Sample records for revealed direct binding

  1. The Rice Resistance Protein Pair RGA4/RGA5 Recognizes the Magnaporthe oryzae Effectors AVR-Pia and AVR1-CO39 by Direct Binding[W][OA

    PubMed Central

    Cesari, Stella; Thilliez, Gaëtan; Ribot, Cécile; Chalvon, Véronique; Michel, Corinne; Jauneau, Alain; Rivas, Susana; Alaux, Ludovic; Kanzaki, Hiroyuki; Okuyama, Yudai; Morel, Jean-Benoit; Fournier, Elisabeth; Tharreau, Didier; Terauchi, Ryohei; Kroj, Thomas

    2013-01-01

    Resistance (R) proteins recognize pathogen avirulence (Avr) proteins by direct or indirect binding and are multidomain proteins generally carrying a nucleotide binding (NB) and a leucine-rich repeat (LRR) domain. Two NB-LRR protein-coding genes from rice (Oryza sativa), RGA4 and RGA5, were found to be required for the recognition of the Magnaporthe oryzae effector AVR1-CO39. RGA4 and RGA5 also mediate recognition of the unrelated M. oryzae effector AVR-Pia, indicating that the corresponding R proteins possess dual recognition specificity. For RGA5, two alternative transcripts, RGA5-A and RGA5-B, were identified. Genetic analysis showed that only RGA5-A confers resistance, while RGA5-B is inactive. Yeast two-hybrid, coimmunoprecipitation, and fluorescence resonance energy transfer–fluorescence lifetime imaging experiments revealed direct binding of AVR-Pia and AVR1-CO39 to RGA5-A, providing evidence for the recognition of multiple Avr proteins by direct binding to a single R protein. Direct binding seems to be required for resistance as an inactive AVR-Pia allele did not bind RGA5-A. A small Avr interaction domain with homology to the Avr recognition domain in the rice R protein Pik-1 was identified in the C terminus of RGA5-A. This reveals a mode of Avr protein recognition through direct binding to a novel, non-LRR interaction domain. PMID:23548743

  2. Genome-Wide Binding Analysis of the Transcription Activator IDEAL PLANT ARCHITECTURE1 Reveals a Complex Network Regulating Rice Plant Architecture[W

    PubMed Central

    Lu, Zefu; Yu, Hong; Xiong, Guosheng; Wang, Jing; Jiao, Yongqing; Liu, Guifu; Jing, Yanhui; Meng, Xiangbing; Hu, Xingming; Qian, Qian; Fu, Xiangdong; Wang, Yonghong; Li, Jiayang

    2013-01-01

    IDEAL PLANT ARCHITECTURE1 (IPA1) is critical in regulating rice (Oryza sativa) plant architecture and substantially enhances grain yield. To elucidate its molecular basis, we first confirmed IPA1 as a functional transcription activator and then identified 1067 and 2185 genes associated with IPA1 binding sites in shoot apices and young panicles, respectively, through chromatin immunoprecipitation sequencing assays. The SQUAMOSA PROMOTER BINDING PROTEIN-box direct binding core motif GTAC was highly enriched in IPA1 binding peaks; interestingly, a previously uncharacterized indirect binding motif TGGGCC/T was found to be significantly enriched through the interaction of IPA1 with proliferating cell nuclear antigen PROMOTER BINDING FACTOR1 or PROMOTER BINDING FACTOR2. Genome-wide expression profiling by RNA sequencing revealed IPA1 roles in diverse pathways. Moreover, our results demonstrated that IPA1 could directly bind to the promoter of rice TEOSINTE BRANCHED1, a negative regulator of tiller bud outgrowth, to suppress rice tillering, and directly and positively regulate DENSE AND ERECT PANICLE1, an important gene regulating panicle architecture, to influence plant height and panicle length. The elucidation of target genes of IPA1 genome-wide will contribute to understanding the molecular mechanisms underlying plant architecture and to facilitating the breeding of elite varieties with ideal plant architecture. PMID:24170127

  3. Small Molecule Interactome Mapping by Photoaffinity Labeling Reveals Binding Site Hotspots for the NSAIDs.

    PubMed

    Gao, Jinxu; Mfuh, Adelphe; Amako, Yuka; Woo, Christina M

    2018-03-28

    Many therapeutics elicit cell-type specific polypharmacology that is executed by a network of molecular recognition events between a small molecule and the whole proteome. However, measurement of the structures that underpin the molecular associations between the proteome and even common therapeutics, such as the nonsteroidal anti-inflammatory drugs (NSAIDs), is limited by the inability to map the small molecule interactome. To address this gap, we developed a platform termed small molecule interactome mapping by photoaffinity labeling (SIM-PAL) and applied it to the in cellulo direct characterization of specific NSAID binding sites. SIM-PAL uses (1) photochemical conjugation of NSAID derivatives in the whole proteome and (2) enrichment and isotope-recoding of the conjugated peptides for (3) targeted mass spectrometry-based assignment. Using SIM-PAL, we identified the NSAID interactome consisting of over 1000 significantly enriched proteins and directly characterized nearly 200 conjugated peptides representing direct binding sites of the photo-NSAIDs with proteins from Jurkat and K562 cells. The enriched proteins were often identified as parts of complexes, including known targets of NSAID activity (e.g., NF-κB) and novel interactions (e.g., AP-2, proteasome). The conjugated peptides revealed direct NSAID binding sites from the cell surface to the nucleus and a specific binding site hotspot for the three photo-NSAIDs on histones H2A and H2B. NSAID binding stabilized COX-2 and histone H2A by cellular thermal shift assay. Since small molecule stabilization of protein complexes is a gain of function regulatory mechanism, it is conceivable that NSAIDs affect biological processes through these broader proteomic interactions. SIM-PAL enabled characterization of NSAID binding site hotspots and is amenable to map global binding sites for virtually any molecule of interest.

  4. Genome-Wide Mapping of Collier In Vivo Binding Sites Highlights Its Hierarchical Position in Different Transcription Regulatory Networks

    PubMed Central

    Dubois, Laurence; Bataillé, Laetitia; Painset, Anaïs; Le Gras, Stéphanie; Jost, Bernard; Crozatier, Michèle; Vincent, Alain

    2015-01-01

    Collier, the single Drosophila COE (Collier/EBF/Olf-1) transcription factor, is required in several developmental processes, including head patterning and specification of muscle and neuron identity during embryogenesis. To identify direct Collier (Col) targets in different cell types, we used ChIP-seq to map Col binding sites throughout the genome, at mid-embryogenesis. In vivo Col binding peaks were associated to 415 potential direct target genes. Gene Ontology analysis revealed a strong enrichment in proteins with DNA binding and/or transcription-regulatory properties. Characterization of a selection of candidates, using transgenic CRM-reporter assays, identified direct Col targets in dorso-lateral somatic muscles and specific neuron types in the central nervous system. These data brought new evidence that Col direct control of the expression of the transcription regulators apterous and eyes-absent (eya) is critical to specifying neuronal identities. They also showed that cross-regulation between col and eya in muscle progenitor cells is required for specification of muscle identity, revealing a new parallel between the myogenic regulatory networks operating in Drosophila and vertebrates. Col regulation of eya, both in specific muscle and neuronal lineages, may illustrate one mechanism behind the evolutionary diversification of Col biological roles. PMID:26204530

  5. Controlled rotation of the F1-ATPase reveals differential and continuous binding changes for ATP synthesis

    PubMed Central

    Adachi, Kengo; Oiwa, Kazuhiro; Yoshida, Masasuke; Nishizaka, Takayuki; Kinosita, Kazuhiko

    2012-01-01

    F1-ATPase is an ATP-driven rotary molecular motor that synthesizes ATP when rotated in reverse. To elucidate the mechanism of ATP synthesis, we imaged binding and release of fluorescently labelled ADP and ATP while rotating the motor in either direction by magnets. Here we report the binding and release rates for each of the three catalytic sites for 360° of the rotary angle. We show that the rates do not significantly depend on the rotary direction, indicating ATP synthesis by direct reversal of the hydrolysis-driven rotation. ADP and ATP are discriminated in angle-dependent binding, but not in release. Phosphate blocks ATP binding at angles where ADP binding is essential for ATP synthesis. In synthesis rotation, the affinity for ADP increases by >104, followed by a shift to high ATP affinity, and finally the affinity for ATP decreases by >104. All these angular changes are gradual, implicating tight coupling between the rotor angle and site affinities. PMID:22929779

  6. Examining the neural correlates of active and passive forms of verbal-spatial binding in working memory.

    PubMed

    Grot, Stéphanie; Leclerc, Marie-Eve; Luck, David

    2018-05-23

    We designed an fMRI study to pinpoint the neural correlates of active and passive binding in working memory. Participants were instructed to memorize three words and three spatial locations. In the passive binding condition, words and spatial locations were directly presented as bound. Conversely, in the active binding condition, words and spatial locations were presented as separated, and participants were directed to intentionally create associations between them. Our results showed that participants performed better on passive binding relative to active binding. FMRI analysis revealed that both binding conditions induced greater activity within the hippocampus. Additionally, our analyses divulged regions specifically engaged in passive and active binding. Altogether, these data allow us to propose the hippocampus as a central candidate for working memory binding. When needed, a frontal-parietal network can contribute to the rearrangement of information. These findings may inform theories of working memory binding. Copyright © 2018. Published by Elsevier B.V.

  7. Structure of the Shroom-Rho Kinase Complex Reveals a Binding Interface with Monomeric Shroom That Regulates Cell Morphology and Stimulates Kinase Activity

    DOE PAGES

    Zalewski, Jenna K.; Mo, Joshua H.; Heber, Simone; ...

    2016-10-10

    Shroom-mediated remodeling of the actomyosin cytoskeleton is a critical driver of cellular shape and tissue morphology that underlies the development of many tissues including the neural tube, eye, intestines, and vasculature. Shroom uses a conserved SD2 domain to direct the subcellular localization of Rho-associated kinase (Rock), which in turn drives changes in the cytoskeleton and cellular morphology through its ability to phosphorylate and activate non-muscle myosin II. Here in this paper, we present the structure of the human Shroom-Rock binding module, revealing an unexpected stoichiometry for Shroom in which two Shroom SD2 domains bind independent surfaces on Rock. Mutation ofmore » interfacial residues impaired Shroom-Rock binding in vitro and resulted in altered remodeling of the cytoskeleton and loss of Shroom-mediated changes in cellular morphology. In addition, we provide the first direct evidence that Shroom can function as a Rock activator. These data provide molecular insight into the Shroom-Rock interface and demonstrate that Shroom directly participates in regulating cytoskeletal dynamics, adding to its known role in Rock localization.« less

  8. Hydrogen-Deuterium Exchange Mass Spectrometry Reveals Calcium Binding Properties and Allosteric Regulation of Downstream Regulatory Element Antagonist Modulator (DREAM).

    PubMed

    Zhang, Jun; Li, Jing; Craig, Theodore A; Kumar, Rajiv; Gross, Michael L

    2017-07-18

    Downstream regulatory element antagonist modulator (DREAM) is an EF-hand Ca 2+ -binding protein that also binds to a specific DNA sequence, downstream regulatory elements (DRE), and thereby regulates transcription in a calcium-dependent fashion. DREAM binds to DRE in the absence of Ca 2+ but detaches from DRE under Ca 2+ stimulation, allowing gene expression. The Ca 2+ binding properties of DREAM and the consequences of the binding on protein structure are key to understanding the function of DREAM. Here we describe the application of hydrogen-deuterium exchange mass spectrometry (HDX-MS) and site-directed mutagenesis to investigate the Ca 2+ binding properties and the subsequent conformational changes of full-length DREAM. We demonstrate that all EF-hands undergo large conformation changes upon calcium binding even though the EF-1 hand is not capable of binding to Ca 2+ . Moreover, EF-2 is a lower-affinity site compared to EF-3 and -4 hands. Comparison of HDX profiles between wild-type DREAM and two EF-1 mutated constructs illustrates that the conformational changes in the EF-1 hand are induced by long-range structural interactions. HDX analyses also reveal a conformational change in an N-terminal leucine-charged residue-rich domain (LCD) remote from Ca 2+ -binding EF-hands. This LCD domain is responsible for the direct interaction between DREAM and cAMP response element-binding protein (CREB) and regulates the recruitment of the co-activator, CREB-binding protein. These long-range interactions strongly suggest how conformational changes transmit the Ca 2+ signal to CREB-mediated gene transcription.

  9. Determination of structure of the MinD-ATP complex reveals the orientation of MinD on the membrane and the relative location of the binding sites for MinE and MinC

    PubMed Central

    Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe

    2011-01-01

    Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967

  10. Binding Isotherms and Time Courses Readily from Magnetic Resonance.

    PubMed

    Xu, Jia; Van Doren, Steven R

    2016-08-16

    Evidence is presented that binding isotherms, simple or biphasic, can be extracted directly from noninterpreted, complex 2D NMR spectra using principal component analysis (PCA) to reveal the largest trend(s) across the series. This approach renders peak picking unnecessary for tracking population changes. In 1:1 binding, the first principal component captures the binding isotherm from NMR-detected titrations in fast, slow, and even intermediate and mixed exchange regimes, as illustrated for phospholigand associations with proteins. Although the sigmoidal shifts and line broadening of intermediate exchange distorts binding isotherms constructed conventionally, applying PCA directly to these spectra along with Pareto scaling overcomes the distortion. Applying PCA to time-domain NMR data also yields binding isotherms from titrations in fast or slow exchange. The algorithm readily extracts from magnetic resonance imaging movie time courses such as breathing and heart rate in chest imaging. Similarly, two-step binding processes detected by NMR are easily captured by principal components 1 and 2. PCA obviates the customary focus on specific peaks or regions of images. Applying it directly to a series of complex data will easily delineate binding isotherms, equilibrium shifts, and time courses of reactions or fluctuations.

  11. MOCCS: Clarifying DNA-binding motif ambiguity using ChIP-Seq data.

    PubMed

    Ozaki, Haruka; Iwasaki, Wataru

    2016-08-01

    As a key mechanism of gene regulation, transcription factors (TFs) bind to DNA by recognizing specific short sequence patterns that are called DNA-binding motifs. A single TF can accept ambiguity within its DNA-binding motifs, which comprise both canonical (typical) and non-canonical motifs. Clarification of such DNA-binding motif ambiguity is crucial for revealing gene regulatory networks and evaluating mutations in cis-regulatory elements. Although chromatin immunoprecipitation sequencing (ChIP-seq) now provides abundant data on the genomic sequences to which a given TF binds, existing motif discovery methods are unable to directly answer whether a given TF can bind to a specific DNA-binding motif. Here, we report a method for clarifying the DNA-binding motif ambiguity, MOCCS. Given ChIP-Seq data of any TF, MOCCS comprehensively analyzes and describes every k-mer to which that TF binds. Analysis of simulated datasets revealed that MOCCS is applicable to various ChIP-Seq datasets, requiring only a few minutes per dataset. Application to the ENCODE ChIP-Seq datasets proved that MOCCS directly evaluates whether a given TF binds to each DNA-binding motif, even if known position weight matrix models do not provide sufficient information on DNA-binding motif ambiguity. Furthermore, users are not required to provide numerous parameters or background genomic sequence models that are typically unavailable. MOCCS is implemented in Perl and R and is freely available via https://github.com/yuifu/moccs. By complementing existing motif-discovery software, MOCCS will contribute to the basic understanding of how the genome controls diverse cellular processes via DNA-protein interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Biological role and structural mechanism of twinfilin–capping protein interaction

    PubMed Central

    Falck, Sandra; Paavilainen, Ville O; Wear, Martin A; Grossmann, J Günter; Cooper, John A; Lappalainen, Pekka

    2004-01-01

    Twinfilin and capping protein (CP) are highly conserved actin-binding proteins that regulate cytoskeletal dynamics in organisms from yeast to mammals. Twinfilin binds actin monomer, while CP binds the barbed end of the actin filament. Remarkably, twinfilin and CP also bind directly to each other, but the mechanism and role of this interaction in actin dynamics are not defined. Here, we found that the binding of twinfilin to CP does not affect the binding of either protein to actin. Furthermore, site-directed mutagenesis studies revealed that the CP-binding site resides in the conserved C-terminal tail region of twinfilin. The solution structure of the twinfilin–CP complex supports these conclusions. In vivo, twinfilin's binding to both CP and actin monomer was found to be necessary for twinfilin's role in actin assembly dynamics, based on genetic studies with mutants that have defined biochemical functions. Our results support a novel model for how sequential interactions between actin monomers, twinfilin, CP, and actin filaments promote cytoskeletal dynamics. PMID:15282541

  13. Direct observation of the influence of cardiolipin and antibiotics on lipid II binding to MurJ

    NASA Astrophysics Data System (ADS)

    Bolla, Jani Reddy; Sauer, Joshua B.; Wu, Di; Mehmood, Shahid; Allison, Timothy M.; Robinson, Carol V.

    2018-03-01

    Translocation of lipid II across the cytoplasmic membrane is essential in peptidoglycan biogenesis. Although most steps are understood, identifying the lipid II flippase has yielded conflicting results, and the lipid II binding properties of two candidate flippases—MurJ and FtsW—remain largely unknown. Here we apply native mass spectrometry to both proteins and characterize lipid II binding. We observed lower levels of lipid II binding to FtsW compared to MurJ, consistent with MurJ having a higher affinity. Site-directed mutagenesis of MurJ suggests that mutations at A29 and D269 attenuate lipid II binding to MurJ, whereas chemical modification of A29 eliminates binding. The antibiotic ramoplanin dissociates lipid II from MurJ, whereas vancomycin binds to form a stable complex with MurJ:lipid II. Furthermore, we reveal cardiolipins associate with MurJ but not FtsW, and exogenous cardiolipins reduce lipid II binding to MurJ. These observations provide insights into determinants of lipid II binding to MurJ and suggest roles for endogenous lipids in regulating substrate binding.

  14. Structure of an Arrestin2-clathrin Complex Reveals a Novel Clathrin Binding Domain that Modulates Receptor Trafficking

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kang, D.; Kern, R; Puthenveedu, M

    2009-01-01

    Non-visual arrestins play a pivotal role as adaptor proteins in regulating the signaling and trafficking of multiple classes of receptors. Although arrestin interaction with clathrin, AP-2, and phosphoinositides contributes to receptor trafficking, little is known about the configuration and dynamics of these interactions. Here, we identify a novel interface between arrestin2 and clathrin through x-ray diffraction analysis. The intrinsically disordered clathrin binding box of arrestin2 interacts with a groove between blades 1 and 2 in the clathrin {beta}-propeller domain, whereas an 8-amino acid splice loop found solely in the long isoform of arrestin2 (arrestin2L) interacts with a binding pocket formedmore » by blades 4 and 5 in clathrin. The apposition of the two binding sites in arrestin2L suggests that they are exclusive and may function in higher order macromolecular structures. Biochemical analysis demonstrates direct binding of clathrin to the splice loop in arrestin2L, whereas functional analysis reveals that both binding domains contribute to the receptor-dependent redistribution of arrestin2L to clathrin-coated pits. Mutagenesis studies reveal that the clathrin binding motif in the splice loop is (L/I){sub 2}GXL. Taken together, these data provide a framework for understanding the dynamic interactions between arrestin2 and clathrin and reveal an essential role for this interaction in arrestin-mediated endocytosis.« less

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Unterberger, Claudia; Hanson, Steven; Department of Infection, Immunity and Inflammation, University of Leicester, University Road, Leicester LE1 9HN

    Little is known about determinants regulating expression of Mannan-binding lectin associated serine protease-2 (MASP-2), the effector component of the lectin pathway of complement activation. Comparative bioinformatic analysis of the MASP2 promoter regions in human, mouse, and rat, revealed conservation of two putative Stat binding sites, termed StatA and StatB. Site directed mutagenesis specific for these sites was performed. Transcription activity was decreased 5-fold when StatB site was mutated in the wildtype reporter gene construct. Gel retardation and competition assays demonstrated that proteins contained in the nuclear extract prepared from HepG2 specifically bound double-stranded StatB oligonucleotides. Supershift analysis revealed Stat3 tomore » be the major specific binding protein. We conclude that Stat3 binding is important for MASP2 promoter activity.« less

  16. Differential Regulation of Elastic Fiber Formation by Fibulin-4 and -5*

    PubMed Central

    Choudhury, Rawshan; McGovern, Amanda; Ridley, Caroline; Cain, Stuart A.; Baldwin, Andrew; Wang, Ming-Chuan; Guo, Chun; Mironov, Aleksandr; Drymoussi, Zoe; Trump, Dorothy; Shuttleworth, Adrian; Baldock, Clair; Kielty, Cay M.

    2009-01-01

    Fibulin-4 and -5 are extracellular glycoproteins with essential non-compensatory roles in elastic fiber assembly. We have determined how they interact with tropoelastin, lysyl oxidase, and fibrillin-1, thereby revealing how they differentially regulate assembly. Strong binding between fibulin-4 and lysyl oxidase enhanced the interaction of fibulin-4 with tropoelastin, forming ternary complexes that may direct elastin cross-linking. In contrast, fibulin-5 did not bind lysyl oxidase strongly but bound tropoelastin in terminal and central regions and could concurrently bind fibulin-4. Both fibulins differentially bound N-terminal fibrillin-1, which strongly inhibited their binding to lysyl oxidase and tropoelastin. Knockdown experiments revealed that fibulin-5 controlled elastin deposition on microfibrils, although fibulin-4 can also bind fibrillin-1. These experiments provide a molecular account of the distinct roles of fibulin-4 and -5 in elastic fiber assembly and how they act in concert to chaperone cross-linked elastin onto microfibrils. PMID:19570982

  17. Crystal structure of the UBR-box from UBR6/FBXO11 reveals domain swapping mediated by zinc binding.

    PubMed

    Muñoz-Escobar, Juliana; Kozlov, Guennadi; Gehring, Kalle

    2017-10-01

    The UBR-box is a 70-residue zinc finger domain present in the UBR family of E3 ubiquitin ligases that directly binds N-terminal degradation signals in substrate proteins. UBR6, also called FBXO11, is an UBR-box containing E3 ubiquitin ligase that does not bind N-terminal signals. Here, we present the crystal structure of the UBR-box domain from human UBR6. The dimeric crystal structure reveals a unique form of domain swapping mediated by zinc coordination, where three independent protein chains come together to regenerate the topology of the monomeric UBR-box fold. Analysis of the structure suggests that the absence of N-terminal residue binding arises from the lack of an amino acid binding pocket. © 2017 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.

  18. SH2 Domains Serve as Lipid-Binding Modules for pTyr-Signaling Proteins.

    PubMed

    Park, Mi-Jeong; Sheng, Ren; Silkov, Antonina; Jung, Da-Jung; Wang, Zhi-Gang; Xin, Yao; Kim, Hyunjin; Thiagarajan-Rosenkranz, Pallavi; Song, Seohyeon; Yoon, Youngdae; Nam, Wonhee; Kim, Ilshin; Kim, Eui; Lee, Dong-Gyu; Chen, Yong; Singaram, Indira; Wang, Li; Jang, Myoung Ho; Hwang, Cheol-Sang; Honig, Barry; Ryu, Sungho; Lorieau, Justin; Kim, You-Me; Cho, Wonhwa

    2016-04-07

    The Src-homology 2 (SH2) domain is a protein interaction domain that directs myriad phosphotyrosine (pY)-signaling pathways. Genome-wide screening of human SH2 domains reveals that ∼90% of SH2 domains bind plasma membrane lipids and many have high phosphoinositide specificity. They bind lipids using surface cationic patches separate from pY-binding pockets, thus binding lipids and the pY motif independently. The patches form grooves for specific lipid headgroup recognition or flat surfaces for non-specific membrane binding and both types of interaction are important for cellular function and regulation of SH2 domain-containing proteins. Cellular studies with ZAP70 showed that multiple lipids bind its C-terminal SH2 domain in a spatiotemporally specific manner and thereby exert exquisite spatiotemporal control over its protein binding and signaling activities in T cells. Collectively, this study reveals how lipids control SH2 domain-mediated cellular protein-protein interaction networks and suggest a new strategy for therapeutic modulation of pY-signaling pathways. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Proliferating cell nuclear antigen (Pcna) as a direct downstream target gene of Hoxc8

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Min, Hyehyun; Lee, Ji-Yeon; Bok, Jinwoong

    2010-02-19

    Hoxc8 is a member of Hox family transcription factors that play crucial roles in spatiotemporal body patterning during embryogenesis. Hox proteins contain a conserved 61 amino acid homeodomain, which is responsible for recognition and binding of the proteins onto Hox-specific DNA binding motifs and regulates expression of their target genes. Previously, using proteome analysis, we identified Proliferating cell nuclear antigen (Pcna) as one of the putative target genes of Hoxc8. Here, we asked whether Hoxc8 regulates Pcna expression by directly binding to the regulatory sequence of Pcna. In mouse embryos at embryonic day 11.5, the expression pattern of Pcna wasmore » similar to that of Hoxc8 along the anteroposterior body axis. Moreover, Pcna transcript levels as well as cell proliferation rate were increased by overexpression of Hoxc8 in C3H10T1/2 mouse embryonic fibroblast cells. Characterization of 2.3 kb genomic sequence upstream of Pcna coding region revealed that the upstream sequence contains several Hox core binding sequences and one Hox-Pbx binding sequence. Direct binding of Hoxc8 proteins to the Pcna regulatory sequence was verified by chromatin immunoprecipitation assay. Taken together, our data suggest that Pcna is a direct downstream target of Hoxc8.« less

  20. Crystal structure of CotA laccase complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) at a novel binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Zhongchuan; Xie, Tian; Key Laboratory of Environmental Microbiology of Sichuan Province, Chengdu 610041, People’s Republic of

    2016-03-24

    The crystal structure of CotA complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) in a hole motif has been solved; this novel binding site could be a potential structure-based target for protein engineering of CotA laccase. The CotA laccase from Bacillus subtilis is an abundant component of the spore outer coat and has been characterized as a typical laccase. The crystal structure of CotA complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) (ABTS) in a hole motif has been solved. The novel binding site was about 26 Å away from the T1 binding pocket. Comparison with known structures of other laccases revealed that the hole is a specific feature ofmore » CotA. The key residues Arg476 and Ser360 were directly bound to ABTS. Site-directed mutagenesis studies revealed that the residues Arg146, Arg429 and Arg476, which are located at the bottom of the novel binding site, are essential for the oxidation of ABTS and syringaldazine. Specially, a Thr480Phe variant was identified to be almost 3.5 times more specific for ABTS than for syringaldazine compared with the wild type. These results suggest this novel binding site for ABTS could be a potential target for protein engineering of CotA laccases.« less

  1. Symbiotic Bacteria Direct Expression of an Intestinal Bactericidal Lectin

    PubMed Central

    Cash, Heather L.; Whitham, Cecilia V.; Behrendt, Cassie L.; Hooper, Lora V.

    2009-01-01

    The mammalian intestine harbors complex societies of beneficial bacteria that are maintained in the lumen with minimal penetration of mucosal surfaces. Microbial colonization of germ-free mice triggers epithelial expression of RegIIIγ, a secreted C-type lectin. RegIIIγ binds intestinal bacteria but lacks the complement recruitment domains present in other microbe-binding mammalian C-type lectins. We show that RegIIIγ and its human counterpart, HIP/PAP, are directly antimicrobial proteins that bind their bacterial targets via interactions with peptidoglycan carbohydrate. We propose that these proteins represent an evolutionarily primitive form of lectin-mediated innate immunity, and that they reveal intestinal strategies for maintaining symbiotic host-microbial relationships. PMID:16931762

  2. The ebolavirus VP24 interferon antagonist

    PubMed Central

    Zhang, Adrianna P.P.; Abelson, Dafna M.; Bornholdt, Zachary A.; Liu, Tong; Woods, Jr, Virgil L.; Saphire, Erica Ollmann

    2012-01-01

    Suppression during the early phases of the immune system often correlates directly with a fatal outcome for the host. The ebolaviruses, some of the most lethal viruses known, appear to cripple initial stages of the host defense network via multiple distinct paths. Two of the eight viral proteins are critical for immunosuppression. One of these proteins is VP35, which binds double-stranded RNA and antagonizes several antiviral signaling pathways.1,2 The other protein is VP24, which binds transporter molecules to prevent STAT1 translocation.3 A more recent discovery is that VP24 also binds STAT1 directly,4 suggesting that VP24 may operate in at least two separate branches of the interferon pathway. New crystal structures of VP24 derived from pathogenic and nonpathogenic ebolaviruses reveal its novel, pyramidal fold, upon which can be mapped sites required for virulence and for STAT1 binding. These structures of VP24, and new information about its direct binding to STAT1, provide avenues by which we may explore its many roles in the viral life cycle, and reasons for differences in pathogenesis among the ebolaviruses. PMID:23076242

  3. Force fields for describing the solution-phase synthesis of shape-selective metal nanoparticles

    NASA Astrophysics Data System (ADS)

    Zhou, Ya; Al-Saidi, Wissam; Fichthorn, Kristen

    2013-03-01

    Polyvinylpyrrolidone (PVP) and polyethylene oxide (PEO) are structure-directing agents that exhibit different performance in the polyol synthesis of Ag nanostructures. The success of these structure-directing agents in selective nanostructure synthesis is often attributed to their selective binding to Ag(100) facets. We use first-principles, density-functional theory (DFT) calculations in a vacuum environment to show that PVP has a stronger preference to bind to Ag(100) than to Ag(111), whereas PEO exhibits much weaker selectivity. To understand the role of solvent in the surface-sensitive binding, we develop classical force fields to describe the interactions of the structure-directing (PVP and PEO) and solvent (ethylene glycol) molecules with various Ag substrates. We parameterize the force fields through force-and-energy matching to DFT results using simulated annealing. We validate the force fields by comparisons to DFT and experimental binding energies. Our force fields reproduce the surface-sensitive binding predicted by DFT calculations. Molecular dynamics simulations based on these force fields can be used to reveal the role of solvent, polymer chain length, and polymer concentration in the selective synthesis of Ag nanostructures.

  4. The ebolavirus VP24 interferon antagonist: know your enemy.

    PubMed

    Zhang, Adrianna P P; Abelson, Dafna M; Bornholdt, Zachary A; Liu, Tong; Woods, Virgil L; Saphire, Erica Ollmann

    2012-08-15

    Suppression during the early phases of the immune system often correlates directly with a fatal outcome for the host. The ebolaviruses, some of the most lethal viruses known, appear to cripple initial stages of the host defense network via multiple distinct paths. Two of the eight viral proteins are critical for immunosuppression. One of these proteins is VP35, which binds double-stranded RNA and antagonizes several antiviral signaling pathways. The other protein is VP24, which binds transporter molecules to prevent STAT1 translocation. A more recent discovery is that VP24 also binds STAT1 directly, suggesting that VP24 may operate in at least two separate branches of the interferon pathway. New crystal structures of VP24 derived from pathogenic and nonpathogenic ebolaviruses reveal its novel, pyramidal fold, upon which can be mapped sites required for virulence and for STAT1 binding. These structures of VP24, and new information about its direct binding to STAT1, provide avenues by which we may explore its many roles in the viral life cycle, and reasons for differences in pathogenesis among the ebolaviruses.

  5. Cryptic glucocorticoid receptor-binding sites pervade genomic NF-κB response elements.

    PubMed

    Hudson, William H; Vera, Ian Mitchelle S de; Nwachukwu, Jerome C; Weikum, Emily R; Herbst, Austin G; Yang, Qin; Bain, David L; Nettles, Kendall W; Kojetin, Douglas J; Ortlund, Eric A

    2018-04-06

    Glucocorticoids (GCs) are potent repressors of NF-κB activity, making them a preferred choice for treatment of inflammation-driven conditions. Despite the widespread use of GCs in the clinic, current models are inadequate to explain the role of the glucocorticoid receptor (GR) within this critical signaling pathway. GR binding directly to NF-κB itself-tethering in a DNA binding-independent manner-represents the standing model of how GCs inhibit NF-κB-driven transcription. We demonstrate that direct binding of GR to genomic NF-κB response elements (κBREs) mediates GR-driven repression of inflammatory gene expression. We report five crystal structures and solution NMR data of GR DBD-κBRE complexes, which reveal that GR recognizes a cryptic response element between the binding footprints of NF-κB subunits within κBREs. These cryptic sequences exhibit high sequence and functional conservation, suggesting that GR binding to κBREs is an evolutionarily conserved mechanism of controlling the inflammatory response.

  6. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

    PubMed Central

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

    2013-01-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

  7. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

    PubMed

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

    2013-09-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

  8. Binding affinities of cationic dyes in the presence of activated charcoal and anionic surfactant in the premicellar region

    NASA Astrophysics Data System (ADS)

    Ali, Farman; Ibrahim, Muhammad; Khan, Fawad; Bibi, Iram; Shah, Syed W. H.

    2018-03-01

    Binding preferences of cationic dyes malachite green and methylene blue in a mixed charcoal-sodium dodecyl sulfate system have been investigated using UV-visible absorption spectroscopy. The dye adsorption shows surfactant-dependent patterns, indicating diverse modes of interactions. At low surfactant concentration, a direct binding to charcoal is preferred. Comparatively greater quantities of surfactant lead to attachment of dye-surfactant complex to charcoal through hydrophobic interactions. A simple model was employed for determination of equilibrium constant K eq and concentration of dye-surfactant ion pair N DS for both dyes. The values of binding parameters revealed that malachite green was directly adsorbed onto charcoal, whereas methylene blue was bound through surfactant monomers. The model is valid for low surfactant concentrations in the premicellar region. These findings have significance for material and environmental sciences.

  9. Multitargeting by curcumin as revealed by molecular interaction studies

    PubMed Central

    Gupta, Subash C.; Prasad, Sahdeo; Kim, Ji Hye; Patchva, Sridevi; Webb, Lauren J.; Priyadarsini, Indira K.

    2012-01-01

    Curcumin (diferuloylmethane), the active ingredient in turmeric (Curcuma longa), is a highly pleiotropic molecule with anti-inflammatory, anti-oxidant, chemopreventive, chemosensitization, and radiosensitization activities. The pleiotropic activities attributed to curcumin come from its complex molecular structure and chemistry, as well as its ability to influence multiple signaling molecules. Curcumin has been shown to bind by multiple forces directly to numerous signaling molecules, such as inflammatory molecules, cell survival proteins, protein kinases, protein reductases, histone acetyltransferase, histone deacetylase, glyoxalase I, xanthine oxidase, proteasome, HIV1 integrase, HIV1 protease, sarco (endo) plasmic reticulum Ca2+ ATPase, DNA methyltransferases 1, FtsZ protofilaments, carrier proteins, and metal ions. Curcumin can also bind directly to DNA and RNA. Owing to its β-diketone moiety, curcumin undergoes keto–enol tautomerism that has been reported as a favorable state for direct binding. The functional groups on curcumin found suitable for interaction with other macromolecules include the α, β-unsaturated β-diketone moiety, carbonyl and enolic groups of the β-diketone moiety, methoxy and phenolic hydroxyl groups, and the phenyl rings. Various biophysical tools have been used to monitor direct interaction of curcumin with other proteins, including absorption, fluorescence, Fourier transform infrared (FTIR) and circular dichroism (CD) spectroscopy, surface plasmon resonance, competitive ligand binding, Forster type fluorescence resonance energy transfer (FRET), radiolabeling, site-directed mutagenesis, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS), immunoprecipitation, phage display biopanning, electron microscopy, 1-anilino-8-naphthalene-sulfonate (ANS) displacement, and co-localization. Molecular docking, the most commonly employed computational tool for calculating binding affinities and predicting binding sites, has also been used to further characterize curcumin’s binding sites. Furthermore, the ability of curcumin to bind directly to carrier proteins improves its solubility and bioavailability. In this review, we focus on how curcumin directly targets signaling molecules, as well as the different forces that bind the curcumin–protein complex and how this interaction affects the biological properties of proteins. We will also discuss various analogues of curcumin designed to bind selective targets with increased affinity. PMID:21979811

  10. Structural, Functional, and Genetic Analysis of Sorangicin Inhibition of Bacterial RNA Polymerase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Campbell,E.; Pavlova, O.; Zenkin, N.

    2005-01-01

    A combined structural, functional, and genetic approach was used to investigate inhibition of bacterial RNA polymerase (RNAP) by sorangicin (Sor), a macrolide polyether antibiotic. Sor lacks chemical and structural similarity to the ansamycin rifampicin (Rif), an RNAP inhibitor widely used to treat tuberculosis. Nevertheless, structural analysis revealed Sor binds in the same RNAP {beta} subunit pocket as Rif, with almost complete overlap of RNAP binding determinants, and functional analysis revealed that both antibiotics inhibit transcription by directly blocking the path of the elongating transcript at a length of 2-3 nucleotides. Genetic analysis indicates that Rif binding is extremely sensitive tomore » mutations expected to change the shape of the antibiotic binding pocket, while Sor is not. We suggest that conformational flexibility of Sor, in contrast to the rigid conformation of Rif, allows Sor to adapt to changes in the binding pocket. This has important implications for drug design against rapidly mutating targets.« less

  11. The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen

    2010-04-26

    Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, themore » streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.« less

  12. Effects of ligand binding on the dynamics of rice nonspecific lipid transfer protein 1: a model from molecular simulations.

    PubMed

    Lai, Yen-Ting; Cheng, Chao-Sheng; Liu, Yu-Nan; Liu, Yaw-Jen; Lyu, Ping-Chiang

    2008-09-01

    Plant nonspecific lipid transfer proteins (nsLTPs) are small, basic proteins constituted mainly of alpha-helices and stabilized by four conserved disulfide bridges. They are characterized by the presence of a tunnel-like hydrophobic cavity, capable of transferring various lipid molecules between lipid bilayers in vitro. In this study, molecular dynamics (MD) simulations were performed at room temperature to investigate the effects of lipid binding on the dynamic properties of rice nsLTP1. Rice nsLTP1, either in the free form or complexed with one or two lipids was subjected to MD simulations. The C-terminal loop was very flexible both before and after lipid binding, as revealed by calculating the root-mean-square fluctuation. After lipid binding, the flexibility of some residues that were not in direct contact with lipid molecules increased significantly, indicating an increase of entropy in the region distal from the binding site. Essential dynamics analysis revealed clear differences in motion between unliganded and liganded rice nsLTP1s. In the free form of rice nsLTP1, loop1 exhibited the largest directional motion. This specific essential motion mode diminished after binding one or two lipid molecules. To verify the origin of the essential motion observed in the free form of rice nsLTP1, we performed multiple sequence alignments to probe the intrinsic motion encoded in the primary sequence. We found that the amino acid sequence of loop1 is highly conserved among plant nsLTP1s, thus revealing its functional importance during evolution. Furthermore, the sequence of loop1 is composed mainly of amino acids with short side chains. In this study, we show that MD simulations, together with essential dynamics analysis, can be used to determine structural and dynamic differences of rice nsLTP1 upon lipid binding. 2008 Wiley-Liss, Inc.

  13. Deletion of transcription factor binding motifs using the CRISPR/spCas9 system in the β-globin LCR.

    PubMed

    Kim, Yea Woon; Kim, AeRi

    2017-07-20

    Transcription factors play roles in gene transcription through direct binding to their motifs in genome, and inhibiting this binding provides an effective strategy for studying their roles. Here we applied the CRISPR/spCas9 system to mutate the binding motifs of transcription factors. Binding motifs for erythroid specific transcription factors were mutated in the locus control region hypersensitive sites of the human β-globin locus. Guide RNAs targeting binding motifs were cloned into lentiviral CRISPR vector containing the spCas9 gene, and transduced into MEL/ch11 cells carrying a human chromosome 11. DNA mutations in clonal cells were initially screened by quantitative PCR in genomic DNA and then clarified by sequencing. Mutations in binding motifs reduced occupancy by transcription factors in a chromatin environment. Characterization of mutations revealed that the CRISPR/spCas9 system mainly induced deletions in short regions of <20 bp and preferentially deleted nucleotides around the fifth nucleotide upstream of Protospacer adjacent motifs. These results indicate that the CRISPR/Cas9 system is suitable for mutating the binding motifs of transcription factors, and, consequently, would contribute to elucidate the direct roles of transcription factors. ©2017 The Author(s).

  14. The MTA family proteins as novel histone H3 binding proteins.

    PubMed

    Wu, Meng; Wang, Lina; Li, Qian; Li, Jiwen; Qin, Jun; Wong, Jiemin

    2013-01-03

    The nucleosome remodeling and histone deacetylase complex (Mi2/NRD/NuRD/NURD) has a broad role in regulation of transcription, DNA repair and cell cycle. Previous studies have revealed a specific interaction between NURD and histone H3N-terminal tail in vitro that is not observed for another HDAC1/2-containing complex, Sin3A. However, the subunit(s) responsible for specific binding of H3 by NURD has not been defined. In this study, we show among several class I HDAC-containing corepressor complexes only NURD exhibits a substantial H3 tail-binding activity in vitro. We present the evidence that the MTA family proteins within the NURD complex interact directly with H3 tail. Extensive in vitro binding assays mapped the H3 tail-binding domain to the C-terminal region of MTA1 and MTA2. Significantly, although the MTA1 and MTA2 mutant proteins with deletion of the C-terminal H3 tail binding domain were assembled into the endogenous NURD complex when expressed in mammalian cells, the resulting NURD complexes were deficient in binding H3 tail in vitro, indicating that the MTA family proteins are required for the observed specific binding of H3 tail peptide by NURD in vitro. However, chromatin fractionation experiments show that the NURD complexes with impaired MTA1/2-H3 tail binding activity remained to be associated with chromatin in cells. Together our study reveals a novel histone H3-binding activity for the MTA family proteins and provides evidence that the MTA family proteins mediate the in vitro specific binding of H3 tail peptide by NURD complex. However, multiple mechanisms are likely to contribute to the chromatin association of NURD complex in cells. Our finding also raises the possibility that the MTA family proteins may exert their diverse biological functions at least in part through their direct interaction with H3 tail.

  15. The MTA family proteins as novel histone H3 binding proteins

    PubMed Central

    2013-01-01

    Background The nucleosome remodeling and histone deacetylase complex (Mi2/NRD/NuRD/NURD) has a broad role in regulation of transcription, DNA repair and cell cycle. Previous studies have revealed a specific interaction between NURD and histone H3N-terminal tail in vitro that is not observed for another HDAC1/2-containing complex, Sin3A. However, the subunit(s) responsible for specific binding of H3 by NURD has not been defined. Results In this study, we show among several class I HDAC-containing corepressor complexes only NURD exhibits a substantial H3 tail-binding activity in vitro. We present the evidence that the MTA family proteins within the NURD complex interact directly with H3 tail. Extensive in vitro binding assays mapped the H3 tail-binding domain to the C-terminal region of MTA1 and MTA2. Significantly, although the MTA1 and MTA2 mutant proteins with deletion of the C-terminal H3 tail binding domain were assembled into the endogenous NURD complex when expressed in mammalian cells, the resulting NURD complexes were deficient in binding H3 tail in vitro, indicating that the MTA family proteins are required for the observed specific binding of H3 tail peptide by NURD in vitro. However, chromatin fractionation experiments show that the NURD complexes with impaired MTA1/2-H3 tail binding activity remained to be associated with chromatin in cells. Conclusions Together our study reveals a novel histone H3-binding activity for the MTA family proteins and provides evidence that the MTA family proteins mediate the in vitro specific binding of H3 tail peptide by NURD complex. However, multiple mechanisms are likely to contribute to the chromatin association of NURD complex in cells. Our finding also raises the possibility that the MTA family proteins may exert their diverse biological functions at least in part through their direct interaction with H3 tail. PMID:23286669

  16. Non-Native Metal Ion Reveals the Role of Electrostatics in Synaptotagmin 1-Membrane Interactions.

    PubMed

    Katti, Sachin; Nyenhuis, Sarah B; Her, Bin; Srivastava, Atul K; Taylor, Alexander B; Hart, P John; Cafiso, David S; Igumenova, Tatyana I

    2017-06-27

    C2 domains are independently folded modules that often target their host proteins to anionic membranes in a Ca 2+ -dependent manner. In these cases, membrane association is triggered by Ca 2+ binding to the negatively charged loop region of the C2 domain. Here, we used a non-native metal ion, Cd 2+ , in lieu of Ca 2+ to gain insight into the contributions made by long-range Coulombic interactions and direct metal ion-lipid bridging to membrane binding. Using X-ray crystallography, NMR, Förster resonance energy transfer, and vesicle cosedimentation assays, we demonstrate that, although Cd 2+ binds to the loop region of C2A/B domains of synaptotagmin 1 with high affinity, long-range Coulombic interactions are too weak to support membrane binding of individual domains. We attribute this behavior to two factors: the stoichiometry of Cd 2+ binding to the loop regions of the C2A and C2B domains and the impaired ability of Cd 2+ to directly coordinate the lipids. In contrast, electron paramagnetic resonance experiments revealed that Cd 2+ does support membrane binding of the C2 domains in full-length synaptotagmin 1, where the high local lipid concentrations that result from membrane tethering can partially compensate for lack of a full complement of divalent metal ions and specific lipid coordination in Cd 2+ -complexed C2A/B domains. Our data suggest that long-range Coulombic interactions alone can drive the initial association of C2A/B with anionic membranes and that Ca 2+ further augments membrane binding by the formation of metal ion-lipid coordination bonds and additional Ca 2+ ion binding to the C2 domain loop regions.

  17. Genome-wide Expression Profiling, In Vivo DNA Binding Analysis, and Probabilistic Motif Prediction Reveal Novel Abf1 Target Genes during Fermentation, Respiration, and Sporulation in Yeast

    PubMed Central

    Schlecht, Ulrich; Erb, Ionas; Demougin, Philippe; Robine, Nicolas; Borde, Valérie; van Nimwegen, Erik; Nicolas, Alain

    2008-01-01

    The autonomously replicating sequence binding factor 1 (Abf1) was initially identified as an essential DNA replication factor and later shown to be a component of the regulatory network controlling mitotic and meiotic cell cycle progression in budding yeast. The protein is thought to exert its functions via specific interaction with its target site as part of distinct protein complexes, but its roles during mitotic growth and meiotic development are only partially understood. Here, we report a comprehensive approach aiming at the identification of direct Abf1-target genes expressed during fermentation, respiration, and sporulation. Computational prediction of the protein's target sites was integrated with a genome-wide DNA binding assay in growing and sporulating cells. The resulting data were combined with the output of expression profiling studies using wild-type versus temperature-sensitive alleles. This work identified 434 protein-coding loci as being transcriptionally dependent on Abf1. More than 60% of their putative promoter regions contained a computationally predicted Abf1 binding site and/or were bound by Abf1 in vivo, identifying them as direct targets. The present study revealed numerous loci previously unknown to be under Abf1 control, and it yielded evidence for the protein's variable DNA binding pattern during mitotic growth and meiotic development. PMID:18305101

  18. Mechanism of Archaeal MCM Helicase Recruitment to DNA Replication Origins

    PubMed Central

    Samson, Rachel Y.; Abeyrathne, Priyanka D.; Bell, Stephen D.

    2015-01-01

    Summary Cellular DNA replication origins direct the recruitment of replicative helicases via the action of initiator proteins belonging to the AAA+ superfamily of ATPases. Archaea have a simplified subset of the eukaryotic DNA replication machinery proteins and possess initiators that appear ancestral to both eukaryotic Orc1 and Cdc6. We have reconstituted origin-dependent recruitment of the homohexameric archaeal MCM in vitro with purified recombinant proteins. Using this system, we reveal that archaeal Orc1-1 fulfills both Orc1 and Cdc6 functions by binding to a replication origin and directly recruiting MCM helicase. We identify the interaction interface between these proteins and reveal how ATP binding by Orc1-1 modulates recruitment of MCM. Additionally, we provide evidence that an open-ring form of the archaeal MCM homohexamer is loaded at origins. PMID:26725007

  19. Direct Pore Binding as a Mechanism for Isoflurane Inhibition of the Pentameric Ligand-gated Ion Channel ELIC.

    PubMed

    Chen, Qiang; Kinde, Monica N; Arjunan, Palaniappa; Wells, Marta M; Cohen, Aina E; Xu, Yan; Tang, Pei

    2015-09-08

    Pentameric ligand-gated ion channels (pLGICs) are targets of general anesthetics, but molecular mechanisms underlying anesthetic action remain debatable. We found that ELIC, a pLGIC from Erwinia chrysanthemi, can be functionally inhibited by isoflurane and other anesthetics. Structures of ELIC co-crystallized with isoflurane in the absence or presence of an agonist revealed double isoflurane occupancies inside the pore near T237(6') and A244(13'). A pore-radius contraction near the extracellular entrance was observed upon isoflurane binding. Electrophysiology measurements with a single-point mutation at position 6' or 13' support the notion that binding at these sites renders isoflurane inhibition. Molecular dynamics simulations suggested that isoflurane binding was more stable in the resting than in a desensitized pore conformation. This study presents compelling evidence for a direct pore-binding mechanism of isoflurane inhibition, which has a general implication for inhibitory action of general anesthetics on pLGICs.

  20. Direct Pore Binding as a Mechanism for Isoflurane Inhibition of the Pentameric Ligand-gated Ion Channel ELIC

    PubMed Central

    Chen, Qiang; Kinde, Monica N.; Arjunan, Palaniappa; Wells, Marta M.; Cohen, Aina E.; Xu, Yan; Tang, Pei

    2015-01-01

    Pentameric ligand-gated ion channels (pLGICs) are targets of general anesthetics, but molecular mechanisms underlying anesthetic action remain debatable. We found that ELIC, a pLGIC from Erwinia chrysanthemi, can be functionally inhibited by isoflurane and other anesthetics. Structures of ELIC co-crystallized with isoflurane in the absence or presence of an agonist revealed double isoflurane occupancies inside the pore near T237(6′) and A244(13′). A pore-radius contraction near the extracellular entrance was observed upon isoflurane binding. Electrophysiology measurements with a single-point mutation at position 6′ or 13′ support the notion that binding at these sites renders isoflurane inhibition. Molecular dynamics simulations suggested that isoflurane binding was more stable in the resting than in a desensitized pore conformation. This study presents compelling evidence for a direct pore-binding mechanism of isoflurane inhibition, which has a general implication for inhibitory action of general anesthetics on pLGICs. PMID:26346220

  1. A solid-phase assay for studying direct binding of progranulin to TNFR and progranulin antagonism of TNF/TNFR interactions.

    PubMed

    Tian, Qingyun; Zhao, Shuai; Liu, Chuanju

    2014-01-01

    The discovery that TNF receptors (TNFR) serve as the binding receptors for progranulin (PGRN) reveals the significant role of PGRN in inflammatory and autoimmune diseases, including inflammatory arthritis. Herein we describe a simple, antibody-free analytical assay, i.e., a biotin-based solid-phase binding assay, to examine the direct interaction of PGRN/TNFR and the PGRN inhibition of TNF/TNFR interactions. Briefly, a 96-well high-binding microplate is first coated with the first protein (protein A), and after blocking, the coated microplate is incubated with the biotin-labeled second protein (protein B) in the absence or presence of the third protein (protein C). Finally the streptavidin conjugated with a detecting enzyme is added, followed by a signal measurement. Also discussed in this chapter are the advantages of the strategy, key elements to obtain reliable results, and discrepancies among various PGRN proteins in view of the binding activity with TNFR.

  2. Load-dependent ADP binding to myosins V and VI: Implications for subunit coordination and function

    PubMed Central

    Oguchi, Yusuke; Mikhailenko, Sergey V.; Ohki, Takashi; Olivares, Adrian O.; De La Cruz, Enrique M.; Ishiwata, Shin'ichi

    2008-01-01

    Dimeric myosins V and VI travel long distances in opposite directions along actin filaments in cells, taking multiple steps in a “hand-over-hand” fashion. The catalytic cycles of both myosins are limited by ADP dissociation, which is considered a key step in the walking mechanism of these motors. Here, we demonstrate that external loads applied to individual actomyosin V or VI bonds asymmetrically affect ADP affinity, such that ADP binds weaker under loads assisting motility. Model-based analysis reveals that forward and backward loads modulate the kinetics of ADP binding to both myosins, although the effect is less pronounced for myosin VI. ADP dissociation is modestly accelerated by forward loads and inhibited by backward loads. Loads applied in either direction slow ADP binding to myosin V but accelerate binding to myosin VI. We calculate that the intramolecular load generated during processive stepping is ≈2 pN for both myosin V and myosin VI. The distinct load dependence of ADP binding allows these motors to perform different cellular functions. PMID:18509050

  3. The carboxyl terminus of the alpha-subunit of the amiloride-sensitive epithelial sodium channel binds to F-actin.

    PubMed

    Mazzochi, Christopher; Bubien, James K; Smith, Peter R; Benos, Dale J

    2006-03-10

    The activity of the amiloride-sensitive epithelial sodium channel (ENaC) is modulated by F-actin. However, it is unknown if there is a direct interaction between alpha-ENaC and actin. We have investigated the hypothesis that the actin cytoskeleton directly binds to the carboxyl terminus of alpha-ENaC using a combination of confocal microscopy, co-immunoprecipitation, and protein binding studies. Confocal microscopy of Madin-Darby canine kidney cell monolayers stably transfected with wild type, rat isoforms of alpha-, beta-, and gamma-ENaC revealed co-localization of alpha-ENaC with the cortical F-actin cytoskeleton both at the apical membrane and within the subapical cytoplasm. F-actin was found to co-immunoprecipitate with alpha-ENaC from whole cell lysates of this cell line. Gel overlay assays demonstrated that F-actin specifically binds to the carboxyl terminus of alpha-ENaC. A direct interaction between F-actin and the COOH terminus of alpha-ENaC was further corroborated by F-actin co-sedimentation studies. This is the first study to report a direct and specific biochemical interaction between F-actin and ENaC.

  4. The RNA-binding complex ESCRT-II in Xenopus laevis eggs recognizes purine-rich sequences through its subunit Vps25.

    PubMed

    Emerman, Amy B; Blower, Michael

    2018-06-14

    RNA-binding proteins (RBPs) are critical regulators of gene expression. Recent studies have uncovered hundreds of mRNA-binding proteins that do not contain annotated RNA-binding domains and have well-established roles in other cellular processes. Investigation of these nonconventional RBPs is critical for revealing novel RNA-binding domains and may disclose connections between RNA regulation and other aspects of cell biology. Endosomal sorting complex required for transport II (ESCRT-II) is a nonconventional RNA-binding complex that has a canonical role in multivesicular body formation. ESCRT-II previously has been identified as an RNA-binding complex in Drosophila oocytes, but whether its RNA-binding properties extend beyond Drosophila is unknown. In this study, we found that the RNA-binding properties of ESCRT-II are conserved in Xenopus eggs, where ESCRT-II interacted with hundreds of mRNAs. Using a UV-crosslinking approach, we demonstrated that ESCRT-II binds directly to RNA through its subunit Vps25. UV-crosslinking and immunoprecipitation (CLIP)-Seq revealed that Vps25 specifically recognizes a polypurine (i.e. GA-rich) motif in RNA. Using purified components, we could reconstitute the selective Vps25-mediated binding of the polypurine motif in vitro. Our results provide insight into the mechanism by which ESCRT-II selectively binds to mRNAs and also suggest an unexpected link between endosome biology and RNA regulation. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Structural characterization of acyl-CoA oxidases reveals a direct link between pheromone biosynthesis and metabolic state in Caenorhabditis elegans

    PubMed Central

    Zhang, Xinxing; Jones, Rachel A.; Bruner, Steven D.; Butcher, Rebecca A.

    2016-01-01

    Caenorhabditis elegans secretes ascarosides as pheromones to communicate with other worms and to coordinate the development and behavior of the population. Peroxisomal β-oxidation cycles shorten the side chains of ascaroside precursors to produce the short-chain ascaroside pheromones. Acyl-CoA oxidases, which catalyze the first step in these β-oxidation cycles, have different side chain-length specificities and enable C. elegans to regulate the production of specific ascaroside pheromones. Here, we determine the crystal structure of the acyl-CoA oxidase 1 (ACOX-1) homodimer and the ACOX-2 homodimer bound to its substrate. Our results provide a molecular basis for the substrate specificities of the acyl-CoA oxidases and reveal why some of these enzymes have a very broad substrate range, whereas others are quite specific. Our results also enable predictions to be made for the roles of uncharacterized acyl-CoA oxidases in C. elegans and in other nematode species. Remarkably, we show that most of the C. elegans acyl-CoA oxidases that participate in ascaroside biosynthesis contain a conserved ATP-binding pocket that lies at the dimer interface, and we identify key residues in this binding pocket. ATP binding induces a structural change that is associated with tighter binding of the FAD cofactor. Mutations that disrupt ATP binding reduce FAD binding and reduce enzyme activity. Thus, ATP may serve as a regulator of acyl-CoA oxidase activity, thereby directly linking ascaroside biosynthesis to ATP concentration and metabolic state. PMID:27551084

  6. Structural analyses of von Willebrand factor C domains of collagen 2A and CCN3 reveal an alternative mode of binding to bone morphogenetic protein-2.

    PubMed

    Xu, Emma-Ruoqi; Blythe, Emily E; Fischer, Gerhard; Hyvönen, Marko

    2017-07-28

    Bone morphogenetic proteins (BMPs) are secreted growth factors that promote differentiation processes in embryogenesis and tissue development. Regulation of BMP signaling involves binding to a variety of extracellular proteins, among which are many von Willebrand factor C (vWC) domain-containing proteins. Although the crystal structure of the complex of crossveinless-2 (CV-2) vWC1 and BMP-2 previously revealed one mode of the vWC/BMP-binding mechanism, other vWC domains may bind to BMP differently. Here, using X-ray crystallography, we present for the first time structures of the vWC domains of two proteins thought to interact with BMP-2: collagen IIA and matricellular protein CCN3. We found that these two vWC domains share a similar N-terminal fold that differs greatly from that in CV-2 vWC, which comprises its BMP-2-binding site. We analyzed the ability of these vWC domains to directly bind to BMP-2 and detected an interaction only between the collagen IIa vWC and BMP-2. Guided by the collagen IIa vWC domain crystal structure and conservation of surface residues among orthologous domains, we mapped the BMP-binding epitope on the subdomain 1 of the vWC domain. This binding site is different from that previously observed in the complex between CV-2 vWC and BMP-2, revealing an alternative mode of interaction between vWC domains and BMPs. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. CW EPR parameters reveal cytochrome P450 ligand binding modes.

    PubMed

    Lockart, Molly M; Rodriguez, Carlo A; Atkins, William M; Bowman, Michael K

    2018-06-01

    Cytochrome P450 (CYP) monoxygenses utilize heme cofactors to catalyze oxidation reactions. They play a critical role in metabolism of many classes of drugs, are an attractive target for drug development, and mediate several prominent drug interactions. Many substrates and inhibitors alter the spin state of the ferric heme by displacing the heme's axial water ligand in the resting enzyme to yield a five-coordinate iron complex, or they replace the axial water to yield a nitrogen-ligated six-coordinate iron complex, which are traditionally assigned by UV-vis spectroscopy. However, crystal structures and recent pulsed electron paramagnetic resonance (EPR) studies find a few cases where molecules hydrogen bond to the axial water. The water-bridged drug-H 2 O-heme has UV-vis spectra similar to nitrogen-ligated, six-coordinate complexes, but are closer to "reverse type I" complexes described in older liteature. Here, pulsed and continuous wave (CW) EPR demonstrate that water-bridged complexes are remarkably common among a range of nitrogenous drugs or drug fragments that bind to CYP3A4 or CYP2C9. Principal component analysis reveals a distinct clustering of CW EPR spectral parameters for water-bridged complexes. CW EPR reveals heterogeneous mixtures of ligated states, including multiple directly-coordinated complexes and water-bridged complexes. These results suggest that water-bridged complexes are under-represented in CYP structural databases and can have energies similar to other ligation modes. The data indicates that water-bridged binding modes can be identified and distinguished from directly-coordinated binding by CW EPR. Copyright © 2018 Elsevier Inc. All rights reserved.

  8. Target engagement and drug residence time can be observed in living cells with BRET

    PubMed Central

    Robers, Matthew B.; Dart, Melanie L.; Woodroofe, Carolyn C.; Zimprich, Chad A.; Kirkland, Thomas A.; Machleidt, Thomas; Kupcho, Kevin R.; Levin, Sergiy; Hartnett, James R.; Zimmerman, Kristopher; Niles, Andrew L.; Ohana, Rachel Friedman; Daniels, Danette L.; Slater, Michael; Wood, Monika G.; Cong, Mei; Cheng, Yi-Qiang; Wood, Keith V.

    2015-01-01

    The therapeutic action of drugs is predicated on their physical engagement with cellular targets. Here we describe a broadly applicable method using bioluminescence resonance energy transfer (BRET) to reveal the binding characteristics of a drug with selected targets within intact cells. Cell-permeable fluorescent tracers are used in a competitive binding format to quantify drug engagement with the target proteins fused to Nanoluc luciferase. The approach enabled us to profile isozyme-specific engagement and binding kinetics for a panel of histone deacetylase (HDAC) inhibitors. Our analysis was directed particularly to the clinically approved prodrug FK228 (Istodax/Romidepsin) because of its unique and largely unexplained mechanism of sustained intracellular action. Analysis of the binding kinetics by BRET revealed remarkably long intracellular residence times for FK228 at HDAC1, explaining the protracted intracellular behaviour of this prodrug. Our results demonstrate a novel application of BRET for assessing target engagement within the complex milieu of the intracellular environment. PMID:26631872

  9. Identification of potential target genes for the tomato fruit-ripening regulator RIN by chromatin immunoprecipitation.

    PubMed

    Fujisawa, Masaki; Nakano, Toshitsugu; Ito, Yasuhiro

    2011-01-30

    During ripening, climacteric fruits increase their ethylene level and subsequently undergo various physiological changes, such as softening, pigmentation and development of aroma and flavor. These changes occur simultaneously and are caused by the highly synchronized expression of numerous genes at the onset of ripening. In tomatoes, the MADS-box transcription factor RIN has been regarded as a key regulator responsible for the onset of ripening by acting upstream of both ethylene- and non-ethylene-mediated controls. However, except for LeACS2, direct targets of RIN have not been clarified, and little is known about the transcriptional cascade for ripening. Using immunoprecipitated (IPed) DNA fragments recovered by chromatin immunoprecipitation (ChIP) with anti-RIN antibody from ripening tomato fruit, we analyzed potential binding sites for RIN (CArG-box sites) in the promoters of representative ripening-induced genes by quantitative PCR. Results revealed nearly a 5- to 20-fold enrichment of CArG boxes in the promoters of LeACS2, LeACS4, PG, TBG4, LeEXP1, and LeMAN4 and of RIN itself, indicating direct interaction of RIN with their promoters in vivo. Moreover, sequence analysis and genome mapping of 51 cloned IPed DNAs revealed potential RIN binding sites. Quantitative PCR revealed that four of the potential binding sites were enriched 4- to 17-fold in the IPed DNA pools compared with the controls, indicating direct interaction of RIN with these sites in vivo. Near one of the four CArG boxes we found a gene encoding a protein similar to thioredoxin y1. An increase in the transcript level of this gene was observed with ripening in normal fruit but not in the rin mutant, suggesting that RIN possibly induces its expression. The presented results suggest that RIN controls fruit softening and ethylene production by the direct transcriptional regulation of cell-wall-modifying genes and ethylene biosynthesis genes during ripening. Moreover, the binding of RIN to its own promoter suggests the presence of autoregulation for RIN expression. ChIP-based analyses identified a novel RIN-binding CArG-box site that harbors a gene associated with RIN expression in its flanking region. These findings clarify the crucial role of RIN in the transcriptional regulation of ripening initiation and progression.

  10. Molecular Mechanotransduction: how forces trigger cytoskeletal dynamics

    NASA Astrophysics Data System (ADS)

    Ehrlicher, Allen

    2012-02-01

    Mechanical stresses elicit cellular reactions mediated by chemical signals. Defective responses to forces underlie human medical disorders, such as cardiac failure and pulmonary injury. Despite detailed knowledge of the cytoskeleton's structure, the specific molecular switches that convert mechanical stimuli into chemical signals have remained elusive. Here we identify the actin-binding protein, filamin A (FLNa) as a central mechanotransduction element of the cytoskeleton by using Fluorescence Loss After photoConversion (FLAC), a novel high-speed alternative to FRAP. We reconstituted a minimal system consisting of actin filaments, FLNa and two FLNa-binding partners: the cytoplasmic tail of ß-integrin, and FilGAP. Integrins form an essential mechanical linkage between extracellular and intracellular environments, with ß integrin tails connecting to the actin cytoskeleton by binding directly to filamin. FilGAP is a FLNa-binding GTPase-activating protein specific for Rac, which in vivo regulates cell spreading and bleb formation. We demonstrate that both externally-imposed bulk shear and myosin II driven forces differentially regulate the binding of integrin and FilGAP to FLNa. Consistent with structural predictions, strain increases ß-integrin binding to FLNa, whereas it causes FilGAP to dissociate from FLNa, providing a direct and specific molecular basis for cellular mechanotransduction. These results identify the first molecular mechanotransduction element within the actin cytoskeleton, revealing that mechanical strain of key proteins regulates the binding of signaling molecules. Moreover, GAP activity has been shown to switch cell movement from mesenchymal to amoeboid motility, suggesting that mechanical forces directly impact the invasiveness of cancer.

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zalewski, Jenna K.; Mo, Joshua H.; Heber, Simone

    Shroom-mediated remodeling of the actomyosin cytoskeleton is a critical driver of cellular shape and tissue morphology that underlies the development of many tissues including the neural tube, eye, intestines, and vasculature. Shroom uses a conserved SD2 domain to direct the subcellular localization of Rho-associated kinase (Rock), which in turn drives changes in the cytoskeleton and cellular morphology through its ability to phosphorylate and activate non-muscle myosin II. Here in this paper, we present the structure of the human Shroom-Rock binding module, revealing an unexpected stoichiometry for Shroom in which two Shroom SD2 domains bind independent surfaces on Rock. Mutation ofmore » interfacial residues impaired Shroom-Rock binding in vitro and resulted in altered remodeling of the cytoskeleton and loss of Shroom-mediated changes in cellular morphology. In addition, we provide the first direct evidence that Shroom can function as a Rock activator. These data provide molecular insight into the Shroom-Rock interface and demonstrate that Shroom directly participates in regulating cytoskeletal dynamics, adding to its known role in Rock localization.« less

  12. Structural basis for collagen recognition by the immune receptor OSCAR.

    PubMed

    Zhou, Long; Hinerman, Jennifer M; Blaszczyk, Michal; Miller, Jeanette L C; Conrady, Deborah G; Barrow, Alexander D; Chirgadze, Dimitri Y; Bihan, Dominique; Farndale, Richard W; Herr, Andrew B

    2016-02-04

    The osteoclast-associated receptor (OSCAR) is a collagen-binding immune receptor with important roles in dendritic cell maturation and activation of inflammatory monocytes as well as in osteoclastogenesis. The crystal structure of the OSCAR ectodomain is presented, both free and in complex with a consensus triple-helical peptide (THP). The structures revealed a collagen-binding site in each immunoglobulin-like domain (D1 and D2). The THP binds near a predicted collagen-binding groove in D1, but a more extensive interaction with D2 is facilitated by the unusually wide D1-D2 interdomain angle in OSCAR. Direct binding assays, combined with site-directed mutagenesis, confirm that the primary collagen-binding site in OSCAR resides in D2, in marked contrast to the related collagen receptors, glycoprotein VI (GPVI) and leukocyte-associated immunoglobulin-like receptor-1 (LAIR-1). Monomeric OSCAR D1D2 binds to the consensus THP with a KD of 28 µM measured in solution, but shows a higher affinity (KD 1.5 μM) when binding to a solid-phase THP, most likely due to an avidity effect. These data suggest a 2-stage model for the interaction of OSCAR with a collagen fibril, with transient, low-affinity interactions initiated by the membrane-distal D1, followed by firm adhesion to the primary binding site in D2. © 2016 by The American Society of Hematology.

  13. LeuT-Desipramine Structure Reveals How Antidepressants Block Neurotransmitter Reuptake

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou,Z.; Zhen, J.; Karpowich, N.

    2007-01-01

    Tricyclic antidepressants exert their pharmacological effect -- inhibiting the reuptake of serotonin, norepinephrine, and dopamine -- by directly blocking neurotransmitter transporters (SERT, NET, and DAT, respectively) in the presynaptic membrane. The drug-binding site and the mechanism of this inhibition are poorly understood. We determined the crystal structure at 2.9 angstroms of the bacterial leucine transporter (LeuT), a homolog of SERT, NET, and DAT, in complex with leucine and the antidepressant desipramine. Desipramine binds at the inner end of the extracellular cavity of the transporter and is held in place by a hairpin loop and by a salt bridge. This bindingmore » site is separated from the leucine-binding site by the extracellular gate of the transporter. By directly locking the gate, desipramine prevents conformational changes and blocks substrate transport. Mutagenesis experiments on human SERT and DAT indicate that both the desipramine-binding site and its inhibition mechanism are probably conserved in the human neurotransmitter transporters.« less

  14. Bidirectional Lipid Droplet Velocities Are Controlled by Differential Binding Strengths of HCV Core DII Protein

    PubMed Central

    Lyn, Rodney K.; Hope, Graham; Sherratt, Allison R.; McLauchlan, John; Pezacki, John Paul

    2013-01-01

    Host cell lipid droplets (LD) are essential in the hepatitis C virus (HCV) life cycle and are targeted by the viral capsid core protein. Core-coated LDs accumulate in the perinuclear region and facilitate viral particle assembly, but it is unclear how mobility of these LDs is directed by core. Herein we used two-photon fluorescence, differential interference contrast imaging, and coherent anti-Stokes Raman scattering microscopies, to reveal novel core-mediated changes to LD dynamics. Expression of core protein’s lipid binding domain II (DII-core) induced slower LD speeds, but did not affect directionality of movement on microtubules. Modulating the LD binding strength of DII-core further impacted LD mobility, revealing the temporal effects of LD-bound DII-core. These results for DII-core coated LDs support a model for core-mediated LD localization that involves core slowing down the rate of movement of LDs until localization at the perinuclear region is accomplished where LD movement ceases. The guided localization of LDs by HCV core protein not only is essential to the viral life cycle but also poses an interesting target for the development of antiviral strategies against HCV. PMID:24223760

  15. A novel assay reveals preferential binding between Rabs, kinesins, and specific endosomal subpopulations

    PubMed Central

    Bentley, Marvin; Decker, Helena; Luisi, Julie

    2015-01-01

    Identifying the proteins that regulate vesicle trafficking is a fundamental problem in cell biology. In this paper, we introduce a new assay that involves the expression of an FKBP12-rapamycin–binding domain–tagged candidate vesicle-binding protein, which can be inducibly linked to dynein or kinesin. Vesicles can be labeled by any convenient method. If the candidate protein binds the labeled vesicles, addition of the linker drug results in a predictable, highly distinctive change in vesicle localization. This assay generates robust and easily interpretable results that provide direct experimental evidence of binding between a candidate protein and the vesicle population of interest. We used this approach to compare the binding of Kinesin-3 family members with different endosomal populations. We found that KIF13A and KIF13B bind preferentially to early endosomes and that KIF1A and KIF1Bβ bind preferentially to late endosomes and lysosomes. This assay may have broad utility for identifying the trafficking proteins that bind to different vesicle populations. PMID:25624392

  16. Demonstration of muscarinic and nicotinic receptor binding activities of distigmine to treat detrusor underactivity.

    PubMed

    Harada, Taketsugu; Fushimi, Kazumi; Kato, Aya; Ito, Yoshihiko; Nishijima, Saori; Sugaya, Kimio; Yamada, Shizuo

    2010-01-01

    The present study was undertaken to examine whether distigmine, a therapeutic agent used to treat detrusor underactivity, binds directly to muscarinic and nicotinic receptors. We used radioreceptor binding assays and compared the effects of distigmine with those of neostigmine and donepedil. The inhibitory effect of distigmine on the blood acetylcholinesterase (AChE) activity was significantly weaker than that of neostigmine. Distigmine, neostigmine, and donepezil competed for specific binding sites of [N-methyl-(3)H]scopolamine methyl chloride ([(3)H]NMS ) and [(3)H]oxotremorine-M in the bladder, submaxillary gland and cerebral cortex of rats in a concentration-dependent manner, indicating significant binding activity of muscarinic receptors. Distigmine displayed significantly higher affinity for binding sites of [(3)H]oxotremorine-M compared with those of [(3)H]NMS as revealed by large ratios of its K(i) value for [(3)H]NMS to that for [(3)H]oxotremorine-M, suggesting that it has preferential affinity for agonist sites of muscarinic receptors. Distigmine seemed to bind to the agonist sites of muscarinic receptors in a competitive manner. Repeated oral administration of distigmine caused a significant decrease in the maximal number of binding sites (B(max)) for [(3)H]NMS in the bladder and submaxillary gland but not cerebral cortex. Distigmine also bound to nicotinic receptors in the rat cerebral cortex. In conclusion, distigmine shows direct binding to muscarinic receptors in the rat bladder, and repeated oral administration of distigmine causes downregulation of muscarinic receptors in the rat bladder. The observed direct interaction of distigmine with the bladder muscarinic receptors may partly contribute to the therapeutic and/or side effects seen in the treatment of detrusor underactivity.

