Sample records for retinoids

  1. HEPATIC METABOLISM OF RETINOIDS AND DISEASE ASSOCIATIONS

    PubMed Central

    Shirakami, Yohei; Lee, Seung-Ah; Clugston, Robin D.; Blaner, William S.

    2012-01-01

    The liver is the most important tissue site in the body for uptake of postprandial retinoid, as well as for retinoid storage. Within the liver, both hepatocytes and hepatic stellate cells (HSCs) are importantly involved in retinoid metabolism. Hepatocytes play an indispensable role in uptake and processing of dietary retinoid into the liver, and in synthesis and secretion of retinol-binding protein (RBP), which is required for mobilizing hepatic retinoid stores. HSCs are the central cellular site for retinoid storage in the healthy animal, accounting for as much as 50–60% of the total retinoid present in the entire body. The liver is also an important target organ for retinoid actions. Retinoic acid is synthesized in the liver and can interact with retinoid receptors which control expression of a large number of genes involved in hepatic processes. Altered retinoid metabolism and the accompanying dysregulation of retinoid signaling in the liver contribute to hepatic disease. This is related to HSCs, which contribute significantly to the development of hepatic disease when they undergo a process of cellular activation. HSC activation results in the loss of HSC retinoid stores and changes in extracellular matrix deposition leading to the onset of liver fibrosis. An association between hepatic disease progression and decreased hepatic retinoid storage has been demonstrated. In this review article, we summarize the essential role of the liver in retinoid metabolism and consider briefly associations between hepatic retinoid metabolism and disease. PMID:21763780

  2. High-throughput screening (HTS) and modeling of the retinoid ...

    EPA Pesticide Factsheets

    Presentation at the Retinoids Review 2nd workshop in Brussels, Belgium on the application of high throughput screening and model to the retinoid system Presentation at the Retinoids Review 2nd workshop in Brussels, Belgium on the application of high throughput screening and model to the retinoid system

  3. Retinoids activate the irritant receptor TRPV1 and produce sensory hypersensitivity

    PubMed Central

    Yin, Shijin; Luo, Jialie; Qian, Aihua; Du, Junhui; Yang, Qing; Zhou, Shentai; Yu, Weihua; Du, Guangwei; Clark, Richard B.; Walters, Edgar T.; Carlton, Susan M.; Hu, Hongzhen

    2013-01-01

    Retinoids are structurally related derivatives of vitamin A and are required for normal vision as well as cell proliferation and differentiation. Clinically, retinoids are effective in treating many skin disorders and cancers. Application of retinoids evokes substantial irritating side effects, including pain and inflammation; however, the precise mechanisms accounting for the sensory hypersensitivity are not understood. Here we show that both naturally occurring and synthetic retinoids activate recombinant or native transient receptor potential channel vanilloid subtype 1 (TRPV1), an irritant receptor for capsaicin, the pungent ingredient of chili peppers. In vivo, retinoids produced pain-related behaviors that were either eliminated or significantly reduced by genetic or pharmacological inhibition of TRPV1 function. These findings identify TRPV1 as an ionotropic receptor for retinoids and provide cellular and molecular insights into retinoid-evoked hypersensitivity. These findings also suggest that selective TRPV1 antagonists are potential therapeutic drugs for treating retinoid-induced sensory hypersensitivity. PMID:23925292

  4. Fingerprint Stimulated Raman Scattering Imaging Reveals Retinoid Coupling Lipid Metabolism and Survival.

    PubMed

    Chen, Andy Jing; Li, Junjie; Jannasch, Amber; Ozseker, Sena; Wang, Meng C; Cheng, Ji-Xin

    2018-06-17

    Retinoids play critical roles in development, immunity and lipid metabolism, and their deficiency leads to various human disorders. Yet, tools for sensing retinoids in vivo are lacking, which limits the understanding of retinoid distribution, dynamics and functions in living organisms. Here, using hyperspectral stimulated Raman scattering microscopy, we discover a previously unknown cytoplasmic store of retinoids in Caenorahbditis elegans. Following the temporal dynamics of retinoids, we reveal that their levels are positively correlated with fat storage, and their supplementation slows down fat loss during dauer starvation. We also discover that retinoids promote fat unsaturation in response to high-glucose stress, and improve organism survival. Together, our studies report a new method for tracking the spatiotemporal dynamics of retinoids in living organisms, and suggest the crucial roles of retinoids in maintaining metabolic homeostasis and enhancing organism fitness upon developmental and dietary stresses. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Photodecomposition and Phototoxicity of Natural Retinoids

    PubMed Central

    Tolleson, William H.; Cherng, Shui-Hui; Xia, Qingsu; Boudreau, Mary; Yin, Jun Jie; Wamer, Wayne G.; Howard, Paul C.; Yu, Hongtao; Fu, Peter P.

    2005-01-01

    Sunlight is a known human carcinogen. Many cosmetics contain retinoid-based compounds, such as retinyl palmitate (RP), either to protect the skin or to stimulate skin responses that will correct skin damaged by sunlight. However, little is known about the photodecomposition of some retinoids and the toxicity of these retinoids and their sunlight-induced photodecomposition products on skin. Thus, studies are required to test whether topical application of retinoids enhances the phototoxicity and photocarcinogenicity of sunlight and UV light. Mechanistic studies are needed to provide insight into the disposition of retinoids in vitro and on the skin, and to test thoroughly whether genotoxic damage by UV-induced radicals may participate in any toxicity of topically applied retinoids in the presence of UV light. This paper reports the update information and our experimental results on photostability, photoreactions, and phototoxicity of the natural retinoids including retinol (ROH), retinal, retinoid acid (RA), retinyl acetate, and RP (Figure 1). PMID:16705812

  6. Retinoids: a journey from the molecular structures and mechanisms of action to clinical uses in dermatology and adverse effects.

    PubMed

    Khalil, Samar; Bardawil, Tara; Stephan, Carla; Darwiche, Nadine; Abbas, Ossama; Kibbi, Abdul Ghani; Nemer, Georges; Kurban, Mazen

    2017-12-01

    Retinoids are a class of compounds derived from vitamin A or having structural and/or functional similarities with vitamin A. They are classified into three generations based on their molecular structures. Inside the body, retinoids bind to several classes of proteins including retinoid-binding proteins and retinoid nuclear receptors. This eventually leads to the activation of specific regulatory regions of DNA - called the retinoic acid response elements - involved in regulating cell growth, differentiation and apoptosis. Several clinical trials have studied the role of topical and systemic retinoids in disease, and research is still ongoing. Currently, retinoids are used in several fields of medicine. This paper aims to review the structure, mechanisms of action, and adverse effects of retinoids, as well as some of their current uses in Dermatology.

  7. Retinoid-xenobiotic interactions: the Ying and the Yang

    PubMed Central

    2015-01-01

    The literature provides compelling evidence pointing to tight metabolic interactions between retinoids and xenobiotics. These are extensive and important for understanding xenobiotic actions in the body. Within the body, retinoids affect xenobiotic metabolism and actions and conversely, xenobiotics affect retinoid metabolism and actions. This article summarizes data that establish the importance of retinoid-dependent metabolic pathways for sustaining the body’s responses to xenobiotic exposure, including the roles of all-trans- and 9-cis-retinoic acid for protecting mammals from harmful xenobiotic effects and for ensuring xenobiotic elimination from the body. This review will also consider molecular mechanisms underlying xenobiotic toxicity focusing on how this may contribute to retinoid deficiency and disruption of normal retinoid homeostasis. Special attention is paid to xenobiotic molecular targets (nuclear receptors, regulatory proteins, enzymes, and transporters) which affect retinoid metabolism and signaling. PMID:26311625

  8. Retinoic acid signaling pathways in development and diseases.

    PubMed

    Das, Bhaskar C; Thapa, Pritam; Karki, Radha; Das, Sasmita; Mahapatra, Sweta; Liu, Ting-Chun; Torregroza, Ingrid; Wallace, Darren P; Kambhampati, Suman; Van Veldhuizen, Peter; Verma, Amit; Ray, Swapan K; Evans, Todd

    2014-01-15

    Retinoids comprise a group of compounds each composed of three basic parts: a trimethylated cyclohexene ring that is a bulky hydrophobic group, a conjugated tetraene side chain that functions as a linker unit, and a polar carbon-oxygen functional group. Biochemical conversion of carotenoid or other retinoids to retinoic acid (RA) is essential for normal regulation of a wide range of biological processes including development, differentiation, proliferation, and apoptosis. Retinoids regulate various physiological outputs by binding to nuclear receptors called retinoic acid receptors (RARs) and retinoid X receptors (RXRs), which themselves are DNA-binding transcriptional regulators. The functional response of RA and their receptors are modulated by a host of coactivators and corepressors. Retinoids are essential in the development and function of several organ systems; however, deregulated retinoid signaling can contribute to serious diseases. Several natural and synthetic retinoids are in clinical use or undergoing trials for treating specific diseases including cancer. In this review, we provide a broad overview on the importance of retinoids in development and various diseases, highlighting various retinoids in the drug discovery process, ranging all the way from retinoid chemistry to clinical uses and imaging. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Consequences of metal exposure on retinoid metabolism in vertebrates: a review.

    PubMed

    Defo, M A; Spear, P A; Couture, P

    2014-02-10

    What we generally refer to as 'vitamin A' is a group of naturally-occurring molecules structurally similar to retinol that are capable of exerting biological activity. These retinoids are essential to diverse physiological functions including vision, immune response, bone mineralization, reproduction, cell differentiation, and growth. As well, some retinoids have antioxidant properties. Independent studies published over the last few decades have revealed that many fish and wildlife populations living in highly polluted environments have altered retinoid status possibly associated with retinoid metabolic or homeostatic mechanisms. Substantial evidence links organic contaminant exposure with changes in retinoid status in animal populations, but only a few detailed studies have been published implicating inorganic contaminants such as metals. This mini-review selectively deals with field and laboratory studies reporting associations between environmental contaminants, especially trace metals, and alterations in retinoid status. Both essential and non-essential trace metals have been reported to affect retinoid status. This review focuses on metabolic imbalances of retinoids in relation to metal contamination and illustrates possible modes of action. The role of retinoids as antioxidants and their potential as biomarkers of metal contamination are discussed. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  10. Inhibition of carcinogenesis by retinoids. [Review

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nettesheim, P.

    1979-01-01

    Progress made in recent years in the search for retinoids with anticarcinogenic activity is reviewed. There are many studies to be found in the literature which show no substantial effect of retinoids on carcinogenesis or tumor growth. Some of these negative findings may be related to the carcinogen dose used, the type of retinoid used, the dose, dose schedule or mode of administration of the retinoid. Others may indicate that the particular type of tumor or tumor system is, indeed, refractory to retinoids in general or to those retinoids that were tested. A great gap still exists in our knowledgemore » concerning the pharmake-kinetics of most retinoids their availability to various normal and cancerous tissues, and the role and existence of transport and binding proteins. There are studies which indicate that under certain conditions, particularly conditions of topical application, some retinoids may even enhance carcinogenesis. It seems, however, indisputable by now that some retinoids are effective inhibitors of carcinogenesis in some organ systems and can even inhibit the growth of some established tumors. While the mechanisms of these inhibitory effects are presently not understood, it does seem clear that they are not mediated via the cytotoxic mechanisms typical of chemotherapeutic agents. The hope that retinoids might become an effective tool to halt the progression of some neoplastic diseases, seems to be justified.« less

  11. Retinoid Pathway and Cancer Therapeutics

    PubMed Central

    Bushue, Nathan; Wan, Yu-Jui Yvonne

    2010-01-01

    The retinoids are a class of compounds that are structurally related to vitamin A. Retinoic acid, which is the active metabolite of retinol, regulates a wide range of biological processes including development, differentiation, proliferation, and apoptosis. Retinoids exert their effects through a variety of binding proteins including cellular retinol binding protein (CRBP), retinol-binding proteins (RBP), cellular retinoic acid-binding protein (CRABP), and nuclear receptors i.e. retinoic acid receptor (RAR) and retinoid × receptor (RXR). Because of the pleiotropic effects of retinoids, understanding the function of these binding proteins and nuclear receptors assists us in developing compounds that have specific effects. This review summarizes our current understanding of how retinoids are processed and act with the emphasis on the application of retinoids in cancer treatment and prevention. PMID:20654663

  12. Potential role of retinoids in ovarian physiology and pathogenesis of polycystic ovary syndrome.

    PubMed

    Jiang, Yanwen; Li, Chunjin; Chen, Lu; Wang, Fengge; Zhou, Xu

    2017-06-01

    Retinoids (retinol and its derivatives) are required for maintaining vision, immunity, barrier function, reproduction, embryogenesis, cell proliferation and differentiation. Furthermore, retinoid signaling plays a key role in initiating meiosis of germ cells of the mammalian fetal ovary. Recently, studies indicated that precise retinoid level regulation in the ovary provides a molecular control of ovarian development, steroidogenesis and oocyte maturation. Besides, abnormal retinoid signaling may be involved in the pathogenesis of polycystic ovary syndrome (PCOS), one of the most common ovarian endocrinopathies in reproductive-aged women worldwide. This review primarily summarizes recent advancements made in investigating the action of retinoid signaling in ovarian physiology as well as the abnormal retinoid signaling in PCOS. Copyright © 2017. Published by Elsevier B.V.

  13. Comparison of the in vitro and in vivo effects of retinoids either alone or in combination with cisplatin and 5-fluorouracil on tumor development and metastasis of melanoma.

    PubMed

    Liu, Xin; Chan, Sui Yung; Ho, Paul Chi-Lui

    2008-12-01

    Retinoids have previously been reported to inhibit proliferation of melanoma cell lines in vitro. However, the relative antimetastatic efficacy of various retinoids on melanoma in vivo is unknown. Therefore, we investigated the effects of different retinoids on the invasion and metastasis of murine melanoma B16-F10 cells in vitro and in vivo. Based on the findings, the antitumor effects of a selected retinoid either alone or in combination with cisplatin were also investigated in a preclinical mouse melanoma model. Cell proliferation and invasion analyses of murine melanoma B16-F10 cells were assessed in the presence of different retinoids, either alone or in combination with cisplatin (CDDP) or 5-fluorouracil (5-FU). Experimental lung metastasis assay was performed in this study to investigate the antimetastatic efficacy of retinoids. Additionally, a mouse melanoma model was used to assess the antitumor efficacy of a selected retinoid in combination with cisplatin. Retinoids showed significant antiproliferation and anti-invasion effects on murine melanoma B16-F10 cells. Pretreatment with retinoids increased the sensitivity to CDDP but not to 5-FU in in-vitro. Moreover, the number of metastatic colonies formed in the lungs of mice injected intravenously with B16-F10 cells was significantly reduced by injecting the respective retinoid once a day for 10 days. Treatment with a combination of cisplatin and 13-cis-retinoic acid resulted in a significant reduction in primary tumor size and the number of lung metastatic nodules in melanoma-bearing mice. These results suggest that retinoids not only exhibit antimetastatic effect, but also enhance the antitumor activity of cisplatin in vivo.

  14. Retinoids: fascinating up-and-coming scenario.

    PubMed

    Sardana, Kabir; Sehgal, Virendra N

    2003-05-01

    Retinoids have been in sharp focus ever since their introduction 30 years ago. They include any drug (s) that bind to retinoid receptors and elicit a biological response. Enormous information on the subject seems to embroil the recent literature. Practically it is impossible to clearly comprehend the undercurrents. The meticulously dispensing text envisages surmounting the perspective reader's predicaments. Accordingly, retinoids and their related facets namely retinoid receptors, classification, mode of action, and the pharmacological diversity have been precisely defined. Commonly used systemic retinoids too have been given a substantial fresh look along with their monitoring. Overall, adverse effects and relative and absolute contraindications have been scrupulously incorporated. Human immuno deficiency virus (HIV) and isoretinoid for acne, in particular, have been highlighted. Micronized isotretinoin formulations have also been taken care so also commonly used topical retinoids. Tretinoin and their newer formulation have also been accounted for along with tretinoin polymer cream. Adapalene, a new chemical entity possessing a unique physico-chemical activity similar to that of tretinoin has also been dealt with. Newer retinoids are likely to be a subject of intrigue. A focus on future potentials of retinoids is its special ingredient. The inclusion of details of rexinoid the most recent introduction in their purview is likely to invoke interest to further consolidate its reckoning in future. All in all the text of the paper should provide an insight into the current rumbling around retinoids.

  15. Spatial distribution of endogenous retinoids in the murine embryonic mandible.

    PubMed

    Kronmiller, J E; Beeman, C S

    1994-12-01

    Retinoids play an important part in pattern formation during embryonic development. Exogenous retinoids alter the pattern of skeletal, neural and odontogenic tissues. Endogenous retinoids have been demonstrated previously in the murine embryonic mandible, reaching a concentration peak during the initiation of odontogenesis. It was now found that endogenous retinoids are present in a concentration gradient in the embryonic mouse mandible at the time of the initiation of the dental lamina. All-trans-retinoic acid was more concentrated in the incisor region and retinol in the molar region. These results, and the fact that exogenous retinoids produce supernumerary incisors and missing molars, suggest that all-trans-retinoic acid may instruct incisor morphology.

  16. Single cell analysis in native tissue: Quantification of the retinoid content of hepatic stellate cells

    NASA Astrophysics Data System (ADS)

    Galler, Kerstin; Requardt, Robert Pascal; Glaser, Uwe; Markwart, Robby; Bocklitz, Thomas; Bauer, Michael; Popp, Jürgen; Neugebauer, Ute

    2016-04-01

    Hepatic stellate cells (HSCs) are retinoid storing cells in the liver: The retinoid content of those cells changes depending on nutrition and stress level. There are also differences with regard to a HSC’s anatomical position in the liver. Up to now, retinoid levels were only accessible from bulk measurements of tissue homogenates or cell extracts. Unfortunately, they do not account for the intercellular variability. Herein, Raman spectroscopy relying on excitation by the minimally destructive wavelength 785 nm is introduced for the assessment of the retinoid state of single HSCs in freshly isolated, unprocessed murine liver lobes. A quantitative estimation of the cellular retinoid content is derived. Implications of the retinoid content on hepatic health state are reported. The Raman-based results are integrated with histological assessments of the tissue samples. This spectroscopic approach enables single cell analysis regarding an important cellular feature in unharmed tissue.

  17. Single cell analysis in native tissue: Quantification of the retinoid content of hepatic stellate cells

    PubMed Central

    Galler, Kerstin; Requardt, Robert Pascal; Glaser, Uwe; Markwart, Robby; Bocklitz, Thomas; Bauer, Michael; Popp, Jürgen; Neugebauer, Ute

    2016-01-01

    Hepatic stellate cells (HSCs) are retinoid storing cells in the liver: The retinoid content of those cells changes depending on nutrition and stress level. There are also differences with regard to a HSC’s anatomical position in the liver. Up to now, retinoid levels were only accessible from bulk measurements of tissue homogenates or cell extracts. Unfortunately, they do not account for the intercellular variability. Herein, Raman spectroscopy relying on excitation by the minimally destructive wavelength 785 nm is introduced for the assessment of the retinoid state of single HSCs in freshly isolated, unprocessed murine liver lobes. A quantitative estimation of the cellular retinoid content is derived. Implications of the retinoid content on hepatic health state are reported. The Raman-based results are integrated with histological assessments of the tissue samples. This spectroscopic approach enables single cell analysis regarding an important cellular feature in unharmed tissue. PMID:27063397

  18. [Studies on the structure-activity relationship of retinoids--Hansch analysis and 3D-OSAR studies on specific ligands of retinoid x receptor].

    PubMed

    Huang, N; Chu, F; Guo, Z

    1998-06-01

    Retinoids (Vitamin A, its metabolites and synthetic analogues) play important roles in a variety of biological processes, including cellular differentiation, proliferation and apoptosis. The many diverse actions of retinoids attribute to the ability of regulating transcription of different target genes through activation of multiple retinoid nuclear receptors (RAR of RXR). So, retinoids with selective binding ability to specific receptor may not only have improved therapeutic indices, but may also be invaluable for elucidating the molecular mechanism of retinoidal transcriptional activation. Based on the two dimensional and three dimensional quantitative structure-activity relationships of specific ligands of RXR, we carried out mimesis of environment of ligands interacting with their receptor and, to some extent, mapping the topological and physico-chemical characteristics of receptor. The knowledge of the QSAR study will offer detailed molecular information for design, synthesis and biological evaluation in drug research and development.

  19. Vitamin A Metabolism: An Update

    PubMed Central

    D’Ambrosio, Diana N.; Clugston, Robin D.; Blaner, William S.

    2011-01-01

    Retinoids are required for maintaining many essential physiological processes in the body, including normal growth and development, normal vision, a healthy immune system, normal reproduction, and healthy skin and barrier functions. In excess of 500 genes are thought to be regulated by retinoic acid. 11-cis-retinal serves as the visual chromophore in vision. The body must acquire retinoid from the diet in order to maintain these essential physiological processes. Retinoid metabolism is complex and involves many different retinoid forms, including retinyl esters, retinol, retinal, retinoic acid and oxidized and conjugated metabolites of both retinol and retinoic acid. In addition, retinoid metabolism involves many carrier proteins and enzymes that are specific to retinoid metabolism, as well as other proteins which may be involved in mediating also triglyceride and/or cholesterol metabolism. This review will focus on recent advances for understanding retinoid metabolism that have taken place in the last ten to fifteen years. PMID:21350678

  20. Retinoids in the treatment of skin aging: an overview of clinical efficacy and safety

    PubMed Central

    Mukherjee, Siddharth; Date, Abhijit; Patravale, Vandana; Korting, Hans Christian; Roeder, Alexander; Weindl, Günther

    2006-01-01

    Aging of skin is an intricate biological process consisting of two types. While intrinsic or chronological aging is an inevitable process, photoaging involves the premature aging of skin occurring due to cumulative exposure to ultraviolet radiation. Chronological and photoaging both have clinically differentiable manifestations. Various natural and synthetic retinoids have been explored for the treatment of aging and many of them have shown histological and clinical improvement, but most of the studies have been carried out in patients presenting with photoaged skin. Amongst the retinoids, tretinoin possibly is the most potent and certainly the most widely investigated retinoid for photoaging therapy. Although retinoids show promise in the treatment of skin aging, irritant reactions such as burning, scaling or dermatitis associated with retinoid therapy limit their acceptance by patients. This problem is more prominent with tretinoin and tazarotene whereas other retinoids mainly represented by retinaldehyde and retinol are considerably less irritating. In order to minimize these side effects, various novel drug delivery systems have been developed. In particular, nanoparticles have shown a good potential in improving the stability, tolerability and efficacy of retinoids like tretinoin and retinol. However, more elaborate clinical studies are required to confirm their advantage in the delivery of topical retinoids. PMID:18046911

  1. Anti-tumor effects of retinoids combined with trastuzumab or tamoxifen in breast cancer cells: induction of apoptosis by retinoid/trastuzumab combinations.

    PubMed

    Koay, Debbie C; Zerillo, Cynthia; Narayan, Murli; Harris, Lyndsay N; DiGiovanna, Michael P

    2010-01-01

    HER2 and estrogen receptor (ER) are important in breast cancer and are therapeutic targets of trastuzumab (Herceptin) and tamoxifen, respectively. Retinoids inhibit breast cancer growth, and modulate signaling by HER2 and ER. We hypothesized that treatment with retinoids and simultaneous targeting of HER2 and/or ER may have enhanced anti-tumor effects. The effects of retinoids combined with trastuzumab or tamoxifen were examined in two human breast cancer cell lines in culture, BT474 and SKBR3. Assays of proliferation, apoptosis, differentiation, cell cycle distribution, and receptor signaling were performed. In HER2-overexpressing/ER-positive BT474 cells, combining all-trans retinoic acid (atRA) with tamoxifen or trastuzumab synergistically inhibited cell growth, and altered cell differentiation and cell cycle. Only atRA/trastuzumab-containing combinations induced apoptosis. BT474 and HER2-overexpressing/ER-negative SKBR3 cells were treated with a panel of retinoids (atRA, 9-cis-retinoic acid, 13-cis-retinoic acid, or N-(4-hydroxyphenyl) retinamide (fenretinide) (4-HPR)) combined with trastuzumab. In BT474 cells, none of the single agents except 4-HPR induced apoptosis, but again combinations of each retinoid with trastuzumab did induce apoptosis. In contrast, the single retinoid agents did cause apoptosis in SKBR3 cells; this was only modestly enhanced by addition of trastuzumab. The retinoid drug combinations altered signaling by HER2 and ER. Retinoids were inactive in trastuzumab-resistant BT474 cells. Combining retinoids with trastuzumab maximally inhibits cell growth and induces apoptosis in trastuzumab-sensitive cells. Treatment with such combinations may have benefit for breast cancer patients.

  2. Retinoid Signaling in Pancreatic Cancer, Injury and Regeneration

    PubMed Central

    Colvin, Emily K.; Susanto, Johana M.; Kench, James G.; Ong, Vivienna N.; Mawson, Amanda; Pinese, Mark; Chang, David K.; Rooman, Ilse; O'Toole, Sandra A.; Segara, Davendra; Musgrove, Elizabeth A.; Sutherland, Robert L.; Apte, Minoti V.; Scarlett, Christopher J.; Biankin, Andrew V.

    2011-01-01

    Background Activation of embryonic signaling pathways quiescent in the adult pancreas is a feature of pancreatic cancer (PC). These discoveries have led to the development of novel inhibitors of pathways such as Notch and Hedgehog signaling that are currently in early phase clinical trials in the treatment of several cancer types. Retinoid signaling is also essential for pancreatic development, and retinoid therapy is used successfully in other malignancies such as leukemia, but little is known concerning retinoid signaling in PC. Methodology/Principal Findings We investigated the role of retinoid signaling in vitro and in vivo in normal pancreas, pancreatic injury, regeneration and cancer. Retinoid signaling is active in occasional cells in the adult pancreas but is markedly augmented throughout the parenchyma during injury and regeneration. Both chemically induced and genetically engineered mouse models of PC exhibit a lack of retinoid signaling activity compared to normal pancreas. As a consequence, we investigated Cellular Retinoid Binding Protein 1 (CRBP1), a key regulator of retinoid signaling known to play a role in breast cancer development, as a potential therapeutic target. Loss, or significant downregulation of CRBP1 was present in 70% of human PC, and was evident in the very earliest precursor lesions (PanIN-1A). However, in vitro gain and loss of function studies and CRBP1 knockout mice suggested that loss of CRBP1 expression alone was not sufficient to induce carcinogenesis or to alter PC sensitivity to retinoid based therapies. Conclusions/Significance In conclusion, retinoid signalling appears to play a role in pancreatic regeneration and carcinogenesis, but unlike breast cancer, it is not mediated directly by CRBP1. PMID:22220202

  3. Retinoids and rexinoids in cancer prevention: from laboratory to clinic.

    PubMed

    Uray, Iván P; Dmitrovsky, Ethan; Brown, Powel H

    2016-02-01

    Early in the age of modern medicine the consequences of vitamin A deficiency drew attention to the fundamental link between retinoid-dependent homeostatic regulation and malignant hyperproliferative diseases. The term "retinoid" includes a handful of endogenous and a large group of synthetic derivatives of vitamin A. These multifunctional lipid-soluble compounds directly regulate target genes of specific biological functions and critical signaling pathways to orchestrate complex functions from vision to development, metabolism, and inflammation. Many of the retinoid activities on the cellular level have been well characterized and translated to the regulation of processes like differentiation and cell death, which play critical roles in the outcome of malignant transformation of tissues. In fact, retinoid-based differentiation therapy of acute promyelocytic leukemia was one of the first successful examples of molecularly targeted treatment strategies. The selectivity, high receptor binding affinity and the ability of retinoids to directly modulate gene expression programs present a distinct pharmacological opportunity for cancer treatment and prevention. However, to fully exploit their potential, the adverse effects of retinoids must be averted. In this review we provide an overview of the biology of retinoid (activated by nuclear retinoic acid receptors [RARs]) and rexinoid (engaged by nuclear retinoid X receptors [RXRs]) action concluded from a long line of preclinical studies, in relation to normal and transformed states of cells. We will also discuss the past and current uses of retinoids in the treatment of malignancies, the potential of rexinoids in the cancer prevention setting, both as single agents and in combinations. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Catalytic mechanism of a retinoid isomerase essential for vertebrate vision

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kiser, Philip D.; Zhang, Jianye; Badiee, Mohsen

    Visual function in vertebrates is dependent on the membrane-bound retinoid isomerase RPE65, an essential component of the retinoid cycle pathway that regenerates 11-cis-retinal for rod and cone opsins. The mechanism by which RPE65 catalyzes stereoselective retinoid isomerization has remained elusive because of uncertainty about how retinoids bind to its active site. Here we present crystal structures of RPE65 in complex with retinoid-mimetic compounds, one of which is in clinical trials for the treatment of age-related macular degeneration. The structures reveal the active site retinoid-binding cavity located near the membrane-interacting surface of the enzyme as well as an Fe-bound palmitate ligandmore » positioned in an adjacent pocket. With the geometry of the RPE65–substrate complex clarified, we delineate a mechanism of catalysis that reconciles the extensive biochemical and structural research on this enzyme. Finally, these data provide molecular foundations for understanding a key process in vision and pharmacological inhibition of RPE65 with small molecules.« less

  5. Catalytic mechanism of a retinoid isomerase essential for vertebrate vision

    DOE PAGES

    Kiser, Philip D.; Zhang, Jianye; Badiee, Mohsen; ...

    2015-04-20

    Visual function in vertebrates is dependent on the membrane-bound retinoid isomerase RPE65, an essential component of the retinoid cycle pathway that regenerates 11-cis-retinal for rod and cone opsins. The mechanism by which RPE65 catalyzes stereoselective retinoid isomerization has remained elusive because of uncertainty about how retinoids bind to its active site. Here we present crystal structures of RPE65 in complex with retinoid-mimetic compounds, one of which is in clinical trials for the treatment of age-related macular degeneration. The structures reveal the active site retinoid-binding cavity located near the membrane-interacting surface of the enzyme as well as an Fe-bound palmitate ligandmore » positioned in an adjacent pocket. With the geometry of the RPE65–substrate complex clarified, we delineate a mechanism of catalysis that reconciles the extensive biochemical and structural research on this enzyme. Finally, these data provide molecular foundations for understanding a key process in vision and pharmacological inhibition of RPE65 with small molecules.« less

  6. Catalytic mechanism of a retinoid isomerase essential for vertebrate vision

    PubMed Central

    Kiser, Philip D.; Zhang, Jianye; Badiee, Mohsen; Li, Qingjiang; Shi, Wuxian; Sui, Xuewu; Golczak, Marcin; Tochtrop, Gregory P.; Palczewski, Krzysztof

    2015-01-01

    Visual function in vertebrates is dependent on the membrane-bound retinoid isomerase, RPE65, an essential component of the retinoid cycle pathway that regenerates 11-cis-retinal for rod and cone opsins. The mechanism by which RPE65 catalyzes stereoselective retinoid isomerization has remained elusive due to uncertainty about how retinoids bind to its active site. Here we present crystal structures of RPE65 in complex with retinoid-mimetic compounds, one of which is in clinical trials for treatment of age-related macular degeneration. The structures reveal the active site retinoid-binding cavity located near the membrane-interacting surface of the enzyme as well as an Fe-bound palmitate ligand positioned in an adjacent pocket. With the geometry of the RPE65-substrate complex clarified we delineate a mechanism of catalysis that reconciles the extensive biochemical and structural research on this enzyme. These data provide molecular foundations for understanding a key process in vision and pharmacological inhibition of RPE65 with small molecules. PMID:25894083

  7. Comparison of extraction phases for a two-phase culture of a recombinant E. coli producing retinoids.

    PubMed

    Jang, Hui-Jeong; Ha, Bo-Kyung; Kim, Jin-Woong; Jung, Kyung-Hwa; Ahn, Jiyoon; Yoon, Sang-Hwal; Kim, Seon-Won

    2014-03-01

    To prevent degradation of intracellular retinoids through in situ extraction from the cells, a two-phase culture system was performed. Several organic solvents, including n-alkanes, mineral oils and cosmetic raw materials, were applied as the extraction phase. Of the n-alkanes, n-decane had the highest retinoid production as 134 mg/l after 72 h. For mineral oil, light and heavy mineral oil gave retinoid productions of 158 and 174 mg/l after 96 h, respectively. Of other materials, isopropyl myristate gave the highest retinoid production of 181 mg/l. These results indicate that many types of oils can be applied for retinoid production, and optimization of the in situ extraction process will lead to further improve of economical production for the industrial purpose.

  8. Simultaneous quantification of various retinoids by high performance liquid chromatography: its relevance to alcohol research.

    PubMed

    Yokoyama, H; Matsumoto, M; Shiraishi, H; Ishii, H

    2000-04-01

    We established a high performance liquid chromatography system that allowed simultaneous quantification of various retinoids. We applied the retinoids to a high performance liquid chromatography system with a silica gel absorption column. Samples were separated by the system with a binary multistep gradient with two kinds of solvent that contained n-Hexan, 2-propanol, and glacial acetic acid in different ratios. Each retinoid was detected at a wavelength of 350 nm. This condition allowed separation of 13-cis-retinoic acid, 9-cis-retinoic acid, all-trans-retinoic acid, 13-cis-retinol, all-trans-retinol, all-trans-4-oxo-retinoic acid, and 13-cis-4-oxo-retinoic acid as distinct single peaks. Each retinoid was also analyzed separately and its retention time determined. To ascertain the reliability of this system for retinoid quantification, retinoids at various concentrations were applied to the system. We observed the linearities between the concentration and area under the curve of the peak for each retinoid by linear least-squares regression analysis up to 2.5 ng/ml for all retinoic acids and up to 5 ng/ml for all retinols. There was no significant scattering in tests of within-day reproducibility or day-to-day reproducibility. Using this system, we examined effects of light exposure on isomerization of retinoids. When retinoids were exposed to room light for 2 hr, the amounts of all but 13-cis-retinol changed significantly. In particular, the amounts of all-trans-retinoic acid and 9-cis-retinoic acid were reduced by 40% and 60%, respectively. The HPLC system established in this study should be useful for studying the oxidation pathway of retinol to retinoic acid. A light-shielded condition is required when particular retinoic acids are analyzed.

  9. MEK blockade converts AML differentiating response to retinoids into extensive apoptosis.

    PubMed

    Milella, Michele; Konopleva, Marina; Precupanu, Cristina M; Tabe, Yoko; Ricciardi, Maria Rosaria; Gregorj, Chiara; Collins, Steven J; Carter, Bing Z; D'Angelo, Carmen; Petrucci, Maria Teresa; Foà, Robin; Cognetti, Francesco; Tafuri, Agostino; Andreeff, Michael

    2007-03-01

    The aberrant function of transcription factors and/or kinase-based signaling pathways that regulate the ability of hematopoietic cells to proliferate, differentiate, and escape apoptosis accounts for the leukemic transformation of myeloid progenitors. Here, we demonstrate that simultaneous retinoid receptor ligation and blockade of the MEK/ERK signaling module, using the small-molecule inhibitor CI-1040, result in a strikingly synergistic induction of apoptosis in both acute myeloid leukemia (AML) and acute promyelocytic leukemia (APL) cells with constitutive ERK activation. This proapoptotic synergism requires functional RAR and RXR retinoid receptors, as demonstrated using RAR- and RXR-selective ligands and RAR-defective cells. In the presence of MEK inhibitors, however, retinoid-induced chromatin remodeling, target-gene transcription, and granulocytic differentiation are strikingly inhibited and apoptosis induction becomes independent of death-inducing ligand/receptor pairs; this suggests that apoptosis induction by combined retinoids and MEK inhibitors is entirely distinct from the classical "postmaturation" apoptosis induced by retinoids alone. Finally, we identify disruption of Bcl-2-dependent mitochondrial homeostasis as a possible point of convergence for the proapoptotic synergism observed with retinoids and MEK inhibitors. Taken together, these results indicate that combined retinoid treatment and MEK blockade exert powerful antileukemic effects and could be developed into a novel therapeutic strategy for both AML and APL.

  10. Retinoids for prevention and treatment of actinic keratosis*

    PubMed Central

    Ianhez, Mayra; Fleury, Luiz Fernando Fróes; Miot, Hélio Amante; Bagatin, Edileia

    2013-01-01

    Actinic keratosis is a common cause of dermatological consultations and it presents a strong association with squamous cell carcinoma. Many substances are used for treatment and prevention, such as retinoids. Nevertheless, many studies on retinoids emphasize their application in treating and preventing non melanoma skin cancers. In this article, we reviewed studies about systemic and topical retinoids used with immunocompetent patients and organ transplant recipients with actinic keratosis, as primary or secondary outcomes. The majority of these papers pointed to a reduction in actinic keratosis count after treatment with retinoids. However, studies need to be better-defined in order to address the lack of a standardized dose, the absence of control groups, the low number of patients and short follow-up periods. Blind, randomized and controlled clinical trials with adequate sample sizes, specifically focused on actinic keratosis, are needed to clarify the real benefit of topical and/or oral retinoids. Comparison of efficacy and safety between oral and topical retinoids in the prevention and treatment of non-melanoma skin cancers and actinic keratosis is an essential pre requisite to establish new strategies to control these conditions. PMID:24068130

  11. Are retinoids a promise for Alzheimer's disease management?

    PubMed

    Carratù, M R; Marasco, C; Signorile, A; Scuderi, C; Steardo, L

    2012-01-01

    Retinoids regulate several physiological and pathological processes through the interaction with nuclear receptors. Retinoid-associated signaling which plays an essential role in neurodevelopment appears to remain active in the adult central nervous system (CNS), thus assuming a high significance in the context of neurodegeneration, and indeed retinoid analogs are thought to be promising therapeutic agents for the treatment of neurodegenerative disorders. The ability of retinoids to exert antioxidant effects, inhibit amyloid-β (Aβ) deposits and likely Aβ-induced mitochondrial dysfunction, tau hyperphosphorylation, Aβ-induced IL6 production and neuroinflammation, increase survival in hippocampal neurons, and reverse cognitive deficits in animal models of Alzheimer's disease (AD) is discussed. Although retinoids with their multi-target activity are revealing to be promising for management of AD which is a multifaceted biochemical phenomenon, timing as well as appropriate dosage and safety remain, however, a challenge. The end-stage lesions, namely senile plaques and neurofibrillary tangles, are, at present, considered an adaptive response to oxidative stress underlying AD, thus paradoxically late administration of retinoids could even suppress a protective mechanism by inhibiting Aβ deposits.

  12. Retinoid production using metabolically engineered Escherichia coli with a two-phase culture system.

    PubMed

    Jang, Hui-Jeong; Yoon, Sang-Hwal; Ryu, Hee-Kyung; Kim, Jung-Hun; Wang, Chong-Long; Kim, Jae-Yean; Oh, Deok-Kun; Kim, Seon-Won

    2011-07-29

    Retinoids are lipophilic isoprenoids composed of a cyclic group and a linear chain with a hydrophilic end group. These compounds include retinol, retinal, retinoic acid, retinyl esters, and various derivatives of these structures. Retinoids are used as cosmetic agents and effective pharmaceuticals for skin diseases. Retinal, an immediate precursor of retinoids, is derived by β-carotene 15,15'-mono(di)oxygenase (BCM(D)O) from β-carotene, which is synthesized from the isoprenoid building blocks isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP). Retinoids are chemically unstable and biologically degraded via retinoic acid. Although extensive studies have been performed on the microbial production of carotenoids, retinoid production using microbial metabolic engineering has not been reported. Here, we report retinoid production using engineered Escherichia coli that express exogenous BCM(D)O and the mevalonate (MVA) pathway for the building blocks synthesis in combination with a two-phase culture system using a dodecane overlay. Among the BCM(D)O tested in E. coli, the synthetic retinoid synthesis protein (SR), based on bacteriorhodopsin-related protein-like homolog (Blh) of the uncultured marine bacteria 66A03, showed the highest β-carotene cleavage activity with no residual intracellular β-carotene. By introducing the exogenous MVA pathway, 8.7 mg/L of retinal was produced, which is 4-fold higher production than that of augmenting the MEP pathway (dxs overexpression). There was a large gap between retinal production and β-carotene consumption using the exogenous MVA pathway; therefore, the retinal derivatives were analyzed. The derivatives, except for retinoic acid, that formed were identified, and the levels of retinal, retinol, and retinyl acetate were measured. Amounts as high as 95 mg/L retinoids were obtained from engineered E. coli DH5α harboring the synthetic SR gene and the exogenous MVA pathway in addition to dxs overexpression, which were cultured at 29°C for 72 hours with 2YT medium containing 2.0% (w/v) glycerol as the main carbon source. However, a significant level of intracellular degradation of the retinoids was also observed in the culture. To prevent degradation of the intracellular retinoids through in situ extraction from the cells, a two-phase culture system with dodecane was used. The highest level of retinoid production (136 mg/L) was obtained after 72 hours with 5 mL of dodecane overlaid on a 5 mL culture. In this study, we successfully produced 136 mg/L retinoids, which were composed of 67 mg/L retinal, 54 mg/L retinol, and 15 mg/L retinyl acetate, using a two-phase culture system with dodecane, which produced 68-fold more retinoids than the initial level of production (2.2 mg/L). Our results demonstrate the potential use of E. coli as a promising microbial cell factory for retinoid production.

  13. Temporal distribution of endogenous retinoids in the embryonic mouse mandible.

    PubMed

    Beeman, C S; Kronmiller, J E

    1994-09-01

    Retinoids play an important part in embryonic pattern formation. They are necessary for normal differentiation of odontogenic tissues and, in excess, disrupt the pattern of tooth formation. Excess retinoids produce supernumerary buds of the dental lamina in the diastema region of the mouse embryonic mandible where teeth do not normally form. This effect is coincident with an increase in epithelial proliferation and an alteration in epidermal growth factor mRNA expression (a gene product necessary for tooth formation). It was found by high-performance liquid chromatography that endogenous retinoids are present in the developing murine mandible and that concentrations of some retinoids reach a peak at the time of the initiation of odontogenesis (dental lamina formation).

  14. Skincare science: update on topical retinoids.

    PubMed

    Boswell, C B

    2006-01-01

    According to the author, the single most effective component in a skincare regimen for reversal of photoaging is the use of retinoids. Here is a guide to the mechanism and application of various formulations of retinoids, and a comprehensive skin regimen incorporating tretinoin.

  15. A forward chemical screen in zebrafish identifies a retinoic acid derivative with receptor specificity.

    PubMed

    Das, Bhaskar C; McCartin, Kellie; Liu, Ting-Chun; Peterson, Randall T; Evans, Todd

    2010-04-02

    Retinoids regulate key developmental pathways throughout life, and have potential uses for differentiation therapy. It should be possible to identify novel retinoids by coupling new chemical reactions with screens using the zebrafish embryonic model. We synthesized novel retinoid analogues and derivatives by amide coupling, obtaining 80-92% yields. A small library of these compounds was screened for bioactivity in living zebrafish embryos. We found that several structurally related compounds significantly affect development. Distinct phenotypes are generated depending on time of exposure, and we characterize one compound (BT10) that produces specific cardiovascular defects when added 1 day post fertilization. When compared to retinoic acid (ATRA), BT10 shows similar but not identical changes in the expression pattern of embryonic genes that are known targets of the retinoid pathway. Reporter assays determined that BT10 interacts with all three RAR receptor sub-types, but has no activity for RXR receptors, at all concentrations tested. Our screen has identified a novel retinoid with specificity for retinoid receptors. This lead compound may be useful for manipulating components of retinoid signaling networks, and may be further derivatized for enhanced activity.

  16. Functions of Intracellular Retinoid Binding-Proteins.

    PubMed

    Napoli, Joseph L

    Multiple binding and transport proteins facilitate many aspects of retinoid biology through effects on retinoid transport, cellular uptake, metabolism, and nuclear delivery. These include the serum retinol binding protein sRBP (aka Rbp4), the plasma membrane sRBP receptor Stra6, and the intracellular retinoid binding-proteins such as cellular retinol-binding proteins (CRBP) and cellular retinoic acid binding-proteins (CRABP). sRBP transports the highly lipophilic retinol through an aqueous medium. The major intracellular retinol-binding protein, CRBP1, likely enhances efficient retinoid use by providing a sink to facilitate retinol uptake from sRBP through the plasma membrane or via Stra6, delivering retinol or retinal to select enzymes that generate retinyl esters or retinoic acid, and protecting retinol/retinal from excess catabolism or opportunistic metabolism. Intracellular retinoic acid binding-proteins (CRABP1 and 2, and FABP5) seem to have more diverse functions distinctive to each, such as directing retinoic acid to catabolism, delivering retinoic acid to specific nuclear receptors, and generating non-canonical actions. Gene ablation of intracellular retinoid binding-proteins does not cause embryonic lethality or gross morphological defects. Metabolic and functional defects manifested in knockouts of CRBP1, CRBP2 and CRBP3, however, illustrate their essentiality to health, and in the case of CRBP2, to survival during limited dietary vitamin A. Future studies should continue to address the specific molecular interactions that occur between retinoid binding-proteins and their targets and their precise physiologic contributions to retinoid homeostasis and function.

  17. In vitro retinoid binding and release from a collagen sponge material in a simulated intravaginal environment.

    PubMed

    Dorr, R T; Surwit, E A; Droegemueller, W; Alberts, D S; Meyskens, F L; Chvapil, M

    1982-11-01

    Four in vitro preparations were constructed to simulate the intravaginal release of two retinoids, all-trans-retinoic acid (t-RA) and 13-cis-retinoic acid (c-RA), from a 0.7% collagen sponge diaphragm insert. Four t-RA concentrations, 0.019, 0.05, 0.1, and 0.15% in methanol were added to the sponge. The release into an artificial vaginal fluid was monitored serially over 72 h by serial analysis for t-RA and c-RA using high-pressure liquid chromatography. In each preparation, retinoid release was immediate and noncontinuous. At 37 degrees C, the retinoids were stable for at least 48 h. Trans-retinoic acid was the predominant retinoid recovered. Only trace amounts of the cis-isomer were released. Peak t-RA levels were 20 microM after 0.01%, 60-80 microM after 0.05%, 100-200 microM after 0.1%, and 320 microM after 0.15%. When the vaginal fluid bath was changed after 5 h, no further significant retinoid release occurred. There was significant loss of up to 70% of the applied t-RA into the collagen sponge. The retinoid binding was concentration dependent (higher binding with higher concentrations) and was maximal only after 24 h of co-incubation. The discontinuous release of t-RA and the high degree of binding to collagen would seem to preclude use of the diaphragm insert as a vaginal drug delivery system, at least for retinoids.

  18. Mefloquine use, psychosis, and violence: a retinoid toxicity hypothesis.

    PubMed

    Mawson, Anthony

    2013-07-15

    Mefloquine use has been linked to severe gastrointestinal and neuropsychiatric adverse effects, including cognitive disturbances, anxiety, depression, psychosis, and violence. The adverse effects of the drug are thought to result from the secondary consequences of hepatocellular injury; in fact, mefloquine is known to cause a transient, anicteric chemical hepatitis. However, the mechanism of mefloquine-associated liver damage and the associated neuropsychiatric and behavioral effects of the drug are not well understood. Mefloquine and other 8-amino-quinolines are the only antimalarial drugs that target the liver-stage malaria parasites, which selectively absorb vitamin A from the host. Vitamin A is also stored mainly in the liver, in potentially poisonous concentrations. These observations suggest that both the therapeutic effectiveness of mefloquine and its adverse effects are related to the ability of the 8-aminoquinolines to alter the metabolism of retinoids (vitamin A and its congeners). Several lines of evidence support the hypothesis that mefloquine neurotoxicity and other adverse effects reflect an endogenous form of hypervitaminosis A due to a process involving: mefloquine-induced dehydrogenase inhibition; the accumulation of retinoids in the liver; retinoid-induced hepatocellular damage; the spillage of stored retinoids into the circulation; and the transport of these compounds to the gut and brain in toxic concentrations. The retinoid hypothesis could be tested clinically by comparing cases of mefloquine toxicity and untreated controls in terms of retinoid profiles (retinol, retinyl esters, percent retinyl esters, and retinoic acid). Subject to such tests, retinoid profiling could provide an indicator for assessing mefloquine-associated adverse effects.

  19. Key enzymes of the retinoid (visual) cycle in vertebrate retina

    PubMed Central

    Kiser, Philip D.; Golczak, Marcin; Maeda, Akiko; Palczewski, Krzysztof

    2011-01-01

    A major goal in vision research over the past few decades has been to understand the molecular details of retinoid processing within the retinoid (visual) cycle. This includes the consequences of side reactions that result from delayed all-trans-retinal clearance and condensation with phospholipids that characterize a variety of serious retinal diseases. Knowledge of the basic retinoid biochemistry involved in these diseases is essential for development of effective therapeutics. Photoisomerization of the 11-cis-retinal chromophore of rhodopsin triggers a complex set of metabolic transformations collectively termed phototransduction that ultimately lead to light perception. Continuity of vision depends on continuous conversion of all-trans-retinal back to the 11-cis-retinal isomer. This process takes place in a series of reactions known as the retinoid cycle, which occur in photoreceptor and RPE cells. All-trans-retinal, the initial substrate of this cycle, is a chemically reactive aldehyde that can form toxic conjugates with proteins and lipids. Therefore, much experimental effort has been devoted to elucidate molecular mechanisms of the retinoid cycle and all-trans-retinal-mediated retinal degeneration, resulting in delineation of many key steps involved in regenerating 11-cis-retinal. Three particularly important reactions are catalyzed by enzymes broadly classified as acyltransferases, short-chain dehydrogenases/reductases and carotenoid/retinoid isomerases/oxygenases. PMID:21447403

  20. Identification of a Novel Non-retinoid Pan Inverse Agonist of the Retinoic Acid Receptors

    PubMed Central

    Busby, Scott A.; Kumar, Naresh; Kuruvilla, Dana S.; Istrate, Monica A.; Conkright, Juliana J.; Wang, Yongjun; Kamenecka, Theodore M.; Cameron, Michael D.; Roush, William R.; Burris, Thomas P.; Griffin, Patrick R.

    2011-01-01

    Retinoids are potent forms of vitamin A and are involved in a broad range of physiological processes and the pharmacological effects of retinoids are primarily mediated by the retinoic acid receptors (RARs) and the retinoid X receptors (RXRs). Several natural and synthetic RAR modulators have proven to be clinically useful for a number of therapeutic indications including cancer, psoriasis, and diabetes. Unfortunately, these agents lead to a number of significant side effects. Most synthetic retinoid ligands are based on the retinoid scaffold and thus have similarities to the natural ligand with all previously disclosed RAR ligands having a carboxylic acid that makes a critical ionic bridge within the ligand binding domain of the receptors. The potential therapeutic value offered from RAR modulation provides the impetus to identify novel ligands based on unique scaffolds that may offer improved toxicity and pharmacokinetic profiles. Here we describe the identification of an atypical RAR inverse agonist that represents the first non-acid, non-retinoid direct modulator of RAR receptor subfamily. SR-0065 functions as a pan-RAR inverse agonist suppressing the basal activity of RARα, RARβ, and RARγ as well as inhibiting agonist induced RAR activity. SR-0065 treatment enhanced receptor interaction with a peptide representative of the corepressor SMRT and in cells SR-0065 enhances recruitment of SMRT to RARγ. The acid form of SR-0065, SR-1758, was inactive in all assays. Thus, SR-0065 represents a new class of non-acid, non-retinoid RAR modulator that may be used as a point to initiate development of improved RAR-targeted drugs. PMID:21381756

  1. Mefloquine use, psychosis, and violence: A retinoid toxicity hypothesis

    PubMed Central

    Mawson, Anthony R.

    2013-01-01

    Mefloquine use has been linked to severe gastrointestinal and neuropsychiatric adverse effects, including cognitive disturbances, anxiety, depression, psychosis, and violence. The adverse effects of the drug are thought to result from the secondary consequences of hepatocellular injury; in fact, mefloquine is known to cause a transient, anicteric chemical hepatitis. However, the mechanism of mefloquine-associated liver damage and the associated neuropsychiatric and behavioral effects of the drug are not well understood. Mefloquine and other 8-amino-quinolines are the only antimalarial drugs that target the liver-stage malaria parasites, which selectively absorb vitamin A from the host. Vitamin A is also stored mainly in the liver, in potentially poisonous concentrations. These observations suggest that both the therapeutic effectiveness of mefloquine and its adverse effects are related to the ability of the 8-aminoquinolines to alter the metabolism of retinoids (vitamin A and its congeners). Several lines of evidence support the hypothesis that mefloquine neurotoxicity and other adverse effects reflect an endogenous form of hypervitaminosis A due to a process involving: mefloquine-induced dehydrogenase inhibition; the accumulation of retinoids in the liver; retinoid-induced hepatocellular damage; the spillage of stored retinoids into the circulation; and the transport of these compounds to the gut and brain in toxic concentrations. The retinoid hypothesis could be tested clinically by comparing cases of mefloquine toxicity and untreated controls in terms of retinoid profiles (retinol, retinyl esters, percent retinyl esters, and retinoic acid). Subject to such tests, retinoid profiling could provide an indicator for assessing mefloquine-associated adverse effects. PMID:23852388

  2. Retinoid receptors, transporters, and metabolizers as therapeutic targets in late onset Alzheimer disease.

    PubMed

    Goodman, Ann B

    2006-12-01

    Vitamin A (retinoid) is required in the adult brain to enable cognition, learning, and memory. While brain levels of retinoid diminish over the course of normal ageing, retinoid deficit is greater in late onset Alzheimer disease (LOAD) brains than in normal-aged controls. This paper reviews recent evidence supporting these statements and further suggests that genes necessary for the synthesis, transport and function of retinoid to and within the ageing brain are appropriate targets for treatment of LOAD. These genes tend to be clustered with genes that have been proposed as candidates in LOAD, are found at chromosomal regions linked to LOAD, and suggest the possibility of an overall coordinated regulation. This phenomenon is termed Chromeron and is analogous to the operon mechanism observed in prokaryotes. Suggested treatment targets are the retinoic-acid inactivating enzymes (CYP26)s, the retinol binding and transport proteins, retinol-binding protein (RBP)4 and transthyretin (TTR), and the retinoid receptors. TTR as a LOAD target is the subject of active investigation. The retinoid receptors and the retinoid-inactivating enzymes have previously been proposed as targets. This is the first report to suggest that RBP4 is an amenable treatment target in LOAD. RBP4 is elevated in type-2 diabetes and obesity, conditions associated with increased risk for LOAD. Fenretinide, a novel synthetic retinoic acid (RA) analog lowers RBP4 in glucose intolerant obese mice. The feasibility of using fenretinide either as an adjunct to present LOAD therapies, or on its own as an early prevention strategy should be determined. (c) 2006 Wiley-Liss, Inc.

  3. [Abnormal expression of genes that regulate retinoid metabolism and signaling in non-small-cell lung cancer].

    PubMed

    Kuznetsova, E S; Zinovieva, O L; Oparina, N Yu; Prokofjeva, M M; Spirin, P V; Favorskaya, I A; Zborovskaya, I B; Lisitsyn, N A; Prassolov, V S; Mashkova, T D

    2016-01-01

    Retinoids are signaling molecules that control a wide variety of cellular processes and possess antitumor activity. This work presents a comprehensive description of changes in the expression of 23 genes that regulate retinoid metabolism and signaling in non-small-cell lung cancer tumors compared to adjacent normal tissues obtained using RT-PCR. Even at early stages of malignant transformation, a significant decrease in ADH1B, ADH3, RDHL, and RALDH1 mRNA levels was observed in 82, 79, 73, and 64% of tumor specimens, respectively, and a considerable increase in AKR1B10 mRNA content was observed in 80% of tumors. Dramatic changes in the levels of these mRNAs can impair the synthesis of all-trans retinoic acid, a key natural regulatory retinoid. Apart from that, it was found that mRNA levels of nuclear retinoid receptor genes RXRγ, RARα, RXRα, and gene RDH11 were significantly decreased in 80, 67, 57, and 66% of tumor specimens, respectively. Thus, neoplastic transformation of lung tissue cells is accompanied with deregulated expression of key genes of retinoid metabolism and function.

  4. Chromosomal locations and modes of action of genes of the retinoid (vitamin A) system support their involvement in the etiology of schizophrenia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goodman, A.B.

    1995-08-14

    Vitamin A (retinoid), an essential nutrient for fetal and subsequent mammalian development, is involved in gene expression, cell differentiation, proliferation, migration, and death. Retinoic acid (RA) the morphogenic derivative of vitamin A is highly teratogenic. In humans retinoid excess or deficit can result in brain anomalies and psychosis. This review discusses chromosomal loci of genes that control the retinoid cascade in relation to some candidate genes in schizophrenia. The paper relates the knowledge about the transport, delivery, and action of retinoids to what is presently known about the pathology of schizophrenia, with particular reference to the dopamine hypothesis, neurotransmitters, themore » glutamate hypothesis, neurotransmitters, the glutamate hypothesis, retinitis pigmentosa, dermatologic disorders, and craniofacial anomalies. 201 refs., 1 tab.« less

  5. ATP7A is a novel target of retinoic acid receptor β2 in neuroblastoma cells

    PubMed Central

    Bohlken, A; Cheung, B B; Bell, J L; Koach, J; Smith, S; Sekyere, E; Thomas, W; Norris, M; Haber, M; Lovejoy, D B; Richardson, D R; Marshall, G M

    2009-01-01

    Increased retinoic acid receptor β (RARβ2) gene expression is a hallmark of cancer cell responsiveness to retinoid anticancer effects. Moreover, low basal or induced RARβ2 expression is a common feature of many human cancers, suggesting that RARβ2 may act as a tumour suppressor gene in the absence of supplemented retinoid. We have previously shown that low RARβ2 expression is a feature of advanced neuroblastoma. Here, we demonstrate that the ABC domain of the RARβ2 protein alone was sufficient for the growth inhibitory effects of RARβ2 on neuroblastoma cells. ATP7A, the copper efflux pump, is a retinoid-responsive gene, was upregulated by ectopic overexpression of RARβ2. The ectopic overexpression of the RARβ2 ABC domain was sufficient to induce ATP7A expression, whereas, RARβ2 siRNA blocked the induction of ATP7A expression in retinoid-treated neuroblastoma cells. Forced downregulation of ATP7A reduced copper efflux and increased viability of retinoid-treated neuroblastoma cells. Copper supplementation enhanced cell growth and reduced retinoid-responsiveness, whereas copper chelation reduced the viability and proliferative capacity. Taken together, our data demonstrates ATP7A expression is regulated by retinoic acid receptor β and it has effects on intracellular copper levels, revealing a link between the anticancer action of retinoids and copper metabolism. PMID:19127267

  6. Evolution of Retinoid and Steroid Signaling: Vertebrate Diversification from an Amphioxus Perspective

    PubMed Central

    Albalat, Ricard; Brunet, Frédéric; Laudet, Vincent; Schubert, Michael

    2011-01-01

    Although the physiological relevance of retinoids and steroids in vertebrates is very well established, the origin and evolution of the genetic machineries implicated in their metabolic pathways is still very poorly understood. We investigated the evolution of these genetic networks by conducting an exhaustive survey of components of the retinoid and steroid pathways in the genome of the invertebrate chordate amphioxus (Branchiostoma floridae). Due to its phylogenetic position at the base of chordates, amphioxus is a very useful model to identify and study chordate versus vertebrate innovations, both on a morphological and a genomic level. We have characterized more than 220 amphioxus genes evolutionarily related to vertebrate components of the retinoid and steroid pathways and found that, globally, amphioxus has orthologs of most of the vertebrate components of these two pathways, with some very important exceptions. For example, we failed to identify a vertebrate-like machinery for retinoid storage, transport, and delivery in amphioxus and were also unable to characterize components of the adrenal steroid pathway in this invertebrate chordate. The absence of these genes from the amphioxus genome suggests that both an elaboration and a refinement of the retinoid and steroid pathways took place at the base of the vertebrate lineage. In stark contrast, we also identified massive amplifications in some amphioxus gene families, most extensively in the short-chain dehydrogenase/reductase superfamily, which, based on phylogenetic and genomic linkage analyses, were likely the result of duplications specific to the amphioxus lineage. In sum, this detailed characterization of genes implicated in retinoid and steroid signaling in amphioxus allows us not only to reconstruct an outline of these pathways in the ancestral chordate but also to discuss functional innovations in retinoid homeostasis and steroid-dependent regulation in both cephalochordate and vertebrate evolution. PMID:21856648

  7. Retinoids and azelaic acid to treat acne and hyperpigmentation in skin of color.

    PubMed

    Woolery-Lloyd, Heather C; Keri, Jonette; Doig, Stefan

    2013-04-01

    In this review, we examine published data reporting the efficacy of pharmaceutical agents to treat associated postinflammatory hyperpigmentation commonly seen in skin of color. Retinoids and azelaic acid have been widely used to treat acne. Now there are increasing data describing their use in skin of color for the treatment of both acne and the subsequent postinflammatory hyperpigmentation. Historically, some dermatologists have been hesitant to use retinoids in skin of color because of perceived hypersensitivity in this patient population. However, recent data support the use of retinoids and azelaic acid in skin of color as both safe and beneficial.

  8. Nuclear retinoid receptors and pregnancy: placental transfer, functions, and pharmacological aspects.

    PubMed

    Comptour, Aurélie; Rouzaire, Marion; Belville, Corinne; Bouvier, Damien; Gallot, Denis; Blanchon, Loïc; Sapin, Vincent

    2016-10-01

    Animal models of vitamin A (retinol) deficiency have highlighted its crucial role in reproduction and placentation, whereas an excess of retinoids (structurally or functionally related entities) can cause toxic and teratogenic effects in the embryo and foetus, especially in the first trimester of human pregnancy. Knock-out experimental strategies-targeting retinoid nuclear receptors RARs and RXRs have confirmed that the effects of vitamin A are mediated by retinoic acid (especially all-trans retinoic acid) and that this vitamin is essential for the developmental process. All these data show that the vitamin A pathway and metabolism are as important for the well-being of the foetus, as they are for that of the adult. Accordingly, during this last decade, extensive research on retinoid metabolism has yielded detailed knowledge on all the actors in this pathway, spurring the development of antagonists and agonists for therapeutic and research applications. Natural and synthetic retinoids are currently used in clinical practice, most often on the skin for the treatment of acne, and as anti-oncogenic agents in acute promyelocytic leukaemia. However, because of the toxicity and teratogenicity of retinoids during pregnancy, their pharmacological use needs a sound knowledge of their metabolism, molecular aspects, placental transfer, and action.

  9. Identification of heparin-binding EGF-like growth factor as a target in intercellular regulation of epidermal basal cell growth by suprabasal retinoic acid receptors.

    PubMed Central

    Xiao, J H; Feng, X; Di, W; Peng, Z H; Li, L A; Chambon, P; Voorhees, J J

    1999-01-01

    The role of retinoic acid receptors (RARs) in intercellular regulation of cell growth was assessed by targeting a dominant-negative RARalpha mutant (dnRARalpha) to differentiated suprabasal cells of mouse epidermis. dnRARalpha lacks transcriptional activation but not DNA-binding and receptor dimerization functions. Analysis of transgenic mice revealed that dnRARalpha dose-dependently impaired induction of basal cell proliferation and epidermal hyperplasia by all-trans RA (tRA). dnRARalpha formed heterodimers with endogenous retinoid X receptor-alpha (RXRalpha) over RA response elements in competition with remaining endogenous RARgamma-RXRalpha heterodimers, and dose-dependently impaired retinoid-dependent gene transcription. To identify genes regulated by retinoid receptors and involved in cell growth control, we analyzed the retinoid effects on expression of the epidermal growth factor (EGF) receptor, EGF, transforming growth factor-alpha, heparin-binding EGF-like growth factor (HB-EGF) and amphiregulin genes. In normal epidermis, tRA rapidly and selectively induced expression of HB-EGF but not the others. This induction occurred exclusively in suprabasal cells. In transgenic epidermis, dnRARalpha dose-dependently inhibited tRA induction of suprabasal HB-EGF and subsequent basal cell hyperproliferation. Together, our observations suggest that retinoid receptor heterodimers located in differentiated suprabasal cells mediate retinoid induction of HB-EGF, which in turn stimulates basal cell growth via intercellular signaling. These events may underlie retinoid action in epidermal regeneration during wound healing. PMID:10075925

  10. Breastfeeding, retinoids, and postpartum depression: a new theory.

    PubMed

    Mawson, Anthony R; Xueyuan, Wang

    2013-09-25

    Postpartum depression (PPD) is an international public health problem affecting at least 1 in 8 mothers. Known risk factors include: giving birth to a preterm or low birth weight infant, babies with greater symptoms of illness at age 4-6 weeks, formula feeding, younger maternal age, smoking, and fatigue. Prolonged breastfeeding is associated with a reduced risk of PPD but the mechanisms are not well understood. Interventions for PPD focusing on psychosocial risk factors have been largely unsuccessful, suggesting that the condition has a mainly biological basis. The hypothesis proposed for consideration is that breastfeeding protects against PPD by maintaining endogenous retinoids (vitamin A-related compounds) below a threshold concentration. In fact, breast milk is rich in retinoids; pregnant women accumulate retinoids in liver and breast in preparation for lactation; there is increasing evidence that retinoids in higher concentration are associated with cognitive disturbances and mood disorders, including depression and suicide; and prolonged lactation reduces maternal stores of retinoids. Consistent with this hypothesis, it is estimated that an amount of vitamin A is transferred from mother to infant during the first six months of exclusive breastfeeding equivalent to 76% of a dose known to cause acute vitamin A poisoning in an adult. Breastfeeding may thus have evolutionary-adaptive functions for both mother and infant, transferring vital nutrients to an infant unable to feed itself, yet at the same time providing a natural means of reducing potentially toxic concentrations of retinoids in the mother. © 2013 Elsevier B.V. All rights reserved.

  11. The Acyclic Retinoid Peretinoin Inhibits Hepatitis C Virus Replication and Infectious Virus Release in Vitro

    NASA Astrophysics Data System (ADS)

    Shimakami, Tetsuro; Honda, Masao; Shirasaki, Takayoshi; Takabatake, Riuta; Liu, Fanwei; Murai, Kazuhisa; Shiomoto, Takayuki; Funaki, Masaya; Yamane, Daisuke; Murakami, Seishi; Lemon, Stanley M.; Kaneko, Shuichi

    2014-04-01

    Clinical studies suggest that the oral acyclic retinoid Peretinoin may reduce the recurrence of hepatocellular carcinoma (HCC) following surgical ablation of primary tumours. Since hepatitis C virus (HCV) infection is a major cause of HCC, we assessed whether Peretinoin and other retinoids have any effect on HCV infection. For this purpose, we measured the effects of several retinoids on the replication of genotype 1a, 1b, and 2a HCV in vitro. Peretinoin inhibited RNA replication for all genotypes and showed the strongest antiviral effect among the retinoids tested. Furthermore, it reduced infectious virus release by 80-90% without affecting virus assembly. These effects could be due to reduced signalling from lipid droplets, triglyceride abundance, and the expression of mature sterol regulatory element-binding protein 1c and fatty acid synthase. These negative effects of Peretinoin on HCV infection may be beneficial in addition to its potential for HCC chemoprevention in HCV-infected patients.

  12. Antiproliferative effect of retinoid compounds on Kaposi's sarcoma cells.

    PubMed Central

    Corbeil, J; Rapaport, E; Richman, D D; Looney, D J

    1994-01-01

    A panel of retinoid compounds (tretinoin, isotretinoin, acitretin, and RO13-1470) were tested for inhibitory activity against Kaposi's sarcoma cell (KSC) cultures in vitro. Tretinoin was found to be the most effective retinoid tested, inhibiting the growth of KSC in vitro while having no effect on the expression of interleukin-6 and basic fibroblast growth factor, two important cytokines involved in KSC growth. Tretinoin also did not appear to downregulate the expression of receptors for these two cytokines. At low concentrations (10(-9) M), acitretin and tretinoin selectively inhibited growth of early passage KSC. At higher concentrations (10(-6)-10(-5) M), retinoid treatment induced a pattern of DNA degradation and morphological changes in KSC characteristic of apoptosis (programmed cell death). The inhibitory activity of tretinoin on KSC growth was decreased if human serum (but not fetal calf serum) was present in the growth medium, and partially restored by removal of serum lipids. These data suggest that retinoids possess potential as therapeutic agents in Kaposi's sarcoma. Images PMID:8182129

  13. Topical retinoids in acne vulgaris: update on efficacy and safety.

    PubMed

    Thielitz, Anja; Gollnick, Harald

    2008-01-01

    Topical retinoids represent a mainstay of acne treatment because they expel mature comedones, reduce microcomedone formation, and exert anti-inflammatory effects. The first-generation retinoid tretinoin (all-trans retinoic acid) and the synthetic third-generation polyaromatics adapalene and tazarotene are approved for acne treatment by the US FDA, whereas topical tretinoin, isotretinoin (13-cis retinoic acid), and adapalene are accredited in Canada and Europe. Topical retinoids have a favorable safety profile distinct from the toxicity of their systemic counterparts. Local adverse effects, including erythema, dryness, itching, and stinging, occur frequently during the early treatment phase. Their impact varies with the vehicle formation, skin type, frequency and mode of application, use of moisturizers, and environmental factors such as sun exposure or temperature. The broad anti-acne activity and safety profile of topical retinoids justifies their use as first-line treatment in most types of non-inflammatory and inflammatory acne. They are also suitable as long-term medications, with no risk of inducing bacterial resistance, for maintenance of remission after cessation of initial combination therapy.

  14. Exploring (novel) gene expression during retinoid-induced maturation and cell death of acute promyelocytic leukemia.

    PubMed

    Benoit, G R; Tong, J H; Balajthy, Z; Lanotte, M

    2001-01-01

    During recent years, reports have shown that biological responses of acute promyelocytic leukemia (APL) cells to retinoids are more complex than initially envisioned. PML-RARalpha chimeric protein disturbs various biological processes such as cell proliferation, differentiation, and apoptosis. The distinct biological programs that regulate these processes stem from specific transcriptional activation of distinct (but overlapping) sets of genes. These programs are sometimes mutually exclusive and depend on whether the signals are delivered by RAR or RXR agonists. Furthermore, evidence that retinoid nuclear signaling by retinoid, on its own, is not enough to trigger these cellular responses is rapidly accumulating. Indeed, work with NB4 cells show that the fate of APL cells treated by retinoid depends on complex signaling cross-talk. Elucidation of the sequence of events and cascades of transcriptional regulation necessary for APL cell maturation will be an additional tool with which to further improve therapy by retinoids. In this task, the classical techniques used to analyze gene expression have proved time consuming, and their yield has been limited. Global analyses of the APL cell transcriptome are needed. We review the technical approaches currently available (differential display, complementary DNA microarrays), to identify novel genes involved in the determination of cell fate.

  15. BMY 30047: A novel topically active retinoid with low local and systemic toxicity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nair, X.; Quigley, J.; Tramposch, K.M.

    In the treatment of various dermatological disorders, topically applied retinoids have potential therapeutic use with the advantage of improved localized activity and lower toxicity over systemically administered retinoids. However, most retinoids cause a significant degree of local irritation. In the present study, the ability to produce local activity with low local irritation potential was evaluated with a novel retinoic acid derivative. BMY 30047 (11-cis, 13-cis-12-hydroxymethylretinoic acid delta-lactone) is one of a series of retinoic acid derivatives in which the carboxyl function of the polar end was modified with the aim of achieving reduced local irritation and systemic toxicity while retainingmore » the local therapeutic effect. BMY 30047 was evaluated and compared with all-trans retinoic acid for topical retinoid activity in several preclinical assay systems, including the utricle reduction assay in rhino mice, 12-o-tetradecanoylphorbol 13-acetate ester-stimulated ornithine decarboxylase induction in hairless mice and the UV light-induced photodamaged skin model in hairless mice. BMY 30047 was assessed for retinoid-type side effects by evaluating the skin irritation potential in rabbits after repeated topical application, and hypervitaminosis A-inducing potential in mice after i.p. injection. BMY 30047 demonstrated significant topical retinoid activity in several in vivo models with less skin irritation potential relative to the most used clinical concentrations of all-trans retinoic acid. BMY 30047 also showed very little systemic activity and did not produce any evidence of hypervitaminosis A syndrome at systemic doses 20 times greater than the no-effect dose of all-trans retinoic acid.« less

  16. Reduced retinoids and retinoid receptors' expression in pancreatic cancer: A link to patient survival.

    PubMed

    Bleul, Tim; Rühl, Ralph; Bulashevska, Svetlana; Karakhanova, Svetlana; Werner, Jens; Bazhin, Alexandr V

    2015-09-01

    Pancreatic ductal adenocarcinoma (PDAC) represents one of the deadliest cancers in the world. All-trans retinoic acid (ATRA) is the major physiologically active form of vitamin A, regulating expression of many genes. Disturbances of vitamin A metabolism are prevalent in some cancer cells. The main aim of this work was to investigate deeply the components of retinoid signaling in PDAC compared to in the normal pancreas and to prove the clinical importance of retinoid receptor expression. For the study, human tumor tissues obtained from PDAC patients and murine tumors from the orthotopic Panc02 model were used for the analysis of retinoids, using high performance liquid chromatography mass spectrometry and real-time RT-PCR gene expression analysis. Survival probabilities in univariate analysis were estimated using the Kaplan-Meier method and the Cox proportional hazards model was used for the multivariate analysis. In this work, we showed for the first time that the ATRA and all-trans retinol concentration is reduced in PDAC tissue compared to their normal counterparts. The expression of RARα and β as well as RXRα and β are down-regulated in PDAC tissue. This reduced expression of retinoid receptors correlates with the expression of some markers of differentiation and epithelial-to-mesenchymal transition as well as of cancer stem cell markers. Importantly, the expression of RARα and RXRβ is associated with better overall survival of PDAC patients. Thus, reduction of retinoids and their receptors is an important feature of PDAC and is associated with worse patient survival outcomes. © 2014 Wiley Periodicals, Inc.

  17. Comparative Analysis of Vitamin A (Retinol) Regulated Genes in African-American and Caucasian Prostate Cancer Patients

    DTIC Science & Technology

    2007-03-01

    chemoprevention strategies and to the development of novel therapies for this disease. 14. SUBJECT TERMS 15. NUMBER OF PAGES 13Retinoids, Vitamin A...the TRAMP model will ultimately lead to improved chemoprevention strategies and to the development of novel therapies for prostate cancer...Selective retinoids and rexinoids in cancer therapy and chemoprevention. Drug Discov Today, 7: 1165-1174, 2002. 5. Wei, L. N. Retinoid receptors and

  18. Retinoids induce differentiation and downregulate telomerase activity and N-Myc to increase sensitivity to flavonoids for apoptosis in human malignant neuroblastoma SH-SY5Y cells.

    PubMed

    Das, Arabinda; Banik, Naren L; Ray, Swapan K

    2009-03-01

    Human malignant neuroblastoma is characterized by poor differentiation and uncontrolled proliferation of immature neuroblasts. Retinoids such as all-trans-retinoic acid (ATRA), 13-cis-retinoic acid (13-CRA), and N-(4-hydroxyphenyl) retinamide (4-HPR) at low doses are capable of inducing differentiation, while flavonoids such as (-)-epigallocatechin-3-gallate (EGCG) and genistein (GST) at relatively high dose can induce apoptosis. We used combination of retinoid and flavonoid for controlling growth of malignant neuroblastoma SH-SY5Y cells. Cells were treated with a retinoid (1 microM ATRA, 1 microM 13-CRA, or 0.5 microM 4-HPR) for 7 days and then with a flavonoid (25 microM EGCG or 25 microM GST) for 24 h. Treatment of cells with a low dose of a retinoid for 7 days induced neuronal differentiation with downregulation of telomerase activity and N-Myc but overexpression of neurofilament protein (NFP) and subsequent treatment with a relatively high dose of a flavonoid for 24 h increased apoptosis in the differentiated cells. Besides, retinoids reduced the levels of inflammatory and angiogenic factors. Apoptosis was associated with increases in intracellular free [Ca2+], Bax expression, cytochrome c release from mitochondria and activities of calpain and caspases. Decreases in expression of calpastatin (endogenous calpain inhibitor) and baculovirus inhibitor-of-apoptosis repeat containing (BIRC) proteins (endogenous caspase inhibitors) favored apoptosis. Treatment of SH-SY5Y cells with EGCG activated caspase-8, indicating induction of the receptor-mediated pathway of apoptosis. Based on our observation, we conclude that combination of a retinoid and a flavonoid worked synergistically for controlling the malignant growth of human neuroblastoma cells.

  19. Synergistic growth inhibition by acyclic retinoid and vitamin K2 in human hepatocellular carcinoma cells.

    PubMed

    Kanamori, Toh; Shimizu, Masahito; Okuno, Masataka; Matsushima-Nishiwaki, Rie; Tsurumi, Hisashi; Kojima, Soichi; Moriwaki, Hisataka

    2007-03-01

    Hepatocellular carcinoma (HCC) is one of the most prevalent cancers worldwide. However, effective chemopreventive and chemotherapeutic agents for this cancer have not yet been developed. In clinical trials acyclic retinoid (ACR) and vitamin K(2) (VK(2)) decreased the recurrence rate of HCC. In the present study we examined the possible combined effects of ACR or another retinoid 9-cis retinoic acid (9cRA) plus VK(2) in the HuH7 human HCC cell line. We found that the combination of 1.0 microM ACR or 1.0 microM 9cRA plus 10 microM VK(2) synergistically inhibited the growth of HuH7 cells without affecting the growth of Hc normal human hepatocytes. The combined treatment with ACR plus VK(2) also acted synergistically to induce apoptosis in HuH7 cells. Treatment with VK(2) alone inhibited phosphorylation of the retinoid X receptor (RXR)alpha protein, which is regarded as a critical factor for liver carcinogenesis, through inhibition of Ras activation and extracellular signal-regulated kinase phosphorylation. Moreover, the inhibition of RXRalpha phosphorylation by VK(2) was enhanced when the cells were cotreated with ACR. The combination of retinoids plus VK(2) markedly increased both the retinoic acid receptor responsive element and retinoid X receptor responsive element promoter activities in HuH7 cells. Our results suggest that retinoids (especially ACR) and VK(2) cooperatively inhibit activation of the Ras/MAPK signaling pathway, subsequently inhibiting the phosphorylation of RXRalpha and the growth of HCC cells. This combination might therefore be effective for the chemoprevention and chemotherapy of HCC.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Orfali, Nina; Department of Pharmacology, Weill Cornell Medical College, New York, NY 10065, USA.; McKenna, Sharon L.

    Retinoids are a family of signaling molecules derived from vitamin A with well established roles in cellular differentiation. Physiologically active retinoids mediate transcriptional effects on cells through interactions with retinoic acid (RARs) and retinoid-X (RXR) receptors. Chromosomal translocations involving the RARα gene, which lead to impaired retinoid signaling, are implicated in acute promyelocytic leukemia (APL). All-trans-retinoic acid (ATRA), alone and in combination with arsenic trioxide (ATO), restores differentiation in APL cells and promotes degradation of the abnormal oncogenic fusion protein through several proteolytic mechanisms. RARα fusion-protein elimination is emerging as critical to obtaining sustained remission and long-term cure in APL.more » Autophagy is a degradative cellular pathway involved in protein turnover. Both ATRA and ATO also induce autophagy in APL cells. Enhancing autophagy may therefore be of therapeutic benefit in resistant APL and could broaden the application of differentiation therapy to other cancers. Here we discuss retinoid signaling in hematopoiesis, leukemogenesis, and APL treatment. We highlight autophagy as a potential important regulator in anti-leukemic strategies. - Highlights: • Normal and aberrant retinoid signaling in hematopoiesis and leukemia is reviewed. • We suggest a novel role for RARα in the development of X-RARα gene fusions in APL. • ATRA therapy in APL activates transcription and promotes onco-protein degradation. • Autophagy may be involved in both onco-protein degradation and differentiation. • Pharmacologic autophagy induction may potentiate ATRA's therapeutic effects.« less

  1. Pharmaceutical and nutraceutical approaches for preventing liver carcinogenesis: chemoprevention of hepatocellular carcinoma using acyclic retinoid and branched-chain amino acids.

    PubMed

    Shimizu, Masahito; Shirakami, Yohei; Hanai, Tatsunori; Imai, Kenji; Suetsugu, Atsushi; Takai, Koji; Shiraki, Makoto; Moriwaki, Hisataka

    2014-01-01

    The poor prognosis for patients with hepatocellular carcinoma (HCC) is associated with its high rate of recurrence in the cirrhotic liver. Therefore, more effective strategies need to be urgently developed for the chemoprevention of this malignancy. The malfunction of retinoid X receptor α, a retinoid receptor, due to phosphorylation by Ras/mitogen-activated protein kinase is closely associated with liver carcinogenesis and may be a promising target for HCC chemoprevention. Acyclic retinoid (ACR), a synthetic retinoid, can prevent HCC development by inhibiting retinoid X receptor α phosphorylation and improve the prognosis for this malignancy. Supplementation with branched-chain amino acids (BCAA), which are used to improve protein malnutrition in patients with liver cirrhosis, can also reduce the risk of HCC in obese cirrhotic patients. In experimental studies, both ACR and BCAA exert suppressive effects on HCC development and the growth of HCC cells. In particular, combined treatment with ACR and BCAA cooperatively inhibits the growth of HCC cells. Furthermore, ACR and BCAA inhibit liver tumorigenesis associated with obesity and diabetes, both of which are critical risk factors for HCC development. These findings suggest that pharmaceutical and nutraceutical approaches using ACR and BCAA may be promising strategies for preventing HCC and improving the prognosis of this malignancy. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Analysis and stability study of retinoids in pharmaceuticals by LC with fluorescence detection.

    PubMed

    Gatti, R; Gioia, M G; Cavrini, V

    2000-08-01

    Liquid chromatographic (HPLC) methods with fluorescence detection at different wavelengths were developed for measurements of retinoic acids (13-cis and all-trans) in pharmaceutical dosage forms and components of 'retinoid solution' (all-trans retinoic acid, vitamin A palmitate and beta-carotene), a galenical of 'Di Bella therapy', using reversed phase columns under isocratic conditions. The stability of all-trans retinoic acid in cream and all-trans retinoic acid and vitamin A palmitate in 'retinoid solution' was investigated. Solid-phase extraction (SPE), using C18 sorbent was applied to the analysis of retinoic acids (9-cis, 13-cis and all-trans) in the 'retinoid solution' to obtain a practical and reliable sample clean-up. The results showed that these preparations (cream and solution) can be conveniently stored in the dark (t.a. or 2-8 degrees C): under these conditions about 86-87% of the all-trans retinoic acid initial concentration in both formulations and about 73-78% of vitamin A palmitate in the 'retinoid solution' remained after 90 days, while under sunlight exposure rapid degradation of the drugs was observed.

  3. Synthetic 9-cis-beta-carotene inhibits photoreceptor degeneration in cultures of eye cups from rpe65rd12 mouse model of retinoid cycle defect.

    PubMed

    Sher, Ifat; Tzameret, Adi; Peri-Chen, Sara; Edelshtain, Victoria; Ioffe, Michael; Sayer, Alon; Buzhansky, Ludmila; Gazit, Ehud; Rotenstreich, Ygal

    2018-04-17

    The retinoid cycle enzymes regenerate the visual chromophore 11-cis retinal to enable vision. Mutations in the genes encoding the proteins of the retinoid cycle are the leading cause for recessively inherited retinal dystrophies such as retinitis pigmentosa, Leber congenital amaurosis, congenital cone-rod dystrophy and fundus albipunctatus. Currently there is no treatment for these blinding diseases. In previous studies we demonstrated that oral treatment with the 9-cis-β-carotene rich Dunaliella Bardawil algae powder significantly improved visual and retinal functions in patients with retinitis pigmentosa and fundus albipunctatus. Here we developed a convenient and economical synthetic route for biologically active 9-cis-β-carotene from inexpensive building materials and demonstrated that the molecule is stable for at least one month. Synthetic 9-cis-β-carotene rescued cone photoreceptors from degeneration in eye cup cultures of mice with a retinoid cycle genetic defect. This study suggests that synthetic 9-cis-β-carotene may serve as an effective treatment for retinal dystrophies involving the retinoid cycle.

  4. All-trans-retinoic acid enhances apoptosis induction by tyrosine kinase inhibitors in the eosinophilic leukemia-derived EoL-1 cell line.

    PubMed

    Robert, Carine; Apàti, Agota; Chomienne, Christine; Papp, Béla

    2008-02-01

    Imatinib and retinoids induce apoptosis in FIP1L1/PDGFRalpha-positive EoL-1 leukemia cells. Although imatinib induces complete remission in most FIP1L1/PDGFRalpha-positive patients, response to imatinib is sometimes suboptimal. In order to enhance the potency of the molecularly targeted therapy of eosinophilic leukemia, we investigated the effect of retinoids combined with tyrosine kinase inhibitors on EoL-1 cells. We demonstrate that retinoids combined with tyrosine kinase inhibitors lead to enhanced apoptosis induction in EoL-1 cells. Our results suggest that tyrosine kinase inhibitors combined with retinoids may constitute a valuable therapeutic approach for sensitive neoplasias that may display enhanced anti-leukemic potency when compared to single drug treatments.

  5. Synergistic effects of acyclic retinoid and OSI-461 on growth inhibition and gene expression in human hepatoma cells.

    PubMed

    Shimizu, Masahito; Suzui, Masumi; Deguchi, Atsuko; Lim, Jin T E; Xiao, Danhua; Hayes, Julia H; Papadopoulos, Kyriakos P; Weinstein, I Bernard

    2004-10-01

    Hepatoma is one of the most frequently occurring cancers worldwide. However, effective chemotherapeutic agents for this disease have not been developed. Acyclic retinoid, a novel synthetic retinoid, can reduce the incidence of postsurgical recurrence of hepatoma and improve the survival rate. OSI-461, a potent derivative of exisulind, can increase intracellular levels of cyclic GMP, which leads to activation of protein kinase G and induction of apoptosis in cancer cells. In the present study, we examined the combined effects of acyclic retinoid plus OSI-461 in the HepG2 human hepatoma cell line. We found that the combination of as little as 1.0 micromol/L acyclic retinoid and 0.01 micromol/L OSI-461 exerted synergistic inhibition of the growth of HepG2 cells. Combined treatment with low concentrations of these two agents also acted synergistically to induce apoptosis in HepG2 cells through induction of Bax and Apaf-1, reduction of Bcl-2 and Bcl-xL, and activation of caspase-3, -8, and -9. OSI-461 enhanced the G0-G1 arrest caused by acyclic retinoid, and the combination of these agents caused a synergistic decrease in the levels of expression of cyclin D1 protein and mRNA, inhibited cyclin D1 promoter activity, decreased the level of hyperphosphorylated forms of the Rb protein, induced increased cellular levels of the p21(CIP1) protein and mRNA, and stimulated p21(CIP1) promoter activity. Moreover, OSI-461 enhanced the ability of acyclic retinoid to induce increased cellular levels of retinoic acid receptor beta and to stimulate retinoic acid response element-chloramphenicol acetyltransferase activity. A hypothetical model involving concerted effects on p21(CIP1) and retinoic acid receptor beta expression is proposed to explain these synergistic effects. Our results suggest that the combination of acyclic retinoid plus OSI-461 might be an effective regimen for the chemoprevention and chemotherapy of human hepatoma and possibly other malignancies.

  6. Assessment of the efficacy and safety of a combination of 2 topical retinoids (RetinSphere) in maintaining post-treatment response of acne to oral isotretinoin.

    PubMed

    Truchuelo, M T; Jiménez, N; Mavura, D; Jaén, P

    2015-03-01

    The high rate of relapse of acne lesions following oral isotretinoin treatment is a common problem which remains unsolved. To avoid or minimize relapses, topical retinoids have been used for many years as maintenance treatment. However, adverse effects frequently occur. To determine the efficacy and safety of a new retinoid combination (Retinsphere technology) in maintaining post-treatment response to oral isotretinoin. Prospective, randomized, double-blind and vehicle-controlled study of 30 patients with acne previously treated with isotretinoin. Treatment with the retinoid combination was applied to one side of the face and vehicle was applied to the other, once daily, for 3 months. Standardized photographs were taken using RBX technology at baseline, 1.5 months and 3 months. The primary efficacy endpoint was the appearance of relapse on the treated side compared to the vehicle-treated side. Other endpoints included lesion count, investigator-reported improvement, patient-reported improvement, impact on quality-of-life, and side effects. Although the majority of patients did not reach the total target dose of oral isotretinoin, the relapse rate was significantly lower on the retinoid-treated side compared to the vehicle-treated side. Likewise, improved lesion count and excellent tolerance were observed. This new retinoid combination (Retinsphere technology) were effective and safe as maintenance therapy after post-treatment response to oral isotretinoin in patients with acne. Copyright © 2014 Elsevier España, S.L.U. and AEDV. All rights reserved.

  7. Retinoic acid stability in stem cell cultures.

    PubMed

    Sharow, Kyle A; Temkin, Boris; Asson-Batres, Mary Ann

    2012-01-01

    It has been reported that retinoids, such as retinoic acid (RA) and retinol (ROL), dissolved in aqueous solutions are susceptible to oxidative damage when exposed to light, air, and relatively high temperatures, conditions that are normal for culturing stem cells. Thus, questions arise regarding the interpretation of results obtained from studies of mouse embryonic stem cells exposed to retinoids because their isomerization state, their stability in culture conditions, and their interactions with other potential differentiation factors in growth media could influence developmental processes under study. Media samples were supplemented with retinoids and exposed to cell culture conditions with and without mouse embryonic stem cells (mESC), and retinoids were extracted and analyzed using HPLC. To determine whether retinoids are stable in media supplemented with fetal bovine serum (FBS) or in chemically-defined, serum-free media, mESC adapted to each type of growth media were investigated. Studies reported here indicate there was little loss or isomerization of at-RA, 9-cis-RA, 13-cis-RA, or ROL in cell cultures grown in serum-supplemented media when cell cultures were maintained in the dark and manipulated and observed under yellow light. In contrast, the stability of both at-RA and ROL were determined to be greatly reduced in serum-free media as compared with serum-supplemented media. Addition of 6 mg/ml bovine serum albumin was found to stabilize retinoids in serum-free media. It was also determined that ROL is less stable than RA in cell culture conditions.

  8. Retinoic acid receptor alpha drives cell cycle progression and is associated with increased sensitivity to retinoids in T-cell lymphoma.

