haeusler, Rebecca A.; Hatch, Amie J.; Larson, Jonathan W.; Maletta, Anthony M.; Yantz, Gregory R.; Carstea, Eugene D.; Fuchs, Martin; Wong, Gordon G.; Gullans, Steven R.; Gilmanshin, Rudolf

    2004-01-01

    We have developed a rapid molecular mapping technology—Direct Linear Analysis (DLA)—on the basis of the analysis of individual DNA molecules bound with sequence-specific fluorescent tags. The apparatus includes a microfluidic device for stretching DNA molecules in elongational flow that is coupled to a multicolor detection system capable of single-fluorophore sensitivity. Double-stranded DNA molecules were tagged at sequence-specific motif sites with fluorescent bisPNA (Peptide Nucleic Acid) tags. The DNA molecules were then stretched in the microfluidic device and driven in a flow stream past confocal fluorescence detectors. DLA provided the spatial locations of multiple specific sequence motifs along individual DNA molecules, and thousands of individual molecules could be analyzed per minute. We validated this technology using the 48.5 kb λ phage genome with different 8-base and 7-base sequence motif tags. The distance between the sequence motifs was determined with an accuracy of ±0.8 kb, and these tags could be localized on the DNA with an accuracy of ±2 kb. Thus, DLA is a rapid mapping technology, suitable for analysis of long DNA molecules. PMID:15173119

  13. An experimentally anchored map of transcriptional start sites in the model cyanobacterium Synechocystis sp. PCC6803

    PubMed Central

    Mitschke, Jan; Georg, Jens; Scholz, Ingeborg; Sharma, Cynthia M.; Dienst, Dennis; Bantscheff, Jens; Voß, Björn; Steglich, Claudia; Wilde, Annegret; Vogel, Jörg; Hess, Wolfgang R.

    2011-01-01

    There has been an increasing interest in cyanobacteria because these photosynthetic organisms convert solar energy into biomass and because of their potential for the production of biofuels. However, the exploitation of cyanobacteria for bioengineering requires knowledge of their transcriptional organization. Using differential RNA sequencing, we have established a genome-wide map of 3,527 transcriptional start sites (TSS) of the model organism Synechocystis sp. PCC6803. One-third of all TSS were located upstream of an annotated gene; another third were on the reverse complementary strand of 866 genes, suggesting massive antisense transcription. Orphan TSS located in intergenic regions led us to predict 314 noncoding RNAs (ncRNAs). Complementary microarray-based RNA profiling verified a high number of noncoding transcripts and identified strong ncRNA regulations. Thus, ∼64% of all TSS give rise to antisense or ncRNAs in a genome that is to 87% protein coding. Our data enhance the information on promoters by a factor of 40, suggest the existence of additional small peptide-encoding mRNAs, and provide corrected 5′ annotations for many genes of this cyanobacterium. The global TSS map will facilitate the use of Synechocystis sp. PCC6803 as a model organism for further research on photosynthesis and energy research. PMID:21245330

  14. Mapping genome-wide transcription-factor binding sites using DAP-seq.

    PubMed

    Bartlett, Anna; O'Malley, Ronan C; Huang, Shao-Shan Carol; Galli, Mary; Nery, Joseph R; Gallavotti, Andrea; Ecker, Joseph R

    2017-08-01

    To enable low-cost, high-throughput generation of cistrome and epicistrome maps for any organism, we developed DNA affinity purification sequencing (DAP-seq), a transcription factor (TF)-binding site (TFBS) discovery assay that couples affinity-purified TFs with next-generation sequencing of a genomic DNA library. The method is fast, inexpensive, and more easily scaled than chromatin immunoprecipitation sequencing (ChIP-seq). DNA libraries are constructed using native genomic DNA from any source of interest, preserving cell- and tissue-specific chemical modifications that are known to affect TF binding (such as DNA methylation) and providing increased specificity as compared with in silico predictions based on motifs from methods such as protein-binding microarrays (PBMs) and systematic evolution of ligands by exponential enrichment (SELEX). The resulting DNA library is incubated with an affinity-tagged in vitro-expressed TF, and TF-DNA complexes are purified using magnetic separation of the affinity tag. Bound genomic DNA is eluted from the TF and sequenced using next-generation sequencing. Sequence reads are mapped to a reference genome, identifying genome-wide binding locations for each TF assayed, from which sequence motifs can then be derived. A researcher with molecular biology experience should be able to follow this protocol, processing up to 400 samples per week.

  15. Experimental and computational active site mapping as a starting point to fragment-based lead discovery.

    PubMed

    Behnen, Jürgen; Köster, Helene; Neudert, Gerd; Craan, Tobias; Heine, Andreas; Klebe, Gerhard

    2012-02-06

    Small highly soluble probe molecules such as aniline, urea, N-methylurea, 2-bromoacetate, 1,2-propanediol, nitrous oxide, benzamidine, and phenol were soaked into crystals of various proteins to map their binding pockets and to detect hot spots of binding with respect to hydrophobic and hydrophilic properties. The selected probe molecules were first tested at the zinc protease thermolysin. They were then applied to a wider range of proteins such as protein kinase A, D-xylose isomerase, 4-diphosphocytidyl-2C-methyl-D-erythritol synthase, endothiapepsin, and secreted aspartic protease 2. The crystal structures obtained clearly show that the probe molecules populate the protein binding pockets in an ordered fashion. The thus characterized, experimentally observed hot spots of binding were subjected to computational active site mapping using HotspotsX. This approach uses knowledge-based pair potentials to detect favorable binding positions for various atom types. Good agreement between the in silico hot spot predictions and the experimentally observed positions of the polar hydrogen bond forming functional groups and hydrophobic portions was obtained. Finally, we compared the observed poses of the small-molecule probes with those of much larger structurally related ligands. They coincide remarkably well with the larger ligands, considering their spatial orientation and the experienced interaction patterns. This observation confirms the fundamental hypothesis of fragment-based lead discovery: that binding poses, even of very small molecular probes, do not significantly deviate or move once a ligand is grown further into the binding site. This underscores the fact that these probes populate given hot spots and can be regarded as relevant seeds for further design.

  16. Mapping of Protein–Protein Interaction Sites by the ‘Absence of Interference’ Approach

    PubMed Central

    Dhayalan, Arunkumar; Jurkowski, Tomasz P.; Laser, Heike; Reinhardt, Richard; Jia, Da; Cheng, Xiaodong; Jeltsch, Albert

    2008-01-01

    Protein–protein interactions are critical to most biological processes, and locating protein–protein interfaces on protein structures is an important task in molecular biology. We developed a new experimental strategy called the ‘absence of interference’ approach to determine surface residues involved in protein–protein interaction of established yeast two-hybrid pairs of interacting proteins. One of the proteins is subjected to high-level randomization by error-prone PCR. The resulting library is selected by yeast two-hybrid system for interacting clones that are isolated and sequenced. The interaction region can be identified by an absence or depletion of mutations. For data analysis and presentation, we developed a Web interface that analyzes the mutational spectrum and displays the mutational frequency on the surface of the structure (or a structural model) of the randomized protein†. Additionally, this interface might be of use for the display of mutational distributions determined by other types of random mutagenesis experiments. We applied the approach to map the interface of the catalytic domain of the DNA methyltransferase Dnmt3a with its regulatory factor Dnmt3L. Dnmt3a was randomized with high mutational load. A total of 76 interacting clones were isolated and sequenced, and 648 mutations were identified. The mutational pattern allowed to identify a unique interaction region on the surface of Dnmt3a, which comprises about 500−600 Å2. The results were confirmed by site-directed mutagenesis and structural analysis. The absence-of-interference approach will allow high-throughput mapping of protein interaction sites suitable for functional studies and protein docking. PMID:18191145

  17. Mapping fatty acid binding to beta-lactoglobulin: Ligand binding is restricted by modification of Cys 121.

    PubMed Central

    Narayan, M.; Berliner, L. J.

    1998-01-01

    Native beta-lactoglobulin (Blg) binds 1 mole of palmitic acid per mole of protein with a dissociation constant of 0.6 microM for the primary fatty acid binding site. Chemical modification of Cys 121, which lies at the external putative hydrophobic binding site of Blg, does not affect retinol or 4,4'-bis 1-(phenylamino)-8-naphthalenesulfonate (bis-ANS) binding to the protein, indicating that the incorporated appendages do not perturb the internal hydrophobic site within the beta-barrel of Blg (i.e., the retinoid site is unaffected). On the other hand, methylation of Cys 121, reduces the affinity of Blg for palmitic acid by 10-fold as monitored by intrinsic fluorescence. Modification of the Cys 121 with methylmethanethiosulfonate or a thiol-specific spin label appears to either further weaken or totally eliminate fatty acid binding, respectively, due to steric hindrance. Furthermore, this binding pattern has been independently verified using a spin labeled fatty acid analog and monitoring ESR as well as by bis-ANS fluorescence when bound to the protein. These results suggest that fatty acids bind at the "external site" of beta-lactoglobulin, between the sole alpha-helix and the beta-barrel. In addition, structural stability studies of native and chemically modified Blg appear to confirm this observation as well. PMID:9514270

  18. Improving the Apollo 12 landing site mapping with Chandrayaan M3 data

    NASA Astrophysics Data System (ADS)

    Chemin, Yann; Crawford, Ian; Bugiolacchi, Roberto; Irfan, Huma; Alexander, Louise

    2014-05-01

    The geology of the Apollo 12 landing site has been the subject of many studies, including recently by Korotev et al. (2011) and Snape et al. (2013). This research attempts to bring additional understanding from a remote sensing perspective using the Moon Mineralogy Mapper (M3) sensor data, onboard the Chandrayaan lunar orbiter. This has a higher spatial-spectral resolution sensor than the Clementine UV-Vis sensor and provides the opportunity to study the lunar surface with detailed spectral signatures. Mapping of FeO (wt%) and TiO2 (wt%) is done using the methods of Lucey et al. (2000) and Wilcox et al. (2005). A FeO & TiO2 processing module (i.feotio2) is made specifically for this research within the Free & Open Source Software GRASS GIS. Attempts will be made to estimate the lava flow thickness using the method of Bugiolacchi et al. (2006) and individual lava layers thicknesses (Weider et al., 2010). Integration of this new information will be put in perspective and integrated with previous work. Analysis from the combined higher spatial and spectral resolutions will improve the accuracy of the geological mapping at the Apollo 12 landing site. References Bugiolacchi, R., Spudis, P.D., Guest, J.E., 2006. Stratigraphy and composition of lava flows in Mare Nubium and Mare Cognitum. Meteoritics & Planetary Science. 41(2):285-304. Korotev, R.L., Jolliff, B.L., Zeigler, R.A., Seddio, S.M., Haskin, L.A., 2011. Apollo 12 revisited. Geochimica et Cosmochimica Acta. 75(6):1540-1573. Lucey, P.G., Blewett, D.T., Jolliff, B.L., 2000. Lunar iron and titanium abundance algorithms based on final processing of Clementine ultraviolet-visible images. J. Geophys. Res. 105(E8): 20297-20305. Snape, J.F., Alexander, L., Crawford, I.A., Joy, K.H., 2013. Basaltic Regolith Sample 12003,314: A New Member of the Apollo 12 Feldspathic Basalt Suite? Lunar and Planetary Institute Science Conference Abstracts 44:1044. Weider, S.Z., Crawford, I.A. and Joy, K.H., "Individual lava flow

  19. Mapping.

    ERIC Educational Resources Information Center

    Kinney, Douglas M.; McIntosh, Willard L.

    1979-01-01

    The area of geological mapping in the United States in 1978 increased greatly over that reported in 1977; state geological maps were added for California, Idaho, Nevada, and Alaska last year. (Author/BB)

  20. Including Faults Detected By Near-Surface Seismic Methods in the USGS National Seismic Hazard Maps - Some Restrictions Apply

    NASA Astrophysics Data System (ADS)

    Williams, R. A.; Haller, K. M.

    2014-12-01

    Every 6 years, the USGS updates the National Seismic Hazard Maps (new version released July 2014) that are intended to help society reduce risk from earthquakes. These maps affect hundreds of billions of dollars in construction costs each year as they are used to develop seismic-design criteria of buildings, bridges, highways, railroads, and provide data for risk assessment that help determine insurance rates. Seismic source characterization, an essential component of hazard model development, ranges from detailed trench excavations across faults at the ground surface to less detailed analysis of broad regions defined mainly on the basis of historical seismicity. Though it is a priority for the USGS to discover new Quaternary fault sources, the discovered faults only become a part of the hazard model if there are corresponding constraints on their geometry (length and depth extent) and slip-rate (or recurrence interval). When combined with fault geometry and slip-rate constraints, near-surface seismic studies that detect young (Quaternary) faults have become important parts of the hazard source model. Examples of seismic imaging studies with significant hazard impact include the Southern Whidbey Island fault, Washington; Santa Monica fault, San Andreas fault, and Palos Verdes fault zone, California; and Commerce fault, Missouri. There are many more faults in the hazard model in the western U.S. than in the expansive region east of the Rocky Mountains due to the higher rate of tectonic deformation, frequent surface-rupturing earthquakes and, in some cases, lower erosion rates. However, the recent increase in earthquakes in the central U.S. has revealed previously unknown faults for which we need additional constraints before we can include them in the seismic hazard maps. Some of these new faults may be opportunities for seismic imaging studies to provide basic data on location, dip, style of faulting, and recurrence.

  1. Mapping the Binding Site of BMS-708163 on γ-Secretase with Cleavable Photoprobes.

    PubMed

    Gertsik, Natalya; Am Ende, Christopher W; Geoghegan, Kieran F; Nguyen, Chuong; Mukherjee, Paramita; Mente, Scot; Seneviratne, Uthpala; Johnson, Douglas S; Li, Yue-Ming

    2017-01-19

    γ-Secretase, a four-subunit transmembrane aspartic proteinase, is a highly valued drug target in Alzheimer's disease and cancer. Despite significant progress in structural studies, the respective molecular mechanisms and binding modes of γ-secretase inhibitors (GSIs) and modulators (GSMs) remain uncertain. Here, we developed biotinylated cleavable-linker photoprobes based on the BMS-708163 GSI to study its interaction with γ-secretase. Comparison of four cleavable linkers indicated that the hydrazine-labile N-1-(4,4-dimethyl-2,6-dioxocyclohexylidene)ethyl (Dde) linker was cleaved most efficiently to release photolabeled and affinity-captured presenilin-1 (PS1), the catalytic subunit of γ-secretase. Peptide mapping showed that the BMS-708163-based probe photoinserted at L282 of PS1. This insertion site was consistent with the results of molecular dynamics simulations of the γ-secretase complex with inhibitor. Taken together, this work reveals the binding site of a GSI and offers insights into the mechanism of action of this class of inhibitors.

  2. Mapping of contamination at Savannah River Site FBWU by INEEL trolley

    SciTech Connect

    Carpenter, M.V.; Gehrke, R.J.; Helmer, R.G.; Josten, N.

    1998-01-01

    The Ford Building Waste Unit (FBWU) 643-11G is a Resource Conservation and Recovery Act/Comprehensive Environmental Response Compensation and Liability Act (RCRA/CERCLA) designated site at the Savannah River Site (SRS) in Aiken, South Carolina. Pre-Work Plan Characterization at the FBWU in May 1996 indicated that radiological contamination was present in surface and near surface soils and identified cesium-137, {sup 137}Cs, the unit specific contaminant, as being primarily in the top 15 cm of soil. The Idaho National Engineering and Environmental Laboratory (INEEL) sent the dig-face trolley system to SRS where it demonstrated its capability over a 6.1-m (20 ft.) x 9.6-m (30 ft.) area to rapidly map the contamination on-line with its large area plastic scintillation detector. Also, an extended-range (10 keV to 3 MeV) Ge detector was used at selected locations to identify and quantify the {sup 137}Cs contamination. The coordinate locations of each measurement acquired in either the scanning or fixed position mode was obtained with a survey system based on radial encoders. Topography measurements were also made during measurements to permit correction of field of view and activity concentrations for changes in the ground to detector distance.

  3. Geologic map of Paleozoic rocks in the Calico Hills, Nevada Test Site, southern Nevada

    SciTech Connect

    Cole, J.C.; Cashman, P.H.

    1998-11-01

    The Calico Hills area in the southwestern part of the Nevada Test Site, Nye County, Nevada, exposes a core of pre-Tertiary rocks surrounded by middle Miocene volcanic strata. This map portrays the very complex relationships among the pre-Tertiary stratigraphic units of the region. The Devonian and Mississippian rocks of the Calico Hills are distinct from age-equivalent carbonate-shelf or submarine-fan strata in other parts of the Nevada Test Site. The Calico Hills strata are interpreted to have been deposited beyond the continental shelf edge from alternating silicic and carbonate clastic sources. Structures of the Calico Hills area record the compounded effects of: (1) eastward-directed, foreland-vergent thrusting; (2) younger folds, kink zones, and thrusts formed by hinterland-vergent deformation toward northwesterly and northerly directions; and (3) low-angle normal faults that displaced blocks of Middle Paleozoic carbonate strata across the contractionally deformed terrane. All of these structures are older than any of the middle Miocene volcanic rocks that were erupted across the Calico Hills.

  4. Auto-FACE: An NMR Based Binding Site Mapping Program for Fast Chemical Exchange Protein-Ligand Systems

    PubMed Central

    Krishnamoorthy, Janarthanan; Yu, Victor C. K.; Mok, Yu-Keung

    2010-01-01

    Background Nuclear Magnetic Resonance (NMR) spectroscopy offers a variety of experiments to study protein-ligand interactions at atomic resolution. Among these experiments, N Heteronuclear Single Quantum Correlation (HSQC) experiment is simple, less time consuming and highly informative in mapping the binding site of the ligand. The interpretation of N HSQC becomes ambiguous when the chemical shift perturbations are caused by non-specific interactions like allosteric changes and local structural rearrangement. Under such cases, detailed chemical exchange analysis based on chemical shift perturbation will assist in locating the binding site accurately. Methodology/Principal Findings We have automated the mapping of binding sites for fast chemical exchange systems using information obtained from N HSQC spectra of protein serially titrated with ligand of increasing concentrations. The automated program Auto-FACE (Auto-FAst Chemical Exchange analyzer) determines the parameters, e.g. rate of change of perturbation, binding equilibrium constant and magnitude of chemical shift perturbation to map the binding site residues. Interestingly, the rate of change of perturbation at lower ligand concentration is highly sensitive in differentiating the binding site residues from the non-binding site residues. To validate this program, the interaction between the protein and the ligand BH3I-1 was studied. Residues in the hydrophobic BH3 binding groove of were easily identified to be crucial for interaction with BH3I-1 from other residues that also exhibited perturbation. The geometrically averaged equilibrium constant () calculated for the residues present at the identified binding site is consistent with the values obtained by other techniques like isothermal calorimetry and fluorescence polarization assays (). Adjacent to the primary site, an additional binding site was identified which had an affinity of 3.8 times weaker than the former one. Further NMR based model fitting for

  5. Multiple docking sites on substrate proteins form a modular system that mediates recognition by ERK MAP kinase

    PubMed Central

    Jacobs, Dave; Glossip, Danielle; Xing, Heming; Muslin, Anthony J.; Kornfeld, Kerry

    1999-01-01

    MAP kinases phosphorylate specific groups of substrate proteins. Here we show that the amino acid sequence FXFP is an evolutionarily conserved docking site that mediates ERK MAP kinase binding to substrates in multiple protein families. FXFP and the D box, a different docking site, form a modular recognition system, as they can function independently or in combination. FXFP is specific for ERK, whereas the D box mediates binding to ERK and JNK MAP kinase, suggesting that the partially overlapping substrate specificities of ERK and JNK result from recognition of shared and unique docking sites. These findings enabled us to predict new ERK substrates and design peptide inhibitors of ERK that functioned in vitro and in vivo. PMID:9925641

  6. Mapping a paleosurface and archaeological site location in an inland dune area in Brandenburg, Germany

    NASA Astrophysics Data System (ADS)

    Schneider, Anna; Hirsch, Florian; Wechler, Klaus-Peter; Raab, Alexandra; Raab, Thomas

    2017-04-01

    Mapping and visualizing the position of archaeological remains in the surface relief provides important basic information for archaeological survey design and interpretation. Geomorphological processes in (pre)history can have resulted in a modification of the local relief around archaeological sites, especially in areas that are prone to sediment erosion and relocation, so that models of past surfaces are necessary for a correct interpretation of archaeological survey results. In this study, we combined terrestrial survey and remote sensing methods to reconstruct the palaeorelief around two archaeological excavation sites in an inland dune area in southern Brandenburg, Germany. Remains from two Mesolithic hunter-gatherer camps were documented in archaeological excavations and found to be associated with a buried soil horizon. To gather information on the relief of the buried soil surface, we used a combination of sedimentological and pedological profile description of archaeological survey trenches and geophysical prospection with Ground-Penetrating Radar; supplemented by microdrone photography and photogrammetry, GPS surveys and analysis of LIDAR-based elevation models. A digital elevation model of the buried surface was created by combining point data from these sources. The buried surface morphology and the position of the archeological remains within the reconstructed landscape were analyzed in GIS. The comparison of the generated paleosurface model with the recent surface elevation model shows that sand remobilization resulted in a considerable reshaping of the relief. Analysis of the buried surface model further shows that the relief position of the two archaeological sites in the study area was considerably more prominent in relation to the corresponding buried soil surface than in relation to the recent surface morphology. Results affirm the importance of considering Holocene relief modifications in archaeological surveys.