  17. Mutations in a CCHC zinc-binding motif of the reovirus sigma 3 protein decrease its intracellular stability.

    PubMed Central

    Mabrouk, T; Lemay, G

    1994-01-01

    It has been demonstrated that the sigma 3 protein of reovirus harbors a zinc-binding domain in its amino-terminal portion. A putative zinc finger in the CCHH form is located in this domain and was considered to be a good candidate for the zinc-binding motif. We performed site-directed mutagenesis to substitute amino acids in this region and demonstrated that many of these mutants, although expressed in COS cells, were unstable compared with the wild-type protein. Further analysis revealed that zinc-binding capability, as measured by retention on a zinc chelate affinity adsorbent, correlates with stability. These studies also allowed us to identify a CCHC box as the most probable zinc-binding motif. Images PMID:8035527

  18. Structure and specificity of the RNA-guided endonuclease Cas9 during DNA interrogation, target binding and cleavage

    PubMed Central

    Josephs, Eric A.; Kocak, D. Dewran; Fitzgibbon, Christopher J.; McMenemy, Joshua; Gersbach, Charles A.; Marszalek, Piotr E.

    2015-01-01

    CRISPR-associated endonuclease Cas9 cuts DNA at variable target sites designated by a Cas9-bound RNA molecule. Cas9's ability to be directed by single ‘guide RNA’ molecules to target nearly any sequence has been recently exploited for a number of emerging biological and medical applications. Therefore, understanding the nature of Cas9's off-target activity is of paramount importance for its practical use. Using atomic force microscopy (AFM), we directly resolve individual Cas9 and nuclease-inactive dCas9 proteins as they bind along engineered DNA substrates. High-resolution imaging allows us to determine their relative propensities to bind with different guide RNA variants to targeted or off-target sequences. Mapping the structural properties of Cas9 and dCas9 to their respective binding sites reveals a progressive conformational transformation at DNA sites with increasing sequence similarity to its target. With kinetic Monte Carlo (KMC) simulations, these results provide evidence of a ‘conformational gating’ mechanism driven by the interactions between the guide RNA and the 14th–17th nucleotide region of the targeted DNA, the stabilities of which we find correlate significantly with reported off-target cleavage rates. KMC simulations also reveal potential methodologies to engineer guide RNA sequences with improved specificity by considering the invasion of guide RNAs into targeted DNA duplex. PMID:26384421

  19. Single-molecule multiparameter fluorescence spectroscopy reveals directional MutS binding to mismatched bases in DNA

    PubMed Central

    Cristóvão, Michele; Sisamakis, Evangelos; Hingorani, Manju M.; Marx, Andreas D.; Jung, Caroline P.; Rothwell, Paul J.; Seidel, Claus A. M.; Friedhoff, Peter

    2012-01-01

    Mismatch repair (MMR) corrects replication errors such as mismatched bases and loops in DNA. The evolutionarily conserved dimeric MMR protein MutS recognizes mismatches by stacking a phenylalanine of one subunit against one base of the mismatched pair. In all crystal structures of G:T mismatch-bound MutS, phenylalanine is stacked against thymine. To explore whether these structures reflect directional mismatch recognition by MutS, we monitored the orientation of Escherichia coli MutS binding to mismatches by FRET and anisotropy with steady state, pre-steady state and single-molecule multiparameter fluorescence measurements in a solution. The results confirm that specifically bound MutS bends DNA at the mismatch. We found additional MutS–mismatch complexes with distinct conformations that may have functional relevance in MMR. The analysis of individual binding events reveal significant bias in MutS orientation on asymmetric mismatches (G:T versus T:G, A:C versus C:A), but not on symmetric mismatches (G:G). When MutS is blocked from binding a mismatch in the preferred orientation by positioning asymmetric mismatches near the ends of linear DNA substrates, its ability to authorize subsequent steps of MMR, such as MutH endonuclease activation, is almost abolished. These findings shed light on prerequisites for MutS interactions with other MMR proteins for repairing the appropriate DNA strand. PMID:22367846

  20. Na+/substrate Coupling in the Multidrug Antiporter NorM Probed with a Spin-labeled Substrate

    PubMed Central

    Steed, P. Ryan; Stein, Richard A.; Mishra, Smriti; Goodman, Michael C.; Mchaourab, Hassane S.

    2013-01-01

    NorM of the multidrug and toxic compound extrusion (MATE) family of transporters couples the efflux of a broad range of hydrophobic molecules to an inward Na+ gradient across the cell membrane. Several crystal structures of MATE transporters revealed distinct substrate binding sites leading to differing models of the mechanism of ion-coupled substrate extrusion. In the experiments reported here, we observed that a spin-labeled derivative of daunorubicin, Ruboxyl, is transported by NorM from Vibrio cholerae. It is therefore ideal to characterize mechanistically relevant binding interactions with NorM and to directly address the coupling of ion and drug binding. Fluorescence and EPR experiments revealed that Ruboxyl binds to NorM with micromolar affinity and becomes immobilized upon binding, even in the presence of Na+. Using double electron-electron resonance (DEER) spectroscopy, we determined that Ruboxyl binds to a single site on the periplasmic side of the protein. The presence of Na+ did not translocate the substrate to a second site as previously proposed. These experiments surprisingly show that Na+ does not affect the affinity or location of the substrate binding site on detergent-solubilized NorM, thus suggesting that additional factors beyond simple mutual exclusivity of binding, such as the presence of a Na+ gradient across the native membrane, govern Na+/drug coupling during antiport. PMID:23902581

  1. Identification of key binding site residues of MCT1 for AR-C155858 reveals the molecular basis of its isoform selectivity.

    PubMed

    Nancolas, Bethany; Sessions, Richard B; Halestrap, Andrew P

    2015-02-15

    The proton-linked monocarboxylate transporters (MCTs) are required for lactic acid transport into and out of all mammalian cells. Thus, they play an essential role in tumour cells that are usually highly glycolytic and are promising targets for anti-cancer drugs. AR-C155858 is a potent MCT1 inhibitor (Ki ~2 nM) that also inhibits MCT2 when associated with basigin but not MCT4. Previous work [Ovens, M.J. et al. (2010) Biochem. J. 425, 523-530] revealed that AR-C155858 binding to MCT1 occurs from the intracellular side and involves transmembrane helices (TMs) 7-10. In the present paper, we generate a molecular model of MCT4 based on our previous models of MCT1 and identify residues in the intracellular substrate-binding cavity that differ significantly between MCT4 and MCT1/MCT2 and so might account for differences in inhibitor binding. We tested their involvement using site-directed mutagenesis (SDM) of MCT1 to change residues individually or in combination with their MCT4 equivalent and determined inhibitor sensitivity following expression in Xenopus oocytes. Phe360 and Ser364 were identified as important for AR-C155858 binding with the F360Y/S364G mutant exhibiting >100-fold reduction in inhibitor sensitivity. To refine the binding site further, we used molecular dynamics (MD) simulations and additional SDM. This approach implicated six more residues whose involvement was confirmed by both transport studies and [3H]-AR-C155858 binding to oocyte membranes. Taken together, our data imply that Asn147, Arg306 and Ser364 are important for directing AR-C155858 to its final binding site which involves interaction of the inhibitor with Lys38, Asp302 and Phe360 (residues that also play key roles in the translocation cycle) and also Leu274 and Ser278.

  2. Identification of key binding site residues of MCT1 for AR-C155858 reveals the molecular basis of its isoform selectivity

    PubMed Central

    Nancolas, Bethany; Sessions, Richard B.; Halestrap, Andrew P.

    2014-01-01

    The proton-linked monocarboxylate transporters (MCTs) are required for lactic acid transport into and out of all mammalian cells. Thus, they play an essential role in tumour cells that are usually highly glycolytic and are promising targets for anti-cancer drugs. AR-C155858 is a potent MCT1 inhibitor (Ki ~2 nM) that also inhibits MCT2 when associated with basigin but not MCT4. Previous work [Ovens, M.J. et al. (2010) Biochem. J. 425, 523–530] revealed that AR-C155858 binding to MCT1 occurs from the intracellular side and involves transmembrane helices (TMs) 7–10. In the present paper, we generate a molecular model of MCT4 based on our previous models of MCT1 and identify residues in the intracellular substrate-binding cavity that differ significantly between MCT4 and MCT1/MCT2 and so might account for differences in inhibitor binding. We tested their involvement using site-directed mutagenesis (SDM) of MCT1 to change residues individually or in combination with their MCT4 equivalent and determined inhibitor sensitivity following expression in Xenopus oocytes. Phe360 and Ser364 were identified as important for AR-C155858 binding with the F360Y/S364G mutant exhibiting >100-fold reduction in inhibitor sensitivity. To refine the binding site further, we used molecular dynamics (MD) simulations and additional SDM. This approach implicated six more residues whose involvement was confirmed by both transport studies and [3H]-AR-C155858 binding to oocyte membranes. Taken together, our data imply that Asn147, Arg306 and Ser364 are important for directing AR-C155858 to its final binding site which involves interaction of the inhibitor with Lys38, Asp302 and Phe360 (residues that also play key roles in the translocation cycle) and also Leu274 and Ser278. PMID:25437897

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chien, Ellen Y.T.; Liu, Wei; Zhao, Qiang

    Dopamine modulates movement, cognition, and emotion through activation of dopamine G protein-coupled receptors in the brain. The crystal structure of the human dopamine D3 receptor (D3R) in complex with the small molecule D2R/D3R-specific antagonist eticlopride reveals important features of the ligand binding pocket and extracellular loops. On the intracellular side of the receptor, a locked conformation of the ionic lock and two distinctly different conformations of intracellular loop 2 are observed. Docking of R-22, a D3R-selective antagonist, reveals an extracellular extension of the eticlopride binding site that comprises a second binding pocket for the aryl amide of R-22, which differsmore » between the highly homologous D2R and D3R. This difference provides direction to the design of D3R-selective agents for treating drug abuse and other neuropsychiatric indications.« less

  4. Phosphoinositide Signaling Regulates the Exocyst Complex and Polarized Integrin Trafficking in Directionally Migrating Cells

    PubMed Central

    Thapa, Narendra; Sun, Yue; Schramp, Mark; Choi, Suyoung; Ling, Kun; Anderson, Richard A

    2011-01-01

    Summary Polarized delivery of signaling and adhesion molecules to the leading edge is required for directional migration of cells. Here, we describe a role for the PIP2 synthesizing enzyme, PIPKIγi2, in regulation of exocyst complex control of cell polarity and polarized integrin trafficking during migration. Loss of PIPKIγi2 impaired directional migration, formation of cell polarity, and integrin trafficking to the leading edge. Upon initiation of directional migration PIPKIγi2 via PIP2 generation controls the integration of the exocyst complex into an integrin-containing trafficking compartment(s) that requires the talin-binding ability of PIPKIγi2, and talin for integrin recruitment to the leading edge. A PIP2 requirement is further emphasized by inhibition of PIPKIγi2-regulated directional migration by an Exo70 mutant deficient in PIP2 binding. These results reveal how phosphoinositide generation orchestrates polarized trafficking of integrin in coordination with talin that links integrins to the actin cytoskeleton, processes that are required for directional migration. PMID:22264730

  5. Chimeric Plant Calcium/Calmodulin-Dependent Protein Kinase Gene with a Neural Visinin-Like Calcium-Binding Domain

    NASA Technical Reports Server (NTRS)

    Patil, Shameekumar; Takezawa, D.; Poovaiah, B. W.

    1995-01-01

    Calcium, a universal second messenger, regulates diverse cellular processes in eukaryotes. Ca-2(+) and Ca-2(+)/calmodulin-regulated protein phosphorylation play a pivotal role in amplifying and diversifying the action of Ca-2(+)- mediated signals. A chimeric Ca-2(+)/calmodulin-dependent protein kinase (CCaMK) gene with a visinin-like Ca-2(+)- binding domain was cloned and characterized from lily. The cDNA clone contains an open reading frame coding for a protein of 520 amino acids. The predicted structure of CCaMK contains a catalytic domain followed by two regulatory domains, a calmodulin-binding domain and a visinin-like Ca-2(+)-binding domain. The amino-terminal region of CCaMK contains all 11 conserved subdomains characteristic of serine/threonine protein kinases. The calmodulin-binding region of CCaMK has high homology (79%) to alpha subunit of mammalian Ca-2(+)/calmodulin-dependent protein kinase. The calmodulin-binding region is fused to a neural visinin-like domain that contains three Ca-2(+)-binding EF-hand motifs and a biotin-binding site. The Escherichia coli-expressed protein (approx. 56 kDa) binds calmodulin in a Ca-2(+)-dependent manner. Furthermore, Ca-45-binding assays revealed that CCaMK directly binds Ca-2(+). The CCaMK gene is preferentially expressed in developing anthers. Southern blot analysis revealed that CCaMK is encoded by a single gene. The structural features of the gene suggest that it has multiple regulatory controls and could play a unique role in Ca-2(+) signaling in plants.

  6. Structural basis of subunit selectivity for competitive NMDA receptor antagonists with preference for GluN2A over GluN2B subunits

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lind, Genevieve E.; Mou, Tung-Chung; Tamborini, Lucia

    NMDA-type glutamate receptors are ligand-gated ion channels that contribute to excitatory neurotransmission in the central nervous system (CNS). Most NMDA receptors comprise two glycine-binding GluN1 and two glutamate-binding GluN2 subunits (GluN2A–D). We describe highly potent (S)-5-[(R)-2-amino-2-carboxyethyl]-4,5-dihydro-1H-pyrazole-3-carboxylic acid (ACEPC) competitive GluN2 antagonists, of which ST3 has a binding affinity of 52 nM at GluN1/2A and 782 nM at GluN1/2B receptors. This 15-fold preference of ST3 for GluN1/2A over GluN1/2B is improved compared with NVP-AAM077, a widely used GluN2A-selective antagonist, which we show has 11-fold preference for GluN1/2A over GluN1/2B. Crystal structures of the GluN1/2A agonist binding domain (ABD) heterodimer with boundmore » ACEPC antagonists reveal a binding mode in which the ligands occupy a cavity that extends toward the subunit interface between GluN1 and GluN2A ABDs. Mutational analyses show that the GluN2A preference of ST3 is primarily mediated by four nonconserved residues that are not directly contacting the ligand, but positioned within 12 Å of the glutamate binding site. Two of these residues influence the cavity occupied by ST3 in a manner that results in favorable binding to GluN2A, but occludes binding to GluN2B. Thus, we reveal opportunities for the design of subunit-selective competitive NMDA receptor antagonists by identifying a cavity for ligand binding in which variations exist between GluN2A and GluN2B subunits. This structural insight suggests that subunit selectivity of glutamate-site antagonists can be mediated by mechanisms in addition to direct contributions of contact residues to binding affinity.« less

  7. Structural basis of subunit selectivity for competitive NMDA receptor antagonists with preference for GluN2A over GluN2B subunits

    PubMed Central

    Lind, Genevieve E.; Mou, Tung-Chung; Tamborini, Lucia; Pomper, Martin G.; De Micheli, Carlo; Conti, Paola; Pinto, Andrea

    2017-01-01

    NMDA-type glutamate receptors are ligand-gated ion channels that contribute to excitatory neurotransmission in the central nervous system (CNS). Most NMDA receptors comprise two glycine-binding GluN1 and two glutamate-binding GluN2 subunits (GluN2A–D). We describe highly potent (S)-5-[(R)-2-amino-2-carboxyethyl]-4,5-dihydro-1H-pyrazole-3-carboxylic acid (ACEPC) competitive GluN2 antagonists, of which ST3 has a binding affinity of 52 nM at GluN1/2A and 782 nM at GluN1/2B receptors. This 15-fold preference of ST3 for GluN1/2A over GluN1/2B is improved compared with NVP-AAM077, a widely used GluN2A-selective antagonist, which we show has 11-fold preference for GluN1/2A over GluN1/2B. Crystal structures of the GluN1/2A agonist binding domain (ABD) heterodimer with bound ACEPC antagonists reveal a binding mode in which the ligands occupy a cavity that extends toward the subunit interface between GluN1 and GluN2A ABDs. Mutational analyses show that the GluN2A preference of ST3 is primarily mediated by four nonconserved residues that are not directly contacting the ligand, but positioned within 12 Å of the glutamate binding site. Two of these residues influence the cavity occupied by ST3 in a manner that results in favorable binding to GluN2A, but occludes binding to GluN2B. Thus, we reveal opportunities for the design of subunit-selective competitive NMDA receptor antagonists by identifying a cavity for ligand binding in which variations exist between GluN2A and GluN2B subunits. This structural insight suggests that subunit selectivity of glutamate-site antagonists can be mediated by mechanisms in addition to direct contributions of contact residues to binding affinity. PMID:28760974

  8. Re-engineering the zinc fingers of PRDM9 reverses hybrid sterility in mice.

    PubMed

    Davies, Benjamin; Hatton, Edouard; Altemose, Nicolas; Hussin, Julie G; Pratto, Florencia; Zhang, Gang; Hinch, Anjali Gupta; Moralli, Daniela; Biggs, Daniel; Diaz, Rebeca; Preece, Chris; Li, Ran; Bitoun, Emmanuelle; Brick, Kevin; Green, Catherine M; Camerini-Otero, R Daniel; Myers, Simon R; Donnelly, Peter

    2016-02-11

    The DNA-binding protein PRDM9 directs positioning of the double-strand breaks (DSBs) that initiate meiotic recombination in mice and humans. Prdm9 is the only mammalian speciation gene yet identified and is responsible for sterility phenotypes in male hybrids of certain mouse subspecies. To investigate PRDM9 binding and its role in fertility and meiotic recombination, we humanized the DNA-binding domain of PRDM9 in C57BL/6 mice. This change repositions DSB hotspots and completely restores fertility in male hybrids. Here we show that alteration of one Prdm9 allele impacts the behaviour of DSBs controlled by the other allele at chromosome-wide scales. These effects correlate strongly with the degree to which each PRDM9 variant binds both homologues at the DSB sites it controls. Furthermore, higher genome-wide levels of such 'symmetric' PRDM9 binding associate with increasing fertility measures, and comparisons of individual hotspots suggest binding symmetry plays a downstream role in the recombination process. These findings reveal that subspecies-specific degradation of PRDM9 binding sites by meiotic drive, which steadily increases asymmetric PRDM9 binding, has impacts beyond simply changing hotspot positions, and strongly support a direct involvement in hybrid infertility. Because such meiotic drive occurs across mammals, PRDM9 may play a wider, yet transient, role in the early stages of speciation.

  9. A functional genomics approach reveals CHE as a component of the Arabidopsis circadian clock.

    PubMed

    Pruneda-Paz, Jose L; Breton, Ghislain; Para, Alessia; Kay, Steve A

    2009-03-13

    Transcriptional feedback loops constitute the molecular circuitry of the plant circadian clock. In Arabidopsis, a core loop is established between CCA1 and TOC1. Although CCA1 directly represses TOC1, the TOC1 protein has no DNA binding domains, which suggests that it cannot directly regulate CCA1. We established a functional genomic strategy that led to the identification of CHE, a TCP transcription factor that binds specifically to the CCA1 promoter. CHE is a clock component partially redundant with LHY in the repression of CCA1. The expression of CHE is regulated by CCA1, thus adding a CCA1/CHE feedback loop to the Arabidopsis circadian network. Because CHE and TOC1 interact, and CHE binds to the CCA1 promoter, a molecular linkage between TOC1 and CCA1 gene regulation is established.

  10. An additional role for the Brønsted acid-base catalysts of mandelate racemase in transition state stabilization.

    PubMed

    Nagar, Mitesh; Bearne, Stephen L

    2015-11-10

    Mandelate racemase (MR) catalyzes the interconversion of the enantiomers of mandelate and serves as a paradigm for understanding the enzyme-catalyzed abstraction of an α-proton from a carbon acid substrate with a high pKa. The enzyme utilizes a two-base mechanism with Lys 166 and His 297 acting as Brønsted acid and base catalysts, respectively, in the R → S reaction direction. In the S → R reaction direction, their roles are reversed. Using isothermal titration calorimetry (ITC), MR is shown to bind the intermediate/transition state (TS) analogue inhibitor benzohydroxamate (BzH) in an entropy-driven process with a value of ΔCp equal to -358 ± 3 cal mol(-1) K(-1), consistent with an increased number of hydrophobic interactions. However, MR binds BzH with an affinity that is ∼2 orders of magnitude greater than that predicted solely on the basis of hydrophobic interactions [St. Maurice, M., and Bearne, S. L. (2004) Biochemistry 43, 2524], suggesting that additional specific interactions contribute to binding. To test the hypothesis that cation-π/NH-π interactions between the side chains of Lys 166 and His 297 and the aromatic ring and/or the hydroxamate/hydroximate moiety of BzH contribute to the binding of BzH, site-directed mutagenesis was used to generate the MR variants K166M, K166C, H297N, and K166M/H297N and their binding affinity for various ligands determined using ITC. Comparison of the binding affinities of these MR variants with the intermediate/TS analogues BzH and cyclohexanecarbohydroxamate revealed that cation-π/NH-π interactions between His 297 and the hydroxamate/hydroximate moiety and the phenyl ring of BzH contribute approximately 0.26 and 0.91 kcal/mol to binding, respectively, while interactions with Lys 166 contribute approximately 1.74 and 1.74 kcal/mol, respectively. Similarly, comparison of the binding affinities of these mutants with substrate analogues revealed that Lys 166 contributes >2.93 kcal/mol to the binding of (R)-atrolactate, and His 297 contributes 2.46 kcal/mol to the binding of (S)-atrolactate. These results are consistent with Lys 166 and His 297 playing dual roles in catalysis: they act as Brønsted acid-base catalysts, and they stabilize both the enolate moiety and phenyl ring of the altered substrate in the TS.

  11. A Cross-Species Study of PI3K Protein-Protein Interactions Reveals the Direct Interaction of P85 and SHP2

    NASA Astrophysics Data System (ADS)

    Breitkopf, Susanne B.; Yang, Xuemei; Begley, Michael J.; Kulkarni, Meghana; Chiu, Yu-Hsin; Turke, Alexa B.; Lauriol, Jessica; Yuan, Min; Qi, Jie; Engelman, Jeffrey A.; Hong, Pengyu; Kontaridis, Maria I.; Cantley, Lewis C.; Perrimon, Norbert; Asara, John M.

    2016-02-01

    Using a series of immunoprecipitation (IP) - tandem mass spectrometry (LC-MS/MS) experiments and reciprocal BLAST, we conducted a fly-human cross-species comparison of the phosphoinositide-3-kinase (PI3K) interactome in a drosophila S2R+ cell line and several NSCLC and human multiple myeloma cell lines to identify conserved interacting proteins to PI3K, a critical signaling regulator of the AKT pathway. Using H929 human cancer cells and drosophila S2R+ cells, our data revealed an unexpected direct binding of Corkscrew, the drosophila ortholog of the non-receptor protein tyrosine phosphatase type II (SHP2) to the Pi3k21B (p60) regulatory subunit of PI3K (p50/p85 human ortholog) but no association with Pi3k92e, the human ortholog of the p110 catalytic subunit. The p85-SHP2 association was validated in human cell lines, and formed a ternary regulatory complex with GRB2-associated-binding protein 2 (GAB2). Validation experiments with knockdown of GAB2 and Far-Western blots proved the direct interaction of SHP2 with p85, independent of adaptor proteins and transfected FLAG-p85 provided evidence that SHP2 binding on p85 occurred on the SH2 domains. A disruption of the SHP2-p85 complex took place after insulin/IGF1 stimulation or imatinib treatment, suggesting that the direct SHP2-p85 interaction was both independent of AKT activation and positively regulates the ERK signaling pathway.

  12. Empty conformers of HLA-B preferentially bind CD8 and regulate CD8+ T cell function.

    PubMed

    Geng, Jie; Altman, John D; Krishnakumar, Sujatha; Raghavan, Malini

    2018-05-09

    When complexed with antigenic peptides, human leukocyte antigen (HLA) class I (HLA-I) molecules initiate CD8 + T cell responses via interaction with the T cell receptor (TCR) and co-receptor CD8. Peptides are generally critical for the stable cell surface expression of HLA-I molecules. However, for HLA-I alleles such as HLA-B*35:01, peptide-deficient (empty) heterodimers are thermostable and detectable on the cell surface. Additionally, peptide-deficient HLA-B*35:01 tetramers preferentially bind CD8 and to a majority of blood-derived CD8 + T cells via a CD8-dependent binding mode. Further functional studies reveal that peptide-deficient conformers of HLA-B*35:01 do not directly activate CD8 + T cells, but accumulate at the immunological synapse in antigen-induced responses, and enhance cognate peptide-induced cell adhesion and CD8 + T cell activation. Together, these findings indicate that HLA-I peptide occupancy influences CD8 binding affinity, and reveal a new set of regulators of CD8 + T cell activation, mediated by the binding of empty HLA-I to CD8. © 2018, Geng et al.

  13. Simultaneous Binding of Two Peptidyl Ligands by a Src Homology 2 Domain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yanyan; Zhang, Jinjin; Yuan, Chunhua

    Src homology 2 (SH2) domains mediate protein-protein interactions by recognizing phosphotyrosine (pY)-containing sequences of target proteins. In all of the SH2 domain-pY peptide interactions described to date, the SH2 domain binds to a single pY peptide. Here, determination of the cocrystal structure of the N-terminal SH2 domain of phosphatase SHP-2 bound to a class IV peptide (VIpYFVP) revealed a noncanonical 1:2 (protein-peptide) complex. The first peptide binds in a canonical manner with its pY side chain inserted in the usual binding pocket, while the second pairs up with the first to form two antiparallel {beta}-strands that extend the central {beta}-sheetmore » of the SH2 domain. This unprecedented binding mode was confirmed in the solution phase by NMR experiments and shown to be adopted by pY peptides derived from cellular proteins. Site-directed mutagenesis and surface plasmon resonance studies revealed that the binding of the first peptide is pY-dependent, but phosphorylation is not required for the second peptide. Our findings suggest a potential new function for the SH2 domain as a molecular clamp to promote dimerization of signaling proteins.« less

  14. Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state

    PubMed Central

    Warfield, Becka M.

    2017-01-01

    RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473

  15. The Actin Nucleator Cobl Is Controlled by Calcium and Calmodulin

    PubMed Central

    Haag, Natja; Kessels, Michael M.; Qualmann, Britta

    2015-01-01

    Actin nucleation triggers the formation of new actin filaments and has the power to shape cells but requires tight control in order to bring about proper morphologies. The regulation of the members of the novel class of WASP Homology 2 (WH2) domain-based actin nucleators, however, thus far has largely remained elusive. Our study reveals signal cascades and mechanisms regulating Cordon-Bleu (Cobl). Cobl plays some, albeit not fully understood, role in early arborization of neurons and nucleates actin by a mechanism that requires a combination of all three of its actin monomer–binding WH2 domains. Our experiments reveal that Cobl is regulated by Ca2+ and multiple, direct associations of the Ca2+ sensor Calmodulin (CaM). Overexpression analyses and rescue experiments of Cobl loss-of-function phenotypes with Cobl mutants in primary neurons and in tissue slices demonstrated the importance of CaM binding for Cobl’s functions. Cobl-induced dendritic branch initiation was preceded by Ca2+ signals and coincided with local F-actin and CaM accumulations. CaM inhibitor studies showed that Cobl-mediated branching is strictly dependent on CaM activity. Mechanistic studies revealed that Ca2+/CaM modulates Cobl’s actin binding properties and furthermore promotes Cobl’s previously identified interactions with the membrane-shaping F-BAR protein syndapin I, which accumulated with Cobl at nascent dendritic protrusion sites. The findings of our study demonstrate a direct regulation of an actin nucleator by Ca2+/CaM and reveal that the Ca2+/CaM-controlled molecular mechanisms we discovered are crucial for Cobl’s cellular functions. By unveiling the means of Cobl regulation and the mechanisms, by which Ca2+/CaM signals directly converge on a cellular effector promoting actin filament formation, our work furthermore sheds light on how local Ca2+ signals steer and power branch initiation during early arborization of nerve cells—a key process in neuronal network formation. PMID:26334624

  16. Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation.

    PubMed Central

    Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B

    1989-01-01

    The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501

  17. Structural basis for diversity in the SAM clan of riboswitches.

    PubMed

    Trausch, Jeremiah J; Xu, Zhenjiang; Edwards, Andrea L; Reyes, Francis E; Ross, Phillip E; Knight, Rob; Batey, Robert T

    2014-05-06

    In bacteria, sulfur metabolism is regulated in part by seven known families of riboswitches that bind S-adenosyl-l-methionine (SAM). Direct binding of SAM to these mRNA regulatory elements governs a downstream secondary structural switch that communicates with the transcriptional and/or translational expression machinery. The most widely distributed SAM-binding riboswitches belong to the SAM clan, comprising three families that share a common SAM-binding core but differ radically in their peripheral architecture. Although the structure of the SAM-I member of this clan has been extensively studied, how the alternative peripheral architecture of the other families supports the common SAM-binding core remains unknown. We have therefore solved the X-ray structure of a member of the SAM-I/IV family containing the alternative "PK-2" subdomain shared with the SAM-IV family. This structure reveals that this subdomain forms extensive interactions with the helix housing the SAM-binding pocket, including a highly unusual mode of helix packing in which two helices pack in a perpendicular fashion. Biochemical and genetic analysis of this RNA reveals that SAM binding induces many of these interactions, including stabilization of a pseudoknot that is part of the regulatory switch. Despite strong structural similarity between the cores of SAM-I and SAM-I/IV members, a phylogenetic analysis of sequences does not indicate that they derive from a common ancestor.

  18. 1-3-A Resolution Structure of Human Glutathione S-Transferase With S-Hexyl Glutathione Bound Reveals Possible Extended Ligandin Binding Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Trong, I.Le; Stenkamp, R.E.; Ibarra, C.

    2005-08-22

    Cytosolic glutathione S-transferases (GSTs) play a critical role in xenobiotic binding and metabolism, as well as in modulation of oxidative stress. Here, the high-resolution X-ray crystal structures of homodimeric human GSTA1-1 in the apo form and in complex with S-hexyl glutathione (two data sets) are reported at 1.8, 1.5, and 1.3A respectively. At this level of resolution, distinct conformations of the alkyl chain of S-hexyl glutathione are observed, reflecting the nonspecific nature of the hydrophobic substrate binding site (H-site). Also, an extensive network of ordered water, including 75 discrete solvent molecules, traverses the open subunit-subunit interface and connects the glutathionemore » binding sites in each subunit. In the highest-resolution structure, three glycerol moieties lie within this network and directly connect the amino termini of the glutathione molecules. A search for ligand binding sites with the docking program Molecular Operating Environment identified the ordered water network binding site, lined mainly with hydrophobic residues, suggesting an extended ligand binding surface for nonsubstrate ligands, the so-called ligandin site. Finally, detailed comparison of the structures reported here with previously published X-ray structures reveal a possible reaction coordinate for ligand-dependent conformational changes in the active site and the C-terminus.« less

  19. High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

    PubMed Central

    Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

    2015-01-01

    Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

  20. The crystal structure of the AgamOBP1•Icaridin complex reveals alternative binding modes and stereo-selective repellent recognition.

    PubMed

    Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E

    2017-01-01

    Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.

  1. Differential Epitope Mapping by STD NMR Spectroscopy To Reveal the Nature of Protein-Ligand Contacts.

    PubMed

    Monaco, Serena; Tailford, Louise E; Juge, Nathalie; Angulo, Jesus

    2017-11-27

    Saturation transfer difference (STD) NMR spectroscopy is extensively used to obtain epitope maps of ligands binding to protein receptors, thereby revealing structural details of the interaction, which is key to direct lead optimization efforts in drug discovery. However, it does not give information about the nature of the amino acids surrounding the ligand in the binding pocket. Herein, we report the development of the novel method differential epitope mapping by STD NMR (DEEP-STD NMR) for identifying the type of protein residues contacting the ligand. The method produces differential epitope maps through 1) differential frequency STD NMR and/or 2) differential solvent (D 2 O/H 2 O) STD NMR experiments. The two approaches provide different complementary information on the binding pocket. We demonstrate that DEEP-STD NMR can be used to readily obtain pharmacophore information on the protein. Furthermore, if the 3D structure of the protein is known, this information also helps in orienting the ligand in the binding pocket. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  2. Crystal structures of ryanodine receptor SPRY1 and tandem-repeat domains reveal a critical FKBP12 binding determinant

    NASA Astrophysics Data System (ADS)

    Yuchi, Zhiguang; Yuen, Siobhan M. Wong King; Lau, Kelvin; Underhill, Ainsley Q.; Cornea, Razvan L.; Fessenden, James D.; van Petegem, Filip

    2015-08-01

    Ryanodine receptors (RyRs) form calcium release channels located in the membranes of the sarcoplasmic and endoplasmic reticulum. RyRs play a major role in excitation-contraction coupling and other Ca2+-dependent signalling events, and consist of several globular domains that together form a large assembly. Here we describe the crystal structures of the SPRY1 and tandem-repeat domains at 1.2-1.5 Å resolution, which reveal several structural elements not detected in recent cryo-EM reconstructions of RyRs. The cryo-EM studies disagree on the position of SPRY domains, which had been proposed based on homology modelling. Computational docking of the crystal structures, combined with FRET studies, show that the SPRY1 domain is located next to FK506-binding protein (FKBP). Molecular dynamics flexible fitting and mutagenesis experiments suggest a hydrophobic cluster within SPRY1 that is crucial for FKBP binding. A RyR1 disease mutation, N760D, appears to directly impact FKBP binding through interfering with SPRY1 folding.

  3. ETHYLENE RESPONSE FACTOR 96 positively regulates Arabidopsis resistance to necrotrophic pathogens by direct binding to GCC elements of jasmonate - and ethylene-responsive defence genes.

    PubMed

    Catinot, Jérémy; Huang, Jing-Bo; Huang, Pin-Yao; Tseng, Min-Yuan; Chen, Ying-Lan; Gu, Shin-Yuan; Lo, Wan-Sheng; Wang, Long-Chi; Chen, Yet-Ran; Zimmerli, Laurent

    2015-12-01

    The ERF (ethylene responsive factor) family is composed of transcription factors (TFs) that are critical for appropriate Arabidopsis thaliana responses to biotic and abiotic stresses. Here we identified and characterized a member of the ERF TF group IX, namely ERF96, that when overexpressed enhances Arabidopsis resistance to necrotrophic pathogens such as the fungus Botrytis cinerea and the bacterium Pectobacterium carotovorum. ERF96 is jasmonate (JA) and ethylene (ET) responsive and ERF96 transcripts accumulation was abolished in JA-insensitive coi1-16 and in ET-insensitive ein2-1 mutants. Protoplast transactivation and electrophoresis mobility shift analyses revealed that ERF96 is an activator of transcription that binds to GCC elements. In addition, ERF96 mainly localized to the nucleus. Microarray analysis coupled to chromatin immunoprecipitation-PCR of Arabidopsis overexpressing ERF96 revealed that ERF96 enhances the expression of the JA/ET defence genes PDF1.2a, PR-3 and PR-4 as well as the TF ORA59 by direct binding to GCC elements present in their promoters. While ERF96-RNAi plants demonstrated wild-type resistance to necrotrophic pathogens, basal PDF1.2 expression levels were reduced in ERF96-silenced plants. This work revealed ERF96 as a key player of the ERF network that positively regulates the Arabidopsis resistance response to necrotrophic pathogens. © 2015 John Wiley & Sons Ltd.

  4. A serum response factor-dependent transcriptional regulatory program identifies distinct smooth muscle cell sublineages.

    PubMed Central

    Kim, S; Ip, H S; Lu, M M; Clendenin, C; Parmacek, M S

    1997-01-01

    The SM22alpha promoter has been used as a model system to define the molecular mechanisms that regulate smooth muscle cell (SMC) specific gene expression during mammalian development. The SM22alpha gene is expressed exclusively in vascular and visceral SMCs during postnatal development and is transiently expressed in the heart and somites during embryogenesis. Analysis of the SM22alpha promoter in transgenic mice revealed that 280 bp of 5' flanking sequence is sufficient to restrict expression of the lacZ reporter gene to arterial SMCs and the myotomal component of the somites. DNase I footprint and electrophoretic mobility shift analyses revealed that the SM22alpha promoter contains six nuclear protein binding sites (designated smooth muscle elements [SMEs] -1 to -6, respectively), two of which bind serum response factor (SRF) (SME-1 and SME-4). Mutational analyses demonstrated that a two-nucleotide substitution that selectively eliminates SRF binding to SME-4 decreases SM22alpha promoter activity in arterial SMCs by approximately 90%. Moreover, mutations that abolish binding of SRF to SME-1 and SME-4 or mutations that eliminate each SME-3 binding activity totally abolished SM22alpha promoter activity in the arterial SMCs and somites of transgenic mice. Finally, we have shown that a multimerized copy of SME-4 (bp -190 to -110) when linked to the minimal SM22alpha promoter (bp -90 to +41) is necessary and sufficient to direct high-level transcription in an SMC lineage-restricted fashion. Taken together, these data demonstrate that distinct transcriptional regulatory programs control SM22alpha gene expression in arterial versus visceral SMCs. Moreover, these data are consistent with a model in which combinatorial interactions between SRF and other transcription factors that bind to SME-4 (and that bind directly to SRF) activate transcription of the SM22alpha gene in arterial SMCs. PMID:9121477

  5. Force spectroscopy studies on protein-ligand interactions: a single protein mechanics perspective.

    PubMed

    Hu, Xiaotang; Li, Hongbin

    2014-10-01

    Protein-ligand interactions are ubiquitous and play important roles in almost every biological process. The direct elucidation of the thermodynamic, structural and functional consequences of protein-ligand interactions is thus of critical importance to decipher the mechanism underlying these biological processes. A toolbox containing a variety of powerful techniques has been developed to quantitatively study protein-ligand interactions in vitro as well as in living systems. The development of atomic force microscopy-based single molecule force spectroscopy techniques has expanded this toolbox and made it possible to directly probe the mechanical consequence of ligand binding on proteins. Many recent experiments have revealed how ligand binding affects the mechanical stability and mechanical unfolding dynamics of proteins, and provided mechanistic understanding on these effects. The enhancement effect of mechanical stability by ligand binding has been used to help tune the mechanical stability of proteins in a rational manner and develop novel functional binding assays for protein-ligand interactions. Single molecule force spectroscopy studies have started to shed new lights on the structural and functional consequence of ligand binding on proteins that bear force under their biological settings. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  6. Structure of the transcriptional regulator LmrR and its mechanism of multidrug recognition.

    PubMed

    Madoori, Pramod Kumar; Agustiandari, Herfita; Driessen, Arnold J M; Thunnissen, Andy-Mark W H

    2009-01-21

    LmrR is a PadR-related transcriptional repressor that regulates the production of LmrCD, a major multidrug ABC transporter in Lactococcus lactis. Transcriptional regulation is presumed to follow a drug-sensitive induction mechanism involving the direct binding of transporter ligands to LmrR. Here, we present crystal structures of LmrR in an apo state and in two drug-bound states complexed with Hoechst 33342 and daunomycin. LmrR shows a common topology containing a typical beta-winged helix-turn-helix domain with an additional C-terminal helix involved in dimerization. Its dimeric organization is highly unusual with a flat-shaped hydrophobic pore at the dimer centre serving as a multidrug-binding site. The drugs bind in a similar manner with their aromatic rings sandwiched in between the indole groups of two dimer-related tryptophan residues. Multidrug recognition is facilitated by conformational plasticity and the absence of drug-specific hydrogen bonds. Combined analyses using site-directed mutagenesis, fluorescence-based drug binding and protein-DNA gel shift assays reveal an allosteric coupling between the multidrug- and DNA-binding sites of LmrR that most likely has a function in the induction mechanism.

  7. Interactions between Human Liver Fatty Acid Binding Protein and Peroxisome Proliferator Activated Receptor Selective Drugs

    PubMed Central

    Velkov, Tony

    2013-01-01

    Fatty acid binding proteins (FABPs) act as intracellular shuttles for fatty acids as well as lipophilic xenobiotics to the nucleus, where these ligands are released to a group of nuclear receptors called the peroxisome proliferator activated receptors (PPARs). PPAR mediated gene activation is ultimately involved in maintenance of cellular homeostasis through the transcriptional regulation of metabolic enzymes and transporters that target the activating ligand. Here we show that liver- (L-) FABP displays a high binding affinity for PPAR subtype selective drugs. NMR chemical shift perturbation mapping and proteolytic protection experiments show that the binding of the PPAR subtype selective drugs produces conformational changes that stabilize the portal region of L-FABP. NMR chemical shift perturbation studies also revealed that L-FABP can form a complex with the PPAR ligand binding domain (LBD) of PPARα. This protein-protein interaction may represent a mechanism for facilitating the activation of PPAR transcriptional activity via the direct channeling of ligands between the binding pocket of L-FABP and the PPARαLBD. The role of L-FABP in the delivery of ligands directly to PPARα via this channeling mechanism has important implications for regulatory pathways that mediate xenobiotic responses and host protection in tissues such as the small intestine and the liver where L-FABP is highly expressed. PMID:23476633

  8. Conformational selection in a protein-protein interaction revealed by dynamic pathway analysis

    DOE PAGES

    Chakrabarti, Kalyan S.; Agafonov, Roman V.; Pontiggia, Francesco; ...

    2015-12-24

    Molecular recognition plays a central role in biology, and protein dynamics has been acknowledged to be important in this process. However, it is highly debated whether conformational changes happen before ligand binding to produce a binding-competent state (conformational selection) or are caused in response to ligand binding (induced fit). Proposals for both mechanisms in protein/protein recognition have been primarily based on structural arguments. However, the distinction between them is a question of the probabilities of going via these two opposing pathways. Here we present a direct demonstration of exclusive conformational selection in protein/protein recognition by measuring the flux for rhodopsinmore » kinase binding to its regulator recoverin, an important molecular recognition in the vision system. Using NMR spectroscopy, stopped-flow kinetics and isothermal titration calorimetry we show that recoverin populates a minor conformation in solution that exposes a hydrophobic binding pocket responsible for binding rhodopsin kinase. Lastly, protein dynamics in free recoverin limits the overall rate of binding.« less

  9. Conformational selection in a protein-protein interaction revealed by dynamic pathway analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chakrabarti, Kalyan S.; Agafonov, Roman V.; Pontiggia, Francesco

    Molecular recognition plays a central role in biology, and protein dynamics has been acknowledged to be important in this process. However, it is highly debated whether conformational changes happen before ligand binding to produce a binding-competent state (conformational selection) or are caused in response to ligand binding (induced fit). Proposals for both mechanisms in protein/protein recognition have been primarily based on structural arguments. However, the distinction between them is a question of the probabilities of going via these two opposing pathways. Here we present a direct demonstration of exclusive conformational selection in protein/protein recognition by measuring the flux for rhodopsinmore » kinase binding to its regulator recoverin, an important molecular recognition in the vision system. Using NMR spectroscopy, stopped-flow kinetics and isothermal titration calorimetry we show that recoverin populates a minor conformation in solution that exposes a hydrophobic binding pocket responsible for binding rhodopsin kinase. Lastly, protein dynamics in free recoverin limits the overall rate of binding.« less

  10. Phosphoinositide-mediated oligomerization of a defensin induces cell lysis

    PubMed Central

    Poon, Ivan KH; Baxter, Amy A; Lay, Fung T; Mills, Grant D; Adda, Christopher G; Payne, Jennifer AE; Phan, Thanh Kha; Ryan, Gemma F; White, Julie A; Veneer, Prem K; van der Weerden, Nicole L; Anderson, Marilyn A; Kvansakul, Marc; Hulett, Mark D

    2014-01-01

    Cationic antimicrobial peptides (CAPs) such as defensins are ubiquitously found innate immune molecules that often exhibit broad activity against microbial pathogens and mammalian tumor cells. Many CAPs act at the plasma membrane of cells leading to membrane destabilization and permeabilization. In this study, we describe a novel cell lysis mechanism for fungal and tumor cells by the plant defensin NaD1 that acts via direct binding to the plasma membrane phospholipid phosphatidylinositol 4,5-bisphosphate (PIP2). We determined the crystal structure of a NaD1:PIP2 complex, revealing a striking oligomeric arrangement comprising seven dimers of NaD1 that cooperatively bind the anionic headgroups of 14 PIP2 molecules through a unique ‘cationic grip’ configuration. Site-directed mutagenesis of NaD1 confirms that PIP2-mediated oligomerization is important for fungal and tumor cell permeabilization. These observations identify an innate recognition system by NaD1 for direct binding of PIP2 that permeabilizes cells via a novel membrane disrupting mechanism. DOI: http://dx.doi.org/10.7554/eLife.01808.001 PMID:24692446

  11. Promoter Engineering Reveals the Importance of Heptameric Direct Repeats for DNA Binding by Streptomyces Antibiotic Regulatory Protein-Large ATP-Binding Regulator of the LuxR Family (SARP-LAL) Regulators in Streptomyces natalensis.

    PubMed

    Barreales, Eva G; Vicente, Cláudia M; de Pedro, Antonio; Santos-Aberturas, Javier; Aparicio, Jesús F

    2018-05-15

    The biosynthesis of small-size polyene macrolides is ultimately controlled by a couple of transcriptional regulators that act in a hierarchical way. A Streptomyces antibiotic regulatory protein-large ATP-binding regulator of the LuxR family (SARP-LAL) regulator binds the promoter of a PAS-LuxR regulator-encoding gene and activates its transcription, and in turn, the gene product of the latter activates transcription from various promoters of the polyene gene cluster directly. The primary operator of PimR, the archetype of SARP-LAL regulators, contains three heptameric direct repeats separated by four-nucleotide spacers, but the regulator can also bind a secondary operator with only two direct repeats separated by a 3-nucleotide spacer, both located in the promoter region of its unique target gene, pimM A similar arrangement of operators has been identified for PimR counterparts encoded by gene clusters for different antifungal secondary metabolites, including not only polyene macrolides but peptidyl nucleosides, phoslactomycins, or cycloheximide. Here, we used promoter engineering and quantitative transcriptional analyses to determine the contributions of the different heptameric repeats to transcriptional activation and final polyene production. Optimized promoters have thus been developed. Deletion studies and electrophoretic mobility assays were used for the definition of DNA-binding boxes formed by 22-nucleotide sequences comprising two conserved heptameric direct repeats separated by four-nucleotide less conserved spacers. The cooperative binding of PimR SARP appears to be the mechanism involved in the binding of regulator monomers to operators, and at least two protein monomers are required for efficient binding. IMPORTANCE Here, we have shown that a modulation of the production of the antifungal pimaricin in Streptomyces natalensis can be accomplished via promoter engineering of the PAS-LuxR transcriptional activator pimM The expression of this gene is controlled by the Streptomyces antibiotic regulatory protein-large ATP-binding regulator of the LuxR family (SARP-LAL) regulator PimR, which binds a series of heptameric direct repeats in its promoter region. The structure and importance of such repeats in protein binding, transcriptional activation, and polyene production have been investigated. These findings should provide important clues to understand the regulatory machinery that modulates antibiotic biosynthesis in Streptomyces and open new possibilities for the manipulation of metabolite production. The presence of PimR orthologues encoded by gene clusters for different secondary metabolites and the conservation of their operators suggest that the improvements observed in the activation of pimaricin biosynthesis by Streptomyces natalensis could be extrapolated to the production of different compounds by other species. Copyright © 2018 Barreales et al.

  12. Regulation of CAPRICE transcription by MYB proteins for root epidermis differentiation in Arabidopsis.

    PubMed

    Koshino-Kimura, Yoshihiro; Wada, Takuji; Tachibana, Tatsuhiko; Tsugeki, Ryuji; Ishiguro, Sumie; Okada, Kiyotaka

    2005-06-01

    Epidermal cell differentiation in Arabidopsis root is studied as a model system for understanding cell fate specification. Two types of MYB-related transcription factors are involved in this cell differentiation. One of these, CAPRICE (CPC), encoding an R3-type MYB protein, is a positive regulator of hair cell differentiation and is preferentially transcribed in hairless cells. We analyzed the regulatory mechanism of CPC transcription. Deletion analyses of the CPC promoter revealed that hairless cell-specific transcription of the CPC gene required a 69 bp sequence, and a tandem repeat of this region was sufficient for its expression in epidermis. This region includes two MYB-binding sites, and the epidermis-specific transcription of CPC was abolished when base substitutions were introduced in these sites. We showed by gel mobility shift experiments and by yeast one-hybrid assay that WEREWOLF (WER), which is an R2R3-type MYB protein, directly binds to this region. We showed that WER also binds to the GL2 promoter region, indicating that WER directly regulates CPC and GL2 transcription by binding to their promoter regions.

  13. Chloride sensing by WNK1 kinase involves inhibition of autophosphorylation

    PubMed Central

    Piala, Alexander T.; Moon, Thomas M.; Akella, Radha; He, Haixia; Cobb, Melanie H.; Goldsmith, Elizabeth J.

    2014-01-01

    WNK1 [with no lysine (K)] is a serine-threonine kinase associated with a form of familial hypertension. WNK1 is at the top of a kinase cascade leading to phosphorylation of several cotransporters, in particular those transporting sodium, potassium, and chloride (NKCC), sodium and chloride (NCC), and potassium and chloride (KCC). The responsiveness of NKCC, NCC, and KCC to changes in extracellular chloride parallels their phosphorylation state, provoking the proposal that these transporters are controlled by a chloride-sensitive protein kinase. Here, we found that chloride stabilizes the inactive conformation of WNK1, preventing kinase autophosphorylation and activation. Crystallographic studies of inactive WNK1 in the presence of chloride revealed that chloride binds directly to the catalytic site, providing a basis for the unique position of the catalytic lysine. Mutagenesis of the chloride binding site rendered the kinase less sensitive to inhibition of autophosphorylation by chloride, validating the binding site. Thus, these data suggest that WNK1 functions as a chloride sensor through direct binding of a regulatory chloride ion to the active site, which inhibits autophosphorylation. PMID:24803536

  14. A cytoplasmic protein, bystin, interacts with trophinin, tastin, and cytokeratin and may be involved in trophinin-mediated cell adhesion between trophoblast and endometrial epithelial cells

    PubMed Central

    Suzuki, Nao; Zara, Jane; Sato, Takaaki; Ong, Edgar; Bakhiet, Nouna; Oshima, Robert G.; Watson, Kellie L.; Fukuda, Michiko N.

    1998-01-01

    Trophinin and tastin form a cell adhesion molecule complex that potentially mediates an initial attachment of the blastocyst to uterine epithelial cells at the time of implantation. Trophinin and tastin, however, do not directly bind to each other, suggesting the presence of an intermediary protein. The present study identifies a cytoplasmic protein, named bystin, that directly binds trophinin and tastin. Bystin consists of 306 amino acid residues and is predicted to contain tyrosine, serine, and threonine residues in contexts conforming to motifs for phosphorylation by protein kinases. Database searches revealed a 53% identity of the predicted peptide sequence with the Drosophila bys (mrr) gene. Direct protein–protein interactions of trophinin, tastin, and bystin analyzed by yeast two-hybrid assays and by in vitro protein binding assays indicated that binding between bystin and trophinin and between bystin and tastin is enhanced when cytokeratin 8 and 18 are present as the third molecule. Immunocytochemistry of bystin showed that bystin colocalizes with trophinin, tastin, and cytokeratins in a human trophoblastic teratocarcinoma cell, HT-H. It is therefore possible that these molecules form a complex and thus are involved in the process of embryo implantation. PMID:9560222

  15. Single-molecule Imaging Analysis of Binding, Processive Movement, and Dissociation of Cellobiohydrolase Trichoderma reesei Cel6A and Its Domains on Crystalline Cellulose*

    PubMed Central

    Nakamura, Akihiko; Tasaki, Tomoyuki; Ishiwata, Daiki; Yamamoto, Mayuko; Okuni, Yasuko; Visootsat, Akasit; Maximilien, Morice; Noji, Hiroyuki; Uchiyama, Taku; Samejima, Masahiro; Igarashi, Kiyohiko; Iino, Ryota

    2016-01-01

    Trichoderma reesei Cel6A (TrCel6A) is a cellobiohydrolase that hydrolyzes crystalline cellulose into cellobiose. Here we directly observed the reaction cycle (binding, surface movement, and dissociation) of single-molecule intact TrCel6A, isolated catalytic domain (CD), cellulose-binding module (CBM), and CBM and linker (CBM-linker) on crystalline cellulose Iα. The CBM-linker showed a binding rate constant almost half that of intact TrCel6A, whereas those of the CD and CBM were only one-tenth of intact TrCel6A. These results indicate that the glycosylated linker region largely contributes to initial binding on crystalline cellulose. After binding, all samples showed slow and fast dissociations, likely caused by the two different bound states due to the heterogeneity of cellulose surface. The CBM showed much higher specificity to the high affinity site than to the low affinity site, whereas the CD did not, suggesting that the CBM leads the CD to the hydrophobic surface of crystalline cellulose. On the cellulose surface, intact molecules showed slow processive movements (8.8 ± 5.5 nm/s) and fast diffusional movements (30–40 nm/s), whereas the CBM-Linker, CD, and a catalytically inactive full-length mutant showed only fast diffusional movements. These results suggest that both direct binding and surface diffusion contribute to searching of the hydrolysable point of cellulose chains. The duration time constant for the processive movement was 7.7 s, and processivity was estimated as 68 ± 42. Our results reveal the role of each domain in the elementary steps of the reaction cycle and provide the first direct evidence of the processive movement of TrCel6A on crystalline cellulose. PMID:27609516

  16. Development of an aptamer beacon for detection of interferon-gamma.

    PubMed

    Tuleuova, Nazgul; Jones, Caroline N; Yan, Jun; Ramanculov, Erlan; Yokobayashi, Yohei; Revzin, Alexander

    2010-03-01

    Traditional antibody-based affinity sensing strategies employ multiple reagents and washing steps and are unsuitable for real-time detection of analyte binding. Aptamers, on the other hand, may be designed to monitor binding events directly, in real-time, without the need for secondary labels. The goal of the present study was to design an aptamer beacon for fluorescence resonance energy transfer (FRET)-based detection of interferon-gamma (IFN-gamma)--an important inflammatory cytokine. Variants of DNA aptamer modified with biotin moieties and spacers were immobilized on avidin-coated surfaces and characterized by surface plasmon resonance (SPR). The SPR studies showed that immobilization of aptamer via the 3' end resulted in the best binding IFN-gamma (K(d) = 3.44 nM). This optimal aptamer variant was then used to construct a beacon by hybridizing fluorophore-labeled aptamer with an antisense oligonucleotide strand carrying a quencher. SPR studies revealed that IFN-gamma binding with an aptamer beacon occurred within 15 min of analyte introduction--suggesting dynamic replacement of the quencher-complementary strand by IFN-gamma molecules. To further highlight biosensing applications, aptamer beacon molecules were immobilized inside microfluidic channels and challenged with varying concentration of analyte. Fluorescence microscopy revealed low fluorescence in the absence of analyte and high fluorescence after introduction of IFN-gamma. Importantly, unlike traditional antibody-based immunoassays, the signal was observed directly upon binding of analyte without the need for multiple washing steps. The surface immobilized aptamer beacon had a linear range from 5 to 100 nM and a lower limit of detection of 5 nM IFN-gamma. In conclusion, we designed a FRET-based aptamer beacon for monitoring of an inflammatory cytokine-IFN-gamma. In the future, this biosensing strategy will be employed to monitor dynamics of cytokine production by the immune cells.

  17. Family 46 Carbohydrate-binding Modules Contribute to the Enzymatic Hydrolysis of Xyloglucan and β-1,3-1,4-Glucans through Distinct Mechanisms.

    PubMed

    Venditto, Immacolata; Najmudin, Shabir; Luís, Ana S; Ferreira, Luís M A; Sakka, Kazuo; Knox, J Paul; Gilbert, Harry J; Fontes, Carlos M G A

    2015-04-24

    Structural carbohydrates comprise an extraordinary source of energy that remains poorly utilized by the biofuel sector as enzymes have restricted access to their substrates within the intricacy of plant cell walls. Carbohydrate active enzymes (CAZYmes) that target recalcitrant polysaccharides are modular enzymes containing noncatalytic carbohydrate-binding modules (CBMs) that direct enzymes to their cognate substrate, thus potentiating catalysis. In general, CBMs are functionally and structurally autonomous from their associated catalytic domains from which they are separated through flexible linker sequences. Here, we show that a C-terminal CBM46 derived from BhCel5B, a Bacillus halodurans endoglucanase, does not interact with β-glucans independently but, uniquely, acts cooperatively with the catalytic domain of the enzyme in substrate recognition. The structure of BhCBM46 revealed a β-sandwich fold that abuts onto the region of the substrate binding cleft upstream of the active site. BhCBM46 as a discrete entity is unable to bind to β-glucans. Removal of BhCBM46 from BhCel5B, however, abrogates binding to β-1,3-1,4-glucans while substantially decreasing the affinity for decorated β-1,4-glucan homopolymers such as xyloglucan. The CBM46 was shown to contribute to xyloglucan hydrolysis only in the context of intact plant cell walls, but it potentiates enzymatic activity against purified β-1,3-1,4-glucans in solution or within the cell wall. This report reveals the mechanism by which a CBM can promote enzyme activity through direct interaction with the substrate or by targeting regions of the plant cell wall where the target glucan is abundant. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. DNA-binding activity of TNF-{alpha} inducing protein from Helicobacter pylori

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuzuhara, T.; Suganuma, M.; Oka, K.

    2007-11-03

    Tumor necrosis factor-{alpha} (TNF-{alpha}) inducing protein (Tip{alpha}) is a carcinogenic factor secreted from Helicobacter pylori (H. pylori), mediated through both enhanced expression of TNF-{alpha} and chemokine genes and activation of nuclear factor-{kappa}B. Since Tip{alpha} enters gastric cancer cells, the Tip{alpha} binding molecules in the cells should be investigated. The direct DNA-binding activity of Tip{alpha} was observed by pull down assay using single- and double-stranded genomic DNA cellulose. The surface plasmon resonance assay, indicating an association between Tip{alpha} and DNA, revealed that the affinity of Tip{alpha} for (dGdC)10 is 2400 times stronger than that of del-Tip{alpha}, an inactive Tip{alpha}. This suggestsmore » a strong correlation between DNA-binding activity and carcinogenic activity of Tip{alpha}. And the DNA-binding activity of Tip{alpha} was first demonstrated with a molecule secreted from H. pylori.« less

  19. How Does Mg2+ Modulate the RNA Folding Mechanism: A Case Study of the G:C W:W Trans Basepair.

    PubMed

    Halder, Antarip; Roy, Rohit; Bhattacharyya, Dhananjay; Mitra, Abhijit

    2017-07-25

    Reverse Watson-Crick G:C basepairs (G:C W:W Trans) occur frequently in different functional RNAs. This is one of the few basepairs whose gas-phase-optimized isolated geometry is inconsistent with the corresponding experimental geometry. Several earlier studies indicate that through post-transcriptional modification, direct protonation, or coordination with Mg 2+ , accumulation of positive charge near N7 of guanine can stabilize the experimental geometry. Interestingly, recent studies reveal significant variation in the position of putatively bound Mg 2+ . This, in conjunction with recently raised doubts regarding some of the Mg 2+ assignments near the imino nitrogen of guanine, is suggestive of the existence of multiple Mg 2+ binding modes for this basepair. Our detailed investigation of Mg 2+ -bound G:C W:W Trans pairs occurring in high-resolution RNA crystal structures shows that they are found in 14 different contexts, eight of which display Mg 2+ binding at the Hoogsteen edge of guanine. Further examination of occurrences in these eight contexts led to the characterization of three different Mg 2+ binding modes: 1) direct binding via N7 coordination, 2) direct binding via O6 coordination, and 3) binding via hydrogen-bonding interaction with the first-shell water molecules. In the crystal structures, the latter two modes are associated with a buckled and propeller-twisted geometry of the basepair. Interestingly, respective optimized geometries of these different Mg 2+ binding modes (optimized using six different DFT functionals) are consistent with their corresponding experimental geometries. Subsequent interaction energy calculations at the MP2 level, and decomposition of its components, suggest that for G:C W:W Trans , Mg 2+ binding can fine tune the basepair geometries without compromising with their stability. Our results, therefore, underline the importance of the mode of binding of Mg 2+ ions in shaping RNA structure, folding and function. Copyright © 2017. Published by Elsevier Inc.

  20. Myopodin is an F-actin bundling protein with multiple independent actin-binding regions.

    PubMed

    Linnemann, Anja; Vakeel, Padmanabhan; Bezerra, Eduardo; Orfanos, Zacharias; Djinović-Carugo, Kristina; van der Ven, Peter F M; Kirfel, Gregor; Fürst, Dieter O

    2013-02-01

    The assembly of striated muscle myofibrils is a multistep process in which a variety of proteins is involved. One of the first and most important steps in myofibrillogenesis is the arrangement of thin myofilaments into ordered I-Z-I brushes, requiring the coordinated activity of numerous actin binding proteins. The early expression of myopodin prior to sarcomeric α-actinin, as well as its binding to actin, α-actinin and filamin indicate an important role for this protein in actin cytoskeleton remodelling with the precise function of myopodin in this process yet remaining to be resolved. While myopodin was previously described as a protein capable of cross-linking actin filaments into thick bundles upon transient transfections, it has remained unclear whether myopodin alone is capable of bundling actin, or if additional proteins are involved. We have therefore investigated the in vitro actin binding properties of myopodin. High speed cosedimentation assays with skeletal muscle actin confirmed direct binding of myopodin to F-actin and showed that this interaction is mediated by at least two independent actin binding sites, found in all myopodin isoforms identified to date. Furthermore, low-speed cosedimentation assays revealed that not only full length myopodin, but also the fragment containing only the second binding site, bundles microfilaments in the absence of accessory proteins. Ultrastructural analysis demonstrated that this bundling activity resembled that of α-actinin. Biochemical experiments revealed that bundling was not achieved by myopodin's ability to dimerize, indicating the presence of two individual F-actin binding sites within the second binding segment. Thus full length myopodin contains at least three F-actin binding sites. These data provide further understanding of the mechanisms by which myopodin contributes to actin reorganization during myofibril assembly.

  1. Structure and Self-Assembly of the Calcium Binding Matrix Protein of Human Metapneumovirus

    PubMed Central

    Leyrat, Cedric; Renner, Max; Harlos, Karl; Huiskonen, Juha T.; Grimes, Jonathan M.

    2014-01-01

    Summary The matrix protein (M) of paramyxoviruses plays a key role in determining virion morphology by directing viral assembly and budding. Here, we report the crystal structure of the human metapneumovirus M at 2.8 Å resolution in its native dimeric state. The structure reveals the presence of a high-affinity Ca2+ binding site. Molecular dynamics simulations (MDS) predict a secondary lower-affinity site that correlates well with data from fluorescence-based thermal shift assays. By combining small-angle X-ray scattering with MDS and ensemble analysis, we captured the structure and dynamics of M in solution. Our analysis reveals a large positively charged patch on the protein surface that is involved in membrane interaction. Structural analysis of DOPC-induced polymerization of M into helical filaments using electron microscopy leads to a model of M self-assembly. The conservation of the Ca2+ binding sites suggests a role for calcium in the replication and morphogenesis of pneumoviruses. PMID:24316400

  2. Complex Interdependence Regulates Heterotypic Transcription Factor Distribution and Coordinates Cardiogenesis.

    PubMed

    Luna-Zurita, Luis; Stirnimann, Christian U; Glatt, Sebastian; Kaynak, Bogac L; Thomas, Sean; Baudin, Florence; Samee, Md Abul Hassan; He, Daniel; Small, Eric M; Mileikovsky, Maria; Nagy, Andras; Holloway, Alisha K; Pollard, Katherine S; Müller, Christoph W; Bruneau, Benoit G

    2016-02-25

    Transcription factors (TFs) are thought to function with partners to achieve specificity and precise quantitative outputs. In the developing heart, heterotypic TF interactions, such as between the T-box TF TBX5 and the homeodomain TF NKX2-5, have been proposed as a mechanism for human congenital heart defects. We report extensive and complex interdependent genomic occupancy of TBX5, NKX2-5, and the zinc finger TF GATA4 coordinately controlling cardiac gene expression, differentiation, and morphogenesis. Interdependent binding serves not only to co-regulate gene expression but also to prevent TFs from distributing to ectopic loci and activate lineage-inappropriate genes. We define preferential motif arrangements for TBX5 and NKX2-5 cooperative binding sites, supported at the atomic level by their co-crystal structure bound to DNA, revealing a direct interaction between the two factors and induced DNA bending. Complex interdependent binding mechanisms reveal tightly regulated TF genomic distribution and define a combinatorial logic for heterotypic TF regulation of differentiation. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Repeated losses of PRDM9-directed recombination despite the conservation of PRDM9 across vertebrates

    PubMed Central

    Baker, Zachary; Schumer, Molly; Haba, Yuki; Bashkirova, Lisa; Holland, Chris; Rosenthal, Gil G; Przeworski, Molly

    2017-01-01

    Studies of highly diverged species have revealed two mechanisms by which meiotic recombination is directed to the genome—through PRDM9 binding or by targeting promoter-like features—that lead to dramatically different evolutionary dynamics of hotspots. Here, we identify PRDM9 orthologs from genome and transcriptome data in 225 species. We find the complete PRDM9 ortholog across distantly related vertebrates but, despite this broad conservation, infer a minimum of six partial and three complete losses. Strikingly, taxa carrying the complete ortholog of PRDM9 are precisely those with rapid evolution of its predicted binding affinity, suggesting that all domains are necessary for directing recombination. Indeed, as we show, swordtail fish carrying only a partial but conserved ortholog share recombination properties with PRDM9 knock-outs. DOI: http://dx.doi.org/10.7554/eLife.24133.001 PMID:28590247

  4. Variola virus E3L Zα domain, but not its Z-DNA binding activity, is required for PKR inhibition.

    PubMed

    Thakur, Meghna; Seo, Eun Joo; Dever, Thomas E

    2014-02-01

    Responding to viral infection, the interferon-induced, double-stranded RNA (dsRNA)-activated protein kinase PKR phosphorylates translation initiation factor eIF2α to inhibit cellular and viral protein synthesis. To overcome this host defense mechanism, many poxviruses express the protein E3L, containing an N-terminal Z-DNA binding (Zα) domain and a C-terminal dsRNA-binding domain (dsRBD). While E3L is thought to inhibit PKR activation by sequestering dsRNA activators and by directly binding the kinase, the role of the Zα domain in PKR inhibition remains unclear. Here, we show that the E3L Zα domain is required to suppress the growth-inhibitory properties associated with expression of human PKR in yeast, to inhibit PKR kinase activity in vitro, and to reverse the inhibitory effects of PKR on reporter gene expression in mammalian cells treated with dsRNA. Whereas previous studies revealed that the Z-DNA binding activity of E3L is critical for viral pathogenesis, we identified point mutations in E3L that functionally uncouple Z-DNA binding and PKR inhibition. Thus, our studies reveal a molecular distinction between the nucleic acid binding and PKR inhibitory functions of the E3L Zα domain, and they support the notion that E3L contributes to viral pathogenesis by targeting PKR and other components of the cellular anti-viral defense pathway.

  5. c-Jun binds the N terminus of human TAF(II)250 to derepress RNA polymerase II transcription in vitro.

    PubMed

    Lively, T N; Ferguson, H A; Galasinski, S K; Seto, A G; Goodrich, J A

    2001-07-06

    c-Jun is an oncoprotein that activates transcription of many genes involved in cell growth and proliferation. We studied the mechanism of transcriptional activation by human c-Jun in a human RNA polymerase II transcription system composed of highly purified recombinant and native transcription factors. Transcriptional activation by c-Jun depends on the TATA-binding protein (TBP)-associated factor (TAF) subunits of transcription factor IID (TFIID). Protein-protein interaction assays revealed that c-Jun binds with high specificity to the largest subunit of human TFIID, TAF(II)250. The region of TAF(II)250 bound by c-Jun lies in the N-terminal 163 amino acids. This same region of TAF(II)250 binds to TBP and represses its interaction with TATA boxes, thereby decreasing DNA binding by TFIID. We hypothesized that c-Jun is capable of derepressing the effect of the TAF(II)250 N terminus on TFIID-driven transcription. In support of this hypothesis, we found that c-Jun increased levels of TFIID-driven transcription in vitro when added at high concentrations to a DNA template lacking activator protein 1 (AP-1) sites. Moreover, c-Jun blocked the repression of TBP DNA binding caused by the N terminus of TAF(II)250. In addition to revealing a mechanism by which c-Jun activates transcription, our studies provide the first evidence that an activator can bind directly to the N terminus of TAF(II)250 to derepress RNA polymerase II transcription in vitro.

  6. Supramolecular binding and separation of hydrocarbons within a functionalized porous metal–organic framework

    DOE PAGES

    Yang, Sihai; Ramirez-Cuesta, Anibal J.; Newby, Ruth; ...