    PubMed

    Wang, Xueju; Dasari, Surendra; Nowakowski, Grzegorz S; Lazaridis, Konstantinos N; Wieben, Eric D; Kadin, Marshall E; Feldman, Andrew L; Boddicker, Rebecca L

    2017-04-18

    Peripheral T-cell lymphomas (PTCLs) are aggressive non-Hodgkin lymphomas with generally poor outcomes following standard therapy. Few candidate therapeutic targets have been identified to date. Retinoic acid receptor alpha (RARA) is a transcription factor that modulates cell growth and differentiation in response to retinoids. While retinoids have been used to treat some cutaneous T-cell lymphomas (CTCLs), their mechanism of action and the role of RARA in CTCL and other mature T-cell lymphomas remain poorly understood. After identifying a PTCL with a RARAR394Q mutation, we sought to characterize the role of RARA in T-cell lymphoma cells. Overexpressing wild-type RARA or RARAR394Q significantly increased cell growth in RARAlow cell lines, while RARA knockdown induced G1 arrest and decreased expression of cyclin-dependent kinases CDK2/4/6 in RARAhigh cells. The retinoids, AM80 (tamibarotene) and all-trans retinoic acid, caused dose-dependent growth inhibition, G1 arrest, and CDK2/4/6 down-regulation. Genes down-regulated in transcriptome data were enriched for cell cycle and G1-S transition. Finally, RARA overexpression augmented chemosensitivity to retinoids. In conclusion, RARA drives cyclin-dependent kinase expression, G1-S transition, and cell growth in T-cell lymphoma. Synthetic retinoids inhibit these functions in a dose-dependent fashion and are most effective in cells with high RARA expression, indicating RARA may represent a therapeutic target in some PTCLs.

  9. Psychiatric disorders, acne and systemic retinoids: comparison of risks.

    PubMed

    Le Moigne, M; Bulteau, S; Grall-Bronnec, Marie; Gerardin, M; Fournier, Jean-Pascal; Jonville-Bera, A P; Jolliet, Pascale; Dreno, Brigitte; Victorri-Vigneau, C

    2017-09-01

    The link between isotretinoin, treatment of a severe form of acne, and psychiatric disorders remains controversial, as acne itself could explain the occurrence of psychiatric disorders. This study aims at assessing the disproportionality of psychiatric adverse events reported with isotretinoin in the French National PharmacoVigilance Database, compared with other systemic acne treatments and systemic retinoids. Data were extracted from the French National PharmacoVigilance Database for systemic acne treatments, systemic retinoids and drugs used as comparators. Each report was subjected to double-blind analysis by two psychiatric experts. A disproportionality analysis was performed, calculating the number of psychiatric ADRs divided by the total number of notifications for each drug of interest. Concerning acne systemic treatments: all 71 reports of severe psychiatric disorders involved isotretinoin, the highest proportion of mild/moderate psychiatric adverse events was reported with isotretinoin (14.1%). Among systemic retinoids, the highest proportion of severe and mild/moderate psychiatric events occurred with isotretinoin and alitretinoin. Our study raises the hypothesis that psychiatric disorders associated with isotretinoin are related to a class effect of retinoids, as a signal emerges for alitretinoin. Complementary studies are necessary to estimate the risk and further determine at-risk populations.

  10. Both retinoic-acid-receptor- and retinoid-X-receptor-dependent signalling pathways mediate the induction of the brown-adipose-tissue-uncoupling-protein-1 gene by retinoids.

    PubMed Central

    Alvarez, R; Checa, M; Brun, S; Viñas, O; Mampel, T; Iglesias, R; Giralt, M; Villarroya, F

    2000-01-01

    The intracellular pathways and receptors mediating the effects of retinoic acid (RA) on the brown-fat-uncoupling-protein-1 gene (ucp-1) have been analysed. RA activates transcription of ucp-1 and the RA receptor (RAR) is known to be involved in this effect. However, co-transfection of an expression vector for retinoid-X receptor (RXR) increases the action of 9-cis RA but not the effects of all-trans RA on the ucp-1 promoter in brown adipocytes. Either RAR-specific ¿p-[(E)-2-(5,6,7,8,-tetrahydro-5,5,8, 8-tetramethyl-2-naphthalenyl)-1-propenyl]benzoic acid¿ or RXR-specific [isopropyl-(E,E)-(R,S)-11-methoxy-3,7, 11-trimethyldodeca-2,4-dienoate, or methoprene] synthetic compounds increase the expression of UCP-1 mRNA and the activity of chloramphenicol acetyltransferase expression vectors driven by the ucp-1 promoter. The RXR-mediated action of 9-cis RA requires the upstream enhancer region at -2469/-2318 in ucp-1. During brown-adipocyte differentiation RXRalpha and RXRgamma mRNA expression is induced in parallel with UCP-1 mRNA, whereas the mRNA for the three RAR subtypes, alpha, beta and gamma, decreases. Co-transfection of murine expression vectors for the different RAR and RXR subtypes indicates that RARalpha and RARbeta as well as RXRalpha are the major retinoid-receptor subtypes capable of mediating the responsiveness of ucp-1 to retinoids. It is concluded that the effects of retinoids on ucp-1 transcription involve both RAR- and RXR-dependent signalling pathways. The responsiveness of brown adipose tissue to retinoids in vivo relies on a complex combination of the capacity of RAR and RXR subtypes to mediate ucp-1 induction and their distinct expression in the differentiated brown adipocyte. PMID:10600643

  11. Hepatic retinoid levels in seven fish species (teleosts) from a tropical coastal lagoon receiving effluents from iron-ore mining and processing.

    PubMed

    Pereira, Adriana A; van Hattum, Bert; Brouwer, Abraham

    2012-02-01

    The present study was undertaken to investigate the possible effects of Fe and trace element exposure on hepatic levels of retinoids in seven fish species. Concentrations of retinoids were measured in fish collected from a coastal lagoon in Brazil that receives effluents from an iron-ore mining and processing plant. Fish from nearby coastal lagoons were also included to assess possible differences related to chemical exposure. Results indicated considerable differences in hepatic retinoid composition among the various species investigated. The most striking differences were in retinol and derivative-specific profiles and in didehydro retinol and derivative-specific profiles. The Perciformes species Geophagus brasiliensis, Tilapia rendalli, Mugil liza, and Cichla ocellaris and the Characiforme Hoplias malabaricus were characterized as retinol and derivative-specific, while the Siluriformes species Hoplosternum littorale and Rhamdia quelen were didehydro retinol and derivative-specific fish species. A negative association was observed between Al, Pb, As, and Cd and hepatic didehydro retinoid levels. Fish with higher levels of hepatic Fe, Cu, and Zn showed unexpectedly significant positive correlations with increased hepatic retinol levels. This finding, associated with the positive relationships between retinol and retinyl palmitate with lipid peroxidation, may suggest that vitamin A is mobilized from other tissues to increase hepatic antioxidant levels for protection against oxidative damage. These data show significant but dissimilar associations between trace element exposure and hepatic retinoid levels in fish species exposed to iron-ore mining and processing effluents, without apparent major impacts on fish health and condition. Copyright © 2011 SETAC.

  12. Retinoid quantification by HPLC/MS(n)

    NASA Technical Reports Server (NTRS)

    McCaffery, Peter; Evans, James; Koul, Omanand; Volpert, Amy; Reid, Kevin; Ullman, M. David

    2002-01-01

    Retinoic acid (RA) mediates most of the biological effects of vitamin A that are essential for vertebrate survival. It acts through binding to receptors that belong to the nuclear receptor transcription factor superfamily (Mangelsdorf et al. 1994). It is also a highly potent vertebrate teratogen. To determine the function and effects of endogenous and exogenous RA, it is important to have a highly specific, sensitive, accurate, and precise analytical procedure. Current analyses of RA and other retinoids are labor intensive, of poor sensitivity, have limited specificity, or require compatibility with RA reporter cell lines (Chen et al. 1995. BIOCHEM: Pharmacol. 50: 1257-1264; Creech Kraft et al. 1994. BIOCHEM: J. 301: 111-119; Lanvers et al. 1996. J. Chromatogr. B Biomed. Appl. 685: 233-240; Maden et al. 1998. DEVELOPMENT: 125: 4133-4144; Wagner et al. 1992. DEVELOPMENT: 116: 55-66). This paper describes an HPLC/mass spectrometry/mass spectrometry product ion scan (HPLC/MS(n)) procedure for the analysis of retinoids that employs atmospheric pressure chemical ionization MS. The retinoids are separated by normal-phase column chromatography with a linear hexane-isopropanol-dioxane gradient. Each retinoid is detected by a unique series of MS(n) functions set at optimal collision-induced dissociation energy (30% to 32%) for all MS(n) steps. The scan events are divided into three segments, based on HPLC elution order, to maximize the mass spectrometer duty cycle. The all-trans, 9-cis, and 13-cis RA isomers are separated, if desired, by an isocratic hexane-dioxane-isopropanol mobile phase. This paper describes an HPLC/MS(n) procedure possessing high sensitivity and specificity for retinoids.

  13. Receptor-selective retinoids implicate retinoic acid receptor alpha and gamma in the regulation of bmp-2 and bmp-4 in F9 embryonal carcinoma cells.

    PubMed

    Rogers, M B

    1996-01-01

    The effect of retinoids on malignant cells and embryos indicates that retinoids influence the expression of growth factors or alter the response of cells to growth factors. The bone morphogenetic proteins, Bmp-2 and Bmp-4, are candidates for such growth factors because retinoic acid (RA) treatment of F9 embryonal carcinoma cells induced Bmp-2 mRNA, while simultaneously repressing Bmp-4 levels. Also, recombinant Bmp-2 affected the growth and differentiation of these cells. Regulation of each gene was concentration dependent and required continuous RA treatment. The short half-lives of the Bmp-2 (75 +/- 11 min) and Bmp-4 (70 +/- 4 min) mRNAs suggest that their abundance is primarily controlled at the transcriptional level. To determine which RA receptor (RAR) controls bmp-2 and bmp-4 expression, F9 cells were exposed to various receptor-selective retinoids. RAR alpha- and gamma-selective retinoids induced Bmp-2 and repressed Bmp-4 equally as well as all-trans RA. In contrast, a RAR beta-selective retinoid had little effect on Bmp-2 induction but repressed Bmp-4. A RAR alpha-selective antagonist inhibited all-trans RA stimulation of Bmp-2, although not as dramatically as a RAR beta gamma-selective antagonist. No differences were observed between Bmp levels in all-trans RA and 9-cis RA-treated cells, indicating that the RXRs play little part in controlling these genes. The results are consistent with RAR alpha and gamma-controlled Bmp-2 and Bmp-4 regulation.

  14. A simple and robust quantitative analysis of retinol and retinyl palmitate using a liquid chromatographic isocratic method.

    PubMed

    Yokota, Satoshi; Oshio, Shigeru

    2018-04-01

    Vitamin A is a vital nutritional substances that regulates biological activities including development, but is also associated with disease onset. The extent of vitamin A intake influences the retinoid content in the liver, the most important organ for the storage of vitamin A. Measurement of endogenous retinoid in biological samples is important to understand retinoid homeostasis. Here we present a reliable, highly sensitive, and robust method for the quantification of retinol and retinyl palmitate using a reverse-phase HPLC/UV isocratic method. We determined the impact of chronic dietary vitamin A on retinoid levels in livers of mice fed an AIN-93G semi-purified diet (4 IU/g) compared with an excess vitamin A diet (1000 IU/g) over a period from birth to 10 weeks of age. Coefficients of variation for intra-assays for both retinoids were less than 5%, suggesting a higher reproducibility than any other HPLC/UV gradient method. Limits of detection and quantification for retinol were 0.08 pmol, and 0.27 pmol, respectively, which are remarkably higher than previous results. Supplementation with higher doses of vitamin A over the study period significantly increased liver retinol and retinyl palmitate concentrations in adult mice. The assays described here provide a sensitive and rigorous quantification of endogenous retinol and retinyl palmitate, which can be used to help determine retinoid homeostasis in disease states, such as toxic hepatitis and liver cancer. Copyright © 2017. Published by Elsevier B.V.

  15. Analysis of follicular fluid retinoids in women undergoing in vitro fertilization: retinoic acid influences embryo quality and is reduced in women with endometriosis.

    PubMed

    Pauli, Samuel A; Session, Donna R; Shang, Weirong; Easley, Kirk; Wieser, Friedrich; Taylor, Robert N; Pierzchalski, Keely; Napoli, Joseph L; Kane, Maureen A; Sidell, Neil

    2013-09-01

    Retinol (ROL) and its biologically active metabolite, all-trans retinoic acid (ATRA), are essential for a number of reproductive processes. However, there is a paucity of information regarding their roles in ovarian folliculogenesis, oocyte maturation, and early embryogenesis. The objectives of this study were to quantify and compare peripheral plasma (PP) and follicular fluid (FF) retinoid levels, including ATRA in women undergoing in vitro fertilization (IVF) and to investigate the relationship between retinoid levels and embryo quality. Retinoid levels were evaluated in PP and FF from 79 women undergoing IVF at the time of oocyte retrieval and corresponding embryo quality assessed on a daily basis after retrieval for 3 days until uterine transfer. Analysis compared the retinoid levels with day 3 embryo grades and between endometriosis versus control patients. Results demonstrated distinctive levels of retinoid metabolites and isomers in FF versus PP. There was a significantly larger percentage of high-quality grade I embryos derived from the largest versus smallest follicles. An increase in follicle size also correlated with a >50% increase in FF ROL and ATRA concentrations. Independent of follicle size, FF yielding grade I versus nongrade I embryos showed higher mean levels of ATRA but not ROL. In a nested case-control analysis, control participants had 50% higher mean levels of ATRA in their FF and PP than women with endometriosis. These findings strongly support the proposition that ATRA plays a fundamental role in oocyte development and quality, and that reduced ATRA synthesis may contribute to decreased fecundity of participants with endometriosis.

  16. Retinoids, race and the pathogenesis of dengue hemorrhagic fever.

    PubMed

    Mawson, Anthony R

    2013-12-01

    Dengue hemorrhagic fever (DHF) is the most significant mosquito-borne viral disease worldwide in terms of illness, mortality and economic cost, but the pathogenesis of DHF is not well understood and there is no specific treatment or vaccine. Based on evidence of liver involvement, it is proposed that dengue virus and retinoids interact to cause cholestatic liver damage, resulting in the spillage of stored retinoids into the circulation and in an endogenous form of hypervitaminosisis A manifested by the signs and symptoms of the disease, including: fever, severe joint and bone pain, capillary leakage, thrombocytopenia, headache, and gastrointestinal symptoms. While retinoids in low concentration are essential for numerous biological functions, they are prooxidant, cytotoxic, mutagenic and teratogenic in higher concentration, especially when unbound to protein, and an endogenous form of vitamin A intoxication is recognized in cholestasis. The model tentatively explains the observations that 1) repeat infections are more severe than initial dengue virus infections; 2) the incidence of denue has increased dramatically worldwide in recent decades; 3) DHF is less prevalent in people of African ancestry than those of other racial backgrounds; and 4) infants are protected from dengue. The retinoid toxicity hypothesis of DHF predicts the co-existence of low serum concentrations of retinol coupled with high concentrations of retinoic acid and an increased percentage of retinyl esters to total vitamin A. Subject to such tests, it may be possible to treat DHF effectively using drugs that target the metabolism and expression of retinoids. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  17. South-East Asia study alliance guidelines on the management of acne vulgaris in South-East Asian patients.

    PubMed

    Goh, Chee Leok; Abad-Casintahan, Flordeliz; Aw, Derrick Chen Wee; Baba, Roshidah; Chan, Lee Chin; Hung, Nguyen Thanh; Kulthanan, Kanokvalai; Leong, Hoe Nam; Medina-Oblepias, Marie Socouer; Noppakun, Nopadon; Sitohang, Irma Bernadette; Sugito, Titi Lestari; Wong, Su-Ni

    2015-10-01

    The management of acne in South-East Asia is unique, as Asian skin and local variables require a clinical approach unlike that utilized in other parts of the world. There are different treatment guidelines per country in the region, and a group of leading dermatologists from these countries convened to review these guidelines, discuss current practices and recent advances, and formulate consensus guidelines to harmonize the management of acne vulgaris in the region. Emphasis has been placed on formulating recommendations to impede the development of antibiotic resistance in Propionibacterium acnes. The group adopted the Acne Consensus Conference system for grading acne severity. The group recommends that patients may be treated with topical medications including retinoids, benzoyl peroxide (BPO), salicylic acid, a combination of retinoid and BPO, or a combination of retinoids and BPO with or without antibiotics for mild acne; topical retinoid with topical BPO and a oral antibiotic for moderate acne; and oral isotretinoin if the patient fails first-line treatment (a 6- or 8-week trial of combined oral antibiotics and topical retinoids with BPO) for severe acne. Maintenance acne treatment using topical retinoids with or without BPO is recommended. To prevent the development of antibiotic resistance, topical antibiotics should not be used as monotherapy or used simultaneously with oral antibiotics. Skin care, comprised of cleansing, moisturizing and sun protection, is likewise recommended. Patient education and good communication is recommended to improve adherence, and advice should be given about the characteristics of the skin care products patients should use. © 2015 Japanese Dermatological Association.

  18. Synchronizing Pharmacotherapy in Acne with Review of Clinical Care

    PubMed Central

    Sacchidanand, Sarvajnamurthy Aradhya; Lahiri, Koushik; Godse, Kiran; Patwardhan, Narendra Gajanan; Ganjoo, Anil; Kharkar, Rajendra; Narayanan, Varsha; Borade, Dhammraj; D’souza, Lyndon

    2017-01-01

    Acne is a chronic inflammatory skin disease that involves the pathogenesis of four major factors, such as androgen-induced increased sebum secretion, altered keratinization, colonization of Propionibacterium acnes, and inflammation. Several acne mono-treatment and combination treatment regimens are available and prescribed in the Indian market, ranging from retinoids, benzoyl peroxide (BPO), anti-infectives, and other miscellaneous agents. Although standard guidelines and recommendations overview the management of mild, moderate, and severe acne, relevance and positioning of each category of pharmacotherapy available in Indian market are still unexplained. The present article discusses the available topical and oral acne therapies and the challenges associated with the overall management of acne in India and suggestions and recommendations by the Indian dermatologists. The experts opined that among topical therapies, the combination therapies are preferred over monotherapy due to associated lower efficacy, poor tolerability, safety issues, adverse effects, and emerging bacterial resistance. Retinoids are preferred in comedonal acne and as maintenance therapy. In case of poor response, combination therapies BPO-retinoid or retinoid-antibacterials in papulopustular acne and retinoid-BPO or BPO-antibacterials in pustular-nodular acne are recommended. Oral agents are generally recommended for severe acne. Low-dose retinoids are economical and have better patient acceptance. Antibiotics should be prescribed till the inflammation is clinically visible. Antiandrogen therapy should be given to women with high androgen levels and are added to regimen to regularize the menstrual cycle. In late-onset hyperandrogenism, oral corticosteroids should be used. The experts recommended that an early initiation of therapy is directly proportional to effective therapeutic outcomes and prevent complications. PMID:28794543

  19. Ligand Binding Induces Conformational Changes in Human Cellular Retinol-binding Protein 1 (CRBP1) Revealed by Atomic Resolution Crystal Structures.

    PubMed

    Silvaroli, Josie A; Arne, Jason M; Chelstowska, Sylwia; Kiser, Philip D; Banerjee, Surajit; Golczak, Marcin

    2016-04-15

    Important in regulating the uptake, storage, and metabolism of retinoids, cellular retinol-binding protein 1 (CRBP1) is essential for trafficking vitamin A through the cytoplasm. However, the molecular details of ligand uptake and targeted release by CRBP1 remain unclear. Here we report the first structure of CRBP1 in a ligand-free form as well as ultra-high resolution structures of this protein bound to either all-trans-retinol or retinylamine, the latter a therapeutic retinoid that prevents light-induced retinal degeneration. Superpositioning of human apo- and holo-CRBP1 revealed major differences within segments surrounding the entrance to the retinoid-binding site. These included α-helix II and hairpin turns between β-strands βC-βD and βE-βF as well as several side chains, such as Phe-57, Tyr-60, and Ile-77, that change their orientations to accommodate the ligand. Additionally, we mapped hydrogen bond networks inside the retinoid-binding cavity and demonstrated their significance for the ligand affinity. Analyses of the crystallographic B-factors indicated several regions with higher backbone mobility in the apoprotein that became more rigid upon retinoid binding. This conformational flexibility of human apo-CRBP1 facilitates interaction with the ligands, whereas the more rigid holoprotein structure protects the labile retinoid moiety during vitamin A transport. These findings suggest a mechanism of induced fit upon ligand binding by mammalian cellular retinol-binding proteins. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Analysis of Follicular Fluid Retinoids in Women Undergoing In Vitro Fertilization

    PubMed Central

    Pauli, Samuel A.; Session, Donna R.; Shang, Weirong; Easley, Kirk; Wieser, Friedrich; Taylor, Robert N.; Pierzchalski, Keely; Napoli, Joseph L.; Kane, Maureen A.

    2013-01-01

    Retinol (ROL) and its biologically active metabolite, all-trans retinoic acid (ATRA), are essential for a number of reproductive processes. However, there is a paucity of information regarding their roles in ovarian folliculogenesis, oocyte maturation, and early embryogenesis. The objectives of this study were to quantify and compare peripheral plasma (PP) and follicular fluid (FF) retinoid levels, including ATRA in women undergoing in vitro fertilization (IVF) and to investigate the relationship between retinoid levels and embryo quality. Retinoid levels were evaluated in PP and FF from 79 women undergoing IVF at the time of oocyte retrieval and corresponding embryo quality assessed on a daily basis after retrieval for 3 days until uterine transfer. Analysis compared the retinoid levels with day 3 embryo grades and between endometriosis versus control patients. Results demonstrated distinctive levels of retinoid metabolites and isomers in FF versus PP. There was a significantly larger percentage of high-quality grade I embryos derived from the largest versus smallest follicles. An increase in follicle size also correlated with a >50% increase in FF ROL and ATRA concentrations. Independent of follicle size, FF yielding grade I versus nongrade I embryos showed higher mean levels of ATRA but not ROL. In a nested case–control analysis, control participants had 50% higher mean levels of ATRA in their FF and PP than women with endometriosis. These findings strongly support the proposition that ATRA plays a fundamental role in oocyte development and quality, and that reduced ATRA synthesis may contribute to decreased fecundity of participants with endometriosis. PMID:23427183

  1. REACTIVITY PROFILE OF CONFORMATIONALLY-FLEXIBLE RETINOID RECEPTOR LIGANDS

    EPA Science Inventory

    Retinoids and associated derivatives represent a class of endogenousr hormones that bind to and activate different families of retinoic acid receptors (RARs, RXRs), and control many aspects of normal vertebrate development. Identification of potential RAR and RXRs ligands is of i...

  2. Identifying the receptor subtype selectivity of retinoid X and retinoic acid receptors via quantum mechanics.

    PubMed

    Tsuji, Motonori; Shudo, Koichi; Kagechika, Hiroyuki

    2017-03-01

    Understanding and identifying the receptor subtype selectivity of a ligand is an important issue in the field of drug discovery. Using a combination of classical molecular mechanics and quantum mechanical calculations, this report assesses the receptor subtype selectivity for the human retinoid X receptor (hRXR) and retinoic acid receptor (hRAR) ligand-binding domains (LBDs) complexed with retinoid ligands. The calculated energies show good correlation with the experimentally reported binding affinities. The technique proposed here is a promising method as it reveals the origin of the receptor subtype selectivity of selective ligands.

  3. Systemic and topical drugs for aging skin.

    PubMed

    Kockaert, Michael; Neumann, Martino

    2003-08-01

    The rejuvenation of aging skin is a common desire for our patients, and several options are available. Although there are some systemic methods, the most commonly used treatments for rejuvenation of the skin are applied topically. The most frequently used topical drugs include retinoids, alpha hydroxy acids (AHAs), vitamin C, beta hydroxy acids, anti-oxidants, and tocopherol. Combination therapy is frequently used; particularly common is the combination of retinoids and AHAs. Systemic therapies available include oral retinoids and vitamin C. Other available therapies such as chemical peels, face-lifts, collagen, and botulinum toxin injections are not discussed in this article.

  4. Interphotoreceptor Retinoid-Binding Protein Protects Retinoids from Photodegradation

    PubMed Central

    Gonzalez-Fernandez, Federico; Betts-Obregon, Brandi; Yust, Brian; Mimun, Joshua; Sung, Dongjin; Sardar, Dhiraj; Tsin, Andrew T.

    2015-01-01

    Retinol degrades rapidly in light into a variety of photoproducts. It is remarkable that visual cycle retinoids can evade photodegradation as they are exchanged between the photoreceptors, retinal pigment epithelium and Müller glia. Within the interphotoreceptor matrix, all-trans retinol, 11-cis retinol and retinal are bound by interphotoreceptor retinoid-binding protein (IRBP). Apart from its role in retinoid trafficking and targeting, could IRBP have a photoprotective function? HPLC was used to evaluate the ability of IRBP to protect all-trans and 11-cis retinols from photodegradation when exposed to incandescent light (0 to 8,842 μW/cm2); time periods of 0 – 60 min, and bIRBP: retinol molar ratios of 1:1 to 1:5. bIRBP afforded a significant prevention of both all-trans and 11-cis retinol to rapid photodegradation. The effect was significant over the entire light intensity range tested, and extended to the bIRBP: retinol ratio 1:5. In view of the continual exposure of the retina to light, and the high oxidative stress in the outer retina, our results suggest IRBP may have an important protective role in the visual cycle by reducing photodegradation of all-trans and 11-cis retinols. This role of IRBP is particularly relevant in the high flux conditions of the cone visual cycle. PMID:25565073

  5. Towards Building an AOP-based Prenatal Developmental Toxicity Ontology (SOT)

    EPA Science Inventory

    Retinoid signaling plays an important role in embryo-fetal development and its disruption is broadly teratogenic. The retinoic acid (RA) pathway includes elements in retinoid metabolism and nuclear receptor (RAR, RXR) activation and thus serves as an excellent prototype for adver...

  6. Use of topical tretinoin and the development of noncutaneous adverse events: evidence from a systematic review of the literature.

    PubMed

    Shapiro, Stanley; Heremans, Annie; Mays, David A; Martin, Amber L; Hernandez-Medina, Marisol; Lanes, Stephan

    2011-12-01

    Topical retinoids have been in clinical use for the treatment of chronic skin conditions, including acne, photodamage, and psoriasis, for 30 years. A systematic literature review was conducted to assess the incidence of noncutaneous adverse events (AE) among patients treated with topical retinoids with a focus on topical tretinoin studies reported before the Veterans Affairs Topical Tretinoin Chemoprevention trial. Electronic literature searches were conducted in Embase and MEDLINE for literature reporting development of nonteratogenic, noncutaneous AE among patients treated with topical retinoids published through September 2008. The search yielded 2778 citations, of which 20 studies met inclusion criteria. Tretinoin was used in 14 of the studies. Other retinoids assessed included isotretinoin, adapalene, alitretinoin, and tazarotene. Within patients receiving topical tretinoin, 27.9% reported the occurrence of at least one noncutaneous AE. The majority of noncutaneous AE were transient and judged not to be related to tretinoin treatment. The conclusions of this study apply largely to tretinoin compared with other topical retinoids. Many of the included trials were designed to evaluate the efficacy of topical treatment and reporting of safety events concentrated on incidence of localized AE, rather than systemic or noncutaneous events. We found no clear evidence of a relationship between the use of topical tretinoin and the development of noncutaneous AE before a recent report of excess mortality in a clinical trial. The majority of noncutaneous AE reported by patients receiving topical retinoids consisted of nonsevere, nonspecific symptoms that were judged not to be related to treatment. Copyright © 2010 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  7. Retinoids induce integrin-independent lymphocyte adhesion through RAR-α nuclear receptor activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Whelan, Jarrett T.; Wang, Lei; Chen, Jianming

    2014-11-28

    Highlights: • Transcription and translation are required for retinoid-induced lymphocyte adhesion. • RAR activation is sufficient to induced lymphocyte cell adhesion. • Vitamin D derivatives inhibit RAR-prompted lymphocyte adhesion. • Adhesion occurs through a novel binding site within ADAM disintegrin domains. • RARα is a key nuclear receptor for retinoid-dependent lymphocyte cell adhesion. - Abstract: Oxidative metabolites of vitamin A, in particular all-trans-retinoic acid (atRA), have emerged as key factors in immunity by specifying the localization of immune cells to the gut. Although it is appreciated that isomers of retinoic acid activate the retinoic acid receptor (RAR) and retinoid Xmore » receptor (RXR) family of nuclear receptors to elicit cellular changes, the molecular details of retinoic acid action remain poorly defined in immune processes. Here we employ a battery of agonists and antagonists to delineate the specific nuclear receptors utilized by retinoids to evoke lymphocyte cell adhesion to ADAM (adisintegrin and metalloprotease) protein family members. We report that RAR agonism is sufficient to promote immune cell adhesion in both immortal and primary immune cells. Interestingly, adhesion occurs independent of integrin function, and mutant studies demonstrate that atRA-induced adhesion to ADAM members required a distinct binding interface(s) as compared to integrin recognition. Anti-inflammatory corticosteroids as well as 1,25-(OH){sub 2}D{sub 3}, a vitamin D metabolite that prompts immune cell trafficking to the skin, potently inhibited the observed adhesion. Finally, our data establish that induced adhesion was specifically attributable to the RAR-α receptor isotype. The current study provides novel molecular resolution as to which nuclear receptors transduce retinoid exposure into immune cell adhesion.« less

  8. Evolution of the genetic machinery of the visual cycle: a novelty of the vertebrate eye?

    PubMed

    Albalat, Ricard

    2012-05-01

    The discovery in invertebrates of ciliary photoreceptor cells and ciliary (c)-opsins established that at least two of the three elements that characterize the vertebrate photoreceptor system were already present before vertebrate evolution. However, the origin of the third element, a series of biochemical reactions known as the "retinoid cycle," remained uncertain. To understand the evolution of the retinoid cycle, I have searched for the genetic machinery of the cycle in invertebrate genomes, with special emphasis on the cephalochordate amphioxus. Amphioxus is closely related to vertebrates, has a fairly prototypical genome, and possesses ciliary photoreceptor cells and c-opsins. Phylogenetic and structural analyses of the amphioxus sequences related with the vertebrate machinery do not support a function of amphioxus proteins in chromophore regeneration but suggest that the genetic machinery of the retinoid cycle arose in vertebrates due to duplications of ancestral nonvisual genes. These results favor the hypothesis that the retinoid cycle machinery was a functional innovation of the primitive vertebrate eye.

  9. Retinoids: Literature Review and Suggested Algorithm for Use Prior to Facial Resurfacing Procedures

    PubMed Central

    Buchanan, Patrick J; Gilman, Robert H

    2016-01-01

    Vitamin A-containing products have been used topically since the early 1940s to treat various skin conditions. To date, there are four generations of retinoids, a family of Vitamin A-containing compounds. Tretinoin, all-trans-retinoic acid, is a first-generation, naturally occurring, retinoid. It is available, commercially, as a gel or cream. The authors conducted a complete review of all studies, clinical- and basic science-based studies, within the literature involving tretinoin treatment recommendations for impending facial procedures. The literature currently lacks definitive recommendations for the use of tretinoin-containing products prior to undergoing facial procedures. Tretinoin pretreatment regimens vary greatly in terms of the strength of retinoid used, the length of the pre-procedure treatment, and the ideal time to stop treatment before the procedure. Based on the current literature and personal experience, the authors set forth a set of guidelines for the use of tretinoin prior to various facial procedures. PMID:27761082

  10. Effects of retinoids on ultraviolet-induced carcinogenesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Epstein, J.H.

    The evidence for effects of the retinoids on UV-induced carcinogenesis is sparse. Clinical observations indicate that topical RA can cause significant regression of premalignant actinic keratoses. Also there is some evidence that this agent can cause dissolution of some basal cell epitheliomas. However this latter effect does not appear to be of therapeutic value. Systemic retinoids are of little value in the treatment of premalignant and malignant cutaneous lesions though 13-cis-retinoic acid might be of use in the basal cell nevus syndrome. Examination of the influence of the retinoids on photocarcinogenesis essentially has been confined to RA and animal experimentation.more » RA in nontoxic concentrations can both stimulate and inhibit photocarcinogenesis depending upon the circumstances of the study. The mechanisms of these responses are not clear. Influences on DNA synthesis directly and/or indirectly or on immune responses may be involved in both effects. Preliminary studies with oral 13-cis-retinoic acid have not demonstrated any effects to date on UV-induced skin cancer formation.« less

  11. Alteration of gene expression in the colon of colorectal cancer model rat by dietary sodium gluconate.

    PubMed

    Kameue, Chiyoko; Tsukahara, Takamitsu; Ushida, Kazunari

    2006-03-01

    Butyrate induces apoptosis of various cancer cell lines in a p53-independent manner and inhibits the proliferation of cancer cells. In a previous report, we reported a significant reduction in tumor incidence in rat colon as a result of dietary sodium gluconate (GNA). The stimulation of apoptosis through enhanced butyrate production in the large intestine was involved in the antitumorigenic effect of GNA. In the present study, a cDNA microarray analysis was performed to investigate the particular mechanism involved in the antitumorigenic effect of GNA. Some up-regulated genes suggested by microarray analysis were further evaluated using real-time PCR. A microarray revealed that GNA regulates the expression of retinoic acid receptor (RAR) and retinoid X receptor (RXR), and several genes known as the target of retinoids in cancer cells. In other words, the antitumorigenic effect of GNA may involve the regulation of the retinoid signaling pathway by butyrate in a retinoid-independent manner.

  12. Beneficial effect of a moisturizing cream as adjunctive treatment to oral isotretinoin or topical tretinoin in the management of acne.

    PubMed

    Laquieze, Sabine; Czernielewski, Janusz; Rueda, Marie-José

    2006-01-01

    Despite their beneficial effects on the treatment of acne vulgaris, topical and oral retinoids may cause severe local irritation (retinoid dermatitis) due to their mechanism of action, thereby jeopardizing patient adherence, and thus compromising treatment efficacy. Alleviating dryness and improving skin comfort by using a moisturizer concomitantly to retinoids could enhance efficacy. In the present study, 30 subjects receiving either oral isotretinoin for at least 2 months or topical tretinoin for at least one month applied a moisturizing cream (Cetaphil Moisturizing Cream) twice daily for 15 days on one half of the face while the other side remained untreated. Clinical assessments, confirmed by biophysical measurements, showed that the moisturizer provided a significant improvement in skin dryness, roughness, and desquamation. Skin properties and skin discomfort were also greatly improved and subjects were very satisfied with the product. Retinoid-induced skin irritation can be relieved by the regular use of a gentle moisturizing cream as an adjunctive treatment.

  13. Pathogenesis of Zika Virus-Associated Embryopathy.

    PubMed

    Mawson, Anthony R

    2016-01-01

    A strong causal association has become evident between Zika virus (ZIKV) infection during pregnancy and the occurrence of fetal growth restriction, microcephaly and eye defects. Circumstantial evidence is presented in this paper in support of the hypothesis that these effects, as well as the Guillain-Barré syndrome, are due to an endogenous form of hypervitaminosis A resulting from ZIKV infection-induced damage to the liver and the spillage of stored vitamin A compounds ("retinoids") into the maternal and fetal circulation in toxic concentrations. Retinoids are mainly stored in the liver (about 80%) and are essential for numerous biological functions. In higher concentration, retinoids are potentially cytotoxic, pro-oxidant, mutagenic and teratogenic, especially if sudden shifts occur in their bodily distribution. Although liver involvement has not been mentioned specifically in recent reports, conventional liver enzyme tests underestimate the true extent of liver dysfunction. The proposed model could be tested by comparing retinoid concentration and expression profiles in microcephalic newborns of ZIKV-infected mothers and nonmicrocephalic newborn controls, and by correlating these profiles with measures of clinical severity.

  14. Synergistic Activation of Steroidogenic Acute Regulatory Protein Expression and Steroid Biosynthesis by Retinoids: Involvement of cAMP/PKA Signaling

    PubMed Central

    Manna, Pulak R.; Slominski, Andrzej T.; King, Steven R.; Stetson, Cloyce L.

    2014-01-01

    Both retinoic acid receptors (RARs) and retinoid X receptors (RXRs) mediate the action of retinoids that play important roles in reproductive development and function, as well as steroidogenesis. Regulation of steroid biosynthesis is principally mediated by the steroidogenic acute regulatory protein (StAR); however, the modes of action of retinoids in the regulation of steroidogenesis remain obscure. In this study we demonstrate that all-trans retinoic acid (atRA) enhances StAR expression, but not its phosphorylation (P-StAR), and progesterone production in MA-10 mouse Leydig cells. Activation of the protein kinase A (PKA) cascade, by dibutyrl-cAMP or type I/II PKA analogs, markedly increased retinoid-responsive StAR, P-StAR, and steroid levels. Targeted silencing of endogenous RARα and RXRα, with small interfering RNAs, resulted in decreases in 9-cis RA-stimulated StAR and progesterone levels. Truncation of and mutational alterations in the 5′-flanking region of the StAR gene demonstrated the importance of the −254/−1-bp region in retinoid responsiveness. An oligonucleotide probe encompassing an RXR/liver X receptor recognition motif, located within the −254/−1-bp region, specifically bound MA-10 nuclear proteins and in vitro transcribed/translated RXRα and RARα in EMSAs. Transcription of the StAR gene in response to atRA and dibutyrl-cAMP was influenced by several factors, its up-regulation being dependent on phosphorylation of cAMP response-element binding protein (CREB). Chromatin immunoprecipitation studies revealed the association of phosphorylation of CREB, CREB binding protein, RXRα, and RARα to the StAR promoter. Further studies elucidated that hormone-sensitive lipase plays an important role in atRA-mediated regulation of the steroidogenic response that involves liver X receptor signaling. These findings delineate the molecular events by which retinoids influence cAMP/PKA signaling and provide additional and novel insight into the regulation of StAR expression and steroidogenesis in mouse Leydig cells. PMID:24265455

  15. Literature Mining Methods for Toxicology and Construction of ...

    EPA Pesticide Factsheets

    Webinar Presentation on text-mining methodologies in use at NCCT and how they can be used to assist with the OECD Retinoid project. Presentation to 1st Workshop/Scientific Expert Group meeting on the OECD Retinoid Project - April 26, 2016 –Brussels, Presented remotely via web.

  16. STORED RETINOIDS IN POPULATIONS OF AN ESTUARINE FISH, FUNDULUS HETERCLITUS, INDIGENOUS TO PCB-CONTAMINATED AND REFERENCE SITES

    EPA Science Inventory

    Concentrations of retinoids, derivatives of vitamin A, were measured in populations of the nonmigratory estuarine fish Fundulus heteroclitus, indigenous to a reference site and a site highly contaminated with polychlorinated biphenyls (PCBs) to address the hypothesis that contami...

  17. CASTING A BROAD NETWORK: FISHING FOR MECHANISMS OF RETINOID TERATOGENICITY

    EPA Science Inventory

    This is a short essay that serves to introduce a featured paper for an issue of Toxicological Sciences. The paper being introduced describes a study of mechanisms of retinoid induced abnormal limb development in mice. The paper was notable because the authors used gene expressi...

  18. Duration of oral tetracycline-class antibiotic therapy and use of topical retinoids for the treatment of acne among general practitioners (GP): A retrospective cohort study.

    PubMed

    Barbieri, John S; Hoffstad, Ole; Margolis, David J

    2016-12-01

    Guidelines recommend limiting the duration of oral antibiotic therapy in acne to 3 to 6 months and prescribing concomitant topical retinoids for all patients. We sought to evaluate the duration of therapy with oral tetracyclines and the use of topical retinoids among patients with acne treated primarily by general practitioners in the United Kingdom. We conducted a retrospective cohort study using the Health Improvement Network database. The mean duration of therapy was 175.1 days. Of antibiotic courses, 62% were not associated with a topical retinoid; 29% exceeded 6 months in duration. If all regions were to achieve uses similar to the region with the shortest mean duration of therapy, approximately 3.3 million antibiotic days per year could be avoided in the United Kingdom. The Health Improvement Network does not include information on acne severity and clinical outcomes. Prescribing behavior for oral antibiotics in the treatment of acne among general practitioners is not aligned with current guideline recommendations. Increasing the use of topical retinoids and considering alternative agents to oral antibiotics when appropriate represent opportunities to reduce antibiotic exposure and associated complications such as antibiotic resistance and to improve outcomes in patients treated for acne. Copyright © 2016 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.

  19. Plasma retinoids concentration in Leptodactylus chaquensis (Amphibia: Leptodactylidae) from rice agroecosystems, Santa Fe province, Argentina.

    PubMed

    Teglia, Carla M; Attademo, Andrés M; Peltzer, Paola M; Goicoechea, Héctor C; Lajmanovich, Rafael C

    2015-09-01

    Retinoids are known to regulate important processes such as differentiation, development, and embryogenesis of vertebrates: Alteration in endogenous retinoids concentration is linked with teratogenic effects. Retinol (ROH), retinoid acid (RA), and isoform 13-Cis-retinoic acid (13-Cis-RA), in plasma of a native adults frog, Leptodactylus chaquensis from a rice field (RF) and a forest (reference site; RS) were measured. ROH did not vary between treatment sites. RA and 13-Cis-RA activities were higher (93.7±8.6 μg mL(-1) and 131.7±11.4 μg mL(-1), respectively) in individuals collected from RF than in those from RS (65.5±8.6 μg mL(-1) and 92.2±10.2 μg mL(-1), respectively). The ratios retinoic acid-retinol (RA/ROH) and 13-Cis-RA/ROH revealed significantly higher values in RF than in RS. RA and 13-Cis-RA concentrations in plasma on wild amphibian's species such as L. chaquensis would be suitable biomarkers of pesticide exposure in field monitoring. Finally, the mechanism of alteration in retinoid metabolites alteration should be further explored both in larvae and adult, considering that the potential exposition and uptake contaminants vary between the double lives of these vertebrates. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Binding of vitamin A with milk α- and β-caseins.

    PubMed

    Bourassa, P; N'soukpoé-Kossi, C N; Tajmir-Riahi, H A

    2013-05-01

    The binding sites of retinol and retinoic acid with milk α- and β-caseins were determined, using constant protein concentration and various retinoid contents. FTIR, UV-visible and fluorescence spectroscopic methods as well as molecular modelling were used to analyse retinol and retinoic acid binding sites, the binding constant and the effect of retinoid complexation on the stability and conformation of caseins. Structural analysis showed that retinoids bind caseins via both hydrophilic and hydrophobic contacts with overall binding constants of K(retinol-)(α)(-caseins)=1.21 (±0.4)×10(5) M(-1) and K(retinol-)(β)(-caseins)=1.11 (±0.5)×10(5) M(-1) and K(retinoic acid-)(α)(-caseins)=6.2 (±0.6)×10(4) M(-1) and K(retinoic acid-)(β)(-caseins)=6.3 (±0.6)×10(4) M(-1). The number of bound retinol molecules per protein (n) was 1.5 (±0.1) for α-casein and 1.0 (±0.1) for β-casein, while 1 molecule of retinoic acid was bound in the α- and β-casein complexes. Molecular modelling showed different binding sites for retinol and retinoic acid on α- and β-caseins with more stable complexes formed with α-casein. Retinoid-casein complexation induced minor alterations of protein conformation. Caseins might act as carriers for transportation of retinoids to target molecules. Copyright © 2012 Elsevier Ltd. All rights reserved.

  1. UPTAKE AND METABOLISM OF ALL-TRANS RETINOIC ACID BY THREE NATIVE NORTH AMERICAN RANIDS

    EPA Science Inventory

    Retinoids, which are Vvitamin A derivatives, are important signaling molecules that regulate processes critical for development in all vertebrates. The objective of our study was to examine uptake and metabolism of the model retinoid, all-trans retinoic acid (all-trans RA), by th...

  2. Toxcast Chemical and Bioactivity Profiles for In Vitro Targets in the Retinoid Signaling System (SOT)

    EPA Science Inventory

    A predictive model for prenatal developmental toxicity using ToxCast Phase I showed the RAR assay set to be the strongest weighting factor (Sipes et al. 2011). Retinoid signaling mediates growth and differentiation of the embryo. ToxCast has 6 reporter assays for trans-activation...

  3. Topical retinoids in the management of photodamaged skin: from theory to evidence-based practical approach.

    PubMed

    Darlenski, R; Surber, C; Fluhr, J W

    2010-12-01

    Skin, being exposed directly to the environment, represents a unique model for demonstrating the synergistic effects of intrinsic and extrinsic factors on the ageing process. Ultraviolet radiation (UVR) is the major factor among exogenous stressors responsible for premature skin ageing. The problem of skin ageing has captured public attention and has an important social impact. Different therapeutic approaches have been developed to treat cutaneous ageing and to diminish or prevent the negative effects of UVR. Topical retinoids represent an important and powerful class of molecules in the dermatologist's hands for the treatment of photodamaged skin. Since their introduction more than 20 years ago, topical retinoids have shown beneficial efficacy and good safety profiles in the management of photodamaged skin, and as therapeutic anti-ageing agents. This review provides a brief retrospective of the development of topical retinoids in the treatment of photodamaged skin, elucidates their mechanism of action, delineates their use and addresses clinical, pharmaceutical and regulatory issues in connection with their intended use. © 2010 The Authors. BJD © 2010 British Association of Dermatologists.

  4. Correlations between conceptal concentrations of all-trans-retinoic acid and dysmorphogenesis after microinjections of all-trans-retinoic acid, 13-cis-retinoic acid, all-trans-retinoyl-beta-glucuronide, or retinol in cultured whole rat embryos.

    PubMed

    Kraft, J C; Juchau, M R

    1992-01-01

    Retinol (4,000 ng/ml), all-trans-retinoyl-beta-glucuronide (4,000 ng/ml), and 13-cis-retinoic acid (1,500 ng/ml) each produced dysmorphogenic effects qualitatively similar to those elicited by 250 ng/ml of all-trans-retinoic acid after microinjections of the respective individual retinoids into the amniotic cavities of cultured whole rat embryos. Subsequent HPLC analyses of the cultured whole conceptuses, embryos proper, yolk sacs, and culture media (24 hr after microinjections) indicated that conceptal biotransformation of each of the retinoids had occurred during the culture period. All-trans-retinoic acid was present in the embryos proper at quantitatively similar concentrations (20-100 nM) after microinjections of the selected quantities of each of the microinjected retinoids: retinol, all-trans-retinoyl-beta-glucuronide, 13-cis-retinoic acid, or all-trans-retinoic acid. The results suggested that all-trans-retinoic acid acted as an ultimate dysmorphogen for the retinoids tested with respect to the anomalies monitored in the embryo culture system.

  5. A human induced pluripotent stem cell-based in vitro assay predicts developmental toxicity through a retinoic acid receptor-mediated pathway for a series of related retinoid analogues.

    PubMed

    Palmer, Jessica A; Smith, Alan M; Egnash, Laura A; Colwell, Michael R; Donley, Elizabeth L R; Kirchner, Fred R; Burrier, Robert E

    2017-10-01

    The relative developmental toxicity potency of a series of retinoid analogues was evaluated using a human induced pluripotent stem (iPS) cell assay that measures changes in the biomarkers ornithine and cystine. Analogue potency was predicted, based on the assay endpoint of the ornithine/cystine (o/c) ratio, to be all-trans-retinoic acid>TTNPB>13-cis-retinoic acid≈9-cis-retinoic acid>acitretin>etretinate>retinol. These rankings correlate with in vivo data and demonstrate successful application of the assay to rank a series of related toxic and non-toxic compounds. The retinoic acid receptor α (RARα)-selective antagonist Ro 41-5253 inhibited the cystine perturbation caused by all-trans-retinoic acid, TTNPB, 13-cis-retinoic acid, 9-cis-retinoic acid, and acitretin. Ornithine was altered independent of RARα in all retinoids except acitretin. These results suggest a role for an RARα-mediated mechanism in retinoid-induced developmental toxicity through altered cystine metabolism. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. The expression of Apoc3 mRNA is regulated by HNF4α and COUP-TFII, but not acute retinoid treatments, in primary rat hepatocytes and hepatoma cells.

    PubMed

    Howell, Meredith; Li, Rui; Zhang, Rui; Li, Yang; Chen, Wei; Chen, Guoxun

    2014-02-01

    Vitamin A status regulates obesity development, hyperlipidemia, and hepatic lipogenic gene expression in Zucker fatty (ZF) rats. The development of hyperlipidemia in acne patients treated with retinoic acid (RA) has been attributed to the induction of apolipoprotein C-III expression. To understand the role of retinoids in the development of hyperlipidemia in ZF rats, the expression levels of several selected RA-responsive genes in the liver and isolated hepatocytes from Zucker lean (ZL) and ZF rats were compared using real-time PCR. The Rarb and Srebp-1c mRNA levels are higher in the liver and isolated hepatocytes from ZF than ZL rats. The Apoc3 mRNA level is only higher in the isolated hepatocytes from ZF than ZL rats. To determine whether dynamic RA production acutely regulates Apoc3 expression, its mRNA levels in response to retinoid treatments or adenovirus-mediated overexpression of hepatocyte nuclear factor 4 alpha (HNF4α) and chicken ovalbumin upstream-transcription factor II (COUP-TFII) were analyzed. Retinoid treatments for 2-6 h did not induce the expression of Apoc3 mRNA. The overexpression of HNF4α or COUP-TFII induced or inhibited Apoc3 expression, respectively. We conclude that short-term retinoid treatments could not induce Apoc3 mRNA expression, which is regulated by HNF4α and COUP-TFII in hepatocytes.

  7. In Vivo Two-Photon Fluorescence Kinetics of Primate Rods and Cones

    PubMed Central

    Sharma, Robin; Schwarz, Christina; Williams, David R.; Palczewska, Grazyna; Palczewski, Krzysztof; Hunter, Jennifer J.

    2016-01-01

    Purpose The retinoid cycle maintains vision by regenerating bleached visual pigment through metabolic events, the kinetics of which have been difficult to characterize in vivo. Two-photon fluorescence excitation has been used previously to track autofluorescence directly from retinoids and pyridines in the visual cycle in mouse and frog retinas, but the mechanisms of the retinoid cycle are not well understood in primates. Methods We developed a two-photon fluorescence adaptive optics scanning light ophthalmoscope dedicated to in vivo imaging in anesthetized macaques. Using pulsed light at 730 nm, two-photon fluorescence was captured from rods and cones during light and dark adaptation through the eye's pupil. Results The fluorescence from rods and cones increased with light exposure but at different rates. During dark adaptation, autofluorescence declined, with cone autofluorescence decreasing approximately 4 times faster than from rods. Rates of autofluorescence decrease in rods and cones were approximately 4 times faster than their respective rates of photopigment regeneration. Also, subsets of sparsely distributed cones were less fluorescent than their neighbors immediately following bleach at 565 nm and they were comparable with the S cone mosaic in density and distribution. Conclusions Although other molecules could be contributing, we posit that these fluorescence changes are mediated by products of the retinoid cycle. In vivo two-photon ophthalmoscopy provides a way to monitor noninvasively stages of the retinoid cycle that were previously inaccessible in the living primate eye. This can be used to assess objectively photoreceptor function in normal and diseased retinas. PMID:26903225

  8. Uptake of Dietary Retinoids at the Maternal-Fetal Barrier

    PubMed Central

    Wassef, Lesley; Quadro, Loredana

    2011-01-01

    Dietary retinoids (vitamin A and its derivatives) contribute to normal embryonic development. However, the mechanism(s) involved in the transfer of recently ingested vitamin A from mother to embryo is not fully understood. We investigated in vivo whether lipoprotein lipase (LPL) facilitates the placental uptake of dietary retinyl ester incorporated in chylomicrons and their remnants and its transfer to the embryo. We examined the effects of both genetic ablation (MCK-L0 mice) and pharmacological inhibition (P-407) of LPL by maintaining wild type and MCK-L0 mice on diets with different vitamin A content or administering them an oral gavage dose of [3H]retinol with or without P-407 treatment. We showed that LPL expressed in placenta facilitates uptake of retinoids by this organ and their transfer to the embryo, mainly through its catalytic activity. In addition, through its “bridging function,” LPL can mediate the acquisition of nascent chylomicrons by the placenta, although less efficiently. Quantitative real-time PCR and Western blot analysis showed that placental LPL acts in concert with LDL receptor and LRP1. Finally, by knocking out the retinol-binding protein (RBP) gene in the MCK-L0 background (MCK-L0-RBP−/− mice) we demonstrated that the placenta acquires dietary retinoids also via the maternal circulating RBP-retinol complex. RBP expressed in the placenta facilitate the transfer of postprandial retinoids across the placental layers toward the embryo. PMID:21795711

  9. Retinoid hyposignaling contributes to aging-related decline in hippocampal function in short-term/working memory organization and long-term declarative memory encoding in mice.

    PubMed

    Mingaud, Frédérique; Mormede, Cécile; Etchamendy, Nicole; Mons, Nicole; Niedergang, Betty; Wietrzych, Marta; Pallet, Véronique; Jaffard, Robert; Krezel, Wojciech; Higueret, Paul; Marighetto, Aline

    2008-01-02

    An increasing body of evidence indicates that the vitamin A metabolite retinoic acid (RA) plays a role in adult brain plasticity by activating gene transcription through nuclear receptors. Our previous studies in mice have shown that a moderate downregulation of retinoid-mediated transcription contributed to aging-related deficits in hippocampal long-term potentiation and long-term declarative memory (LTDM). Here, knock-out, pharmacological, and nutritional approaches were used in a series of radial-arm maze experiments with mice to further assess the hypothesis that retinoid-mediated nuclear events are causally involved in preferential degradation of hippocampal function in aging. Molecular and behavioral findings confirmed our hypothesis. First, a lifelong vitamin A supplementation, like short-term RA administration, was shown to counteract the aging-related hippocampal (but not striatal) hypoexpression of a plasticity-related retinoid target-gene, GAP43 (reverse transcription-PCR analyses, experiment 1), as well as short-term/working memory (STWM) deterioration seen particularly in organization demanding trials (STWM task, experiment 2). Second, using a two-stage paradigm of LTDM, we demonstrated that the vitamin A supplementation normalized memory encoding-induced recruitment of (hippocampo-prefrontal) declarative memory circuits, without affecting (striatal) procedural memory system activity in aged mice (Fos neuroimaging, experiment 3A) and alleviated their LTDM impairment (experiment 3B). Finally, we showed that (knock-out, experiment 4) RA receptor beta and retinoid X receptor gamma, known to be involved in STWM (Wietrzych et al., 2005), are also required for LTDM. Hence, aging-related retinoid signaling hypoexpression disrupts hippocampal cellular properties critically required for STWM organization and LTDM formation, and nutritional vitamin A supplementation represents a preventive strategy. These findings are discussed within current neurobiological perspectives questioning the historical consensus on STWM and LTDM system partition.

  10. Retinoids in the treatment of glioma: a new perspective.

    PubMed

    Mawson, Anthony R

    2012-01-01

    Primary brain tumors are among the top ten causes of cancer-related deaths in the US. Malignant gliomas account for approximately 70% of the 22,500 new cases of malignant primary brain tumors diagnosed in adults each year and are associated with high morbidity and mortality. Despite optimal treatment, the prognosis for patients with gliomas remains poor. The use of retinoids (vitamin A and its congeners) in the treatment of certain tumors was originally based on the assumption that these conditions were associated with an underlying deficiency of vitamin A and that supplementation with pharmacological doses would correct the deficiency. Yet the results of retinoid treatment have been only modestly beneficial and usually short-lived. Studies also indicate that vitamin A excess and supplementation have pro-oxidant effects and are associated with increased risks of mortality from cancer and other diseases. The therapeutic role of vitamin A in cancer thus remains uncertain and a new perspective on the facts is needed. The modest and temporary benefits of retinoid treatment could result from a process of feedback inhibition, whereby exogenous retinoid temporarily inhibits the endogenous synthesis of these compounds. In fact, repeated and/or excessive exposure of the tissues to endogenous retinoic acid may contribute to carcinogenesis. Gliomas, in particular, may result from an imbalance in retinoid receptor expression initiated by environmental factors that increase the endogenous production of retinoic acid in glia. At the receptor level, it is proposed that this imbalance is characterized by excessive expression of retinoic acid receptor-α (RARα) and reduced expression of retinoic acid receptor-β (RARβ). This suggests a potential new treatment strategy for gliomas, possibly even at a late stage of the disease, ie, to combine the use of a RARα antagonist and a RARβ agonist. According to this hypothesis, the RARα antagonist would be expected to inhibit RARα-induced gliomas, while the RARβ agonist would suppress tumor growth and possibly contribute to the regeneration of normal glia.

  11. Activation of RAS/ERK alone is insufficient to inhibit RXRα function and deplete retinoic acid in hepatocytes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Ai-Guo, E-mail: wangaiguotl@hotmail.com; Song, Ya-Nan; Chen, Jun

    2014-09-26

    Highlights: • The activation of RAS/ERK is insufficient to inhibit RXRα function and deplete RA. • The retinoid metabolism-related genes are down-regulated by ras oncogene. • The atRA has no effect on preventing hepatic tumorigenesis or curing the developed hepatic nodules. - Abstract: Activation of RAS/ERK signaling pathway, depletion of retinoid, and phosphorylation of retinoid X receptor alpha (RXRα) are frequent events found in liver tumors and thought to play important roles in hepatic tumorigenesis. However, the relationships among them still remained to be elucidated. By exploring the transgenic mouse model of hepatic tumorigenesis induced by liver-specific expression of H-ras12Vmore » oncogene, the activation of RAS/ERK, the mRNA expression levels of retinoid metabolism-related genes, the contents of retinoid metabolites, and phosphorylation of RXRα were determined. RAS/ERK signaling pathway was gradually and significantly activated in hepatic tumor adjacent normal liver tissues (P) and hepatic tumor tissues (T) of H-ras12V transgenic mice compared with normal liver tissues (Wt) of wild type mice. On the contrary, the mRNA expression levels of retinoid metabolism-related genes were significantly reduced in P and T compared with Wt. Interestingly, the retinoid metabolites 9-cis-retinoic acid (9cRA) and all-trans-retinoic acid (atRA), the well known ligands for nuclear transcription factor RXR and retinoic acid receptor (RAR), were significantly decreased only in T compared with Wt and P, although the oxidized polar metabolite of atRA, 4-keto-all-trans-retinoic-acid (4-keto-RA) was significantly decreased in both P and T compared with Wt. To our surprise, the functions of RXRα were significantly blocked only in T compared with Wt and P. Namely, the total protein levels of RXRα were significantly reduced and the phosphorylation levels of RXRα were significantly increased only in T compared with Wt and P. Treatment of H-ras12V transgenic mice at 5-week-old or 5-month-old with atRA had no effect on the prevention of tumorigenesis or cure of developed nodules in liver. These events imply that the depletion of 9cRA and atRA and the inhibition of RXRα function in hepatic tumors involve more complex mechanisms besides the activation of RAS/ERK pathway.« less

  12. Evidence of Early Childhood Defects Due to Prenatal Over-Exposure to Vitamin A: A Case Study

    ERIC Educational Resources Information Center

    Naude, H.; Marx, J.; Pretorius, E.; Hislop-Esterhuyzen, N.

    2007-01-01

    One of the important nutrients during pregnancy is vitamin A or related compounds called retinoids. Although it is well-known that vitamin A deficiency may be detrimental to foetal development, overdosage of retinoids might cause developmental defects, particularly affecting the central nervous system development of the foetus, causing hindbrain…

  13. Efficacy of steroidal vs non-steroidal agents in oral lichen planus: a randomised, open-label study.

    PubMed

    Singh, A R; Rai, A; Aftab, M; Jain, S; Singh, M

    2017-01-01

    This study compared the therapeutic efficacy of steroidal and non-steroidal agents for treating oral lichen planus. Forty patients with clinical and/or histologically proven oral lichen planus were randomly placed into four groups and treated with topical triamcinolone, oral dapsone, topical tacrolimus or topical retinoid for three months. Pre- and post-treatment symptoms and signs were scored for each patient. Patients in all treatment groups showed significant clinical improvement after three months (p 0.05) and for topical retinoid vs topical tacrolimus (p > 0.05). Non-steroidal drugs such as dapsone, tacrolimus and retinoid are as efficacious as steroidal drugs for treating oral lichen planus, and avoid the side effects associated with steroids.

  14. Vitamin A and Retinoids as Mitochondrial Toxicants

    PubMed Central

    de Oliveira, Marcos Roberto

    2015-01-01

    Vitamin A and its derivatives, the retinoids, are micronutrient necessary for the human diet in order to maintain several cellular functions from human development to adulthood and also through aging. Furthermore, vitamin A and retinoids are utilized pharmacologically in the treatment of some diseases, as, for instance, dermatological disturbances and some types of cancer. In spite of being an essential micronutrient with clinical application, vitamin A exerts several toxic effects regarding redox environment and mitochondrial function. Moreover, decreased life quality and increased mortality rates among vitamin A supplements users have been reported. However, the exact mechanism by which vitamin A elicits its deleterious effects is not clear yet. In this review, the role of mitochondrial dysfunction in the mechanism of vitamin A-induced toxicity is discussed. PMID:26078802

  15. Structure of Zebrafish IRBP Reveals Fatty Acid Binding

    PubMed Central

    Ghosh, Debashis; Haswell, Karen M.; Sprada, Molly; Gonzalez-Fernandez, Federico

    2015-01-01

    Interphotoreceptor retinoid-binding protein (IRBP) has a remarkable role in targeting and protecting all-trans and 11-cis retinol, and 11-cis retinal during the rod and cone visual cycles. Little is known about how the correct retinoid is efficiently delivered and removed from the correct cell at the required time. It has been proposed that different fatty composition at that the outer-segments and retinal-pigmented epithelium could have an important role is regulating the delivery and uptake of the visual cycle retinoids at the cell-interphotoreceptor-matrix interface. Although this suggests intriguing mechanisms for the role of local fatty acids in visual-cycle retinoid trafficking, nothing is known about the structural basis of IRBP-fatty acid interactions. Such regulation may be mediated through IRBP’s unusual repeating homologous modules, each containing about 300 amino acids. We have been investigating structure-function relationships of Zebrafish IRBP (zIRBP), which has only two tandem modules (z1 and z2), as a model for the more complex four-module mammalian IRBP’s. Here we report the first X-ray crystal structure of a teleost IRBP, and the only structure with a bound ligand. The X-ray structure of z1, determined at 1.90Å resolution, reveals a two-domain organization of the module (domains A and B). A deep hydrophobic pocket was identified within the N-terminal domain A. In fluorescence titrations assays, oleic acid displaced all-trans retinol from zIRBP. Our study, which provides the first structure of an IRBP with bound ligand, supports a potential role for fatty acids in regulating retinoid binding. PMID:26344741

  16. Diethylnitrosamine-induced hepatocarcinogenesis is suppressed in lecithin:retinol acyltransferase-deficient mice primarily through retinoid actions immediately after carcinogen administration.

    PubMed

    Shirakami, Yohei; Gottesman, Max E; Blaner, William S

    2012-02-01

    Loss of retinoid-containing lipid droplets upon hepatic stellate cell (HSC) activation is one of the first events in the development of liver disease leading to hepatocellular carcinoma. Although retinoid stores are progressively lost from HSCs during the development of hepatic disease, how this affects hepatocarcinogenesis is unclear. To investigate this, we used diethylnitrosamine (DEN) to induce hepatic tumorigenesis in matched wild-type (WT) and lecithin:retinol acyltransferase (LRAT) knockout (KO) mice, which lack stored retinoid and HSC lipid droplets. Male 15-day-old WT or Lrat KO mice were given intraperitoneal injections of DEN (25 mg/kg body wt). Eight months later, Lrat KO mice showed significantly less liver tumor development compared with WT mice, characterized by less liver tumor incidence and smaller tumor size. Two days after DEN injection, lower serum levels of alanine aminotransferase and decreased hepatic levels of cyclin D1 were observed in Lrat KO mice. Lrat KO mice also exhibited increased levels of retinoic acid-responsive genes, including p21, lower levels of cytochrome P450 enzymes required for DEN bioactivation and higher levels of the DNA repair enzyme O(6)-methylguanine-DNA methyltransferase (MGMT), both before and after DEN treatment. Our results indicate that Lrat KO mice are less susceptible to DEN-induced hepatocarcinogenesis due to increased retinoid signaling and higher expression of p21, which is accompanied by altered hepatic levels of DEN-activating enzymes and MGMT in Lrat KO mice also contribute to decreased cancer initiation and suppressed liver tumor development.

  17. Plant-mediated silencing of the fatty acid- and retinoid-binding Pp-far-1 gene can reduce development of the root lesion nematode, Pratylenchus penetrans

    USDA-ARS?s Scientific Manuscript database

    Pratylenchus penetrans is one of the most important plant-parasitic nematodes and can act as a limiting factor of important agricultural, horticultural and industrial crops. Fatty acid- and retinoid- (FAR) binding proteins are unique to nematodes. The cDNA corresponding to a putative P. penetrans FA...

  18. Effects of retinoids on differentiation, lipid metabolism, epidermal growth factor, and low-density lipoprotein binding in squamous carcinoma cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ponec, M.; Weerheim, A.; Havekes, L.

    The relationship among keratinocyte differentiation capacity, lipid synthesis, low-density lipoprotein (LDL) metabolism, plasma membrane composition, and epidermal growth factor (EGF) binding has been studied in SCC-12F2 cells. The differentiation capacity of the cells, i.e., ionophore-induced cornified envelope formation, was inhibited by various retinoids and stimulated by hydrocortisone. Retinoids that caused a significant reduction of cornified envelope formation, i.e., retinoic acid and 13-cis-retinoic acid, caused only minor changes in lipid synthesis and plasma membrane composition. Arotinoid ethylsulfone, having a minor effect on cornified envelope formation, caused a drastic inhibition of cholesterol synthesis resulting in changes in the plasma membrane composition. Hydrocortisonemore » stimulated cornified envelope formation but had only minor effects on lipid synthesis and plasma membrane composition. Of all retinoids tested, only arotinoid ethylsulfone caused a drastic increase in EGF binding, while hydrocortisone had no effect. These results clearly demonstrate that the plasma membrane composition is not related to keratinocyte differentiation capacity, but most likely does determine EGF binding. Furthermore, EGF binding does not determine keratinocyte differentiation capacity.« less

  19. UVA is the major contributor to the photodegradation of tretinoin and isotretinoin: implications for development of improved pharmaceutical formulations

    PubMed Central

    Tashtoush, Bassam M.; Jacobson, Elaine L.; Jacobson, Myron K.

    2008-01-01

    The chemical stability of tretinoin (RA) and isotretinoin (13RA) in ethanol and dermatological cream preparations exposed to solar simulated light (SSL), UVA, and visible light has been studied. Photostability was monitored by an HPLC method that allowed simultaneous analysis of RA and 13RA, thus allowing photodegradation due to isomerization to other retinoids and photolysis to non-retinoid products to be monitored. Both retinoids undergo both isomerization and photolysis following SSL, UVA and visible light exposure but RA is more sensitive to photodegradation than 13RA. Degradation of both retinoids by photolysis is considerably greater in cream formulations than in ethanol and the photodegradation follows second order kinetics. Rate constants and half-lives for degradation of RA and 13RA in ethanol solution and cream preparations subjected to different light sources are reported. The UVA component of SSL is the major contributor to photodegradation. Since UVA penetrates deeply into skin, our results suggest that photodegradation of RA may contribute to the photosensitivity associated with RA therapy. Our studies suggest that development of improved formulations and the use of effective UVA sunscreens may reduce the side effects of RA therapy. PMID:18093761

  20. Enzymology of retinoic acid biosynthesis and degradation

    PubMed Central

    Kedishvili, Natalia Y.

    2013-01-01

    All-trans-retinoic acid is a biologically active derivative of vitamin A that regulates numerous physiological processes. The concentration of retinoic acid in the cells is tightly regulated, but the exact mechanisms responsible for this regulation are not completely understood, largely because the enzymes involved in the biosynthesis of retinoic acid have not been fully defined. Recent studies using in vitro and in vivo models suggest that several members of the short-chain dehydrogenase/reductase superfamily of proteins are essential for retinoic acid biosynthesis and the maintenance of retinoic acid homeostasis. However, the exact roles of some of these recently identified enzymes are yet to be characterized. The properties of the known contributors to retinoid metabolism have now been better defined and allow for more detailed understanding of their interactions with retinoid-binding proteins and other retinoid enzymes. At the same time, further studies are needed to clarify the interactions between the cytoplasmic and membrane-bound proteins involved in the processing of hydrophobic retinoid metabolites. This review summarizes current knowledge about the roles of various biosynthetic and catabolic enzymes in the regulation of retinoic acid homeostasis and outlines the remaining questions in the field. PMID:23630397

  1. UVA is the major contributor to the photodegradation of tretinoin and isotretinoin: Implications for development of improved pharmaceutical formulations.

    PubMed

    Tashtoush, Bassam M; Jacobson, Elaine L; Jacobson, Myron K

    2008-03-20

    The chemical stability of tretinoin (RA) and isotretinoin (13RA) in ethanol and dermatological cream preparations exposed to solar simulated light (SSL), UVA, and visible light has been studied. Photostability was monitored by an HPLC method that allowed simultaneous analysis of RA and 13RA, thus allowing photodegradation due to isomerization to other retinoids and photolysis to non-retinoid products to be monitored. Both retinoids undergo both isomerization and photolysis following SSL, UVA and visible light exposure but RA is more sensitive to photodegradation than 13RA. Degradation of both retinoids by photolysis is considerably greater in cream formulations than in ethanol and the photodegradation follows second order kinetics. Rate constants and half-lives for degradation of RA and 13RA in ethanol solution and cream preparations subjected to different light sources are reported. The UVA component of SSL is the major contributor to photodegradation. Since UVA penetrates deeply into skin, our results suggest that photodegradation of RA may contribute to the photosensitivity associated with RA therapy. Our studies suggest that development of improved formulations and the use of effective UVA sunscreens may reduce the side effects of RA therapy.

  2. Synthetic retinoids in dermatology

    PubMed Central

    Heller, Elizabeth H.; Shiffman, Norman J.

    1985-01-01

    The potential of vitamin A, or retinol, in the treatment of a variety of skin diseases has long been recognized, but because of serious toxic effects this substance generally could not be used. The recent development and marketing of two relatively nontoxic synthetic analogues, which are known as retinoids, has made it possible to treat some of the diseases that are resistant to standard forms of therapy. Isotretinoin is very effective in cystic and conglobate acne, while etretinate is especially useful in the more severe forms of psoriasis. Good results have also been obtained in other disorders of keratinization. Vitamin A and its derivatives apparently have an antineoplastic effect as well and may come to be used in both the prevention and the treatment of epithelial cancer. In many of these diseases the retinoids act by enhancing the normal differentiation and proliferation of epidermal tissues, but the exact mechanisms are not well understood. Their influence on the intracellular polyamines that control the synthesis of nucleic acids and proteins may be an important factor. Although the retinoids have few serious systemic effects, they are teratogenic, and because they persist in the body their use in women of childbearing potential is limited. ImagesFig. 3 PMID:3158386

  3. Space, self, and the theater of consciousness.

    PubMed

    Trehub, Arnold

    2007-06-01

    Over a decade ago, I introduced a large-scale theory of the cognitive brain which explained for the first time how the human brain is able to create internal models of its intimate world and invent models of a wider universe. An essential part of the theoretical model is an organization of neuronal mechanisms which I have named the Retinoid Model [Trehub, A. (1977). Neuronal models for cognitive processes: Networks for learning, perception and imagination. Journal of Theoretical Biology, 65, 141-169; Trehub, A. (1991). The Cognitive Brain: MIT Press]. This hypothesized brain system has structural and dynamic properties enabling it to register and appropriately integrate disparate foveal stimuli into a perspectival, egocentric representation of an extended 3D world scene including a neuronally tokened locus of the self which, in this theory, is the neuronal origin of retinoid space. As an integral part of the larger neuro-cognitive model, the retinoid system is able to perform many other useful perceptual and higher cognitive functions. In this paper, I draw on the hypothesized properties of this system to argue that neuronal activity within the retinoid structure constitutes the phenomenal content of consciousness and the unique sense of self that each of us experiences.

  4. Evaluation of vitamin A and carotenoid data in food composition tables.

    PubMed

    Beecher, G R; Khachik, F

    1984-12-01

    Vitamin A and carotenoid data in food composition tables have been generated with the use of the Association of Official Analytical Chemists procedures. These procedures fractionate complex mixtures of retinoids and carotenoids into only three fractions, e.g., retinoids, carotenes, and xanthophylls. Food tables lack uniformity in the presentation of vitamin A and carotenoid data. For example, the revisions of Agriculture Handbook, No. 8 (Washington, D.C.: U.S. Govt Print Off, 1963), report both international units and retinol equivalents of vitamin A in foods. Food tables published in the United Kingdom (Paul AA, Southgate DA. McCance and Widdowson's: The composition of foods. Amsterdam: Elsevier/North-Holland, 1978) report preformed vitamin A as retinol and carotenoids as carotene on a weight basis (micrograms/100 g food). The vitamin A and carotenoid data currently available in food composition tables allow only the intake of total vitamin A activity to be estimated. Information about the intake of specific species of retinoids or carotenoids is not available and could not be calculated from existing food tables. Limited applications of new separation techniques and chemical instrumentation have demonstrated the potential for generating detailed analytic information in regard to the retinoid and carotenoid contents of foods.

  5. Uncoupling RARA transcriptional activation and degradation clarifies the bases for APL response to therapies.

    PubMed

    Ablain, Julien; Leiva, Magdalena; Peres, Laurent; Fonsart, Julien; Anthony, Elodie; de Thé, Hugues

    2013-04-08

    In PML/RARA-driven acute promyelocytic leukemia (APL), retinoic acid (RA) induces leukemia cell differentiation and transiently clears the disease. Molecularly, RA activates PML/RARA-dependent transcription and also initiates its proteasome-mediated degradation. In contrast, arsenic, the other potent anti-APL therapy, only induces PML/RARA degradation by specifically targeting its PML moiety. The respective contributions of RA-triggered transcriptional activation and proteolysis to clinical response remain disputed. Here, we identify synthetic retinoids that potently activate RARA- or PML/RARA-dependent transcription, but fail to down-regulate RARA or PML/RARA protein levels. Similar to RA, these uncoupled retinoids elicit terminal differentiation, but unexpectedly fail to impair leukemia-initiating activity of PML/RARA-transformed cells ex vivo or in vivo. Accordingly, the survival benefit conferred by uncoupled retinoids in APL mice is dramatically lower than the one provided by RA. Differentiated APL blasts sorted from uncoupled retinoid-treated mice retain PML/RARA expression and reinitiate APL in secondary transplants. Thus, differentiation is insufficient for APL eradication, whereas PML/RARA loss is essential. These observations unify the modes of action of RA and arsenic and shed light on the potency of their combination in mice or patients.

  6. Docking simulations suggest that all-trans retinoic acid could bind to retinoid X receptors.

    PubMed

    Tsuji, Motonori; Shudo, Koichi; Kagechika, Hiroyuki

    2015-10-01

    Retinoid X receptors (RXRs) are ligand-controlled transcription factors which heterodimerize with other nuclear receptors to regulate gene transcriptions associated with crucial biological events. 9-cis retinoic acid (9cRA), which transactivates RXRs, is believed to be an endogenous RXR ligand. All-trans retinoic acid (ATRA) is a natural ligand for retinoic acid receptors (RARs), which heterodimerize with RXRs. Although the concentration of 9cRA in tissues is very low, ATRA is relatively abundant and some reports show that ATRA activates RXRs. We computationally studied the possibility of ATRA binding to RXRs using two different docking methods with our developed programs to assess the binding affinities of naturally occurring retinoids. The simulations showed good correlations to the reported binding affinities of these molecules for RXRs and RARs.

  7. Characterization of three novel fatty acid- and retinoid-binding protein genes (Ha-far-1, Ha-far-2 and Hf-far-1) from the cereal cyst nematodes Heterodera avenae and H. filipjevi

    USDA-ARS?s Scientific Manuscript database

    Heterodera avenae and H. filipjevi are major parasites of wheat, reducing production worldwide. Both are sedentary endoparasitic nematodes, and their development and parasitism depend strongly on nutrients obtained from hosts. Secreted fatty acid- and retinoid-binding (FAR) proteins are nematode-spe...

  8. 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) alters the endogenous metabolism of all-trans-retinoic acid in the rat.

    PubMed

    Schmidt, Carsten K; Hoegberg, Pi; Fletcher, Nicholas; Nilsson, Charlotte B; Trossvik, Christina; Håkansson, Helen; Nau, Heinz

    2003-07-01

    2,3,7,8-Tetrachlorodibenzo- p-dioxin (TCDD) is known to influence vitamin A homeostasis. In order to investigate the mechanism behind this retinoid disruption, male Sprague-Dawley rats were exposed to TCDD at doses ranging from 0.1 to 100 micro g/kg body weight, and were killed 3 days after exposure. Additional groups of rats were killed 1 and 28 days after a single oral dose of 10 micro g TCDD/kg body weight. Serum, kidney, and liver were investigated for retinoid levels, as well as gene expression and enzyme activities relevant for retinoid metabolism. Besides the well known effects of TCDD on apolar retinoids, i.e. decreased hepatic and increased renal retinyl ester (RE) levels, we have found dose-dependent elevation of all- trans-retinoic acid (all- trans-RA) levels in all investigated tissues. In the liver, 9- cis-4-oxo-13,14-dihydro-RA was drastically decreased by TCDD in a dose-dependent manner. In serum, cis-isomers of all- trans-RA, including 9,13-di- cis-RA, were significantly reduced already at the lowest dose level. Protein and mRNA levels of cellular retinol binding protein I (CRBP-I) in liver or kidneys were not significantly altered by TCDD exposure at doses at which retinoid levels were affected, making CRBP-I an unlikely candidate to account for the alterations in retinoid metabolism caused by TCDD. The expression and activities of relevant cytochrome P450 (CYP) enzymes with potential roles in all- trans-RA synthesis and/or degradation (CYP1A1, 1A2, and 2B1/2) were also monitored. A possible role of CYP1A1 in TCDD-induced all- trans-RA synthesis is suggested from the time-course relationship between CYP1A1 activity and all- trans-RA levels in liver and kidney. The significant alteration of the all- trans-RA metabolism has the potential to contribute significantly to the toxicity of TCDD.

  9. Oral Vitamin A and Retinoic Acid Supplementation Stimulates Antibody Production and Splenic Stra6 Expression in Tetanus Toxoid–Immunized Mice12

    PubMed Central

    Tan, Libo; Wray, Amanda E.; Ross, A. Catharine

    2012-01-01

    Coadministration of retinoic acid (RA) and polyinosinic acid:polycytidylic acid (PIC) has been shown to cooperatively enhance the anti–tetanus toxoid (anti-TT) vaccine response in adult mice. Germinal center formation in the spleen is critical for a normal antibody response. Recent studies have identified Stimulated by Retinoic Acid-6 (Stra6) as the cell membrane receptor for retinol-binding protein (RBP) in many organs, including spleen. The objectives of the present studies were to test whether orally administered vitamin A (VA) itself, either alone or combined with RA, and/or treatment with PIC regulates Stra6 gene expression in mouse spleen and, concomitantly, antibody production. Eight-week-old C57BL/6 mice were immunized with TT. In an initial kinetic study, oral VA (6 mg/kg) increased anti-TT IgM and IgG production as well as splenic Stra6 mRNA expression. In treatment studies that were analyzed 9 d postimmunization, retinoids including VA, RA, VA and RA combined, and PIC significantly increased plasma anti-TT IgM and IgG (P < 0.05) and splenic Stra6 mRNA (P < 0.05). Treatments that included PIC elevated plasma anti-TT IgM and IgG concentrations >20-fold (P < 0.01). Immunohistochemistry of STRA6 protein in mouse spleen confirmed its increase after immunization and retinoid treatment. In conclusion, retinoid treatments that included VA, RA, VA and RA combined, and the combination of retinoid and PIC stimulated the expression of Stra6 in spleen, which potentially could increase the local uptake of retinol. Concomitantly, these treatments increased the systemic antigen-specific antibody response. The ability of oral retinoids to stimulate systemic immunity has implications for public health and therapeutic use of VA. PMID:22739370

  10. Gestational exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin alters retinoid homeostasis in maternal and perinatal tissues of the Holtzman rat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kransler, Kevin M.; Tonucci, David A.; McGarrigle, Barbara P.

    2007-10-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD), one of the most widely studied environmental contaminants, causes a variety of adverse health effects including teratogenesis and altered development which may be related to disruptions in retinoid homeostasis. The purpose of this study was to determine the effect that gestational administration of TCDD has on retinoid homeostasis in both pregnant Holtzman rats and developing fetuses and neonates. A single oral dose of TCDD (0, 1.5, 3, or 6 {mu}g/kg) was administered to pregnant rats on gestation day 10, with fetuses analyzed on gestation days 17 and 20, and neonates analyzed on post natal day 7. Exposure tomore » TCDD generally produced decreases in the concentrations of retinyl esters, such as retinyl palmitate, and retinol in maternal and perinatal liver and lung, while increasing levels in the maternal kidney. Additionally, perinatal hepatic retinol binding protein 1-dependent retinyl ester hydrolysis was also decrease by TCDD. Sensitivity of the developing perinates to TCDD appeared to have an age-related component demonstrated by an increased rate of mortality and significant alterations to body weight and length on post natal day 7 relative to that observed at gestation day 20. A unique observation made in this study was a significant decrease in lung weight observed in the perinates exposed to TCDD. Taken together, these data demonstrate that TCDD significantly alters retinoid homeostasis in tissues of the developing fetus and neonate, suggesting that their unique sensitivity to TCDD may at least be in part the result of altered retinoid homeostasis.« less

  11. N-retinylidene-phosphatidylethanolamine is the preferred retinoid substrate for the photoreceptor-specific ABC transporter ABCA4 (ABCR).

    PubMed

    Beharry, Seelochan; Zhong, Ming; Molday, Robert S

    2004-12-24

    ABCA4, a member of the family of ATP binding cassette (ABC) proteins found in rod and cone photoreceptors, has been implicated in the transport of retinoid compounds across the outer segment disk membrane following the photoactivation of rhodopsin. Mutations in the ABCA4 gene are responsible for Stargardt macular dystrophy and related retinal degenerative diseases that cause a loss in vision. To identify the retinoid substrate that interacts with ABCA4, we have isolated ABCA4 from rod outer segment disk membranes on an immunoaffinity matrix and analyzed retinoid compounds that bind to ABCA4 using high performance liquid chromatography and radiolabeling methods. When all-trans-retinal was added to ABCA4 in the presence of phosphatidylethanolamine, approximately 0.9 mol of N-retinylidene-phosphatidylethanolamine and 0.3 mol of all-trans-retinal were bound per mol of ABCA4 with an apparent K(d) of 2-5 microm. ATP and GTP released these retinoids from ABCA4, whereas ADP, GDP, and nonhydrolyzable derivatives, adenosine 5'-(beta,gamma-imido)triphosphate and guanosine 5'-(beta,gamma-imido)triphosphate, were ineffective. One mole of N-retinyl-phosphatidylethanolamine, the reduced form of N-retinylidene-phosphatidylethanolamine, bound per mol of ABCA4, whereas 0.3 mol of all-trans-retinal were bound in the absence of phosphatidylethanolamine. No binding of all-trans-retinol to ABCA4 was observed. Our results indicate that ABCA4 preferentially binds N-retinylidene-phosphatidylethanolamine with high affinity in the absence of ATP. Our studies further suggest that ATP binding and hydrolysis induces a protein conformational change that causes N-retinylidene-phosphatidylethanolamine to dissociate from ABCA4.

  12. Lipocalin 2, a Regulator of Retinoid Homeostasis and Retinoid-mediated Thermogenic Activation in Adipose Tissue*

    PubMed Central

    Guo, Hong; Foncea, Rocio; O'Byrne, Sheila M.; Jiang, Hongfeng; Zhang, Yuanyuan; Deis, Jessica A.; Blaner, William S.; Bernlohr, David A.; Chen, Xiaoli

    2016-01-01

    We have recently characterized the role of lipocalin 2 (Lcn2) as a new adipose-derived cytokine in the regulation of adaptive thermogenesis via a non-adrenergic pathway. Herein, we explored a potential non-adrenergic mechanism by which Lcn2 regulates thermogenesis and lipid metabolism. We found that Lcn2 is a retinoic acid target gene, and retinoic acid concurrently stimulated UCP1 and Lcn2 expression in adipocytes. Lcn2 KO mice exhibited a blunted effect of all-trans-retinoic acid (ATRA) on body weight and fat mass, lipid metabolism, and retinoic acid signaling pathway activation in adipose tissue under the high fat diet-induced obese condition. We further demonstrated that Lcn2 is required for the full action of ATRA on the induction of UCP1 and PGC-1α expression in brown adipocytes and the restoration of cold intolerance in Lcn2 KO mice. Interestingly, we discovered that Lcn2 KO mice have decreased levels of retinoic acid and retinol in adipose tissue. The protein levels of STRA6 responsible for retinol uptake were significantly decreased in adipose tissue. The retinol transporter RBP4 was increased in adipose tissue but decreased in the circulation, suggesting the impairment of RBP4 secretion in Lcn2 KO adipose tissue. Moreover, Lcn2 deficiency abolished the ATRA effect on RBP4 expression in adipocytes. All the data suggest that the decreased retinoid level and action are associated with impaired retinol transport and storage in adipose tissue in Lcn2 KO mice. We conclude that Lcn2 plays a critical role in regulating metabolic homeostasis of retinoids and retinoid-mediated thermogenesis in adipose tissue. PMID:27008859

  13. Singlet Oxygen and Free Radical Reactions of Retinoids and Carotenoids—A Review

    PubMed Central

    Truscott, T. George

    2018-01-01

    We report on studies of reactions of singlet oxygen with carotenoids and retinoids and a range of free radical studies on carotenoids and retinoids with emphasis on recent work, dietary carotenoids and the role of oxygen in biological processes. Many previous reviews are cited and updated together with new data not previously reviewed. The review does not deal with computational studies but the emphasis is on laboratory-based results. We contrast the ease of study of both singlet oxygen and polyene radical cations compared to neutral radicals. Of particular interest is the switch from anti- to pro-oxidant behavior of a carotenoid with change of oxygen concentration: results for lycopene in a cellular model system show total protection of the human cells studied at zero oxygen concentration, but zero protection at 100% oxygen concentration. PMID:29301252

  14. Retinoids, 585-nm laser, and carbon dioxide laser: a numeric comparison of neocollagen formation in photoaged hairless mouse skin.

    PubMed

    Lee, C J; Park, J H; Ciesielski, T E; Thomson, J G; Persing, J A

    2008-11-01

    A variety of new methods for treating photoaging have been recently introduced. There has been increasing interest in comparing the relative efficacy of multiple methods for photoaging. However, the efficacy of a single method is difficult to assess from the data reported in the literature. Photoaged hairless mice were randomly divided into seven treatment groups: control, retinoids (tretinoin and adapalene), lasers (585 nm and CO(2)), and combination groups (585 nm + adapalene and CO(2 )+ adapalene). Biopsies were taken from the treated regions, and the results were analyzed based on the repair zone. The repair zones of the various methods for photoaging were compared. Retinoids produced a wider repair zone than the control condition. The 585-nm and CO(2) laser resurfacing produced a result equivalent to that of the control condition. A combination of these lasers with adapalene produced a wider repair zone than the lasers alone, but the combination produced a result equivalent to that of adapalene alone. Retinoids are potent stimuli for neocollagen formation. The 585-nm or CO(2) laser alone did not induce more neocollagen than the control condition. In addition, no synergistic effect was observed with the combination treatments. The repair zone of the combination treatment is mainly attributable to adapalene.

  15. A new class of synthetic retinoid antibiotics effective against bacterial persisters.

    PubMed

    Kim, Wooseong; Zhu, Wenpeng; Hendricks, Gabriel Lambert; Van Tyne, Daria; Steele, Andrew D; Keohane, Colleen E; Fricke, Nico; Conery, Annie L; Shen, Steven; Pan, Wen; Lee, Kiho; Rajamuthiah, Rajmohan; Fuchs, Beth Burgwyn; Vlahovska, Petia M; Wuest, William M; Gilmore, Michael S; Gao, Huajian; Ausubel, Frederick M; Mylonakis, Eleftherios

    2018-04-05

    A challenge in the treatment of Staphylococcus aureus infections is the high prevalence of methicillin-resistant S. aureus (MRSA) strains and the formation of non-growing, dormant 'persister' subpopulations that exhibit high levels of tolerance to antibiotics and have a role in chronic or recurrent infections. As conventional antibiotics are not effective in the treatment of infections caused by such bacteria, novel antibacterial therapeutics are urgently required. Here we used a Caenorhabditis elegans-MRSA infection screen to identify two synthetic retinoids, CD437 and CD1530, which kill both growing and persister MRSA cells by disrupting lipid bilayers. CD437 and CD1530 exhibit high killing rates, synergism with gentamicin, and a low probability of resistance selection. All-atom molecular dynamics simulations demonstrated that the ability of retinoids to penetrate and embed in lipid bilayers correlates with their bactericidal ability. An analogue of CD437 was found to retain anti-persister activity and show an improved cytotoxicity profile. Both CD437 and this analogue, alone or in combination with gentamicin, exhibit considerable efficacy in a mouse model of chronic MRSA infection. With further development and optimization, synthetic retinoids have the potential to become a new class of antimicrobials for the treatment of Gram-positive bacterial infections that are currently difficult to cure.

  16. A new class of synthetic retinoid antibiotics effective against bacterial persisters

    NASA Astrophysics Data System (ADS)

    Kim, Wooseong; Zhu, Wenpeng; Hendricks, Gabriel Lambert; van Tyne, Daria; Steele, Andrew D.; Keohane, Colleen E.; Fricke, Nico; Conery, Annie L.; Shen, Steven; Pan, Wen; Lee, Kiho; Rajamuthiah, Rajmohan; Fuchs, Beth Burgwyn; Vlahovska, Petia M.; Wuest, William M.; Gilmore, Michael S.; Gao, Huajian; Ausubel, Frederick M.; Mylonakis, Eleftherios

    2018-04-01

    A challenge in the treatment of Staphylococcus aureus infections is the high prevalence of methicillin-resistant S. aureus (MRSA) strains and the formation of non-growing, dormant ‘persister’ subpopulations that exhibit high levels of tolerance to antibiotics and have a role in chronic or recurrent infections. As conventional antibiotics are not effective in the treatment of infections caused by such bacteria, novel antibacterial therapeutics are urgently required. Here we used a Caenorhabditis elegans–MRSA infection screen to identify two synthetic retinoids, CD437 and CD1530, which kill both growing and persister MRSA cells by disrupting lipid bilayers. CD437 and CD1530 exhibit high killing rates, synergism with gentamicin, and a low probability of resistance selection. All-atom molecular dynamics simulations demonstrated that the ability of retinoids to penetrate and embed in lipid bilayers correlates with their bactericidal ability. An analogue of CD437 was found to retain anti-persister activity and show an improved cytotoxicity profile. Both CD437 and this analogue, alone or in combination with gentamicin, exhibit considerable efficacy in a mouse model of chronic MRSA infection. With further development and optimization, synthetic retinoids have the potential to become a new class of antimicrobials for the treatment of Gram-positive bacterial infections that are currently difficult to cure.