  7. Near-surface gas mapping studies of salt geologic features at Weeks Island and other sites

    SciTech Connect

    Molecke, M.A.; Carney, K.R.; Autin, W.J.; Overton, E.B.

    1996-10-01

    Field sampling and rapid gas analysis techniques were used to survey near-surface soil gases for geotechnical diagnostic purposes at the Weeks Island Strategic Petroleum Reserve (SPR) site and other salt dome locations in southern Louisiana. This report presents the complete data, results and interpretations obtained during 1995. Weeks Island 1994 gas survey results are also briefly summarized; this earlier study did not find a definitive correlation between sinkhole No. 1 and soil gases. During 1995, several hundred soil gas samples were obtained and analyzed in the field by gas chromatography, for profiling low concentrations and gas anomalies at ppm to percent levels. The target gases included hydrogen, methane, ethane and ethylene. To supplement the field data, additional gas samples were collected at various site locations for laboratory analysis of target gases at ppb levels. Gases in the near-surface soil originate predominantly from the oil, from petrogenic sources within the salt, or from surface microbial activity. Surveys were conducted across two Weeks Island sinkholes, several mapped anomalous zones in the salt, and over the SPR repository site and its perimeter. Samples were also taken at other south Louisiana salt dome locations for comparative purposes. Notable results from these studies are that elevated levels of hydrogen and methane (1) were positively associated with anomalous gassy or shear zones in the salt dome(s) and (2) are also associated with suspected salt fracture (dilatant) zones over the edges of the SPR repository. Significantly elevated areas of hydrogen, methane, plus some ethane, were found over anomalous shear zones in the salt, particularly in a location over high pressure gas pockets in the salt, identified in the mine prior to SPR operations. Limited stable isotope ratio analyses, SIRA, were also conducted and determined that methane samples were of petrogenic origin, not biogenic.

  8. Type II restriction endonuclease R.Hpy188I belongs to the GIY-YIG nuclease superfamily, but exhibits an unusual active site

    PubMed Central

    Kaminska, Katarzyna H; Kawai, Mikihiko; Boniecki, Michal; Kobayashi, Ichizo; Bujnicki, Janusz M

    2008-01-01

    Background Catalytic domains of Type II restriction endonucleases (REases) belong to a few unrelated three-dimensional folds. While the PD-(D/E)XK fold is most common among these enzymes, crystal structures have been also determined for single representatives of two other folds: PLD (R.BfiI) and half-pipe (R.PabI). Bioinformatics analyses supported by mutagenesis experiments suggested that some REases belong to the HNH fold (e.g. R.KpnI), and that a small group represented by R.Eco29kI belongs to the GIY-YIG fold. However, for a large fraction of REases with known sequences, the three-dimensional fold and the architecture of the active site remain unknown, mostly due to extreme sequence divergence that hampers detection of homology to enzymes with known folds. Results R.Hpy188I is a Type II REase with unknown structure. PSI-BLAST searches of the non-redundant protein sequence database reveal only 1 homolog (R.HpyF17I, with nearly identical amino acid sequence and the same DNA sequence specificity). Standard application of state-of-the-art protein fold-recognition methods failed to predict the relationship of R.Hpy188I to proteins with known structure or to other protein families. In order to increase the amount of evolutionary information in the multiple sequence alignment, we have expanded our sequence database searches to include sequences from metagenomics projects. This search resulted in identification of 23 further members of R.Hpy188I family, both from metagenomics and the non-redundant database. Moreover, fold-recognition analysis of the extended R.Hpy188I family revealed its relationship to the GIY-YIG domain and allowed for computational modeling of the R.Hpy188I structure. Analysis of the R.Hpy188I model in the light of sequence conservation among its homologs revealed an unusual variant of the active site, in which the typical Tyr residue of the YIG half-motif had been substituted by a Lys residue. Moreover, some of its homologs have the otherwise

  9. Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions.

    PubMed

    Romano, Oriana; Cifola, Ingrid; Poletti, Valentina; Severgnini, Marco; Peano, Clelia; De Bellis, Gianluca; Mavilio, Fulvio; Miccio, Annarita

    2017-05-28

    Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV integration sites can be used as functional markers of active regulatory elements. Here, we present a retroviral scanning tool, which allows the genome-wide identification of cell-specific enhancers and promoters. Briefly, the target cell population is transduced with an mLV-derived vector and genomic DNA is digested with a frequently cutting restriction enzyme. After ligation of genomic fragments with a compatible DNA linker, linker-mediated polymerase chain reaction (LM-PCR) allows the amplification of the virus-host genome junctions. Massive sequencing of the amplicons is used to define the mLV integration profile genome-wide. Finally, clusters of recurrent integrations are defined to identify cell-specific regulatory regions, responsible for the activation of cell-type specific transcriptional programs. The retroviral scanning tool allows the genome-wide identification of cell-specific promoters and enhancers in prospectively isolated target cell populations. Notably, retroviral scanning represents an instrumental technique for the retrospective identification of rare populations (e.g. somatic stem cells) that lack robust markers for prospective isolation.

  10. A switch in the mechanism of communication between the two DNA-binding sites in the SfiI restriction endonuclease.

    PubMed

    Bellamy, Stuart R W; Milsom, Susan E; Kovacheva, Yana S; Sessions, Richard B; Halford, Stephen E

    2007-11-09

    While many Type II restriction enzymes are dimers with a single DNA-binding cleft between the subunits, SfiI is a tetramer of identical subunits. Two of its subunits (a dimeric unit) create one DNA-binding cleft, and the other two create a second cleft on the opposite side of the protein. The two clefts bind specific DNA cooperatively to give a complex of SfiI with two recognition sites. This complex is responsible for essentially all of the DNA-cleavage reactions by SfiI: virtually none is due to the complex with one site. The communication between the DNA-binding clefts was examined by disrupting one of the very few polar interactions in the otherwise hydrophobic interface between the dimeric units: a tyrosine hydroxyl was removed by mutation to phenylalanine. The mutant protein remained tetrameric in solution and could bind two DNA sites. But instead of being activated by binding two sites, like wild-type SfiI, it showed maximal activity when bound to a single site and had a lower activity when bound to two sites. This interaction across the dimer interface thus enforces in wild-type SfiI a cooperative transition between inactive and active states in both dimers, but without this interaction as in the mutant protein, a single dimer can undergo the transition to give a stable intermediate with one inactive dimer and one active dimer.

  11. Restriction fragment length polymorphism mapping of quantitative trait loci for malaria parasite susceptibility in the mosquito Aedes aegypti

    SciTech Connect

    Severson, D.W.; Thathy, V.; Mori, A.

    1995-04-01

    Susceptibility of the mosquito Aedes aegypti to the malarial parasite Plasmodium gallinaceum was investigated as a quantitative trait using restriction fragment length polymorphisms (RFLP). Two F{sub 2} populations of mosquitoes were independently prepared from pairwise matings between a highly susceptible and a refractory strain of A. aegypti. RFLP were tested for association with oocyst development on the mosquito midgut. Two putative quantitative trait loci (QTL) were identified that significantly affect susceptibility. One QTL, pgs [2,LF98], is located on chromosome 2 and accounted for 65 and 49% of the observed phenotypic variance in the two populations, respectively. A second QTL, pgs[3,MalI], is located on chromosome 3 and accounted for 14 and 10% of the observed phenotypic variance in the two populations, respectively. Both QTL exhibit a partial dominance effect on susceptibility, wherein the dominance effect is derived from the refractory parent. No indication of epistasis between these QTL was detected. Evidence suggests that either a tightly linked cluster of independent genes or a single locus affecting susceptibility to various mosquito-borne parasites and pathogens has evolved near the LF98 locus; in addition to P. gallinaceum susceptibility, this general genome region has previously been implicated in susceptibility to the filaria nematode Brugia malayi and the yellow fever virus. 35 refs., 2 figs., 3 tabs.

  12. Near-Atomic Three-Dimensional Mapping for Site-Specific Chemistry of 'Superbugs'.

    PubMed

    Adineh, Vahid R; Marceau, Ross K W; Velkov, Tony; Li, Jian; Fu, Jing

    2016-11-09

    Emergence of multidrug resistant Gram-negative bacteria has caused a global health crisis and last-line class of antibiotics such as polymyxins are increasingly used. The chemical composition at the cell surface plays a key role in antibiotic resistance. Unlike imaging the cellular ultrastructure with well-developed electron microscopy, the acquisition of a high-resolution chemical map of the bacterial surface still remains a technological challenge. In this study, we developed an atom probe tomography (APT) analysis approach to acquire mass spectra in the pulsed-voltage mode and reconstructed the 3D chemical distribution of atoms and molecules in the subcellular domain at the near-atomic scale. Using focused ion beam (FIB) milling together with micromanipulation, site-specific samples were retrieved from a single cell of Acinetobacter baumannii prepared as needle-shaped tips with end radii less than 60 nm, followed by a nanoscale coating of silver in the order of 10 nm. The significantly elevated conductivity provided by the metallic coating enabled successful and routine field evaporation of the biological material, with all the benefits of pulsed-voltage APT. In parallel with conventional cryo-TEM imaging, our novel approach was applied to investigate polymyxin-susceptible and -resistant strains of A. baumannii after treatment of polymyxin B. Acquired atom probe mass spectra from the cell envelope revealed characteristic fragments of phosphocholine from the polymyxin-susceptible strain, but limited signals from this molecule were detected in the polymyxin-resistant strain. This study promises unprecedented capacity for 3D nanoscale imaging and chemical mapping of bacterial cells at the ultimate 3D spatial resolution using APT.

  13. Mapping of the alpha-bungarotoxin binding site within the alpha subunit of the acetylcholine receptor.

    PubMed Central

    Neumann, D; Barchan, D; Safran, A; Gershoni, J M; Fuchs, S

    1986-01-01

    Synthetic peptides and their respective antibodies have been used in order to map the alpha-bungarotoxin binding site within the alpha subunit of the acetylcholine receptor. By using antibodies to a synthetic peptide corresponding to residues 169-181 of the alpha subunit, we demonstrate that this sequence is included within the 18-kDa toxin binding fragment previously reported. Furthermore, the 18-kDa fragment was also found to bind a monoclonal antibody (5.5) directed against the cholinergic binding site. Sequential proteolysis of the acetylcholine receptor with trypsin, prior to Staphylococcus aureus V8 protease digestion, resulted in a 15-kDa toxin binding fragment that is included within the 18-kDa fragment but is shorter than it only at its carboxyl terminus. This 15-kDa fragment therefore initiates beyond Asp-152 and terminates in the region of Arg-313/Lys-314. In addition, experiments are reported that indicate that in the intact acetylcholine receptor, Cys-128 and/or Cys-142 are not crosslinked by disulfide bridges with any of the cysteines (at positions 192, 193, and 222) that reside in the 15-kDa toxin binding fragment. Finally, the synthetic dodecapeptide Lys-His-Trp-Val-Tyr-Tyr-Thr-Cys-Cys-Pro-Asp-Thr, which is present in the 15-kDa fragment (corresponding to residues 185-196 of the alpha subunit) was shown to bind alpha-bungarotoxin directly. This binding was completely inhibited by competition with d-tubocurarine. Images PMID:3458258

  14. Mapping of the alpha-bungarotoxin binding site within the alpha subunit of the acetylcholine receptor.

    PubMed

    Neumann, D; Barchan, D; Safran, A; Gershoni, J M; Fuchs, S

    1986-05-01

    Synthetic peptides and their respective antibodies have been used in order to map the alpha-bungarotoxin binding site within the alpha subunit of the acetylcholine receptor. By using antibodies to a synthetic peptide corresponding to residues 169-181 of the alpha subunit, we demonstrate that this sequence is included within the 18-kDa toxin binding fragment previously reported. Furthermore, the 18-kDa fragment was also found to bind a monoclonal antibody (5.5) directed against the cholinergic binding site. Sequential proteolysis of the acetylcholine receptor with trypsin, prior to Staphylococcus aureus V8 protease digestion, resulted in a 15-kDa toxin binding fragment that is included within the 18-kDa fragment but is shorter than it only at its carboxyl terminus. This 15-kDa fragment therefore initiates beyond Asp-152 and terminates in the region of Arg-313/Lys-314. In addition, experiments are reported that indicate that in the intact acetylcholine receptor, Cys-128 and/or Cys-142 are not crosslinked by disulfide bridges with any of the cysteines (at positions 192, 193, and 222) that reside in the 15-kDa toxin binding fragment. Finally, the synthetic dodecapeptide Lys-His-Trp-Val-Tyr-Tyr-Thr-Cys-Cys-Pro-Asp-Thr, which is present in the 15-kDa fragment (corresponding to residues 185-196 of the alpha subunit) was shown to bind alpha-bungarotoxin directly. This binding was completely inhibited by competition with d-tubocurarine.

  15. Mapping the lipoylation site of Arabidopsis thaliana plastidial dihydrolipoamide S-acetyltransferase using mass spectrometry and site-directed mutagenesis

    USDA-ARS?s Scientific Manuscript database

    Background: The catalytic enhancement achieved by the pyruvate dehydrogenase complex (PDC) results from a combination of substrate channeling plus active-site coupling. The mechanism for active-site coupling involves lipoic acid prosthetic groups covalently attached to Lys residues in the primary ...

  16. Preliminary analysis of Airborne Visible/Infrared Imaging Spectrometer (AVIRIS) for mineralogic mapping at sites in Nevada and Colorado

    NASA Technical Reports Server (NTRS)

    Kruse, Fred A.; Taranik, Dan L.; Kierein-Young, Kathryn S.

    1988-01-01

    Airborne Visible/Infrared Imaging Spectrometer (AVIRIS) data for sites in Nevada and Colorado were evaluated to determine their utility for mineralogical mapping in support of geologic investigations. Equal energy normalization is commonly used with imaging spectrometer data to reduce albedo effects. Spectra, profiles, and stacked, color-coded spectra were extracted from the AVIRIS data using an interactive analysis program (QLook) and these derivative data were compared to Airborne Imaging Spectrometer (AIS) results, field and laboratory spectra, and geologic maps. A feature extraction algorithm was used to extract and characterize absorption features from AVIRIS and laboratory spectra, allowing direct comparison of the position and shape of absorption features. Both muscovite and carbonate spectra were identified in the Nevada AVIRIS data by comparison with laboratory and AIS spectra, and an image was made that showed the distribution of these minerals for the entire site. Additional, distinctive spectra were located for an unknown mineral. For the two Colorado sites, the signal-to-noise problem was significantly worse and attempts to extract meaningful spectra were unsuccessful. Problems with the Colorado AVIRIS data were accentuated by the IAR reflectance technique because of moderate vegetation cover. Improved signal-to-noise and alternative calibration procedures will be required to produce satisfactory reflectance spectra from these data. Although the AVIRIS data were useful for mapping strong mineral absorption features and producing mineral maps at the Nevada site, it is clear that significant improvements to the instrument performance are required before AVIRIS will be an operational instrument.

  17. Geologic map of the MTM 25047 and 20047 quadrangles, central Chryse Planitia/Viking 1 Lander site, Mars

    USGS Publications Warehouse

    Crumpler, L.S.; Craddock, R.A.; Aubele, J.C.

    2001-01-01

    This map uses Viking Orbiter image data and Viking 1 Lander image data to evaluate the geologic history of a part of Chryse Planitia, Mars. The map area lies at the termini of the Maja and Kasei Valles outwash channels and includes the site of the Viking 1 Lander. The photomosaic base for these quadrangles was assembled from 98 Viking Orbiter frames comprising 1204 pixels per line and 1056 lines and ranging in resolution from 20 to 200 m/pixel. These orbital image data were supplemented with images of the surface as seen from the Viking 1 Lander, one of only three sites on the martian surface where planetary geologic mapping is assisted by ground truth.

  18. Real-time PCR mapping of DNaseI-hypersensitive sites using a novel ligation-mediated amplification technique

    PubMed Central

    Follows, George A.; Janes, Mary E.; Vallier, Ludovic; Green, Anthony R.; Gottgens, Berthold

    2007-01-01

    Mapping sites within the genome that are hypersensitive to digestion with DNaseI is an important method for identifying DNA elements that regulate transcription. The standard approach to locating these DNaseI-hypersensitive sites (DHSs) has been to use Southern blotting techniques, although we, and others, have recently published alternative methods using a range of technologies including high-throughput sequencing and genomic array tiling paths. In this article, we describe a novel protocol to use real-time PCR to map DHS. Advantages of the technique reported here include the small cell numbers required for each analysis, rapid, relatively low-cost experiments with minimal need for specialist equipment. Presented examples include comparative DHS mapping of known TAL1/SCL regulatory elements between human embryonic stem cells and K562 cells. PMID:17389645

  19. Mapping the Binding Site of an Aptamer on ATP Using MicroScale Thermophoresis.

    PubMed

    Entzian, Clemens; Schubert, Thomas

    2017-01-07

    Characterization of molecular interactions in terms of basic binding parameters such as binding affinity, stoichiometry, and thermodynamics is an essential step in basic and applied science. MicroScale Thermophoresis (MST) is a sensitive biophysical method to obtain this important information. Relying on a physical effect called thermophoresis, which describes the movement of molecules through temperature gradients, this technology allows for the fast and precise determination of binding parameters in solution and allows the free choice of buffer conditions (from buffer to lysates/sera). MST uses the fact that an unbound molecule displays a different thermophoretic movement than a molecule that is in complex with a binding partner. The thermophoretic movement is altered in the moment of molecular interaction due to changes in size, charge, and hydration shell. By comparing the movement profiles of different molecular ratios of the two binding partners, quantitative information such as binding affinity (pM to mM) can be determined. Even challenging interactions between molecules of small sizes, such as aptamers and small compounds, can be studied by MST. Using the well-studied model interaction between the DH25.42 DNA aptamer and ATP, this manuscript provides a protocol to characterize aptamer-small molecule interactions. This study demonstrates that MST is highly sensitive and permits the mapping of the binding site of the 7.9 kDa DNA aptamer to the adenine of ATP.

  20. A terrain-based site characterization map of California with implications for the contiguous United States

    USGS Publications Warehouse

    Yong, Alan K.; Hough, Susan E.; Iwahashi, Junko; Braverman, Amy

    2012-01-01

    We present an approach based on geomorphometry to predict material properties and characterize site conditions using the VS30 parameter (time‐averaged shear‐wave velocity to a depth of 30 m). Our framework consists of an automated terrain classification scheme based on taxonomic criteria (slope gradient, local convexity, and surface texture) that systematically identifies 16 terrain types from 1‐km spatial resolution (30 arcsec) Shuttle Radar Topography Mission digital elevation models (SRTM DEMs). Using 853 VS30 values from California, we apply a simulation‐based statistical method to determine the mean VS30 for each terrain type in California. We then compare the VS30 values with models based on individual proxies, such as mapped surface geology and topographic slope, and show that our systematic terrain‐based approach consistently performs better than semiempirical estimates based on individual proxies. To further evaluate our model, we apply our California‐based estimates to terrains of the contiguous United States. Comparisons of our estimates with 325 VS30 measurements outside of California, as well as estimates based on the topographic slope model, indicate our method to be statistically robust and more accurate. Our approach thus provides an objective and robust method for extending estimates of VS30 for regions where in situ measurements are sparse or not readily available.

  1. Predicting and mapping potential Whooping Crane stopover habitat to guide site selection for wind energy projects.

    PubMed

    Belaire, J Amy; Kreakie, Betty J; Keitt, Timothy; Minor, Emily

    2014-04-01

    Migratory stopover habitats are often not part of planning for conservation or new development projects. We identified potential stopover habitats within an avian migratory flyway and demonstrated how this information can guide the site-selection process for new development. We used the random forests modeling approach to map the distribution of predicted stopover habitat for the Whooping Crane (Grus americana), an endangered species whose migratory flyway overlaps with an area where wind energy development is expected to become increasingly important. We then used this information to identify areas for potential wind power development in a U.S. state within the flyway (Nebraska) that minimize conflicts between Whooping Crane stopover habitat and the development of clean, renewable energy sources. Up to 54% of our study area was predicted to be unsuitable as Whooping Crane stopover habitat and could be considered relatively low risk for conflicts between Whooping Cranes and wind energy development. We suggest that this type of analysis be incorporated into the habitat conservation planning process in areas where incidental take permits are being considered for Whooping Cranes or other species of concern. Field surveys should always be conducted prior to construction to verify model predictions and understand baseline conditions. © 2013 Society for Conservation Biology.