    2014-12-01

    Supramolecular interactions are fundamental to host–guest binding in many chemical and biological processes. Direct visualization of such supramolecular interactions within host–guest systems is extremely challenging, but crucial to understanding their function. Within this paper, we report a comprehensive study that combines neutron scattering, synchrotron X-ray and neutron diffraction, and computational modelling to define the detailed binding at a molecular level of acetylene, ethylene and ethane within the porous host NOTT-300. This study reveals simultaneous and cooperative hydrogen-bonding, π···π stacking interactions and intermolecular dipole interactions in the binding of acetylene and ethylene to give up to 12 individual weak supramolecular interactionsmore » aligned within the host to form an optimal geometry for the selective binding of hydrocarbons. In addition, we also report the cooperative binding of a mixture of acetylene and ethylene within the porous host, together with the corresponding breakthrough experiments and analysis of adsorption isotherms of gas mixtures.« less

  7. Protein unfolding as a switch from self-recognition to high-affinity client binding

    PubMed Central

    Groitl, Bastian; Horowitz, Scott; Makepeace, Karl A. T.; Petrotchenko, Evgeniy V.; Borchers, Christoph H.; Reichmann, Dana; Bardwell, James C. A.; Jakob, Ursula

    2016-01-01

    Stress-specific activation of the chaperone Hsp33 requires the unfolding of a central linker region. This activation mechanism suggests an intriguing functional relationship between the chaperone's own partial unfolding and its ability to bind other partially folded client proteins. However, identifying where Hsp33 binds its clients has remained a major gap in our understanding of Hsp33's working mechanism. By using site-specific Fluorine-19 nuclear magnetic resonance experiments guided by in vivo crosslinking studies, we now reveal that the partial unfolding of Hsp33's linker region facilitates client binding to an amphipathic docking surface on Hsp33. Furthermore, our results provide experimental evidence for the direct involvement of conditionally disordered regions in unfolded protein binding. The observed structural similarities between Hsp33's own metastable linker region and client proteins present a possible model for how Hsp33 uses protein unfolding as a switch from self-recognition to high-affinity client binding. PMID:26787517

  8. The structure of lactoferrin-binding protein B from Neisseria meningitidis suggests roles in iron acquisition and neutralization of host defences

    PubMed Central

    Brooks, Cory L.; Arutyunova, Elena; Lemieux, M. Joanne

    2014-01-01

    Pathogens have evolved a range of mechanisms to acquire iron from the host during infection. Several Gram-negative pathogens including members of the genera Neisseria and Moraxella have evolved two-component systems that can extract iron from the host glycoproteins lactoferrin and transferrin. The homologous iron-transport systems consist of a membrane-bound transporter and an accessory lipoprotein. While the mechanism behind iron acquisition from transferrin is well understood, relatively little is known regarding how iron is extracted from lactoferrin. Here, the crystal structure of the N-terminal domain (N-lobe) of the accessory lipoprotein lactoferrin-binding protein B (LbpB) from the pathogen Neisseria meningitidis is reported. The structure is highly homologous to the previously determined structures of the accessory lipoprotein transferrin-binding protein B (TbpB) and LbpB from the bovine pathogen Moraxella bovis. Docking the LbpB structure with lactoferrin reveals extensive binding interactions with the N1 subdomain of lactoferrin. The nature of the interaction precludes apolactoferrin from binding LbpB, ensuring the specificity of iron-loaded lactoferrin. The specificity of LbpB safeguards proper delivery of iron-bound lactoferrin to the transporter lactoferrin-binding protein A (LbpA). The structure also reveals a possible secondary role for LbpB in protecting the bacteria from host defences. Following proteolytic digestion of lactoferrin, a cationic peptide derived from the N-terminus is released. This peptide, called lactoferricin, exhibits potent antimicrobial effects. The docked model of LbpB with lactoferrin reveals that LbpB interacts extensively with the N-terminal lactoferricin region. This may provide a venue for preventing the production of the peptide by proteolysis, or directly sequestering the peptide, protecting the bacteria from the toxic effects of lactoferricin. PMID:25286931

  9. Hierarchical Control on Polyene Macrolide Biosynthesis: PimR Modulates Pimaricin Production via the PAS-LuxR Transcriptional Activator PimM

    PubMed Central

    Santos-Aberturas, Javier; Vicente, Cláudia M.; Payero, Tamara D.; Martín-Sánchez, Lara; Cañibano, Carmen; Martín, Juan F.; Aparicio, Jesús F.

    2012-01-01

    Control of polyene macrolide production in Streptomyces natalensis is mediated by the transcriptional activator PimR. This regulator combines an N-terminal domain corresponding to the Streptomyces antibiotic regulatory protein (SARP) family of transcriptional activators with a C-terminal half homologous to guanylate cyclases and large ATP-binding regulators of the LuxR family. The PimR SARP domain (PimRSARP) was expressed in Escherichia coli as a glutathione S-transferase (GST)–fused protein. Electrophoretic mobility shift assays showed that GST-PimRSARP binds a single target, the intergenic region between the regulatory genes pimR and pimMs in the pimaricin cluster. The PimRSARP-binding site was investigated by DNaseI protection studies, revealing that it contains three heptameric direct repeats adjusting to the consensus 5′-CGGCAAG-3′. Transcription start points of pimM and pimR promoters were identified by 5′-RACE, revealing that unlike other SARPs, PimRSARP does not interact with the -35 region of its target promoter. Quantitative transcriptional analysis of these regulatory genes on mutants on each of them has allowed the identification of the pimM promoter as the transcriptional target for PimR. Furthermore, the constitutive expression of pimM restored pimaricin production in a pimaricin-deficient strain carrying a deletion mutant of pimR. These results reveal that PimR exerts its positive effect on pimaricin production by controlling pimM expression level, a regulator whose gene product activates transcription from eight different promoters of pimaricin structural genes directly. PMID:22693644

  10. GATA-1 directly regulates Nanog in mouse embryonic stem cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Wen-Zhong; Ai, Zhi-Ying; Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A&F University, Yangling 712100

    2015-09-25

    Nanog safeguards pluripotency in mouse embryonic stem cells (mESCs). Insight into the regulation of Nanog is important for a better understanding of the molecular mechanisms that control pluripotency of mESCs. In a silico analysis, we identify four GATA-1 putative binding sites in Nanog proximal promoter. The Nanog promoter activity can be significantly repressed by ectopic expression of GATA-1 evidenced by a promoter reporter assay. Mutation studies reveal that one of the four putative binding sites counts for GATA-1 repressing Nanog promoter activity. Direct binding of GATA-1 on Nanog proximal promoter is confirmed by electrophoretic mobility shift assay and chromatin immunoprecipitation.more » Our data provide new insights into the expanded regulatory circuitry that coordinates Nanog expression. - Highlights: • The Nanog proximal promoter conceives functional element for GATA-1. • GATA-1 occupies the Nanog proximal promoter in vitro and in vivo. • GATA-1 transcriptionally suppresses Nanog.« less

  11. Direct interactions of OCA-B and TFII-I regulate immunoglobulin heavy-chain gene transcription by facilitating enhancer-promoter communication.

    PubMed

    Ren, Xiaodi; Siegel, Rachael; Kim, Unkyu; Roeder, Robert G

    2011-05-06

    B cell-specific coactivator OCA-B, together with Oct-1/2, binds to octamer sites in promoters and enhancers to activate transcription of immunoglobulin (Ig) genes, although the mechanisms underlying their roles in enhancer-promoter communication are unknown. Here, we demonstrate a direct interaction of OCA-B with transcription factor TFII-I, which binds to DICE elements in Igh promoters, that affects transcription at two levels. First, OCA-B relieves HDAC3-mediated Igh promoter repression by competing with HDAC3 for binding to promoter-bound TFII-I. Second, and most importantly, Igh 3' enhancer-bound OCA-B and promoter-bound TFII-I mediate promoter-enhancer interactions, in both cis and trans, that are important for Igh transcription. These and other results reveal an important function for OCA-B in Igh 3' enhancer function in vivo and strongly favor an enhancer mechanism involving looping and facilitated factor recruitment rather than a tracking mechanism. Copyright © 2011 Elsevier Inc. All rights reserved.

  12. Direct interactions of OCA-B and TFII-I regulate immunoglobulin heavy-chain gene transcription by facilitating enhancer-promoter communication

    PubMed Central

    Ren, Xiaodi; Siegel, Rachael; Kim, Unkyu; Roeder, Robert G.

    2011-01-01

    Summary B cell-specific coactivator OCA-B, together with Oct-1/2, binds to octamer sites in promoters and enhancers to activate transcription of immunoglobulin (Ig) genes, although the mechanisms underlying their roles in enhancer-promoter communication are unknown. Here, we demonstrate a direct interaction of OCA-B with transcription factor TFII-I, which binds to DICE elements in IgH promoters, that affects transcription at two levels. First, OCA-B relieves HDAC3-mediated IgH promoter repression by competing with HDAC3 for binding to promoter-bound TFII-I. Second, and most importantly, Igh 3′enhancer-bound OCA-B and promoter-bound TFII-I mediate promoter-enhancer interactions, in both cis and trans, that are important for Igh transcription. These and other results reveal an important function for OCA-B in Igh 3′enhancer function in vivo and strongly favor an enhancer mechanism involving looping and facilitated factor recruitment rather than a tracking mechanism. PMID:21549311

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Urusova, Darya V.; Shim, Jung-Hyun; Kim, Dong Joon

    The most active anticancer component in green tea is epigallocatechin-3-gallate (EGCG). The human peptidyl prolyl cis/trans isomerase (Pin1) plays a critical role in oncogenic signaling. Herein, we report the X-ray crystal structure of the Pin1/EGCG complex resolved at 1.9 Å resolution. Notably, the structure revealed the presence of EGCG in both the WW and PPIase domains of Pin1. The direct binding of EGCG with Pin1 was confirmed and the interaction inhibited Pin1 PPIase activity. In addition, proliferation of cells expressing Pin1 was inhibited and tumor growth in a xenograft mouse model was suppressed. The binding of EGCG with Arg17 inmore » the WW domain prevented the binding of c-Jun, a well-known Pin1 substrate. EGCG treatment corresponded with a decreased abundance of cyclin D1 and diminution of 12-O-tetradecanoylphorbol-l3-acetate–induced AP-1 or NF-κB promoter activity in cells expressing Pin1. Overall, these results showed that EGCG directly suppresses the tumor-promoting effect of Pin1.« less

  14. Novel DNA Motif Binding Activity Observed In Vivo With an Estrogen Receptor α Mutant Mouse

    PubMed Central

    Li, Leping; Grimm, Sara A.; Winuthayanon, Wipawee; Hamilton, Katherine J.; Pockette, Brianna; Rubel, Cory A.; Pedersen, Lars C.; Fargo, David; Lanz, Rainer B.; DeMayo, Francesco J.; Schütz, Günther; Korach, Kenneth S.

    2014-01-01

    Estrogen receptor α (ERα) interacts with DNA directly or indirectly via other transcription factors, referred to as “tethering.” Evidence for tethering is based on in vitro studies and a widely used “KIKO” mouse model containing mutations that prevent direct estrogen response element DNA- binding. KIKO mice are infertile, due in part to the inability of estradiol (E2) to induce uterine epithelial proliferation. To elucidate the molecular events that prevent KIKO uterine growth, regulation of the pro-proliferative E2 target gene Klf4 and of Klf15, a progesterone (P4) target gene that opposes the pro-proliferative activity of KLF4, was evaluated. Klf4 induction was impaired in KIKO uteri; however, Klf15 was induced by E2 rather than by P4. Whole uterine chromatin immunoprecipitation-sequencing revealed enrichment of KIKO ERα binding to hormone response elements (HREs) motifs. KIKO binding to HRE motifs was verified using reporter gene and DNA-binding assays. Because the KIKO ERα has HRE DNA-binding activity, we evaluated the “EAAE” ERα, which has more severe DNA-binding domain mutations, and demonstrated a lack of estrogen response element or HRE reporter gene induction or DNA-binding. The EAAE mouse has an ERα null–like phenotype, with impaired uterine growth and transcriptional activity. Our findings demonstrate that the KIKO mouse model, which has been used by numerous investigators, cannot be used to establish biological functions for ERα tethering, because KIKO ERα effectively stimulates transcription using HRE motifs. The EAAE-ERα DNA-binding domain mutant mouse demonstrates that ERα DNA-binding is crucial for biological and transcriptional processes in reproductive tissues and that ERα tethering may not contribute to estrogen responsiveness in vivo. PMID:24713037

  15. Structural analysis of the Sil1-Bip complex reveals the mechanism for Sil1 to function as a nucleotide-exchange factor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yan, Ming; Li, Jingzhi; Sha, Bingdong

    2013-01-16

    Sil1 functions as a NEF (nucleotide-exchange factor) for the ER (endoplasmic reticulum) Hsp70 (heat-shock protein of 70 kDa) Bip in eukaryotic cells. Sil1 may catalyse the ADP release from Bip by interacting directly with the ATPase domain of Bip. In the present study we show the complex crystal structure of the yeast Bip and the NEF Sil1 at the resolution of 2.3 {angstrom} (1 {angstrom} = 0.1 nm). In the Sil1-Bip complex structure, the Sil1 molecule acts as a 'clamp' which binds lobe IIb of the Bip ATPase domain. The binding of Sil1 causes the rotation of lobe IIb {approx}more » 13.5{sup o} away from the ADP-binding pocket. The complex formation also induces lobe Ib to swing in the opposite direction by {approx} 3.7{sup o}. These conformational changes open up the nucleotide-binding pocket in the Bip ATPase domain and disrupt the hydrogen bonds between Bip and bound ADP, which may catalyse ADP release. Mutation of the Sil1 residues involved in binding the Bip ATPase domain compromise the binding affinity of Sil1 to Bip, and these Sil1 mutants also abolish the ability to stimulate the ATPase activity of Bip.« less

  16. Amides Do Not Always Work: Observation of Guest Binding in an Amide-Functionalized Porous Metal-Organic Framework.

    PubMed

    Benson, Oguarabau; da Silva, Ivan; Argent, Stephen P; Cabot, Rafel; Savage, Mathew; Godfrey, Harry G W; Yan, Yong; Parker, Stewart F; Manuel, Pascal; Lennox, Matthew J; Mitra, Tamoghna; Easun, Timothy L; Lewis, William; Blake, Alexander J; Besley, Elena; Yang, Sihai; Schröder, Martin

    2016-11-16

    An amide-functionalized metal organic framework (MOF) material, MFM-136, shows a high CO 2 uptake of 12.6 mmol g -1 at 20 bar and 298 K. MFM-136 is the first example of an acylamide pyrimidyl isophthalate MOF without open metal sites and, thus, provides a unique platform to study guest binding, particularly the role of free amides. Neutron diffraction reveals that, surprisingly, there is no direct binding between the adsorbed CO 2 /CH 4 molecules and the pendant amide group in the pore. This observation has been confirmed unambiguously by inelastic neutron spectroscopy. This suggests that introduction of functional groups solely may not necessarily induce specific guest-host binding in porous materials, but it is a combination of pore size, geometry, and functional group that leads to enhanced gas adsorption properties.

  17. Elucidation of the Hsp90 C-terminal Inhibitor Binding Site

    PubMed Central

    Matts, Robert L.; Dixit, Anshuman; Peterson, Laura B.; Sun, Liang; Voruganti, Sudhakar; Kalyanaraman, Palgunan; Hartson, Steve D.; Verkhivker, Gennady M.; Blagg, Brian S. J.

    2011-01-01

    The Hsp90 chaperone machine is required for the folding, activation and/or stabilization of more than 50 proteins directly related to malignant progression. Hsp90 contains small molecule binding sites at both its N- and C-terminal domains, however, limited structural and biochemical data regarding the C-terminal binding site is available. In this report, the small molecule binding site in the Hsp90 C-terminal domain was revealed by protease fingerprinting and photoaffinity labeling utilizing LC-MS/MS. The identified site was characterized by generation of a homology model for hHsp90α using the SAXS open structure of HtpG and docking the bioactive conformation of NB into the generated model. The resulting model for the bioactive conformation of NB bound to Hsp90α is presented herein. PMID:21548602

  18. Myosin Va Bound to Phagosomes Binds to F-Actin and Delays Microtubule-dependent Motility

    PubMed Central

    Al-Haddad, Ahmed; Shonn, Marion A.; Redlich, Bärbel; Blocker, Ariel; Burkhardt, Janis K.; Yu, Hanry; Hammer, John A.; Weiss, Dieter G.; Steffen, Walter; Griffiths, Gareth; Kuznetsov, Sergei A.

    2001-01-01

    We established a light microscopy-based assay that reconstitutes the binding of phagosomes purified from mouse macrophages to preassembled F-actin in vitro. Both endogenous myosin Va from mouse macrophages and exogenous myosin Va from chicken brain stimulated the phagosome–F-actin interaction. Myosin Va association with phagosomes correlated with their ability to bind F-actin in an ATP-regulated manner and antibodies to myosin Va specifically blocked the ATP-sensitive phagosome binding to F-actin. The uptake and retrograde transport of phagosomes from the periphery to the center of cells in bone marrow macrophages was observed in both normal mice and mice homozygous for the dilute-lethal spontaneous mutation (myosin Va null). However, in dilute-lethal macrophages the accumulation of phagosomes in the perinuclear region occurred twofold faster than in normal macrophages. Motion analysis revealed saltatory phagosome movement with temporarily reversed direction in normal macrophages, whereas almost no reversals in direction were observed in dilute-lethal macrophages. These observations demonstrate that myosin Va mediates phagosome binding to F-actin, resulting in a delay in microtubule-dependent retrograde phagosome movement toward the cell center. We propose an “antagonistic/cooperative mechanism” to explain the saltatory phagosome movement toward the cell center in normal macrophages. PMID:11553713

  19. High resolution Chromatin Immunoprecipitation (ChIP) sequencing reveals novel bindings targets and prognostic role for SOX11 in Mantle cell lymphoma

    PubMed Central

    Kuo, Pei-Yu; Leshchenko, Violetta V.; Fazzari, Melissa J.; Perumal, Deepak; Gellen, Tobias; He, Tianfang; Iqbal, Javeed; Baumgartner-Wennerholm, Stefanie; Nygren, Lina; Zhang, Fan; Zhang, Weijia; Suh, K. Stephen; Goy, Andre; Yang, David T.; Chan, Wing-Chung; Kahl, Brad S.; Verma, Amit K.; Gascoyne, Randy D.; Kimby, Eva; Sander, Birgitta; Ye, B. Hilda; Melnick, Ari M.; Parekh, Samir

    2015-01-01

    SOX11 (Sex determining region Y-box 11) expression is specific for MCL as compared to other Non-Hodgkin's lymphomas. However, the function and direct binding targets of SOX11 in MCL are largely unknown. We used high-resolution ChIP-Seq to identify the direct target genes of SOX11 in a genome-wide, unbiased manner and elucidate its functional significance. Pathway analysis identified WNT, PKA and TGF-beta signaling pathways as significantly enriched by SOX11 target genes. qCHIP and promoter reporter assays confirmed that SOX11 directly binds to individual genes and modulates their transcription activities in these pathways in MCL. Functional studies using RNA interference demonstrate that SOX11 directly regulates WNT in MCL. We analyzed SOX11 expression in three independent well-annotated tissue microarrays from the University of Wisconsin (UW), Karolinska Institute and British Columbia Cancer Agency (BCCA). Our findings suggest that high SOX11 expression is associated with improved survival in a subset of MCL patients, particularly those treated with intensive chemotherapy. Transcriptional regulation of WNT and other biological pathways affected by SOX11 target genes may help explain the impact of SOX11 expression on patient outcomes. PMID:24681958

  20. Comparing anterior and posterior Hox complex formation reveals guidelines for predicting cis-regulatory elements

    PubMed Central

    Uhl, Juli D.; Cook, Tiffany A.; Gebelein, Brian

    2010-01-01

    Hox transcription factors specify numerous cell fates along the anterior-posterior axis by regulating the expression of downstream target genes. While expression analysis has uncovered large numbers of de-regulated genes in cells with altered Hox activity, determining which are direct versus indirect targets has remained a significant challenge. Here, we characterize the DNA binding activity of Hox transcription factor complexes on eight experimentally verified cis-regulatory elements. Hox factors regulate the activity of each element by forming protein complexes with two cofactor proteins, Extradenticle (Exd) and Homothorax (Hth). Using comparative DNA binding assays, we found that a number of flexible arrangements of Hox, Exd, and Hth binding sites mediate cooperative transcription factor complexes. Moreover, analysis of a Distal-less regulatory element (DMXR) that is repressed by abdominal Hox factors revealed that suboptimal binding sites can be combined to form high affinity transcription complexes. Lastly, we determined that the anterior Hox factors are more dependent upon Exd and Hth for complex formation than posterior Hox factors. Based upon these findings, we suggest a general set of guidelines to serve as a basis for designing bioinformatics algorithms aimed at identifying Hox regulatory elements using the wealth of recently sequenced genomes. PMID:20398649

  1. The nuclear receptor PPARγ individually responds to serotonin- and fatty acid-metabolites

    PubMed Central

    Waku, Tsuyoshi; Shiraki, Takuma; Oyama, Takuji; Maebara, Kanako; Nakamori, Rinna; Morikawa, Kosuke

    2010-01-01

    The nuclear receptor, peroxisome proliferator-activated receptor γ (PPARγ), recognizes various synthetic and endogenous ligands by the ligand-binding domain. Fatty-acid metabolites reportedly activate PPARγ through conformational changes of the Ω loop. Here, we report that serotonin metabolites act as endogenous agonists for PPARγ to regulate macrophage function and adipogenesis by directly binding to helix H12. A cyclooxygenase inhibitor, indomethacin, is a mimetic agonist of these metabolites. Crystallographic analyses revealed that an indole acetate functions as a common moiety for the recognition by the sub-pocket near helix H12. Intriguingly, a serotonin metabolite and a fatty-acid metabolite each bind to distinct sub-pockets, and the PPARγ antagonist, T0070907, blocked the fatty-acid agonism, but not that of the serotonin metabolites. Mutational analyses on receptor-mediated transcription and coactivator binding revealed that each metabolite individually uses coregulator and/or heterodimer interfaces in a ligand-type-specific manner. Furthermore, the inhibition of the serotonin metabolism reduced the expression of the endogenous PPARγ-target gene. Collectively, these results suggest a novel agonism, in which PPARγ functions as a multiple sensor in response to distinct metabolites. PMID:20717101

  2. Interaction of dihydrofolate reductase with methotrexate: Ensemble and single-molecule kinetics

    NASA Astrophysics Data System (ADS)

    Rajagopalan, P. T. Ravi; Zhang, Zhiquan; McCourt, Lynn; Dwyer, Mary; Benkovic, Stephen J.; Hammes, Gordon G.

    2002-10-01

    The thermodynamics and kinetics of the interaction of dihydrofolate reductase (DHFR) with methotrexate have been studied by using fluorescence, stopped-flow, and single-molecule methods. DHFR was modified to permit the covalent addition of a fluorescent molecule, Alexa 488, and a biotin at the N terminus of the molecule. The fluorescent molecule was placed on a protein loop that closes over methotrexate when binding occurs, thus causing a quenching of the fluorescence. The biotin was used to attach the enzyme in an active form to a glass surface for single-molecule studies. The equilibrium dissociation constant for the binding of methotrexate to the enzyme is 9.5 nM. The stopped-flow studies revealed that methotrexate binds to two different conformations of the enzyme, and the association and dissociation rate constants were determined. The single-molecule investigation revealed a conformational change in the enzyme-methotrexate complex that was not observed in the stopped-flow studies. The ensemble averaged rate constants for this conformation change in both directions is about 2-4 s1 and is attributed to the opening and closing of the enzyme loop over the bound methotrexate. Thus the mechanism of methotrexate binding to DHFR involves multiple steps and protein conformational changes.

  3. The Runt domain of AML1 (RUNX1) binds a sequence-conserved RNA motif that mimics a DNA element.

    PubMed

    Fukunaga, Junichi; Nomura, Yusuke; Tanaka, Yoichiro; Amano, Ryo; Tanaka, Taku; Nakamura, Yoshikazu; Kawai, Gota; Sakamoto, Taiichi; Kozu, Tomoko

    2013-07-01

    AML1 (RUNX1) is a key transcription factor for hematopoiesis that binds to the Runt-binding double-stranded DNA element (RDE) of target genes through its N-terminal Runt domain. Aberrations in the AML1 gene are frequently found in human leukemia. To better understand AML1 and its potential utility for diagnosis and therapy, we obtained RNA aptamers that bind specifically to the AML1 Runt domain. Enzymatic probing and NMR analyses revealed that Apt1-S, which is a truncated variant of one of the aptamers, has a CACG tetraloop and two stem regions separated by an internal loop. All the isolated aptamers were found to contain the conserved sequence motif 5'-NNCCAC-3' and 5'-GCGMGN'N'-3' (M:A or C; N and N' form Watson-Crick base pairs). The motif contains one AC mismatch and one base bulged out. Mutational analysis of Apt1-S showed that three guanines of the motif are important for Runt binding as are the three guanines of RDE, which are directly recognized by three arginine residues of the Runt domain. Mutational analyses of the Runt domain revealed that the amino acid residues used for Apt1-S binding were similar to those used for RDE binding. Furthermore, the aptamer competed with RDE for binding to the Runt domain in vitro. These results demonstrated that the Runt domain of the AML1 protein binds to the motif of the aptamer that mimics DNA. Our findings should provide new insights into RNA function and utility in both basic and applied sciences.

  4. The Runt domain of AML1 (RUNX1) binds a sequence-conserved RNA motif that mimics a DNA element

    PubMed Central

    Fukunaga, Junichi; Nomura, Yusuke; Tanaka, Yoichiro; Amano, Ryo; Tanaka, Taku; Nakamura, Yoshikazu; Kawai, Gota; Sakamoto, Taiichi; Kozu, Tomoko

    2013-01-01

    AML1 (RUNX1) is a key transcription factor for hematopoiesis that binds to the Runt-binding double-stranded DNA element (RDE) of target genes through its N-terminal Runt domain. Aberrations in the AML1 gene are frequently found in human leukemia. To better understand AML1 and its potential utility for diagnosis and therapy, we obtained RNA aptamers that bind specifically to the AML1 Runt domain. Enzymatic probing and NMR analyses revealed that Apt1-S, which is a truncated variant of one of the aptamers, has a CACG tetraloop and two stem regions separated by an internal loop. All the isolated aptamers were found to contain the conserved sequence motif 5′-NNCCAC-3′ and 5′-GCGMGN′N′-3′ (M:A or C; N and N′ form Watson–Crick base pairs). The motif contains one AC mismatch and one base bulged out. Mutational analysis of Apt1-S showed that three guanines of the motif are important for Runt binding as are the three guanines of RDE, which are directly recognized by three arginine residues of the Runt domain. Mutational analyses of the Runt domain revealed that the amino acid residues used for Apt1-S binding were similar to those used for RDE binding. Furthermore, the aptamer competed with RDE for binding to the Runt domain in vitro. These results demonstrated that the Runt domain of the AML1 protein binds to the motif of the aptamer that mimics DNA. Our findings should provide new insights into RNA function and utility in both basic and applied sciences. PMID:23709277

  5. Molecular dynamic simulations reveal the structural determinants of fatty acid binding to oxy-myoglobin

    USDA-ARS?s Scientific Manuscript database

    The mechanism(s) by which fatty acids are sequestered and transported in muscle have not been fully elucidated. A potential key player in this process is the protein myoglobin (Mb). Indeed, there is a catalogue of empirical evidence supporting direct interaction of globins with fatty acid metabolite...

  6. Allosteric receptor activation by the plant peptide hormone phytosulfokine.

    PubMed

    Wang, Jizong; Li, Hongju; Han, Zhifu; Zhang, Heqiao; Wang, Tong; Lin, Guangzhong; Chang, Junbiao; Yang, Weicai; Chai, Jijie

    2015-09-10

    Phytosulfokine (PSK) is a disulfated pentapeptide that has a ubiquitous role in plant growth and development. PSK is perceived by its receptor PSKR, a leucine-rich repeat receptor kinase (LRR-RK). The mechanisms underlying the recognition of PSK, the activation of PSKR and the identity of the components downstream of the initial binding remain elusive. Here we report the crystal structures of the extracellular LRR domain of PSKR in free, PSK- and co-receptor-bound forms. The structures reveal that PSK interacts mainly with a β-strand from the island domain of PSKR, forming an anti-β-sheet. The two sulfate moieties of PSK interact directly with PSKR, sensitizing PSKR recognition of PSK. Supported by biochemical, structural and genetic evidence, PSK binding enhances PSKR heterodimerization with the somatic embryogenesis receptor-like kinases (SERKs). However, PSK is not directly involved in PSKR-SERK interaction but stabilizes PSKR island domain for recruitment of a SERK. Our data reveal the structural basis for PSKR recognition of PSK and allosteric activation of PSKR by PSK, opening up new avenues for the design of PSKR-specific small molecules.

  7. Dynamic binding of visual features by neuronal/stimulus synchrony.

    PubMed

    Iwabuchi, A

    1998-05-01

    When people see a visual scene, certain parts of the visual scene are treated as belonging together and we regard them as a perceptual unit, which is called a "figure". People focus on figures, and the remaining parts of the scene are disregarded as "ground". In Gestalt psychology this process is called "figure-ground segregation". According to current perceptual psychology, a figure is formed by binding various visual features in a scene, and developments in neuroscience have revealed that there are many feature-encoding neurons, which respond to such features specifically. It is not known, however, how the brain binds different features of an object into a coherent visual object representation. Recently, the theory of binding by neuronal synchrony, which argues that feature binding is dynamically mediated by neuronal synchrony of feature-encoding neurons, has been proposed. This review article portrays the problem of figure-ground segregation and features binding, summarizes neurophysiological and psychophysical experiments and theory relevant to feature binding by neuronal/stimulus synchrony, and suggests possible directions for future research on this topic.

  8. Analysis of the NuRD subunits reveals a histone deacetylase core complex and a connection with DNA methylation

    PubMed Central

    Zhang, Yi; Ng, Huck-Hui; Erdjument-Bromage, Hediye; Tempst, Paul; Bird, Adrian; Reinberg, Danny

    1999-01-01

    ATP-dependent nucleosome remodeling and core histone acetylation and deacetylation represent mechanisms to alter nucleosome structure. NuRD is a multisubunit complex containing nucleosome remodeling and histone deacetylase activities. The histone deacetylases HDAC1 and HDAC2 and the histone binding proteins RbAp48 and RbAp46 form a core complex shared between NuRD and Sin3-histone deacetylase complexes. The histone deacetylase activity of the core complex is severely compromised. A novel polypeptide highly related to the metastasis-associated protein 1, MTA2, and the methyl-CpG-binding domain-containing protein, MBD3, were found to be subunits of the NuRD complex. MTA2 modulates the enzymatic activity of the histone deacetylase core complex. MBD3 mediates the association of MTA2 with the core histone deacetylase complex. MBD3 does not directly bind methylated DNA but is highly related to MBD2, a polypeptide that binds to methylated DNA and has been reported to possess demethylase activity. MBD2 interacts with the NuRD complex and directs the complex to methylated DNA. NuRD may provide a means of gene silencing by DNA methylation. PMID:10444591

  9. Long non-coding RNA CRYBG3 blocks cytokinesis by directly binding G-actin.

    PubMed

    Pei, Hailong; Hu, Wentao; Guo, Ziyang; Chen, Huaiyuan; Ma, Ji; Mao, Weidong; Li, Bingyan; Wang, Aiqing; Wan, Jianmei; Zhang, Jian; Nie, Jing; Zhou, Guangming; Hei, Tom K

    2018-06-22

    The dynamic interchange between monomeric globular actin (G-actin) and polymeric filamentous actin filaments (F-actin) is fundamental and essential to many cellular processes including cytokinesis and maintenance of genomic stability. Here we report that the long non-coding RNA LNC CRYBG3 directly binds G-actin to inhibit its polymerization and formation of contractile rings, resulting in M-Phase cell arrest. Knockdown of LNC CRYBG3 in tumor cells enhanced their malignant phenotypes. Nucleotide sequence 228-237 of the full-length LNC CRYBG3 and the ser14 domain of beta-actin are essential for their interaction, and mutation of either of these sites abrogated binding of LNC CRYBG3 to G-actin. Binding of LNC CRYBG3 to G-actin blocked nuclear localization of MAL, which consequently kept serum response factor (SRF) away from the promoter region of several immediate early genes, including JUNB and Arp3, which are necessary for cellular proliferation, tumor growth, adhesion, movement, and metastasis. These findings reveal a novel lncRNA-actin-MAL-SRF pathway and highlight LNC CRYBG3 as a means to block cytokinesis and treat cancer by targeting the actin cytoskeleton. Copyright ©2018, American Association for Cancer Research.

  10. Promoter selection in human mitochondria involves binding of a transcription factor to orientation-independent upstream regulatory elements.

    PubMed

    Fisher, R P; Topper, J N; Clayton, D A

    1987-07-17

    Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.

  11. CsrA Represses Translation of sdiA, Which Encodes the N-Acylhomoserine-l-Lactone Receptor of Escherichia coli, by Binding Exclusively within the Coding Region of sdiA mRNA ▿ †

    PubMed Central

    Yakhnin, Helen; Baker, Carol S.; Berezin, Igor; Evangelista, Michael A.; Rassin, Alisa; Romeo, Tony; Babitzke, Paul

    2011-01-01

    The RNA binding protein CsrA is the central component of a conserved global regulatory system that activates or represses gene expression posttranscriptionally. In every known example of CsrA-mediated translational control, CsrA binds to the 5′ untranslated region of target transcripts, thereby repressing translation initiation and/or altering the stability of the RNA. Furthermore, with few exceptions, repression by CsrA involves binding directly to the Shine-Dalgarno sequence and blocking ribosome binding. sdiA encodes the quorum-sensing receptor for N-acyl-l-homoserine lactone in Escherichia coli. Because sdiA indirectly stimulates transcription of csrB, which encodes a small RNA (sRNA) antagonist of CsrA, we further explored the relationship between sdiA and the Csr system. Primer extension analysis revealed four putative transcription start sites within 85 nucleotides of the sdiA initiation codon. Potential σ70-dependent promoters were identified for each of these primer extension products. In addition, two CsrA binding sites were predicted in the initially translated region of sdiA. Expression of chromosomally integrated sdiA′-′lacZ translational fusions containing the entire promoter and CsrA binding site regions indicates that CsrA represses sdiA expression. The results from gel shift and footprint studies demonstrate that tight binding of CsrA requires both of these sites. Furthermore, the results from toeprint and in vitro translation experiments indicate that CsrA represses translation of sdiA by directly competing with 30S ribosomal subunit binding. Thus, this represents the first example of CsrA preventing translation by interacting solely within the coding region of an mRNA target. PMID:21908661

  12. Noncompetitive blocking of human GLUT1 hexose transporter by methylxanthines reveals an exofacial regulatory binding site.

    PubMed

    Ojeda, Paola; Pérez, Alejandra; Ojeda, Lorena; Vargas-Uribe, Mauricio; Rivas, Coralia I; Salas, Monica; Vera, Juan Carlos; Reyes, Alejandro M

    2012-09-01

    Glucose transporter (GLUT)1 has become an attractive target to block glucose uptake in malignant cells since most cancer cells overexpress GLUT1 and are sensitive to glucose deprivation. Methylxanthines are natural compounds that inhibit glucose uptake; however, the mechanism of inhibition remains unknown. Here, we used a combination of binding and glucose transport kinetic assays to analyze in detail the effects of caffeine, pentoxifylline, and theophylline on hexose transport in human erythrocytes. The displacement of previously bound cytochalasin B revealed a direct interaction between the methylxanthines and GLUT1. Methylxanthines behave as noncompetitive blockers (inhibition constant values of 2-3 mM) in exchange and zero-trans efflux assays, whereas mixed inhibition with a notable uncompetitive component is observed in zero-trans influx assays (inhibition constant values of 5-12 mM). These results indicate that methylxanthines do not bind to either exofacial or endofacial d-glucose-binding sites but instead interact at a different site accessible by the external face of the transporter. Additionally, infinite-cis exit assays (Sen-Widdas assays) showed that only pentoxifylline disturbed d-glucose for binding to the exofacial substrate site. Interestingly, coinhibition assays showed that methylxanthines bind to a common site on the transporter. We concluded that there is a methylxanthine regulatory site on the external surface of the transporter, which is close but distinguishable from the d-glucose external site. Therefore, the methylxanthine moiety may become an attractive framework for the design of novel specific noncompetitive facilitative GLUT inhibitors.

  13. Exploration of the conformational landscape in pregnane X receptor reveals a new binding pocket

    PubMed Central

    Chandran, Aneesh

    2016-01-01

    Abstract Ligand‐regulated pregnane X receptor (PXR), a member of the nuclear receptor superfamily, plays a central role in xenobiotic metabolism. Despite its critical role in drug metabolism, PXR activation can lead to adverse drug‐drug interactions and early stage metabolism of drugs. Activated PXR can induce cancer drug resistance and enhance the onset of malignancy. Since promiscuity in ligand binding makes it difficult to develop competitive inhibitors targeting PXR ligand binding pocket (LBP), it is essential to identify allosteric sites for effective PXR antagonism. Here, molecular dynamics (MD) simulation studies unravelled the existence of two different conformational states, namely “expanded” and “contracted”, in apo PXR ligand binding domain (LBD). Ligand binding events shifted this conformational equilibrium and locked the LBD in a single “ligand‐adaptable” conformational state. Ensemble‐based computational solvent mapping identified a transiently open potential small molecule binding pocket between α5 and α8 helices, named “α8 pocket”, whose opening‐closing mechanism directly correlated with the conformational shift in LBD. A virtual hit identified through structure‐based virtual screening against α8 pocket locks the pocket in its open conformation. MD simulations further revealed that the presence of small molecule at allosteric site disrupts the LBD dynamics and locks the LBD in a “tightly‐contracted” conformation. The molecular details provided here could guide new structural studies to understand PXR activation and antagonism. PMID:27515410

  14. Tagging methyl-CpG-binding domain proteins reveals different spatiotemporal expression and supports distinct functions.

    PubMed

    Wood, Kathleen H; Johnson, Brian S; Welsh, Sarah A; Lee, Jun Y; Cui, Yue; Krizman, Elizabeth; Brodkin, Edward S; Blendy, Julie A; Robinson, Michael B; Bartolomei, Marisa S; Zhou, Zhaolan

    2016-04-01

    DNA methylation is recognized by methyl-CpG-binding domain (MBD) proteins. Multiple MBDs are linked to neurodevelopmental disorders in humans and mice. However, the functions of MBD2 are poorly understood. We characterized Mbd2 knockout mice and determined spatiotemporal expression of MBDs and MBD2-NuRD (nucleosome remodeling deacetylase) interactions. We analyzed behavioral phenotypes, generated biotin-tagged MBD1 and MBD2 knockin mice, and performed biochemical studies of MBD2-NuRD. Most behavioral measures are minimally affected in Mbd2 knockout mice. In contrast to other MBDs, MBD2 shows distinct expression patterns. Unlike most MBDs, MBD2 is ubiquitously expressed in all tissues examined and appears dispensable for brain functions measured in this study. We provide novel genetic tools and reveal new directions to investigate MBD2 functions in vivo.

  15. Structure-function analysis of the auxilin J-domain reveals an extended Hsc70 interaction interface.

    PubMed

    Jiang, Jianwen; Taylor, Alexander B; Prasad, Kondury; Ishikawa-Brush, Yumiko; Hart, P John; Lafer, Eileen M; Sousa, Rui

    2003-05-20

    J-domains are widespread protein interaction modules involved in recruiting and stimulating the activity of Hsp70 family chaperones. We have determined the crystal structure of the J-domain of auxilin, a protein which is involved in uncoating clathrin-coated vesicles. Comparison to the known structures of J-domains from four other proteins reveals that the auxilin J-domain is the most divergent of all J-domain structures described to date. In addition to the canonical J-domain features described previously, the auxilin J-domain contains an extra N-terminal helix and a long loop inserted between helices I and II. The latter loop extends the positively charged surface which forms the Hsc70 binding site, and is shown by directed mutagenesis and surface plasmon resonance to contain side chains important for binding to Hsc70.

  16. Rotenone Activates Phagocyte NADPH Oxidase through Binding to Its Membrane Subunit gp91phox

    PubMed Central

    Zhou, Hui; Zhang, Feng; Chen, Shih-heng; Zhang, Dan; Wilson, Belinda; Hong, Jau-shyong; Gao, Hui-Ming

    2011-01-01

    Rotenone, a widely used pesticide, reproduces Parkinsonism in rodents and associates with increased risk for Parkinson’s disease. We previously reported rotenone increased superoxide production through stimulating microglial phagocyte NADPH oxidase (PHOX). The present study identified a novel mechanism by which rotenone activates PHOX. Ligand-binding assay revealed that rotenone directly bound to membrane gp91phox, the catalytic subunit of PHOX; such binding was inhibited by diphenyleneiodonium, a PHOX inhibitor with a binding site on gp91phox. Functional studies showed both membrane and cytosolic subunits were required for rotenone-induced superoxide production in cell-free systems, intact phagocytes, and COS7 cells transfected with membrane subunits (gp91phox/p22phox) and cytosolic subunits (p67phox and p47phox). Rotenone-elicited extracellular superoxide release in p47phox-deficient macrophages suggested rotenone enabled to activate PHOX through a p47phox-independent mechanism. Increased membrane translocation of p67phox, elevated binding of p67phox to rotenone-treated membrane fractions, and co-immunoprecipitation of p67phox and gp91phox in rotenone-treated wild-type and p47phox-deficient macrophages indicated p67phox played a critical role in rotenone-induced PHOX activation via its direct interaction with gp91phox. Rac1, a Rho-like small GTPase, enhanced p67phox-gp91phox interaction; Rac1 inhibition decreased rotenone-elicited superoxide release. In conclusion, rotenone directly interacted with gp91phox; such an interaction triggered membrane translocation of p67phox, leading to PHOX activation and superoxide production. PMID:22094225

  17. Regulation of Egr1 Target Genes by the NuRD Chromatin Remodeling Complex

    DTIC Science & Technology

    2006-12-01

    the M12 metastatic subline of P69SV40T prostate epithelial cells (Bae et al. 1998), Western analysis using an antibody directed against CHD4 revealed...Chromatin was then sonicated and immunoprecipitated with antibodies directed against EGR1, MTA2 or IgG control. The specificity of the assay is tested...subtle. Control ChIP assays employing an EGR1 antibody show correlated increased binding of EGR1 upon EGR1 overexpression, but this level of EGR1

  18. Phenazine virulence factor binding to extracellular DNA is important for Pseudomonas aeruginosa biofilm formation.

    PubMed

    Das, Theerthankar; Kutty, Samuel K; Tavallaie, Roya; Ibugo, Amaye I; Panchompoo, Janjira; Sehar, Shama; Aldous, Leigh; Yeung, Amanda W S; Thomas, Shane R; Kumar, Naresh; Gooding, J Justin; Manefield, Mike

    2015-02-11

    Bacterial resistance to conventional antibiotics necessitates the identification of novel leads for infection control. Interference with extracellular phenomena, such as quorum sensing, extracellular DNA integrity and redox active metabolite release, represents a new frontier to control human pathogens such as Pseudomonas aeruginosa and hence reduce mortality. Here we reveal that the extracellular redox active virulence factor pyocyanin produced by P. aeruginosa binds directly to the deoxyribose-phosphate backbone of DNA and intercalates with DNA nitrogenous base pair regions. Binding results in local perturbations of the DNA double helix structure and enhanced electron transfer along the nucleic acid polymer. Pyocyanin binding to DNA also increases DNA solution viscosity. In contrast, antioxidants interacting with DNA and pyocyanin decrease DNA solution viscosity. Biofilms deficient in pyocyanin production and biofilms lacking extracellular DNA show similar architecture indicating the interaction is important in P. aeruginosa biofilm formation.

  19. Phenazine virulence factor binding to extracellular DNA is important for Pseudomonas aeruginosa biofilm formation

    PubMed Central

    Das, Theerthankar; Kutty, Samuel K.; Tavallaie, Roya; Ibugo, Amaye I.; Panchompoo, Janjira; Sehar, Shama; Aldous, Leigh; Yeung, Amanda W. S.; Thomas, Shane R.; Kumar, Naresh; Gooding, J. Justin; Manefield, Mike

    2015-01-01

    Bacterial resistance to conventional antibiotics necessitates the identification of novel leads for infection control. Interference with extracellular phenomena, such as quorum sensing, extracellular DNA integrity and redox active metabolite release, represents a new frontier to control human pathogens such as Pseudomonas aeruginosa and hence reduce mortality. Here we reveal that the extracellular redox active virulence factor pyocyanin produced by P. aeruginosa binds directly to the deoxyribose-phosphate backbone of DNA and intercalates with DNA nitrogenous base pair regions. Binding results in local perturbations of the DNA double helix structure and enhanced electron transfer along the nucleic acid polymer. Pyocyanin binding to DNA also increases DNA solution viscosity. In contrast, antioxidants interacting with DNA and pyocyanin decrease DNA solution viscosity. Biofilms deficient in pyocyanin production and biofilms lacking extracellular DNA show similar architecture indicating the interaction is important in P. aeruginosa biofilm formation. PMID:25669133

  20. Footprinting reveals that nogalamycin and actinomycin shuffle between DNA binding sites.

    PubMed Central

    Fox, K R; Waring, M J

    1986-01-01

    The hypothesis that sequence-selective DNA-binding antibiotics locate their preferred binding sites by a process involving migration from nonspecific sites has been tested by footprinting with DNAase I. Footprinting patterns on the tyrT DNA fragment produced by nogalamycin and actinomycin change with time after mixing the antibiotic with the DNA. Sites of protection as well as enhanced cleavage are seen to develop in a fashion which is both temperature and concentration-dependent. At certain sites cutting is transiently enhanced, then blocked. Limited evidence for slow reaction with echinomycin and mithramycin is presented, but the kinetics of footprinting with daunomycin and distamycin appear instantaneous. The feasibility of adducing direct evidence for shuffling by footprinting seems to be governed by slow dissociation of the antibiotic-DNA complex. It may also be dependent upon the mode of binding, be it intercalative or non-intercalative in character. Images PMID:2421246

  1. Mannobiose Binding Induces Changes in Hydrogen Bonding and Protonation States of Acidic Residues in Concanavalin A As Revealed by Neutron Crystallography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gerlits, Oksana O.; Coates, Leighton; Woods, Robert J.

    Plant lectins are carbohydrate-binding proteins with various biomedical applications. Concanavalin A (Con A) holds promise in treating cancerous tumors. To better understand the Con A carbohydrate binding specificity, we obtained a room-temperature neutron structure of this legume lectin in complex with a disaccharide Manα1–2Man, mannobiose. The neutron structure afforded direct visualization of the hydrogen bonding between the protein and ligand, showing that the ligand is able to alter both protonation states and interactions for residues located close to and distant from the binding site. An unprecedented low-barrier hydrogen bond was observed forming between the carboxylic side chains of Asp28 andmore » Glu8, with the D atom positioned equidistant from the oxygen atoms having an O···D···O angle of 101.5°.« less

  2. Amides Do Not Always Work: Observation of Guest Binding in an Amide-Functionalized Porous Metal–Organic Framework

    PubMed Central

    2016-01-01

    An amide-functionalized metal organic framework (MOF) material, MFM-136, shows a high CO2 uptake of 12.6 mmol g–1 at 20 bar and 298 K. MFM-136 is the first example of an acylamide pyrimidyl isophthalate MOF without open metal sites and, thus, provides a unique platform to study guest binding, particularly the role of free amides. Neutron diffraction reveals that, surprisingly, there is no direct binding between the adsorbed CO2/CH4 molecules and the pendant amide group in the pore. This observation has been confirmed unambiguously by inelastic neutron spectroscopy. This suggests that introduction of functional groups solely may not necessarily induce specific guest–host binding in porous materials, but it is a combination of pore size, geometry, and functional group that leads to enhanced gas adsorption properties. PMID:27665845

  3. DNA Mismatch Binding and Antiproliferative Activity of Rhodium Metalloinsertors

    PubMed Central

    Ernst, Russell J.; Song, Hang; Barton, Jacqueline K.

    2009-01-01

    Deficiencies in mismatch repair (MMR) are associated with carcinogenesis. Rhodium metalloinsertors bind to DNA base mismatches with high specificity and inhibit cellular proliferation preferentially in MMR-deficient cells versus MMR-proficient cells. A family of chrysenequinone diimine complexes of rhodium with varying ancillary ligands that serve as DNA metalloinsertors has been synthesized, and both DNA mismatch binding affinities and antiproliferative activities against the human colorectal carcinoma cell lines HCT116N and HCT116O, an isogenic model system for MMR deficiency, have been determined. DNA photocleavage experiments reveal that all complexes bind to the mismatch sites with high specificities; DNA binding affinities to oligonucleotides containing single base CA and CC mismatches, obtained through photocleavage titration or competition, vary from 104 to 108 M−1 for the series of complexes. Significantly, binding affinities are found to be inversely related to ancillary ligand size and directly related to differential inhibition of the HCT116 cell lines. The observed trend in binding affinity is consistent with the metalloinsertion mode where the complex binds from the minor groove with ejection of mismatched base pairs. The correlation between binding affinity and targeting of the MMR-deficient cell line suggests that rhodium metalloinsertors exert their selective biological effects on MMR-deficient cells through mismatch binding in vivo. PMID:19175313

  4. An RNA-Binding Multimer Specifies Nematode Sperm Fate.

    PubMed

    Aoki, Scott T; Porter, Douglas F; Prasad, Aman; Wickens, Marvin; Bingman, Craig A; Kimble, Judith

    2018-06-26

    FOG-3 is a master regulator of sperm fate in Caenorhabditis elegans and homologous to Tob/BTG proteins, which in mammals are monomeric adaptors that recruit enzymes to RNA binding proteins. Here, we determine the FOG-3 crystal structure and in vitro demonstrate that FOG-3 forms dimers that can multimerize. The FOG-3 multimeric structure has a basic surface potential, suggestive of binding nucleic acid. Consistent with that prediction, FOG-3 binds directly to nearly 1,000 RNAs in nematode spermatogenic germ cells. Most binding is to the 3' UTR, and most targets (94%) are oogenic mRNAs, even though assayed in spermatogenic cells. When tethered to a reporter mRNA, FOG-3 represses its expression. Together these findings elucidate the molecular mechanism of sperm fate specification and reveal the evolution of a protein from monomeric to multimeric form with acquisition of a distinct mode of mRNA repression. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  5. Extended HSR/CARD domain mediates AIRE binding to DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maslovskaja, Julia, E-mail: julia.maslovskaja@ut.ee; Saare, Mario; Liiv, Ingrid

    Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved inmore » AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.« less

  6. Phosphorylation of an intrinsically disordered segment in Ets1 shifts conformational sampling toward binding-competent substates.

    PubMed

    Bui, Jennifer M; Gsponer, Jörg

    2014-08-05

    Functions of many proteins are affected by posttranslational modifications of intrinsically disordered (ID) regions, yet little is known about the underlying molecular mechanisms. By combining molecular dynamics simulations and protein docking, we demonstrate that the addition of phosphates to an ID segment adjacent to the PNT domain of Ets1 directs conformational sampling toward substates that are most compatible with high-affinity binding of the TAZ1 domain of its coactivator CBP. The phosphate charges disrupt salt bridges and thereby open a hydrophobic cleft and expose hydrophobic residues at the ID N terminus. The structure of the PNT-TAZ1 complex that we determined shows that PNT binds to TAZ1 via these hydrophobic regions in a similar manner to how it interacts with other partners. Our calculations reveal a dual effect of phosphorylation in that it changes the dynamics of PNT so that it becomes more compatible for TAZ1 binding and increases complementarity with this binding partner. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. CLASPs are required for proper microtubule localization of End-binding proteins

    PubMed Central

    Grimaldi, Ashley D.; Maki, Takahisa; Fitton, Benjamin P.; Roth, Daniel; Yampolsky, Dmitry; Davidson, Michael W.; Svitkina, Tatyana; Straube, Anne; Hayashi, Ikuko; Kaverina, Irina

    2014-01-01

    Summary Microtubule (MT) plus-end tracking proteins (+TIPs) preferentially localize to MT plus-ends. End-binding proteins (EBs) are master regulators of the +TIP complex; however, it is unknown whether EBs are regulated by other +TIPs. Here, we show that Cytoplasmic linker associated proteins (CLASPs) modulate EB localization at MTs. In CLASP-depleted cells, EBs localized along the MT lattice in addition to plus-ends. The MT-binding region of CLASP was sufficient for restoring normal EB localization, while neither EB-CLASP interactions nor EB tail-binding proteins are involved. In vitro assays revealed that CLASP directly functions to remove EB from MTs. Importantly, this effect occurs specifically during MT polymerization, but not at pre-formed MTs. Increased GTP-tubulin content within MTs in CLASP-depleted cells suggests that CLASPs facilitate GTP-hydrolysis to reduce EB lattice binding. Together, these findings suggest that CLASPs influence the MT lattice itself to regulate EB and determine exclusive plus-end localization of EBs in cells. PMID:25117684

  8. Phosphatidylglycerol directs binding and inhibitory action of EIIAGlc protein on the maltose transporter.

    PubMed

    Bao, Huan; Duong, Franck

    2013-08-16

    The signal-transducing protein EIIA(Glc) belongs to the phosphoenolpyruvate carbohydrate phosphotransferase system. In its dephosphorylated state, EIIA(Glc) is a negative regulator for several permeases, including the maltose transporter MalFGK2. How EIIA(Glc) is targeted to the membrane, how it interacts with the transporter, and how it inhibits sugar uptake remain obscure. We show here that acidic phospholipids together with the N-terminal tail of EIIA(Glc) are essential for the high affinity binding of the protein to the transporter. Using protein docking prediction and chemical cross-linking, we demonstrate that EIIA(Glc) binds to the MalK dimer, interacting with both the nucleotide-binding and the C-terminal regulatory domains. Dissection of the ATPase cycle reveals that EIIA(Glc) does not affect the binding of ATP but rather inhibits the capacity of MalK to cleave ATP. We propose a mechanism of maltose transport inhibition by this central amphitropic regulatory protein.

  9. Plasminogen associates with phosphatidylserine-exposing platelets and contributes to thrombus lysis under flow

    PubMed Central

    Whyte, Claire S.; Swieringa, Frauke; Mastenbroek, Tom G.; Lionikiene, Ausra S.; Lancé, Marcus D.; van der Meijden, Paola E. J.; Heemskerk, Johan W. M.

    2015-01-01

    The interaction of plasminogen with platelets and their localization during thrombus formation and fibrinolysis under flow are not defined. Using a novel model of whole blood thrombi, formed under flow, we examine dose-dependent fibrinolysis using fluorescence microscopy. Fibrinolysis was dependent upon flow and the balance between fibrin formation and plasminogen activation, with tissue plasminogen activator-mediated lysis being more efficient than urokinase plasminogen activator-mediated lysis. Fluorescently labeled plasminogen radiates from platelet aggregates at the base of thrombi, primarily in association with fibrin. Hirudin attenuates, but does not abolish plasminogen binding, denoting the importance of fibrin. Flow cytometry revealed that stimulation of platelets with thrombin/convulxin significantly increased the plasminogen signal associated with phosphatidylserine (PS)-exposing platelets. Binding was attenuated by tirofiban and Gly-Pro-Arg-Pro amide, confirming a role for fibrin in amplifying plasminogen binding to PS-exposing platelets. Confocal microscopy revealed direct binding of plasminogen and fibrinogen to different platelet subpopulations. Binding of plasminogen and fibrinogen co-localized with PAC-1 in the center of spread platelets. In contrast, PS-exposing platelets were PAC-1 negative, and bound plasminogen and fibrinogen in a protruding “cap.” These data show that different subpopulations of platelets harbor plasminogen by diverse mechanisms and provide an essential scaffold for the accumulation of fibrinolytic proteins that mediate fibrinolysis under flow. PMID:25712989

  10. DNA binding mechanism revealed by high resolution crystal structure of Arabidopsis thaliana WRKY1 protein

    PubMed Central

    Duan, Ming-Rui; Nan, Jie; Liang, Yu-He; Mao, Peng; Lu, Lu; Li, Lanfen; Wei, Chunhong; Lai, Luhua; Li, Yi; Su, Xiao-Dong

    2007-01-01

    WRKY proteins, defined by the conserved WRKYGQK sequence, are comprised of a large superfamily of transcription factors identified specifically from the plant kingdom. This superfamily plays important roles in plant disease resistance, abiotic stress, senescence as well as in some developmental processes. In this study, the Arabidopsis WRKY1 was shown to be involved in the salicylic acid signaling pathway and partially dependent on NPR1; a C-terminal domain of WRKY1, AtWRKY1-C, was constructed for structural studies. Previous investigations showed that DNA binding of the WRKY proteins was localized at the WRKY domains and these domains may define novel zinc-binding motifs. The crystal structure of the AtWRKY1-C determined at 1.6 Å resolution has revealed that this domain is composed of a globular structure with five β strands, forming an antiparallel β-sheet. A novel zinc-binding site is situated at one end of the β-sheet, between strands β4 and β5. Based on this high-resolution crystal structure and site-directed mutagenesis, we have defined and confirmed that the DNA-binding residues of AtWRKY1-C are located at β2 and β3 strands. These results provided us with structural information to understand the mechanism of transcriptional control and signal transduction events of the WRKY proteins. PMID:17264121

  11. The CcpA regulon of Streptococcus suis reveals novel insights into the regulation of the streptococcal central carbon metabolism by binding of CcpA to two distinct binding motifs.

    PubMed

    Willenborg, Jörg; de Greeff, Astrid; Jarek, Michael; Valentin-Weigand, Peter; Goethe, Ralph

    2014-04-01

    Streptococcus suis (S. suis) is a neglected zoonotic streptococcus causing fatal diseases in humans and in pigs. The transcriptional regulator CcpA (catabolite control protein A) is involved in the metabolic adaptation to different carbohydrate sources and virulence of S. suis and other pathogenic streptococci. In this study, we determined the DNA binding characteristics of CcpA and identified the CcpA regulon during growth of S. suis. Electrophoretic mobility shift analyses showed promiscuous DNA binding of CcpA to cognate cre sites in vitro. In contrast, sequencing of immunoprecipitated chromatin revealed two specific consensus motifs, a pseudo-palindromic cre motif (WWGAAARCGYTTTCWW) and a novel cre2 motif (TTTTYHWDHHWWTTTY), within the regulatory elements of the genes directly controlled by CcpA. Via these elements CcpA regulates expression of genes involved in carbohydrate uptake and conversion, and in addition in important metabolic pathways of the central carbon metabolism, like glycolysis, mixed-acid fermentation, and the fragmentary TCA cycle. Furthermore, our analyses provide evidence that CcpA regulates the genes of the central carbon metabolism by binding either the pseudo-palindromic cre motif or the cre2 motif in a HPr(Ser)∼P independent conformation. © 2014 John Wiley & Sons Ltd.

  12. Combinatorial multispectral, thermodynamics, docking and site-directed mutagenesis reveal the cognitive characteristics of honey bee chemosensory protein to plant semiochemical.

    PubMed

    Tan, Jing; Song, Xinmi; Fu, Xiaobin; Wu, Fan; Hu, Fuliang; Li, Hongliang

    2018-08-05

    In the chemoreceptive system of insects, there are always some soluble binding proteins, such as some antennal-specific chemosensory proteins (CSPs), which are abundantly distributed in the chemosensory sensillar lymph. The antennal-specific CSPs usually have strong capability to bind diverse semiochemicals, while the detailed interaction between CSPs and the semiochemicals remain unclear. Here, by means of the combinatorial multispectral, thermodynamics, docking and site-directed mutagenesis, we detailedly interpreted a binding interaction between a plant semiochemical β-ionone and antennal-specific CSP1 from the worker honey bee. Thermodynamic parameters (ΔH < 0, ΔS > 0) indicate that the interaction is mainly driven by hydrophobic forces and electrostatic interactions. Docking prediction results showed that there are two key amino acids, Phe44 and Gln63, may be involved in the interacting process of CSP1 to β-ionone. In order to confirm the two key amino acids, site-directed mutagenesis were performed and the binding constant (K A ) for two CSP1 mutant proteins was reduced by 60.82% and 46.80% compared to wild-type CSP1. The thermodynamic analysis of mutant proteins furtherly verified that Phe44 maintained an electrostatic interaction and Gln63 contributes hydrophobic and electrostatic forces. Our investigation initially elucidates the physicochemical mechanism of the interaction between antennal-special CSPs in insects including bees to plant semiochemicals, as well as the development of twice thermodynamic analysis (wild type and mutant proteins) combined with multispectral and site-directed mutagenesis methods. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Elucidation of Hydrogen Bonding Patterns in Ligand-Free, Lactose- and Glycerol-Bound Galectin-3C by Neutron Crystallography to Guide Drug Design.

    PubMed

    Manzoni, Francesco; Wallerstein, Johan; Schrader, Tobias E; Ostermann, Andreas; Coates, Leighton; Akke, Mikael; Blakeley, Matthew P; Oksanen, Esko; Logan, Derek T

    2018-05-24

    The medically important drug target galectin-3 binds galactose-containing moieties on glycoproteins through an intricate pattern of hydrogen bonds to a largely polar surface-exposed binding site. All successful inhibitors of galectin-3 to date have been based on mono- or disaccharide cores closely resembling natural ligands. A detailed understanding of the H-bonding networks in these natural ligands will provide an improved foundation for the design of novel inhibitors. Neutron crystallography is an ideal technique to reveal the geometry of hydrogen bonds because the positions of hydrogen atoms are directly detected rather than being inferred from the positions of heavier atoms as in X-ray crystallography. We present three neutron crystal structures of the C-terminal carbohydrate recognition domain of galectin-3: the ligand-free form and the complexes with the natural substrate lactose and with glycerol, which mimics important interactions made by lactose. The neutron crystal structures reveal unambiguously the exquisite fine-tuning of the hydrogen bonding pattern in the binding site to the natural disaccharide ligand. The ligand-free structure shows that most of these hydrogen bonds are preserved even when the polar groups of the ligand are replaced by water molecules. The protonation states of all histidine residues in the protein are also revealed and correlate well with NMR observations. The structures give a solid starting point for molecular dynamics simulations and computational estimates of ligand binding affinity that will inform future drug design.

  14. Studies of the TLR4-associated protein MD-2 using yeast-display and mutational analyses

    PubMed Central

    Mattis, Daiva M.; Chervin, Adam; Ranoa, Diana; Kelley, Stacy; Tapping, Richard; Kranz, David M.

    2015-01-01

    Bacterial lipopolysaccharide (LPS) activates the innate immune system by forming a complex with myeloid differentiation factor 2 (MD-2) and Toll-like receptor 4 (TLR4), which is present on antigen presenting cells. MD-2 plays an essential role in this activation of the innate immune system as a member of the ternary complex, TLR4:MD-2:LPS. With the goal of further understanding the molecular details of the interaction of MD-2 with LPS and TLR4, and possibly toward engineering dominant negative regulators of the MD-2 protein, here we subjected MD-2 to a mutational analysis using yeast display. The approach included generation of site-directed alanine mutants, and ligand-driven selections of MD-2 mutant libraries. Our findings showed that: 1) proline mutations in the F119-K132 loop that binds LPS were strongly selected for enhanced yeast surface stability, 2) there was a preference for positive-charged side chains (R/K) at residue 120 for LPS binding, and negative-charged side chains (D/E) for TLR4 binding, 3) aromatic residues were strongly preferred at F119 and F121 for LPS binding, and 4) an MD-2 mutant (T84N/D101A/S118A/S120D/K122P) exhibited increased binding to TLR4 but decreased binding to LPS. These studies revealed the impact of specific residues and regions of MD-2 on the binding of LPS and TLR4, and they provide a framework for further directed evolution of the MD-2 protein. PMID:26320630

  15. Two-sided block of a dual-topology F- channel.

    PubMed

    Turman, Daniel L; Nathanson, Jacob T; Stockbridge, Randy B; Street, Timothy O; Miller, Christopher

    2015-05-05

    The Fluc family is a set of small membrane proteins forming F(-)-specific electrodiffusive ion channels that rescue microorganisms from F(-) toxicity during exposure to weakly acidic environments. The functional channel is built as a dual-topology homodimer with twofold symmetry parallel to the membrane plane. Fluc channels are blocked by nanomolar-affinity fibronectin-domain monobodies originally selected from phage-display libraries. The unusual symmetrical antiparallel dimeric architecture of Flucs demands that the two chemically equivalent monobody-binding epitopes reside on opposite ends of the channel, a double-sided blocking situation that has never before presented itself in ion channel biophysics. However, it is not known if both sites can be simultaneously occupied, and if so, whether monobodies bind independently or cooperatively to their transmembrane epitopes. Here, we use direct monobody-binding assays and single-channel recordings of a Fluc channel homolog to reveal a novel trimolecular blocking behavior that reveals a doubly occupied blocked state. Kinetic analysis of single-channel recordings made with monobody on both sides of the membrane shows substantial negative cooperativity between the two blocking sites.

  16. mTOR kinase structure, mechanism and regulation by the rapamycin-binding domain

    PubMed Central

    Yang, Haijuan; Rudge, Derek G.; Koos, Joseph D.; Vaidialingam, Bhamini; Yang, Hyo J.; Pavletich, Nikola P.

    2015-01-01

    The mammalian target of rapamycin (mTOR), a phosphoinositide 3-kinase related protein kinase, controls cell growth in response to nutrients and growth factors and is frequently deregulated in cancer. Here we report co-crystal structures of a truncated mTOR-mLST8 complex with an ATP transition state mimic and with ATP-site inhibitors. The structures reveal an intrinsically active kinase conformation, with catalytic residues and mechanism remarkably similar to canonical protein kinases. The active site is highly recessed due to the FKBP12-Rapamycin binding (FRB) domain and an inhibitory helix protruding from the catalytic cleft. mTOR activating mutations map to the structural framework that holds these elements in place, indicating the kinase is controlled by restricted access. In vitro biochemistry indicates that the FRB domain acts as a gatekeeper, with its rapamycin-binding site interacting with substrates to grant them access to the restricted active site. FKBP12-rapamycin inhibits by directly blocking substrate recruitment and by further restricting active site access. The structures also reveal active site residues and conformational changes that underlie inhibitor potency and specificity. PMID:23636326

  17. Neutron diffraction of acetazolamide-bound human carbonic anhydrase II reveals atomic details of drug binding

    PubMed Central

    Fisher, S. Zoë; Aggarwal, Mayank; Kovalevsky, Andrey Y.; Silverman, David N.; McKenna, Robert

    2012-01-01

    Carbonic anhydrases (CAs) catalyze the hydration of CO2 forming HCO3− and a proton, an important reaction for many physiological processes including respiration, fluid secretion, and pH regulation. As such, CA isoforms are prominent clinical targets for treating various diseases. The clinically used acetazolamide (AZM) is a sulfonamide that binds with high affinity to human CA isoform II (HCA II). There are several X-ray structures available of AZM bound to various CA isoforms, but these complexes do not show the charged state of AZM, or hydrogen (H) atom positions of the protein and solvent. Neutron diffraction is a useful technique for directly observing H atoms and the mapping of H-bonding networks that can greatly contribute to rational drug design. To this end the neutron structure of H/D exchanged HCA II crystals in complex with AZM was determined. The structure reveals the molecular details of AZM binding and the charged state of the bound drug. This represents the first determined neutron structure of a clinically used drug bound to its target. PMID:22928733

  18. Phospho-selective mechanisms of arrestin conformations and functions revealed by unnatural amino acid incorporation and 19F-NMR

    PubMed Central

    Yang, Fan; Yu, Xiao; Liu, Chuan; Qu, Chang-Xiu; Gong, Zheng; Liu, Hong-Da; Li, Fa-Hui; Wang, Hong-Mei; He, Dong-Fang; Yi, Fan; Song, Chen; Tian, Chang-Lin; Xiao, Kun-Hong; Wang, Jiang-Yun; Sun, Jin-Peng

    2015-01-01

    Specific arrestin conformations are coupled to distinct downstream effectors, which underlie the functions of many G-protein-coupled receptors (GPCRs). Here, using unnatural amino acid incorporation and fluorine-19 nuclear magnetic resonance (19F-NMR) spectroscopy, we demonstrate that distinct receptor phospho-barcodes are translated to specific β-arrestin-1 conformations and direct selective signalling. With its phosphate-binding concave surface, β-arrestin-1 ‘reads' the message in the receptor phospho-C-tails and distinct phospho-interaction patterns are revealed by 19F-NMR. Whereas all functional phosphopeptides interact with a common phosphate binding site and induce the movements of finger and middle loops, different phospho-interaction patterns induce distinct structural states of β-arrestin-1 that are coupled to distinct arrestin functions. Only clathrin recognizes and stabilizes GRK2-specific β-arrestin-1 conformations. The identified receptor-phospho-selective mechanism for arrestin conformation and the spacing of the multiple phosphate-binding sites in the arrestin enable arrestin to recognize plethora phosphorylation states of numerous GPCRs, contributing to the functional diversity of receptors. PMID:26347956

  19. Structure and self-assembly of the calcium binding matrix protein of human metapneumovirus.

    PubMed

    Leyrat, Cedric; Renner, Max; Harlos, Karl; Huiskonen, Juha T; Grimes, Jonathan M

    2014-01-07

    The matrix protein (M) of paramyxoviruses plays a key role in determining virion morphology by directing viral assembly and budding. Here, we report the crystal structure of the human metapneumovirus M at 2.8 Å resolution in its native dimeric state. The structure reveals the presence of a high-affinity Ca²⁺ binding site. Molecular dynamics simulations (MDS) predict a secondary lower-affinity site that correlates well with data from fluorescence-based thermal shift assays. By combining small-angle X-ray scattering with MDS and ensemble analysis, we captured the structure and dynamics of M in solution. Our analysis reveals a large positively charged patch on the protein surface that is involved in membrane interaction. Structural analysis of DOPC-induced polymerization of M into helical filaments using electron microscopy leads to a model of M self-assembly. The conservation of the Ca²⁺ binding sites suggests a role for calcium in the replication and morphogenesis of pneumoviruses. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  20. ChIP-Chip Identifies SEC23A, CFDP1, and NSD1 as TFII-I Target Genes in Human Neural Crest Progenitor Cells.

    PubMed

    Makeyev, Aleksandr V; Bayarsaihan, Dashzeveg

    2013-05-01

    Objectives :  GTF2I and GTF2IRD1 genes located in Williams-Beuren syndrome (WBS) critical region encode TFII-I family transcription factors. The aim of this study was to map genomic sites bound by these proteins across promoter regions of developmental regulators associated with craniofacial development. Design :  Chromatin was isolated from human neural crest progenitor cells and the DNA-binding profile was generated using the human RefSeq tiling promoter ChIP-chip arrays. Results :  TFII-I transcription factors are recruited to the promoters of SEC23A, CFDP1, and NSD1 previously defined as TFII-I target genes. Moreover, our analysis revealed additional binding elements that contain E-boxes and initiator-like motifs. Conclusions :  Genome-wide promoter binding studies revealed SEC23A, CFDP1, and NSD1 linked to craniofacial or dental development as direct TFII-I targets. Developmental regulation of these genes by TFII-I factors could contribute to the WBS-specific facial dysmorphism.

  1. Identification of the Regulon of AphB and Its Essential Roles in LuxR and Exotoxin Asp Expression in the Pathogen Vibrio alginolyticus.

    PubMed

    Gao, Xiating; Liu, Yang; Liu, Huan; Yang, Zhen; Liu, Qin; Zhang, Yuanxing; Wang, Qiyao

    2017-10-15

    In Vibrio species, AphB is essential to activate virulence cascades by sensing low-pH and anaerobiosis signals; however, its regulon remains largely unknown. Here, AphB is found to be a key virulence regulator in Vibrio alginolyticus , a pathogen for marine animals and humans. Chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq) enabled the detection of 20 loci in the V. alginolyticus genome that contained AphB-binding peaks. An AphB-specific binding consensus was confirmed by electrophoretic mobility shift assays (EMSAs), and the regulation of genes flanking such binding sites was demonstrated using quantitative real-time PCR analysis. AphB binds directly to its own promoter and positively controls its own expression in later growth stages. AphB also activates the expression of the exotoxin Asp by binding directly to the promoter regions of asp and the master quorum-sensing (QS) regulator luxR DNase I footprinting analysis uncovered distinct AphB-binding sites (BBS) in these promoters. Furthermore, a BBS in the luxR promoter region overlaps that of LuxR-binding site I, which mediates the positive control of luxR promoter activity by AphB. This study provides new insights into the AphB regulon and reveals the mechanisms underlying AphB regulation of physiological adaptation and QS-controlled virulence in V. alginolyticus IMPORTANCE In this work, AphB is determined to play essential roles in the expression of genes associated with QS, physiology, and virulence in V. alginolyticus , a pathogen for marine animals and humans. AphB was found to bind directly to 20 genes and control their expression by a 17-bp consensus binding sequence. Among the 20 genes, the aphB gene itself was identified to be positively autoregulated, and AphB also positively controlled asp and luxR expression. Taken together, these findings improve our understanding of the roles of AphB in controlling physiological adaptation and QS-controlled virulence gene expression. Copyright © 2017 American Society for Microbiology.