  17. Evolution and the origin of the visual retinoid cycle in vertebrates.

    PubMed

    Kusakabe, Takehiro G; Takimoto, Noriko; Jin, Minghao; Tsuda, Motoyuki

    2009-10-12

    Absorption of a photon by visual pigments induces isomerization of 11-cis-retinaldehyde (RAL) chromophore to all-trans-RAL. Since the opsins lacking 11-cis-RAL lose light sensitivity, sustained vision requires continuous regeneration of 11-cis-RAL via the process called 'visual cycle'. Protostomes and vertebrates use essentially different machinery of visual pigment regeneration, and the origin and early evolution of the vertebrate visual cycle is an unsolved mystery. Here we compare visual retinoid cycles between different photoreceptors of vertebrates, including rods, cones and non-visual photoreceptors, as well as between vertebrates and invertebrates. The visual cycle systems in ascidians, the closest living relatives of vertebrates, show an intermediate state between vertebrates and non-chordate invertebrates. The ascidian larva may use retinochrome-like opsin as the major isomerase. The entire process of the visual cycle can occur inside the photoreceptor cells with distinct subcellular compartmentalization, although the visual cycle components are also present in surrounding non-photoreceptor cells. The adult ascidian probably uses RPE65 isomerase, and trans-to-cis isomerization may occur in distinct cellular compartments, which is similar to the vertebrate situation. The complete transition to the sophisticated retinoid cycle of vertebrates may have required acquisition of new genes, such as interphotoreceptor retinoid-binding protein, and functional evolution of the visual cycle genes.

  18. Intracellular transport of fat-soluble vitamins A and E.

    PubMed

    Kono, Nozomu; Arai, Hiroyuki

    2015-01-01

    Vitamins are compounds that are essential for the normal growth, reproduction and functioning of the human body. Of the 13 known vitamins, vitamins A, D, E and K are lipophilic compounds and are therefore called fat-soluble vitamins. Because of their lipophilicity, fat-soluble vitamins are solubilized and transported by intracellular carrier proteins to exert their actions and to be metabolized properly. Vitamin A and its derivatives, collectively called retinoids, are solubilized by intracellular retinoid-binding proteins such as cellular retinol-binding protein (CRBP), cellular retinoic acid-binding protein (CRABP) and cellular retinal-binding protein (CRALBP). These proteins act as chaperones that regulate the metabolism, signaling and transport of retinoids. CRALBP-mediated intracellular retinoid transport is essential for vision in human. α-Tocopherol, the main form of vitamin E found in the body, is transported by α-tocopherol transfer protein (α-TTP) in hepatic cells. Defects of α-TTP cause vitamin E deficiency and neurological disorders in humans. Recently, it has been shown that the interaction of α-TTP with phosphoinositides plays a critical role in the intracellular transport of α-tocopherol and is associated with familial vitamin E deficiency. In this review, we summarize the mechanisms and biological significance of the intracellular transport of vitamins A and E. © 2014 The Authors. Traffic published by John Wiley & Sons Ltd.

  19. Retinoid and Histone Deacetylase Inhibitors in the Treatment of Prostate Cancer

    DTIC Science & Technology

    2004-12-01

    prostate cancer therapy (2). BODY Task 1. To determine the mechanism by which concomitant administration of retinoids and various histone deacetylase...cell proliferation assays to determine if we observed increased growth inhibition using combination therapy with ATRA plus a low dose of a variety of...cancer therapy trials (3-8). We also added the drug 5-aza-deoxycytidine to our growth inhibition studies because of much recent data that in combination

  20. 1 ALPHA-Hydroxyvitamin D5 as a Chemotherapeutic and Possibly Chemopreventive Agent

    DTIC Science & Technology

    2004-09-01

    with differential, platelets, PT, and PTT. 7.1.4 Serum chemistries : glucose, electrolytes (Na+, K+, Cl-, C0 2), BUN, creatinine, total protein... chemistries : glucose, electrolytes (Na+, K+, Cl-, and C02), BUN, creatinine, total protein, albumin, bilirubin, alkaline phosphatase, LDH, SGOT, SGPT, calcium...Roberts AB, Goodman DS (eds) The Retinoids: Biology, Chemistry , and Medicine. New York: Raven, 1994, pp. 573-596. 3. Hong WK, Itri LM. Retinoids and human

  1. Tretinoin for the treatment of photodamaged skin.

    PubMed

    Ting, William

    2010-07-01

    Interest in and interventions for photodamaged skin have dramatically increased over the last few years. Although a number of topical therapies have been used for the treatment of photodamaged skin, many therapies remain unproven in efficacy, unapproved, or only supported with limited clinical evidence. Topical retinoids, particularly tretinoin, are the most extensively studied. They have been shown to attenuate and reverse the signs of photodamage, such as coarse wrinkling. In addition, the clinical changes achieved with tretinoin are accompanied by histologic evidence of benefit. The main drawbacks to retinoid use are local irritation and erythema that can limit utility in some patients. New retinoids and formulations specifically optimized to improve cutaneous tolerability have been introduced. Two case reports of patients using low-concentration tretinoin gel 0.05% for the treatment of photodamaged skin are discussed. Over a relatively short treatment period of 4 weeks, tretinoin gel 0.05% was shown to provide both chemoprevention and reversal of photodamage.

  2. Retinoids and Retinal Diseases

    PubMed Central

    Kiser, Philip D.; Palczewski, Krzysztof

    2016-01-01

    Recent progress in molecular understanding of the retinoid cycle in mammalian retina stems from painstaking biochemical reconstitution studies supported by natural or engineered animal models with known genetic lesions and studies of humans with specific genetic blinding diseases. Structural and membrane biology have been used to detect critical retinal enzymes and proteins and their substrates and ligands, placing them in a cellular context. These studies have been supplemented by analytical chemistry methods that have identified small molecules by their spectral characteristics, often in conjunction with the evaluation of models of animal retinal disease. It is from this background that rational therapeutic interventions to correct genetic defects or environmental insults are identified. Thus, most presently accepted modulators of the retinoid cycle already have demonstrated promising results in animal models of retinal degeneration. These encouraging signs indicate that some human blinding diseases can be alleviated by pharmacological interventions. PMID:27917399

  3. Effect of Lipid Peroxidation Products on the Activity of Human Retinol Dehydrogenase 12 (RDH12) and Retinoid Metabolism

    PubMed Central

    Lee, Seung-Ah; Belyaeva, Olga V.; Kedishvili, Natalia Y.

    2008-01-01

    SUMMARY Mutations in human Retinol Dehydrogenase 12 (RDH12) are known to cause photoreceptor cell death but the physiological function of RDH12 in photoreceptors remains poorly understood. In vitro, RDH12 recognizes both retinoids and medium-chain aldehydes as substrates. Our previous study suggested that RDH12 protects cells against toxic levels of retinaldehyde and retinoic acid [Lee et al., J. Biol. Chem. 282 (2007) 35621–35628]. Here, we investigated whether RDH12 can also protect cells against highly reactive medium-chain aldehydes. Analysis of cell survival demonstrated that RDH12 was protective against nonanal but not against 4-hydroxynonenal. At high concentrations, nonanal inhibited the activity of RDH12 towards retinaldehyde, suggesting that nonanal was metabolized by RDH12. 4-Hydroxynonenal did not inhibit the RDH12 retinaldehyde reductase activity, but it strongly inhibited the activities of lecithin:retinol acyl transferase and aldehyde dehydrogenase, resulting in decreased levels of retinyl esters and retinoic acid and accumulation of unesterified retinol. Thus, the results of this study showed that RDH12 is more effective in protection against retinaldehyde than against medium-chain aldehydes, and that medium-chain aldehydes, especially 4-hydroxynonenal, severely disrupt cellular retinoid homeostasis. Together, these findings provide a new insight into the effects of lipid peroxidation products and the impact of oxidative stress on retinoid metabolism. PMID:18396173

  4. The action of a dietary retinoid on gene expression and cancer induction in electron-irradiated rat skin

    NASA Technical Reports Server (NTRS)

    Burns, Fredric J.; Chen, Shuaili; Xu, Guijuan; Wu, Feng; Tang, Moon-Shong

    2002-01-01

    Current models of radiation carcinogenesis generally assume that the DNA is damaged in a variety of ways by the radiation and that subsequent cell divisions contribute to the conversion of the damage to heritable mutations. Cancer may seem complex and intractable, but its complexity provides multiple opportunities for preventive interventions. Mitotic inhibitors are among the strongest cancer preventive agents, not only slowing the growth rate of preneoplasias but also increasing the fidelity of DNA repair processes. Ionizing radiation, including electrons, is a strong inducer of cancer in rat skin, and dietary retinoids have shown potent cancer preventive activity in the same system. A non-toxic dietary dose of retinyl acetate altered gene expression levels 24 hours after electron irradiation of rat skin. Of the 8740 genes on an Affymetrix rat expression array, the radiation significantly (5 fold or higher) altered 188, while the retinoid altered 231, including 16 radiation-altered genes that were reversely altered. While radiation strongly affected the expression of stress response, immune/inflammation and nucleic acid metabolism genes, the retinoid most strongly affected proliferation-related genes, including some significant reversals, such as, keratin 14, retinol binding protein, and calcium binding proteins. These results point to reversal of proliferation-relevant genes as a likely basis for the anti-radiogenic effects of dietary retinyl acetate.

  5. The cytostatic effect of 9-cis-retinoic acid, tretinoin, and isotretinoin on three different human bladder cancer cell lines in vitro.

    PubMed

    Laaksovirta, S; Rajala, P; Nurmi, M; Tammela, T L; Laato, M

    1999-01-01

    Retinoids have been shown to have activity in both preclinical and clinical bladder cancer studies but their exact role in its treatment and prevention remains obscure. In this study cytostatic activity of a novel 9-cis-retinoic acid (9-cis-RA) was compared with two other retinoids: tretinoin and isotretinoin, in three different bladder cancer cell lines: RT4 (well differentiated), 5637 (moderately differentiated) and T24 (poorly differentiated). The three retinoids were incubated at concentrations of 0.3, 3 and 30 microg/ml with bladder cancer cells in microtitre plates for 3 and 6 days. The cytostatic effect was estimated by using luminometric measuring of ATP activity of viable cells in suspension. Compared with the older retinoids, tretinoin and isotretinoin, the highest concentration of 9-cis-RA had a cytostatic efficacy in all three bladder cancer cell lines tested. A clear dose response relationship was observed in isotretinoin-treated cultures after 6 days and in all 9-cis-RA-treated cultures. Tretinoin was either ineffective or had a stimulating effect on poorly differentiated tumour cells. To conclude, isotretinoin and 9-cis-RA had a cytostatic effect on human bladder cancer cells in vitro. However, the possibility of stimulating cancer growth at small doses, at least with tretinoin, and toxicity at high doses must be considered when planning clinical trials.

  6. Cumulative irritation potential of topical retinoid formulations.

    PubMed

    Leyden, James J; Grossman, Rachel; Nighland, Marge

    2008-08-01

    Localized irritation can limit treatment success with topical retinoids such as tretinoin and adapalene. The factors that influence irritant reactions have been shown to include individual skin sensitivity, the particular retinoid and concentration used, and the vehicle formulation. To compare the cutaneous tolerability of tretinoin 0.04% microsphere gel (TMG) with that of adapalene 0.3% gel and a standard tretinoin 0.025% cream. The results of 2 randomized, investigator-blinded studies of 2 to 3 weeks' duration, which utilized a split-face method to compare cumulative irritation scores induced by topical retinoids in subjects with healthy skin, were combined. Study 1 compared TMG 0.04% with adapalene 0.3% gel over 2 weeks, while study 2 compared TMG 0.04% with tretinoin 0.025% cream over 3 weeks. In study 1, TMG 0.04% was associated with significantly lower cumulative scores for erythema, dryness, and burning/stinging than adapalene 0.3% gel. However, in study 2, there were no significant differences in cumulative irritation scores between TMG 0.04% and tretinoin 0.025% cream. Measurements of erythema by a chromameter showed no significant differences between the test formulations in either study. Cutaneous tolerance of TMG 0.04% on the face was superior to that of adapalene 0.3% gel and similar to that of a standard tretinoin cream containing a lower concentration of the drug (0.025%).

  7. Running increases neurogenesis without retinoic acid receptor activation in the adult mouse dentate gyrus.

    PubMed

    Aberg, Elin; Perlmann, Thomas; Olson, Lars; Brené, Stefan

    2008-01-01

    Both vitamin A deficiency and high doses of retinoids can result in learning and memory impairments, depression as well as decreases in cell proliferation, neurogenesis and cell survival. Physical activity enhances hippocampal neurogenesis and can also exert an antidepressant effect. Here we elucidate a putative link between running, retinoid signaling, and neurogenesis in hippocampus. Adult transgenic reporter mice designed to detect ligand-activated retinoic acid receptors (RAR) or retinoid X receptors (RXR) were used to localize the distribution of activated RAR or RXR at the single-cell level in the brain. Two months of voluntary wheel-running induced an increase in hippocampal neurogenesis as indicated by an almost two-fold increase in doublecortin-immunoreactive cells. Running activity was correlated with neurogenesis. Under basal conditions a distinct pattern of RAR-activated cells was detected in the granule cell layer of the dentate gyrus (DG), thalamus, and cerebral cortex layers 3-4 and to a lesser extent in hippocampal pyramidal cell layers CA1-CA3. Running did not change the number of RAR-activated cells in the DG. There was no correlation between running and RAR activation or between RAR activation and neurogenesis in the DG of hippocampus. Only a few scattered activated retinoid X receptors were found in the DG under basal conditions and after wheel-running, but RXR was detected in other areas such as in the hilus region of hippocampus and in layer VI of cortex cerebri. RAR agonists affect mood in humans and reduce neurogenesis, learning and memory in animal models. In our study, long-term running increased neurogenesis but did not alter RAR ligand activation in the DG in individually housed mice. Thus, our data suggest that the effects of exercise on neurogenesis and other plasticity changes in the hippocampal formation are mediated by mechanisms that do not involve retinoid receptor activation. (c) 2008 Wiley-Liss, Inc.

  8. Liver X Receptors Balance Lipid Stores in Hepatic Stellate Cells via Rab18, a Retinoid Responsive Lipid Droplet Protein

    PubMed Central

    O’Mahony, Fiona; Wroblewski, Kevin; O’Byrne, Sheila M.; Jiang, Hongfeng; Clerkin, Kara; Benhammou, Jihane; Blaner, William S.; Beaven, Simon W.

    2014-01-01

    Liver X receptors (LXRs) are determinants of hepatic stellate cell (HSC) activation and liver fibrosis. Freshly isolated HSCs from Lxrαβ−/− mice have increased lipid droplet (LD) size but the functional consequences of this are unknown. Our aim was to determine whether LXRs link cholesterol to retinoid storage in HSCs and how this impacts activation. Primary HSCs from Lxrαβ−/− and wild-type (WT) mice were profiled by gene array during in vitro activation. Lipid content was quantified by HPLC and mass spectroscopy. Primary HSCs were treated with nuclear receptor ligands, transfected with siRNA and plasmid constructs, and analyzed by immunocytochemistry. Lxrαβ−/− HSCs have increased cholesterol and retinyl esters (CEs & REs). The retinoid increase drives intrinsic retinoic acid receptor (RAR) signaling and activation occurs more rapidly in Lxrαβ−/− HSCs. We identify Rab18 as a novel retinoic acid responsive, lipid droplet associated protein that helps mediate stellate cell activation. Rab18 mRNA, protein, and membrane insertion increase during activation. Both Rab18 GTPase activity and isoprenylation are required for stellate cell lipid droplet loss and induction of activation markers. These phenomena are accelerated in the Lxrαβ−/− HSCs, where there is greater retinoic acid flux. Conversely, Rab18 knockdown retards lipid droplet loss in culture and blocks activation, just like the functional mutants. Rab18 is also induced with acute liver injury in vivo. Conclusion Retinoid and cholesterol metabolism are linked in stellate cells by the LD associated protein, Rab18. Retinoid overload helps explain the pro-fibrotic phenotype of Lxrαβ−/− mice and we establish a pivotal role for Rab18 GTPase activity and membrane insertion in wild-type stellate cell activation. Interference with Rab18 may have significant therapeutic benefit in ameliorating liver fibrosis. PMID:25482505

  9. Liver X receptors balance lipid stores in hepatic stellate cells through Rab18, a retinoid responsive lipid droplet protein.

    PubMed

    O'Mahony, Fiona; Wroblewski, Kevin; O'Byrne, Sheila M; Jiang, Hongfeng; Clerkin, Kara; Benhammou, Jihane; Blaner, William S; Beaven, Simon W

    2015-08-01

    Liver X receptors (LXRs) are determinants of hepatic stellate cell (HSC) activation and liver fibrosis. Freshly isolated HSCs from Lxrαβ(-/-) mice have increased lipid droplet (LD) size, but the functional consequences of this are unknown. Our aim was to determine whether LXRs link cholesterol to retinoid storage in HSCs and how this impacts activation. Primary HSCs from Lxrαβ(-/-) and wild-type mice were profiled by gene array during in vitro activation. Lipid content was quantified by high-performance liquid chromatography and mass spectroscopy. Primary HSCs were treated with nuclear receptor ligands, transfected with small interfering RNA and plasmid constructs, and analyzed by immunocytochemistry. Lxrαβ(-/-) HSCs have increased cholesterol and retinyl esters. The retinoid increase drives intrinsic retinoic acid receptor signaling, and activation occurs more rapidly in Lxrαβ(-/-) HSCs. We identify Rab18 as a novel retinoic acid-responsive, LD-associated protein that helps mediate stellate cell activation. Rab18 mRNA, protein, and membrane insertion increase during activation. Both Rab18 guanosine triphosphatase activity and isoprenylation are required for stellate cell LD loss and induction of activation markers. These phenomena are accelerated in Lxrαβ(-/-) HSCs, where there is greater retinoic acid flux. Conversely, Rab18 knockdown retards LD loss in culture and blocks activation, just like the functional mutants. Rab18 is also induced with acute liver injury in vivo. Retinoid and cholesterol metabolism are linked in stellate cells by the LD-associated protein Rab18. Retinoid overload helps explain the profibrotic phenotype of Lxrαβ(-/-) mice, and we establish a pivotal role for Rab18 GTPase activity and membrane insertion in wild-type stellate cell activation. Interference with Rab18 may have significant therapeutic benefit in ameliorating liver fibrosis. © 2015 by the American Association for the Study of Liver Diseases.

  10. All-trans-retinoic acid and 13-cis-retinoic acid: pharmacokinetics and biological activity in different cell culture models of human keratinocytes.

    PubMed

    Schroeder, M; Zouboulis, C C

    2007-02-01

    Despite its known biological effect on epithelial cells, 13- CIS-retinoic acid shows low binding affinity to either cellular retinoic acid-binding proteins or nuclear retinoid receptors compared to its isomer all- TRANS-retinoic acid. We have postulated a prodrug-drug relation with 13- CIS-retinoic acid which isomerizes to all- TRANS-retinoic acid. On the other hand, the biological effects of these two compounds can differ in the widely used cell culture models of HaCaT and normal primary keratinocytes. In this study, we seeded HaCaT and normal keratinocytes at high densities leading to early confluence in order to imitate high keratinocyte proliferation, such as in acne and psoriasis, while to model decreased keratinocyte proliferation, as in aged and steroid-damaged skin, cells were seeded at a low density. High performance liquid chromatography was administered to examine retinoid uptake and metabolism in monolayer HaCaT and normal keratinocyte cultures and the 4-methylumbelliferyl heptanoate assay to estimate cell growth at different cell densities. Major qualitative and quantitative differences were detected in the two cell types regarding intracellular 13- CIS-retinoic acid isomerization to all- TRANS-retinoic acid. On the other hand, the two retinoic acid isomers showed similar effects on cell growth of both cell types tested with increasing proliferation at low cell densities, but being rather inactive at high ones in normal keratinocytes and exhibiting an antiproliferative effect in HaCaT keratinocytes. The missing effect of retinoids on cell proliferation in high seeding densities of normal keratinocytes may indicate that the normalizing activity of retinoids on hyperkeratotic diseases, such as acne or psoriasis, is likely to be carried out by modulation of cell differentiation than cell growth. On the other hand, induced keratinocyte proliferation in low seeding densities may provide an explanation for the acanthosis induced by topical retinoids in aged and steroid-damaged skin.

  11. LE135, a retinoid acid receptor antagonist, produces pain through direct activation of TRP channels

    PubMed Central

    Yin, Shijin; Luo, Jialie; Qian, Aihua; Yu, Weihua; Hu, Hongzhen

    2014-01-01

    Background and PurposeRetinoids, through their activation of retinoic acid receptors (RARs) and retinoid X receptors, regulate diverse cellular processes, and pharmacological intervention in their actions has been successful in the treatment of skin disorders and cancers. Despite the many beneficial effects, administration of retinoids causes irritating side effects with unknown mechanisms. Here, we demonstrate that LE135 [4-(7,8,9,10-tetrahydro-5,7,7,10,10-pentamethyl-5H-benzo[e]naphtho[2,3-b][1,4]diazepin-13-yl)benzoic acid], a selective antagonist of RARβ, is a potent activator of the capsaicin (TRPV1) and wasabi (TRPA1) receptors, two critical pain-initiating cation channels. Experimental ApproachWe performed to investigate the excitatory effects of LE135 on TRPV1 and TRPA1 channels expressed in HEK293T cells and in dorsal root ganglia neurons with calcium imaging and patch-clamp recordings. We also used site-directed mutagenesis of the channels to determine the structural basis of LE135-induced activation of TRPV1 and TRPA1 channels and behavioural testing to examine if pharmacological inhibition and genetic deletion of the channels affected LE135-evoked pain-related behaviours. Key ResultsLE135 activated both the capsaicin receptor (TRPV1) and the allyl isothiocyanate receptor (TRPA1) heterologously expressed in HEK293T cells and endogenously expressed by sensory nociceptors. Mutations disrupting the capsaicin-binding site attenuated LE135 activation of TRPV1 channels and a single mutation (K170R) eliminated TRPA1 activity evoked by LE135. Intraplantar injection of LE135 evoked pain-related behaviours. Both TRPV1 and TRPA1 channels were involved in LE135-elicited pain-related responses, as shown by pharmacological and genetic ablation studies. Conclusions and ImplicationsThis blocker of retinoid acid signalling also exerted non-genomic effects through activating the pain-initiating TRPV1 and TRPA1 channels. PMID:24308840

  12. LE135, a retinoid acid receptor antagonist, produces pain through direct activation of TRP channels.

    PubMed

    Yin, Shijin; Luo, Jialie; Qian, Aihua; Yu, Weihua; Hu, Hongzhen

    2014-03-01

    Retinoids, through their activation of retinoic acid receptors (RARs) and retinoid X receptors, regulate diverse cellular processes, and pharmacological intervention in their actions has been successful in the treatment of skin disorders and cancers. Despite the many beneficial effects, administration of retinoids causes irritating side effects with unknown mechanisms. Here, we demonstrate that LE135 [4-(7,8,9,10-tetrahydro-5,7,7,10,10-pentamethyl-5H-benzo[e]naphtho[2,3-b][1,4]diazepin-13-yl)benzoic acid], a selective antagonist of RARβ , is a potent activator of the capsaicin (TRPV1) and wasabi (TRPA1) receptors, two critical pain-initiating cation channels. We performed to investigate the excitatory effects of LE135 on TRPV1 and TRPA1 channels expressed in HEK293T cells and in dorsal root ganglia neurons with calcium imaging and patch-clamp recordings. We also used site-directed mutagenesis of the channels to determine the structural basis of LE135-induced activation of TRPV1 and TRPA1 channels and behavioural testing to examine if pharmacological inhibition and genetic deletion of the channels affected LE135-evoked pain-related behaviours. LE135 activated both the capsaicin receptor (TRPV1) and the allyl isothiocyanate receptor (TRPA1) heterologously expressed in HEK293T cells and endogenously expressed by sensory nociceptors. Mutations disrupting the capsaicin-binding site attenuated LE135 activation of TRPV1 channels and a single mutation (K170R) eliminated TRPA1 activity evoked by LE135. Intraplantar injection of LE135 evoked pain-related behaviours. Both TRPV1 and TRPA1 channels were involved in LE135-elicited pain-related responses, as shown by pharmacological and genetic ablation studies. This blocker of retinoid acid signalling also exerted non-genomic effects through activating the pain-initiating TRPV1 and TRPA1 channels. © 2013 The British Pharmacological Society.

  13. Retinoids, retinoid analogs, and lactoferrin interact and differentially affect cell viability of 2 bovine mammary cell types in vitro.

    PubMed

    Wang, Y; Baumrucker, C R

    2010-07-01

    Two bovine mammary cell types (BME-UV1 and MeBo cells) were used to evaluate the effect of natural retinoids, retinoid analogs, and bovine lactoferrin (bLf) on cell viability in vitro. Experiments with Alamar Blue showed a linear relationship between fluorescence and cell viability index. The BME-UV1 cells exhibited twice the metabolic activity but required half the doubling time of the MeBo cells. The BME-UV1 cells were very sensitive to all-trans retinoic acid (atRA) inhibition of cell viability (P<0.05) and exhibited a dose-dependent inhibition with 9-cisRA (9cRA; P<0.05). The MeBo cells exhibited some inhibition with these natural ligands (P<0.05), but they were not as sensitive. The addition of bLf had similar inhibitory effects (P<0.05) on cell viability of the 2 mammary cell types. Applications of RA receptor (RAR) agonist indicated that the stimulation of the RAR in both mammary cell types was highly effective in inhibition of cell viability (P<0.05), whereas the application of an RAR antagonist stimulated MeBo cell viability (P<0.05) and inhibited BME-UV1 cell viability (P<0.05). Finally, the use of the RAR antagonist in conjunction with bLf indicated a rescue of the bLf effect in the MeBo cells, suggesting that bLf is acting through the RAR receptor. Conversely, bLf reverted inhibition of cell viability by 9cRA in the BME-UV1 cell type (P<0.05). We conclude that RAR interaction in bovine mammary cell types regulates cell viability in vitro; we hypothesize that the natural ligands mediate regulation of bovine mammary cell viability in vivo and that bLf can either enhance or reverse the retinoid-induced inhibition of cell viability, depending on the type of bovine mammary cell studied.

  14. Low aqueous solubility of 11-cis-retinal limits the rate of pigment formation and dark adaptation in salamander rods.

    PubMed

    Frederiksen, Rikard; Boyer, Nicholas P; Nickle, Benjamin; Chakrabarti, Kalyan S; Koutalos, Yiannis; Crouch, Rosalie K; Oprian, Daniel; Cornwall, M Carter

    2012-06-01

    We report experiments designed to test the hypothesis that the aqueous solubility of 11-cis-retinoids plays a significant role in the rate of visual pigment regeneration. Therefore, we have compared the aqueous solubility and the partition coefficients in photoreceptor membranes of native 11-cis-retinal and an analogue retinoid, 11-cis 4-OH retinal, which has a significantly higher solubility in aqueous medium. We have then correlated these parameters with the rates of pigment regeneration and sensitivity recovery that are observed when bleached intact salamander rod photoreceptors are treated with physiological solutions containing these retinoids. We report the following results: (a) 11-cis 4-OH retinal is more soluble in aqueous buffer than 11-cis-retinal. (b) Both 11-cis-retinal and 11-cis 4-OH retinal have extremely high partition coefficients in photoreceptor membranes, though the partition coefficient of 11-cis-retinal is roughly 50-fold greater than that of 11-cis 4-OH retinal. (c) Intact bleached isolated rods treated with solutions containing equimolar amounts of 11-cis-retinal or 11-cis 4-OH retinal form functional visual pigments that promote full recovery of dark current, sensitivity, and response kinetics. However, rods treated with 11-cis 4-OH retinal regenerated on average fivefold faster than rods treated with 11-cis-retinal. (d) Pigment regeneration from recombinant and wild-type opsin in solution is slower when treated with 11-cis 4-OH retinal than with 11-cis-retinal. Based on these observations, we propose a model in which aqueous solubility of cis-retinoids within the photoreceptor cytosol can place a limit on the rate of visual pigment regeneration in vertebrate photoreceptors. We conclude that the cytosolic gap between the plasma membrane and the disk membranes presents a bottleneck for retinoid flux that results in slowed pigment regeneration and dark adaptation in rod photoreceptors.

  15. Severe hepatotoxic reaction with progression to cirrhosis after use of a novel retinoid (acitretin).

    PubMed

    van Ditzhuijsen, T J; van Haelst, U J; van Dooren-Greebe, R J; van de Kerkhof, P C; Yap, S H

    1990-09-01

    We report the case of a 50-year-old female who suffered from severe palmar and plantar pustulosis. During treatment with acitretin, a novel oral retinoid, which is the main derivative of etretinate, the patient developed a severe hepatotoxic reaction. Subsequent histological studies strongly suggested the development of liver cirrhosis. Reversible elevation of serum aminotransferase values during treatment with acitretin has been reported. However, the present observation indicates that severe hepatotoxic injury may also follow treatment with this agent.

  16. Maternal-fetal transfer and metabolism of vitamin A and its precursor β-carotene in the developing tissues.

    PubMed

    Spiegler, Elizabeth; Kim, Youn-Kyung; Wassef, Lesley; Shete, Varsha; Quadro, Loredana

    2012-01-01

    The requirement of the developing mammalian embryo for retinoic acid is well established. Retinoic acid, the active form of vitamin A, can be generated from retinol and retinyl ester obtained from food of animal origin, and from carotenoids, mainly β-carotene, from vegetables and fruits. The mammalian embryo relies on retinol, retinyl ester and β-carotene circulating in the maternal bloodstream for its supply of vitamin A. The maternal-fetal transfer of retinoids and carotenoids, as well as the metabolism of these compounds in the developing tissues are still poorly understood. The existing knowledge in this field has been summarized in this review in reference to our basic understanding of the transport and metabolism of retinoids and carotenoids in adult tissues. The need for future research on the metabolism of these essential lipophilic nutrients during development is highlighted. This article is part of a Special Issue entitled: Retinoid and Lipid Metabolism. © 2011 Elsevier B.V. All rights reserved.

  17. High level transactivation by a modified Bombyx ecdysone receptor in mammalian cells without exogenous retinoid X receptor

    PubMed Central

    Suhr, Steven T.; Gil, Elad B.; Senut, Marie-Claude; Gage, Fred H.

    1998-01-01

    Our studies of the Bombyx mori ecdysone receptor (BE) revealed that, unlike the Drosophila melanogaster ecdysone receptor (DE), treatment of BE with the ecdysone agonist tebufenozide stimulated high level transactivation in mammalian cells without adding an exogenous heterodimer partner. Gel mobility shift and transfection assays with both the ultraspiracle gene product (Usp) and retinoid X receptor heterodimer partners indicated that this property of BE stems from significantly augmented heterodimer complex formation and concomitant DNA binding. We have mapped this “gain of function” to determinants within the D and E domains of BE and demonstrated that, although the D domain determinant is sufficient for high affinity heterodimerization with Usp, both determinants are necessary for high affinity interaction with retinoid X receptor. Modified BE receptors alone used as replication-defective retroviruses potently stimulated separate “reporter” viruses in all cell types examined, suggesting that BE has potentially broad utility in the modulation of transgene expression in mammalian cells. PMID:9653129

  18. A novel RPE65 inhibitor CU239 suppresses visual cycle and prevents retinal degeneration.

    PubMed

    Shin, Younghwa; Moiseyev, Gennadiy; Petrukhin, Konstantin; Cioffi, Christopher L; Muthuraman, Parthasarathy; Takahashi, Yusuke; Ma, Jian-Xing

    2018-07-01

    The retinoid visual cycle is an ocular retinoid metabolism specifically dedicated to support vertebrate vision. The visual cycle serves not only to generate light-sensitive visual chromophore 11-cis-retinal, but also to clear toxic byproducts of normal visual cycle (i.e. all-trans-retinal and its condensation products) from the retina, ensuring both the visual function and the retinal health. Unfortunately, various conditions including genetic predisposition, environment and aging may attribute to a functional decline of the all-trans-retinal clearance. To combat all-trans-retinal mediated retinal degeneration, we sought to slow down the retinoid influx from the RPE by inhibiting the visual cycle with a small molecule. The present study describes identification of CU239, a novel non-retinoid inhibitor of RPE65, a key enzyme in the visual cycle. Our data demonstrated that CU239 selectively inhibited isomerase activity of RPE65, with IC 50 of 6 μM. Further, our results indicated that CU239 inhibited RPE65 via competition with its substrate all-trans-retinyl ester. Mice with systemic injection of CU239 exhibited delayed chromophore regeneration after light bleach, and conferred a partial protection of the retina against injury from high intensity light. Taken together, CU239 is a potent visual cycle modulator and may have a therapeutic potential for retinal degeneration. Copyright © 2018 The Author(s). Published by Elsevier B.V. All rights reserved.

  19. Metabolism of oral 9-cis-retinoic acid in the human. Identification of 9-cis-retinoyl-beta-glucuronide and 9-cis-4-oxo-retinoyl-beta-glucuronide as urinary metabolites.

    PubMed

    Sass, J O; Masgrau, E; Saurat, J H; Nau, H

    1995-09-01

    Data from a number of investigators suggest that the 9-cis-isomer of RA1 (9-cis-RA) may be a promising agent in chemoprevention and treatment of certain types of cancer. Therefore, clinical studies on this retinoid have been initiated. However, up to now, no information has been published on the metabolism of 9-cis-RA in the human. Herein, we report the first data on retinoid metabolism after multiple administration of 9-cis-RA (20 mg/day po) to human volunteers. After 2 and 12-13 hr, plasma concentrations of 9-cis-RA and its metabolites 9,13-dicis-RA, 13-cis-RA, and all-trans-RA were low. In contrast, dosing with 13-cis-RA yielded much higher plasma retinoid levels. Effects on plasma retinol concentrations did not become obvious after any drug treatment. Several retinoid metabolites were found in the urine of 9-cis-RA-treated individuals, and 9-cis-RAG, as well as 9-cis-4-oxo-RAG, could be identified. After treatment with 9-cis-RA, high concentrations of the administered drug were found in the feces, along with comparably low concentrations of 13-cis-RA, 9,13-dicis-RA, and all-trans-RA. Our report indicates that 9-cis-RA is either eliminated much more rapidly than 13-cis-RA, or it is poorly absorbed, and presents the characterization of two urinary glucuronides.

  20. Antagonism of hypervitaminosis A-induced anterior neural tube closure defects with a methyl-donor deficiency in murine whole-embryo culture.

    PubMed

    Santos-Guzmán, Jesús; Arnhold, Thomas; Nau, Heinz; Wagner, Conrad; Fahr, Sharon H; Mao, Gloria E; Caudill, Marie A; Wang, Jennie C; Henning, Susanne M; Swendseid, Marian E; Collins, Michael D

    2003-11-01

    The interaction of a dietary excess of vitamin A (retinoid) and deficiency of methyl-donor compounds was examined in murine early-organogenesis embryonic development. Female mice were fed one of six diets from the time of vaginal plug detection until gestational d 8.0, when embryos were removed and grown in whole embryo culture for 46 h, using serum from rats fed the same diet for 36 d as the culture medium. The six diets were either methyl-donor deficient (designated -FCM: devoid of folic acid, choline and supplemental L-methionine, but having methionine as a component of the protein portion of the diet) or methyl-donor sufficient (designated +FCM: containing folic acid, choline and L-methionine supplementation), in combination with one of three concentrations of retinyl palmitate (0.016, 0.416 or 4.016 g/kg diet). The high dose of retinyl palmitate induced a failure of anterior neuropore closure and hypoplasia of the visceral arches, both of which were significantly ameliorated by simultaneous administration of the methyl-donor-deficient diet. The primary acidic retinoid detected in the rat serum was 9,13-di-cis-retinoic acid, although we hypothesize that teratogenic retinoids were formed by embryonic biotransformation of the retinyl esters to toxic metabolites. Biochemical measurements of metabolites in relevant pathways were performed. We propose that the amelioration of these malformations may be used to determine biochemical pathways critical for retinoid teratogenesis.

  1. Malaria, Epstein-Barr virus infection and the pathogenesis of Burkitt's lymphoma.

    PubMed

    Mawson, Anthony R; Majumdar, Suvankar

    2017-11-01

    A geographical and causal connection has long been recognized between malaria, Epstein-Barr virus (EBV) infection and Burkitt's lymphoma (BL), but the underlying mechanisms remain obscure. Potential clues are that the malaria parasite Plasmodium falciparum selectively absorbs vitamin A from the host and depends on it for its biological activities; secondly, alterations in vitamin A (retinoid) metabolism have been implicated in many forms of cancer, including BL. The first author has proposed that the merozoite-stage malaria parasite, emerging from the liver, uses its absorbed vitamin A as a cell membrane destabilizer to invade the red blood cells, causing anemia and other signs and symptoms of the disease as manifestations of an endogenous form of hypervitaminosis A (Mawson AR, Path Global Health 2013;107(3):122-9). Repeated episodes of malaria would therefore be expected to expose the tissues of affected individuals to potentially toxic doses of vitamin A. It is proposed that such episodes activate latent EBV infection, which in turn activates retinoid-responsive genes. Expression of these genes enhances viral replication and induces germinal center (GC) B cell expansion, activation-induced cytidine deaminase (AID) expression, and c-myc translocation, which in turn predisposes to BL. Thus, an endogenous form of retinoid toxicity related to malaria infection may be the common factor linking frequent malaria, EBV infection and BL, whereby prolonged exposure of lymphatic tissues to high concentrations of retinoids may combine to induce B-cell translocation and increase the risk of Burkitt's lymphoma. © 2017 UICC.

  2. Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis (SJS/TEN): Could Retinoids Play a Causative Role?

    PubMed Central

    Mawson, Anthony R.; Eriator, Ike; Karre, Sridhar

    2015-01-01

    Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS/TEN) are overlapping manifestations on a spectrum of acute drug-induced conditions associated with severe blistering, skin peeling, and multi-organ damage. TEN is an eruption resembling severe scalding, with ≥30% skin detachment. SJS is a mild form of TEN, characterized histologically by epidermal keratinocyte apoptosis with dermo-epidermal separation and extensive small blisters with <10% body surface skin detachment. The syndrome can be induced by numerous medications and typically occurs 1–4 weeks after the initiation of therapy. Granulysin is found in the lesions of patients with SJS/TEN and plays a significant pathogenic role in the condition, but the overall mechanisms linking medications, granulysin, and disease manifestations remain obscure. This paper reviews evidence suggesting that the different medications implicated in SJS/TEN have the common property of interacting and synergizing with endogenous retinoids (vitamin A and its congeners), in many instances causing the latter to accumulate in and damage the liver, the main storage organ for vitamin A. It is hypothesized that liver damage leads to the spillage of toxic retinoid compounds into the circulation, resulting in an endogenous form of hypervitaminosis A and cytotoxicity with widespread apoptosis, mediated by granulysin and recognized as SJS/TEN. Subject to testing, the model suggests that symptom worsening could be arrested at onset by lowering the concentration of circulating retinoids and/or granulysin via phlebotomy or plasmapheresis or by pharmacological measures to limit their expression. PMID:25579087

  3. Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS/TEN): could retinoids play a causative role?

    PubMed

    Mawson, Anthony R; Eriator, Ike; Karre, Sridhar

    2015-01-12

    Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS/TEN) are overlapping manifestations on a spectrum of acute drug-induced conditions associated with severe blistering, skin peeling, and multi-organ damage. TEN is an eruption resembling severe scalding, with ≥30% skin detachment. SJS is a mild form of TEN, characterized histologically by epidermal keratinocyte apoptosis with dermo-epidermal separation and extensive small blisters with <10% body surface skin detachment. The syndrome can be induced by numerous medications and typically occurs 1-4 weeks after the initiation of therapy. Granulysin is found in the lesions of patients with SJS/TEN and plays a significant pathogenic role in the condition, but the overall mechanisms linking medications, granulysin, and disease manifestations remain obscure. This paper reviews evidence suggesting that the different medications implicated in SJS/TEN have the common property of interacting and synergizing with endogenous retinoids (vitamin A and its congeners), in many instances causing the latter to accumulate in and damage the liver, the main storage organ for vitamin A. It is hypothesized that liver damage leads to the spillage of toxic retinoid compounds into the circulation, resulting in an endogenous form of hypervitaminosis A and cytotoxicity with widespread apoptosis, mediated by granulysin and recognized as SJS/TEN. Subject to testing, the model suggests that symptom worsening could be arrested at onset by lowering the concentration of circulating retinoids and/or granulysin via phlebotomy or plasmapheresis or by pharmacological measures to limit their expression.

  4. Involvement of all-trans-retinal in acute light-induced retinopathy of mice.

    PubMed

    Maeda, Akiko; Maeda, Tadao; Golczak, Marcin; Chou, Steven; Desai, Amar; Hoppel, Charles L; Matsuyama, Shigemi; Palczewski, Krzysztof

    2009-05-29

    Exposure to bright light can cause visual dysfunction and retinal photoreceptor damage in humans and experimental animals, but the mechanism(s) remain unclear. We investigated whether the retinoid cycle (i.e. the series of biochemical reactions required for vision through continuous generation of 11-cis-retinal and clearance of all-trans-retinal, respectively) might be involved. Previously, we reported that mice lacking two enzymes responsible for clearing all-trans-retinal, namely photoreceptor-specific ABCA4 (ATP-binding cassette transporter 4) and RDH8 (retinol dehydrogenase 8), manifested retinal abnormalities exacerbated by light and associated with accumulation of diretinoid-pyridinium-ethanolamine (A2E), a condensation product of all-trans-retinal and a surrogate marker for toxic retinoids. Now we show that these mice develop an acute, light-induced retinopathy. However, cross-breeding these animals with lecithin:retinol acyltransferase knock-out mice lacking retinoids within the eye produced progeny that did not exhibit such light-induced retinopathy until gavaged with the artificial chromophore, 9-cis-retinal. No significant ocular accumulation of A2E occurred under these conditions. These results indicate that this acute light-induced retinopathy requires the presence of free all-trans-retinal and not, as generally believed, A2E or other retinoid condensation products. Evidence is presented that the mechanism of toxicity may include plasma membrane permeability and mitochondrial poisoning that lead to caspase activation and mitochondria-associated cell death. These findings further understanding of the mechanisms involved in light-induced retinal degeneration.

  5. Cytotoxic effect induced by retinoic acid loaded into galactosyl-sphingosine containing liposomes on human hepatoma cell lines.

    PubMed

    Díaz, Cecilia; Vargas, Ernesto; Gätjens-Boniche, Omar

    2006-11-15

    Two retinoids, ATRA and 13cisRA, were incorporated into liposomes of different composition and charge and added to two hepatoma cell lines with different degree of transformation to measure cytotoxicity by MTT assay. Retinoid-free cationic liposomes were more toxic than the other kinds (anionic and made only of PC) but were also the best delivery system for retinoic acid to induce specific cytotoxic effects on these tumor hepatoma cell lines. Galactosyl-sphingosine containing cationic liposomes increased the cytotoxic effect induced by ATRA on Hep3B cells when compared to glucosyl-sphingosine cationic liposomes, but did not improve the effect induced by free retinoid or ATRA loaded into liposomes without glycolipids. This suggests that in this cell line, ATRA is being incorporated by a mechanism mediated by the asialoglycoprotein receptor, but at the same time, non-specific sugar-independent capture is also taking place as well as free diffusion of ATRA directly through the membrane. Galactose-specific effect was not observed in HepG2 cells treated with ATRA or both cell lines treated with 13cisRA. In fact, treatment of HepG2 cells with retinoids entrapped into liposomes likely induces proliferation instead of cytotoxicity, a result that interferes with the measurement of cell death by MTT. Compared to the specific effect of ATRA entrapped into cationic liposomes, vesicles made only by PC, did not mediate a specific mechanism, since differences between ATRA in galactosyl- and glucosyl-shpingosine PC-liposomes were not statistically significant. The specific mechanism was not present in the myoblastic cell line C2C12, where ATRA incorporated into galactosyl- and glucosyl-sphingosine containing cationic and PC-liposomes, was able to induce cytotoxicity at the same extent. Micelles containing ATRA and galactosyl-sphingosine had a significantly more toxic effect than the retinoid administered together with glucosyl-sphingosine, in Hep3B cells. Also, micelles containing ATRA were more toxic than glycolipid-containing liposomes with ATRA, for both kinds of sphingosines. The same effect was not observed in C2C12 cells, where glycolipid-containing liposomes worked better than micelles, and a sugar-specific mechanism was not seen. This suggests that, even though galactose-containing cationic liposomes could be a promising approach, a galactose-specific emulsion system could be the best strategy to specifically deliver retinoic acid to liver tumor cells, since it shows tissue specificity (perhaps induced by ASGPR-mediated internalization) and a stronger cytotoxic effect than the retinoid incorporated into liposomes.

  6. Schools of pharmacology: retinoid update.

    PubMed

    Scheinfeld, Noah

    2006-10-01

    The most widely used retinoids include topical tretinoin (Retin-A), adapalene (Differin), topical tazarotene (Tazorac), isotretinoin (Accutane), and acitretin (Soriatane). This article will review new uses and developments in tazarotene (its failure to secure FDA approval in oral form for psoriasis), adapalene (its new 0.3% gel form and use in rosacea), alitretinoin (its use in photoaging), bexarotene (its use for psoriasis and chronic hand dermatitis), isotretinoin (the IPledge program, its use for neuroblastoma and branded formulation pharmacological superiority to generics), and retinoic acid metabolism-blocking agents (RAMBAs) (liarazole use for ichthyosis and psoriasis).

  7. Biochemical Properties of Purified Human Retinol Dehydrogenase 12 (RDH12): Catalytic Efficiency toward Retinoids and C9 Aldehydes and Effects of Cellular Retinol-Binding Protein Type I (CRBPI) and Cellular Retinaldehyde-Binding Protein (CRALBP) on the Oxidation and Reduction of Retinoids†

    PubMed Central

    Belyaeva, Olga V.; Korkina, Olga V.; Stetsenko, Anton V.; Kim, Tom; Nelson, Peter S.; Kedishvili, Natalia Y.

    2008-01-01

    Retinol dehydrogenase 12 (RDH12) is a novel member of the short-chain dehydrogenase/reductase superfamily of proteins that was recently linked to Leber’s congenital amaurosis 3 (LCA). We report the first biochemical characterization of purified human RDH12 and analysis of its expression in human tissues. RDH12 exhibits ~2000-fold lower Km values for NADP+ and NADPH than for NAD+ and NADH and recognizes both retinoids and lipid peroxidation products (C9 aldehydes) as substrates. The kcat values of RDH12 for retinaldehydes and C9 aldehydes are similar, but the Km values are, in general, lower for retinoids. The enzyme exhibits the highest catalytic efficiency for all-trans-retinal (kcat/Km ~900 min−1 μM−1), followed by 11-cis-retinal (450 min−1 mM−1) and 9-cis-retinal (100 min−1 mM−1). Analysis of RDH12 activity toward retinoids in the presence of cellular retinol-binding protein (CRBP) type I or cellular retinaldehyde-binding protein (CRALBP) suggests that RDH12 utilizes the unbound forms of all-trans- and 11-cis-retinoids. As a result, the widely expressed CRBPI, which binds all-trans-retinol with much higher affinity than all-trans-retinaldehyde, restricts the oxidation of all-trans-retinol by RDH12, but has little effect on the reduction of all-trans-retinaldehyde, and CRALBP inhibits the reduction of 11-cis-retinal stronger than the oxidation of 11-cis-retinol, in accord with its higher affinity for 11-cis-retinal. Together, the tissue distribution of RDH12 and its catalytic properties suggest that, in most tissues, RDH12 primarily contributes to the reduction of all-trans-retinaldehyde; however, at saturating concentrations of peroxidic aldehydes in the cells undergoing oxidative stress, for example, photoreceptors, RDH12 might also play a role in detoxification of lipid peroxidation products. PMID:15865448

  8. Differential patterns of induction of NGFI-B, Nor1 and c-fos mRNAs in striatal subregions by haloperidol and clozapine.

    PubMed

    Werme, M; Ringholm, A; Olson, L; Brené, S

    2000-04-28

    Disturbances of retinoid activated transcription mechanisms have recently been implicated as risk factors for schizophrenia. In this study we have compared the regulation of mRNAs for the nuclear orphan receptor NGFI-B, which forms a functional heterodimer with the retinoid x receptor and the related orphan nuclear receptor Nor1 with c-fos mRNA after acute and chronic treatments with haloperidol and clozapine. The antipsychotic drugs haloperidol and clozapine have different clinical profiles. Haloperidol is a typical neuroleptic giving extrapyramidal side effects (EPS), whereas the atypical compound clozapine does not. Acute haloperidol treatment increased NGFI-B, Nor1 and c-fos mRNAs in nucleus accumbens shell and core as well as medial and lateral caudate putamen. In contrast, clozapine lead to an increase of NGFI-B, Nor1 and c-fos only in the accumbens shell. No haloperidol or clozapine effect on these mRNAs was detected in cingulate, sensory or motor cortex. Chronic haloperidol lead to an increase of NGFI-B mRNA in the accumbens core. Acutely, it is possible that the increased levels of NGFI-B, Nor1 and c-fos mRNA levels in striatum and accumbens might indicate a neural activation which possibly can be used when screening for drugs that do not produce EPS. Also, the increased levels of NGFI-B, which is an important component in retinoid signaling, both after acute and chronic treatments of haloperidol suggests altered sensitivity to retinoids which could be an important component for the beneficial antipsychotic effect.

  9. Cross-linked matrix rigidity and soluble retinoids synergize in nuclear lamina regulation of stem cell differentiation.

    PubMed

    Ivanovska, Irena L; Swift, Joe; Spinler, Kyle; Dingal, Dave; Cho, Sangkyun; Discher, Dennis E

    2017-07-07

    Synergistic cues from extracellular matrix and soluble factors are often obscure in differentiation. Here the rigidity of cross-linked collagen synergizes with retinoids in the osteogenesis of human marrow mesenchymal stem cells (MSCs). Collagen nanofilms serve as a model matrix that MSCs can easily deform unless the film is enzymatically cross-linked, which promotes the spreading of cells and the stiffening of nuclei as both actomyosin assembly and nucleoskeletal lamin-A increase. Expression of lamin-A is known to be controlled by retinoic acid receptor (RAR) transcription factors, but soft matrix prevents any response to any retinoids. Rigid matrix is needed to induce rapid nuclear accumulation of the RARG isoform and for RARG-specific antagonist to increase or maintain expression of lamin-A as well as for RARG-agonist to repress expression. A progerin allele of lamin-A is regulated in the same manner in iPSC-derived MSCs. Rigid matrices are further required for eventual expression of osteogenic markers, and RARG-antagonist strongly drives lamin-A-dependent osteogenesis on rigid substrates, with pretreated xenografts calcifying in vivo to a similar extent as native bone. Proteomics-detected targets of mechanosensitive lamin-A and retinoids underscore the convergent synergy of insoluble and soluble cues in differentiation. © 2017 Ivanovska et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  10. A Microparticle/Hydrogel Combination Drug-Delivery System for Sustained Release of Retinoids

    PubMed Central

    Gao, Song-Qi; Maeda, Tadao; Okano, Kiichiro; Palczewski, Krzysztof

    2012-01-01

    Purpose. To design and develop a drug-delivery system containing a combination of poly(d,l-lactide-co-glycolide) (PLGA) microparticles and alginate hydrogel for sustained release of retinoids to treat retinal blinding diseases that result from an inadequate supply of retinol and generation of 11-cis-retinal. Methods. To study drug release in vivo, either the drug-loaded microparticle–hydrogel combination was injected subcutaneously or drug-loaded microparticles were injected intravitreally into Lrat−/− mice. Orally administered 9-cis-retinoids were used for comparison and drug concentrations in plasma were determined by HPLC. Electroretinography (ERG) and both chemical and histologic analyses were used to evaluate drug effects on visual function and morphology. Results. Lrat−/− mice demonstrated sustained drug release from the microparticle/hydrogel combination that lasted 4 weeks after subcutaneous injection. Drug concentrations in plasma of the control group treated with the same oral dose rose to higher levels for 6−7 hours but then dropped markedly by 24 hours. Significantly increased ERG responses and a markedly improved retinal pigmented epithelium (RPE)–rod outer segment (ROS) interface were observed after subcutaneous injection of the drug-loaded delivery combination. Intravitreal injection of just 2% of the systemic dose of drug-loaded microparticles provided comparable therapeutic efficacy. Conclusions. Sustained release of therapeutic levels of 9-cis-retinoids was achieved in Lrat−/− mice by subcutaneous injection in a microparticle/hydrogel drug-delivery system. Both subcutaneous and intravitreal injections of drug-loaded microparticles into Lrat−/− mice improved visual function and retinal structure. PMID:22918645

  11. Feasibility of retinoids for the treatment of emphysema study.

    PubMed

    Roth, Michael D; Connett, John E; D'Armiento, Jeanine M; Foronjy, Robert F; Friedman, Paul J; Goldin, Jonathan G; Louis, Thomas A; Mao, Jenny T; Muindi, Josephia R; O'Connor, George T; Ramsdell, Joe W; Ries, Andrew L; Scharf, Steven M; Schluger, Neil W; Sciurba, Frank C; Skeans, Melissa A; Walter, Robert E; Wendt, Christine H; Wise, Robert A

    2006-11-01

    Retinoids promote alveolar septation in the developing lung and stimulate alveolar repair in some animal models of emphysema. One hundred forty-eight subjects with moderate-to-severe COPD and a primary component of emphysema, defined by diffusing capacity of the lung for carbon monoxide (Dlco) [37.1 +/- 12.0% of predicted] and CT density mask (38.5 +/- 12.8% of voxels <- 910 Hounsfield units) [mean +/- SD] were enrolled into a randomized, double-blind, feasibility study at five university hospitals. Participants received all-trans retinoic acid (ATRA) at either a low dose (LD) [1 mg/kg/d] or high dose (HD) [2 mg/kg/d], 13-cis retinoic acid (13-cRA) [1 mg/kg/d], or placebo for 6 months followed by a 3-month crossover period. No treatment was associated with an overall improvement in pulmonary function, CT density mask score, or health-related quality of life (QOL) at the end of 6 months. However, time-dependent changes in Dlco (initial decrease with delayed recovery) and St. George Respiratory Questionnaire (delayed improvement) were observed in the HD-ATRA cohort and correlated with plasma drug levels. In addition, 5 of 25 participants in the HD-ATRA group had delayed improvements in their CT scores that also related to ATRA levels. Retinoid-related side effects were common but generally mild. No definitive clinical benefits related to the administration of retinoids were observed in this feasibility study. However, time- and dose-dependent changes in Dlco, CT density mask score, and health-related QOL were observed in subjects treated with ATRA, suggesting the possibility of exposure-related biological activity that warrants further investigation.

  12. UV-induced isomerization of oral retinoids in vitro and in vivo in hairless mice.

    PubMed

    Berne, B; Rollman, O; Vahlquist, A

    1990-08-01

    Ultraviolet (UV) irradiation causes isomerization and destruction of many vitamin A analogues (retinoids). Using high-performance liquid chromatography (HPLC), we investigated in vitro and in vivo the effects of UV irradiation on 2 all-trans aromatic retinoids (etretinate and acitretin) and on 13-cis retinoic acid (isotretinoin). When etretinate and acitretin dissolved in ethanol were irradiated with UVB (280-320 nm; 10-336 mJ/cm2) or UVA (320-400 nm; 1-5 J/cm2), extensive and reproducible cis-isomerizations occurred at the 13-position (cis/trans ratio approximately 1.6 in all experiments) but there was no progressive photodegradation of the molecules. Irradiation of isotretinoin produced only moderate trans-isomerization but the sum of HPLC peak heights fell with increasing UV doses, being 72% of the original value after 336 mJ/cm2 of UVB. Hairless mice were given etretinate (50 mg/kg bw), acitretin (200 mg/kg) or isotretinoin (50 mg/kg) on days 1, 4 and 7 and were irradiated daily for 8 d with 13 mJ/cm2 UVB plus 1 J/cm2 UVA. Samples of serum, dorsal skin and liver were collected and retinoids analyzed by HPLC. In the etretinate and acitretin-treated, irradiated animals the serum concentrations of the 13-cis isomers were 2-6 times higher than in nonirradiated controls. Irradiated epidermis also contained significantly higher concentrations of 13-cis etretinate and 13-cis acitretin than did control epidermis. The serum and epidermal concentrations of all-trans etretinate and acitretin were unchanged or even increased after irradiation.(ABSTRACT TRUNCATED AT 250 WORDS)

  13. Azadirachtin interacts with retinoic acid receptors and inhibits retinoic acid-mediated biological responses.

    PubMed

    Thoh, Maikho; Babajan, Banaganapalli; Raghavendra, Pongali B; Sureshkumar, Chitta; Manna, Sunil K

    2011-02-11

    Considering the role of retinoids in regulation of more than 500 genes involved in cell cycle and growth arrest, a detailed understanding of the mechanism and its regulation is useful for therapy. The extract of the medicinal plant Neem (Azadirachta indica) is used against several ailments especially for anti-inflammatory, anti-itching, spermicidal, anticancer, and insecticidal activities. In this report we prove the detailed mechanism on the regulation of retinoic acid-mediated cell signaling by azadirachtin, active components of neem extract. Azadirachtin repressed all trans-retinoic acid (ATRA)-mediated nuclear transcription factor κB (NF-κB) activation, not the DNA binding but the NF-κB-dependent gene expression. It did not inhibit IκBα degradation, IκBα kinase activity, or p65 phosphorylation and its nuclear translocation but inhibited NF-κB-dependent reporter gene expression. Azadirachtin inhibited TRAF6-mediated, but not TRAF2-mediated NF-κB activation. It inhibited ATRA-induced Sp1 and CREB (cAMP-response element-binding protein) DNA binding. Azadirachtin inhibited ATRA binding with retinoid receptors, which is supported by biochemical and in silico evidences. Azadirachtin showed strong interaction with retinoid receptors. It suppressed ATRA-mediated removal of retinoid receptors, bound with DNA by inhibiting ATRA binding to its receptors. Overall, our data suggest that azadirachtin interacts with retinoic acid receptors and suppresses ATRA binding, inhibits falling off the receptors, and activates transcription factors like CREB, Sp1, NF-κB, etc. Thus, azadirachtin exerts anti-inflammatory and anti-metastatic responses by a novel pathway that would be beneficial for further anti-inflammatory and anti-cancer therapies.

  14. Role of the histone deacetylase complex in acute promyelocytic leukaemia.

    PubMed

    Lin, R J; Nagy, L; Inoue, S; Shao, W; Miller, W H; Evans, R M

    1998-02-19

    Non-liganded retinoic acid receptors (RARs) repress transcription of target genes by recruiting the histone deacetylase complex through a class of silencing mediators termed SMRT or N-CoR. Mutant forms of RARalpha, created by chromosomal translocations with either the PML (for promyelocytic leukaemia) or the PLZF (for promyelocytic leukaemia zinc finger) locus, are oncogenic and result in human acute promyelocytic leukaemia (APL). PML-RARalpha APL patients achieve complete remission following treatments with pharmacological doses of retinoic acids (RA); in contrast, PLZF-RARalpha patients respond very poorly, if at all. Here we report that the association of these two chimaeric receptors with the histone deacetylase (HDAC) complex helps to determine both the development of APL and the ability of patients to respond to retinoids. Consistent with these observations, inhibitors of histone deacetylase dramatically potentiate retinoid-induced differentiation of RA-sensitive, and restore retinoid responses of RA-resistant, APL cell lines. Our findings suggest that oncogenic RARs mediate leukaemogenesis through aberrant chromatin acetylation, and that pharmacological manipulation of nuclear receptor co-factors may be a useful approach in the treatment of human disease.

  15. The negligible systemic availability of retinoids with multiple and excessive topical application of isotretinoin 0.05% gel (Isotrex) in patients with acne vulgaris.

    PubMed

    Jensen, B K; McGann, L A; Kachevsky, V; Franz, T J

    1991-03-01

    The potential systemic availability of retinoids from topically applied isotretinoin was assessed in 12 men with acne vulgaris. Isotretinoin 0.05% gel was applied to patients at a daily dose of 20 gm (equivalent to 10 mg of isotretinoin) over a 1900 cm2 surface area of skin on the face, back, and chest for 30 days. Blood samples were collected throughout the study and up to 48 hours after the last topical application; they were assayed for isotretinoin, tretinoin, and 4-oxo-isotretinoin by specific high-performance liquid chromatography. Plasma concentrations of isotretinoin, tretinoin, and 4-oxo-isotretinoin were not measurable (less than 20 ng/ml) at any time. Most adverse experiences were cutaneous; a few systemic adverse experiences were judged to be remotely related to topical drug administration. The lack of measurable plasma concentrations of isotretinoin, tretinoin, or 4-oxo-isotretinoin and systemic adverse experiences indicates negligible systemic availability of retinoids even after multiple application of isotretinoin 0.05% gel at doses approximately 12 times greater than normal daily use.

  16. Pathogenesis of Zika Virus-Associated Embryopathy

    PubMed Central

    Mawson, Anthony R.

    2016-01-01

    Abstract A strong causal association has become evident between Zika virus (ZIKV) infection during pregnancy and the occurrence of fetal growth restriction, microcephaly and eye defects. Circumstantial evidence is presented in this paper in support of the hypothesis that these effects, as well as the Guillain-Barré syndrome, are due to an endogenous form of hypervitaminosis A resulting from ZIKV infection-induced damage to the liver and the spillage of stored vitamin A compounds (“retinoids”) into the maternal and fetal circulation in toxic concentrations. Retinoids are mainly stored in the liver (about 80%) and are essential for numerous biological functions. In higher concentration, retinoids are potentially cytotoxic, pro-oxidant, mutagenic and teratogenic, especially if sudden shifts occur in their bodily distribution. Although liver involvement has not been mentioned specifically in recent reports, conventional liver enzyme tests underestimate the true extent of liver dysfunction. The proposed model could be tested by comparing retinoid concentration and expression profiles in microcephalic newborns of ZIKV-infected mothers and nonmicrocephalic newborn controls, and by correlating these profiles with measures of clinical severity. PMID:27403405

  17. Structures of holo wild-type human cellular retinol-binding protein II (hCRBPII) bound to retinol and retinal

    PubMed Central

    Nossoni, Zahra; Assar, Zahra; Yapici, Ipek; Nosrati, Meisam; Wang, Wenjing; Berbasova, Tetyana; Vasileiou, Chrysoula; Borhan, Babak; Geiger, James

    2014-01-01

    Cellular retinol-binding proteins (CRBPs) I and II, which are members of the intracellular lipid-binding protein (iLBP) family, are retinoid chaperones that are responsible for the intracellular transport and delivery of both retinol and retinal. Although structures of retinol-bound CRBPI and CRBPII are known, no structure of a retinal-bound CRBP has been reported. In addition, the retinol-bound human CRBPII (hCRBPII) structure shows partial occupancy of a non­canonical conformation of retinol in the binding pocket. Here, the structure of retinal-bound hCRBPII and the structure of retinol-bound hCRBPII with retinol fully occupying the binding pocket are reported. It is further shown that the retinoid derivative seen in both the zebrafish CRBP and the hCRBPII structures is likely to be the product of flux-dependent and wavelength-dependent X-ray damage during data collection. The structures of retinoid-bound CRBPs are compared and contrasted, and rationales for the differences in binding affinities for retinal and retinol are provided. PMID:25478840

  18. Structures of holo wild-type human cellular retinol-binding protein II (hCRBPII) bound to retinol and retinal.

    PubMed

    Nossoni, Zahra; Assar, Zahra; Yapici, Ipek; Nosrati, Meisam; Wang, Wenjing; Berbasova, Tetyana; Vasileiou, Chrysoula; Borhan, Babak; Geiger, James

    2014-12-01

    Cellular retinol-binding proteins (CRBPs) I and II, which are members of the intracellular lipid-binding protein (iLBP) family, are retinoid chaperones that are responsible for the intracellular transport and delivery of both retinol and retinal. Although structures of retinol-bound CRBPI and CRBPII are known, no structure of a retinal-bound CRBP has been reported. In addition, the retinol-bound human CRBPII (hCRBPII) structure shows partial occupancy of a noncanonical conformation of retinol in the binding pocket. Here, the structure of retinal-bound hCRBPII and the structure of retinol-bound hCRBPII with retinol fully occupying the binding pocket are reported. It is further shown that the retinoid derivative seen in both the zebrafish CRBP and the hCRBPII structures is likely to be the product of flux-dependent and wavelength-dependent X-ray damage during data collection. The structures of retinoid-bound CRBPs are compared and contrasted, and rationales for the differences in binding affinities for retinal and retinol are provided.

  19. Clindamycin phosphate 1.2% / tretinoin 0.025%: a novel fixed-dose combination treatment for acne vulgaris.

    PubMed

    Ochsendorf, F

    2015-06-01

    The Global Alliance to Improve Outcomes in Acne Group recommends retinoid-based combination therapy as first-line therapy and the preferred treatment approach for almost all acne patients except those with the most severe disease. Clindamycin 1% (as clindamycin phosphate 1.2%)/tretinoin 0.025% (Clin-RA) is a new fixed-dose retinoid-based combination therapy. The aqueous-based gel formulation of Clin-RA was designed to minimize skin irritation and optimize adherence with the therapy. It contains both solubilized and crystalline tretinoin which allows the retinoid to be slowly released onto the skin surface and decreases the potential for cutaneous irritation. A pooled analysis of three pivotal studies involving 4550 acne patients showed that Clin-RA is well tolerated and effective at treating both inflammatory and non-inflammatory acne lesions. The onset of action of Clin-RA is rapid occurring within 2 weeks of treatment initiation. It is not associated with acne flaring or an increase in clindamycin-resistant Propionibacterium acnes counts. Clin-RA is considered as effective as adapalene 0.1%/benzoyl peroxide (BPO) 2.5%, whereas Clin-RA has a more favourable tolerability profile. Clin-RA may be more effective than clindamycin 1%/BPO 5% at treating non-inflammatory acne lesions since the latter does not contain a retinoid to target comedones. Clin-RA is also easy for patients to handle and apply, and has the advantage of not containing BPO which can bleach hair and fabrics. Taken together, the profile of Clin-RA suggests Clin-RA to be a first-line treatment for patients with facial acne. © 2015 European Academy of Dermatology and Venereology.

  20. Combination therapy with retinaldehyde (0.1%) glycolic acid (6%) and efectiose (0.1%) in mild to moderate acne vulgaris during the period of sun exposure--efficacy and skin tolerability.

    PubMed

    Masini, F; Ricci, F; Fossati, B; Frascione, P; Capizzi, R; De Waure, C; Guerriero, C

    2014-08-01

    Acne vulgaris is the most common disease of the adolescence age (70-94%). Main topical treatments for acne vulgaris are retinoids, benzoyl peroxide and antibiotics in mono or combination therapy. Topical retinoids, some antibiotics and antiseptics although effective on acne lesions, can due photosensitivity or make the skin more sensitive to the sun. Our study is aimed to evaluate the efficacy and tolerability of a combination therapy with Retinaldheyde (0.1%), Glycolic acid (6%) and Efectiose (0.1%) (RGE) cream in patients affected by acne vulgaris, during the lasting period of sun exposure. We retrospectively observed 30 patients of Central Italy with mild or moderate acne between April and September. All the patients selected underwent only therapy with RGE cream once a day in the evening for 8 weeks, while in the morning they just applied SPF 50 sunscreen. We evaluate the efficacy at 30 and 60 days with the "Global Evaluation Scale" (GES) and the tolerability with a 0-3 qualitative scale. The mean GES value showed a statistically significant reduction: 1.83 (SD 0.83) at baseline 1.57 (SD 0.77) and 0.90 (SD 0.76) respectively at 30 and 60 days (p < 0.01). Side effects were very uncommon. Topical treatments with retinoids, antibiotics and antiseptics can be associated with an increased occurrence of facial dryness and erythema restricting their use in sun exposure period. RGE cream has shown a good skin tolerability and efficacy, so it can be considerate an effective maintaining therapy to treat mild to moderate acne during the sun exposure period in which retinoids, antibiotics or antiseptic treatments are not recommended.

  1. The neurobiology of retinoic acid in affective disorders.

    PubMed

    Bremner, J Douglas; McCaffery, Peter

    2008-02-15

    Current models of affective disorders implicate alterations in norepinephrine, serotonin, dopamine, and CRF/cortisol; however treatments targeted at these neurotransmitters or hormones have led to imperfect resolution of symptoms, suggesting that the neurobiology of affective disorders is incompletely understood. Until now retinoids have not been considered as possible contributors to affective disorders. Retinoids represent a family of compounds derived from vitamin A that perform a large number of functions, many via the vitamin A product, retinoic acid. This signaling molecule binds to specific retinoic acid receptors in the brain which, like the glucocorticoid and thyroid hormone receptors, are part of the nuclear receptor superfamily and regulate gene transcription. Research in the field of retinoic acid in the CNS has focused on the developing brain, in part stimulated by the observation that isotretinoin (13-cis retinoic acid), an isomer of retinoic acid used in the treatment of acne, is highly teratogenic for the CNS. More recent work has suggested that retinoic acid may influence the adult brain; animal studies indicated that the administration of isotretinoin is associated with alterations in behavior as well as inhibition of neurogenesis in the hippocampus. Clinical evidence for an association between retinoids and depression includes case reports in the literature, studies of health care databases, and other sources. A preliminary PET study in human subjects showed that isotretinoin was associated with a decrease in orbitofrontal metabolism. Several studies have shown that the molecular components required for retinoic acid signaling are expressed in the adult brain; the overlap of brain areas implicated in retinoic acid function and stress and depression suggest that retinoids could play a role in affective disorders. This report reviews the evidence in this area and describes several systems that may be targets of retinoic acid and which contribute to the pathophysiology of depression.

  2. The neurobehavioral teratology of retinoids: a 50-year history.

    PubMed

    Adams, Jane

    2010-10-01

    This review of the central nervous system (CNS) and behavioral teratology of the retinoids over the last 50 years is a commemorative retrospective organized by decade to show the prominent research focus within each period and the most salient findings. In the 1960s, research focused on the gross CNS malformations associated with exposure and the delineation of dose-response and stage-specific responses in rodent models. Relevant scientific events before and during the 1960s are also discussed to provide the zeitgeist in which the field of neurobehavioral teratology emerged in the 1970s. During this period, studies demonstrated that adverse effects on postnatal behavior could be produced in animals exposed to doses of vitamin A lower than those that were teratogenic or impacted growth. Work during the 1980s showed an overrepresentation of behavioral studies focused on the reliability of screening methods, while the marked effects of human exposure were illustrated in children born to women treated with isotretinoin during pregnancy. The human catastrophe invigorated research during the 1990s, a period when technological advances allowed more elegant examinations of the developing CNS, of biochemical, cellular, and molecular developmental events and regulatory actions, and of the effects of direct genetic manipulations. Likewise, research in the 1990s reflected a reinvigoration of research in neurobehavioral teratology evinced in studies that used animal models to try to better understand human vulnerability. These foci continued in the 2000-2010 period while examinations of the role of retinoids in brain development and lifelong functioning became increasingly sophisticated and broader in scope. This review of the work on retinoids also provides a lens on the more general ontogeny of the field of neurobehavioral teratology. Birth Defects Research (Part A), 2010. © 2010 Wiley-Liss, Inc.

  3. The Neurobiology of Retinoic Acid in Affective Disorders

    PubMed Central

    Bremner, J Douglas; McCaffery, Peter

    2009-01-01

    Current models of affective disorders implicate alterations in norepinephrine, serotonin, dopamine, and CRF/cortisol; however treatments targeted at these neurotransmitters or hormones have led to imperfect resolution of symptoms, suggesting that the neurobiology of affective disorders is incompletely understood. Until now retinoids have not been considered as possible contributors to affective disorders. Retinoids represent a family of compounds derived from Vitamin A that perform a large number of functions, many via the vitamin A product, retinoic acid. This signaling molecule binds to specific retinoic acid receptors in the brain which, like the glucocorticoid and thyroid hormone receptors, are part of the nuclear receptor superfamily and regulate gene transcription. Research in the field of retinoic acid in the CNS has focused on the developing brain, in part stimulated by the observation that isotretinoin (13-cis retinoic acid), an isomer of retinoic acid used in the treatment of acne, is highly teratogenic for the CNS. More recent work has suggested that retinoic acid may influence the adult brain; animal studies indicated that the administration of isotretinoin is associated with alterations in behavior as well as inhibition of neurogenesis in the hippocampus. Clinical evidence for an association between retinoids and depression includes case reports in the literature, studies of health care databases, and other sources. A preliminary PET study in human subjects showed that isotretinoin was associated with a decrease in orbitofrontal metabolism. Several studies have shown that the molecular components required for retinoic acid signaling are expressed in the adult brain ; the overlap of brain areas implicated in retinoic acid function and stress and depression suggest that retinoids could play a role in affective disorders. This report reviews the evidence in this area and describes several systems that may be targets of retinoic acid and which contribute to the pathophysiology of depression. PMID:17707566

  4. Human gene therapy for RPE65 isomerase deficiency activates the retinoid cycle of vision but with slow rod kinetics

    PubMed Central

    Cideciyan, Artur V.; Aleman, Tomas S.; Boye, Sanford L.; Schwartz, Sharon B.; Kaushal, Shalesh; Roman, Alejandro J.; Pang, Ji-jing; Sumaroka, Alexander; Windsor, Elizabeth A. M.; Wilson, James M.; Flotte, Terence R.; Fishman, Gerald A.; Heon, Elise; Stone, Edwin M.; Byrne, Barry J.; Jacobson, Samuel G.; Hauswirth, William W.

    2008-01-01

    The RPE65 gene encodes the isomerase of the retinoid cycle, the enzymatic pathway that underlies mammalian vision. Mutations in RPE65 disrupt the retinoid cycle and cause a congenital human blindness known as Leber congenital amaurosis (LCA). We used adeno-associated virus-2-based RPE65 gene replacement therapy to treat three young adults with RPE65-LCA and measured their vision before and up to 90 days after the intervention. All three patients showed a statistically significant increase in visual sensitivity at 30 days after treatment localized to retinal areas that had received the vector. There were no changes in the effect between 30 and 90 days. Both cone- and rod-photoreceptor-based vision could be demonstrated in treated areas. For cones, there were increases of up to 1.7 log units (i.e., 50 fold); and for rods, there were gains of up to 4.8 log units (i.e., 63,000 fold). To assess what fraction of full vision potential was restored by gene therapy, we related the degree of light sensitivity to the level of remaining photoreceptors within the treatment area. We found that the intervention could overcome nearly all of the loss of light sensitivity resulting from the biochemical blockade. However, this reconstituted retinoid cycle was not completely normal. Resensitization kinetics of the newly treated rods were remarkably slow and required 8 h or more for the attainment of full sensitivity, compared with <1 h in normal eyes. Cone-sensitivity recovery time was rapid. These results demonstrate dramatic, albeit imperfect, recovery of rod- and cone-photoreceptor-based vision after RPE65 gene therapy. PMID:18809924

  5. Fenretinide

    PubMed Central

    Pavone, Mary Ellen; Malpani, Saurabh S.; Dyson, Matthew; Kim, J. Julie; Bulun, Serdar E.

    2016-01-01

    Objective: Fenretinide is a synthetic retinoid analogue that promotes apoptosis but has decreased toxicity when compared to other retinoids. We have previously shown that retinoic acid (RA) production in endometriotic tissue is decreased, resulting in reduced estrogen metabolism and apoptotic resistance. We hypothesize fenretinide may induce apoptosis in endometriotic cells and tissues, thereby reducing disease burden. Materials and Methods: Primary endometriotic stromal cells were collected, isolated, cultured, and treated with fenretinide in doses from 0 to 20 µmol/L. Cell count, viability, and immunoblots were performed to examine apoptosis. Quantitative reverse transcription-polymerase chain reaction from endometriotic cells treated with fenretinide was used to examine expression of genes involved in RA signaling including stimulated by RA 6 (STRA6), cellular RA binding protein 2 (CRABP2), and fatty acid binding protein 5 (FABP5). Endometriotic tissue was xenografted subcutaneously into the flanks of mice which were treated with fenretinide for 2 weeks, after which the mice were killed and lesion volumes calculated. Statistical analysis was performed using t test and analysis of variance. Results: Treatment with fenretinide significantly decreased total cell count (doses 5-20 µL) and viability (doses 10-20 µmol/L). Fenretinide increased protein levels of the apoptotic marker poly (ADP ribose) polymerase (starting at 10 µmol/L) and decreased proliferation marker proliferating cell nuclear antigen (10 µmol/L, starting at 8-day treatment). Examination of genes involved in retinoid uptake and action showed that treatment induced STRA6 expression while expression of CRABP2 and FABP5 remained unchanged. Fenretinide also significantly decreased the endometriotic lesion xenograft volume. Conclusions: Fenretinide increases STRA6 expression thereby potentially reversing the pathological loss of retinoid availability. Treatment with this compound induces apoptosis. In vivo treatments decrease lesion volume. Targeting the RA signaling pathway may be a promising novel treatment for women with endometriosis. PMID:26919975

  6. Azadirachtin Interacts with Retinoic Acid Receptors and Inhibits Retinoic Acid-mediated Biological Responses*

    PubMed Central

    Thoh, Maikho; Babajan, Banaganapalli; Raghavendra, Pongali B.; Sureshkumar, Chitta; Manna, Sunil K.

    2011-01-01

    Considering the role of retinoids in regulation of more than 500 genes involved in cell cycle and growth arrest, a detailed understanding of the mechanism and its regulation is useful for therapy. The extract of the medicinal plant Neem (Azadirachta indica) is used against several ailments especially for anti-inflammatory, anti-itching, spermicidal, anticancer, and insecticidal activities. In this report we prove the detailed mechanism on the regulation of retinoic acid-mediated cell signaling by azadirachtin, active components of neem extract. Azadirachtin repressed all trans-retinoic acid (ATRA)-mediated nuclear transcription factor κB (NF-κB) activation, not the DNA binding but the NF-κB-dependent gene expression. It did not inhibit IκBα degradation, IκBα kinase activity, or p65 phosphorylation and its nuclear translocation but inhibited NF-κB-dependent reporter gene expression. Azadirachtin inhibited TRAF6-mediated, but not TRAF2-mediated NF-κB activation. It inhibited ATRA-induced Sp1 and CREB (cAMP-response element-binding protein) DNA binding. Azadirachtin inhibited ATRA binding with retinoid receptors, which is supported by biochemical and in silico evidences. Azadirachtin showed strong interaction with retinoid receptors. It suppressed ATRA-mediated removal of retinoid receptors, bound with DNA by inhibiting ATRA binding to its receptors. Overall, our data suggest that azadirachtin interacts with retinoic acid receptors and suppresses ATRA binding, inhibits falling off the receptors, and activates transcription factors like CREB, Sp1, NF-κB, etc. Thus, azadirachtin exerts anti-inflammatory and anti-metastatic responses by a novel pathway that would be beneficial for further anti-inflammatory and anti-cancer therapies. PMID:21127062

  7. Retinoid agonist isotretinoin ameliorates obstructive renal injury.

    PubMed

    Schaier, Matthias; Jocks, Thomas; Grone, Hermann-Josef; Ritz, Eberhard; Wagner, Juergen

    2003-10-01

    Interstitial fibrosis is a major cause of end stage renal failure. Retinoids, which are involved in tissue repair and fibrosis, inhibit inflammatory and proliferative pathways. Therefore, we studied the dose dependent effects of the retinoid receptor agonist isotretinoin 13-cis retinoic acid in the unilateral ureteral obstruction model (UUO). Sham operated control rats were compared with UUO rats treated with vehicle (UUO-Veh), or low (5 mg/kg body weight (UUO-LD) or high (25 mg/kg) (UUO-HD) dose isotretinoin. Kidneys were evaluated using reverse transcriptase-polymerase chain reaction and immunohistology 7 days after UUO. Renal injury and fibrosis were quantified by immunostaining and expression measurements of the genes involved in renal fibrosis. In UUO-Veh kidneys the interstitial area was expanded 5-fold but only 3-fold in UUO-HD and 3.5-fold in UUO-LD rats. Interstitial cell counts were 3-fold higher in UUO-Veh rats but significantly less in UUO-HD or UUO-LD animals. Tubular and interstitial cell proliferation was significantly higher in UUO-Veh rats compared with sham operated control plus vehicle animals but less so in UUO-LD and UUO-HD rats. In UUO-Veh rats interstitial infiltration by monocytes/macrophages was higher compared with unobstructed controls. It was significantly less after isotretinoin treatment. In UUO-Veh rats mRNA for procollagen I, and transforming growth factor-beta1 and II receptor was significantly increased. It was significantly less after treatment with isotretinoin. Fibronectin and collagen I immunostaining was also decreased by isotretinoin. Since isotretinoin limits proliferation, inflammation and fibrosis after UUO, retinoids should be further investigated as potentially promising therapeutic agents for renal disease.

  8. The Visual Cycle in the Inner Retina of Chicken and the Involvement of Retinal G-Protein-Coupled Receptor (RGR).

    PubMed

    Díaz, Nicolás M; Morera, Luis P; Tempesti, Tomas; Guido, Mario E

    2017-05-01

    The vertebrate retina contains typical photoreceptor (PR) cones and rods responsible for day/night vision, respectively, and intrinsically photosensitive retinal ganglion cells (ipRGCs) involved in the regulation of non-image-forming tasks. Rhodopsin/cone opsin photopigments in visual PRs or melanopsin (Opn4) in ipRGCs utilizes retinaldehyde as a chromophore. The retinoid regeneration process denominated as "visual cycle" involves the retinal pigment epithelium (RPE) or Müller glial cells. Opn4, on the contrary, has been characterized as a bi/tristable photopigment, in which a photon of one wavelength isomerizes 11-cis to all-trans retinal (Ral), with a second photon re-isomerizing it back. However, it is unknown how the chromophore is further metabolized in the inner retina. Nor is it yet clear whether an alternative secondary cycle occurs involving players such as the retinal G-protein-coupled receptor (RGR), a putative photoisomerase of unidentified inner retinal activity. Here, we investigated the role of RGR in retinoid photoisomerization in Opn4x (Xenopus ortholog) (+) RGC primary cultures free of RPE and other cells from chicken embryonic retinas. Opn4x (+) RGCs display significant photic responses by calcium fluorescent imaging and photoisomerize exogenous all-trans to 11-cis Ral and other retinoids. RGR was found to be expressed in developing retina and in primary cultures; when its expression was knocked down, the levels of 11-cis, all-trans Ral, and all-trans retinol in cultures exposed to light were significantly higher and those in all-trans retinyl esters lower than in dark controls. The results support a novel role for RGR in ipRGCs to modulate retinaldehyde levels in light, keeping the balance of inner retinal retinoid pools.

  9. Nuclear Receptors, RXR, and the Big Bang.

    PubMed

    Evans, Ronald M; Mangelsdorf, David J

    2014-03-27

    Isolation of genes encoding the receptors for steroids, retinoids, vitamin D, and thyroid hormone and their structural and functional analysis revealed an evolutionarily conserved template for nuclear hormone receptors. This discovery sparked identification of numerous genes encoding related proteins, termed orphan receptors. Characterization of these orphan receptors and, in particular, of the retinoid X receptor (RXR) positioned nuclear receptors at the epicenter of the "Big Bang" of molecular endocrinology. This Review provides a personal perspective on nuclear receptors and explores their integrated and coordinated signaling networks that are essential for multicellular life, highlighting the RXR heterodimer and its associated ligands and transcriptional mechanism. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Oral treatment with retinoic acid decreases bone mass in rats.

    PubMed

    Hotchkiss, Charlotte E; Latendresse, John; Ferguson, Sherry A

    2006-12-01

    13-cis-retinoic acid (13-cis-RA, isotretinoin) is used to treat severe recalcitrant acne. Other retinoids have adverse effects on bone. Recent studies of human patients treated with 13-cis-RA have had varying results, perhaps because of variability among patients and the lack of control groups. The effects of retinoids have been studied in rodents, but little information is available regarding the effects of clinically relevant retinoid doses as evaluated by use of bone densitometric techniques. We treated rats for 15 or 20 wk with 13-cis-RA, all-trans-RA, or soybean oil (control) by gavage. We used dual-energy X-ray absorptiometry, histomorphometry, and histologic evaluation to evaluate effects on bone. Spontaneous long bone fractures occurred in some rats treated with 15 mg/kg all-trans-RA daily. Bone mineral density, bone mineral content, bone diameter, and cortical thickness of the femur were reduced in rats treated daily with 10 or 15 mg/kg all-trans-RA or 30 mg/kg 13-cis-RA. The lumbar spine was not affected. Although the effects of 13-cis-RA were not as dramatic as those of all-trans-RA, further study of the effects of 13-cis-RA on long bones is warranted.

  11. Lipid peroxide, alpha-tocopherol and retinoid levels in plasma and liver of rats fed diets containing beta-carotene and 13-cis-retinoic acid.

    PubMed

    Alam, S Q; Alam, B S

    1983-12-01

    The effect of feeding large amounts of beta-carotene and 13-cis-retinoic acid (RA) on plasma and liver levels of alpha-tocopherol, lipid peroxides and retinoids was studied. Groups of young male rats were fed semipurified diets supplemented with 0, 100 mg/kg beta-carotene, 20 and 100 mg/kg 13-cis-RA. After feeding the various diets for 11 weeks, rats were killed and the concentrations of lipid peroxides, alpha-tocopherol, and retinoids were measured in blood plasma and liver. Peroxide levels were increased and alpha-tocopherol levels were decreased in plasma as well as liver of rats fed diets containing 13-cis-RA; this effect seems to be dose dependent, beta-Carotene had no significant effect on either of the above parameters. There was a decrease in the liver and plasma concentrations of retinol in rats fed 13-cis-RA; the levels of RA were generally higher in these two groups. The results suggest that the mechanism whereby 13-cis-RA increases the tissue peroxide levels may be related to its ability to decrease alpha-tocopherol levels.

  12. The interphotoreceptor retinoid binding protein gene in therian mammals: implications for higher level relationships and evidence for loss of function in the marsupial mole.

    PubMed

    Springer, M S; Burk, A; Kavanagh, J R; Waddell, V G; Stanhope, M J

    1997-12-09

    The subclass Theria of Mammalia includes marsupials (infraclass Metatheria) and placentals (infraclass Eutheria). Within each group, interordinal relationships remain unclear. One limitation of many studies is incomplete ordinal representation. Here, we analyze DNA sequences for part of exon 1 of the interphotoreceptor retinoid binding protein gene, including 10 that are newly reported, for representatives of all therian orders. Among placentals, the most robust clades are Cetartiodactyla, Paenungulata, and an expanded African clade that includes paenungulates, tubulidentates, and macroscelideans. Anagalida, Archonta, Altungulata, Hyracoidea + Perissodactyla, Ungulata, and the "flying primate" hypothesis are rejected by statistical tests. Among marsupials, the most robust clade includes all orders except Didelphimorphia. The phylogenetic placement of the monito del monte and the marsupial mole remains unclear. However, the marsupial mole sequence contains three frameshift indels and numerous stop codons in all three reading frames. Given that the interphotoreceptor retinoid binding protein gene is a single-copy gene that functions in the visual cycle and that the marsupial mole is blind with degenerate eyes, this finding suggests that phenotypic degeneration of the eyes is accompanied by parallel changes at the molecular level as a result of relaxed selective constraints.

  13. Uncoupling RARA transcriptional activation and degradation clarifies the bases for APL response to therapies

    PubMed Central

    Ablain, Julien; Leiva, Magdalena; Peres, Laurent; Fonsart, Julien; Anthony, Elodie

    2013-01-01

    In PML/RARA-driven acute promyelocytic leukemia (APL), retinoic acid (RA) induces leukemia cell differentiation and transiently clears the disease. Molecularly, RA activates PML/RARA-dependent transcription and also initiates its proteasome-mediated degradation. In contrast, arsenic, the other potent anti-APL therapy, only induces PML/RARA degradation by specifically targeting its PML moiety. The respective contributions of RA-triggered transcriptional activation and proteolysis to clinical response remain disputed. Here, we identify synthetic retinoids that potently activate RARA- or PML/RARA-dependent transcription, but fail to down-regulate RARA or PML/RARA protein levels. Similar to RA, these uncoupled retinoids elicit terminal differentiation, but unexpectedly fail to impair leukemia-initiating activity of PML/RARA-transformed cells ex vivo or in vivo. Accordingly, the survival benefit conferred by uncoupled retinoids in APL mice is dramatically lower than the one provided by RA. Differentiated APL blasts sorted from uncoupled retinoid–treated mice retain PML/RARA expression and reinitiate APL in secondary transplants. Thus, differentiation is insufficient for APL eradication, whereas PML/RARA loss is essential. These observations unify the modes of action of RA and arsenic and shed light on the potency of their combination in mice or patients. PMID:23509325

  14. Hydroperoxide-dependent cooxidation of 13-cis-retinoic acid by prostaglandin H synthase.

    PubMed

    Samokyszyn, V M; Marnett, L J

    1987-10-15

    Reverse phase high pressure liquid chromatography was employed to separate the major products resulting from the hydroperoxide-dependent cooxidation of 13-cis-retinoic acid by microsomal and purified prostaglandin H (PGH) synthase. Several major oxygenated metabolites including 4-hydroxy-, 5,6-epoxy-, and 5,8-oxy-13-cis-retinoic acid were unambiguously identified on the basis of cochromatography with authentic standards, uv spectra, and mass spectral analysis. Identical product profiles were generated regardless of the type of oxidizing substrate employed, and heat-denatured microsomes or enzyme did not support oxidation. In addition, several geometric isomers including all trans-retinoic acid were identified. Isomerization to all trans-retinoic acid in microsomes occurred in the absence of exogenous hydroperoxide, was insensitive to inhibition by antioxidant, and was eliminated when heat-denatured preparations were substituted for intact microsomes. Conversely, isomerization to at least one other isomer required the addition of hydroperoxide and was sensitive to antioxidant inhibition. Addition of antioxidant to microsomal incubation mixtures inhibited the hydroperoxide-dependent generation of 5,6-epoxy- and 5,8-oxy-13-cis-retinoic acid and other oxygenated metabolites but stimulated the formation of 4-hydroxy-13-cis-retinoic acid. Under standard conditions, 77% of the original retinoid was metabolized resulting in products containing 1.25 oxygen atoms/oxygenated metabolite, and two dioxygen molecules were consumed per hydroperoxide reduced. Purified PGH synthase also supported O2 uptake during cooxidation of 13-cis-retinoic acid by H2O2 or 5-phenyl-4-pentenyl-1-hydroperoxide, and the initial velocities of O2 uptake were directly proportional to enzyme concentration. 13-cis-Retinoic acid effectively inhibited peroxidase-dependent cooxidation of guaiacol indicating a direct interaction of retinoid with peroxidase iron-oxo intermediates, and EPR spin trapping studies demonstrated the formation of retinoid-derived free radical intermediates. Incubating H2O2 with microsomal PGH synthase resulted in the initiation of lipid peroxidation, detected via measurement of malondialdehyde generation, that was inhibited by retinoid and suggests some limited involvement of lipid peroxidation in retinoid oxidation. Incubation of 13-cis-retinoic acid with hematin and 15-hydroperoxy-5,8,11,13-eicosatetraenoic acid in the presence of detergent, a system that generates high yields of peroxyl radicals, resulted in high yields of 5,6-epoxide; 4-hydroxy-13-cis-retinoic acid was not detected.(ABSTRACT TRUNCATED AT 400 WORDS)

  15. Control of retinoic acid synthesis and FGF expression in the nasal pit is required to pattern the craniofacial skeleton.