  2. SELMAP - SELEX affinity landscape MAPping of transcription factor binding sites using integrated microfluidics.

    PubMed

    Chen, Dana; Orenstein, Yaron; Golodnitsky, Rada; Pellach, Michal; Avrahami, Dorit; Wachtel, Chaim; Ovadia-Shochat, Avital; Shir-Shapira, Hila; Kedmi, Adi; Juven-Gershon, Tamar; Shamir, Ron; Gerber, Doron

    2016-09-15

    Transcription factors (TFs) alter gene expression in response to changes in the environment through sequence-specific interactions with the DNA. These interactions are best portrayed as a landscape of TF binding affinities. Current methods to study sequence-specific binding preferences suffer from limited dynamic range, sequence bias, lack of specificity and limited throughput. We have developed a microfluidic-based device for SELEX Affinity Landscape MAPping (SELMAP) of TF binding, which allows high-throughput measurement of 16 proteins in parallel. We used it to measure the relative affinities of Pho4, AtERF2 and Btd full-length proteins to millions of different DNA binding sites, and detected both high and low-affinity interactions in equilibrium conditions, generating a comprehensive landscape of the relative TF affinities to all possible DNA 6-mers, and even DNA10-mers with increased sequencing depth. Low quantities of both the TFs and DNA oligomers were sufficient for obtaining high-quality results, significantly reducing experimental costs. SELMAP allows in-depth screening of hundreds of TFs, and provides a means for better understanding of the regulatory processes that govern gene expression.

  3. SELMAP - SELEX affinity landscape MAPping of transcription factor binding sites using integrated microfluidics

    PubMed Central

    Chen, Dana; Orenstein, Yaron; Golodnitsky, Rada; Pellach, Michal; Avrahami, Dorit; Wachtel, Chaim; Ovadia-Shochat, Avital; Shir-Shapira, Hila; Kedmi, Adi; Juven-Gershon, Tamar; Shamir, Ron; Gerber, Doron

    2016-01-01

    Transcription factors (TFs) alter gene expression in response to changes in the environment through sequence-specific interactions with the DNA. These interactions are best portrayed as a landscape of TF binding affinities. Current methods to study sequence-specific binding preferences suffer from limited dynamic range, sequence bias, lack of specificity and limited throughput. We have developed a microfluidic-based device for SELEX Affinity Landscape MAPping (SELMAP) of TF binding, which allows high-throughput measurement of 16 proteins in parallel. We used it to measure the relative affinities of Pho4, AtERF2 and Btd full-length proteins to millions of different DNA binding sites, and detected both high and low-affinity interactions in equilibrium conditions, generating a comprehensive landscape of the relative TF affinities to all possible DNA 6-mers, and even DNA10-mers with increased sequencing depth. Low quantities of both the TFs and DNA oligomers were sufficient for obtaining high-quality results, significantly reducing experimental costs. SELMAP allows in-depth screening of hundreds of TFs, and provides a means for better understanding of the regulatory processes that govern gene expression. PMID:27628341

  4. Active Site Mapping of Human Cathepsin F with Dipeptide Nitrile Inhibitors.

    PubMed

    Schmitz, Janina; Furtmann, Norbert; Ponert, Moritz; Frizler, Maxim; Löser, Reik; Bartz, Ulrike; Bajorath, Jürgen; Gütschow, Michael

    2015-08-01

    Cleavage of the invariant chain is the key event in the trafficking pathway of major histocompatibility complex class II. Cathepsin S is the major processing enzyme of the invariant chain, but cathepsin F acts in macrophages as its functional synergist which is as potent as cathepsin S in invariant chain cleavage. Dedicated low-molecular-weight inhibitors for cathepsin F have not yet been developed. An active site mapping with 52 dipeptide nitriles, reacting as covalent-reversible inhibitors, was performed to draw structure-activity relationships for the non-primed binding region of human cathepsin F. In a stepwise process, new compounds with optimized fragment combinations were designed and synthesized. These dipeptide nitriles were evaluated on human cysteine cathepsins F, B, L, K and S. Compounds 10 (N-(4-phenylbenzoyl)-leucylglycine nitrile) and 12 (N-(4-phenylbenzoyl)leucylmethionine nitrile) were found to be potent inhibitors of human cathepsin F, with Ki values <10 nM. With all dipeptide nitriles from our study, a 3D activity landscape was generated to visualize structure-activity relationships for this series of cathepsin F inhibitors.

  5. Active Site Mapping of Xylan-Deconstructing Enzymes with Arabinoxylan Oligosaccharides Produced by Automated Glycan Assembly.

    PubMed

    Senf, Deborah; Ruprecht, Colin; de Kruijff, Goswinus H M; Simonetti, Sebastian O; Schuhmacher, Frank; Seeberger, Peter H; Pfrengle, Fabian

    2017-03-02

    Xylan-degrading enzymes are crucial for the deconstruction of hemicellulosic biomass, making the hydrolysis products available for various industrial applications such as the production of biofuel. To determine the substrate specificities of these enzymes, we prepared a collection of complex xylan oligosaccharides by automated glycan assembly. Seven differentially protected building blocks provided the basis for the modular assembly of 2-substituted, 3-substituted, and 2-/3-substituted arabino- and glucuronoxylan oligosaccharides. Elongation of the xylan backbone relied on iterative additions of C4-fluorenylmethoxylcarbonyl (Fmoc) protected xylose building blocks to a linker-functionalized resin. Arabinofuranose and glucuronic acid residues have been selectively attached to the backbone using fully orthogonal 2-(methyl)naphthyl (Nap) and 2-(azidomethyl)benzoyl (Azmb) protecting groups at the C2 and C3 hydroxyls of the xylose building blocks. The arabinoxylan oligosaccharides are excellent tools to map the active site of glycosyl hydrolases involved in xylan deconstruction. The substrate specificities of several xylanases and arabinofuranosidases were determined by analyzing the digestion products after incubation of the oligosaccharides with glycosyl hydrolases. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Single chain human interleukin 5 and its asymmetric mutagenesis for mapping receptor binding sites.

    PubMed

    Li, J; Cook, R; Dede, K; Chaiken, I

    1996-01-26

    Wild type human (h) interleukin 5 (wt IL5) is composed of two identical peptide chains linked by disulfide bonds. A gene encoding a single chain form of hIL5 dimer was constructed by linking the two hIL5 chain coding regions with Gly-Gly linker. Expression of this gene in COS cells yielded a single chain IL5 protein (sc IL5) having biological activity similar to that of wt IL5, as judged by stimulation of human cell proliferation. Single chain and wt IL5 also had similar binding affinity for soluble IL5 receptor alpha chain, the specificity subunit of the IL5 receptor, as measured kinetically with an optical biosensor. The design of functionally active sc IL5 molecule. Such mutagenesis was exemplified by changes at residues Glu-13, Arg-91, Glu-110, and Trp-111. The receptor binding and bioactivity data obtained are consistent with a model in which residues from both IL5 monomers interact with the receptor alpha chain, while the interaction likely is asymmetric due to the intrinsic asymmetry of folded receptor. The results demonstrate a general route to the further mapping of receptor and other binding sites on the surface of human IL5.

  7. Spirit rover localization and topographic mapping at the landing site of Gusev crater, Mars

    USGS Publications Warehouse

    Li, R.; Archinal, B.A.; Arvidson, R. E.; Bell, J.; Christensen, P.; Crumpler, L.; Des Marais, D.J.; Di, K.; Duxbury, T.; Golombek, M.P.; Grant, J. A.; Greeley, R.; Guinn, J.; Johnson, Aaron H.; Kirk, R.L.; Maimone, M.; Matthies, L.H.; Malin, M.; Parker, T.; Sims, M.; Thompson, S.; Squyres, S. W.; Soderblom, L.A.

    2006-01-01

    By sol 440, the Spirit rover has traversed a distance of 3.76 km (actual distance traveled instead of odometry). Localization of the lander and the rover along the traverse has been successfully performed at the Gusev crater landing site. We localized the lander in the Gusev crater using two-way Doppler radio positioning and cartographic triangulations through landmarks visible in both orbital and ground images. Additional high-resolution orbital images were used to verify the determined lander position. Visual odometry and bundle adjustment technologies were applied to compensate for wheel slippage, azimuthal angle drift, and other navigation errors (which were as large as 10.5% in the Husband Hill area). We generated topographic products, including 72 ortho maps and three-dimensional (3-D) digital terrain models, 11 horizontal and vertical traverse profiles, and one 3-D crater model (up to sol 440). Also discussed in this paper are uses of the data for science operations planning, geological traverse surveys, surveys of wind-related features, and other science applications. Copyright 2006 by the American Geophysical Union.

  8. Mapping the tRNA binding site on the surface of human DNMT2 methyltransferase.

    PubMed

    Jurkowski, Tomasz P; Shanmugam, Raghuvaran; Helm, Mark; Jeltsch, Albert

    2012-06-05

    The DNMT2 enzyme methylates tRNA-Asp at position C38. Because there is no tRNA-Dnmt2 cocrystal structure available, we have mapped the tRNA binding site of DNMT2 by systematically mutating surface-exposed lysine and arginine residues to alanine and studying the tRNA methylation activity and binding of the corresponding variants. After mutating 20 lysine and arginine residues, we identified eight of them that caused large (>4-fold) decreases in catalytic activity. These residues cluster within and next to a surface cleft in the protein, which is large enough to accommodate the tRNA anticodon loop and stem. This cleft is located next to the binding pocket for the cofactor S-adenosyl-L-methionine, and the catalytic residues of DNMT2 are positioned at its walls or bottom. Many of the variants with strongly reduced catalytic activity showed only a weak loss of tRNA binding or even bound better to tRNA than wild-type DNMT2, which suggests that the enzyme induces some conformational changes in the tRNA in the transition state of the methyl group transfer reaction. Manual placement of tRNA into the structure suggests that DNMT2 mainly interacts with the anticodon stem and loop.

  9. Spirit rover localization and topographic mapping at the landing site of Gusev crater, Mars

    NASA Astrophysics Data System (ADS)

    Li, Rongxing; Archinal, Brent A.; Arvidson, Raymond E.; Bell, Jim; Christensen, Philip; Crumpler, Larry; Des Marais, David J.; Di, Kaichang; Duxbury, Tom; Golombek, Matt; Grant, John; Greeley, Ronald; Guinn, Joe; Johnson, Andrew; Kirk, Randolph L.; Maimone, Mark; Matthies, Larry H.; Malin, Mike; Parker, Tim; Sims, Mike; Thompson, Shane; Squyres, Steven W.; Soderblom, Larry A.

    2006-01-01

    By sol 440, the Spirit rover has traversed a distance of 3.76 km (actual distance traveled instead of odometry). Localization of the lander and the rover along the traverse has been successfully performed at the Gusev crater landing site. We localized the lander in the Gusev crater using two-way Doppler radio positioning and cartographic triangulations through landmarks visible in both orbital and ground images. Additional high-resolution orbital images were used to verify the determined lander position. Visual odometry and bundle adjustment technologies were applied to compensate for wheel slippage, azimuthal angle drift, and other navigation errors (which were as large as 10.5% in the Husband Hill area). We generated topographic products, including 72 ortho maps and three-dimensional (3-D) digital terrain models, 11 horizontal and vertical traverse profiles, and one 3-D crater model (up to sol 440). Also discussed in this paper are uses of the data for science operations planning, geological traverse surveys, surveys of wind-related features, and other science applications.

  10. A remote characterization system for subsurface mapping of buried waste sites

    SciTech Connect

    Sandness, G.A.; Bennett, D.W.

    1992-10-01

    Mapping of buried objects and regions of chemical and radiological contamination is required at US Department of Energy (DOE) buried waste sites. The DOE Office of Technology Development Robotics Integrated Program has initiated a project to develop and demonstrate a remotely controlled subsurface sensing system, called the Remote Characterization System (RCS). This project, a collaborative effort by five of the National Laboratories, involves the development of a unique low-signature survey vehicle, a base station, radio telemetry data links, satellite-based vehicle tracking, stereo vision, and sensors for non-invasive inspection of the surface and subsurface. To minimize interference with on-board sensors, the survey vehicle has been constructed predominatantly of non-metallic materials. The vehicle is self-propelled and will be guided by an operator located at a remote base station. The RCS sensors will be environmentally sealed and internally cooled to preclude contamination during use. Ground-penetrating radar, magnetometers, and conductivity devices are planned for geophysical surveys. Chemical and radiological sensors will be provided to locate hot spots and to provide isotopic concentration data.

  11. Combined geophysical methods for mapping infiltration pathways at the Aurora Water Aquifer recharge and recovery site

    NASA Astrophysics Data System (ADS)

    Jasper, Cameron A.

    Although aquifer recharge and recovery systems are a sustainable, decentralized, low cost, and low energy approach for the reclamation, treatment, and storage of post- treatment wastewater, they can suffer from poor infiltration rates and the development of a near-surface clogging layer within infiltration ponds. One such aquifer recharge and recovery system, the Aurora Water site in Colorado, U.S.A, functions at about 25% of its predicted capacity to recharge floodplain deposits by flooding infiltration ponds with post-treatment wastewater extracted from river bank aquifers along the South Platte River. The underwater self-potential method was developed to survey self-potential signals at the ground surface in a flooded infiltration pond for mapping infiltration pathways. A method for using heat as a groundwater tracer within the infiltration pond used an array of in situ high-resolution temperature sensing probes. Both relatively positive and negative underwater self-potential anomalies are consistent with observed recovery well pumping rates and specific discharge estimates from temperature data. Results from electrical resistivity tomography and electromagnetics surveys provide consistent electrical conductivity distributions associated with sediment textures. A lab method was developed for resistivity tests of near-surface sediment samples. Forward numerical modeling synthesizes the geophysical information to best match observed self- potential anomalies and provide permeability distributions, which is important for effective aquifer recharge and recovery system design, and optimization strategy development.

  12. Mapping of the Lunokhod-1 Landing Site: A Case Study for Future Lunar Exploration

    NASA Astrophysics Data System (ADS)

    Karachevtseva, I.; Oberst, J.; Konopikhin, A.; Shingareva, K.; Gusakova, E.; Kokhanov, A.; Baskakova, M.; Peters, O.; Scholten, F.; Wählisch, M.; Robinson, M.

    2012-04-01

    Introduction. Luna-17 landed on November 17, 1970 and deployed Lunokhod-1, the first remotely operated roving vehicle ever to explore a planetary surface. Within 332 days, the vehicle conquered a traverse of approx. 10 km. The rover was equipped with a navigation camera system as well as a scanner camera with which panoramic images were obtained. From separated stations, stereoscopic views were obtained. The history of the Lunokhods came back into focus recently, when the Lunar Reconnaissance Orbiter [1] obtained images from orbit at highest resolutions of 0.5-0.25 m/pixel. The Luna-17 landing platform as well as the roving vehicles at their final resting positions can clearly be identified. In addition, the rover tracks are clearly visible in most areas. From LRO stereo images, digital elevation model (DEM) of the Lunokhod-1 landing site areas have been derived [2]. These are useful to study the topographic profile and slopes of the traverse. The data are also useful to study the 3-D morphology of craters in the surroundings. Methodology. Lunokhod-1 area mapping have been done using GIS techniques. With CraterTools [3] we digitized craters in the Lunokhod-1 traverse area and created a geodatabase, which consists at this moment of about 45,000 craters including their diameters and depths, obtained from the DEM [4]. The LRO DEM also was used to measure traverse. We used automatic GIS functions for calculating various surface parameters of the Lunokhod-1 area surface including slopes, roughness, crater cumulative and spatial densities, and prepared respective thematic maps. We also measured relative depth (ratio D/H) and inner slopes of craters and classified craters by their morphological type using automatic and visual methods. Vertical profiles through several craters using the high resolution DEM have been done, and the results show good agreement with the topographic models with contours in 10cm that have been obtained from the Lunokhod-1 stereo images [5]. The

  13. Restriction-Site-Specific PCR as a Rapid Test To Detect Enterohemorrhagic Escherichia coli O157:H7 Strains in Environmental Samples

    PubMed Central

    Kimura, Richard; Mandrell, Robert E.; Galland, John C.; Hyatt, Doreene; Riley, Lee W.

    2000-01-01

    Enterohemorrhagic Escherichia coli (EHEC) O157:H7 is an important food-borne pathogen in industrialized countries. We developed a rapid and simple test for detecting E. coli O157:H7 using a method based on restriction site polymorphisms. Restriction-site-specific PCR (RSS-PCR) involves the amplification of DNA fragments using primers based on specific restriction enzyme recognition sequences, without the use of endonucleases, to generate a set of amplicons that yield “fingerprint” patterns when resolved electrophoretically on an agarose gel. The method was evaluated in a blinded study of E. coli isolates obtained from environmental samples collected at beef cattle feedyards. The 54 isolates were all initially identified by a commonly used polyclonal antibody test as belonging to O157:H7 serotype. They were retested by anti-O157 and anti-H7 monoclonal antibody enzyme-linked immunosorbent assay (ELISA). The RSS-PCR method identified all 28 isolates that were shown to be E. coli O157:H7 by the monoclonal antibody ELISA as belonging to the O157:H7 serotype. Of the remaining 26 ELISA-confirmed non-O157:H7 strains, the method classified 25 strains as non-O157:H7. The specificity of the RSS-PCR results correlated better with the monoclonal antibody ELISA than with the polyclonal antibody latex agglutination tests. The RSS-PCR method may be a useful test to distinguish E. coli O157:H7 from a large number of E. coli isolates from environmental samples. PMID:10831431

  14. Comparative receptor mapping of serotoninergic 5-HT3 and 5-HT4 binding sites*

    NASA Astrophysics Data System (ADS)

    López-Rodríguez, María L.; Morcillo, María José; Benhamú, Bellinda; Rosado, María Luisa

    1997-11-01

    The clinical use of currently available drugs acting at the5-HT4 receptor has been hampered by their lack of selectivityover 5-HT3 binding sites. For this reason, there is considerableinterest in the medicinal chemistry of these serotonin receptor subtypes, andsignificant effort has been made towards the discovery of potent and selectiveligands. Computer-aided conformational analysis was used to characterizeserotoninergic 5-HT3 and 5-HT4 receptorrecognition. On the basis of the generally accepted model of the5-HT3 antagonist pharmacophore, we have performed a receptormapping of this receptor binding site, following the active analog approach(AAA) defined by Marshall. The receptor excluded volume was calculated as theunion of the van der Waals density maps of nine active ligands(pKi ≥ 8.9), superimposed in pharmacophoric conformations.Six inactive analogs (pKi < 7.0) were subsequently used todefine the essential volume, which in its turn can be used to define theregions of steric intolerance of the 5-HT3 receptor. Five activeligands (pKi ≥ 9.3) at 5-HT4 receptors wereused to construct an antagonist pharmacophore for this receptor, and todetermine its excluded volume by superimposition of pharmacophoricconformations. The volume defined by the superimposition of five inactive5-HT4 receptor analogs that possess the pharmacophoric elements(pKi ≤ 6.6) did not exceed the excluded volume calculated forthis receptor. In this case, the inactivity may be due to the lack of positiveinteraction of the amino moiety with a hypothetical hydrophobic pocket, whichwould interact with the voluminous substituents of the basic nitrogen ofactive ligands. The difference between the excluded volumes of both receptorshas confirmed that the main difference is indeed in the basic moiety. Thus,the 5-HT3 receptor can only accommodate small substituents inthe position of the nitrogen atom, whereas the 5-HT4 receptorrequires more voluminous groups. Also, the basic nitrogen is located at ca

  15. Mapping of colicin E2 and colicin E3 plasmid deoxyribonucleic acid EcoR-1-sensitive sites.

    PubMed

    Inselburg, J; Johns, V

    1975-01-01

    Colicin plasmids E2 and E3 (Col E2 and Col E3) deoxyribonucleic acid (DNA) has been shown to contain, respectively, two and three EcoR1 restriction endonuclease-sensitive sites. This was determined by measuring the DNA fragments generated after EcoR1 endonuclease treatment by agarose gel electrophoresis and electron microscopy. The structure of heteroduplex Col E2-col E3 DNA molecules formed from EcoR1-generated fragments permitted a localization of the EcoR1-sensitive sites on the plasmid chromosomes.

  16. Thermo-switchable activity of the restriction endonuclease SsoII achieved by site-directed enzyme modification.

    PubMed

    Abrosimova, Liudmila A; Monakhova, Mayya V; Migur, Anzhela Yu; Wolfgang, Wende; Pingoud, Alfred; Kubareva, Elena A; Oretskaya, Tatiana S

    2013-12-01

    In this work, the possibility of constructing a thermo-switchable enzyme according to the "molecular gate" strategy is demonstrated. The approach is based on the covalent attachment of oligodeoxyribonucleotides to cysteine residues of an enzyme adjacent to its active center to form a temporal barrier for enzyme-substrate complex formation. The activity of the modified enzyme that had been studied here-the restriction endonuclease SsoII (R.SsoII)-was diminished by a factor of 180 at 25 °С that almost abolished the enzymatic activity when compared with the unmodified enzyme. However, heating of the modified enzyme to 45 °С resulted in a 30-fold increase of activity. The activity of unmodified R.SsoII also increased on heating from 25 to 45 °; however, the difference did not exceed a factor of 3-4. The changes in enzymatic activity observed were shown to be reversible for both the unmodified and the modified R.SsoII. Variation of the length and the sequence of the attached oligodeoxyribonucleotides might allow greater modulation of the activity of DNA-protein conjugates. © 2013 International Union of Biochemistry and Molecular Biology.