  2. Unravelling the specificity and mechanism of sialic acid recognition by the gut symbiont Ruminococcus gnavus.

    PubMed

    Owen, C David; Tailford, Louise E; Monaco, Serena; Šuligoj, Tanja; Vaux, Laura; Lallement, Romane; Khedri, Zahra; Yu, Hai; Lecointe, Karine; Walshaw, John; Tribolo, Sandra; Horrex, Marc; Bell, Andrew; Chen, Xi; Taylor, Gary L; Varki, Ajit; Angulo, Jesus; Juge, Nathalie

    2017-12-19

    Ruminococcus gnavus is a human gut symbiont wherein the ability to degrade mucins is mediated by an intramolecular trans-sialidase (RgNanH). RgNanH comprises a GH33 catalytic domain and a sialic acid-binding carbohydrate-binding module (CBM40). Here we used glycan arrays, STD NMR, X-ray crystallography, mutagenesis and binding assays to determine the structure and function of RgNanH_CBM40 (RgCBM40). RgCBM40 displays the canonical CBM40 β-sandwich fold and broad specificity towards sialoglycans with millimolar binding affinity towards α2,3- or α2,6-sialyllactose. RgCBM40 binds to mucus produced by goblet cells and to purified mucins, providing direct evidence for a CBM40 as a novel bacterial mucus adhesin. Bioinformatics data show that RgCBM40 canonical type domains are widespread among Firmicutes. Furthermore, binding of R. gnavus ATCC 29149 to intestinal mucus is sialic acid mediated. Together, this study reveals novel features of CBMs which may contribute to the biogeography of symbiotic bacteria in the gut.

  3. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  4. Ubiquitin Interacts with the Tollip C2 and CUE Domains and Inhibits Binding of Tollip to Phosphoinositides*

    PubMed Central

    Mitra, Sharmistha; Traughber, C. Alicia; Brannon, Mary K.; Gomez, Stephanie; Capelluto, Daniel G. S.

    2013-01-01

    A large number of cellular signaling processes are directed through internalization, via endocytosis, of polyubiquitinated cargo proteins. Tollip is an adaptor protein that facilitates endosomal cargo sorting for lysosomal degradation. Tollip preferentially binds phosphatidylinositol 3-phosphate (PtdIns(3)P) via its C2 domain, an association that may be required for endosomal membrane targeting. Here, we show that Tollip binds ubiquitin through its C2 and CUE domains and that its association with the C2 domain inhibits PtdIns(3)P binding. NMR analysis demonstrates that the C2 and CUE domains bind to overlapping sites on ubiquitin, suggesting that two ubiquitin molecules associate with Tollip simultaneously. Hydrodynamic studies reveal that ubiquitin forms heterodimers with the CUE domain, indicating that the association disrupts the dimeric state of the CUE domain. We propose that, in the absence of polyubiquitinated cargo, the dual binding of ubiquitin partitions Tollip into membrane-bound and membrane-free states, a function that contributes to the engagement of Tollip in both membrane trafficking and cytosolic pathways. PMID:23880770

  5. Molecular and functional characterization of clathrin- and AP-2-binding determinants within a disordered domain of auxilin.

    PubMed

    Scheele, Urte; Alves, Jurgen; Frank, Ronald; Duwel, Michael; Kalthoff, Christoph; Ungewickell, Ernst

    2003-07-11

    Uncoating of clathrin-coated vesicles requires the J-domain protein auxilin for targeting hsc70 to the clathrin coats and for stimulating the hsc70 ATPase activity. This results in the release of hsc70-complexed clathrin triskelia and concomitant dissociation of the coat. To understand the complex role of auxilin in uncoating and clathrin assembly in more detail, we analyzed the molecular organization of its clathrin-binding domain (amino acids 547-813). CD spectroscopy of auxilin fragments revealed that the clathrin-binding domain is almost completely disordered in solution. By systematic mapping using synthetic peptides and by site-directed mutagenesis, we identified short peptide sequences involved in clathrin heavy chain and AP-2 binding and evaluated their significance for the function of auxilin. Some of the binding determinants, including those containing sequences 674DPF and 636WDW, showed dual specificity for both clathrin and AP-2. In contrast, the two DLL motifs within the clathrin-binding domain were exclusively involved in clathrin binding. Surprisingly, they interacted not only with the N-terminal domain of the heavy chain, but also with the distal domain. Moreover, both DLL peptides proved to be essential for clathrin assembly and uncoating. In addition, we found that the motif 726NWQ is required for efficient clathrin assembly activity. Auxilin shares a number of protein-protein interaction motifs with other endocytic proteins, including AP180. We demonstrate that AP180 and auxilin compete for binding to the alpha-ear domain of AP-2. Like AP180, auxilin also directly interacts with the ear domain of beta-adaptin. On the basis of our data, we propose a refined model for the uncoating mechanism of clathrin-coated vesicles.

  6. The yeast kinesin-5 Cin8 interacts with the microtubule in a noncanonical manner

    PubMed Central

    Bell, Kayla M.; Cha, Hyo Keun; Sindelar, Charles V.; Cochran, Jared C.

    2017-01-01

    Kinesin motors play central roles in establishing and maintaining the mitotic spindle during cell division. Unlike most other kinesins, Cin8, a kinesin-5 motor in Saccharomyces cerevisiae, can move bidirectionally along microtubules, switching directionality according to biochemical conditions, a behavior that remains largely unexplained. To this end, we used biochemical rate and equilibrium constant measurements as well as cryo-electron microscopy methodologies to investigate the microtubule interactions of the Cin8 motor domain. These experiments unexpectedly revealed that, whereas Cin8 ATPase kinetics fell within measured ranges for kinesins (especially kinesin-5 proteins), approximately four motors can bind each αβ-tubulin dimer within the microtubule lattice. This result contrasted with those observations on other known kinesins, which can bind only a single “canonical” site per tubulin dimer. Competition assays with human kinesin-5 (Eg5) only partially abrogated this behavior, indicating that Cin8 binds microtubules not only at the canonical site, but also one or more separate (“noncanonical”) sites. Moreover, we found that deleting the large, class-specific insert in the microtubule-binding loop 8 reverts Cin8 to one motor per αβ-tubulin in the microtubule. The novel microtubule-binding mode of Cin8 identified here provides a potential explanation for Cin8 clustering along microtubules and potentially may contribute to the mechanism for direction reversal. PMID:28701465

  7. Metabolic Control of Virulence Genes in Brucella abortus: HutC Coordinates virB Expression and the Histidine Utilization Pathway by Direct Binding to Both Promoters ▿ †

    PubMed Central

    Sieira, Rodrigo; Arocena, Gastón M.; Bukata, Lucas; Comerci, Diego J.; Ugalde, Rodolfo A.

    2010-01-01

    Type IV secretion systems (T4SS) are multicomponent machineries involved in the translocation of effector molecules across the bacterial cell envelope. The virB operon of Brucella abortus codes for a T4SS that is essential for virulence and intracellular multiplication of the bacterium in the host. Previous studies showed that the virB operon of B. abortus is tightly regulated within the host cells. In order to identify factors implicated in the control of virB expression, we searched for proteins of Brucella that directly bind to the virB promoter (PvirB). Using different procedures, we isolated a 27-kDa protein that binds specifically to PvirB. This protein was identified as HutC, the transcriptional repressor of the histidine utilization (hut) genes. Analyses of virB and hut promoter activity revealed that HutC exerts two different roles: it acts as a coactivator of transcription of the virB operon, whereas it represses the hut genes. Such activities were observed both intracellularly and in bacteria incubated under conditions that resemble the intracellular environment. Electrophoresis mobility shift assays (EMSA) and DNase I footprinting experiments revealed the structure, affinity, and localization of the HutC-binding sites and supported the regulatory role of HutC in both hut and virB promoters. Taken together, these results indicate that Brucella coopted the function of HutC to coordinate the Hut pathway with transcriptional regulation of the virB genes, probably as a way to sense its own metabolic state and develop adaptive responses to overcome intracellular host defenses. PMID:19854911

  8. A Synthetic Glycan Microarray Enables Epitope Mapping of Plant Cell Wall Glycan-Directed Antibodies.

    PubMed

    Ruprecht, Colin; Bartetzko, Max P; Senf, Deborah; Dallabernadina, Pietro; Boos, Irene; Andersen, Mathias C F; Kotake, Toshihisa; Knox, J Paul; Hahn, Michael G; Clausen, Mads H; Pfrengle, Fabian

    2017-11-01

    In the last three decades, more than 200 monoclonal antibodies have been raised against most classes of plant cell wall polysaccharides by different laboratories worldwide. These antibodies are widely used to identify differences in plant cell wall components in mutants, organ and tissue types, and developmental stages. Despite their importance and broad use, the precise binding epitope has been determined for only a few of these antibodies. Here, we use a plant glycan microarray equipped with 88 synthetic oligosaccharides to comprehensively map the epitopes of plant cell wall glycan-directed antibodies. Our results reveal the binding epitopes for 78 arabinogalactan-, rhamnogalacturonan-, xylan-, and xyloglucan-directed antibodies. We demonstrate that, with knowledge of the exact epitopes recognized by individual antibodies, specific glycosyl hydrolases can be implemented into immunological cell wall analyses, providing a framework to obtain structural information on plant cell wall glycans with unprecedented molecular precision. © 2017 American Society of Plant Biologists. All Rights Reserved.

  9. Homocysteine directly interacts and activates the angiotensin II type I receptor to aggravate vascular injury.

    PubMed

    Li, Tuoyi; Yu, Bing; Liu, Zhixin; Li, Jingyuan; Ma, Mingliang; Wang, Yingbao; Zhu, Mingjiang; Yin, Huiyong; Wang, Xiaofeng; Fu, Yi; Yu, Fang; Wang, Xian; Fang, Xiaohong; Sun, Jinpeng; Kong, Wei

    2018-01-02

    Hyperhomocysteinemia (HHcy) is a risk factor for various cardiovascular diseases. However, the mechanism underlying HHcy-aggravated vascular injury remains unclear. Here we show that the aggravation of abdominal aortic aneurysm by HHcy is abolished in mice with genetic deletion of the angiotensin II type 1 (AT1) receptor and in mice treated with an AT1 blocker. We find that homocysteine directly activates AT1 receptor signalling. Homocysteine displaces angiotensin II and limits its binding to AT1 receptor. Bioluminescence resonance energy transfer analysis reveals distinct conformational changes of AT1 receptor upon binding to angiotensin II and homocysteine. Molecular dynamics and site-directed mutagenesis experiments suggest that homocysteine regulates the conformation of the AT1 receptor both orthosterically and allosterically by forming a salt bridge and a disulfide bond with its Arg 167 and Cys 289 residues, respectively. Together, these findings suggest that strategies aimed at blocking the AT1 receptor may mitigate HHcy-associated aneurysmal vascular injuries.

  10. Direct Microtubule-Binding by Myosin-10 Orients Centrosomes toward Retraction Fibers and Subcortical Actin Clouds.

    PubMed

    Kwon, Mijung; Bagonis, Maria; Danuser, Gaudenz; Pellman, David

    2015-08-10

    Positioning of centrosomes is vital for cell division and development. In metazoan cells, spindle positioning is controlled by a dynamic pool of subcortical actin that organizes in response to the position of retraction fibers. These actin "clouds" are proposed to generate pulling forces on centrosomes and mediate spindle orientation. However, the motors that pull astral microtubules toward these actin structures are not known. Here, we report that the unconventional myosin, Myo10, couples actin-dependent forces from retraction fibers and subcortical actin clouds to centrosomes. Myo10-mediated centrosome positioning requires its direct microtubule binding. Computational image analysis of large microtubule populations reveals a direct effect of Myo10 on microtubule dynamics and microtubule-cortex interactions. Myo10's role in centrosome positioning is distinct from, but overlaps with, that of dynein. Thus, Myo10 plays a key role in integrating the actin and microtubule cytoskeletons to position centrosomes and mitotic spindles. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Direct Microtubule-Binding by Myosin-10 Orients Centrosomes toward Retraction Fibers and Subcortical Actin Clouds

    PubMed Central

    Kwon, Mijung; Bagonis, Maria; Danuser, Gaudenz; Pellman, David

    2015-01-01

    SUMMARY Positioning of centrosomes is vital for cell division and development. In metazoan cells, spindle positioning is controlled by a dynamic pool of subcortical actin that organizes in response to the position of retraction fibers. These actin “clouds” are proposed to generate pulling forces on centrosomes and mediate spindle orientation. However, the motors that pull astral microtubules toward these actin structures are not known. Here, we report that the unconventional myosin, Myo10, couples actin-dependent forces from retraction fibers and subcortical actin clouds to centrosomes. Myo10-mediated centrosome positioning requires its direct microtubule binding. Computational image analysis of large microtubule populations reveals a direct effect of Myo10 on microtubule dynamics and microtubule-cortex interactions. Myo10’s role in centrosome positioning is distinct from, but overlaps with, that of dynein. Thus, Myo10 plays a key role in integrating the actin and microtubule cytoskeletons to position centrosomes and mitotic spindles. PMID:26235048

  12. The role of monovalent cations in the ATPase reaction of DNA gyrase.

    PubMed

    Hearnshaw, Stephen James; Chung, Terence Tsz-Hong; Stevenson, Clare Elizabeth Mary; Maxwell, Anthony; Lawson, David Mark

    2015-04-01

    Four new crystal structures of the ATPase domain of the GyrB subunit of Escherichia coli DNA gyrase have been determined. One of these, solved in the presence of K(+), is the highest resolution structure reported so far for this domain and, in conjunction with the three other structures, reveals new insights into the function of this domain. Evidence is provided for the existence of two monovalent cation-binding sites: site 1, which preferentially binds a K(+) ion that interacts directly with the α-phosphate of ATP, and site 2, which preferentially binds an Na(+) ion and the functional significance of which is not clear. The crystallographic data are corroborated by ATPase data, and the structures are compared with those of homologues to investigate the broader conservation of these sites.

  13. Biochemical and biophysical characterization of the selenium-binding and reducing site in Arabidopsis thaliana homologue to mammals selenium-binding protein 1.

    PubMed

    Schild, Florie; Kieffer-Jaquinod, Sylvie; Palencia, Andrés; Cobessi, David; Sarret, Géraldine; Zubieta, Chloé; Jourdain, Agnès; Dumas, Renaud; Forge, Vincent; Testemale, Denis; Bourguignon, Jacques; Hugouvieux, Véronique

    2014-11-14

    The function of selenium-binding protein 1 (SBP1), present in almost all organisms, has not yet been established. In mammals, SBP1 is known to bind the essential element selenium but the binding site has not been identified. In addition, the SBP family has numerous potential metal-binding sites that may play a role in detoxification pathways in plants. In Arabidopsis thaliana, AtSBP1 over-expression increases tolerance to two toxic compounds for plants, selenium and cadmium, often found as soil pollutants. For a better understanding of AtSBP1 function in detoxification mechanisms, we investigated the chelating properties of the protein toward different ligands with a focus on selenium using biochemical and biophysical techniques. Thermal shift assays together with inductively coupled plasma mass spectrometry revealed that AtSBP1 binds selenium after incubation with selenite (SeO3(2-)) with a ligand to protein molar ratio of 1:1. Isothermal titration calorimetry confirmed the 1:1 stoichiometry and revealed an unexpectedly large value of binding enthalpy suggesting a covalent bond between selenium and AtSBP1. Titration of reduced Cys residues and comparative mass spectrometry on AtSBP1 and the purified selenium-AtSBP1 complex identified Cys(21) and Cys(22) as being responsible for the binding of one selenium. These results were validated by site-directed mutagenesis. Selenium K-edge x-ray absorption near edge spectroscopy performed on the selenium-AtSBP1 complex demonstrated that AtSBP1 reduced SeO3(2-) to form a R-S-Se(II)-S-R-type complex. The capacity of AtSBP1 to bind different metals and selenium is discussed with respect to the potential function of AtSBP1 in detoxification mechanisms and selenium metabolism. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Biochemical and Biophysical Characterization of the Selenium-binding and Reducing Site in Arabidopsis thaliana Homologue to Mammals Selenium-binding Protein 1*

    PubMed Central

    Schild, Florie; Kieffer-Jaquinod, Sylvie; Palencia, Andrés; Cobessi, David; Sarret, Géraldine; Zubieta, Chloé; Jourdain, Agnès; Dumas, Renaud; Forge, Vincent; Testemale, Denis; Bourguignon, Jacques; Hugouvieux, Véronique

    2014-01-01

    The function of selenium-binding protein 1 (SBP1), present in almost all organisms, has not yet been established. In mammals, SBP1 is known to bind the essential element selenium but the binding site has not been identified. In addition, the SBP family has numerous potential metal-binding sites that may play a role in detoxification pathways in plants. In Arabidopsis thaliana, AtSBP1 over-expression increases tolerance to two toxic compounds for plants, selenium and cadmium, often found as soil pollutants. For a better understanding of AtSBP1 function in detoxification mechanisms, we investigated the chelating properties of the protein toward different ligands with a focus on selenium using biochemical and biophysical techniques. Thermal shift assays together with inductively coupled plasma mass spectrometry revealed that AtSBP1 binds selenium after incubation with selenite (SeO32−) with a ligand to protein molar ratio of 1:1. Isothermal titration calorimetry confirmed the 1:1 stoichiometry and revealed an unexpectedly large value of binding enthalpy suggesting a covalent bond between selenium and AtSBP1. Titration of reduced Cys residues and comparative mass spectrometry on AtSBP1 and the purified selenium-AtSBP1 complex identified Cys21 and Cys22 as being responsible for the binding of one selenium. These results were validated by site-directed mutagenesis. Selenium K-edge x-ray absorption near edge spectroscopy performed on the selenium-AtSBP1 complex demonstrated that AtSBP1 reduced SeO32− to form a R-S-Se(II)-S-R-type complex. The capacity of AtSBP1 to bind different metals and selenium is discussed with respect to the potential function of AtSBP1 in detoxification mechanisms and selenium metabolism. PMID:25274629

  15. PilN binding modulates the structure and binding partners of the Pseudomonas aeruginosa type IVa pilus protein PilM

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCallum, Matthew; Tammam, Stephanie; Little, Dustin J.

    Pseudomonas aeruginosa is an opportunistic bacterial pathogen that expresses type IVa pili. The pilus assembly system, which promotes surface-associated twitching motility and virulence, is composed of inner and outer membrane subcomplexes, connected by an alignment subcomplex composed of PilMNOP. PilM binds to the N terminus of PilN, and we hypothesize that this interaction causes functionally significant structural changes in PilM. To characterize this interaction, we determined the crystal structures of PilM and a PilM chimera where PilM was fused to the first 12 residues of PilN (PilM·PilN(1–12)). Structural analysis, multiangle light scattering coupled with size exclusion chromatography, and bacterial two-hybridmore » data revealed that PilM forms dimers mediated by the binding of a novel conserved motif in the N terminus of PilM, and binding PilN abrogates this binding interface, resulting in PilM monomerization. Structural comparison of PilM with PilM·PilN(1–12) revealed that upon PilN binding, there is a large domain closure in PilM that alters its ATP binding site. Using biolayer interferometry, we found that the association rate of PilN with PilM is higher in the presence of ATP compared with ADP. Bacterial two-hybrid data suggested the connectivity of the cytoplasmic and inner membrane components of the type IVa pilus machinery in P. aeruginosa, with PilM binding to PilB, PilT, and PilC in addition to PilN. Pull-down experiments demonstrated direct interactions of PilM with PilB and PilT. As a result, we propose a working model in which dynamic binding of PilN facilitates functionally relevant structural changes in PilM.« less

  16. Insights into the binding specificity of wild type and mutated wheat germ agglutinin towards Neu5Acα(2-3)Gal: a study by in silico mutations and molecular dynamics simulations.

    PubMed

    Parasuraman, Ponnusamy; Murugan, Veeramani; Selvin, Jeyasigamani F A; Gromiha, M Michael; Fukui, Kazuhiko; Veluraja, Kasinadar

    2014-08-01

    Wheat germ agglutinin (WGA) is a plant lectin, which specifically recognizes the sugars NeuNAc and GlcNAc. Mutated WGA with enhanced binding specificity can be used as biomarkers for cancer. In silico mutations are performed at the active site of WGA to enhance the binding specificity towards sialylglycans, and molecular dynamics simulations of 20 ns are carried out for wild type and mutated WGAs (WGA1, WGA2, and WGA3) in complex with sialylgalactose to examine the change in binding specificity. MD simulations reveal the change in binding specificity of wild type and mutated WGAs towards sialylgalactose and bound conformational flexibility of sialylgalactose. The mutated polar amino acid residues Asn114 (S114N), Lys118 (G118K), and Arg118 (G118R) make direct and water mediated hydrogen bonds and hydrophobic interactions with sialylgalactose. An analysis of possible hydrogen bonds, hydrophobic interactions, total pair wise interaction energy between active site residues and sialylgalactose and MM-PBSA free energy calculation reveals the plausible binding modes and the role of water in stabilizing different binding modes. An interesting observation is that the binding specificity of mutated WGAs (cyborg lectin) towards sialylgalactose is found to be higher in double point mutation (WGA3). One of the substituted residues Arg118 plays a crucial role in sugar binding. Based on the interactions and energy calculations, it is concluded that the order of binding specificity of WGAs towards sialylgalactose is WGA3 > WGA1 > WGA2 > WGA. On comparing with the wild type, double point mutated WGA (WGA3) exhibits increased specificity towards sialylgalactose, and thus, it can be effectively used in targeted drug delivery and as biological cell marker in cancer therapeutics. Copyright © 2014 John Wiley & Sons, Ltd.

  17. PilN binding modulates the structure and binding partners of the Pseudomonas aeruginosa type IVa pilus protein PilM

    DOE PAGES

    McCallum, Matthew; Tammam, Stephanie; Little, Dustin J.; ...

    2016-03-28

    Pseudomonas aeruginosa is an opportunistic bacterial pathogen that expresses type IVa pili. The pilus assembly system, which promotes surface-associated twitching motility and virulence, is composed of inner and outer membrane subcomplexes, connected by an alignment subcomplex composed of PilMNOP. PilM binds to the N terminus of PilN, and we hypothesize that this interaction causes functionally significant structural changes in PilM. To characterize this interaction, we determined the crystal structures of PilM and a PilM chimera where PilM was fused to the first 12 residues of PilN (PilM·PilN(1–12)). Structural analysis, multiangle light scattering coupled with size exclusion chromatography, and bacterial two-hybridmore » data revealed that PilM forms dimers mediated by the binding of a novel conserved motif in the N terminus of PilM, and binding PilN abrogates this binding interface, resulting in PilM monomerization. Structural comparison of PilM with PilM·PilN(1–12) revealed that upon PilN binding, there is a large domain closure in PilM that alters its ATP binding site. Using biolayer interferometry, we found that the association rate of PilN with PilM is higher in the presence of ATP compared with ADP. Bacterial two-hybrid data suggested the connectivity of the cytoplasmic and inner membrane components of the type IVa pilus machinery in P. aeruginosa, with PilM binding to PilB, PilT, and PilC in addition to PilN. Pull-down experiments demonstrated direct interactions of PilM with PilB and PilT. As a result, we propose a working model in which dynamic binding of PilN facilitates functionally relevant structural changes in PilM.« less

  18. Binding Sites Analyser (BiSA): Software for Genomic Binding Sites Archiving and Overlap Analysis

    PubMed Central

    Khushi, Matloob; Liddle, Christopher; Clarke, Christine L.; Graham, J. Dinny

    2014-01-01

    Genome-wide mapping of transcription factor binding and histone modification reveals complex patterns of interactions. Identifying overlaps in binding patterns by different factors is a major objective of genomic studies, but existing methods to archive large numbers of datasets in a personalised database lack sophistication and utility. Therefore we have developed transcription factor DNA binding site analyser software (BiSA), for archiving of binding regions and easy identification of overlap with or proximity to other regions of interest. Analysis results can be restricted by chromosome or base pair overlap between regions or maximum distance between binding peaks. BiSA is capable of reporting overlapping regions that share common base pairs; regions that are nearby; regions that are not overlapping; and average region sizes. BiSA can identify genes located near binding regions of interest, genomic features near a gene or locus of interest and statistical significance of overlapping regions can also be reported. Overlapping results can be visualized as Venn diagrams. A major strength of BiSA is that it is supported by a comprehensive database of publicly available transcription factor binding sites and histone modifications, which can be directly compared to user data. The documentation and source code are available on http://bisa.sourceforge.net PMID:24533055

  19. Long noncoding RNA OCC-1 suppresses cell growth through destabilizing HuR protein in colorectal cancer.

    PubMed

    Lan, Yang; Xiao, Xuewei; He, Zhengchi; Luo, Yu; Wu, Chuanfang; Li, Ling; Song, Xu

    2018-06-20

    Overexpressed in colon carcinoma-1 (OCC-1) is one of the earliest annotated long noncoding RNAs (lncRNAs) in colorectal cancer (CRC); however, its function remains largely unknown. Here, we revealed that OCC-1 plays a tumor suppressive role in CRC. OCC-1 knockdown by RNA interference promotes cell growth both in vitro and in vivo, which is largely due to its ability to inhibit G0 to G1 and G1 to S phase cell cycle transitions. In addition, overexpression of OCC-1 can suppress cell growth in OCC-1 knockdown cells. OCC-1 exerts its function by binding to and destabilizing HuR (ELAVL1), a cancer-associated RNA binding protein (RBP) which can bind to and stabilize thousands of mRNAs. OCC-1 enhances the binding of ubiquitin E3 ligase β-TrCP1 to HuR and renders HuR susceptible to ubiquitination and degradation, thereby reducing the levels of HuR and its target mRNAs, including the mRNAs directly associated with cancer cell growth. These findings reveal that lncRNA OCC-1 can regulate the levels of a large number of mRNAs at post-transcriptional level through modulating RBP HuR stability.

  20. Structure of the Nucleoprotein Binding Domain of Mokola Virus Phosphoprotein▿

    PubMed Central

    Assenberg, René; Delmas, Olivier; Ren, Jingshan; Vidalain, Pierre-Olivier; Verma, Anil; Larrous, Florence; Graham, Stephen C.; Tangy, Frédéric; Grimes, Jonathan M.; Bourhy, Hervé

    2010-01-01

    Mokola virus (MOKV) is a nonsegmented, negative-sense RNA virus that belongs to the Lyssavirus genus and Rhabdoviridae family. MOKV phosphoprotein P is an essential component of the replication and transcription complex and acts as a cofactor for the viral RNA-dependent RNA polymerase. P recruits the viral polymerase to the nucleoprotein-bound viral RNA (N-RNA) via an interaction between its C-terminal domain and the N-RNA complex. Here we present a structure for this domain of MOKV P, obtained by expression of full-length P in Escherichia coli, which was subsequently truncated during crystallization. The structure has a high degree of homology with P of rabies virus, another member of Lyssavirus genus, and to a lesser degree with P of vesicular stomatitis virus (VSV), a member of the related Vesiculovirus genus. In addition, analysis of the crystal packing of this domain reveals a potential binding site for the nucleoprotein N. Using both site-directed mutagenesis and yeast two-hybrid experiments to measure P-N interaction, we have determined the relative roles of key amino acids involved in this interaction to map the region of P that binds N. This analysis also reveals a structural relationship between the N-RNA binding domain of the P proteins of the Rhabdoviridae and the Paramyxoviridae. PMID:19906936

  1. Structural basis for antibody recognition in the receptor-binding domains of toxins A and B from Clostridium difficile.

    PubMed

    Murase, Tomohiko; Eugenio, Luiz; Schorr, Melissa; Hussack, Greg; Tanha, Jamshid; Kitova, Elena N; Klassen, John S; Ng, Kenneth K S

    2014-01-24

    Clostridium difficile infection is a serious and highly prevalent nosocomial disease in which the two large, Rho-glucosylating toxins TcdA and TcdB are the main virulence factors. We report for the first time crystal structures revealing how neutralizing and non-neutralizing single-domain antibodies (sdAbs) recognize the receptor-binding domains (RBDs) of TcdA and TcdB. Surprisingly, the complexes formed by two neutralizing antibodies recognizing TcdA do not show direct interference with the previously identified carbohydrate-binding sites, suggesting that neutralization of toxin activity may be mediated by mechanisms distinct from steric blockage of receptor binding. A camelid sdAb complex also reveals the molecular structure of the TcdB RBD for the first time, facilitating the crystallization of a strongly negatively charged protein fragment that has resisted previous attempts at crystallization and structure determination. Electrospray ionization mass spectrometry measurements confirm the stoichiometries of sdAbs observed in the crystal structures. These studies indicate how key epitopes in the RBDs from TcdA and TcdB are recognized by sdAbs, providing molecular insights into toxin structure and function and providing for the first time a basis for the design of highly specific toxin-specific therapeutic and diagnostic agents.

  2. Structural Basis for Antibody Recognition in the Receptor-binding Domains of Toxins A and B from Clostridium difficile*

    PubMed Central

    Murase, Tomohiko; Eugenio, Luiz; Schorr, Melissa; Hussack, Greg; Tanha, Jamshid; Kitova, Elena N.; Klassen, John S.; Ng, Kenneth K. S.

    2014-01-01

    Clostridium difficile infection is a serious and highly prevalent nosocomial disease in which the two large, Rho-glucosylating toxins TcdA and TcdB are the main virulence factors. We report for the first time crystal structures revealing how neutralizing and non-neutralizing single-domain antibodies (sdAbs) recognize the receptor-binding domains (RBDs) of TcdA and TcdB. Surprisingly, the complexes formed by two neutralizing antibodies recognizing TcdA do not show direct interference with the previously identified carbohydrate-binding sites, suggesting that neutralization of toxin activity may be mediated by mechanisms distinct from steric blockage of receptor binding. A camelid sdAb complex also reveals the molecular structure of the TcdB RBD for the first time, facilitating the crystallization of a strongly negatively charged protein fragment that has resisted previous attempts at crystallization and structure determination. Electrospray ionization mass spectrometry measurements confirm the stoichiometries of sdAbs observed in the crystal structures. These studies indicate how key epitopes in the RBDs from TcdA and TcdB are recognized by sdAbs, providing molecular insights into toxin structure and function and providing for the first time a basis for the design of highly specific toxin-specific therapeutic and diagnostic agents. PMID:24311789

  3. Effects of Frequency Separation and Diotic/Dichotic Presentations on the Alternation Frequency Limits in Audition Derived from a Temporal Phase Discrimination Task.

    PubMed

    Kanaya, Shoko; Fujisaki, Waka; Nishida, Shin'ya; Furukawa, Shigeto; Yokosawa, Kazuhiko

    2015-02-01

    Temporal phase discrimination is a useful psychophysical task to evaluate how sensory signals, synchronously detected in parallel, are perceptually bound by human observers. In this task two stimulus sequences synchronously alternate between two states (say, A-B-A-B and X-Y-X-Y) in either of two temporal phases (ie A and B are respectively paired with X and Y, or vice versa). The critical alternation frequency beyond which participants cannot discriminate the temporal phase is measured as an index characterizing the temporal property of the underlying binding process. This task has been used to reveal the mechanisms underlying visual and cross-modal bindings. To directly compare these binding mechanisms with those in another modality, this study used the temporal phase discrimination task to reveal the processes underlying auditory bindings. The two sequences were alternations between two pitches. We manipulated the distance between the two sequences by changing intersequence frequency separation, or presentation ears (diotic vs dichotic). Results showed that the alternation frequency limit ranged from 7 to 30 Hz, becoming higher as the intersequence distance decreased, as is the case with vision. However, unlike vision, auditory phase discrimination limits were higher and more variable across participants. © 2015 SAGE Publications.

  4. Multimodal biopanning of T7 phage-displayed peptides reveals angiomotin as a potential receptor of the anti-angiogenic macrolide Roxithromycin.

    PubMed

    Takakusagi, Kaori; Takakusagi, Yoichi; Suzuki, Takahiro; Toizaki, Aya; Suzuki, Aiko; Kawakatsu, Yaichi; Watanabe, Madoka; Saito, Yukihiro; Fukuda, Ryushi; Nakazaki, Atsuo; Kobayashi, Susumu; Sakaguchi, Kengo; Sugawara, Fumio

    2015-01-27

    Roxithromycin (RXM) is a semi-synthetic fourteen-membered macrolide antibiotic that shows anti-angiogenic activity in solid tumors. In the present study, we conducted biopanning of T7 phage-displayed peptides either on a 96-well formatted microplate, a flow injection-type quartz-crystal microbalance (QCM) biosensor, or a cuvette-type QCM. RXM-selected peptides of different sequence, length and number were obtained from each mode of screening. Subsequent bioinformatics analysis of the RXM-selected peptides consistently gave positive scores for the extracellular domain (E458-T596) of angiomotin (Amot), indicating that this may comprise a binding region for RXM. Bead pull down assay and QCM analysis confirmed that RXM directly interacts with Amot via the screen-guided region, which also corresponds to the binding site for the endogenous anti-angiogenic inhibitor angiostatin (Anst). Thus, multimodal biopanning of T7PD revealed that RXM binds to the extracellular domain on Amot as a common binding site with Anst, leading to inhibition of angiogenesis-dependent tumor growth and metastasis. These data might explain the molecular basis underlying the mechanism of action for the anti-angiogenic activity of RXM. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  5. Structural basis for specific recognition of multiple mRNA targets by a PUF regulatory protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Yeming; Opperman, Laura; Wickens, Marvin

    2011-11-02

    Caenorhabditis elegans fem-3 binding factor (FBF) is a founding member of the PUMILIO/FBF (PUF) family of mRNA regulatory proteins. It regulates multiple mRNAs critical for stem cell maintenance and germline development. Here, we report crystal structures of FBF in complex with 6 different 9-nt RNA sequences, including elements from 4 natural mRNAs. These structures reveal that FBF binds to conserved bases at positions 1-3 and 7-8. The key specificity determinant of FBF vs. other PUF proteins lies in positions 4-6. In FBF/RNA complexes, these bases stack directly with one another and turn away from the RNA-binding surface. A short regionmore » of FBF is sufficient to impart its unique specificity and lies directly opposite the flipped bases. We suggest that this region imposes a flattened curvature on the protein; hence, the requirement for the additional nucleotide. The principles of FBF/RNA recognition suggest a general mechanism by which PUF proteins recognize distinct families of RNAs yet exploit very nearly identical atomic contacts in doing so.« less

  6. Structural basis for specific recognition of multiple mRNA targets by a PUF regulatory protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Yeming; Opperman, Laura; Wickens, Marvin

    2010-08-19

    Caenorhabditis elegans fem-3 binding factor (FBF) is a founding member of the PUMILIO/FBF (PUF) family of mRNA regulatory proteins. It regulates multiple mRNAs critical for stem cell maintenance and germline development. Here, we report crystal structures of FBF in complex with 6 different 9-nt RNA sequences, including elements from 4 natural mRNAs. These structures reveal that FBF binds to conserved bases at positions 1-3 and 7-8. The key specificity determinant of FBF vs. other PUF proteins lies in positions 4-6. In FBF/RNA complexes, these bases stack directly with one another and turn away from the RNA-binding surface. A short regionmore » of FBF is sufficient to impart its unique specificity and lies directly opposite the flipped bases. We suggest that this region imposes a flattened curvature on the protein; hence, the requirement for the additional nucleotide. The principles of FBF/RNA recognition suggest a general mechanism by which PUF proteins recognize distinct families of RNAs yet exploit very nearly identical atomic contacts in doing so.« less

  7. Cyclophilin A stabilizes the HIV-1 capsid through a novel non-canonical binding site

    NASA Astrophysics Data System (ADS)

    Liu, Chuang; Perilla, Juan R.; Ning, Jiying; Lu, Manman; Hou, Guangjin; Ramalho, Ruben; Himes, Benjamin A.; Zhao, Gongpu; Bedwell, Gregory J.; Byeon, In-Ja; Ahn, Jinwoo; Gronenborn, Angela M.; Prevelige, Peter E.; Rousso, Itay; Aiken, Christopher; Polenova, Tatyana; Schulten, Klaus; Zhang, Peijun

    2016-03-01

    The host cell factor cyclophilin A (CypA) interacts directly with the HIV-1 capsid and regulates viral infectivity. Although the crystal structure of CypA in complex with the N-terminal domain of the HIV-1 capsid protein (CA) has been known for nearly two decades, how CypA interacts with the viral capsid and modulates HIV-1 infectivity remains unclear. We determined the cryoEM structure of CypA in complex with the assembled HIV-1 capsid at 8-Å resolution. The structure exhibits a distinct CypA-binding pattern in which CypA selectively bridges the two CA hexamers along the direction of highest curvature. EM-guided all-atom molecular dynamics simulations and solid-state NMR further reveal that the CypA-binding pattern is achieved by single-CypA molecules simultaneously interacting with two CA subunits, in different hexamers, through a previously uncharacterized non-canonical interface. These results provide new insights into how CypA stabilizes the HIV-1 capsid and is recruited to facilitate HIV-1 infection.

  8. Direct regulation of the Akt proto-oncogene product by phosphatidylinositol-3,4-bisphosphate.

    PubMed

    Franke, T F; Kaplan, D R; Cantley, L C; Toker, A

    1997-01-31

    The regulation of the serine-threonine kinase Akt by lipid products of phosphoinositide 3-kinase (PI 3-kinase) was investigated. Akt activity was found to correlate with the amount of phosphatidylinositol-3,4-bisphosphate (PtdIns-3,4-P2) in vivo, and synthetic PtdIns-3,4-P2 activated Akt both in vitro and in vivo. Binding of PtdIns-3,4-P2 occurred within the Akt pleckstrin homology (PH) domain and facilitated dimerization of Akt. Akt mutated in the PH domain was not activated by PI 3-kinase in vivo or by PtdIns-3, 4-P2 in vitro, and it was impaired in binding to PtdIns-3,4-P2. Examination of the binding to other phosphoinositides revealed that they bound to the Akt PH domain with much lower affinity than did PtdIns-3,4-P2 and failed to increase Akt activity. Thus, Akt is apparently regulated by the direct interaction of PtdIns-3,4-P2 with the Akt PH domain.

  9. Analysis of the promoter of the cudA gene reveals novel mechanisms of Dictyostelium cell type differentiation.

    PubMed

    Fukuzawa, M; Williams, J G

    2000-06-01

    The cudA gene encodes a nuclear protein that is essential for normal multicellular development. At the slug stage cudA is expressed in the prespore cells and in a sub-region of the prestalk zone. We show that cap site distal promoter sequences direct cudA expression in prespore cells, while proximal sequences direct expression in the prestalk sub-region. The promoter domain that directs prespore-specific transcription consists of a positively acting region, that has the potential to direct expression in all cells within the slug, and a negatively acting region that prevents expression in the prestalk cells. Dd-STATa is the STAT protein that regulates commitment to stalk cell gene expression, where it is known to function as a transcriptional repressor. We show that Dd-STATa binds in vitro to the positively acting part of the prespore domain of the cudA promoter. However, Dd-STATa cannot be utilised for this purpose in vivo, because analysis of a Dd-STATa null mutant strain shows that Dd-STATa is not necessary for cudA transcription in prespore cells. In contrast, the part of the cudA promoter that directs prestalk-specific expression contains a binding site for Dd-STATa that is essential for its biological activity. Dd-STATa appears therefore to serve as a direct activator of cudA transcription in prestalk cells, while a protein with a DNA binding specificity highly related to that of Dd-STATa is utilised to activate cudA transcription in prespore cells.

  10. A pollen-specific calmodulin-binding protein, NPG1, interacts with putative pectate lyases.

    PubMed

    Shin, Sung-Bong; Golovkin, Maxim; Reddy, Anireddy S N

    2014-06-12

    Previous genetic studies have revealed that a pollen-specific calmodulin-binding protein, No Pollen Germination 1 (NPG1), is required for pollen germination. However, its mode of action is unknown. Here we report direct interaction of NPG1 with pectate lyase-like proteins (PLLs). A truncated form of AtNPG1 lacking the N-terminal tetratricopeptide repeat 1 (TPR1) failed to interact with PLLs, suggesting that it is essential for NPG1 interaction with PLLs. Localization studies with AtNPG1 fused to a fluorescent reporter driven by its native promoter revealed its presence in the cytosol and cell wall of the pollen grain and the growing pollen tube of plasmolyzed pollen. Together, our data suggest that the function of NPG1 in regulating pollen germination is mediated through its interaction with PLLs, which may modify the pollen cell wall and regulate pollen tube emergence and growth.

  11. Molecular interaction of 2-mercaptobenzimidazole with catalase reveals a potentially toxic mechanism of the inhibitor.

    PubMed

    Teng, Yue; Zou, Luyi; Huang, Ming; Zong, Wansong

    2014-12-01

    2-Mercaptobenzimidazole (MBI) is widely utilized as a corrosion inhibitor, copper-plating brightener and rubber accelerator. The residue of MBI in the environment possesses a potential risk to human health. In this work, the toxic interaction of MBI with the important antioxidant enzyme catalase (CAT) was investigated using spectroscopic and molecular docking methods under physiological conditions. MBI can spontaneously bind with CAT with one binding site through hydrogen bonds and van der Waals forces to form MBI-CAT complex. The molecular docking study revealed that MBI bound into the CAT interface of chains B and C, which led to some conformational and microenvironmental changes of CAT and further resulted in the inhibition of CAT activity. This present study provides direct evidence at a molecular level to show that exposure to MBI could induce changes in the structure and function of the enzyme CAT. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. New insights into the catalytic mechanism of Bombyx mori prostaglandin E synthase gained from structure–function analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yamamoto, Kohji, E-mail: yamamok@agr.kyushu-u.ac.jp; Suzuki, Mamoru; Higashiura, Akifumi

    2013-11-01

    Highlights: •Structure of Bombyx mori prostaglandin E synthase is determined. •Bound glutathione sulfonic acid is located at the glutathione-binding site. •Electron-sharing network is present in this protein. •This network includes Asn95, Asp96, and Arg98. •Site-directed mutagenesis reveals that the residues contribute to the catalytic activity. -- Abstract: Prostaglandin E synthase (PGES) catalyzes the isomerization of PGH{sub 2} to PGE{sub 2}. We previously reported the identification and structural characterization of Bombyx mori PGES (bmPGES), which belongs to Sigma-class glutathione transferase. Here, we extend these studies by determining the structure of bmPGES in complex with glutathione sulfonic acid (GTS) at a resolutionmore » of 1.37 Å using X-ray crystallography. GTS localized to the glutathione-binding site. We found that electron-sharing network of bmPGES includes Asn95, Asp96, and Arg98. Site-directed mutagenesis of these residues to create mutant forms of bmPGES mutants indicate that they contribute to catalytic activity. These results are, to our knowledge, the first to reveal the presence of an electron-sharing network in bmPGES.« less

  13. Minoxidil may suppress androgen receptor-related functions.

    PubMed

    Hsu, Cheng-Lung; Liu, Jai-Shin; Lin, An-Chi; Yang, Chih-Hsun; Chung, Wen-Hung; Wu, Wen-Guey

    2014-04-30

    Although minoxidil has been used for more than two decades to treat androgenetic alopecia (AGA), an androgen-androgen receptor (AR) pathway-dominant disease, its precise mechanism of action remains elusive. We hypothesized that minoxidil may influence the AR or its downstream signaling. These tests revealed that minoxidil suppressed AR-related functions, decreasing AR transcriptional activity in reporter assays, reducing expression of AR targets at the protein level, and suppressing AR-positive LNCaP cell growth. Dissecting the underlying mechanisms, we found that minoxidil interfered with AR-peptide, AR-coregulator, and AR N/C-terminal interactions, as well as AR protein stability. Furthermore, a crystallographic analysis using the AR ligand-binding domain (LBD) revealed direct binding of minoxidil to the AR in a minoxidil-AR-LBD co-crystal model, and surface plasmon resonance assays demonstrated that minoxidil directly bound the AR with a K(d) value of 2.6 µM. Minoxidil also suppressed AR-responsive reporter activity and decreased AR protein stability in human hair dermal papilla cells. The current findings provide evidence that minoxidil could be used to treat both cancer and age-related disease, and open a new avenue for applications of minoxidil in treating androgen-AR pathway-related diseases.

  14. Minoxidil may suppress androgen receptor-related functions

    PubMed Central

    Hsu, Cheng-Lung; Liu, Jai-Shin; Lin, An-Chi; Yang, Chih-Hsun; Chung, Wen-Hung; Wu, Wen-Guey

    2014-01-01

    Although minoxidil has been used for more than two decades to treat androgenetic alopecia (AGA), an androgen-androgen receptor (AR) pathway-dominant disease, its precise mechanism of action remains elusive. We hypothesized that minoxidil may influence the AR or its downstream signaling. These tests revealed that minoxidil suppressed AR-related functions, decreasing AR transcriptional activity in reporter assays, reducing expression of AR targets at the protein level, and suppressing AR-positive LNCaP cell growth. Dissecting the underlying mechanisms, we found that minoxidil interfered with AR-peptide, AR-coregulator, and AR N/C-terminal interactions, as well as AR protein stability. Furthermore, a crystallographic analysis using the AR ligand-binding domain (LBD) revealed direct binding of minoxidil to the AR in a minoxidil-AR-LBD co-crystal model, and surface plasmon resonance assays demonstrated that minoxidil directly bound the AR with a Kd value of 2.6 μM. Minoxidil also suppressed AR-responsive reporter activity and decreased AR protein stability in human hair dermal papilla cells. The current findings provide evidence that minoxidil could be used to treat both cancer and age-related disease, and open a new avenue for applications of minoxidil in treating androgen-AR pathway-related diseases. PMID:24742982

  15. (19)F NMR reveals multiple conformations at the dimer interface of the nonstructural protein 1 effector domain from influenza A virus.

    PubMed

    Aramini, James M; Hamilton, Keith; Ma, Li-Chung; Swapna, G V T; Leonard, Paul G; Ladbury, John E; Krug, Robert M; Montelione, Gaetano T

    2014-04-08

    Nonstructural protein 1 of influenza A virus (NS1A) is a conserved virulence factor comprised of an N-terminal double-stranded RNA (dsRNA)-binding domain and a multifunctional C-terminal effector domain (ED), each of which can independently form symmetric homodimers. Here we apply (19)F NMR to NS1A from influenza A/Udorn/307/1972 virus (H3N2) labeled with 5-fluorotryptophan, and we demonstrate that the (19)F signal of Trp187 is a sensitive, direct monitor of the ED helix:helix dimer interface. (19)F relaxation dispersion data reveal the presence of conformational dynamics within this functionally important protein:protein interface, whose rate is more than three orders of magnitude faster than the kinetics of ED dimerization. (19)F NMR also affords direct spectroscopic evidence that Trp187, which mediates intermolecular ED:ED interactions required for cooperative dsRNA binding, is solvent exposed in full-length NS1A at concentrations below aggregation. These results have important implications for the diverse roles of this NS1A epitope during influenza virus infection. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Human EAG channels are directly modulated by PIP2 as revealed by electrophysiological and optical interference investigations

    PubMed Central

    Han, Bo; He, Kunyan; Cai, Chunlin; Tang, Yin; Yang, Linli; Heinemann, Stefan H.; Hoshi, Toshinori; Hou, Shangwei

    2016-01-01

    Voltage-gated ether à go-go (EAG) K+ channels are expressed in various types of cancer cells and also in the central nervous system. Aberrant overactivation of human EAG1 (hEAG1) channels is associated with cancer and neuronal disorders such as Zimmermann-Laband and Temple-Baraitser syndromes. Although hEAG1 channels are recognized as potential therapeutic targets, regulation of their functional properties is only poorly understood. Here, we show that the membrane lipid phosphatidylinositol 4,5-bisphosphate (PIP2) is a potent inhibitory gating modifier of hEAG1 channels. PIP2 inhibits the channel activity by directly binding to a short N-terminal segment of the channel important for Ca2+/calmodulin (CaM) binding as evidenced by bio-layer interferometry measurements. Conversely, depletion of endogenous PIP2 either by serotonin-induced phospholipase C (PLC) activation or by a rapamycin-induced translocation system enhances the channel activity at physiological membrane potentials, suggesting that PIP2 exerts a tonic inhibitory influence. Our study, combining electrophysiological and direct binding assays, demonstrates that hEAG1 channels are subject to potent inhibitory modulation by multiple phospholipids and suggests that manipulations of the PIP2 signaling pathway may represent a strategy to treat hEAG1 channel-associated diseases. PMID:27005320

  17. Neutron Reflectometry Study of the Conformation of HIV Nef Bound to Lipid Membranes

    PubMed Central

    Kent, Michael S.; Murton, Jaclyn K.; Sasaki, Darryl Y.; Satija, Sushil; Akgun, Bulent; Nanda, Hirsh; Curtis, Joseph E.; Majewski, Jaroslaw; Morgan, Christopher R.; Engen, John R.

    2010-01-01

    Nef is an HIV-1 accessory protein that directly contributes to AIDS progression. Nef is myristoylated on the N-terminus, associates with membranes, and may undergo a transition from a solution conformation to a membrane-associated conformation. It has been hypothesized that conformational rearrangement enables membrane-associated Nef to interact with cellular proteins. Despite its medical relevance, to our knowledge there is no direct information about the conformation of membrane-bound Nef. In this work, we used neutron reflection to reveal what we believe are the first details of the conformation of membrane-bound Nef. The conformation of Nef was probed upon binding to Langmuir monolayers through the interaction of an N-terminal His tag with a synthetic metal-chelating lipid, which models one of the possible limiting cases for myr-Nef. The data indicate that residues are inserted into the lipid headgroups during interaction, and that the core domain lies directly against the lipid headgroups, with a thickness of ∼40 Å. Binding of Nef through the N-terminal His tag apparently facilitates insertion of residues, as no insertion occurred upon binding of Nef through weak electrostatic interactions in the absence of the specific interaction through the His tag. PMID:20858440

  18. Effect of urea on protein-ligand association.

    PubMed

    Stepanian, Lora; Son, Ikbae; Chalikian, Tigran V

    2017-12-01

    We combine experimental and theoretical approaches to investigate the influence of a cosolvent on a ligand-protein association event. We apply fluorescence measurements to determining the affinity of the inhibitor tri-N-acetylglucosamine [(GlcNAc) 3 ] for lysozyme at urea concentrations ranging from 0 to 8M. Notwithstanding that, at room temperature and neutral pH, lysozyme retains its native conformation up to the solubility limit of urea, the affinity of (GlcNAc) 3 for the protein steadily decreases as the concentration of urea increases. We analyze the urea dependence of the binding free energy within the framework of a simplified statistical thermodynamics-based model that accounts for the excluded volume effect and direct solute-solvent interactions. The analysis reveals that the detrimental action of urea on the inhibitor-lysozyme binding originates from competition between the free energy contributions of the excluded volume effect and direct solute-solvent interactions. The free energy contribution of direct urea-solute interactions narrowly overcomes the excluded volume contribution thereby resulting in urea weakening the protein-ligand association. More broadly, the successful application of the simple model employed in this work points to the possibility of its use in quantifying the stabilizing/destabilizing action of individual cosolvents on biochemical folding and binding reactions. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. miR-200/375 control epithelial plasticity-associated alternative splicing by repressing the RNA-binding protein Quaking.

    PubMed

    Pillman, Katherine A; Phillips, Caroline A; Roslan, Suraya; Toubia, John; Dredge, B Kate; Bert, Andrew G; Lumb, Rachael; Neumann, Daniel P; Li, Xiaochun; Conn, Simon J; Liu, Dawei; Bracken, Cameron P; Lawrence, David M; Stylianou, Nataly; Schreiber, Andreas W; Tilley, Wayne D; Hollier, Brett G; Khew-Goodall, Yeesim; Selth, Luke A; Goodall, Gregory J; Gregory, Philip A

    2018-06-05

    Members of the miR-200 family are critical gatekeepers of the epithelial state, restraining expression of pro-mesenchymal genes that drive epithelial-mesenchymal transition (EMT) and contribute to metastatic cancer progression. Here, we show that miR-200c and another epithelial-enriched miRNA, miR-375, exert widespread control of alternative splicing in cancer cells by suppressing the RNA-binding protein Quaking (QKI). During EMT, QKI-5 directly binds to and regulates hundreds of alternative splicing targets and exerts pleiotropic effects, such as increasing cell migration and invasion and restraining tumour growth, without appreciably affecting mRNA levels. QKI-5 is both necessary and sufficient to direct EMT-associated alternative splicing changes, and this splicing signature is broadly conserved across many epithelial-derived cancer types. Importantly, several actin cytoskeleton-associated genes are directly targeted by both QKI and miR-200c, revealing coordinated control of alternative splicing and mRNA abundance during EMT These findings demonstrate the existence of a miR-200/miR-375/QKI axis that impacts cancer-associated epithelial cell plasticity through widespread control of alternative splicing. © 2018 The Authors. Published under the terms of the CC BY 4.0 license.

  20. Carbohydrate Recognition by an Architecturally Complex α-N-Acetylglucosaminidase from Clostridium perfringens

    PubMed Central

    Ficko-Blean, Elizabeth; Stuart, Christopher P.; Suits, Michael D.; Cid, Melissa; Tessier, Matthew; Woods, Robert J.; Boraston, Alisdair B.

    2012-01-01

    CpGH89 is a large multimodular enzyme produced by the human and animal pathogen Clostridium perfringens. The catalytic activity of this exo-α-d-N-acetylglucosaminidase is directed towards a rare carbohydrate motif, N-acetyl-β-d-glucosamine-α-1,4-d-galactose, which is displayed on the class III mucins deep within the gastric mucosa. In addition to the family 89 glycoside hydrolase catalytic module this enzyme has six modules that share sequence similarity to the family 32 carbohydrate-binding modules (CBM32s), suggesting the enzyme has considerable capacity to adhere to carbohydrates. Here we suggest that two of the modules, CBM32-1 and CBM32-6, are not functional as carbohydrate-binding modules (CBMs) and demonstrate that three of the CBMs, CBM32-3, CBM32-4, and CBM32-5, are indeed capable of binding carbohydrates. CBM32-3 and CBM32-4 have a novel binding specificity for N-acetyl-β-d-glucosamine-α-1,4-d-galactose, which thus complements the specificity of the catalytic module. The X-ray crystal structure of CBM32-4 in complex with this disaccharide reveals a mode of recognition that is based primarily on accommodation of the unique bent shape of this sugar. In contrast, as revealed by a series of X-ray crystal structures and quantitative binding studies, CBM32-5 displays the structural and functional features of galactose binding that is commonly associated with CBM family 32. The functional CBM32s that CpGH89 contains suggest the possibility for multivalent binding events and the partitioning of this enzyme to highly specific regions within the gastrointestinal tract. PMID:22479408

  1. Structural and Functional Characterization of the Kindlin-1 Pleckstrin Homology Domain*

    PubMed Central

    Yates, Luke A.; Lumb, Craig N.; Brahme, Nina N.; Zalyte, Ruta; Bird, Louise E.; De Colibus, Luigi; Owens, Raymond J.; Calderwood, David A.; Sansom, Mark S. P.; Gilbert, Robert J. C.

    2012-01-01

    Inside-out activation of integrins is mediated via the binding of talin and kindlin to integrin β-subunit cytoplasmic tails. The kindlin FERM domain is interrupted by a pleckstrin homology (PH) domain within its F2 subdomain. Here, we present data confirming the importance of the kindlin-1 PH domain for integrin activation and its x-ray crystal structure at a resolution of 2.1 Å revealing a C-terminal second α-helix integral to the domain but found only in the kindlin protein family. An isoform-specific salt bridge occludes the canonical phosphoinositide binding site, but molecular dynamics simulations display transient switching to an alternative open conformer. Molecular docking reveals that the opening of the pocket would enable potential ligands to bind within it. Although lipid overlay assays suggested the PH domain binds inositol monophosphates, surface plasmon resonance demonstrated weak affinities for inositol 3,4,5-triphosphate (Ins(3,4,5)P3; KD ∼100 μm) and no monophosphate binding. Removing the salt bridge by site-directed mutagenesis increases the PH domain affinity for Ins(3,4,5)P3 as measured by surface plasmon resonance and enables it to bind PtdIns(3,5)P2 on a dot-blot. Structural comparison with other PH domains suggests that the phosphate binding pocket in the kindlin-1 PH domain is more occluded than in kindlins-2 and -3 due to its salt bridge. In addition, the apparent affinity for Ins(3,4,5)P3 is affected by the presence of PO4 ions in the buffer. We suggest the physiological ligand of the kindlin-1 PH domain is most likely not an inositol phosphate but another phosphorylated species. PMID:23132860

  2. Exploring the binding pathways of the 14-3-3ζ protein: Structural and free-energy profiles revealed by Hamiltonian replica exchange molecular dynamics with distancefield distance restraints

    PubMed Central

    Nagy, Gabor; Oostenbrink, Chris; Hritz, Jozef

    2017-01-01

    The 14-3-3 protein family performs regulatory functions in eukaryotic organisms by binding to a large number of phosphorylated protein partners. Whilst the binding mode of the phosphopeptides within the primary 14-3-3 binding site is well established based on the crystal structures of their complexes, little is known about the binding process itself. We present a computational study of the process by which phosphopeptides bind to the 14-3-3ζ protein. Applying a novel scheme combining Hamiltonian replica exchange molecular dynamics and distancefield restraints allowed us to map and compare the most likely phosphopeptide-binding pathways to the 14-3-3ζ protein. The most important structural changes to the protein and peptides involved in the binding process were identified. In order to bind phosphopeptides to the primary interaction site, the 14-3-3ζ adopted a newly found wide-opened conformation. Based on our findings we additionally propose a secondary interaction site on the inner surface of the 14-3-3ζ dimer, and a direct interference on the binding process by the flexible C-terminal tail. A minimalistic model was designed to allow for the efficient calculation of absolute binding affinities. Binding affinities calculated from the potential of mean force along the binding pathway are in line with the available experimental estimates for two of the studied systems. PMID:28727767

  3. Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

    PubMed Central

    Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

    2017-01-01

    AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

  4. Computational analysis of a novel mutation in ETFDH gene highlights its long-range effects on the FAD-binding motif.

    PubMed

    Er, Tze-Kiong; Chen, Chih-Chieh; Liu, Yen-Yi; Chang, Hui-Chiu; Chien, Yin-Hsiu; Chang, Jan-Gowth; Hwang, Jenn-Kang; Jong, Yuh-Jyh

    2011-10-21

    Multiple acyl-coenzyme A dehydrogenase deficiency (MADD) is an autosomal recessive disease caused by the defects in the mitochondrial electron transfer system and the metabolism of fatty acids. Recently, mutations in electron transfer flavoprotein dehydrogenase (ETFDH) gene, encoding electron transfer flavoprotein:ubiquinone oxidoreductase (ETF:QO) have been reported to be the major causes of riboflavin-responsive MADD. To date, no studies have been performed to explore the functional impact of these mutations or their mechanism of disrupting enzyme activity. High resolution melting (HRM) analysis and sequencing of the entire ETFDH gene revealed a novel mutation (p.Phe128Ser) and the hotspot mutation (p.Ala84Thr) from a patient with MADD. According to the predicted 3D structure of ETF:QO, the two mutations are located within the flavin adenine dinucleotide (FAD) binding domain; however, the two residues do not have direct interactions with the FAD ligand. Using molecular dynamics (MD) simulations and normal mode analysis (NMA), we found that the p.Ala84Thr and p.Phe128Ser mutations are most likely to alter the protein structure near the FAD binding site as well as disrupt the stability of the FAD binding required for the activation of ETF:QO. Intriguingly, NMA revealed that several reported disease-causing mutations in the ETF:QO protein show highly correlated motions with the FAD-binding site. Based on the present findings, we conclude that the changes made to the amino acids in ETF:QO are likely to influence the FAD-binding stability.

  5. Computational analysis of a novel mutation in ETFDH gene highlights its long-range effects on the FAD-binding motif

    PubMed Central

    2011-01-01

    Background Multiple acyl-coenzyme A dehydrogenase deficiency (MADD) is an autosomal recessive disease caused by the defects in the mitochondrial electron transfer system and the metabolism of fatty acids. Recently, mutations in electron transfer flavoprotein dehydrogenase (ETFDH) gene, encoding electron transfer flavoprotein:ubiquinone oxidoreductase (ETF:QO) have been reported to be the major causes of riboflavin-responsive MADD. To date, no studies have been performed to explore the functional impact of these mutations or their mechanism of disrupting enzyme activity. Results High resolution melting (HRM) analysis and sequencing of the entire ETFDH gene revealed a novel mutation (p.Phe128Ser) and the hotspot mutation (p.Ala84Thr) from a patient with MADD. According to the predicted 3D structure of ETF:QO, the two mutations are located within the flavin adenine dinucleotide (FAD) binding domain; however, the two residues do not have direct interactions with the FAD ligand. Using molecular dynamics (MD) simulations and normal mode analysis (NMA), we found that the p.Ala84Thr and p.Phe128Ser mutations are most likely to alter the protein structure near the FAD binding site as well as disrupt the stability of the FAD binding required for the activation of ETF:QO. Intriguingly, NMA revealed that several reported disease-causing mutations in the ETF:QO protein show highly correlated motions with the FAD-binding site. Conclusions Based on the present findings, we conclude that the changes made to the amino acids in ETF:QO are likely to influence the FAD-binding stability. PMID:22013910

  6. Novel high-performance purification protocol of recombinant CNBP suitable for biochemical and biophysical characterization.

    PubMed

    Challier, Emilse; Lisa, María-Natalia; Nerli, Bibiana B; Calcaterra, Nora B; Armas, Pablo

    2014-01-01

    Cellular nucleic acid binding protein (CNBP) is a highly conserved multi-zinc knuckle protein that enhances c-MYC expression, is related to certain human muscular diseases and is required for proper rostral head development. CNBP binds to single-stranded DNA (ssDNA) and RNA and acts as nucleic acid chaperone. Despite the advances made concerning CNBP biological roles, a full knowledge about the structure-function relationship has not yet been achieved, likely due to difficulty in obtaining pure and tag-free CNBP. Here, we report a fast, simple, reproducible, and high-performance expression and purification protocol that provides recombinant tag-free CNBP from Escherichia coli cultures. We determined that tag-free CNBP binds its molecular targets with higher affinity than tagged-CNBP. Furthermore, fluorescence spectroscopy revealed the presence of a unique and conserved tryptophan, which is exposed to the solvent and involved, directly or indirectly, in nucleic acid binding. Size-exclusion HPLC revealed that CNBP forms homodimers independently of nucleic acid binding and coexist with monomers as non-interconvertible forms or in slow equilibrium. Circular dichroism spectroscopy showed that CNBP has a secondary structure dominated by random-coil and β-sheet coincident with the sequence-predicted repetitive zinc knuckles motifs, which folding is required for CNBP structural stability and biochemical activity. CNBP structural stability increased in the presence of single-stranded nucleic acid targets similar to other unstructured nucleic acid chaperones. Altogether, data suggest that CNBP is a flexible protein with interspersed structured zinc knuckles, and acquires a more rigid structure upon nucleic acid binding. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Interaction of Aluminum with PHFτ in Alzheimer’s Disease Neurofibrillary Degeneration Evidenced by Desferrioxamine-Assisted Chelating Autoclave Method

    PubMed Central

    Murayama, Harunobu; Shin, Ryong-Woon; Higuchi, Jun; Shibuya, Satoshi; Muramoto, Tamaki; Kitamoto, Tetsuyuki

    1999-01-01

    To demonstrate that aluminum III (Al) interacts with PHFτ in neurofibrillary degeneration (NFD) of Alzheimer’s disease (AD) brain, we developed a “chelating autoclave method” that allows Al chelation by using trivalent-cationic chelator desferrioxamine. Its application to AD brain sections before Morin histochemistry for Al attenuated the positive fluorescence of neurofibrillary tangles, indicating Al removal from them. This method, applied for immunostaining with phosphorylation-dependent anti-τ antibodies, significantly enhanced the PHFτ immunoreactivity of the NFD. These results suggest that each of the phosphorylated epitopes in PHFτ are partially masked by Al binding. Incubation of AD sections with AlCl3 before Morin staining revealed Al accumulation with association to neurofibrillary tangles. Such incubation before immunostaining with the phosphorylation-dependent anti-τ antibodies abolished the immunolabeling of the NFD and this abolition was reversed by the Al chelation. These findings indicate cumulative Al binding to and thereby antigenic masking of the phosphorylated epitopes of PHFτ. Al binding was further documented for electrophoretically-resolved PHFτ on immunoblots, indicating direct Al binding to PHFτ. In vitro aggregation by AlCl3 was observed for PHFτ but was lost on dephosphorylation of PHFτ. Taken together, phosphorylation-dependent and direct PHFτ-Al interaction occurs in the NFD of the AD brain. PMID:10487845

  8. Genome-wide binding site analysis of FAR-RED ELONGATED HYPOCOTYL3 reveals its novel function in Arabidopsis development.

    PubMed

    Ouyang, Xinhao; Li, Jigang; Li, Gang; Li, Bosheng; Chen, Beibei; Shen, Huaishun; Huang, Xi; Mo, Xiaorong; Wan, Xiangyuan; Lin, Rongcheng; Li, Shigui; Wang, Haiyang; Deng, Xing Wang

    2011-07-01

    FAR-RED ELONGATED HYPOCOTYL3 (FHY3) and its homolog FAR-RED IMPAIRED RESPONSE1 (FAR1), two transposase-derived transcription factors, are key components in phytochrome A signaling and the circadian clock. Here, we use chromatin immunoprecipitation-based sequencing (ChIP-seq) to identify 1559 and 1009 FHY3 direct target genes in darkness (D) and far-red (FR) light conditions, respectively, in the Arabidopsis thaliana genome. FHY3 preferentially binds to promoters through the FHY3/FAR1 binding motif (CACGCGC). Interestingly, FHY3 also binds to two motifs in the 178-bp Arabidopsis centromeric repeats. Comparison between the ChIP-seq and microarray data indicates that FHY3 quickly regulates the expression of 197 and 86 genes in D and FR, respectively. FHY3 also coregulates a number of common target genes with PHYTOCHROME INTERACTING FACTOR 3-LIKE5 and ELONGATED HYPOCOTYL5. Moreover, we uncover a role for FHY3 in controlling chloroplast development by directly activating the expression of ACCUMULATION AND REPLICATION OF CHLOROPLASTS5, whose product is a structural component of the latter stages of chloroplast division in Arabidopsis. Taken together, our data suggest that FHY3 regulates multiple facets of plant development, thus providing insights into its functions beyond light and circadian pathways.

  9. Genome wide analysis reveals Zic3 interaction with distal regulatory elements of stage specific developmental genes in zebrafish.

    PubMed

    Winata, Cecilia L; Kondrychyn, Igor; Kumar, Vibhor; Srinivasan, Kandhadayar G; Orlov, Yuriy; Ravishankar, Ashwini; Prabhakar, Shyam; Stanton, Lawrence W; Korzh, Vladimir; Mathavan, Sinnakaruppan

    2013-10-01

    Zic3 regulates early embryonic patterning in vertebrates. Loss of Zic3 function is known to disrupt gastrulation, left-right patterning, and neurogenesis. However, molecular events downstream of this transcription factor are poorly characterized. Here we use the zebrafish as a model to study the developmental role of Zic3 in vivo, by applying a combination of two powerful genomics approaches--ChIP-seq and microarray. Besides confirming direct regulation of previously implicated Zic3 targets of the Nodal and canonical Wnt pathways, analysis of gastrula stage embryos uncovered a number of novel candidate target genes, among which were members of the non-canonical Wnt pathway and the neural pre-pattern genes. A similar analysis in zic3-expressing cells obtained by FACS at segmentation stage revealed a dramatic shift in Zic3 binding site locations and identified an entirely distinct set of target genes associated with later developmental functions such as neural development. We demonstrate cis-regulation of several of these target genes by Zic3 using in vivo enhancer assay. Analysis of Zic3 binding sites revealed a distribution biased towards distal intergenic regions, indicative of a long distance regulatory mechanism; some of these binding sites are highly conserved during evolution and act as functional enhancers. This demonstrated that Zic3 regulation of developmental genes is achieved predominantly through long distance regulatory mechanism and revealed that developmental transitions could be accompanied by dramatic changes in regulatory landscape.