    PubMed

    Song, Y; Hui, J N; Fu, K K; Richman, J M

    2004-12-15

    Endogenous retinoids are important for patterning many aspects of the embryo including the branchial arches and frontonasal region of the embryonic face. The nasal placodes express retinaldehyde dehydrogenase-3 (RALDH3) and thus retinoids from the placode are a potential patterning influence on the developing face. We have carried out experiments that have used Citral, a RALDH antagonist, to address the function of retinoid signaling from the nasal pit in a whole embryo model. When Citral-soaked beads were implanted into the nasal pit of stage 20 chicken embryos, the result was a specific loss of derivatives from the lateral nasal prominences. Providing exogenous retinoic acid residue development of the beak demonstrating that most Citral-induced defects were produced by the specific blocking of RA synthesis. The mechanism of Citral effects was a specific increase in programmed cell death on the lateral (lateral nasal prominence) but not the medial side (frontonasal mass) of the nasal pit. Gene expression studies were focused on the Bone Morphogenetic Protein (BMP) pathway, which has a well-established role in programmed cell death. Unexpectedly, blocking RA synthesis decreased rather than increased Msx1, Msx2, and Bmp4 expression. We also examined cell survival genes, the most relevant of which was Fgf8, which is expressed around the nasal pit and in the frontonasal mass. We found that Fgf8 was not initially expressed along the lateral side of the nasal pit at the start of our experiments, whereas it was expressed on the medial side. Citral prevented upregulation of Fgf8 along the lateral edge and this may have contributed to the specific increase in programmed cell death in the lateral nasal prominence. Consistent with this idea, exogenous FGF8 was able to prevent cell death, rescue most of the morphological defects and was able to prevent a decrease in retinoic acid receptorbeta (Rarbeta) expression caused by Citral. Together, our results demonstrate that endogenous retinoids act upstream of FGF8 and the balance of these two factors is critical for regulating programmed cell death and morphogenesis in the face. In addition, our data suggest a novel role for endogenous retinoids from the nasal pit in controlling the precise downregulation of FGF in the center of the frontonasal mass observed during normal vertebrate development.

  16. The conserved regulation of mitochondrial uncoupling proteins: From unicellular eukaryotes to mammals.

    PubMed

    Woyda-Ploszczyca, Andrzej M; Jarmuszkiewicz, Wieslawa

    2017-01-01

    Uncoupling proteins (UCPs) belong to the mitochondrial anion carrier protein family and mediate regulated proton leak across the inner mitochondrial membrane. Free fatty acids, aldehydes such as hydroxynonenal, and retinoids activate UCPs. However, there are some controversies about the effective action of retinoids and aldehydes alone; thus, only free fatty acids are commonly accepted positive effectors of UCPs. Purine nucleotides such as GTP inhibit UCP-mediated mitochondrial proton leak. In turn, membranous coenzyme Q may play a role as a redox state-dependent metabolic sensor that modulates the complete activation/inhibition of UCPs. Such regulation has been observed for UCPs in microorganisms, plant and animal UCP1 homologues, and UCP1 in mammalian brown adipose tissue. The origin of UCPs is still under debate, but UCP homologues have been identified in all systematic groups of eukaryotes. Despite the differing levels of amino acid/DNA sequence similarities, functional studies in unicellular and multicellular organisms, from amoebae to mammals, suggest that the mechanistic regulation of UCP activity is evolutionarily well conserved. This review focuses on the regulatory feedback loops of UCPs involving free fatty acids, aldehydes, retinoids, purine nucleotides, and coenzyme Q (particularly its reduction level), which may derive from the early stages of evolution as UCP first emerged. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Cell-type-specific regulation of the retinoic acid receptor mediated by the orphan nuclear receptor TLX.

    PubMed

    Kobayashi, M; Yu, R T; Yasuda, K; Umesono, K

    2000-12-01

    Malformations in the eye can be caused by either an excess or deficiency of retinoids. An early target gene of the retinoid metabolite, retinoic acid (RA), is that encoding one of its own receptors, the retinoic acid receptor beta (RARbeta). To better understand the mechanisms underlying this autologous regulation, we characterized the chick RARbeta2 promoter. The region surrounding the transcription start site of the avian RARbeta2 promoter is over 90% conserved with the corresponding region in mammals and confers strong RA-dependent transactivation in primary cultured embryonic retina cells. This response is selective for RAR but not retinoid X receptor-specific agonists, demonstrating a principal role for RAR(s) in retina cells. Retina cells exhibit a far higher sensitivity to RA than do fibroblasts or osteoblasts, a property we found likely due to expression of the orphan nuclear receptor TLX. Ectopic expression of TLX in fibroblasts resulted in increased sensitivity to RA induction, an effect that is conserved between chick and mammals. We have identified a cis element, the silencing element relieved by TLX (SET), within the RARbeta2 promoter region which confers TLX- and RA-dependent transactivation. These results indicate an important role for TLX in autologous regulation of the RARbeta gene in the eye.

  18. Cell-Type-Specific Regulation of the Retinoic Acid Receptor Mediated by the Orphan Nuclear Receptor TLX†

    PubMed Central

    Kobayashi, Mime; Yu, Ruth T.; Yasuda, Kunio; Umesono, Kazuhiko

    2000-01-01

    Malformations in the eye can be caused by either an excess or deficiency of retinoids. An early target gene of the retinoid metabolite, retinoic acid (RA), is that encoding one of its own receptors, the retinoic acid receptor β (RARβ). To better understand the mechanisms underlying this autologous regulation, we characterized the chick RARβ2 promoter. The region surrounding the transcription start site of the avian RARβ2 promoter is over 90% conserved with the corresponding region in mammals and confers strong RA-dependent transactivation in primary cultured embryonic retina cells. This response is selective for RAR but not retinoid X receptor-specific agonists, demonstrating a principal role for RAR(s) in retina cells. Retina cells exhibit a far higher sensitivity to RA than do fibroblasts or osteoblasts, a property we found likely due to expression of the orphan nuclear receptor TLX. Ectopic expression of TLX in fibroblasts resulted in increased sensitivity to RA induction, an effect that is conserved between chick and mammals. We have identified a cis element, the silencing element relieved by TLX (SET), within the RARβ2 promoter region which confers TLX- and RA-dependent transactivation. These results indicate an important role for TLX in autologous regulation of the RARβ gene in the eye. PMID:11073974

  19. 9-cis-Retinoic Acid Promotes Cell Adhesion Through Integrin Dependent and Independent Mechanisms Across Immune Lineages

    PubMed Central

    Whelan, Jarrett T.; Chen, Jianming; Miller, Jabin; Morrow, Rebekah L.; Lingo, Joshuah D.; Merrell, Kaitlin; Shaikh, Saame Raza; Bridges, Lance C.

    2012-01-01

    Retinoids are essential in the proper establishment and maintenance of immunity. Although retinoids are implicated in immune related processes, their role in immune cell adhesion has not been well established. In this study, the effect of 9-cis-retinoic acid (9-cis-RA) on human hematopoietic cell adhesion was investigated. 9-cis-RA treatment specifically induced cell adhesion of the human immune cell lines HuT-78, NB4, RPMI 8866, and U937. Due to the prominent role of integrin receptors in mediating immune cell adhesion, we sought to evaluate if cell adhesion was integrin-dependent. By employing a variety of integrin antagonist including function-blocking antibodies and EDTA, we establish that 9-cis-RA prompts immune cell adhesion through established integrin receptors in addition to a novel integrin-independent process. The novel integrin-independent adhesion required the presence of retinoid and was attenuated by treatment with synthetic corticosteroids. Finally, we demonstrate that 9-cis-RA treatment of primary murine B-cells induces ex vivo adhesion that persists in the absence of integrin function. Our study is the first to demonstrate that 9-cis-retinoic acid influences immune cell adhesion through at least two functionally distinct mechanisms. PMID:22925918

  20. Is tretinoin still a key agent for photoaging management?

    PubMed

    Ascenso, Andreia; Ribeiro, Helena; Marques, Helena C; Oliveira, Helena; Santos, Conceicao; Simões, Sandra

    2014-01-01

    BACKGROUND & SCOPE OF THE REVIEW: This review focuses on the UV radiation effects on skin, emphasizing the photoaging process, and the photoprotection conferred by tretinoin (all-trans retinoic acid or ATRA). Tretinoin is still the best tested retinoid to reverse photoaged skin. Tretinoin can be used for photoaging treatment or combined treatment by different mechanisms. It binds to and activates retinoic acid receptors, inducing changes in gene expression that leads to cell differentiation, decreased cell proliferation, and inhibition of tumourigenesis. It has been demonstrated that photoaging resulting from UV-B radiation can be treated by retinoid formulations. Pretreatment of human skin with tretinoin blocks dermal matrix degradation followed by sun exposure, inhibiting the induction of the activated protein-1 (AP-1) transcription factor and AP-1 regulated matrix-degrading metalloproteinases. GENERAL SIGNIFICANCE AND INTEREST: Tretinoin should be considered as a key factor as it is the most potent and best-studied retinoid. In addition, the development of advanced drug delivery systems, especially novel nanoformulations, has contributed to overpass some technical drawbacks besides the skin irritation potential. The triple combination of tretinoin, hydroquinone and corticosteroids is still considered the gold standard for melasma. Although there are other novel therapeutic approaches, more high-quality clinical trials are still needed.

  1. Focal epithelial hyperplasia by human papillomavirus (HPV)-32 misdiagnosed as HPV-16 and treated with combination of retinoids, imiquimod and quadrivalent HPV vaccine.

    PubMed

    Gemigniani, Franco; Hernández-Losa, Javier; Ferrer, Berta; García-Patos, Vicente

    2015-12-01

    Focal epithelial hyperplasia (FEH) or Heck's disease is a rare, benign and asymptomatic mucosal proliferation associated with human papillomavirus (HPV) infection, mainly with genotypes 13 and 32. We report a florid case of FEH in an 11-year-old Haitian girl with systemic lupus erythematosus receiving immunosuppressive therapy. Cryotherapy was previously performed on numerous occasions with no results. We decided to prescribe a non-invasive and more comfortable treatment. A combination of topical retinoid and imiquimod cream was well tolerated and led to an important improvement. The evidence of infection by HPV-16 detected by polymerase chain reaction (PCR) technique, prompted us to prescribe the quadrivalent HPV vaccine (types 6, 11,16 and 18). Subsequent PCR sequencing with generic primers GP5-GP6 and further BLAST comparative analysis confirmed that genomic viral sequence in our case truly corresponded with HPV-32. This molecular misdiagnosis can be explained by the similarity between genomic sequences of both HPV-16 and -32 genotypes. At the 1-year follow up, we observed total clinical improvement and no recurrences of the disease. Complete healing in this case may correspond to a potential action of topical retinoid, imiquimod and the cross-protection mechanism of the quadrivalent HPV vaccine. © 2015 Japanese Dermatological Association.

  2. The efficacy of 9-cis retinoic acid in experimental models of cancer.

    PubMed

    Gottardis, M M; Lamph, W W; Shalinsky, D R; Wellstein, A; Heyman, R A

    1996-01-01

    9-cis retinoic acid (9-cis RA) is a retinoid receptor pan-agonist that binds with high affinity to both retinoic acid receptors (RARs) and retinoid X receptors (RXRs). Using a variety of in vivo and in vitro cancer models, we present experimental data that 9-cis RA has activity as a potential chemotherapeutic agent. Treatment of the human promyelocytic leukemia cell line HL-60 with 9-cis RA decreases cell proliferation, increases cell differentiation, and increases apoptosis. Induction of apoptosis correlates with an increase in tissue transglutaminase (type II) activity. In vivo, 9-cis RA induces complete tumor regression of an early passage human lip squamous cell carcinoma xenograft. Finally, 9-cis RA inhibits the anchorage-independent growth of the human breast cancer cell lines MCF-7 and LY2 (an antiestrogen-resistant MCF-7 variant). Transient co-transfection assays indicate that 9-cis RA inhibits estrogen receptor transcription of an ERE-tk-LUC reporter through RAR or RXR receptors. These data suggest that retinoid receptors can antagonize estrogen-dependent transcription and provides one possible mechanism for the inhibition of cell growth by 9-cis RA in breast cancer cell lines. In summary, these findings present evidence that 9-cis RA has a wide range of activities in human cancer models.

  3. Simultaneous analysis of retinol, all-trans- and 13-cis-retinoic acid and 13-cis-4-oxoretinoic acid in plasma by liquid chromatography using on-column concentration after single-phase fluid extraction.

    PubMed

    Teerlink, T; Copper, M P; Klaassen, I; Braakhuis, B J

    1997-06-20

    A reversed-phase high-performance liquid chromatographic method for the simultaneous analysis of retinol, all-trans-retinoic acid, 13-cis-retinoic acid and 13-cis-4-oxoretinoic acid in human plasma and cell culture medium is described. Sample preparation involves precipitation of proteins and extraction of retinoids with 60% acetonitrile. After centrifugation, the acetonitrile content of the supernatant is reduced to 45%, allowing on-column concentration of analytes. Injection volumes up to 2.0 ml (equivalent to 0.525 ml of sample) can be used without compromising chromatographic resolution of all-trans-retinoic acid and 13-cis-retinoic acid. Retinoids were stable in this extract and showed no isomerization when stored in the dark in a cooled autosampler, allowing automated analysis of large series of samples. Recoveries from spiked plasma samples were between 95 and 103%. Although no internal standard was used, the inter-assay precision for all retinoids was better than 6% and 4% at concentrations of 30 nM and 100 nM, respectively. The method is a valuable tool for the study of cellular metabolism of all-trans-retinoic acid, as polar metabolites of this compound can be detected with high sensitivity in cell culture media.

  4. Retinoid Receptors in Bone and Their Role in Bone Remodeling

    PubMed Central

    Henning, Petra; Conaway, H. Herschel; Lerner, Ulf H.

    2015-01-01

    Vitamin A (retinol) is a necessary and important constituent of the body which is provided by food intake of retinyl esters and carotenoids. Vitamin A is known best for being important for vision, but in addition to the eye, vitamin A is necessary in numerous other organs in the body, including the skeleton. Vitamin A is converted to an active compound, all-trans-retinoic acid (ATRA), which is responsible for most of its biological actions. ATRA binds to intracellular nuclear receptors called retinoic acid receptors (RARα, RARβ, RARγ). RARs and closely related retinoid X receptors (RXRα, RXRβ, RXRγ) form heterodimers which bind to DNA and function as ligand-activated transcription factors. It has been known for many years that hypervitaminosis A promotes skeleton fragility by increasing osteoclast formation and decreasing cortical bone mass. Some epidemiological studies have suggested that increased intake of vitamin A and increased serum levels of retinoids may decrease bone mineral density and increase fracture rate, but the literature on this is not conclusive. The current review summarizes how vitamin A is taken up by the intestine, metabolized, stored in the liver, and processed to ATRA. ATRA’s effects on formation and activity of osteoclasts and osteoblasts are outlined, and a summary of clinical data pertaining to vitamin A and bone is presented. PMID:25814978

  5. Maternal retinoids control type 3 innate lymphoid cells and set the offspring immunity

    NASA Astrophysics Data System (ADS)

    van de Pavert, Serge A.; Ferreira, Manuela; Domingues, Rita G.; Ribeiro, Hélder; Molenaar, Rosalie; Moreira-Santos, Lara; Almeida, Francisca F.; Ibiza, Sales; Barbosa, Inês; Goverse, Gera; Labão-Almeida, Carlos; Godinho-Silva, Cristina; Konijn, Tanja; Schooneman, Dennis; O'Toole, Tom; Mizee, Mark R.; Habani, Yasmin; Haak, Esther; Santori, Fabio R.; Littman, Dan R.; Schulte-Merker, Stefan; Dzierzak, Elaine; Simas, J. Pedro; Mebius, Reina E.; Veiga-Fernandes, Henrique

    2014-04-01

    The impact of nutritional status during fetal life on the overall health of adults has been recognized; however, dietary effects on the developing immune system are largely unknown. Development of secondary lymphoid organs occurs during embryogenesis and is considered to be developmentally programmed. Secondary lymphoid organ formation depends on a subset of type 3 innate lymphoid cells (ILC3) named lymphoid tissue inducer (LTi) cells. Here we show that mouse fetal ILC3s are controlled by cell-autonomous retinoic acid (RA) signalling in utero, which pre-sets the immune fitness in adulthood. We found that embryonic lymphoid organs contain ILC progenitors that differentiate locally into mature LTi cells. Local LTi cell differentiation was controlled by maternal retinoid intake and fetal RA signalling acting in a haematopoietic cell-autonomous manner. RA controlled LTi cell maturation upstream of the transcription factor RORγt. Accordingly, enforced expression of Rorgt restored maturation of LTi cells with impaired RA signalling, whereas RA receptors directly regulated the Rorgt locus. Finally, we established that maternal levels of dietary retinoids control the size of secondary lymphoid organs and the efficiency of immune responses in the adult offspring. Our results reveal a molecular link between maternal nutrients and the formation of immune structures required for resistance to infection in the offspring.

  6. Maternal retinoids control type 3 innate lymphoid cells and set the offspring immunity.

    PubMed

    van de Pavert, Serge A; Ferreira, Manuela; Domingues, Rita G; Ribeiro, Hélder; Molenaar, Rosalie; Moreira-Santos, Lara; Almeida, Francisca F; Ibiza, Sales; Barbosa, Inês; Goverse, Gera; Labão-Almeida, Carlos; Godinho-Silva, Cristina; Konijn, Tanja; Schooneman, Dennis; O'Toole, Tom; Mizee, Mark R; Habani, Yasmin; Haak, Esther; Santori, Fabio R; Littman, Dan R; Schulte-Merker, Stefan; Dzierzak, Elaine; Simas, J Pedro; Mebius, Reina E; Veiga-Fernandes, Henrique

    2014-04-03

    The impact of nutritional status during fetal life on the overall health of adults has been recognized; however, dietary effects on the developing immune system are largely unknown. Development of secondary lymphoid organs occurs during embryogenesis and is considered to be developmentally programmed. Secondary lymphoid organ formation depends on a subset of type 3 innate lymphoid cells (ILC3) named lymphoid tissue inducer (LTi) cells. Here we show that mouse fetal ILC3s are controlled by cell-autonomous retinoic acid (RA) signalling in utero, which pre-sets the immune fitness in adulthood. We found that embryonic lymphoid organs contain ILC progenitors that differentiate locally into mature LTi cells. Local LTi cell differentiation was controlled by maternal retinoid intake and fetal RA signalling acting in a haematopoietic cell-autonomous manner. RA controlled LTi cell maturation upstream of the transcription factor RORγt. Accordingly, enforced expression of Rorgt restored maturation of LTi cells with impaired RA signalling, whereas RA receptors directly regulated the Rorgt locus. Finally, we established that maternal levels of dietary retinoids control the size of secondary lymphoid organs and the efficiency of immune responses in the adult offspring. Our results reveal a molecular link between maternal nutrients and the formation of immune structures required for resistance to infection in the offspring.

  7. Hyperlipidemia secondary to acitretin therapy for lamellar ichthyosis associated with a NIPAL4 mutation improves on a plant-based diet and relapses on a standard Western diet.

    PubMed

    Lin, Jonathan C; Massera, Daniele; Ghalib, Mohammad; Marion, Robert; Graf, Lauren; Cohen, Steven R; Ostfeld, Robert J

    2018-04-01

    Oral retinoids are commonly prescribed for many dermatological conditions and may induce hyperlipidemia. We document the case of a 35-year-old man taking acitretin for congenital lamellar ichthyosis associated with a homozygous deleterious mutation in NIPAL4 who developed retinoid-induced hyperlipidemia that responded dramatically to a whole-food plant-based (WFPB) diet. On presentation, his diet consisted of chicken, fish, low fat meats and dairy, grains, and some fruits and vegetables. He then adopted a WFPB diet without making changes to his medications. His serum lipid levels dropped and his exercise capacity improved. Five months later, after discontinuing the plant-based diet and returning to his baseline diet, his hyperlipidemia returned and persisted despite adjustments to his medications. After a year and a half, the patient again adopted a plant-based diet and his lipid levels fell sharply again. A WFPB diet helped improve and control serum lipid levels in a patient with retinoid-induced hyperlipidemia. Future interventions should focus on ways to help patients successfully adopt and maintain a WFPB diet, as increased adherence to a healthy lifestyle is associated with greater health benefits. Copyright © 2018 European Society for Clinical Nutrition and Metabolism. Published by Elsevier Ltd. All rights reserved.

  8. Molecular characterization and gene expression patterns of retinoid receptors, in normal and regenerating tissues of the sea cucumber, Holothuria glaberrima.

    PubMed

    Viera-Vera, Jorge; García-Arrarás, José E

    2018-05-15

    Retinoic acid receptors (RAR) and retinoid X receptors (RXR) are ligand-mediated transcription factors that synchronize intricate signaling networks in metazoans. Dimer formation between these two nuclear receptors mediates the recruitment of co-regulatory complexes coordinating the progression of signaling cascades during developmental and regenerative events. In the present study we identified and characterized the receptors for retinoic acid in the sea cucumber Holothuria glaberrima; a model system capable of regenerative organogenesis during adulthood. Molecular characterizations revealed the presence of three isoforms of RAR and two of RXR as a consequence of alternative splicing events. Various analyses including: primary structure sequencing, phylogenetic analysis, protein domain prediction, and multiple sequence alignment further confirmed their identity. Semiquantitative reverse transcription PCR analysis of each receptor isoform herein identified showed that the retinoid receptors are expressed in all tissues sampled: the mesenteries, respiratory trees, muscles, gonads, and the digestive tract. During regenerative organogenesis two of the receptors (RAR-L and RXR-T) showed differential expression in the posterior segment while RAR-S is differentially expressed in the anterior segment of the intestine. This work presents the first description of the components relaying the signaling for retinoic acid within this model system. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Mesodermal and neuronal retinoids regulate the induction and maintenance of limb innervating spinal motor neurons.

    PubMed

    Ji, Sheng-Jian; Zhuang, BinQuan; Falco, Crystal; Schneider, André; Schuster-Gossler, Karin; Gossler, Achim; Sockanathan, Shanthini

    2006-09-01

    During embryonic development, the generation, diversification and maintenance of spinal motor neurons depend upon extrinsic signals that are tightly regulated. Retinoic acid (RA) is necessary for specifying the fates of forelimb-innervating motor neurons of the Lateral Motor Column (LMC), and the specification of LMC neurons into medial and lateral subtypes. Previous studies implicate motor neurons as the relevant source of RA for specifying lateral LMC fates at forelimb levels. However, at the time of LMC diversification, a significant amount of retinoids in the spinal cord originates from the adjacent paraxial mesoderm. Here we employ mouse genetics to show that RA derived from the paraxial mesoderm is required for lateral LMC induction at forelimb and hindlimb levels, demonstrating that mesodermally synthesized RA functions as a second source of signals to specify lateral LMC identity. Furthermore, reduced RA levels in postmitotic motor neurons result in a decrease of medial and lateral LMC neurons, and abnormal axonal projections in the limb; invoking additional roles for neuronally synthesized RA in motor neuron maintenance and survival. These findings suggest that during embryogenesis, mesodermal and neuronal retinoids act coordinately to establish and maintain appropriate cohorts of spinal motor neurons that innervate target muscles in the limb.

  10. The interphotoreceptor retinoid binding protein gene in therian mammals: Implications for higher level relationships and evidence for loss of function in the marsupial mole

    PubMed Central

    Springer, Mark S.; Burk, Angela; Kavanagh, John R.; Waddell, Victor G.; Stanhope, Michael J.

    1997-01-01

    The subclass Theria of Mammalia includes marsupials (infraclass Metatheria) and placentals (infraclass Eutheria). Within each group, interordinal relationships remain unclear. One limitation of many studies is incomplete ordinal representation. Here, we analyze DNA sequences for part of exon 1 of the interphotoreceptor retinoid binding protein gene, including 10 that are newly reported, for representatives of all therian orders. Among placentals, the most robust clades are Cetartiodactyla, Paenungulata, and an expanded African clade that includes paenungulates, tubulidentates, and macroscelideans. Anagalida, Archonta, Altungulata, Hyracoidea + Perissodactyla, Ungulata, and the “flying primate” hypothesis are rejected by statistical tests. Among marsupials, the most robust clade includes all orders except Didelphimorphia. The phylogenetic placement of the monito del monte and the marsupial mole remains unclear. However, the marsupial mole sequence contains three frameshift indels and numerous stop codons in all three reading frames. Given that the interphotoreceptor retinoid binding protein gene is a single-copy gene that functions in the visual cycle and that the marsupial mole is blind with degenerate eyes, this finding suggests that phenotypic degeneration of the eyes is accompanied by parallel changes at the molecular level as a result of relaxed selective constraints. PMID:9391099

  11. RARα-PLZF overcomes PLZF-mediated repression of CRABPI, contributing to retinoid resistance in t(11;17) acute promyelocytic leukemia

    PubMed Central

    Guidez, Fabien; Parks, Sarah; Wong, Henna; Jovanovic, Jelena V.; Mays, Ashley; Gilkes, Amanda F.; Mills, Kenneth I.; Guillemin, Marie-Claude; Hobbs, Robin M.; Pandolfi, Pier Paolo; de Thé, Hugues; Solomon, Ellen; Grimwade, David

    2007-01-01

    Leukemia-associated chimeric oncoproteins often act as transcriptional repressors, targeting promoters of master genes involved in hematopoiesis. We show that CRABPI (encoding cellular retinoic acid binding protein I) is a target of PLZF, which is fused to RARα by the t(11;17)(q23;q21) translocation associated with retinoic acid (RA)-resistant acute promyelocytic leukemia (APL). PLZF represses the CRABPI locus through propagation of chromatin condensation from a remote intronic binding element culminating in silencing of the promoter. Although the canonical, PLZF-RARα oncoprotein has no impact on PLZF-mediated repression, the reciprocal translocation product RARα-PLZF binds to this remote binding site, recruiting p300, inducing promoter hypomethylation and CRABPI gene up-regulation. In line with these observations, RA-resistant murine PLZF/RARα+RARα/PLZF APL blasts express much higher levels of CRABPI than standard RA-sensitive PML/RARα APL. RARα-PLZF confers RA resistance to a retinoid-sensitive acute myeloid leukemia (AML) cell line in a CRABPI-dependent fashion. This study supports an active role for PLZF and RARα-PLZF in leukemogenesis, identifies up-regulation of CRABPI as a mechanism contributing to retinoid resistance, and reveals the ability of the reciprocal fusion gene products to mediate distinct epigenetic effects contributing to the leukemic phenotype. PMID:18000064

  12. Retinoic Acid Isomers Up-Regulate ATP Binding Cassette A1 and G1 and Cholesterol Efflux in Rat Astrocytes: Implications for Their Therapeutic and Teratogenic Effects

    PubMed Central

    Chen, Jing; Costa, Lucio G.

    2011-01-01

    Recent studies suggest that retinoids may be effective in the treatment of Alzheimer's disease, although exposure to an excess of retinoids during gestation causes teratogenesis. Cholesterol is essential for brain development, but high levels of cholesterol have been associated with Alzheimer's disease. We hypothesized that retinoic acid may affect cholesterol homeostasis in rat astrocytes, which regulate cholesterol distribution in the brain, through the up-regulation of cholesterol transporters ATP binding cassette (Abc)a1 and Abcg1. Tretinoin, 13-cis retinoic acid (13-cis-RA), 9-cis-RA, and the selective retinoid X receptor (RXR) agonist methoprene significantly increased cholesterol efflux induced by cholesterol acceptors and protein levels of Abca1 by 2.3- (±0.25), 3.6- (±0.42), 4.1- (±0.5), and 1.75- (±0.43) fold, respectively, and Abcg1 by 2.1- (±0.26), 2.2- (±0.33), 2.5- (±0.23), and 2.2- (±0.21) fold, respectively. 13-cis-RA and 9-cis-RA also significantly increased mRNA levels of Abca1 (maximal induction 7.3 ± 0.42 and 2.7 ± 0.17, respectively) and Abcg1 (maximal induction 2.0 ± 0.18 and 1.8 ± 0.09, respectively), and the levels of membrane-bound Abca1 (2.5 ± 0.3 and 2.5 ± 0.40-fold increase, respectively), whereas they significantly decreased intracellular cholesterol content without affecting cholesterol synthesis. The effect of 9-cis-RA on cholesterol homeostasis in astrocytes can be ascribed to the activation of RXR, whereas the effects of 13-cis-RA and tretinoin were independent of either RXRs or retinoic acid receptors. These findings suggest that retinoids affect cholesterol homeostasis in astrocytes and that this effect may be involved in both their therapeutic and teratogenic actions. PMID:21628419

  13. A role for retinoids in human oocyte fertilization: regulation of connexin 43 by retinoic acid in cumulus granulosa cells

    PubMed Central

    Best, Monica W.; Wu, Juanjuan; Pauli, Samuel A.; Kane, Maureen A.; Pierzchalski, Keely; Session, Donna R.; Woods, Dori C.; Shang, Weirong; Taylor, Robert N.; Sidell, Neil

    2015-01-01

    Retinoids are essential for ovarian steroid production and oocyte maturation in mammals. Oocyte competency is known to positively correlate with efficient gap junction intercellular communication (GJIC) among granulosa cells in the cumulus-oocyte complex. Connexin 43 (Cx43) is the main subunit of gap junction channels in human cumulus granulosa cells (CGC) and is regulated by all-trans retinoic acid (ATRA) in other hormone responsive cell types. The objectives of this study were to quantify retinoid levels in human CGC obtained during IVF oocyte retrievals, to investigate the potential relationship between CGC ATRA levels and successful oocyte fertilization, and to determine the effects of ATRA on Cx43 protein expression in CGC. Results showed that CGC cultures actively metabolize retinol to produce ATRA. Grouped according to fertilization rate tertiles, mean ATRA levels were 2-fold higher in pooled CGC from women in the highest versus the lowest tertile (P < 0.05). ATRA induced a rapid dephosphorylation of Cx43 in CGC and granulosa cell line (KGN) cultures resulting in a >2-fold increase in the expression of the functional non-phosphorylated (P0) species (P < 0.02). Similar enhancement of P0 by ATRA was shown in CGC and KGN cultures co-treated with LH or hCG which, by themselves, enhanced the protein levels of Cx43 without altering its phosphorylation profile. Correspondingly, the combination of ATRA+hCG treatment of KGN caused a significant increase in GJIC compared with single agent treatments (P < 0.025) and a doubling of GJIC from that seen in untreated cells (P < 0.01). These findings indicate that CGC are a primary site of retinoid uptake and ATRA biosynthesis. Regulation of Cx43 by ATRA may serve an important role in folliculogenesis, development of oocyte competency, and successful fertilization by increasing GJIC in CGC. PMID:25877907

  14. All-trans-retinoic Acid Modulates the Plasticity and Inhibits the Motility of Breast Cancer Cells: ROLE OF NOTCH1 AND TRANSFORMING GROWTH FACTOR (TGFβ).

    PubMed

    Zanetti, Adriana; Affatato, Roberta; Centritto, Floriana; Fratelli, Maddalena; Kurosaki, Mami; Barzago, Maria Monica; Bolis, Marco; Terao, Mineko; Garattini, Enrico; Paroni, Gabriela

    2015-07-17

    All-trans-retinoic acid (ATRA) is a natural compound proposed for the treatment/chemoprevention of breast cancer. Increasing evidence indicates that aberrant regulation of epithelial-to-mesenchymal transition (EMT) is a determinant of the cancer cell invasive and metastatic behavior. The effects of ATRA on EMT are largely unknown. In HER2-positive SKBR3 and UACC812 cells, showing co-amplification of the ERBB2 and RARA genes, ATRA activates a RARα-dependent epithelial differentiation program. In SKBR3 cells, this causes the formation/reorganization of adherens and tight junctions. Epithelial differentiation and augmented cell-cell contacts underlie the anti-migratory action exerted by the retinoid in cells exposed to the EMT-inducing factors EGF and heregulin-β1. Down-regulation of NOTCH1, an emerging EMT modulator, is involved in the inhibition of motility by ATRA. Indeed, the retinoid blocks NOTCH1 up-regulation by EGF and/or heregulin-β1. Pharmacological inhibition of γ-secretase and NOTCH1 processing also abrogates SKBR3 cell migration. Stimulation of TGFβ contributes to the anti-migratory effect of ATRA. The retinoid switches TGFβ from an EMT-inducing and pro-migratory determinant to an anti-migratory mediator. Inhibition of the NOTCH1 pathway not only plays a role in the anti-migratory action of ATRA; it is relevant also for the anti-proliferative activity of the retinoid in HCC1599 breast cancer cells, which are addicted to NOTCH1 for growth/viability. This effect is enhanced by the combination of ATRA and the γ-secretase inhibitor N-(N-(3,5-difluorophenacetyl)-l-alanyl)-S-phenylglycine t-butyl ester, supporting the concept that the two compounds act at the transcriptional and post-translational levels along the NOTCH1 pathway. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Retinoids in pediatric onco-hematology: the model of acute promyelocytic leukemia and neuroblastoma.

    PubMed

    Masetti, Riccardo; Biagi, Carlotta; Zama, Daniele; Vendemini, Francesca; Martoni, Anna; Morello, William; Gasperini, Pietro; Pession, Andrea

    2012-09-01

    Retinoids are lipophilic compounds derived from vitamin A, which have been extensively studied in cancer prevention and therapy. In pediatric oncology, they are successfully used for the treatment of acute promyelocytic leukemia (APL) and high-risk neuroblastoma (HR-NBL). APL is a subtype of acute myeloid leukemia (AML) clinically characterized by a severe bleeding tendency with a highrisk of fatal hemorrhage. The molecular hallmark of this disease is the presence of the promyelocytic leukemia (PML)-retinoic acid receptor-α (RAR α) gene fusion that plays a critical role in promyelocytic leukemogenesis and represents the target of retinoid therapy. The introduction in the late 1980s of all-trans retinoic acid (ATRA) into the therapy of APL radically changed the management and the outcome of this disease. Presently, the standard front-line therapeutic approach for pediatric APL includes anthracycline-based chemotherapy and ATRA, leading to a complete remission in almost 90% of the patients. Neuroblastoma (NBL) is an aggressive childhood tumor derived from the peripheral neural crest. More than half of patients have a high-risk disease, with a poor outcome despite intensive multimodal treatment. Although the exact mechanism of action remains unclear, the introduction of 13-cis-retinoic acid (13-cis-RA) in the therapy of NBL has improved the prognosis of this disease. Currently, the standard treatment for HR-NBL consists of myeloablative therapy followed by autologous hematopoietic stem cell transplantation (HSCT) and maintenance with 13-cis-RA for the treatment of minimal residual disease, leading to a 3-year disease-free survival rate (DFS) of about 50%. In this paper the authors provide a review of the peer-reviewed literature on the role of retinoids in the treatment of pediatric APL and HR-NBL, summarizing the most relevant clinical trial results of the last decades, analyzing the ongoing trials, and investigating future therapeutic perspectives of children affected by these diseases.

  16. Embryonic subcellular distribution of 13-cis- and all-trans-retinoic acid indicates differential cytosolic/nuclear localization.

    PubMed

    Rühl, R; Plum, C; Elmazar, M M; Nau, H

    2001-09-01

    Isotretinoin (13-cis-retinoic acid [13CRA], Accutane) is used for the treatment of dermatological diseases. Isotretinoin is, however, teratogenic in animals and humans. The mechanism of action of its teratogenicity is still not clearly identified. It has little or no binding properties to cytosolic retinoid-binding proteins or nuclear retinoid receptors (RAR, RXR). One hypothesis is that the teratogenicity of 2 approximately equipotent teratogenic doses of 13CRA and all-trans-retinoic acids (ATRA) could mainly be correlated to ATRA in the nuclei, where the retinoic acid receptors (RARs) are located. To test this hypothesis, female mice at gestational day 11 were treated with approximately equipotent teratogenic doses of 13-cis-retinoic acid (100 mg/kg orally) or all-trans-retinoic acid (10 mg/kg orally) and sacrificed 1 h and 4 h after administration. Embryos were homogenized and centrifuged into 4 fractions, and the purity of the fractions was tested by quantification of marker constituents for various cell compartments. We analyzed, by RP-HPLC, nuclear, mitochondrial, microsomal, and cytosolic fractions, as well as embryo homogenate and maternal plasma. After treatment with 13-cis-retinoic acid, this substance was mainly located in the nuclear fraction of the embryo (approximately 82%), whereas all-trans-retinoic acid, after ATRA treatment, was mainly located in the cytosolic supernatant (approximately 64%). The binding to cellular retinoid-binding protein (CRABP) may limit the access of ATRA to the nucleus, in contrast to 13CRA, which does not bind to CRABP. The concentration of ATRA in the nuclear fraction was similar after administration of either 13CRA or ATRA. The teratogenic activity of 13-cis-retinoic acid could therefore be explained by its access to the nucleus and its possible conversion to all-trans-retinoic acids, which will interact with the nuclear retinoid receptors.

  17. Comparative teratology and transplacental pharmacokinetics of all-trans-retinoic acid, 13-cis-retinoic acid, and retinyl palmitate following daily administrations in rats.

    PubMed

    Collins, M D; Tzimas, G; Hummler, H; Bürgin, H; Nau, H

    1994-07-01

    The retinoids are teratogenic in a wide variety of species. In the rat, 13-cis-retinoic acid and retinyl palmitate are significantly less potent teratogens than all-trans-retinoic acid. This investigation questioned whether differing teratogenic potencies of these moieties can be correlated with the concentrations of these drugs and/or metabolites in the embryonic compartment. Approximately equipotent teratogenic doses of these three retinoids were administered and the pharmacokinetics in maternal plasma and embryo of the most prevalent vitamin A metabolites were measured. The glucuronides of the respective retinoids were the predominant metabolites in the maternal plasma, but were not detected in the embryo. Also, the transport of 13-cis-retinoic acid across the placenta occurred to a much lesser extent than the transport of all-trans-retinoic acid. Administration of either all-trans- or 13-cis-retinoic acid causes a depression in the endogenous retinol concentration. This depression is more pronounced in the maternal plasma than in the embryo. The depression of the retinol level in both plasma and embryo after 13-cis-retinoic acid administration (75 mg/kg/day) was greater than the depression after all-trans-retinoic acid (6 mg/kg/day), corroborating the inferential teratological data that the 13-cis-retinoic acid dose was more embryotoxic than the all-trans-retinoic acid dose. Although the dose of all-trans-retinoic acid was less embryotoxic than that of either 13-cis-retinoic acid or retinyl palmitate, the embryonic exposure to all-trans-retinoic acid was considerably larger, as determined by maximum concentration or area under the concentration-versus-time curve, after administration of all-trans-retinoic acid than after either retinyl palmitate or 13-cis-retinoic acid application. These results suggest that embryonic retinoids other than all-trans-retinoic acid--including the administered substances themselves--are important in the teratogenic process induced by 13-cis-retinoic acid and retinyl palmitate.

  18. Hypervitaminosis A is prevalent in children with CKD and contributes to hypercalcemia.

    PubMed

    Manickavasagar, Baheerathi; McArdle, Andrew J; Yadav, Pallavi; Shaw, Vanessa; Dixon, Marjorie; Blomhoff, Rune; Connor, Graeme O'; Rees, Lesley; Ledermann, Sarah; Van't Hoff, William; Shroff, Rukshana

    2015-02-01

    Vitamin A accumulates in renal failure, but the prevalence of hypervitaminosis A in children with predialysis chronic kidney disease (CKD) is not known. Hypervitaminosis A has been associated with hypercalcemia. In this study we compared dietary vitamin A intake with serum retinoid levels and their associations with hypercalcemia. We studied the relationship between vitamin A intake, serum retinoid levels, and serum calcium in 105 children with CKD stages 2-5 on dialysis and posttransplant. Serum retinoid measures included retinol (ROH), its active retinoic acid (RA) metabolites [all-trans RA (at-RA) and 13-cis RA] and carrier proteins [retinol-binding protein-4 (RBP4) and transthyretin (TTR)]. Dietary vitamin A intake was assessed using a food diary. Twenty-five children were in CKD 2-3, 35 in CKD 4-5, 23 on dialysis and 22 posttransplant; 53 % had vitamin A intake above the Reference Nutrient Intake (RNI) value. Children receiving supplemental feeds compared with diet alone had higher vitamin A intake (p = 0.02) and higher serum ROH (p < 0.001). Notably, increased ROH was seen as early as CKD stage 2. For every 10 ml/min/1.73 m(2) fall in estimated glomerular filtration rate (eGFR), there was a 13 % increase in ROH. RBP4 levels were increased in CKD 3-5 and dialysis patients. The lowest ratios of ROH:RBP4 were seen in dialysis compared with CKD 2-3 (p = 0.03), suggesting a relative increase in circulating RBP4. Serum ROH, RBP4 and at-RA were associated with serum calcium. On multivariable analysis RBP4 levels and alfacalcidol dose were significant predictors of serum calcium (model R (2) 32 %) in dialysis patients. Hypervitaminosis A is seen in early CKD, with highest levels in children on supplemental feeds compared with diet alone. Serum retinoid levels significantly predict hypercalcemia.

  19. Design of selective nuclear receptor modulators: RAR and RXR as a case study.

    PubMed

    de Lera, Angel R; Bourguet, William; Altucci, Lucia; Gronemeyer, Hinrich

    2007-10-01

    Retinoic acid receptors (RARs) and retinoid X receptors (RXRs) are members of the nuclear receptor superfamily whose effects on cell growth and survival can be modulated therapeutically by small-molecule ligands. Although compounds that target these receptors are powerful anticancer drugs, their use is limited by toxicity. An improved understanding of the structural biology of RXRs and RARs and recent advances in the chemical synthesis of modified retinoid and rexinoid ligands should enable the rational design of more selective agents that might overcome such problems. Here, we review structural data for RXRs and RARs, discuss strategies in the design of selective RXR and RAR modulators, and consider lessons that can be learned for the design of selective nuclear-receptor modulators in general.

  20. Reversal of skin aging with topical retinoids.

    PubMed

    Hubbard, Bradley A; Unger, Jacob G; Rohrich, Rod J

    2014-04-01

    Topical skin care and its place in plastic surgery today are often overlooked by clinicians formulating a plan for facial rejuvenation. Not only is it important to consider topical skin care as part of comprehensive care, but clinicians should also be educated with the data available in today's literature. This review aims to familiarize the reader with the biological processes of skin aging and evidence-based clinical outcomes afforded by various topical therapies. Furthermore, this review will focus on solar damage, the value of retinoids, and how they can be used in conjunction with forms of treatment such as chemical peel, dermabrasion, and lasers. Finally, guidelines will be provided to help the physician administer appropriate skin care based on the data presented.

  1. [Treatment of acne with consequences -- pseudotumor cerebri due to hypervitaminosis A].

    PubMed

    Meyer-Heim, A; Landau, K; Boltshauser, E

    2002-01-09

    Pseudotumor cerebri (PTC) is an entity characterized by elevated intracranial pressure of probably multifactoral origin, but most cases remain idiopathic. We report a 15-year-old girl with PTC due to prolonged consumption of Arovit (Vitamin A) for treatment of acne. The diagnosis was established by measuring raised cerebrospinal fluid pressure after an intracranial mass lesion and dural venous sinsus thrombosis were excluded. The increased level of vitamin A confirmed the diagnosis of hypervitaminosis A as the causative pathogen. The patient was treated with lumbar punctures and acetazolamide (Diamox). PTC due to hypervitaminosis A is a serious complication, which can cause permanent visual impairment. Patients treated with retinoids require proper surveillance. The elevated serum level of retinoids after withdrawal may persist for weeks.

  2. Recurrent Glioblastoma Multiforme (grade IV - WHO 2007): a case of complete objective response - concomitant administration of Somatostatin / Octreotide, Retinoids, Vit E, Vit D3, Vit C, Melatonin, D2 R agonists (Di Bella Method.

    PubMed

    Di Bella, Giuseppe; Leci, Jovan; Ricchi, Alessandro; Toscano, Rosilde

    2015-01-01

    In a 41 year old man, with Glioblastoma Multiforme (Grade IV - WHO 2007) and loco-regional recurrence, treated conventionally with surgery, radio-therapy and Temolozomide, a complete objective response was subsequently achieved by means of the well-tolerated concomitant administration of Somatostatin + slow-release Octreotide, Melatonin, Retinoids solubilized in Vitamin E, Vit D3, Vit C, D2 R agonists, and Temolozomide. In addition to the positive and previously unreported therapeutic finding, this result allowed the patient to avoid further surgical trauma and the correlated risks, achieving an excellent quality of life and working capacity.

  3. RAR/RXR and PPAR/RXR Signaling in Spinal Cord Injury

    PubMed Central

    van Neerven, Sabien; Mey, Jörg

    2007-01-01

    The retinoid acid receptors (RAR) and peroxisome proliferator-activated receptors (PPAR) have been implicated in the regulation of inflammatory reactions. Both receptor families contain ligand-activated transcription factors which form heterodimers with retinoid X receptors (RXR). We review data that imply RAR/RXR and PPAR/RXR pathways in physiological reactions after spinal cord injury. Experiments show how RAR signaling may improve axonal regeneration and modulate reactions of glia cells. While anti-inflammatory properties of PPAR are well documented in the periphery, their possible roles in the central nervous system have only recently become evident. Due to its anti-inflammatory function this transcription factor family promises to be a useful target after spinal cord or brain lesions. PMID:18060014

  4. Carotenoids and Retinoids: Nomenclature, Chemistry, and Analysis.

    PubMed

    Harrison, Earl H; Curley, Robert W

    Carotenoids are polyenes synthesized in plants and certain microorganisms and are pigments used by plants and animals in various physiological processes. Some of the over 600 known carotenoids are capable of metabolic conversion to the essential nutrient vitamin A (retinol) in higher animals. Vitamin A also gives rise to a number of other metabolites which, along with their analogs, are known as retinoids. To facilitate discussion about these important molecules, a nomenclature is required to identify specific substances. The generally accepted rules for naming these important molecules have been agreed to by various Commissions of the International Union of Pure and Applied Chemistry and International Union of Biochemistry. These naming conventions are explained along with comparisons to more systematic naming rules that apply for these organic chemicals. Identification of the carotenoids and retinoids has been advanced by their chemical syntheses, and here, both classical and modern methods for synthesis of these molecules, as well as their analogs, are described. Because of their importance in biological systems, sensitive methods for the detection and quantification of these compounds from various sources have been essential. Early analyses that relied on liquid adsorption and partition chromatography have given way to high-performance liquid chromatography (HPLC) coupled with various detection methods. The development of HPLC coupled to mass spectrometry, particularly LC/MS-MS with Multiple Reaction Monitoring, has resulted in the greatest sensitivity and specificity in these analyses.

  5. Selective ligand activity at Nur/retinoid X receptor complexes revealed by dimer-specific bioluminescence resonance energy transfer-based sensors

    PubMed Central

    Giner, Xavier C; Cotnoir-White, David; Mader, Sylvie; Lévesque, Daniel

    2017-01-01

    Retinoid X receptors (RXR) play a role as master regulators due to their capacity to form heterodimers with other nuclear receptors. Accordingly, retinoid signaling is involved in multiple biological processes, including development, cell differentiation, metabolism and cell death. However, the role and functions of RXR in different heterodimer complexes remain unsolved, mainly because most RXR drugs (called rexinoids) are not selective to specific heterodimer complexes. This also strongly limits the use of rexinoids for specific therapeutic approaches. In order to better characterize rexinoids at specific nuclear receptor complexes, we have developed and optimized luciferase protein complementation-based Bioluminescence Resonance Energy Transfer (BRET) assays, which can directly measure recruitment of a co-activator motif fused to yellow fluorescent protein (YFP) by specific nuclear receptor dimers. To validate the assays, we compared rexinoid modulation of co-activator recruitment by RXR homodimer, and heterodimers Nur77/RXR and Nurr1/RXR. Results reveal that some rexinoids display selective co-activator recruitment activities with homo- or hetero-dimer complexes. In particular, SR11237 (BMS649) has increased potency for recruitment of co-activator motif and transcriptional activity with the Nur77/RXR heterodimer compared to other complexes. This technology should prove useful to identify new compounds with specificity for individual dimeric species formed by nuclear receptors. PMID:26148973

  6. Increased uptake of dietary retinoids at the maternal-fetal barrier in the nitrofen model of congenital diaphragmatic hernia.

    PubMed

    Kutasy, Balazs; Friedmacher, Florian; Pes, Lara; Paradisi, Francesca; Puri, Prem

    2014-06-01

    The retinol signaling pathway is disrupted in congenital diaphragmatic hernia (CDH). Since there is no fetal retinol synthesis, maternal retinol has to cross the placenta. Nitrofen interferes with the retinol-binding protein (RBP) transfer pathway in CDH. However, in RBP knockout mice, retinol has been shown to be present. In this model, increased uptake of maternal dietary retinyl ester (RE) bounded in low-dense-lipoprotein (LDL) through low-density-lipoprotein-receptor 1 (LRP1) and increased activity of RE hydrolysis by lipoprotein-lipase (LPL) have been found. The aim of this study was to investigate the RE transfer pathway in the nitrofen CDH model. Pregnant rats were treated with nitrofen or vehicle on gestational day (D9) and sacrificed on D21. Immunohistochemistry was performed to evaluate LRP1 and LPL protein expression. Serum LDL levels were measured by ELISA. Pulmonary and serum retinoid levels were measured using HPLC. Markedly increased trophoblastic and pulmonary LRP1 and LPL immunoreactivity were observed in CDH compared to controls. Significantly increased serum LDL and RE levels were observed in CDH compared to controls. The increased uptake of dietary retinoids at the maternal-fetal barrier in the nitrofen CDH model suggests that the RE transfer pathway may be the main source of retinol in this model. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Ligand recognition by RAR and RXR receptors: binding and selectivity.

    PubMed

    Sussman, Fredy; de Lera, Angel R

    2005-10-06

    Fundamental biological functions, most notably embriogenesis, cell growth, cell differentiation, and cell apoptosis, are in part regulated by a complex genomic network that starts with the binding (and activation) of retinoids to their cognate receptors, members of the superfamily of nuclear receptors. We have studied ligand recognition of retinoic receptors (RXRalpha and RARgamma) using a molecular-mechanics-based docking method. The protocol used in this work is able to rank the affinity of pairs of ligands for a single retinoid receptor, the highest values corresponding to those that adapt better to the shape of the binding site and generate the optimal set of electrostatic and apolar interactions with the receptor. Moreover, our studies shed light onto some of the energetic contributions to retinoid receptor ligand selectivity. In this regard we show that there is a difference in polarity between the binding site regions that anchor the carboxylate in RAR and RXR, which translates itself into large differences in the energy of interaction of both receptors with the same ligand. We observe that the latter energy change is canceled off by the solvation energy penalty upon binding. This energy compensation is borne out as well by experiments that address the effect of site-directed mutagenesis on ligand binding to RARgamma. The hypothesis that the difference in binding site polarity might be exploited to build RXR-selective ligands is tested with some compounds having a thiazolidinedione anchoring group.

  8. Allergen-induced dermatitis causes alterations in cutaneous retinoid-mediated signaling in mice.

    PubMed

    Gericke, Janine; Ittensohn, Jan; Mihály, Johanna; Dubrac, Sandrine; Rühl, Ralph

    2013-01-01

    Nuclear receptor-mediated signaling via RARs and PPARδ is involved in the regulation of skin homeostasis. Moreover, activation of both RAR and PPARδ was shown to alter skin inflammation. Endogenous all-trans retinoic acid (ATRA) can activate both receptors depending on specific transport proteins: Fabp5 initiates PPARδ signaling whereas Crabp2 promotes RAR signaling. Repetitive topical applications of ovalbumin (OVA) in combination with intraperitoneal injections of OVA or only intraperitoneal OVA applications were used to induce allergic dermatitis. In our mouse model, expression of IL-4, and Hbegf increased whereas expression of involucrin, Abca12 and Spink5 decreased in inflamed skin, demonstrating altered immune response and epidermal barrier homeostasis. Comprehensive gene expression analysis showed alterations of the cutaneous retinoid metabolism and retinoid-mediated signaling in allergic skin immune response. Notably, ATRA synthesis was increased as indicated by the elevated expression of retinaldehyde dehydrogenases and increased levels of ATRA. Consequently, the expression pattern of genes downstream to RAR was altered. Furthermore, the increased ratio of Fabp5 vs. Crabp2 may indicate an up-regulation of the PPARδ pathway in allergen-induced dermatitis in addition to the altered RAR signaling. Thus, our findings suggest that ATRA levels, RAR-mediated signaling and signaling involved in PPARδ pathways are mainly increased in allergen-induced dermatitis and may contribute to the development and/or maintenance of allergic skin diseases.

  9. Age-related change in the retinoid X receptor beta gene expression in peripheral blood mononuclear cells of healthy volunteers: effect of 13-cis retinoic acid supplementation.

    PubMed

    Brtko, J; Rock, E; Nezbedova, P; Krizanova, O; Dvorcakova, M; Minet-Quinard, R; Farges, M-C; Ribalta, J; Winklhofer-Roob, B M; Vasson, M-P; Macejova, D

    2007-01-01

    The regulation of cell growth and differentiation and also expression of a number of genes by retinoids are mediated by nuclear retinoid receptors (RARs and/or RXRs). In this study we investigated age-related alteration in both RAR and RXR receptor subtypes gene expression and tissue transglutaminase (tTG) activity before and after supplementation with 13-cis retinoic acid (13cRA) in human peripheral blood mononuclear cells (PBMCs). Healthy men (40) were divided in two groups according to their age (young group: 26.1+/-4.1 years and old group: 65.4+/-3.8 years). Each volunteer received 13cRA (Curacné), 0.5mg/(kgday)) during a period of 4 weeks. We have shown that RXRbeta expression was decreased significantly (p=0.0108) in PBMCs of elderly men when compared to that of young volunteers. Distribution of retinoic acid receptor subtype expression in PBMCs was found in the order: RXRbeta>RARgamma>RXRalpha>RARalpha. The tTG activity in PBMCs reflected a trend to be enhanced after 13-cis retinoic acid supplementation. In conclusion, we demonstrate a significant decrease in the expression of RXRbeta subtype of rexinoid receptors in PBMCs of healthy elderly men. Our data suggest that in healthy elderly men reduction of RXRbeta expression in PBMCs might be a common feature of physiological senescence.

  10. Persistent behavioral effects following early life exposure to retinoic acid or valproic acid in zebrafish

    PubMed Central

    Bailey, Jordan M.; Oliveri, Anthony N.; Karbhari, Nishika; Brooks, Roy A.J.; De La Rocha, Amberlene J.; Janardhan, Sheila; Levin, Edward D.

    2015-01-01

    BACKGROUND Moderate to severe dysregulation in retinoid signaling during early development is associated with a constellation of physical malformations and/or neural tube defects, including spina bifida. It is thought that more subtle dysregulation of this system, which might be achievable via dietary (i.e. hypervitaminosis A) or pharmacological (i.e. valproic acid) exposure in humans, will manifest on behavioral domains including sociability, without overt physical abnormalities. METHODS During early life, zebrafish were exposed to low doses of two chemicals that disrupt retinoid signaling. From 0-5 dpf, larvae were reared in aqueous solutions containing retinoic acid (0, 0.02, 0.2 or 2 nM) or valproic acid (0, 0.5, 5.0 or 50 uM). One cohort of zebrafish was assessed using a locomotor activity screen at 6-dpf; another was reared to adulthood and assessed using a neurobehavioral test battery (startle habituation, novel tank exploration, shoaling, and predator escape/avoidance). RESULTS There was no significant increase in the incidence of physical malformation among exposed fish compared to controls. Both retinoic acid and valproic acid exposures during development disrupted larval activity with persisting behavioral alterations later in life, primarily manifesting as decreased social affiliation. CONCLUSIONS Social behavior and some aspects of motor function were altered in exposed fish; the importance of examining emotional or psychological consequences of early life exposure to retinoid acting chemicals is discussed. PMID:26439099

  11. A Case of AML Characterized by a Novel t(4;15)(q31;q22) Translocation That Confers a Growth-Stimulatory Response to Retinoid-Based Therapy

    PubMed Central

    Watts, Justin M.; Pereira, Lutecia; Fan, Yao-Shan; Brown, Geoffrey; Vega, Francisco; Swords, Ronan T.; Zelent, Arthur

    2017-01-01

    Here we report the case of a 30-year-old woman with relapsed acute myeloid leukemia (AML) who was treated with all-trans retinoic acid (ATRA) as part of investigational therapy (NCT02273102). The patient died from rapid disease progression following eight days of continuous treatment with ATRA. Karyotype analysis and RNA-Seq revealed the presence of a novel t(4;15)(q31;q22) reciprocal translocation involving the TMEM154 and RASGRF1 genes. Analysis of primary cells from the patient revealed the expression of TMEM154-RASGRF1 mRNA and the resulting fusion protein, but no expression of the reciprocal RASGRF1-TMEM154 fusion. Consistent with the response of the patient to ATRA therapy, we observed a rapid proliferation of t(4;15) primary cells following ATRA treatment ex vivo. Preliminary characterization of the retinoid response of t(4;15) AML revealed that in stark contrast to non-t(4;15) AML, these cells proliferate in response to specific agonists of RARα and RARγ. Furthermore, we observed an increase in the levels of nuclear RARγ upon ATRA treatment. In summary, the identification of the novel t(4;15)(q31;q22) reciprocal translocation opens new avenues in the study of retinoid resistance and provides potential for a new biomarker for therapy of AML. PMID:28696354

  12. Allergen-Induced Dermatitis Causes Alterations in Cutaneous Retinoid-Mediated Signaling in Mice

    PubMed Central

    Gericke, Janine; Ittensohn, Jan; Mihály, Johanna; Dubrac, Sandrine; Rühl, Ralph

    2013-01-01

    Nuclear receptor-mediated signaling via RARs and PPARδ is involved in the regulation of skin homeostasis. Moreover, activation of both RAR and PPARδ was shown to alter skin inflammation. Endogenous all-trans retinoic acid (ATRA) can activate both receptors depending on specific transport proteins: Fabp5 initiates PPARδ signaling whereas Crabp2 promotes RAR signaling. Repetitive topical applications of ovalbumin (OVA) in combination with intraperitoneal injections of OVA or only intraperitoneal OVA applications were used to induce allergic dermatitis. In our mouse model, expression of IL-4, and Hbegf increased whereas expression of involucrin, Abca12 and Spink5 decreased in inflamed skin, demonstrating altered immune response and epidermal barrier homeostasis. Comprehensive gene expression analysis showed alterations of the cutaneous retinoid metabolism and retinoid-mediated signaling in allergic skin immune response. Notably, ATRA synthesis was increased as indicated by the elevated expression of retinaldehyde dehydrogenases and increased levels of ATRA. Consequently, the expression pattern of genes downstream to RAR was altered. Furthermore, the increased ratio of Fabp5 vs. Crabp2 may indicate an up-regulation of the PPARδ pathway in allergen-induced dermatitis in addition to the altered RAR signaling. Thus, our findings suggest that ATRA levels, RAR-mediated signaling and signaling involved in PPARδ pathways are mainly increased in allergen-induced dermatitis and may contribute to the development and/or maintenance of allergic skin diseases. PMID:23977003

  13. Effects of Tributyltin and Other Retinoid Receptor Agonists in Reproductive-Related Endpoints in the Zebrafish (Danio rerio).

    PubMed

    Lima, Daniela; Castro, L Filipe C; Coelho, Inês; Lacerda, Ricardo; Gesto, Manuel; Soares, Joana; André, Ana; Capela, Ricardo; Torres, Tiago; Carvalho, António Paulo; Santos, Miguel M

    2015-01-01

    Both field and experimental data examined the influence of exposure to environmental contaminant tributyltin (TBT) on marine organisms. Although most attention focused on the imposex phenomenon in gastropods, adverse effects were also observed in other taxonomic groups. It has been shown that imposex induction involves modulation of retinoid signaling in gastropods. Whether TBT influences similar pathways in fish is yet to be addressed. In this study, larvae of the model teleost Danio rerio were exposed to natural retinoids, all-trans-retinoic acid, 9-cis-retinoic acid, and all-trans-retinol, as well as to the RXR synthetic pan-agonist methoprene acid (MA) and to TBT. Larvae were exposed to TBT from 5 days post fertilization (dpf) to adulthood, and reproductive capacity was assessed and correlated with mode of action. TBT significantly decreased fecundity at environmentally relevant levels at 1 μg TBT Sn/g in diet. Interestingly, in contrast to previous reports, TBT altered zebrafish sex ratio toward females, whereas MA exposure biased sex toward males. Since fecundity was significantly altered in the TBT-exposed group with up to 62% decrease, the potentially affected pathways were investigated. Significant downregulation was observed in brain mRNA levels of aromatase b (CYP19a1b) in females and peroxisome proliferator activated receptor gamma (PPARg) in both males and females, suggesting an involvement of these pathways in reproductive impairment associated with TBT.

  14. Arginine methylation of HSP70 regulates retinoid acid-mediated RARβ2 gene activation

    PubMed Central

    Gao, Wei-wei; Xiao, Rong-quan; Peng, Bing-ling; Xu, Huan-teng; Shen, Hai-feng; Huang, Ming-feng; Shi, Tao-tao; Yi, Jia; Zhang, Wen-juan; Wu, Xiao-nan; Gao, Xiang; Lin, Xiang-zhi; Dorrestein, Pieter C.; Rosenfeld, Michael G.; Liu, Wen

    2015-01-01

    Although “histone” methyltransferases and demethylases are well established to regulate transcriptional programs and to use nonhistone proteins as substrates, their possible roles in regulation of heat-shock proteins in the nucleus have not been investigated. Here, we report that a highly conserved arginine residue, R469, in HSP70 (heat-shock protein of 70 kDa) proteins, an evolutionarily conserved protein family of ATP-dependent molecular chaperone, was monomethylated (me1), at least partially, by coactivator-associated arginine methyltransferase 1/protein arginine methyltransferase 4 (CARM1/PRMT4) and demethylated by jumonji-domain–containing 6 (JMJD6), both in vitro and in cultured cells. Functional studies revealed that HSP70 could directly regulate retinoid acid (RA)-induced retinoid acid receptor β2 (RARβ2) gene transcription through its binding to chromatin, with R469me1 being essential in this process. HSP70’s function in gene transcriptional regulation appears to be distinct from its protein chaperon activity. R469me1 was shown to mediate the interaction between HSP70 and TFIIH, which involves in RNA polymerase II phosphorylation and thus transcriptional initiation. Our findings expand the repertoire of nonhistone substrates targeted by PRMT4 and JMJD6, and reveal a new function of HSP70 proteins in gene transcription at the chromatin level aside from its classic role in protein folding and quality control. PMID:26080448

  15. Aberrant Expression of Retinoic Acid Signaling Molecules Influences Patient Survival in Astrocytic Gliomas

    PubMed Central

    Campos, Benito; Centner, Franz-Simon; Bermejo, Justo Lorenzo; Ali, Ramadan; Dorsch, Katharina; Wan, Feng; Felsberg, Jörg; Ahmadi, Rezvan; Grabe, Niels; Reifenberger, Guido; Unterberg, Andreas; Burhenne, Jürgen; Herold-Mende, Christel

    2011-01-01

    Undifferentiated cell populations may influence tumor growth in malignant glioma. We investigated potential disruptions in the retinoic acid (RA) differentiation pathway that could lead to a loss of differentiation capacity, influencing patient prognosis. Expression of key molecules belonging to the RA differentiation pathway was analyzed in 283 astrocytic gliomas and was correlated with tumor proliferation, tumor differentiation, and patient survival. In addition, in situ concentrations of retinoids were measured in tumors, and RA signaling events were studied in vitro. Unlike other tumors, in gliomas expression of most RA signaling molecules increased with malignancy and was associated with augmented intratumoral retinoid levels in high-grade gliomas. Aberrantly expressed RA signaling molecules included i) the retinol-binding protein CRBP1, which facilitates cellular retinoid uptake; ii) ALDH1A1, capable of activating RA precursors; iii) the RA-degrading enzyme CYP26B1; and iv) the RA-binding protein FABP5, which can inhibit RA-induced differentiation. In contrast, expression of the RA-binding protein CRABP2, which fosters differentiation, was decreased in high-grade tumors. Moreover, expression of CRBP1 correlated with tumor proliferation, and FABP5 expression correlated with an undifferentiated tumor phenotype. CRBP1 and ALDH1A1 were independent prognostic markers for adverse patient survival. Our data indicate a complex and clinically relevant deregulation of RA signaling, which seems to be a central event in glioma pathogenesis. PMID:21514413

  16. Cloning retinoid and peroxisome proliferator-activated nuclear receptors of the Pacific oyster and in silico binding to environmental chemicals

    PubMed Central

    Vogeler, Susanne; Galloway, Tamara S.; Isupov, Michail

    2017-01-01

    Disruption of nuclear receptors, a transcription factor superfamily regulating gene expression in animals, is one proposed mechanism through which pollution causes effects in aquatic invertebrates. Environmental pollutants have the ability to interfere with the receptor’s functions through direct binding and inducing incorrect signals. Limited knowledge of invertebrate endocrinology and molecular regulatory mechanisms, however, impede the understanding of endocrine disruptive effects in many aquatic invertebrate species. Here, we isolated three nuclear receptors of the Pacific oyster, Crassostrea gigas: two isoforms of the retinoid X receptor, CgRXR-1 and CgRXR-2, a retinoic acid receptor ortholog CgRAR, and a peroxisome proliferator-activated receptor ortholog CgPPAR. Computer modelling of the receptors based on 3D crystal structures of human proteins was used to predict each receptor’s ability to bind to different ligands in silico. CgRXR showed high potential to bind and be activated by 9-cis retinoic acid and the organotin tributyltin (TBT). Computer modelling of CgRAR revealed six residues in the ligand binding domain, which prevent the successful interaction with natural and synthetic retinoid ligands. This supports an existing theory of loss of retinoid binding in molluscan RARs. Modelling of CgPPAR was less reliable due to high discrepancies in sequence to its human ortholog. Yet, there are suggestions of binding to TBT, but not to rosiglitazone. The effect of potential receptor ligands on early oyster development was assessed after 24h of chemical exposure. TBT oxide (0.2μg/l), all-trans retinoic acid (ATRA) (0.06 mg/L) and perfluorooctanoic acid (20 mg/L) showed high effects on development (>74% abnormal developed D-shelled larvae), while rosiglitazone (40 mg/L) showed no effect. The results are discussed in relation to a putative direct (TBT) disruption effect on nuclear receptors. The inability of direct binding of ATRA to CgRAR suggests either a disruptive effect through a pathway excluding nuclear receptors or an indirect interaction. Our findings provide valuable information on potential mechanisms of molluscan nuclear receptors and the effects of environmental pollution on aquatic invertebrates. PMID:28426724

  17. BCL-x{sub L}/MCL-1 inhibition and RARγ antagonism work cooperatively in human HL60 leukemia cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Perri, Mariarita; Yap, Jeremy L.; Yu, Jianshi

    2014-10-01

    The acute promyelocytic leukemia (APL) subtype of acute myeloid leukemia (AML) is characterized by chromosomal translocations that result in fusion proteins, including the promyelocytic leukemia–retinoic acid receptor, alpha fusion protein (PML–RARα). All-trans retinoic acid (atRA) treatment is the standard drug treatment for APL yielding cure rates >80% by activating transcription and proteasomal degradation of retinoic acid receptor, alpha (RARα). Whereas combination therapy with As{sub 2}O{sub 3} has increased survival further, patients that experience relapse and are refractory to atRA and/or As{sub 2}O{sub 3} is a clinically significant problem. BCL-2 family proteins regulate apoptosis and over-expression of anti-apoptotic B-cell leukemia/lymphoma 2more » (BCL-2) family proteins has been associated with chemotherapeutic resistance in APL including impairment of the ability of atRA to induce growth arrest and differentiation. Here we investigated the novel BH3 domain mimetic, JY-1-106, which antagonizes the anti-apoptotic BCL-2 family members B-cell lymphoma-extra large (BCL-x{sub L}) and myeloid cell leukemia-1 (MCL-1) alone and in combination with retinoids including atRA, AM580 (RARα agonist), and SR11253 (RARγ antagonist). JY-1-106 reduced cell viability in HL-60 cells alone and in combination with retinoids. The combination of JY-1-106 and SR11253 had the greatest impact on cell viability by stimulating apoptosis. These studies indicate that dual BCL-x{sub L}/MCL-1 inhibitors and retinoids could work cooperatively in leukemia treatment. - Highlights: • Novel Bcl-x{sub L}/Mcl-1 inhibitor JY-1-106 reduces HL60 cell viability. • JY-1-106 is investigated in combination with retinoic acid, AM580, and SR11253. • AM580 is an RARα agonist; SR11253 is an RARγ antagonist. • Combined use of JY-1-106/SR11253 exhibited the greatest cell viability reduction. • JY-1-106 alone or in combination with retinoids induces apoptosis.« less

  18. Isotretinoin and Other Retinoids During Pregnancy

    MedlinePlus

    ... due date Ovulation calendar Order bereavement materials News Moms Need Blog Stories & Media News & Media News Videos ... Tools & Resources Frequently asked media questions Blog: News Moms Need Share Your Story community Join us on ...

  19. An update on the management of acne vulgaris

    PubMed Central

    Keri, Jonette; Shiman, Michael

    2009-01-01

    Acne vulgaris is a common skin disorder that can affect individuals from childhood to adulthood, most often occurring in the teenage years. Acne can have a significant physical, emotional, and social impact on an individual. Many different treatment options are available for the treatment of acne vulgaris. Commonly used topical treatments include benzoyl peroxide, antibiotics, sulfur and sodium sulfacetamide, azelaic acid, and retinoids. Systemic treatment is frequently used and includes the use of systemic antibiotics, oral contraceptives, antiandrogens, and retinoids. Other treatment modalities exist such as the use of superficial chemical peels as well as using laser and light devices for the treatment of acne. With the multitude of treatment options and the rapidly expanding newer technologies available to clinicians, it is important to review and be aware of the current literature and studies regarding the treatment of acne vulgaris. PMID:21436973

  20. Retinoid-Related Orphan Receptor β and Transcriptional Control of Neuronal Differentiation.

    PubMed

    Liu, Hong; Aramaki, Michihiko; Fu, Yulong; Forrest, Douglas

    2017-01-01

    The ability to generate neuronal diversity is central to the function of the nervous system. Here we discuss the key neurodevelopmental roles of retinoid-related orphan receptor β (RORβ) encoded by the Rorb (Nr1f2) gene. Recent studies have reported loss of function of the human RORB gene in cases of familial epilepsy and intellectual disability. Principal sites of expression of the Rorb gene in model species include sensory organs, the spinal cord, and brain regions that process sensory and circadian information. Genetic analyses in mice have indicated functions in circadian behavior, vision, and, at the cellular level, the differentiation of specific neuronal cell types. Studies in the retina and sensory areas of the cerebral cortex suggest that this orphan nuclear receptor acts at decisive steps in transcriptional hierarchies that determine neuronal diversity. 2017 Published by Elsevier Inc.

  1. Antiageing Mechanisms of a Standardized Supercritical CO2 Preparation of Black Jack (Bidens pilosa L.) in Human Fibroblasts and Skin Fragments

    PubMed Central

    Dieamant, Gustavo; Pereda, Maria Del Carmen V.; Nogueira, Cecília; Eberlin, Samara; Facchini, Gustavo; Checon, Juliana Tibério; Cesar, Camila Kappke; Mussi, Lilian; Polezel, Márcio Antonio; Martins-Oliveira, Divino; Di Stasi, Luiz Claudio

    2015-01-01

    The use of topical retinoids to treat skin disorders and ageing can induce local reactions, while oral retinoids are potent teratogens and produce several unwanted effects. This way, efforts to explore complementary care resources should be supported. Based on this, we evaluate the antiageing effects of a supercritical CO2 extract from Bidens pilosa L. (BPE-CO2A) containing a standardized multicomponent mixture of phytol, linolenic, palmitic, linoleic, and oleic acids. BPE-CO2A was assessed for its effects on human dermal fibroblasts (TGF-β1 and FGF levels using ELISA; collagen, elastin, and glycosaminoglycan by colorimetric assays, and mRNA expression of RXR, RAR, and EGFr by qRT-PCR) and human skin fragments (RAR, RXR, collagen, elastin, and glycosaminoglycan by immunohistochemical analysis). Levels of extracellular matrix elements, TGF-β1 and FGF, and EGFr gene expression were significantly increased by BPE-CO2A. The modulation of RXR and RAR was positively demonstrated after the treatment with BPE-CO2A or phytol, a component of BPE-CO2A. The effects produced by BPE-CO2A were similar to or better than those produced by retinol and retinoic acid. The ability to stimulate extracellular matrix elements, increase growth factors, and modulate retinoid and rexinoid receptors provides a basis for the development of preparation containing BPE-CO2A as an antiageing/skin-repair agent. PMID:25883669

  2. MDI 301, a nonirritating retinoid, improves abrasion wound healing in damaged/atrophic skin

    PubMed Central

    Warner, Roscoe L.; Bhagavathula, Narasimharao; Nerusu, Kamalakar; Hanosh, Andrew; McClintock, Shannon D.; Naik, Madhav K.; Johnson, Kent J.; Ginsburg, Isaac; Varani, James

    2010-01-01

    MDI 301 is a picolinic acid-substituted ester of 9-cis retinoic acid. It has been shown in the past that MDI 301 increases epidermal thickness, decreases matrix metalloproteinase (MMP) activity, and increases procollagen synthesis in organ-cultured human skin. Unlike all-trans retinoic acid (RA), MDI 301 does not induce expression of proinflammatory cytokines or induce expression of leukocyte adhesion molecules in human skin. In the present study we examined topical MDI 301 treatment for ability to improve the structure and function of skin in three models of skin damage in rodents and for ability to improve abrasion wound healing in these models. MDI 301 was applied daily to the skin of rats treated with the potent corticosteroid, clobetasol propionate, to the skin of diabetic rats (8 weeks posttreatment with streptozotocin) and to the skin of aged (14–16-month-old) rats. In all three models, subsequently induced abrasion wounds healed more rapidly in the retinoid-treated animals than in vehicle-treated controls. Immediately after complete wound closure, tissue from the wound site (as well as from a control site) was put into organ culture and maintained for 3 days. At the end of the incubation period, culture fluids were assessed for soluble type I collagen and for MMPs-2 and -9. In all three models, the level of type I collagen was increased and MMP levels were decreased by MDI 301. In all three models, skin irritation during the retinoid-treatment phase was virtually nonexistent. PMID:18211583

  3. Immunolocalization of peroxisome proliferator-activated receptors and retinoid X receptors in the adult rat CNS.

    PubMed

    Moreno, S; Farioli-Vecchioli, S; Cerù, M P

    2004-01-01

    Peroxisome proliferator-activated and retinoid X receptors (PPARs and RXRs) are transcription factors belonging to the steroid hormone receptor superfamily. Upon activation by their ligands, PPARs and RXRs bind to their target genes as heterodimers. Ligands of these receptors include lipophylic molecules, such as retinoids, fatty acids and eicosanoids, the importance of which in the metabolism and functioning of the nervous tissue is well documented. The immunohistochemical distribution of PPARs and RXRs in the CNS of the adult rat was studied by means of a sensitive biotinyl-tyramide method. All PPAR (alpha, beta/delta and gamma) and RXR (alpha, beta and gamma) isotypes were detected and found to exhibit specific patterns of localization in the different areas of the brain and spinal cord. The presence of the nuclear receptors was observed in both neuronal and glial cells. While PPAR beta/delta and RXR beta showed a widespread distribution, alpha and gamma isotypes exhibited a more restricted pattern of expression. The frontal cortex, basal ganglia, reticular formation, some cranial nerve nuclei, deep cerebellar nuclei, and cerebellar Golgi cells appeared rather rich in all studied receptors. Based on our data, we suggest that in the adult CNS, PPARs and RXRs, besides playing roles common to many other tissues, may have specific functions in regulating the expression of genes involved in neurotransmission, and therefore play roles in complex processes, such as aging, neurodegeneration, learning and memory.

  4. Concentrations of retinoids in early pregnancy and in newborns and their mothers.

    PubMed

    Berggren Söderlund, Maria; Fex, Göran A; Nilsson-Ehle, Peter

    2005-03-01

    Retinoids are vital for embryonic development; both excesses and deficiencies of vitamin A are known to give similar patterns of birth defects. Concentrations of retinol in newborns and in pregnant women have been investigated, but concentrations of the biologically active metabolite all-trans retinoic acid and its isomer 13-cis retinoic acid have not. We measured serum concentrations of these retinoid derivatives in newborns and their mothers and in women in the first trimester of pregnancy, when embryonic differentiation (organogenesis) takes place. In this descriptive study, 10 newborns from normal deliveries and their mothers and 16 healthy women in their first trimester of pregnancy were studied. Seventeen healthy women served as control subjects. all-trans and 13-cis Retinoic acid and retinol concentrations were measured by HPLC. The newborns had significantly lower retinol concentrations (1.0 micromol/L) than did their mothers (1.7 micromol/L; P = 0.013). Serum all-trans retinoic acid was also significantly lower in the newborns (3.4 nmol/L) than in their mothers (5.8 nmol/L; P = 0.008). In addition, serum concentrations of 13-cis retinoic acid were significantly lower in the newborns (2.0 nmol/L) than in their mothers (2.6 nmol/L; P = 0.005). The serum concentrations of all-trans retinoic acid and retinol did not correlate in any group. Retinol concentrations do not accurately reflect the concentrations of the biologically active derivative all-trans retinoic acid.

  5. 13-cis-retinoic acid metabolism in vivo. The major tissue metabolites in the rat have the all-trans configuration.

    PubMed

    McCormick, A M; Kroll, K D; Napoli, J L

    1983-08-02

    The liver and intestinal metabolites of orally dosed 13-cis-[11-3H]retinoic acid were analyzed in normal and 13-cis-retinoic acid treated rats 3 h after administration of the radiolabeled retinoid. all-trans-Retinoic acid was identified as a liver and intestinal mucosa metabolite in normal rats given physiological doses of 13-cis-[3H]retinoic acid. all-trans-Retinoyl glucuronide was identified as the most abundant radiolabeled metabolite in mucosa and a prominent liver metabolite under the same conditions. Thus, the major 13-cis-retinoic acid metabolites retained in liver and mucosa, two retinoid target tissues, had the all-trans configuration. These data indicate that the isomerization of 13-cis-retinoic acid to all-trans-retinoic acid and the subsequent conversion to all-trans-retinoyl glucuronide are central events in the in vivo metabolism of 13-cis-retinoic acid in the rat. Moreover, the all-trans-retinoic acid detected in vivo could account for a significant fraction of the physiological activity of 13-cis-retinoic acid. The tissue disposition and metabolism of orally dosed 13-cis-[3H]retinoic acid are modulated by retinoid treatment. Chronic 13-cis-retinoic acid treatment apparently increased the intestinal accumulation of all-trans-retinoic acid, all-trans-retinoyl glucuronide, and 13-cis-retinoyl glucuronide. The liver concentrations of tritiated all-trans-retinoic acid and all-trans-retinoyl glucuronide were also elevated in 13-cis-retinoic acid treated rats.

  6. Reactive oxygen species mediate N-(4-hydroxyphenyl)retinamide-induced cell death in malignant T cells and are inhibited by the HTLV-I oncoprotein Tax.

    PubMed

    Darwiche, N; Abou-Lteif, G; Bazarbachi, A

    2007-02-01

    N-(4-hydroxyphenyl)retinamide (HPR) is a synthetic retinoid that inhibits growth of many human tumor cells, including those resistant to natural retinoids. HPR is an effective chemopreventive agent for prostate, cervix, breast, bladder, skin and lung cancers, and has shown promise for the treatment of neuroblastomas. We have previously shown that HPR inhibits proliferation and induces apoptosis of human T-cell lymphotropic virus type I (HTLV-I)-associated adult T-cell leukemia (ATL) and HTLV-I-negative malignant T cells, whereas no effect is observed on normal lymphocytes. In this report, we identified HPR-induced reactive oxygen species (ROS) generation as the key mediator of cell cycle arrest and apoptosis of malignant T cells. HPR treatment of HTLV-I-negative malignant T cells was associated with a rapid and progressive ROS accumulation. Pre-treatment with the antioxidants vitamin C and dithiothreitol inhibited ROS generation, prevented HPR-induced ceramide accumulation, cell cycle arrest, cytochrome c release, caspase-activation and apoptosis. Therefore, anti-oxidants protected malignant T cells from HPR-induced growth inhibition. The expression of the HTLV-I oncoprotein Tax abrogated HPR-induced ROS accumulation in HTLV-I-infected cells, which explains their lower sensitivity to HPR. Defining the mechanism of free radical induction by HPR may support a potential therapeutic role for this synthetic retinoid in ATL and HTLV-I-negative T-cell lymphomas.

  7. On the role of transforming growth factor-beta in the growth inhibitory effects of retinoic acid in human pancreatic cancer cells.

    PubMed

    Singh, Brahmchetna; Murphy, Richard F; Ding, Xian-Zhong; Roginsky, Alexandra B; Bell, Richard H; Adrian, Thomas E

    2007-12-24

    Retinoids are potent growth inhibitory and differentiating agents in a variety of cancer cell types. We have shown that retinoids induce growth arrest in all pancreatic cancer cell lines studied, regardless of their p53 and differentiation status. However, the mechanism of growth inhibition is not known. Since TGF-beta2 is markedly induced by retinoids in other cancers and mediates MUC4 expression in pancreatic cancer cells, we investigated the role of TGF-beta in retinoic acid-mediated growth inhibition in pancreatic cancer cells. Retinoic acid markedly inhibited proliferation of two cell lines (Capan-2 and Hs766T) in a concentration and time-dependent manner. Retinoic acid increased TGF-beta2 mRNA content and secretion of the active and latent forms of TGF-beta2 (measured by ELISA and bioassay). The concentrations of active and TGF-beta2 secreted in response to 0.1 - 10 muM retinoic acid were between 1-5 pM. TGF-beta2 concentrations within this range also inhibited proliferation. A TGF-beta neutralizing antibody blocked the growth inhibitory effects of retinoic acid in Capan-2 cells and partially inhibitory the effects in Hs766T cells. These findings indicate that TGF-beta can cause growth inhibition of pancreatic cancer cells, in a p53-independent manner. Furthermore, it demonstrates the fundamental role of TGF-beta in growth inhibition in response to retinoic acid treatment is preserved in vitro.

  8. Metabolic Effects of Inflammation on Vitamin A and Carotenoids in Humans and Animal Models.

    PubMed

    Rubin, Lewis P; Ross, A Catharine; Stephensen, Charles B; Bohn, Torsten; Tanumihardjo, Sherry A

    2017-03-01

    The association between inflammation and vitamin A (VA) metabolism and status assessment has been documented in multiple studies with animals and humans. The relation between inflammation and carotenoid status is less clear. Nonetheless, it is well known that carotenoids are associated with certain health benefits. Understanding these relations is key to improving health outcomes and mortality risk in infants and young children. Hyporetinolemia, i.e., low serum retinol concentrations, occurs during inflammation, and this can lead to the misdiagnosis of VA deficiency. On the other hand, inflammation causes impaired VA absorption and urinary losses that can precipitate VA deficiency in at-risk groups of children. Many epidemiologic studies have suggested that high dietary carotenoid intake and elevated plasma concentrations are correlated with a decreased risk of several chronic diseases; however, large-scale carotenoid supplementation trials have been unable to confirm the health benefits and in some cases resulted in controversial results. However, it has been documented that dietary carotenoids and retinoids play important roles in innate and acquired immunity and in the body's response to inflammation. Although animal models have been useful in investigating retinoid effects on developmental immunity, it is more challenging to tease out the effects of carotenoids because of differences in the absorption, kinetics, and metabolism between humans and animal models. The current understanding of the relations between inflammation and retinoid and carotenoid metabolism and status are the topics of this review. © 2017 American Society for Nutrition.

  9. Metabolic Effects of Inflammation on Vitamin A and Carotenoids in Humans and Animal Models123

    PubMed Central

    Rubin, Lewis P; Ross, A Catharine; Stephensen, Charles B; Bohn, Torsten; Tanumihardjo, Sherry A

    2017-01-01

    The association between inflammation and vitamin A (VA) metabolism and status assessment has been documented in multiple studies with animals and humans. The relation between inflammation and carotenoid status is less clear. Nonetheless, it is well known that carotenoids are associated with certain health benefits. Understanding these relations is key to improving health outcomes and mortality risk in infants and young children. Hyporetinolemia, i.e., low serum retinol concentrations, occurs during inflammation, and this can lead to the misdiagnosis of VA deficiency. On the other hand, inflammation causes impaired VA absorption and urinary losses that can precipitate VA deficiency in at-risk groups of children. Many epidemiologic studies have suggested that high dietary carotenoid intake and elevated plasma concentrations are correlated with a decreased risk of several chronic diseases; however, large-scale carotenoid supplementation trials have been unable to confirm the health benefits and in some cases resulted in controversial results. However, it has been documented that dietary carotenoids and retinoids play important roles in innate and acquired immunity and in the body’s response to inflammation. Although animal models have been useful in investigating retinoid effects on developmental immunity, it is more challenging to tease out the effects of carotenoids because of differences in the absorption, kinetics, and metabolism between humans and animal models. The current understanding of the relations between inflammation and retinoid and carotenoid metabolism and status are the topics of this review. PMID:28298266

  10. Assessment of the efficacy and tolerance of a new combination of retinoids and depigmenting agents in the treatment of melasma.

    PubMed

    Truchuelo, Maria Teresa; Jiménez, Natalia; Jaén, Pedro

    2014-12-01

    Melasma is a dermatosis with significant repercussions on patients' quality of life, and there is currently no standard treatment. Hydroquinone is deemed the treatment of choice, but its safety has been questioned in certain cases. To determine the efficacy and safety of a new combination of retinoids in the improvement of melasma. Prospective, double-blind, vehicle-controlled, and randomized study in 30 patients with melasma. The product was applied on one side of the face and the vehicle on the other, twice daily during 3 months. Standardized photographs were taken using RBX technology on the three visits (basal, at one and a half months and at 3 months). The main variable to determine the efficacy was the improvement of the hemifacial Melasma Area Severity Index (MASI). Other variables were determined such as improvement perceived by the investigator, improvement perceived by the patient, impact on quality of life or side effects. The MASI improvement at 3 months of treatment was significant on the treated side vs. the vehicle side, reaching an improvement of 70%, which is comparable to the percentage of improvement described with hydroquinone. No notable side effects were detected, in spite of a significant percentage of patients included in the study citing a history that could be compatible with sensitive skin. This new combination of retinoids and depigmenting agents proved to be effective and safe in the treatment of melasma. © 2014 Wiley Periodicals, Inc.

  11. Reappraising the phototoxicity of tretinoin: a report of four controlled clinical trials.

    PubMed

    Slade, Herbert B; Shroot, Braham; Feldman, Steven R; Cargill, D Innes; Stanfield, Joe

    2009-06-01

    Retinoids are photoreactive molecules found in skin and retinal tissue. The use of retinoids in pharmacologic doses, applied topically, raises the potential of phototoxicities. Recent review articles and current US drug labeling indicate that tretinoin is a phototoxin. In developing a new formulation of topical all-trans-retinoic acid (tretinoin), formal testing of dermal photoreactions was therefore undertaken. Four prospective, randomized, and controlled trials were carried out in healthy volunteers at two independent research facilities. Two trials examined phototoxicity following 24 h of drug exposure under occlusion (combined n=51), and two examined photoallergenicity following a 3-week, six dose induction phase (combined n=72) followed by challenge. No phototoxic or photoallergic reactions occurred with tretinoin 0.05% in a new gel formulation. The findings in these studies are consistent with previous studies of tretinoin in various formulations, and support the conclusion that tretinoin appears to be neither phototoxic nor photoallergenic in vivo.

  12. Pathogenesis of Endometriosis: Roles of Retinoids and Inflammatory Pathways

    PubMed Central

    Taylor, Robert N.; Kane, Maureen A.; Sidell, Neil

    2016-01-01

    Endometriosis is a nonmalignant, but potentially metastatic, gynecological condition manifested by the extrauterine growth of inflammatory endometrial implants. Ten percent of reproductive-age women are affected and commonly suffer pelvic pain and/ or infertility. The theories of endometriosis histogenesis remain controversial, but retrograde menstruation and metaplasia each infer mechanisms that explain the immune cell responses observed around the ectopic lesions. Recent findings from our laboratories and others suggest that retinoic acid metabolism and action are fundamentally flawed in endometriotic tissues and even generically in women with endometriosis. The focus of our ongoing research is to develop medical therapies as adjuvants or alternatives to the surgical excision of these lesions. On the basis of concepts put forward in this review, we predict that the pharmacological actions and anticipated low side-effect profiles of retinoid supplementation might provide a new treatment option for the long-term management of this chronic and debilitating gynecological disease. PMID:26132929

  13. Independent Activation of Hepatitis B Virus Biosynthesis by Retinoids, Peroxisome Proliferators, and Bile Acids

    PubMed Central

    Reese, Vanessa C.; Oropeza, Claudia E.