  17. Mapping subsurface pathways for contaminant migration at a proposed low level waste disposal site using electromagnetic methods

    SciTech Connect

    Pin, F.G.; Ketelle, R.H.

    1984-01-01

    Electromagnetic methods have been used to measure apparent terrain conductivity in the downstream portion of a watershed in which a waste disposal site is proposed. At that site, the pathways for waste migration in ground water are controlled by subsurface channels. The channels are identified using isocurves of measured apparent conductivity. Two upstream channel branches are found to merge into a single downstream channel which constitutes the main drainage path out of the watershed. The identification and mapping of the ground water pathways is an important contribution to the site characterization study and the pathways analysis. The direct applications of terrain conductivity mapping to the planning of the monitoring program, the hydrogeological testing, and the modeling study are demonstrated. 7 references, 4 figures.

  18. First-generation site-response maps for the Los Angeles region based on earthquake ground motions

    USGS Publications Warehouse

    Hartzell, S.; Harmsen, S.; Frankel, A.; Carver, D.; Cranswick, E.; Meremonte, M.; Michael, J.

    1998-01-01

    Ground-motion records from aftershocks of the 1994 Northridge earthquake and mainshock records from the 1971 San Fernando, 1987 Whittier Narrows, 1991 Sierra Madre, and 1994 Northridge earthquakes are used to estimate site response relative to a rock site for the urban Los Angeles area. Site response is estimated at 232 mainshock and 201 aftershock sites relative to a low-amplitude site in the Santa Monica Mountains. Average amplification values are calculated for the frequency bands: 1 to 3, 3 to 5, and 5 to 7 Hz. These bands are chosen based on limitations in aftershock recording equipment at lower frequencies and reduced significance to the building inventory at higher frequencies. Site amplification factors determined at the instrumented locations are grouped by the surficial geology and contoured to produce a continuous spatial estimation of amplification. The maps in this article represent the first attempt to produce estimates of site amplification based on observations of ground motion for such a large areal extent of the Los Angeles region. These maps are expected to evolve as more data become available and more analysis is done.

  19. Using integrated geospatial mapping and conceptual site models to guide risk-based environmental clean-up decisions.

    PubMed

    Mayer, Henry J; Greenberg, Michael R; Burger, Joanna; Gochfield, Michael; Powers, Charles; Kosson, David; Keren, Roger; Danis, Christine; Vyas, Vikram

    2005-04-01

    Government and private sector organizations are increasingly turning to the use of maps and other visual models to provide a depiction of environmental hazards and the potential risks they represent to humans and ecosystems. Frequently, the graphic presentation is tailored to address a specific contaminant, its location and possible exposure pathways, and potential receptors. Its format is usually driven by the data available, choice of graphics technology, and the audience being served. A format that is effective for displaying one contaminant at one scale at one site, however, may be ineffective in accurately portraying the circumstances surrounding a different contaminant at the same site, or the same contaminant at a different site, because of limitations in available data or the graphics technology being used. This is the daunting challenge facing the U.S. Department of Energy (DOE), which is responsible for the nation's legacy wastes from nuclear weapons research, testing, and production at over 100 sites in the United States. In this article, we discuss the development and use of integrated geospatial mapping and conceptual site models to identify hazards and evaluate alternative long-term environmental clean-up strategies at DOE sites located across the United States. While the DOE probably has the greatest need for such information, the Department of Defense and other public and private responsible parties for many large and controversial National Priority List or Superfund sites would benefit from a similar approach.

  20. Mapping Microbial Populations Relative to Sites of Ongoing Serpentinization: Results from the Tablelands Ophiolite Complex, Canada

    NASA Astrophysics Data System (ADS)

    Schrenk, M. O.; Brazelton, W. J.; Woodruff, Q.; Szponar, N.; Morrill, P. L.

    2010-12-01

    The aqueous alteration of ultramafic rocks (serpentinization) has been suggested to be a favorable process for the habitability of astrobodies in our solar system including subsurface environments of Mars and Europa. Serpentinization produces copious quantities of hydrogen and small organic molecules, and leads to highly reducing, highly alkaline conditions (up to pH 12) and a lack of dissolved inorganic carbon, which both stimulates and challenges microbial activities. Several environments on Earth provide insight into the relationships between serpentinization and microbial life including slow-spreading mid-ocean ridges, subduction zones, and ophiolite materials emplaced along continental margins. The Tablelands, an ophiolite in western Newfoundland, Canada provides an opportunity to carefully document and map the relationships between geochemical energy, microbial growth, and physiology. Alkaline fluids at the Tablelands originate from 500-million year old oceanic crust and accumulate in shallow pools or seep from beneath serpentinized talus. Fluids, rocks, and gases were collected from the Tablelands during a series of field excursions in 2009 and 2010, and geochemical, microscopic, molecular, and cultivation-based approaches were used to study the serpentinite microbial ecosystem. These samples provide an opportunity to generate a comprehensive map of microbial communities and their activities in space and time. Data indicate that a low but detectable stock of microorganisms inhabit high pH pools associated with end-member serpentinite fluids. Enrichment cultures yielded brightly pigmented colonies related to Alphaproteobacteria, presumably carrying out anoxygenic photosynthesis, and Firmicutes, presumably catalyzing the fermentation of organic matter. Culture-independent analyses of SSU rRNA using T-RFLP indicated low diversity communities of Firmicutes and Archaea in standing alkaline pools, communities of Beta- and Gammaproteobacteria at high pH seeps, and

  1. Structure–function analysis of the extracellular domain of the pneumococcal cell division site positioning protein MapZ

    PubMed Central

    Manuse, Sylvie; Jean, Nicolas L.; Guinot, Mégane; Lavergne, Jean-Pierre; Laguri, Cédric; Bougault, Catherine M.; VanNieuwenhze, Michael S.; Grangeasse, Christophe; Simorre, Jean-Pierre

    2016-01-01

    Accurate placement of the bacterial division site is a prerequisite for the generation of two viable and identical daughter cells. In Streptococcus pneumoniae, the positive regulatory mechanism involving the membrane protein MapZ positions precisely the conserved cell division protein FtsZ at the cell centre. Here we characterize the structure of the extracellular domain of MapZ and show that it displays a bi-modular structure composed of two subdomains separated by a flexible serine-rich linker. We further demonstrate in vivo that the N-terminal subdomain serves as a pedestal for the C-terminal subdomain, which determines the ability of MapZ to mark the division site. The C-terminal subdomain displays a patch of conserved amino acids and we show that this patch defines a structural motif crucial for MapZ function. Altogether, this structure–function analysis of MapZ provides the first molecular characterization of a positive regulatory process of bacterial cell division. PMID:27346279

  2. Structure-function analysis of the extracellular domain of the pneumococcal cell division site positioning protein MapZ

    NASA Astrophysics Data System (ADS)

    Manuse, Sylvie; Jean, Nicolas L.; Guinot, Mégane; Lavergne, Jean-Pierre; Laguri, Cédric; Bougault, Catherine M.; Vannieuwenhze, Michael S.; Grangeasse, Christophe; Simorre, Jean-Pierre

    2016-06-01

    Accurate placement of the bacterial division site is a prerequisite for the generation of two viable and identical daughter cells. In Streptococcus pneumoniae, the positive regulatory mechanism involving the membrane protein MapZ positions precisely the conserved cell division protein FtsZ at the cell centre. Here we characterize the structure of the extracellular domain of MapZ and show that it displays a bi-modular structure composed of two subdomains separated by a flexible serine-rich linker. We further demonstrate in vivo that the N-terminal subdomain serves as a pedestal for the C-terminal subdomain, which determines the ability of MapZ to mark the division site. The C-terminal subdomain displays a patch of conserved amino acids and we show that this patch defines a structural motif crucial for MapZ function. Altogether, this structure-function analysis of MapZ provides the first molecular characterization of a positive regulatory process of bacterial cell division.

  3. Cdc37 (cell division cycle 37) restricts Hsp90 (heat shock protein 90) motility by interaction with N-terminal and middle domain binding sites.

    PubMed

    Eckl, Julia M; Rutz, Daniel A; Haslbeck, Veronika; Zierer, Bettina K; Reinstein, Jochen; Richter, Klaus

    2013-05-31

    The ATPase-driven dimeric molecular Hsp90 (heat shock protein 90) and its cofactor Cdc37 (cell division cycle 37 protein) are crucial to prevent the cellular depletion of many protein kinases. In complex with Hsp90, Cdc37 is thought to bind an important lid structure in the ATPase domain of Hsp90 and inhibit ATP turnover by Hsp90. As different interaction modes have been reported, we were interested in the interaction mechanism of Hsp90 and Cdc37. We find that Cdc37 can bind to one subunit of the Hsp90 dimer. The inhibition of the ATPase activity is caused by a reduction in the closing rate of Hsp90 without obviously bridging the two subunits or affecting nucleotide accessibility to the binding site. Although human Cdc37 binds to the N-terminal domain of Hsp90, nematodal Cdc37 preferentially interacts with the middle domain of CeHsp90 and hHsp90, exposing two Cdc37 interaction sites. A previously unreported site in CeCdc37 is utilized for the middle domain interaction. Dephosphorylation of CeCdc37 by the Hsp90-associated phosphatase PPH-5, a step required during the kinase activation process, proceeds normally, even if only the new interaction site is used. This shows that the second interaction site is also functionally relevant and highlights that Cdc37, similar to the Hsp90 cofactors Sti1 and Aha1, may utilize two different attachment sites to restrict the conformational freedom and the ATP turnover of Hsp90.

  4. Cdc37 (Cell Division Cycle 37) Restricts Hsp90 (Heat Shock Protein 90) Motility by Interaction with N-terminal and Middle Domain Binding Sites*

    PubMed Central

    Eckl, Julia M.; Rutz, Daniel A.; Haslbeck, Veronika; Zierer, Bettina K.; Reinstein, Jochen; Richter, Klaus

    2013-01-01

    The ATPase-driven dimeric molecular Hsp90 (heat shock protein 90) and its cofactor Cdc37 (cell division cycle 37 protein) are crucial to prevent the cellular depletion of many protein kinases. In complex with Hsp90, Cdc37 is thought to bind an important lid structure in the ATPase domain of Hsp90 and inhibit ATP turnover by Hsp90. As different interaction modes have been reported, we were interested in the interaction mechanism of Hsp90 and Cdc37. We find that Cdc37 can bind to one subunit of the Hsp90 dimer. The inhibition of the ATPase activity is caused by a reduction in the closing rate of Hsp90 without obviously bridging the two subunits or affecting nucleotide accessibility to the binding site. Although human Cdc37 binds to the N-terminal domain of Hsp90, nematodal Cdc37 preferentially interacts with the middle domain of CeHsp90 and hHsp90, exposing two Cdc37 interaction sites. A previously unreported site in CeCdc37 is utilized for the middle domain interaction. Dephosphorylation of CeCdc37 by the Hsp90-associated phosphatase PPH-5, a step required during the kinase activation process, proceeds normally, even if only the new interaction site is used. This shows that the second interaction site is also functionally relevant and highlights that Cdc37, similar to the Hsp90 cofactors Sti1 and Aha1, may utilize two different attachment sites to restrict the conformational freedom and the ATP turnover of Hsp90. PMID:23569206

  5. MAPS

    Atmospheric Science Data Center

    2014-07-03

    ... Measurement of Air Pollution from Satellites (MAPS) data were collected during Space Shuttle flights in 1981, ... Facts Correlative Data  - CDIAC - Spring & Fall 1994 - Field and Aircraft Campaigns SCAR-B Block:  ...

  6. Synthesis and serotonin binding site studies of some conformationally restricted indolylethylamine analogues based on 2-amino-3-(3'-indolyl)bicyclo[2.2.2]octane.

    PubMed

    Schlecht, M F; Tsarouhtsis, D; Lipovac, M N; Debler, E A

    1990-01-01

    The bicycloannulation reaction between cyclohexenone and indolyl enamines yields trans-3-(cyclic amino)-2-(3'-indolyl)bicyclo[2.2.2]octan-5-ones, and these adducts are conformationally restricted analogues of indolylethylamine (tryptamine) which exhibit structure-dependent affinity for the serotonin 5HT2 and 5HT1a receptors. The stereochemistry of the isomeric endo and exo adducts obtained is assigned from the 1H NMR spectra of the specifically deuterated alkenes prepared from the ketones by the Bamford-Stevens reaction. Molecular mechanics calculations indicate that the conformational flexibility of the amino and indolyl groups is restricted through van der Waals interactions with the bridges of the bicyclic unit. These compounds inhibit the binding of [3H]ketanserin to 5HT2 sites in mouse cerebrocortical membranes, and the binding of [3H]-8-hydroxy-2-(di-n-propylamino)tetralin ([3H]-8-OH-DPAT) to 5HT1a sites in mouse hippocampal membranes. The endo compounds are the most potent, and molecular mechanics calculations indicate that these isomers have a less bulky bicyclo bridge proximate to the amine group and more conformational freedom about the C alpha-C beta-N(+)-H dihedral angle (tau 3). In the 5HT2 assay, endo-trans-3-(N-piperidinyl)-2-(3'-indolyl)bicyclo[2.2.2]octan-5-one (10a) is the most potent, and endo-trans-3-(N-pyrrolidinyl)-2-(3'-indolyl)bicyclo[2.2.2]oct-5-ene (12a) is the most potent in the 5HT1a assay. A phenyl-substituted adduct shows the least affinity in these two assays. These data provide insight into the structural differences between the 5HT1a and 5HT2 receptor sites.

  7. The abandoned surface mining sites in the Czech Republic: mapping and creating a database with a GIS web application

    NASA Astrophysics Data System (ADS)

    Pokorný, Richard; Tereza Peterková, Marie

    2016-05-01

    Based on the vectorization of the 55-volume book series the Quarry Inventories of the Czechoslovak Republic/Czechoslovak Socialist Republic, published in the years 1932-1961, a new comprehensive database was built comprising 9958 surface mining sites of raw materials, which were active in the first half of the 20th century. The mapped area covers 40.9 % of the territory of the Czech Republic. For the purposes of visualization, a map application, the Quarry Inventories Online, was created that enables the data visualization.

  8. Monoamines tissue content analysis reveals restricted and site-specific correlations in brain regions involved in cognition.

    PubMed

    Fitoussi, A; Dellu-Hagedorn, F; De Deurwaerdère, P

    2013-01-01

    The dopamine (DA), noradrenalin (NA) and serotonin (5-HT) monoaminergic systems are deeply involved in cognitive processes via their influence on cortical and subcortical regions. The widespread distribution of these monoaminergic networks is one of the main difficulties in analyzing their functions and interactions. To address this complexity, we assessed whether inter-individual differences in monoamine tissue contents of various brain areas could provide information about their functional relationships. We used a sensitive biochemical approach to map endogenous monoamine tissue content in 20 rat brain areas involved in cognition, including 10 cortical areas and examined correlations within and between the monoaminergic systems. Whereas DA content and its respective metabolite largely varied across brain regions, the NA and 5-HT contents were relatively homogenous. As expected, the tissue content varied among individuals. Our analyses revealed a few specific relationships (10%) between the tissue content of each monoamine in paired brain regions and even between monoamines in paired brain regions. The tissue contents of NA, 5-HT and DA were inter-correlated with a high incidence when looking at a specific brain region. Most correlations found between cortical areas were positive while some cortico-subcortical relationships regarding the DA, NA and 5-HT tissue contents were negative, in particular for DA content. In conclusion, this work provides a useful database of the monoamine tissue content in numerous brain regions. It suggests that the regulation of these neuromodulatory systems is achieved mainly at the terminals, and that each of these systems contributes to the regulation of the other two. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.

  9. Transposon Tc1-derived, sequence-tagged sites in Caenorhabditis elegans as markers for gene mapping

    PubMed Central

    Korswagen, Hendrik C.; Durbin, Richard M.; Smits, Miriam T.; Plasterk, Ronald H. A.

    1996-01-01

    We present an approach to map large numbers of Tc1 transposon insertions in the genome of Caenorhabditis elegans. Strains have been described that contain up to 500 polymorphic Tc1 insertions. From these we have cloned and shotgun sequenced over 2000 Tc1 flanks, resulting in an estimated set of 400 or more distinct Tc1 insertion alleles. Alignment of these sequences revealed a weak Tc1 insertion site consensus sequence that was symmetric around the invariant TA target site and reads CAYATATRTG. The Tc1 flanking sequences were compared with 40 Mbp of a C. elegans genome sequence. We found 151 insertions within the sequenced area, a density of ≈1 Tc1 insertion in every 265 kb. As the rest of the C. elegans genome sequence is obtained, remaining Tc1 alleles will fall into place. These mapped Tc1 insertions can serve two functions: (i) insertions in or near genes can be used to isolate deletion derivatives that have that gene mutated; and (ii) they represent a dense collection of polymorphic sequence-tagged sites. We demonstrate a strategy to use these Tc1 sequence-tagged sites in fine-mapping mutations. PMID:8962114

  10. Dephosphorylation of distinct sites on microtubule-associated protein MAP1B by protein phosphatases 1, 2A and 2B.

    PubMed

    Ulloa, L; Dombrádi, V; Díaz-Nido, J; Szücs, K; Gergely, P; Friedrich, P; Avila, J

    1993-09-06

    Rat brain microtubule-associated protein MAP1B has been tested as a substrate for Ser/Thr protein phosphatases (PP). The dephosphorylation reactions were followed by specific antibodies recognizing phosphorylated and phosphorylatable epitopes. One set of phosphorylation sites on MAP1B are referred to as mode I sites, and their phosphorylation is presumably catalyzed by proline-directed protein kinases. These mode I sites are efficiently dephosphorylated by PP2B and 2A but not by PP1. Another set of phosphorylation sites on MAP1B are named mode II sites, and their phosphorylation is possibly due to casein kinase II. These mode II sites are dephosphorylated by PP2A and PP1, the PP2B being ineffective. The selectivity of phosphatases for different sites within the same protein indicates the complexity of the dephosphorylation reactions regulating the functionality of MAP1B in neurons.

  11. Mapping site index and volume increment from forest inventory, Landsat, and ecological variables in Tahoe National Forest, California, USA

    USGS Publications Warehouse

    Huang, Shengli; Ramirez, Carlos; Conway, Scott; Kennedy, Kama; Kohler, Tanya; Liu, Jinxun

    2016-01-01

    High-resolution site index (SI) and mean annual increment (MAI) maps are desired for local forest management. We integrated field inventory, Landsat, and ecological variables to produce 30 m SI and MAI maps for the Tahoe National Forest (TNF) where different tree species coexist. We converted species-specific SI using adjustment factors. Then, the SI map was produced by (i) intensifying plots to expand the training sets to more climatic, topographic, soil, and forest reflective classes, (ii) using results from a stepwise regression to enable a weighted imputation that minimized the effects of outlier plots within classes, and (iii) local interpolation and strata median filling to assign values to pixels without direct imputations. The SI (reference age is 50 years) map had an R2 of 0.7637, a root-mean-square error (RMSE) of 3.60, and a mean absolute error (MAE) of 3.07 m. The MAI map was similarly produced with an R2 of 0.6882, an RMSE of 1.73, and a MAE of 1.20 m3·ha−1·year−1. Spatial patterns and trends of SI and MAI were analyzed to be related to elevation, aspect, slope, soil productivity, and forest type. The 30 m SI and MAI maps can be used to support decisions on fire, plantation, biodiversity, and carbon.

  12. Mapping the lipoylation site of Arabidopsis thaliana plastidial dihydrolipoamide S-acetyltransferase using mass spectrometry and site-directed mutagenesis.

    PubMed

    Casteel, Jill; Miernyk, Ján A; Thelen, Jay J

    2011-11-01

    Catalytic enhancement achieved by the pyruvate dehydrogenase complex (PDC) results from a combination of substrate channeling plus active-site coupling. The mechanism for active-site coupling involves lipoic acid prosthetic groups covalently attached to Lys in the primary sequence of the dihydrolipoyl S-acetyltransferase (E2) component. Arabidopsis thaliana plastidial E2 (AtplE2-1A-His(6)) was expressed in Escherichia coli. Analysis of recombinant protein by SDS-PAGE revealed a Mr 59,000 band. Supplementation of bacterial culture medium with l-lipoic acid (LA) shifted the band to Mr 57,000. Intact mass determinations using matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry (MS) revealed the faster migrating E2 species was 189 Da larger than the slower migrating form, exactly the difference that would result from addition of a single lipoamide group. Results from systematic MALDI-TOF analysis of Lys-containing tryptic peptides derived from purified recombinant AtplE2-1A indicate that Lys96 is the site of lipoyl-addition. Analysis of Lys96 site-directed mutant proteins showed that they migrated as single species during SDS-PAGE when expressed in either the absence or presence of supplemental LA. Results from both intact and tryptic peptide mass determinations by MALDI-TOF MS confirmed that the mutant proteins were not lipoylated. The A. thaliana plastidial E2 subunit includes a single lipoyl-prosthetic group covalently attached to Lys96. Despite low primary sequence identity with bacterial E2, the plant E2 protein was recognized and modified by E. coli E2 lipoyl-addition system. Results from meta-genomic analysis suggest a β-turn is more important in defining the site for LA addition than a conserved sequence motif. Copyright © 2011. Published by Elsevier Masson SAS.