  10. Cloning retinoid and peroxisome proliferator-activated nuclear receptors of the Pacific oyster and in silico binding to environmental chemicals

    PubMed Central

    Vogeler, Susanne; Galloway, Tamara S.; Isupov, Michail

    2017-01-01

    Disruption of nuclear receptors, a transcription factor superfamily regulating gene expression in animals, is one proposed mechanism through which pollution causes effects in aquatic invertebrates. Environmental pollutants have the ability to interfere with the receptor’s functions through direct binding and inducing incorrect signals. Limited knowledge of invertebrate endocrinology and molecular regulatory mechanisms, however, impede the understanding of endocrine disruptive effects in many aquatic invertebrate species. Here, we isolated three nuclear receptors of the Pacific oyster, Crassostrea gigas: two isoforms of the retinoid X receptor, CgRXR-1 and CgRXR-2, a retinoic acid receptor ortholog CgRAR, and a peroxisome proliferator-activated receptor ortholog CgPPAR. Computer modelling of the receptors based on 3D crystal structures of human proteins was used to predict each receptor’s ability to bind to different ligands in silico. CgRXR showed high potential to bind and be activated by 9-cis retinoic acid and the organotin tributyltin (TBT). Computer modelling of CgRAR revealed six residues in the ligand binding domain, which prevent the successful interaction with natural and synthetic retinoid ligands. This supports an existing theory of loss of retinoid binding in molluscan RARs. Modelling of CgPPAR was less reliable due to high discrepancies in sequence to its human ortholog. Yet, there are suggestions of binding to TBT, but not to rosiglitazone. The effect of potential receptor ligands on early oyster development was assessed after 24h of chemical exposure. TBT oxide (0.2μg/l), all-trans retinoic acid (ATRA) (0.06 mg/L) and perfluorooctanoic acid (20 mg/L) showed high effects on development (>74% abnormal developed D-shelled larvae), while rosiglitazone (40 mg/L) showed no effect. The results are discussed in relation to a putative direct (TBT) disruption effect on nuclear receptors. The inability of direct binding of ATRA to CgRAR suggests either a disruptive effect through a pathway excluding nuclear receptors or an indirect interaction. Our findings provide valuable information on potential mechanisms of molluscan nuclear receptors and the effects of environmental pollution on aquatic invertebrates. PMID:28426724

  11. Abnormal prefrontal and parietal activity linked to deficient active binding in working memory in schizophrenia.

    PubMed

    Grot, Stéphanie; Légaré, Virginie Petel; Lipp, Olivier; Soulières, Isabelle; Dolcos, Florin; Luck, David

    2017-10-01

    Working memory deficits have been widely reported in schizophrenia, and may result from inefficient binding processes. These processes, and their neural correlates, remain understudied in schizophrenia. Thus, we designed an FMRI study aimed at investigating the neural correlates of both passive and active binding in working memory in schizophrenia. Nineteen patients with schizophrenia and 23 matched controls were recruited to perform a working memory binding task, in which they were instructed to memorize three letters and three spatial locations. In the passive binding condition, letters and spatial locations were directly presented as bound. Conversely, in the active binding condition, words and spatial locations were presented as separated, and participants were instructed to intentionally create associations between them. Patients exhibited a similar performance to the controls for the passive binding condition, but a significantly lower performance for the active binding. FMRI analyses revealed that this active binding deficit was related to aberrant activity in the posterior parietal cortex and the ventrolateral prefrontal cortex. This study provides initial evidence of a specific deficit for actively binding information in schizophrenia, which is linked to dysfunctions in the neural networks underlying attention, manipulation of information, and encoding strategies. Together, our results suggest that all these dysfunctions may be targets for neuromodulation interventions known to improve cognitive deficits in schizophrenia. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Comparison of crystal structures of human type 3 3α-hydroxysteroid dehydrogenase reveals an “induced-fit” mechanism and a conserved basic motif involved in the binding of androgen

    PubMed Central

    Couture, Jean-François; Pereira De Jésus-Tran, Karine; Roy, Anne-Marie; Cantin, Line; Côté, Pierre-Luc; Legrand, Pierre; Luu-The, Van; Labrie, Fernand; Breton, Rock

    2005-01-01

    The aldo-keto reductase (AKR) human type 3 3α-hydroxysteroid dehydrogenase (h3α–HSD3, AKR1C2) plays a crucial role in the regulation of the intracellular concentrations of testosterone and 5α-dihydrotestosterone (5α-DHT), two steroids directly linked to the etiology and the progression of many prostate diseases and cancer. This enzyme also binds many structurally different molecules such as 4-hydroxynonenal, polycyclic aromatic hydrocarbons, and indanone. To understand the mechanism underlying the plasticity of its substrate-binding site, we solved the binary complex structure of h3α–HSD3-NADP(H) at 1.9 Å resolution. During the refinement process, we found acetate and citrate molecules deeply engulfed in the steroid-binding cavity. Superimposition of this structure with the h3α–HSD3-NADP(H)-testosterone/acetate ternary complex structure reveals that one of themobile loops forming the binding cavity operates a slight contraction movement against the citrate molecule while the side chains of many residues undergo numerous conformational changes, probably to create an optimal binding site for the citrate. These structural changes, which altogether cause a reduction of the substrate-binding cavity volume (from 776 Å3 in the presence of testosterone/acetate to 704 Å3 in the acetate/citratecomplex), are reminiscent of the “induced-fit” mechanism previously proposed for the aldose reductase, another member of the AKR superfamily. We also found that the replacement of residues Arg301 and Arg304, localized near the steroid-binding cavity, significantly affects the 3α–HSD activity of this enzyme toward 5α-DHT and completely abolishes its 17β–HSD activity on 4-dione. All these results have thus been used to reevaluate the binding mode of this enzyme for androgens. PMID:15929998

  13. Solution NMR studies provide structural basis for endotoxin pattern recognition by the innate immune receptor CD14

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Albright, Seth; Chen Bin; Holbrook, Kristen

    CD14 functions as a key pattern recognition receptor for a diverse array of Gram-negative and Gram-positive cell-wall components in the host innate immune response by binding to pathogen-associated molecular patterns (PAMPs) at partially overlapping binding site(s). To determine the potential contribution of CD14 residues in this pattern recognition, we have examined using solution NMR spectroscopy, the binding of three different endotoxin ligands, lipopolysaccharide, lipoteichoic acid, and a PGN-derived compound, muramyl dipeptide to a {sup 15}N isotopically labeled 152-residue N-terminal fragment of sCD14 expressed in Pichia pastoris. Mapping of NMR spectral changes upon addition of ligands revealed that the pattern ofmore » residues affected by binding of each ligand is partially similar and partially different. This first direct structural observation of the ability of specific residue combinations of CD14 to differentially affect endotoxin binding may help explain the broad specificity of CD14 in ligand recognition and provide a structural basis for pattern recognition. Another interesting finding from the observed spectral changes is that the mode of binding may be dynamically modulated and could provide a mechanism for binding endotoxins with structural diversity through a common binding site.« less

  14. Transfer of sulfur from IscS to IscU during Fe/S cluster assembly.

    PubMed

    Urbina, H D; Silberg, J J; Hoff, K G; Vickery, L E

    2001-11-30

    The cysteine desulfurase enzymes NifS and IscS provide sulfur for the biosynthesis of Fe/S proteins. NifU and IscU have been proposed to serve as template or scaffold proteins in the initial Fe/S cluster assembly events, but the mechanism of sulfur transfer from NifS or IscS to NifU or IscU has not been elucidated. We have employed [(35)S]cysteine radiotracer studies to monitor sulfur transfer between IscS and IscU from Escherichia coli and have used direct binding measurements to investigate interactions between the proteins. IscS catalyzed transfer of (35)S from [(35)S]cysteine to IscU in the absence of additional thiol reagents, suggesting that transfer can occur directly and without involvement of an intermediate carrier. Surface plasmon resonance studies and isothermal titration calorimetry measurements further revealed that IscU binds to IscS with high affinity (K(d) approximately 2 microm) in support of a direct transfer mechanism. Transfer was inhibited by treatment of IscU with iodoacetamide, and (35)S was released by reducing reagents, suggesting that transfer of persulfide sulfur occurs to cysteinyl groups of IscU. A deletion mutant of IscS lacking C-terminal residues 376-413 (IscSDelta376-413) displayed cysteine desulfurase activity similar to the full-length protein but exhibited lower binding affinity for IscU, decreased ability to transfer (35)S to IscU, and reduced activity in assays of Fe/S cluster assembly on IscU. The findings with IscSDelta376-413 provide additional support for a mechanism of sulfur transfer involving a direct interaction between IscS and IscU and suggest that the C-terminal region of IscS may be important for binding IscU.

  15. ATRX Directs Binding of PRC2 to Xist RNA and Polycomb Targets

    PubMed Central

    Sarma, Kavitha; Cifuentes-Rojas, Catherine; Ergun, Ayla; del Rosario, Amanda; Jeon, Yesu; White, Forest; Sadreyev, Ruslan; Lee, Jeannie T.

    2015-01-01

    SUMMARY X chromosome inactivation (XCI) depends on the long noncoding RNA Xist and its recruitment of Polycomb Repressive Complex 2 (PRC2). PRC2 is also targeted to other sites throughout the genome to effect transcriptional repression. Using XCI as a model, we apply an unbiased proteomics approach to isolate Xist and PRC2 regulators and identified ATRX. ATRX unexpectedly functions as a high-affinity RNA-binding protein that directly interacts with RepA/Xist RNA to promote loading of PRC2 in vivo. Without ATRX, PRC2 cannot load onto Xist RNA nor spread in cis along the X chromosome. Moreover, epigenomic profiling reveals that genome-wide targeting of PRC2 depends on ATRX, as loss of ATRX leads to spatial redistribution of PRC2 and derepression of Polycomb responsive genes. Thus, ATRX is a required specificity determinant for PRC2 targeting and function. PMID:25417162

  16. Protein-directed self-assembly of a fullerene crystal.

    PubMed

    Kim, Kook-Han; Ko, Dong-Kyun; Kim, Yong-Tae; Kim, Nam Hyeong; Paul, Jaydeep; Zhang, Shao-Qing; Murray, Christopher B; Acharya, Rudresh; DeGrado, William F; Kim, Yong Ho; Grigoryan, Gevorg

    2016-04-26

    Learning to engineer self-assembly would enable the precise organization of molecules by design to create matter with tailored properties. Here we demonstrate that proteins can direct the self-assembly of buckminsterfullerene (C60) into ordered superstructures. A previously engineered tetrameric helical bundle binds C60 in solution, rendering it water soluble. Two tetramers associate with one C60, promoting further organization revealed in a 1.67-Å crystal structure. Fullerene groups occupy periodic lattice sites, sandwiched between two Tyr residues from adjacent tetramers. Strikingly, the assembly exhibits high charge conductance, whereas both the protein-alone crystal and amorphous C60 are electrically insulating. The affinity of C60 for its crystal-binding site is estimated to be in the nanomolar range, with lattices of known protein crystals geometrically compatible with incorporating the motif. Taken together, these findings suggest a new means of organizing fullerene molecules into a rich variety of lattices to generate new properties by design.

  17. Direct observation of TALE protein dynamics reveals a two-state search mechanism

    PubMed Central

    Cuculis, Luke; Abil, Zhanar; Zhao, Huimin; Schroeder, Charles M.

    2015-01-01

    Transcription activator-like effector (TALE) proteins are a class of programmable DNA-binding proteins for which the fundamental mechanisms governing the search process are not fully understood. Here we use single-molecule techniques to directly observe TALE search dynamics along DNA templates. We find that TALE proteins are capable of rapid diffusion along DNA using a combination of sliding and hopping behaviour, which suggests that the TALE search process is governed in part by facilitated diffusion. We also observe that TALE proteins exhibit two distinct modes of action during the search process—a search state and a recognition state—facilitated by different subdomains in monomeric TALE proteins. Using TALE truncation mutants, we further demonstrate that the N-terminal region of TALEs is required for the initial non-specific binding and subsequent rapid search along DNA, whereas the central repeat domain is required for transitioning into the site-specific recognition state. PMID:26027871

  18. Direct observation of TALE protein dynamics reveals a two-state search mechanism.

    PubMed

    Cuculis, Luke; Abil, Zhanar; Zhao, Huimin; Schroeder, Charles M

    2015-06-01

    Transcription activator-like effector (TALE) proteins are a class of programmable DNA-binding proteins for which the fundamental mechanisms governing the search process are not fully understood. Here we use single-molecule techniques to directly observe TALE search dynamics along DNA templates. We find that TALE proteins are capable of rapid diffusion along DNA using a combination of sliding and hopping behaviour, which suggests that the TALE search process is governed in part by facilitated diffusion. We also observe that TALE proteins exhibit two distinct modes of action during the search process-a search state and a recognition state-facilitated by different subdomains in monomeric TALE proteins. Using TALE truncation mutants, we further demonstrate that the N-terminal region of TALEs is required for the initial non-specific binding and subsequent rapid search along DNA, whereas the central repeat domain is required for transitioning into the site-specific recognition state.

  19. Functionality screen of streptavidin mutants by non-denaturing SDS-PAGE using biotin-4-fluorescein.

    PubMed

    Humbert, Nicolas; Ward, Thomas R

    2008-01-01

    Site-directed mutagenesis or directed evolution of proteins often leads to the production of inactive mutants. For streptavidin and related proteins, mutations may lead to the loss of their biotin-binding properties. With high-throughput screening methodologies in mind, it is imperative to detect, prior to the high-density protein production, the bacteria that produce non-functional streptavidin isoforms. Based on the incorporation of biotin-4-fluorescein in streptavidin mutants present in Escherichia coli bacterial extracts, we detail a functional screen that allows the identification of biotin-binding streptavidin variants. Bacteria are cultivated in a small volume, followed by a rapid treatment of the cells; biotin-4-fluorescein is added to the bacterial extract and loaded on an Sodium Dodecyl Sulfate Poly-Acrylamide Gel Electrophoresis (SDS-PAGE) under non-denaturing conditions. Revealing is performed using a UV transilluminator. This screen is thus easy to implement, cheap and requires only readily available equipment.

  20. The Bacterial Response Regulator ArcA Uses a Diverse Binding Site Architecture to Regulate Carbon Oxidation Globally

    PubMed Central

    Park, Dan M.; Akhtar, Md. Sohail; Ansari, Aseem Z.; Landick, Robert; Kiley, Patricia J.

    2013-01-01

    Despite the importance of maintaining redox homeostasis for cellular viability, how cells control redox balance globally is poorly understood. Here we provide new mechanistic insight into how the balance between reduced and oxidized electron carriers is regulated at the level of gene expression by mapping the regulon of the response regulator ArcA from Escherichia coli, which responds to the quinone/quinol redox couple via its membrane-bound sensor kinase, ArcB. Our genome-wide analysis reveals that ArcA reprograms metabolism under anaerobic conditions such that carbon oxidation pathways that recycle redox carriers via respiration are transcriptionally repressed by ArcA. We propose that this strategy favors use of catabolic pathways that recycle redox carriers via fermentation akin to lactate production in mammalian cells. Unexpectedly, bioinformatic analysis of the sequences bound by ArcA in ChIP-seq revealed that most ArcA binding sites contain additional direct repeat elements beyond the two required for binding an ArcA dimer. DNase I footprinting assays suggest that non-canonical arrangements of cis-regulatory modules dictate both the length and concentration-sensitive occupancy of DNA sites. We propose that this plasticity in ArcA binding site architecture provides both an efficient means of encoding binding sites for ArcA, σ70-RNAP and perhaps other transcription factors within the same narrow sequence space and an effective mechanism for global control of carbon metabolism to maintain redox homeostasis. PMID:24146625

  1. Direct interaction of SRY-related protein SOX9 and steroidogenic factor 1 regulates transcription of the human anti-Müllerian hormone gene.

    PubMed

    De Santa Barbara, P; Bonneaud, N; Boizet, B; Desclozeaux, M; Moniot, B; Sudbeck, P; Scherer, G; Poulat, F; Berta, P

    1998-11-01

    For proper male sexual differentiation, anti-Müllerian hormone (AMH) must be tightly regulated during embryonic development to promote regression of the Müllerian duct. However, the molecular mechanisms specifying the onset of AMH in male mammals are not yet clearly defined. A DNA-binding element for the steroidogenic factor 1 (SF-1), a member of the orphan nuclear receptor family, located in the AMH proximal promoter has recently been characterized and demonstrated as being essential for AMH gene activation. However, the requirement for a specific promoter environment for SF-1 activation as well as the presence of conserved cis DNA-binding elements in the AMH promoter suggest that SF-1 is a member of a combinatorial protein-protein and protein-DNA complex. In this study, we demonstrate that the canonical SOX-binding site within the human AMH proximal promoter can bind the transcription factor SOX9, a Sertoli cell factor closely associated with Sertoli cell differentiation and AMH expression. Transfection studies with COS-7 cells revealed that SOX9 can cooperate with SF-1 in this activation process. In vitro and in vivo protein-binding studies indicate that SOX9 and SF-1 interact directly via the SOX9 DNA-binding domain and the SF-1 C-terminal region, respectively. We propose that the two transcription factors SOX9 and SF-1 could both be involved in the expression of the AMH gene, in part as a result of their respective binding to the AMH promoter and in part because of their ability to interact with each other. Our work thus identifies SOX9 as an interaction partner of SF-1 that could be involved in the Sertoli cell-specific expression of AMH during embryogenesis.

  2. Direct Interaction of SRY-Related Protein SOX9 and Steroidogenic Factor 1 Regulates Transcription of the Human Anti-Müllerian Hormone Gene

    PubMed Central

    De Santa Barbara, Pascal; Bonneaud, Nathalie; Boizet, Brigitte; Desclozeaux, Marion; Moniot, Brigitte; Sudbeck, Peter; Scherer, Gerd; Poulat, Francis; Berta, Philippe

    1998-01-01

    For proper male sexual differentiation, anti-Müllerian hormone (AMH) must be tightly regulated during embryonic development to promote regression of the Müllerian duct. However, the molecular mechanisms specifying the onset of AMH in male mammals are not yet clearly defined. A DNA-binding element for the steroidogenic factor 1 (SF-1), a member of the orphan nuclear receptor family, located in the AMH proximal promoter has recently been characterized and demonstrated as being essential for AMH gene activation. However, the requirement for a specific promoter environment for SF-1 activation as well as the presence of conserved cis DNA-binding elements in the AMH promoter suggest that SF-1 is a member of a combinatorial protein-protein and protein-DNA complex. In this study, we demonstrate that the canonical SOX-binding site within the human AMH proximal promoter can bind the transcription factor SOX9, a Sertoli cell factor closely associated with Sertoli cell differentiation and AMH expression. Transfection studies with COS-7 cells revealed that SOX9 can cooperate with SF-1 in this activation process. In vitro and in vivo protein-binding studies indicate that SOX9 and SF-1 interact directly via the SOX9 DNA-binding domain and the SF-1 C-terminal region, respectively. We propose that the two transcription factors SOX9 and SF-1 could both be involved in the expression of the AMH gene, in part as a result of their respective binding to the AMH promoter and in part because of their ability to interact with each other. Our work thus identifies SOX9 as an interaction partner of SF-1 that could be involved in the Sertoli cell-specific expression of AMH during embryogenesis. PMID:9774680

  3. Competition between Ski and CREB-binding protein for binding to Smad proteins in transforming growth factor-beta signaling.

    PubMed

    Chen, Weijun; Lam, Suvana S; Srinath, Hema; Schiffer, Celia A; Royer, William E; Lin, Kai

    2007-04-13

    The family of Smad proteins mediates transforming growth factor-beta (TGF-beta) signaling in cell growth and differentiation. Smads repress or activate TGF-beta signaling by interacting with corepressors (e.g. Ski) or coactivators (e.g. CREB-binding protein (CBP)), respectively. Specifically, Ski has been shown to interfere with the interaction between Smad3 and CBP. However, it is unclear whether Ski competes with CBP for binding to Smads and whether they can interact with Smad3 at the same binding surface on Smad3. We investigated the interactions among purified constructs of Smad, Ski, and CBP in vitro by size-exclusion chromatography, isothermal titration calorimetry, and mutational studies. Here, we show that Ski-(16-192) interacted directly with a homotrimer of receptor-regulated Smad protein (R-Smad), e.g. Smad2 or Smad3, to form a hexamer; Ski-(16-192) interacted with an R-Smad.Smad4 heterotrimer to form a pentamer. CBP-(1941-1992) was also found to interact directly with an R-Smad homotrimer to form a hexamer and with an R-Smad.Smad4 heterotrimer to form a pentamer. Moreover, these domains of Ski and CBP competed with each other for binding to Smad3. Our mutational studies revealed that domains of Ski and CBP interacted with Smad3 at a portion of the binding surface of the Smad anchor for receptor activation. Our results suggest that Ski negatively regulates TGF-beta signaling by replacing CBP in R-Smad complexes. Our working model suggests that Smad protein activity is delicately balanced by Ski and CBP in the TGF-beta pathway.

  4. Structures of the flax-rust effector AvrM reveal insights into the molecular basis of plant-cell entry and effector-triggered immunity.

    PubMed

    Ve, Thomas; Williams, Simon J; Catanzariti, Ann-Maree; Rafiqi, Maryam; Rahman, Motiur; Ellis, Jeffrey G; Hardham, Adrienne R; Jones, David A; Anderson, Peter A; Dodds, Peter N; Kobe, Bostjan

    2013-10-22

    Fungal and oomycete pathogens cause some of the most devastating diseases in crop plants, and facilitate infection by delivering a large number of effector molecules into the plant cell. AvrM is a secreted effector protein from flax rust (Melampsora lini) that can internalize into plant cells in the absence of the pathogen, binds to phosphoinositides (PIPs), and is recognized directly by the resistance protein M in flax (Linum usitatissimum), resulting in effector-triggered immunity. We determined the crystal structures of two naturally occurring variants of AvrM, AvrM-A and avrM, and both reveal an L-shaped fold consisting of a tandem duplicated four-helix motif, which displays similarity to the WY domain core in oomycete effectors. In the crystals, both AvrM variants form a dimer with an unusual nonglobular shape. Our functional analysis of AvrM reveals that a hydrophobic surface patch conserved between both variants is required for internalization into plant cells, whereas the C-terminal coiled-coil domain mediates interaction with M. AvrM binding to PIPs is dependent on positive surface charges, and mutations that abrogate PIP binding have no significant effect on internalization, suggesting that AvrM binding to PIPs is not essential for transport of AvrM across the plant membrane. The structure of AvrM and the identification of functionally important surface regions advance our understanding of the molecular mechanisms underlying how effectors enter plant cells and how they are detected by the plant immune system.

  5. The role of monovalent cations in the ATPase reaction of DNA gyrase

    PubMed Central

    Hearnshaw, Stephen James; Chung, Terence Tsz-Hong; Stevenson, Clare Elizabeth Mary; Maxwell, Anthony; Lawson, David Mark

    2015-01-01

    Four new crystal structures of the ATPase domain of the GyrB subunit of Escherichia coli DNA gyrase have been determined. One of these, solved in the presence of K+, is the highest resolution structure reported so far for this domain and, in conjunction with the three other structures, reveals new insights into the function of this domain. Evidence is provided for the existence of two monovalent cation-binding sites: site 1, which preferentially binds a K+ ion that interacts directly with the α-phosphate of ATP, and site 2, which preferentially binds an Na+ ion and the functional significance of which is not clear. The crystallographic data are corroborated by ATPase data, and the structures are compared with those of homologues to investigate the broader conservation of these sites. PMID:25849408

  6. Uncoupling PIP2-calmodulin regulation of Kv7.2 channels by an assembly destabilizing epileptogenic mutation.

    PubMed

    Alberdi, Araitz; Gomis-Perez, Carolina; Bernardo-Seisdedos, Ganeko; Alaimo, Alessandro; Malo, Covadonga; Aldaregia, Juncal; Lopez-Robles, Carlos; Areso, Pilar; Butz, Elisabeth; Wahl-Schott, Christian; Villarroel, Alvaro

    2015-11-01

    We show that the combination of an intracellular bi-partite calmodulin (CaM)-binding site and a distant assembly region affect how an ion channel is regulated by a membrane lipid. Our data reveal that regulation by phosphatidylinositol(4,5)bisphosphate (PIP2) and stabilization of assembled Kv7.2 subunits by intracellular coiled-coil regions far from the membrane are coupled molecular processes. Live-cell fluorescence energy transfer measurements and direct binding studies indicate that remote coiled-coil formation creates conditions for different CaM interaction modes, each conferring different PIP2 dependency to Kv7.2 channels. Disruption of coiled-coil formation by epilepsy-causing mutation decreases apparent CaM-binding affinity and interrupts CaM influence on PIP2 sensitivity. © 2015. Published by The Company of Biologists Ltd.

  7. Proflavine acts as a Rev inhibitor by targeting the high-affinity Rev binding site of the Rev responsive element of HIV-1.

    PubMed

    DeJong, Eric S; Chang, Chia-en; Gilson, Michael K; Marino, John P

    2003-07-08

    Rev is an essential regulatory HIV-1 protein that binds the Rev responsive element (RRE) within the env gene of the HIV-1 RNA genome, activating the switch between viral latency and active viral replication. Previously, we have shown that selective incorporation of the fluorescent probe 2-aminopurine (2-AP) into a truncated form of the RRE sequence (RRE-IIB) allowed the binding of an arginine-rich peptide derived from Rev and aminoglycosides to be characterized directly by fluorescence methods. Using these fluorescence and nuclear magnetic resonance (NMR) methods, proflavine has been identified, through a limited screen of selected small heterocyclic compounds, as a specific and high-affinity RRE-IIB binder which inhibits the interaction of the Rev peptide with RRE-IIB. Direct and competitive 2-AP fluorescence binding assays reveal that there are at least two classes of proflavine binding sites on RRE-IIB: a high-affinity site that competes with the Rev peptide for binding to RRE-IIB (K(D) approximately 0.1 +/- 0.05 microM) and a weaker binding site(s) (K(D) approximately 1.1 +/- 0.05 microM). Titrations of RRE-IIB with proflavine, monitored using (1)H NMR, demonstrate that the high-affinity proflavine binding interaction occurs with a 2:1 (proflavine:RRE-IIB) stoichiometry, and NOEs observed in the NOESY spectrum of the 2:1 proflavine.RRE-IIB complex indicate that the two proflavine molecules bind specifically and close to each other within a single binding site. NOESY data further indicate that formation of the 2:1 proflavine.RRE-IIB complex stabilizes base pairing and stacking within the internal purine-rich bulge of RRE-IIB in a manner analogous to what has been observed in the Rev peptide.RRE-IIB complex. The observation that proflavine competes with Rev for binding to RRE-IIB by binding as a dimer to a single high-affinity site opens the possibility for rational drug design based on linking and modifying it and related compounds.

  8. Selective Photoaffinity Labeling Identifies the Signal Peptide Binding Domain on SecA

    PubMed Central

    Musial-Siwek, Monika; Rusch, Sharyn L.; Kendall, Debra A.

    2007-01-01

    SecA, an ATPase crucial to the Sec-dependent translocation machinery in Escherichia coli, recognizes and directly binds the N-terminal signal peptide of an exported preprotein. This interaction plays a central role in the targeting and transport of preproteins via the SecYEG channel. Here we identify the Signal Peptide Binding Groove (SPBG) on SecA addressing a key issue regarding the SecA-preprotein interaction. We employ a synthetic signal peptide containing the photoreactive benzoylphenylalanine to efficiently and specifically label SecA containing a unique Factor Xa site. Comparison of the photolabeled fragment from the subsequent proteolysis of several SecAs, which vary only in the location of the Factor Xa site, reveals one 53-residue segment in common with the entire series. The covalently modified SecA segment produced is the same in aqueous solution and in lipid vesicles. This spans amino acids 269 to 322 of the E. coli protein, which is distinct from a previously proposed signal peptide binding site, and contributes to a hydrophobic peptide binding groove evident in molecular models of SecA. PMID:17084862

  9. A single mutation in Taiwanese H6N1 influenza hemagglutinin switches binding to human-type receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    de Vries, Robert P.; Tzarum, Netanel; Peng, Wenjie

    In June 2013, the first case of human infection with an avian H6N1 virus was reported in a Taiwanese woman. Although this was a single non-fatal case, the virus continues to circulate in Taiwanese poultry. As with any emerging avian virus that infects humans, there is concern that acquisition of human-type receptor specificity could enable transmission in the human population. Despite mutations in the receptor-binding pocket of the human H6N1 isolate, it has retained avian-type (NeuAcα2-3Gal) receptor specificity. However, we show here that a single nucleotide substitution, resulting in a change from Gly to Asp at position 225 (G225D), completelymore » switches specificity to human-type (NeuAcα2-6Gal) receptors. Significantly, G225D H6 loses binding to chicken trachea epithelium and is now able to bind to human tracheal tissue. Structural analysis reveals that Asp225 directly interacts with the penultimate Gal of the human-type receptor, stabilizing human receptor binding.« less

  10. Mapping the ER Interactome: The P Domains of Calnexin and Calreticulin as Plurivalent Adapters for Foldases and Chaperones.

    PubMed

    Kozlov, Guennadi; Muñoz-Escobar, Juliana; Castro, Karla; Gehring, Kalle

    2017-09-05

    The lectin chaperones calreticulin (CRT) and calnexin (CNX) contribute to the folding of glycoproteins in the ER by recruiting foldases such as the protein disulfide isomerase ERp57 and the peptidyl prolyl cis-trans isomerase CypB. Recently, CRT was shown to interact with the chaperone ERp29. Here, we show that ERp29 directly binds to the P domain of CNX. Crystal structures of the D domain of ERp29 in complex with the P domains from CRT and calmegin, a tissue-specific CNX homolog, reveal a commonality in the mechanism of binding whereby the tip of the P domain functions as a plurivalent adapter to bind a variety of folding factors. We show that mutation of a single residue, D348 in CNX, abrogates binding to ERp29 as well as ERp57 and CypB. The structural diversity of the accessory factors suggests that these chaperones became specialized for glycoprotein folding through convergent evolution of their P-domain binding sites. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Molecular coevolution of mammalian ribosomal gene terminator sequences and the transcription termination factor TTF-I.

    PubMed Central

    Evers, R; Grummt, I

    1995-01-01

    Both the DNA elements and the nuclear factors that direct termination of ribosomal gene transcription exhibit species-specific differences. Even between mammals--e.g., human and mouse--the termination signals are not identical and the respective transcription termination factors (TTFs) which bind to the terminator sequence are not fully interchangeable. To elucidate the molecular basis for this species-specificity, we have cloned TTF-I from human and mouse cells and compared their structural and functional properties. Recombinant TTF-I exhibits species-specific DNA binding and terminates transcription both in cell-free transcription assays and in transfection experiments. Chimeric constructs of mouse TTF-I and human TTF-I reveal that the major determinant for species-specific DNA binding resides within the C terminus of TTF-I. Replacing 31 C-terminal amino acids of mouse TTF-I with the homologous human sequences relaxes the DNA-binding specificity and, as a consequence, allows the chimeric factor to bind the human terminator sequence and to specifically stop rDNA transcription. Images Fig. 2 Fig. 3 Fig. 4 PMID:7597036

  12. Cdc13 N-Terminal Dimerization DNA Binding and Telomere Length Regulation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    M Mitchell; J Smith; M Mason

    The essential yeast protein Cdc13 facilitates chromosome end replication by recruiting telomerase to telomeres, and together with its interacting partners Stn1 and Ten1, it protects chromosome ends from nucleolytic attack, thus contributing to genome integrity. Although Cdc13 has been studied extensively, the precise role of its N-terminal domain (Cdc13N) in telomere length regulation remains unclear. Here we present a structural, biochemical, and functional characterization of Cdc13N. The structure reveals that this domain comprises an oligonucleotide/oligosaccharide binding (OB) fold and is involved in Cdc13 dimerization. Biochemical data show that Cdc13N weakly binds long, single-stranded, telomeric DNA in a fashion that ismore » directly dependent on domain oligomerization. When introduced into full-length Cdc13 in vivo, point mutations that prevented Cdc13N dimerization or DNA binding caused telomere shortening or lengthening, respectively. The multiple DNA binding domains and dimeric nature of Cdc13 offer unique insights into how it coordinates the recruitment and regulation of telomerase access to the telomeres.« less

  13. Translation repression via modulation of the cytoplasmic poly(A)-binding protein in the inflammatory response

    PubMed Central

    Zhang, Xu; Chen, Xiaoli; Liu, Qiuying; Zhang, Shaojie; Hu, Wenqian

    2017-01-01

    Gene expression is precisely regulated during the inflammatory response to control infection and limit the detrimental effects of inflammation. Here, we profiled global mRNA translation dynamics in the mouse primary macrophage-mediated inflammatory response and identified hundreds of differentially translated mRNAs. These mRNAs’ 3’UTRs have enriched binding motifs for several RNA-binding proteins, which implies extensive translational regulatory networks. We characterized one such protein, Zfp36, as a translation repressor. Using primary macrophages from a Zfp36-V5 epitope tagged knock-in mouse generated by CRISPR/Cas9-mediated genome editing, we found that the endogenous Zfp36 directly interacts with the cytoplasmic poly(A)-binding protein. Importantly, this interaction is required for the translational repression of Zfp36’s target mRNAs in resolving inflammation. Altogether, these results uncovered critical roles of translational regulations in controlling appropriate gene expression during the inflammatory response and revealed a new biologically relevant molecular mechanism of translational repression via modulating the cytoplasmic poly(A)-binding protein. DOI: http://dx.doi.org/10.7554/eLife.27786.001 PMID:28635594

  14. A novel progesterone receptor membrane component (PGRMC) in the human and swine parasite Taenia solium: implications to the host-parasite relationship.

    PubMed

    Aguilar-Díaz, Hugo; Nava-Castro, Karen E; Escobedo, Galileo; Domínguez-Ramírez, Lenin; García-Varela, Martín; Del Río-Araiza, Víctor H; Palacios-Arreola, Margarita I; Morales-Montor, Jorge

    2018-03-09

    We have previously reported that progesterone (P 4 ) has a direct in vitro effect on the scolex evagination and growth of Taenia solium cysticerci. Here, we explored the hypothesis that the P 4 direct effect on T. solium might be mediated by a novel steroid-binding parasite protein. By way of using immunofluorescent confocal microscopy, flow cytometry analysis, double-dimension electrophoresis analysis, and sequencing the corresponding protein spot, we detected a novel PGRMC in T. solium. Molecular modeling studies accompanied by computer docking using the sequenced protein, together with phylogenetic analysis and sequence alignment clearly demonstrated that T. solium PGRMC is from parasite origin. Our results show that P 4 in vitro increases parasite evagination and scolex size. Using immunofluorescent confocal microscopy, we detected that parasite cells showed expression of a P 4 -binding like protein exclusively located at the cysticercus subtegumental tissue. Presence of the P 4 -binding protein in cyst cells was also confirmed by flow cytometry. Double-dimension electrophoresis analysis, followed by sequencing the corresponding protein spot, revealed a protein that was previously reported in the T. solium genome belonging to a membrane-associated progesterone receptor component (PGRMC). Molecular modeling studies accompanied by computer docking using the sequenced protein showed that PGRMC is potentially able to bind steroid hormones such as progesterone, estradiol, testosterone and dihydrodrotestosterone with different affinities. Phylogenetic analysis and sequence alignment clearly demonstrated that T. solium PGRMC is related to a steroid-binding protein of Echinoccocus granulosus, both of them being nested within a cluster including similar proteins present in platyhelminths such as Schistocephalus solidus and Schistosoma haematobium. Progesterone may directly act upon T. solium cysticerci probably by binding to PGRMC. This research has implications in the field of host-parasite co-evolution as well as the sex-associated susceptibility to this infection. In a more practical matter, present results may contribute to the molecular design of new drugs with anti-parasite actions.

  15. Mannan-binding lectin directly interacts with Toll-like receptor 4 and suppresses lipopolysaccharide-induced inflammatory cytokine secretion from THP-1 cells

    PubMed Central

    Wang, Mingyong; Chen, Yue; Zhang, Yani; Zhang, Liyun; Lu, Xiao; Chen, Zhengliang

    2011-01-01

    Mannan-binding lectin (MBL) plays a key role in the lectin pathway of complement activation and can influence cytokine expression. Toll-like receptor 4 (TLR4) is expressed extensively and has been demonstrated to be involved in lipopolysaccharide (LPS)-induced signaling. We first sought to determine whether MBL exposure could modulate LPS-induced inflammatory cytokine secretion and nuclear factor-κB (NF-κB) activity by using the monocytoid cell line THP-1. We then investigated the possible mechanisms underlying any observed regulatory effect. Using ELISA and reverse transcriptase polymerase chain reaction (RT-PCR) analysis, we found that at both the protein and mRNA levels, treatment with MBL suppresses LPS-induced tumor-necrosis factor (TNF)-α and IL-12 production in THP-1 cells. An electrophoretic mobility shift assay and western blot analysis revealed that MBL treatment can inhibit LPS-induced NF-κB DNA binding and translocation in THP-1 cells. While the binding of MBL to THP-1 cells was evident at physiological calcium concentrations, this binding occurred optimally in response to supraphysiological calcium concentrations. This binding can be partly inhibited by treatment with either a soluble form of recombinant TLR4 extracellular domain or anti-TLR4 monoclonal antibody (HTA125). Activation of THP-1 cells by LPS treatment resulted in increased MBL binding. We also observed that MBL could directly bind to the extracellular domain of TLR4 in a dose-dependent manner, and this interaction could attenuate the binding of LPS to cell surfaces. Taken together, these data suggest that MBL may affect cytokine expression through modulation of LPS-/TLR-signaling pathways. These findings suggest that MBL may play an important role in both immune regulation and the signaling pathways involved in cytokine networks. PMID:21383675

  16. Structural Basis for the ABO Blood-Group Dependence of Plasmodium falciparum Rosetting

    PubMed Central

    Hessel, Audrey; Raynal, Bertrand; England, Patrick; Cohen, Jacques H.; Bertrand, Olivier; Peyrard, Thierry; Bentley, Graham A.; Lewit-Bentley, Anita; Mercereau-Puijalon, Odile

    2012-01-01

    The ABO blood group influences susceptibility to severe Plasmodium falciparum malaria. Recent evidence indicates that the protective effect of group O operates by virtue of reduced rosetting of infected red blood cells (iRBCs) with uninfected RBCs. Rosetting is mediated by a subgroup of PfEMP1 adhesins, with RBC binding being assigned to the N-terminal DBL1α1 domain. Here, we identify the ABO blood group as the main receptor for VarO rosetting, with a marked preference for group A over group B, which in turn is preferred to group O RBCs. We show that recombinant NTS-DBL1α1 and NTS-DBL1α1-CIDR1γ reproduce the VarO-iRBC blood group preference and document direct binding to blood group trisaccharides by surface plasmon resonance. More detailed RBC subgroup analysis showed preferred binding to group A1, weaker binding to groups A2 and B, and least binding to groups Ax and O. The 2.8 Å resolution crystal structure of the PfEMP1-VarO Head region, NTS-DBL1α1-CIDR1γ, reveals extensive contacts between the DBL1α1 and CIDR1γ and shows that the NTS-DBL1α1 hinge region is essential for RBC binding. Computer docking of the blood group trisaccharides and subsequent site-directed mutagenesis localized the RBC-binding site to the face opposite to the heparin-binding site of NTS-DBLα1. RBC binding involves residues that are conserved between rosette-forming PfEMP1 adhesins, opening novel opportunities for intervention against severe malaria. By deciphering the structural basis of blood group preferences in rosetting, we provide a link between ABO blood grouppolymorphisms and rosette-forming adhesins, consistent with the selective role of falciparum malaria on human genetic makeup. PMID:22807674

  17. Genome-wide characterization reveals complex interplay between TP53 and TP63 in response to genotoxic stress

    PubMed Central

    McDade, Simon S.; Patel, Daksha; Moran, Michael; Campbell, James; Fenwick, Kerry; Kozarewa, Iwanka; Orr, Nicholas J.; Lord, Christopher J.; Ashworth, Alan A.; McCance, Dennis J.

    2014-01-01

    In response to genotoxic stress the TP53 tumour suppressor activates target gene expression to induce cell cycle arrest or apoptosis depending on the extent of DNA damage. These canonical activities can be repressed by TP63 in normal stratifying epithelia to maintain proliferative capacity or drive proliferation of squamous cell carcinomas, where TP63 is frequently overexpressed/amplified. Here we use ChIP-sequencing, integrated with microarray analysis, to define the genome-wide interplay between TP53 and TP63 in response to genotoxic stress in normal cells. We reveal that TP53 and TP63 bind to overlapping, but distinct cistromes of sites through utilization of distinctive consensus motifs and that TP53 is constitutively bound to a number of sites. We demonstrate that cisplatin and adriamycin elicit distinct effects on TP53 and TP63 binding events, through which TP53 can induce or repress transcription of an extensive network of genes by direct binding and/or modulation of TP63 activity. Collectively, this results in a global TP53-dependent repression of cell cycle progression, mitosis and DNA damage repair concomitant with activation of anti-proliferative and pro-apoptotic canonical target genes. Further analyses reveal that in the absence of genotoxic stress TP63 plays an important role in maintaining expression of DNA repair genes, loss of which results in defective repair. PMID:24823795

  18. A Potent and Broad Neutralizing Antibody Recognizes and Penetrates the HIV Glycan Shield

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pejchal, Robert; Doores, Katie J.; Walker, Laura M.

    The HIV envelope (Env) protein gp120 is protected from antibody recognition by a dense glycan shield. However, several of the recently identified PGT broadly neutralizing antibodies appear to interact directly with the HIV glycan coat. Crystal structures of antigen-binding fragments (Fabs) PGT 127 and 128 with Man{sub 9} at 1.65 and 1.29 angstrom resolution, respectively, and glycan binding data delineate a specific high mannose-binding site. Fab PGT 128 complexed with a fully glycosylated gp120 outer domain at 3.25 angstroms reveals that the antibody penetrates the glycan shield and recognizes two conserved glycans as well as a short {beta}-strand segment ofmore » the gp120 V3 loop, accounting for its high binding affinity and broad specificify. Furthermore, our data suggest that the high neutralization potency of PGT 127 and 128 immunoglobulin Gs may be mediated by cross-linking Env trimers on the viral surface.« less

  19. Structure and electronic properties of ion pairs accompanying cyclic morpholinium cation and alkylphosphite anion based ionic liquids

    NASA Astrophysics Data System (ADS)

    Verma, Prakash L.; Singh, Priti; Gejji, Shridhar P.

    2017-07-01

    Molecular insights for the formation of ion pairs accompanying the cyclic ammonium cation based room temperature ionic liquids (RTILs) composed of alkyl substituted N-methylmorpholinium (RMMor) and alkylphosphite [(Rsbnd O)2PHdbnd O] (Rdbnd ethyl, butyl, hexyl, octyl) anion have been derived from the M06-2x level of theory. Electronic structures, binding energies, and spectral characteristics of the ion pairs underlying these RTILs have been characterized. The ion pair formation is largely governed by Csbnd H⋯O and other intermolecular interactions. Calculated binding energies increase with the increasing alkyl chain on either cation or alkylphosphite anion. The cation-anion binding reveals signature in the frequency down-(red) shift of the characteristic anionic Pdbnd O stretching whereas the Psbnd H stretching exhibits a shift in the opposite direction in vibrational spectra which has further been rationalized through molecular electron density topography. Correlations of measured electrochemical stability with the separation of frontier orbital energies and binding energies in the ion pairs have further been established.

  20. Enterocyte fatty acid-binding proteins (FABPs): different functions of liver and intestinal FABPs in the intestine.

    PubMed

    Gajda, Angela M; Storch, Judith

    2015-02-01

    Fatty acid-binding proteins (FABP) are highly abundant cytosolic proteins that are expressed in most mammalian tissues. In the intestinal enterocyte, both liver- (LFABP; FABP1) and intestinal FABPs (IFABP; FABP2) are expressed. These proteins display high-affinity binding for long-chain fatty acids (FA) and other hydrophobic ligands; thus, they are believed to be involved with uptake and trafficking of lipids in the intestine. In vitro studies have identified differences in ligand-binding stoichiometry and specificity, and in mechanisms of FA transfer to membranes, and it has been hypothesized that LFABP and IFABP have different functions in the enterocyte. Studies directly comparing LFABP- and IFABP-null mice have revealed markedly different phenotypes, indicating that these proteins indeed have different functions in intestinal lipid metabolism and whole body energy homeostasis. In this review, we discuss the evolving knowledge of the functions of LFABP and IFABP in the intestinal enterocyte. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Selective class IIa histone deacetylase inhibition via a nonchelating zinc-binding group.

    PubMed

    Lobera, Mercedes; Madauss, Kevin P; Pohlhaus, Denise T; Wright, Quentin G; Trocha, Mark; Schmidt, Darby R; Baloglu, Erkan; Trump, Ryan P; Head, Martha S; Hofmann, Glenn A; Murray-Thompson, Monique; Schwartz, Benjamin; Chakravorty, Subhas; Wu, Zining; Mander, Palwinder K; Kruidenier, Laurens; Reid, Robert A; Burkhart, William; Turunen, Brandon J; Rong, James X; Wagner, Craig; Moyer, Mary B; Wells, Carrow; Hong, Xuan; Moore, John T; Williams, Jon D; Soler, Dulce; Ghosh, Shomir; Nolan, Michael A

    2013-05-01

    In contrast to studies on class I histone deacetylase (HDAC) inhibitors, the elucidation of the molecular mechanisms and therapeutic potential of class IIa HDACs (HDAC4, HDAC5, HDAC7 and HDAC9) is impaired by the lack of potent and selective chemical probes. Here we report the discovery of inhibitors that fill this void with an unprecedented metal-binding group, trifluoromethyloxadiazole (TFMO), which circumvents the selectivity and pharmacologic liabilities of hydroxamates. We confirm direct metal binding of the TFMO through crystallographic approaches and use chemoproteomics to demonstrate the superior selectivity of the TFMO series relative to a hydroxamate-substituted analog. We further apply these tool compounds to reveal gene regulation dependent on the catalytic active site of class IIa HDACs. The discovery of these inhibitors challenges the design process for targeting metalloenzymes through a chelating metal-binding group and suggests therapeutic potential for class IIa HDAC enzyme blockers distinct in mechanism and application compared to current HDAC inhibitors.

  2. An allosteric conduit facilitates dynamic multisite substrate recognition by the SCFCdc4 ubiquitin ligase

    NASA Astrophysics Data System (ADS)

    Csizmok, Veronika; Orlicky, Stephen; Cheng, Jing; Song, Jianhui; Bah, Alaji; Delgoshaie, Neda; Lin, Hong; Mittag, Tanja; Sicheri, Frank; Chan, Hue Sun; Tyers, Mike; Forman-Kay, Julie D.

    2017-01-01

    The ubiquitin ligase SCFCdc4 mediates phosphorylation-dependent elimination of numerous substrates by binding one or more Cdc4 phosphodegrons (CPDs). Methyl-based NMR analysis of the Cdc4 WD40 domain demonstrates that Cyclin E, Sic1 and Ash1 degrons have variable effects on the primary Cdc4WD40 binding pocket. Unexpectedly, a Sic1-derived multi-CPD substrate (pSic1) perturbs methyls around a previously documented allosteric binding site for the chemical inhibitor SCF-I2. NMR cross-saturation experiments confirm direct contact between pSic1 and the allosteric pocket. Phosphopeptide affinity measurements reveal negative allosteric communication between the primary CPD and allosteric pockets. Mathematical modelling indicates that the allosteric pocket may enhance ultrasensitivity by tethering pSic1 to Cdc4. These results suggest negative allosteric interaction between two distinct binding pockets on the Cdc4WD40 domain may facilitate dynamic exchange of multiple CPD sites to confer ultrasensitive dependence on substrate phosphorylation.

  3. Mechanistic insights into metal ion activation and operator recognition by the ferric uptake regulator

    NASA Astrophysics Data System (ADS)

    Deng, Zengqin; Wang, Qing; Liu, Zhao; Zhang, Manfeng; Machado, Ana Carolina Dantas; Chiu, Tsu-Pei; Feng, Chong; Zhang, Qi; Yu, Lin; Qi, Lei; Zheng, Jiangge; Wang, Xu; Huo, Xinmei; Qi, Xiaoxuan; Li, Xiaorong; Wu, Wei; Rohs, Remo; Li, Ying; Chen, Zhongzhou

    2015-07-01

    Ferric uptake regulator (Fur) plays a key role in the iron homeostasis of prokaryotes, such as bacterial pathogens, but the molecular mechanisms and structural basis of Fur-DNA binding remain incompletely understood. Here, we report high-resolution structures of Magnetospirillum gryphiswaldense MSR-1 Fur in four different states: apo-Fur, holo-Fur, the Fur-feoAB1 operator complex and the Fur-Pseudomonas aeruginosa Fur box complex. Apo-Fur is a transition metal ion-independent dimer whose binding induces profound conformational changes and confers DNA-binding ability. Structural characterization, mutagenesis, biochemistry and in vivo data reveal that Fur recognizes DNA by using a combination of base readout through direct contacts in the major groove and shape readout through recognition of the minor-groove electrostatic potential by lysine. The resulting conformational plasticity enables Fur binding to diverse substrates. Our results provide insights into metal ion activation and substrate recognition by Fur that suggest pathways to engineer magnetotactic bacteria and antipathogenic drugs.

  4. Electrostatic forces govern the binding mechanism of intrinsically disordered histone chaperones

    PubMed Central

    Liu, Chuanbo; Wang, Tianshu; Bai, Yawen; Wang, Jin

    2017-01-01

    A unified picture to understand the protein recognition and function must include the native binding complex structure ensembles and the underlying binding mechanisms involved in specific biological processes. However, quantifications of both binding complex structures and dynamical mechanisms are still challenging for IDP. In this study, we have investigated the underlying molecular mechanism of the chaperone Chz1 and histone H2A.Z-H2B association by equilibrium and kinetic stopped-flow fluorescence spectroscopy. The dependence of free energy and kinetic rate constant on electrolyte mean activity coefficient and urea concentration are uncovered. Our results indicate a previous unseen binding kinetic intermediate. An initial conformation selection step of Chz1 is also revealed before the formation of this intermediate state. Based on these observations, a mixed mechanism of three steps including both conformation selection and induced fit is proposed. By combination of the ion- and denaturant-induced experiments, we demonstrate that electrostatic forces play a dominant role in the recognition of bipolar charged intrinsically disordered protein Chz1 to its preferred partner H2A.Z-H2B. Both the intra-chain and inter-chain electrostatic interactions have direct impacts on the native collapsed structure and binding mechanism. PMID:28552960

  5. Competition effects in cation binding to humic acid: Conditional affinity spectra for fixed total metal concentration conditions

    NASA Astrophysics Data System (ADS)

    David, Calin; Mongin, Sandrine; Rey-Castro, Carlos; Galceran, Josep; Companys, Encarnació; Garcés, José Luis; Salvador, José; Puy, Jaume; Cecilia, Joan; Lodeiro, Pablo; Mas, Francesc

    2010-09-01

    Information on the Pb and Cd binding to a purified Aldrich humic acid (HA) is obtained from the influence of different fixed total metal concentrations on the acid-base titrations of this ligand. NICA (Non-Ideal Competitive Adsorption) isotherm has been used for a global quantitative description of the binding, which has then been interpreted by plotting the Conditional Affinity Spectra of the H + binding at fixed total metal concentrations (CAScTM). This new physicochemical tool, here introduced, allows the interpretation of binding results in terms of distributions of proton binding energies. A large increase in the acidity of the phenolic sites as the total metal concentration increases, especially in presence of Pb, is revealed from the shift of the CAScTM towards lower affinities. The variance of the CAScTM distribution, which can be used as a direct measure of the heterogeneity, also shows a significant dependence on the total metal concentration. A discussion of the factors that influence the heterogeneity of the HA under the conditions of each experiment is provided, so that the smoothed pattern exhibited by the titration curves can be justified.

  6. CRYO-EM STRUCTURES OF THE ACTIN:TROPOMYOSIN FILAMENT REVEAL THE MECHANISM FOR THE TRANSITION FROM C- TO M-STATE

    PubMed Central

    Sousa, Duncan R.; Stagg, Scott M.; Stroupe, M. Elizabeth

    2013-01-01

    Tropomyosin is a key factor in the molecular mechanisms that regulate the binding of myosin motors to actin filaments in most eukaryotic cells. This regulation is achieved by the azimuthal repositioning of tropomyosin along the actin:tropomyosin:troponin thin filament to block or expose myosin binding sites on actin. In striated muscle, including involuntary cardiac muscle, tropomyosin regulates muscle contraction by coupling Ca2+ binding to troponin with myosin binding to the thin filament. In smooth muscle, the switch is the post-translational modification of the myosin. Depending on the activation state of troponin and the binding state of myosin, tropomyosin can occupy the blocked, closed, or open position on actin. Using native cryogenic 3DEM, we have directly resolved and visualized cardiac and gizzard muscle tropomyosin on filamentous actin in the position that corresponds to the closed state. From the 8-Å resolution structure of the reconstituted Ac:Tm filament formed with gizzard-derived Tm we discuss two possible mechanisms for the transition from closed to open state and describe the role Tm plays in blocking myosin tight binding in the closed state position. PMID:24021812

  7. Comparison of ligand migration and binding in heme proteins of the globin family

    NASA Astrophysics Data System (ADS)

    Karin, Nienhaus; Ulrich Nienhaus, G.

    2015-12-01

    The binding of small diatomic ligands such as carbon monoxide or dioxygen to heme proteins is among the simplest biological processes known. Still, it has taken many decades to understand the mechanistic aspects of this process in full detail. Here, we compare ligand binding in three heme proteins of the globin family, myoglobin, a dimeric hemoglobin, and neuroglobin. The combination of structural, spectroscopic, and kinetic experiments over many years by many laboratories has revealed common properties of globins and a clear mechanistic picture of ligand binding at the molecular level. In addition to the ligand binding site at the heme iron, a primary ligand docking site exists that ensures efficient ligand binding to and release from the heme iron. Additional, secondary docking sites can greatly facilitate ligand escape after its dissociation from the heme. Although there is only indirect evidence at present, a preformed histidine gate appears to exist that allows ligand entry to and exit from the active site. The importance of these features can be assessed by studies involving modified proteins (via site-directed mutagenesis) and comparison with heme proteins not belonging to the globin family.

  8. How Structure Defines Affinity in Protein-Protein Interactions

    PubMed Central

    Erijman, Ariel; Rosenthal, Eran; Shifman, Julia M.

    2014-01-01

    Protein-protein interactions (PPI) in nature are conveyed by a multitude of binding modes involving various surfaces, secondary structure elements and intermolecular interactions. This diversity results in PPI binding affinities that span more than nine orders of magnitude. Several early studies attempted to correlate PPI binding affinities to various structure-derived features with limited success. The growing number of high-resolution structures, the appearance of more precise methods for measuring binding affinities and the development of new computational algorithms enable more thorough investigations in this direction. Here, we use a large dataset of PPI structures with the documented binding affinities to calculate a number of structure-based features that could potentially define binding energetics. We explore how well each calculated biophysical feature alone correlates with binding affinity and determine the features that could be used to distinguish between high-, medium- and low- affinity PPIs. Furthermore, we test how various combinations of features could be applied to predict binding affinity and observe a slow improvement in correlation as more features are incorporated into the equation. In addition, we observe a considerable improvement in predictions if we exclude from our analysis low-resolution and NMR structures, revealing the importance of capturing exact intermolecular interactions in our calculations. Our analysis should facilitate prediction of new interactions on the genome scale, better characterization of signaling networks and design of novel binding partners for various target proteins. PMID:25329579

  9. A Novel DNA Binding Mechanism for maf Basic Region-Leucine Zipper Factors Inferred from a MafA-DNA Complex Structure and Binding Specificities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, Xun; Guanga, Gerald P; Wan, Cheng

    2012-11-13

    MafA is a proto-oncoprotein and is critical for insulin gene expression in pancreatic β-cells. Maf proteins belong to the AP1 superfamily of basic region-leucine zipper (bZIP) transcription factors. Residues in the basic helix and an ancillary N-terminal domain, the Extended Homology Region (EHR), endow maf proteins with unique DNA binding properties: binding a 13 bp consensus site consisting of a core AP1 site (TGACTCA) flanked by TGC sequences and binding DNA stably as monomers. To further characterize maf DNA binding, we determined the structure of a MafA–DNA complex. MafA forms base-specific hydrogen bonds with the flanking G –5C –4 andmore » central C 0/G 0 bases, but not with the core-TGA bases. However, in vitro binding studies utilizing a pulse–chase electrophoretic mobility shift assay protocol revealed that mutating either the core-TGA or flanking-TGC bases dramatically increases the binding off rate. Comparing the known maf structures, we propose that DNA binding specificity results from positioning the basic helix through unique phosphate contacts. The EHR does not contact DNA directly but stabilizes DNA binding by contacting the basic helix. Collectively, these results suggest a novel multistep DNA binding process involving a conformational change from contacting the core-TGA to contacting the flanking-TGC bases.« less

  10. The RNA binding protein CsrA controls c-di-GMP metabolism by directly regulating the expression of GGDEF proteins

    PubMed Central

    Jonas, Kristina; Edwards, Adrianne N.; Simm, Roger; Romeo, Tony; Römling, Ute; Melefors, Öjar

    2009-01-01

    Summary The carbon storage regulator CsrA is an RNA binding protein that controls carbon metabolism, biofilm formation and motility in various eubacteria. Nevertheless, in Escherichia coli only five target mRNAs have been shown to be directly regulated by CsrA at the post-transcriptional level. Here we identified two new direct targets for CsrA, ycdT and ydeH, both of which encode proteins with GGDEF domains. A csrA mutation caused mRNA levels of ycdT and ydeH to increase more than 10-fold. RNA mobility shift assays confirmed the direct and specific binding of CsrA to the mRNA leaders of ydeH and ycdT. Overexpression of ycdT and ydeH resulted in a more than 20-fold increase in the cellular concentration of the second messenger c-di-GMP, implying that both proteins possess diguanylate cyclase activity. Phenotypic characterization revealed that both proteins are involved in the regulation of motility in a c-di-GMP dependent manner. CsrA was also found to regulate the expression of five additional GGDEF/EAL proteins and a csrA mutation led to modestly increased cellular levels of c-di-GMP. All together, these data demonstrate a global role for CsrA in the regulation of c-di-GMP metabolism by regulating the expression of GGDEF proteins at the post-transcriptional level. PMID:18713317

  11. Proton movement and coupling in the POT family of peptide transporters

    PubMed Central

    Parker, Joanne L.; Li, Chenghan; Brinth, Allete; Wang, Zhi; Vogeley, Lutz; Solcan, Nicolae; Ledderboge-Vucinic, Gregory; Swanson, Jessica M. J.; Caffrey, Martin; Voth, Gregory A.

    2017-01-01

    POT transporters represent an evolutionarily well-conserved family of proton-coupled transport systems in biology. An unusual feature of the family is their ability to couple the transport of chemically diverse ligands to an inwardly directed proton electrochemical gradient. For example, in mammals, fungi, and bacteria they are predominantly peptide transporters, whereas in plants the family has diverged to recognize nitrate, plant defense compounds, and hormones. Although recent structural and biochemical studies have identified conserved sites of proton binding, the mechanism through which transport is coupled to proton movement remains enigmatic. Here we show that different POT transporters operate through distinct proton-coupled mechanisms through changes in the extracellular gate. A high-resolution crystal structure reveals the presence of ordered water molecules within the peptide binding site. Multiscale molecular dynamics simulations confirm proton transport occurs through these waters via Grotthuss shuttling and reveal that proton binding to the extracellular side of the transporter facilitates a reorientation from an inward- to outward-facing state. Together these results demonstrate that within the POT family multiple mechanisms of proton coupling have likely evolved in conjunction with variation of the extracellular gate. PMID:29180426

  12. Proton movement and coupling in the POT family of peptide transporters.

    PubMed

    Parker, Joanne L; Li, Chenghan; Brinth, Allete; Wang, Zhi; Vogeley, Lutz; Solcan, Nicolae; Ledderboge-Vucinic, Gregory; Swanson, Jessica M J; Caffrey, Martin; Voth, Gregory A; Newstead, Simon

    2017-12-12

    POT transporters represent an evolutionarily well-conserved family of proton-coupled transport systems in biology. An unusual feature of the family is their ability to couple the transport of chemically diverse ligands to an inwardly directed proton electrochemical gradient. For example, in mammals, fungi, and bacteria they are predominantly peptide transporters, whereas in plants the family has diverged to recognize nitrate, plant defense compounds, and hormones. Although recent structural and biochemical studies have identified conserved sites of proton binding, the mechanism through which transport is coupled to proton movement remains enigmatic. Here we show that different POT transporters operate through distinct proton-coupled mechanisms through changes in the extracellular gate. A high-resolution crystal structure reveals the presence of ordered water molecules within the peptide binding site. Multiscale molecular dynamics simulations confirm proton transport occurs through these waters via Grotthuss shuttling and reveal that proton binding to the extracellular side of the transporter facilitates a reorientation from an inward- to outward-facing state. Together these results demonstrate that within the POT family multiple mechanisms of proton coupling have likely evolved in conjunction with variation of the extracellular gate. Copyright © 2017 the Author(s). Published by PNAS.

  13. Conformational analysis of the Streptococcus pneumoniae hyaluronate lyase and characterization of its hyaluronan-specific carbohydrate-binding module.

    PubMed

    Suits, Michael D L; Pluvinage, Benjamin; Law, Adrienne; Liu, Yan; Palma, Angelina S; Chai, Wengang; Feizi, Ten; Boraston, Alisdair B

    2014-09-26

    For a subset of pathogenic microorganisms, including Streptococcus pneumoniae, the recognition and degradation of host hyaluronan contributes to bacterial spreading through the extracellular matrix and enhancing access to host cell surfaces. The hyaluronate lyase (Hyl) presented on the surface of S. pneumoniae performs this role. Using glycan microarray screening, affinity electrophoresis, and isothermal titration calorimetry we show that the N-terminal module of Hyl is a hyaluronan-specific carbohydrate-binding module (CBM) and the founding member of CBM family 70. The 1.2 Å resolution x-ray crystal structure of CBM70 revealed it to have a β-sandwich fold, similar to other CBMs. The electrostatic properties of the binding site, which was identified by site-directed mutagenesis, are distinct from other CBMs and complementary to its acidic ligand, hyaluronan. Dynamic light scattering and solution small angle x-ray scattering revealed the full-length Hyl protein to exist as a monomer/dimer mixture in solution. Through a detailed analysis of the small angle x-ray scattering data, we report the pseudoatomic solution structures of the monomer and dimer forms of the full-length multimodular Hyl. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Identification of boric acid as a novel chemoattractant and elucidation of its chemoreceptor in Ralstonia pseudosolanacearum Ps29.

    PubMed

    Hida, Akiko; Oku, Shota; Nakashimada, Yutaka; Tajima, Takahisa; Kato, Junichi

    2017-08-17

    Chemotaxis enables bacteria to move toward more favorable environmental conditions. We observed chemotaxis toward boric acid by Ralstonia pseudosolanacearum Ps29. At higher concentrations, the chemotactic response of R. pseudosolanacearum toward boric acid was comparable to or higher than that toward L-malate, indicating that boric acid is a strong attractant for R. pseudosolanacearum. Chemotaxis assays under different pH conditions suggested that R. pseudosolanacearum recognizes B(OH) 3 (or B(OH 3 ) + B(OH) 4 - ) but not B(OH) 4 - alone. Our previous study revealed that R. pseudosolanacearum Ps29 harbors homologs of all 22R. pseudosolanacearum GMI1000 mcp genes. Screening of 22 mcp single-deletion mutants identified the RS_RS17100 homolog as the boric acid chemoreceptor, which was designated McpB. The McpB ligand-binding domain (LBD) was purified in order to characterize its binding to boric acid. Using isothermal titration calorimetry, we demonstrated that boric acid binds directly to the McpB LBD with a K D (dissociation constant) of 5.4 µM. Analytical ultracentrifugation studies revealed that the McpB LBD is present as a dimer that recognizes one boric acid molecule.

  15. A novel site contributing to growth-arrest-specific gene 6 binding to its receptors as revealed by a human monoclonal antibody

    PubMed Central

    2004-01-01

    Gas6 (growth-arrest-specific gene 6) is a vitamin K-dependent protein known to activate the Axl family of receptor tyrosine kinases. It is an important regulator of thrombosis and many other biological functions. The C-terminus of Gas6 binds to receptors and consists of two laminin-like globular domains LG1 and LG2. It has been reported that a Ca2+-binding site at the junction of LG1 and LG2 domains and a hydrophobic patch at the LG2 domain are important for receptor binding [Sasaki, Knyazev, Cheburkin, Gohring, Tisi, Ullrich, Timpl and Hohenester (2002) J. Biol. Chem. 277, 44164–44170]. In the present study, we developed a neutralizing human monoclonal antibody, named CNTO300, for Gas6. The antibody was generated by immunization of human IgG-expressing transgenic mice with recombinant human Gas6 protein and the anti-Gas6 IgG sequences were rescued from an unstable hybridoma clone. Binding of Gas6 to its receptors was partially inhibited by the CNTO300 antibody in a dose-dependent manner. To characterize further the interaction between Gas6 and this antibody, the binding kinetics of CNTO300 for recombinant Gas6 were compared with independently expressed LG1 and LG2. The CNTO300 antibody showed comparable binding affinity, yet different dependence on Ca2+, to Gas6 and LG1. No binding to LG2 was detected. In the presence of EDTA, binding of the antibody to Gas6 was disrupted, but no significant effect of EDTA on LG1 binding was evident. Further epitope mapping identified a Gas6 peptide sequence recognized by the CNTO300 antibody. This peptide sequence was found to be located at the LG1 domain distant from the Ca2+-binding site and the hydrophobic patch. Co-interaction of Gas6 with its receptor and CNTO300 antibody was detected by BIAcore analysis, suggesting a second receptor-binding site on the LG1 domain. This hypothesis was further supported by direct binding of Gas6 receptors to an independently expressed LG1 domain. Our results revealed, for the first time, a second binding site for Gas6–receptor interaction. PMID:15579134

  16. [Planar molecular arrangements aid the design of MHC class II binding peptides].

    PubMed

    Cortés, A; Coral, J; McLachlan, C; Benítez, R; Pinilla, L

    2017-01-01

    The coupling between peptides and MHC-II proteins in the human immune system is not well understood. This work presents an evidence-based hypothesis of a guiding intermolecular force present in every human MHC-II protein (HLA-II). Previously, we examined the spatial positions of the fully conserved residues in all HLA-II protein types. In each one, constant planar patterns were revealed. These molecular planes comprise of amino acid groups of the same chemical species (for example, Gly) distributed across the protein structure. Each amino acid plane has a unique direction and this directional element offers spatial selectivity. Constant within all planes, too, is the presence of an aromatic residue possessing electrons in movement, leading the authors to consider that the planes generate electromagnetic fields that could serve as an attractive force in a single direction. Selection and attraction between HLA-II molecules and antigen peptides would, therefore, be non-random, resulting in a coupling mechanism as effective and rapid as is clearly required in the immune response. On the basis of planar projections onto the HLA-II groove, modifications were made by substituting the key residues in the class II-associated invariant chain peptide-a peptide with a universal binding affinity-resulting in eight different modified peptides with affinities greater than that of the unmodified peptide. Accurate and reliable prediction of MHC class II-binding peptides may facilitate the design of universal vaccine-peptides with greatly enhanced binding affinities. The proposed mechanisms of selection, attraction and coupling between HLA-II and antigen peptides are explained further in the paper.

  17. IFIT3 and IFIT2/3 promote IFIT1-mediated translation inhibition by enhancing binding to non-self RNA.

    PubMed

    Fleith, Renata C; Mears, Harriet V; Leong, Xin Yun; Sanford, Thomas J; Emmott, Edward; Graham, Stephen C; Mansur, Daniel S; Sweeney, Trevor R

    2018-06-01

    Interferon-induced proteins with tetratricopeptide repeats (IFITs) are highly expressed during the cell-intrinsic immune response to viral infection. IFIT1 inhibits translation by binding directly to the 5' end of foreign RNAs, particularly those with non-self cap structures, precluding the recruitment of the cap-binding eukaryotic translation initiation factor 4F and ribosome recruitment. The presence of IFIT1 imposes a requirement on viruses that replicate in the cytoplasm to maintain mechanisms to avoid its restrictive effects. Interaction of different IFIT family members is well described, but little is known of the molecular basis of IFIT association or its impact on function. Here, we reconstituted different complexes of IFIT1, IFIT2 and IFIT3 in vitro, which enabled us to reveal critical aspects of IFIT complex assembly. IFIT1 and IFIT3 interact via a YxxxL motif present in the C-terminus of each protein. IFIT2 and IFIT3 homodimers dissociate to form a more stable heterodimer that also associates with IFIT1. We show for the first time that IFIT3 stabilizes IFIT1 protein expression, promotes IFIT1 binding to a cap0 Zika virus reporter mRNA and enhances IFIT1 translation inhibition. This work reveals molecular aspects of IFIT interaction and provides an important missing link between IFIT assembly and function.

  18. Crystal structure of a lipoxygenase from Cyanothece sp. may reveal novel features for substrate acquisition[S

    PubMed Central

    Newie, Julia; Andreou, Alexandra; Neumann, Piotr; Einsle, Oliver; Feussner, Ivo; Ficner, Ralf

    2016-01-01

    In eukaryotes, oxidized PUFAs, so-called oxylipins, are vital signaling molecules. The first step in their biosynthesis may be catalyzed by a lipoxygenase (LOX), which forms hydroperoxides by introducing dioxygen into PUFAs. Here we characterized CspLOX1, a phylogenetically distant LOX family member from Cyanothece sp. PCC 8801 and determined its crystal structure. In addition to the classical two domains found in plant, animal, and coral LOXs, we identified an N-terminal helical extension, reminiscent of the long α-helical insertion in Pseudomonas aeruginosa LOX. In liposome flotation studies, this helical extension, rather than the β-barrel domain, was crucial for a membrane binding function. Additionally, CspLOX1 could oxygenate 1,2-diarachidonyl-sn-glycero-3-phosphocholine, suggesting that the enzyme may act directly on membranes and that fatty acids bind to the active site in a tail-first orientation. This binding mode is further supported by the fact that CspLOX1 catalyzed oxygenation at the n-10 position of both linoleic and arachidonic acid, resulting in 9R- and 11R-hydroperoxides, respectively. Together these results reveal unifying structural features of LOXs and their function. While the core of the active site is important for lipoxygenation and thus highly conserved, peripheral domains functioning in membrane and substrate binding are more variable. PMID:26667668

  19. Structural basis for the antibody neutralization of Herpes simplex virus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Cheng-Chung; Lin, Li-Ling; Academia Sinica, Taipei 115, Taiwan

    2013-10-01

    The gD–E317-Fab complex crystal revealed the conformational epitope of human mAb E317 on HSV gD, providing a molecular basis for understanding the viral neutralization mechanism. Glycoprotein D (gD) of Herpes simplex virus (HSV) binds to a host cell surface receptor, which is required to trigger membrane fusion for virion entry into the host cell. gD has become a validated anti-HSV target for therapeutic antibody development. The highly inhibitory human monoclonal antibody E317 (mAb E317) was previously raised against HSV gD for viral neutralization. To understand the structural basis of antibody neutralization, crystals of the gD ectodomain bound to the E317more » Fab domain were obtained. The structure of the complex reveals that E317 interacts with gD mainly through the heavy chain, which covers a large area for epitope recognition on gD, with a flexible N-terminal and C-terminal conformation. The epitope core structure maps to the external surface of gD, corresponding to the binding sites of two receptors, herpesvirus entry mediator (HVEM) and nectin-1, which mediate HSV infection. E317 directly recognizes the gD–nectin-1 interface and occludes the HVEM contact site of gD to block its binding to either receptor. The binding of E317 to gD also prohibits the formation of the N-terminal hairpin of gD for HVEM recognition. The major E317-binding site on gD overlaps with either the nectin-1-binding residues or the neutralizing antigenic sites identified thus far (Tyr38, Asp215, Arg222 and Phe223). The epitopes of gD for E317 binding are highly conserved between two types of human herpesvirus (HSV-1 and HSV-2). This study enables the virus-neutralizing epitopes to be correlated with the receptor-binding regions. The results further strengthen the previously demonstrated therapeutic and diagnostic potential of the E317 antibody.« less

  20. Chimeras of Bet v 1 and Api g 1 reveal heterogeneous IgE responses in patients with birch pollen allergy

    PubMed Central

    Gepp, Barbara; Lengger, Nina; Bublin, Merima; Hemmer, Wolfgang; Breiteneder, Heimo; Radauer, Christian

    2014-01-01

    Background Characterization of IgE-binding epitopes of allergens and determination of their patient-specific relevance is crucial for the diagnosis and treatment of allergy. Objective We sought to assess the contribution of specific surface areas of the major birch pollen allergen Bet v 1.0101 to binding IgE of individual patients. Methods Four distinct areas of Bet v 1 representing in total 81% of its surface were grafted onto the scaffold of its homolog, Api g 1.0101, to yield the chimeras Api-Bet-1 to Api-Bet-4. The chimeras were expressed in Escherichia coli and purified. IgE binding of 64 sera from Bet v 1–sensitized subjects with birch pollen allergy was determined by using direct ELISA. Specificity was assessed by means of inhibition ELISA. Results rApi g 1.0101, Api-Bet-1, Api-Bet-2, Api-Bet-3, and Api-Bet-4 bound IgE from 44%, 89%, 80%, 78%, and 48% of the patients, respectively. By comparing the amount of IgE binding to the chimeras and to rApi g 1.0101, 81%, 70%, 75%, and 45% of the patients showed significantly enhanced IgE binding to Api-Bet-1, Api-Bet-2, Api-Bet-3, and Api-Bet-4, respectively. The minority (8%) of the sera revealed enhanced IgE binding exclusively to a single chimera, whereas 31% showed increased IgE binding to all 4 chimeras compared with rApi g 1.0101. The chimeras inhibited up to 70% of IgE binding to rBet v 1.0101, confirming the specific IgE recognition of the grafted regions. Conclusion The Bet v 1–specific IgE response is polyclonal, and epitopes are spread across the entire Bet v 1 surface. Furthermore, the IgE recognition profile of Bet v 1 is highly patient specific. PMID:24529686

  1. Chimeras of Bet v 1 and Api g 1 reveal heterogeneous IgE responses in patients with birch pollen allergy.

    PubMed

    Gepp, Barbara; Lengger, Nina; Bublin, Merima; Hemmer, Wolfgang; Breiteneder, Heimo; Radauer, Christian

    2014-07-01

    Characterization of IgE-binding epitopes of allergens and determination of their patient-specific relevance is crucial for the diagnosis and treatment of allergy. We sought to assess the contribution of specific surface areas of the major birch pollen allergen Bet v 1.0101 to binding IgE of individual patients. Four distinct areas of Bet v 1 representing in total 81% of its surface were grafted onto the scaffold of its homolog, Api g 1.0101, to yield the chimeras Api-Bet-1 to Api-Bet-4. The chimeras were expressed in Escherichia coli and purified. IgE binding of 64 sera from Bet v 1-sensitized subjects with birch pollen allergy was determined by using direct ELISA. Specificity was assessed by means of inhibition ELISA. rApi g 1.0101, Api-Bet-1, Api-Bet-2, Api-Bet-3, and Api-Bet-4 bound IgE from 44%, 89%, 80%, 78%, and 48% of the patients, respectively. By comparing the amount of IgE binding to the chimeras and to rApi g 1.0101, 81%, 70%, 75%, and 45% of the patients showed significantly enhanced IgE binding to Api-Bet-1, Api-Bet-2, Api-Bet-3, and Api-Bet-4, respectively. The minority (8%) of the sera revealed enhanced IgE binding exclusively to a single chimera, whereas 31% showed increased IgE binding to all 4 chimeras compared with rApi g 1.0101. The chimeras inhibited up to 70% of IgE binding to rBet v 1.0101, confirming the specific IgE recognition of the grafted regions. The Bet v 1-specific IgE response is polyclonal, and epitopes are spread across the entire Bet v 1 surface. Furthermore, the IgE recognition profile of Bet v 1 is highly patient specific. Copyright © 2014 The Authors. Published by Mosby, Inc. All rights reserved.