    2013-01-01

    In the human hepatoma cell line HepG2, retinoic acid, clofibric acid, and bile acid treatment can only modestly increase hepatitis B virus (HBV) biosynthesis. Utilizing the human embryonic kidney cell line 293T, it was possible to demonstrate that the retinoid X receptor α (RXRα) plus its ligand can support viral biosynthesis independently of additional nuclear receptors. In addition, RXRα/peroxisome proliferator-activated receptor α (PPARα) and RXRα/farnesoid X receptor α (FXRα) heterodimeric nuclear receptors can also mediate ligand-dependent HBV transcription and replication when activated by clofibric acid and bile acid, respectively, independently of a requirement for the ligand-dependent activation of RXRα. These observations indicate that there are at least three possible modes of ligand-mediated activation of HBV transcription and replication existing within hepatocytes, suggesting that multiple independent mechanisms control viral production in the livers of infected individuals. PMID:23135717

  14. The Retinoid X Receptors and Their Ligands

    PubMed Central

    Dawson, Marcia I.; Xia, Zebin

    2014-01-01

    This chapter presents an overview of the current status of studies on the structural and molecular biology of the retinoid X receptor subtypes α, β, and γ (RXRs, NR2B1–3), their nuclear and cytoplasmic functions, post-transcriptional processing, and recently reported ligands. Points of interest are the different changes in the ligand-binding pocket induced by variously shaped agonists, the communication of the ligand–bound pocket with the coactivator binding surface and the heterodimerization interface, and recently identified ligands that are natural products, those that function as environmental toxins or drugs that had been originally designed to interact with other targets, as well as those that were deliberately designed as RXR-selective transcriptional agonists, synergists, or antagonists. Of these synthetic ligands, the general trend in design appears to be away from fully aromatic rigid structures to those containing partial elements of the flexible tetraene side chain of 9-cis-retinoic acid. PMID:22020178

  15. Determination of highly protein bound drugs in plasma using high-performance liquid chromatography and column switching, exemplified by the retinoids.

    PubMed

    Wyss, R; Bucheli, F

    1988-12-02

    During method development for the determination of either isotretinoin, tretinoin and their 4-oxo-metabolites, or etretinate, acitretin and 13-cis-acitretin in plasma using high-performance liquid chromatography and column switching, recovery problems arose, when undiluted plasma samples were injected directly onto the precolumn. These recovery problems may be due to the strong binding of the retinoids to different plasma proteins. Measures to overcome this strong protein binding, such as variation of the injection solution composition and the purge mobile phase, were systematically investigated. Best recoveries were obtained by diluting of plasma with 9 mM sodium hydroxide-acetonitrile (8:2, v/v) and protein precipitation with ethanol for the isotretinoin and etretinate series, respectively, in combination with the use of a purge mobile phase containing ammonium acetate and 10-20% acetonitrile. Less effective was the use of a longer precolumn or heating of the precolumn.

  16. Selected retinoids: determination by isocratic normal-phase HPLC.

    PubMed

    Klvanova, J; Brtko, J

    2002-09-01

    Retinol (ROL), retinal (RAL) and retinoic acid (RA) are physiologically active forms of vitamin A. All-trans retinoic acid (ATRA) can be formed by oxidation from all-trans retinal (ATRAL). Isomerization of RA is considered to be an important metabolic pathway of retinoids. RA isomers transactivate various response pathways via their cognate nuclear receptors that act as ligand inducible transcription factors. The aim of this study was to establish a rapid and simple method for determination of ATRA, 13-cis retinoic acid (13CRA) and ATRAL by HPLC. In our laboratory, we slightly modified the method of Miyagi et al. (2001) and separated ATRA, 13CRA and ATRAL by simple isocratic normal phase HPLC. Both retinoic acid isomers and ATRAL were eluted within 13 min and all components were well resolved. The coefficients of variation (C.V.) for RAs and RAL were from 3.0 to 5.4 %.

  17. Vitamin D receptor–retinoid X receptor heterodimer signaling regulates oligodendrocyte progenitor cell differentiation

    PubMed Central

    de la Fuente, Alerie Guzman; Errea, Oihana; van Wijngaarden, Peter; Gonzalez, Ginez A.; Kerninon, Christophe; Jarjour, Andrew A.; Lewis, Hilary J.; Jones, Clare A.; Nait-Oumesmar, Brahim; Zhao, Chao; Huang, Jeffrey K.; ffrench-Constant, Charles

    2015-01-01

    The mechanisms regulating differentiation of oligodendrocyte (OLG) progenitor cells (OPCs) into mature OLGs are key to understanding myelination and remyelination. Signaling via the retinoid X receptor γ (RXR-γ) has been shown to be a positive regulator of OPC differentiation. However, the nuclear receptor (NR) binding partner of RXR-γ has not been established. In this study we show that RXR-γ binds to several NRs in OPCs and OLGs, one of which is vitamin D receptor (VDR). Using pharmacological and knockdown approaches we show that RXR–VDR signaling induces OPC differentiation and that VDR agonist vitamin D enhances OPC differentiation. We also show expression of VDR in OLG lineage cells in multiple sclerosis. Our data reveal a role for vitamin D in the regenerative component of demyelinating disease and identify a new target for remyelination medicines. PMID:26644513

  18. Moving Toward Bioadjuvant Approaches to Head and Neck Cancer Prevention

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Saba, Nabil F.; Hammond, Anthea; Shin, Dong M.

    2007-10-01

    Head and neck squamous cell carcinoma affects >45,000 Americans annually. Patients who are successfully treated for their primary tumor are at high risk of developing a second primary tumor, making effective preventive strategies highly desirable for this disease. Although a landmark study in 1990 suggested some benefit of high-dose retinoids in head and neck cancer prevention, subsequent trials using more tolerable doses have shown limited clinical success. Newer preventive strategies have included bioadjuvant therapy combining retinoids with interferon and {alpha}-tocopherol, combinations of molecularly targeted agents, and oncolytic viruses. Furthermore, considerable evidence has supported a cancer protective role for several nutrients,more » including green tea and curcumin analogs. Natural compounds such as these with favorable long-term safety profiles might be particularly suited to the cancer prevention setting, in which patients will usually tolerate only moderate risk and toxicity.« less

  19. Management strategies for acne vulgaris

    PubMed Central

    Whitney, Kristen M; Ditre, Chérie M

    2011-01-01

    Clinical question: What are the most effective treatment(s) for mild, moderate, severe, and hormonally driven acne? Results: Mild acne responds favorably to topical treatments such as benzoyl peroxide, salicylic acid, and a low-dose retinoid. Moderate acne responds well to combination therapy comprising-topical benzoyl peroxide, antibiotics, and/or retinoids, as well as oral antibiotics in refractory cases and oral contraceptive pills for female acne patients. Severe nodulocystic acne vulgaris responds best to oral isotretinoin therapy. In female patients with moderate to severe acne, facial hair, loss of scalp hair and irregular periods, polycystic ovarian syndrome should be considered and appropriate treatment with hormonal modulation given. Adjunctive procedures can also be considered for all acne patients. Implementation: Pitfalls to avoid when treating acne: treatment of acne in women of child-bearing age; familiarization of all acne treatments in order to individualize management for patients; indications for specialist referral. PMID:21691566

  20. Increasing human Th17 differentiation through activation of orphan nuclear receptor retinoid acid-related orphan receptor γ (RORγ) by a class of aryl amide compounds.

    PubMed

    Zhang, Wei; Zhang, Jing; Fang, Leiping; Zhou, Ling; Wang, Shuai; Xiang, Zhijun; Li, Yuan; Wisely, Bruce; Zhang, Guifeng; An, Gang; Wang, Yonghui; Leung, Stewart; Zhong, Zhong

    2012-10-01

    In a screen for small-molecule inhibitors of retinoid acid-related orphan receptor γ (RORγ), we fortuitously discovered that a class of aryl amide compounds behaved as functional activators of the interleukin 17 (IL-17) reporter in Jurkat cells. Three of these compounds were selected for further analysis and found to activate the IL-17 reporter with potencies of ∼0.1 μM measured by EC₅₀. These compounds were shown to directly bind to RORγ by circular dichroism-based thermal stability experiments. Furthermore, they can enhance an in vitro Th17 differentiation process in human primary T cells. As RORγ remains an orphan nuclear receptor, discovery of these aryl amide compounds as functional agonists will now provide pharmacological tools for us to dissect functions of RORγ and facilitate drug discovery efforts for immune-modulating therapies.

  1. A molecular mechanism of optic nerve regeneration in fish: the retinoid signaling pathway.

    PubMed

    Kato, Satoru; Matsukawa, Toru; Koriyama, Yoshiki; Sugitani, Kayo; Ogai, Kazuhiro

    2013-11-01

    The fish optic nerve regeneration process takes more than 100 days after axotomy and comprises four stages: neurite sprouting (1-4 days), axonal elongation (5-30 days), synaptic refinement (35-80 days) and functional recovery (100-120 days). We screened genes specifically upregulated in each stage from axotomized fish retina. The mRNAs for heat shock protein 70 and insulin-like growth factor-1 rapidly increased in the retinal ganglion cells soon after axotomy and function as cell-survival factors. Purpurin mRNA rapidly and transiently increased in the photoreceptors and purpurin protein diffusely increased in all nuclear layers at 1-4 days after injury. The purpurin gene has an active retinol-binding site and a signal peptide. Purpurin with retinol functions as a sprouting factor for thin neurites. This neurite-sprouting effect was closely mimicked by retinoic acid and blocked by its inhibitor. We propose that purpurin works as a retinol transporter to supply retinoic acid to damaged RGCs which in turn activates target genes. We also searched for genes involved in the second stage of regeneration. The mRNA of retinoid-signaling molecules increased in retinal ganglion cells at 7-14 days after injury and tissue transglutaminase and neuronal nitric oxide synthase mRNAs, RA-target genes, increased in retinal ganglion cells at 10-30 days after injury. They function as factors for the outgrowth of thick, long neurites. Here we present a retinoid-signaling hypothesis to explain molecular events during the early stages of optic nerve regeneration in fish. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. PNPLA3 has retinyl-palmitate lipase activity in human hepatic stellate cells

    PubMed Central

    Pirazzi, Carlo; Valenti, Luca; Motta, Benedetta Maria; Pingitore, Piero; Hedfalk, Kristina; Mancina, Rosellina Margherita; Burza, Maria Antonella; Indiveri, Cesare; Ferro, Yvelise; Montalcini, Tiziana; Maglio, Cristina; Dongiovanni, Paola; Fargion, Silvia; Rametta, Raffaela; Pujia, Arturo; Andersson, Linda; Ghosal, Saswati; Levin, Malin; Wiklund, Olov; Iacovino, Michelina; Borén, Jan; Romeo, Stefano

    2014-01-01

    Retinoids are micronutrients that are stored as retinyl esters in the retina and hepatic stellate cells (HSCs). HSCs are key players in fibrogenesis in chronic liver diseases. The enzyme responsible for hydrolysis and release of retinyl esters from HSCs is unknown and the relationship between retinoid metabolism and liver disease remains unclear. We hypothesize that the patatin-like phospholipase domain-containing 3 (PNPLA3) protein is involved in retinol metabolism in HSCs. We tested our hypothesis both in primary human HSCs and in a human cohort of subjects with non-alcoholic fatty liver disease (N = 146). Here we show that PNPLA3 is highly expressed in human HSCs. Its expression is regulated by retinol availability and insulin, and increased PNPLA3 expression results in reduced lipid droplet content. PNPLA3 promotes extracellular release of retinol from HSCs in response to insulin. We also show that purified wild-type PNPLA3 hydrolyzes retinyl palmitate into retinol and palmitic acid. Conversely, this enzymatic activity is markedly reduced with purified PNPLA3 148M, a common mutation robustly associated with liver fibrosis and hepatocellular carcinoma development. We also find the PNPLA3 I148M genotype to be an independent (P = 0.009 in a multivariate analysis) determinant of circulating retinol-binding protein 4, a reliable proxy for retinol levels in humans. This study identifies PNPLA3 as a lipase responsible for retinyl-palmitate hydrolysis in HSCs in humans. Importantly, this indicates a potential novel link between HSCs, retinoid metabolism and PNPLA3 in determining the susceptibility to chronic liver disease. PMID:24670599

  3. PNPLA3 has retinyl-palmitate lipase activity in human hepatic stellate cells.

    PubMed

    Pirazzi, Carlo; Valenti, Luca; Motta, Benedetta Maria; Pingitore, Piero; Hedfalk, Kristina; Mancina, Rosellina Margherita; Burza, Maria Antonella; Indiveri, Cesare; Ferro, Yvelise; Montalcini, Tiziana; Maglio, Cristina; Dongiovanni, Paola; Fargion, Silvia; Rametta, Raffaela; Pujia, Arturo; Andersson, Linda; Ghosal, Saswati; Levin, Malin; Wiklund, Olov; Iacovino, Michelina; Borén, Jan; Romeo, Stefano

    2014-08-01

    Retinoids are micronutrients that are stored as retinyl esters in the retina and hepatic stellate cells (HSCs). HSCs are key players in fibrogenesis in chronic liver diseases. The enzyme responsible for hydrolysis and release of retinyl esters from HSCs is unknown and the relationship between retinoid metabolism and liver disease remains unclear. We hypothesize that the patatin-like phospholipase domain-containing 3 (PNPLA3) protein is involved in retinol metabolism in HSCs. We tested our hypothesis both in primary human HSCs and in a human cohort of subjects with non-alcoholic fatty liver disease (N = 146). Here we show that PNPLA3 is highly expressed in human HSCs. Its expression is regulated by retinol availability and insulin, and increased PNPLA3 expression results in reduced lipid droplet content. PNPLA3 promotes extracellular release of retinol from HSCs in response to insulin. We also show that purified wild-type PNPLA3 hydrolyzes retinyl palmitate into retinol and palmitic acid. Conversely, this enzymatic activity is markedly reduced with purified PNPLA3 148M, a common mutation robustly associated with liver fibrosis and hepatocellular carcinoma development. We also find the PNPLA3 I148M genotype to be an independent (P = 0.009 in a multivariate analysis) determinant of circulating retinol-binding protein 4, a reliable proxy for retinol levels in humans. This study identifies PNPLA3 as a lipase responsible for retinyl-palmitate hydrolysis in HSCs in humans. Importantly, this indicates a potential novel link between HSCs, retinoid metabolism and PNPLA3 in determining the susceptibility to chronic liver disease. © The Author 2014. Published by Oxford University Press.

  4. Antitumor activity of the synthetic retinoid ST1926 on primary effusion lymphoma in vitro and in vivo models.

    PubMed

    Karam, Louna; Houshaymi, Bilal; Abdel-Samad, Rana; Jaafar, Mariam; Halloum, Iman; Pisano, Claudio; Neipel, Frank; Darwiche, Nadine; Abou Merhi, Raghida

    2018-02-01

    Primary effusion lymphoma (PEL) is a rare B-cell neoplasm, associated with Kaposi sarcoma-associated herpes virus/human herpes virus-8 (KSHV/HHV-8), arising as malignant effusions in body cavities. PEL cells do not harbor conventional genetic cancer mutations; however, their oncogenesis is mainly attributed to HHV-8 latent genes. Treatment strategies are inefficient resulting in poor prognosis of PEL patients, stressing the need for new effective therapy. ST1926 is a synthetic retinoid with favorable antitumor properties and no cross-resistance with the natural retinoid, all-trans retinoic acid. ST1926 has shown potent apoptotic activities on a variety of solid tumors and hematologic malignancies in in vitro and in vivo models. In the present study we elucidated the antitumor activities and underlying molecular mechanism of ST1926 using in vitro, ex vivo, and in vivo PEL preclinical models. ST1926, at sub‑micromolar concentrations, displayed potent antiproliferative effects on PEL cell lines and malignant ascites. Furthermore, ST1926 treatment of PEL cells and ascites resulted in their accumulation in the sub-G1 region, S phase cell cycle arrest, early DNA damage, PARP cleavage and p53 activation including the upregulation of its target genes p21 and Bax. However, ST1926 did not significantly modulate HHV-8 latent viral transcripts. Importantly, ST1926 delayed formation of ascites and enhanced survival of PEL mice. These results highlight the therapeutic potential of ST1926 in combination with drugs that target HHV-8 in PEL patients.

  5. Increased frequency of anti-retina antibodies in asymptomatic patients with chronic t. gondii infection

    PubMed Central

    Cursino, Sylvia Regina Temer; da Costa, Thaís Boccia; Yamamoto, Joyce Hisae; Meireles, Luciana Regina; Silva, Maria Antonieta Longo Galvão; de Andrade Junior, Heitor Franco

    2010-01-01

    PURPOSE: To search for anti-retina antibodies that serve as markers for eye disease in uveitis. MATERIALS AND METHODS: Stored sera from patients with uveitis, ocular toxoplasmosis (n = 30) and non-infectious, immune-mediated uveitis (n = 50) and from asymptomatic individuals who were positive (n = 250) and negative (n = 250) for anti-Toxoplasma antibodies were tested. Serum anti-retina IgG was detected by an optimized ELISA using a solid-phase whole human retina extract, bovine S-antigen or interphotoreceptor retinoid-binding protein. RESULTS: Uveitis patients showed a higher mean reactivity to whole human retina extract, interphotoreceptor retinoid-binding protein and S-antigen in comparison to the asymptomatic population. These findings were independent of the uveitis origin and allowed the determination of the lower anti-retina antibody cut-off for the three antigens. Asymptomatic anti-Toxoplasma serum-positive individuals showed a higher frequency of anti-human whole retina extract antibodies in comparison to asymptomatic anti-Toxoplasma serum-negative patients. The bovine S-antigen and interphotoreceptor retinoid-binding protein ELISAs also showed a higher mean reactivity in the uveitis groups compared to the asymptomatic group, but the observed reactivities were lower and overlapped without discrimination. CONCLUSION: We detected higher levels of anti-retina antibodies in uveitis patients and in a small fraction of asymptomatic patients with chronic toxoplasmosis. The presence of anti-retina antibodies in sera might be a marker of eye disease in asymptomatic patients, especially when whole human retina extract is used in a solid-phase ELISA. PMID:21120306

  6. Increasing the intracellular availability of all-trans retinoic acid in neuroblastoma cells.

    PubMed

    Armstrong, J L; Ruiz, M; Boddy, A V; Redfern, C P F; Pearson, A D J; Veal, G J

    2005-02-28

    Recent data indicate that isomerisation to all-trans retinoic acid (ATRA) is the key mechanism underlying the favourable clinical properties of 13-cis retinoic acid (13cisRA) in the treatment of neuroblastoma. Retinoic acid (RA) metabolism is thought to contribute to resistance, and strategies to modulate this may increase the clinical efficacy of 13cisRA. The aim of this study was to test the hypothesis that retinoids, such as acitretin, which bind preferentially to cellular retinoic acid binding proteins (CRABPs), or specific inhibitors of the RA hydroxylase CYP26, such as R116010, can increase the intracellular availability of ATRA. Incubation of SH-SY5Y cells with acitretin (50 microM) or R116010 (1 or 10 microM) in combination with either 10 microM ATRA or 13cisRA induced a selective increase in intracellular levels of ATRA, while 13cisRA levels were unaffected. CRABP was induced in SH-SY5Y cells in response to RA. In contrast, acitretin had no significant effect on intracellular retinoid concentrations in those neuroblastoma cell lines that showed little or no induction of CRABP after RA treatment. Both ATRA and 13cisRA dramatically induced the expression of CYP26A1 in SH-SY5Y cells, and treatment with R116010, but not acitretin, potentiated the RA-induced expression of a reporter gene and CYP26A1. The response of neuroblastoma cells to R116010 was consistent with inhibition of CYP26, indicating that inhibition of RA metabolism may further optimise retinoid treatment in neuroblastoma.

  7. Increasing the intracellular availability of all-trans retinoic acid in neuroblastoma cells

    PubMed Central

    Armstrong, J L; Ruiz, M; Boddy, A V; Redfern, C P F; Pearson, A D J; Veal, G J

    2005-01-01

    Recent data indicate that isomerisation to all-trans retinoic acid (ATRA) is the key mechanism underlying the favourable clinical properties of 13-cis retinoic acid (13cisRA) in the treatment of neuroblastoma. Retinoic acid (RA) metabolism is thought to contribute to resistance, and strategies to modulate this may increase the clinical efficacy of 13cisRA. The aim of this study was to test the hypothesis that retinoids, such as acitretin, which bind preferentially to cellular retinoic acid binding proteins (CRABPs), or specific inhibitors of the RA hydroxylase CYP26, such as R116010, can increase the intracellular availability of ATRA. Incubation of SH-SY5Y cells with acitretin (50 μM) or R116010 (1 or 10 μM) in combination with either 10 μM ATRA or 13cisRA induced a selective increase in intracellular levels of ATRA, while 13cisRA levels were unaffected. CRABP was induced in SH-SY5Y cells in response to RA. In contrast, acitretin had no significant effect on intracellular retinoid concentrations in those neuroblastoma cell lines that showed little or no induction of CRABP after RA treatment. Both ATRA and 13cisRA dramatically induced the expression of CYP26A1 in SH-SY5Y cells, and treatment with R116010, but not acitretin, potentiated the RA-induced expression of a reporter gene and CYP26A1. The response of neuroblastoma cells to R116010 was consistent with inhibition of CYP26, indicating that inhibition of RA metabolism may further optimise retinoid treatment in neuroblastoma. PMID:15714209

  8. Placental transfer and developmental effects of 9-cis retinoic acid in mice.

    PubMed

    Kochhar, D M; Jiang, H; Penner, J D; Heyman, R A

    1995-04-01

    9-cis retinoic acid (RA) is a naturally occurring isomer of all-trans RA. While both isomers can bind with high affinity and activate RA receptors, only 9-cis RA is the specific ligand for the retinoid X receptors. 9-cis RA has also been shown to be much more potent than all-trans RA in inducing digit duplication in the chick embryo wing bud. To gain further insight into its mechanisms, here we investigated the teratogenic activity in pregnant mice of 9-cis RA and compared it with those of all-trans RA and 13-cis RA. Using frequency and severity of limb reduction defects as well as palatal clefts in the resultant fetuses as indicators, we found that orally administered 9-cis RA was one-half as potent a teratogen as all-trans RA. That 9-cis RA was intrinsically less active than all-trans RA was deduced by comparing the inhibitory activities of the two retinoids in the limb bud mesenchymal cell micromass cultures using chondrogenesis as an end-point. Since placental transfer of cis isomers of RA is generally poor, we monitored the identities and amounts of retinoids in the embryo after administration of 9-cis RA to the mother. We found that 9-cis RA undergoes extensive metabolism and isomerization during absorption resulting in a number of metabolites in the maternal circulation within 30 min after administration. Although some of these metabolites remain to be identified, the most abundant RA isomers in the plasma coeluted with 13-cis RA.(ABSTRACT TRUNCATED AT 250 WORDS)

  9. Retinoic Acid Is Present in the Postnatal Rat Olfactory Organ and Persists in Vitamin A–Depleted Neural Tissue1–3

    PubMed Central

    Asson-Batres, Mary Ann; Smith, W. Bradford; Clark, Gale

    2009-01-01

    Vitamin A (VA), all-trans-retinol (at-ROL), and its derivative, all-trans-retinoic acid (at-RA), are required for neuron development. The effects of these retinoids are dependent upon the nutritional status of the rat and tissue-specific dynamics of retinoid access and utilization. The purpose of this study was to determine the status of at-ROL and at-RA in the peripheral olfactory organ of postnatal rats fed a normal diet and rats fed a VA-deficient (VAD) diet. Extracted retinoids were analyzed by HPLC. Resolved sample peaks were identified by comparing their elution times and spectra with those of authentic standards. Mean at-RA and at-ROL concentrations of 23 pmol/g olfactory tissue and 0.13 nmol/g, respectively, were recovered from olfactory tissue. The ratio of at-RA:at-ROL in olfactory was ∼2 times that in testis and 200 times that in liver. at-ROL was depleted from the liver and olfactory organ of rats fed a VAD diet from birth to 70 d of age. Surprisingly, at-RA was still present in olfactory tissue from these rats. At 90 d of age, the VAD rats were frankly deficient and at-RA was no longer detectable in olfactory tissue. The comparatively high ratio of at-RA:at-ROL in the peripheral olfactory organ and the persistence of at-RA in at-ROL-depleted tissues strongly suggests that maintenance of local stores of at-RA is functionally relevant in this tissue. PMID:19403718

  10. Effects of a synthetic retinoid on skin structure, matrix metalloproteinases, and procollagen in healthy and high-risk subjects with diabetes.

    PubMed

    Zeng, Wei; Tahrani, Abd; Shakher, Jayadave; Varani, James; Hughes, Sharon; Dubb, Kiran; Stevens, Martin J

    2011-01-01

    In diabetes, foot ulceration may result from increased skin fragility. Retinoids can reverse some diabetes-induced deficits of skin structure and function, but their clinical utility is limited by skin irritation. The effects of diabetes and MDI 301, a nonirritating synthetic retinoid, and retinoic acid have been evaluated on matrix metalloproteinases (MMPs), procollagen expression, and skin structure in skin biopsies from nondiabetic volunteers and diabetic subjects at risk of foot ulceration using organ culture techniques. Zymography and enzyme-linked immunosorbent assay were utilized for analysis of MMP-1, -2, and -9 and tissue inhibitor of metalloproteinase-1 (TIMP-1) and immunohistochemistry for type I procollagen protein abundance. Collagen structure parameters were assessed in formalin-fixed, paraffin-embedded tissue sections. The % of active MMP-1 and -9 was higher and TIMP-1 abundance was lower in subjects with diabetes. Type 1 procollagen abundance was reduced and skin structural deficits were increased in diabetes. Three μM MDI 301 reduced active MMP-1 and -9 abundance by 29% (P < .05) and 40% (P < .05), respectively, and increased TIMP-1 by 45% (P = .07). MDI 301 increased type 1 procollagen abundance by 40% (P < .01) and completely corrected structural deficit scores. Two μM retinoic acid reduced MMP-1 but did not significantly affect skin structure. These data indicate that diabetic patients at risk of foot ulceration have deficits of skin structure and function. MDI 301 offers potential for repairing this skin damage complicating diabetes. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. ISX is a retinoic acid-sensitive gatekeeper that controls intestinal β,β-carotene absorption and vitamin A production

    PubMed Central

    Lobo, Glenn P.; Hessel, Susanne; Eichinger, Anne; Noy, Noa; Moise, Alexander R.; Wyss, Adrian; Palczewski, Krzysztof; von Lintig, Johannes

    2010-01-01

    The uptake of dietary lipids from the small intestine is a complex process that depends on the activities of specific membrane receptors with yet unknown regulatory mechanisms. Using both mouse models and human cell lines, we show here that intestinal lipid absorption by the scavenger receptor class B type 1 (SR-BI) is subject to control by retinoid signaling. Retinoic acid via retinoic acid receptors induced expression of the intestinal transcription factor ISX. ISX then repressed the expression of SR-B1 and the carotenoid-15,15′-oxygenase Bcmo1. BCMO1 acts downstream of SR-BI and converts absorbed β,β-carotene to the retinoic acid precursor, retinaldehyde. Using BCMO1-knockout mice, we demonstrated increased intestinal SR-BI expression and systemic β,β-carotene accumulation. SR-BI-dependent accumulation of β,β-carotene was prevented by dietary retinoids that induced ISX expression. Thus, our study revealed a diet-responsive regulatory network that controls β,β-carotene absorption and vitamin A production by negative feedback regulation. The role of SR-BI in the intestinal absorption of other dietary lipids, including cholesterol, fatty acids, and tocopherols, implicates retinoid signaling in the regulation of lipid absorption more generally and has clinical implications for diseases associated with dyslipidemia.—Lobo, G. P., Hessel, S., Eichinger, A., Noy, N., Moise, A. R., Wyss, A., Palczewski, K., von Lintig, J. ISX is a retinoic acid-sensitive gatekeeper that controls intestinal β,β-carotene absorption and vitamin A production. PMID:20061533

  12. Evidence for metabolic imbalance of vitamin A2 in wild fish chronically exposed to metals.

    PubMed

    Defo, Michel A; Pierron, Fabien; Spear, Philip A; Bernatchez, Louis; Campbell, Peter G C; Couture, Patrice

    2012-11-01

    In a recent study on indigenous yellow perch chronically exposed to metals, we reported a negative correlation between liver metal concentration and liver transcription levels of genes encoding for enzymes involved in the metabolism of retinoids. We therefore speculated that metals, and especially the non-essential metal Cd, could alter the metabolism of retinoids in wild fish. Thus the present field study investigates the impact of in situ metal exposure on retinoid storage. A total of 55 yellow perch (Perca flavescens) were sampled in six lakes representing a metal contamination gradient (8≤N≤10 per lake). Our results show that yellow perch from Cd-contaminated lakes had significantly higher concentrations of liver dehydroretinol and dehydroretinyl esters than did fish from reference lakes. However, the increase in retinyl ester stores with increasing Cd concentrations was quantitatively much more important than the increase in free dehydroretinol. As a result, a significant decrease in the percentage of hepatic free dehydroretinol with increasing renal Cd concentrations was observed. These results suggest that the enzymes and the binding proteins involved in vitamin A homeostasis are inhibited by the presence of Cd. Alternatively, the increase in tissue vitamin A (antioxidant) levels could serve to better counteract the oxidative stress engendered by Cd exposure. Overall our findings illustrate that vitamin A(2) homeostasis can be altered as a consequence of chronic exposure to low Cd concentrations. Thus, in the context of environmental risk assessment, the percentage of liver free dehydroretinol can be considered as a biomarker of for in situ Cd exposure. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. PREDICTING RETINOID RECEPTOR BINDING AFFINITY: COREPA-M APPLICATION

    EPA Science Inventory

    Retinoic acid and associated vitamin A derivatives comprise a class of endogenous hormones that activate different retinoic acid receptors RARs). Transcriptional events subsequent to this activation are key to controlling several aspects of vertebrate development. As such, identi...

  14. Retinoid metabolism and transplacental pharmacokinetics in the cynomolgus monkey following a nonteratogenic dosing regimen with all-trans-retinoic acid.

    PubMed

    Tzimas, G; Nau, H; Hendrickx, A G; Peterson, P E; Hummler, H

    1996-11-01

    Retinoids often exhibit a complex metabolic pattern and differential transplacental kinetics, which make it difficult to pinpoint the proximate compound responsible for the observed teratogenic effect. We have therefore studied the pharmacokinetics and metabolism of all-trans-retinoic acid (all-trans-RA) in cynomolgus monkeys following application of a nonteratogenic dosing regimen and compared the results with corresponding data from a previous study with a teratogenic dosing regimen with 13-cis-RA [Hummler et al. (1994) Teratology 50:184-193]. All-trans-RA was administered to pregnant cynomolgus monkeys (Macaca fascicularis) by nasogastric intubation at a dose of 5 mg/kg body wt once daily from gestational day (GD) 16 to 26 and twice daily at 8-h intervals from GD 27 to 31. Examination of the fetuses of four dams on GD 100 +/- 2 showed no embryotoxic or teratogenic effects of the applied dosing regimen (Experiment 1). Maternal plasma retinoid pharmacokinetics on GD 16, 26, and 31 as well as embryonic retinoid profiles after the last drug administration on GD 31 were determined in thirteen further dams (Experiment 2). All-trans-RA reached much lower plasma concentrations after the last two treatments on GD 31 than after the first one on GD 16 and the eleventh one on GD 26 (0-24-h area-under-the-concentration-time-curve (AUC) values: 104 +/- 59 ng x h/ml (after the last treatment on GD 31), 189 +/- 110 (GD 16) and 393 +/- 305 ng x h/ml (GD 26). The predominant plasma metabolites of all-trans-RA were its beta-glucuronide and the beta-glucuronide of all-trans-4-oxo-RA. Both of these retinoids accumulated in the plasma during the period of treatment and displayed AUC values 5- to 30-fold higher than those of all-trans-RA. Embryonic concentrations of all-trans-RA were not increased over endogenous levels after the last administration on GD 31 when plasma concentrations were low. To evaluate the placental transport of all-trans-RA in the presence of high plasma concentrations, a further experiment was performed, in which a single dose of all-trans-RA (10 mg/kg body wt) was given to four pregnant monkeys on GD 31, and plasma pharmacokinetics as well as embryonic concentrations of retinoids at 4 h post-treatment were determined (Experiment 3). This dosing schedule yielded high plasma concentrations of all-trans-RA, while embryonic concentrations were about 40% of plasma levels. Based on the plasma AUC values on GDs 16 and 26 obtained in Experiment 2 and the degree of placental transfer, as determined on GD 31 in the presence of high plasma levels in Experiment 3, we estimated embryonic AUC values for the 24-h period following the nonteratogenic doses on GDs 16 and 26 in Experiment 2. These AUC values were similarly high to the embryonic AUC value of all-trans-RA obtained after application of the teratogenic dosing regimen with 13-cis-RA [Hummler et al. (1994) Teratology 50:184-193]. In addition, plasma AUC values of all-trans-RA were 2- to 7-fold higher after all-trans-RA administration (present study) than after dosing with the teratogenic dose of 13-cis-RA. These results strengthen our recent suggestion that the teratogenic effects induced in cynomolgus monkeys by 13-cis-RA treatment cannot solely result from the action of all-trans-RA, but may involve 13-cis-RA and 13-cis-4-oxo-RA, which could act directly or function as transport vehicle.

  15. BIOCONCENTRATION AND METABOLISM OF ALL-TRANS RETINOIC ACID BY RANA SYLVATICA AND RANA CLAMITANS TADPOLES

    EPA Science Inventory

    Retinoids, which are Vitamin A derivatives, are important signaling molecules that regulate processes critical for development in all vertebrates. The objective of our study was to examine uptake and metabolism of all-trans retinoic acid...

  16. A randomized, double-blind, controlled comparative trial of the anti-aging properties of non-prescription tri-retinol 1.1% vs. prescription tretinoin 0.025%.

    PubMed

    Ho, Elizabeth T; Trookman, Nathan S; Sperber, Brian R; Rizer, Ronald L; Spindler, Ralph; Sonti, Sujatha; Gotz, Vincent; Mehta, Rahul

    2012-01-01

    Vitamin A and its derivatives (commonly termed retinoids) are widely used in topical anti-aging products. Certain retinoids such as retinol and its esters are available without a prescription, while others such as tretinoin are available only via prescription. A randomized, double-blind, controlled clinical study was conducted to compare the efficacy and tolerability of a tri-retinol 1.1% gradual release cream vs. tretinoin 0.025% cream in females with mild-to-moderate facial photodamage. Subjects applied the test product to the entire face in the evening after cleansing in a progressively increasing frequency starting twice weekly for the first week, followed by three times weekly during the second week and then daily as tolerated for the third week and beyond. Treatment was continued for a total of three months. Clinical evaluations and standardized digital photographs were performed at baseline and after four, eight, and 12 weeks of treatment. Self-assessment questionnaires were completed by the subjects at four, eight, and 12 weeks to assess perceived efficacy of the test products. Thirty-four subjects (16: tri-retinol and 18: tretinoin) completed the study. Both test products significantly improved signs of photodamage, including fine and coarse periocular wrinkles, skin firmness, skin tone, mottled pigmentation, tactile roughness, overall photodamage and global photodamage improvement. There were no significant differences in efficacy between the two products for these assessments. The adverse effects (which were graded as mild or less) were those typically seen with topical retinoids. Subjects reported >93 percent overall satisfaction with both products at weeks 8 and 12.

  17. Up-regulation of COUP-TFII gene expression in the nitrofen-induced hypoplastic lung.

    PubMed

    Doi, Takashi; Sugimoto, Kaoru; Puri, Prem

    2009-02-01

    Recent studies have suggested that the retinoid signaling pathway (RSP) is inhibited in the nitrofen-induced hypoplastic lung. The exact mechanism by which nitrofen acts in the RSP remains unclear. Targeted ablation of COUP-TFII, a gene encoding a transfactor regulated by the RSP, has been shown to cause Bochdalek-type congenital diaphragmatic hernia. It has been shown that COUP-TFII has 2 main roles in the RSP, (i) repressing the RSP by directly sequestering retinoid X receptors, thereby preventing heterodimerization to retinoid acid receptors and inhibiting gene transcription, and (ii) modulating the transcriptional activity of GATA proteins. We designed this study to investigate the gene expression of COUP-TFII in the nitrofen-induced hypoplastic lung. Pregnant rats were exposed to either olive oil or 100 mg of nitrofen on day 9 of gestation. Fetuses were harvested and lungs were dissected on day 15 (D15), D18, and D21 and divided into 2 groups: control (n = 9) and nitrofen (n = 9). Real-time reverse transcription-polymerase chain reaction was performed to evaluate the relative mRNA levels of COUP-TFII expression in the hypoplastic lung. The relative mRNA levels of COUP-TFII at D15 was significantly increased in the nitrofen group (0.76 +/- 0.53) compared to controls (0.45 +/- 0.05) (P < .01). The expression levels of COUP-TFII at D18 and D21 were not significantly different between the nitrofen group and controls. Our results provide evidence for the first time that the pulmonary gene expression of COUP-TFII is up-regulated in the early stages of lung development in the nitrofen-induced hypoplastic lung. We speculate that up-regulation of COUP-TFII gene expression during the stage of branching lung morphogenesis may cause pulmonary hypoplasia by repressing RSP.

  18. 9-Cis-Retinoic Acid Induces Growth Inhibition in Retinoid-Sensitive Breast Cancer and Sea Urchin Embryonic Cells via Retinoid X Receptor α and Replication Factor C3

    PubMed Central

    Maeng, Sejung; Kim, Gil Jung; Choi, Eun Ju; Yang, Hyun Ok; Lee, Dong-Sup

    2012-01-01

    There is widespread interest in defining factors and mechanisms that suppress the proliferation of cancer cells. Retinoic acid (RA) is a potent suppressor of mammary cancer and developmental embryonic cell proliferation. However, the molecular mechanisms by which 9-cis-RA signaling induces growth inhibition in RA-sensitive breast cancer and embryonic cells are not apparent. Here, we provide evidence that the inhibitory effect of 9-cis-RA on cell proliferation depends on 9-cis-RA-dependent interaction of retinoid X receptor α (RXRα) with replication factor C3 (RFC3), which is a subunit of the RFC heteropentamer that opens and closes the circular proliferating cell nuclear antigen (PCNA) clamp on DNA. An RFC3 ortholog in a sea urchin cDNA library was isolated by using the ligand-binding domain of RXRα as bait in a yeast two-hybrid screening. The interaction of RFC3 with RXRα depends on 9-cis-RA and bexarotene, but not on all-trans-RA or an RA receptor (RAR)-selective ligand. Truncation and mutagenesis experiments demonstrated that the C-terminal LXXLL motifs in both human and sea urchin RFC3 are critical for the interaction with RXRα. The transient interaction between 9-cis-RA-activated RXRα and RFC3 resulted in reconfiguration of the PCNA-RFC complex. Furthermore, we found that knockdown of RXRα or overexpression of RFC3 impairs the ability of 9-cis-RA to inhibit proliferation of MCF-7 breast cancer cells and sea urchin embryogenesis. Our results indicate that 9-cis-RA-activated RXRα suppresses the growth of RA-sensitive breast cancer and embryonic cells through RFC3. PMID:22949521

  19. Endocrine, teratogenic and neurotoxic effects of cyanobacteria detected by cellular in vitro and zebrafish embryos assays.

    PubMed

    Jonas, Adam; Scholz, Stefan; Fetter, Eva; Sychrova, Eliska; Novakova, Katerina; Ortmann, Julia; Benisek, Martin; Adamovsky, Ondrej; Giesy, John P; Hilscherova, Klara

    2015-02-01

    Cyanobacteria contain various types of bioactive compounds, which could cause adverse effects on organisms. They are released into surface waters during cyanobacterial blooms, but there is little information on their potential relevance for effects in vivo. In this study presence of bioactive compounds was characterized in cyanobacteria Microcystis aeruginosa (Chroococcales), Planktothrix agardhii (Oscillatoriales) and Aphanizomenon gracile (Nostocales) with selected in vitro assays. The in vivo relevance of detected bioactivities was analysed using transgenic zebrafish embryos tg(cyp19a1b-GFP). Teratogenic potency was assessed by analysis of developmental disorders and effects on functions of the neuromuscular system by video tracking of locomotion. Estrogenicity in vitro corresponded to 0.95-54.6 ng estradiol equivalent(g dry weight (dw))(-1). In zebrafish embryos, estrogenic effects could not be detected potentially because they were masked by high toxicity. There was no detectable (anti)androgenic/glucocorticoid activity in any sample. Retinoid-like activity was determined at 1-1.3 μg all-trans-retinoic acid equivalent(g dw)(-1). Corresponding to the retinoid-like activity A. gracile extract also caused teratogenic effects in zebrafish embryos. Furthermore, exposure to biomass extracts at 0.3 gd wL(-1) caused increase of body length in embryos. There were minor effects on locomotion caused by 0.3 gd wL(-1)M. aeruginosa and P. agardhii extracts. The traditionally measured cyanotoxins microcystins did not seem to play significant role in observed effects. This indicates importance of other cyanobacterial compounds at least towards some species or their developmental phases. More attention should be paid to activity of retinoids, estrogens and other bioactive substances in phytoplankton using in vitro and in vivo bioassays. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. A sensitive and specific method for measurement of multiple retinoids in human serum with UHPLC-MS/MS

    PubMed Central

    Arnold, Samuel L. M.; Amory, John K.; Walsh, Thomas J.; Isoherranen, Nina

    2012-01-01

    Retinol (vitamin A) circulates at 1–4 μM concentration and is easily measured in serum. However, retinol is biologically inactive. Its metabolite, retinoic acid (RA), is believed to be responsible for biological effects of vitamin A, and hence the measurement of retinol concentrations is of limited value. A UHPLC-MS/MS method using isotope-labeled internal standards was developed and validated for quantitative analysis of endogenous RA isomers and metabolites. The method was used to measure retinoids in serum samples from 20 healthy men. In the fed state, the measured concentrations were 3.1 ± 0.2 nM for atRA, 0.1 ± 0.02 nM for 9-cisRA, 5.3 ± 1.3 nM for 13-cisRA, 0.4 ± 0.4 nM for 9,13-dicisRA, and 17.2 ± 6.8 nM for 4oxo-13-cisRA. The concentrations of the retinoids were not significantly different when measured after an overnight fast (3.0 ± 0.1 nM for atRA, 0.09 ± 0.01nM for 9-cisRA, 3.9 ± 0.2 nM for 13-cisRA, 0.3 ± 0.1 nM for 9,13-dicisRA, and 11.9 ± 1.6 nM for 4oxo-13-cisRA). 11-cisRA and 4OH-RA were not detected in human serum. The high sensitivity of the MS/MS method combined with the UHPLC separation power allowed detection of endogenous 9-cisRA and 4oxo-atRA for the first time in human serum. PMID:22192917

  1. Sebum-suppressing activity of the nonpolar arotinoid Ro 15-0778 in rodents.

    PubMed

    Boris, A; Hurley, J; Wong, C Q; Comai, K; Shapiro, S

    1988-01-01

    Retinoids are known to modulate sebaceous gland activity in humans and animals. The nonpolar arotinoid Ro 15-0778 [(E)-1,2,3,4-tetrahydro-1,1,4,4-tetramethyl-6-(1-methyl-2-phenylethen yl) naphthalene] does not contain a polar end group and is devoid of the classical retinoid side effects of hypervitaminosis A. The favorable toxicological profile stimulated the evaluation of this arotinoid in animal models of sebum production. In castrated, testosterone-stimulated male rats, Ro 15-0778 is 50 times more potent than 13-cis-retinoic acid in inhibiting the production and subsequent secretion of sebum. The oral ED50 value of Ro 15-0778 is 30 micrograms/kg, while an oral dose of 0.5 mg/kg inhibited sebum secretion nearly 100%. In testosterone-stimulated female rats, Ro 15-0778 inhibits sebum secretion significantly with an oral ED50 of 140 micrograms/kg and an s.c. ED50 of 75 micrograms/kg. Ro 15-0778 was also evaluated for its ability to prevent testosterone induction of the immature hamster flank organ. The topical ED50 is 0.53 mg/kg and the oral ED50 is 38 mg/kg. This arotinoid is similarly active in mature male hamsters without testosterone treatment. In addition, the retinoid is active topically and orally in reducing the size of the gerbil abdominal sebaceous gland. The compound exhibits no antiandrogenic activity when tested in ventral prostrate and seminal vesicle assays in rats. Additionally, the compound does not have estrogenic activity when tested in the rat uterine weight assay. High doses of Ro 15-0778 in humans did not demonstrate significant sebum-suppressing activity.(ABSTRACT TRUNCATED AT 250 WORDS)

  2. Prescription patterns and costs of acne/rosacea medications in Medicare patients vary by prescriber specialty.

    PubMed

    Zhang, Myron; Silverberg, Jonathan I; Kaffenberger, Benjamin H

    2017-09-01

    Prescription patterns for acne/rosacea medications have not been described in the Medicare population, and comparisons across specialties are lacking. To describe the medications used for treating acne/rosacea in the Medicare population and evaluate differences in costs between specialties. A cross-sectional study was performed of the 2008 and 2010 Centers for Medicare and Medicaid Services Prescription Drug Profiles, which contains 100% of Medicare part D claims. Topical antibiotics accounted for 63% of all prescriptions. Patients ≥65 years utilized more oral tetracycline-class antibiotics and less topical retinoids. Specialists prescribed brand name drugs for the most common topical retinoids and most common topical antibiotics more frequently than family medicine/internal medicine (FM/IM) physicians by 6%-7%. Topical retinoids prescribed by specialists were, on average, $18-$20 more in total cost and $2-$3 more in patient cost than the same types of prescriptions from FM/IM physicians per 30-day supply. Specialists (60%) and IM physicians (56%) prescribed over twice the rate of branded doxycycline than FM doctors did (27%). The total and patient costs for tetracycline-class antibiotics were higher from specialists ($18 and $4 more, respectively) and IM physicians ($3 and $1 more, respectively) than they were from FM physicians. The data might contain rare prescriptions used for conditions other than acne/rosacea, and suppression algorithms might underestimate the number of specialist brand name prescriptions. Costs of prescriptions for acne/rosacea from specialists are higher than those from primary care physicians and could be reduced by choosing generic and less expensive options. Copyright © 2017 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.

  3. Down-regulated RPS3a/nbl expression during retinoid-induced differentiation of HL-60 cells: a close association with diminished susceptibility to actinomycin D-stimulated apoptosis.

    PubMed

    Russell, L; Naora, H; Naora, H

    2000-04-01

    The efficacy of anticancer agents significantly depends on the differential susceptibility of undifferentiated cancer cells and differentiated normal cells to undergo apoptosis. We previously found that enhanced expression of RPS3a/nbl, which apparently encodes a ribosomal protein, seems to prime cells for apoptosis, while suppressing such enhanced expression triggers cell death. The present study found that HL-60 cells induced to differentiate by all-trans retinoic acid did not undergo apoptosis following treatment with actinomycin D whereas undifferentiated HL-60 cells were highly apoptosis-susceptible, confirming earlier suggestions that differentiated cells have diminished apoptosis-susceptibility. Undifferentiated HL-60 cells highly expressed RPS3a/nbl whereas all-trans retinoic acid -induced differentiated cells exhibited markedly reduced levels, suggesting that apoptosis-resistance of differentiated cells could be due to low RPS3a/nbl expression. Down-regulation of enhanced RPS3a/nbl expression was also observed in cells induced to differentiate with the retinoid 4-[(E)-2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-napthalenyl)-1- propenyl]benzoic acid without any significant induction of cell death. While down-regulation of RPS3a/nbl expression during differentiation did not apparently induce apoptosis, RPS3a/nbl antisense oligomers triggered death of undifferentiated HL-60 cells, but not of retinoid-induced differentiated cells. It therefore seems that while down-regulation of enhanced RPS3a/nbl expression can induce apoptosis in undifferentiated cells, down-regulation of enhanced RPS3a/nbl expression during differentiation occurs independently of apoptosis, and could be regarded as reverting the primed condition to the unprimed (low RPS3a/nbl) state.

  4. A non-retinoid antagonist of Retinol-Binding Protein 4 rescues phenotype in a model of Stargardt disease without inhibiting the visual cycle.

    PubMed

    Racz, Boglarka; Varadi, Andras; Kong, Jian; Allikmets, Rando; Pearson, Paul G; Johnson, Graham; Cioffi, Christopher L; Petrukhin, Konstantin

    2018-06-05

    A primary pathological defect in the heritable eye disorder Stargardt disease is excessive accumulation of cytotoxic lipofuscin bisretinoids in the retina. Age-dependent accumulation of lipofuscin in the retinal pigment epithelium (RPE) matches the age-dependent increase in the incidence of the atrophic (dry) form of age-related macular degeneration (AMD) and therefore may be one of several pathogenic factors contributing to AMD progression. Lipofuscin bisretinoid synthesis in the retina depends on the influx of serum retinol from the circulation into the RPE. Formation of the tertiary retinol-binding protein 4 (RBP4)-transthyretin-retinol complex in the serum is required for this influx. Herein, we report the pharmacological effects of the non-retinoid RBP4 antagonist, BPN-14136. BPN-14136 dosing in the Abca4-/- mouse model of increased lipofuscinogenesis significantly reduced serum RBP4 levels and inhibited bisretinoid synthesis, and this inhibition correlated with a partial reduction in visual cycle retinoids such as retinaldehydes serving as bisretinoid precursors. BPN-14136 administration at doses inducing maximal serum RBP4 reduction did not produce changes in the rate of the visual cycle, consistent with minimal changes in dark adaptation. Abca4-/- mice exhibited dysregulation of the complement system in the retina, and BPN-14136 administration normalized the retinal levels of proinflammatory complement cascade components such as complement factors D and H, C-reactive protein, and C3. We conclude that BPN-14136 has several beneficial characteristics, combining inhibition of bisretinoid synthesis and reduction in retinaldehydes with normalization of the retinal complement system. BPN-14136, or a similar compound, may be a promising drug candidate to manage Stargardt disease and dry AMD. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  5. The Sun & Our Skin: An Update for Biology Teachers.

    ERIC Educational Resources Information Center

    Anastasiou, C. J.

    1991-01-01

    The effect of sunlight on skin is described. Topics of discussion include the ozone layer, photosynthesis of vitamin D, tanning, the immune system, skin cancers, moles, prevention, sunscreens, effect of diet, vitamins C and E, the retinoids, carotenoids, and vaccines. Activities are provided. (KR)

  6. Am80 induces neuronal differentiation via increased tropomyosin-related kinase B expression in a human neuroblastoma SH-SY5Y cell line.

    PubMed

    Shiohira, Hideo; Kitaoka, Akira; Enjoji, Munechika; Uno, Tsukasa; Nakashima, Manabu

    2012-01-01

    Am80, a synthetic retinoid, has been used in differentiation therapy for acute promyelocytic leukemia (APL). All-trans retinoic acid (ATRA) as one of natural retinoid has been also used to treat APL. ATRA treatment causes neuronal differentiation by inducing tropomyosin-related kinase B (TrkB) expression and increasing the sensitivity to brain-derived neurotrophic factor (BDNF), a TrkB ligand. In the present study, we investigated the effects of Am80 on neuronal differentiation, BDNF sensitivity and TrkB expression in human neuroblastoma SH-SY5Y cells. Treatment with Am80 induced morphological differentiation of neurite outgrowth and increased the expression of GAP43 mRNA, a neuronal differentiation marker. Additionally, TrkB protein was also increased, and exogenous BDNF stimulation after treatment with Am80 induced greater neurite outgrowth than without BDNF treatment. These results suggest that Am80 induced neuronal differentiation by increasing TrkB expression and BDNF sensitivity.

  7. Retinoid X receptor α attenuates host antiviral response by suppressing type I interferon

    PubMed Central

    Ma, Feng; Liu, Su-Yang; Razani, Bahram; Arora, Neda; Li, Bing; Kagechika, Hiroyuki; Tontonoz, Peter; Núñez, Vanessa; Ricote, Mercedes; Cheng, Genhong

    2015-01-01

    The retinoid X receptor α (RXRα), a key nuclear receptor in metabolic processes, is down-regulated during host antiviral response. However, the roles of RXRα in host antiviral response are unknown. Here we show that RXRα overexpression or ligand activation increases host susceptibility to viral infections in vitro and in vivo, while Rxra −/− or antagonist treatment reduces infection by the same viruses. Consistent with these functional studies, ligand activation of RXR inhibits the expression of antiviral genes including type I interferon (IFN) and Rxra −/− macrophages produce more IFNβ than WT macrophages in response to polyI:C stimulation. Further results indicate that ligand activation of RXR suppresses the nuclear translocation of β-catenin, a co-activator of IFNβ enhanceosome. Thus, our studies have uncovered a novel RXR-dependent innate immune regulatory pathway, suggesting that the downregulation of RXR expression or RXR antagonist treatment benefits host antiviral response, whereas RXR agonist treatment may increase the risk of viral infections. PMID:25417649

  8. Clindamycin phosphate 1.2% and tretinoin 0.025% gel for rosacea: summary of a placebo-controlled, double-blind trial.

    PubMed

    Freeman, Scott A; Moon, Summer D; Spencer, James M

    2012-12-01

    Rosacea is a common, chronic, and poorly understood dermatological condition characterized by an inflammatory component composed of papules and pustules and a vascular component composed of flushing and erythema. Current treatment options include topical, systemic, and light-based methods, each of which focuses on either the inflammatory or the vascular component. Retinoids are not routinely indicated as treatment because of the common conception that they would be too inflammatory for the sensitive rosacea patient. However, photodamage may play a role in rosacea and tretinoin is well-known to repair photodamage. Thirty rosacea subjects were enrolled to assess their response to the use of clindamycin phosphate 1.2% and tretinoin 0.025% gel (ZIANA; Medicis Pharmaceutical Corporation, Scottsdale, AZ) for a period of 12 weeks. The results showed a dramatic decrease in pustules and papules without any significant inflammation or overall intolerance. No improvement in facial redness was achieved. Based on our results, more investigation of topical retinoids for rosacea treatment is prudent.

  9. Triple nanoemulsion potentiates the effects of topical treatments with microencapsulated retinol and modulates biological processes related to skin aging.

    PubMed

    Afornali, Alessandro; Vecchi, Rodrigo de; Stuart, Rodrigo Makowiecky; Dieamant, Gustavo; Oliveira, Luciana Lima de; Brohem, Carla Abdo; Feferman, Israel Henrique Stokfisz; Fabrício, Lincoln Helder Zambaldi; Lorencini, Márcio

    2013-01-01

    The sum of environmental and genetic factors affects the appearance and function of the skin as it ages. The identification of molecular changes that take place during skin aging provides biomarkers and possible targets for therapeutic intervention. Retinoic acid in different formulations has emerged as an alternative to prevent and repair age-related skin damage. To understand the effects of different retinoid formulations on the expression of genes associated with biological processes that undergo changes during skin aging. Ex-vivo skin samples were treated topically with different retinoid formulations. The modulation of biological processes associated with skin aging was measured by Reverse Transcription quantitative PCR (RT-qPCR). A formulation containing microencapsulated retinol and a blend of active ingredients prepared as a triple nanoemulsion provided the best results for the modulation of biological, process-related genes that are usually affected during skin aging. This association proved to be therapeutically more effective than tretinoin or microencapsulated retinol used singly.

  10. Classical dendritic cells mediate fibrosis directly via the retinoic acid pathway in severe eye allergy

    PubMed Central

    Ahadome, Sarah D.; Mathew, Rose; Reyes, Nancy J.; Mettu, Priyatham S.; Cousins, Scott W.; Calder, Virginia L.; Saban, Daniel R.

    2016-01-01

    Fibrosis is a shared end-stage pathway to lung, liver, and heart failure. In the ocular mucosa (conjunctiva), fibrosis leads to blindness in trachoma, pemphigoid, and allergy. The indirect fibrogenic role of DCs via T cell activation and inflammatory cell recruitment is well documented. However, here we demonstrate that DCs can directly induce fibrosis. In the mouse model of allergic eye disease (AED), classical CD11b+ DCs in the ocular mucosa showed increased activity of aldehyde dehydrogenase (ALDH), the enzyme required for retinoic acid synthesis. In vitro, CD11b+ DC–derived ALDH was associated with 9-cis-retinoic acid ligation to retinoid x receptor (RXR), which induced conjunctival fibroblast activation. In vivo, stimulating RXR led to rapid onset of ocular mucosal fibrosis, whereas inhibiting ALDH activity in DCs or selectively depleting DCs markedly reduced fibrosis. Collectively, these data reveal a profibrotic ALDH-dependent pathway by DCs and uncover a role for DC retinoid metabolism. PMID:27595139

  11. Retinoid-signaling in progenitors controls specification and regeneration of the urothelium

    PubMed Central

    Reiley, Maia; Laufer, Ed; Metzger, Daniel; Liang, Fengxia; Liao, Yi; Sun, Tung-Tien; Aronow, Bruce; Rosen, Roni; Mauney, Josh; Adam, Rosalyn; Rosselot, Carolina; Van Batavia, Jason; McMahon, Andrew; McMahon, Jill; Guo, Jin-Jin; Mendelsohn, Cathy

    2013-01-01

    The urothelium is a stratified epithelium that prevents exchange of water and toxic substances between the urinary tract and blood. It is composed of Keratin-5-expressing-basal-cells (K5-BCs), intermediate cells and superficial cells specialized for synthesis and transport of uroplakins that assemble into the apical barrier. K5-BCs are considered to be a progenitor cell type in the urothelium and other stratified epithelia. Fate mapping studies however, reveal that P-cells, a transient population, are urothelial progenitors in the embryo, intermediate cells are superficial cell progenitors in the adult regenerating urothelium, and K5-BCs are a distinct lineage. Our studies indicate that retinoids, potent regulators of ES cells and other progenitors, are also required in P-cells and intermediate cells for their specification. These observations have important implications for tissue engineering and repair, and ultimately, may lead to treatments that prevent loss of the urothelial barrier, a major cause of voiding dysfunction and bladder pain syndrome. PMID:23993789

  12. Retinoid signaling in progenitors controls specification and regeneration of the urothelium.

    PubMed

    Gandhi, Devangini; Molotkov, Andrei; Batourina, Ekatherina; Schneider, Kerry; Dan, Hanbin; Reiley, Maia; Laufer, Ed; Metzger, Daniel; Liang, Fengxia; Liao, Yi; Sun, Tung-Tien; Aronow, Bruce; Rosen, Roni; Mauney, Josh; Adam, Rosalyn; Rosselot, Carolina; Van Batavia, Jason; McMahon, Andrew; McMahon, Jill; Guo, Jin-Jin; Mendelsohn, Cathy

    2013-09-16

    The urothelium is a multilayered epithelium that serves as a barrier between the urinary tract and blood, preventing the exchange of water and toxic substances. It consists of superficial cells specialized for synthesis and transport of uroplakins that assemble into a tough apical plaque, one or more layers of intermediate cells, and keratin 5-expressing basal cells (K5-BCs), which are considered to be progenitors in the urothelium and other specialized epithelia. Fate mapping, however, reveals that intermediate cells rather than K5-BCs are progenitors in the adult regenerating urothelium, that P cells, a transient population, are progenitors in the embryo, and that retinoids are critical in P cells and intermediate cells, respectively, for their specification during development and regeneration. These observations have important implications for tissue engineering and repair and, ultimately, may lead to treatments that prevent loss of the urothelial barrier, a major cause of voiding dysfunction and bladder pain syndrome. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. Use of a Cutaneous Body Image (CBI) scale to evaluate self perception of body image in acne vulgaris.

    PubMed

    Amr, Mostafa; Kaliyadan, Feroze; Shams, Tarek

    2014-01-01

    Skin disorders such as acne, which have significant cosmetic implications, can affect the self-perception of cutaneous body image. There are many scales which measure self-perception of cutaneous body image. We evaluated the use of a simple Cutaneous Body Image (CBI) scale to assess self-perception of body image in a sample of young Arab patients affected with acne. A total of 70 patients with acne answered the CBI questionnaire. The CBI score was correlated with the severity of acne and acne scarring, gender, and history of retinoids use. There was no statistically significant correlation between CBI and the other parameters - gender, acne/acne scarring severity, and use of retinoids. Our study suggests that cutaneous body image perception in Arab patients with acne was not dependent on variables like gender and severity of acne or acne scarring. A simple CBI scale alone is not a sufficiently reliable tool to assess self-perception of body image in patients with acne vulgaris.

  14. Primary amines protect against retinal degeneration in mouse models of retinopathies

    PubMed Central

    Maeda, Akiko; Golczak, Marcin; Chen, Yu; Okano, Kiichiro; Kohno, Hideo; Shiose, Satomi; Ishikawa, Kaede; Harte, William; Palczewska, Grazyna; Maeda, Tadao; Palczewski, Krzysztof

    2011-01-01

    Vertebrate vision is initiated by photoisomerization of the visual pigment chromophore, 11-cis-retinal, and is maintained by continuous regeneration of this retinoid through a series of reactions termed the retinoid cycle. However, toxic side reaction products, especially those involving reactive aldehyde groups of the photoisomered product, all-trans-retinal, can cause severe retinal pathology. Here we lowered peak concentrations of free all-trans-retinal with primary amine-containing FDA-approved drugs that did not inhibit chromophore regeneration in mouse models of retinal degeneration. Schiff base adducts between all-trans-retinal and these amines were identified by mass spectrometry. Adducts were observed in mouse eyes only when an experimental drug protected the retina from degeneration in both short-term and long-term treatment experiments. This study demonstrates a molecular basis of all-trans-retinal-induced retinal pathology and identifies an assemblage of FDA-approved compounds with protective effects against this pathology in a mouse model that displays features of Stargardt’s and age-related retinal degeneration. PMID:22198730

  15. Clearance of PML/RARA-bound promoters suffice to initiate APL differentiation.

    PubMed

    Vitaliano-Prunier, Adeline; Halftermeyer, Juliane; Ablain, Julien; de Reynies, Aurélien; Peres, Laurent; Le Bras, Morgane; Metzger, Daniel; de Thé, Hugues

    2014-12-11

    PML/RARA, a potent transcriptional inhibitor of nuclear receptor signaling, represses myeloid differentiation genes and drives acute promyelocytic leukemia (APL). Association of the retinoid X receptor-α (RXRA) coreceptor to PML/RARA is required for transformation, with RXRA promoting its efficient DNA binding. APL is exquisitely sensitive to retinoic acid (RA) and arsenic trioxide (arsenic), which both trigger cell differentiation in vivo. Whereas RA elicits transcriptional activation of PML/RARA targets, how arsenic triggers differentiation remains unclear. Here we demonstrate that extinction of PML/RARA triggers terminal differentiation in vivo. Similarly, ablation of retinoid X receptors loosens PML/RARA DNA binding, inducing terminal differentiation of APL cells ex vivo or in vivo. RXRA sumoylation directly contributes to PML/RARA-dependent transformation ex vivo, presumably by enhancing transcriptional repression. Thus, APL differentiation is a default program triggered by clearance of PML/RARA-bound promoters, rather than obligatory active transcriptional activation, explaining how arsenic elicits APL maturation through PML/RARA degradation. © 2014 by The American Society of Hematology.

  16. RXR function requires binding to an endogenous terpenoid ligand

    USDA-ARS?s Scientific Manuscript database

    The issue of whether the nuclear receptor RXR must bind to an endogenous, nanomolar affinity ligand in order to perform its natural function is still unsettled (1). On the basis of our previous studies establishing that the Drosophilamelanogaster ortholog of the retinoid X receptor ("ultraspiracle,"...

  17. Cone outer segment and Müller microvilli pericellular matrices provide binding domains for interphotoreceptor retinoid-binding protein (IRBP).

    PubMed

    Garlipp, Mary Alice; Gonzalez-Fernandez, Federico

    2013-08-01

    The close packing of vertebrate photoreceptors presents a challenge to the exchange of molecules between the outer segments, retinal pigmented epithelium (RPE), and Müller glia. An extracellular hyaluronan scaffold separates these cells while soluble interphotoreceptor matrix (IPM) proteins traffic visual cycle retinoids, fatty acids, and other molecules between them. In the IPM, retinoids and fatty acids are carried by interphotoreceptor retinoid-binding protein (IRBP). The fact that much of the retina's IRBP can be extracted by saline wash has led to the notion that IRBP does not bind to the retina, but freely distributes itself within the subretinal space. In this study, we challenge this idea by asking if there are specialized IPM domains that bind IRBP, perhaps facilitating its ability to target delivery/uptake of its ligands. Xenopus is an ideal animal model to study the role of the IPM in RPE-photoreceptor interactions. Here, we took advantage of the large size of its photoreceptors, ability to detach the retina in light, sustainability of the retina in short term organ culture, and the availability of recombinant full-length Xenopus IRBP and antisera directed against Xenopus IRBP. We compared the distribution of wash resistant native IRBP, and that of IRBP-Alexa 647 binding in Xenopus retina. IRBP and cone opsin were localized using anti-Xenopus IRBP serum, and monoclonal COS-1 respectively. Cone matrix sheath proteoglycans were localized with wheat germ agglutinin (WGA), and diffuse IPM proteoglycans with peanut agglutinin (PNA). Wholemounts and frozen sections were compared by immunofluorescence from retinas detached under Ringer's followed by additional washes, or detached directly under 4% paraformaldehyde without Ringer's wash. Undetached Lowicryl embedded retinas were subjected to IRBP immunogold electron microscopy (EM). Immunogold labeled a diffuse network of filamentous structures, and a separate distinct flocculant material directly coating the outer segments, filling the rod periciliary ridge, and associated with Müller microvilli. By immunofluorescence, Ringer's wash removed most of the diffuse IRBP, but not that coating the outer segments. IRBP-Alexa 647 bound to the cone outer segments and Müller villi region, and comparably less to rod outer segments. Co-incubation with unlabeled IRBP markedly reduced this binding; ovalbumin-Alexa 647 and Alexa 647 dye alone showed no binding. Our data suggest that the pericellular matrix of the cone outer segments and Müller microvilli provide specialized domains that facilitate IRBP's functions. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. The retinoids. A review of their clinical pharmacology and therapeutic use.

    PubMed

    Orfanos, C E; Ehlert, R; Gollnick, H

    1987-10-01

    With the introduction of the synthetic retinoids, oral therapy with an acceptable risk/benefit ratio became possible for a variety of skin diseases including severe acne, psoriasis and numerous genodermatoses. This article reviews the clinical pharmacology, mechanisms of action and therapeutic use of the retinoids, particularly isotretinoin (13-cis-retinoic acid) and etretinate. The free aromatic acid of etretinate, etretin, and the new polyaromatic retinoid compounds (arotinoids) are also discussed. Isotretinoin is used clinically for oral therapy of severe acne, but is also recommended for severe Gram-negative folliculitis and rosacea not responding to traditional therapy. The results of several studies have established that acne therapy should be started with 1.0 mg/kg/day for 2 to 3 months after which the daily dosage should be lowered to 0.2 to 0.5 mg/kg/day for another 2 to 3 months. This therapeutic regimen of isotretinoin has proven to be the most successful in preventing relapses. Etretinate is particularly useful for oral therapy of widespread plaque-like, pustular and erythrodermic psoriasis, and of generalised lichen planus, Darier's disease and severe congenital ichthyoses. Whereas pustular forms of psoriasis require a high daily dosage of 1.0 mg/kg/day, erythrodermic psoriasis should be treated with a lower dosage of 0.25 to 0.35 mg/kg/day. In chronic plaque-like psoriasis, a mean daily dosage of 0.5 mg/kg/day over several weeks to months, usually combined with photo(chemo)therapy, tar or dithranol, is recommended. Other indications for oral etretinate therapy are adequately treated with a moderate dosage of 0.4 to 0.75 mg/kg/day. Etretin differs from etretinate in having a much shorter elimination half-life of 2 to 3 days, in contrast to 80 to 100 days after long term administration of etretinate. Moreover, it has not been shown to increase serum cholesterol levels. However, its clinical efficacy is not yet clearly established. Among the arotinoids, arotinoid ethylester (Ro 13-6298) has revealed the best anti-psoriatic and anti-inflammatory effects at extremely low dose levels. Furthermore, no significant elevations of serum lipids have been observed. Taking its prolonged elimination half-life and its efficacy/side effect ratio into account, the drug is comparable to etretinate. The free arotinoid carboxylic acid (Ro 13-7410) is currently undergoing clinical investigation. Another arotinoid, the parent compound Ro 15-0778, has not demonstrated any convincing clinical efficacy in acne or psoriasis, but topical anti-inflammatory effects were evident in some models.(ABSTRACT TRUNCATED AT 400 WORDS)

  19. COMPARING THE EFFECTS OF RETINOIC ACID ON AMPHIBIAN LIMB DEVELOPMENT AND LETHALITY: CHRONIC EXPOSURE RESULTS IN LETHALITY NOT LIMB MALFORMATIONS

    EPA Science Inventory

    Recently, high frequencies of malformations have been reported in amphibians across the United States. It has been suggested that the malformations may be the result of xenobiotic disruption of retinoid signaling pathways during embryogenesis and tadpole development. Therefore, a...

  20. RETINOID METABOLISM IN FISH EMBRYOS FROM SENSITIVE AND RESISTANT POPULATIONS EXPOSED TO DIOXIN-LIKE COMPOUNDS

    EPA Science Inventory

    Early developmental stages of fish are extremely sensitive to a class of toxic and persistent environmental contaminants known as dioxin-like compounds (DLCs). Most of the toxicological actions of DLCs are mediated via the Aryl hydrocarbon Receptor (AhR) that regulates transcript...

  1. Combination Therapy Employing Retinoids and Chromatin Remodeling Agents in Human Breast Carcinomas

    DTIC Science & Technology

    2004-10-01

    transfected with 1.5 ýtg of a Renilla luciferase plasmid as a transfection control. Sixteen hours after the transfection, fresh medium was replaced in the...luciferase activity was normalized to the corresponding Renilla luciferase activity. Relative luciferase activity was calculated as a ratio over

  2. EFFECTS OF METHOPRENE, ITS METABOLITES, AND BREAKDOWN PRODUCTS ON RETINOID-ACTIVATED PATHWAYS IN TRANSFECTED CELL LINES

    EPA Science Inventory

    Methoprene is a terpene-based insecticide designed to act as an agonist of insect juvenile hormone, which is essential for the transition from larval to adult forms in some metamorphic insects. Recent evidence suggests that a methoprene metabolite, methoprene acid, activates a ve...

  3. EFFECTS OF METHOPRENE DERIVATIVES ON THE EXPRESSION OF RETINOIC ACID SENSITIVE GENES AND PROTEINS IN CULTURED CELLS

    EPA Science Inventory

    The insect juvenile hormone analog methoprene has been suggested as a possible cause of malformations in frogs and other amphibians. Methoprene has structural similarities to the ubiquitous development regulator, retinoic acid, and thus, may bind to retinoid receptors and consequ...

  4. STAGE- AND SPECIES- SPECIFIC DEVELOPMENTAL TOXICITY OF ALL-TRANS RETINOIC ACID IN FOUR NATIVE NORTH AMERICAN RANIDS AND XENOPUS LAEVIS

    EPA Science Inventory

    Within the last decade there have been increasing reports of malformed amphibians across North America. Recently, it has been suggested that hindlimb malformations are a consequence of xenobiotic disruption of developmental pathways regulated by retinoids. To assess the validity ...

  5. Transcriptome profiling to identify ATRA-responsive genes in human iPSC-derived endoderm for high-throughput point of departure analysis (SOT Annual Meeting)

    EPA Science Inventory

    Toxicological tipping points occur at chemical concentrations that overwhelm a cell’s adaptive response leading to permanent effects. We focused on retinoid signaling in differentiating endoderm to identify developmental pathways for tipping point analysis. Human induced pluripot...

  6. SENESCENCE-ASSOCIATED DECLINE IN HEPATIC PEROXISOMAL ENZYME ACTIVITIES CORRESPONDS WITH DIMINISHED LEVELS OF RETINOID X RECEPTOR ALPHA, BUT NOT PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR ALPHA1

    EPA Science Inventory

    Abstract

    Aging is associated with alterations in hepatic peroxisomal metabolism and susceptibility to hepatocarcinogenecity produced by agonists of peroxisome proliferator-activated receptor alpha (PPARa). Mechanisms involved in these effects are not well understood. Howev...

  7. Effect of different carotenoid-containing diets on the vitamin A levels and colour parameters in Iberian pigs' tissues: utility as biomarkers of traceability.

    PubMed

    Álvarez, R; Vicario, I M; Meléndez-Martínez, A J; Alcalde, M J

    2014-10-01

    Retinol and fat colour parameters in Iberian pigs fed on different carotenoid-containing diets were assessed. Thirty animals in two groups were considered: Iberian breed pigs fed on acorns and grass (Montanera) and on concentrate (Cebo). Carotenoids and retinoids were analysed in the diets and in plasma, liver and perirenal fat of the animals by HPLC and HPLC-MS. Retinol levels in plasma and fat were similar in Montanera and Cebo animals. The utility of retonids and colour parameters as traceability index was also explored. Retinoids in liver classified correctly 93% of the animals according to their diet L* and hab. CIELAB parameters of the perirenal fat discriminated correctly 78.6% of the animals according to their diet. L* values for the Montanera animals were significantly different (P<0.01) from those fed on concentrate. It can be claimed that the liver retinol profile and fat colour parameters can be useful for feeding traceability purposes in Iberian pigs breed in Montanera and Cebo. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Triple nanoemulsion potentiates the effects of topical treatments with microencapsulated retinol and modulates biological processes related to skin aging *

    PubMed Central

    Afornali, Alessandro; de Vecchi, Rodrigo; Stuart, Rodrigo Makowiecky; Dieamant, Gustavo; de Oliveira, Luciana Lima; Brohem, Carla Abdo; Feferman, Israel Henrique Stokfisz; Fabrício, Lincoln Helder Zambaldi; Lorencini, Márcio

    2013-01-01

    BACKGROUND The sum of environmental and genetic factors affects the appearance and function of the skin as it ages. The identification of molecular changes that take place during skin aging provides biomarkers and possible targets for therapeutic intervention. Retinoic acid in different formulations has emerged as an alternative to prevent and repair age-related skin damage. OBJECTIVES To understand the effects of different retinoid formulations on the expression of genes associated with biological processes that undergo changes during skin aging. METHODS Ex-vivo skin samples were treated topically with different retinoid formulations. The modulation of biological processes associated with skin aging was measured by Reverse Transcription quantitative PCR (RT-qPCR). RESULTS A formulation containing microencapsulated retinol and a blend of active ingredients prepared as a triple nanoemulsion provided the best results for the modulation of biological, process-related genes that are usually affected during skin aging. CONCLUSION This association proved to be therapeutically more effective than tretinoin or microencapsulated retinol used singly. PMID:24474102

  9. Phase II Trial of β-All-trans-Retinoic Acid for Cervical Intraepithelial Neoplasia Delivered via a Collagen Sponge and Cervical Cap

    PubMed Central

    Graham, Vivian; Surwit, Earl S.; Weiner, Sheldon; Meyskens, Frank L.

    1986-01-01

    Retinoids are effective suppressors of the phenotypic development of cancer in many animal systems, whether the process is initiated by chemical, physical or viral carcinogens. Cases of cervical intraepithelial neoplasia are excellent for studying the effectiveness of retinoids as chemopreventive agents because the process can be closely followed by serial colposcopic and pathologic (cytology or biopsy) means and changes in the condition safely monitored. We have previously conducted a phase I study of trans-retinoic acid (Tretinoin) given topically by a collagen sponge and cervical cap. A dose of 0.372% was selected for phase II trial. We have treated 20 patients with topical retinoic acid, and a complete response with total regression of disease was obtained in 50%. Systemic and cervical side effects were mild and vaginal side effects moderate but tolerable. These results provide a clinical basis for a randomized, double-blind phase III study to definitely answer the question of whether retinoic acid is an effective chemopreventive agent for cervical cancer. ImagesFigure. 1. PMID:3765597

  10. Chronic treatment with 13-cis-retinoic acid changes aggressive behaviours in the resident-intruder paradigm in rats.

    PubMed

    Trent, Simon; Drew, Cheney J G; Mitchell, Paul J; Bailey, Sarah J

    2009-12-01

    Retinoids, vitamin A related compounds, have an established role in the development of the nervous system and are increasingly recognized to play a role in adult brain function. The synthetic retinoid, 13-cis-retinoic acid (13-cis-RA, Roaccutane) is widely used to treat severe acne but has been linked to an increased risk of neuropsychiatric side effects, including depression. Here we report that chronic administration with 13-cis-RA (1 mg/kg i.p. daily, 7-14 days) in adult rats reduced aggression- and increased flight-related behaviours in the resident-intruder paradigm. However, in the forced swim, sucrose consumption and open field tests treatment for up to 6 weeks with 13-cis-RA did not modify behaviour in adult or juvenile animals. The behavioural change observed in the resident-intruder paradigm is directly opposite to that observed with chronic antidepressant administration. These findings indicate that when a suitably sensitive behavioural test is employed then chronic administration of 13-cis-RA in adult rats induces behavioural changes consistent with a pro-depressant action.

  11. Treatment of keratitis-ichthyosis- deafness (KID) syndrome in children: a case report and review of the literature.

    PubMed

    Patel, Viraat; Sun, Grace; Dickman, Meghan; Khuu, Phuong; Teng, Joyce M C

    2015-01-01

    Keratitis-ichthyosis-deafness (KID) syndrome is a rare hereditary cornification disorder resulting from mutations in connexin 26, a protein important for intercellular communication. In addition to the characteristic clinical triad of congenital bilateral sensorineural hearing loss, keratitis, and erythrokeratoderma, affected individuals also suffer from chronic bacterial and fungal infections and have an increased risk of benign and malignant cutaneous tumors. Treatments with antibiotics, antifungals, and systemic retinoids have been reported with variable response. Ocular and skeletal toxicity from prolonged exposure to systemic retinoids is a major concern especially in children. We report a case of a 7-year-old boy with KID syndrome complicated by frequent infections who responded well to acitretin 0.5-1.0 mg/kg/day. The patient had significant improvement of the hyperkeratosis on the scalp, trunk, and extremities within 4 weeks after initiating treatment. The patient has been on treatment for over a year without notable ocular, skeletal, or laboratory side effects. A review of the literature focusing on therapeutic options for KID syndrome and concerns about safety and tolerability is presented. © 2014 Wiley Periodicals, Inc.

  12. An antagonist of the retinoid X receptor reduces the viability of Trichuris muris in vitro.

    PubMed

    Hurst, Rebecca J M; Hopwood, Thomas; Gallagher, Amanda L; Partridge, Frederick A; Burgis, Timothy; Sattelle, David B; Else, Kathryn J

    2014-09-27

    Trichuriasis is a parasitic disease caused by the human whipworm, Trichuris trichiura. It affects millions worldwide, particularly in the tropics. This nematode parasite burrows into the colonic epithelium resulting in inflammation and morbidity, especially in children. Current treatment relies mainly on general anthelmintics such as mebendazole but resistance to these drugs is increasingly problematic. Therefore, new treatments are urgently required. The prospect of using the retinoid X receptor (RXR) antagonist HX531 as a novel anthelmintic was investigated by carrying out multiple viability assays with the mouse whipworm Trichuris muris. HX531 reduced both the motility and viability of T. muris at its L3, L4 and adult stages. Further, bioinformatic analyses show that the T. muris genome possesses an RXR-like receptor, a possible target for HX531. The study suggested that Trichuris-specific RXR antagonists may be a source of much-needed novel anthelmintic candidates for the treatment of trichuriasis. The identification of an RXR-like sequence in the T. muris genome also paves the way for further research based on this new anthelmintic lead compound.

  13. The role of retinoic acid receptors and their cognate ligands in reproduction in a context of triorganotin based endocrine disrupting chemicals.

    PubMed

    Macejova, Dana; Toporova, L; Brtko, J

    2016-07-01

    Retinoic acid (RA), an active form of vitamin A, regulates the embryonic development, male and female reproduction and induces important effects on the cell development, proliferation, and differentiation. These effects are mediated by the retinoid (RAR) and rexinoid nuclear receptors (RXR), which are considered to be a ligand-activated, DNA-binding, trans-acting, and transcription-modulating proteins, involved in a general molecular mechanism responsible for the transcriptional responses in target genes. Organotin compounds are typical environmental contaminants and suspected endocrine disrupting substances. They may affect processes of reproductive system in mammals, predominantly via nuclear receptor signaling pathways. Triorganotins, such as tributyltin chloride (TBTCl) and triphenyltin chloride (TPTCl), are capable to bind to RXR molecules, and thus represent potent agonists of RXR subtypes of nuclear receptors not sharing any structural characteristics with endogenous ligands of nuclear receptors. Th is article summarizes selected effects of biologically active retinoids and rexinoids on both male and female reproduction and also deals with the effects of organotin compounds evoking endocrine disrupting actions in reproduction.

  14. Cheilitis in acne vulgaris patients with no previous use of systemic retinoid products.

    PubMed

    Balighi, Kamran; Daneshpazhooh, Maryam; Lajevardi, Vahideh; Talebi, Shahin; Azizpour, Arghavan

    2017-08-01

    Isotretinoin is commonly used in the treatment of acne vulgaris. While one of the more common side-effects is cheilitis, we have observed an increased incidence of cheilitis prior to the commencement of systemic isotretinoin. The aim of this study was to assess the prevalence of cheilitis among acne vulgaris patients. A non-interventional cross-sectional study of patients with acne vulgaris. Patients with previous use of systemic retinoids were excluded. The patients were examined for signs and symptoms of cheilitis. Of a total of 400 patients, 134 (34%) had evidence of cheilitis at initial presentation. Two-thirds (63%) were female (P < 0.001). The distribution of the cheilitis was as follows; 55% on the lower lip, 30% on both lips, and 16% on the upper lip. Over a quarter (27%) of patients with cheilitis had acne excorie, compared with only 8% of patients with no signs of cheilitis. Our findings suggest that cheilitis is quite common among acne vulgaris patients even before treatment with isotretinoin. © 2016 The Australasian College of Dermatologists.

  15. Inhibition of benzo(a)pyrene-induced mammary carcinogenesis by retinyl acetate. [Rats

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCormick, D.L.; Burns, F.J.; Albert, R.E.

    1981-03-01

    The administration of a 250-ppM retinyl acetate dietary supplement for various periods relative to intragastric administration of 50 mg benzo(a)pyrene (BP) significantly inhibited the induction of mammary cancers in virgin female inbred LEW/Mai rats. With day of BP administration taken as time 0, groups receiving the retinoid from weeks -2 to +1, +1 to +90, +20 to +90, and -2 to +90 showed a significant reduction in tumor response as compared to controls. The inhibition of carcinogenesis achieved by a +1 to +20 administration schedule was temporary. A 2-week exposure to supplemental retinyl acetate significantly reduced the mammary gland parenchymalmore » cell labeling index in ductal, alveolar, and terminal end bud structures. Beginning the retinyl acetate supplement 1 week after the administration of BP significantly reduced the number of terminal ductal hyperplasias. The inhibition of carcinogenesis achieved by a short period of retinyl acetate administration before and during the period of carcinogen availability as well as the inhibition achieved by long-term postcarcinogen retinoid exposure may involve an antiproliferative effect on the rat mammary gland.« less

  16. Sex-different effects of tributyltin on brain aromatase, estrogen receptor and retinoid X receptor gene expression in rockfish (Sebastiscus marmoratus).

    PubMed

    Zhang, Jiliang; Zuo, Zhenghong; Zhu, Wenwen; Sun, Ping; Wang, Chonggang

    2013-09-01

    Since the brain plays important roles in reproduction, the brain aromatase (Cyp19b), estrogen receptor (ER), retinoid X receptor (RXR) α and peroxisome proliferator-activated receptor γ were examined in rockfish after TBT exposure (1, 10, and 100 ng L(-1)). The results showed that the Cyp19b expression was elevated in the male rockfish, while no effect was produced in the females. Inconsistently, serum testosterone and 17β-estradiol showed no change in the males, while an increase of testosterone and a decrease of 17β-estradiol were observed in the females. TBT affected the ER expression in the males depending on the concentrations, however, no change was observed in the females. In addition, TBT elevated the RXRα expression in the males but produced an opposite effect in the females. In conclusion, TBT might have had sex-different effects on the brain Cyp19b, ER and RXR expression in rockfish, indicating a complex endocrine disrupting effect of TBT. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  17. DGAT1-deficiency affects the cellular distribution of hepatic retinoid and attenuates the progression of CCl4-induced liver fibrosis

    PubMed Central

    Yuen, Jason J.; Lee, Seung-Ah; Jiang, Hongfeng; Brun, Pierre-Jacques

    2015-01-01

    Background Diacylglycerol O-acyltransferase 1 (DGAT1) catalyzes the final step of triglyceride synthesis, transferring an acyl group from acyl-CoA to diacylglycerol. DGAT1 also catalyzes the acyl-CoA-dependent formation of retinyl esters in vitro and in mouse intestine and skin. Although DGAT1 is expressed in both hepatocytes and hepatic stellate cells (HSCs), we reported genetic and nutritional studies that established that DGAT1 does not contribute to retinyl ester formation in the liver. Methods We now have explored in more depth the role(s) of DGAT1 in hepatic retinoid metabolism and storage. Results Our data show that DGAT1 affects the cellular distribution between hepatocytes and HSCs of stored and newly absorbed dietary retinol. For livers of Dgat1-deficient mice, a greater percentage of stored retinyl ester is present in HSCs at the expense of hepatocytes. This is also true for newly absorbed oral [3H]retinol. These differences are associated with significantly increased expression, by 2.8-fold, of cellular retinol-binding protein, type I (RBP1) in freshly isolated HSCs from Dgat1-deficient mice, raising the possibility that RBP1, which contributes to retinol uptake into cells and retinyl ester synthesis, accounts for the differences. We further show that the retinyl ester-containing lipid droplets in HSCs are affected in Dgat1-null mice, being fewer in number but, on average, larger than in wild type (WT) HSCs. Finally, we demonstrate that DGAT1 affects experimentally induced HSC activation in vivo but that this effect is independent of altered retinoic acid availability or effects on gene expression. Conclusions Our studies establish that DGAT1 has a role in hepatic retinoid storage and metabolism, but this does not involve direct actions of DGAT1 in retinyl ester synthesis. PMID:26151058

  18. Retinoid Expression in Onchocercal Skin Disease: Pilot Study

    PubMed Central

    Mawson, Anthony R; Makunde, Williams H; Penman, Alan D; Hernandez Morales, Veronica de Los Angeles; Kalinga, Akili K; Francis, Filbert; Rubinchik, Semyon; Kibweja, Addow

    2017-01-01

    Based on the observation that the parasite Onchocerca volvulus selectively absorbs vitamin A from the host, and the known toxicity of vitamin A in higher concentration, it was hypothesized that dying microfilariae (mf) release their stores of vitamin A (retinoids) into the host circulation in toxic concentrations, inducing the signs and symptoms of onchocerciasis. We conducted a pilot study to test the hypothesis in Songea communities in Southern Tanzania, where mass drug administration with ivermectin had not been implemented by the time of the survey. The specific aim was to evaluate the correlation between the diagnosis of onchocerciasis and increased levels of retinoic acid at infection sites. The analysis was performed by determining copy numbers of a genome of O volvulus present in skin snip samples of persons with onchocerciacis, and correlating these numbers with expression levels of retinoic acid receptor-α (RAR-α), which is inducible by retinoic acid. Total DNA and RNA were extracted from each of 25 mf-positive and 25 mf-negative skin samples and evaluated using quantitative polymerase chain reaction with appropriate negative controls. Analysis of the samples, adjusted with glyceraldehyde 3-phosphate dehydrogenase gene levels, revealed that most samples with detectable RAR-α transcripts had higher levels of RAR-α expression than the assay control. However, the quality and number of samples were insufficient for statistical analysis. Fold data on the expression levels of both O volvulus DNA and RAR RNA suggested a possible trend toward higher relative RAR-α expression in samples with higher levels of O volvulus DNA (r2 = 0.25, P = .079). Evidence of a contribution of vitamin A to the pathology of onchocerciasis thus remains elusive. Future studies on the role of retinoids in onchocerciasis will require larger groups of participants as well as careful monitoring of the cold chain and tissue storage procedures in view of the sensitivity of vitamin A to heat and light. PMID:29317828

  19. Inhibitory effects of fenretinide metabolites N-[4-methoxyphenyl]retinamide (MPR) and 4-oxo-N-(4-hydroxyphenyl)retinamide (3-keto-HPR) on fenretinide molecular targets β-carotene oxygenase 1, stearoyl-CoA desaturase 1 and dihydroceramide Δ4-desaturase 1

    PubMed Central

    Poliakov, Eugenia; Samuel, William; Duncan, Todd; Gutierrez, Danielle B.; Mata, Nathan L.; Redmond, T. Michael

    2017-01-01

    The therapeutic capacity of fenretinide (N-[4-hydroxyphenyl] retinamide; 4-HPR) has been demonstrated for several conditions, including cancer, obesity, diabetes, and ocular disease. Yet, the mechanisms of action for its pleiotropic effects are still undefined. We hypothesized that investigation of two of the major physiological metabolites of fenretinide, N-[4-methoxyphenyl]retinamide (MPR) and 4-oxo-N-(4-hydroxyphenyl)retinamide (3-keto-HPR), might begin to resolve the multifaceted effects of this synthetic retinoid. We analyzed the effects of fenretinide, MPR, 3-keto-HPR, and the non-retinoid RBP4 ligand A1120, on the activity of known targets of fenretinide, stearoyl-CoA desaturase 1 (SCD1) and dihydroceramide Δ4-desaturase 1 (DES1) in ARPE-19 cells, and purified recombinant mouse beta-carotene oxygenase 1 (BCO1) in vitro. Lipids and retinoids were extracted and quantified by liquid chromatography-mass spectrometry and reversed phase HPLC, respectively. The data demonstrate that while fenretinide is an inhibitor of the activities of these three enzymes, that 3-keto-HPR is a more potent inhibitor of all three enzymes, potentially mediating most of the in vivo beneficial effects of fenretinide. However, while MPR does not affect SCD1 and DES1 activity, it is a potent specific inhibitor of BCO1. We conclude that a deeper understanding of the mechanisms of action of fenretinide and its metabolites provides new avenues for therapeutic specificity. For example, administration of 3-keto-HPR instead of fenretinide may be preferential if inhibition of SCD1 or DES1 activity is the goal (cancer), while MPR may be better for BCO1 modulation (carotenoid metabolism). Continued investigation of fenretinide metabolites in the context of fenretinide’s various therapeutic uses will begin to resolve the pleotropic nature of this compound. PMID:28448568

  20. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    PubMed

    Lee, M O; Liu, Y; Zhang, X K

    1995-08-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene expression.