  13. Using JournalMap to link spatial information with ecological site descriptions

    USDA-ARS?s Scientific Manuscript database

    JournalMap is a scientific literature search engine that empowers you to find relevant research based on location and biophysical variables as well as traditional keyword searches. All publications are geotagged based on reported location information and plotted on a world map showing where the rese...

  14. Ground-water maps of the Hanford Site Separations Area, December 1987

    SciTech Connect

    Schatz, A.L.; Ammerman, J.J.

    1988-03-01

    The ground-water maps of the Separations Area are prepared by the Environmental Technology Section of the Defense Waste Management Division of Westinghouse Hanford Company. The Separations Area consists of the 200 East and 200 West Areas, where chemical processing activities are carried out. This set of ground-water maps consists of a water-table map of the unconfined aquifer, a depth-to-water map of the unconfined aquifer, and a potentiometric map of the uppermost confined aquifer (the Rattlesnake Ridge sedimentary interbed) in the area where West Lake, the deactivated Gable Mountain Pond, and the B Pond system are located. The Separations Area water-table map is prepared from water-level measurements made in June and December. For the December 1987 map approximately 200 wells were used for contouring the water table. The water-table mound beneath the deactivated U Pond has decreased in size since the June 1987 measurements were taken, reflecting the impact of shutting off flow to the pond in the fall of 1984. This mound has declined approximately 8 ft. since 1984. The water-table map also shows the locations of wells where the December 1987 measurements were made, and the data for these measurements are listed.

  15. Dynamic prescription maps for site-specific variable rate irrigation of cotton

    USDA-ARS?s Scientific Manuscript database

    A prescription map is a set of instructions that controls a variable rate irrigation (VRI) system. These maps, which may be based on prior yield, soil texture, topography, or soil electrical conductivity data, are often manually applied at the beginning of an irrigation season and remain static. The...

  16. Candidate disease resistance genes in sunflower cloned using conserved nucleotide-binding site motifs: genetic mapping and linkage to the downy mildew resistance gene Pl1.

    PubMed

    Gedil, M A; Slabaugh, M B; Berry, S; Johnson, R; Michelmore, R; Miller, J; Gulya, T; Knapp, S J

    2001-04-01

    Disease resistance gene candidates (RGCs) belonging to the nucleotide-binding site (NBS) superfamily have been cloned from numerous crop plants using highly conserved DNA sequence motifs. The aims of this research were to (i) isolate genomic DNA clones for RGCs in cultivated sunflower (Helianthus annuus L.) and (ii) map RGC markers and Pl1, a gene for resistance to downy mildew (Plasmopara halstedii (Farl.) Berl. & de Toni) race 1. Degenerate oligonucleotide primers targeted to conserved NBS DNA sequence motifs were used to amplify RGC fragments from sunflower genomic DNA. PCR products were cloned, sequenced, and assigned to 11 groups. RFLP analyses mapped six RGC loci to three linkage groups. One of the RGCs (Ha-4W2) was linked to Pl1, a downy mildew resistance gene. A cleaved amplified polymorphic sequence (CAPS) marker was developed for Ha-4W2 using gene-specific oligonucleotide primers. Downy mildew susceptible lines (HA89 and HA372) lacked a 276-bp Tsp5091 restriction fragment that was present in downy mildew resistant lines (HA370, 335, 336, 337, 338, and 339). HA370 x HA372 F2 progeny were genotyped for the Ha-4W2 CAPS marker and phenotyped for resistance to downy mildew race 1. The CAPS marker was linked to but did not completely cosegregate with Pl1 on linkage group 8. Ha-4W2 was found to comprise a gene family with at least five members. Although genetic markers for Ha-4W2 have utility for marker-assisted selection, the RGC detected by the CAPS marker has been ruled out as a candidate gene for Pl1. Three of the RGC probes were monomorphic between HA370 and HA372 and still need to be mapped and screened for linkage to disease resistance loci.

  17. HPV integration detection in CaSki and SiHa using detection of integrated papillomavirus sequences and restriction-site PCR.

    PubMed

    Raybould, Rachel; Fiander, Alison; Wilkinson, Gavin W G; Hibbitts, Sam

    2014-09-01

    Human Papillomavirus (HPV) infection is the primary cause of cervical neoplasia. HPV DNA is integrated into the human genome in the majority of cervical cancers. The nature of integration may differ with integration incorporating a single copy of HPV or occurring in concatenated form. Our understanding of HPV tumorigenesis is largely based on studies using characterised cell lines with defined integration sites; these cell lines provide an invaluable standard for validation of diagnostic assays. Cell lines also further understanding of integration mechanisms in clinical samples. The objective of this study was to explore integration assays and to investigate integration events in cell lines where HPV is integrated in concatenated form. Restriction site PCR and detection of integrated papillomavirus sequences were performed on DNA from SiHa and CaSki. A novel integration site on Xq27.3 and HPV genome rearrangements were detected in CaSki DNA. However, where integration was previously detected by FISH in CaSki, and reported to be integrated in concatenated form, integration was not detected by DIPS or RS-PCR. The data presented illustrate that HPV copy number can hinder integration detection; this needs consideration when interpreting results from tests applied to clinical samples.

  18. The human mast cell chymase gene (CMA1): Mapping to the cathepsin G/granzyme gene cluster and lineage-restricted expression

    SciTech Connect

    Caughey, G.H.; Schaumberg, T.H.; Zerweck, E.H. ); Butterfield, J.H. ); Hanson, R.D.; Ley, T.J. ); Silverman, G.A. )

    1993-03-01

    Genes encoding T-cell receptor [alpha]/[delta] chains, neutrophil cathepsin G, and lymphocyte CGL/granzymes are closely linked on chromosomal band 14q11.2. The current work identifies the human mast cell chymase gene (CMA1) as the fourth protease in this cluster and maps the gene to within 150 kb of the cathepsin G gene. The gene order is centromere-T cell receptor [alpha]/[delta]-CGL-1/granzyme B-CGL-2/granzyme H-cathepsin G-chymase. Chymase and cathepsin G genes are shown to be cotranscribed in the human mast cell line HMC-1 and in U-937 cells. Other cells transcribe cathepsin G or CGL/granzyme genes, but not chymase genes, suggesting a capacity for independent regulation. Comparison of the 5[prime] flank of the chymase gene with those of cathepsin G and CGL/granzymes reveals little overall homology. Only short regions of the 5[prime] flanks of the human and murine chymase genes sequenced to date are similar, suggesting that they are more distantly related than human and rodent CGL-1/granzyme B, the flanks of which are highly homologous. The expression patterns and clustering of genes provide possible clues to the presence of locus control regions that orchestrate lineage-restricted expression of leukocyte and mast cell proteases. 30 refs., 4 figs., 1 tab.

  19. Geologic Site Characterization of the North Korean Nuclear Test Site at Punggye-Ri: A Reconnaissance Mapping Redux

    DTIC Science & Technology

    2013-11-30

    geologic text states that Manthapsan is a multiphase intrusion into carbonate rocks of the Puktaechon Series, dipping 40 to 70 degrees towards the...Jurassic-Triassic, 250-145 Ma) intrusive igneous rocks , as well as Cenozoic and Quaternary (ɚ.5 Ma) (extrusive volcanic rocks extending toward the test...site area are low- porosity, dense, intrusive and extrusive igneous rocks, including granites (considered the most likely source rock), basalts, and

  20. Use of enhancer trapping to identify pathogen-induced regulatory events spatially restricted to plant-microbe interaction sites.

    PubMed

    Schroeder, Mercedes; Tsuchiya, Tokuji; He, Shuilin; Eulgem, Thomas

    2016-04-01

    Plant genes differentially expressed during plant-pathogen interactions can be important for host immunity or can contribute to pathogen virulence. Large-scale transcript profiling studies, such as microarray- or mRNA-seq-based analyses, have revealed hundreds of genes that are differentially expressed during plant-pathogen interactions. However, transcriptional responses limited to a small number of cells at infection sites can be difficult to detect using these approaches, as they are under-represented in the whole-tissue datasets typically generated by such methods. This study examines the interactions between Arabidopsis thaliana (Arabidopsis) and the pathogenic oomycete Hyaloperonospora arabidopsidis (Hpa) by enhancer trapping to uncover novel plant genes involved in local infection responses. We screened a β-glucuronidase (GUS) reporter-based enhancer-trap population for expression patterns related to Hpa infection. Several independent lines exhibited GUS expression in leaf mesophyll cells surrounding Hpa structures, indicating a regulatory response to pathogen infection. One of these lines contained a single enhancer-trap insertion in an exon of At1g08800 (MyoB1, Myosin Binding Protein 1) and was subsequently found to exhibit reduced susceptibility to Hpa. Two additional Arabidopsis lines with T-DNA insertions in exons of MyoB1 also exhibited approximately 30% fewer spores than wild-type plants. This study demonstrates that our enhancer-trapping strategy can result in the identification of functionally relevant pathogen-responsive genes. Our results further suggest that MyoB1 either positively contributes to Hpa virulence or negatively affects host immunity against this pathogen.

  1. Comparative Genomics Reveals the Diversity of Restriction-Modification Systems and DNA Methylation Sites in Listeria monocytogenes.

    PubMed

    Chen, Poyin; den Bakker, Henk C; Korlach, Jonas; Kong, Nguyet; Storey, Dylan B; Paxinos, Ellen E; Ashby, Meredith; Clark, Tyson; Luong, Khai; Wiedmann, Martin; Weimer, Bart C

    2017-02-01

    Listeria monocytogenes is a bacterial pathogen that is found in a wide variety of anthropogenic and natural environments. Genome sequencing technologies are rapidly becoming a powerful tool in facilitating our understanding of how genotype, classification phenotypes, and virulence phenotypes interact to predict the health risks of individual bacterial isolates. Currently, 57 closed L. monocytogenes genomes are publicly available, representing three of the four phylogenetic lineages, and they suggest that L. monocytogenes has high genomic synteny. This study contributes an additional 15 closed L. monocytogenes genomes that were used to determine the associations between the genome and methylome with host invasion magnitude. In contrast to previous findings, large chromosomal inversions and rearrangements were detected in five isolates at the chromosome terminus and within rRNA genes, including a previously undescribed inversion within rRNA-encoding regions. Each isolate's epigenome contained highly diverse methyltransferase recognition sites, even within the same serotype and methylation pattern. Eleven strains contained a single chromosomally encoded methyltransferase, one strain contained two methylation systems (one system on a plasmid), and three strains exhibited no methylation, despite the occurrence of methyltransferase genes. In three isolates a new, unknown DNA modification was observed in addition to diverse methylation patterns, accompanied by a novel methylation system. Neither chromosome rearrangement nor strain-specific patterns of epigenome modification observed within virulence genes were correlated with serotype designation, clonal complex, or in vitro infectivity. These data suggest that genome diversity is larger than previously considered in L. monocytogenes and that as more genomes are sequenced, additional structure and methylation novelty will be observed in this organism.

  2. Site-condition map for Portugal based on Vs30 values and evaluation of the applicability of Vs30 proxies

    NASA Astrophysics Data System (ADS)

    Narciso, Joao; Vilanova, Susana; Carvalho, Joao; Pinto, Carlos; Lopes, Isabel; Nemser, Eliza; Sousa Oliveira, Carlos; Borges, Jose

    2013-04-01

    Maps providing information on site conditions are essential tools to accurately represent the spatial distribution of ground motions, both in seismic hazard maps and in instrumental intensity maps (ShakeMaps). Project SCENE, funded by the Portuguese Foundation for Science and Technology, aims at characterizing the site conditions for Portugal and to outline a first-order site effects map to be used in seismic hazard assessment at a national level. In the context of project SCENE we developed a database of available shear-wave velocity profiles together with surface-geology data and geotechnical data. Currently the database includes around 60 profiles dispersed in a variety of lithological and geological units. The vast majority of data consist of seismic refraction sections that were acquired both within the scope of ongoing research projects SCENE and NEFITAG, and previously performed CAPSA and ERSTA campaigns. Few sites analyzed with multichannel analysis of surface waves by Lopes et al. (2005) were also included. The Vs30 values calculated from the profiles range from 100 m/s to1000 m/s, but the higher values are poorly represented. We performed a careful evaluation of the geological conditions at database sites, using the smallest scale available maps (usually 1:50000), and grouped it into six generalized geological units. The variability of the distribution of Vs30 values varies significantly with the generalized geological unit. Holocene deposits and Pliocene units display the lowest variance. On the other hand the Pleistocene and Miocene units, which are characterized in Portugal by a large lithological variety, display a large dispersion. Geological outcrop studies and the analysis of geotechnical data in close association the seismic refraction data acquisition are currently under way to better understand this velocity-lithology relation. The use of proxies based either on exogenous geological-geographical defined units (Wills et al., 2006) or topographic

  3. Mapping General Anesthetic Sites in Heteromeric γ-Aminobutyric Acid Type A Receptors Reveals a Potential For Targeting Receptor Subtypes.

    PubMed

    Forman, Stuart A; Miller, Keith W

    2016-11-01

    IV general anesthetics, including propofol, etomidate, alphaxalone, and barbiturates, produce important actions by enhancing γ-aminobutyric acid type A (GABAA) receptor activation. In this article, we review scientific studies that have located and mapped IV anesthetic sites using photoaffinity labeling and substituted cysteine modification protection. These anesthetics bind in transmembrane pockets between subunits of typical synaptic GABAA receptors, and drugs that display stereoselectivity also show remarkably selective interactions with distinct interfacial sites. These results suggest strategies for developing new drugs that selectively modulate distinct GABAA receptor subtypes.

  4. Risk map and spatial determinants of pancreas disease in the marine phase of Norwegian Atlantic salmon farming sites

    PubMed Central

    2012-01-01

    Background Outbreaks of pancreas disease (PD) greatly contribute to economic losses due to high mortality, control measures, interrupted production cycles, reduced feed conversion and flesh quality in the aquaculture industries in European salmon-producing countries. The overall objective of this study was to evaluate an effect of potential factors contributing to PD occurrence accounting for spatial congruity of neighboring infected sites, and then create quantitative risk maps for predicting PD occurrence. The study population included active Atlantic salmon farming sites located in the coastal area of 6 southern counties of Norway (where most of PD outbreaks have been reported so far) from 1 January 2009 to 31 December 2010. Results Using a Bayesian modeling approach, with and without spatial component, the final model included site latitude, site density, PD history, and local biomass density. Clearly, the PD infected sites were spatially clustered; however, the cluster was well explained by the covariates of the final model. Based on the final model, we produced a map presenting the predicted probability of the PD occurrence in the southern part of Norway. Subsequently, the predictive capacity of the final model was validated by comparing the predicted probabilities with the observed PD outbreaks in 2011. Conclusions The framework of the study could be applied for spatial studies of other infectious aquatic animal diseases. PMID:23006469

  5. Digital Aeromagnetic Map of the Nevada Test Site and Vicinity, Nye, Lincoln, and Clark Counties, Nevada, and Inyo County, California

    USGS Publications Warehouse

    Ponce, David A.

    2000-01-01

    An aeromagnetic map of the Nevada Test Site area was prepared from publicly available aeromagnetic data described by McCafferty and Grauch (1997). Magnetic surveys were processed using standard techniques. Southwest Nevada is characterized by magnetic anomalies that reflect the distribution of thick sequences of volcanic rocks, magnetic sedimentary rocks, and the occurrence of granitic rocks. In addition, aeromagnetic data reveal the presence of linear features that reflect faulting at both regional and local scales.

  6. Modular Robotics for Delivering On-Site contamination Sensors and Mapping Systems to Difficult-to-Access Locations

    SciTech Connect

    Geisinger, Joseph

    2001-05-21

    Presently, characterization operations are scheduled for thousands of facilities and pieces of equipment throughout DOE sites, each of which requires manual surveying with handheld instruments and manual record keeping. Such work, particularly in difficult-to-access-areas, results in significant amounts of worker exposure, long timelines and additional secondary waste generation. Therefore, a distinct need exists for remote tools that can quickly deploy sensors and automated contamination mapping systems into these areas.

  7. Multidisciplinary geophysical approach to map a disposal site: The Ponza island case study

    NASA Astrophysics Data System (ADS)

    Sapia, Vincenzo; Baccheschi, Paola; Villani, Fabio; Taroni, Matteo; Marchetti, Marco

    2017-03-01

    Electrical resistivity tomography (ERT) and magnetometric surveys are extensively used for environmental investigations of uncontrolled landfills, where the presence of waste with potential contaminants and metal objects requires a detailed characterization and monitoring of their subsurface location. Capacitively-coupled resistivity (CCR) measurements applied for similar environmental studies are far less used. In this study, we show the results and discuss the advantages of a combined application of ERT, CCR and magnetometric surveys applied to the characterization of the disposal site of Mt. Pagliaro, in the island of Ponza (central Italy). The survey area is located on volcanic deposits, which characterize the low resistive geological bedrock. We acquired four CCR profiles and five ERT profiles in addition to a magnetic survey covering a total area of about 7000 m2. The recovered smooth resistivity models suggest the presence of a shallow resistive layer (ρ > 75 Ωm) of variable thickness (2.0-6.0 m), overlying a relatively low-resistive layer, which we interpret as the electrical response of the volcanic bedrock. This interpretation is supported by few shallow boreholes and field observation in the northern part of the landfill area. The magnetic maps show three suspicious dipolar magnetic anomalies, probably ascribed to the presence of a high concentration of buried ferrous waste. Several small-scale dipolar anomalies have been interpreted as due to the presence of sparse and shallow metal objects within the waste material. Due to the resistivity models' smoothness, to improve the characterization of the interface between the bedrock and the waste material we performed a statistical analysis of the resistivity data. Following the philosophy of the steepest gradient method, we found a significative change in resistivity computed on an averaged depth resistivity function of the ERT data. Accordingly, we classify two distinct units: a) an upper unit, with

  8. Recording and labeling at a site along the cochlea shows alignment of medial olivocochlear and auditory nerve tonotopic mappings

    PubMed Central

    2016-01-01

    Medial olivocochlear (MOC) neurons provide an efferent innervation to outer hair cells (OHCs) of the cochlea, but their tonotopic mapping is incompletely known. In the present study of anesthetized guinea pigs, the MOC mapping was investigated using in vivo, extracellular recording, and labeling at a site along the cochlear course of the axons. The MOC axons enter the cochlea at its base and spiral apically, successively turning out to innervate OHCs according to their characteristic frequencies (CFs). Recordings made at a site in the cochlear basal turn yielded a distribution of MOC CFs with an upper limit, or “edge,” due to usually absent higher-CF axons that presumably innervate more basal locations. The CFs at the edge, normalized across preparations, were equal to the CFs of the auditory nerve fibers (ANFs) at the recording sites (near 16 kHz). Corresponding anatomical data from extracellular injections showed spiraling MOC axons giving rise to an edge of labeling at the position of a narrow band of labeled ANFs. Overall, the edges of the MOC CFs and labeling, with their correspondences to ANFs, suggest similar tonotopic mappings of these efferent and afferent fibers, at least in the cochlear basal turn. They also suggest that MOC axons miss much of the position of the more basally located cochlear amplifier appropriate for their CF; instead, the MOC innervation may be optimized for protection from damage by acoustic overstimulation. PMID:26823515

  9. Mapping the heparin-binding site of the BMP antagonist gremlin by site-directed mutagenesis based on predictive modelling.

    PubMed

    Tatsinkam, Arnold Junior; Mulloy, Barbara; Rider, Christopher C

    2015-08-15

    Gremlin is a member of the CAN (cerberus and DAN) family of secreted BMP (bone morphogenetic protein) antagonists and also an agonist of VEGF (vascular endothelial growth factor) receptor-2. It is critical in limb skeleton and kidney development and is re-expressed during tissue fibrosis. Gremlin binds strongly to heparin and heparan sulfate and, in the present study, we sought to investigate its heparin-binding site. In order to explore a putative non-contiguous binding site predicted by computational molecular modelling, we substituted a total of 11 key arginines and lysines located in three basic residue sequence clusters with homologous sequences from cerberus and DAN (differential screening selected gene abberative in neuroblastoma), CAN proteins which lack basic residues in these positions. A panel of six Myc-tagged gremlin mutants, MGR-1-MGR-6 (MGR, mutant gremlin), each containing different combinations of targeted substitutions, all showed markedly reduced affinity for heparin as demonstrated by their NaCl elution on heparin affinity chromatography, thus verifying our predictions. Both MGR-5 and MGR-6 retained BMP-4-binding activity comparable to that of wild-type gremlin. Low-molecular-mass heparin neither promoted nor inhibited BMP-4 binding. Finally, glutaraldehyde cross-linking demonstrated that gremlin forms non-covalent dimers, similar behaviour to that of DAN and also PRDC (protein related to cerberus and DAN), another CAN protein. The resulting dimer would possess two heparin-binding sites, each running along an exposed surface on the second β-strand finger loop of one of the monomers.