  2. Molecular Mechanism of Action for Allosteric Modulators and Agonists in CC-chemokine Receptor 5 (CCR5).

    PubMed

    Karlshøj, Stefanie; Amarandi, Roxana Maria; Larsen, Olav; Daugvilaite, Viktorija; Steen, Anne; Brvar, Matjaž; Pui, Aurel; Frimurer, Thomas Michael; Ulven, Trond; Rosenkilde, Mette Marie

    2016-12-23

    The small molecule metal ion chelators bipyridine and terpyridine complexed with Zn 2+ (ZnBip and ZnTerp) act as CCR5 agonists and strong positive allosteric modulators of CCL3 binding to CCR5, weak modulators of CCL4 binding, and competitors for CCL5 binding. Here we describe their binding site using computational modeling, binding, and functional studies on WT and mutated CCR5. The metal ion Zn 2+ is anchored to the chemokine receptor-conserved Glu-283 VII:06/7.39 Both chelators interact with aromatic residues in the transmembrane receptor domain. The additional pyridine ring of ZnTerp binds deeply in the major binding pocket and, in contrast to ZnBip, interacts directly with the Trp-248 VI:13/6.48 microswitch, contributing to its 8-fold higher potency. The impact of Trp-248 was further confirmed by ZnClTerp, a chloro-substituted version of ZnTerp that showed no inherent agonism but maintained positive allosteric modulation of CCL3 binding. Despite a similar overall binding mode of all three metal ion chelator complexes, the pyridine ring of ZnClTerp blocks the conformational switch of Trp-248 required for receptor activation, thereby explaining its lack of activity. Importantly, ZnClTerp becomes agonist to the same extent as ZnTerp upon Ala mutation of Ile-116 III:16/3.40 , a residue that constrains the Trp-248 microswitch in its inactive conformation. Binding studies with 125 I-CCL3 revealed an allosteric interface between the chemokine and the small molecule binding site, including residues Tyr-37 I:07/1.39 , Trp-86 II:20/2.60 , and Phe-109 III:09/3.33 The small molecules and CCL3 approach this interface from opposite directions, with some residues being mutually exploited. This study provides new insight into the molecular mechanism of CCR5 activation and paves the way for future allosteric drugs for chemokine receptors. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Specialized Dynamical Properties of Promiscuous Residues Revealed by Simulated Conformational Ensembles

    PubMed Central

    2013-01-01

    The ability to interact with different partners is one of the most important features in proteins. Proteins that bind a large number of partners (hubs) have been often associated with intrinsic disorder. However, many examples exist of hubs with an ordered structure, and evidence of a general mechanism promoting promiscuity in ordered proteins is still elusive. An intriguing hypothesis is that promiscuous binding sites have specific dynamical properties, distinct from the rest of the interface and pre-existing in the protein isolated state. Here, we present the first comprehensive study of the intrinsic dynamics of promiscuous residues in a large protein data set. Different computational methods, from coarse-grained elastic models to geometry-based sampling methods and to full-atom Molecular Dynamics simulations, were used to generate conformational ensembles for the isolated proteins. The flexibility and dynamic correlations of interface residues with a different degree of binding promiscuity were calculated and compared considering side chain and backbone motions, the latter both on a local and on a global scale. The study revealed that (a) promiscuous residues tend to be more flexible than nonpromiscuous ones, (b) this additional flexibility has a higher degree of organization, and (c) evolutionary conservation and binding promiscuity have opposite effects on intrinsic dynamics. Findings on simulated ensembles were also validated on ensembles of experimental structures extracted from the Protein Data Bank (PDB). Additionally, the low occurrence of single nucleotide polymorphisms observed for promiscuous residues indicated a tendency to preserve binding diversity at these positions. A case study on two ubiquitin-like proteins exemplifies how binding promiscuity in evolutionary related proteins can be modulated by the fine-tuning of the interface dynamics. The interplay between promiscuity and flexibility highlighted here can inspire new directions in protein–protein interaction prediction and design methods. PMID:24250278

  4. Multifunctional centromere binding factor 1 is essential for chromosome segregation in the human pathogenic yeast Candida glabrata.

    PubMed

    Stoyan, T; Gloeckner, G; Diekmann, S; Carbon, J

    2001-08-01

    The CBF1 (centromere binding factor 1) gene of Candida glabrata was cloned by functional complementation of the methionine biosynthesis defect of a Saccharomyces cerevisiae cbf1 deletion mutant. The C. glabrata-coded protein, CgCbf1, contains a basic-helix-loop-helix leucine zipper domain and has features similar to those of other budding yeast Cbf1 proteins. CgCbf1p binds in vitro to the centromere DNA element I (CDEI) sequence GTCACATG with high affinity (0.9 x 10(9) M(-1)). Bandshift experiments revealed a pattern of protein-DNA complexes on CgCEN DNA different from that known for S. cerevisiae. We examined the effect of altering the CDEI binding site on CEN plasmid segregation, using a newly developed colony-sectoring assay. Internal deletion of the CDEI binding site led only to a fivefold increase in rates of plasmid loss, indicating that direct binding of Cbf1p to the centromere DNA is not required for full function. Additional deletion of sequences to the left of CDEI, however, led to a 70-fold increase in plasmid loss rates. Deletion of the CBF1 gene proved to be lethal in C. glabrata. C. glabrata cells containing the CBF1 gene under the influence of a shutdown promoter (tetO-ScHOP) arrested their growth after 5 h of cultivation in the presence of the reactive drug doxycycline. DAPI (4',6'-diamidino-2-phenylindole) staining of the arrested cells revealed a significant increase in the number of large-budded cells with single nuclei, 2C DNA content, and short spindles, indicating a defect in the G(2)/M transition of the cell cycle. Thus, we conclude that Cbf1p is required for chromosome segregation in C. glabrata.

  5. Interactions of the Human LIP5 Regulatory Protein with Endosomal Sorting Complexes Required for Transport*♦

    PubMed Central

    Skalicky, Jack J.; Arii, Jun; Wenzel, Dawn M.; Stubblefield, William-May B.; Katsuyama, Angela; Uter, Nathan T.; Bajorek, Monika; Myszka, David G.; Sundquist, Wesley I.

    2012-01-01

    The endosomal sorting complex required for transport (ESCRT) pathway remodels membranes during multivesicular body biogenesis, the abscission stage of cytokinesis, and enveloped virus budding. The ESCRT-III and VPS4 ATPase complexes catalyze the membrane fission events associated with these processes, and the LIP5 protein helps regulate their interactions by binding directly to a subset of ESCRT-III proteins and to VPS4. We have investigated the biochemical and structural basis for different LIP5-ligand interactions and show that the first microtubule-interacting and trafficking (MIT) module of the tandem LIP5 MIT domain binds CHMP1B (and other ESCRT-III proteins) through canonical type 1 MIT-interacting motif (MIM1) interactions. In contrast, the second LIP5 MIT module binds with unusually high affinity to a novel MIM element within the ESCRT-III protein CHMP5. A solution structure of the relevant LIP5-CHMP5 complex reveals that CHMP5 helices 5 and 6 and adjacent linkers form an amphipathic “leucine collar” that wraps almost completely around the second LIP5 MIT module but makes only limited contacts with the first MIT module. LIP5 binds MIM1-containing ESCRT-III proteins and CHMP5 and VPS4 ligands independently in vitro, but these interactions are coupled within cells because formation of stable VPS4 complexes with both LIP5 and CHMP5 requires LIP5 to bind both a MIM1-containing ESCRT-III protein and CHMP5. Our studies thus reveal how the tandem MIT domain of LIP5 binds different types of ESCRT-III proteins, promoting assembly of active VPS4 enzymes on the polymeric ESCRT-III substrate. PMID:23105106

  6. ARTD1/PARP1 negatively regulates glycolysis by inhibiting hexokinase 1 independent of NAD+ depletion

    PubMed Central

    Fouquerel, Elise; Goellner, Eva M.; Yu, Zhongxun; Gagné, Jean-Philippe; de Moura, Michelle Barbi; Feinstein, Tim; Wheeler, David; Redpath, Philip; Li, Jianfeng; Romero, Guillermo; Migaud, Marie; Van Houten, Bennett; Poirier, Guy G.; Sobol, Robert W.

    2014-01-01

    Summary ARTD1 (PARP1) is a key enzyme involved in DNA repair by synthesizing poly(ADP-ribose) (PAR) in response to strand breaks and plays an important role in cell death following excessive DNA damage. ARTD1-induced cell death is associated with NAD+ depletion and ATP loss, however the molecular mechanism of ARTD1-mediated energy collapse remains elusive. Using real-time metabolic measurements, we directly compared the effects of ARTD1 activation and direct NAD+ depletion. We found that ARTD1-mediated PAR synthesis, but not direct NAD+ depletion, resulted in a block to glycolysis and ATP loss. We then established a proteomics based PAR-interactome after DNA damage and identified hexokinase 1 (HK1) as a PAR binding protein. HK1 activity is suppressed following nuclear ARTD1 activation and binding by PAR. These findings help explain how prolonged activation of ARTD1 triggers energy collapse and cell death, revealing new insight on the importance of nucleus to mitochondria communication via ARTD1 activation. PMID:25220464

  7. Functional implications of Major Histocompatibility (MH) variation using estuarine fish populations.

    PubMed

    Cohen, Sarah; Tirindelli, Joëlle; Gomez-Chiarri, Marta; Nacci, Diane

    2006-12-01

    Recently, there has been a dramatic expansion of studies of major histocompatibility complex (MHC) variation aimed at discovering functional differences in immunity across wild populations of diverse vertebrate species. Some species with relatively low genetic diversity or under strong directional selection by pathogens have revealed fascinating cases of MHC allelic disease linkage. More generally in genetically diverse species, however, these linkages may be hard to find. In this paper, we review approaches for assessing functional variation in MHC and discuss their potential use for discovering smaller-scale intraspecific spatial and temporal patterns of MHC variation. Then, we describe and illustrate an approach using the structural model to produce a population composite of variation in antigen-binding regions by mapping population-specific substitutions onto functional regions of the molecule. We are producing models of variation in major histocompatibility (MH) loci for populations of non-migratory fish (killifish, Fundulus heteroclitus) resident at sites that vary dramatically in environmental quality. We discuss the goal of relating MH population variation to functional differences in disease susceptibility such as those inferred by observations of parasitic infection and direct measurement of bacterial challenges in the laboratory. Our study has focused on relatively well-studied killifish populations, including those resident in a highly disturbed, chemically contaminated estuary and nearby less contaminated sites. Population-specific genetic changes at MHC antigen-binding loci are described, and evidence relevant to functional implications of these changes is reviewed. Population-specific patterns of variation in antigen-binding regions in combination with a range of assessments of immune function will provide a powerful new approach to reveal functional changes in MHC.

  8. Structural basis of DNA sequence recognition by the response regulator PhoP in Mycobacterium tuberculosis.

    PubMed

    He, Xiaoyuan; Wang, Liqin; Wang, Shuishu

    2016-04-15

    The transcriptional regulator PhoP is an essential virulence factor in Mycobacterium tuberculosis, and it presents a target for the development of new anti-tuberculosis drugs and attenuated tuberculosis vaccine strains. PhoP binds to DNA as a highly cooperative dimer by recognizing direct repeats of 7-bp motifs with a 4-bp spacer. To elucidate the PhoP-DNA binding mechanism, we determined the crystal structure of the PhoP-DNA complex. The structure revealed a tandem PhoP dimer that bound to the direct repeat. The surprising tandem arrangement of the receiver domains allowed the four domains of the PhoP dimer to form a compact structure, accounting for the strict requirement of a 4-bp spacer and the highly cooperative binding of the dimer. The PhoP-DNA interactions exclusively involved the effector domain. The sequence-recognition helix made contact with the bases of the 7-bp motif in the major groove, and the wing interacted with the adjacent minor groove. The structure provides a starting point for the elucidation of the mechanism by which PhoP regulates the virulence of M. tuberculosis and guides the design of screening platforms for PhoP inhibitors.

  9. Integration of Inhibition Kinetics and Molecular Dynamics Simulations: A Urea-Mediated Folding Study on Acetaldehyde Dehydrogenase 1.

    PubMed

    Xu, Yingying; Lee, Jinhyuk; Lü, Zhi-Rong; Mu, Hang; Zhang, Qian; Park, Yong-Doo

    2016-07-01

    Understanding the mechanism of acetaldehyde dehydrogenase 1 (ALDH1) folding is important because this enzyme is directly involved in several types of cancers and other diseases. We investigated the urea-mediated unfolding of ALDH1 by integrating kinetic inhibition studies with computational molecular dynamics (MD) simulations. Conformational changes in the enzyme structure were also analyzed using intrinsic and 1-anilinonaphthalene-8-sulfonate (ANS)-binding fluorescence measurements. Kinetic studies revealed that the direct binding of urea to ALDH1 induces inactivation of ALDH1 in a manner of mixed-type inhibition. Tertiary structural changes associated with regional hydrophobic exposure of the active site were observed. The urea binding regions on ALDH1 were predicted by docking simulations and were partly shared with active site residues of ALDH1 and with interface residues of the oligomerization domain for tetramer formation. The docking results suggest that urea prevents formation of the ALDH1 normal shape for the tetramer state as well as entrance of the substrate into the active site. Our study provides insight into the structural changes that accompany urea-mediated unfolding of ALDH1 and the catalytic role associated with conformational changes.

  10. Fatty Acid-binding Proteins Interact with Comparative Gene Identification-58 Linking Lipolysis with Lipid Ligand Shuttling*

    PubMed Central

    Hofer, Peter; Boeszoermenyi, Andras; Jaeger, Doris; Feiler, Ursula; Arthanari, Haribabu; Mayer, Nicole; Zehender, Fabian; Rechberger, Gerald; Oberer, Monika; Zimmermann, Robert; Lass, Achim; Haemmerle, Guenter; Breinbauer, Rolf; Zechner, Rudolf; Preiss-Landl, Karina

    2015-01-01

    The coordinated breakdown of intracellular triglyceride (TG) stores requires the exquisitely regulated interaction of lipolytic enzymes with regulatory, accessory, and scaffolding proteins. Together they form a dynamic multiprotein network designated as the “lipolysome.” Adipose triglyceride lipase (Atgl) catalyzes the initiating step of TG hydrolysis and requires comparative gene identification-58 (Cgi-58) as a potent activator of enzyme activity. Here, we identify adipocyte-type fatty acid-binding protein (A-Fabp) and other members of the fatty acid-binding protein (Fabp) family as interaction partners of Cgi-58. Co-immunoprecipitation, microscale thermophoresis, and solid phase assays proved direct protein/protein interaction between A-Fabp and Cgi-58. Using nuclear magnetic resonance titration experiments and site-directed mutagenesis, we located a potential contact region on A-Fabp. In functional terms, A-Fabp stimulates Atgl-catalyzed TG hydrolysis in a Cgi-58-dependent manner. Additionally, transcriptional transactivation assays with a luciferase reporter system revealed that Fabps enhance the ability of Atgl/Cgi-58-mediated lipolysis to induce the activity of peroxisome proliferator-activated receptors. Our studies identify Fabps as crucial structural and functional components of the lipolysome. PMID:25953897

  11. Allosteric Inhibition of Bcr-Abl Kinase by High Affinity Monobody Inhibitors Directed to the Src Homology 2 (SH2)-Kinase Interface*

    PubMed Central

    Wojcik, John; Lamontanara, Allan Joaquim; Grabe, Grzegorz; Koide, Akiko; Akin, Louesa; Gerig, Barbara; Hantschel, Oliver; Koide, Shohei

    2016-01-01

    Bcr-Abl is a constitutively active kinase that causes chronic myelogenous leukemia. We have shown that a tandem fusion of two designed binding proteins, termed monobodies, directed to the interaction interface between the Src homology 2 (SH2) and kinase domains and to the phosphotyrosine-binding site of the SH2 domain, respectively, inhibits the Bcr-Abl kinase activity. Because the latter monobody inhibits processive phosphorylation by Bcr-Abl and the SH2-kinase interface is occluded in the active kinase, it remained undetermined whether targeting the SH2-kinase interface alone was sufficient for Bcr-Abl inhibition. To address this question, we generated new, higher affinity monobodies with single nanomolar KD values targeting the kinase-binding surface of SH2. Structural and mutagenesis studies revealed the molecular underpinnings of the monobody-SH2 interactions. Importantly, the new monobodies inhibited Bcr-Abl kinase activity in vitro and in cells, and they potently induced cell death in chronic myelogenous leukemia cell lines. This work provides strong evidence for the SH2-kinase interface as a pharmacologically tractable site for allosteric inhibition of Bcr-Abl. PMID:26912659

  12. Crystal Structure of the Chromodomain Helicase DNA-binding Protein 1 (Chd1) DNA-binding Domain in Complex with DNA*

    PubMed Central

    Sharma, Amit; Jenkins, Katherine R.; Héroux, Annie; Bowman, Gregory D.

    2011-01-01

    Chromatin remodelers are ATP-dependent machines that dynamically alter the chromatin packaging of eukaryotic genomes by assembling, sliding, and displacing nucleosomes. The Chd1 chromatin remodeler possesses a C-terminal DNA-binding domain that is required for efficient nucleosome sliding and believed to be essential for sensing the length of DNA flanking the nucleosome core. The structure of the Chd1 DNA-binding domain was recently shown to consist of a SANT and SLIDE domain, analogous to the DNA-binding domain of the ISWI family, yet the details of how Chd1 recognized DNA were not known. Here we present the crystal structure of the Saccharomyces cerevisiae Chd1 DNA-binding domain in complex with a DNA duplex. The bound DNA duplex is straight, consistent with the preference exhibited by the Chd1 DNA-binding domain for extranucleosomal DNA. Comparison of this structure with the recently solved ISW1a DNA-binding domain bound to DNA reveals that DNA lays across each protein at a distinct angle, yet contacts similar surfaces on the SANT and SLIDE domains. In contrast to the minor groove binding seen for Isw1 and predicted for Chd1, the SLIDE domain of the Chd1 DNA-binding domain contacts the DNA major groove. The majority of direct contacts with the phosphate backbone occur only on one DNA strand, suggesting that Chd1 may not strongly discriminate between major and minor grooves. PMID:22033927

  13. Direct contact with perivascular tumor cells enhances integrin αvβ3 signaling and migration of endothelial cells

    PubMed Central

    Burgett, Monica E.; Lathia, Justin D.; Roth, Patrick; Nowacki, Amy S.; Galileo, Deni S.; Pugacheva, Elena; Huang, Ping; Vasanji, Amit; Li, Meizhang; Byzova, Tatiana; Mikkelsen, Tom; Bao, Shideng; Rich, Jeremy N.; Weller, Michael; Gladson, Candece L.

    2016-01-01

    The secretion of soluble pro-angiogenic factors by tumor cells and stromal cells in the perivascular niche promotes the aggressive angiogenesis that is typical of glioblastoma (GBM). Here, we show that angiogenesis also can be promoted by a direct interaction between brain tumor cells, including tumor cells with cancer stem-like properties (CSCs), and endothelial cells (ECs). As shown in vitro, this direct interaction is mediated by binding of integrin αvβ3 expressed on ECs to the RGD-peptide in L1CAM expressed on CSCs. It promotes both EC network formation and enhances directed migration toward basic fibroblast growth factor. Activation of αvβ3 and bone marrow tyrosine kinase on chromosome X (BMX) is required for migration stimulated by direct binding but not for migration stimulated by soluble factors. RGD-peptide treatment of mice with established intracerebral GBM xenografts significantly reduced the percentage of Sox2-positive tumor cells and CSCs in close proximity to ECs, decreased integrin αvβ3 and BMX activation and p130CAS phosphorylation in the ECs, and reduced the vessel surface area. These results reveal a previously unrecognized aspect of the regulation of angiogenesis in GBM that can impact therapeutic anti-angiogenic targeting. PMID:27270311

  14. Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

    PubMed

    Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

    2016-12-15

    The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

  15. Direct modulation of T-box riboswitch-controlled transcription by protein synthesis inhibitors

    PubMed Central

    Stamatopoulou, Vassiliki; Apostolidi, Maria; Li, Shuang; Lamprinou, Katerina; Papakyriakou, Athanasios

    2017-01-01

    Abstract Recently, it was discovered that exposure to mainstream antibiotics activate numerous bacterial riboregulators that control antibiotic resistance genes including metabolite-binding riboswitches and other transcription attenuators. However, the effects of commonly used antibiotics, many of which exhibit RNA-binding properties, on the widespread T-box riboswitches, remain unknown. In Staphylococcus aureus, a species-specific glyS T-box controls the supply of glycine for both ribosomal translation and cell wall synthesis, making it a promising target for next-generation antimicrobials. Here, we report that specific protein synthesis inhibitors could either significantly increase T-box-mediated transcription antitermination, while other compounds could suppress it, both in vitro and in vivo. In-line probing of the full-length T-box combined with molecular modelling and docking analyses suggest that the antibiotics that promote transcription antitermination stabilize the T-box:tRNA complex through binding specific positions on stem I and the Staphylococcal-specific stem Sa. By contrast, the antibiotics that attenuate T-box transcription bind to other positions on stem I and do not interact with stem Sa. Taken together, our results reveal that the transcription of essential genes controlled by T-box riboswitches can be directly modulated by commonly used protein synthesis inhibitors. These findings accentuate the regulatory complexities of bacterial response to antimicrobials that involve multiple riboregulators. PMID:28973457

  16. Effect-directed analysis to explore the polar bear exposome: identification of thyroid hormone disrupting compounds in plasma.

    PubMed

    Simon, Eszter; van Velzen, Martin; Brandsma, Sicco H; Lie, Elisabeth; Løken, Katharina; de Boer, Jacob; Bytingsvik, Jenny; Jenssen, Bjørn M; Aars, Jon; Hamers, Timo; Lamoree, Marja H

    2013-08-06

    Compounds with transthyretin (TTR)-binding potency in the blood plasma of polar bear cubs were identified with effect-directed analysis (EDA). This approach contributes to the understanding of the thyroid disrupting exposome of polar bears. The selection of these samples for in-depth EDA was based on the difference between the observed TTR-binding potency on the one hand and the calculated potency (based on known concentrations of TTR-binding compounds and their relative potencies) on the other. A library-based identification was applied to the liquid chromatography-time-of-flight-mass spectrometry (LC-ToF-MS) data by screening for matches between compound lists and the LC-ToF-MS data regarding accurate mass and isotope pattern. Then, isotope cluster analysis (ICA) was applied to the LC-ToF-MS data allowing specific screening for halogen isotope patterns. The presence of linear and branched nonylphenol (NP) was observed for the first time in polar bears. Furthermore, the presence of one di- and two monohydroxylated octachlorinated biphenyls (octaCBs) was revealed in the extracts. Linear and branched NP, 4'-OH-CB201 and 4,4'-OH-CB202 could be successfully confirmed with respect to their retention time in the analytical system. In addition, branched NP, mono- and dihydroxylated-octaCBs showed TTR-binding potencies and could explain another 32 ± 2% of the total measured activities in the extracts.

  17. Alpha-enolase on apical surface of renal tubular epithelial cells serves as a calcium oxalate crystal receptor

    NASA Astrophysics Data System (ADS)

    Fong-Ngern, Kedsarin; Thongboonkerd, Visith

    2016-10-01

    To search for a strategy to prevent kidney stone formation/recurrence, this study addressed the role of α-enolase on apical membrane of renal tubular cells in mediating calcium oxalate monohydrate (COM) crystal adhesion. Its presence on apical membrane and in COM crystal-bound fraction was confirmed by Western blotting and immunofluorescence staining. Pretreating MDCK cells with anti-α-enolase antibody, not isotype-controlled IgG, dramatically reduced cell-crystal adhesion. Immunofluorescence staining also confirmed the direct binding of purified α-enolase to COM crystals at {121} > {100} > {010} crystal faces. Coating COM crystals with urinary proteins diminished the crystal binding capacity to cells and purified α-enolase. Moreover, α-enolase selectively bound to COM, not other crystals. Chemico-protein interactions analysis revealed that α-enolase interacted directly with Ca2+ and Mg2+. Incubating the cells with Mg2+ prior to cell-crystal adhesion assay significantly reduced crystal binding on the cell surface, whereas preincubation with EDTA, a divalent cation chelator, completely abolished Mg2+ effect, indicating that COM and Mg2+ competitively bind to α-enolase. Taken together, we successfully confirmed the role of α-enolase as a COM crystal receptor to mediate COM crystal adhesion at apical membrane of renal tubular cells. It may also serve as a target for stone prevention by blocking cell-crystal adhesion and stone nidus formation.

  18. Direct modulation of T-box riboswitch-controlled transcription by protein synthesis inhibitors.

    PubMed

    Stamatopoulou, Vassiliki; Apostolidi, Maria; Li, Shuang; Lamprinou, Katerina; Papakyriakou, Athanasios; Zhang, Jinwei; Stathopoulos, Constantinos

    2017-09-29

    Recently, it was discovered that exposure to mainstream antibiotics activate numerous bacterial riboregulators that control antibiotic resistance genes including metabolite-binding riboswitches and other transcription attenuators. However, the effects of commonly used antibiotics, many of which exhibit RNA-binding properties, on the widespread T-box riboswitches, remain unknown. In Staphylococcus aureus, a species-specific glyS T-box controls the supply of glycine for both ribosomal translation and cell wall synthesis, making it a promising target for next-generation antimicrobials. Here, we report that specific protein synthesis inhibitors could either significantly increase T-box-mediated transcription antitermination, while other compounds could suppress it, both in vitro and in vivo. In-line probing of the full-length T-box combined with molecular modelling and docking analyses suggest that the antibiotics that promote transcription antitermination stabilize the T-box:tRNA complex through binding specific positions on stem I and the Staphylococcal-specific stem Sa. By contrast, the antibiotics that attenuate T-box transcription bind to other positions on stem I and do not interact with stem Sa. Taken together, our results reveal that the transcription of essential genes controlled by T-box riboswitches can be directly modulated by commonly used protein synthesis inhibitors. These findings accentuate the regulatory complexities of bacterial response to antimicrobials that involve multiple riboregulators. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. The metabolic regulator CodY links L. monocytogenes metabolism to virulence by directly activating the virulence regulatory gene, prfA

    PubMed Central

    Lobel, Lior; Sigal, Nadejda; Borovok, Ilya; Belitsky, Boris R.; Sonenshein, Abraham L.; Herskovits, Anat A.

    2015-01-01

    Summary Metabolic adaptations are critical to the ability of bacterial pathogens to grow within host cells and are normally preceded by sensing of host-specific metabolic signals, which in turn can influence the pathogen's virulence state. Previously, we reported that the intracellular bacterial pathogen Listeria monocytogenes responds to low availability of branched-chain amino acids (BCAA) within mammalian cells by up-regulating both BCAA biosynthesis and virulence genes. The induction of virulence genes required the BCAA-responsive transcription regulator, CodY, but the molecular mechanism governing this mode of regulation was unclear. In this report, we demonstrate that CodY directly binds the coding sequence of the L. monocytogenes master virulence activator gene, prfA, 15 nt downstream of its start codon, and that this binding results in up-regulation of prfA transcription specifically under low concentrations of BCAA. Mutating this site abolished CodY binding and reduced prfA transcription in macrophages, and attenuated bacterial virulence in mice. Notably, the mutated binding site did not alter prfA transcription or PrfA activity under other conditions that are known to activate PrfA, such as during growth in the presence of glucose-1-phosphate. This study highlights the tight crosstalk between L. monocytogenes metabolism and virulence' while revealing novel features of CodY-mediated regulation. PMID:25430920

  20. Novel interactions of CAPS (Ca2+-dependent activator protein for secretion) with the three neuronal SNARE proteins required for vesicle fusion.

    PubMed

    Daily, Neil J; Boswell, Kristin L; James, Declan J; Martin, Thomas F J

    2010-11-12

    CAPS (aka CADPS) is required for optimal vesicle exocytosis in neurons and endocrine cells where it functions to prime the exocytic machinery for Ca(2+)-triggered fusion. Fusion is mediated by trans complexes of the SNARE proteins VAMP-2, syntaxin-1, and SNAP-25 that bridge vesicle and plasma membrane. CAPS promotes SNARE complex formation on liposomes, but the SNARE binding properties of CAPS are unknown. The current work revealed that CAPS exhibits high affinity binding to syntaxin-1 and SNAP-25 and moderate affinity binding to VAMP-2. CAPS binding is specific for a subset of exocytic SNARE protein isoforms and requires membrane integration of the SNARE proteins. SNARE protein binding by CAPS is novel and mediated by interactions with the SNARE motifs in the three proteins. The C-terminal site for CAPS binding on syntaxin-1 does not overlap the Munc18-1 binding site and both proteins can co-reside on membrane-integrated syntaxin-1. As expected for a C-terminal binding site on syntaxin-1, CAPS stimulates SNARE-dependent liposome fusion with N-terminal truncated syntaxin-1 but exhibits impaired activity with C-terminal syntaxin-1 mutants. Overall the results suggest that SNARE complex formation promoted by CAPS may be mediated by direct interactions of CAPS with each of the three SNARE proteins required for vesicle exocytosis.

  1. Novel Interactions of CAPS (Ca2+-dependent Activator Protein for Secretion) with the Three Neuronal SNARE Proteins Required for Vesicle Fusion*

    PubMed Central

    Daily, Neil J.; Boswell, Kristin L.; James, Declan J.; Martin, Thomas F. J.

    2010-01-01

    CAPS (aka CADPS) is required for optimal vesicle exocytosis in neurons and endocrine cells where it functions to prime the exocytic machinery for Ca2+-triggered fusion. Fusion is mediated by trans complexes of the SNARE proteins VAMP-2, syntaxin-1, and SNAP-25 that bridge vesicle and plasma membrane. CAPS promotes SNARE complex formation on liposomes, but the SNARE binding properties of CAPS are unknown. The current work revealed that CAPS exhibits high affinity binding to syntaxin-1 and SNAP-25 and moderate affinity binding to VAMP-2. CAPS binding is specific for a subset of exocytic SNARE protein isoforms and requires membrane integration of the SNARE proteins. SNARE protein binding by CAPS is novel and mediated by interactions with the SNARE motifs in the three proteins. The C-terminal site for CAPS binding on syntaxin-1 does not overlap the Munc18-1 binding site and both proteins can co-reside on membrane-integrated syntaxin-1. As expected for a C-terminal binding site on syntaxin-1, CAPS stimulates SNARE-dependent liposome fusion with N-terminal truncated syntaxin-1 but exhibits impaired activity with C-terminal syntaxin-1 mutants. Overall the results suggest that SNARE complex formation promoted by CAPS may be mediated by direct interactions of CAPS with each of the three SNARE proteins required for vesicle exocytosis. PMID:20826818

  2. Familial Blau syndrome without uveitis caused by a novel mutation in the nucleotide-binding oligomerization domain-containing protein 2 gene with good response to infliximab.

    PubMed

    Toral-López, Jaime; González-Huerta, Luz M; Martín-Del Campo, Mónica; Messina-Baas, Olga; Cuevas-Covarrubias, Sergio A

    2018-05-01

    The proband in this study was a 4-year-old Mexican girl with Blau syndrome. She and her affected family members had skin rash and arthritis but no uveitis. Exome sequencing and DNA direct sequencing from blood samples revealed a novel nucleotide-binding oligomerization domain-containing protein 2 gene mutation in the affected family members. This study is the first report of a Mexican family with Blau syndrome showing good infliximab treatment response. The novel mutation in the nucleotide-binding oligomerization domain-containing protein 2 gene (c.1808A>G) enriches the mutation spectrum in Blau syndrome. This family represents one of the few cases of autosomal Blau syndrome with no uveitis; because of phenotype variability, it is important to recognize Blau syndrome's clinical spectrum and recommend genetic consultation. © 2018 Wiley Periodicals, Inc.

  3. Artificial hydrogenases based on cobaloximes and heme oxygenase

    DOE PAGES

    Bacchi, Marine; Veinberg, Elias; Field, Martin J.; ...

    2016-06-06

    The insertion of cobaloxime catalysts in the heme-binding pocket of heme oxygenase (HO) yields artificial hydrogenases active for H 2 evolution in neutral aqueous solutions. These novel biohybrids have been purified and characterized by using UV/visible and EPR spectroscopy. These analyses revealed the presence of two distinct binding conformations, thereby providing the cobaloxime with hydrophobic and hydrophilic environments, respectively. Quantum chemical/molecular mechanical docking calculations found open and closed conformations of the binding pocket owing to mobile amino acid residues. HO-based biohybrids incorporating a {Co(dmgH) 2} (dmgH 2 = dimethylglyoxime) catalytic center displayed up to threefold increased turnover numbers with respectmore » to the cobaloxime alone or to analogous sperm whale myoglobin adducts. Here, this study thus provides a strong basis for further improvement of such biohybrids, using well-designed modifications of the second and outer coordination spheres, through site-directed mutagenesis of the host protein.« less

  4. Artificial hydrogenases based on cobaloximes and heme oxygenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bacchi, Marine; Veinberg, Elias; Field, Martin J.

    The insertion of cobaloxime catalysts in the heme-binding pocket of heme oxygenase (HO) yields artificial hydrogenases active for H 2 evolution in neutral aqueous solutions. These novel biohybrids have been purified and characterized by using UV/visible and EPR spectroscopy. These analyses revealed the presence of two distinct binding conformations, thereby providing the cobaloxime with hydrophobic and hydrophilic environments, respectively. Quantum chemical/molecular mechanical docking calculations found open and closed conformations of the binding pocket owing to mobile amino acid residues. HO-based biohybrids incorporating a {Co(dmgH) 2} (dmgH 2 = dimethylglyoxime) catalytic center displayed up to threefold increased turnover numbers with respectmore » to the cobaloxime alone or to analogous sperm whale myoglobin adducts. Here, this study thus provides a strong basis for further improvement of such biohybrids, using well-designed modifications of the second and outer coordination spheres, through site-directed mutagenesis of the host protein.« less

  5. Emerging roles for Sam68 in adipogenesis and neuronal development.

    PubMed

    Vogel, Gillian; Richard, Stéphane

    2012-09-01

    Sam68, the Src-associated substrate during mitosis of 68 kDa, belongs to the large class of heteronuclear ribonucleoprotein particle K (hnRNP K) homology (KH) domain family of RNA-binding proteins. Sam68 contains a single KH domain harboring conserved N- and C-terminal sequences required for RNA binding and homodimerization. The KH domain is one of the most prevalent RNA binding domains that directly contacts single-stranded RNA. Sam68 has been implicated in numerous aspects of RNA metabolism including alternative splicing and polysomal recruitment of mRNAs. Studies in mice have revealed physiological roles linking Sam68 to osteoporosis, obesity, cancer, infertility and ataxia. Recent publications have greatly enhanced our understanding of Sam68 mechanism of action in addition to its cellular role. Herein, we will discuss the latest advances in the literature pertaining to obesity and neuronal development.

  6. Evolution of cyclohexadienyl dehydratase from an ancestral solute-binding protein.

    PubMed

    Clifton, Ben E; Kaczmarski, Joe A; Carr, Paul D; Gerth, Monica L; Tokuriki, Nobuhiko; Jackson, Colin J

    2018-04-23

    The emergence of enzymes through the neofunctionalization of noncatalytic proteins is ultimately responsible for the extraordinary range of biological catalysts observed in nature. Although the evolution of some enzymes from binding proteins can be inferred by homology, we have a limited understanding of the nature of the biochemical and biophysical adaptations along these evolutionary trajectories and the sequence in which they occurred. Here we reconstructed and characterized evolutionary intermediate states linking an ancestral solute-binding protein to the extant enzyme cyclohexadienyl dehydratase. We show how the intrinsic reactivity of a desolvated general acid was harnessed by a series of mutations radiating from the active site, which optimized enzyme-substrate complementarity and transition-state stabilization and minimized sampling of noncatalytic conformations. Our work reveals the molecular evolutionary processes that underlie the emergence of enzymes de novo, which are notably mirrored by recent examples of computational enzyme design and directed evolution.

  7. Dual GPCR and GAG mimicry by the M3 chemokine decoy receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alexander-Brett, Jennifer M.; Fremont, Daved H.

    2008-09-23

    Viruses have evolved a myriad of evasion strategies focused on undermining chemokine-mediated immune surveillance, exemplified by the mouse {gamma}-herpesvirus 68 M3 decoy receptor. Crystal structures of M3 in complex with C chemokine ligand 1/lymphotactin and CC chemokine ligand 2/monocyte chemoattractant protein 1 reveal that invariant chemokine features associated with G protein-coupled receptor binding are primarily recognized by the decoy C-terminal domain, whereas the N-terminal domain (NTD) reconfigures to engage divergent basic residue clusters on the surface of chemokines. Favorable electrostatic forces dramatically enhance the association kinetics of chemokine binding by M3, with a primary role ascribed to acidic NTD regionsmore » that effectively mimic glycosaminoglycan interactions. Thus, M3 employs two distinct mechanisms of chemical imitation to potently sequester chemokines, thereby inhibiting chemokine receptor binding events as well as the formation of chemotactic gradients necessary for directed leukocyte trafficking.« less

  8. Highly selective inhibition of myosin motors provides the basis of potential therapeutic application

    PubMed Central

    Sirigu, Serena; Hartman, James J.; Ropars, Virginie; Clancy, Sheila; Wang, Xi; Chuang, Grace; Qian, Xiangping; Lu, Pu-Ping; Barrett, Edward; Rudolph, Karin; Royer, Christopher; Morgan, Bradley P.; Stura, Enrico A.; Malik, Fady I.; Houdusse, Anne M.

    2016-01-01

    Direct inhibition of smooth muscle myosin (SMM) is a potential means to treat hypercontractile smooth muscle diseases. The selective inhibitor CK-2018571 prevents strong binding to actin and promotes muscle relaxation in vitro and in vivo. The crystal structure of the SMM/drug complex reveals that CK-2018571 binds to a novel allosteric pocket that opens up during the “recovery stroke” transition necessary to reprime the motor. Trapped in an intermediate of this fast transition, SMM is inhibited with high selectivity compared with skeletal muscle myosin (IC50 = 9 nM and 11,300 nM, respectively), although all of the binding site residues are identical in these motors. This structure provides a starting point from which to design highly specific myosin modulators to treat several human diseases. It further illustrates the potential of targeting transition intermediates of molecular machines to develop exquisitely selective pharmacological agents. PMID:27815532

  9. Penicillin-binding proteins in Actinobacteria.

    PubMed

    Ogawara, Hiroshi

    2015-04-01

    Because some Actinobacteria, especially Streptomyces species, are β-lactam-producing bacteria, they have to have some self-resistant mechanism. The β-lactam biosynthetic gene clusters include genes for β-lactamases and penicillin-binding proteins (PBPs), suggesting that these are involved in self-resistance. However, direct evidence for the involvement of β-lactamases does not exist at the present time. Instead, phylogenetic analysis revealed that PBPs in Streptomyces are distinct in that Streptomyces species have much more PBPs than other Actinobacteria, and that two to three pairs of similar PBPs are present in most Streptomyces species examined. Some of these PBPs bind benzylpenicillin with very low affinity and are highly similar in their amino-acid sequences. Furthermore, other low-affinity PBPs such as SCLAV_4179 in Streptomyces clavuligerus, a β-lactam-producing Actinobacterium, may strengthen further the self-resistance against β-lactams. This review discusses the role of PBPs in resistance to benzylpenicillin in Streptomyces belonging to Actinobacteria.

  10. Models of metal binding structures in fulvic acid from the Suwannee River, Georgia

    USGS Publications Warehouse

    Leenheer, J.A.; Brown, G.K.; MacCarthy, P.; Cabaniss, S.E.

    1998-01-01

    Fulvic acid, isolated from the Suwannee River, Georgia, was assessed for its ability to bind Ca2+, Cd2+, Cu2+, Ni2+, and Zn2+ ions at pH 6 before and after extensive fractionation that was designed to reveal the nature of metal binding functional groups. The binding constant for Ca2+ ion had the greatest increase of all the ions in a metal binding fraction that was selected for intensive characterization for the purpose of building quantitative average model structures. The 'metal binding' fraction was characterized by quantitative 13C NMR, 1H NMR, and FT-1R spectrometry and elemental, titrimetric, and molecular weight determinations. The characterization data revealed that carboxyl groups were clustered in short- chain aliphatic dibasic acid structures. The Ca2+ binding data suggested that ether-substituted oxysuccinic acid structures are good models for the metal binding sites at pH 6. Structural models were derived based upon oxidation and photolytic rearrangements of cutin, lignin, and tannin precursors. These structural models rich in substituted dibasic acid structures revealed polydentate binding sites with the potential for both inner-sphere and outer-sphere type binding. The majority of the fulvic acid molecule was involved with metal binding rather than a small substructural unit.Fulvic acid, isolated from the Suwannee River, Georgia, was assessed for its ability to bind Ca2+, Cd2+, Cu2+, Ni2+, and Zn2+ ions at pH 6 before and after extensive fractionation that was designed to reveal the nature of metal binding functional groups. The binding constant for Ca2+ ion had the greatest increase of all the ions in a metal binding fraction that was selected for intensive characterization for the purpose of building quantitative average model structures. The `metal binding' fraction was characterized by quantitative 13C NMR, 1H NMR, and FT-IR spectrometry and elemental, titrimetric, and molecular weight determinations. The characterization data revealed that carboxyl groups were clustered in short-chain aliphatic dibasic acid structures. The Ca2+ binding data suggested that ether-substituted oxysuccinic acid structures are good models for the metal binding sites at pH 6. Structural models were derived based upon oxidation and photolytic rearrangements of cutin, lignin, and tannin precursors. These structural models rich in substituted dibasic acid structures revealed polydentate binding sites with the potential for both inner-sphere and outer-sphere type binding. The majority of the fulvic acid molecule was involved with metal binding rather than a small substructural unit.

  11. OPAQUE11 Is a Central Hub of the Regulatory Network for Maize Endosperm Development and Nutrient Metabolism[OPEN

    PubMed Central

    Feng, Fan; Qi, Weiwei; Lv, Yuanda; Yan, Shumei; Xu, Liming; Yang, Wenyao; Yuan, Yue; Chen, Yihan

    2018-01-01

    Maize (Zea mays) endosperm is a primary tissue for nutrient storage and is highly differentiated during development. However, the regulatory networks of endosperm development and nutrient metabolism remain largely unknown. Maize opaque11 (o11) is a classic seed mutant with a small and opaque endosperm showing decreased starch and protein accumulation. We cloned O11 and found that it encodes an endosperm-specific bHLH transcription factor (TF). Loss of function of O11 significantly affected transcription of carbohydrate/amino acid metabolism and stress response genes. Genome-wide binding site analysis revealed 9885 O11 binding sites distributed over 6033 genes. Using chromatin immunoprecipitation sequencing (ChIP-seq) coupled with RNA sequencing (RNA-seq) assays, we identified 259 O11-modulated target genes. O11 was found to directly regulate key TFs in endosperm development (NKD2 and ZmDOF3) and nutrient metabolism (O2 and PBF). Moreover, O11 directly regulates cyPPDKs and multiple carbohydrate metabolic enzymes. O11 is an activator of ZmYoda, suggesting its regulatory function through the MAPK pathway in endosperm development. Many stress-response genes are also direct targets of O11. In addition, 11 O11-interacting proteins were identified, including ZmIce1, which coregulates stress response targets and ZmYoda with O11. Therefore, this study reveals an endosperm regulatory network centered around O11, which coordinates endosperm development, metabolism and stress responses. PMID:29436476

  12. An affinity improved single-chain antibody from phage display of a library derived from monoclonal antibodies detects fumonisins by immunoassay.

    PubMed

    Hu, Zu-Quan; Li, He-Ping; Wu, Ping; Li, Ya-Bo; Zhou, Zhu-Qing; Zhang, Jing-Bo; Liu, Jin-Long; Liao, Yu-Cai

    2015-03-31

    Fumonisin B analogs, particularly FB1, FB2, and FB3, are major mycotoxins found in cereals. Single-chain fragment variable (scFv) antibodies represent a promising alternative immunoassay system. A phage-displayed antibody library derived from four monoclonal antibodies (mAbs) generated against FB1 was used to screen high binding affinity scFv antibodies; the best candidate was designated H2. Surface plasmon resonance measurements confirmed that the H2 scFv displayed a 82-fold higher binding affinity than its parent mAb. Direct competitive enzyme-linked immunosorbent assay demonstrated that the H2 antibody could competitively bind to free FB1, FB2, and FB3, with an IC50 of 0.11, 0.04, and 0.10 μM, respectively; it had no cross-reactivity to deoxynivalenol, nivalenol and aflatoxin. Validation assays with naturally contaminated samples revealed a linear relationship between the H2 antibody-based assay results and chemical analysis results, that could be expressed as y=1.7072x+5.5606 (R(2)=0.8883). Homology modeling of H2 revealed a favorable binding structure highly complementary to the three fumonisins. Molecular docking analyses suggested that the preferential binding of the H2 scFv to FB2 was due to the presence of a hydrogen radical in its R1 position, leading to a proper electrostatic matching and hydrophobic interaction. The H2 scFv antibody can be used for the rapid, accurate, and specific detection of fumonisin contamination in agricultural samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Crystal structures of Mmm1 and Mdm12–Mmm1 reveal mechanistic insight into phospholipid trafficking at ER-mitochondria contact sites

    PubMed Central

    Jeong, Hanbin; Park, Jumi; Jun, Youngsoo; Lee, Changwook

    2017-01-01

    The endoplasmic reticulum (ER)-mitochondria encounter structure (ERMES) comprises mitochondrial distribution and morphology 12 (Mdm12), maintenance of mitochondrial morphology 1 (Mmm1), Mdm34, and Mdm10 and mediates physical membrane contact sites and nonvesicular lipid trafficking between the ER and mitochondria in yeast. Herein, we report two crystal structures of the synaptotagmin-like mitochondrial lipid-binding protein (SMP) domain of Mmm1 and the Mdm12–Mmm1 complex at 2.8 Å and 3.8 Å resolution, respectively. Mmm1 adopts a dimeric SMP structure augmented with two extra structural elements at the N and C termini that are involved in tight self-association and phospholipid coordination. Mmm1 binds two phospholipids inside the hydrophobic cavity, and the phosphate ion of the distal phospholipid is specifically recognized through extensive H-bonds. A positively charged concave surface on the SMP domain not only mediates ER membrane docking but also results in preferential binding to glycerophospholipids such as phosphatidylcholine (PC), phosphatidic acid (PA), phosphatidylglycerol (PG), and phosphatidylserine (PS), some of which are substrates for lipid-modifying enzymes in mitochondria. The Mdm12–Mmm1 structure reveals two Mdm12s binding to the SMP domains of the Mmm1 dimer in a pairwise head-to-tail manner. Direct association of Mmm1 and Mdm12 generates a 210-Å-long continuous hydrophobic tunnel that facilitates phospholipid transport. The Mdm12–Mmm1 complex binds all glycerophospholipids except for phosphatidylethanolamine (PE) in vitro. PMID:29078410

  14. Editor's Highlight: Structure-Based Investigation on the Binding and Activation of Typical Pesticides With Thyroid Receptor.

    PubMed

    Xiang, Dandan; Han, Jian; Yao, Tingting; Wang, Qiangwei; Zhou, Bingsheng; Mohamed, Abou Donia; Zhu, Guonian

    2017-12-01

    A broad range of pesticides have been reported to interfere with the normal function of the thyroid endocrine system. However, the precise mechanism(s) of action has not yet been thoroughly elucidated. In this study, 21 pesticides were assessed for their binding interactions and the potential to disrupt thyroid homeostasis. In the GH3 luciferase reporter gene assays, 5 of the pesticides tested had agonistic effects in the order of procymidone > imidacloprid > mancozeb > fluroxypyr > atrazine. 11 pesticides inhibited luciferase activity of T3 to varying degrees, demonstrating their antagonistic activity. And there are 4 pesticides showed mixed effects when treated with different concentrations. Surface plasmon resonance (SPR) biosensor technique was used to directly measure the binding interactions of these pesticides to the human thyroid hormone receptor (hTR). 13 pesticides were observed to bind directly with TR, with a KD ranging from 4.80E-08 M to 9.44E-07 M. The association and disassociation of the hTR/pesticide complex revealed 2 distinctive binding modes between the agonists and antagonists. At the same time, a different binding mode was displayed by the pesticides showed mix agonist and antagonist activity. In addition, the molecular docking simulation analyses indicated that the interaction energy calculated by CDOCKER for the agonists and antagonists correlated well with the KD values measured by the surface plasmon resonance assay. These results help to explain the differences of the TR activities of these tested pesticides. © The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  15. Identification of C3b-Binding Small-Molecule Complement Inhibitors Using Cheminformatics.

    PubMed

    Garcia, Brandon L; Skaff, D Andrew; Chatterjee, Arindam; Hanning, Anders; Walker, John K; Wyckoff, Gerald J; Geisbrecht, Brian V

    2017-05-01

    The complement system is an elegantly regulated biochemical cascade formed by the collective molecular recognition properties and proteolytic activities of more than two dozen membrane-bound or serum proteins. Complement plays diverse roles in human physiology, such as acting as a sentry against invading microorganisms, priming of the adaptive immune response, and removal of immune complexes. However, dysregulation of complement can serve as a trigger for a wide range of human diseases, which include autoimmune, inflammatory, and degenerative conditions. Despite several potential advantages of modulating complement with small-molecule inhibitors, small-molecule drugs are highly underrepresented in the current complement-directed therapeutics pipeline. In this study, we have employed a cheminformatics drug discovery approach based on the extensive structural and functional knowledge available for the central proteolytic fragment of the cascade, C3b. Using parallel in silico screening methodologies, we identified 45 small molecules that putatively bind C3b near ligand-guided functional hot spots. Surface plasmon resonance experiments resulted in the validation of seven dose-dependent C3b-binding compounds. Competition-based biochemical assays demonstrated the ability of several C3b-binding compounds to interfere with binding of the original C3b ligand that guided their discovery. In vitro assays of complement function identified a single complement inhibitory compound, termed cmp-5, and mechanistic studies of the cmp-5 inhibitory mode revealed it acts at the level of C5 activation. This study has led to the identification of a promising new class of C3b-binding small-molecule complement inhibitors and, to our knowledge, provides the first demonstration of cheminformatics-based, complement-directed drug discovery. Copyright © 2017 by The American Association of Immunologists, Inc.

  16. Identification of C3b-binding Small Molecule Complement Inhibitors Using Cheminformatics

    PubMed Central

    Garcia, Brandon L.; Skaff, D. Andrew; Chatterjee, Arindam; Hanning, Anders; Walker, John K.; Wyckoff, Gerald J.; Geisbrecht, Brian V.

    2017-01-01

    The complement system is an elegantly regulated biochemical cascade formed by the collective molecular recognition properties and proteolytic activities of over two dozen membrane-bound or serum proteins. Complement plays diverse roles in human physiology which include acting as a sentry against invading microorganisms, priming of the adaptive immune response, and removal of immune complexes. However, dysregulation of complement can serve as a trigger for a wide range of human diseases which include autoimmune, inflammatory, and degenerative conditions. Despite several potential advantages of modulating complement with small molecule inhibitors, small molecule drugs are highly underrepresented in the current complement-directed therapeutics pipeline. In this study we have employed a cheminformatics drug discovery approach based on the extensive structural and functional knowledge available for the central proteolytic fragment of the cascade, C3b. Using parallel in silico screening methodologies we identified 45 small molecules which putatively bind C3b near ligand-guided functional hot-spots. Surface plasmon resonance experiments resulted in the validation of seven dose-dependent C3b-binding compounds. Competition-based biochemical assays demonstrated the ability of several C3b-binding compounds to interfere with binding of the original C3b ligand which guided their discovery. In vitro assays of complement function identified a single complement inhibitory compound, termed cmp-5, and mechanistic studies of the cmp-5 inhibitory mode revealed it acts at the level of C5 activation. This study has led to the identification of a promising new class of C3b-binding small molecule complement inhibitors, and to our knowledge, provides the first demonstration of cheminformatics-based complement-directed drug discovery. PMID:28298523

  17. Structure of the PSD-95/MAP1A complex reveals a unique target recognition mode of the MAGUK GK domain.

    PubMed

    Xia, Yitian; Shang, Yuan; Zhang, Rongguang; Zhu, Jinwei

    2017-08-10

    The PSD-95 family of membrane-associated guanylate kinases (MAGUKs) are major synaptic scaffold proteins and play crucial roles in the dynamic regulation of dendritic remodelling, which is understood to be the foundation of synaptogenesis and synaptic plasticity. The guanylate kinase (GK) domain of MAGUK family proteins functions as a phosphor-peptide binding module. However, the GK domain of PSD-95 has been found to directly bind to a peptide sequence within the C-terminal region of neuronal-specific microtubule-associated protein 1A (MAP1A), although the detailed molecular mechanism governing this phosphorylation-independent interaction at the atomic level is missing. In the present study, we determine the crystal structure of PSD-95 GK in complex with the MAP1A peptide at 2.6-Å resolution. The complex structure reveals that, unlike a linear and elongated conformation in the phosphor-peptide/GK complexes, the MAP1A peptide adopts a unique conformation with a stretch of hydrophobic residues far from each other in the primary sequence clustering and interacting with the 'hydrophobic site' of PSD-95 GK and a highly conserved aspartic acid of MAP1A (D2117) mimicking the phosphor-serine/threonine in binding to the 'phosphor-site' of PSD-95 GK. We demonstrate that the MAP1A peptide may undergo a conformational transition upon binding to PSD-95 GK. Further structural comparison of known DLG GK-mediated complexes reveals the target recognition specificity and versatility of DLG GKs. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  18. Molecular modeling and docking studies of human 5-hydroxytryptamine 2A (5-HT2A) receptor for the identification of hotspots for ligand binding.

    PubMed

    Kanagarajadurai, Karuppiah; Malini, Manoharan; Bhattacharya, Aditi; Panicker, Mitradas M; Sowdhamini, Ramanathan

    2009-12-01

    The serotonergic system has been implicated in emotional and cognitive function. In particular, 5-HT(2A) (5-hydroxytrytamine receptor 2A) is attributed to a number of disorders like schizophrenia, depression, eating disorders and anxiety. 5-HT(2A), being a GPCR (G-protein coupled receptor), is important in the pharmaceutical industry as a proven target for these disorders. Despite their extensive clinical importance, the structural studies of this protein is lacking due to difficulties in determining its crystal structure. We have performed sequence analysis and molecular modeling of 5-HT(2A) that has revealed a set of conserved residues and motifs considered to play an important role in maintaining structural integrity and function of the receptor. The analysis also revealed a set of residues specific to the receptor which distinguishes them from other members of the subclass and their orthologs. Further, starting from the model structure of human 5-HT(2A) receptor, docking studies were attempted to envisage how it might interact with eight of its ligands (such as serotonin, dopamine, DOI, LSD, haloperidol, ketanserin, risperidone and clozapine). The binding studies of dopamine to 5-HT(2A) receptor can bring up better understanding in the etiology of a number of neurological disorders involving both these two receptors. Our sequence analysis and study of interactions of this receptor with other ligands reveal additional residue hotspots such as Asn 363 and Tyr 370. The function of these residues can be further analyzed by rational design of site-directed mutagenesis. Two distinct binding sites are identified which could play important roles in ligand binding and signaling.

  19. Functional roles of H98 and W99 and β2α2 loop dynamics in the α-l-arabinofuranosidase from Thermobacillus xylanilyticus.

    PubMed

    Arab-Jaziri, Faten; Bissaro, Bastien; Barbe, Sophie; Saurel, Olivier; Débat, Hélène; Dumon, Claire; Gervais, Virginie; Milon, Alain; André, Isabelle; Fauré, Régis; O'Donohue, Michael J

    2012-10-01

    This study is focused on the elucidation of the functional role of the mobile β2α2 loop in the α-L-arabinofuranosidase from Thermobacillus xylanilyticus, and particularly on the roles of loop residues H98 and W99. Using site-directed mutagenesis, coupled to characterization methods including isothermal titration calorimetry (ITC) and saturation transfer difference nuclear magnetic resonance (STD-NMR) spectroscopy, and molecular dynamics simulations, it has been possible to provide a molecular level view of interactions and the consequences of mutations. Binding of para-nitrophenyl α-L-arabinofuranoside (pNP-α-l-Araf) to the wild-type arabinofuranosidase was characterized by K(d) values (0.32 and 0.16 mm, from ITC and STD-NMR respectively) that highly resembled that of the arabinoxylo-oligosaccharide XA(3)XX (0.21 mm), and determination of the thermodynamic parameters of enzyme : pNP-α-L-Araf binding revealed that this process is driven by favourable entropy, which is linked to the movement of the β2α2 loop. Loop closure relocates the solvent-exposed W99 into a buried location, allowing its involvement in substrate binding and in the formation of a functional active site. Similarly, the data underline the role of H98 in the ‘dynamic’ formation and definition of a catalytically operational active site, which may be a specific feature of a subset of GH51 arabinofuranosidases. Substitution of H98 and W99 by alanine or phenylalanine revealed that mutations affected K(M) and/or k(cat). Molecular dynamics performed on W99A implied that this mutation causes the loss of a hydrogen bond and leads to an alternative binding mode that is detrimental for catalysis. STD-NMR experiments revealed altered binding of the aglycon motif in the active site, combined with reduced STD intensities of the α-L-arabinofuranosyl moiety for W99 substitutions. © 2012 The Authors Journal compilation © 2012 FEBS.

  20. Interaction between phloretin and the red blood cell membrane

    PubMed Central

    1976-01-01

    Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575

  1. Mutations in the substrate binding site of human heat-shock protein 70 indicate specific interaction with HLA-DR outside the peptide binding groove

    PubMed Central

    Rohrer, Karin M; Haug, Markus; Schwörer, Daniela; Kalbacher, Hubert; Holzer, Ursula

    2014-01-01

    Heat-shock protein 70 (Hsp70)–peptide complexes are involved in MHC class I-and II-restricted antigen presentation, enabling enhanced activation of T cells. As shown previously, mammalian cytosolic Hsp70 (Hsc70) molecules interact specifically with HLA-DR molecules. This interaction might be of significance as Hsp70 molecules could transfer bound antigenic peptides in a ternary complex into the binding groove of HLA-DR molecules. The present study provides new insights into the distinct interaction of Hsp70 with HLA-DR molecules. Using a quantitative binding assay, it could be demonstrated that a point mutation of amino acids alanine 406 and valine 438 in the substrate binding pocket led to reduced peptide binding compared with the wild-type Hsp70 whereas HLA-DR binding remains unaffected. The removal of the C-terminal lid neither altered the substrate binding capacity nor the Hsp70 binding characteristics to HLA-DR. A truncated variant lacking the nucleotide binding domain showed no binding interactions with HLA-DR. Furthermore, the truncated ATPase subunit of constitutively expressed Hsc70 revealed similar binding affinities to HLA-DR compared with the complete Hsc70. Hence, it can be assumed that the Hsp70–HLA-DR interaction takes place outside the peptide binding groove and is attributed to the ATPase domain of HSP70 molecules. The Hsp70-chaperoned peptides might thereby be directly transferred into the binding groove of HLA-DR, so enabling enhanced presentation of the peptide on antigen-presenting cells and leading to an improved proliferation of responding T cells as shown previously. PMID:24428437

  2. Communication between Thiamin Cofactors in the Escherichia coli Pyruvate Dehydrogenase Complex E1 Component Active Centers EVIDENCE FOR A DIRECT PATHWAY BETWEEN THE 4′-AMINOPYRIMIDINE N1′ ATOMS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nemeria, Natalia S; Arjunan, Palaniappa; Chandrasekhar, Krishnamoorthy

    2010-11-03

    Kinetic, spectroscopic, and structural analysis tested the hypothesis that a chain of residues connecting the 4{prime}-aminopyrimidine N1{prime} atoms of thiamin diphosphates (ThDPs) in the two active centers of the Escherichia coli pyruvate dehydrogenase complex E1 component provides a signal transduction pathway. Substitution of the three acidic residues (Glu{sup 571}, Glu{sup 235}, and Glu{sup 237}) and Arg{sup 606} resulted in impaired binding of the second ThDP, once the first active center was filled, suggesting a pathway for communication between the two ThDPs. (1) Steady-state kinetic and fluorescence quenching studies revealed that upon E571A, E235A, E237A, and R606A substitutions, ThDP binding inmore » the second active center was affected. (2) Analysis of the kinetics of thiazolium C2 hydrogen/deuterium exchange of enzyme-bound ThDP suggests half-of-the-sites reactivity for the E1 component, with fast (activated site) and slow exchanging sites (dormant site). The E235A and E571A variants gave no evidence for the slow exchanging site, indicating that only one of two active sites is filled with ThDP. (3) Titration of the E235A and E237A variants with methyl acetylphosphonate monitored by circular dichroism suggested that only half of the active sites were filled with a covalent predecarboxylation intermediate analog. (4) Crystal structures of E235A and E571A in complex with ThDP revealed the structural basis for the spectroscopic and kinetic observations and showed that either substitution affects cofactor binding, despite the fact that Glu{sup 235} makes no direct contact with the cofactor. The role of the conserved Glu{sup 571} residue in both catalysis and cofactor orientation is revealed by the combined results for the first time.« less

  3. Single-molecule enzymology of steroid transforming enzymes: Transient kinetic studies and what they tell us.

    PubMed

    Penning, Trevor M

    2016-07-01

    Structure-function studies on steroid transforming enzymes often use site-directed mutagenesis to inform mechanisms of catalysis and effects on steroid binding, and data are reported in terms of changes in steady state kinetic parameters kcat, Km and kcat/Km. However, this dissection of function is limited since kcat is governed by the rate-determining step and Km is a complex macroscopic kinetic constant. Often site-directed mutagenesis can lead to a change in the rate-determining step which cannot be revealed by just reporting a decrease in kcat alone. These issues are made more complex when it is considered that many steroid transforming enzymes have more than one substrate and product. We present the case for using transient-kinetics performed with stopped-flow spectrometry to assign rate constants to discrete steps in these multi-substrate reactions and their use to interpret enzyme mechanism and the effects of disease and engineered mutations. We demonstrate that fluorescence kinetic transients can be used to measure ligand binding that may be accompanied by isomerization steps, revealing the existence of new enzyme intermediates. We also demonstrate that single-turnover reactions can provide a klim for the chemical step and Ks for steroid-substrate binding and that when coupled with kinetic isotope effect measurements can provide information on transition state intermediates. We also demonstrate how multiple turnover experiments can provide evidence for either "burst-phase" kinetics, which can reveal a slow product release step, or linear-phase kinetics, in which the chemical step can be rate-determining. With these assignments it becomes more straightforward to analyze the effects of mutations. We use examples from the hydroxysteroid dehydrogenases (AKR1Cs) and human steroid 5β-reductase (AKR1D1) to illustrate the utility of the approach, which are members of the aldo-keto reductase (AKR) superfamily. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Homotropic Cooperativity from the Activation Pathway of the Allosteric Ligand-Responsive Regulatory Protein TRAP†

    PubMed Central

    Kleckner, Ian R.; McElroy, Craig A.; Kuzmic, Petr; Gollnick, Paul; Foster, Mark P.

    2014-01-01

    The trp RNA-binding Attenuation Protein (TRAP) assembles into an 11-fold symmetric ring that regulates transcription and translation of trp-mRNA in bacilli via heterotropic allosteric activation by the amino acid tryptophan (Trp). Whereas nuclear magnetic resonance studies have revealed that Trp-induced activation coincides with both μs-ms rigidification and local structural changes in TRAP, the pathway of binding of the 11 Trp ligands to the TRAP ring remains unclear. Moreover, because each of eleven bound Trp molecules is completely surrounded by protein, its release requires flexibility of Trp-bound (holo) TRAP. Here, we used stopped-flow fluorescence to study the kinetics of Trp binding by Bacillus stearothermophilus TRAP over a range of temperatures and we observed well-separated kinetic steps. These data were analyzed using non-linear least-squares fitting of several two- and three-step models. We found that a model with two binding steps best describes the data, although the structural equivalence of the binding sites in TRAP implies a fundamental change in the time-dependent structure of the TRAP rings upon Trp binding. Application of the two binding step model reveals that Trp binding is much slower than the diffusion limit, suggesting a gating mechanism that depends on the dynamics of apo TRAP. These data also reveal that Trp dissociation from the second binding mode is much slower than after the first Trp binding mode, revealing insight into the mechanism for positive homotropic allostery, or cooperativity. Temperature dependent analyses reveal that both binding modes imbue increases in bondedness and order toward a more compressed active state. These results provide insight into mechanisms of cooperative TRAP activation, and underscore the importance of protein dynamics for ligand binding, ligand release, protein activation, and allostery. PMID:24224873

  5. C2 Domain of Protein Kinase Cα: Elucidation of the Membrane Docking Surface by Site-Directed Fluorescence and Spin Labeling†

    PubMed Central

    Kohout, Susy C.; Corbalán-García, Senena; Gómez-Fernández, Juan C.; Falke, Joseph J.

    2013-01-01

    The C2 domain is a conserved signaling motif that triggers membrane docking in a Ca2+-dependent manner, but the membrane docking surfaces of many C2 domains have not yet been identified. Two extreme models can be proposed for the docking of the protein kinase Cα (PKCα) C2 domain to membranes. In the parallel model, the membrane-docking surface includes the Ca2+ binding loops and an anion binding site on β-strands 3–4, such that the β-strands are oriented parallel to the membrane. In the perpendicular model, the docking surface is localized to the Ca2+ binding loops and the β-strands are oriented perpendicular to the membrane surface. The present study utilizes site-directed fluorescence and spin-labeling to map out the membrane docking surface of the PKCα C2 domain. Single cysteine residues were engineered into 18 locations scattered over all regions of the protein surface, and were used as attachment sites for spectroscopic probes. The environmentally sensitive fluorescein probe identified positions where Ca2+ activation or membrane docking trigger measurable fluorescence changes. Ca2+ binding was found to initiate a global conformational change, while membrane docking triggered the largest fluorescein environmental changes at labeling positions on the three Ca2+ binding loops (CBL), thereby localizing these loops to the membrane docking surface. Complementary EPR power saturation measurements were carried out using a nitroxide spin probe to determine a membrane depth parameter, Φ, for each spin-labeled mutant. Positive membrane depth parameters indicative of membrane insertion were found for three positions, all located on the Ca2+ binding loops: N189 on CBL 1, and both R249 and R252 on CBL 3. In addition, EPR power saturation revealed that five positions near the anion binding site are partially protected from collisions with an aqueous paramagnetic probe, indicating that the anion binding site lies at or near the surface of the headgroup layer. Together, the fluorescence and EPR results indicate that the Ca2+ first and third Ca2+ binding loops insert directly into the lipid headgroup region of the membrane, and that the anion binding site on β-strands 3–4 lies near the headgroups. The data support a model in which the β-strands are tilted toward the parallel orientation relative to the membrane surface. PMID:12564928

  6. Reprogramming cell fate with a genome-scale library of artificial transcription factors.

    PubMed

    Eguchi, Asuka; Wleklinski, Matthew J; Spurgat, Mackenzie C; Heiderscheit, Evan A; Kropornicka, Anna S; Vu, Catherine K; Bhimsaria, Devesh; Swanson, Scott A; Stewart, Ron; Ramanathan, Parameswaran; Kamp, Timothy J; Slukvin, Igor; Thomson, James A; Dutton, James R; Ansari, Aseem Z

    2016-12-20

    Artificial transcription factors (ATFs) are precision-tailored molecules designed to bind DNA and regulate transcription in a preprogrammed manner. Libraries of ATFs enable the high-throughput screening of gene networks that trigger cell fate decisions or phenotypic changes. We developed a genome-scale library of ATFs that display an engineered interaction domain (ID) to enable cooperative assembly and synergistic gene expression at targeted sites. We used this ATF library to screen for key regulators of the pluripotency network and discovered three combinations of ATFs capable of inducing pluripotency without exogenous expression of Oct4 (POU domain, class 5, TF 1). Cognate site identification, global transcriptional profiling, and identification of ATF binding sites reveal that the ATFs do not directly target Oct4; instead, they target distinct nodes that converge to stimulate the endogenous pluripotency network. This forward genetic approach enables cell type conversions without a priori knowledge of potential key regulators and reveals unanticipated gene network dynamics that drive cell fate choices.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Huixian; Wacker, Daniel; Mileni, Mauro

    Opioid receptors mediate the actions of endogenous and exogenous opioids on many physiological processes, including the regulation of pain, respiratory drive, mood, and - in the case of {kappa}-opioid receptor ({kappa}-OR) - dysphoria and psychotomimesis. Here we report the crystal structure of the human {kappa}-OR in complex with the selective antagonist JDTic, arranged in parallel dimers, at 2.9 {angstrom} resolution. The structure reveals important features of the ligand-binding pocket that contribute to the high affinity and subtype selectivity of JDTic for the human {kappa}-OR. Modelling of other important {kappa}-OR-selective ligands, including the morphinan-derived antagonists norbinaltorphimine and 5'-guanidinonaltrindole, and the diterpenemore » agonist salvinorin A analogue RB-64, reveals both common and distinct features for binding these diverse chemotypes. Analysis of site-directed mutagenesis and ligand structure-activity relationships confirms the interactions observed in the crystal structure, thereby providing a molecular explanation for {kappa}-OR subtype selectivity, and essential insights for the design of compounds with new pharmacological properties targeting the human {kappa}-OR.« less

  8. The post-rigor structure of myosin VI and implications for the recovery stroke

    PubMed Central

    Ménétrey, Julie; Llinas, Paola; Cicolari, Jérome; Squires, Gaëlle; Liu, Xiaoyan; Li, Anna; Sweeney, H Lee; Houdusse, Anne

    2008-01-01

    Myosin VI has an unexpectedly large swing of its lever arm (powerstroke) that optimizes its unique reverse direction movement. The basis for this is an unprecedented rearrangement of the subdomain to which the lever arm is attached, referred to as the converter. It is unclear at what point(s) in the myosin VI ATPase cycle rearrangements in the converter occur, and how this would effect lever arm position. We solved the structure of myosin VI with an ATP analogue (ADP.BeF3) bound in its nucleotide-binding pocket. The structure reveals that no rearrangement in the converter occur upon ATP binding. Based on previously solved myosin structures, our structure suggests that no reversal of the powerstroke occurs during detachment of myosin VI from actin. The structure also reveals novel features of the myosin VI motor that may be important in maintaining the converter conformation during detachment from actin, and other features that may promote rapid rearrangements in the structure following actin detachment that enable hydrolysis of ATP. PMID:18046460

  9. Reprogramming cell fate with a genome-scale library of artificial transcription factors

    PubMed Central

    Eguchi, Asuka; Wleklinski, Matthew J.; Spurgat, Mackenzie C.; Heiderscheit, Evan A.; Kropornicka, Anna S.; Vu, Catherine K.; Bhimsaria, Devesh; Swanson, Scott A.; Stewart, Ron; Ramanathan, Parameswaran; Kamp, Timothy J.; Slukvin, Igor; Thomson, James A.; Dutton, James R.; Ansari, Aseem Z.