  1. Deficiency of retinaldehyde dehydrogenase 1 induces BMP2 and increases bone mass in vivo.

    PubMed

    Nallamshetty, Shriram; Wang, Hong; Rhee, Eun-Jung; Kiefer, Florian W; Brown, Jonathan D; Lotinun, Sutada; Le, Phuong; Baron, Roland; Rosen, Clifford J; Plutzky, Jorge

    2013-01-01

    The effects of retinoids, the structural derivatives of vitamin A (retinol), on post-natal peak bone density acquisition and skeletal remodeling are complex and compartment specific. Emerging data indicates that retinoids, such as all trans retinoic acid (ATRA) and its precursor all trans retinaldehyde (Rald), exhibit distinct and divergent transcriptional effects in metabolism. Despite these observations, the role of enzymes that control retinoid metabolism in bone remains undefined. In this study, we examined the skeletal phenotype of mice deficient in retinaldehyde dehydrogenase 1 (Aldh1a1), the enzyme responsible for converting Rald to ATRA in adult animals. Bone densitometry and micro-computed tomography (µCT) demonstrated that Aldh1a1-deficient (Aldh1a1(-/-) ) female mice had higher trabecular and cortical bone mass compared to age and sex-matched control C57Bl/6 wild type (WT) mice at multiple time points. Histomorphometry confirmed increased cortical bone thickness and demonstrated significantly higher bone marrow adiposity in Aldh1a1(-/-) mice. In serum assays, Aldh1a1(-/-) mice also had higher serum IGF-1 levels. In vitro, primary Aldh1a1(-/-) mesenchymal stem cells (MSCs) expressed significantly higher levels of bone morphogenetic protein 2 (BMP2) and demonstrated enhanced osteoblastogenesis and adipogenesis versus WT MSCs. BMP2 was also expressed at higher levels in the femurs and tibias of Aldh1a1(-/-) mice with accompanying induction of BMP2-regulated responses, including expression of Runx2 and alkaline phosphatase, and Smad phosphorylation. In vitro, Rald, which accumulates in Aldh1a1(-/-) mice, potently induced BMP2 in WT MSCs in a retinoic acid receptor (RAR)-dependent manner, suggesting that Rald is involved in the BMP2 increases seen in Aldh1a1 deficiency in vivo. Collectively, these data implicate Aldh1a1 as a novel determinant of cortical bone density and marrow adiposity in the skeleton in vivo through modulation of BMP signaling.

  2. Reduced adiponectin expression after high-fat diet is associated with selective up-regulation of ALDH1A1 and further retinoic acid receptor signaling in adipose tissue

    PubMed Central

    Landrier, Jean-Francois; Kasiri, Elnaz; Karkeni, Esma; Mihály, Johanna; Béke, Gabriella; Weiss, Kathrin; Lucas, Renata; Aydemir, Gamze; Salles, Jérome; Walrand, Stéphane; de Lera, Angel R.; Rühl, Ralph

    2017-01-01

    Adiponectin is an adipocyte-derived adipokine with potent antidiabetic, anti-inflammatory, and antiatherogenic activity. Long-term, high-fat diet results in gain of body weight, adiposity, further inflammatory-based cardiovascular diseases, and reduced adiponectin secretion. Vitamin A derivatives/retinoids are involved in several of these processes, which mainly take place in white adipose tissue (WAT). In this study, we examined adiponectin expression as a function of dietary high-fat and high–vitamin A conditions in mice. A decrease of adiponectin expression in addition to an up-regulation of aldehyde dehydrogenase A1 (ALDH1A1), retinoid signaling, and retinoic acid response element signaling was selectively observed in WAT of mice fed a normal–vitamin A, high-fat diet. Reduced adiponectin expression in WAT was also observed in mice fed a high–vitamin A diet. Adipocyte cell culture revealed that endogenous and synthetic retinoic acid receptor (RAR)α- and RARγ-selective agonists, as well as a synthetic retinoid X receptor agonist, efficiently reduced adiponectin expression, whereas ALDH1A1 expression only increased with RAR agonists. We conclude that reduced adiponectin expression under high-fat dietary conditions is dependent on 1) increased ALDH1A1 expression in adipocytes, which does not increase all-trans-retinoic acid levels; 2) further RAR ligand–induced, WAT-selective, increased retinoic acid response element–mediated signaling; and 3) RAR ligand–dependent reduction of adiponectin expression.—Landrier, J.-F., Kasiri, E., Karkeni, E., Mihály, J., Béke, G., Weiss, K., Lucas, R., Aydemir, G., Salles, J., Walrand, S., de Lera, A. R., Rühl, R. Reduced adiponectin expression after high-fat diet is associated with selective up-regulation of ALDH1A1 and further retinoic acid receptor signaling in adipose tissue. PMID:27729412

  3. Retinoid Expression in Onchocercal Skin Disease: Pilot Study.

    PubMed

    Mawson, Anthony R; Makunde, Williams H; Penman, Alan D; Hernandez Morales, Veronica de Los Angeles; Kalinga, Akili K; Francis, Filbert; Rubinchik, Semyon; Kibweja, Addow

    2017-01-01

    Based on the observation that the parasite Onchocerca volvulus selectively absorbs vitamin A from the host, and the known toxicity of vitamin A in higher concentration, it was hypothesized that dying microfilariae (mf) release their stores of vitamin A (retinoids) into the host circulation in toxic concentrations, inducing the signs and symptoms of onchocerciasis. We conducted a pilot study to test the hypothesis in Songea communities in Southern Tanzania, where mass drug administration with ivermectin had not been implemented by the time of the survey. The specific aim was to evaluate the correlation between the diagnosis of onchocerciasis and increased levels of retinoic acid at infection sites. The analysis was performed by determining copy numbers of a genome of O volvulus present in skin snip samples of persons with onchocerciacis, and correlating these numbers with expression levels of retinoic acid receptor-α (RAR-α), which is inducible by retinoic acid. Total DNA and RNA were extracted from each of 25 mf-positive and 25 mf-negative skin samples and evaluated using quantitative polymerase chain reaction with appropriate negative controls. Analysis of the samples, adjusted with glyceraldehyde 3-phosphate dehydrogenase gene levels, revealed that most samples with detectable RAR-α transcripts had higher levels of RAR-α expression than the assay control. However, the quality and number of samples were insufficient for statistical analysis. Fold data on the expression levels of both O volvulus DNA and RAR RNA suggested a possible trend toward higher relative RAR-α expression in samples with higher levels of O volvulus DNA ( r 2  = 0.25, P  = .079). Evidence of a contribution of vitamin A to the pathology of onchocerciasis thus remains elusive. Future studies on the role of retinoids in onchocerciasis will require larger groups of participants as well as careful monitoring of the cold chain and tissue storage procedures in view of the sensitivity of vitamin A to heat and light.

  4. Combination Superficial Peels With Salicylic Acid and Post-Peel Retinoids.

    PubMed

    Kligman, Douglas E; Draelos, Zoe D

    2016-04-01

    Salicylic acid (SA) and retinoids, tretinoin (all-trans retinoic acid [ATRA]), and retinol (all-trans retinol) are widely used as topical agents for the improvement of photodamage and acne vulgaris. They can be used in daily take-home products or as part of an in-office procedure, combining the benefits of a keratolytic (SA) and a retinoid. The objective of this research was to compare the efficacy for ameliorating photodamage of topical tretinoin (0.25%) and retinol (0.25%) to baseline and with each other when applied after a 30% salicylic acid peel on human facial skin. Twenty female subjects received a full face 30% SA peel followed by the overnight application of tretinoin to a 1 randomized half-face and retinol to the opposite side (split-face study). The identical procedure was repeated at week 2. Double-blinded subject and investigator assessments of the results were captured at weeks 2 and 4. By investigator evaluation, both peeling regimens were effective in improving photodamage parameters compared to baseline. (ATRA P-values at week 4 were: P=.00008 texture, P=.00013 roughness, P=.00221 pores, P=.00098 dryness, P=.02770 erythema, and P=.00008 overall appearance. Retinol P-values at week 4 were: P=.00019 texture, P=.00053 roughness, P=.00221 pores, P=.00147 dryness, P=.02770 erythema, and P=.0043 overall appearance.) By subject self-assessment compared with baseline, both tretinoin and retinol were effective in improving overall appearance (ATRA P=.0229 and retinol P=.0190). By investigator evaluation comparing tretinoin with retinol, tretinoin was slightly better than retinol at week 4 in improving texture P=.00506, roughness P=.01171, and overall appearance P=.00506. By subject self-assessment comparing tretinoin with retinol, there was no difference in overall appearance (ATRA P=.2367 and retinol P=.3613). Either topical tretinoin (0.25%) or retinol (0.25%) can be used safely and effectively when applied in office immediately after SA peeling to ameliorate signs of photoaging.

  5. Can transforming growth factor-beta1 and retinoids modify the activity of estradiol and antiestrogens in MCF-7 breast cancer cells?.

    PubMed

    Czeczuga-Semeniuk, Ewa; Anchim, Tomasz; Dziecioł, Janusz; Dabrowska, Milena; Wołczyński, Sławomir

    2004-01-01

    Retinoic acid and transforming growth factor-beta (TGF-beta) affect differentiation, proliferation and carcinogenesis of epithelial cells. The effect of both compounds on the proliferation of cells of the hormone sensitive human breast cancer cell line (ER+) MCF-7 was assessed in the presence of estradiol and tamoxifen. The assay was based on [3H]thymidine incorporation and the proliferative activity of PCNA- and Ki 67-positive cells. The apoptotic index and expression of the Bcl-2 and p53 antigens in MCF-7 cells were also determined. Exogenous TGF-beta1 added to the cell culture showed antiproliferative activity within the concentration range of 0.003-30 ng/ml. Irrespective of TGF-beta1 concentrations, a marked reduction in the stimulatory action of estradiol (10(-9) and 10(-8) M) was observed whereas in combination with tamoxifen (10(-7) and 10(-6) M) only 30 ng/ml TGF-beta1 caused a statistically significant reduction to approximately 30% of the proliferative cells. In further experiments we examined the effect of exposure of breast cancer cells to retinoids in combination with TGF-beta1. The incorporation of [3H]thymidine into MCF-7 cells was inhibited to 52 +/- 19% (control =100%) by 3 ng/ml TGF-beta1, and this dose was used throughout. It was found that addition of TGF-beta1 and isotretinoin to the culture did not decrease proliferation, while TGF-beta1 and tretinoin at low concentrations (3 x 10(-8) and 3 x 10(-7) M) reduced the percentage of proliferating cells by approximately 30% (67+/-8% and 67+/-5%, P<0.05 compared to values in the tretinoin group). Both retinoids also led to a statistically significant decrease in the stimulatory effect of 10(-9) M estradiol, attenuated by TGF-beta1. In addition, the retinoids in combination with TGF-beta1 and tamoxifen (10(-6) M) caused a further reduction in the percentage of proliferating cells. Immunocytochemical analysis showed that all the examined compounds gave a statistically significant reduction in the percentage of cells with a positive reaction to PCNA and Ki 67 antigen. TGF-beta1, isotretinoin and tretinoin added to the culture resulted in the lowest percentage of PCNA positive cells. However, the lowest fraction of Ki 67 positive cells was observed after addition of isotretinoin. The obtained results also confirm the fact that the well-known regulatory proteins Bcl-2 and p53 play an important role in the regulation of apoptosis in the MCF-7 cell line, with lowered Bcl-2 expression accompanying easier apoptotic induction. The majority of the examined compounds act via the p53 pathway although some bypass this important proapoptotic factor.

  6. Retinoids, carotenoids, and tocopherols in breast adipose tissue and serum of benign breast disease and breast cancer patients

    USDA-ARS?s Scientific Manuscript database

    Various retinoic acid (RA) isomers (all-trans, 13-cis, 11-cis, and 9-cis) as well as retinol, carotenoids, and tocopherol concentrations were determined in both serum and breast adipose tissue of 22 benign breast disease patients and 52 breast cancer patients categorized into 4 stages by malignancy....

  7. Mechanism of Action of a Novel Analog of Vitamin D3, 1alpha-hydroxy-24-ethyl Cholecalciferol (D5), in Normal and Transformed Human Breast Epithelial Cells

    DTIC Science & Technology

    2003-05-01

    retinoids, deltanoids (vitamin D derivatives), phytoestrogens, flavonoids , and aromatase inhibitors among others (Kelloffet al, 1996). On a global basis...Dietetics, University of Illinois at Chicago, Chicago. Responsibilities included development and validation of MDA-TBA assay by HPLC with fluorometric

  8. Methyl farnesoate action, and morphogenetic signaling through the ligand binding pocket of the ortholog of the retinoid X receptor, in higher dipter

    USDA-ARS?s Scientific Manuscript database

    Most attention on metamorphic signaling by small terpenoids has focused action by juvenile hormone (JH) through bHLH-PAS proteins (e.g., MET and GCE), especially as that signaling axis intersects with ecdysteroid action through the receptor EcR. However, a long-standing series of endocrine and pharm...

  9. Synergistic growth inhibition in HL-60 cells by the combination of acyclic retinoid and vitamin K2.

    PubMed

    Kitagawa, Junichi; Hara, Takeshi; Tsurumi, Hisashi; Ninomiya, Soranobu; Ogawa, Kengo; Adachi, Seiji; Kanemura, Nobuhiro; Kasahara, Senji; Shimizu, Masahito; Moriwaki, Hisataka

    2011-05-01

    The aim of this study was to assess the effects of acyclic retinoid (ACR) and vitamin K(2) (VK(2)) in HL-60 cells. We used HL-60 cells, and the Trypan Blue dye exclusion method was used for cell proliferation assays. For detection of apoptosis, the Annexin V-binding capacity of treated cells was examined by flow cytometry. To evaluate the cell cycle, we used a FITC BrdU Flow KIT and flow cytometry. Total extracted and equivalent amounts of protein were examined by Western blotting using specific antibodies. ACR and VK(2) dose dependently inhibited the proliferation of HL-60 cells. These two agents in combination synergistically inhibited cell growth and induced apoptosis. VK(2) inhibited activation of the Ras/MAPK signaling pathway, and ACR plus VK(2) cooperatively inhibited phosphorylation of RXRα and the growth of HL-60 cells. Moreover, ACR and VK(2) induced increases in G0/G1 phase HL-60 cells, alone and synergistically in combination. The synergistic effects of ACR and VK(2) on HL-60 cells may provide a novel strategy for treating leukemia.

  10. Modulation of 3-methylcholanthrene toxicity in cultured neoplastic keratinocytes by glucocorticoids and retinoids is not accounted for by macromolecular adduct formation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rubin, A.L.; Rice, R.H.

    3-Methylcholanthrene (3-MC) greatly inhibits the growth of two lines of human squamous carcinoma cells, SCC-9 and SCC-12B{sub 2}. The degree of 3-MC-mediated inhibition, however, was markedly alleviated by inclusion of retinoic acid and hydrocortisone or dexamethasone in the culture medium. These physiological effectors, which are known to have opposing actions on keratinocyte character in SCC cells, did not significantly alter either aryl hydrocarbon hydroxylase activity or macromolecular adduct formation. Further analysis of the cellular responses indicated that hydrocortisone and, in some experiments, retinoids increased the growth rate in 3-MC-exposed cultures, while 3-MC increased the saturation density in retinoic acid-exposed cultures,more » an example of interference with a physiological response of the cells. These results indicate that alteration of the differentiated state, regardless of the direction of the change, can alter the sensitivity of these cells to toxic stimuli. Further investigation of the bases of such toxic responses and their modulation by the microenvironment may enhance our understanding of the target cell specificity of polycyclic aromatic hydrocarbons.« less

  11. [Experiences with an isolation method for retinal S-antigen and interphotoreceptor retinoid-binding protein].

    PubMed

    Sych, F J; Strobel, J

    1996-12-01

    S-antigen (AgS) and interphotoreceptor retinoid-binding protein (IRBP) are two highly potent uveitopathogenic autoantigens of the retina frequently used to trigger autoimmune uveitis in animal trials. The aim of this study was the simultaneous isolation of both proteins from bovine retina, additionally avoiding time-consuming dialysis and employing prepacked, commercially available cartridges. Retina extract, obtained in the usual manner, was precipitated with ammonium sulfate. Both the desalting and the buffer exchange of dissolved precipitate were carried out using a Bio-Gel P6 column. Subsequent separation with Econo-Pac Q gave prepurified AgS and IRBP fractions. Further purification was realized predominantly with Econo-Pac Q, -HTP and -HIC (5-ml cartridges). AgS and IRBP were isolated in high purity (sodium dodecylsulfate polyacrylamide gel electrophoresis, silver stain) from bovine retina using prepacked cartridges with yields of approximately 0.25 (for AgS) and 0.15 (for IRBP) mg/g retina, respectively. The application of ready-to-use cartridges allows simultaneous isolation of AgS and IRBP in milligram amounts under simplified conditions. This approach might be of particular interest for small samples of retina.

  12. Racial and Ethnic Differences in the Pathogenesis and Clinical Manifestations of Uterine Leiomyoma

    PubMed Central

    Catherino, William H.; Eltoukhi, Heba M.; Al-Hendy, Ayman

    2014-01-01

    Uterine leiomyomas are the most common benign gynecologic condition. The prevalence is three times more common among women of African ethnicity. Disparity in this disease is evidenced by earlier age of onset, greater severity of symptoms, and different response to treatment. Although the pathogenesis of disease development is not completely known, growing evidence focuses on investigating the molecular mechanisms in disease development and the influence of ethnicity. Variation in the expression levels or function of estrogen and progesterone receptors, polymorphism of genes involved in estrogen synthesis and/or metabolism (COMT, CYP17), retinoic acid nuclear receptors (retinoid acid receptor-α, retinoid X receptor-α), and aberrant expression of micro-RNAs (miRNAs) are some of the molecular mechanisms that may be involved. Nutritional factors, such as vitamin D deficiency, might also contribute to the higher incidence in dark skinned populations who are also commonly suffer from hypovitaminosis D. Culture and environmental difference might have a role in disease development. Further analysis and better understanding of these mechanisms will provide insight into the molecular basis of racial disparities in leiomyoma formation and will help to develop new innovations in leiomyoma treatment. PMID:23934698

  13. Carotenoids and their conversion products in the control of adipocyte function, adiposity and obesity.

    PubMed

    Luisa Bonet, M; Canas, Jose A; Ribot, Joan; Palou, Andreu

    2015-04-15

    A novel perspective of the function of carotenoids and carotenoid-derived products - including, but not restricted to, the retinoids - is emerging in recent years which connects these compounds to the control of adipocyte biology and body fat accumulation, with implications for the management of obesity, diabetes and cardiovascular disease. Cell and animal studies indicate that carotenoids and carotenoids derivatives can reduce adiposity and impact key aspects of adipose tissue biology including adipocyte differentiation, hypertrophy, capacity for fatty acid oxidation and thermogenesis (including browning of white adipose tissue) and secretory function. Epidemiological studies in humans associate higher dietary intakes and serum levels of carotenoids with decreased adiposity. Specifically designed human intervention studies, though still sparse, indicate a beneficial effect of carotenoid supplementation in the accrual of abdominal adiposity. The objective of this review is to summarize recent findings in this area, place them in physiological contexts, and provide likely regulatory schemes whenever possible. The focus will be on the effects of carotenoids as nutritional regulators of adipose tissue biology and both animal and human studies, which support a role of carotenoids and retinoids in the prevention of abdominal adiposity. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  14. A double-blind investigation of the potential systemic absorption of isotretinoin, when combined with chemical sunscreens, following topical application to patients with widespread acne of the face and trunk.

    PubMed

    Cunliffe, W J; Glass, D; Goode, K; Stables, G I; Boorman, G C

    2001-01-01

    This study assessed the systemic absorption of isotretinoin and its metabolites, during a 4-week application of a cream containing 0.1% isotretinoin and chemical sunscreens, compared with a 4% benzoyl peroxide cream, in patients with acne on the face and trunk. Blood was drawn at weeks 0, 1, 2, 3 and 4 and at 96 h post-treatment. Plasma levels of isotretinoin (13-cis-retinoic acid) and tretinoin (all-trans-retinoic acid) were quantified by liquid chromatography with tandem mass spectrometry and the presence of their combined 4-oxo metabolites were monitored from the peak area ratios observed. The isotretinoin group showed no statistically or clinically significant increases in plasma retinoid levels and mean levels did not exceed +/-2 SD of the mean pre-treatment values, indicating that endogenous levels were not being exceeded. No significant differences were detected between the isotretinoin group and the 4% benzoyl peroxide group. These findings indicated that retinoid absorption from a cream containing 0.1% isotretinoin and chemical sunscreens was clinically insignificant, when applied to patients with widespread acne.

  15. 13-cis-retinoic acid competitively inhibits 3 alpha-hydroxysteroid oxidation by retinol dehydrogenase RoDH-4: a mechanism for its anti-androgenic effects in sebaceous glands?

    PubMed

    Karlsson, Teresa; Vahlquist, Anders; Kedishvili, Natalia; Törmä, Hans

    2003-03-28

    Retinol dehydrogenase-4 (RoDH-4) converts retinol and 13-cis-retinol to corresponding aldehydes in human liver and skin in the presence of NAD(+). RoDH-4 also converts 3 alpha-androstanediol and androsterone into dihydrotestosterone and androstanedione, which may stimulate sebum secretion. This oxidative 3 alpha-hydroxysteroid dehydrogenase (3 alpha-HSD) activity of RoDH-4 is competitively inhibited by retinol and 13-cis-retinol. Here, we further examine the substrate specificity of RoDH-4 and the inhibition of its 3 alpha-HSD activity by retinoids. Recombinant RoDH-4 oxidized 3,4-didehydroretinol-a major form of vitamin A in the skin-to its corresponding aldehyde. 13-cis-retinoic acid (isotretinoin), 3,4-didehydroretinoic acid, and 3,4-didehydroretinol, but not all-trans-retinoic acid or the synthetic retinoids acitretin and adapalene, were potent competitive inhibitors of the oxidative 3 alpha-HSD activity of RoDH-4, i.e., reduced the formation of dihydrotestosterone and androstandione in vitro. Extrapolated to the in vivo situation, this effect might explain the unique sebosuppressive effect of isotretinoin when treating acne.

  16. Chromatin Accessibility Mapping Identifies Mediators of Basal Transcription and Retinoid-Induced Repression of OTX2 in Medulloblastoma

    PubMed Central

    Zhang, Monica; Song, Lingyun; Lee, Bum-Kyu; Iyer, Vishwanath R.; Furey, Terrence S.; Crawford, Gregory E.; Yan, Hai; He, Yiping

    2014-01-01

    Despite an emerging understanding of the genetic alterations giving rise to various tumors, the mechanisms whereby most oncogenes are overexpressed remain unclear. Here we have utilized an integrated approach of genomewide regulatory element mapping via DNase-seq followed by conventional reporter assays and transcription factor binding site discovery to characterize the transcriptional regulation of the medulloblastoma oncogene Orthodenticle Homeobox 2 (OTX2). Through these studies we have revealed that OTX2 is differentially regulated in medulloblastoma at the level of chromatin accessibility, which is in part mediated by DNA methylation. In cell lines exhibiting chromatin accessibility of OTX2 regulatory regions, we found that autoregulation maintains OTX2 expression. Comparison of medulloblastoma regulatory elements with those of the developing brain reveals that these tumors engage a developmental regulatory program to drive OTX2 transcription. Finally, we have identified a transcriptional regulatory element mediating retinoid-induced OTX2 repression in these tumors. This work characterizes for the first time the mechanisms of OTX2 overexpression in medulloblastoma. Furthermore, this study establishes proof of principle for applying ENCODE datasets towards the characterization of upstream trans-acting factors mediating expression of individual genes. PMID:25198066

  17. SIGNALLING THROUGH RETINOIC ACID RECEPTORS IN CARDIAC DEVELOPMENT: DOING THE RIGHT THINGS AT THE RIGHT TIMES

    PubMed Central

    Xavier-Neto, José; Costa, Ângela M. Sousa; Figueira, Ana Carolina M.; Caiaffa, Carlo Donato; do Amaral, Fabio Neves; Peres, Lara Maldanis Cerqueira; da Silva, Bárbara Santos Pires; Santos, Luana Nunes; Moise, Alexander R.; Castillo, Hozana Andrade

    2015-01-01

    Retinoic acid (RA) is a terpenoid that is synthesized from Vitamin A/retinol (ROL) and binds to the nuclear receptors retinoic acid receptor (RAR)/retinoid X receptor (RXR) to control multiple developmental processes in vertebrates. The available clinic and experimental data provide uncontested evidence for the pleiotropic roles of RA signalling in development of multiple embryonic structures and organs such eyes, central nervous system, gonads, lungs and heart. The development of any of these above-mentioned embryonic organ systems can be effectively utilized to showcase the many strategies utilized by RA signalling. However, it is very likely that the strategies employed to transfer RA signals during cardiac development comprise the majority of the relevant and sophisticated ways through which retinoid signals can be conveyed in a complex biological system. Here, we provide the reader with arguments indicating that RA signalling is exquisitely regulated according to specific phases of cardiac development and that RA signalling itself is one of the major regulators of the timing of cardiac morphogenesis and differentiation. We will focus on the role of signalling by RA receptors (RARs) in early phases of heart development. PMID:25134739

  18. Modeling, Synthesis and Biological Evaluation of Potential Retinoid-X-Receptor (RXR) Selective Agonists: Novel Halogenated Analogs of 4-[1-(3,5,5,8,8-Pentamethyl-5,6,7,8-tetrahydro-2-naphthyl)ethynyl]benzoic Acid (Bexarotene)

    PubMed Central

    Furmick, Julie K.; Kaneko, Ichiro; Walsh, Angela N.; Yang, Joanna; Bhogal, Jaskaran S.; Gray, Geoffrey M.; Baso, Juan C.; Browder, Drew O.; Prentice, Jessica L.S.; Montano, Luis A.; Huynh, Chanh C.; Marcus, Lisa M.; Tsosie, Dorian G.; Kwon, Jungeun S.; Quezada, Alexis; Reyes, Nicole M.; Lemming, Brittney; Saini, Puneet; van der Vaart, Arjan; Groy, Thomas L.; Marshall, Pamela A.; Jurutka, Peter W.; Wagner, Carl E.

    2012-01-01

    The synthesis of halogenated analogs of 4-[1-(3,5,5,8,8-pentamethyl-5,6,7,8-tetrahydro-2-naphthyl)ethynyl]benzoic acid (1), known commonly as bexarotene, and their evaluation for retinoid-X-receptor (RXR)-specific agonist performance is described. Compound 1 is FDA approved to treat cutaneous T-cell lymphoma (CTCL); however, bexarotene treatment can induce hypothyroidism and elevated triglyceride levels, presumably by disrupting RXR heterodimer pathways for other nuclear receptors. The novel halogenated analogs in this study were modeled and assessed for their ability to bind to RXR and stimulate RXR homodimerization in an RXRE-mediated transcriptional assay as well as an RXR mammalian-2-hybrid assay. In an array of 8 novel compounds, 4 analogs were discovered to promote RXR-mediated transcription with comparable EC50 values as 1 and are selective RXR agonists. Our approach also uncovered a periodic trend of increased binding and homodimerization of RXR when substituting a halogen atom for a proton ortho to the carboxylic acid on 1. PMID:22927238

  19. Antagonist-perturbation mechanism for activation function-2 fixed motifs: active conformation and docking mode of retinoid X receptor antagonists

    NASA Astrophysics Data System (ADS)

    Tsuji, Motonori

    2017-06-01

    HX531, which contains a dibenzodiazepine skeleton, is one of the first retinoid X receptor (RXR) antagonists. Functioning via RXR-PPARγ heterodimer, this compound is receiving a lot of attention as a therapeutic drug candidate for diabetic disease controlling differentiation of adipose tissue. However, the active conformation of HX531 for RXRs is not well established. In the present study, quantum mechanics calculations and molecular mechanical docking simulations were carried out to precisely study the docking mode of HX531 with the human RXRα ligand-binding domain, as well as to provide a new approach to drug design using a structure-based perspective. It was suggested that HX531, which has the R configuration for the bent dibenzodiazepine plane together with the equatorial configuration for the N-methyl group attached to the nitrogen atom in the seven-membered diazepine ring, is a typical activation function-2 (AF-2) fixed motif perturbation type antagonist, which destabilizes the formation of AF-2 fixed motifs. On the other hand, the docking simulations supported the experimental result that LG100754 is an RXR homodimer antagonist and an RXR heterodimer agonist.

  20. RETINOIC ACID SYNTHESIS AND DEGRADATION

    PubMed Central

    Kedishvili, Natalia Y.

    2017-01-01

    Retinoic acid was identified as the biologically active form of vitamin A almost 70 years ago, but the exact enzymes and control mechanisms that regulate its biosynthesis and degradation are yet to be fully defined. The currently accepted model postulates that RA is produced in two sequential oxidative steps: first, retinol is oxidized reversibly to retinaldehyde, and then retinaldehyde is oxidized irreversibly to RA, which is inactivated by conversion to hydroxylated derivatives. This chapter describes the history, development and recent advances in our understanding of the enzymatic pathways and mechanisms that control the rate of RA production and degradation. Gene knockout studies provided strong evidence that the members of the short chain dehydrogenase reductase superfamily of proteins play indispensable roles in retinoic acid biosynthesis during development. Furthermore, recent finding that two of these proteins regulate the rate of retinoic acid biosynthesis by mutually activating each other provided a novel insight into the mechanism of this regulation. Despite significant progress made since the middle of the 20th century many unanswered questions still remain, and there is much to be learned, especially about trafficking of the hydrophobic retinoid substrates between membrane bound and cytosolic enzymes and the roles of the retinoid binding proteins. PMID:27830503

  1. Decidual β-carotene-15,15'-oxygenase-1 and 2 (BCMO1,2) expression is increased in nitrofen model of congenital diaphragmatic hernia.

    PubMed

    Takahashi, Hiromizu; Kutasy, Balazs; Pes, Lara; Paradisi, Francesca; Puri, Prem

    2015-01-01

    Retinoids are essential for fetal and lung development. Beta-carotene(BC) is the main dietary retinoid source and beta-carotene-15,15'-oxygenase-1 and 2 (Bcmo1,2) is the primary enzyme generating retinoid from BC in adult mammalian tissues. Placenta has a major role in the retinol homeostasis in fetal life: Since there is no fetal retinol synthesis, maternal retinol has to cross the placenta. It has been recently shown that BC can be converted to retinol by Bcmo1,2 in placenta for retinol transfer and moreover, BC can cross the placenta intact. The placental Bcmo1,2 expression is tightly controlled by placental retinol level. In severe retinol deficiency it has been shown that placental Bcmo1,2 expression are increased for generating retinol from dietary maternal BC even when the main retinol transfer is blocked. In recent years, low pulmonary retinol levels and disrupted retinoid signaling pathway have been implicated in the pathogenesis of pulmonary hypoplasia and congenital diaphragmatic hernia (CDH) in the nitrofen model of CDH. Recently, it has been demonstrated that the main retinol transfer in the placenta is blocked in the nitrofen model of CDH causing increased placental and decreased serum retinol level. The aim of our study was to determine maternal and fetal β-carotene levels and to investigate the hypothesis that placental expression of BCMO1 and BCMO2 is altered in nitrofen-exposed rat fetuses with CDH. Pregnant rats were exposed to either olive oil or nitrofen on day 9 of gestation (D9). Maternal and fetal serum, placenta, liver and left lungs were harvested on D21 and divided into two groups: control (n = 8) and nitrofen with CDH (n = 8). Immunochistochemistry was performed to evaluate trophoblasts by cytokeratin expression and placental Bcmo1,2 expression. Expression levels of Bcmo1,2 genes in fetal lungs and liver were determined using RT-PCR and immunohistochemistry. BC level was measured using HPLC. Markedly increased decidual Bcmo1,2 immunoreactivity was observed in CDH group compared to controls. There was no difference neither in the trophoblastic Bcmo1,2 immunoreactivity nor in the pulmonary and liver Bcmo1,2 expression compared to controls. There was no significant difference in maternal serum BC levels between control and CDH mothers (2.14 ± 0.55 vs 2.56 ± 1.6 μM/g, p = 0.8). BC was not detectable neither in the fetal serum nor liver or lungs. Our data show that nitrofen increases maternal but not fetal Bcmo1,2 expression in the placenta in nitrofen-induced CDH group. The markedly increased decidual Bcmo1,2 expression suggests that nitrofen may trigger local, decidual retinol synthesis in the nitrofen model of CDH.

  2. Rapid isocratic HPLC method and sample extraction procedures for measuring carotenoid, retinoid, and tocopherol concentrations in human blood and breast milk for intervention studies

    USDA-ARS?s Scientific Manuscript database

    Vitamin A deficiency is an important cause of death in the developing world. A variety of dietary interventions using provitamin A-carotenoid rich fruits and vegetables are being tested for their potential to alleviate vitamin A deficiency in several countries. Thus, there is a need for a simple, ...

  3. Medication adherence, healthcare costs and utilization associated with acne drugs in Medicaid enrollees with acne vulgaris.

    PubMed

    Tan, Xi; Al-Dabagh, Amir; Davis, Scott A; Lin, Hsien-Chang; Balkrishnan, Rajesh; Chang, Jongwha; Feldman, Steven R

    2013-06-01

    Acne vulgaris is a common chronic disease that may require long-term treatment. Medication adherence is critical to acne management; non-adherence is a common reason for treatment failure and can lead to poor quality of life. The aim of the study was to examine medication adherence, healthcare costs, and utilization associated with acne drugs among acne patients in the USA. This was a retrospective cohort study from January 2004 to December 2007 using the Marketscan Medicaid Database, a national healthcare claims database. The study followed acne patients aged 0-64 years for 90 days after the first acne drug prescription to measure acne medication adherence, acne-related outpatient visits, and total acne-related healthcare costs. Adherence was measured among different acne drug classes using medication possession ratio (MPR). Multivariate regression analyses were conducted to assess the outcomes. The study included 24,438 eligible patients, of whom 89.39 % were under 18 years old. The average adherence rate to acne drugs (MPR) was 0.34, and only 11.74 % of the patients were adherent (MPR ≥0.80). Patients with drug refills had a higher adherence rate (MPR = 0.74) than who those without refills (MPR = 0.27). Factors significantly associated with adherence were age, comorbidity, gender, number of drug refills and number of drug classes used. Patients were more adherent to oral retinoids than any other acne drug classes (MPR = 0.78, 57 % adherent). Patients were less adherent to oral antibiotics (MPR = 0.21) and topical retinoids (MPR = 0.31). After controlling for medication use behavior, the use of oral antibiotics decreased the number of acne-related outpatient visits by 50.9 % (p < 0.001) and lowered acne-related total costs by 51.7 % (p < 0.001). Medication non-adherence is generally prevalent among young acne patients enrolled in Medicaid. The combination of a topical retinoid and an antibiotic agent may be a good choice given their associated healthcare outcomes and costs. However, adherence to these agents is not satisfactory. Therefore, developing specific strategies to improve adherence to these drugs among teenage acne patients is warranted.

  4. Deficiency of Retinaldehyde Dehydrogenase 1 Induces BMP2 and Increases Bone Mass In Vivo

    PubMed Central

    Nallamshetty, Shriram; Wang, Hong; Rhee, Eun-Jung; Kiefer, Florian W.; Brown, Jonathan D.; Lotinun, Sutada; Le, Phuong; Baron, Roland; Rosen, Clifford J.; Plutzky, Jorge

    2013-01-01

    The effects of retinoids, the structural derivatives of vitamin A (retinol), on post-natal peak bone density acquisition and skeletal remodeling are complex and compartment specific. Emerging data indicates that retinoids, such as all trans retinoic acid (ATRA) and its precursor all trans retinaldehyde (Rald), exhibit distinct and divergent transcriptional effects in metabolism. Despite these observations, the role of enzymes that control retinoid metabolism in bone remains undefined. In this study, we examined the skeletal phenotype of mice deficient in retinaldehyde dehydrogenase 1 (Aldh1a1), the enzyme responsible for converting Rald to ATRA in adult animals. Bone densitometry and micro-computed tomography (µCT) demonstrated that Aldh1a1-deficient (Aldh1a1−/−) female mice had higher trabecular and cortical bone mass compared to age and sex-matched control C57Bl/6 wild type (WT) mice at multiple time points. Histomorphometry confirmed increased cortical bone thickness and demonstrated significantly higher bone marrow adiposity in Aldh1a1−/− mice. In serum assays, Aldh1a1−/− mice also had higher serum IGF-1 levels. In vitro, primary Aldh1a1−/− mesenchymal stem cells (MSCs) expressed significantly higher levels of bone morphogenetic protein 2 (BMP2) and demonstrated enhanced osteoblastogenesis and adipogenesis versus WT MSCs. BMP2 was also expressed at higher levels in the femurs and tibias of Aldh1a1−/− mice with accompanying induction of BMP2-regulated responses, including expression of Runx2 and alkaline phosphatase, and Smad phosphorylation. In vitro, Rald, which accumulates in Aldh1a1−/− mice, potently induced BMP2 in WT MSCs in a retinoic acid receptor (RAR)-dependent manner, suggesting that Rald is involved in the BMP2 increases seen in Aldh1a1 deficiency in vivo. Collectively, these data implicate Aldh1a1 as a novel determinant of cortical bone density and marrow adiposity in the skeleton in vivo through modulation of BMP signaling. PMID:23951127

  5. A Possible Link Between Pyriproxyfen and Microcephaly

    PubMed Central

    Parens, Raphael; Nijhout, H. Frederik; Morales, Alfredo; Xavier Costa, Felipe; Bar-Yam, Yaneer

    2017-01-01

    The Zika virus has been the primary suspect in the large increase in incidence of microcephaly in 2015-6 in Brazil. While evidence for Zika being the cause of some of the cases is strong, its role as the primary cause of the large number of cases in Brazil has not been confirmed. Recently, the disparity between the incidences in different geographic locations has led to questions about the virus's role. Here we consider the alternative possibility that the use of the insecticide pyriproxyfen for control of mosquito populations in Brazilian drinking water is the primary cause. Pyriproxifen is a juvenile hormone analog which has been shown to correspond in mammals to a number of fat soluble regulatory molecules including retinoic acid, a metabolite of vitamin A, with which it has cross-reactivity and whose application during development has been shown to cause microcephaly. Methoprene, another juvenile hormone analog that was approved as an insecticide based upon tests performed in the 1970s, has metabolites that bind to the mammalian retinoid X receptor, and has been shown to cause developmental disorders in mammals. Isotretinoin is another example of a retinoid causing microcephaly in human babies via maternal exposure and activation of the retinoid X receptor in developing fetuses. Moreover, tests of pyriproxyfen by the manufacturer, Sumitomo, widely quoted as giving no evidence for developmental toxicity, actually found some evidence for such an effect, including low brain mass and arhinencephaly—incomplete formation of the anterior cerebral hemispheres—in exposed rat pups. Finally, the pyriproxyfen use in Brazil is unprecedented—it has never before been applied to a water supply on such a scale. Claims that it is not being used in Recife, the epicenter of microcephaly cases, do not distinguish the metropolitan area of Recife, where it is widely used, and the municipality, and have not been adequately confirmed. Given this combination of information about molecular mechanisms and toxicological evidence, we strongly recommend that the use of pyriproxyfen in Brazil be suspended until the potential causal link to microcephaly is investigated further. PMID:29362686

  6. RAMBAs for Breast Cancer Prevention and Treatment

    DTIC Science & Technology

    2009-01-01

    activated by CYPs only in cancer cells. Finally, the expression of CYPs within tumors has been utilized in the development of bioreductive molecules...enable us to utilize the Catalyst molecular modeling program to create a general phar- macophore model that can differentiate compounds as active or...the discovery and char- acterization of retinoid receptor and the realization of these compounds as nonsteroidal small-molecule hor- mones .1 All-trans

  7. Exuberant clinical picture of Buschke-Fischer-Brauer palmoplantar keratoderma in bedridden patient.

    PubMed

    Antonio, João Roberto; Oliveira, Guilherme Bueno de; Rossi, Natalia Cristina Pires; Pires, Laiza Gabriela Garcia

    2014-01-01

    Buschke-Fisher-Brauer keratoderma is a rare hereditary autosomal dominant disease of incomplete penetrance. Important differential diagnoses include other palmoplantar keratinization disorders, acquired or hereditary, which is done based on the histopathological findings. This diagnosis alerts especially about the possibility of associated neoplasms. Treatment involves topical keratolytic agents, usually with little efficacy, or with long-term systemic retinoids with follow-up of exuberant collateral effects.

  8. Molecular Mechanism by which Retinoids Prevent Breast Cancer Development

    DTIC Science & Technology

    2005-06-01

    activated receptor ( PPAR ), liver X receptor (LXR), farnesoid X receptor (FXR) and pregnane X receptor (PXR) suggesting its involvement in several signaling...essential co-activators required for the gene activation. Different and inappropriate sub- 5 localization of the receptor may also explain the...XL act as anti-apoptotic regulators, while Bax and Bak act as pro-apoptotic regulators. Over-expressed Bax is transported to the mitochondria where it

  9. A case of keratosis lichenoid chronica.

    PubMed

    Baczewski, Natasha; Albano, Brian

    2012-01-01

    Keratosis lichenoid chronica is a rare dermatologic anomaly believed to be a variant of lichen planus. It presents as violaceous, nodular lesions usually on the dorsal aspects of the extremities and the trunk. The disease is refractory to treatment although psoralen ultraviolet A therapy and oral retinoids have been proven useful in some cases. Here we present the case of a 58-year-old male diagnosed with keratosis lichenoid chronica.

  10. Retinoid X receptor suppresses a metastasis-promoting transcriptional program in myeloid cells via a ligand-insensitive mechanism

    PubMed Central

    Kiss, Mate; Czimmerer, Zsolt; Nagy, Gergely; Bieniasz-Krzywiec, Pawel; Ehling, Manuel; Pap, Attila; Poliska, Szilard; Boto, Pal; Tzerpos, Petros; Horvath, Attila; Kolostyak, Zsuzsanna; Daniel, Bence; Szatmari, Istvan; Mazzone, Massimiliano; Nagy, Laszlo

    2017-01-01

    Retinoid X receptor (RXR) regulates several key functions in myeloid cells, including inflammatory responses, phagocytosis, chemokine secretion, and proangiogenic activity. Its importance, however, in tumor-associated myeloid cells is unknown. In this study, we demonstrate that deletion of RXR in myeloid cells enhances lung metastasis formation while not affecting primary tumor growth. We show that RXR deficiency leads to transcriptomic changes in the lung myeloid compartment characterized by increased expression of prometastatic genes, including important determinants of premetastatic niche formation. Accordingly, RXR-deficient myeloid cells are more efficient in promoting cancer cell migration and invasion. Our results suggest that the repressive activity of RXR on prometastatic genes is mediated primarily through direct DNA binding of the receptor along with nuclear receptor corepressor (NCoR) and silencing mediator of retinoic acid and thyroid hormone receptor (SMRT) corepressors and is largely unresponsive to ligand activation. In addition, we found that expression and transcriptional activity of RXRα is down-modulated in peripheral blood mononuclear cells of patients with lung cancer, particularly in advanced and metastatic disease. Overall, our results identify RXR as a regulator in the myeloid cell-assisted metastatic process and establish lipid-sensing nuclear receptors in the microenvironmental regulation of tumor progression. PMID:28923935

  11. Combined therapy in vulvar lichen sclerosus: does topical tretinoin improve the efficacy of mometasone furoate?

    PubMed

    Borghi, Alessandro; Minghetti, Sara; Toni, Giulia; Virgili, Annarosa; Corazza, Monica

    2017-09-01

    Abstrract Purpose: To assess efficacy and safety profile of combining a potent corticosteroid with a retinoid in the treatment of vulvar lichen sclerosus (VLS). We retrospectively compared 21 VLS patients treated with tretinoin (T) in short-contact therapy and mometasone furoate (MMF) (group A) and 20 treated with cold cream (CC) and MMF (group B) for 5 consecutive days/week for 12 weeks. The efficacy parameters were the response rate, the percentage of patients achieving an improvement from baseline of ≥75% in subjective and objective scores and the mean reduction in subjective and objective scores. Thirteen patients (75.2%) were considered as responders in group A and 15 (78.9%) in group B; 50% and 61.1% of patients in group A and 100% and 63.1% in group B achieved an improvement of at least 75% in subjective and objective scores, respectively. The scheme combining MMF and CC was better tolerated than the combination of MMF and T. The combination with a topical retinoid did not enhance the effectiveness of a potent corticosteroid in the treatment of VLS. Either the scarce efficacy of the short-contact therapy regimen or a less favorable safety profile of such combination may account for these findings.

  12. Jojoba Oil Soft Colloidal Nanocarrier of a Synthetic Retinoid: Preparation, Characterization and Clinical Efficacy in Psoriatic Patients.

    PubMed

    Nasr, Maha; Abdel-Hamid, Sameh; Moftah, Noha H; Fadel, Maha; Alyoussef, Abdullah A

    2017-01-01

    Nanotechnology has provided substantial benefits in drug delivery, especially in the treatment of dermatological diseases. Psoriasis is a chronic inflammatory skin disease in which topical delivery of antipsoriatic agents is considered the first line treatment. To investigate whether the encapsulation of the synthetic retinoid tazarotene in a nanocarrier based on jojoba oil would decrease its irritation potential and clinically improve its therapeutic outcome in psoriatic patients. A microemulsion system based on jojoba wax and labrasol/plurol isostearique was prepared and characterized. The selected formula displayed spherical morphology, particle size of 15.49±2.41 nm, polydispersity index of 0.20 ±0.08, negative charge and low viscosity. The microemulsion provided two folds increase in skin deposition of tazarotene, correlating with higher reduction in psoriatic patients PASI scores after treatment (68% reduction in PASI scores versus 8.96% reduction with the marketed gel). No irritation was encountered in patients using microemulsion, with redness and inflammation reported with the marketed gel-treated patients. Jojoba oil microemulsion proved to be advantageous in reducing the irritancy of tazarotene, enhancing its skin deposition and achieving better therapeutic outcome in psoriatic patients. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  13. Carotenoids and fat-soluble vitamins in horse tissues: a comparison with cattle.

    PubMed

    Álvarez, R; Meléndez-Martínez, A J; Vicario, I M; Alcalde, M J

    2015-07-01

    Carotenoids are important for human health because of their provitamin A function among other biological actions. Their implication on consumer point of view of cattle products have been widely studied, but very little information is available for horse products. The aim of this study was to study the accumulation of carotenoids, retinoids and tocopherol by HPLC and HPLC-MS analysis in different horse tissues (plasma, milk, adipose tissue and liver) and compare it with that of cattle. Fat color was also studied. Four groups of animals were studied (15 animals within each group): lactating mares (709.82±23.09 kg) and cows (576.93±31.94 kg) reared outdoors; and foals (556.8±25.9 kg, 14 months old) and calves (474.7±36.2 kg, 14 months old) reared indoors. Both mares and foals were from the Hispano-Breton breed, whereas both cows and calves belonged to the commercial crossbred Limousine-Retinta. Differences in plasma and milk carotenoids (P0.05). Both species showed different levels of accumulation of retinoids in the liver, with the foal having better accumulation (P<0.01, P<0.001). These results indicate that there are species-specific differences in the accumulation of carotenoids, retinol and tocopherol, but further studies are required to establish the mechanism of these differences.

  14. Determination of carotenoids and all-trans-retinol in fish eggs by liquid chromatography-electrospray ionization-tandem mass spectrometry.

    PubMed

    Li, Hongxia; Tyndale, Sélène T; Heath, Daniel D; Letcher, Robert J

    2005-02-25

    A novel method was developed for the combined determination of carotenoids and retinoids in fish eggs, which incorporates prior analyte isolation using liquid-liquid partitioning to minimize analyte degradation, and fraction analysis using high-performance liquid chromatography-electrospray (positive)-quadrupole mass spectrometry (LC-ESI(+)-MS; SIM or MRM modes). Eggs from Chinook salmon (Oncorhynchus tshawytscha) were used as the model fish egg matrix. The methodology was assessed and validated for beta-carotene, lutein, zeaxanthin, and beta-cryptoxanthin (molecular ion radicals [M](+)), canthaxanthin and astaxanthin ([M+Na](+) adducts) and all-trans-retinol ([(M+H)-H(2)O](+)). Using replicate egg samples (n=5) spiked with beta-cryptoxanthin and beta-carotene before and after extraction, matrix-sourced ESI(+) enhancement was observed as evidenced by comparable %matrix effect and %process efficiency values for beta-cryptoxanthin and beta-carotene of 114-119%. In aquaculture-raised eggs from adult Chinook salmon astaxanthin, all-trans-retinol, lutein and canthaxanthin were identified and determined at concentrations of 4.12, 1.06, 0.12 and 0.45 microg/g (egg wet weight), respectively. To our knowledge, this is the first report on a method for LC-MS determination of carotenoids and retinoids in a fish egg matrix, and the first carotenoid-specific determination in any fish egg sample.

  15. Activation of the CRABPII/RAR pathway by curcumin induces retinoic acid mediated apoptosis in retinoic acid resistant breast cancer cells

    PubMed Central

    Thulasiraman, Padmamalini; Garriga, Galen; Danthuluri, Veena; McAndrews, Daniel J.; Mohiuddin, Imran Q.

    2017-01-01

    Due to the anti-proliferative and anti-apoptotic effects of retinoic acid (RA), this hormone has emerged as a target for several diseases, including cancer. However, development of retinoid resistance is a critical issue and efforts to understand the retinoid signaling pathway may identify useful biomarkers for future clinical trials. Apoptotic responses of RA are exhibited through the cellular RA-binding protein II (CRABPII)/retinoic acid receptor (RAR) signaling cascade. Delivery of RA to RAR by CRABPII enhances the transcriptional activity of genes involved in cell death and cell cycle arrest. The purpose of this study was to investigate the role of curcumin in sensitizing RA-resistant triple-negative breast cancer (TNBC) cells to RA-mediated apoptosis. We provide evidence that curcumin upregulates the expression of CRABPII, RARβ and RARγ in two different TNBC cell lines. Co-treatment of the cells with curcumin and RA results in increased apoptosis as demonstrated by elevated cleavage of poly(ADP-ribose) polymerase and cleaved caspase-9. Additionally, silencing CRABPII reverses curcumin sensitization of TNBC cells to the apoptotic inducing effects of RA. These findings provide mechanistic insights into sensitizing TNBC cells to RA-mediated cell death by curcumin-induced upregulation of the CRABPII/RAR pathway. PMID:28350049

  16. [Influence of Cx26/Cx32 gap junction channel on antineoplastic effect of etoposide in Hela cells].

    PubMed

    Tong, Xu-Hui; Dong, Shu-Ying; Jiang, Guo-Jun; Fan, Gao-Fu

    2012-03-01

    To observe the influence of Cx26/Cx32 gap junction channel on the antineoplastic effect of etoposide in Hela cervical cancer cells. Fluorescence trace was used to assay the gap junction intercellular communication mediated by Cx26/Cx32 in Hela cells and its functional modulation by the pharmacological agents (oleamide, retinoid acid). A standard colony-forming assay was applied to determine the cell growth-inhibiting effect of etoposide in Hela cells with functional modulation of the gap junction. Hoechst 33258 staining was used to assess the changes in etoposide-induced apoptosis of Hela cells with altered gap junction functions. Oleamide markedly decreased while retinoid acid obviously increased the gap junction function in Hela cells. Standard colony-forming assay showed that etoposide produced a lowered antiproliferative effect in Hela cells with reduced gap junction and an increased antiproliferative effect in cells with enhanced gap junction function. In cells with a reduced gap junction function, etoposide induced a lowered apoptosis rate, which increased obviously in cells with an enhanced gap junction function. The antineoplastic effect of etoposide is reduced in Hela cells with a decreased gap junction intercellular communication mediated by Cx26/Cx32 and is enhanced in cells with an increased gap junction intercellular communication.

  17. Esterase 22 and beta-glucuronidase hydrolyze retinoids in mouse liver

    PubMed Central

    Schreiber, Renate; Taschler, Ulrike; Wolinski, Heimo; Seper, Andrea; Tamegger, Stefanie N.; Graf, Maria; Kohlwein, Sepp D.; Haemmerle, Guenter; Zimmermann, Robert; Zechner, Rudolf; Lass, Achim

    2009-01-01

    Excess dietary vitamin A is esterified with fatty acids and stored in the form of retinyl ester (RE) predominantly in the liver. According to the requirements of the body, liver RE stores are hydrolyzed and retinol is delivered to peripheral tissues. The controlled mobilization of retinol ensures a constant supply of the body with the vitamin. Currently, the enzymes catalyzing liver RE hydrolysis are unknown. In this study, we identified mouse esterase 22 (Es22) as potent RE hydrolase highly expressed in the liver, particularly in hepatocytes. The enzyme is located exclusively at the endoplasmic reticulum (ER), implying that it is not involved in the mobilization of RE present in cytosolic lipid droplets. Nevertheless, cell culture experiments revealed that overexpression of Es22 attenuated the formation of cellular RE stores, presumably by counteracting retinol esterification at the ER. Es22 was previously shown to form a complex with β-glucuronidase (Gus). Our studies revealed that Gus colocalizes with Es22 at the ER but does not affect its RE hydrolase activity. Interestingly, however, Gus was capable of hydrolyzing the naturally occurring vitamin A metabolite retinoyl β-glucuronide. In conclusion, our observations implicate that both Es22 and Gus play a role in liver retinoid metabolism. PMID:19723663

  18. A controlled study of comparative efficacy of oral retinoids and topical betamethasone/salicylic acid for chronic hyperkeratotic palmoplantar dermatitis.

    PubMed

    Capella, Giovanni Luigi; Fracchiolla, Claudio; Frigerio, Elena; Altomare, Gianfranco

    2004-04-01

    Chronic hyperkeratotic dermatitis of the palms and soles represents a severe multi-etiological problem, too often faced with ineffective or tedious topical remedies. A single-blind, matched-sample design investigation was carried out of 42 patients with chronic hyperkeratotic palmoplantar dermatitis, who were administered acitretin 25-50 mg/day for 1 month, which was controlled versus a conventional topical treatment (betamethasone/salicylic acid ointment). Therapeutic improvement was expressed with the reduction of severity score (expressed on a 0-10 scale). Acitretin was significantly better than the conventional treatment after 30 days (two sided p<0.0001). Moreover, improvement significantly persisted 5 months after suspension of acitretin (p<0.0001), while this was not the case after suspension of the control treatment (p=0.3019). Lesions improved more rapidly with acitretin than with the control treatment (p<0.0002). Some cases of loss of sensitization in patch-test-positive patients were observed. Side effects were minimal or absent, and patients expressed overtly their preference for acitretin treatment. After evaluating the former literature, the risks and the benefits, as well as the overt superiority of retinoid treatment, the authors conclude that acitretin should be considered a first choice treatment for this fastidious condition.

  19. Uveitis in horses induced by interphotoreceptor retinoid-binding protein is similar to the spontaneous disease.

    PubMed

    Deeg, Cornelia A; Thurau, Stephan R; Gerhards, Hartmut; Ehrenhofer, Marion; Wildner, Gerhild; Kaspers, Bernd

    2002-09-01

    Equine recurrent uveitis (ERU) is an inflammatory eye disease with high similarity to uveitis in man. It is the only spontaneous animal model for uveitis and the most frequent eye disease in horses affecting up to 10% of the population. To further investigate the pathophysiology of ERU we now report the establishment of an inducible uveitis model in horses. An ERU-like disease was elicited in seven out of seven horses by injection of interphotoreceptor retinoid-binding protein (IRBP) in complete Freund's adjuvant. Control horses did not develop uveitis. The disease model is characterized by a highly reproducible disease course and recurrent episodes with an identical time course elicited in all horses by repeated IRBP injections. The histology revealed the formation of lymphoid follicle-like structures in the eyes and an intraocular infiltration dominated by CD3(+) lymphocytes, morphological patterns typical for the spontaneous disease. Antigen-specific T cell proliferation of PBL was monitored prior to clinical uveitis and during disease episodes. An initial T cell response to IRBP-derived peptides was followed by epitope spreading to S-antigen-derived peptides in response to subsequent immunizations. Thus, horse experimental uveitis represents a valuable disease model for comparative studies with the spontaneous disease and the investigation of immunomodulatory therapeutic approaches after onset of the disease.

  20. Cardiac compartment-specific overexpression of a modified retinoic acid receptor produces dilated cardiomyopathy and congestive heart failure in transgenic mice.

    PubMed

    Colbert, M C; Hall, D G; Kimball, T R; Witt, S A; Lorenz, J N; Kirby, M L; Hewett, T E; Klevitsky, R; Robbins, J

    1997-10-15

    Retinoids play a critical role in cardiac morphogenesis. To examine the effects of excessive retinoid signaling on myocardial development, transgenic mice that overexpress a constitutively active retinoic acid receptor (RAR) controlled by either the alpha- or beta-myosin heavy chain (MyHC) promoter were generated. Animals carrying the alpha-MyHC-RAR transgene expressed RARs in embryonic atria and in adult atria and ventricles, but developed no signs of either malformations or disease. In contrast, beta-MyHC-RAR animals, where expression was activated in fetal ventricles, developed a dilated cardiomyopathy that varied in severity with transgene copy number. Characteristic postmortem lesions included biventricular chamber dilation and left atrial thrombosis; the incidence and severity of these lesions increased with increasing copy number. Transcript analyses showed that molecular markers of hypertrophy, alpha-skeletal actin, atrial natriuretic factor and beta-MyHC, were upregulated. Cardiac performance of transgenic hearts was evaluated using the isolated perfused working heart model as well as in vivo, by transthoracic M-mode echocardiography. Both analyses showed moderate to severe impairment of left ventricular function and reduced cardiac contractility. Thus, expression of a constitutively active RAR in developing atria and/ or in postnatal ventricles is relatively benign, while ventricular expression during gestation can lead to significant cardiac dysfunction.

  1. Pre-Clinical Evaluation of a Novel RXR Agonist for the Treatment of Neuroblastoma

    PubMed Central

    Waters, Alicia M.; Stewart, Jerry E.; Atigadda, Venkatram R.; Mroczek-Musulman, Elizabeth; Muccio, Donald D.; Grubbs, Clinton J.; Beierle, Elizabeth A.

    2015-01-01

    Neuroblastoma remains a common cause of pediatric cancer deaths, especially for children who present with advanced stage or recurrent disease. Currently, retinoic acid therapy is used as maintenance treatment to induce differentiation and reduce tumor recurrence following induction therapy for neuroblastoma, but unavoidable side effects are seen. A novel retinoid, UAB30, has been shown to generate negligible toxicities. In the current study, we hypothesized that UAB30 would have a significant impact on multiple neuroblastoma cell lines in vitro and in vivo. Cellular survival, cell cycle analysis, migration, and invasion were studied using alamarBlue® assays, FACS, and Transwell® assays, respectively, in multiple cell lines following treatment with UAB30. In addition, an in vivo murine model of human neuroblastoma was utilized to study the effects of UAB30 upon tumor xenograft growth and animal survival. We successfully demonstrated decreased cellular survival, invasion and migration, cell cycle arrest and increased apoptosis after treatment with UAB30. Furthermore, inhibition of tumor growth and increased survival was observed in a murine neuroblastoma xenograft model. The results of these in vitro and in vivo studies suggest a potential therapeutic role for the low toxicity synthetic retinoid X receptor selective agonist, UAB30, in neuroblastoma treatment. PMID:25944918

  2. Disposition and biotransformation of the acetylenic retinoid tazarotene in humans.

    PubMed

    Attar, Mayssa; Yu, Dale; Ni, Jinsong; Yu, Zhiling; Ling, Kah-Hiing John; Tang-Liu, Diane D-S

    2005-10-01

    Oral tazarotene, an acetylenic retinoid, is in clinical development for the treatment of psoriasis. The disposition and biotransformation of tazarotene were investigated in six healthy male volunteers, following a single oral administration of a 6 mg (100 microCi) dose of [14C]tazarotene, in a gelatin capsule. Blood levels of radioactivity peaked 2 h postdose and then rapidly declined. Total recovery of radioactivity was 89.2+/-8.0% of the administered dose, with 26.1+/-4.2% in urine and 63.0+/-7.0% in feces, within 7 days of dosing. Only tazarotenic acid, the principle active metabolite formed via esterase hydrolysis of tazarotene, was detected in blood. One major urinary oxidative metabolite, tazarotenic acid sulfoxide, accounted for 19.2+/-3.0% of the dose. The majority of radioactivity recovered in the feces was attributed to tazarotenic acid representing 46.9+/-9.9% of the dose and only 5.82+/-3.84% of dose was excreted as unchanged tazarotene. Thus following oral administration, tazarotene was rapidly absorbed and underwent extensive hydrolysis to tazarotenic acid, the major circulating species in the blood that was then excreted unchanged in feces. A smaller fraction of tazarotenic acid was further metabolized to an inactive sulfoxide that was excreted in the urine. Copyright (c) 2005 Wiley-Liss, Inc. and the American Pharmacists Association

  3. Enzymatic Metabolism of Vitamin A in Developing Vertebrate Embryos

    PubMed Central

    Metzler, Melissa A.; Sandell, Lisa L.

    2016-01-01

    Embryonic development is orchestrated by a small number of signaling pathways, one of which is the retinoic acid (RA) signaling pathway. Vitamin A is essential for vertebrate embryonic development because it is the molecular precursor of the essential signaling molecule RA. The level and distribution of RA signaling within a developing embryo must be tightly regulated; too much, or too little, or abnormal distribution, all disrupt embryonic development. Precise regulation of RA signaling during embryogenesis is achieved by proteins involved in vitamin A metabolism, retinoid transport, nuclear signaling, and RA catabolism. The reversible first step in conversion of the precursor vitamin A to the active retinoid RA is mediated by retinol dehydrogenase 10 (RDH10) and dehydrogenase/reductase (SDR family) member 3 (DHRS3), two related membrane-bound proteins that functionally activate each other to mediate the interconversion of retinol and retinal. Alcohol dehydrogenase (ADH) enzymes do not contribute to RA production under normal conditions during embryogenesis. Genes involved in vitamin A metabolism and RA catabolism are expressed in tissue-specific patterns and are subject to feedback regulation. Mutations in genes encoding these proteins disrupt morphogenesis of many systems in a developing embryo. Together these observations demonstrate the importance of vitamin A metabolism in regulating RA signaling during embryonic development in vertebrates. PMID:27983671

  4. Direct inhibition of retinoic acid catabolism by fluoxetine.

    PubMed

    Hellmann-Regen, Julian; Uhlemann, Ria; Regen, Francesca; Heuser, Isabella; Otte, Christian; Endres, Matthias; Gertz, Karen; Kronenberg, Golo

    2015-09-01

    Recent evidence from animal and human studies suggests neuroprotective effects of the SSRI fluoxetine, e.g., in the aftermath of stroke. The underlying molecular mechanisms remain to be fully defined. Because of its effects on the cytochrome P450 system (CYP450), we hypothesized that neuroprotection by fluoxetine is related to altered metabolism of retinoic acid (RA), whose CYP450-mediated degradation in brain tissue constitutes an important step in the regulation of its site-specific auto- and paracrine actions. Using traditional pharmacological in vitro assays, the effects of fluoxetine on RA degradation were probed in crude synaptosomes from rat brain and human-derived SH-SY5Y cells, and in cultures of neuron-like SH-SY5Y cells. Furthermore, retinoid-dependent effects of fluoxetine on neuronal survival following glutamate exposure were investigated in rat primary neurons cells using specific retinoid receptor antagonists. Experiments revealed dose-dependent inhibition of synaptosomal RA degradation by fluoxetine along with dose-dependent increases in RA levels in cell cultures. Furthermore, fluoxetine's neuroprotective effects against glutamate excitotoxicity in rat primary neurons were demonstrated to partially depend on RA signaling. Taken together, these findings demonstrate for the first time that the potent, pleiotropic antidepressant fluoxetine directly interacts with RA homeostasis in brain tissue, thereby exerting its neuroprotective effects.

  5. Asbestos-Induced Epithelial Changes in Organ Cultures of Hamster Trachea: Inhibition by Retinyl Methyl Ether

    NASA Astrophysics Data System (ADS)

    Mossman, B. T.; Craighead, J. E.; MacPherson, B. V.

    1980-01-01

    The epithelium of the hamster trachea in organ culture undergoes hyperplasia and squamous metaplasia after exposure to the amphibole types of asbestos, crocidolite and amosite. These changes are inhibited when the synthetic vitamin A analog, retinyl methyl ether, is incorporated into the culture medium. These findings suggest a possible use for retinoids in the prevention and treatment of respiratory tract disease associated with environmental exposure to asbestos.

  6. Characterization of Breast Cancer Cell Death Induced by Interferons and Retinoids

    DTIC Science & Technology

    1999-07-01

    treated cells. Cells were treated for 48 hr, before RNA extraction . Figure 4: Expression of GRIM-I in different mouse tissues. A multiple tissue...knockout approach (12). In this teria were scraped from the plates, and plasmid DNA was extracted and purified approach specific cell death-associated genes...ml), and Hirt DNA extracts intracellular redox regulatory enzyme (16). We show that cel- were prepared (22). DNA was digested with DpnI and

  7. Inhibition of proliferation and induction of apoptosis in soft tissue sarcoma cells by interferon-α and retinoids

    PubMed Central

    Brodowicz, T; Wiltschke, C; Kandioler-Eckersberger, D; Grunt, T W; Rudas, M; Schneider, S M; Hejna, M; Budinsky, A; Zielinski, C C

    1999-01-01

    Uncontrolled proliferation and a defect of apoptosis constitute crucial elements in the development and progression of tumours. Among many other biological response modifiers known to influence these mechanisms, the efficacy of retinoids and interferons in the treatment of various malignant entities is currently matter of discussion. In the present study, we have investigated the effects of 9-cis-retinoic acid (9cRA), 13-cis-retinoic acid (13cRA), all-trans-retinoic acid (tRA) and interferon-α on proliferation and apoptosis of human soft tissue sarcoma (STS) cell lines HTB-82 (rhabdomyosarcoma), HTB-91 (fibrosarcoma), HTB-92 (liposarcoma), HTB-93 (synovial sarcoma) and HTB-94 (chondrosarcoma) in relation to p53 genotype as well as p53 expression. HTB-91, HTB-92 and HTB-94 STS cells exhibited mutant p53, whereas wild-type p53 was found in HTB-93 STS cells, and a normal p53 status in HTB-82 STS cells, carrying a silent point mutation only. Interferon-α, irrespective of p53 status, inhibited the proliferation of all five cell lines dose- and time-dependently. Similarly, 9cRA, 13cRA and tRA decreased the proliferation of HTB-82 and HTB-93 STS cells, whereas the proliferation of p53-mutated HTB-91, HTB-92 and HTB-94 STS cells remained unchanged. Furthermore, only 9cRA and tRA were capable of inducing apoptosis in HTB-82 and HTB-93 STS cells, whereas HTB-91, HTB-92 and HTB-94 STS cells did not undergo apoptosis under the influence of 9cRA or tRA. Retinoic acid receptor (RAR)-α and RAR-β mRNA were not detectable by Northern blot analysis in the five STS cell lines, whereas mRNA for the universal retinoic acid receptor, RAR-γ, was expressed in all STS cell lines indicating that retinoid resistance was not associated with a lack of RAR expression. Apoptosis was not induced by interferon-α or 13cRA in any of the five STS cell lines tested. Our results indicate that within the panel of tested STS cell lines, inhibition of proliferation and induction of apoptosis result from different mechanisms which differ in their dependence upon the presence of intact p53. © 1999 Cancer Research Campaign PMID:10424735

  8. Effects of retinoids and thiazolidinediones on proliferation, insulin release, insulin mRNA, GLUT 2 transporter protein and mRNA of INS-1 cells.

    PubMed

    Blumentrath, J; Neye, H; Verspohl, E J

    2001-09-01

    Both 9-cis-retinoic acid (9cRA) and all-trans-retinoic acid (ATRA) are active metabolites of vitamin A (retinol). There exists an interaction between retinoid receptors and peroxisome proliferator-activated receptors (PPARgamma). To define their functions in an insulin secreting system the effects of ATRA, 9cRA and the PPARgamma agonist rosiglitazone on cell proliferation, insulin release and glucose transporter (GLUT) 2 of INS-1 cells were tested. Retinoic acid receptor (RAR-alpha and -gamma) and retinoid X receptor (RXR-alpha and -beta) proteins are present (immunoblots). Both 9cRA and ATRA inhibit INS-1 cell proliferation ([3H]-thymidine assay) in a concentration dependent manner. Both 9cRA and ATRA increased insulin release, but only ATRA ralsed the GLUT 2 mRNA in a bell-shaped concentration response curve after 48 h. The insulinotropic effect of one compound is not significantly superimposed by the other indicating that the same binding sites are used by 9cRA and ATRA. The acute and chronic effects of the PPARgamma agonist rosiglitazone on insulin release were additionally determined since glitazones act as transcription factors together with RXR agonists. At high concentrations (100 microM) rosiglitazone inhibited glucose (8.3 mM) stimulated insulin secretion (acute experiment over 60 min). Insulin secretion, however, was increased during a 24 h treatment at a concentration of 10 microM and again inhibited at 100 microM. Changes in preproinsulin mRNA expression were not observed. Rosiglitazone (100 microM) increased GLUT 2 mRNA paralleled by an increase of GLUT 2 protein, but only after 24 h of treatment. This data indicate that RAR and RXR mediate insulin release. The changes in GLUT 2 have no direct impact on insulin release; the inhibition seen at high concentrations of either compound is possibly the result of the observed inhibition of cell proliferation. Effects of rosiglitazone on preproinsulin mRNA and GLUT 2 (mRNA and protein) do not play a role in modulating insulin secretion. With the presence of an RXR receptor agonist the effect of rosiglitazone on insulin release becomes stimulatory. Thus the effects of RAR-, RXR agonists and rosiglitazone depend on their concentrations, the duration of their presence and are due to specific interactions. Copyright 2001 John Wiley & Sons, Ltd.

  9. Abscisic-acid-induced cellular apoptosis and differentiation in glioma via the retinoid acid signaling pathway.

    PubMed

    Zhou, Nan; Yao, Yu; Ye, Hongxing; Zhu, Wei; Chen, Liang; Mao, Ying

    2016-04-15

    Retinoid acid (RA) plays critical roles in regulating differentiation and apoptosis in a variety of cancer cells. Abscisic acid (ABA) and RA are direct derivatives of carotenoids and share structural similarities. Here we proposed that ABA may also play a role in cellular differentiation and apoptosis by sharing a similar signaling pathway with RA that may be involved in glioma pathogenesis. We reported for the first time that the ABA levels were twofold higher in low-grade gliomas compared with high-grade gliomas. In glioma tissues, there was a positive correlation between the ABA levels and the transcription of cellular retinoic acid-binding protein 2 (CRABP2) and a negative correlation between the ABA levels and transcription of fatty acid-binding protein 5 (FABP5). ABA treatment induced a significant increase in the expression of CRABP2 and a decrease in the expression of peroxisome proliferator-activated receptor (PPAR) in glioblastoma cells. Remarkably, both cellular apoptosis and differentiation were increased in the glioblastoma cells after ABA treatment. ABA-induced cellular apoptosis and differentiation were significantly reduced by selectively silencing RAR-α, while RAR-α overexpression exaggerated the ABA-induced effects. These results suggest that ABA may play a role in the pathogenesis of glioma by promoting cellular apoptosis and differentiation through the RA signaling pathway. © 2015 UICC.

  10. Development of a Magnetic Microbead Affinity Selection Screen (MagMASS) Using Mass Spectrometry for Ligands to the Retinoid X Receptor-α

    NASA Astrophysics Data System (ADS)

    Rush, Michael D.; Walker, Elisabeth M.; Prehna, Gerd; Burton, Tristesse; van Breemen, Richard B.

    2017-03-01

    To overcome limiting factors in mass spectrometry-based screening methods such as automation while still facilitating the screening of complex mixtures such as botanical extracts, magnetic microbead affinity selection screening (MagMASS) was developed. The screening process involves immobilization of a target protein on a magnetic microbead using a variety of possible chemistries, incubation with mixtures of molecules containing possible ligands, a washing step that removes non-bound compounds while a magnetic field retains the beads in the microtiter well, and an organic solvent release step followed by LC-MS analysis. Using retinoid X receptor-α (RXRα) as an example, which is a nuclear receptor and target for anti-inflammation therapy as well as cancer treatment and prevention, a MagMASS assay was developed and compared with an existing screening assay, pulsed ultrafiltration (PUF)-MS. Optimization of MagMASS involved evaluation of multiple protein constructs and several magnetic bead immobilization chemistries. The full-length RXRα construct immobilized with amylose beads provided optimum results. Additional enhancements of MagMASS were the application of 96-well plates to enable automation, use of UHPLC instead of HPLC for faster MS analyses, and application of metabolomics software for faster, automated data analysis. Performance of MagMASS was demonstrated using mixtures of synthetic compounds and known ligands spiked into botanical extracts.

  11. Separate development of the maxilla and mandible is controlled by regional signaling of the maxillomandibular junction during avian development.

    PubMed

    Tak, Hye-Jin; Park, Tae-Jin; Piao, Zhenngu; Lee, Sang-Hwy

    2017-01-01

    Syngnathia is a congenital craniofacial disorder characterized by bony or soft tissue fusion of upper and lower jaws. Previous studies suggested some causative signals, such as Foxc1 or Bmp4, cause the disruption of maxillomandibular identity, but their location and the interactive signals involved remain unexplored. We wanted to examine the embryonic origin of syngnathia based on the assumption that it may be located at the separation between the maxillary and mandibular processes. This region, known as the maxillomandibular junction (MMJ), is involved in segregation of cranial neural crest-derived mesenchyme into the presumptive upper and lower jaws. Here we investigated the role of Fgf, Bmp, and retinoid signaling during development of MMJ in chicken embryos. By changing the levels of these signals with bead implants, we induced syngnathia with microstomia on the treated side, which showed increased Barx1 and neural cell adhesion molecule (NCAM) expression. Redistribution of proliferating cells was also observed at the proximal region to maxillary and mandibular arch around MMJ. We propose that interactive molecular signaling by Fgfs, Bmps, and retinoids around MMJ is required for normal separation of the maxilla and mandible, as well as the proper positioning of beak commissure during early facial morphogenesis. Developmental Dynamics 246:28-40, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  12. Communication development of a young child with foetal retinoid syndrome: a seven-year follow-up study.

    PubMed

    Kritzinger, Alta; Steenkamp, Lizanne

    2006-01-01

    The aim of the article is to describe the communication development of a child with Fetal Retinoid syndrome (FRS) from six months to seven years of age. Little is known about this rare acquired syndrome and its long-term implications, especially on a child's communication development. A descriptive, ex post facto research design was used to study the participant's communication development from 1996 when the family enrolled in an early communication intervention programme. Annual serial assessments of the participant and her family were conducted and the data were stored in a research database after each assessment. The results are described according to a 4-level assessment framework and indicated consistent, but moderate to minor delays in the participant's communication development with a mild hearing loss in the right ear, associated with ear anomalies. Although prenatal exposure to isotretinoin may have serious effects on the unborn fetus and even cause death, the participant did not display all the symptoms of FRS described in the literature. The favorable family circumstances, early commencement of intervention, and supporting early educational environments were protecting factors that could have contributed positively to the participant's communication development. The importance of knowledge accumulation about rare syndromes such as FRS in Communication Pathology and Audiology is discussed and guidelines for early identification, assessment and treatment applicable to the case are proposed as an intervention option.

  13. Molecular cloning and expression analysis of the retinoid X receptor (RXR) gene in golden pompano Trachinotus ovatus fed Artemia nauplii with different enrichments.

    PubMed

    Yang, Qibin; Zheng, Panlong; Ma, Zhenhua; Li, Tao; Jiang, Shigui; Qin, Jian G

    2015-12-01

    The retinoid X receptors (RXRs) are involved in the skeletal development and other biological process such as blood vessel formation and metabolism. Partial sequences of RXRα and β genes were obtained, and their expressions were quantified on golden pompano Trachinotus ovatus at 28 days post hatching (DPH) to explore the molecular response to nutritional manipulation in fish larvae. As live food, Artemia nauplii were separately enriched with Nannochloropsis and Algamac 3080 and non-enriched Artemia nauplii (control) for fish feeding. The expressions of RXRs were detected in the embryos and fish larvae at early stages, suggesting that the skeletal development in golden pompano initiated before yolk re-sorption completion. Fish fed non-enriched Artemia nauplii ended up with higher jaw malformation. The highest specific growth rate was obtained when fish were fed with the Artemia nauplii enriched with Algamac 3080, and the lowest growth rate was observed when fish were fed with unenriched Artemia nauplii. The highest survival was obtained when fish were fed with non-enriched or Nannochloropsis-enriched Artemia nauplii. This study indicates that the use of enriched formula for Artemia nauplii can significantly affect the expression levels of RXRs and jaw malformation of golden pompano larvae, but there is no clear correlation between RXRs expressions and malformation rates when fish are subjected to nutrient challenge.

  14. Duration of oral antibiotic therapy for the treatment of adult acne: a retrospective analysis investigating adherence to guideline recommendations and opportunities for cost-savings.

    PubMed

    Straight, Chelsey E; Lee, Young H; Liu, Guodong; Kirby, Joslyn S

    2015-05-01

    The duration of oral antibiotic acne therapy for adolescents compared with guidelines was recently investigated; however it was uncertain if duration of antibiotics for adult acne therapy differed. This study aimed to evaluate duration of oral antibiotics for adult acne compared with guidelines and determine possible cost-savings. This was a retrospective cohort study of MarketScan Commercial Claims and Encounters database that incorporated claims data to determine duration and costs of antibiotic treatment among adults ages 21 years and older. Of 17,448 courses, 84.5% (14,737) aligned with duration guidelines, although 12,040 (69.0%) courses did not include concomitant topical retinoid therapy. Mean savings of $592.26 per person could result if prolonged courses met guidelines. Mean (median) costs of generic and branded formulations for the most frequent course duration (90-179 days) were $103.77 ($54.27) and $1421.61 ($1462.25), respectively. Actual patient prescription adherence is uncertain and database lacks information regarding acne severity, patient physical characteristics, and clinical outcomes. The majority of oral antibiotic course durations follow guidelines, although topical retinoids are underused. Costs of antibiotic therapy were lower for shorter courses and those using generic medications; the cost-effectiveness of these modifications has not been investigated. Copyright © 2015 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.

  15. Topical tretinoin therapy and all-cause mortality.

    PubMed

    Weinstock, Martin A; Bingham, Stephen F; Lew, Robert A; Hall, Russell; Eilers, David; Kirsner, Robert; Naylor, Mark; Kalivas, James; Cole, Gary; Marcolivio, Kimberly; Collins, Joseph; Digiovanna, John J; Vertrees, Julia E

    2009-01-01

    To evaluate the relation of topical tretinoin, a commonly used retinoid cream, with all-cause mortality in the Veterans Affairs Topical Tretinoin Chemoprevention Trial (VATTC). The planned outcome of this trial was risk of keratinocyte carcinoma, and systemic administration of certain retinoid compounds has been shown to reduce risk of this cancer but has also been associated with increased mortality risk among smokers. The VATTC Trial was a blinded randomized chemoprevention trial, with 2- to 6-year follow-up. Oversight was provided by multiple independent committees. US Department of Veterans Affairs medical centers. Patients A total of 1131 veterans were randomized. Their mean age was 71 years. Patients with a very high estimated short-term risk of death were excluded. Interventions Application of tretinoin, 0.1%, or vehicle control cream twice daily to the face and ears. Death, which was not contemplated as an end point in the original study design. The intervention was terminated 6 months early because of an excessive number of deaths in the tretinoin-treated group. Post hoc analysis of this difference revealed minor imbalances in age, comorbidity, and smoking status, all of which were important predictors of death. After adjusting for these imbalances, the difference in mortality between the randomized groups remained statistically significant. We observed an association of topical tretinoin therapy with death, but we do not infer a causal association that current evidence suggests is unlikely.

  16. Hypoxia-inducible factor 1 mediates hypoxia-induced cardiomyocyte lipid accumulation by reducing the DNA binding activity of peroxisome proliferator-activated receptor {alpha}/retinoid X receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Belanger, Adam J.; Luo Zhengyu; Vincent, Karen A.

    2007-12-21

    In response to cellular hypoxia, cardiomyocytes adapt to consume less oxygen by shifting ATP production from mitochondrial fatty acid {beta}-oxidation to glycolysis. The transcriptional activation of glucose transporters and glycolytic enzymes by hypoxia is mediated by hypoxia-inducible factor 1 (HIF-1). In this study, we examined whether HIF-1 was involved in the suppression of mitochondrial fatty acid {beta}-oxidation in hypoxic cardiomyocytes. We showed that either hypoxia or adenovirus-mediated expression of a constitutively stable hybrid form (HIF-1{alpha}/VP16) suppressed mitochondrial fatty acid metabolism, as indicated by an accumulation of intracellular neutral lipid. Both treatments also reduced the mRNA levels of muscle carnitine palmitoyltransferasemore » I which catalyzes the rate-limiting step in the mitochondrial import of fatty acids for {beta}-oxidation. Furthermore, adenovirus-mediated expression of HIF-1{alpha}/VP16 in cardiomyocytes under normoxic conditions also mimicked the reduction in the DNA binding activity of peroxisome proliferator-activated receptor {alpha} (PPAR{alpha})/retinoid X receptor (RXR), in the presence or absence of a PPAR{alpha} ligand. These results suggest that HIF-1 may be involved in hypoxia-induced suppression of fatty acid metabolism in cardiomyocytes by reducing the DNA binding activity of PPAR{alpha}/RXR.« less

  17. Topical adapalene gel 0.1% vs. isotretinoin gel 0.05% in the treatment of acne vulgaris: a randomized open-label clinical trial.

    PubMed

    Ioannides, D; Rigopoulos, D; Katsambas, A

    2002-09-01

    Topical application of isotretinoin and adapalene has proved effective in treating acne vulgaris. Both drugs demonstrate therapeutic advantages and less irritancy over tretinoin, the most widely used treatment for acne. They both act as retinoid agonists, but differ in their affinity profile for nuclear and cytosolic retinoic acid receptors. To compare the efficacy and tolerability of adapalene gel 0.1% and isotretinoin gel 0.05% in the treatment of acne vulgaris of the face, in a randomized open-label clinical trial. Eighty patients were enrolled and were instructed to apply adapalene gel 0.1% or isotretinoin gel 0.05% once daily over a 12-week treatment period. Efficacy determination included noninflammatory and inflammatory lesion counts by the investigator and global evaluation of improvement. Cutaneous tolerance was assessed by determining erythema, scaling and burning with pruritus. Adapalene and isotretinoin gels were highly effective in treating facial acne. Adapalene gel produced greater reductions in noninflammatory and inflammatory lesion counts than did isotretinoin gel, but differences between treatments were not statistically significant. Adapalene gel was significantly better tolerated than isotretinoin gel during the whole treatment period. The two gels studied demonstrated comparable efficacy. When adapalene and isotretinoin were compared, significantly lower skin irritation was noted with adapalene, indicating that adapalene may begin a new era of treatment with low-irritant retinoids.

  18. Hyperspectral imaging of endogenous fluorescent metabolic molecules to identify pain states in central nervous system tissue

    NASA Astrophysics Data System (ADS)

    Staikopoulos, Vasiliki; Gosnell, Martin E.; Anwer, Ayad G.; Mustafa, Sanam; Hutchinson, Mark R.; Goldys, Ewa M.

    2016-12-01

    Fluorescence-based bio-imaging methods have been extensively used to identify molecular changes occurring in biological samples in various pathological adaptations. Auto-fluorescence generated by endogenous fluorescent molecules within these samples can interfere with signal to background noise making positive antibody based fluorescent staining difficult to resolve. Hyperspectral imaging uses spectral and spatial imaging information for target detection and classification, and can be used to resolve changes in endogenous fluorescent molecules such as flavins, bound and free NADH and retinoids that are involved in cell metabolism. Hyperspectral auto-fluorescence imaging of spinal cord slices was used in this study to detect metabolic differences within pain processing regions of non-pain versus sciatic chronic constriction injury (CCI) animals, an established animal model of peripheral neuropathy. By using an endogenous source of contrast, subtle metabolic variations were detected between tissue samples, making it possible to distinguish between animals from non-injured and injured groups. Tissue maps of native fluorophores, flavins, bound and free NADH and retinoids unveiled subtle metabolic signatures and helped uncover significant tissue regions with compromised mitochondrial function. Taken together, our results demonstrate that hyperspectral imaging provides a new non-invasive method to investigate central changes of peripheral neuropathic injury and other neurodegenerative disease models, and paves the way for novel cellular characterisation in health, disease and during treatment, with proper account of intrinsic cellular heterogeneity.

  19. staggerer phenotype in retinoid-related orphan receptor α-deficient mice

    PubMed Central

    Steinmayr, Markus; André, Elisabeth; Conquet, François; Rondi-Reig, Laure; Delhaye-Bouchaud, Nicole; Auclair, Nathalie; Daniel, Hervé; Crépel, Francis; Mariani, Jean; Sotelo, Constantino; Becker-André, Michael

    1998-01-01

    Retinoid-related orphan receptor α (RORα) is a member of the nuclear receptor superfamily. To study its physiological role we generated null-mutant mice by targeted insertion of a lacZ reporter gene encoding the enzyme β-galactosidase. In heterozygous RORα+/− mice we found β-galactosidase activity, indicative of RORα protein expression, confined to the central nervous system, skin and testis. In the central nervous system, the RORα gene is expressed in cerebellar Purkinje cells, the thalamus, the suprachiasmatic nuclei, and retinal ganglion cells. In skin, RORα is strongly expressed in the hair follicle, the epidermis, and the sebaceous gland. Finally, the peritubular cells of the testis and the epithelial cells of the epididymis also strongly express RORα. Recently, it was reported that the ataxic mouse mutant staggerer (sg/sg) is caused by a deletion in the RORα gene. The analysis of the cerebellar and the behavioral phenotype of homozygous RORα−/− mice proves identity to sg/sg mice. Although the absence of RORα causes dramatic developmental effects in the cerebellum, it has no apparent morphological effect on thalamus, hypothalamus, and retina. Similarly, testis and skin of RORα−/− mice display a normal phenotype. However, the pelage hair of both sg/sg and RORα−/− is significantly less dense and when shaved shows reluctance to regrow. PMID:9520475

  20. European best practice guidelines for renal transplantation. Section IV: Long-term management of the transplant recipient. IV.6.2. Cancer risk after renal transplantation. Skin cancers: prevention and treatment.

    PubMed

    2002-01-01

    D. Due to the high prevalence of skin cancers after organ transplantation, it is highly recommended to inform patients about self-awareness. E. Primary prevention should include the avoidance of sun exposure, use of protective clothing and use of an effective sunscreen (protection factor >15) for unclothed body parts (head, neck, hands and arms) in order to prevent the occurrence of squamous-cell carcinoma. This is the most frequent skin tumour in transplant recipients, and its preferential location is the head. F. Recipients with pre-malignant skin lesions (warts, epidermodysplasia verruciformis or actinic keratoses) should be referred early to a dermatologist for active treatment and close follow-up. G. All skin cancers should be completely removed by a dermatologist with appropriate techniques, such as electro-desiccation with curettage, cryotherapy or surgical excision. H. Secondary prevention for recipients should include close follow-up by a dermatologist (at least every 6 months), the use of topical retinoids to control actinic keratoses and to diminish squamous-cell carcinoma recurrence, and reduction of immunosuppression whenever possible. I. In recipients with multiple and/or recurrent skin cancers, the use of systemic retinoids, such as low-dose acitretin, could be recommended for months/years, if well tolerated, in addition to further reduction in immunosuppression whenever possible.

  1. SoxB1-driven transcriptional network underlies neural-specific interpretation of morphogen signals.

    PubMed

    Oosterveen, Tony; Kurdija, Sanja; Ensterö, Mats; Uhde, Christopher W; Bergsland, Maria; Sandberg, Magnus; Sandberg, Rickard; Muhr, Jonas; Ericson, Johan

    2013-04-30

    The reiterative deployment of a small cadre of morphogen signals underlies patterning and growth of most tissues during embyogenesis, but how such inductive events result in tissue-specific responses remains poorly understood. By characterizing cis-regulatory modules (CRMs) associated with genes regulated by Sonic hedgehog (Shh), retinoids, or bone morphogenetic proteins in the CNS, we provide evidence that the neural-specific interpretation of morphogen signaling reflects a direct integration of these pathways with SoxB1 proteins at the CRM level. Moreover, expression of SoxB1 proteins in the limb bud confers on mesodermal cells the potential to activate neural-specific target genes upon Shh, retinoid, or bone morphogenetic protein signaling, and the collocation of binding sites for SoxB1 and morphogen-mediatory transcription factors in CRMs faithfully predicts neural-specific gene activity. Thus, an unexpectedly simple transcriptional paradigm appears to conceptually explain the neural-specific interpretation of pleiotropic signaling during vertebrate development. Importantly, genes induced in a SoxB1-dependent manner appear to constitute repressive gene regulatory networks that are directly interlinked at the CRM level to constrain the regional expression of patterning genes. Accordingly, not only does the topology of SoxB1-driven gene regulatory networks provide a tissue-specific mode of gene activation, but it also determines the spatial expression pattern of target genes within the developing neural tube.

  2. Cardiac compartment-specific overexpression of a modified retinoic acid receptor produces dilated cardiomyopathy and congestive heart failure in transgenic mice.