  10. An automated approach to mapping ecological sites using hyper-temporal remote sensing and SVM classification

    USDA-ARS?s Scientific Manuscript database

    The development of ecological sites as management units has emerged as a highly effective land management framework, but its utility has been limited by spatial ambiguity of ecological site locations in the U.S., lack of ecological site concepts in many other parts of the world, and the inability to...

  11. Toward a physical map of Drosophila buzzatii. Use of randomly amplified polymorphic dna polymorphisms and sequence-tagged site landmarks.

    PubMed Central

    Laayouni, H; Santos, M; Fontdevila, A

    2000-01-01

    We present a physical map based on RAPD polymorphic fragments and sequence-tagged sites (STSs) for the repleta group species Drosophila buzzatii. One hundred forty-four RAPD markers have been used as probes for in situ hybridization to the polytene chromosomes, and positive results allowing the precise localization of 108 RAPDs were obtained. Of these, 73 behave as effectively unique markers for physical map construction, and in 9 additional cases the probes gave two hybridization signals, each on a different chromosome. Most markers (68%) are located on chromosomes 2 and 4, which partially agree with previous estimates on the distribution of genetic variation over chromosomes. One RAPD maps close to the proximal breakpoint of inversion 2z(3) but is not included within the inverted fragment. However, it was possible to conclude from this RAPD that the distal breakpoint of 2z(3) had previously been wrongly assigned. A total of 39 cytologically mapped RAPDs were converted to STSs and yielded an aggregate sequence of 28,431 bp. Thirty-six RAPDs (25%) did not produce any detectable hybridization signal, and we obtained the DNA sequence from three of them. Further prospects toward obtaining a more developed genetic map than the one currently available for D. buzzatii are discussed. PMID:11102375

  12. Large-scale mapping of transposable element insertion sites using digital encoding of sample identity.

    PubMed

    Gohl, Daryl M; Freifeld, Limor; Silies, Marion; Hwa, Jennifer J; Horowitz, Mark; Clandinin, Thomas R

    2014-03-01

    Determining the genomic locations of transposable elements is a common experimental goal. When mapping large collections of transposon insertions, individualized amplification and sequencing is both time consuming and costly. We describe an approach in which large numbers of insertion lines can be simultaneously mapped in a single DNA sequencing reaction by using digital error-correcting codes to encode line identity in a unique set of barcoded pools.

  13. Groundwater contaminant plume maps and volumes, 100-K and 100-N Areas, Hanford Site, Washington

    USGS Publications Warehouse

    Johnson, Kenneth H.

    2016-09-27

    This study provides an independent estimate of the areal and volumetric extent of groundwater contaminant plumes which are affected by waste disposal in the 100-K and 100-N Areas (study area) along the Columbia River Corridor of the Hanford Site. The Hanford Natural Resource Trustee Council requested that the U.S. Geological Survey perform this interpolation to assess the accuracy of delineations previously conducted by the U.S. Department of Energy and its contractors, in order to assure that the Natural Resource Damage Assessment could rely on these analyses. This study is based on previously existing chemical (or radionuclide) sampling and analysis data downloaded from publicly available Hanford Site Internet sources, geostatistically selected and interpreted as representative of current (from 2009 through part of 2012) but average conditions for groundwater contamination in the study area. The study is limited in scope to five contaminants—hexavalent chromium, tritium, nitrate, strontium-90, and carbon-14, all detected at concentrations greater than regulatory limits in the past.All recent analytical concentrations (or activities) for each contaminant, adjusted for radioactive decay, non-detections, and co-located wells, were converted to log-normal distributions and these transformed values were averaged for each well location. The log-normally linearized well averages were spatially interpolated on a 50 × 50-meter (m) grid extending across the combined 100-N and 100-K Areas study area but limited to avoid unrepresentative extrapolation, using the minimum curvature geostatistical interpolation method provided by SURFER®data analysis software. Plume extents were interpreted by interpolating the log-normally transformed data, again using SURFER®, along lines of equal contaminant concentration at an appropriate established regulatory concentration . Total areas for each plume were calculated as an indicator of relative environmental damage. These plume

  14. Mapping of the Allosteric Site in Cholesterol Hydroxylase CYP46A1 for Efavirenz, a Drug That Stimulates Enzyme Activity*

    PubMed Central

    Anderson, Kyle W.; Mast, Natalia; Hudgens, Jeffrey W.; Lin, Joseph B.; Turko, Illarion V.; Pikuleva, Irina A.

    2016-01-01

    Cytochrome P450 46A1 (CYP46A1) is a microsomal enzyme and cholesterol 24-hydroxylase that controls cholesterol elimination from the brain. This P450 is also a potential target for Alzheimer disease because it can be activated pharmacologically by some marketed drugs, as exemplified by efavirenz, the anti-HIV medication. Previously, we suggested that pharmaceuticals activate CYP46A1 allosterically through binding to a site on the cytosolic protein surface, which is different from the enzyme active site facing the membrane. Here we identified this allosteric site for efavirenz on CYP46A1 by using a combination of hydrogen-deuterium exchange coupled to MS, computational modeling, site-directed mutagenesis, and analysis of the CYP46A1 crystal structure. We also mapped the binding region for the CYP46A1 redox partner oxidoreductase and found that the allosteric and redox partner binding sites share a common border. On the basis of the data obtained, we propose the mechanism of CYP46A1 allostery and the pathway for the signal transmission from the P450 allosteric site to the active site. PMID:27056331

  15. Mapping of the Allosteric Site in Cholesterol Hydroxylase CYP46A1 for Efavirenz, a Drug That Stimulates Enzyme Activity.

    PubMed

    Anderson, Kyle W; Mast, Natalia; Hudgens, Jeffrey W; Lin, Joseph B; Turko, Illarion V; Pikuleva, Irina A

    2016-05-27

    Cytochrome P450 46A1 (CYP46A1) is a microsomal enzyme and cholesterol 24-hydroxylase that controls cholesterol elimination from the brain. This P450 is also a potential target for Alzheimer disease because it can be activated pharmacologically by some marketed drugs, as exemplified by efavirenz, the anti-HIV medication. Previously, we suggested that pharmaceuticals activate CYP46A1 allosterically through binding to a site on the cytosolic protein surface, which is different from the enzyme active site facing the membrane. Here we identified this allosteric site for efavirenz on CYP46A1 by using a combination of hydrogen-deuterium exchange coupled to MS, computational modeling, site-directed mutagenesis, and analysis of the CYP46A1 crystal structure. We also mapped the binding region for the CYP46A1 redox partner oxidoreductase and found that the allosteric and redox partner binding sites share a common border. On the basis of the data obtained, we propose the mechanism of CYP46A1 allostery and the pathway for the signal transmission from the P450 allosteric site to the active site.

  16. Photoaffinity labeling with cholesterol analogues precisely maps a cholesterol-binding site in voltage-dependent anion channel-1.

    PubMed

    Budelier, Melissa M; Cheng, Wayland W L; Bergdoll, Lucie; Chen, Zi-Wei; Janetka, James W; Abramson, Jeff; Krishnan, Kathiresan; Mydock-McGrane, Laurel; Covey, Douglas F; Whitelegge, Julian P; Evers, Alex S

    2017-06-02

    Voltage-dependent anion channel-1 (VDAC1) is a highly regulated β-barrel membrane protein that mediates transport of ions and metabolites between the mitochondria and cytosol of the cell. VDAC1 co-purifies with cholesterol and is functionally regulated by cholesterol, among other endogenous lipids. Molecular modeling studies based on NMR observations have suggested five cholesterol-binding sites in VDAC1, but direct experimental evidence for these sites is lacking. Here, to determine the sites of cholesterol binding, we photolabeled purified mouse VDAC1 (mVDAC1) with photoactivatable cholesterol analogues and analyzed the photolabeled sites with both top-down mass spectrometry (MS), and bottom-up MS paired with a clickable, stable isotope-labeled tag, FLI-tag. Using cholesterol analogues with a diazirine in either the 7 position of the steroid ring (LKM38) or the aliphatic tail (KK174), we mapped a binding pocket in mVDAC1 localized to Thr(83) and Glu(73), respectively. When Glu(73) was mutated to a glutamine, KK174 no longer photolabeled this residue, but instead labeled the nearby Tyr(62) within this same binding pocket. The combination of analytical strategies employed in this work permits detailed molecular mapping of a cholesterol-binding site in a protein, including an orientation of the sterol within the site. Our work raises the interesting possibility that cholesterol-mediated regulation of VDAC1 may be facilitated through a specific binding site at the functionally important Glu(73) residue. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Genomic mapping of Suppressor of Hairy-wing binding sites in Drosophila.

    PubMed

    Adryan, Boris; Woerfel, Gertrud; Birch-Machin, Ian; Gao, Shan; Quick, Marie; Meadows, Lisa; Russell, Steven; White, Robert

    2007-01-01

    Insulator elements are proposed to play a key role in the organization of the regulatory architecture of the genome. In Drosophila, one of the best studied is the gypsy retrotransposon insulator, which is bound by the Suppressor of Hairy-wing (Su [Hw]) transcriptional regulator. Immunolocalization studies suggest that there are several hundred Su(Hw) sites in the genome, but few of these endogenous Su(Hw) binding sites have been identified. We used chromatin immunopurification with genomic microarray analysis to identify in vivo Su(Hw) binding sites across the 3 megabase Adh region. We find 60 sites, and these enabled the construction of a robust new Su(Hw) binding site consensus. In contrast to the gypsy insulator, which contains tightly clustered Su(Hw) binding sites, endogenous sites generally occur as isolated sites. These endogenous sites have three key features. In contrast to most analyses of DNA-binding protein specificity, we find that strong matches to the binding consensus are good predictors of binding site occupancy. Examination of occupancy in different tissues and developmental stages reveals that most Su(Hw) sites, if not all, are constitutively occupied, and these isolated Su(Hw) sites are generally highly conserved. Analysis of transcript levels in su(Hw) mutants indicate widespread and general changes in gene expression. Importantly, the vast majority of genes with altered expression are not associated with clustering of Su(Hw) binding sites, emphasizing the functional relevance of isolated sites. Taken together, our in vivo binding and gene expression data support a role for the Su(Hw) protein in maintaining a constant genomic architecture.

  18. Pst I restriction fragment length polymorphism of human placental alkaline phosphatase gene: Mendelian in segregation and localization of mutation site in the gene

    SciTech Connect

    Tsavaler, L.; Penhallow, R.C.; Sussman, H.H. )

    1988-10-01

    The pattern of inheritance of a Pst I restriction fragment length polymorphism (RFLP) of the human placental alkaline phosphatase gene was studied in nine nuclear families by Southern blot hybridization analysis of genomic DNA. The dimorphic RFLP is defined by the presence of allelic fragments 1.0 kilobase and 0.8 kilobase long. The results of this study show that the two alleles of the Pst I RFLP of the placental alkaline phosphatase gene segregate as codominant traits according to Mendelian expectations. For a polymorphism to be useful as a genetic marker the probability that an offspring is informative (PIC) must be at least 0.15. The allelic frequency of the 1.0-kilobase allele is 0.21, which correlates to a probability that an offspring is informative of 0.275 and is indicative of a useful polymorphism. By using probes derived from different regions of the placental alkaline phosphatase cDNA, the mutated Pst I site causing the RFLP was located in the penultimate intron 2497 base pairs downstream from the transcriptional initiation site.

  19. The Documentation of Historic Maps of World Heritage Site City Suzhou

    NASA Astrophysics Data System (ADS)

    Guangwei, Z.

    2013-07-01

    Documentation and analysis of historic maps enhance understanding of temporal and spatial interactions between events and the evolution of physical canals upon which they occurred. And the challenge of this work lies on carefully sifting of information through the maps drawn with relative accuracy by traditional cartographical principles before the emergence of scientific survey. This research project focuses on sorting out the evolution of historic city Suzhou in a spatio-temporal view. The investigation was conducted through an in-depth analysis of historic maps. Re-projection of the geographical elements of the city to one single georeference, that is to say a standard map BASE, help acquiring an actual sense of the scale and facilitate the recognition of the city's evolution in clear details. It is an important contribution of this thesis in coordination of variously distorted geographical information contained in nineteen periods span from 1229 to 2013 into a single research resource. Through the work both quantitative and qualitative, a clear vision of the evolution and characteristics of the urban structure of ancient Suzhou is achieved. Meanwhile, in the process of projecting the historical geometrical information onto the topographic map, historical bibliographic and cartographic records is key to the data coordination and readjustment, this inspire as well on the cautious utilization of historical materials from ancient time in the recording, documentation work.

  20. Restrictive cardiomyopathy

    MedlinePlus

    Cardiomyopathy - restrictive; Infiltrative cardiomyopathy; Idiopathic myocardial fibrosis ... In a case of restrictive cardiomyopathy, the heart muscle is of normal size or slightly enlarged. Most of the time, it also pumps normally. However, it does ...

  1. The combination of Forest Site Maps, Site specific Growth Models and Nutrient Balance Models as a Basis for Sustainable Management in the Northern Limestone Alps

    NASA Astrophysics Data System (ADS)

    Ettmayer, C.; Katzensteiner, K.; Eckmüllner, O.

    2012-04-01

    The demand for biomass from forests is rising continuously. Decision support tools for managers and forest authorities should help to avoid negative consequences of increased biomass extraction on ecosystem processes and the sustainable supply of forest services. Those tools have to be site and stand specific. In Alpine regions shallow soils with high organic matter content are widespread on calcareous bedrock. There is increasing evidence that those soils are particularly vulnerable and intensive harvest leads to rapid humus and nutrient losses and a decline of water storage capacity. Such soils may rely on the existence of a continuous forest cover and/or a minimum input of coarse woody debris. For a test region in Tyrol management scenarios will be modelled to predict management effects on sites with calcareous bedrock. Site specific growth and yield models for biomass fractions are developed based on existing inventory data, site maps and high resolution digital surface and terrain models, complemented by stratified biomass and nutrient inventories, and are used for the calculation of different production scenarios. Nutrient balance models taking into account nutrient extraction via harvest, leaching losses as well as gains via atmospheric deposition, and fertilization are used to calculate the potential sustainable harvest intensity. In addition humus dynamics of the frequently shallow rendzic Leptosols is taken into account. Concepts for long term carbon and nutrient management experiments as a basis for adaptive forest management in the Calacareous Alps are developed.

  2. Mapping the carriage of flaA-restriction fragment length polymorphism Campylobacter genotypes on poultry carcasses through the processing chain and comparison to clinical isolates.

    PubMed

    Duffy, Lesley L; Blackall, Patrick J; Cobbold, Rowland N; Fegan, Narelle

    2015-06-01

    Poultry are considered a major source for campylobacteriosis in humans. A total of 1866 Campylobacter spp. isolates collected through the poultry processing chain were typed using flaA-restriction fragment length polymorphism to measure the impact of processing on the genotypes present. Temporally related human clinical isolates (n = 497) were also typed. Isolates were obtained from whole chicken carcass rinses of chickens collected before scalding, after scalding, before immersion chilling, after immersion chilling and after packaging as well as from individual caecal samples. A total of 32 genotypes comprising at least four isolates each were recognised. Simpson's Index of Diversity (D) was calculated for each sampling site within each flock, for each flock as a whole and for the clinical isolates. From caecal collection to after packaging samples the D value did not change in two flocks, decreased in one flock and increased in the fourth flock. Dominant genotypes occurred in each flock but their constitutive percentages changed through processing. There were 23 overlapping genotypes between clinical and chicken isolates. The diversity of Campylobacter is flock dependant and may alter through processing. This study confirms that poultry are a source of campylobacteriosis in the Australian population although other sources may contribute. Crown Copyright © 2014. Published by Elsevier Ltd. All rights reserved.

  3. High-Resolution Mapping of the Drosophila Fourth Chromosome Using Site-Directed Terminal Deficiencies

    PubMed Central

    Sousa-Neves, Rui; Lukacsovich, Tamas; Mizutani, Claudia Mieko; Locke, John; Podemski, Lynn; Marsh, J. Lawrence

    2005-01-01

    For more than 80 years, the euchromatic right arm of the Drosophila fourth chromosome (101F-102F) has been one of the least genetically accessible regions of the fly genome despite the fact that many important genes reside there. To improve the mapping of genes on the fourth chromosome, we describe a strategy to generate targeted deficiencies and we describe 13 deficiencies that subdivide the 300 kb between the cytological coordinates 102A6 and 102C1 into five discrete regions plus a 200-kb region from 102C1 to 102D6. Together these deficiencies substantially improve the mapping capabilities for mutant loci on the fourth chromosome. PMID:15466427

  4. Mapping Sites of O-Glycosylation and Fringe Elongation on Drosophila Notch.

    PubMed

    Harvey, Beth M; Rana, Nadia A; Moss, Hillary; Leonardi, Jessica; Jafar-Nejad, Hamed; Haltiwanger, Robert S

    2016-07-29

    Glycosylation of the Notch receptor is essential for its activity and serves as an important modulator of signaling. Three major forms of O-glycosylation are predicted to occur at consensus sites within the epidermal growth factor-like repeats in the extracellular domain of the receptor: O-fucosylation, O-glucosylation, and O-GlcNAcylation. We have performed comprehensive mass spectral analyses of these three types of O-glycosylation on Drosophila Notch produced in S2 cells and identified peptides containing all 22 predicted O-fucose sites, all 18 predicted O-glucose sites, and all 18 putative O-GlcNAc sites. Using semiquantitative mass spectral methods, we have evaluated the occupancy and relative amounts of glycans at each site. The majority of the O-fucose sites were modified to high stoichiometries. Upon expression of the β3-N-acetylglucosaminyltransferase Fringe with Notch, we observed varying degrees of elongation beyond O-fucose monosaccharide, indicating that Fringe preferentially modifies certain sites more than others. Rumi modified O-glucose sites to high stoichiometries, although elongation of the O-glucose was site-specific. Although the current putative consensus sequence for O-GlcNAcylation predicts 18 O-GlcNAc sites on Notch, we only observed apparent O-GlcNAc modification at five sites. In addition, we performed mass spectral analysis on endogenous Notch purified from Drosophila embryos and found that the glycosylation states were similar to those found on Notch from S2 cells. These data provide foundational information for future studies investigating the mechanisms of how O-glycosylation regulates Notch activity.

  5. Mapping Sites of O-Glycosylation and Fringe Elongation on Drosophila Notch*

    PubMed Central

    Harvey, Beth M.; Rana, Nadia A.; Moss, Hillary; Leonardi, Jessica; Jafar-Nejad, Hamed; Haltiwanger, Robert S.

    2016-01-01

    Glycosylation of the Notch receptor is essential for its activity and serves as an important modulator of signaling. Three major forms of O-glycosylation are predicted to occur at consensus sites within the epidermal growth factor-like repeats in the extracellular domain of the receptor: O-fucosylation, O-glucosylation, and O-GlcNAcylation. We have performed comprehensive mass spectral analyses of these three types of O-glycosylation on Drosophila Notch produced in S2 cells and identified peptides containing all 22 predicted O-fucose sites, all 18 predicted O-glucose sites, and all 18 putative O-GlcNAc sites. Using semiquantitative mass spectral methods, we have evaluated the occupancy and relative amounts of glycans at each site. The majority of the O-fucose sites were modified to high stoichiometries. Upon expression of the β3-N-acetylglucosaminyltransferase Fringe with Notch, we observed varying degrees of elongation beyond O-fucose monosaccharide, indicating that Fringe preferentially modifies certain sites more than others. Rumi modified O-glucose sites to high stoichiometries, although elongation of the O-glucose was site-specific. Although the current putative consensus sequence for O-GlcNAcylation predicts 18 O-GlcNAc sites on Notch, we only observed apparent O-GlcNAc modification at five sites. In addition, we performed mass spectral analysis on endogenous Notch purified from Drosophila embryos and found that the glycosylation states were similar to those found on Notch from S2 cells. These data provide foundational information for future studies investigating the mechanisms of how O-glycosylation regulates Notch activity. PMID:27268051

  6. Mapping solvation dynamics at the function site of flavodoxin in three redox states.

    PubMed

    Chang, Chih-Wei; He, Ting-Fang; Guo, Lijun; Stevens, Jeffrey A; Li, Tanping; Wang, Lijuan; Zhong, Dongping

    2010-09-15

    Flavoproteins are unique redox coenzymes, and the dynamic solvation at their function sites is critical to the understanding of their electron-transfer properties. Here, we report our complete characterization of the function-site solvation of holoflavodoxin in three redox states and of the binding-site solvation of apoflavodoxin. Using intrinsic flavin cofactor and tryptophan residue as the local optical probes with two site-specific mutations, we observed distinct ultrafast solvation dynamics at the function site in the three states and at the related recognition site of the cofactor, ranging from a few to hundreds of picoseconds. The initial ultrafast motion in 1-2.6 ps reflects the local water-network relaxation around the shallow, solvent-exposed function site. The second relaxation in 20-40 ps results from the coupled local water-protein fluctuation. The third dynamics in hundreds of picoseconds is from the intrinsic fluctuation of the loose loops flanking the cofactor at the function site. These solvation dynamics with different amplitudes well correlate with the redox states from the oxidized form, to the more rigid semiquinone and to the much looser hydroquinone. This observation of the redox control of local protein conformation plasticity and water network flexibility is significant, and such an intimate relationship is essential to the biological function of interprotein electron transfer.