    2016-01-01

    Artificial transcription factors (ATFs) are precision-tailored molecules designed to bind DNA and regulate transcription in a preprogrammed manner. Libraries of ATFs enable the high-throughput screening of gene networks that trigger cell fate decisions or phenotypic changes. We developed a genome-scale library of ATFs that display an engineered interaction domain (ID) to enable cooperative assembly and synergistic gene expression at targeted sites. We used this ATF library to screen for key regulators of the pluripotency network and discovered three combinations of ATFs capable of inducing pluripotency without exogenous expression of Oct4 (POU domain, class 5, TF 1). Cognate site identification, global transcriptional profiling, and identification of ATF binding sites reveal that the ATFs do not directly target Oct4; instead, they target distinct nodes that converge to stimulate the endogenous pluripotency network. This forward genetic approach enables cell type conversions without a priori knowledge of potential key regulators and reveals unanticipated gene network dynamics that drive cell fate choices. PMID:27930301

  10. PRISM offers a comprehensive genomic approach to transcription factor function prediction

    PubMed Central

    Wenger, Aaron M.; Clarke, Shoa L.; Guturu, Harendra; Chen, Jenny; Schaar, Bruce T.; McLean, Cory Y.; Bejerano, Gill

    2013-01-01

    The human genome encodes 1500–2000 different transcription factors (TFs). ChIP-seq is revealing the global binding profiles of a fraction of TFs in a fraction of their biological contexts. These data show that the majority of TFs bind directly next to a large number of context-relevant target genes, that most binding is distal, and that binding is context specific. Because of the effort and cost involved, ChIP-seq is seldom used in search of novel TF function. Such exploration is instead done using expression perturbation and genetic screens. Here we propose a comprehensive computational framework for transcription factor function prediction. We curate 332 high-quality nonredundant TF binding motifs that represent all major DNA binding domains, and improve cross-species conserved binding site prediction to obtain 3.3 million conserved, mostly distal, binding site predictions. We combine these with 2.4 million facts about all human and mouse gene functions, in a novel statistical framework, in search of enrichments of particular motifs next to groups of target genes of particular functions. Rigorous parameter tuning and a harsh null are used to minimize false positives. Our novel PRISM (predicting regulatory information from single motifs) approach obtains 2543 TF function predictions in a large variety of contexts, at a false discovery rate of 16%. The predictions are highly enriched for validated TF roles, and 45 of 67 (67%) tested binding site regions in five different contexts act as enhancers in functionally matched cells. PMID:23382538

  11. Substrate Binding Drives Active-Site Closing of Human Blood Group B Galactosyltransferase as Revealed by Hot-Spot Labeling and NMR Spectroscopy Experiments.

    PubMed

    Weissbach, Sophie; Flügge, Friedemann; Peters, Thomas

    2018-05-04

    Crystallography has shown that human blood group A (GTA) and B (GTB) glycosyltransferases undergo transitions between "open", "semiclosed", and "closed" conformations upon substrate binding. However, the timescales of the corresponding conformational reorientations are unknown. Crystal structures show that the Trp and Met residues are located at "conformational hot spots" of the enzymes. Therefore, we utilized 15 N side-chain labeling of Trp residues and 13 C-methyl labeling of Met residues to study substrate-induced conformational transitions of GTB. Chemical-shift perturbations (CSPs) of Met and Trp residues in direct contact with substrate ligands reflect binding kinetics, whereas the CSPs of Met and Trp residues at remote sites reflect conformational changes of the enzyme upon substrate binding. Acceptor binding is fast on the chemical-shift timescale with rather small CSPs in the range of less than approximately 20 Hz. Donor binding matches the intermediate exchange regime to yield an estimate for exchange rate constants of approximately 200-300 Hz. Donor or acceptor binding to GTB saturated with acceptor or donor substrate, respectively, is slow (<10 Hz), as are coupled protein motions, reflecting mutual allosteric control of donor and acceptor binding. Remote CSPs suggest that substrate binding drives the enzyme into the closed state required for catalysis. These findings should contribute to better understanding of the mechanism of glycosyl transfer of GTA and GTB. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. The intracellular domain of teneurin-1 induces the activity of microphthalmia-associated transcription factor (MITF) by binding to transcriptional repressor HINT1.

    PubMed

    Schöler, Jonas; Ferralli, Jacqueline; Thiry, Stéphane; Chiquet-Ehrismann, Ruth

    2015-03-27

    Teneurins are large type II transmembrane proteins that are necessary for the normal development of the CNS. Although many studies highlight the significance of teneurins, especially during development, there is only limited information known about the molecular mechanisms of function. Previous studies have shown that the N-terminal intracellular domain (ICD) of teneurins can be cleaved at the membrane and subsequently translocates to the nucleus, where it can influence gene transcription. Because teneurin ICDs do not contain any intrinsic DNA binding sequences, interaction partners are required to affect transcription. Here, we identified histidine triad nucleotide binding protein 1 (HINT1) as a human teneurin-1 ICD interaction partner in a yeast two-hybrid screen. This interaction was confirmed in human cells, where HINT1 is known to inhibit the transcription of target genes by directly binding to transcription factors at the promoter. In a whole transcriptome analysis of BS149 glioblastoma cells overexpressing the teneurin-1 ICD, several microphthalmia-associated transcription factor (MITF) target genes were found to be up-regulated. Directly comparing the transcriptomes of MITF versus TEN1-ICD-overexpressing BS149 cells revealed 42 co-regulated genes, including glycoprotein non-metastatic b (GPNMB). Using real-time quantitative PCR to detect endogenous GPNMB expression upon overexpression of MITF and HINT1 as well as promoter reporter assays using GPNMB promoter constructs, we could demonstrate that the teneurin-1 ICD binds HINT1, thus switching on MITF-dependent transcription of GPNMB. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Protein Association and Dissociation Regulated by Ferric Ion

    PubMed Central

    Li, Chaorui; Fu, Xiaoping; Qi, Xin; Hu, Xiaosong; Chasteen, N. Dennis; Zhao, Guanghua

    2009-01-01

    Iron stored in phytoferritin plays an important role in the germination and early growth of seedlings. The protein is located in the amyloplast where it stores large amounts of iron as a hydrated ferric oxide mineral core within its shell-like structure. The present work was undertaken to study alternate mechanisms of core formation in pea seed ferritin (PSF). The data reveal a new mechanism for mineral core formation in PSF involving the binding and oxidation of iron at the extension peptide (EP) located on the outer surface of the protein shell. This binding induces aggregation of the protein into large assemblies of ∼400 monomers. The bound iron is gradually translocated to the mineral core during which time the protein dissociates back into its monomeric state. Either the oxidative addition of Fe2+ to the apoprotein to form Fe3+ or the direct addition of Fe3+ to apoPSF causes protein aggregation once the binding capacity of the 24 ferroxidase centers (48 Fe3+/shell) is exceeded. When the EP is enzymatically deleted from PSF, aggregation is not observed, and the rate of iron oxidation is significantly reduced, demonstrating that the EP is a critical structural component for iron binding, oxidation, and protein aggregation. These data point to a functional role for the extension peptide as an iron binding and ferroxidase center that contributes to mineralization of the iron core. As the iron core grows larger, the new pathway becomes less important, and Fe2+ oxidation and deposition occurs directly on the surface of the iron core. PMID:19398557

  14. Water channel in the binding site of a high affinity anti-methotrexate antibody.

    PubMed

    Gayda, Susan; Longenecker, Kenton L; Manoj, Sharmila; Judge, Russell A; Saldana, Sylvia C; Ruan, Qiaoqiao; Swift, Kerry M; Tetin, Sergey Y

    2014-06-17

    In the present study, we report the structure of the free and drug-bound Fab fragment of a high affinity anti-methotrexate antibody and perform a thermodynamic analysis of the binding process. The anti-methotrexate Fab fragment features a remarkably rigid tunnel-like binding site that extends into a water channel serving as a specialized route to move solvent out and into the site upon ligand binding and dissociation. This new finding in antibody structure-function relationships directly relates to the fast association (1 × 10⁷ M⁻¹ s⁻¹) and slow dissociation (4 × 10⁻⁵ s⁻¹) rates determined for mAb ADD056, resulting in a very strong binding with a K(D) ~ 3.6 pM at 20 °C. As follows from the X-ray data analysis, the methotrexate-antibody complex is stabilized by an extended network of hydrogen bonds and stacking interactions. The analysis also shows structural involvement of the CDR H3 in formation of the water channel revealing another important role of this hypervariable region. This suggests a new direction in natural affinity maturation and opens a new possibility in antibody engineering. Methotrexate is a widely used therapeutic agent for many malignant diseases and inflammatory disorders. Unfortunately, it may also interfere with central aspects of metabolism and thereby cause inevitable side effects. Therefore, methotrexate therapy requires careful monitoring of drug blood levels, which is traditionally done by immunoassays. An understanding of the structure-function properties of antibodies selected for drug monitoring substantiates the performance and robustness of such tests.

  15. Molecular and biochemical evidence for the involvement of calcium/calmodulin in auxin action

    NASA Technical Reports Server (NTRS)

    Yang, T.; Poovaiah, B. W.

    2000-01-01

    The use of (35)S-labeled calmodulin (CaM) to screen a corn root cDNA expression library has led to the isolation of a CaM-binding protein, encoded by a cDNA with sequence similarity to small auxin up RNAs (SAURs), a class of early auxin-responsive genes. The cDNA designated as ZmSAUR1 (Zea mays SAURs) was expressed in Escherichia coli, and the recombinant protein was purified by CaM affinity chromatography. The CaM binding assay revealed that the recombinant protein binds to CaM in a calcium-dependent manner. Deletion analysis revealed that the CaM binding site was located at the NH(2)-terminal domain. A synthetic peptide of amino acids 20-45, corresponding to the potential CaM binding region, was used for calcium-dependent mobility shift assays. The synthetic peptide formed a stable complex with CaM only in the presence of calcium. The CaM affinity assay indicated that ZmSAUR1 binds to CaM with high affinity (K(d) approximately 15 nM) in a calcium-dependent manner. Comparison of the NH(2)-terminal portions of all of the characterized SAURs revealed that they all contain a stretch of the basic alpha-amphiphilic helix similar to the CaM binding region of ZmSAUR1. CaM binds to the two synthetic peptides from the NH(2)-terminal regions of Arabidopsis SAUR-AC1 and soybean 10A5, suggesting that this is a general phenomenon for all SAURs. Northern analysis was carried out using the total RNA isolated from auxin-treated corn coleoptile segments. ZmSAUR1 gene expression began within 10 min, increased rapidly between 10 and 60 min, and peaked around 60 min after 10 microM alpha-naphthaleneacetic acid treatment. These results indicate that ZmSAUR1 is an early auxin-responsive gene. The CaM antagonist N-(6-aminohexyl)5-chloro-1-naphthalenesulfonamide hydrochloride inhibited the auxin-induced cell elongation but not the auxin-induced expression of ZmSAUR1. This suggests that calcium/CaM do not regulate ZmSAUR1 at the transcriptional level. CaM binding to ZmSAUR1 in a calcium-dependent manner suggests that calcium/CaM regulate ZmSAUR1 at the post-translational level. Our data provide the first direct evidence for the involvement of calcium/CaM-mediated signaling in auxin-mediated signal transduction.

  16. Single-stranded DNA Binding by the Helix-Hairpin-Helix Domain of XPF Protein Contributes to the Substrate Specificity of the ERCC1-XPF Protein Complex*

    PubMed Central

    Das, Devashish; Faridounnia, Maryam; Kovacic, Lidija; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

    2017-01-01

    The nucleotide excision repair protein complex ERCC1-XPF is required for incision of DNA upstream of DNA damage. Functional studies have provided insights into the binding of ERCC1-XPF to various DNA substrates. However, because no structure for the ERCC1-XPF-DNA complex has been determined, the mechanism of substrate recognition remains elusive. Here we biochemically characterize the substrate preferences of the helix-hairpin-helix (HhH) domains of XPF and ERCC-XPF and show that the binding to single-stranded DNA (ssDNA)/dsDNA junctions is dependent on joint binding to the DNA binding domain of ERCC1 and XPF. We reveal that the homodimeric XPF is able to bind various ssDNA sequences but with a clear preference for guanine-containing substrates. NMR titration experiments and in vitro DNA binding assays also show that, within the heterodimeric ERCC1-XPF complex, XPF specifically recognizes ssDNA. On the other hand, the HhH domain of ERCC1 preferentially binds dsDNA through the hairpin region. The two separate non-overlapping DNA binding domains in the ERCC1-XPF heterodimer jointly bind to an ssDNA/dsDNA substrate and, thereby, at least partially dictate the incision position during damage removal. Based on structural models, NMR titrations, DNA-binding studies, site-directed mutagenesis, charge distribution, and sequence conservation, we propose that the HhH domain of ERCC1 binds to dsDNA upstream of the damage, and XPF binds to the non-damaged strand within a repair bubble. PMID:28028171

  17. The structure of the SBP-Tag–streptavidin complex reveals a novel helical scaffold bridging binding pockets on separate subunits

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Barrette-Ng, Isabelle H.; Wu, Sau-Ching; Tjia, Wai-Mui

    2013-05-01

    The structure of the SBP-Tag–streptavidin complex reveals a novel mode of peptide recognition in which a single peptide binds simultaneously to biotin-binding pockets from adjacent subunits of streptavidin. The molecular details of peptide recognition suggest how the SBP-Tag can be further modified to become an even more useful tag for a wider range of biotechnological applications. The 38-residue SBP-Tag binds to streptavidin more tightly (K{sub d} ≃ 2.5–4.9 nM) than most if not all other known peptide sequences. Crystallographic analysis at 1.75 Å resolution shows that the SBP-Tag binds to streptavidin in an unprecedented manner by simultaneously interacting with biotin-bindingmore » pockets from two separate subunits. An N-terminal HVV peptide sequence (residues 12–14) and a C-terminal HPQ sequence (residues 31–33) form the bulk of the direct interactions between the SBP-Tag and the two biotin-binding pockets. Surprisingly, most of the peptide spanning these two sites (residues 17–28) adopts a regular α-helical structure that projects three leucine side chains into a groove formed at the interface between two streptavidin protomers. The crystal structure shows that residues 1–10 and 35–38 of the original SBP-Tag identified through in vitro selection and deletion analysis do not appear to contact streptavidin and thus may not be important for binding. A 25-residue peptide comprising residues 11–34 (SBP-Tag2) was synthesized and shown using surface plasmon resonance to bind streptavidin with very similar affinity and kinetics when compared with the SBP-Tag. The SBP-Tag2 was also added to the C-terminus of β-lactamase and was shown to be just as effective as the full-length SBP-Tag in affinity purification. These results validate the molecular structure of the SBP-Tag–streptavidin complex and establish a minimal bivalent streptavidin-binding tag from which further rational design and optimization can proceed.« less

  18. Protein-protein binding before and after photo-modification of albumin

    NASA Astrophysics Data System (ADS)

    Rozinek, Sarah C.; Glickman, Randolph D.; Thomas, Robert J.; Brancaleon, Lorenzo

    2016-03-01

    Bioeffects of directed-optical-energy encompass a wide range of applications. One aspect of photochemical interactions involves irradiating a photosensitizer with visible light in order to induce protein unfolding and consequent changes in function. In the past, irradiation of several dye-protein combinations has revealed effects on protein structure. Beta lactoglobulin, human serum albumin (HSA) and tubulin have all been photo-modified with meso-tetrakis(4- sulfonatophenyl)porphyrin (TSPP) bound, but only in the case of tubulin has binding caused a verified loss of biological function (loss of ability to form microtubules) as a result of this light-induced structural change. The current work questions if the photo-induced structural changes that occur to HSA, are sufficient to disable its biological function of binding to osteonectin. The albumin-binding protein, osteonectin, is about half the molecular weight of HSA, so the two proteins and their bound product can be separated and quantified by size exclusion high performance liquid chromatography. TSPP was first bound to HSA and irradiated, photo-modifying the structure of HSA. Then native HSA or photo-modified HSA (both with TSPP bound) were compared, to assess loss in HSA's innate binding ability as a result of light-induced structure modification.

  19. Cholesterol-Binding Sites in GIRK Channels: The Devil is in the Details.

    PubMed

    Rosenhouse-Dantsker, Avia

    2018-01-01

    In recent years, it has become evident that cholesterol plays a direct role in the modulation of a variety of ion channels. In most cases, cholesterol downregulates channel activity. In contrast, our earlier studies have demonstrated that atrial G protein inwardly rectifying potassium (GIRK) channels are upregulated by cholesterol. Recently, we have shown that hippocampal GIRK currents are also upregulated by cholesterol. A combined computational-experimental approach pointed to putative cholesterol-binding sites in the transmembrane domain of the GIRK2 channel, the primary subunit in hippocampal GIRK channels. In particular, the principal cholesterol-binding site was located in the center of the transmembrane domain in between the inner and outer α-helices of 2 adjacent subunits. Further studies pointed to a similar cholesterol-binding site in GIRK4, a major subunit in atrial GIRK channels. However, a close look at a sequence alignment of the transmembrane helices of the 2 channels reveals surprising differences among the residues that interact with the cholesterol molecule in these 2 channels. Here, we compare the residues that form putative cholesterol-binding sites in GIRK2 and GIRK4 and discuss the similarities and differences among them.

  20. Structure of Drosophila Oskar reveals a novel RNA binding protein

    PubMed Central

    Yang, Na; Yu, Zhenyu; Hu, Menglong; Wang, Mingzhu; Lehmann, Ruth; Xu, Rui-Ming

    2015-01-01

    Oskar (Osk) protein plays critical roles during Drosophila germ cell development, yet its functions in germ-line formation and body patterning remain poorly understood. This situation contrasts sharply with the vast knowledge about the function and mechanism of osk mRNA localization. Osk is predicted to have an N-terminal LOTUS domain (Osk-N), which has been suggested to bind RNA, and a C-terminal hydrolase-like domain (Osk-C) of unknown function. Here, we report the crystal structures of Osk-N and Osk-C. Osk-N shows a homodimer of winged-helix–fold modules, but without detectable RNA-binding activity. Osk-C has a lipase-fold structure but lacks critical catalytic residues at the putative active site. Surprisingly, we found that Osk-C binds the 3′UTRs of osk and nanos mRNA in vitro. Mutational studies identified a region of Osk-C important for mRNA binding. These results suggest possible functions of Osk in the regulation of stability, regulation of translation, and localization of relevant mRNAs through direct interaction with their 3′UTRs, and provide structural insights into a novel protein–RNA interaction motif involving a hydrolase-related domain. PMID:26324911

  1. Metformin is a novel suppressor for transforming growth factor (TGF)-β1

    NASA Astrophysics Data System (ADS)

    Xiao, Han; Zhang, Jianshu; Xu, Zhonghe; Feng, Yenan; Zhang, Mingliang; Liu, Jianli; Chen, Ruifei; Shen, Jing; Wu, Jimin; Lu, Zhizhen; Fang, Xiaohong; Li, Jingyuan; Zhang, Youyi

    2016-06-01

    Metformin is a widely used first-line antidiabetic drug that has been shown to protect against a variety of specific diseases in addition to diabetes, including cardiovascular disorders, polycystic ovary syndrome, and cancer. However, the precise mechanisms underlying the diverse therapeutic effects of metformin remain elusive. Here, we report that transforming growth factor-β1 (TGF-β1), which is involved in the pathogenesis of numerous diseases, is a novel target of metformin. Using a surface plasmon resonance-based assay, we identified the direct binding of metformin to TGF-β1 and found that metformin inhibits [125I]-TGF-β1 binding to its receptor. Furthermore, based on molecular docking and molecular dynamics simulations, metformin was predicted to interact with TGF-β1 at its receptor-binding domain. Single-molecule force spectroscopy revealed that metformin reduces the binding probability but not the binding force of TGF-β1 to its type II receptor. Consequently, metformin suppresses type II TGF-β1 receptor dimerization upon exposure to TGF-β1, which is essential for downstream signal transduction. Thus, our results indicate that metformin is a novel TGF-β suppressor with therapeutic potential for numerous diseases in which TGF-β1 hyperfunction is indicated.

  2. Different domains of the murine RNA polymerase I-specific termination factor mTTF-I serve distinct functions in transcription termination.

    PubMed

    Evers, R; Smid, A; Rudloff, U; Lottspeich, F; Grummt, I

    1995-03-15

    Termination of mouse ribosomal gene transcription by RNA polymerase I (Pol I) requires the specific interaction of a DNA binding protein, mTTF-I, with an 18 bp sequence element located downstream of the rRNA coding region. Here we describe the molecular cloning and functional characterization of the cDNA encoding this transcription termination factor. Recombinant mTTF-I binds specifically to the murine terminator elements and terminates Pol I transcription in a reconstituted in vitro system. Deletion analysis has defined a modular structure of mTTF-I comprising a dispensable N-terminal half, a large C-terminal DNA binding region and an internal domain which is required for transcription termination. Significantly, the C-terminal region of mTTF-I reveals striking homology to the DNA binding domains of the proto-oncogene c-Myb and the yeast transcription factor Reb1p. Site-directed mutagenesis of one of the tryptophan residues that is conserved in the homology region of c-Myb, Reb1p and mTTF-I abolishes specific DNA binding, a finding which underscores the functional relevance of these residues in DNA-protein interactions.

  3. Different domains of the murine RNA polymerase I-specific termination factor mTTF-I serve distinct functions in transcription termination.

    PubMed Central

    Evers, R; Smid, A; Rudloff, U; Lottspeich, F; Grummt, I

    1995-01-01

    Termination of mouse ribosomal gene transcription by RNA polymerase I (Pol I) requires the specific interaction of a DNA binding protein, mTTF-I, with an 18 bp sequence element located downstream of the rRNA coding region. Here we describe the molecular cloning and functional characterization of the cDNA encoding this transcription termination factor. Recombinant mTTF-I binds specifically to the murine terminator elements and terminates Pol I transcription in a reconstituted in vitro system. Deletion analysis has defined a modular structure of mTTF-I comprising a dispensable N-terminal half, a large C-terminal DNA binding region and an internal domain which is required for transcription termination. Significantly, the C-terminal region of mTTF-I reveals striking homology to the DNA binding domains of the proto-oncogene c-Myb and the yeast transcription factor Reb1p. Site-directed mutagenesis of one of the tryptophan residues that is conserved in the homology region of c-Myb, Reb1p and mTTF-I abolishes specific DNA binding, a finding which underscores the functional relevance of these residues in DNA-protein interactions. Images PMID:7720715

  4. A single mutation in Taiwanese H6N1 influenza hemagglutinin switches binding to human-type receptors.

    PubMed

    de Vries, Robert P; Tzarum, Netanel; Peng, Wenjie; Thompson, Andrew J; Ambepitiya Wickramasinghe, Iresha N; de la Pena, Alba T Torrents; van Breemen, Marielle J; Bouwman, Kim M; Zhu, Xueyong; McBride, Ryan; Yu, Wenli; Sanders, Rogier W; Verheije, Monique H; Wilson, Ian A; Paulson, James C

    2017-09-01

    In June 2013, the first case of human infection with an avian H6N1 virus was reported in a Taiwanese woman. Although this was a single non-fatal case, the virus continues to circulate in Taiwanese poultry. As with any emerging avian virus that infects humans, there is concern that acquisition of human-type receptor specificity could enable transmission in the human population. Despite mutations in the receptor-binding pocket of the human H6N1 isolate, it has retained avian-type (NeuAcα2-3Gal) receptor specificity. However, we show here that a single nucleotide substitution, resulting in a change from Gly to Asp at position 225 (G225D), completely switches specificity to human-type (NeuAcα2-6Gal) receptors. Significantly, G225D H6 loses binding to chicken trachea epithelium and is now able to bind to human tracheal tissue. Structural analysis reveals that Asp225 directly interacts with the penultimate Gal of the human-type receptor, stabilizing human receptor binding. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  5. Nanopore Force Spectroscopy of Aptamer–Ligand Complexes

    PubMed Central

    Arnaut, Vera; Langecker, Martin; Simmel, Friedrich C.

    2013-01-01

    The stability of aptamer–ligand complexes is probed in nanopore-based dynamic force spectroscopy experiments. Specifically, the ATP-binding aptamer is investigated using a backward translocation technique, in which the molecules are initially pulled through an α-hemolysin nanopore from the cis to the trans side of a lipid bilayer membrane, allowed to refold and interact with their target, and then translocated back in the trans–cis direction. From these experiments, the distribution of bound and unbound complexes is determined, which in turn allows determination of the dissociation constant Kd ≈ 0.1 mM of the aptamer and of voltage-dependent unfolding rates. The experiments also reveal differences in binding of the aptamer to AMP, ADP, or ATP ligands. Investigation of an aptamer variant with a stabilized ATP-binding site indicates fast conformational switching of the original aptamer before ATP binding. Nanopore force spectroscopy is also used to study binding of the thrombin-binding aptamer to its target. To detect aptamer–target interactions in this case, the stability of the ligand-free aptamer—containing G-quadruplexes—is tuned via the potassium content of the buffer. Although the presence of thrombin was detected, limitations of the method for aptamers with strong secondary structures and complexes with nanomolar Kd were identified. PMID:24010663

  6. Structure of a retro-binding peptide inhibitor complexed with human alpha-thrombin.

    PubMed

    Tabernero, L; Chang, C Y; Ohringer, S L; Lau, W F; Iwanowicz, E J; Han, W C; Wang, T C; Seiler, S M; Roberts, D G; Sack, J S

    1995-02-10

    The crystallographic structure of the ternary complex between human alpha-thrombin, hirugen and the peptidyl inhibitor Phe-alloThr-Phe-O-CH3, which is acylated at its N terminus with 4-guanidino butanoic acid (BMS-183507), has been determined at 2.6 A resolution. The structure reveals a unique "retro-binding" mode for this tripeptide active site inhibitor. The inhibitor binds with its alkyl-guanidine moiety in the primary specificity pocket and its two phenyl rings occupying the hydrophobic proximal and distal pockets of the thrombin active site. In this arrangement the backbone of the tripeptide forms a parallel beta-strand to the thrombin main-chain at the binding site. This is opposite to the orientation of the natural substrate, fibrinogen, and all the small active site-directed thrombin inhibitors whose bound structures have been previously reported. BMS-183507 is the first synthetic inhibitor proved to bind in a retro-binding fashion to thrombin, in a fashion similar to that of the N-terminal residues of the natural inhibitor hirudin. Furthermore, this new potent thrombin inhibitor (Ki = 17.2 nM) is selective for thrombin over other serine proteases tested and may be a template to be considered in designing hirudin-based thrombin inhibitors with interactions at the specificity pocket.

  7. Flexible DNA binding of the BTB/POZ-domain protein FBI-1.

    PubMed

    Pessler, Frank; Hernandez, Nouria

    2003-08-01

    POZ-domain transcription factors are characterized by the presence of a protein-protein interaction domain called the POZ or BTB domain at their N terminus and zinc fingers at their C terminus. Despite the large number of POZ-domain transcription factors that have been identified to date and the significant insights that have been gained into their cellular functions, relatively little is known about their DNA binding properties. FBI-1 is a BTB/POZ-domain protein that has been shown to modulate HIV-1 Tat trans-activation and to repress transcription of some cellular genes. We have used various viral and cellular FBI-1 binding sites to characterize the interaction of a POZ-domain protein with DNA in detail. We find that FBI-1 binds to inverted sequence repeats downstream of the HIV-1 transcription start site. Remarkably, it binds efficiently to probes carrying these repeats in various orientations and spacings with no particular rotational alignment, indicating that its interaction with DNA is highly flexible. Indeed, FBI-1 binding sites in the adenovirus 2 major late promoter, the c-fos gene, and the c-myc P1 and P2 promoters reveal variously spaced direct, inverted, and everted sequence repeats with the consensus sequence G(A/G)GGG(T/C)(C/T)(T/C)(C/T) for each repeat.

  8. Structural basis of PP2A activation by PTPA, an ATP-dependent activation chaperone

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guo, Feng; Stanevich, Vitali; Wlodarchak, Nathan

    Proper activation of protein phosphatase 2A (PP2A) catalytic subunit is central for the complex PP2A regulation and is crucial for broad aspects of cellular function. The crystal structure of PP2A bound to PP2A phosphatase activator (PTPA) and ATPγS reveals that PTPA makes broad contacts with the structural elements surrounding the PP2A active site and the adenine moiety of ATP. PTPA-binding stabilizes the protein fold of apo-PP2A required for activation, and orients ATP phosphoryl groups to bind directly to the PP2A active site. This allows ATP to modulate the metal-binding preferences of the PP2A active site and utilize the PP2A activemore » site for ATP hydrolysis. In vitro, ATP selectively and drastically enhances binding of endogenous catalytic metal ions, which requires ATP hydrolysis and is crucial for acquisition of pSer/Thr-specific phosphatase activity. Furthermore, both PP2A- and ATP-binding are required for PTPA function in cell proliferation and survival. Our results suggest novel mechanisms of PTPA in PP2A activation with structural economy and a unique ATP-binding pocket that could potentially serve as a specific therapeutic target.« less

  9. Evidence that Poly(A) Binding Protein C1 Binds Nuclear Pre-mRNA Poly(A) Tails

    PubMed Central

    Hosoda, Nao; Lejeune, Fabrice; Maquat, Lynne E.

    2006-01-01

    In mammalian cells, poly(A) binding protein C1 (PABP C1) has well-known roles in mRNA translation and decay in the cytoplasm. However, PABPC1 also shuttles in and out of the nucleus, and its nuclear function is unknown. Here, we show that PABPC1, like the major nuclear poly(A) binding protein PABPN1, associates with nuclear pre-mRNAs that are polyadenylated and intron containing. PABPC1 does not bind nonpolyadenylated histone mRNA, indicating that the interaction of PABPC1 with pre-mRNA requires a poly(A) tail. Consistent with this conclusion, UV cross-linking results obtained using intact cells reveal that PABPC1 binds directly to pre-mRNA poly(A) tails in vivo. We also show that PABPC1 immunopurifies with poly(A) polymerase, suggesting that PABPC1 is acquired by polyadenylated transcripts during poly(A) tail synthesis. Our findings demonstrate that PABPC1 associates with polyadenylated transcripts earlier in mammalian mRNA biogenesis than previously thought and offer insights into the mechanism by which PABPC1 is recruited to newly synthesized poly(A). Our results are discussed in the context of pre-mRNA processing and stability and mRNA trafficking and the pioneer round of translation. PMID:16581783

  10. Metal Binding Properties of Escherichia coli YjiA, a Member of the Metal Homeostasis-Associated COG0523 Family of GTPases

    PubMed Central

    2013-01-01

    GTPases are critical molecular switches involved in a wide range of biological functions. Recent phylogenetic and genomic analyses of the large, mostly uncharacterized COG0523 subfamily of GTPases revealed a link between some COG0523 proteins and metal homeostasis pathways. In this report, we detail the bioinorganic characterization of YjiA, a representative member of COG0523 subgroup 9 and the only COG0523 protein to date with high-resolution structural information. We find that YjiA is capable of binding several types of transition metals with dissociation constants in the low micromolar range and that metal binding affects both the oligomeric structure and GTPase activity of the enzyme. Using a combination of X-ray crystallography and site-directed mutagenesis, we identify, among others, a metal-binding site adjacent to the nucleotide-binding site in the GTPase domain that involves a conserved cysteine and several glutamate residues. Mutations of the coordinating residues decrease the impact of metal, suggesting that metal binding to this site is responsible for modulating the GTPase activity of the protein. These findings point toward a regulatory function for these COG0523 GTPases that is responsive to their metal-bound state. PMID:24449932

  11. Structural Basis for High Affinity Volatile Anesthetic Binding in a Natural 4-helix Bundle Protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu,R.; Loll, P.; Eckenhoff, R.

    2005-01-01

    Physiologic sites for inhaled anesthetics are presumed to be cavities within transmembrane 4-{alpha}-helix bundles of neurotransmitter receptors, but confirmation of binding and structural detail of such sites remains elusive. To provide such detail, we screened soluble proteins containing this structural motif, and found only one that exhibited evidence of strong anesthetic binding. Ferritin is a 24-mer of 4-{alpha}-helix bundles; both halothane and isoflurane bind with K{sub A} values of {approx}10{sup 5} M{sup -1, } higher than any previously reported inhaled anesthetic-protein interaction. The crystal structures of the halothane/apoferritin and isoflurane/apoferritin complexes were determined at 1.75 Angstroms resolution, revealing a commonmore » anesthetic binding pocket within an interhelical dimerization interface. The high affinity is explained by several weak polar contacts and an optimal host/guest packing relationship. Neither the acidic protons nor ether oxygen of the anesthetics contribute to the binding interaction. Compared with unliganded apoferritin, the anesthetic produced no detectable alteration of structure or B factors. The remarkably high affinity of the anesthetic/apoferritin complex implies greater selectivity of protein sites than previously thought, and suggests that direct protein actions may underlie effects at lower than surgical levels of anesthetic, including loss of awareness.« less

  12. Interactions between G-actin and myosin subfragment 1: immunochemical probing of the NH2-terminal segment on actin.

    PubMed

    DasGupta, G; White, J; Cheung, P; Reisler, E

    1990-09-11

    The role of the N-terminal segment of actin in myosin-induced polymerization of G-actin was studied by using peptide antibodies directed against the first seven N-terminal residues of alpha-skeletal actin. Light scattering, fluorescence, and analytical ultracentrifugation experiments showed that the Fab fragments of these antibodies inhibited the polymerization of G-actin by myosin subfragment 1 (S-1) by inhibiting the binding of these proteins to each other. Fluorescence measurements using actin labeled with pyrenyliodoacetamide revealed that Fab inhibited the initial step in the binding of S-1 to G-actin. It is deduced from these results and from other literature data that the initial contact between G-actin and S-1 involves residues 1-7 on actin and residues 633-642 on the S-1 heavy chain. This interaction appears to be of major importance for the binding of S-1 and G-actin. The presence of additional myosin contact sites on G-actin was indicated by concentration-dependent recovery of S-1 binding to G-actin without displacement of Fab. The reduced Fab inhibition of S-1 binding to polymerizing and polymerized actin is consistent with the tightening of acto-S-1 binding at these sites or the creation of new sites upon formation of F-actin.

  13. Structure of the Response Regulator PhoP from Mycobacterium tuberculosis Reveals a Dimer Through the Receiver Domain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    S Menon; S Wang

    The PhoP protein from Mycobacterium tuberculosis is a response regulator of the OmpR/PhoB subfamily, whose structure consists of an N-terminal receiver domain and a C-terminal DNA-binding domain. How the DNA-binding activities are regulated by phosphorylation of the receiver domain remains unclear due to a lack of structural information on the full-length proteins. Here we report the crystal structure of the full-length PhoP of M. tuberculosis. Unlike other known structures of full-length proteins of the same subfamily, PhoP forms a dimer through its receiver domain with the dimer interface involving {alpha}4-{beta}5-{alpha}5, a common interface for activated receiver domain dimers. However, themore » switch residues, Thr99 and Tyr118, are in a conformation resembling those of nonactivated receiver domains. The Tyr118 side chain is involved in the dimer interface interactions. The receiver domain is tethered to the DNA-binding domain through a flexible linker and does not impose structural constraints on the DNA-binding domain. This structure suggests that phosphorylation likely facilitates/stabilizes receiver domain dimerization, bringing the DNA-binding domains to close proximity, thereby increasing their binding affinity for direct repeat DNA sequences.« less

  14. Structural Characterization of the E2 Domain of APL-1, a C. Elegans Homolog of Human Amyloid Precursor Protein, and its Heparin Binding Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoopes, J.; Liu, X; Xu, X

    2010-01-01

    The amyloid {beta}-peptide deposit found in the brain tissue of patients with Alzheimer disease is derived from a large heparin-binding protein precursor APP. The biological function of APP and its homologs is not precisely known. Here we report the x-ray structure of the E2 domain of APL-1, an APP homolog in Caenorhabditis elegans, and compare it to the human APP structure. We also describe the structure of APL-1 E2 in complex with sucrose octasulfate, a highly negatively charged disaccharide, which reveals an unexpected binding pocket between the two halves of E2. Based on the crystal structure, we are able tomore » map, using site-directed mutagenesis, a surface groove on E2 to which heparin may bind. Our biochemical data also indicate that the affinity of E2 for heparin is influenced by pH: at pH 5, the binding appears to be much stronger than that at neutral pH. This property is likely caused by histidine residues in the vicinity of the mapped heparin binding site and could be important for the proposed adhesive function of APL-1.« less

  15. Active site-directed double mutants of dihydrofolate reductase.

    PubMed

    Ercikan-Abali, E A; Mineishi, S; Tong, Y; Nakahara, S; Waltham, M C; Banerjee, D; Chen, W; Sadelain, M; Bertino, J R

    1996-09-15

    Variants of dihydrofolate reductase (DHFR), which confer resistance to antifolates, are used as dominant selectable markers in vitro and in vivo and may be useful in the context of gene therapy. To identify improved mutant human DHFRs with increased catalytic efficiency and decreased binding to methotrexate, we constructed by site-directed mutagenesis four variants with substitutions at both Leu22 and Phe31 (i.e., Phe22-Ser31, Tyr22-Ser31, Phe22-Gly31, and Tyr22-Gly31). Antifolate resistance has been observed previously when individual changes are made at these active-site residues. Substrate and antifolate binding properties of these "double" mutants revealed that each have greatly diminished affinity for antifolates (> 10,000-fold) yet only slightly reduced substrate affinity. Comparison of in vitro measured properties with those of single-residue variants indicates that double mutants are indeed significantly superior. This was verified for one of the double mutants that provided high-level methotrexate resistance following retrovirus-mediated gene transfer in NIH3T3 cells.

  16. The transcription factor FBI-1 inhibits SAM68-mediated BCL-X alternative splicing and apoptosis.

    PubMed

    Bielli, Pamela; Busà, Roberta; Di Stasi, Savino M; Munoz, Manuel J; Botti, Flavia; Kornblihtt, Alberto R; Sette, Claudio

    2014-04-01

    Alternative splicing (AS) is tightly coupled to transcription for the majority of human genes. However, how these two processes are linked is not well understood. Here, we unveil a direct role for the transcription factor FBI-1 in the regulation of AS. FBI-1 interacts with the splicing factor SAM68 and reduces its binding to BCL-X mRNA. This, in turn, results in the selection of the proximal 5' splice site in BCL-X exon 2, thereby favoring the anti-apoptotic BCL-XL variant and counteracting SAM68-mediated apoptosis. Conversely, depletion of FBI-1, or expression of a SAM68 mutant lacking the FBI-1 binding region, restores the ability of SAM68 to induce BCL-XS splicing and apoptosis. FBI-1's role in splicing requires the activity of histone deacetylases, whose pharmacological inhibition recapitulates the effects of FBI-1 knockdown. Our study reveals an unexpected function for FBI-1 in splicing modulation with a direct impact on cell survival.

  17. The transcription factor FBI-1 inhibits SAM68-mediated BCL-X alternative splicing and apoptosis

    PubMed Central

    Bielli, Pamela; Busà, Roberta; Di Stasi, Savino M; Munoz, Manuel J; Botti, Flavia; Kornblihtt, Alberto R; Sette, Claudio

    2014-01-01

    Alternative splicing (AS) is tightly coupled to transcription for the majority of human genes. However, how these two processes are linked is not well understood. Here, we unveil a direct role for the transcription factor FBI-1 in the regulation of AS. FBI-1 interacts with the splicing factor SAM68 and reduces its binding to BCL-X mRNA. This, in turn, results in the selection of the proximal 5′ splice site in BCL-X exon 2, thereby favoring the anti-apoptotic BCL-XL variant and counteracting SAM68-mediated apoptosis. Conversely, depletion of FBI-1, or expression of a SAM68 mutant lacking the FBI-1 binding region, restores the ability of SAM68 to induce BCL-XS splicing and apoptosis. FBI-1's role in splicing requires the activity of histone deacetylases, whose pharmacological inhibition recapitulates the effects of FBI-1 knockdown. Our study reveals an unexpected function for FBI-1 in splicing modulation with a direct impact on cell survival. PMID:24514149

  18. Identification of the Doublesex protein binding sites that activate expression of lozenge in the female genital disc in Drosophila melanogaster.

    PubMed

    Wagamitsu, Shunsuke; Takase, Dan; Aoki, Fugaku; Suzuki, Masataka G

    2017-02-01

    Normal sexual differentiation in the genital organs is essential for the animal species that use sexual reproduction. Although it is known that doublesex (dsx) is required for the sexual development of the genitalia in various insect species, the direct target genes responsible for the sexual differentiation of the genitalia have not been identified. The lozenge (lz) gene is expressed in the female genital disc and is essential for developments of spermathecae and accessory glands in Drosophila melanogaster. The female-specific isoform of DSX (DSXF) is required for activating lz expression in the female genital disc. However, it still remains unclear whether the DSXF directly activates the transcription of lz in the female genital disc. In this study, we found two sequences (lz-DBS1 and lz-DBS2) within lz locus that showed high homoloty to the DSX binding motif identified previously. Competition assays using recombinant DSX DNA-binding domain (DSX-DBD) protein verified that the DSX-DBD protein bound to lz-DBS1 and lz-DBS2 in a sequence-specific manner with lower affinity than to the known DSX binding site in the bric-à-brac 1 (bab1) gene. Reporter gene analyses revealed that a 2.5-kbp lz genomic fragment containing lz-DBS1 and lz-DBS2 drove reporter gene (EGFP) expression in a manner similar to endogenous lz expression in the female genital disc. Mutations in lz-DBS1 alone significantly reduced the area of EGFP-expressing region, while EGFP expression in the female genital disc was abolished when both sites were mutated. These results demonstrated that DSX directly activates female-specific lz expression in the genital disc through lz-DBS1 and lz-DBS2. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Structural Basis for Certain Naturally Occurring Bioflavonoids to Function as Reducing Co-Substrates of Cyclooxygenase I and II

    PubMed Central

    Zhu, Bao Ting

    2010-01-01

    Background Recent studies showed that some of the dietary bioflavonoids can strongly stimulate the catalytic activity of cyclooxygenase (COX) I and II in vitro and in vivo, presumably by facilitating enzyme re-activation. In this study, we sought to understand the structural basis of COX activation by these dietary compounds. Methodology/Principal Findings A combination of molecular modeling studies, biochemical analysis and site-directed mutagenesis assay was used as research tools. Three-dimensional quantitative structure-activity relationship analysis (QSAR/CoMFA) predicted that the ability of bioflavonoids to activate COX I and II depends heavily on their B-ring structure, a moiety known to be associated with strong antioxidant ability. Using the homology modeling and docking approaches, we identified the peroxidase active site of COX I and II as the binding site for bioflavonoids. Upon binding to this site, bioflavonoid can directly interact with hematin of the COX enzyme and facilitate the electron transfer from bioflavonoid to hematin. The docking results were verified by biochemical analysis, which reveals that when the cyclooxygenase activity of COXs is inhibited by covalent modification, myricetin can still stimulate the conversion of PGG2 to PGE2, a reaction selectively catalyzed by the peroxidase activity. Using the site-directed mutagenesis analysis, we confirmed that Q189 at the peroxidase site of COX II is essential for bioflavonoids to bind and re-activate its catalytic activity. Conclusions/Significance These findings provide the structural basis for bioflavonoids to function as high-affinity reducing co-substrates of COXs through binding to the peroxidase active site, facilitating electron transfer and enzyme re-activation. PMID:20808785

  20. Cloning and bacterial expression of adenosine-5'-triphosphate sulfurylase from the enteric protozoan parasite Entamoeba histolytica.

    PubMed

    Nozaki, T; Arase, T; Shigeta, Y; Asai, T; Leustek, T; Takeuchi, T

    1998-12-08

    A gene encoding adenosine-5'-triphosphate sulfurylase (AS) was cloned from the enteric protozoan parasite Entamoeba histolytica by polymerase chain reaction using degenerate oligonucleotide primers corresponding to conserved regions of the protein from a variety of organisms. The deduced amino acid sequence of E. histolytica AS revealed a calculated molecular mass of 47925 Da and an unusual basic pI of 9.38. The amebic protein sequence showed 23-48% identities with AS from bacteria, yeasts, fungi, plants, and animals with the highest identities being to Synechocystis sp. and Bacillus subtilis (48 and 44%, respectively). Four conserved blocks including putative sulfate-binding and phosphate-binding regions were highly conserved in the E. histolytica AS. The upstream region of the AS gene contained three conserved elements reported for other E. histolytica genes. A recombinant E. histolytica AS revealed enzymatic activity, measured in both the forward and reverse directions. Expression of the E. histolytica AS complemented cysteine auxotrophy of the AS-deficient Escherichia coli strains. Genomic hybridization revealed that the AS gene exists as a single copy gene. In the literature, this is the first description of an AS gene in Protozoa.

  1. Structures of minute virus of mice replication initiator protein N-terminal domain: Insights into DNA nicking and origin binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tewary, Sunil K.; Liang, Lingfei; Lin, Zihan

    Members of the Parvoviridae family all encode a non-structural protein 1 (NS1) that directs replication of single-stranded viral DNA, packages viral DNA into capsid, and serves as a potent transcriptional activator. Here we report the X-ray structure of the minute virus of mice (MVM) NS1 N-terminal domain at 1.45 Å resolution, showing that sites for dsDNA binding, ssDNA binding and cleavage, nuclear localization, and other functions are integrated on a canonical fold of the histidine-hydrophobic-histidine superfamily of nucleases, including elements specific for this Protoparvovirus but distinct from its Bocaparvovirus or Dependoparvovirus orthologs. High resolution structural analysis reveals a nickase activemore » site with an architecture that allows highly versatile metal ligand binding. The structures support a unified mechanism of replication origin recognition for homotelomeric and heterotelomeric parvoviruses, mediated by a basic-residue-rich hairpin and an adjacent helix in the initiator proteins and by tandem tetranucleotide motifs in the replication origins. - Highlights: • The structure of a parvovirus replication initiator protein has been determined; • The structure sheds light on mechanisms of ssDNA binding and cleavage; • The nickase active site is preconfigured for versatile metal ligand binding; • The binding site for the double-stranded replication origin DNA is identified; • A single domain integrates multiple functions in virus replication.« less

  2. Trifluoperazine Regulation of Calmodulin Binding to Fas: A Computational Study

    PubMed Central

    Pan, Di; Yan, Qi; Chen, Yabing; McDonald, Jay M; Song, Yuhua

    2011-01-01

    Death-inducing signaling complex (DISC) formation is a critical step in Fas-mediated signaling for apoptosis. Previous experiments have demonstrated that the calmodulin (CaM) antagonist, trifluoperazine (TFP) regulates CaM-Fas binding and affects Fas-mediated DISC formation. In this study, we investigated the anti-cooperative characteristics of TFP binding to CaM and the effect of TFP on the CaM-Fas interaction from both structural and thermodynamic perspectives using combined molecular dynamics simulations and binding free energy analyses. We studied the interactions of different numbers of TFP molecules with CaM and explored the effects of the resulting conformational changes in CaM on CaM-Fas binding. Results from these analyses showed that the number of TFP molecules bound to CaM directly influenced α-helix formation and hydrogen bond occupancy within the α-helices of CaM, contributing to the conformational and motion changes in CaM. These changes affected CaM binding to Fas, resulting in secondary structural changes in Fas and conformational and motion changes of Fas in CaM-Fas complexes, potentially perturbing the recruitment of Fas-associated death domain (FADD) for DISC formation. The computational results from this study reveal the structural and molecular mechanisms that underlie the role of the CaM antagonist, TFP, in regulation of CaM-Fas binding and Fas-mediated DISC formation in a concentration-dependent manner. PMID:21656570

  3. Mutations Abrogating VP35 Interaction with Double-Stranded RNA Render Ebola Virus Avirulent in Guinea Pigs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prins, Kathleen C.; Delpeut, Sebastien; Leung, Daisy W.

    2010-10-11

    Ebola virus (EBOV) protein VP35 is a double-stranded RNA (dsRNA) binding inhibitor of host interferon (IFN)-{alpha}/{beta} responses that also functions as a viral polymerase cofactor. Recent structural studies identified key features, including a central basic patch, required for VP35 dsRNA binding activity. To address the functional significance of these VP35 structural features for EBOV replication and pathogenesis, two point mutations, K319A/R322A, that abrogate VP35 dsRNA binding activity and severely impair its suppression of IFN-{alpha}/{beta} production were identified. Solution nuclear magnetic resonance (NMR) spectroscopy and X-ray crystallography reveal minimal structural perturbations in the K319A/R322A VP35 double mutant and suggest that lossmore » of basic charge leads to altered function. Recombinant EBOVs encoding the mutant VP35 exhibit, relative to wild-type VP35 viruses, minimal growth attenuation in IFN-defective Vero cells but severe impairment in IFN-competent cells. In guinea pigs, the VP35 mutant virus revealed a complete loss of virulence. Strikingly, the VP35 mutant virus effectively immunized animals against subsequent wild-type EBOV challenge. These in vivo studies, using recombinant EBOV viruses, combined with the accompanying biochemical and structural analyses directly correlate VP35 dsRNA binding and IFN inhibition functions with viral pathogenesis. Moreover, these studies provide a framework for the development of antivirals targeting this critical EBOV virulence factor.« less

  4. Structural basis for cargo binding and autoinhibition of Bicaudal-D1 by a parallel coiled-coil with homotypic registry

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Terawaki, Shin-ichi, E-mail: terawaki@gunma-u.ac.jp; SPring-8 Center, RIKEN, 1-1-1 Koto, Sayo-cho, Sayo-gun, Hyogo 679-5148; Yoshikane, Asuka

    Bicaudal-D1 (BICD1) is an α-helical coiled-coil protein mediating the attachment of specific cargo to cytoplasmic dynein. It plays an essential role in minus end-directed intracellular transport along microtubules. The third C-terminal coiled-coil region of BICD1 (BICD1 CC3) has an important role in cargo sorting, including intracellular vesicles associating with the small GTPase Rab6 and the nuclear pore complex Ran binding protein 2 (RanBP2), and inhibiting the association with cytoplasmic dynein by binding to the first N-terminal coiled-coil region (CC1). The crystal structure of BICD1 CC3 revealed a parallel homodimeric coiled-coil with asymmetry and complementary knobs-into-holes interactions, differing from Drosophila BicDmore » CC3. Furthermore, our binding study indicated that BICD1 CC3 possesses a binding surface for two distinct cargos, Rab6 and RanBP2, and that the CC1-binding site overlaps with the Rab6-binding site. These findings suggest a molecular basis for cargo recognition and autoinhibition of BICD proteins during dynein-dependent intracellular retrograde transport. - Highlights: • BICD1 CC3 is a parallel homodimeric coiled-coil with axial asymmetry. • The coiled-coil packing of BICD1 CC3 is adapted to the equivalent heptad position. • BICD1 CC3 has distinct binding sites for two classes of cargo, Rab6 and RanBP2. • The CC1-binding site of BICD1 CC3 overlaps with the Rab6-binding site.« less

  5. Insight into the binding mechanism of imipenem to human serum albumin by spectroscopic and computational approaches.

    PubMed

    Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U

    2014-06-02

    The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.

  6. NMR unfolding studies on a liver bile acid binding protein reveal a global two-state unfolding and localized singular behaviors.

    PubMed

    D'Onofrio, Mariapina; Ragona, Laura; Fessas, Dimitrios; Signorelli, Marco; Ugolini, Raffaella; Pedò, Massimo; Assfalg, Michael; Molinari, Henriette

    2009-01-01

    The folding properties of a bile acid binding protein, belonging to a subfamily of the fatty acid binding proteins, have been here investigated both by hydrogen exchange measurements, using the SOFAST NMR approach, and urea denaturation experiments. The urea unfolding profiles of individual residues, acting as single probes, were simultaneously analyzed through a global fit, according to a two-state unfolding model. The resulting conformational stability DeltaG(U)(H(2)O)=7.2+/-0.25kcal mol(-1) is in good agreement with hydrogen exchange stability DeltaG(op). While the majority of protein residues satisfy this model, few amino-acids display a singular behavior, not directly amenable to the presence of a folding intermediate, as reported for other fatty acid binding proteins. These residues are part of a protein patch characterized by enhanced plasticity. To explain this singular behavior a tentative model has been proposed which takes into account the interplay between the dynamic features and the formation of transient aggregates. A functional role for this plasticity, related to translocation across the nuclear membrane, is discussed.

  7. Hemi-methylated DNA regulates DNA methylation inheritance through allosteric activation of H3 ubiquitylation by UHRF1.

    PubMed

    Harrison, Joseph S; Cornett, Evan M; Goldfarb, Dennis; DaRosa, Paul A; Li, Zimeng M; Yan, Feng; Dickson, Bradley M; Guo, Angela H; Cantu, Daniel V; Kaustov, Lilia; Brown, Peter J; Arrowsmith, Cheryl H; Erie, Dorothy A; Major, Michael B; Klevit, Rachel E; Krajewski, Krzysztof; Kuhlman, Brian; Strahl, Brian D; Rothbart, Scott B

    2016-09-06

    The epigenetic inheritance of DNA methylation requires UHRF1, a histone- and DNA-binding RING E3 ubiquitin ligase that recruits DNMT1 to sites of newly replicated DNA through ubiquitylation of histone H3. UHRF1 binds DNA with selectivity towards hemi-methylated CpGs (HeDNA); however, the contribution of HeDNA sensing to UHRF1 function remains elusive. Here, we reveal that the interaction of UHRF1 with HeDNA is required for DNA methylation but is dispensable for chromatin interaction, which is governed by reciprocal positive cooperativity between the UHRF1 histone- and DNA-binding domains. HeDNA recognition activates UHRF1 ubiquitylation towards multiple lysines on the H3 tail adjacent to the UHRF1 histone-binding site. Collectively, our studies are the first demonstrations of a DNA-protein interaction and an epigenetic modification directly regulating E3 ubiquitin ligase activity. They also define an orchestrated epigenetic control mechanism involving modifications both to histones and DNA that facilitate UHRF1 chromatin targeting, H3 ubiquitylation, and DNA methylation inheritance.

  8. Pervasive Targeting of Nascent Transcripts by Hfq.

    PubMed

    Kambara, Tracy K; Ramsey, Kathryn M; Dove, Simon L

    2018-05-01

    Hfq is an RNA chaperone and an important post-transcriptional regulator in bacteria. Using chromatin immunoprecipitation coupled with high-throughput DNA sequencing (ChIP-seq), we show that Hfq associates with hundreds of different regions of the Pseudomonas aeruginosa chromosome. These associations are abolished when transcription is inhibited, indicating that they reflect Hfq binding to transcripts during their synthesis. Analogous ChIP-seq analyses with the post-transcriptional regulator Crc reveal that it associates with many of the same nascent transcripts as Hfq, an activity we show is Hfq dependent. Our findings indicate that Hfq binds many transcripts co-transcriptionally in P. aeruginosa, often in concert with Crc, and uncover direct regulatory targets of these proteins. They also highlight a general approach for studying the interactions of RNA-binding proteins with nascent transcripts in bacteria. The binding of post-transcriptional regulators to nascent mRNAs may represent a prevalent means of controlling translation in bacteria where transcription and translation are coupled. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Novel fatty acid binding protein 4 (FABP4) inhibitors: virtual screening, synthesis and crystal structure determination.

    PubMed

    Cai, Haiyan; Liu, Qiufeng; Gao, Dingding; Wang, Ting; Chen, Tiantian; Yan, Guirui; Chen, Kaixian; Xu, Yechun; Wang, Heyao; Li, Yingxia; Zhu, Weiliang

    2015-01-27

    Fatty acid binding protein 4 (FABP4) is a potential drug target for diabetes and atherosclerosis. For discovering new chemical entities as FABP4 inhibitors, structure-based virtual screening (VS) was performed, bioassay demonstrated that 16 of 251 tested compounds are FABP4 inhibitors, among which compound m1 are more active than endogenous ligand linoleic acid (LA). Based on the structure of m1, new derivatives were designed and prepared, leading to the discovery of two more potent inhibitors, compounds 9 and 10. To further explore the binding mechanisms of these new inhibitors, we determined the X-ray structures of the complexes of FABP4-9 and FABP4-10, which revealed similar binding conformations of the two compounds. Residue Ser53 and Arg126 formed direct hydrogen bonding with the ligands. We also found that 10 could significantly reduce the levels of lipolysis on mouse 3T3-L1 adipocytes. Taken together, in silico, in vitro and crystallographic data provide useful hints for future development of novel inhibitors against FABP4. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  10. In silico Analysis of Conformational Changes Induced by Mutation of Aromatic Binding Residues: Consequences for Drug Binding in the hERG K+ Channel

    PubMed Central

    Knape, Kirsten; Linder, Tobias; Wolschann, Peter; Beyer, Anton; Stary-Weinzinger, Anna

    2011-01-01

    Pharmacological inhibition of cardiac hERG K+ channels is associated with increased risk of lethal arrhythmias. Many drugs reduce hERG current by directly binding to the channel, thereby blocking ion conduction. Mutation of two aromatic residues (F656 and Y652) substantially decreases the potency of numerous structurally diverse compounds. Nevertheless, some drugs are only weakly affected by mutation Y652A. In this study we utilize molecular dynamics simulations and docking studies to analyze the different effects of mutation Y652A on a selected number of hERG blockers. MD simulations reveal conformational changes in the binding site induced by mutation Y652A. Loss of π-π-stacking between the two aromatic residues induces a conformational change of the F656 side chain from a cavity facing to cavity lining orientation. Docking studies and MD simulations qualitatively reproduce the diverse experimentally observed modulatory effects of mutation Y652A and provide a new structural interpretation for the sensitivity differences. PMID:22194911

  11. Structural insights into RISC assembly facilitated by dsRNA-binding domains of human RNA helicase A (DHX9)

    PubMed Central

    Fu, Qinqin; Yuan, Y. Adam

    2013-01-01

    Intensive research interest has focused on small RNA-processing machinery and the RNA-induced silencing complex (RISC), key cellular machines in RNAi pathways. However, the structural mechanism regarding RISC assembly, the primary step linking small RNA processing and RNA-mediated gene silencing, is largely unknown. Human RNA helicase A (DHX9) was reported to function as an RISC-loading factor, and such function is mediated mainly by its dsRNA-binding domains (dsRBDs). Here, we report the crystal structures of human RNA helicase A (RHA) dsRBD1 and dsRBD2 domains in complex with dsRNAs, respectively. Structural analysis not only reveals higher siRNA duplex-binding affinity displayed by dsRBD1, but also identifies a crystallographic dsRBD1 pair of physiological significance in cooperatively recognizing dsRNAs. Structural observations are further validated by isothermal titration calorimetric (ITC) assay. Moreover, co-immunoprecipitation (co-IP) assay coupled with mutagenesis demonstrated that both dsRBDs are required for RISC association, and such association is mediated by dsRNA. Hence, our structural and functional efforts have revealed a potential working model for siRNA recognition by RHA tandem dsRBDs, and together they provide direct structural insights into RISC assembly facilitated by RHA. PMID:23361462

  12. Association with AflR in Endosomes Reveals New Functions for AflJ in Aflatoxin Biosynthesis

    PubMed Central

    Ehrlich, Kenneth C.; Mack, Brian M.; Wei, Qijian; Li, Ping; Roze, Ludmila V.; Dazzo, Frank; Cary, Jeffrey W.; Bhatnagar, Deepak; Linz, John E.

    2012-01-01

    Aflatoxins are the most potent naturally occurring carcinogens of fungal origin. Biosynthesis of aflatoxin involves the coordinated expression of more than 25 genes. The function of one gene in the aflatoxin gene cluster, aflJ, is not entirely understood but, because previous studies demonstrated a physical interaction between the Zn2Cys6 transcription factor AflR and AflJ, AflJ was proposed to act as a transcriptional co-activator. Image analysis revealed that, in the absence of aflJ in A. parasiticus, endosomes cluster within cells and near septa. AflJ fused to yellow fluorescent protein complemented the mutation in A. parasiticus ΔaflJ and localized mainly in endosomes. We found that AflJ co-localizes with AflR both in endosomes and in nuclei. Chromatin immunoprecipitation did not detect AflJ binding at known AflR DNA recognition sites suggesting that AflJ either does not bind to these sites or binds to them transiently. Based on these data, we hypothesize that AflJ assists in AflR transport to or from the nucleus, thus controlling the availability of AflR for transcriptional activation of aflatoxin biosynthesis cluster genes. AflJ may also assist in directing endosomes to the cytoplasmic membrane for aflatoxin export. PMID:23342682

  13. Structural insights into RISC assembly facilitated by dsRNA-binding domains of human RNA helicase A (DHX9).

    PubMed

    Fu, Qinqin; Yuan, Y Adam

    2013-03-01

    Intensive research interest has focused on small RNA-processing machinery and the RNA-induced silencing complex (RISC), key cellular machines in RNAi pathways. However, the structural mechanism regarding RISC assembly, the primary step linking small RNA processing and RNA-mediated gene silencing, is largely unknown. Human RNA helicase A (DHX9) was reported to function as an RISC-loading factor, and such function is mediated mainly by its dsRNA-binding domains (dsRBDs). Here, we report the crystal structures of human RNA helicase A (RHA) dsRBD1 and dsRBD2 domains in complex with dsRNAs, respectively. Structural analysis not only reveals higher siRNA duplex-binding affinity displayed by dsRBD1, but also identifies a crystallographic dsRBD1 pair of physiological significance in cooperatively recognizing dsRNAs. Structural observations are further validated by isothermal titration calorimetric (ITC) assay. Moreover, co-immunoprecipitation (co-IP) assay coupled with mutagenesis demonstrated that both dsRBDs are required for RISC association, and such association is mediated by dsRNA. Hence, our structural and functional efforts have revealed a potential working model for siRNA recognition by RHA tandem dsRBDs, and together they provide direct structural insights into RISC assembly facilitated by RHA.

  14. Cationic Peptides and Peptidomimetics Bind Glycosaminoglycans as Potential Sema3A Pathway Inhibitors

    PubMed Central

    Corredor, Miriam; Bonet, Roman; Moure, Alejandra; Domingo, Cecilia; Bujons, Jordi; Alfonso, Ignacio; Pérez, Yolanda; Messeguer, Àngel

    2016-01-01

    Semaphorin3A (Sema3A) is a vertebrate-secreted protein that was initially characterized as a repulsive-guidance cue. Semaphorins have crucial roles in several diseases; therefore, the development of Sema3A inhibitors is of therapeutic interest. Sema3A interacts with glycosaminoglycans (GAGs), presumably through its C-terminal basic region. We used different biophysical techniques (i.e., NMR, surface plasmon resonance, isothermal titration calorimetry, fluorescence, and UV-visible spectroscopy) to characterize the binding of two Sema3A C-terminus-derived basic peptides (FS2 and NFS3) to heparin and chondroitin sulfate A. We found that these peptides bind to both GAGs with affinities in the low-micromolar range. On the other hand, a peptoid named SICHI (semaphorin-induced chemorepulsion inhibitor), which is positively charged at physiological pH, was first identified by our group as being able to block Sema3A chemorepulsion and growth-cone collapse in axons at the extracellular level. To elucidate the direct target for the reported SICHI inhibitory effect in the Sema3A signaling pathway, we looked first to the protein-protein interaction between secreted Sema3A and the Nrp1 receptor. However, our results show that SICHI does not bind directly to the Sema3A sema domain or to Nrp1 extracellular domains. We evaluated a new, to our knowledge, hypothesis, according to which SICHI binds to GAGs, thereby perturbing the Sema3A-GAG interaction. By using the above-mentioned techniques, we observed that SICHI binds to GAGs and competes with Sema3A C-terminus-derived basic peptides for binding to GAGs. These data support the ability of SICHI to block the biologically relevant interaction between Sema3A and GAGs, thus revealing SICHI as a new, to our knowledge, class of inhibitors that target the GAG-protein interaction. PMID:27028639

  15. Characterization of the SAM domain of the PKD-related protein ANKS6 and its interaction with ANKS3.

    PubMed

    Leettola, Catherine N; Knight, Mary Jane; Cascio, Duilio; Hoffman, Sigrid; Bowie, James U

    2014-07-07

    Autosomal dominant polycystic kidney disease (ADPKD) is the most common genetic disorder leading to end-stage renal failure in humans. In the PKD/Mhm(cy/+) rat model of ADPKD, the point mutation R823W in the sterile alpha motif (SAM) domain of the protein ANKS6 is responsible for disease. SAM domains are known protein-protein interaction domains, capable of binding each other to form polymers and heterodimers. Despite its physiological importance, little is known about the function of ANKS6 and how the R823W point mutation leads to PKD. Recent work has revealed that ANKS6 interacts with a related protein called ANKS3. Both ANKS6 and ANKS3 have a similar domain structure, with ankyrin repeats at the N-terminus and a SAM domain at the C-terminus. The SAM domain of ANKS3 is identified as a direct binding partner of the ANKS6 SAM domain. We find that ANKS3-SAM polymerizes and ANKS6-SAM can bind to one end of the polymer. We present crystal structures of both the ANKS3-SAM polymer and the ANKS3-SAM/ANKS6-SAM complex, revealing the molecular details of their association. We also learn how the R823W mutation disrupts ANKS6 function by dramatically destabilizing the SAM domain such that the interaction with ANKS3-SAM is lost. ANKS3 is a direct interacting partner of ANKS6. By structurally and biochemically characterizing the interaction between the ANKS3 and ANKS6 SAM domains, our work provides a basis for future investigation of how the interaction between these proteins mediates kidney function.

  16. Characterization of the SAM domain of the PKD-related protein ANKS6 and its interaction with ANKS3

    PubMed Central

    2014-01-01

    Background Autosomal dominant polycystic kidney disease (ADPKD) is the most common genetic disorder leading to end-stage renal failure in humans. In the PKD/Mhm(cy/+) rat model of ADPKD, the point mutation R823W in the sterile alpha motif (SAM) domain of the protein ANKS6 is responsible for disease. SAM domains are known protein-protein interaction domains, capable of binding each other to form polymers and heterodimers. Despite its physiological importance, little is known about the function of ANKS6 and how the R823W point mutation leads to PKD. Recent work has revealed that ANKS6 interacts with a related protein called ANKS3. Both ANKS6 and ANKS3 have a similar domain structure, with ankyrin repeats at the N-terminus and a SAM domain at the C-terminus. Results The SAM domain of ANKS3 is identified as a direct binding partner of the ANKS6 SAM domain. We find that ANKS3-SAM polymerizes and ANKS6-SAM can bind to one end of the polymer. We present crystal structures of both the ANKS3-SAM polymer and the ANKS3-SAM/ANKS6-SAM complex, revealing the molecular details of their association. We also learn how the R823W mutation disrupts ANKS6 function by dramatically destabilizing the SAM domain such that the interaction with ANKS3-SAM is lost. Conclusions ANKS3 is a direct interacting partner of ANKS6. By structurally and biochemically characterizing the interaction between the ANKS3 and ANKS6 SAM domains, our work provides a basis for future investigation of how the interaction between these proteins mediates kidney function. PMID:24998259

  17. The co-crystal structure of ubiquitin carboxy-terminal hydrolase L1 (UCHL1) with a tripeptide fluoromethyl ketone (Z-VAE(OMe)-FMK)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Davies, Christopher W.; Chaney, Joseph; Korbel, Gregory

    2012-07-25

    UCHL1 is a 223 amino acid member of the UCH family of deubiquitinating enzymes (DUBs), found abundantly and exclusively expressed in neurons and the testis in normal tissues. Two naturally occurring variants of UCHL1 are directly involved in Parkinson's disease (PD). Not only has UCHL1 been linked to PD, but it has oncogenic properties, having been found abnormally expressed in lung, pancreatic, and colorectal cancers. Although inhibitors of UCHL1 have been described previously the co-crystal structure of the enzyme bound to any inhibitor has not been reported. Herein, we report the X-ray structure of UCHL1 co-crystallized with a peptide-based fluoromethylketonemore » inhibitor, Z-VAE(OMe)-FMK (VAEFMK) at 2.35 {angstrom} resolution. The co-crystal structure reveals that the inhibitor binds in the active-site cleft, irreversibly modifying the active-site cysteine; however, the catalytic histidine is still misaligned as seen in the native structure, suggesting that the inhibitor binds to an inactive form of the enzyme. Our structure also reveals that the inhibitor approaches the active-site cleft from the opposite side of the crossover loop as compared to the direction of approach of ubiquitin's C-terminal tail, thereby occupying the P1{prime} (leaving group) site, a binding site perhaps used by the unknown C-terminal extension of ubiquitin in the actual in vivo substrate(s) of UCHL1. This structure provides a view of molecular contacts at the active-site cleft between the inhibitor and the enzyme as well as furnishing structural information needed to facilitate further design of inhibitors targeted to UCHL1 with high selectivity and potency.« less

  18. A Novel Assay for Antibody-Dependent Cell-Mediated Cytotoxicity against HIV-1- or SIV-Infected Cells Reveals Incomplete Overlap with Antibodies Measured by Neutralization and Binding Assays

    PubMed Central

    Alpert, Michael D.; Heyer, Lisa N.; Williams, David E. J.; Harvey, Jackson D.; Greenough, Thomas; Allhorn, Maria

    2012-01-01

    The resistance of human immunodeficiency virus type 1 (HIV-1) to antibody-mediated immunity often prevents the detection of antibodies that neutralize primary isolates of HIV-1. However, conventional assays for antibody functions other than neutralization are suboptimal. Current methods for measuring the killing of virus-infected cells by antibody-dependent cell-mediated cytotoxicity (ADCC) are limited by the number of natural killer (NK) cells obtainable from individual donors, donor-to-donor variation, and the use of nonphysiological targets. We therefore developed an ADCC assay based on NK cell lines that express human or macaque CD16 and a CD4+ T-cell line that expresses luciferase from a Tat-inducible promoter upon HIV-1 or simian immunodeficiency virus (SIV) infection. NK cells and virus-infected targets are mixed in the presence of serial plasma dilutions, and ADCC is measured as the dose-dependent loss of luciferase activity. Using this approach, ADCC titers were measured in plasma samples from HIV-infected human donors and SIV-infected macaques. For the same plasma samples paired with the same test viruses, this assay was approximately 2 orders of magnitude more sensitive than optimized assays for neutralizing antibodies—frequently allowing the measurement of ADCC in the absence of detectable neutralization. Although ADCC correlated with other measures of Env-specific antibodies, neutralizing and gp120 binding titers did not consistently predict ADCC activity. Hence, this assay affords a sensitive method for measuring antibodies capable of directing ADCC against HIV- or SIV-infected cells expressing native conformations of the viral envelope glycoprotein and reveals incomplete overlap of the antibodies that direct ADCC and those measured in neutralization and binding assays. PMID:22933282

  19. Crystal structures of Bbp from Staphylococcus aureus reveal the ligand binding mechanism with Fibrinogen α.

    PubMed

    Zhang, Xinyue; Wu, Meng; Zhuo, Wei; Gu, Jinke; Zhang, Sensen; Ge, Jingpeng; Yang, Maojun

    2015-10-01

    Bone sialoprotein-binding protein (Bbp), a MSCRAMMs (Microbial Surface Components Recognizing Adhesive Matrix Molecules) family protein expressed on the surface of Staphylococcus aureus (S. aureus), mediates adherence to fibrinogen α (Fg α), a component in the extracellular matrix of the host cell and is important for infection and pathogenesis. In this study, we solved the crystal structures of apo-Bbp(273-598) and Bbp(273-598)-Fg α(561-575) complex at a resolution of 2.03 Å and 1.45 Å, respectively. Apo-Bbp(273-598) contained the ligand binding region N2 and N3 domains, both of which followed a DE variant IgG fold characterized by an additional D1 strand in N2 domain and D1' and D2' strands in N3 domain. The peptide mapped to the Fg α(561-575) bond to Bbp(273-598) on the open groove between the N2 and N3 domains. Strikingly, the disordered C-terminus in the apo-form reorganized into a highly-ordered loop and a β-strand G'' covering the ligand upon ligand binding. Bbp(Ala298-Gly301) in the N2 domain of the Bbp(273-598)-Fg α(561-575) complex, which is a loop in the apo-form, formed a short α-helix to interact tightly with the peptide. In addition, Bbp(Ser547-Gln561) in the N3 domain moved toward the binding groove to make contact directly with the peptide, while Bbp(Asp338-Gly355) and Bbp(Thr365-Tyr387) in N2 domain shifted their configurations to stabilize the reorganized C-terminus mainly through strong hydrogen bonds. Altogether, our results revealed the molecular basis for Bbp-ligand interaction and advanced our understanding of S. aureus infection process.