    PubMed Central

    Colbert, M C; Hall, D G; Kimball, T R; Witt, S A; Lorenz, J N; Kirby, M L; Hewett, T E; Klevitsky, R; Robbins, J

    1997-01-01

    Retinoids play a critical role in cardiac morphogenesis. To examine the effects of excessive retinoid signaling on myocardial development, transgenic mice that overexpress a constitutively active retinoic acid receptor (RAR) controlled by either the alpha- or beta-myosin heavy chain (MyHC) promoter were generated. Animals carrying the alpha-MyHC-RAR transgene expressed RARs in embryonic atria and in adult atria and ventricles, but developed no signs of either malformations or disease. In contrast, beta-MyHC-RAR animals, where expression was activated in fetal ventricles, developed a dilated cardiomyopathy that varied in severity with transgene copy number. Characteristic postmortem lesions included biventricular chamber dilation and left atrial thrombosis; the incidence and severity of these lesions increased with increasing copy number. Transcript analyses showed that molecular markers of hypertrophy, alpha-skeletal actin, atrial natriuretic factor and beta-MyHC, were upregulated. Cardiac performance of transgenic hearts was evaluated using the isolated perfused working heart model as well as in vivo, by transthoracic M-mode echocardiography. Both analyses showed moderate to severe impairment of left ventricular function and reduced cardiac contractility. Thus, expression of a constitutively active RAR in developing atria and/ or in postnatal ventricles is relatively benign, while ventricular expression during gestation can lead to significant cardiac dysfunction. PMID:9329959

  3. Physiological and Microfluorometric Studies of Reduction and Clearance of Retinal in Bleached Rod Photoreceptors

    PubMed Central

    Tsina, Efthymia; Chen, Chunhe; Koutalos, Yiannis; Ala-Laurila, Petri; Tsacopoulos, Marco; Wiggert, Barbara; Crouch, Rosalie K.; Cornwall, M. Carter

    2004-01-01

    The visual cycle comprises a sequence of reactions that regenerate the visual pigment in photoreceptors during dark adaptation, starting with the reduction of all-trans retinal to all-trans retinol and its clearance from photoreceptors. We have followed the reduction of retinal and clearance of retinol within bleached outer segments of red rods isolated from salamander retina by measuring its intrinsic fluorescence. Following exposure to a bright light (bleach), increasing fluorescence intensity was observed to propagate along the outer segments in a direction from the proximal region adjacent to the inner segment toward the distal tip. Peak retinol fluorescence was achieved after ∼30 min, after which it declined very slowly. Clearance of retinol fluorescence is considerably accelerated by the presence of the exogenous lipophilic substances IRBP (interphotoreceptor retinoid binding protein) and serum albumin. We have used simultaneous fluorometric and electrophysiological measurements to compare the rate of reduction of all-trans retinal to all-trans retinol to the rate of recovery of flash response amplitude in these cells in the presence and absence of IRBP. We find that flash response recovery in rods is modestly accelerated in the presence of extracellular IRBP. These results suggest such substances may participate in the clearance of retinoids from rod photoreceptors, and that this clearance, at least in rods, may facilitate dark adaptation by accelerating the clearance of photoproducts of bleaching. PMID:15452202

  4. Moisturizers for Acne

    PubMed Central

    Chularojanamontri, Leena; Tuchinda, Papapit; Kulthanan, Kanokvalai

    2014-01-01

    Acne is a chronic inflammatory disease of the pilosebaceous unit that affects almost all teenagers. Different treatments offer different modes of action, but aim to target acne pathology. Topical therapies, such as benzoyl peroxide, retinoids, antibiotics with alcohol-based preparations, and salicylic acid, can cause skin irritation resulting in a lack of patient adherence. Some physicians recommend patients use moisturizers as adjunctive treatment of acne, especially when either topical benzoyl peroxide or a retinoid is prescribed. Furthermore, some evidence shows that moisturizers can contribute independently to improve signs and symptoms of acne. Moisturizers contain three main properties, which are occlusive, humectant, and emollient effects. Currently, many moisturizers claim to be suitable for acne treatment. This article aims to provide a review of the active ingredients and properties of those moisturizers. Fifty-two moisturizers for acne were included for analysis. Most of the products (92%) have anti-inflammatory properties apart from occlusive, humectant, and emollient effects. Anti-acne medications, including salicylic acid, benzoyl peroxide, and retinol, were found respectively in 35, 10, and 8 percent of the moisturizer products containing anti-inflammatory properties. More than half of the products contain dimethicone and/or glycerin for its moisturizer property. Aloe vera and witch hazel are botanical anti-inflammatories that were commonly found in this study. Scientific data regarding some ingredients are discussed to provide a guide for physicians in selecting moisturizers for acne patients. PMID:24847408

  5. Molecular cloning and multifunctional characterization of GRIM-19 (gene associated with retinoid-interferon-induced mortality 19) homologue from turbot (Scophthalmus maximus).

    PubMed

    Wang, Na; Wang, Xianli; Yang, Changgeng; Zhao, Xiaojie; Zhang, Yuxi; Wang, Tianzi; Chen, Songlin

    2014-03-01

    GRIM-19 (gene associated with retinoid-interferon-induced mortality 19), a novel cell death regulatory gene, plays important roles in cell apoptosis, embryogenesis, mitochondrial respiratory chain and immune response. To date, little information is known about fish GRIM-19 characteristics except orange-spotted grouper (Epinephelus coioides). Here a new GRIM-19 gene is identified and characterized from turbot (Scophthalmus maximus), an economic marine fish in China and Europe. Briefly, turbot GRIM-19 is a 595-bp gene encoding a 144 amino acids protein, which shares the closest relationship with Atlantic halibut (Hippoglossus hippoglossus). The expression of turbot grim-19 in liver, spleen and kidney is up-regulated by the infection of Vibrio anguillarum and LCDV (lymphocystis disease virus). Subsequently, a recombinant protein of turbot GRIM-19 is acquired and the anti-bacterial function is proved by liquid culture inhibition experiment. The subcellular location indicates that turbot GRIM-19 is co-localized with STAT3 in the cytoplasm, which is mainly determined by GRIM-19 41-84 amino acids and STAT3 1-321 amino acids. Finally, the involvements of turbot GRIM-19 in cell apoptosis and NF-κB pathway are investigated. All these data help to understand GRIM-19 function in fish, as well as provide the application possibility of GRIM-19 in fish disease resistance breeding. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Transforming growth factor (TGF)beta, fibroblast growth factor (FGF) and retinoid signalling pathways promote pancreatic exocrine gene expression in mouse embryonic stem cells.

    PubMed Central

    Skoudy, Anouchka; Rovira, Meritxell; Savatier, Pierre; Martin, Franz; León-Quinto, Trinidad; Soria, Bernat; Real, Francisco X

    2004-01-01

    Extracellular signalling cues play a major role in the activation of differentiation programmes. Mouse embryonic stem (ES) cells are pluripotent and can differentiate into a wide variety of specialized cells. Recently, protocols designed to induce endocrine pancreatic differentiation in vitro have been designed but little information is currently available concerning the potential of ES cells to differentiate into acinar pancreatic cells. By using conditioned media of cultured foetal pancreatic rudiments, we demonstrate that ES cells can respond in vitro to signalling pathways involved in exocrine development and differentiation. In particular, modulation of the hedgehog, transforming growth factor beta, retinoid, and fibroblast growth factor pathways in ES cell-derived embryoid bodies (EB) resulted in increased levels of transcripts encoding pancreatic transcription factors and cytodifferentiation markers, as demonstrated by RT-PCR. In EB undergoing spontaneous differentiation, expression of the majority of the acinar genes (i.e. amylase, carboxypeptidase A and elastase) was induced after the expression of endocrine genes, as occurs in vivo during development. These data indicate that ES cells can undergo exocrine pancreatic differentiation with a kinetic pattern of expression reminiscent of pancreas development in vivo and that ES cells can be coaxed to express an acinar phenotype by activation of signalling pathways known to play a role in pancreatic development and differentiation. PMID:14733613

  7. Tazarotene-induced gene 3 is suppressed in basal cell carcinomas and reversed in vivo by tazarotene application.

    PubMed

    Duvic, Madeleine; Ni, Xiao; Talpur, Rakhashandra; Herne, Kelly; Schulz, Claudia; Sui, Dawen; Ward, Staci; Joseph, Aaron; Hazarika, Parul

    2003-10-01

    Basal cell carcinomas are the most common form of skin cancer. Tazarotene is a retinoic acid receptor selective retinoid that upregulates a tumor suppressor, tazarotene-induced gene 3 (TIG-3), in keratinocytes and psoriasis. Expression of TIG-3 in basal cell carcinomas was studied in an opened-label pilot biomarker study of 22 patients with basal cell carcinomas who applied tazarotene 0.1% gel for up to 12 wk prior to excision. Nineteen paired baseline and treated specimens were compared using immunohistochemistry and in situ hybridization. Compared to overlying normal epidermis, TIG-3 protein and mRNA were decreased in 14 and 18 of 19 basal cell carcinomas (74% and 95%), respectively (p < 0.001). Tazarotene treatment was associated with increased TIG-3 protein and mRNA expression in basal cell carcinomas compared to baseline levels (p < or = 0.001 and p = 0.028, respectively). Sixty percent of basal cell carcinomas treated with tazarotene decreased in size by at least 25%. Ten of 19 lesions improved histologically, including three complete responses. There was a correlation between the increased expression of TIG-3 protein and histologic improvement (p = 0.020), suggesting that suppression of TIG-3 may underlie the development of basal cell carcinomas. This association suggests that reversal of TIG-3 expression may help to explain the mechanism of retinoid action in epidermal differentiation and chemoprevention.

  8. Oily Skin: A review of Treatment Options

    PubMed Central

    Miller, Richard A.

    2017-01-01

    One of the most common dermatologic concerns is oily skin, and the demand for effective treatment options is ever apparent. This review article addresses numerous topical treatment options such as retinoids, olumacostat glasaretil, and various cosmeceutical agents. several systemic and procedural techniques that incorporate isotretinoin, spironolactone, oral contraceptives, botulinum toxin, photodynamic therapy, and lasers are reviewed as well. Each treatment option is analyzed in terms of the proposed mechanism of action, efficacy reported in the literature, and potential adverse effects. PMID:28979664

  9. Gene Regulation by Retinoid Receptors in Human Mammary Epithelial Cells

    DTIC Science & Technology

    2002-10-01

    ceptors for collagen and fibronectin in human fibrosarcoma cells possessing Xia, Y-, S.G. Gil, and W.G. Carter. 1996. Anchorage mediated by integrin...simultaneously block all TdT terminal deoxynucleotidyl transferase pRB retinoblastoma protein wild-type RAR isoforms (-o, -P, and -- ) (Damm et CAT ...P0 pM treated with 0, 0,1, 1.0, or 10 jIM ATRA for 24 hours and cell lysates were assayed for CAT reporter activity. pCMV-GH was used as a transfection

  10. Retinoic Acid and Affective Disorders: The Evidence for an Association

    PubMed Central

    Bremner, J Douglas; Shearer, Kirsty; McCaffery, Peter

    2011-01-01

    Objective Isotretinoin (13-cis-retinoic acid, or 13-cis-RA) (Accutane), approved by the FDA for the treatment of acne, carries a black box warning related to the risk of depression, suicide, and psychosis. Retinoic acid (RA), the active form of vitamin A, regulates gene expression in the brain, and isotretinoin is its 13-cis isomer. Retinoids represent a group of compounds derived from vitamin A that perform a large variety of functions in many systems, in particular the CNS, and abnormal retinoid levels can have neurological effects. Although infrequent, proper recognition and treatment of psychiatric side effects in acne patients is critical given the risk of death and disability. This paper reviews the evidence for a relationship between isotretinoin, depression and suicidality. Data Sources Evidence examined includes: 1) case reports; 2) temporal association between onset of depression and exposure to the drug; 3) challenge-rechallenge cases; 4) class effect (other compounds in the same class, like vitamin A, having similar neuropsychiatric effects); 5) dose response; and 6) biologically plausible mechanisms. Study Selection All papers in the literature related to isotretinoin, depression and suicide were reviewed, as well as papers related to class effect, dose response, and biological plausibility. Data Extraction Information from individual articles in the literature was extracted. Data Synthesis The literature reviewed is consistent with an association between isotretinoin administration, depression and suicide in some individuals. Conclusions The relationship between isotretinoin and depression may have implications for a greater understanding of the neurobiology of affective disorders. PMID:21903028

  11. A retrospective analysis of the duration of oral antibiotic therapy for the treatment of acne among adolescents: investigating practice gaps and potential cost-savings.

    PubMed

    Lee, Young H; Liu, Guodong; Thiboutot, Diane M; Leslie, Douglas L; Kirby, Joslyn S

    2014-07-01

    Duration of oral antibiotic therapy in acne has not been widely studied. Recent guidelines suggest it should be limited to 3 to 6 months. We sought to compare the duration of oral antibiotic use with recent guidelines and determine the potential cost-savings related to shortened durations. This is a retrospective cohort study from the MarketScan Commercial Claims and Encounters database. Claims data were used to determine duration and costs of antibiotic therapy. The mean course duration was 129 days. The majority (93%) of courses were less than 9 months. Among the 31,634 courses, 18,280 (57.8%) did not include concomitant topical retinoid therapy. The mean (95% confidence interval) duration with and without topical retinoid use was 133 (131.5-134.7) days and 127 (125.4-127.9) days, respectively. The mean excess direct cost of antibiotic treatment for longer than 6 months was $580.99/person. Claims cannot be attributed to a specific diagnosis or provider. The database does not provide information on acne severity. Duration of antibiotic use is decreasing when compared with previous data. However, 5547 (17.53%) courses exceeded 6 months, highlighting an opportunity for reduced antibiotic use. If courses greater than 6 months were shortened to 6 months, savings would be $580.99/person. Copyright © 2014 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  12. Downregulation of insulin-like growth factor binding protein 3 and 5 in nitrofen-induced pulmonary hypoplasia.

    PubMed

    Ruttenstock, Elke; Doi, Takashi; Dingemann, Jens; Puri, Prem

    2010-01-01

    The high mortality in congenital diaphragmatic hernia (CDH) is mainly attributed to pulmonary hypoplasia. Recent studies suggest that retinoid signaling pathway (RSP) is inhibited in the nitrofen-induced hypoplastic lung. The insulin-like growth factor (IGF) system plays a crucial role in fetal lung development by interaction of IGFBP-3 and IGFBP-5 with RSP. We hypothesized that pulmonary IGFBP-3 and IGFBP-5 gene expression levels are downregulated in the nitrofen-induced pulmonary hypoplasia. Pregnant rats were exposed to either olive oil or 100 mg nitrofen on day 9.5 (D9.5) of gestation. Fetal lungs were harvested on D18 and D21 and divided into control and nitrofen groups. IGFBP-3 and IGFBP-5 pulmonary gene and protein expression were determined using real-time RT-PCR and immunohistochemistry. Relative levels of IGFBP-3 mRNA were significantly decreased in the nitrofen group (8.00 +/- 14.44) in D21 compared to controls (14.81 +/- 16.11; p < 0.05). Expression levels of IGFBP-5 mRNA were also significantly decreased in nitrofen group (10.66 +/- 4.83) on D18 compared to controls (17.92 +/- 4.77). Immunohistochemistry showed decreased IGFBP-3 expression on D21 and decreased IGFBP-5 immunoreactivity on D18 in hypoplastic lungs compared to controls. Downregulation of IGFBP-3 and IGFBP-5 gene expression may cause pulmonary hypoplasia in the nitrofen-induced CDH model by interfering with retinoid signaling pathway.

  13. Expression of peroxisomal proliferator-activated receptors and retinoid X receptors in the kidney.

    PubMed

    Yang, T; Michele, D E; Park, J; Smart, A M; Lin, Z; Brosius, F C; Schnermann, J B; Briggs, J P

    1999-12-01

    The discovery that 15-deoxy-Delta12,14-prostaglandin J2 (15d-PGJ2) is a ligand for the gamma-isoform of peroxisome proliferator-activated receptor (PPAR) suggests nuclear signaling by prostaglandins. Studies were undertaken to determine the nephron localization of PPAR isoforms and their heterodimer partners, retinoid X receptors (RXR), and to evaluate the function of this system in the kidney. PPARalpha mRNA, determined by RT-PCR, was found predominately in cortex and further localized to proximal convoluted tubule (PCT); PPARgamma was abundant in renal inner medulla, localized to inner medullary collecting duct (IMCD) and renal medullary interstitial cells (RMIC); PPARbeta, the ubiquitous form of PPAR, was abundant in all nephron segments examined. RXRalpha was localized to PCT and IMCD, whereas RXRbeta was expressed in almost all nephron segments examined. mRNA expression of acyl-CoA synthase (ACS), a known PPAR target gene, was stimulated in renal cortex of rats fed with fenofibrate, but the expression was not significantly altered in either cortex or inner medulla of rats fed with troglitazone. In cultured RMIC cells, both troglitazone and 15d-PGJ2 significantly inhibited cell proliferation and dramatically altered cell shape by induction of cell process formation. We conclude that PPAR and RXR isoforms are expressed in a nephron segment-specific manner, suggesting distinct functions, with PPARalpha being involved in energy metabolism through regulating ACS in PCT and with PPARgamma being involved in modulating RMIC growth and differentiation.

  14. Effects of vitamin A deficiency in the postnatal mouse heart: role of hepatic retinoid stores

    PubMed Central

    Ryzhov, Sergey; Tikhomirov, Oleg; Duarte, Christine W.; Congdon, Clare Bates; Lessard, Craig R.; McFarland, Samuel; Rochette-Egly, Cecile; Tran, Truc-Linh; Galindo, Cristi L.; Favreau-Lessard, Amanda J.; Sawyer, Douglas B.

    2016-01-01

    To determine whether hepatic depletion of vitamin A (VA) stores has an effect on the postnatal heart, studies were carried out with mice lacking liver retinyl ester stores fed either a VA-sufficient (LRVAS) or VA-deficient (LRVAD) diet (to deplete circulating retinol and extrahepatic stores of retinyl esters). There were no observable differences in the weights or gross morphology of hearts from LRVAS or LRVAD mice relative to sex-matched, age-matched, and genetically matched wild-type (WT) controls fed the VAS diet (WTVAS), but changes in the transcription of functionally relevant genes were consistent with a state of VAD in LRVAS and LRVAD ventricles. In silico analysis revealed that 58/67 differentially expressed transcripts identified in a microarray screen are products of genes that have DNA retinoic acid response elements. Flow cytometric analysis revealed a significant and cell-specific increase in the number of proliferating Sca-1 cardiac progenitor cells in LRVAS animals relative to WTVAS controls. Before myocardial infarction, LRVAS and WTVAS mice had similar cardiac systolic function and structure, as measured by echocardiography, but, unexpectedly, repeat echocardiography demonstrated that LRVAS mice had less adverse remodeling by 1 wk after myocardial infarction. Overall, the results demonstrate that the adult heart is responsive to retinoids, and, most notably, reducing hepatic VA stores (while maintaining circulating levels of VA) impacts ventricular gene expression profiles, progenitor cell numbers, and response to injury. PMID:27084391

  15. Effects of vitamin A deficiency in the postnatal mouse heart: role of hepatic retinoid stores.

    PubMed

    Asson-Batres, Mary Ann; Ryzhov, Sergey; Tikhomirov, Oleg; Duarte, Christine W; Congdon, Clare Bates; Lessard, Craig R; McFarland, Samuel; Rochette-Egly, Cecile; Tran, Truc-Linh; Galindo, Cristi L; Favreau-Lessard, Amanda J; Sawyer, Douglas B

    2016-06-01

    To determine whether hepatic depletion of vitamin A (VA) stores has an effect on the postnatal heart, studies were carried out with mice lacking liver retinyl ester stores fed either a VA-sufficient (LRVAS) or VA-deficient (LRVAD) diet (to deplete circulating retinol and extrahepatic stores of retinyl esters). There were no observable differences in the weights or gross morphology of hearts from LRVAS or LRVAD mice relative to sex-matched, age-matched, and genetically matched wild-type (WT) controls fed the VAS diet (WTVAS), but changes in the transcription of functionally relevant genes were consistent with a state of VAD in LRVAS and LRVAD ventricles. In silico analysis revealed that 58/67 differentially expressed transcripts identified in a microarray screen are products of genes that have DNA retinoic acid response elements. Flow cytometric analysis revealed a significant and cell-specific increase in the number of proliferating Sca-1 cardiac progenitor cells in LRVAS animals relative to WTVAS controls. Before myocardial infarction, LRVAS and WTVAS mice had similar cardiac systolic function and structure, as measured by echocardiography, but, unexpectedly, repeat echocardiography demonstrated that LRVAS mice had less adverse remodeling by 1 wk after myocardial infarction. Overall, the results demonstrate that the adult heart is responsive to retinoids, and, most notably, reducing hepatic VA stores (while maintaining circulating levels of VA) impacts ventricular gene expression profiles, progenitor cell numbers, and response to injury. Copyright © 2016 the American Physiological Society.

  16. Pharmacokinetics and metabolism of all-trans- and 13-cis-retinoic acid in pulmonary emphysema patients.

    PubMed

    Muindi, Josephia R; Roth, Michael D; Wise, Robert A; Connett, John E; O'Connor, George T; Ramsdell, Joe W; Schluger, Neil W; Romkes, Marjorie; Branch, Robert A; Sciurba, Frank C

    2008-01-01

    Retinoids promote lung alveolarization in animal models and were administered to patients as part of the Feasibility of Retinoid Therapy for Emphysema (FORTE) study. This FORTE substudy investigated the pharmacokinetic profiles of 2 retinoic acid isomers-all-trans-retinoic acid (ATRA) and 13-cis-retinoic acid (13-cRA)-in subjects with emphysema, evaluated strategies to overcome self-induced ATRA catabolism, and identified pharmacodynamic relationships. Comprehensive and limited pharmacokinetics were obtained at multiple visits in emphysema subjects treated with placebo (n = 30), intermittent dosing (4 days/week) with low-dose ATRA (1 mg/kg/day, n = 21), or high-dose ATRA (2 mg/kg/day, n = 25) or daily administration of 13-cRA (1 mg/kg/day, n = 40). High-dose ATRA produced the highest peak plasma ATRA Cmax. However, at follow-up, plasma ATRA C(max) was significantly decreased from baseline in subjects whose day 1 levels exceeded 100 ng/mL (P < .0001). In contrast, administration of 13-cRA produced lower plasma ATRA C(max) (<100 ng/mL), but the levels were significantly higher at follow-up than those on day 1 (P < .001). Plasma ATRA levels as determined on day 1 correlated with changes in pulmonary diffusing capacity at 6 months, consistent with concentration-dependent biologic effects (r2 = -0.25). The authors conclude that intermittent therapy with high-dose ATRA produced the greatest ATRA exposure, but alternative approaches for limiting self-induced ATRA catabolism should be sought.

  17. Low-dose retinoic acid enhances in vitro invasiveness of human oral squamous-cell-carcinoma cell lines

    PubMed Central

    Uchida, D; Kawamata, H; Nakashiro, K; Omotehara, F; Hino, S; Hoque, M O; Begum, N-M; Yoshida, H; Sato, M; Fujimori, T

    2001-01-01

    Retinoids inhibit the proliferation of several types of tumour cells, and are used for patients with several malignant tumours. In this study, we examined the effect of retinoic acids (RAs) on the invasive potentials of the oral squamous cell carcinoma (SCC) cells, BHY and HNt. BHY cells expressed all of retinoid nuclear receptors (RARα, β, γ, and RXRα) and cytoplasmic retinoic acid binding proteins (CRABP1 and CRABP2). HNt cells lacked the expression of RARβ, but expressed other nuclear receptors and CRABPs. All-trans retinoic acid (ATRA) and 13-cis retinoic acid (13-cisRA) (10−6and 10−7M) inhibited the growth of the cells, but low-dose ATRA and 13-cisRA (10−8M) marginally affected the growth of the cells. Surprisingly, low-dose RAs enhanced the activity of tissue-type plasminogen activator (tPA), and activated pro-matrix metalloproteinases (proMMP2 and proMMP9). Activation of proMMP2 and proMMP9 was inhibited by aprotinin, a serine-proteinase, tPA inhibitor. Furthermore, low-dose RAs enhanced the in vitro invasiveness of BHY cells. These results indicate that low-dose RAs enhances the in vitro invasiveness of oral SCC cells via an activation of proMMP2 and proMMP9 probably mediated by the induction of tPA. © 2001 Cancer Research Campaign http://www.bjcancer.com PMID:11437413

  18. Intake of high levels of vitamin A and polyunsaturated fatty acids during different developmental periods modifies the expression of morphogenesis genes in European sea bass (Dicentrarchus labrax).

    PubMed

    Villeneuve, Laure A N; Gisbert, Enric; Moriceau, Jacques; Cahu, Chantal L; Zambonino Infante, José L

    2006-04-01

    The effect of the feeding period on larval development was investigated in European sea bass larvae by considering the expression level of some genes involved in morphogenesis. Larvae were fed a control diet except during three different periods (period A: from 8 to 13 d post-hatching (dph); period B: from 13 to 18 dph; period C: from 18 to 23 dph) with two compound diets containing high levels of vitamin A or PUFA. European sea bass morphogenesis was affected by these two dietary nutrients during the early stages of development. The genes involved in morphogenesis could be modulated between 8 and 13 dph, and our results indicated that retinoids and fatty acids influenced two different molecular pathways that in turn implicated two different gene cascades, resulting in two different kinds of malformation. Hypervitaminosis A delayed development, reducing the number of vertebral segments and disturbing bone formation in the cephalic region. These malformations were correlated to an upregulation of retinoic acid receptor gamma, retinoid X receptor (RXR) alpha and bone morphogenetic protein (BMP)4. An excess of PUFA accelerated the osteoblast differentiation process through the upregulation of RXRalpha and BMP4, leading to a supernumerary vertebra. These results suggest that the composition of diets devoted to marine fish larvae has a particularly determining effect before 13 dph on the subsequent development of larvae and juvenile fish.

  19. Lycopene, Lutein and Zeaxanthin May Reduce Faecal Blood, Mucus and Pus but not Abdominal Pain in Individuals with Ulcerative Colitis.

    PubMed

    Głąbska, Dominika; Guzek, Dominika; Zakrzewska, Paulina; Włodarek, Dariusz; Lech, Gustaw

    2016-09-30

    The main symptom of ulcerative colitis is diarrhoea, which is often accompanied by painful tenesmus and faecal blood and mucus. It sometimes co-occurs with abdominal pain, fever, feeling of fatigue, loss of appetite and weight loss. Some dietary factors have been indicated as important in the treatment of ulcerative colitis. The aim of the study was to analyse the association between retinoid intake (total vitamin A, retinol, β-carotene, α-carotene, β-cryptoxanthin, lycopene, lutein and zeaxanthin) and ulcerative colitis symptoms (abdominal pain, faecal blood, faecal mucus, faecal pus) in individuals with ulcerative colitis in remission. Assessment of diet was based on self-reported data from each patient's dietary records taken over a period of three typical, random days (2 weekdays and 1 day of the weekend). A total of 56 individuals with ulcerative colitis in remission (19 males and 37 females) were recruited for the study. One in every four individuals with ulcerative colitis in remission was characterised as having inadequate vitamin A intake. Higher lycopene, lutein and zeaxanthin intakes in individuals with ulcerative colitis in remission were associated with lower faecal blood, mucus and pus but not with lower incidence of abdominal pain. Higher carotene intake in individuals with ulcerative colitis in remission may contribute to higher incidence of faecal mucus. Optimising intake of specific retinoids may enhance disease control in individuals with ulcerative colitis. Prospective studies, including patient reported and objective outcomes, are required to confirm this.

  20. Involvement of retinol dehydrogenase 10 in embryonic patterning and rescue of its loss of function by maternal retinaldehyde treatment

    PubMed Central

    Rhinn, Muriel; Schuhbaur, Brigitte; Niederreither, Karen; Dollé, Pascal

    2011-01-01

    Retinoic acid (RA), an active vitamin A metabolite, is a key signaling molecule in vertebrate embryos. Morphogenetic RA gradients are thought to be set up by tissue-specific actions of retinaldehyde dehydrogenases (RALDHs) and catabolizing enzymes. According to the species, two enzymatic pathways (β-carotene cleavage and retinol oxidation) generate retinaldehyde, the substrate of RALDHs. Placental species depend on maternal retinol transferred to the embryo. The retinol-to-retinaldehyde conversion was thought to be achieved by several redundant enzymes; however, a random mutagenesis screen identified retinol dehydrogenase 10 [Rdh10Trex allele; Sandell LL, et al. (2007) Genes Dev 21:1113–1124] as responsible for a homozygous lethal phenotype with features of RA deficiency. We report here the production and characterization of unique murine Rdh10 loss-of-function alleles generated by gene targeting. We show that although Rdh10−/− mutants die at an earlier stage than Rdh10Trex mutants, their molecular patterning defects do not reflect a complete state of RA deficiency. Furthermore, we were able to correct most developmental abnormalities by administering retinaldehyde to pregnant mothers, thereby obtaining viable Rdh10−/− mutants. This demonstrates the rescue of an embryonic lethal phenotype by simple maternal administration of the missing retinoid compound. These results underscore the importance of maternal retinoids in preventing congenital birth defects, and lead to a revised model of the importance of RDH10 and RALDHs in controlling embryonic RA distribution. PMID:21930923

  1. Genomic characterization and regulation of CYP3a13: role of xenobiotics and nuclear receptors.

    PubMed

    Anakk, Sayeepriyadarshini; Kalsotra, Auinash; Shen, Qi; Vu, Mary T; Staudinger, Jeffrey L; Davies, Peter J A; Strobel, Henry W

    2003-09-01

    We report that CYP3a13 gene, located on mouse chromosome 5, spans 27.5 Kb and contains 13 exons. The transcription start site is 35 bp upstream of the coding region and results in a 109 bp 5' untranslated region. CYP3a13 promoter shows putative binding sites for retinoid X receptor, pregnane X receptor, and estrogen receptor. CYP3a13 shows a broad tissue distribution with predominant expression in liver. Although CYP3a13 shares 92% nucleotide identity with the female-specific rat CYP3A9, its expression does not exhibit sexual dimorphism. Ligand activation of peroxisomal proliferator-activated receptor-gamma and retinoid X receptor inhibit expression of CYP3a13 at the transcription level in a tissue-specific manner. Another novel finding is hepatic induction of CYP3a13 by dexamethasone occurring only in pregnane X receptor null mice. We also report that pregnane X receptor is essential to maintain robust in vivo basal levels of CYP3a13 in contrast to CYP3a11. CYP3a13 protein expressed in vitro can metabolize clinically active drugs ethylmorphine and erythromycin, as well as benzphetamine. We conclude that CYP3a13 is regulated differentially by various nuclear receptors. In humans this may lead to altered drug metabolism, as many of the newly synthesized ligands/drugs targeted toward these nuclear receptors could influence CYP3A gene expression.

  2. Effective anti-PD-1 therapy in a SUFU-mutated patient with Gorlin-Goltz syndrome.

    PubMed

    Moreira, A; Kirchberger, M C; Toussaint, F; Erdmann, M; Schuler, G; Heinzerling, L

    2018-03-30

    We present a case of a 77-year-old male patient with more than 50 basal cell carcinomas on the head and upper trunk. The patient did not respond to several lines of treatment, including surgery, imiquimod, retinoids, itraconazole and therapy with the hedgehog inhibitor vismodegib. The patient responded well to an off-label therapy with the anti-PD-1 antibody pembrolizumab after 4 infusions. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  3. A review of tazarotene in the treatment of photodamaged skin

    PubMed Central

    Ogden, Stephanie; Samuel, Miny; Griffiths, Christopher EM

    2008-01-01

    Chronic sun exposure leads to photodamage, which is characterized clinically by fine and coarse wrinkles, dyspigmentation, telangiectasia, laxity, roughness and a sallow appearance. Many treatments claim to reduce the signs of photodamage, however evidence from randomized controlled trials (RCT) to support these claims is limited. The use of topical retinoids, particularly tretinoin, isotretinoin and tazarotene, has been shown to significantly reduce signs of photodamage both clinically and histologically. Over recent years a number of RCTs, have affirmed that topical tazarotene is an effective and safe treatment for photodamaged skin. PMID:18488880

  4. Toward a New Chemotherapy for Breast Cancer: Structural and Functional Mechanism of the Retinoid Receptors Addressed by a Novel Computer Approach

    DTIC Science & Technology

    1999-05-01

    substitution of the second leucine in an LxxLL core with isoleucine still permits a strong hydrophobic interaction with the liganded receptor (Table 2...through electrostatic interactions. Figure 10 illustrates that the two leucines and one isoleucine (green and cyan) of the LxxlL motif are predicted to be...RARox was carried out as described in Materials and methods. The side chains of the two leucines (green) and one isoleucine (cyan) of the LxxIL core fit

  5. The Tricky Tear Trough

    PubMed Central

    Belden, Sarah; Miller, Richard A.

    2015-01-01

    There is a growing demand for noninvasive anti-aging products for which the periorbital region serves as a critical aspect of facial rejuvenation. This article reviews a multitude of cosmeceutical ingredients that have good scientific data, specifically for the periorbital region. Topical treatment options have exponentially grown from extensively studied retinoids, to recently developed technology, such as growth factors and peptides. With a focus on the periorbital anatomy, the authors review the mechanisms of action of topical cosmeceutical ingredients, effectiveness of ingredient penetration through the stratum corneum, and validity of clinical trials. PMID:26430490

  6. Current treatments of acne: Medications, lights, lasers, and a novel 650-μs 1064-nm Nd: YAG laser.

    PubMed

    Gold, Michael H; Goldberg, David J; Nestor, Mark S

    2017-09-01

    The treatment of acne, especially severe acne, remains a challenge to dermatologists. Therapies include retinoids, antibiotics, hormones, lights, lasers, and various combinations of these modalities. Acne is currently considered a chronic rather than an adolescent condition. The appropriate treatment depends on the patient and the severity of disease. The purpose of this study was to review current therapies for acne of all severities and to introduce the 650-μs 1064-nm laser for the treatment of acne. © 2017 Wiley Periodicals, Inc.

  7. Toward a New Chemotherapy for Breast Cancer: Structural and Functional Mechanism of the Retinoid Receptors Addressed by a Novel Computer Approach

    DTIC Science & Technology

    2002-01-01

    the surface of the receptor. This pocket is the target for several known and unknown coactivator proteins, which bind the LBD through a conserved LxxLL...was and to Not se FLKAILN) and the LBDs of several receptors (TRo was used as an example in prisingly, the LBD of TR13 was also found to interact with...receptors. 541 ATTCCTTAAAGCCATTTTAAACTGAGGCATTAAGAAGAAATGCACTCACCATGAGCACCA The LBDs of several nuclear receptors were examined for FL. K. A • 1,...N

  8. Successful treatment of recalcitrant folliculitis barbae and pseudofolliculitis barbae with photodynamic therapy.

    PubMed

    Diernaes, Jon Erik Fraes; Bygum, Anette

    2013-12-01

    Folliculitis and pseudofolliculitis barbae typically affects men with curly hair who shave too close. Treatment modalities vary in effectiveness and include improved hair removal methods, topical corticosteroids, topical and oral antibiotics, and retinoids as well as laser surgery. We report a novel treatment of recalcitrant pseudofolliculitis barbae and confirm effectiveness in recalcitrant folliculitis in a 58-year old man who responded completely following photodynamic therapy with methyl aminolevulinate. Photodynamic therapy should be considered in recalcitrant folliculitis and pseudofolliculitis barbae. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Studies on the apoptotic activity of natural and synthetic retinoids: discovery of a new class of synthetic terphenyls that potently support cell growth and inhibit apoptosis in neuronal and HL-60 cells.

    PubMed

    Simoni, Daniele; Giannini, Giuseppe; Roberti, Marinella; Rondanin, Riccardo; Baruchello, Riccardo; Rossi, Marcello; Grisolia, Giuseppina; Invidiata, Francesco Paolo; Aiello, Stefania; Marino, Silvia; Cavallini, Sabrina; Siniscalchi, Anna; Gebbia, Nicola; Crosta, Lucia; Grimaudo, Stefania; Abbadessa, Vincenzo; Di Cristina, Antonietta; Tolomeo, Manlio

    2005-06-30

    New terphenyl derivatives have been synthesized and tested for their effect on cell survival in serum-free cultures. These compounds protected HL60 cells from death and supported their growth with an activity higher than that of the natural 14-hydroxy-retro-retinol. Terphenyls 26 and 28 also possess antiapoptotic activity on neuronal cells, proving them as possible candidates for the treatment of neurodegenerative and ischemic diseases.

  10. Interphotoreceptor matrix components in retinal cell transplants.

    PubMed

    Juliusson, B; Mieziewska, K; Bergström, A; Wilke, K; Van Veen, T; Ehinger, B

    1994-05-01

    To further investigate the functional potential of retinal transplants we have used immunocytochemistry to study the distribution of four different interphotoreceptor matrix (IPM)-specific components in rabbit retinal transplants. The different components were: interphotoreceptor retinoid-binding protein (IRBP), chondroitin-6-sulfate, F22 antigen and peanut agglutinin (PNA) binding structures. IRBP acts as a retinoid-transport protein between the neural retina and the retinal pigment epithelium. Chondroitin-6-sulfate is a glycosaminoglycan and a part of the insoluble IPM skeleton. The identity and role of the F22 antigen is not known. However, it is a 250 kDa protein localized to specific extracellular compartments such as teh IPM. PNA is a lectin with a high binding affinity for D-galactose-beta (1-3) N-acetyl-D-galactosamine disaccharide linkages and binds to IPM domains surrounding cones, but not rods. The transplants (15-day-old embryonic rabbit retina) were placed between the neural retina and retinal pigment epithelium in adult hosts. The transplants developed the typical rosette formations with photoreceptors toward the center. IRBP labeling was distinct in the IPM in the host retina. However, no IRBP labeling could be detected in the transplants. The chondroitin-6-sulfate and F22 antibodies strongly labeled the IPM in the host retina and corresponding structures in the center of rosettes. A cone-specific labeling with PNA could be seen in the host retina. In the transplants, however, PNA labeling appeared in association with many more photoreceptors than in the host retina. There is no previous study available on the IPM in retinal cell transplants.(ABSTRACT TRUNCATED AT 250 WORDS)

  11. Fundus autofluorescence and the bisretinoids of retina.

    PubMed

    Sparrow, Janet R; Wu, Yalin; Nagasaki, Takayuki; Yoon, Kee Dong; Yamamoto, Kazunori; Zhou, Jilin

    2010-11-01

    Imaging of the human fundus of the eye with excitation wavelengths in the visible spectrum reveals a natural autofluorescence, that in a healthy retina originates primarily from the bisretinoids that constitute the lipofuscin of retinal pigment epithelial (RPE) cells. Since the intensity and distribution of fundus autofluorescence is altered in the presence of retinal disease, we have examined the fluorescence properties of the retinal bisretinoids with a view to aiding clinical interpretations. As is also observed for fundus autofluorescence, fluorescence emission from RPE lipofuscin was generated with a wide range of exciting wavelengths; with increasing excitation wavelength, the emission maximum shifted towards longer wavelengths and spectral width was decreased. These features are consistent with fluorescence generation from a mixture of compounds. While the bisretinoids that constitute RPE lipofuscin all fluoresced with maxima that were centered around 600 nm, fluorescence intensities varied when excited at 488 nm, the excitation wavelength utilized for fundus autofuorescence imaging. For instance the fluorescence efficiency of the bisretinoid A2-dihydropyridine-phosphatidylethanolamine (A2-DHP-PE) was greater than A2E and relative to both of the latter, all-trans-retinal dimer-phosphatidylethanolamine was weakly fluorescent. On the other hand, certain photooxidized forms of the bisretinoids present in both RPE and photoreceptor cells were more strongly fluorescent than the parent compound. We also sought to evaluate whether diffuse puncta of autofluorescence observed in some retinal disorders of monogenic origin are attributable to retinoid accumulation. However, two retinoids of the visual cycle, all-trans-retinyl ester and all-trans-retinal, did not exhibit fluorescence at 488 nm excitation.

  12. [Psoriasis: the clinical use of "minute therapy" with Cignolin].

    PubMed

    Runne, U; Kunze, J

    1983-02-15

    The so called "minutes" therapy is a fundamental new method of psoriasis treatment with dithranol (anthralin). Dithranol is applied to the lesions for only 10 to 20 minutes and thereafter washed off thoroughly under a shower. We use an ointment of 0.5 to 3% dithranol with 2% salicylic acid in yellow soft paraffin which is applied with a plastic glove to the lesions. This regimen makes it now possible to offer dithranol routinely for home treatment. The patient should be well informed and must consult the dermatologist weekly. The course of treatment usually starts with 1% dithranol for 10 minutes. Depending on the healing effect and the degree of irritation, the concentration and the contact time is increased step by step. Up to now, 200 patients have been treated, 64 of them as in-patients and 136 carrying out the treatment at home. The clearance rate was 77.5% (84% for the in-patients and 74% for the outpatients). The average clearing time for out-patients was 5.5 days longer than for in-patients (31.5 to 26 days). The rate of non-responders in both groups was 10%. The application of corticosteroids or oral retinoids in addition to the "minutes" therapy showed no better therapeutic results. The "minutes" therapy has medical, social and financial advantages. Dithranol is very effective and has no permanent side-effects. Therefore, corticosteroids, retinoids and PUVA can be restricted. Treatment at home enables the patients to enjoy normal family and professional life. Finally, the "minutes" therapy saves large amounts of money in comparison to a hospital stay for several weeks.

  13. Isotretinoin: the ups are just as troubling as the downs.

    PubMed

    Truitt, Jay M; Reichenberg, Jason S; Sharghi, Kevin G; Sampson, Shirlene M; Roenigk, Randall K; Magid, Michelle

    2018-08-01

    Isotretinoin, previously marketed as Accutane®, is an oral retinoid medication that is used to treat acne and other cutaneous disorders. Although the data is conflicting, previous reports suggest a causal relationship between isotretinoin and depression. When reviewing these previous reports, many patients who were diagnosed as "depressed" did not undergo a thorough psychiatric evaluation and/or were not diagnosed according to the criteria of the Diagnostic and Statistical Manual of Mental Disorders (DSM). These patients reported agitation, irritability, sleep disturbances, and aggression. We hypothesize that some patients previously reported as "depressed" may have been "misdiagnosed" and were actually experiencing symptoms of mania, mixed mood (depression and mania at the same time), or psychosis. An Ovid Medline and PubMed literature search of English language articles was performed using the keywords "isotretinoin", "retinoids", "mood", "psychiatric", "depression", "elevation", "bipolar", and "psychosis". Eleven case reports, three case series, three retrospective chart reviews, five drug registries, and two prospective studies were reviewed. We found that many of the patients labeled as "depressed", had signs of activation, agitation, elevated mood, and psychosis. We believe that many of these patients were most likely having manic or mixed mood episodes. These symptoms appeared to be more prevalent in patients with a personal or family history of mental illness. Isotretinoin may cause mood instability in both directions - depression and mania - especially in a predisposed population. With this in mind, we urge clinicians prescribing isotretinoin to focus on all psychiatric symptoms (not just depression) including mania, mixed mood, and psychosis, paying particular attention to individuals who have a personal or family history of psychiatric disease.

  14. Loss of function of the retinoid-related nuclear receptor (RORB) gene and epilepsy

    PubMed Central

    Rudolf, Gabrielle; Lesca, Gaetan; Mehrjouy, Mana M; Labalme, Audrey; Salmi, Manal; Bache, Iben; Bruneau, Nadine; Pendziwiat, Manuela; Fluss, Joel; de Bellescize, Julitta; Scholly, Julia; Møller, Rikke S; Craiu, Dana; Tommerup, Niels; Valenti-Hirsch, Maria Paola; Schluth-Bolard, Caroline; Sloan-Béna, Frédérique; Helbig, Katherine L; Weckhuysen, Sarah; Edery, Patrick; Coulbaut, Safia; Abbas, Mohamed; Scheffer, Ingrid E; Tang, Sha; Myers, Candace T; Stamberger, Hannah; Carvill, Gemma L; Shinde, Deepali N; Mefford, Heather C; Neagu, Elena; Huether, Robert; Lu, Hsiao-Mei; Dica, Alice; Cohen, Julie S; Iliescu, Catrinel; Pomeran, Cristina; Rubenstein, James; Helbig, Ingo; Sanlaville, Damien; Hirsch, Edouard; Szepetowski, Pierre

    2016-01-01

    Genetic generalized epilepsy (GGE), formerly known as idiopathic generalized epilepsy, is the most common form of epilepsy and is thought to have predominant genetic etiology. GGE are clinically characterized by absence, myoclonic, or generalized tonic-clonic seizures with electroencephalographic pattern of bilateral, synchronous, and symmetrical spike-and-wave discharges. Despite their strong heritability, the genetic basis of generalized epilepsies remains largely elusive. Nevertheless, recent advances in genetic technology have led to the identification of numerous genes and genomic defects in various types of epilepsies in the past few years. In the present study, we performed whole-exome sequencing in a family with GGE consistent with the diagnosis of eyelid myoclonia with absences. We found a nonsense variant (c.196C>T/p.(Arg66*)) in RORB, which encodes the beta retinoid-related orphan nuclear receptor (RORβ), in four affected family members. In addition, two de novo variants (c.218T>C/p.(Leu73Pro); c.1249_1251delACG/p.(Thr417del)) were identified in sporadic patients by trio-based exome sequencing. We also found two de novo deletions in patients with behavioral and cognitive impairment and epilepsy: a 52-kb microdeletion involving exons 5–10 of RORB and a larger 9q21-microdeletion. Furthermore, we identified a patient with intellectual disability and a balanced translocation where one breakpoint truncates RORB and refined the phenotype of a recently reported patient with RORB deletion. Our data support the role of RORB gene variants/CNVs in neurodevelopmental disorders including epilepsy, and especially in generalized epilepsies with predominant absence seizures. PMID:27352968

  15. Carotenoids: biochemistry, pharmacology and treatment.

    PubMed

    Milani, Alireza; Basirnejad, Marzieh; Shahbazi, Sepideh; Bolhassani, Azam

    2017-06-01

    Carotenoids and retinoids have several similar biological activities such as antioxidant properties, the inhibition of malignant tumour growth and the induction of apoptosis. Supplementation with carotenoids can affect cell growth and modulate gene expression and immune responses. Epidemiological studies have shown a correlation between a high carotenoid intake in the diet with a reduced risk of breast, cervical, ovarian, colorectal cancers, and cardiovascular and eye diseases. Cancer chemoprevention by dietary carotenoids involves several mechanisms, including effects on gap junctional intercellular communication, growth factor signalling, cell cycle progression, differentiation-related proteins, retinoid-like receptors, antioxidant response element, nuclear receptors, AP-1 transcriptional complex, the Wnt/β-catenin pathway and inflammatory cytokines. Moreover, carotenoids can stimulate the proliferation of B- and T-lymphocytes, the activity of macrophages and cytotoxic T-cells, effector T-cell function and the production of cytokines. Recently, the beneficial effects of carotenoid-rich vegetables and fruits in health and in decreasing the risk of certain diseases has been attributed to the major carotenoids, β-carotene, lycopene, lutein, zeaxanthin, crocin (/crocetin) and curcumin, due to their antioxidant effects. It is thought that carotenoids act in a time- and dose-dependent manner. In this review, we briefly describe the biological and immunological activities of the main carotenoids used for the treatment of various diseases and their possible mechanisms of action. This article is part of a themed section on Principles of Pharmacological Research of Nutraceuticals. To view the other articles in this section visit http://onlinelibrary.wiley.com/doi/10.1111/bph.v174.11/issuetoc. © 2016 The British Pharmacological Society.

  16. Natural and synthetic retinoids afford therapeutic effects on intracerebral hemorrhage in mice.

    PubMed

    Matsushita, Hideaki; Hijioka, Masanori; Hisatsune, Akinori; Isohama, Yoichiro; Shudo, Koichi; Katsuki, Hiroshi

    2012-05-15

    We have recently proposed that retinoic acid receptor (NR1B) is a promising target of neuroprotective therapy for intracerebral hemorrhage, since pretreatment of mice with an NR1B1/NR1B2 agonist Am80 attenuated various pathological and neurological abnormalities associated with the disease. In the present study we further addressed the effects of retinoids as potential therapeutic drugs, using a collagenase-induced model of intracerebral hemorrhage. Daily oral administration of all-trans retinoic acid (ATRA; 5 and 15 mg/kg), a naturally occurring NR1B agonist, from 1 day before collagenase injection significantly inhibited loss of neurons within the hematoma. ATRA in the same treatment regimen also decreased the number of activated microglia/macrophages around the hematoma but did not affect the hematoma volume. ATRA (15 mg/kg) as well as Am80 (5mg/kg) rescued neurons in the central region of hematoma, even when drug administration was started from 6h after induction of intracerebral hemorrhage. However, in this post-treatment regimen, only Am80 significantly decreased the number of activated microglia/macrophages. With regard to neurological deficits, both ATRA (15 mg/kg) and Am80 (5mg/kg) given in the post-treatment regimen improved performance of mice in the beam-walking test and the modified limb-placing test. ATRA and Am80 also significantly attenuated damage of axon tracts as revealed by amyloid precursor protein immunohistochemistry. These results underscore potential therapeutic values of NR1B agonists for intracerebral hemorrhage. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Signaling cross-talk between peroxisome proliferator-activated receptor/retinoid X receptor and estrogen receptor through estrogen response elements.

    PubMed

    Keller, H; Givel, F; Perroud, M; Wahli, W

    1995-07-01

    Peroxisome proliferator-activated receptors (PPARs) and retinoid X receptors (RXRs) are nuclear hormone receptors that are activated by fatty acids and 9-cis-retinoic acid, respectively. PPARs and RXRs form heterodimers that activate transcription by binding to PPAR response elements (PPREs) in the promoter of target genes. The PPREs described thus far consist of a direct tandem repeat of the AGGTCA core element with one intervening nucleotide. We show here that the vitellogenin A2 estrogen response element (ERE) can also function as a PPRE and is bound by a PPAR/RXR heterodimer. Although this heterodimer can bind to several other ERE-related palindromic response elements containing AGGTCA half-sites, only the ERE is able to confer transactivation of test reporter plasmids, when the ERE is placed either close to or at a distance from the transcription initiation site. Examination of natural ERE-containing promoters, including the pS2, very-low-density apolipoprotein II and vitellogenin A2 genes, revealed considerable differences in the binding of PPAR/RXR heterodimers to these EREs. In their natural promoter context, these EREs did not allow transcriptional activation by PPARs/RXRs. Analysis of this lack of stimulation of the vitellogenin A2 promoter demonstrated that PPARs/RXRs bind to the ERE but cannot transactivate due to a nonpermissive promoter structure. As a consequence, PPARs/RXRs inhibit transactivation by the estrogen receptor through competition for ERE binding. This is the first example of signaling cross-talk between PPAR/RXR and estrogen receptor.

  18. Radiolabeling and initial biological evaluation of [18F]KBM-1 for imaging RAR-α receptors in neuroblastoma.

    PubMed

    Solingapuram Sai, Kiran Kumar; Das, Bhaskar C; Sattiraju, Anirudh; Almaguel, Frankis G; Craft, Suzanne; Mintz, Akiva

    2017-03-15

    Retinoic acid receptor alpha (RAR-α) plays a significant role in a number of diseases, including neuroblastoma. Children diagnosed with high-risk neuroblastoma are treated13-cis-retinoic acid, which reduces risk of cancer recurrence. Neuroblastoma cell death is mediated via RAR-α, and expression of RAR-α is upregulated after treatment. A molecular imaging probe that binds RAR-α will help clinicians to diagnose and stratify risk for patients with neuroblastoma, who could benefit from retinoid-based therapy. In this study, we report the radiolabeling, and initial in vivo evaluation of [ 18 F]KBM-1, a novel RAR-α agonist. The radiochemical synthesis of [ 18 F]KBM-1 was carried out through KHF 2 assisted substitution of [ 18 F] - from aryl-substituted pinacolatoesters-based retinoid precursor. In vitro cell uptake assay in human neuroblastoma cell line showed that the uptake of [ 18 F]KBM-1 was significantly inhibited by all three blocking agents (KBM-1, ATRA, BD4) at all the selected incubation times. Standard biodistribution in mice bearing neuroblastoma tumors demonstrated increased tumor uptake from 5min to 60min post radiotracer injection and the uptake ratios for target to non-target (tumor: muscle) increased 2.2-fold to 3.7-fold from 30min to 60min post injection. Tumor uptake in subset of 30min blocking group was 1.7-fold lower than unblocked. These results demonstrate the potential utility of [ 18 F]KBM-1 as a RAR-α imaging agent. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Enhanced Lithium-Induced Brain Recovery Following Cranial Irradiation Is Not Impeded by Inflammation

    PubMed Central

    Malaterre, Jordane; McPherson, Cameron S.; Denoyer, Delphine; Lai, Emily; Hagekyriakou, Jim; Lightowler, Sally; Shudo, Koishi; Ernst, Matthias; Ashley, David M.; Short, Jennifer L.; Wheeler, Greg

    2012-01-01

    Radiation-induced brain injury occurs in many patients receiving cranial radiation therapy, and these deleterious effects are most profound in younger patients. Impaired neurocognitive functions in both humans and rodents are associated with inflammation, demyelination, and neural stem cell dysfunction. Here we evaluated the utility of lithium and a synthetic retinoid receptor agonist in reducing damage in a model of brain-focused irradiation in juvenile mice. We found that lithium stimulated brain progenitor cell proliferation and differentiation following cranial irradiation while also preventing oligodendrocyte loss in the dentate gyrus of juvenile mice. In response to inflammation induced by radiation, which may have encumbered the optimal reparative action of lithium, we used the anti-inflammatory synthetic retinoid Am80 that is in clinical use in the treatment of acute promyelocytic leukemia. Although Am80 reduced the number of cyclooxygenase-2-positive microglial cells following radiation treatment, it did not enhance lithium-induced neurogenesis recovery, and this alone was not significantly different from the effect of lithium on this proinflammatory response. Similarly, lithium was superior to Am80 in supporting the restoration of new doublecortin-positive neurons following irradiation. These data suggest that lithium is superior in its restorative effects to blocking inflammation alone, at least in the case of Am80. Because lithium has been in routine clinical practice for 60 years, these preclinical studies indicate that this drug might be beneficial in reducing post-therapy late effects in patients receiving cranial radiotherapy and that blocking inflammation in this context may not be as advantageous as previously suggested. PMID:23197851

  20. 13-cis Retinoic Acid Inhibits Development and Progression of Chronic Allograft Nephropathy

    PubMed Central

    Adams, Judith; Kiss, Eva; Arroyo, Ana B.V.; Bonrouhi, Mahnaz; Sun, Qiang; Li, Zhen; Gretz, Norbert; Schnitger, Anna; Zouboulis, Christos C.; Wiesel, Manfred; Wagner, Jürgen; Nelson, Peter J.; Gröne, Hermann-Josef

    2005-01-01

    Chronic allograft nephropathy is characterized by chronic inflammation and fibrosis. Because retinoids exhibit anti-proliferative, anti-inflammatory, and anti-fibrotic functions, the effects of low and high doses of 13-cis-retinoic acid (13cRA) were studied in a chronic Fisher344→Lewis transplantation model. In 13cRA animals, independent of dose (2 or 20 mg/kg body weight/day) and start (0 or 14 days after transplantation) of 13cRA administration, serum creatinine was significantly lower and chronic rejection damage was dramatically reduced, including subendothelial fibrosis of preglomerular vessels and chronic tubulointerstitial damage. The number of infiltrating mononuclear cells and their proliferative activity were significantly diminished. The mRNA expression of chemokines (MCP-1/CCL2, MIP-1α/CCL3, IP-10/CXCL10, RANTES/CCL5) and proteins associated with fibrosis (plasminogen activator inhibitor-1, transforming growth factor-β1, and collagens I and III) were strikingly lower in treated allografts. In vitro, activated peritoneal macrophages of 13cRA-treated rats showed a pronounced decrease in protein secretion of inflammatory cytokines (eg, tumor necrosis factor-α, interleukin-6). The suppression of the proinflammatory chemokine RANTES/CCL5 × 13cRA in fibroblasts could be mapped to a promoter module comprising IRF-1 and nuclear factor-κB binding elements, but direct binding of retinoid receptors to promoter elements could be excluded. In summary, 13cRA acted as a potent immunosuppressive and anti-fibrotic agent able to prevent and inhibit progression of chronic allograft nephropathy. PMID:15972972

  1. Lycopene, Lutein and Zeaxanthin May Reduce Faecal Blood, Mucus and Pus but not Abdominal Pain in Individuals with Ulcerative Colitis

    PubMed Central

    Głąbska, Dominika; Guzek, Dominika; Zakrzewska, Paulina; Włodarek, Dariusz; Lech, Gustaw

    2016-01-01

    Background: The main symptom of ulcerative colitis is diarrhoea, which is often accompanied by painful tenesmus and faecal blood and mucus. It sometimes co-occurs with abdominal pain, fever, feeling of fatigue, loss of appetite and weight loss. Some dietary factors have been indicated as important in the treatment of ulcerative colitis. The aim of the study was to analyse the association between retinoid intake (total vitamin A, retinol, β-carotene, α-carotene, β-cryptoxanthin, lycopene, lutein and zeaxanthin) and ulcerative colitis symptoms (abdominal pain, faecal blood, faecal mucus, faecal pus) in individuals with ulcerative colitis in remission. Methods: Assessment of diet was based on self-reported data from each patient’s dietary records taken over a period of three typical, random days (2 weekdays and 1 day of the weekend). Results: A total of 56 individuals with ulcerative colitis in remission (19 males and 37 females) were recruited for the study. One in every four individuals with ulcerative colitis in remission was characterised as having inadequate vitamin A intake. Higher lycopene, lutein and zeaxanthin intakes in individuals with ulcerative colitis in remission were associated with lower faecal blood, mucus and pus but not with lower incidence of abdominal pain. Higher carotene intake in individuals with ulcerative colitis in remission may contribute to higher incidence of faecal mucus. Conclusions: Optimising intake of specific retinoids may enhance disease control in individuals with ulcerative colitis. Prospective studies, including patient reported and objective outcomes, are required to confirm this. PMID:27706028

  2. Nuclear hormone retinoid X receptor (RXR) negatively regulates the glucose-stimulated insulin secretion of pancreatic ß-cells.

    PubMed

    Miyazaki, Satsuki; Taniguchi, Hidenori; Moritoh, Yusuke; Tashiro, Fumi; Yamamoto, Tsunehiko; Yamato, Eiji; Ikegami, Hiroshi; Ozato, Keiko; Miyazaki, Jun-ichi

    2010-11-01

    Retinoid X receptors (RXRs) are members of the nuclear hormone receptor superfamily and are thought to be key regulators in differentiation, cellular growth, and gene expression. Although several experiments using pancreatic β-cell lines have shown that the ligands of nuclear hormone receptors modulate insulin secretion, it is not clear whether RXRs have any role in insulin secretion. To elucidate the function of RXRs in pancreatic β-cells, we generated a double-transgenic mouse in which a dominant-negative form of RXRβ was inducibly expressed in pancreatic β-cells using the Tet-On system. We also established a pancreatic β-cell line from an insulinoma caused by the β-cell-specific expression of simian virus 40 T antigen in the above transgenic mouse. In the transgenic mouse, expression of the dominant-negative RXR enhanced the insulin secretion with high glucose stimulation. In the pancreatic β-cell line, the suppression of RXRs also enhanced glucose-stimulated insulin secretion at a high glucose concentration, while 9-cis-retinoic acid, an RXR agonist, repressed it. High-density oligonucleotide microarray analysis showed that expression of the dominant-negative RXR affected the expression levels of a number of genes, some of which have been implicated in the function and/or differentiation of β-cells. These results suggest that endogenous RXR negatively regulates the glucose-stimulated insulin secretion. Given these findings, we propose that the modulation of endogenous RXR in β-cells may be a new therapeutic approach for improving impaired insulin secretion in type 2 diabetes.

  3. DAILY PATTERNS OF CLOCK AND COGNITION-RELATED FACTORS ARE MODIFIED IN THE HIPPOCAMPUS OF VITAMIN A-DEFICIENT RATS

    PubMed Central

    Golini, Rebeca S.; Delgado, Silvia M.; Navigatore Fonzo, Lorena S.; Ponce, Ivana T.; Lacoste, María G.; Anzulovich, Ana C.

    2012-01-01

    The circadian expression of clock and clock-controlled cognition-related genes in the hippocampus would be essential to achieve an optimal daily cognitive performance. There is some evidence that retinoid nuclear receptors (RARs and RXRs) can regulate circadian gene expression in different tissues. In this study, Holtzman male rats from control and vitamin A-deficient groups were sacrificed throughout a 24-h period and hippocampus samples were isolated every 4 or 5 h. RARα and RXRβ expression level was quantified and daily expression patterns of clock BMAL1, PER1, RORα and REVERB genes, RORα and REVERB proteins, as well as temporal expression of cognition-related RC3 and BDNF genes were determined in the hippocampus of the two groups of rats. Our results show significant daily variations of BMAL1, PER1, RORα and REVERB genes, RORα and REVERB proteins and, consequently, daily oscillating expression of RC3 and BDNF genes in the rat hippocampus. Vitamin A deficiency reduced RXRβ mRNA level as well as the amplitude of PER1, REVERB gene and REVERB protein rhythms, and phase-shifted the daily peaks of BMAL1 and RORα mRNA, RORα protein and RC3 and BDNF mRNA levels. Thus, nutritional factors, such as vitamin A and its derivatives the retinoids, might modulate daily patterns of BDNF and RC3 expression in the hippocampus and they could be essential to maintain an optimal daily performance at molecular level in this learning-and-memory-related brain area. PMID:22434687

  4. Retinoid X receptor activation during adipogenesis of female mesenchymal stem cells programs a dysfunctional adipocyte.

    PubMed

    Shoucri, Bassem M; Hung, Victor T; Chamorro-García, Raquel; Shioda, Toshi; Blumberg, Bruce

    2018-05-31

    Early life exposure to endocrine disrupting chemicals (EDCs) is an emerging risk factor for the development of obesity and diabetes later in life. We previously showed that prenatal exposure to the EDC tributyltin (TBT) results in increased adiposity in the offspring. These effects linger into adulthood and are propagated through successive generations. TBT activates two nuclear receptors, the peroxisome proliferator-activated receptor γ (PPARγ) and its heterodimeric partner retinoid X receptor (RXR), that promote adipogenesis in vivo and in vitro. We recently employed a mesenchymal stem cell (MSC) model to show that TBT promotes adipose lineage commitment by activating RXR, not PPARγ. This led us to consider the functional consequences of PPARγ versus RXR activation in developing adipocytes. We used a transcriptomal approach to characterize genome-wide differences in MSCs differentiated with the PPARγ agonist rosiglitazone (ROSI) or TBT. Pathway analysis suggested functional deficits in TBT-treated cells. We then compared adipocytes differentiated with ROSI, TBT, or a pure RXR agonist IRX4204 (4204). Our data show that RXR activators ('rexinoids', 4204 and TBT) attenuate glucose uptake, blunt expression of the anti-diabetic hormone adiponectin, and fail to down-regulate pro-inflammatory and pro-fibrotic transcripts as does ROSI. Finally, 4204 and TBT treatment results in an inability to induce markers of adipocyte browning, in part due to sustained interferon signaling. Taken together, these data implicate rexinoids in the development of dysfunctional white adipose tissue that could potentially exacerbate obesity and/or diabetes risk in vivo. These data warrant further screening and characterization of EDCs that activate RXR.

  5. Dark adaptation and the retinoid cycle of vision.

    PubMed

    Lamb, T D; Pugh, E N

    2004-05-01

    Following exposure of our eye to very intense illumination, we experience a greatly elevated visual threshold, that takes tens of minutes to return completely to normal. The slowness of this phenomenon of "dark adaptation" has been studied for many decades, yet is still not fully understood. Here we review the biochemical and physical processes involved in eliminating the products of light absorption from the photoreceptor outer segment, in recycling the released retinoid to its original isomeric form as 11-cis retinal, and in regenerating the visual pigment rhodopsin. Then we analyse the time-course of three aspects of human dark adaptation: the recovery of psychophysical threshold, the recovery of rod photoreceptor circulating current, and the regeneration of rhodopsin. We begin with normal human subjects, and then analyse the recovery in several retinal disorders, including Oguchi disease, vitamin A deficiency, fundus albipunctatus, Bothnia dystrophy and Stargardt disease. We review a large body of evidence showing that the time-course of human dark adaptation and pigment regeneration is determined by the local concentration of 11-cis retinal, and that after a large bleach the recovery is limited by the rate at which 11-cis retinal is delivered to opsin in the bleached rod outer segments. We present a mathematical model that successfully describes a wide range of results in human and other mammals. The theoretical analysis provides a simple means of estimating the relative concentration of free 11-cis retinal in the retina/RPE, in disorders exhibiting slowed dark adaptation, from analysis of psychophysical measurements of threshold recovery or from analysis of pigment regeneration kinetics.

  6. Clindamycin phosphate-tretinoin combination gel revisited: status report on a specific formulation used for acne treatment.

    PubMed

    Del Rosso, James Q

    2017-03-01

    Topical agents, including retinoids and antibiotics, are commonly used to treat acne vulgaris (AV) and remain as components of acne treatment guidelines. Approved topical combination formulations offer the advantages of established efficacy, decreased frequency of application, and improved convenience for patients. This article discusses both clindamycin phosphate (CP) and tretinoin (Tret) as components of a topical aqueous-based combination gel that has been shown to be effective, safe, and well tolerated for treatment of facial AV. Clinically relevant considerations with use of this treatment are also discussed, including therapeutic advantages and potential limitations.

  7. Perforating collagenosis.

    PubMed

    Yancovitz, Molly; Johnson, Hillary; Wang, Nadia; Pomeranz, Miriam K

    2008-10-15

    A 55-year-old man presented with a three-week history of pruritic, erythematous papules with hyperkeratotic dells on the dorsum of the left hand, which was preceded by swelling, redness and itching. Histopathologic examination showed an acanthotic epidermis with a central invagination filled with a plug composed of parakeratotic debris, collagen, and inflammatory cells. These findings are consistent with acquired reactive perforating collagenosis, which is most frequently reported in patients with pruritus and underlying diabetes mellitus or chronic renal insufficiency. Topical and oral retinoids and topical and intralesional glucocorticoids have been reported to be effective in some patients in case series.

  8. Molecular Mechanism by Which Retinoids Prevent Breast Cancer Development

    DTIC Science & Technology

    2007-06-01

    10.11 AFFX-r2-Ec- bioB -M_at E. coli /GEN= bioB /DB_XREF=gb:J04423.1 /NOTE=SIF corresponding to nucleotides 2393-2682 of gb:J04423.1 /DEF=E.coli...7,8-diamino-pelargonic acid (bioA), biotin synthetase ( bioB ), 7-keto-8-amino-pelargonic acid synthetase (bioF), bioC protein, and dethiobiot 9.76...9.42 AFFX- BioB - M_at E. coli /GEN= bioB /DB_XREF=gb:J04423.1 /NOTE=SIF corresponding to nucleotides 2482-2739 of gb:J04423.1 /DEF=E.coli 7,8

  9. [Epidermic chalone receptors in psoriasis treated with retinoid:Ro 10-9359].

    PubMed

    Vignale, R A; Lasalvia, E; Espasandín, J; Borras, A

    1983-01-01

    The epidermic chalone receptor of skin with lesion and without lesion are studied on 20 patients with active psoriasis. The testlest were performed before and two month after oral treatment with RO 10-9359. Roche. The results show significant variation with an increased a the number of receptors after treatment. As these receptors are in the cell membrane, the authors consider that RO 10-9359 action in on the membrane and its surrounding, making in possible to the epithelial cell to begin its autoregulation, autocontrol and differentiation when the specific activity of the chalones become normal.

  10. Topical therapies for the treatment of plaque psoriasis: systematic review and network meta-analyses.

    PubMed

    Samarasekera, E J; Sawyer, L; Wonderling, D; Tucker, R; Smith, C H

    2013-05-01

    The majority of people with psoriasis have localized disease, where topical therapy forms the cornerstone of treatment. We set out to summarize evidence on the relative efficacy, safety and tolerability of different topical treatments used in plaque psoriasis. We undertook a systematic review and meta-analyses of randomized trial data of U.K.-licensed topical therapies. The primary outcome was clear or nearly clear status stratified for (i) trunk and limbs; and (ii) scalp. Network meta-analyses allowed ranking of treatment efficacy. In total, 48 studies were available for trunk and limb psoriasis, and 17 for scalp psoriasis (22,028 patients in total); the majority included people with at least moderate severity psoriasis. Strategies containing potent corticosteroids (alone or in combination with a vitamin D analogue) or very potent corticosteroids dominated the treatment hierarchy at both sites (trunk and limbs, scalp); coal tar and retinoids were no better than placebo. No significant differences in achievement of clear or nearly clear status were observed between twice- and once-daily application of the same intervention or between any of the following: combined vitamin D analogue and potent corticosteroid (applied separately or in a single product), very potent corticosteroids, or potent corticosteroids (applied twice daily). Investigator and patient assessment of response differed significantly for some interventions (response rates to very potent corticosteroids: 78% and 39%, respectively). No significant differences were noted for tolerability or steroid atrophy, but data were limited. In conclusion, corticosteroids are highly effective in psoriasis when used continuously for up to 8 weeks and intermittently for up to 52 weeks. Coal tar and retinoids are of limited benefit. There is a lack of long-term efficacy and safety data available on topical interventions used for psoriasis. © 2013 The Authors BJD © 2013 British Association of Dermatologists.

  11. Retinoic Acid Isomers Facilitate Apolipoprotein E Production and Lipidation in Astrocytes through the Retinoid X Receptor/Retinoic Acid Receptor Pathway*

    PubMed Central

    Zhao, Jing; Fu, Yuan; Liu, Chia-Chen; Shinohara, Mitsuru; Nielsen, Henrietta M.; Dong, Qiang; Kanekiyo, Takahisa; Bu, Guojun

    2014-01-01

    Apolipoprotein E (apoE) is the major cholesterol transport protein in the brain. Among the three human APOE alleles (APOE2, APOE3, and APOE4), APOE4 is the strongest genetic risk factor for late-onset Alzheimer disease (AD). The accumulation of amyloid-β (Aβ) is a central event in AD pathogenesis. Increasing evidence demonstrates that apoE isoforms differentially regulate AD-related pathways through both Aβ-dependent and -independent mechanisms; therefore, modulating apoE secretion, lipidation, and function might be an attractive approach for AD therapy. We performed a drug screen for compounds that modulate apoE production in immortalized astrocytes derived from apoE3-targeted replacement mice. Here, we report that retinoic acid (RA) isomers, including all-trans-RA, 9-cis-RA, and 13-cis-RA, significantly increase apoE secretion to ∼4-fold of control through retinoid X receptor (RXR) and RA receptor. These effects on modulating apoE are comparable with the effects recently reported for the RXR agonist bexarotene. Furthermore, all of these compounds increased the expression of the cholesterol transporter ABCA1 and ABCG1 levels and decreased cellular uptake of Aβ in an apoE-dependent manner. Both bexarotene and 9-cis-RA promote the lipidation status of apoE, in which 9-cis-RA promotes a stronger effect and exhibits less cytotoxicity compared with bexarotene. Importantly, we showed that oral administration of bexarotene and 9-cis-RA significantly increases apoE, ABCA1, and ABCG1 levels in mouse brains. Taken together, our results demonstrate that RXR/RA receptor agonists, including several RA isomers, are effective modulators of apoE secretion and lipidation and may be explored as potential drugs for AD therapy. PMID:24599963

  12. Effects of electroacupuncture and the retinoid X receptor (RXR) signalling pathway on oligodendrocyte differentiation in the demyelinated spinal cord of rats

    PubMed Central

    Yang, Xiao-Hua; Ding, Ying; Li, Wen; Zhang, Rong-Yi; Wu, Jin-Lang; Ling, Eng-Ang; Wu, Wutian

    2017-01-01

    Objectives In spinal cord demyelination, some oligodendrocyte precursor cells (OPCs) remain in the demyelinated region but have a reduced capacity to differentiate into oligodendrocytes. This study investigated whether ‘Governor Vessel’ (GV) electroacupuncture (EA) would promote the differentiation of endogenous OPCs into oligodendrocytes by activating the retinoid X receptor γ (RXR-γ)-mediated signalling pathway. Methods Adult rats were microinjected with ethidium bromide (EB) into the T10 spinal cord to establish a model of spinal cord demyelination. EB-injected rats remained untreated (EB group, n=26) or received EA treatment (EB+EA group, n=26). A control group (n=26) was also included that underwent dural exposure without EB injection. After euthanasia at 7 days (n=5 per group), 15 days (n=8 per group) or 30 days (n=13 per group), protein expression of RXR-γ in the demyelinated spinal cord was evaluated by immunohistochemistry and Western blotting. In addition, OPCs derived from rat embryonic spinal cord were cultured in vitro, and exogenous 9-cis-RA (retinoic acid) and RXR-γ antagonist HX531 were administered to determine whether RA could activate RXR-γ and promote OPC differentiation. Results EA was found to increase the numbers of both OPCs and oligodendrocytes expressing RXR-γ and RALDH2, and promote remyelination in the remyelinated spinal cord. Exogenous 9-cis-RA enhanced the differentiation of OPCs into mature oligodendrocytes by activating RXR-γ. Conclusions The results suggest that EA may activate RXR signalling to promote the differentiation of OPCs into oligodendrocytes in spinal cord demyelination. PMID:27841975

  13. Nitrofen increases total retinol levels in placenta during lung morphogenesis in the nitrofen model of congenital diaphragmatic hernia.

    PubMed

    Kutasy, Balazs; Pes, Lara; Friedmacher, Florian; Paradisi, Francesca; Puri, Prem

    2014-10-01

    It has been shown that pulmonary retinol level is decreased during lung morphogenesis in the nitrofen-induced PH in congenital diaphragmatic hernia (CDH). Placenta has a major role in the retinol homeostasis in fetal life. Since there is no fetal retinol synthesis, maternal retinol has to cross the placenta. Placenta is the main fetal retinol store where retinol is stored in retinyl-ester formation. Trophoblasts have to produce its own retinol-binding protein (RBP) for retinol transport from placenta to fetus. Recently, we demonstrated that trophoblastic RBP expression is decreased in the nitrofen model of CDH. The aim of this study was to investigate the retinol transfer from mother to the placenta in nitrofen model of CDH. Pregnant rats were exposed to either olive oil or nitrofen on day 9 of gestation (D9). Fetal placenta harvested on D21 and divided into two groups: control (n = 11) and nitrofen with CDH (n = 11). Retinoid levels in placenta were measured using HPLC. Immunohistochemistry was performed to evaluate trophoblastic expression of main RSP genes. Total retinol levels in the placenta were significantly increased in CDH placenta compared to control placenta. The retinyl-ester levels were significantly increased in CDH placenta compared to control placenta. Markedly, decreased immunoreactivity of retinoid signaling pathway was observed in trophoblast cells in CDH compared to control placenta. Increased placental retinol levels show that retinol is transferred from mother to placenta and stored in the placenta in nitrofen model of CDH during lung morphogenesis. Nitrofen may disturb the mobilization of retinol from placenta to fetal circulation causing PH in CDH.

  14. Rational Tuning of Visual Cycle Modulator Pharmacodynamics

    PubMed Central

    Kiser, Philip D.; Zhang, Jianye; Badiee, Mohsen; Kinoshita, Junzo; Peachey, Neal S.; Tochtrop, Gregory P.

    2017-01-01

    Modulators of the visual cycle have been developed for treatment of various retinal disorders. These agents were designed to inhibit retinoid isomerase [retinal pigment epithelium-specific 65 kDa protein (RPE65)], the rate-limiting enzyme of the visual cycle, based on the idea that attenuation of visual pigment regeneration could reduce formation of toxic retinal conjugates. Of these agents, certain ones that contain primary amine groups can also reversibly form retinaldehyde Schiff base adducts, which contributes to their retinal protective activity. Direct inhibition of RPE65 as a therapeutic strategy is complicated by adverse effects resulting from slowed chromophore regeneration, whereas effective retinal sequestration can require high drug doses with potential off-target effects. We hypothesized that the RPE65-emixustat crystal structure could help guide the design of retinaldehyde-sequestering agents with varying degrees of RPE65 inhibitory activity. We found that addition of an isopropyl group to the central phenyl ring of emixustat and related compounds resulted in agents effectively lacking in vitro retinoid isomerase inhibitory activity, whereas substitution of the terminal 6-membered ring with branched moieties capable of stronger RPE65 interaction potentiated inhibition. The isopropyl derivative series produced discernible visual cycle suppression in vivo, albeit much less potently than compounds with a high affinity for the RPE65 active site. These agents were distributed into the retina and formed Schiff base adducts with retinaldehyde. Except for one compound [3-amino-1-(3-isopropyl-5-((2,6,6-trimethylcyclohex-1-en-1-yl)methoxy)phenyl)propan-1-ol (MB-007)], these agents conferred protection against retinal phototoxicity, suggesting that both direct RPE65 inhibition and retinal sequestration are mechanisms of potential therapeutic relevance. PMID:28476927

  15. Inhibition of estrogen-responsive gene activation by the retinoid X receptor beta: evidence for multiple inhibitory pathways.

    PubMed

    Segars, J H; Marks, M S; Hirschfeld, S; Driggers, P H; Martinez, E; Grippo, J F; Brown, M; Wahli, W; Ozato, K

    1993-04-01

    The retinoid X receptor beta (RXR beta; H-2RIIBP) forms heterodimers with various nuclear hormone receptors and binds multiple hormone response elements, including the estrogen response element (ERE). In this report, we show that endogenous RXR beta contributes to ERE binding activity in nuclear extracts of the human breast cancer cell line MCF-7. To define a possible regulatory role of RXR beta regarding estrogen-responsive transcription in breast cancer cells, RXR beta and a reporter gene driven by the vitellogenin A2 ERE were transfected into estrogen-treated MCF-7 cells. RXR beta inhibited ERE-driven reporter activity in a dose-dependent and element-specific fashion. This inhibition occurred in the absence of the RXR ligand 9-cis retinoic acid. The RXR beta-induced inhibition was specific for estrogen receptor (ER)-mediated ERE activation because inhibition was observed in ER-negative MDA-MB-231 cells only following transfection of the estrogen-activated ER. No inhibition of the basal reporter activity was observed. The inhibition was not caused by simple competition of RXR beta with the ER for ERE binding, since deletion mutants retaining DNA binding activity but lacking the N-terminal or C-terminal domain failed to inhibit reporter activity. In addition, cross-linking studies indicated the presence of an auxiliary nuclear factor present in MCF-7 cells that contributed to RXR beta binding of the ERE. Studies using known heterodimerization partners of RXR beta confirmed that RXR beta/triiodothyronine receptor alpha heterodimers avidly bind the ERE but revealed the existence of another triiodothyronine-independent pathway of ERE inhibition. These results indicate that estrogen-responsive genes may be negatively regulated by RXR beta through two distinct pathways.

  16. Retinoid X receptor and peroxisome proliferator-activated receptor activate an estrogen responsive gene independent of the estrogen receptor.

    PubMed

    Nuñez, S B; Medin, J A; Braissant, O; Kemp, L; Wahli, W; Ozato, K; Segars, J H

    1997-03-14

    Estrogen receptors regulate transcription of genes essential for sexual development and reproductive function. Since the retinoid X receptor (RXR) is able to modulate estrogen responsive genes and both 9-cis RA and fatty acids influenced development of estrogen responsive tumors, we hypothesized that estrogen responsive genes might be modulated by RXR and the fatty acid receptor (peroxisome proliferator-activated receptor, PPAR). To test this hypothesis, transfection assays in CV-1 cells were performed with an estrogen response element (ERE) coupled to a luciferase reporter construct. Addition of expression vectors for RXR and PPAR resulted in an 11-fold increase in luciferase activity in the presence of 9-cis RA. Furthermore, mobility shift assays demonstrated binding of RXR and PPAR to the vitellogenin A2-ERE and an ERE in the oxytocin promoter. Methylation interference assays demonstrated that specific guanine residues required for RXR/PPAR binding to the ERE were similar to residues required for ER binding. Moreover, RXR domain-deleted constructs in transfection assays showed that activation required RXR since an RXR delta AF-2 mutant completely abrogated reporter activity. Oligoprecipitation binding studies with biotinylated ERE and (35)S-labeled in vitro translated RXR constructs confirmed binding of delta AF-2 RXR mutant to the ERE in the presence of baculovirus-expressed PPAR. Finally, in situ hybridization confirmed RXR and PPAR mRNA expression in estrogen responsive tissues. Collectively, these data suggest that RXR and PPAR are present in reproductive tissues, are capable of activating estrogen responsive genes and suggest that the mechanism of activation may involve direct binding of the receptors to estrogen response elements.

  17. Phosphorylation of a conserved serine in the deoxyribonucleic acid binding domain of nuclear receptors alters intracellular localization.

    PubMed

    Sun, Kai; Montana, Vedrana; Chellappa, Karthikeyani; Brelivet, Yann; Moras, Dino; Maeda, Yutaka; Parpura, Vladimir; Paschal, Bryce M; Sladek, Frances M

    2007-06-01

    Nuclear receptors (NRs) are a superfamily of transcription factors whose genomic functions are known to be activated by lipophilic ligands, but little is known about how to deactivate them or how to turn on their nongenomic functions. One obvious mechanism is to alter the nuclear localization of the receptors. Here, we show that protein kinase C (PKC) phosphorylates a highly conserved serine (Ser) between the two zinc fingers of the DNA binding domain of orphan receptor hepatocyte nuclear factor 4alpha (HNF4alpha). This Ser (S78) is adjacent to several positively charged residues (Arg or Lys), which we show here are involved in nuclear localization of HNF4alpha and are conserved in nearly all other NRs, along with the Ser/threonine (Thr). A phosphomimetic mutant of HNF4alpha (S78D) reduced DNA binding, transactivation ability, and protein stability. It also impaired nuclear localization, an effect that was greatly enhanced in the MODY1 mutant Q268X. Treatment of the hepatocellular carcinoma cell line HepG2 with PKC activator phorbol 12-myristate 13-acetate also resulted in increased cytoplasmic localization of HNF4alpha as well as decreased endogenous HNF4alpha protein levels in a proteasome-dependent fashion. We also show that PKC phosphorylates the DNA binding domain of other NRs (retinoic acid receptor alpha, retinoid X receptor alpha, and thyroid hormone receptor beta) and that phosphomimetic mutants of the same Ser/Thr result in cytoplasmic localization of retinoid X receptor alpha and peroxisome proliferator-activated receptor alpha. Thus, phosphorylation of this conserved Ser between the two zinc fingers may be a common mechanism for regulating the function of NRs.

  18. Bexarotene via CBP/p300 induces suppression of NF-κB-dependent cell growth and invasion in thyroid cancer.

    PubMed

    Cras, Audrey; Politis, Béatrice; Balitrand, Nicole; Darsin-Bettinger, Diane; Boelle, Pierre Yves; Cassinat, Bruno; Toubert, Marie-Elisabeth; Chomienne, Christine

    2012-01-15

    Retinoic acid (RA) treatment has been used for redifferentiation of metastatic thyroid cancer with loss of radioiodine uptake. The aim of this study was to improve the understanding of RA resistance and investigate the role of bexarotene in thyroid cancer cells. A model of thyroid cancer cell lines with differential response to RA was used to evaluate the biological effects of retinoid and rexinoid and to correlate this with RA receptor levels. Subsequently, thyroid cancer patients were treated with 13-cis RA and bexarotene and response evaluated on radioiodine uptake reinduction on posttherapy scan and conventional imaging. In thyroid cancer patients, 13-cis RA resistance can be bypassed in some tumors by bexarotene. A decreased tumor growth without differentiation was observed confirming our in vitro data. Indeed, we show that ligands of RARs or RXRs exert different effects in thyroid cancer cell lines through either differentiation or inhibition of cell growth and invasion. These effects are associated with restoration of RARβ and RXRγ levels and downregulation of NF-κB targets genes. We show that bexarotene inhibits the transactivation potential of NF-κB in an RXR-dependent manner through decreased promoter permissiveness without interfering with NF-κB nuclear translocation and binding to its responsive elements. Inhibition of transcription results from the release of p300 coactivator from NF-κB target gene promoters and subsequent histone deacetylation. This study highlights dual mechanisms by which retinoids and rexinoids may target cell tumorigenicity, not only via RARs and RXRs, as expected, but also via NF-κB pathway. ©2011 AACR.

  19. Topical isotretinoin for melasma in Thai patients: a vehicle-controlled clinical trial.

    PubMed

    Leenutaphong, V; Nettakul, A; Rattanasuwon, P

    1999-09-01

    Melasma is an acquired hyperpigmentary disorder commonly seen in Orientals. Recently it has been demonstrated that tretinoin (all-trans-retinoic acid) can produce significant clinical improvement of melasma. However, moderate cutaneous side effects (retinoid dermatitis) occurred in a number of patients. To investigate the efficacy of topical 0.05 per cent isotretinoin gel (Isotrex) in the treatment of melasma in Thai patients. Thirty patients with moderate to severe melasma entered a 40-week, randomized, vehicle-controlled clinical trial in which they applied either 0.05 per cent isotretinoin gel, or its vehicle base together with a broad spectrum sunscreen (SPF 28) daily to the entire face. They were evaluated clinically (using Melasma Area and Severity Index), and colorimetrically (using our Melasma Area and Melanin Index). After 40 weeks, the average MASI and MAMI scores of the isotretinoin-treated group decreased by 68.2 per cent and 47 per cent respectively, while the corresponding control scores declined 60 per cent and 34 per cent. There was no statistically significant difference between the isotretinoin and vehicle groups. When the MASI and MAMI scores of each visit were compared to their baseline data, a statistically significant reduction of the score was first noted at weeks 4 and 12 respectively. Lightening of melasma, as determined clinically (MASI score), correlated well with pigmentation measurements (MAMI score). Side effects were limited to a mild transient "retinoid dermatitis" occurring in 27 per cent of isotretinoin-treated patients. Daily use of broad spectrum sunscreen has a significant lightening effect on melasma in Thai patients. However, there was no statistically significant difference between the isotretinoin and vehicle-treated group.

  20. Elevated risks for amyotrophic lateral sclerosis and blood disorders in Ashkenazi schizophrenic pedigrees suggest new candidate genes in schizophrenia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goodman, A.B.

    1994-09-15

    Among relatives of Ashkenazi schizophrenic probands the rate of amyotrophic lateral sclerosis was 3/1,000, compared to expected population rates of approximately 2/100,000. Relative risk of bleeding disorders, including hematologic cancers, was increased more than three-fold compared to controls. Co-occurrence of motor neuron disease and blood dyscrasias, accompanied by psychosis, has long been recognized. A virally-mediated autoimmune pathogenesis has been proposed. However, the familial co-occurrence of these three disease entities raises the possibility that the disease constellation be considered as a manifestation of a common underlying genetic defect. Such expansion of the spectrum of affectation might enhance the power of bothmore » candidate gene and linkage studies. Based on these findings, the loci suggested as candidate regions in schizophrenia include a potential hot spot on chromosome 21q21-q22, involving the superoxide dismutase and amyloid precursor protein genes. Alternatively, genes on other chromosomes involved in the expression, transcription, or regulation of these genes, or associated with the illnesses of high frequency in these pedigrees are suggested. Candidates include the choroid plexus transport protein, transthyretin at 18q11.2-q12.1; the t(14;18)(q22;21) characterizing B-cell lymphoma-2, the most common form of hematologic cancer; and the 14q24 locus of early onset Alzheimer`s disease, c-Fos, transforming growth factor beta 3, and heat shock protein A2. Expression of hematologic cancers and the suggested candidate genes are known to involve retinoid pathways, and retinoid disregulation has been proposed as a cause of schizophrenia. 67 refs., 2 figs., 1 tab.« less

  1. Epigenetic Plasticity Drives Adipogenic and Osteogenic Differentiation of Marrow-derived Mesenchymal Stem Cells*

    PubMed Central

    Meyer, Mark B.; Benkusky, Nancy A.; Sen, Buer; Rubin, Janet; Pike, J. Wesley

    2016-01-01

    Terminal differentiation of multipotent stem cells is achieved through a coordinated cascade of activated transcription factors and epigenetic modifications that drive gene transcription responsible for unique cell fate. Within the mesenchymal lineage, factors such as RUNX2 and PPARγ are indispensable for osteogenesis and adipogenesis, respectively. We therefore investigated genomic binding of transcription factors and accompanying epigenetic modifications that occur during osteogenic and adipogenic differentiation of mouse bone marrow-derived mesenchymal stem cells (MSCs). As assessed by ChIP-sequencing and RNA-sequencing analyses, we found that genes vital for osteogenic identity were linked to RUNX2, C/EBPβ, retinoid X receptor, and vitamin D receptor binding sites, whereas adipocyte differentiation favored PPARγ, retinoid X receptor, C/EBPα, and C/EBPβ binding sites. Epigenetic marks were clear predictors of active differentiation loci as well as enhancer activities and selective gene expression. These marrow-derived MSCs displayed an epigenetic pattern that suggested a default preference for the osteogenic pathway; however, these patterns were rapidly altered near the Adipoq, Cidec, Fabp4, Lipe, Plin1, Pparg, and Cebpa genes during adipogenic differentiation. Surprisingly, we found that these cells also exhibited an epigenetic plasticity that enabled them to trans-differentiate from adipocytes to osteoblasts (and vice versa) after commitment, as assessed by staining, gene expression, and ChIP-quantitative PCR analysis. The osteogenic default pathway may be subverted during pathological conditions, leading to skeletal fragility and increased marrow adiposity during aging, estrogen deficiency, and skeletal unloading. Taken together, our data provide an increased mechanistic understanding of the epigenetic programs necessary for multipotent differentiation of MSCs that may prove beneficial in the development of therapeutic strategies. PMID:27402842

  2. p-Dodecylaminophenol derived from the synthetic retinoid, fenretinide: antitumor efficacy in vitro and in vivo against human prostate cancer and mechanism of action.

    PubMed

    Takahashi, Noriko; Watanabe, Yusuke; Maitani, Yoshie; Yamauchi, Takayasu; Higashiyama, Kimio; Ohba, Toshihiro

    2008-02-01

    Fenretinide, N-(4-hydroxyphenyl)retinamide (4-HPR) is an aminophenol-containing synthetic retinoid derivative of all-trans-retinoic acid, which is a potent chemopreventive and antiproliferative agent against various cancers. Clinical studies of 4-HPR have shown side effects consisting of night blindness and ocular toxicity. To maintain potent anticancer activity without side effects, p-dodecylaminophenol (p-DDAP) was designed based on structure-activity relationships of 4-HPR. In our study, we investigate whether p-DDAP shows anticancer activity against human prostate cancer cell line PC-3 when compared with 4-HPR. p-DDAP inhibited PC-3 cell growth progressively from low to high concentration in a dose-dependent manner. p-DDAP was the most potent antiproliferative agent in vitro among 6 p-alkylaminophenols and 3 4-hydroxyphenyl analogs examined including 4-HPR. Cells treated with p-DDAP were shown to undergo apoptosis, based on condensation nuclei, cytofluorimetric analysis, propidium iodide staining and the expression of bcl-2 and caspase 3. p-DDAP arrested the S phase of the cell cycle, while 4-HPR arrested the G(0)/G(1) phase. In addition, both the i.v. and i.p. administration of p-DDAP suppressed tumor growth in PC-3-implanted mice in vivo. p-DDAP showed no effects on blood retinol concentrations, in contrast to reductions after 4-HPR administration. These results indicate that p-DDAP exhibits excellent anticancer efficacy against hormonal independent prostate cancer in vitro and in vivo, and it may have great potential for clinical use in the treatment of prostate cancer with reduced side effects. (c) 2007 Wiley-Liss, Inc.

  3. Fundamental studies of adrenal retinoid-X-receptor: Protein isoform, tissue expression, subcellular distribution, and ligand availability.