  7. 24 CFR 3285.103 - Site suitability with design zone maps.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... is to be installed. The design zone maps are those identified in part 3280 of this chapter. (a) Wind zone. Manufactured homes must not be installed in a wind zone that exceeds the design wind loads for which the home has been designed, as evidenced by the wind zone indicated on the home's data plate and...

  8. Geomorphic/Geologic Mapping, Localization, and Traverse Planning at the Opportunity Landing Site, Mars

    NASA Astrophysics Data System (ADS)

    Parker, T. J.; Golombek, M. P.; Powell, M. W.

    2010-03-01

    Mapping of the Opportunity traverse, using the project’s planning tool, “maestro”, and GIS software. Experience gained by the science and engineering teams will be invaluable for planning and conducting future mobile explorer missions to Mars and other planetary bodies.

  9. Geophysical logging and geologic mapping data in the vicinity of the GMH Electronics Superfund site near Roxboro, North Carolina

    USGS Publications Warehouse

    Chapman, Melinda J.; Clark, Timothy W.; Williams, John H.

    2013-01-01

    Geologic mapping, the collection of borehole geophysical logs and images, and passive diffusion bag sampling were conducted by the U.S. Geological Survey North Carolina Water Science Center in the vicinity of the GMH Electronics Superfund site near Roxboro, North Carolina, during March through October 2011. The study purpose was to assist the U.S. Environmental Protection Agency in the development of a conceptual groundwater model for the assessment of current contaminant distribution and future migration of contaminants. Data compilation efforts included geologic mapping of more than 250 features, including rock type and secondary joints, delineation of more than 1,300 subsurface features (primarily fracture orientations) in 15 open borehole wells, and the collection of passive diffusion-bag samples from 42 fracture zones at various depths in the 15 wells.

  10. High-definition mapping of retroviral integration sites defines the fate of allogeneic T cells after donor lymphocyte infusion.

    PubMed

    Cattoglio, Claudia; Maruggi, Giulietta; Bartholomae, Cynthia; Malani, Nirav; Pellin, Danilo; Cocchiarella, Fabienne; Magnani, Zulma; Ciceri, Fabio; Ambrosi, Alessandro; von Kalle, Christof; Bushman, Frederic D; Bonini, Chiara; Schmidt, Manfred; Mavilio, Fulvio; Recchia, Alessandra

    2010-12-22

    The infusion of donor lymphocytes transduced with a retroviral vector expressing the HSV-TK suicide gene in patients undergoing hematopoietic stem cell transplantation for leukemia/lymphoma promotes immune reconstitution and prevents infections and graft-versus-host disease. Analysis of the clonal dynamics of genetically modified lymphocytes in vivo is of crucial importance to understand the potential genotoxic risk of this therapeutic approach. We used linear amplification-mediated PCR and pyrosequencing to build a genome-wide, high-definition map of retroviral integration sites in the genome of peripheral blood T cells from two different donors and used gene expression profiling and bioinformatics to associate integration clusters to transcriptional activity and to genetic and epigenetic features of the T cell genome. Comparison with matched random controls and with integrations obtained from CD34(+) hematopoietic stem/progenitor cells showed that integration clusters occur within chromatin regions bearing epigenetic marks associated with active promoters and regulatory elements in a cell-specific fashion. Analysis of integration sites in T cells obtained ex vivo two months after infusion showed no evidence of integration-related clonal expansion or dominance, but rather loss of cells harboring integration events interfering with RNA post-transcriptional processing. The study shows that high-definition maps of retroviral integration sites are a powerful tool to analyze the fate of genetically modified T cells in patients and the biological consequences of retroviral transduction.

  11. High-Definition Mapping of Retroviral Integration Sites Defines the Fate of Allogeneic T Cells After Donor Lymphocyte Infusion

    PubMed Central

    Cattoglio, Claudia; Maruggi, Giulietta; Bartholomae, Cynthia; Malani, Nirav; Pellin, Danilo; Cocchiarella, Fabienne; Magnani, Zulma; Ciceri, Fabio; Ambrosi, Alessandro; von Kalle, Christof; Bushman, Frederic D.; Bonini, Chiara; Schmidt, Manfred; Mavilio, Fulvio; Recchia, Alessandra

    2010-01-01

    The infusion of donor lymphocytes transduced with a retroviral vector expressing the HSV-TK suicide gene in patients undergoing hematopoietic stem cell transplantation for leukemia/lymphoma promotes immune reconstitution and prevents infections and graft-versus-host disease. Analysis of the clonal dynamics of genetically modified lymphocytes in vivo is of crucial importance to understand the potential genotoxic risk of this therapeutic approach. We used linear amplification-mediated PCR and pyrosequencing to build a genome-wide, high-definition map of retroviral integration sites in the genome of peripheral blood T cells from two different donors and used gene expression profiling and bioinformatics to associate integration clusters to transcriptional activity and to genetic and epigenetic features of the T cell genome. Comparison with matched random controls and with integrations obtained from CD34+ hematopoietic stem/progenitor cells showed that integration clusters occur within chromatin regions bearing epigenetic marks associated with active promoters and regulatory elements in a cell-specific fashion. Analysis of integration sites in T cells obtained ex vivo two months after infusion showed no evidence of integration-related clonal expansion or dominance, but rather loss of cells harboring integration events interfering with RNA post-transcriptional processing. The study shows that high-definition maps of retroviral integration sites are a powerful tool to analyze the fate of genetically modified T cells in patients and the biological consequences of retroviral transduction. PMID:21203516

  12. Mapping of IS6110 Insertion Sites in Two Epidemic Strains of Mycobacterium tuberculosis

    PubMed Central

    Beggs, Marjorie L.; Eisenach, Kathleen D.; Cave, M. Donald

    2000-01-01

    A widely distributed strain designated 210 was identified in a study of the diversity of Mycobacterium tuberculosis DNA fingerprints from three geographically separate states in the United States. This strain is characterized by a 21-band fingerprint pattern when probed with IS6110, and the pattern is similar to that displayed by strains designated W. Intracellular growth of strain 210 isolates in human macrophages is significantly faster than that of isolates from other clusters or nonclustered isolates. The purpose of this study was to identify the sites of IS6110 insertions in strain 210 and compare these to IS6110 insertion sites in strain W. Our hypothesis is that an IS6110 insertion site(s) could possibly be responsible for a strain's increased capacity for transmission and/or replication. In this report, the insertion sites in strains 210 and W are described and referenced to their location in the M. tuberculosis H37Rv genome sequence. The W and 210 strains have 17 identical sites of IS6110 insertion and additional sequence not found in H37Rv but present in other clinical isolates. The IS6110 insertion site in the 36-bp direct repeat (DR) region of strains 210 and W has 15 spacers in the left flanking region. The DR region on the right side of IS6110 has been deleted. Five sites of insertion in strain 210 not found in strain W are described, as well as two unique sites in strain W. One copy of IS6110 was found to reside 55 bp in the ctpD gene. This gene is expressed, indicating that IS6110 can provide a promoter sequence for the transcription of genes. PMID:10921952

  13. Digital mapping of the Mars Pathfinder landing site: Design, acquisition, and derivation of cartographic products for science applications

    USGS Publications Warehouse

    Gaddis, L.R.; Kirk, R.L.; Johnson, J. R.; Soderblom, L.A.; Ward, A.W.; Barrett, J.; Becker, K.; Decker, T.; Blue, J.; Cook, D.; Eliason, E.; Hare, T.; Howington-Kraus, E.; Isbell, C.; Lee, E.M.; Redding, B.; Sucharski, R.; Sucharski, T.; Smith, P.H.; Britt, D.T.

    1999-01-01

    The Imager for Mars Pathfinder (IMP) acquired more than 16,000 images and provided panoramic views of the surface of Mars at the Mars Pathfinder landing site in Ares Vallis. This paper describes the stereoscopic, multispectral IMP imaging sequences and focuses on their use for digital mapping of the landing site and for deriving cartographic products to support science applications of these data. Two-dimensional cartographic processing of IMP data, as performed via techniques and specialized software developed for ISIS (the U.S.Geological Survey image processing software package), is emphasized. Cartographic processing of IMP data includes ingestion, radiometric correction, establishment of geometric control, coregistration of multiple bands, reprojection, and mosaicking. Photogrammetric processing, an integral part of this cartographic work which utilizes the three-dimensional character of the IMP data, supplements standard processing with geometric control and topographic information [Kirk et al., this issue]. Both cartographic and photogrammetric processing are required for producing seamless image mosaics and for coregistering the multispectral IMP data. Final, controlled IMP cartographic products include spectral cubes, panoramic (360?? azimuthal coverage) and planimetric (top view) maps, and topographic data, to be archived on four CD-ROM volumes. Uncontrolled and semicontrolled versions of these products were used to support geologic characterization of the landing site during the nominal and extended missions. Controlled products have allowed determination of the topography of the landing site and environs out to ???60 m, and these data have been used to unravel the history of large- and small-scale geologic processes which shaped the observed landing site. We conclude by summarizing several lessons learned from cartographic processing of IMP data. Copyright 1999 by the American Geophysical Union.

  14. Mapping precursor-binding site on TatC subunit of twin arginine-specific protein translocase by site-specific photo cross-linking.

    PubMed

    Zoufaly, Stefan; Fröbel, Julia; Rose, Patrick; Flecken, Tobias; Maurer, Carlo; Moser, Michael; Müller, Matthias

    2012-04-13

    A number of secreted precursor proteins of bacteria, archaea, and plant chloroplasts stand out by a conserved twin arginine-containing sequence motif in their signal peptides. Many of these precursor proteins are secreted in a completely folded conformation by specific twin arginine translocation (Tat) machineries. Tat machineries are high molecular mass complexes consisting of two types of membrane proteins, a hexahelical TatC protein, and usually one or two single-spanning membrane proteins, called TatA and TatB. TatC has previously been shown to be involved in the recognition of twin arginine signal peptides. We have performed an extensive site-specific cross-linking analysis of the Escherichia coli TatC protein under resting and translocating conditions. This strategy allowed us to map the recognition site for twin arginine signal peptides to the cytosolic N-terminal region and first cytosolic loop of TatC. In addition, discrete contact sites between TatC, TatB, and TatA were revealed. We discuss a tentative model of how a twin arginine signal sequence might be accommodated in the Tat translocase.

  15. Mapping Precursor-binding Site on TatC Subunit of Twin Arginine-specific Protein Translocase by Site-specific Photo Cross-linking*

    PubMed Central

    Zoufaly, Stefan; Fröbel, Julia; Rose, Patrick; Flecken, Tobias; Maurer, Carlo; Moser, Michael; Müller, Matthias

    2012-01-01

    A number of secreted precursor proteins of bacteria, archaea, and plant chloroplasts stand out by a conserved twin arginine-containing sequence motif in their signal peptides. Many of these precursor proteins are secreted in a completely folded conformation by specific twin arginine translocation (Tat) machineries. Tat machineries are high molecular mass complexes consisting of two types of membrane proteins, a hexahelical TatC protein, and usually one or two single-spanning membrane proteins, called TatA and TatB. TatC has previously been shown to be involved in the recognition of twin arginine signal peptides. We have performed an extensive site-specific cross-linking analysis of the Escherichia coli TatC protein under resting and translocating conditions. This strategy allowed us to map the recognition site for twin arginine signal peptides to the cytosolic N-terminal region and first cytosolic loop of TatC. In addition, discrete contact sites between TatC, TatB, and TatA were revealed. We discuss a tentative model of how a twin arginine signal sequence might be accommodated in the Tat translocase. PMID:22362773

  16. Selection of optimal recording sites for limited lead body surface potential mapping: A sequential selection based approach

    PubMed Central

    Finlay, Dewar D; Nugent, Chris D; Donnelly, Mark P; Lux, Robert L; McCullagh, Paul J; Black, Norman D

    2006-01-01

    Background In this study we propose the development of a new algorithm for selecting optimal recording sites for limited lead body surface potential mapping. The proposed algorithm differs from previously reported methods in that it is based upon a simple and intuitive data driven technique that does not make any presumptions about deterministic characteristics of the data. It uses a forward selection based search technique to find the best combination of electrocardiographic leads. Methods The study was conducted using a dataset consisting of body surface potential maps (BSPM) recorded from 116 subjects which included 59 normals and 57 subjects exhibiting evidence of old Myocardial Infarction (MI). The performance of the algorithm was evaluated using spatial RMS voltage error and correlation coefficient to compare original and reconstructed map frames. Results In all, three configurations of the algorithm were evaluated and it was concluded that there was little difference in the performance of the various configurations. In addition to observing the performance of the selection algorithm, several lead subsets of 32 electrodes as chosen by the various configurations of the algorithm were evaluated. The rationale for choosing this number of recording sites was to allow comparison with a previous study that used a different algorithm, where 32 leads were deemed to provide an acceptable level of reconstruction performance. Conclusion It was observed that although the lead configurations suggested in this study were not identical to that suggested in the previous work, the systems did bear similar characteristics in that recording sites were chosen with greatest density in the precordial region. PMID:16503972

  17. A Remote Characterization System for subsurface mapping of buried waste sites

    SciTech Connect

    Sandness, G.A.; Bennett, D.W.; Martinson, L.

    1992-06-01

    This paper describes a development project that will provide new technology for characterizing hazardous waste burial sites. The project is a collaborative effort by five of the national laboratories, involving the development and demonstration of a remotely controlled site characterization system. The Remote Characterization System (RCS) includes a unique low-signature survey vehicle, a base station, radio telemetry data links, satellite-based vehicle tracking, stereo vision, and sensors for non-invasive inspection of the surface and subsurface.

  18. DNA methylation at the CfrBI site is involved in expression control in the CfrBI restriction-modification system.

    PubMed

    Beletskaya, I V; Zakharova, M V; Shlyapnikov, M G; Semenova, L M; Solonin, A S

    2000-10-01

    We have previously found that genes of the CFR:BI restriction-modification (R-M) system from Citrobacter freundii are oriented divergently and that their promoter regions overlap. The overlapping promoters suggest regulation of gene expression at the transcriptional level. In this study the transcription regulation of CFR:BI R-M genes was analyzed in vivo and in vitro in Escherichia coli. It was shown that in the presence of CFR:BI methyltransferase (M.CFR:BI), cell galactokinase activity decreases 10-fold when the galactokinase gene (galK) is under the control of the cfrBIM promoter and increases 20-fold when galK is under the control of the cfrBIR promoter. The CFR:BI site, proven to be unique for the entire CFR:BI R-M gene sequence, is located in the -35 cfrBIM promoter region and is in close vicinity of the -10 cfrBIR promoter region. A comparison of the cfrBIM and the cfrBIR promoter activities in the in vitro transcription system using methylated and unmethylated DNA fragments as templates demonstrated that the efficiency of CFR:BI R-M gene transcription is regulated by enzymatic modification at the N-4-position of cytosine bases of the CFR:BI site by M.CFR:BI. From the results of the in vivo and in vitro experiments we suggest a new model of gene expression regulation in type II R-M systems.

  19. Missouri aeromagnetic and gravity maps and data: a web site for distribution of data

    USGS Publications Warehouse

    Kucks, Robert P.; Hill, Patricia L.

    2005-01-01

    Magnetic anomalies are due to variations in the Earth's magnetic field caused by the uneven distribution of magnetic minerals (primarily magnetite) in the rocks that make up the upper part of the Earth's crust. The features and patterns of the magnetic anomalies can be used to delineate details of subsurface geology, including the locations of buried faults and magnetite-bearing rocks and the depth to the base of sedimentary basins. This information is valuable for mineral exploration, geologic mapping, and environmental studies. The Missouri magnetic map is constructed from grids that combine information collected in 25 separate magnetic surveys conducted between 1943 and 1987. The data from these surveys are of varying quality. The design and specifications (terrain clearance, sampling rates, line spacing, and reduction procedures) varied from survey to survey depending on the purpose of the project and the technology of that time. Every attempt was made to acquire the data in digital form.

  20. DNase I Digestion of Isolated Nulcei for Genome-Wide Mapping of DNase Hypersensitivity Sites in Chromatin

    PubMed Central

    Ling, Guoyu; Waxman, David J.

    2013-01-01

    Summary DNase I hypersensitivity (DHS) analysis is a powerful method to analyze chromatin structure and identify genomic regulatory elements. Integration of a high throughput detection method into DHS analysis makes genome-wide mapping of DHS sites possible at a reasonable cost. Here we describe methods for DHS analysis carried out with mouse liver nuclei, involving DNase I digestion followed by isolation of DNase I-released DNA fragments suitable for high throughput, next generation DNA sequencing (DNase-seq). A real-time PCR-based assay used to optimize DNase I digestion conditions is also described. PMID:23436351

  1. Creation of a data base for sequences of ribosomal nucleic acids and detection of conserved restriction endonucleases sites through computerized processing.

    PubMed Central

    Patarca, R; Dorta, B; Ramirez, J L

    1982-01-01

    As part of a project pertaining the organization of ribosomal genes in Kinetoplastidae, we have created a data base for published sequences of ribosomal nucleic acids, with information in Spanish. As a first step in their processing, we have written a computer program which introduces the new feature of determining the length of the fragments produced after single or multiple digestion with any of the known restriction enzymes. With this information we have detected conserved SAU 3A sites: (i) at the 5' end of the 5.8S rRNA and at the 3' end of the small subunit rRNA, both included in similar larger sequences; (ii) in the 5.8S rRNA of vertebrates (a second one), which is not present in lower eukaryotes, showing a clear evolutive divergence; and, (iii) at the 5' terminal of the small subunit rRNA, included in a larger conserved sequence. The possible biological importance of these sequences is discussed. PMID:6278402

  2. Evaluation of a novel method based on amplification of DNA fragments surrounding rare restriction sites (ADSRRS fingerprinting) for typing strains of vancomycin-resistant Enterococcus faecium.

    PubMed

    Krawczyk, Beata; Lewandowski, Krzysztof; Bronk, Marek; Samet, Alfred; Myjak, Przemysław; Kur, Józef

    2003-03-01

    In the search for an effective DNA-typing technique for use in hospital epidemiology, the performance and convenience of a novel assay based on the fingerprinting of bacterial genomes by amplification of DNA fragments surrounding rare restriction sites (ADSRRS fingerprinting) was tested. A large number of vancomycin-resistant Enterococcus faecium (VREM) isolates from haematological ward patients of the Clinical Hospital in Gdańsk were examined. We found that ADSRRS fingerprinting analysis is a rapid method that offers good discriminatory power. The method demonstrated also excellent reproducibility. The usefulness of the ADSRRS fingerprinting method for molecular typing was compared with pulsed field gel electrophoresis (PFGE) method, which is currently considered the gold standard for molecular typing of isolates recovered from patients and the environment in the course of investigation and control of nosocomial outbreaks. Clustering of ADSRRS fingerprinting data matched pulsed field gel electrophoresis data. The features of ADSRRS fingerprinting technique is discussed in comparison with conventional methods. Data presented here demonstrate the complexity of the epidemiological situation concerning VREM that may occur in a single medical ward.

  3. Restriction Site-Associated DNA Sequencing (RAD-seq) Reveals an Extraordinary Number of Transitions among Gecko Sex-Determining Systems.

    PubMed

    Gamble, Tony; Coryell, Jessi; Ezaz, Tariq; Lynch, Joshua; Scantlebury, Daniel P; Zarkower, David

    2015-05-01

    Sex chromosomes have evolved many times in animals and studying these replicate evolutionary "experiments" can help broaden our understanding of the general forces driving the origin and evolution of sex chromosomes. However this plan of study has been hindered by the inability to identify the sex chromosome systems in the large number of species with cryptic, homomorphic sex chromosomes. Restriction site-associated DNA sequencing (RAD-seq) is a critical enabling technology that can identify the sex chromosome systems in many species where traditional cytogenetic methods have failed. Using newly generated RAD-seq data from 12 gecko species, along with data from the literature, we reinterpret the evolution of sex-determining systems in lizards and snakes and test the hypothesis that sex chromosomes can routinely act as evolutionary traps. We uncovered between 17 and 25 transitions among gecko sex-determining systems. This is approximately one-half to two-thirds of the total number of transitions observed among all lizards and snakes. We find support for the hypothesis that sex chromosome systems can readily become trap-like and show that adding even a small number of species from understudied clades can greatly enhance hypothesis testing in a model-based phylogenetic framework. RAD-seq will undoubtedly prove useful in evaluating other species for male or female heterogamety, particularly the majority of fish, amphibian, and reptile species that lack visibly heteromorphic sex chromosomes, and will significantly accelerate the pace of biological discovery.