    PubMed

    Cheng, Behling; Al-Shammari, Fatema H; Ghader, Isra'a A; Sequeira, Fatima; Thakkar, Jitendra; Mathew, Thazhumpal C

    2017-07-01

    Adrenal gland reportedly expresses many nuclear receptors that are known to heterodimerize with retinoid-X-receptor (RXR) for functions, but the information regarding the glandular RXR is not adequate. Studies of rat adrenal homogenate by Western blotting revealed three RXR proteins: RXRα (55kDa), RXRβ (47kDa) and RXR (56kDa). RXRγ was not detectable. After fractionation, RXRα was almost exclusively localized in the nuclear fraction. In comparison, substantial portions of RXRβ and RXR were found in both nuclear and post-nuclear particle fractions, suggesting genomic and non-genomic functions. Cells immunostained for RXRα were primarily localized in zona fasciculata (ZF) and medulla, although some stained cells were found in zona glomerulosa (ZG) and zona reticularis (ZR). In contrast, cells immunostained for RXRβ were concentrated principally in ZG, although some stained cells were seen in ZR, ZF, and medulla (in descending order, qualitatively). Analysis of adrenal lipid extracts by LC/MS did not detect 9-cis-retinoic acid (a potent RXR-ligand) but identified all-trans retinoic acid. Since C20 and C22 polyunsaturated fatty acids (PUFAs) can also activate RXR, subcellular availabilities of unesterified fatty acids were investigated by GC/MS. As results, arachidonic acid (C20:4), adrenic acid (C22:4), docosapentaenoic acid (C22:5), and cervonic acid (C22:6) were detected in the lipids extracted from each subcellular fraction. Thus, the RXR-agonizing PUFAs are available in all the main subcellular compartments considerably. The present findings not only shed light on the adrenal network of RXRs but also provide baseline information for further investigations of RXR heterodimers in the regulation of adrenal steroidogenesis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Insights into the pathogenesis of dominant retinitis pigmentosa associated with a D477G mutation in RPE65.

    PubMed

    Choi, Elliot H; Suh, Susie; Sander, Christopher L; Hernandez, Christian J Ortiz; Bulman, Elizabeth R; Khadka, Nimesh; Dong, Zhiqian; Shi, Wuxian; Palczewski, Krzysztof; Kiser, Philip D

    2018-04-12

    RPE65 is the essential trans-cis isomerase of the classical retinoid (visual) cycle. Mutations in RPE65 give rise to severe retinal dystrophies, most of which are associated with loss of protein function and recessive inheritance. The only known exception is a c.1430G>A (D477G) mutation that gives rise to dominant retinitis pigmentosa with delayed onset and choroidal and macular involvement. Position 477 is distant from functionally critical regions of RPE65. Hence, the mechanism of D477G pathogenicity remains unclear, although protein misfolding and aggregation mechanisms have been suggested. We characterized a D477G knock-in mouse model which exhibited mild age-dependent changes in retinal structure and function. Immunoblot analysis of protein extracts from the eyes of the knock-in mice demonstrated the presence of ubiquitinated RPE65 and reduced RPE65 expression. We observed an accumulation of retinyl esters in the knock-in mice as well as a delay in rhodopsin regeneration kinetics and diminished electroretinography responses, indicative of RPE65 functional impairment induced by the D477G mutation in vivo. However, a cell line expressing D477G RPE65 revealed protein expression levels, cellular localization, and retinoid isomerase activity comparable to cells expressing wild-type protein. Structural analysis of an RPE65 chimera suggested that the D477G mutation does not perturb protein folding or tertiary structure. Instead, the mutation generates an aggregation-prone surface that could induce cellular toxicity through abnormal complex formation as suggested by crystal packing analysis. These results indicate that a toxic gain-of-function induced by the D477G RPE65 substitution may play a role in the pathogenesis of this form of dominant retinitis pigmentosa.

  5. [The effect of drugs used in treatment of skin disorders on visual system].

    PubMed

    Szostakiewicz-Grabek, Beata; Juszkiewicz-Borowiec, Maria; Krasowska, Dorota

    2016-04-01

    Drugs with side effects affecting vision are often used in the treatment of skin disorders. The study evaluated principal groups of medicines which may negatively influence vision and the eye itself. Antimalaric drugs may cause a number of disorders of vision and a diagnosed retinophaty is an absolute contraindication. Retinoids often cause a dry eye condition, which results in intolerance to wearing contact lenses. They can also be a cause of poor nightly vision. Psoralens, used in photochemotherapy, can penetrate to the frontal part of the eye, inducing clouding of the lens and cataract. Glucocorticosteroids, often used in skin conditions, increase intraocular pressure, which may result in development of glaucoma. Methotrexate may also cause complications, such as eyelid edema, conjunctival hyperemia, increased lacrimation and photophobia. A prolonged use of tetracyclines may induce side effect in eye organs. Swelling of the optic nerve head with subsequent decreased vision, and even accumulate of metabolites of tetracycline within the conjunctival were observed. In the study a distinction was made between the medications which may lead to a temporary visual impairment and the medication with a side effect lasting beyond the treatment. It was pointed out that some of the side effects could be avoided or minimised by not combining retinoids and tetracyclines or with the use of protective eyewear during photochemotherapy. An examination by ophthalmologist is a crucial step prior to the treatment with chloroquine, hydroxychloroquine or psoralens. Regular eye exams are necessary when using, especially in a protracted fashion, most of the discussed drugs. Finally, the cooperation between dermatologist and ophthalmologist is fundamental for ensuring patient's safety. © 2016 MEDPRESS.

  6. Suppressive effects of retinoids, carotenoids and antioxidant vitamins on heterocyclic amine-induced umu C gene expression in Salmonella typhimurium (TA 1535/pSK 1002).

    PubMed

    Okai, Y; Higashi-Okai, K; Nakamura, S; Yano, Y; Otani, S

    1996-06-12

    Effects of retinoids, carotenoids and antioxidant vitamins were studied by mutagen-induced umu C gene expression system in Salmonella typhimurium (TA 1535/pSK 1002). Retinol (vitamin A), retinol acetate and retinoic acid showed remarkable inhibitory activities, whereas retinol palmitate exhibited significant but weak activity for umu C gene expression in tester bacteria induced by 3-amino-3,4-dimethyl-5H-pyrido[4.3-b]indol (Trp-P-1) in the presence of hepatic metabolizing enzymes (S9 mixture). Carotenoids having provitamin A activity (beta-carotene and canthaxanthin) exhibited moderate suppressive effects on the same experimental system. The ranks of suppressive activities were retinol > retinol acetate > retinoic acid > canthaxanthin > beta-carotene > retinol palmitate and their doses for inhibition by 50% (ID50) were estimated to be 1.2 x 10(-7), 3.0 x 10(-7), 5.4 x 10(-7), 1.5 x 10(-6), 4.0 x 10(-5) and 6.0 x 10(-5) M, respectively. However, they did not cause significant inhibition on umu C gene expression induced by direct-acting mutagen (adriamycin or mitomycin C) in the absence of S9 mixture. Inhibition of umu gene expression appears to be due to inhibition of P450-mediated metabolic activation of the heterocyclic amine Trp-P-1. Ascorbic acid (vitamin C) showed weak but significant suppressive activity at high-dose concentrations (3 x 10(-6) - 10(-4)M). However, alpha-tocopherol did not exhibit significant suppression at all dose concentrations. The significance of the experimental results is discussed from the viewpoint of the chemoprevention against genotoxicity associated with carcinogenesis.

  7. Reduction of MDSCs with all-trans retinoic acid improves CAR therapy efficacy for sarcomas

    PubMed Central

    Long, Adrienne H.; Highfill, Steven L.; Cui, Yongzhi; Smith, Jillian P.; Walker, Alec J.; Ramakrishna, Sneha; El-Etriby, Rana; Galli, Susana; Tsokos, Maria G.; Orentas, Rimas J.; Mackall, Crystal L.

    2016-01-01

    Genetically engineered T cells expressing CD19-specific chimeric antigen receptors (CARs) have shown impressive activity against B cell malignancies, and preliminary results suggest that T cells expressing a first generation disialoganglioside (GD2)-specific CAR can also provide clinical benefit in patients with neuroblastoma. We sought to assess the potential of GD2-CAR therapies to treat pediatric sarcomas. We observed that 18/18 (100%) of osteosarcomas, 2/15 (13%) of rhabdomyosarcomas, and 7/35 (20%) of Ewing sarcomas expressed GD2. T cells engineered to express a third generation GD2-CAR incorporating the 14g2a-scFv with the CD28, OX40, and CD3ζ signaling domains (14g2a.CD28.OX40.ζ) mediated efficient and comparable lysis of both GD2+ sarcoma and neuroblastoma cell lines in vitro. However in xenograft models, GD2-CAR T cells had no antitumor effect against GD2+ sarcoma, despite effectively controlling GD2+ neuroblastoma. We observed that pediatric sarcoma xenografts, but not neuroblastoma xenografts, induced large populations of monocytic and granulocytic murine myeloid-derived suppressor cells (MDSCs) that inhibited human CAR T-cell responses in vitro. Treatment of sarcoma-bearing mice with all-trans retinoic acid (ATRA) largely eradicated monocytic MDSCs and diminished the suppressive capacity of granulocytic MDSCs. Combined therapy using GD2-CAR T cells plus ATRA significantly improved antitumor efficacy against sarcoma xenografts. We conclude that retinoids provide a clinically accessible class of agents capable of diminishing the suppressive effects of MDSCs, and that co-administration of retinoids may enhance the efficacy of CAR therapies targeting solid tumors. PMID:27549124

  8. Left-right analysis of mammary gland development in retinoid X receptor-α+/- mice.

    PubMed

    Robichaux, Jacqulyne P; Fuseler, John W; Patel, Shrusti S; Kubalak, Steven W; Hartstone-Rose, Adam; Ramsdell, Ann F

    2016-12-19

    Left-right (L-R) differences in mammographic parenchymal patterns are an early predictor of breast cancer risk; however, the basis for this asymmetry is unknown. Here, we use retinoid X receptor alpha heterozygous null (RXRα +/- ) mice to propose a developmental origin: perturbation of coordinated anterior-posterior (A-P) and L-R axial body patterning. We hypothesized that by analogy to somitogenesis-in which retinoic acid (RA) attenuation causes anterior somite pairs to develop L-R asynchronously-that RA pathway perturbation would likewise result in asymmetric mammary development. To test this, mammary glands of RXRα +/- mice were quantitatively assessed to compare left- versus right-side ductal epithelial networks. Unlike wild-type controls, half of the RXRα +/- thoracic mammary gland (TMG) pairs exhibited significant L-R asymmetry, with left-side reduction in network size. In RXRα +/- TMGs in which symmetry was maintained, networks had bilaterally increased size, with left networks showing greater variability in area and pattern. Reminiscent of posterior somites, whose bilateral symmetry is refractory to RA attenuation, inguinal mammary glands (IMGs) also had bilaterally increased network size, but no loss of symmetry. Together, these results demonstrate that mammary glands exhibit differential A-P sensitivity to RXRα heterozygosity, with ductal network symmetry markedly compromised in anterior but not posterior glands. As TMGs more closely model human breast development than IMGs, these findings raise the possibility that for some women, breast cancer risk may initiate with subtle axial patterning defects that result in L-R asymmetric growth and pattern of the mammary ductal epithelium.This article is part of the themed issue 'Provocative questions in left-right asymmetry'. © 2016 The Author(s).

  9. Frog decline, frog malformations, and a comparison of frog and human health.

    PubMed

    Cohen, M M

    2001-11-22

    The decline in frog populations and the increase in the frequency of frog malformations are discussed. Topics considered for analysis include chytridiomycosis, retinoids, UV-B radiation, chemical contaminants, environmental threats, introduced invasive species and predation, unsustainable use, and enigmatic decline. Care must be taken to distinguish between hypotheses, laboratory experiments, and the findings in feral frog populations. Clearly, the causes of population decline and malformations are heterogeneous. The subject of frogs and humans is addressed under three subheadings: the importance of frogs to human societies, medical implications of frog studies, and a comparison of frog and human disease factors. Copyright 2001 Wiley-Liss, Inc.

  10. Acral Hemorrhagic Darier Disease.

    PubMed

    Flores-Terry, M Á; García-Arpa, M; Llamas-Velasco, M; Mendoza-Chaparro, C; Ramos-Rodríguez, C

    2017-09-01

    Darier disease is an autosomal-dominant inherited condition caused by mutation of a gene, which produces a protein involved in calcium channel regulation. The disease has a variety of manifestations and lacks consistent genotype-phenotype correlations. Acral hemorrhagic Darier disease causes macules, papules, vesicles and/or hemorrhagic blisters on the extremities. Other classic signs of the disease may be present in the same patient or relatives. Histopathology reveals dyskeratosis and suprabasal acantholysis with hemorrhagic lacunae. We report 3 new cases of this type of Darier disease triggered by injuries. Response to retinoid therapy was good. Copyright © 2017 AEDV. Publicado por Elsevier España, S.L.U. All rights reserved.

  11. Postinflammatory hyperpigmentation: evolving combination treatment strategies.

    PubMed

    Taylor, Susan C; Burgess, Cheryl M; Callender, Valerie D; Fu, Jan; Rendon, Marta I; Roberts, Wendy E; Shalita, Alan R

    2006-08-01

    Postinflammatory hyperpigmentation (PIH) is a common acquired excess of pigment in the epidermal and/or dermal layers of the skin. Lesions persist for extended periods if untreated, thus therapy is warranted. Topical monotherapies include the standard bleaching agent hydroquinone (HQ) as well as retinoids. Recently, several fixed-dose combination products were introduced to the armamentarium: HQ 4%-retinol 0.15% in a microsponge formulation; HQ 4%-retinol 0.3%; mequinol 2%-tretinoin (RA) 0.01%; and fluocinolone acetonide (FA) 0.01%, HQ 4%, and RA 0.05%. Recent findings have suggested that mequinol 2%-RA 0.01% solution is a promising alternative for the treatment of PIH.

  12. Transcriptional changes in organoculture of full-thickness human skin following topical application of all-trans retinoic acid

    PubMed Central

    Gillbro, J M; Al-Bader, T; Westman, M; Olsson, M J; Mavon, A

    2014-01-01

    Synopsis Objective Retinoids are used as therapeutic agents for numerous skin diseases, for example, psoriasis, acne and keratinization disorders. The same substances have also been recognized in the treatment for hyperpigmentation disorders such as melasma. Other studies on photo-damaged skin have shown that retinoids reduce wrinkles, surface roughness, mottled pigmentation, and visual skin appearance as a whole. We tested the hypothesis that an organoculture of full-thickness human skin could be used as a preclinical model to investigate the retinoid transcriptional profile in human skin in vitro. Methods Full-thickness skin explants were exposed to topically applied all-trans retinoic acid (RA) for 24 h. The gene expression profile was analysed using oligonucleotide microarrays, and data were validated with real-time (RT) PCR. Results We showed that the expression of 93 genes was significantly altered more than twofold. Several of the altered genes, for example, KRT4, CYP26 and LCN2, have previously been shown to be affected by RA in keratinocyte monocultures, reconstructed epidermis and skin biopsies from patients treated topically or orally with RA. In addition, genes, such as SCEL, NRIP1, DGAT2, RDH12 EfnB2, MAPK14, SAMD9 and CEACAM6 not previously reported to be affected by RA in human skin, were identified for the first time in this study. Conclusion The results in the present study show that full-thickness human explants represent a valuable pre-clinical model for studying the effects of retinoids in skin. Résumé Objectif Les rétinoïdes sont utilisés comme agents thérapeutiques pour de nombreuses maladies de la peau, p.ex. le psoriasis, l'acné et les troubles de la kératinisation. Les mêmes substances ont également été reconnues dans le traitement des troubles de l' hyperpigmentation tels que le melasma. D'autres études sur la peau photo-endommagée ont montré que les rétinoïdes réduisent les rides, la rugosité de la surface, la pigmentation tachetée, et l'aspect visuel de la peau dans son ensemble. Nous avons testé l'hypothèse selon laquelle une organoculture de épaisseur intégrale de la peau humaine pourrait être utilisée comme modèle préclinique pour étudier le profil transcriptionnel des rétinoïdes dans la peau humaine in vitro. Méthodes Des explants de peau intégrale ont été exposés à l'application topique de all-trans acide rétinoïque (RA) pendant 24 heures. Le profil d' expression des gènes a été analysé en utilisant des puces DNA array et les données ont été validées par (RT) -PCR. Resultats Nous avons montré que l'expression de 93 gènes a été modifiée de façon significative par plus d'un facteur 2. Plusieurs des gènes modifiés par exemple KRT4, CYP26 et LCN2 ont été montrés précédemment d'être affectés par RA dans les monocultures de kératinocytes, dans l'épiderme reconstruit et dans des biopsies cutanées de patients traités par voie topique ou par voie orale avec RA. En outre, des gènes tels que SCEL, NRIP1, DGAT2, RDH12 EfnB2, MAPK14, SAMD9 et CEACAM6 non signalés précédemment, sont touchés par RA dans la peau humaine, et ont été identifiés pour la première fois dans cette étude. Conclusion Les résultats de la présente étude montrent que les explants humains de pleine épaisseur représentent un modèle préclinique précieux pour l'étude des effets des rétinoïdes dans la peau. PMID:24697191

  13. Structure-based design of Trifarotene (CD5789), a potent and selective RARγ agonist for the treatment of acne.

    PubMed

    Thoreau, Etienne; Arlabosse, Jean-Marie; Bouix-Peter, Claire; Chambon, Sandrine; Chantalat, Laurent; Daver, Sébastien; Dumais, Laurence; Duvert, Gwenaëlle; Feret, Angélique; Ouvry, Gilles; Pascau, Jonathan; Raffin, Catherine; Rodeville, Nicolas; Soulet, Catherine; Tabet, Samuel; Talano, Sandrine; Portal, Thibaud

    2018-06-01

    Retinoids have a dominant role in topical acne therapy and to date, only RARβ and RARγ dual agonists have reached the market. Given the tissue distribution of RAR isoforms, it was hypothesized that developing RARγ -selective agonists could yield a new generation of topical acne treatments that would increase safety margins while maintaining the robust efficacy of previous drugs. Structural knowledge derived from the X-ray structure of known γ-selective CD437, suggested the design of a novel triaryl series of agonists which was optimized and ultimately led to the discovery of Trifarotene/CD5789. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. Milia en plaque of the nose: report of a case and successful treatment with topical tretinoin.

    PubMed

    Nambudiri, Vinod E; Habib, Nancy; Arndt, Kenneth A; Kane, Kay S

    2014-05-01

    Milia are benign, superficial keratinaceous cysts that present as fine, small white papules. Milia en plaque is a rare, challenging-to-treat variant most often seen in the posterior auricular region. A total of 9 cases of milia en plaque have been reported in the pediatric literature to date. We report a case of milia en plaque of the nose in a 7-year-old boy, a novel site of involvement in the pediatric population, and successful treatment with the use of topical tretinoin. Topical retinoids offer an effective treatment option for the management of milia en plaque in the pediatric population. Copyright © 2014 by the American Academy of Pediatrics.

  15. Update on the use of alitretinoin in treating chronic hand eczema.

    PubMed

    Ghasri, Pedram; Scheinfeld, Noah

    2010-04-19

    Chronic hand eczema is a debilitating dermatological condition with significant economic, social, and functional impacts. To date, conventional treatments such as topical corticosteroids, phototherapy, and systemic immunosuppressants have yielded disappointing results, owing to either a lack of efficacy or significant adverse events. Oral alitretinoin (9-cis-retinoic acid) is a unique panagonist retinoid with immunomodulatory and anti-inflammatory activity that has emerged as a novel treatment for chronic hand eczema. Several large-scale clinical studies have demonstrated oral alitretinoin's high efficacy rate of 28% to 89%, its safe tolerability profile, and its positive impact on quality of life, validating it as a therapeutic option for patients with severe chronic hand eczema refractory to standard treatment.

  16. Oral Lichen Planus in a Pediatric Patient: A Novel Therapeutic Approach.

    PubMed

    Sharma, Gaurav; Sardana, Divesh; Vohra, Puneeta; Rehani, Shweta; Nagpal, Archna

    2017-03-01

    Lichen planus is a mucocutaneous disease, predominantly affecting the middle-aged individuals and may be associated with a plethora of signs and symptoms related to the skin, scalp, nails and mucous membranes. The definitive etiology of lichen planus is not yet known and no therapeutic modality has yet been universally accepted. Lichen planus in pediatric patients is a rare phenomenon and its presence in the oral mucosa is even rarer. The aim of this article is to present a rare case of a symptomatic oral lichen planus (OLP) occurring in a 12-year old child that was managed successfully with a novel sequential modality of topical retinoids followed by aloe vera gel application.

  17. Proteomic analysis of ethanol-induced embryotoxicity in cultured post-implantation rat embryos.

    PubMed

    Usami, Makoto; Mitsunaga, Katsuyoshi; Irie, Tomohiko; Miyajima, Atsuko; Doi, Osamu

    2014-04-01

    Protein expression changes were examined in day 10.5 rat embryos cultured for 24 hr in the presence of ethanol by using two-dimensional electrophoresis and mass spectrometry. Exposure to ethanol resulted in quantitative changes in many embryonic protein spots (16 decreased and 28 increased) at in vitro embryotoxic concentrations (130 and 195 mM); most changes occurred in a concentration-dependent manner. For these protein spots, 17 proteins were identified, including protein disulfide isomerase A3, alpha-fetoprotein, phosphorylated cofilin-1, and serum albumin. From the gene ontology classification and pathway mapping of the identified proteins, it was found that ethanol affected several biological processes involving oxidative stress and retinoid metabolism.

  18. Oral Lichen Planus in a Pediatric Patient: A Novel Therapeutic Approach

    PubMed Central

    Sharma, Gaurav; Vohra, Puneeta; Rehani, Shweta; Nagpal, Archna

    2017-01-01

    Lichen planus is a mucocutaneous disease, predominantly affecting the middle-aged individuals and may be associated with a plethora of signs and symptoms related to the skin, scalp, nails and mucous membranes. The definitive etiology of lichen planus is not yet known and no therapeutic modality has yet been universally accepted. Lichen planus in pediatric patients is a rare phenomenon and its presence in the oral mucosa is even rarer. The aim of this article is to present a rare case of a symptomatic oral lichen planus (OLP) occurring in a 12-year old child that was managed successfully with a novel sequential modality of topical retinoids followed by aloe vera gel application. PMID:29104603

  19. Ribavirin suppresses hepatic lipogenesis through inosine monophosphate dehydrogenase inhibition: Involvement of adenosine monophosphate-activated protein kinase-related kinases and retinoid X receptor α.

    PubMed

    Satoh, Shinya; Mori, Kyoko; Onomura, Daichi; Ueda, Youki; Dansako, Hiromichi; Honda, Masao; Kaneko, Shuichi; Ikeda, Masanori; Kato, Nobuyuki

    2017-08-01

    Ribavirin (RBV) has been widely used as an antiviral reagent, specifically for patients with chronic hepatitis C. We previously demonstrated that adenosine kinase, which monophosphorylates RBV into the metabolically active form, is a key determinant for RBV sensitivity against hepatitis C virus RNA replication. However, the precise mechanism of RBV action and whether RBV affects cellular metabolism remain unclear. Analysis of liver gene expression profiles obtained from patients with advanced chronic hepatitis C treated with the combination of pegylated interferon and RBV showed that the adenosine kinase expression level tends to be lower in patients who are overweight and significantly decreases with progression to advanced fibrosis stages. In our effort to investigate whether RBV affects cellular metabolism, we found that RBV treatment under clinically achievable concentrations suppressed lipogenesis in hepatic cells. In this process, guanosine triphosphate depletion through inosine monophosphate dehydrogenase inhibition by RBV and adenosine monophosphate-activated protein kinase-related kinases, especially microtubule affinity regulating kinase 4, were required. In addition, RBV treatment led to the down-regulation of retinoid X receptor α (RXRα), a key nuclear receptor in various metabolic processes, including lipogenesis. Moreover, we found that guanosine triphosphate depletion in cells induced the down-regulation of RXRα, which was mediated by microtubule affinity regulating kinase 4. Overexpression of RXRα attenuated the RBV action for suppression of lipogenic genes and intracellular neutral lipids, suggesting that down-regulation of RXRα was required for the suppression of lipogenesis in RBV action. Conclusion : We provide novel insights about RBV action in lipogenesis and its mechanisms involving inosine monophosphate dehydrogenase inhibition, adenosine monophosphate-activated protein kinase-related kinases, and down-regulation of RXRα. RBV may be a potential reagent for anticancer therapy against the active lipogenesis involved in hepatocarcinogenesis. ( Hepatology Communications 2017;1:550-563).

  20. The retinoid X receptor agonist, 9-cis UAB30, inhibits cutaneous T-cell lymphoma proliferation through the SKP2-p27kip1 axis.

    PubMed

    Chou, Chu-Fang; Hsieh, Yu-Hua; Grubbs, Clinton J; Atigadda, Venkatram R; Mobley, James A; Dummer, Reinhard; Muccio, Donald D; Eto, Isao; Elmets, Craig A; Garvey, W Timothy; Chang, Pi-Ling

    2018-06-01

    Bexarotene (Targretin ® ) is currently the only FDA approved retinoid X receptor (RXR) -selective agonist for the treatment of cutaneous T-cell lymphomas (CTCLs). The main side effects of bexarotene are hypothyroidism and elevation of serum triglycerides (TGs). The novel RXR ligand, 9-cis UAB30 (UAB30) does not elevate serum TGs or induce hypothyroidism in normal subjects. To assess preclinical efficacy and mechanism of action of UAB30 in the treatment of CTCLs and compare its action with bexarotene. With patient-derived CTCL cell lines, we evaluated UAB30 function in regulating growth, apoptosis, cell cycle check points, and cell cycle-related markers. Compared to bexarotene, UAB30 had lower half maximal inhibitory concentration (IC 50 ) values and was more effective in inhibiting the G1 cell cycle checkpoint. Both rexinoids increased the stability of the cell cycle inhibitor, p27kip1 protein, in part, through targeting components involved in the ubiquitination-proteasome system: 1) decreasing SKP2, a F-box protein that binds and targets p27kip1 for degradation by 26S proteasome and 2) suppressing 20S proteasome activity (cell line-dependent) through downregulation of PSMA7, a component of the 20S proteolytic complex in 26S proteasome. UAB30 and bexarotene induce both early cell apoptosis and suppress cell proliferation. Inhibition of the G1 to S cell cycle transition by rexinoids is mediated, in part, through downregulation of SKP2 and/or 20S proteasome activity, leading to increased p27kip1 protein stability. Because UAB30 has minimal effect in elevating serum TGs and inducing hypothyroidism, it is potentially a better alternative to bexarotene for the treatment of CTCLs. Copyright © 2018 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.

  1. Expression of retinoid-related orphan receptor (ROR)γt on NK22 cells in the peripheral blood and uterine endometrium of women with unexplained recurrent pregnancy loss and unexplained infertility.

    PubMed

    Fuchinoue, Kohei; Fukui, Atsushi; Chiba, Hitomi; Kamoi, Mai; Funamizu, Ayano; Taima, Ayako; Fukuhara, Rie; Mizunuma, Hideki

    2016-11-01

    Recently, NK22 cells, a subset of interleukin (IL)-22-producing natural killer (NK) cells, were identified. We have previously reported the higher percentage of NK22 cells in women suffering recurrent pregnancy loss (RPL). Moreover, we have also reported lower expression of NKp46, a kind of natural cytotoxicity receptor (NCR), on NK cells and the changes of NK cell producing cytokines in women who experience RPL. NK22 cells express NCRs, such as NKp44 or NKp46. Retinoid-related orphan receptor γt (RORγt) is known as a regulator of NK22 cells; however, in NK22 cells of peripheral blood (PB) and the uterine endometrium (UE), the relationship between NCRs and RORγt is unclear. We investigate RORγt expression NK22 cells in the PB and UE of women with unexplained infertility (uI) or unexplained RPL (uRPL). Lymphocytes were extracted from PB and UE, derived from women with uI or uRPL. Expression of RORγt and NCRs in NK cells and NK cell-produced cytokines were analyzed by flow cytometry. CD56 + /NKp46 + /RORγt + cells were positively correlated with CD56 + /IL-22 + cells in both PB and UE. CD56 bright /NKp46 bright /RORγt + cells were significantly higher in uRPL than in uI, and endometrial CD56 bright /NKp46 bright /RORγt + cells were positively correlated with PB. In UE, CD56 bright /RORγt + cells were negatively correlated with CD56 bright /interferon-γ + and CD56 bright /tumor necrosis factor-α + cells of uRPL. RORγt may be associated with NK22 cells in reproduction. Particularly, higher expression of RORγt may be associated with elevated NK22 cells in uRPL. © 2016 Japan Society of Obstetrics and Gynecology.

  2. Peretinoin, an acyclic retinoid, suppresses steatohepatitis and tumorigenesis by activating autophagy in mice fed an atherogenic high-fat diet

    PubMed Central

    Honda, Masao; Takegoshi, Kai; Yamashita, Taro; Nakamura, Mikiko; Shirasaki, Takayoshi; Sakai, Yoshio; Shimakami, Tetsuro; Nagata, Naoto; Takamura, Toshinari; Tanaka, Takuji; Kaneko, Shuichi

    2017-01-01

    The pathogenesis of non-alcoholic steatohepatitis (NASH) is still unclear and the prevention of the development of hepatocellular carcinoma (HCC) has not been established. We established an atherogenic and high-fat diet mouse model that develops hepatic steatosis, inflammation, fibrosis, and liver tumors at a high frequency. Using two NASH-HCC mouse models, we showed that peretinoin, an acyclic retinoid, significantly improved liver histology and reduced the incidence of liver tumors. Interestingly, we found that peretinoin induced autophagy in the liver of mice, which was characterized by the increased co-localized expression of microtubule-associated protein light chain 3B-II and lysosome-associated membrane protein 2, and increased autophagosome formation and autophagy flux in the liver. These findings were confirmed using primary mouse hepatocytes. Among representative autophagy pathways, the autophagy related (Atg) 5-Atg12-Atg16L1 pathway was impaired; especially, Atg16L1 was repressed at both the mRNA and protein level. Decreased Atg16L1 mRNA expression was also found in the liver of patients with NASH according to disease progression. Promoter analysis revealed that peretinoin activated the promoter of Atg16L1 by increasing the expression of CCAAT/enhancer-binding-protein-alpha. Interestingly, Atg16L1 overexpression in HepG2 cells inhibited palmitate-induced NF-kB activation and interleukin-6-induced STAT3 activation. We showed that Atg16L1 induced the de-phosphorylation of Gp130, a receptor subunit of interleukin-6 family cytokines, which subsequently repressed phosphorylated-STAT3 (Tyr705) levels, and this process might be independent of autophagy function. Thus, peretinoin prevents the progression of NASH and the development of HCC through activating the autophagy pathway by increased Atg16L1 expression, which is an essential regulator of autophagy and anti-inflammatory proteins. PMID:28591717

  3. Retinoic acid‐induced glandular differentiation of the oesophagus

    PubMed Central

    Chang, Chih‐Long; Lao‐Sirieix, Pierre; Save, Vicki; De La Cueva Mendez, Guillermo; Laskey, Ron; Fitzgerald, Rebecca C

    2007-01-01

    Background Retinoic acid (RA) is a powerful differentiation agent. Barrett's oesophagus occurs when duodeno‐gastro‐oesophageal reflux causes squamous epithelium (SE) tissue to become columnar epithelium tissue by an unknown mechanism. The bile acid lithocholic acid (LCA) competes for the retinoid X receptor retinoid binding site. Hence, RA pathways may be implicated in Barrett's oesophagus. Methods RA activity in tissues and cell lines treated with all‐trans retinoic acid (ATRA) with or without LCA was assessed using a reporter. Expression of p21 was determined by real‐time PCR in Barrett's oesophagus cell lines with or without LCA. SE and Barrett's oesophagus biopsy specimens were exposed to 100 μM of ATRA or 20 mM of a RA inhibitor, citral, in organ culture for >72 h. Characteristics of treated specimens, compared with untreated controls, were analysed by immunohistochemical analysis (cytokeratins (CKs), vimentin) and RT‐PCR (CKs). Confocal microscopy assessed temporal changes in co‐localisation of CK8/18 and vimentin. Cell proliferation was assessed by bromo‐deoxyuridine incorporation and immunohistochemical analysis for Ki67 and p21. Results RA biosynthesis was increased in Barrett's oesophagus compared with SE (p<0.001). LCA and ATRA caused a synergistic increase in RA signalling as shown by increased p21 (p<0.01). Morphological and molecular analysis of SE exposed to ATRA showed columnar differentiation independent of proliferation. Metaplasia could be induced from the stromal compartment alone and vimentin expression co‐localised with CK8/18 at 24 h, which separated into CK8/18‐positive glands and vimentin‐positive stroma by 48 h. Citral‐treated Barrett's oesophagus led to phenotypic and immunohistochemical characteristics of SE, which was independent of proliferation. Conclusion RA activity is increased in Barrett's oesophagus and is induced by LCA. Under conditions of altered RA activity and an intact stroma, the oesophageal phenotype can be altered independent of proliferation. PMID:17185354

  4. Implication of multiple mechanisms in apoptosis induced by the synthetic retinoid CD437 in human prostate carcinoma cells.

    PubMed

    Sun, S Y; Yue, P; Lotan, R

    2000-09-14

    The synthetic retinoid 6-[3-(1-adamantyl)-4-hydroxyphenyl]-2-naphthalene carboxylic acid (CD437) induces apoptosis in several types of cancer cell. CD437 inhibited the growth of both androgen-dependent and -independent human prostate carcinoma (HPC) cells in a concentration-dependent manner by rapid induction of apoptosis. CD437 was more effective in killing androgen-independent HPC cells such as DU145 and PC-3 than the androgen-dependent LNCaP cells. The caspase inhibitors Z-VAD-FMK and Z-DEVD-FMK blocked apoptosis induced by CD437 in DU145 and LNCaP cells, in which increased caspase-3 activity and PARP cleavage were observed, but not in PC-3 cells, in which CD437 did not induce caspase-3 activation and PARP cleavage. Thus, CD437 can induce either caspase-dependent or caspase-independent apoptosis in HPC cells. CD437 increased the expression of c-Myc, c-Jun, c-Fos, and death receptors DR4, DR5 and Fas. CD437's potency in apoptosis induction in the different cell lines was correlated with its effects on the expression of oncogenes and death receptors, thus implicating these genes in CD437-induced apoptosis in HPC cells. However, the importance and contribution of each of these genes in different HPC cell lines may vary. Because CD437 induced the expression of DR4, DR5 and Fas, we examined the effects of combining CD437 and tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) and Fas ligand, respectively, in HPC cells. We found synergistic induction of apoptosis, highlighting the importance of the modulation of these death receptors in CD437-induced apoptosis in HPC cells. This result also suggests a potential strategy of using CD437 with TRAIL for treatment of HPC. Oncogene (2000) 19, 4513 - 4522.

  5. Pharmacological and rAAV Gene Therapy Rescue of Visual Functions in a Blind Mouse Model of Leber Congenital Amaurosis

    PubMed Central

    Batten, Matthew L; Imanishi, Yoshikazu; Tu, Daniel C; Doan, Thuy; Zhu, Li; Pang, Jijing; Glushakova, Lyudmila; Moise, Alexander R; Baehr, Wolfgang; Van Gelder, Russell N.; Hauswirth, William W; Rieke, Fred; Palczewski, Krzysztof

    2005-01-01

    Background Leber congenital amaurosis (LCA), a heterogeneous early-onset retinal dystrophy, accounts for ~15% of inherited congenital blindness. One cause of LCA is loss of the enzyme lecithin:retinol acyl transferase (LRAT), which is required for regeneration of the visual photopigment in the retina. Methods and Findings An animal model of LCA, the Lrat −/− mouse, recapitulates clinical features of the human disease. Here, we report that two interventions—intraocular gene therapy and oral pharmacologic treatment with novel retinoid compounds—each restore retinal function to Lrat −/− mice. Gene therapy using intraocular injection of recombinant adeno-associated virus carrying the Lrat gene successfully restored electroretinographic responses to ~50% of wild-type levels (p < 0.05 versus wild-type and knockout controls), and pupillary light responses (PLRs) of Lrat −/− mice increased ~2.5 log units (p < 0.05). Pharmacological intervention with orally administered pro-drugs 9-cis-retinyl acetate and 9-cis-retinyl succinate (which chemically bypass the LRAT-catalyzed step in chromophore regeneration) also caused long-lasting restoration of retinal function in LRAT-deficient mice and increased ERG response from ~5% of wild-type levels in Lrat −/− mice to ~50% of wild-type levels in treated Lrat −/− mice (p < 0.05 versus wild-type and knockout controls). The interventions produced markedly increased levels of visual pigment from undetectable levels to 600 pmoles per eye in retinoid treated mice, and ~1,000-fold improvements in PLR and electroretinogram sensitivity. The techniques were complementary when combined. Conclusion Intraocular gene therapy and pharmacologic bypass provide highly effective and complementary means for restoring retinal function in this animal model of human hereditary blindness. These complementary methods offer hope of developing treatment to restore vision in humans with certain forms of hereditary congenital blindness. PMID:16250670

  6. Suppressive effects of RXR agonist PA024 on adrenal CYP11B2 expression, aldosterone secretion and blood pressure.

    PubMed

    Suzuki, Dai; Saito-Hakoda, Akiko; Ito, Ryo; Shimizu, Kyoko; Parvin, Rehana; Shimada, Hiroki; Noro, Erika; Suzuki, Susumu; Fujiwara, Ikuma; Kagechika, Hiroyuki; Rainey, William E; Kure, Shigeo; Ito, Sadayoshi; Yokoyama, Atsushi; Sugawara, Akira

    2017-01-01

    The effects of retinoids on adrenal aldosterone synthase gene (CYP11B2) expression and aldosterone secretion are still unknown. We therefore examined the effects of nuclear retinoid X receptor (RXR) pan-agonist PA024 on CYP11B2 expression, aldosterone secretion and blood pressure, to elucidate its potential as a novel anti-hypertensive drug. We demonstrated that PA024 significantly suppressed angiotensin II (Ang II)-induced CYP11B2 mRNA expression, promoter activity and aldosterone secretion in human adrenocortical H295R cells. Human CYP11B2 promoter functional analyses using its deletion and point mutants indicated that the suppression of CYP11B2 promoter activity by PA024 was in the region from -1521 (full length) to -106 including the NBRE-1 and the Ad5 elements, and the Ad5 element may be mainly involved in the PA024-mediated suppression. PA024 also significantly suppressed the Ang II-induced mRNA expression of transcription factors NURR1 and NGFIB that bind to and activate the Ad5 element. NURR1 overexpression demonstrated that the decrease of NURR1 expression may contribute to the PA024-mediated suppression of CYP11B2 transcription. PA024 also suppressed the Ang II-induced mRNA expression of StAR, HSD3β2 and CYP21A2, a steroidogenic enzyme group involved in aldosterone biosynthesis. Additionally, the PA024-mediated CYP11B2 transcription suppression was shown to be exerted via RXRα. Moreover, the combination of PPARγ agonist pioglitazone and PA024 caused synergistic suppressive effects on CYP11B2 mRNA expression. Finally, PA024 treatment significantly lowered both the systolic and diastolic blood pressure in Tsukuba hypertensive mice (hRN8-12 x hAG2-5). Thus, RXR pan-agonist PA024 may be a candidate anti-hypertensive drugs that acts via the suppression of aldosterone synthesis and secretion.

  7. Influence of N-methyl-N-nitrosourea, testosterone, and N-(4-hydroxyphenyl)-all-trans-retinamide on prostate cancer induction in Wistar-Unilever rats.

    PubMed

    McCormick, D L; Rao, K V; Dooley, L; Steele, V E; Lubet, R A; Kelloff, G J; Bosland, M C

    1998-08-01

    The influence of chemical carcinogen, hormonal stimulation, and chronic dietary administration of the synthetic retinoid, N-(4-hydroxyphenyl)-all-trans-retinamide (4-HPR), on the induction of prostate cancer in male Wistar-Unilever rats was determined. Three different tumor induction regimens were used: (a) a single i.v. dose of 50 mg of N-methyl-N-nitrosourea (MNU) per kg body weight, followed by chronic androgen stimulation via s.c. implantation of two silastic capsules containing 40 mg testosterone each; (b) a single i.v. dose of 50 mg of MNU per kg body weight (no testosterone treatment); and (c) chronic androgen stimulation with implanted testosterone capsules (no MNU treatment). In a fourth series of animals, the incidence of spontaneous prostate tumors was determined in groups of rats receiving neither carcinogen nor hormone stimulation. Within each series, parallel groups of animals were fed a control (vehicle-supplemented) diet or control diet supplemented with 4-HPR beginning 1 day after carcinogen administration; retinoid administration was continuous until termination of the study at 450 days. The incidence of accessory sex gland cancer in rats treated sequentially with MNU + testosterone was >60%, in comparison with cancer incidences of <20% in rats receiving MNU only and <5% in rats treated with testosterone only. No spontaneous accessory sex gland tumors were observed in rats receiving no carcinogen and no testosterone. Tumor induction in the accessory sex glands by MNU + testosterone was relatively specific for the prostate: the incidence of carcinoma of the dorsolateral/anterior prostate was more than 5-fold greater than the incidence of cancer present only in the seminal vesicle. 4-HPR conferred no protection against cancer induction in the prostate by any regimen of MNU and/or testosterone. These results demonstrate the importance of both carcinogen exposure and hormone stimulation on the induction of neoplasia in the prostate of Wistar-Unilever rats.

  8. A regulatory sequence from the retinoid X receptor γ gene directs expression to horizontal cells and photoreceptors in the embryonic chicken retina.

    PubMed

    Blixt, Maria K E; Hallböök, Finn

    2016-01-01

    Combining techniques of episomal vector gene-specific Cre expression and genomic integration using the piggyBac transposon system enables studies of gene expression-specific cell lineage tracing in the chicken retina. In this work, we aimed to target the retinal horizontal cell progenitors. A 208 bp gene regulatory sequence from the chicken retinoid X receptor γ gene (RXRγ208) was used to drive Cre expression. RXRγ is expressed in progenitors and photoreceptors during development. The vector was combined with a piggyBac "donor" vector containing a floxed STOP sequence followed by enhanced green fluorescent protein (EGFP), as well as a piggyBac helper vector for efficient integration into the host cell genome. The vectors were introduced into the embryonic chicken retina with in ovo electroporation. Tissue electroporation targets specific developmental time points and in specific structures. Cells that drove Cre expression from the regulatory RXRγ208 sequence excised the floxed STOP-sequence and expressed GFP. The approach generated a stable lineage with robust expression of GFP in retinal cells that have activated transcription from the RXRγ208 sequence. Furthermore, GFP was expressed in cells that express horizontal or photoreceptor markers when electroporation was performed between developmental stages 22 and 28. Electroporation of a stage 12 optic cup gave multiple cell types in accordance with RXRγ gene expression in the early retina. In this study, we describe an easy, cost-effective, and time-efficient method for testing regulatory sequences in general. More specifically, our results open up the possibility for further studies of the RXRγ-gene regulatory network governing the formation of photoreceptor and horizontal cells. In addition, the method presents approaches to target the expression of effector genes, such as regulators of cell fate or cell cycle progression, to these cells and their progenitor.

  9. Identification of the 11-cis-specific retinyl-ester synthase in retinal Müller cells as multifunctional O-acyltransferase (MFAT)

    PubMed Central

    Kaylor, Joanna J.; Cook, Jeremy D.; Makshanoff, Jacob; Bischoff, Nicholas; Yong, Jennifer; Travis, Gabriel H.

    2014-01-01

    Absorption of a photon by a rhodopsin or cone-opsin pigment isomerizes its 11-cis-retinaldehyde (11-cis-RAL) chromophore to all-trans-retinaldehyde (all-trans-RAL), which dissociates after a brief period of activation. Light sensitivity is restored to the resulting apo-opsin when it recombines with another 11-cis-RAL. Conversion of all-trans-RAL to 11-cis-RAL is carried out by an enzyme pathway called the visual cycle in cells of the retinal pigment epithelium. A second visual cycle is present in Müller cells of the retina. The retinol isomerase for this noncanonical pathway is dihydroceramide desaturase (DES1), which catalyzes equilibrium isomerization of retinol. Because 11-cis-retinol (11-cis-ROL) constitutes only a small fraction of total retinols in an equilibrium mixture, a subsequent step involving selective removal of 11-cis-ROL is required to drive synthesis of 11-cis-retinoids for production of visual chromophore. Selective esterification of 11-cis-ROL is one possibility. Crude homogenates of chicken retinas rapidly convert all-trans-ROL to 11-cis-retinyl esters (11-cis-REs) with minimal formation of other retinyl-ester isomers. This enzymatic activity implies the existence of an 11-cis-specific retinyl-ester synthase in Müller cells. Here, we evaluated multifunctional O-acyltransferase (MFAT) as a candidate for this 11-cis-RE-synthase. MFAT exhibited much higher catalytic efficiency as a synthase of 11-cis-REs versus other retinyl-ester isomers. Further, we show that MFAT is expressed in Müller cells. Finally, homogenates of cells coexpressing DES1 and MFAT catalyzed the conversion of all-trans-ROL to 11-cis-RP, similar to what we observed with chicken-retina homogenates. MFAT is therefore an excellent candidate for the retinyl-ester synthase that cooperates with DES1 to drive synthesis of 11-cis-retinoids by mass action. PMID:24799687

  10. The topical treatment of psoriasis.

    PubMed

    van de Kerkhof, P C M; Vissers, W H P M

    2003-01-01

    According to the patients, improvement of efficacy, long-term safety and improvement of compliance are needed. The topical treatment has been innovated during the last decade. Most important are the introduction of two new classes of treatments: topical vitamin D(3) analogues and the retinoid tazarotene. To what extent, however, have we achieved developments which are in line with the needs as expressed by the patients? Improved efficacy has been realized by successful combinations of topical treatments. In particular, the combinations of dithranol, vitamin D(3) and tazarotene with a topical corticosteroid proved to be very effective with a reduced profile of side-effects. The efficacy of vitamin D(3) analogues and tazarotene is such that the efficacy of a potent corticosteroid (betamethasone-17-valerate) is approached; calcipotriol even showed an efficacy which is at least as good as this corticosteroid. The long-term safety of new compounds has been evaluated for at least 12 months in large studies. Remarkably for corticosteroids such information is available for only 12 weeks. However, intermittent applications of a topical corticosteroid in combination with another topical treatment provide an effective and safe long-term control of psoriasis. Compliance is a conditio sine qua non for an effective topical treatment. Important progress has been made to increase compliance. Short-contact dithranol has been popularized as an ambulatory treatment which is a highly effective approach as a care instruction programme. Formulations which are better from a cosmetical point of view have been developed for various topical treatments. Reduction of the frequency of applications proved to be possible for most treatments. Once daily applications for corticosteroids, vitamin D(3) analogues and retinoids have been developed, and intermittent applications, a few times per week, are possible for corticosteroids, which proved to be very effective with a reduced profile of side-effects, and are also developed for dithranol. Copyright 2003 S. Karger AG, Basel

  11. Effects of topical acne treatment on the ocular surface in patients with acne vulgaris.

    PubMed

    Aslan Bayhan, Seray; Bayhan, Hasan Ali; Çölgeçen, Emine; Gürdal, Canan

    2016-12-01

    To assess the ocular side effects during topical retinoid-antibiotic combination treatment in patients with facial acne vulgaris. Forty-three patients applying topical isotretinoin+erythromycin combination (isotrexin gel, GlaxoSmithKline) once daily for the treatment of acne vulgaris were enrolled. Full ophthalmologic examination, Schirmer test (with topical anesthesia), fluorescein break-up time (BUT), corneal fluorescein staining and tear osmolarity measurement with the TearLab system (TearLab Corporation) were carried out before and at the end of the first month of the treatment. For evaluation of symptoms participants completed the ocular surface disease index (OSDI) questionnaire at each visit. The mean age of the patients was 23.16±3.03 (18-30) years. Mean tear osmolarity increased significantly from 282.09±8.95 mOsm/L at baseline to 300.39±16.65 mOsm/L after the treatment (p<0.001). BUT decreased from an average of 11.93±1.12s at baseline to 6.65±3.03s at the end of the first month (p<0.001). The OSDI score worsened significantly (5.41±3.65 vs 21.53±12.95, p<0.001) and punctate epitheliopathy was seen in 51% of eyes after the treatment. The average Schirmer values were 13.09±1.90 and 12.41±2.44mm/5min before and at the end of the first month of the treatment, respectively (p=0.117). The findings of this study indicate that topical retinoid-antibiotic combination treatment causes significant signs and symptoms of dry eye. Patients receiving topical treatment for acne should be evaluated regularly to ensure the timely detection and treatment of pathologic signs on the ocular surface. Copyright © 2016 British Contact Lens Association. Published by Elsevier Ltd. All rights reserved.

  12. Cow's milk increases the activities of human nuclear receptors peroxisome proliferator-activated receptors alpha and delta and retinoid X receptor alpha involved in the regulation of energy homeostasis, obesity, and inflammation.

    PubMed

    Suhara, W; Koide, H; Okuzawa, T; Hayashi, D; Hashimoto, T; Kojo, H

    2009-09-01

    The nuclear peroxisome proliferator-activated receptors (PPAR) have been shown to play crucial roles in regulating energy homeostasis including lipid and carbohydrate metabolism, inflammatory responses, and cell proliferation, differentiation, and survival. Because PPAR agonists have the potential to prevent or ameliorate diseases such as hyperlipidemia, diabetes, atherosclerosis, and obesity, we have explored new natural agonists for PPAR. For this purpose, cow's milk was tested for agonistic activity toward human PPAR subtypes using a reporter gene assay. Milk increased human PPARalpha activity in a dose-dependent manner with a 3.2-fold increase at 0.5% (vol/vol). It also enhanced human PPARdelta activity in a dose-dependent manner with an 11.5-fold increase at 0.5%. However, it only slightly affected human PPARgamma activity. Ice cream, butter, and yogurt also increased the activities of PPARalpha and PPARdelta, whereas vegetable cream affected activity of PPARdelta but not PPARalpha. Skim milk enhanced the activity of PPAR to a lesser degree than regular milk. Milk and fresh cream increased the activity of human retinoid X receptor (RXR)alpha as well as PPARalpha and PPARdelta, whereas neither affected vitamin D3 receptor, estrogen receptors alpha and beta, or thyroid receptors alpha and beta. Both milk and fresh cream were shown by quantitative real-time PCR to increase the quantity of mRNA for uncoupling protein 2 (UCP2), an energy expenditure gene, in a dose-dependent manner. The increase in UCP2 mRNA was found to be reduced by treatment with PPARdelta-short interfering (si)RNA. This study unambiguously clarified at the cellular level that cow's milk increased the activities of human PPARalpha, PPARdelta, and RXRalpha. The possible role in enhancing the activities of PPARalpha, PPARdelta, and RXRalpha, and the health benefits of cow's milk were discussed.

  13. The distribution of immunomodulatory cells in the lungs of patients with idiopathic pulmonary fibrosis

    PubMed Central

    Nuovo, Gerard J.; Hagood, James S.; Magro, Cynthia M.; Chin, Nena; Kapil, Rubina; Davis, Luke; Marsh, Clay B.; Folcik, Virginia A.

    2011-01-01

    We have characterized the immune system involvement in the disease processes of idiopathic pulmonary fibrosis in novel ways. To do so, we analyzed lung tissue from 21 cases of idiopathic pulmonary fibrosis and 21 (non-fibrotic, non-cancerous) controls for immune cell and inflammation-related markers. The immunohistochemical analysis of the tissue was grouped by patterns of severity in disease pathology. There were significantly greater numbers of CD68+ and CD80+ cells, and significantly fewer CD3+, CD4+, and CD45RO+ cells in areas of relatively (histologically) normal lung in biopsies from idiopathic pulmonary fibrosis patients compared to controls. In zones of active disease, characterized by epithelial cell regeneration and fibrosis, there were significantly more cells expressing CD4, CD8, CD20, CD68, CD80, CCR6, S100, IL-17, tumor necrosis factor-α, and retinoic acid-related orphan receptors compared to histologically normal lung areas from idiopathic pulmonary fibrosis patients. Inflammation was implicated in these active regions by the cells that expressed retinoid orphan receptor-α, -β, and -γ, CCR6, and IL-17. The regenerating epithelial cells predominantly expressed these pro-inflammatory molecules, as evidenced by co-expression analyses with epithelial cytokeratins. Macrophages in pseudo-alveoli and CD3+ T cells in the fibrotic interstitium also expressed IL-17. Co-expression of IL-17 with retinoid orphan receptors, and epithelial cytoskeletal proteins, CD68, and CD3 in epithelial cells, macrophages, and T-cells, respectively, confirmed the production of IL-17 by these cell types. There was little staining for Foxp3, CD56, or CD34 in any idiopathic pulmonary fibrosis lung regions. The fibrotic regions had fewer immune cells overall. In summary, our study shows participation of innate and adaptive mononuclear cells in active-disease regions of idiopathic pulmonary fibrosis lung, where the regenerating epithelial cells appear to propagate inflammation. The regenerative mechanisms become skewed to ultimately result in lethal, fibrotic restriction of lung function. PMID:22037258

  14. The retinoid X receptor in a marine invertebrate chordate: evolutionary insights from urochordates.

    PubMed

    Maeng, Sejung; Lee, Jung Hwan; Choi, Sung-Chang; Kim, Mi Ae; Shin, Yun Kyung; Sohn, Young Chang

    2012-09-01

    Retinoid X receptors (RXRs) are highly conserved members of the nuclear hormone receptor family that mediate various physiological processes in vertebrates and invertebrates. We examined the expression patterns of RXR in the ascidian Halocynthia roretzi across a wide range of tissues and stages of embryo development, as well as the regulation of gene transcription by the ascidian RXR. H. roretzi RXR cDNA (HrRXR) was cloned from 64-cell stage embryos. The overall amino acid sequence of HrRXR showed high sequence identity with a urochordate Ciona intestinalis RXR (58%), but the ligand-binding domain of HrRXR was more similar to vertebrate orthologs than to those of invertebrate RXRs. Based on a phylogenetic analysis, HrRXR belongs to a group of urochordates that are separate from vertebrate RXRs, showing a clear evolutionary history. Real-time quantitative polymerase chain reaction and whole-mount in situ hybridization analyses revealed that the HrRXR mRNA is of maternal origin during embryogenesis, and in the examined adult tissues it is expressed in the muscles, gills, gonads, and the hepatopancreas. Immunofluorescence and immunohistochemical staining demonstrated that HrRXR is localized to the nucleus and highly expressed in the gills and hepatopancreas. Unlike human RXRα, HrRXR did not show 9-cis retinoic acid- and bexarotene (LGD1069)-dependent transactivation. While a synthetic ligand for farnesoid X receptor (FXR), GW4064, did not increase the transcriptional activation in HrRXR- or HrRXR/HrFXR-transfected HEK-293 cells, the ligand showed weak but significant activity for a single amino acid mutant of HrRXR ((Phe)231(Cys)) and HrFXR cotransfected cells. The present study suggests that the marine invertebrate chordate RXR may possess endogenous ligands that are different than vertebrate RXR ligands and which function during early embryonic stages. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Imposex induction is mediated through the Retinoid X Receptor signalling pathway in the neogastropod Nucella lapillus.

    PubMed

    Castro, L Filipe C; Lima, D; Machado, A; Melo, C; Hiromori, Y; Nishikawa, J; Nakanishi, T; Reis-Henriques, M A; Santos, M M

    2007-11-15

    The imposex phenomenon in female prosobranch gastropods provides one of the best documented examples of endocrine disruption in wildlife. While many field studies have demonstrated the negative impact of tributyltin (TBT) upon female gastropods, the mechanism(s) underlying imposex development has not yet been fully clarified. Over the years several hypotheses have been raised to determine the biochemical and molecular determinants of this process. Nevertheless, the interplay between the different suggested pathways (neuroendocrine, steroid and retinoid) is still unknown. Hence, through a combination of exposure experiments, we show that the 9-cis-retinoic acid (9cisRA), the proposed natural ligand of the retinoic X receptor (RXR), induces imposex in females of Nucella lapillus to the same degree as tributyltin, when administered at similar concentrations (1 microg/g body weight). Methoprene acid, a selective ligand for RXR, also induces imposex, albeit to a lower degree than that of the positive control. In contrast, testosterone significantly induced imposex, but had no effect on female penis induction, while the neuropeptide APGWamide had no effect on imposex development. These results clearly demonstrate that imposex induction in N. lapillus is mediated through the modulation of the RXR signalling pathways. In addition to the effects reported in female dogwhelks, both TBT and RA significantly increased male penis length, thus suggesting that TBT may also impact male secondary sex organs through the RXR signalling pathways. As a step for future studies, we have cloned the orthologue of N. lapillus RXR and provide experimental evidence that it binds 9cisRA. Finally, the basal expression level of RXR in several tissues of N. lapillus was determined through real-time PCR, thus showing that RXR is ubiquitously expressed in mollusc tissues, with the highest expression levels being recorded in female and male gonads. The mechanistic impacts of the overall findings to the imposex process are discussed.

  16. Retinoic acid modulates intrahippocampal levels of corticosterone in middle-aged mice: consequences on hippocampal plasticity and contextual memory

    PubMed Central

    Bonhomme, Damien; Pallet, Véronique; Dominguez, Gaelle; Servant, Laure; Henkous, Nadia; Lafenêtre, Pauline; Higueret, Paul; Béracochéa, Daniel; Touyarot, Katia

    2014-01-01

    It is now established that vitamin A and its derivatives, retinoic acid (RA), are required for cognitive functions in adulthood. RA hyposignaling and hyperactivity of glucocorticoid (GC) pathway appear concomitantly during aging and would contribute to the deterioration of hippocampal synaptic plasticity and functions. Furthermore, recent data have evidenced counteracting effects of retinoids on GC signaling pathway. In the present study, we addressed the following issue: whether the stimulation of RA pathway could modulate intrahippocampal corticosterone (CORT) levels in middle-aged mice and thereby impact on hippocampal plasticity and cognitive functions. We firstly investigated the effects of vitamin A supplementation and RA treatment in middle-aged mice, on contextual serial discrimination task, a paradigm which allows the detection of early signs of age-related hippocampal-dependent memory dysfunction. We then measured intrahippocampal CORT concentrations by microdialysis before and after a novelty-induced stress. Our results show that both RA treatment and vitamin A supplementation improve “episodic-like” memory in middle-aged mice but RA treatment appears to be more efficient. Moreover, we show that the beneficial effect of RA on memory is associated to an increase in hippocampal PSD-95 expression. In addition, intrahippocampal CORT levels are reduced after novelty-induced stress in RA-treated animals. This effect cannot be related to a modulation of hippocampal 11β-HSD1 expression. Interestingly, RA treatment induces a modulation of RA receptors RARα and RARβ expression in middle-aged mice, a finding which has been correlated with the amplitude of intrahippocampal CORT levels after novelty-induced stress. Taken together, our results suggest that the preventive action of RA treatment on age-related memory deficits in middle-aged mice could be, at least in part, due to an inhibitory effect of retinoids on GC activity. PMID:24570662

  17. Vitamin D receptor displays DNA binding and transactivation as a heterodimer with the retinoid X receptor, but not with the thyroid hormone receptor.

    PubMed

    Thompson, P D; Hsieh, J C; Whitfield, G K; Haussler, C A; Jurutka, P W; Galligan, M A; Tillman, J B; Spindler, S R; Haussler, M R

    1999-12-01

    The vitamin D receptor (VDR) is a transcription factor believed to function as a heterodimer with the retinoid X receptor (RXR). However, it was reported [Schräder et al., 1994] that, on putative vitamin D response elements (VDREs) within the rat 9k and mouse 28k calcium binding protein genes (rCaBP 9k and mCaBP 28k), VDR and thyroid hormone receptor (TR) form heterodimers that transactivate in response to both 1,25-dihydroxyvitamin D(3) (1,25(OH)(2)D(3)) and triiodothyronine (T(3)). We, therefore, examined associations of these receptors on the putative rCaBP 9k and mCaBP 28k VDREs, as well as on established VDREs from the rat osteocalcin (rOC) and mouse osteopontin (mOP) genes, plus the thyroid hormone response element (TRE) from the rat myosin heavy chain (rMHC) gene. In gel mobility shift assays, we found no evidence for VDR-TR heterodimer interaction with any tested element. Further, employing these hormone response elements linked to reporter genes in transfected cells, VDR and TR mediated responses to their cognate ligands only from the rOC/mOP and rMHC elements, respectively, while the CaBP elements were unresponsive to any combination of ligand(s). Utilizing the rOC and mOP VDREs, two distinct repressive actions of TR on VDR-mediated signaling were demonstrated: a T(3)-independent action, presumably via direct TR-RXR competition for DNA binding, and a T(3)-dependent repression, likely by diversion of limiting RXR from VDR-RXR toward the formation of TR-RXR heterodimers. The relative importance of these two mechanisms differed in a response element-specific manner. These results may provide a partial explanation for the observed association between hyperthyroidism and bone demineralization/osteoporosis. Copyright 1999 Wiley-Liss, Inc.

  18. Foraging in maize field areas: A risky business?

    PubMed

    Boily, Monique; Aras, Philippe; Jumarie, Catherine

    2017-12-01

    In Quebec, Canada, the cultivation of maize dominates the agricultural territory. This crop requires a sustained supply of fertilizers from different sources: chemical, natural or from residual materials (sludge). These amendments contain metallic trace elements, which may lead to metal-contaminated maize pollen, a possible source of prooxidants for the foraging bees. Our objective was to determine whether maize fields environment influences the oxidation processes and the accumulation of metals in bees. A few days prior to pollen shedding, beehives were installed in maize fields: one organically grown (site A) and three conventionally grown (sites B, C and D). Soil, maize pollen and bees were analyzed for metal content. Every 15days, bees were collected and analyzed for peroxidation of lipids, metallothionein-like proteins (MTLPs), proteins, retinoids and lipophilic antioxidants (carotenoids and α-tocopherol). The compound β-carotene was the most abundant in bees from all sites, followed by α-carotene, β-cryptoxanthin, α-cryptoxanthin, zeaxanthin and lutein. Retinaldehyde and retinol varied according to times and sites without demonstrating clear trends. However, significant differences between sites were noted in 13-cis-retinoic acid and two retinoic acid metabolites measured in bees, suggesting alteration in the reduction-oxidation processes. In line with these results, the level of lipid peroxidation was globally higher in sites B, C and D compared with the organic site. Higher concentrations of metals were observed in soil and pollen from the field A, but bees metal contents were equal or less than those measured in bees from other sites. Higher bee MTLP levels were measured in sites B, C and D. For most sampling times, the discriminant analysis revealed that the conditions were distinguished by the oxidation processes in bees. Our data suggest that bees foraging in conventionally grown maize fields are at risk of increased oxidative damages which can alter the fine regulation of retinoids. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Technical brief: Pump-probe paradigm in an integrating cavity to study photodecomposition processes

    PubMed Central

    Betts-Obregon, Brandi; Tsin, Andrew T.; DeSa, Richard J.

    2016-01-01

    Purpose Assaying photodecomposition is challenging because light must be used to initiate the photodamage and light must be used to monitor the photodecomposition. The experimental requirements are as follows: 1) During exposure of the actinic beam, continuously monitor the spectral characteristics of the sample, 2) uniformly expose the reactants to the actinic source, 3) obtain informative spectra in the presence of light scatter, and 4) achieve sufficient sensitivity for dilute reactants. Traditional spectrophotometers cannot address these issues due to sample turbidity, the inability to uniformly expose the cuvette contents to the incident beam, the inability to simultaneously perform spectral scans, and inherent low sensitivity. Here, we describe a system that meets these challenges in a practical way. Methods Light access to a 8.6 ml quartz integrating sphere containing 10 µM all-trans retinol in PBS was provided by three ports at right angles allowing for the following: 1) actinic light delivery from light-emitting diodes (LEDs) firing at 100 pulses/sec, 2) entry of a separate scanning beam at 100 scans/sec (10,000 µsec scan time) via an OLIS RSM 1000 ultraviolet/visual (UV/Vis) rapid-scanning spectrophotometer (RSM), and 3) light exit to the detector photomultiplier. The RSM spectral intermediate slit was partially covered to allow for a “dark” period of 2,000 µsec when no scanning light was admitted to the cuvette. During that interval, the LED was flashed, and the photomultiplier was temporarily blocked by a perforated spinning shutter disk. The absorbance per centimeter, which is increased due to the internal reflectance of the integrating sphere compared to a standard 1 cm rectangular cuvette, was calculated according to Fry et al. (2010) Applied Optics 49:575. Retinoid photodecomposition was confirmed with high-performance liquid chromatography (HPLC). Results Using the RSM to trigger the LED flash and photomultiplier shutter closure during the “dark” period allowed actinic flashes to be placed between scans. Exposure of the all-trans retinol to 366 nm flashes resulted in marked reduction in absorbance and a blue shift of the λmax. A white LED, despite its higher photon output, did not support all-trans retinol photolysis. Singular value decomposition (SVD) analysis revealed three spectral intermediates with mechanism, I -> II -> III. HPLC analysis of the reactants at the beginning and the conclusion of the light exposure confirmed the retinol photodecomposition. Conclusions The highly reflecting cavity acts as a multipass cuvette that markedly increased the light path length and, thus, sensitivity. Triggering the LED during a dark period within the scan time allowed the actinic flashes to be interleafed between scans in a pump-probe paradigm. Furthermore, the entire sample was exposed to scan beam and actinic flashes, which is not possible in traditional spectrophotometers. Finally, the integrating cavity cuvette allowed use of turbid samples. SVD was useful for resolving spectral intermediates. Although the identity of the intermediates was not determined here, the ability to define molecular intermediates during photodecomposition reactions will allow future studies to isolate and identify the degradation products and determine the mechanism of light-induced retinoid degradation and that of retinoid-binding protein-mediated photoprotection. PMID:27559291

  20. Raman microimaging of murine lungs: insight into the vitamin A content.

    PubMed

    Marzec, K M; Kochan, K; Fedorowicz, A; Jasztal, A; Chruszcz-Lipska, K; Dobrowolski, J Cz; Chlopicki, S; Baranska, M

    2015-04-07

    The composition of the lung tissue of mice was investigated using Raman confocal microscopy at 532 nm excitation wavelength and was supported with various staining techniques as well as DFT calculations. This combination of experimental and theoretical techniques allows for the study of the distribution of lung lipofibroblasts (LIFs), rich in vitamin A, as well as the chemical structure of vitamin A. The comparison of the Raman spectra derived from LIFs with the experimental and theoretical spectra of standard retinoids showed the ability of LIFs to store all-trans retinol, which is partially oxidized to all-trans retinal and retinoic acid. Moreover, we were able to visualize the distribution of other lung tissue components including the surfactant and selected enzymes (lipoxygenase/glucose oxidase).

  1. Apremilast Use in a Case of Cicatricial Ectropion Secondary to Severe Lamellar Ichthyosis.

    PubMed

    Abboud, Jean-Paul J; Whittington, Alexander; Ahmed, Masih; Himebaugh, Jesse T; Wiley, Lee A; Haffar, Ahmad; Nguyen, John

    Ichthyosis is a cutaneous disorder characterized by excessive amounts of dry thickened skin surface scales. Ocular manifestations of ichthyosis include cicatricial ectropion, which may cause exposure keratoconjunctivitis and rarely corneal perforation. Topical emollients, anti-inflammatory ointments, and systemic retinoids have been used to control the disease process, while surgical correction with donor graft has been reserved for severe cases involving corneal exposure. The authors report a case of a Caucasian male with lamellar ichthyosis with severe bilateral upper and lower eyelid cicatricial ectropion and corneal ulceration requiring surgical correction. Treatment with apremilast, a novel phosphodiesterase-4 inhibitor, for the treatment of a concomitant plaque psoriasis achieved good control of his skin diseases and minimized the recurrence of eyelid ectropion.

  2. Techniques for Optimizing Surgical Scars, Part 3: Erythema, Hyperpigmentation, and Hypopigmentation.

    PubMed

    Potter, Kathryn; Konda, Sailesh; Ren, Vicky Zhen; Wang, Apphia Lihan; Srinivasan, Aditya; Chilukuri, Suneel

    2018-01-01

    Surgical management of benign or malignant cutaneous tumors may result in noticeable scars that are of great concern to patients, regardless of sex, age, or ethnicity. Techniques to optimize surgical scars are discussed in this three-part review. Part 3 focuses on scar revision for erythema, hyperpigmentation, and hypopigmentation. Scar revision options for erythematous scars include moist exposed burn ointment (MEBO), onion extract, silicone, methyl aminolevulinate-photodynamic therapy (MAL-PDT), pulsed dye laser, intense pulsed light (IPL), and nonablative fractional lasers. Hyperpigmented scars may be treated with tyrosinase inhibitors, IPL, and nonablative fractional lasers. Hypopigmented scars may be treated with needle dermabrasion, medical tattoos, autologous cell transplantation, prostaglandin analogues, retinoids, calcineurin inhibitors, excimer laser, and nonablative fractional lasers.

  3. Update on the use of alitretinoin in treating chronic hand eczema

    PubMed Central

    Ghasri, Pedram; Scheinfeld, Noah

    2010-01-01

    Chronic hand eczema is a debilitating dermatological condition with significant economic, social, and functional impacts. To date, conventional treatments such as topical corticosteroids, phototherapy, and systemic immunosuppressants have yielded disappointing results, owing to either a lack of efficacy or significant adverse events. Oral alitretinoin (9-cis-retinoic acid) is a unique panagonist retinoid with immunomodulatory and anti-inflammatory activity that has emerged as a novel treatment for chronic hand eczema. Several large-scale clinical studies have demonstrated oral alitretinoin’s high efficacy rate of 28% to 89%, its safe tolerability profile, and its positive impact on quality of life, validating it as a therapeutic option for patients with severe chronic hand eczema refractory to standard treatment. PMID:21437060

  4. Retinoic acid concentrations in patients with squamous cell carcinoma of the head and neck.

    PubMed

    Wahlberg, P; Fex, G

    1996-02-01

    The serum concentrations of all-trans (atRA) and 13-cis (13cRA) retinoic acid were determined by high performance liquid chromatography in 27 patients with squamous cell carcinoma of the head and neck and in 80 healthy controls. This investigation seemed relevant as ethanol is an aetiological factor in these cancers and has been suggested to interfere with the synthesis of atRA. Neither the serum concentration of atRA nor that of 13cRA differed between patients and controls. The serum atRA concentration did not differ between fasting and non-fasting patients, but the serum 13cRA concentration was significantly higher in non-fasting than in fasting patients, probably due to the dietary retinoid content.

  5. Vitamin A supplementation increases levels of retinoic acid compounds in human plasma: possible implications for teratogenesis.

    PubMed

    Eckhoff, C; Nau, H

    1990-01-01

    The concentrations of retinoic acid compounds were monitored by a newly developed highly sensitive HPLC procedure in plasma of six volunteers who received 833 IU vitamin A per kg body weight per day during a 20-day period. There was a significant increase of all-trans-retinoic acid (two-fold), 13-cis-retinoic acid (7-fold) and 13-cis-4-oxoretinoic acid (5-fold) over endogenous plasma levels of these retinoids. The same compounds had previously been found after treatment with the teratogenic drug isotretinoin (Roaccutan, Accutane). Our results raise the possibility that high vitamin A intake may carry a teratogenic risk attributable to increased levels of retinoic acid compounds generated from retinol by metabolic processes.

  6. [Chronic blepharoconjunctivitis during a treatment with acitretin (Soriatane)].

    PubMed

    Denis, P; Nordmann, J P; Saiag, P; Liotet, S; Laroche, L; Saraux, H

    1993-01-01

    We report external ocular side effects after treatment with acitretin, a new synthetic vitamin A analogue and the main metabolite of etretinate. A patient treated with 20-25 mg/day of acitretin for psoriasis suffered from chronic blepharoconjunctivitis. Schirmer tests, tear lysozyme were normal while rose bengal and fluorescein staining disclosed epithelial punctate defects and tear break-up time was shortened. Meibomian glands of the lower lid were photographed with transillumination and appeared atrophic. Conjunctival cytology and biopsy showed snake-like chromatine appearance, keratinized epithelial cells and some lymphocytes infiltrates. Accessory salivary gland histological aspects were nonspecific. There was a clear relationship between restarting the acitretin therapy and recurrence of ocular symptoms. Acitretin, like other retinoids, may induce or exacerbate blepharoconjunctivitis in patients with psoriasis.

  7. Using a Distant Abdominal Skin Flap to Treat Digital Constriction Bands: A Case Report for Vohwinkel Syndrome.

    PubMed

    Zhang, Mingzi; Song, Kexin; Ding, Ning; Shu, Chang; Wang, Youbin

    2016-02-01

    In this study, a Vohwinkel syndrome case is presented where in 5th digit constriction bands in the right hand were reconstructed using a distant abdominal skin flap. Vohwinkel syndrome, or keratoderma hereditarium mutilans, is a rare, autosomal dominant genetic skin condition that causes palmoplantar hyperkeratosis and constricts finger and/or toe bands. In a typical manifestation, the finger and toe constriction bands lead to progressive strangulation and autoamputation, which requires immediate clinical treatment. Topical keratolytics and systemic retinoids have been used to treat hyperkeratosis but without consistent results. Only 1 effective approach for autoamputation has been accepted, reconstructive surgery.Applying a distant abdominal skin flap produced satisfying postoperative effects at the 18-month follow-up.

  8. Energy-Based Devices in Treatment of Acne Vulgaris.

    PubMed

    Handler, Marc Z; Bloom, Bradley S; Goldberg, David J

    2016-05-01

    Acne vulgaris is a chronic dermatologic complaint with a multifactorial cause. Traditionally, antibiotics and retinoids have been used to manage the condition; patient compliance has been an ongoing issue. A variety of energy-based devices have been reported to be effective in the treatment of acne vulgaris. To review and summarize the current literature specific to treatment of acne vulgaris with energy-based devices. A review of the current literature of energy-based devices used for the treatment of acne vulgaris. Although limited randomized controlled trials for the treatment of acne have been performed, significant clinical improvement of acne vulgaris, especially of inflammatory lesions, has been demonstrated with a variety of energy-based devices. Newer approaches may lead to even better results.

  9. Unusual cortical bone features in a patient with gorlin-goltz syndrome: a case report.

    PubMed

    Tarnoki, Adam Domonkos; Tarnoki, David Laszlo; Klara Kiss, Katalin; Bata, Pal; Karlinger, Kinga; Banvolgyi, Andras; Wikonkal, Norbert; Berczi, Viktor

    2014-12-01

    Gorlin-Goltz syndrome (GGS) consists of ectodermal and mesodermal abnormalities. In this case report we will investigate lower extremity lesions of GGS. A 52-year-old man with GGS underwent skull and lower extremity computer tomography. Radiographic findings included cervical spondylosis, transparent areas with slurred margins, and cerebral falx calcification. Tibial and fibular specific cortical lesions (thin cortical and subcortical cystic lesions) were seen on the radiography, which was confirmed by computer tomography. To our knowledge, this is the first report of such a long lesion of the tibia and fibula. Specific lower extremity cortical lesions (thin cortical and subcortical cystic lesions) may occur and these abnormalities can be found on radiography or CT, which are most probably attributed to retinoid treatment.

  10. Unusual Cortical Bone Features in a Patient with Gorlin-Goltz Syndrome: A Case Report

    PubMed Central

    Tarnoki, Adam Domonkos; Tarnoki, David Laszlo; Klara Kiss, Katalin; Bata, Pal; Karlinger, Kinga; Banvolgyi, Andras; Wikonkal, Norbert; Berczi, Viktor

    2014-01-01

    Gorlin-Goltz syndrome (GGS) consists of ectodermal and mesodermal abnormalities. In this case report we will investigate lower extremity lesions of GGS. A 52-year-old man with GGS underwent skull and lower extremity computer tomography. Radiographic findings included cervical spondylosis, transparent areas with slurred margins, and cerebral falx calcification. Tibial and fibular specific cortical lesions (thin cortical and subcortical cystic lesions) were seen on the radiography, which was confirmed by computer tomography. To our knowledge, this is the first report of such a long lesion of the tibia and fibula. Specific lower extremity cortical lesions (thin cortical and subcortical cystic lesions) may occur and these abnormalities can be found on radiography or CT, which are most probably attributed to retinoid treatment. PMID:25780550

  11. Nutrigenomic regulation of adipose tissue development --- role of retinoic acid: A review

    PubMed Central

    Wang, Bo; Yang, Qiyuan; Harris, Corrine L.; Nelson, Mark L.; Busboom, Jan R.; Zhu, Mei-Jun; Du, Min

    2016-01-01

    To improve the efficiency of animal production, livestock have been extensively selected or managed to reduce fat accumulation and increase lean growth, which reduces intramuscular or marbling fat content. To enhance marbling, a better understanding of the mechanisms regulating adipogenesis is needed. Vitamin A has recently been shown to have a profound impact on all stages of adipogenesis. Retinoic acid, an active metabolite of vitamin A, activates both retinoic acid receptors (RAR) and retinoid X receptors (RXR), inducing epigenetic changes in key regulatory genes governing adipogenesis. Additionally, Vitamin D and folates interact with the retinoic acid receptors to regulate adipogenesis. In this review, we discuss nutritional regulation of adipogenesis, focusing on retinoic acid and its impact on epigenetic modifications of key adipogenic genes. PMID:27086067

  12. Minireview: The Role of Nuclear Receptors in Photoreceptor Differentiation and Disease

    PubMed Central

    Swaroop, Anand

    2012-01-01

    Rod and cone photoreceptors are specialized sensory cells that mediate vision. Transcriptional controls are critical for the development and long-term survival of photoreceptors; when these controls become ineffective, retinal dysfunction or degenerative disease may result. This review discusses the role of nuclear receptors, a class of ligand-regulated transcription factors, at key stages of photoreceptor life in the mammalian retina. Nuclear receptors with known ligands, such as retinoids or thyroid hormone, together with several orphan receptors without identified physiological ligands, complement other classes of transcription factors in directing the differentiation and functional maintenance of photoreceptors. The potential of nuclear receptors to respond to ligands introduces versatility into the control of photoreceptor development and function and may suggest new opportunities for treatments of photoreceptor disease. PMID:22556342

  13. Treatment of Annular Elastolytic Giant Cell Granuloma With Topical Tretinoin.

    PubMed

    Wagenseller, Aubrey; Larocca, Cecilia; Vashi, Neelam A

    2017-07-01

    Annular elastolytic giant cell granuloma, also known as actinic granuloma, is a rare skin condition with a chronic course that is often resistant to treatment. Literature is sparse, and only a handful of case reports are available to guide treatment decisions. Typical first line treatment options include topical and intralesional steroids, topical pimecrolimus, and cryotherapy. Resistant cases have been treated with cyclosporine, systemic steroids, antimalarials, and oral retinoids. In particular, acitretin and isotretinoin have shown success in three cases. However, these medications can have side effects and require frequent lab monitoring. We present a case of a 47-year-old woman with bilateral forearm lesions consistent with annular elastolytic giant cell granuloma who was successfully treated with topical tretinoin.

    J Drugs Dermatol. 2017;16(7):699-700.

    .

  14. Functional and phenotypic heterogeneity of group 3 innate lymphoid cells.

    PubMed

    Melo-Gonzalez, Felipe; Hepworth, Matthew R

    2017-03-01

    Group 3 innate lymphoid cells (ILC3), defined by expression of the transcription factor retinoid-related orphan receptor γt, play key roles in the regulation of inflammation and immunity in the gastrointestinal tract and associated lymphoid tissues. ILC3 consist largely of two major subsets, NCR + ILC3 and LTi-like ILC3, but also demonstrate significant plasticity and heterogeneity. Recent advances have begun to dissect the relationship between ILC3 subsets and to define distinct functional states within the intestinal tissue microenvironment. In this review we discuss the ever-expanding roles of ILC3 in the context of intestinal homeostasis, infection and inflammation - with a focus on comparing and contrasting the relative contributions of ILC3 subsets. © 2016 The Authors. Immunology published by John Wiley & Sons Ltd.

  15. Structure and function of the interphotoreceptor matrix surrounding retinal photoreceptor cells.

    PubMed

    Ishikawa, Makoto; Sawada, Yu; Yoshitomi, Takeshi

    2015-04-01

    The interphotoreceptor matrix (IPM) is a highly organized structure with interconnected domains surrounding cone and rod photoreceptor cells and extends throughout the subretinal space. Based on known roles of the extracellular matrix in other tissues, the IPM is thought to have several prominent functions including serving as a receptor for growth factors, regulating retinoid transport, participating in cytoskeletal organization in surrounding cells, and regulation of oxygen and nutrient transport. In addition, a number of studies suggest that the IPM also may play a significant role in the etiology of retinal degenerative disorders. In this review, we describe the present knowledge concerning the structure and function of the IPM under physiological and pathological conditions. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  16. Molecular characterization and functions of fatty acid and retinoid binding protein gene (Ab-far-1) in Aphelenchoides besseyi.

    PubMed

    Cheng, Xi; Xiang, Yu; Xie, Hui; Xu, Chun-Ling; Xie, Teng-Fei; Zhang, Chao; Li, Yu

    2013-01-01

    Rice white tip nematode, Aphelenchoides besseyi, is a kind of plant parasitic nematodes that cause serious losses in rice and many other crops. Fatty acid and retinoid binding protein (FAR) is a specific protein in nematodes and is related to development, reproduction, infection to the host, and disruption of plant defense reactions, so the inhibition of FAR function is the potential approach to control A. besseyi. The full-length of Ab-far-1 cDNA is 805 bp, including 546 bp of ORF that encodes 181 amino acids. Software analysis revealed that the Ab-FAR-1 was rich in α-helix structure, contained a predicted consensus casein kinase II phosphorylation site and a hydrophobic secretory signal peptide, but did not have glycosylation sites. The Ab-FAR-1 had 52% homology to Gp-FAR-1 protein. The Ab-FAR-1 and Gp-FAR-1 were grouped in the same branch according to the phylogenetic tree. Fluorescence-based ligand binding analysis confirmed that the recombinant Ab-FAR-1 (rAb-FAR-1) bound with the fluorescent analogues 11-((5-dimethylaminonaphthalene-1-sulfonyl) amino) undecannoic acid (DAUDA), cis-parinaric acid and retinol, but the oleic acid would compete with the binding site. Quantitative PCR (qPCR) was used to assess the expression level of Ab-far-1 at different development stages of A. besseyi, the highest expression was found in the females, followed by eggs, juveniles and males. Using in situ hybridization technique, Ab-far-1 mRNA was present in the hypodermis of juveniles and adults, the ovaries of females and the testes of males. When A. besseyi was treated with Ab-far-1 dsRNA for 48 h, the silencing efficiency of Ab-far-1 was the best and the number of nematodes on the carrot was the least. Thus FAR plays important roles in the development and reproduction of nematodes. This study is useful and helpful to figure out a new way to control the plant parasitic nematodes.

  17. Liarozole (R75251) in hormone-resistant prostate cancer patients.

    PubMed

    Dijkman, G A; Fernandez del Moral, P; Bruynseels, J; de Porre, P; Denis, L; Debruyne, F M

    1997-09-15

    Liarozole is an imidazole derivative that has been identified as an inhibitor of the cytochrome P450-dependent all-trans retinoid acid (RA) breakdown. RA is one of the principal endogenous compounds that controls growth and differentiation of epithelial tissues in mammals. Fifty-five patients with hormone-resistant prostate cancer in progression, following at least first-line androgen ablation therapy, were evaluated. Thirty-one patients were treated with liarozole 300 mg b.i.d., while 24 patients started with 150 mg b.i.d., which was increased to 300 mg b.i.d. after 4 or 8 weeks. Two patients were not evaluable because they withdrew after initial consent. The WHO performance status was 0 (n = 18), 1 (n = 22), 2 (n = 17), and 3 (n = 6). Most patients (80%) used analgesics. For 11 out of the 53 patients, treatment lasted less than 1 month (they were therefore not evaluable for response) due to: poor compliance (n = 1); early death (n = 3); side-effects (n = 2); and decline of physical condition and continuous progression (n = 4). One patient refused to report for follow-up. In all responders, except one, the dose was increased to 300 mg b.i.d. In 23 of the 42 patients evaluable for response, the pain score improved. In 5 patients the pain score had reduced from 2 or 3 to 0. In 11 out of the 42 patients there was a 1-point improvement of WHO performance status. The prostatic-specific antigen (PSA) response rate was 41%; 15 out of 42 evaluable patients presented a decrease of > or = 50%, whereas PSA normalized in 2 further patients. Most of the side effects mimicked retinoid acid toxicity: cutaneous manifestations (such as dry skin, dry lips, sticky skin, brittle nails, erythema, or itch). All patients experienced one or more of these side effects. Other side effects include nausea, fatigue, and slight alopecia. Liarozole can be an enrichment of the therapeutic armamentarium for treatment of hormone-resistant prostate cancer patients after first-line androgen ablation therapy without serious toxicity.

  18. Nitrofen interferes with trophoblastic expression of retinol-binding protein and transthyretin during lung morphogenesis in the nitrofen-induced congenital diaphragmatic hernia model.

    PubMed

    Kutasy, Balazs; Gosemann, Jan H; Doi, Takashi; Fujiwara, Naho; Friedmacher, Florian; Puri, Prem

    2012-02-01

    Retinoids play a key role in lung development. Retinoid signaling pathway has been shown to be disrupted in the nitrofen model of congenital diaphragmatic hernia (CDH) but the exact mechanism is not clearly understood. Retinol-binding protein (RBP) and transthyretin (TTR) are transport proteins for delivery of retinol to the tissues via circulation. Previous studies have shown that pulmonary retinol levels are decreased during lung morphogenesis in the nitrofen CDH model. In human newborns with CDH, both retinol and RBP levels are decreased. It has been reported that maternal RBP does not cross the placenta and the fetus produces its own RBP by trophoblast. RBP and TTR synthesized in the fetus are essential for retinol transport to the developing organs including lung morphogenesis. We hypothesized that nitrofen interferes with the trophoblastic expression of RBP and TTR during lung morphogenesis and designed this study to examine the trophoblastic expression of RBP and TTR, and the total level of RBP and TTR in the lung in the nitrofen model of CDH. Pregnant rats were exposed to either olive oil or nitrofen on day 9 of gestation (D9). Fetal lungs and placenta harvested on D21 and divided into two groups: control (n = 8) and nitrofen with CDH (n = 8). Total lung RBP and TTR levels using protein extraction were compared with enzyme linked immunoassay (ELISA). Immunohistochemistry was performed to evaluate trophoblastic RBP and TTR expression. Total protein levels of lung RBP and TTR were significantly lower in CDH (0.26 ± 0.003 and 6.4 ± 0.5 μg/mL) compared with controls (0.4 ± 0.001 and 9.9 ± 1.6 μg/mL, p < 0.05). In the control group, immunohistochemical staining showed strong immunoreactivity of RBP and TTR in the trophoblast compared to CDH group. Decreased trophoblast expression of retinol transport proteins suggest that nitrofen may interfere with the fetal retinol transport resulting in reduced pulmonary RBP and TTR levels and causing pulmonary hypoplasia in CDH.

  19. [Acne therapy with topical benzoyl peroxide, antibiotics and azelaic acid].

    PubMed

    Worret, Wolf-Ingo; Fluhr, Joachim W

    2006-04-01

    Benzoyl peroxide (BPO) was introduced in the treatment of acne in 1934. Despite the fact that only few randomized trials have been published, BPO is considered the standard in topical acne treatment. Anaerobic bacteria are reduced by oxidative mechanisms and the induction of resistant strains is reduced. Topical formulations are available at concentrations of 2.5, 5, 10 and 20 %. The effect is dose-dependent, but the irritation increases with higher concentrations. Usually 5 % BPO is sufficient to control acne grade I-II. Due to its strong oxidative potential, patients should be advised that BPO may bleach colored and dark clothing, bedding and even hair. BPO is safe for use in pregnant and lactating females because it is degraded to benzoic acid. It is a cost-effective treatment for acne grade I-II. Patients with papulopustular acne grade I-II, particularly with marked inflammation, show satisfactory improvement with topical antibiotic treatment. The following compounds are available and effective: erythromycin, clindamycin and tetracycline (the latter being less frequently used). A review in 1990 suggested that topical tetracycline was ineffective in the treatment of acne. Along with eliminating Propionibacterium acnes, the main mechanism of topical antibiotics is their antiinflammatory effect. All three penetrate the epidermal barrier well and are similarly efficacious. Randomized trials have shown that in concentrations of 2-4 %, their effects are comparable to oral tetracycline and minocycline. Combination therapy with retinoids or benzoyl peroxide (BPO) increases efficacy. Retinoids increase penetration and reduce comedones, while topical antibiotics primarily address inflammation. One side effect of topical antibacterial treatment is an increase in drug-resistant resident skin flora with gram-negative microorganisms prevailing, which can lead to gram-negative folliculitis. All three antibiotics fluoresce under black light which may produce interesting effects in a discotheque. There are two reports of topical clindamycin causing pseudomembranous colitis after long-term and widespread usage. Azelaic acid has a predominant antibacterial action, although it is not considered as an antibiotic in the classical sense. Furthermore, it possesses a modest comedolytic effect. Burning upon application is common. Since azelaic acid is naturally present, systemic side effects are not likely to occur, making it safe for acne treatment during pregnancy and lactation.

  20. Comparison of the cumulative irritation potential of adapalene gel and cream with that of erythromycin/tretinoin solution and gel and erythromycin/isotretinoin gel.

    PubMed

    Queille-Roussel, C; Poncet, M; Mesaros, S; Clucas, A; Baker, M; Soloff, A M

    2001-02-01

    Adapalene is a naphthoic acid derivative with retinoid activity that is effective in the treatment of mild to moderate acne vulgaris. This study assessed the cumulative irritation potential of adapalene gel (0.1%) and adapalene cream (0.1%) compared with that of erythromycin (4%)/tretinoin (0.025%) solution, erythromycin (4%)/tretinoin (0.025%) gel, erythromycin (2%)/isotretinoin (0.05%) gel, and white petrolatum (negative control). This was a single-center, randomized, controlled, investigator-blinded, intraindividual comparison study in healthy subjects with normal skin. The cumulative irritation assay (patch test) was used to assess the potential for irritation (including erythema) of the treatments. Each subject received all study treatments, randomly applied under occlusion (patch), to sites on either side of the midline on the mid-thoracic area of the back. All patches were applied to the same sites throughout the study, unless the degree of reaction to the treatment or adhesive necessitated removal. For 3 weeks, each test material was applied daily, Monday through Friday, for approximately 24 hours; the Friday patches were left in place over the weekend for approximately 72 hours. All 36 subjects (26 men, 10 women; age, 18-49 years [mean, 30 years]) completed the study. In the course of the study, all subjects had > or =1 application discontinued prematurely on > or =1 site due to intolerance. There were no discontinuations with white petrolatum. All erythromycin/tretinoin gel patches were discontinued at day 10; 35 of 36 erythromycin/isotretinoin gel patches were discontinued at day 9; and 35 of 36 erythromycin/tretinoin solution patches were discontinued at day 11 or day 17. The adapalene products, although slightly more irritating (mean cumulative irritation index, 0.25-1) than white petrolatum, were significantly less irritating than the erythromycin/tretinoin and erythromycin/isotretinoin products (P < 0.01). Adapalene gel and cream were well tolerated, with possible benefits for compliance. Their low irritation potential should be considered when prescribing a topical retinoid for the treatment of acne vulgaris.

Top