  4. Design and Analysis of Map Relative Localization for Access to Hazardous Landing Sites on Mars

    NASA Technical Reports Server (NTRS)

    Johnson, Andrew E.; Aaron, Seth; Cheng, Yang; Montgomery, James; Trawny, Nikolas; Tweddle, Brent; Vaughan, Geoffrey; Zheng, Jason

    2016-01-01

    Human and robotic planetary lander missions require accurate surface relative position knowledge to land near science targets or next to pre-deployed assets. In the absence of GPS, accurate position estimates can be obtained by automatically matching sensor data collected during descent to an on-board map. The Lander Vision System (LVS) that is being developed for Mars landing applications generates landmark matches in descent imagery and combines these with inertial data to estimate vehicle position, velocity and attitude. This paper describes recent LVS design work focused on making the map relative localization algorithms robust to challenging environmental conditions like bland terrain, appearance differences between the map and image and initial input state errors. Improved results are shown using data from a recent LVS field test campaign. This paper also fills a gap in analysis to date by assessing the performance of the LVS with data sets containing significant vertical motion including a complete data set from the Mars Science Laboratory mission, a Mars landing simulation, and field test data taken over multiple altitudes above the same scene. Accurate and robust performance is achieved for all data sets indicating that vertical motion does not play a significant role in position estimation performance.

  5. A Cladistic Analysis of Phenotypic Associations with Haplotypes Inferred from Restriction Endonuclease Mapping. IV. Nested Analyses with Cladogram Uncertainty and Recombination

    PubMed Central

    Templeton, A. R.; Sing, C. F.

    1993-01-01

    We previously developed an analytical strategy based on cladistic theory to identify subsets of haplotypes that are associated with significant phenotypic deviations. Our initial approach was limited to segments of DNA in which little recombination occurs. In such cases, a cladogram can be constructed from the restriction site data to estimate the evolutionary steps that interrelate the observed haplotypes to one another. The cladogram is then used to define a nested statistical design for identifying mutational steps associated with significant phenotypic deviations. The central assumption behind this strategy is that a mutation responsible for a particular phenotypic effect is embedded within the evolutionary history that is represented by the cladogram. The power of this approach depends on the accuracy of the cladogram in portraying the evolutionary history of the DNA region. This accuracy can be diminished both by recombination and by uncertainty in the estimated cladogram topology. In a previous paper, we presented an algorithm for estimating the set of likely cladograms and recombination events. In this paper we present an algorithm for defining a nested statistical design under cladogram uncertainty and recombination. Given the nested design, phenotypic associations can be examined using either a nested analysis of variance (for haploids or homozygous strains) or permutation testing (for outcrossed, diploid gene regions). In this paper we also extend this analytical strategy to include categorical phenotypes in addition to quantitative phenotypes. Some worked examples are presented using Drosophila data sets. These examples illustrate that having some recombination may actually enhance the biological inferences that may derived from a cladistic analysis. In particular, recombination can be used to assign a physical localization to a given subregion for mutations responsible for significant phenotypic effects. PMID:8100789

  6. Mineral Mapping of High Priority Landing Sites for MSL and Beyond Using Mars Express OMEGA and HRSC Data

    NASA Astrophysics Data System (ADS)

    Michalski, J.; Bibring, J.; Poulet, F.; Mangold, N.; Loizeau, D.; Hauber, E.; Altieri, F.; Carrozzo, G.

    2008-12-01

    High priority candidate landing sites for the Mars Science Laboratory (MSL) mission have been proposed by various researchers, their significance based largely on spectroscopic and geomorphic evidence for aqueous processes. Specifically, seven candidate landing sites are under consideration for MSL at the time of this writing: Mawrth Vallis, Nili Fossae, southern Meridiani Planum, Eberswalde Crater, Holden Crater, Gale Crater, and Miyamoto Crater. While only one of these sites can be visited by MSL, the other sites remain among the most compelling localities on Mars for future in-situ exploration by ESA's ExoMars mission or an international Mars sample return mission. We have produced regional scale mineral maps of these sites using data from the Mars Express Observatoire pour la Minéralogie, l'Eau, les Glaces, et l'Activité (OMEGA). Visible images from the High Resolution Stereo Camera (HRSC) are used as a map base. OMEGA infrared band parameters are used to identify and map pyroxene, olivine, oxides, sulfates, phyllosilicates, and other hydrated phases. OMEGA visible channel data also provide color information, which gives an estimate of dust cover and additional insights into the mineralogy of altered deposits. The dustiest site is Gale Crater and the least dusty is Nili Fossae. The strongest signature of phyllosilicates occurs in Mawrth Vallis, followed by Nili Fossae. However, Nili Fossae also has some of the strongest olivine signatures on the planet. One fundamental difference between the Nili Fossae and Mawrth Vallis sites is that in Mawrth Vallis, phyllosilicate-bearing, light-toned rocks contain no evidence for primary phases in OMEGA data, but in the Nili Fossae area, phyllosilicates, olivine, and pyroxene are mixed at the subpixel level. South Meridiani Planum shows hydrated plains in contact with ancient, pyroxene-bearing, slightly altered, older bedrock. Patchy deposits of phyllosilicates are found in Miyamoto Crater, but their geologic context is

  7. Evaluation of a Single-Beam Sonar System to Map Seagrass at Two Sites in Northern Puget Sound, Washington

    USGS Publications Warehouse

    Stevens, Andrew W.; Lacy, Jessica R.; Finlayson, David P.; Gelfenbaum, Guy

    2008-01-01

    Seagrass at two sites in northern Puget Sound, Possession Point and nearby Browns Bay, was mapped using both a single-beam sonar and underwater video camera. The acoustic and underwater video data were compared to evaluate the accuracy of acoustic estimates of seagrass cover. The accuracy of the acoustic method was calculated for three classifications of seagrass observed in underwater video: bare (no seagrass), patchy seagrass, and continuous seagrass. Acoustic and underwater video methods agreed in 92 percent and 74 percent of observations made in bare and continuous areas, respectively. However, in patchy seagrass, the agreement between acoustic and underwater video was poor (43 percent). The poor agreement between the two methods in areas with patchy seagrass is likely because the two instruments were not precisely colocated. The distribution of seagrass at the two sites differed both in overall percent vegetated and in the distribution of percent cover versus depth. On the basis of acoustic data, seagrass inhabited 0.29 km2 (19 percent of total area) at Possession Point and 0.043 km2 (5 percent of total area) at the Browns Bay study site. The depth distribution at the two sites was markedly different. Whereas the majority of seagrass at Possession Point occurred between -0.5 and -1.5 m MLLW, most seagrass at Browns Bay occurred at a greater depth, between -2.25 and -3.5 m MLLW. Further investigation of the anthropogenic and natural factors causing these differences in distribution is needed.

  8. Convenient and Precise Strategy for Mapping N-Glycosylation Sites Using Microwave-Assisted Acid Hydrolysis and Characteristic Ions Recognition.

    PubMed

    Ma, Cheng; Qu, Jingyao; Meisner, Jeffrey; Zhao, Xinyuan; Li, Xu; Wu, Zhigang; Zhu, Hailiang; Yu, Zaikuan; Li, Lei; Guo, Yuxi; Song, Jing; Wang, Peng George

    2015-08-04

    N-glycosylation is one of the most prevalence protein post-translational modifications (PTM) which is involved in several biological processes. Alternation of N-glycosylation is associated with cellular malfunction and development of disease. Thus, investigation of protein N-glycosylation is crucial for diagnosis and treatment of disease. Currently, deglycosylation with peptide N-glycosidase F is the most commonly used technique in N-glycosylation analysis. Additionally, a common error in N-glycosylation site identification, resulting from protein chemical deamidation, has largely been ignored. In this study, we developed a convenient and precise approach for mapping N-glycosylation sites utilizing with optimized TFA hydrolysis, ZIC-HILIC enrichment, and characteristic ions of N-acetylglucosamine (GlcNAc) from higher-energy collisional dissociation (HCD) fragmentation. Using this method, we identified a total of 257 N-glycosylation sites and 144 N-glycoproteins from healthy human serum. Compared to deglycosylation with endoglycosidase, this strategy is more convenient and efficient for large scale N-glycosylation sites identification and provides an important alternative approach for the study of N-glycoprotein function.

  9. Point Cloud Mapping Methods for Documenting Cultural Landscape Features at the Wormsloe State Historic Site, Savannah, Georgia, USA

    NASA Astrophysics Data System (ADS)

    Jordana, T. R.; Goetcheus, C. L.; Madden, M.

    2016-06-01

    Documentation of the three-dimensional (3D) cultural landscape has traditionally been conducted during site visits using conventional photographs, standard ground surveys and manual measurements. In recent years, there have been rapid developments in technologies that produce highly accurate 3D point clouds, including aerial LiDAR, terrestrial laser scanning, and photogrammetric data reduction from unmanned aerial systems (UAS) images and hand held photographs using Structure from Motion (SfM) methods. These 3D point clouds can be precisely scaled and used to conduct measurements of features even after the site visit has ended. As a consequence, it is becoming increasingly possible to collect non-destructive data for a wide variety of cultural site features, including landscapes, buildings, vegetation, artefacts and gardens. As part of a project for the U.S. National Park Service, a variety of data sets have been collected for the Wormsloe State Historic Site, near Savannah, Georgia, USA. In an effort to demonstrate the utility and versatility of these methods at a range of scales, comparisons of the features mapped with different techniques will be discussed with regards to accuracy, data set completeness, cost and ease-of-use.

  10. Multi-Site N-glycan mapping study 1: Capillary electrophoresis – laser induced fluorescence

    PubMed Central

    Szekrényes, Ákos; Park, SungAe Suhr; Santos, Marcia; Lew, Clarence; Jones, Aled; Haxo, Ted; Kimzey, Michael; Pourkaveh, Shiva; Szabó, Zoltán; Sosic, Zoran; Feng, Peng; Váradi, Csaba; de l'Escaille, François; Falmagne, Jean-Bernard; Sejwal, Preeti; Niedringhaus, Thomas; Michels, David; Freckleton, Gordon; Hamm, Melissa; Manuilov, Anastasiya; Schwartz, Melissa; Luo, Jiann-Kae; van Dyck, Jonathan; Leung, Pui-King; Olajos, Marcell; Gu, Yingmei; Gao, Kai; Wang, Wenbo; Wegstein, Jo; Tep, Samnang; Guttman, András

    2016-01-01

    An international team that included 20 independent laboratories from biopharmaceutical companies, universities, analytical contract laboratories and national authorities in the United States, Europe and Asia was formed to evaluate the reproducibility of sample preparation and analysis of N-glycans using capillary electrophoresis of 8-aminopyrene-1,3,6-trisulfonic acid (APTS)-labeled glycans with laser induced fluorescence (CE-LIF) detection (16 sites) and ultra high-performance liquid chromatography (UHPLC, 12 sites; results to be reported in a subsequent publication). All participants used the same lot of chemicals, samples, reagents, and columns/capillaries to run their assays. Migration time, peak area and peak area percent values were determined for all peaks with >0.1% peak area. Our results demonstrated low variability and high reproducibility, both, within any given site as well across all sites, which indicates that a standard N-glycan analysis platform appropriate for general use (clone selection, process development, lot release, etc.) within the industry can be established. PMID:26466659

  11. Multi-Site N-glycan mapping study 1: Capillary electrophoresis - laser induced fluorescence.

    PubMed

    Szekrényes, Ákos; Park, SungAe Suhr; Santos, Marcia; Lew, Clarence; Jones, Aled; Haxo, Ted; Kimzey, Michael; Pourkaveh, Shiva; Szabó, Zoltán; Sosic, Zoran; Feng, Peng; Váradi, Csaba; de l'Escaille, François; Falmagne, Jean-Bernard; Sejwal, Preeti; Niedringhaus, Thomas; Michels, David; Freckleton, Gordon; Hamm, Melissa; Manuilov, Anastasiya; Schwartz, Melissa; Luo, Jiann-Kae; van Dyck, Jonathan; Leung, Pui-King; Olajos, Marcell; Gu, Yingmei; Gao, Kai; Wang, Wenbo; Wegstein, Jo; Tep, Samnang; Guttman, András

    2016-01-01

    An international team that included 20 independent laboratories from biopharmaceutical companies, universities, analytical contract laboratories and national authorities in the United States, Europe and Asia was formed to evaluate the reproducibility of sample preparation and analysis of N-glycans using capillary electrophoresis of 8-aminopyrene-1,3,6-trisulfonic acid (APTS)-labeled glycans with laser induced fluorescence (CE-LIF) detection (16 sites) and ultra high-performance liquid chromatography (UHPLC, 12 sites; results to be reported in a subsequent publication). All participants used the same lot of chemicals, samples, reagents, and columns/capillaries to run their assays. Migration time, peak area and peak area percent values were determined for all peaks with >0.1% peak area. Our results demonstrated low variability and high reproducibility, both, within any given site as well across all sites, which indicates that a standard N-glycan analysis platform appropriate for general use (clone selection, process development, lot release, etc.) within the industry can be established.

  12. Molecular mapping of general anesthetic sites in a voltage-gated ion channel.

    PubMed

    Barber, Annika F; Liang, Qiansheng; Amaral, Cristiano; Treptow, Werner; Covarrubias, Manuel

    2011-10-05

    Several voltage-gated ion channels are modulated by clinically relevant doses of general anesthetics. However, the structural basis of this modulation is not well understood. Previous work suggested that n-alcohols and inhaled anesthetics stabilize the closed state of the Shaw2 voltage-gated (Kv) channel (K-Shaw2) by directly interacting with a discrete channel site. We hypothesize that the inhibition of K-Shaw2 channels by general anesthetics is governed by interactions between binding and effector sites involving components of the channel's activation gate. To investigate this hypothesis, we applied Ala/Val scanning mutagenesis to the S4-S5 linker and the post-PVP S6 segment, and conducted electrophysiological analysis to evaluate the energetic impact of the mutations on the inhibition of the K-Shaw2 channel by 1-butanol and halothane. These analyses identified residues that determine an apparent binding cooperativity and residue pairs that act in concert to modulate gating upon anesthetic binding. In some instances, due to their critical location, key residues also influence channel gating. Complementing these results, molecular dynamics simulations and in silico docking experiments helped us visualize possible anesthetic sites and interactions. We conclude that the inhibition of K-Shaw2 by general anesthetics results from allosteric interactions between distinct but contiguous binding and effector sites involving inter- and intrasubunit interfaces.

  13. Modeling and mapping oak advance reproduction density using soil and site variables

    Treesearch

    John M. Kabrick; Jason L. Villwock; Daniel C. Dey; Tara L. Keyser; David R. Larsen

    2014-01-01

    Regenerating oaks (Quercus spp.) has remained a widespread and persistent problem throughout their natural range. Research shows that abundant oak advance reproduction is crucial for success. Although it is recognized that oak advance reproduction accumulation is inversely related to site quality, there has been little effort to model oak advance...

  14. Map Your Future through ASA's New and Transfer Student Web Site.

    ERIC Educational Resources Information Center

    Shelton, Beverley; Isberner, Fred

    This paper describes the College of Applied Science and Arts (ASA) at Southern Illinois University Carbondale (SIUC) Transfer and New Students Info Web site that responds to the need for high school and community college students, guidance counselors, and parents to explore and plan a program of study that provides the opportunity to enter the…

  15. Permafrost distribution map of San Juan Dry Andes (Argentina) based on rock glacier sites

    NASA Astrophysics Data System (ADS)

    Esper Angillieri, María Yanina

    2017-01-01

    Rock glaciers are frozen water reservoirs in mountainous areas. Water resources are important for the local populations and economies. The presence of rock glaciers is commonly used as a direct indicator of mountain permafrost conditions. Over 500 active rock glaciers have been identified, showing that elevations between 3500 and 4500 m asl., a south-facing or east-facing aspect, areas with relatively low solar radiation and low mean annual air temperature (-4 to 0 °C) favour the existence of rock glaciers in this region. The permafrost probability model, for Dry Andes of San Juan Province between latitudes 28º30‧S and 32°30‧S, have been analyzed by logistic regression models based on the active rock glaciers occurrence in relation to some topoclimatic variables such as altitude, aspect, mean annual temperature, mean annual precipitation and solar radiation, using optical remote sensing techniques in a GIS environment. The predictive performances of the model have been estimated by known rock glaciers locations and by the area under the receiver operating characteristic curve (AUROC). This regional permafrost map can be applied by the Argentinean Government for their recent initiatives which include creating inventories, monitoring and studying ice masses along the Argentinean Andes. Further, this generated map provides valuable input data for permafrost scenarios and contributes to a better understanding of our geosystem.

  16. Opportunity rover localization and topographic mapping at the landing site of Meridiani Planum, Mars

    NASA Astrophysics Data System (ADS)

    Li, Rongxing; Arvidson, Raymond E.; Di, Kaichang; Golombek, Matt; Guinn, Joe; Johnson, Andrew; Maimone, Mark; Matthies, Larry H.; Malin, Mike; Parker, Tim; Squyres, Steven W.; Watters, Wesley A.

    2007-02-01

    This paper presents the results of Mars topographic mapping and lander and rover localization for the Opportunity rover at Meridiani Planum during the Mars Exploration Rover (MER) 2003 mission. By Sol 458, the Opportunity rover traversed a distance of 5.20 km. We localized the lander using two-way Doppler radio positioning and cartographic triangulation of craters visible in both orbital and ground images. Additional high-resolution orbital images were taken to verify the determined lander position. Visual odometry and bundle adjustment techniques were applied to overcome wheel slippages, azimuthal angle drift, and other navigation errors (as large as 21% within Eagle crater). In addition, orbit-to-ground image-based adjustment was applied to correct rover location errors where bundle adjustment was not applicable. We generated timely topographic products, including orthoimages, digital terrain models (DTMs), three-dimensional (3-D) crater models, and rover traverse maps. In particular, detailed 3-D terrain models of major features, such as Endurance crater, have been generated using multisite panoramic stereo images based on bundle adjustment and wide baseline stereo technique.

  17. North Dakota aeromagnetic and gravity maps and data, a web site for distribution of data

    USGS Publications Warehouse

    Sweeney, Ronald E.; Hill, Patricia L.

    2003-01-01

    The North Dakota aeromagnetic grid is constructed from grids that combine information collected in 13 separate aeromagnetic surveys conducted between 1978 and 2001. The data from these surveys are of varying quality. The design and specifications (terrain clearance, sampling rates, line spacing, and reduction procedures) varied from survey to survey depending on the purpose of the project and the technology of that time. Every attempt was made to acquire the data in digital form. Most of the available digital data were obtained from aeromagnetic surveys flown by the U.S. Geological Survey (USGS), flown on contract with the USGS, or were obtained from other federal agencies and state universities. Some of the 1980 data are available only on hand-contoured maps and had to be digitized. These maps were digitized along flight-line/contour-line intersections, which is considered to be the most accurate method of recovering the original data. Digitized data are available as USGS Open File Report 99-557. All surveys have been continued to 304.8 meters (1000 feet) above ground and then blended or merged together.

  18. Iowa magnetic and gravity maps and data: a web site for distribution of data

    USGS Publications Warehouse

    Kucks, Robert P.; Hill, Patricia L.

    2005-01-01

    Magnetic anomalies are due to variations in the Earth's magnetic field caused by the uneven distribution of magnetic minerals (primarily magnetite) in the rocks that make up the upper part of the Earth's crust. The features and patterns of the magnetic anomalies can be used to delineate details of subsurface geology, including the locations of buried faults and magnetite-bearing rocks and the depth to the base of sedimentary basins. This information is valuable for mineral exploration, geologic mapping, and environmental studies. The Iowa magnetic map is constructed from grids that combine information collected in nine separate magnetic surveys conducted between 1953 and 1972. The data from these surveys are of varying quality. The design and specifications (terrain clearance, sampling rates, line spacing, and reduction procedures) varied from survey to survey depending on the purpose of the project and the technology of that time. Every attempt was made to acquire the data in digital form. All survey grids have been continued to 305 m (1,000 ft) above ground and merged together to form the State compilation.

  19. Value of epicardial potential maps in localizing pre-excitation sites for radiofrequency ablation. A simulation study

    NASA Astrophysics Data System (ADS)

    Hren, Rok

    1998-06-01

    Using computer simulations, we systematically investigated the limitations of an inverse solution that employs the potential distribution on the epicardial surface as an equivalent source model in localizing pre-excitation sites in Wolff-Parkinson-White syndrome. A model of the human ventricular myocardium that features an anatomically accurate geometry, an intramural rotating anisotropy and a computational implementation of the excitation process based on electrotonic interactions among cells, was used to simulate body surface potential maps (BSPMs) for 35 pre-excitation sites positioned along the atrioventricular ring. Two individualized torso models were used to account for variations in torso boundaries. Epicardial potential maps (EPMs) were computed using the L-curve inverse solution. The measure for accuracy of the localization was the distance between a position of the minimum in the inverse EPMs and the actual site of pre-excitation in the ventricular model. When the volume conductor properties and lead positions of the torso were precisely known and the measurement noise was added to the simulated BSPMs, the minimum in the inverse EPMs was at 12 ms after the onset on average within cm of the pre-excitation site. When the standard torso model was used to localize the sites of onset of the pre-excitation sequence initiated in individualized male and female torso models, the mean distance between the minimum and the pre-excitation site was cm for the male torso and