  20. Active Participation of Cellular Chaperone Hsp90 in Regulating the Function of Rotavirus Nonstructural Protein 3 (NSP3)*

    PubMed Central

    Dutta, Dipanjan; Chattopadhyay, Shiladitya; Bagchi, Parikshit; Halder, Umesh Chandra; Nandi, Satabdi; Mukherjee, Anupam; Kobayashi, Nobumichi; Taniguchi, Koki; Chawla-Sarkar, Mamta

    2011-01-01

    Heat shock protein 90 (Hsp90) has been reported to positively regulate rotavirus replication by modulating virus induced PI3K/Akt and NFκB activation. Here, we report the active association of Hsp90 in the folding and stabilization of rotavirus nonstructural protein 3 (NSP3). In pCD-NSP3-transfected cells, treatment with Hsp90 inhibitor (17-N,N-dimethylethylenediamine-geldanamycin (17DMAG)) resulted in the proteasomal degradation of NSP3. Sequence analysis and deletion mutations revealed that the region spanning amino acids 225–258 within the C-terminal eIF4G-binding domain of NSP3 is a putative Hsp90 binding region. Co-immunoprecipitation and mammalian two-hybrid experiments revealed direct interaction of the C-terminal 12-kDa domain of Hsp90 (C90) with residues 225–258 of NSP3. NSP3-Hsp90 interaction is important for the formation of functionally active mature NSP3, because full-length NSP3 in the presence of the Hsp90 inhibitor or NSP3 lacking the amino acid 225–258 region did not show NSP3 dimers following in vitro coupled transcription-translation followed by chase. Disruption of residues 225–258 within NSP3 also resulted in poor RNA binding and eIF4G binding activity. In addition, inhibition of Hsp90 by 17DMAG resulted in reduced nuclear translocation of poly(A)-binding protein and translation of viral proteins. These results highlight the crucial role of Hsp90 chaperone in the regulation of assembly and functionality of a viral protein during the virus replication and propagation in host cells. PMID:21489987

  1. Loop III region of platelet-derived growth factor (PDGF) B-chain mediates binding to PDGF receptors and heparin.

    PubMed Central

    Schilling, D; Reid IV, J D; Hujer, A; Morgan, D; Demoll, E; Bummer, P; Fenstermaker, R A; Kaetzel, D M

    1998-01-01

    Site-directed mutagenesis of the platelet-derived growth factor (PDGF) B-chain was conducted to determine the importance of cationic amino acid residues (Arg160-Lys161-Lys162; RKK) located within the loop III region in mediating the biological and cell-association properties of the molecule. Binding to both PDGF alpha-and beta-receptors was inhibited by the conversion of all three cationic residues into anionic glutamates (RKK-->EEE), whereas an RKK-->SSS mutant also exhibited a modest loss in affinity for beta-receptors. Replacements with serine at either Arg160 (RKK-->SKK) or at all three positions (RKK-->SSS) had little effect on binding to alpha-receptors. Replacements with either glutamic or serine residues at any of the three positions also resulted in significant inhibition of heparin-binding activity. Furthermore, the RKK-->EEE mutant exhibited decreased association with the cell surface and accumulated in the culture medium as 29-32 kDa forms. Stable transfection of U87 astrocytoma cells with RKK-->EEE mutants of either the A-chain or the B-chain inhibited malignant growth in athymic nude mice. Despite altered receptor-binding activities, each of the loop III mutants retained full mitogenic activity when applied to cultured Swiss 3T3 cells. CD spectrophotometric analysis of the RKK-->EEE mutant revealed a secondary structure indistinguishable from the wild type, with a high degree of beta-sheet structure and random coil content (50% and 43% respectively). These findings indicate an important role of the Arg160-Lys161-Lys162 sequence in mediating the biological and cell-associative activities of the PDGF-BB homodimer, and reveal that the mitogenic activity of PDGF-BB is insufficient to mediate its full oncogenic properties. PMID:9677323

  2. Phosphorylated Nuclear Receptor CAR Forms a Homodimer To Repress Its Constitutive Activity for Ligand Activation

    PubMed Central

    Shizu, Ryota; Osabe, Makoto; Perera, Lalith; Moore, Rick; Sueyoshi, Tatsuya

    2017-01-01

    ABSTRACT The nuclear receptor CAR (NR1I3) regulates hepatic drug and energy metabolism as well as cell fate. Its activation can be a critical factor in drug-induced toxicity and the development of diseases, including diabetes and tumors. CAR inactivates its constitutive activity by phosphorylation at threonine 38. Utilizing receptor for protein kinase 1 (RACK1) as the regulatory subunit, protein phosphatase 2A (PP2A) dephosphorylates threonine 38 to activate CAR. Here we demonstrate that CAR undergoes homodimer-monomer conversion to regulate this dephosphorylation. By coexpression of two differently tagged CAR proteins in Huh-7 cells, mouse primary hepatocytes, and mouse livers, coimmunoprecipitation and two-dimensional gel electrophoresis revealed that CAR can form a homodimer in a configuration in which the PP2A/RACK1 binding site is buried within its dimer interface. Epidermal growth factor (EGF) was found to stimulate CAR homodimerization, thus constraining CAR in its inactive form. The agonistic ligand CITCO binds directly to the CAR homodimer and dissociates phosphorylated CAR into its monomers, exposing the PP2A/RACK1 binding site for dephosphorylation. Phenobarbital, which is not a CAR ligand, binds the EGF receptor, reversing the EGF signal to monomerize CAR for its indirect activation. Thus, the homodimer-monomer conversion is the underlying molecular mechanism that regulates CAR activation, by placing phosphorylated threonine 38 as the common target for both direct and indirect activation of CAR. PMID:28265001

  3. ChIP-seq analysis of the σ E regulon of Salmonella enterica serovar typhimurium reveals new genes implicated in heat shock and oxidative stress response

    DOE PAGES

    Li, Jie; Overall, Christopher C.; Johnson, Rudd C.; ...

    2015-09-21

    The alternative sigma factor σ E functions to maintain bacterial homeostasis and membrane integrity in response to extracytoplasmic stress by regulating thousands of genes both directly and indirectly. The transcriptional regulatory network governed by σ E in Salmonella and E. coli has been examined using microarray, however a genome-wide analysis of σ E–binding sites inSalmonella has not yet been reported. We infected macrophages with Salmonella Typhimurium over a select time course. Using chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq), 31 σ E–binding sites were identified. Seventeen sites were new, which included outer membrane proteins, a quorum-sensing protein, a cellmore » division factor, and a signal transduction modulator. The consensus sequence identified for σ E in vivo binding was similar to the one previously reported, except for a conserved G and A between the -35 and -10 regions. One third of the σ E–binding sites did not contain the consensus sequence, suggesting there may be alternative mechanisms by which σ E modulates transcription. By dissecting direct and indirect modes of σ E-mediated regulation, we found that σ E activates gene expression through recognition of both canonical and reversed consensus sequence. Lastly, new σ E regulated genes ( greA, luxS, ompA and ompX) are shown to be involved in heat shock and oxidative stress responses.« less

  4. ChIP-seq analysis of the σ E regulon of Salmonella enterica serovar typhimurium reveals new genes implicated in heat shock and oxidative stress response

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Jie; Overall, Christopher C.; Johnson, Rudd C.

    The alternative sigma factor σ E functions to maintain bacterial homeostasis and membrane integrity in response to extracytoplasmic stress by regulating thousands of genes both directly and indirectly. The transcriptional regulatory network governed by σ E in Salmonella and E. coli has been examined using microarray, however a genome-wide analysis of σ E–binding sites inSalmonella has not yet been reported. We infected macrophages with Salmonella Typhimurium over a select time course. Using chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq), 31 σ E–binding sites were identified. Seventeen sites were new, which included outer membrane proteins, a quorum-sensing protein, a cellmore » division factor, and a signal transduction modulator. The consensus sequence identified for σ E in vivo binding was similar to the one previously reported, except for a conserved G and A between the -35 and -10 regions. One third of the σ E–binding sites did not contain the consensus sequence, suggesting there may be alternative mechanisms by which σ E modulates transcription. By dissecting direct and indirect modes of σ E-mediated regulation, we found that σ E activates gene expression through recognition of both canonical and reversed consensus sequence. Lastly, new σ E regulated genes ( greA, luxS, ompA and ompX) are shown to be involved in heat shock and oxidative stress responses.« less

  5. Fatty acid DSF binds and allosterically activates histidine kinase RpfC of phytopathogenic bacterium Xanthomonas campestris pv. campestris to regulate quorum-sensing and virulence

    PubMed Central

    Zhang, Huan; Pan, Yue; Wu, Yao; Tian, Xiu-Qi; Wang, Fang-Fang; Wang, Li

    2017-01-01

    As well as their importance to nutrition, fatty acids (FA) represent a unique group of quorum sensing chemicals that modulate the behavior of bacterial population in virulence. However, the way in which full-length, membrane-bound receptors biochemically detect FA remains unclear. Here, we provide genetic, enzymological and biophysical evidences to demonstrate that in the phytopathogenic bacterium Xanthomonas campestris pv. campestris, a medium-chain FA diffusible signal factor (DSF) binds directly to the N-terminal, 22 amino acid-length sensor region of a receptor histidine kinase (HK), RpfC. The binding event remarkably activates RpfC autokinase activity by causing an allosteric change associated with the dimerization and histidine phosphotransfer (DHp) and catalytic ATP-binding (CA) domains. Six residues were found essential for sensing DSF, especially those located in the region adjoining to the inner membrane of cells. Disrupting direct DSF-RpfC interaction caused deficiency in bacterial virulence and biofilm development. In addition, two amino acids within the juxtamembrane domain of RpfC, Leu172 and Ala178, are involved in the autoinhibition of the RpfC kinase activity. Replacements of them caused constitutive activation of RpfC-mediated signaling regardless of DSF stimulation. Therefore, our results revealed a biochemical mechanism whereby FA activates bacterial HK in an allosteric manner, which will assist in future studies on the specificity of FA-HK recognition during bacterial virulence regulation and cell-cell communication. PMID:28369120

  6. Comparison of S. cerevisiae F-BAR domain structures reveals a conserved inositol phosphate binding site

    PubMed Central

    Moravcevic, Katarina; Alvarado, Diego; Schmitz, Karl R.; Kenniston, Jon A.; Mendrola, Jeannine M.; Ferguson, Kathryn M.; Lemmon, Mark A.

    2015-01-01

    SUMMARY F-BAR domains control membrane interactions in endocytosis, cytokinesis, and cell signaling. Although generally thought to bind curved membranes containing negatively charged phospholipids, numerous functional studies argue that differences in lipid-binding selectivities of F-BAR domains are functionally important. Here, we compare membrane-binding properties of the S. cerevisiae F-BAR domains in vitro and in vivo. Whereas some F-BAR domains (such as Bzz1p and Hof1p F-BARs) bind equally well to all phospholipids, the F-BAR domain from the RhoGAP Rgd1p preferentially binds phosphoinositides. We determined X-ray crystal structures of F-BAR domains from Hof1p and Rgd1p, the latter bound to an inositol phosphate. The structures explain phospholipid-binding selectivity differences, and reveal an F-BAR phosphoinositide binding site that is fully conserved in a mammalian RhoGAP called Gmip, and is partly retained in certain other F-BAR domains. Our findings reveal previously unappreciated determinants of F-BAR domain lipid-binding specificity, and provide a basis for its prediction from sequence. PMID:25620000

  7. Plasma autoantibodies against platelet glycoprotein IIb/IIIa from patients with autoimmune thrombocytopenic purpura may recognize different antigenic determinants.

    PubMed

    Berchtold, P; Müller, D; Kouns, W C; Riederer, M A; Steiner, B

    1998-10-01

    Autoantibodies against platelet glycoprotein (GP) GPIIb/IIIa have been demonstrated in patients with autoimmune thrombocytopenic purpura. Recently, it has been shown that plasma autoantibodies from some patients bind to the cytoplasmic domain of GPIIIa. Our aim was to evaluate further the binding specificity of these plasma autoantibodies. From 7 patients with detectable plasma antibodies against intact GPIIb/IIIa, 1 showed strong antibody binding to a synthetic C-terminal peptide of GPIIIa. Ig class analysis of affinity purified anti-GPIIb/IIIa autoantibodies from this patient revealed an IgM antibody that reacted with intact GPIIb/IIIa as well as with recombinant GPIIb/IIIa lacking the C-terminal domains, and an IgG antibody that bound to intact GPIIb/IIIa but not to GPIIb/IIIa lacking the C-terminal region. These data indicate that this patient has at least 2 autoantibodies, an IgG directed against the cytoplasmic domain of GPIIIa and an IgM reacting with the extracellular part of GPIIIa. This may support the hypothesis that plasma IgG antibodies directed against the C-terminal domain of GPIIIa may be due to the exposition of cytoplasmic epitopes of GPIIIa as a result of increased cell lysis by IgM autoantibodies.

  8. Observation of Binding and Rotation of Methane and Hydrogen within a Functional Metal–Organic Framework

    PubMed Central

    2016-01-01

    The key requirement for a portable store of natural gas is to maximize the amount of gas within the smallest possible space. The packing of methane (CH4) in a given storage medium at the highest possible density is, therefore, a highly desirable but challenging target. We report a microporous hydroxyl-decorated material, MFM-300(In) (MFM = Manchester Framework Material, replacing the NOTT designation), which displays a high volumetric uptake of 202 v/v at 298 K and 35 bar for CH4 and 488 v/v at 77 K and 20 bar for H2. Direct observation and quantification of the location, binding, and rotational modes of adsorbed CH4 and H2 molecules within this host have been achieved, using neutron diffraction and inelastic neutron scattering experiments, coupled with density functional theory (DFT) modeling. These complementary techniques reveal a very efficient packing of H2 and CH4 molecules within MFM-300(In), reminiscent of the condensed gas in pure component crystalline solids. We also report here, for the first time, the experimental observation of a direct binding interaction between adsorbed CH4 molecules and the hydroxyl groups within the pore of a material. This is different from the arrangement found in CH4/water clathrates, the CH4 store of nature. PMID:27410670

  9. The ebola virus interferon antagonist VP24 directly binds STAT1 and has a novel, pyramidal fold.

    PubMed

    Zhang, Adrianna P P; Bornholdt, Zachary A; Liu, Tong; Abelson, Dafna M; Lee, David E; Li, Sheng; Woods, Virgil L; Saphire, Erica Ollmann

    2012-02-01

    Ebolaviruses cause hemorrhagic fever with up to 90% lethality and in fatal cases, are characterized by early suppression of the host innate immune system. One of the proteins likely responsible for this effect is VP24. VP24 is known to antagonize interferon signaling by binding host karyopherin α proteins, thereby preventing them from transporting the tyrosine-phosphorylated transcription factor STAT1 to the nucleus. Here, we report that VP24 binds STAT1 directly, suggesting that VP24 can suppress at least two distinct branches of the interferon pathway. Here, we also report the first crystal structures of VP24, derived from different species of ebolavirus that are pathogenic (Sudan) and nonpathogenic to humans (Reston). These structures reveal that VP24 has a novel, pyramidal fold. A site on a particular face of the pyramid exhibits reduced solvent exchange when in complex with STAT1. This site is above two highly conserved pockets in VP24 that contain key residues previously implicated in virulence. These crystal structures and accompanying biochemical analysis map differences between pathogenic and nonpathogenic viruses, offer templates for drug design, and provide the three-dimensional framework necessary for biological dissection of the many functions of VP24 in the virus life cycle.

  10. Allosteric Inhibition of Bcr-Abl Kinase by High Affinity Monobody Inhibitors Directed to the Src Homology 2 (SH2)-Kinase Interface.

    PubMed

    Wojcik, John; Lamontanara, Allan Joaquim; Grabe, Grzegorz; Koide, Akiko; Akin, Louesa; Gerig, Barbara; Hantschel, Oliver; Koide, Shohei

    2016-04-15

    Bcr-Abl is a constitutively active kinase that causes chronic myelogenous leukemia. We have shown that a tandem fusion of two designed binding proteins, termed monobodies, directed to the interaction interface between the Src homology 2 (SH2) and kinase domains and to the phosphotyrosine-binding site of the SH2 domain, respectively, inhibits the Bcr-Abl kinase activity. Because the latter monobody inhibits processive phosphorylation by Bcr-Abl and the SH2-kinase interface is occluded in the active kinase, it remained undetermined whether targeting the SH2-kinase interface alone was sufficient for Bcr-Abl inhibition. To address this question, we generated new, higher affinity monobodies with single nanomolar KD values targeting the kinase-binding surface of SH2. Structural and mutagenesis studies revealed the molecular underpinnings of the monobody-SH2 interactions. Importantly, the new monobodies inhibited Bcr-Abl kinase activity in vitro and in cells, and they potently induced cell death in chronic myelogenous leukemia cell lines. This work provides strong evidence for the SH2-kinase interface as a pharmacologically tractable site for allosteric inhibition of Bcr-Abl. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. The epitope of monoclonal antibodies blocking erythrocyte invasion by Plasmodium falciparum map to the dimerization and receptor glycan binding sites of EBA-175.

    PubMed

    Ambroggio, Xavier; Jiang, Lubin; Aebig, Joan; Obiakor, Harold; Lukszo, Jan; Narum, David L

    2013-01-01

    The malaria parasite, Plasmodium falciparum, and related parasites use a variety of proteins with Duffy-Binding Like (DBL) domains to bind glycoproteins on the surface of host cells. Among these proteins, the 175 kDa erythrocyte binding antigen, EBA-175, specifically binds to glycophorin A on the surface of human erythrocytes during the process of merozoite invasion. The domain responsible for glycophorin A binding was identified as region II (RII) which contains two DBL domains, F1 and F2. The crystal structure of this region revealed a dimer that is presumed to represent the glycophorin A binding conformation as sialic acid binding sites and large cavities are observed at the dimer interface. The dimer interface is largely composed of two loops from within each monomer, identified as the F1 and F2 β-fingers that contact depressions in the opposing monomers in a similar manner. Previous studies have identified a panel of five monoclonal antibodies (mAbs) termed R215 to R218 and R256 that bind to RII and inhibit invasion of erythrocytes to varying extents. In this study, we predict the F2 β-finger region as the conformational epitope for mAbs, R215, R217, and R256, and confirm binding for the most effective blocking mAb R217 and R215 to a synthetic peptide mimic of the F2 β-finger. Localization of the epitope to the dimerization and glycan binding sites of EBA-175 RII and site-directed mutagenesis within the predicted epitope are consistent with R215 and R217 blocking erythrocyte invasion by Plasmodium falciparum by preventing formation of the EBA-175- glycophorin A complex.

  12. Functional Elements on SIRPα IgV domain Mediate Cell Surface Binding to CD47

    PubMed Central

    Liu, Yuan; Tong, Qiao; Zhou, Yubin; Lee, Hsiau-Wei; Yang, Jenny J.; Bühring, Hans-Jörg; Chen, Yi-Tien; Ha, Binh; Chen, Celia X-J.; Zen, Ke

    2007-01-01

    Summary SIRPα and SIRPβ1, the two major isoforms of the signal regulatory protein (SIRP) family, are co-expressed in human leukocytes but mediate distinct extracellular binding interactions and divergent cell signaling responses. Previous studies have demonstrated that binding of SIRPα with CD47, another important cell surface molecule, through the extracellular IgV domain regulates important leukocyte functions including macrophage recognition, leukocyte adhesion and transmigration. Although SIRPβ1 shares highly homologous extracellular IgV structure with SIRPα, it does not bind to CD47. In this study, we defined key amino acid residues exclusively expressing in the IgV domain of SIRPα, but not SIRPβ1, which determine the extracellular binding interaction of SIRPα to CD47. These key residues include Gln67, a small hydrophobic amino acid (Ala or Val) at the 57th position and Met102. We found that Gln67 and Ala/Val57 are critical. Mutation of either of these residues abates SIRPα directly binding to CD47. Functional cell adhesion and leukocyte transmigration assays further demonstrated central roles of Gln67 and Ala/Val57 in SIRPα extracellular binding mediated cell interactions and cell migration. Another SIRPα-specific residue, Met102, appears to assist SIRPα IgV binding through Gln67 and Ala/Val57. An essential role of these amino acids in SIRPα binding to CD47 was further confirmed by introducing these residues into the SIRPβ1 IgV domain, which dramatically converts SIRPβ1 into a CD47-binding molecule. Our results thus revealed the molecular basis by which SIRPα selectively binds to CD47 and shed new light into the structural mechanisms of SIRP isoform mediated distinctive extracellular interactions and cellular responses. PMID:17070842

  13. Functional elements on SIRPalpha IgV domain mediate cell surface binding to CD47.

    PubMed

    Liu, Yuan; Tong, Qiao; Zhou, Yubin; Lee, Hsiau-Wei; Yang, Jenny J; Bühring, Hans-Jörg; Chen, Yi-Tien; Ha, Binh; Chen, Celia X-J; Yang, Yang; Zen, Ke

    2007-01-19

    SIRPalpha and SIRPbeta1, the two major isoforms of the signal regulatory protein (SIRP) family, are co-expressed in human leukocytes but mediate distinct extracellular binding interactions and divergent cell signaling responses. Previous studies have demonstrated that binding of SIRPalpha with CD47, another important cell surface molecule, through the extracellular IgV domain regulates important leukocyte functions including macrophage recognition, leukocyte adhesion and transmigration. Although SIRPbeta1 shares highly homologous extracellular IgV structure with SIRPalpha, it does not bind to CD47. Here, we defined key amino acid residues exclusively expressing in the IgV domain of SIRPalpha, but not SIRPbeta1, which determine the extracellular binding interaction of SIRPalpha to CD47. These key residues include Gln67, a small hydrophobic amino acid (Ala or Val) at the 57th position and Met102. We found that Gln67 and Ala/Val57 are critical. Mutation of either of these residues abates SIRPalpha directly binding to CD47. Functional cell adhesion and leukocyte transmigration assays further demonstrated central roles of Gln67 and Ala/Val57 in SIRPalpha extracellular binding mediated cell interactions and cell migration. Another SIRPalpha-specific residue, Met102, appears to assist SIRPalpha IgV binding through Gln67 and Ala/Val57. An essential role of these amino acid residues in SIRPalpha binding to CD47 was further confirmed by introducing these residues into the SIRPbeta1 IgV domain, which dramatically converts SIRPbeta1 into a CD47-binding molecule. Our results thus revealed the molecular basis by which SIRPalpha binds to CD47 and shed new light into the structural mechanisms of SIRP isoform mediated distinctive extracellular interactions and cellular responses.

  14. Definition of a consensus DNA-binding site for PecS, a global regulator of virulence gene expression in Erwinia chrysanthemi and identification of new members of the PecS regulon.

    PubMed

    Rouanet, Carine; Reverchon, Sylvie; Rodionov, Dmitry A; Nasser, William

    2004-07-16

    In Erwinia chrysanthemi, production of pectic enzymes is modulated by a complex network involving several regulators. One of them, PecS, which belongs to the MarR family, also controls the synthesis of various other virulence factors, such as cellulases and indigoidine. Here, the PecS consensus-binding site is defined by combining a systematic evolution of ligands by an exponential enrichment approach and mutational analyses. The consensus consists of a 23-base pair palindromic-like sequence (C(-11)G(-10)A(-9)N(-8)W(-7)T(-6)C(-5)G(-4)T(-3)A(-2))T(-1)A(0)T(1)(T(2)A(3)C(4)G(5)A(6)N(7)N(8)N(9)C(10)G(11)). Mutational experiments revealed that (i) the palindromic organization is required for the binding of PecS, (ii) the very conserved part of the consensus (-6 to 6) allows for a specific interaction with PecS, but the presence of the relatively degenerated bases located apart significantly increases PecS affinity, (iii) the four bases G, A, T, and C are required for efficient binding of PecS, and (iv) the presence of several binding sites on the same promoter increases the affinity of PecS. This consensus is detected in the regions involved in PecS binding on the previously characterized target genes. This variable consensus is in agreement with the observation that the members of the MarR family are able to bind various DNA targets as dimers by means of a winged helix DNA-binding motif. Binding of PecS on a promoter region containing the defined consensus results in a repression of gene transcription in vitro. Preliminary scanning of the E. chrysanthemi genome sequence with the consensus revealed the presence of strong PecS-binding sites in the intergenic region between fliE and fliFGHIJKLMNOPQR which encode proteins involved in the biogenesis of flagellum. Accordingly, PecS directly represses fliE expression. Thus, PecS seems to control the synthesis of virulence factors required for the key steps of plant infection.

  15. Ugi 4-CR Synthesis of γ- and δ-Lactams providing new access to diverse enzyme interactions, a PDB analysis.

    PubMed

    Boltjes, André; Liao, George P; Zhao, Ting; Herdtweck, Eberhardt; Dömling, Alexander

    2014-07-01

    A three step synthesis of N -unsubstituted tetrazolo γ- and δ-lactams involving a key Ugi-4CR is presented. The compounds, otherwise difficult to access, are conveniently synthesized in overall good yields by our route. PDB analysis of the N -unsubstituted γ- and δ-lactam fragment reveals a strongly tri-directional hydrogen bond donor acceptor interaction with the amino acids of the binding sites.

  16. Dynamic reorganization of Eg5 in the mammalian spindle throughout mitosis requires dynein and TPX2

    PubMed Central

    Gable, Alyssa; Qiu, Minhua; Titus, Janel; Balchand, Sai; Ferenz, Nick P.; Ma, Nan; Collins, Elizabeth S.; Fagerstrom, Carey; Ross, Jennifer L.; Yang, Ge; Wadsworth, Patricia

    2012-01-01

    Kinesin-5 is an essential mitotic motor. However, how its spatial–temporal distribution is regulated in mitosis remains poorly understood. We expressed localization and affinity purification–tagged Eg5 from a mouse bacterial artificial chromosome (this construct was called mEg5) and found its distribution to be tightly regulated throughout mitosis. Fluorescence recovery after photobleaching analysis showed rapid Eg5 turnover throughout mitosis, which cannot be accounted for by microtubule turnover. Total internal reflection fluorescence microscopy and high-resolution, single-particle tracking revealed that mEg5 punctae on both astral and midzone microtubules rapidly bind and unbind. mEg5 punctae on midzone microtubules moved transiently both toward and away from spindle poles. In contrast, mEg5 punctae on astral microtubules moved transiently toward microtubule minus ends during early mitosis but switched to plus end–directed motion during anaphase. These observations explain the poleward accumulation of Eg5 in early mitosis and its redistribution in anaphase. Inhibition of dynein blocked mEg5 movement on astral microtubules, whereas depletion of the Eg5-binding protein TPX2 resulted in plus end–directed mEg5 movement. However, motion of Eg5 on midzone microtubules was not altered. Our results reveal differential and precise spatial and temporal regulation of Eg5 in the spindle mediated by dynein and TPX2. PMID:22337772

  17. Modulation of CaV2.1 channels by neuronal calcium sensor-1 induces short-term synaptic facilitation.

    PubMed

    Yan, Jin; Leal, Karina; Magupalli, Venkat G; Nanou, Evanthia; Martinez, Gilbert Q; Scheuer, Todd; Catterall, William A

    2014-11-01

    Facilitation and inactivation of P/Q-type Ca2+ currents mediated by Ca2+/calmodulin binding to Ca(V)2.1 channels contribute to facilitation and rapid depression of synaptic transmission, respectively. Other calcium sensor proteins displace calmodulin from its binding site and differentially modulate P/Q-type Ca2 + currents, resulting in diverse patterns of short-term synaptic plasticity. Neuronal calcium sensor-1 (NCS-1, frequenin) has been shown to enhance synaptic facilitation, but the underlying mechanism is unclear. We report here that NCS-1 directly interacts with IQ-like motif and calmodulin-binding domain in the C-terminal domain of Ca(V)2.1 channel. NCS-1 reduces Ca2 +-dependent inactivation of P/Q-type Ca2+ current through interaction with the IQ-like motif and calmodulin-binding domain without affecting peak current or activation kinetics. Expression of NCS-1 in presynaptic superior cervical ganglion neurons has no effect on synaptic transmission, eliminating effects of this calcium sensor protein on endogenous N-type Ca2+ currents and the endogenous neurotransmitter release machinery. However, in superior cervical ganglion neurons expressing wild-type Ca(V)2.1 channels, co-expression of NCS-1 induces facilitation of synaptic transmission in response to paired pulses and trains of depolarizing stimuli, and this effect is lost in Ca(V)2.1 channels with mutations in the IQ-like motif and calmodulin-binding domain. These results reveal that NCS-1 directly modulates Ca(V)2.1 channels to induce short-term synaptic facilitation and further demonstrate that CaS proteins are crucial in fine-tuning short-term synaptic plasticity.

  18. Brain tumor is a sequence-specific RNA-binding protein that directs maternal mRNA clearance during the Drosophila maternal-to-zygotic transition.

    PubMed

    Laver, John D; Li, Xiao; Ray, Debashish; Cook, Kate B; Hahn, Noah A; Nabeel-Shah, Syed; Kekis, Mariana; Luo, Hua; Marsolais, Alexander J; Fung, Karen Yy; Hughes, Timothy R; Westwood, J Timothy; Sidhu, Sachdev S; Morris, Quaid; Lipshitz, Howard D; Smibert, Craig A

    2015-05-12

    Brain tumor (BRAT) is a Drosophila member of the TRIM-NHL protein family. This family is conserved among metazoans and its members function as post-transcriptional regulators. BRAT was thought to be recruited to mRNAs indirectly through interaction with the RNA-binding protein Pumilio (PUM). However, it has recently been demonstrated that BRAT directly binds to RNA. The precise sequence recognized by BRAT, the extent of BRAT-mediated regulation, and the exact roles of PUM and BRAT in post-transcriptional regulation are unknown. Genome-wide identification of transcripts associated with BRAT or with PUM in Drosophila embryos shows that they bind largely non-overlapping sets of mRNAs. BRAT binds mRNAs that encode proteins associated with a variety of functions, many of which are distinct from those implemented by PUM-associated transcripts. Computational analysis of in vitro and in vivo data identified a novel RNA motif recognized by BRAT that confers BRAT-mediated regulation in tissue culture cells. The regulatory status of BRAT-associated mRNAs suggests a prominent role for BRAT in post-transcriptional regulation, including a previously unidentified role in transcript degradation. Transcriptomic analysis of embryos lacking functional BRAT reveals an important role in mediating the decay of hundreds of maternal mRNAs during the maternal-to-zygotic transition. Our results represent the first genome-wide analysis of the mRNAs associated with a TRIM-NHL protein and the first identification of an RNA motif bound by this protein family. BRAT is a prominent post-transcriptional regulator in the early embryo through mechanisms that are largely independent of PUM.

  19. Asymmetry of the three catalytic sites on beta subunits of TF1 from a thermophilic Bacillus strain PS3.

    PubMed

    Hisabori, T; Kobayashi, H; Kaibara, C; Yoshida, M

    1994-03-01

    F1-ATPase isolated from plasma membrane of a thermophilic Bacillus strain PS3 (TF1) has very little or no endogenously bound adenine nucleotides. However, it can bind one ADP per mol of the enzyme on one of three beta subunits to form a stable TF1.ADP complex when incubated with a high concentration of ADP [Yoshida, M. & Allison, W.S. (1986) J. Biol. Chem. 261, 5714-5721]. The same TF1.ADP complex was recovered after filling all ADP binding sites with [3H]ADP and repeated gel filtration. Direct binding assay revealed that the TF1.ADP complex had lost the highest affinity site for TNP-ADP. When a substoichiometric amount of TNP-ATP was added, the complex hydrolyzed TNP-ATP slowly (single site hydrolysis), like native TF1. However, this hydrolysis was not promoted by chase-addition of excess ATP. The optimal pH of the ATPase activity of TF1 or the TF1.ADP complex measured with a short reaction period, 6.5, was lower than the reported value, 9.0, under the steady-state condition. Although the bound ADP was released from the complex only when the enzyme underwent multiple catalytic turnover, the rate of this release was much slower than the turnover. These results suggest that when one ADP binds to a site on one of the beta subunits and stays there for a long time, the enzyme will change form and the bound ADP will become a special species which is not able to be directly involved in the enzyme catalysis. This binding site for ADP appears to be the first site responsible for the single-site catalysis reaction observed for native TF1.

  20. Target gene analysis by microarrays and chromatin immunoprecipitation identifies HEY proteins as highly redundant bHLH repressors.

    PubMed

    Heisig, Julia; Weber, David; Englberger, Eva; Winkler, Anja; Kneitz, Susanne; Sung, Wing-Kin; Wolf, Elmar; Eilers, Martin; Wei, Chia-Lin; Gessler, Manfred

    2012-01-01

    HEY bHLH transcription factors have been shown to regulate multiple key steps in cardiovascular development. They can be induced by activated NOTCH receptors, but other upstream stimuli mediated by TGFß and BMP receptors may elicit a similar response. While the basic and helix-loop-helix domains exhibit strong similarity, large parts of the proteins are still unique and may serve divergent functions. The striking overlap of cardiac defects in HEY2 and combined HEY1/HEYL knockout mice suggested that all three HEY genes fulfill overlapping function in target cells. We therefore sought to identify target genes for HEY proteins by microarray expression and ChIPseq analyses in HEK293 cells, cardiomyocytes, and murine hearts. HEY proteins were found to modulate expression of their target gene to a rather limited extent, but with striking functional interchangeability between HEY factors. Chromatin immunoprecipitation revealed a much greater number of potential binding sites that again largely overlap between HEY factors. Binding sites are clustered in the proximal promoter region especially of transcriptional regulators or developmental control genes. Multiple lines of evidence suggest that HEY proteins primarily act as direct transcriptional repressors, while gene activation seems to be due to secondary or indirect effects. Mutagenesis of putative DNA binding residues supports the notion of direct DNA binding. While class B E-box sequences (CACGYG) clearly represent preferred target sequences, there must be additional and more loosely defined modes of DNA binding since many of the target promoters that are efficiently bound by HEY proteins do not contain an E-box motif. These data clearly establish the three HEY bHLH factors as highly redundant transcriptional repressors in vitro and in vivo, which explains the combinatorial action observed in different tissues with overlapping expression.

  1. Target Gene Analysis by Microarrays and Chromatin Immunoprecipitation Identifies HEY Proteins as Highly Redundant bHLH Repressors

    PubMed Central

    Englberger, Eva; Winkler, Anja; Kneitz, Susanne; Sung, Wing-Kin; Wolf, Elmar; Eilers, Martin; Wei, Chia-Lin; Gessler, Manfred

    2012-01-01

    HEY bHLH transcription factors have been shown to regulate multiple key steps in cardiovascular development. They can be induced by activated NOTCH receptors, but other upstream stimuli mediated by TGFß and BMP receptors may elicit a similar response. While the basic and helix-loop-helix domains exhibit strong similarity, large parts of the proteins are still unique and may serve divergent functions. The striking overlap of cardiac defects in HEY2 and combined HEY1/HEYL knockout mice suggested that all three HEY genes fulfill overlapping function in target cells. We therefore sought to identify target genes for HEY proteins by microarray expression and ChIPseq analyses in HEK293 cells, cardiomyocytes, and murine hearts. HEY proteins were found to modulate expression of their target gene to a rather limited extent, but with striking functional interchangeability between HEY factors. Chromatin immunoprecipitation revealed a much greater number of potential binding sites that again largely overlap between HEY factors. Binding sites are clustered in the proximal promoter region especially of transcriptional regulators or developmental control genes. Multiple lines of evidence suggest that HEY proteins primarily act as direct transcriptional repressors, while gene activation seems to be due to secondary or indirect effects. Mutagenesis of putative DNA binding residues supports the notion of direct DNA binding. While class B E-box sequences (CACGYG) clearly represent preferred target sequences, there must be additional and more loosely defined modes of DNA binding since many of the target promoters that are efficiently bound by HEY proteins do not contain an E-box motif. These data clearly establish the three HEY bHLH factors as highly redundant transcriptional repressors in vitro and in vivo, which explains the combinatorial action observed in different tissues with overlapping expression. PMID:22615585

  2. The molecular mechanism for interaction of ceruloplasmin and myeloperoxidase

    NASA Astrophysics Data System (ADS)

    Bakhautdin, Bakytzhan; Bakhautdin, Esen Göksöy

    2016-04-01

    Ceruloplasmin (Cp) is a copper-containing ferroxidase with potent antioxidant activity. Cp is expressed by hepatocytes and activated macrophages and has been known as physiologic inhibitor of myeloperoxidase (MPO). Enzymatic activity of MPO produces anti-microbial agents and strong prooxidants such as hypochlorous acid and has a potential to damage host tissue at the sites of inflammation and infection. Thus Cp-MPO interaction and inhibition of MPO has previously been suggested as an important control mechanism of excessive MPO activity. Our aim in this study was to identify minimal Cp domain or peptide that interacts with MPO. We first confirmed Cp-MPO interaction by ELISA and surface plasmon resonance (SPR). SPR analysis of the interaction yielded 30 nM affinity between Cp and MPO. We then designed and synthesized 87 overlapping peptides spanning the entire amino acid sequence of Cp. Each of the peptides was tested whether it binds to MPO by direct binding ELISA. Two of the 87 peptides, P18 and P76 strongly interacted with MPO. Amino acid sequence analysis of identified peptides revealed high sequence and structural homology between them. Further structural analysis of Cp's crystal structure by PyMOL software unfolded that both peptides represent surface-exposed sites of Cp and face nearly the same direction. To confirm our finding we raised anti-P18 antisera in rabbit and demonstrated that this antisera disrupts Cp-MPO binding and rescues MPO activity. Collectively, our results confirm Cp-MPO interaction and identify two nearly identical sites on Cp that specifically bind MPO. We propose that inhibition of MPO by Cp requires two nearly identical sites on Cp to bind homodimeric MPO simultaneously and at an angle of at least 120 degrees, which, in turn, exerts tension on MPO and results in conformational change.

  3. Bean Metal-Responsive Element-Binding Transcription Factor Confers Cadmium Resistance in Tobacco1

    PubMed Central

    Sun, Na; Liu, Meng; Zhang, Wentao; Yang, Wanning; Bei, Xiujuan; Ma, Hui; Qiao, Fan; Qi, Xiaoting

    2015-01-01

    Cadmium (Cd) is highly toxic to plants. Modulation of Cd-responsive transcription is an important way for Cd detoxification in plants. Metal-responsive element (MRE) is originally described in animal metallothionein genes. Although functional MREs also exist in Cd-regulated plant genes, specific transcription factors that bind MRE to regulate Cd tolerance have not been identified. Previously, we showed that Cd-inducible bean (Phaseolus vulgaris) stress-related gene2 (PvSR2) produces a short (S) PvSR2 transcript (S-PvSR2) driven by an intronic promoter. Here, we demonstrate that S-PvSR2 encodes a bean MRE-binding transcription factor1 (PvMTF-1) that confers Cd tolerance in tobacco (Nicotiana tabacum). PvMTF-1 expression was up-regulated by Cd at the levels of RNA and protein. Importantly, expression of PvMTF-1 in tobacco enhanced Cd tolerance, indicating its role in regulating Cd resistance in planta. This was achieved through direct regulation of a feedback-insensitive Anthranilate Synthase α-2 chain gene (ASA2), which catalyzes the first step for tryptophan biosynthesis. In vitro and in vivo DNA-protein interaction studies further revealed that PvMTF-1 directly binds to the MRE in the ASA2 promoter, and this binding depends on the zinc finger-like motif of PvMTF-1. Through modulating ASA2 up-regulation by Cd, PvMTF-1 increased free tryptophan level and subsequently reduced Cd accumulation, thereby enhancing Cd tolerance of transgenic tobacco plants. Consistent with this observation, tobacco transiently overexpressing ASA2 also exhibited increased tolerance to Cd. We conclude that PvMTF-1 is a zinc finger-like transcription factor that links MRE to Cd resistance in transgenic tobacco through activation of tryptophan biosynthesis. PMID:25624396

  4. Mannose-recognition mutant of the galactose/N-acetylgalactosamine-specific C-type lectin CEL-I engineered by site-directed mutagenesis.

    PubMed

    Moriuchi, Hiromi; Unno, Hideaki; Goda, Shuichiro; Tateno, Hiroaki; Hirabayashi, Jun; Hatakeyama, Tomomitsu

    2015-07-01

    CEL-I is a galactose/N-acetylgalactosamine-specific C-type lectin isolated from the sea cucumber Cucumaria echinata. Its carbohydrate-binding site contains a QPD (Gln-Pro-Asp) motif, which is generally recognized as the galactose specificity-determining motif in the C-type lectins. In our previous study, replacement of the QPD motif by an EPN (Glu-Pro-Asn) motif led to a weak binding affinity for mannose. Therefore, we examined the effects of an additional mutation in the carbohydrate-binding site on the specificity of the lectin. Trp105 of EPN-CEL-I was replaced by a histidine residue using site-directed mutagenesis, and the binding affinity of the resulting mutant, EPNH-CEL-I, was examined by sugar-polyamidoamine dendrimer assay, isothermal titration calorimetry, and glycoconjugate microarray analysis. Tertiary structure of the EPNH-CEL-I/mannose complex was determined by X-ray crystallographic analysis. Sugar-polyamidoamine dendrimer assay and glycoconjugate microarray analysis revealed a drastic change in the specificity of EPNH-CEL-I from galactose/N-acetylgalactosamine to mannose. The association constant of EPNH-CEL-I for mannose was determined to be 3.17×10(3) M(-1) at 25°C. Mannose specificity of EPNH-CEL-I was achieved by stabilization of the binding of mannose in a correct orientation, in which the EPN motif can form proper hydrogen bonds with 3- and 4-hydroxy groups of the bound mannose. Specificity of CEL-I can be engineered by mutating a limited number of amino acid residues in addition to the QPD/EPN motifs. Versatility of the C-type carbohydrate-recognition domain structure in the recognition of various carbohydrate chains could become a promising platform to develop novel molecular recognition proteins. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Conformational Ensembles of Calmodulin Revealed by Nonperturbing Site-Specific Vibrational Probe Groups.

    PubMed

    Kelly, Kristen L; Dalton, Shannon R; Wai, Rebecca B; Ramchandani, Kanika; Xu, Rosalind J; Linse, Sara; Londergan, Casey H

    2018-03-22

    Seven native residues on the regulatory protein calmodulin, including three key methionine residues, were replaced (one by one) by the vibrational probe amino acid cyanylated cysteine, which has a unique CN stretching vibration that reports on its local environment. Almost no perturbation was caused by this probe at any of the seven sites, as reported by CD spectra of calcium-bound and apo calmodulin and binding thermodynamics for the formation of a complex between calmodulin and a canonical target peptide from skeletal muscle myosin light chain kinase measured by isothermal titration. The surprising lack of perturbation suggests that this probe group could be applied directly in many protein-protein binding interfaces. The infrared absorption bands for the probe groups reported many dramatic changes in the probes' local environments as CaM went from apo- to calcium-saturated to target peptide-bound conditions, including large frequency shifts and a variety of line shapes from narrow (interpreted as a rigid and invariant local environment) to symmetric to broad and asymmetric (likely from multiple coexisting and dynamically exchanging structures). The fast intrinsic time scale of infrared spectroscopy means that the line shapes report directly on site-specific details of calmodulin's variable structural distribution. Though quantitative interpretation of the probe line shapes depends on a direct connection between simulated ensembles and experimental data that does not yet exist, formation of such a connection to data such as that reported here would provide a new way to evaluate conformational ensembles from data that directly contains the structural distribution. The calmodulin probe sites developed here will also be useful in evaluating the binding mode of calmodulin with many uncharacterized regulatory targets.

  6. Physical and genetic interactions of yeast Cwc21p, an ortholog of human SRm300/SRRM2, suggest a role at the catalytic center of the spliceosome

    PubMed Central

    Grainger, Richard J.; Barrass, J. David; Jacquier, Alain; Rain, Jean-Christophe; Beggs, Jean D.

    2009-01-01

    In Saccharomyces cerevisiae, Cwc21p is a protein of unknown function that is associated with the NineTeen Complex (NTC), a group of proteins involved in activating the spliceosome to promote the pre-mRNA splicing reaction. Here, we show that Cwc21p binds directly to two key splicing factors—namely, Prp8p and Snu114p—and becomes the first NTC-related protein known to dock directly to U5 snRNP proteins. Using a combination of proteomic techniques we show that the N-terminus of Prp8p contains an intramolecular fold that is a Snu114p and Cwc21p interacting domain (SCwid). Cwc21p also binds directly to the C-terminus of Snu114p. Complementary chemical cross-linking experiments reveal reciprocal protein footprints between the interacting Prp8 and Cwc21 proteins, identifying the conserved cwf21 domain in Cwc21p as a Prp8p binding site. Genetic and functional interactions between Cwc21p and Isy1p indicate that they have related functions at or prior to the first catalytic step of splicing, and suggest that Cwc21p functions at the catalytic center of the spliceosome, possibly in response to environmental or metabolic changes. We demonstrate that SRm300, the only SR-related protein known to be at the core of human catalytic spliceosomes, is a functional ortholog of Cwc21p, also interacting directly with Prp8p and Snu114p. Thus, the function of Cwc21p is likely conserved from yeast to humans. PMID:19854871

  7. K-Ras protein as a drug target.

    PubMed

    McCormick, Frank

    2016-03-01

    K-Ras proteins are major drivers of human cancers, playing a direct causal role in about one million cancer cases/year. In cancers driven by mutant K-Ras, the protein is locked in the active, GTP-bound state constitutively, through a defect in the off-switch mechanism. As such, the mutant protein resembles the normal K-Ras protein from a structural perspective, making therapeutic attack extremely challenging. K-Ras is a member of a large family of related proteins, which share very similar GDP/GTP-binding domains, making specific therapies more difficult. Furthermore, Ras proteins lack pockets to which small molecules can bind with high affinity, with a few interesting exceptions. However, new insights into the structure and function of K-Ras proteins reveal opportunities for intervention that were not appreciated many years ago, when efforts were launched to develop K-Ras therapies. Furthermore, K-Ras undergoes post-translational modification and interactions with cellular signaling proteins that present additional therapeutic opportunities, such as specific binding to calmodulin and regulation of non-canonical Wnt signaling.

  8. Small leucine-rich repeat proteoglycans associated with mature insoluble elastin serve as binding sites for galectins.

    PubMed

    Itoh, Aiko; Nonaka, Yasuhiro; Ogawa, Takashi; Nakamura, Takanori; Nishi, Nozomu

    2017-11-01

    We previously reported that galectin-9 (Gal-9), an immunomodulatory animal lectin, could bind to insoluble collagen preparations and exerted direct cytocidal effects on immune cells. In the present study, we found that mature insoluble elastin is capable of binding Gal-9 and other members of the human galectin family. Lectin blot analysis of a series of commercial water-soluble elastin preparations, PES-(A) ~ PES-(E), revealed that only PES-(E) contained substances recognized by Gal-9. Gal-9-interacting substances in PES-(E) were affinity-purified, digested with trypsin and then analyzed by reversed-phase HPLC. Peptide fragments derived from five members of the small leucine-rich repeat proteoglycan family, versican, lumican, osteoglycin/mimecan, prolargin, and fibromodulin, were identified by N-terminal amino acid sequence analysis. The results indicate that Gal-9 and possibly other galectins recognize glycans attached to small leucine-rich repeat proteoglycans associated with insoluble elastin and also indicate the possibility that mature insoluble elastin serves as an extracellular reservoir for galectins.

  9. A dominant role for the methyl-CpG-binding protein Mbd2 in controlling Th2 induction by dendritic cells.

    PubMed

    Cook, Peter C; Owen, Heather; Deaton, Aimée M; Borger, Jessica G; Brown, Sheila L; Clouaire, Thomas; Jones, Gareth-Rhys; Jones, Lucy H; Lundie, Rachel J; Marley, Angela K; Morrison, Vicky L; Phythian-Adams, Alexander T; Wachter, Elisabeth; Webb, Lauren M; Sutherland, Tara E; Thomas, Graham D; Grainger, John R; Selfridge, Jim; McKenzie, Andrew N J; Allen, Judith E; Fagerholm, Susanna C; Maizels, Rick M; Ivens, Alasdair C; Bird, Adrian; MacDonald, Andrew S

    2015-04-24

    Dendritic cells (DCs) direct CD4(+) T-cell differentiation into diverse helper (Th) subsets that are required for protection against varied infections. However, the mechanisms used by DCs to promote Th2 responses, which are important both for immunity to helminth infection and in allergic disease, are currently poorly understood. We demonstrate a key role for the protein methyl-CpG-binding domain-2 (Mbd2), which links DNA methylation to repressive chromatin structure, in regulating expression of a range of genes that are associated with optimal DC activation and function. In the absence of Mbd2, DCs display reduced phenotypic activation and a markedly impaired capacity to initiate Th2 immunity against helminths or allergens. These data identify an epigenetic mechanism that is central to the activation of CD4(+) T-cell responses by DCs, particularly in Th2 settings, and reveal methyl-CpG-binding proteins and the genes under their control as possible therapeutic targets for type-2 inflammation.

  10. Novobiocin binding to NalD induces the expression of the MexAB-OprM pump in Pseudomonas aeruginosa.

    PubMed

    Chen, Weizhong; Wang, Dan; Zhou, Wenquan; Sang, Hong; Liu, Xichun; Ge, Zhiyun; Zhang, Jin; Lan, Lefu; Yang, Cai-Guang; Chen, Hao

    2016-06-01

    NalD was reported to be the secondary repressor of the MexAB-OprM multidrug efflux pump, the major system contributing to intrinsic multidrug resistance in Pseudomonas aeruginosa. Here, we show that novobiocin binds directly to NalD, which leads NalD to dissociate from the DNA promoter, and thus de-represses the expression of the MexAB-OprM pump. In addition, we have solved the crystal structure of NalD at a resolution of 2.90 Å. The structural alignment of NalD to its homologue TtgR reveals that the residues N129 and H167 in NalD are involved in its novobiocin-binding ability. We have confirmed the function of these two amino acids by EMSA and plate assay. The results presented here highlight the importance and diversity of regulatory mechanism in bacterial antibiotic resistance, and provide further insight for novel antimicrobial development. © 2016 John Wiley & Sons Ltd.

  11. Mechanistic determinants of the directionality and energetics of active export by a heterodimeric ABC transporter

    DOE PAGES

    Grossmann, Nina; Vakkasoglu, Ahmet S.; Hulpke, Sabine; ...

    2014-11-07

    The ATP-binding cassette (ABC) transporter associated with antigen processing (TAP) participates in immune surveillance by moving proteasomal products into the endoplasmic reticulum (ER) lumen for major histocompatibility complex class I loading and cell surface presentation to cytotoxic T cells. Here we delineate the mechanistic basis for antigen translocation. Notably, TAP works as a molecular diode, translocating peptide substrates against the gradient in a strict unidirectional way. We reveal the importance of the D-loop at the dimer interface of the two nucleotide-binding domains (NBDs) in coupling substrate translocation with ATP hydrolysis and defining transport vectoriality. Substitution of the converved aspartate, whichmore » coordinates the ATP-binding site, decreases NBD dimerization affinity and turns the unidirectional primary active pump into a passive bidirectional nucleotide-gated facilitator. Thus, ATP hydrolysis is not required for translocation per se, but is essential for both active and unidirectional transport. As a result, our data provide detailed mechanistic insight into how heterodimeric ABC exporters operate.« less

  12. Crystallographic structure of a small molecule SIRT1 activator-enzyme complex

    NASA Astrophysics Data System (ADS)

    Dai, Han; Case, April W.; Riera, Thomas V.; Considine, Thomas; Lee, Jessica E.; Hamuro, Yoshitomo; Zhao, Huizhen; Jiang, Yong; Sweitzer, Sharon M.; Pietrak, Beth; Schwartz, Benjamin; Blum, Charles A.; Disch, Jeremy S.; Caldwell, Richard; Szczepankiewicz, Bruce; Oalmann, Christopher; Yee Ng, Pui; White, Brian H.; Casaubon, Rebecca; Narayan, Radha; Koppetsch, Karsten; Bourbonais, Francis; Wu, Bo; Wang, Junfeng; Qian, Dongming; Jiang, Fan; Mao, Cheney; Wang, Minghui; Hu, Erding; Wu, Joe C.; Perni, Robert B.; Vlasuk, George P.; Ellis, James L.

    2015-07-01

    SIRT1, the founding member of the mammalian family of seven NAD+-dependent sirtuins, is composed of 747 amino acids forming a catalytic domain and extended N- and C-terminal regions. We report the design and characterization of an engineered human SIRT1 construct (mini-hSIRT1) containing the minimal structural elements required for lysine deacetylation and catalytic activation by small molecule sirtuin-activating compounds (STACs). Using this construct, we solved the crystal structure of a mini-hSIRT1-STAC complex, which revealed the STAC-binding site within the N-terminal domain of hSIRT1. Together with hydrogen-deuterium exchange mass spectrometry (HDX-MS) and site-directed mutagenesis using full-length hSIRT1, these data establish a specific STAC-binding site and identify key intermolecular interactions with hSIRT1. The determination of the interface governing the binding of STACs with human SIRT1 facilitates greater understanding of STAC activation of this enzyme, which holds significant promise as a therapeutic target for multiple human diseases.

  13. Starch Catabolism by a Prominent Human Gut Symbiont Is Directed by the Recognition of Amylose Helices

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Koropatkin, Nicole M.; Martens, Eric C.; Gordon, Jeffrey I.

    2009-01-12

    The human gut microbiota performs functions that are not encoded in our Homo sapiens genome, including the processing of otherwise undigestible dietary polysaccharides. Defining the structures of proteins involved in the import and degradation of specific glycans by saccharolytic bacteria complements genomic analysis of the nutrient-processing capabilities of gut communities. Here, we describe the atomic structure of one such protein, SusD, required for starch binding and utilization by Bacteroides thetaiotaomicron, a prominent adaptive forager of glycans in the distal human gut microbiota. The binding pocket of this unique {alpha}-helical protein contains an arc of aromatic residues that complements the naturalmore » helical structure of starch and imposes this conformation on bound maltoheptaose. Furthermore, SusD binds cyclic oligosaccharides with higher affinity than linear forms. The structures of several SusD/oligosaccharide complexes reveal an inherent ligand recognition plasticity dominated by the three-dimensional conformation of the oligosaccharides rather than specific interactions with the composite sugars.« less

  14. Crystal structure of inhibitor of growth 4 (ING4) dimerization domain reveals functional organization of ING family of chromatin-binding proteins.

    PubMed

    Culurgioni, Simone; Muñoz, Inés G; Moreno, Alberto; Palacios, Alicia; Villate, Maider; Palmero, Ignacio; Montoya, Guillermo; Blanco, Francisco J

    2012-03-30

    The protein ING4 binds to histone H3 trimethylated at Lys-4 (H3K4me3) through its C-terminal plant homeodomain, thus recruiting the HBO1 histone acetyltransferase complex to target promoters. The structure of the plant homeodomain finger bound to an H3K4me3 peptide has been described, as well as the disorder and flexibility in the ING4 central region. We report the crystal structure of the ING4 N-terminal domain, which shows an antiparallel coiled-coil homodimer with each protomer folded into a helix-loop-helix structure. This arrangement suggests that ING4 can bind simultaneously two histone tails on the same or different nucleosomes. Dimerization has a direct impact on ING4 tumor suppressor activity because monomeric mutants lose the ability to induce apoptosis after genotoxic stress. Homology modeling based on the ING4 structure suggests that other ING dimers may also exist.

  15. RNA regulatory networks diversified through curvature of the PUF protein scaffold

    DOE PAGES

    Wilinski, Daniel; Qiu, Chen; Lapointe, Christopher P.; ...

    2015-09-14

    Proteins bind and control mRNAs, directing their localization, translation and stability. Members of the PUF family of RNA-binding proteins control multiple mRNAs in a single cell, and play key roles in development, stem cell maintenance and memory formation. Here we identified the mRNA targets of a S. cerevisiae PUF protein, Puf5p, by ultraviolet-crosslinking-affinity purification and high-throughput sequencing (HITS-CLIP). The binding sites recognized by Puf5p are diverse, with variable spacer lengths between two specific sequences. Each length of site correlates with a distinct biological function. Crystal structures of Puf5p–RNA complexes reveal that the protein scaffold presents an exceptionally flat and extendedmore » interaction surface relative to other PUF proteins. In complexes with RNAs of different lengths, the protein is unchanged. A single PUF protein repeat is sufficient to induce broadening of specificity. Changes in protein architecture, such as alterations in curvature, may lead to evolution of mRNA regulatory networks.« less

  16. RNA regulatory networks diversified through curvature of the PUF protein scaffold

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wilinski, Daniel; Qiu, Chen; Lapointe, Christopher P.

    Proteins bind and control mRNAs, directing their localization, translation and stability. Members of the PUF family of RNA-binding proteins control multiple mRNAs in a single cell, and play key roles in development, stem cell maintenance and memory formation. Here we identified the mRNA targets of a S. cerevisiae PUF protein, Puf5p, by ultraviolet-crosslinking-affinity purification and high-throughput sequencing (HITS-CLIP). The binding sites recognized by Puf5p are diverse, with variable spacer lengths between two specific sequences. Each length of site correlates with a distinct biological function. Crystal structures of Puf5p–RNA complexes reveal that the protein scaffold presents an exceptionally flat and extendedmore » interaction surface relative to other PUF proteins. In complexes with RNAs of different lengths, the protein is unchanged. A single PUF protein repeat is sufficient to induce broadening of specificity. Changes in protein architecture, such as alterations in curvature, may lead to evolution of mRNA regulatory networks.« less

  17. Temperature dependent dispersion and electron-phonon coupling surface states on Be(1010)

    NASA Astrophysics Data System (ADS)

    Tang, Shu-Jung; Ismail; Sprunger, Philip; Plummer, Ward

    2002-03-01

    Temperature dependent dispersion and electron-phonon coupling surface states on Be(10-10) S.-J Tang*, Ismail* , P.T . Sprunger#, E. W. Plummer* * Department of Physics and Astronomy, University of Tennessee, Knoxville, TN37996 , # Center for Advanced Microstructures and Devices (CAMD), Louisiana State University The surface states dispersing in a large band gap from -A to -Γ in Be(10-10) were studied with high-resolution, angle-resolved photoemission. Spectra reveal that the two zone-boundary surface states, S1 and S2, behave significantly different with respect to band dispersion, the temperature dependence of binding energies, and the electron-phonon coupling. The band dispersion of S1 is purely free-electron like with the maximum binding energy of 0.37+-0.05 eV at -A and effective mass m*/m =0835. However, the maximum binding energy 2.74+-0.05 eV of the S2 is located 0.2Åaway from -A and disperses into the bulk band edge at a binding energy of 1.75+-0.05 eV. Temperature dependent data reveal that the binding energies of S1 and S2 at -A shift in opposite directions at the rate of (-0.61+-0.3)+- 10E-4 eV/K and (1.71+-0.8)+-10E-4 eV/K, respectively. Moreover, from the temperature-dependent spectral widths of the surface states S1 and S2 at , the electron-phonon coupling parameters,λ, have been determined. Unusually different, the coupling strength λ for S1 and S2 are 0.67+-0.03 and 0.51+-0.04, respectively. The differences between the electron-phonon coupling, temperature dependent binding energies, and dispersions between these two zone-centered surface states will be discussed in light unique bonding at the surface and localization.

  18. Conformational changes induced in the eukaryotic translation initiation factor eIF4E by a clinically relevant inhibitor, ribavirin triphosphate

    PubMed Central

    Volpon, Laurent; Osborne, Michael J.; Zahreddine, Hiba; Romeo, Andrea A.; Borden, Katherine L.B.

    2013-01-01

    The eukaryotic translation initiation factor eIF4E is highly elevated in human cancers including acute myeloid leukemia (AML). A potential anticancer agent, ribavirin, targets eIF4E activity in AML patients corresponding to clinical responses. To date, ribavirin is the only direct inhibitor of eIF4E to reach clinical trials. We showed that ribavirin acts as a competitive inhibitor of the methyl 7-guanosine (m7G) cap, the natural ligand of eIF4E. Here we examine the conformational changes occurring in human eIF4E upon binding the active metabolite of ribavirin, ribavirin triphosphate (RTP). Our NMR data revealed an unexpected concentration dependence on RTP affinity for eIF4E. We observed NMR spectra characteristic of tight binding at low micromolar concentrations (2-5μM eIF4E) but much weaker affinity at more typical NMR concentrations (50-200μM). Comparison of chemical shift perturbation and line broadening suggest that the two eIF4E-RTP complexes differ in the precise positioning of RTP within the cap binding pocket, with the high affinity complex showing more extensive changes to the central β-sheet and dorsal surface of eIF4E, similar to m7G cap. The differences between high and low affinity complexes arise due to concentration dependent aggregation of eIF4E and RTP. Given the intracellular concentrations of eIF4E and RTP and the differential binding toward the W56A eIF4E mutant the high affinity complex is the most physiologically relevant. In summary, these findings demonstrate that RTP binds in the cap-binding site but also suggests new features of this pocket that should be considered in both drug design efforts and reveal new insights into ligand eIF4E recognition. PMID:23583375

  19. Effects of the central potassium ions on the G-quadruplex and stabilizer binding.

    PubMed

    Wang, Zhiguo; Liu, Jun-Ping

    2017-03-01

    Human telomeres undertake the structure of intra-molecular parallel G-quadruplex in the presence of K + in eukaryotic cell. Stabilization of the telomere G-quadruplex represents a potential strategy to prevent telomere lengthening by telomerase in cancer therapy. Current work demonstrates that the binding of central K + with the parallel G-quadruplex is a coordinated water directed step-wise process. The K + above the top G-tetrad is prone to leak into environment and the 5'-adenine quickly flips over the top G-tetrad, leading to the bottom gate of G-tetrads as the only viable pathway of K + binding. Present molecular dynamics studies on the two most potent stabilizers RHPS4 and BRACO-19 reveal that the central K + has little influence on the binding conformations of the bound stabilizers. But without the central K + , either RHPS4 or BRACO-19 cannot stabilize the structure of G-quadruplex. The binding strength of stabilizers evaluated by the MM-PBSA method follows the order of BRACO-19> RHPS4, which agrees with the experimental results. The difference in binding affinities between RHPS4 and BRACO-19 is probably related to the ability to form intramolecular hydrogen bonds and favorable van del Waals interactions with G-quadruplex. In the models that have one central K + located at the upper/lower binding site, the corresponding top/bottom stacked stabilizers show more favorable binding affinities, indicating the apparent promoting effect of central K + on the stabilizer binding. Our findings provide further insights into the regulatory effect of K + on the G-quadruplex targeted binding, which is meaningful to the development of G-quadruplex stabilizers. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Structural Basis for Antifreeze Activity of Ice-binding Protein from Arctic Yeast*

    PubMed Central

    Lee, Jun Hyuck; Park, Ae Kyung; Do, Hackwon; Park, Kyoung Sun; Moh, Sang Hyun; Chi, Young Min; Kim, Hak Jun

    2012-01-01

    Arctic yeast Leucosporidium sp. produces a glycosylated ice-binding protein (LeIBP) with a molecular mass of ∼25 kDa, which can lower the freezing point below the melting point once it binds to ice. LeIBP is a member of a large class of ice-binding proteins, the structures of which are unknown. Here, we report the crystal structures of non-glycosylated LeIBP and glycosylated LeIBP at 1.57- and 2.43-Å resolution, respectively. Structural analysis of the LeIBPs revealed a dimeric right-handed β-helix fold, which is composed of three parts: a large coiled structural domain, a long helix region (residues 96–115 form a long α-helix that packs along one face of the β-helix), and a C-terminal hydrophobic loop region (243PFVPAPEVV251). Unexpectedly, the C-terminal hydrophobic loop region has an extended conformation pointing away from the body of the coiled structural domain and forms intertwined dimer interactions. In addition, structural analysis of glycosylated LeIBP with sugar moieties attached to Asn185 provides a basis for interpreting previous biochemical analyses as well as the increased stability and secretion of glycosylated LeIBP. We also determined that the aligned Thr/Ser/Ala residues are critical for ice binding within the B face of LeIBP using site-directed mutagenesis. Although LeIBP has a common β-helical fold similar to that of canonical hyperactive antifreeze proteins, the ice-binding site is more complex and does not have a simple ice-binding motif. In conclusion, we could identify the ice-binding site of LeIBP and discuss differences in the ice-binding modes compared with other known antifreeze proteins and ice-binding proteins. PMID:22303017

  1. Structural basis for the ligand-binding specificity of fatty acid-binding proteins (pFABP4 and pFABP5) in gentoo penguin.

    PubMed

    Lee, Chang Woo; Kim, Jung Eun; Do, Hackwon; Kim, Ryeo-Ok; Lee, Sung Gu; Park, Hyun Ho; Chang, Jeong Ho; Yim, Joung Han; Park, Hyun; Kim, Il-Chan; Lee, Jun Hyuck

    2015-09-11

    Fatty acid-binding proteins (FABPs) are involved in transporting hydrophobic fatty acids between various aqueous compartments of the cell by directly binding ligands inside their β-barrel cavities. Here, we report the crystal structures of ligand-unbound pFABP4, linoleate-bound pFABP4, and palmitate-bound pFABP5, obtained from gentoo penguin (Pygoscelis papua), at a resolution of 2.1 Å, 2.2 Å, and 2.3 Å, respectively. The pFABP4 and pFABP5 proteins have a canonical β-barrel structure with two short α-helices that form a cap region and fatty acid ligand binding sites in the hydrophobic cavity within the β-barrel structure. Linoleate-bound pFABP4 and palmitate-bound pFABP5 possess different ligand-binding modes and a unique ligand-binding pocket due to several sequence dissimilarities (A76/L78, T30/M32, underlining indicates pFABP4 residues) between the two proteins. Structural comparison revealed significantly different conformational changes in the β3-β4 loop region (residues 57-62) as well as the flipped Phe60 residue of pFABP5 than that in pFABP4 (the corresponding residue is Phe58). A ligand-binding study using fluorophore displacement assays shows that pFABP4 has a relatively strong affinity for linoleate as compared to pFABP5. In contrast, pFABP5 exhibits higher affinity for palmitate than that for pFABP4. In conclusion, our high-resolution structures and ligand-binding studies provide useful insights into the ligand-binding preferences of pFABPs based on key protein-ligand interactions. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. The Verrucomicrobia LexA-Binding Motif: Insights into the Evolutionary Dynamics of the SOS Response.

    PubMed

    Erill, Ivan; Campoy, Susana; Kılıç, Sefa; Barbé, Jordi

    2016-01-01

    The SOS response is the primary bacterial mechanism to address DNA damage, coordinating multiple cellular processes that include DNA repair, cell division, and translesion synthesis. In contrast to other regulatory systems, the composition of the SOS genetic network and the binding motif of its transcriptional repressor, LexA, have been shown to vary greatly across bacterial clades, making it an ideal system to study the co-evolution of transcription factors and their regulons. Leveraging comparative genomics approaches and prior knowledge on the core SOS regulon, here we define the binding motif of the Verrucomicrobia, a recently described phylum of emerging interest due to its association with eukaryotic hosts. Site directed mutagenesis of the Verrucomicrobium spinosum recA promoter confirms that LexA binds a 14 bp palindromic motif with consensus sequence TGTTC-N4-GAACA. Computational analyses suggest that recognition of this novel motif is determined primarily by changes in base-contacting residues of the third alpha helix of the LexA helix-turn-helix DNA binding motif. In conjunction with comparative genomics analysis of the LexA regulon in the Verrucomicrobia phylum, electrophoretic shift assays reveal that LexA binds to operators in the promoter region of DNA repair genes and a mutagenesis cassette in this organism, and identify previously unreported components of the SOS response. The identification of tandem LexA-binding sites generating instances of other LexA-binding motifs in the lexA gene promoter of Verrucomicrobia species leads us to postulate a novel mechanism for LexA-binding motif evolution. This model, based on gene duplication, successfully addresses outstanding questions in the intricate co-evolution of the LexA protein, its binding motif and the regulatory network it controls.

  3. The human mitochondrial single-stranded DNA-binding protein displays distinct kinetics and thermodynamics of DNA binding and exchange

    PubMed Central

    Qian, Yufeng; Johnson, Kenneth A.

    2017-01-01

    The human mitochondrial ssDNA-binding protein (mtSSB) is a homotetrameric protein, involved in mtDNA replication and maintenance. Although mtSSB is structurally similar to SSB from Escherichia coli (EcoSSB), it lacks the C-terminal disordered domain, and little is known about the biophysics of mtSSB–ssDNA interactions. Here, we characterized the kinetics and thermodynamics of mtSSB binding to ssDNA by equilibrium titrations and stopped-flow kinetic measurements. We show that the mtSSB tetramer can bind to ssDNA in two distinct binding modes: (SSB)30 and (SSB)60, defined by DNA binding site sizes of 30 and 60 nucleotides, respectively. We found that the binding mode is modulated by magnesium ion and NaCl concentration, but unlike EcoSSB, the mtSSB does not show negative intersubunit cooperativity. Global fitting of both the equilibrium and kinetic data afforded estimates for the rate and equilibrium constants governing the formation of (SSB)60 and (SSB)30 complexes and for the transitions between the two binding modes. We found that the mtSSB tetramer binds to ssDNA with a rate constant near the diffusion limit (2 × 109 m−1 s−1) and that longer DNA (≥60 nucleotides) rapidly wraps around all four monomers, as revealed by FRET assays. We also show that the mtSSB tetramer can directly transfer from one ssDNA molecule to another via an intermediate with two DNA molecules bound to the mtSSB. In conclusion, our results indicate that human mtSSB shares many physicochemical properties with EcoSSB and that the differences may be explained by the lack of an acidic, disordered C-terminal tail in human mtSSB protein. PMID:28615444

  4. Survey of immune-related, mannose/fucose-binding C-type lectin receptors reveals widely divergent sugar-binding specificities

    PubMed Central

    Lee, Reiko T; Hsu, Tsui-Ling; Huang, Shau Ku; Hsieh, Shie-Liang; Wong, Chi-Huey; Lee, Yuan C

    2011-01-01

    C-type lectins (CTLs) are proteins that contain one or more carbohydrate-recognition domains (CRDs) that require calcium for sugar binding and share high degree of sequence homology and tertiary structure. CTLs whose CRD contain EPN (Glu-Pro-Asn) tripeptide motifs have potential to bind mannose (Man), N-acetylglucosamine (GlcNAc), glucose (Glc) and l-fucose (Fuc), whereas those with QPD (Glu-Pro-Asp) tripeptide motifs bind galactose (Gal) and N-acetylgalactosamine (GalNAc). We report here for the first time a direct comparison of monosaccharide (and some di- and trisaccharides)-binding characteristics of 11 EPX-containing (X = N, S or D) immune-related CTLs using a competition assay and an enzyme-linked immunosorbent assay, and neoglycoproteins as ligand. The EPX CTLs studied are DC-SIGN, L-SIGN, mSIGNR1, human and mouse mannose receptors, Langerin, BDCA-2, DCIR, dectin-2, MCL and MINCLE. We found that: (1) they all bound Man and Fuc; (2) binding of Glc and GlcNAc varied considerably among these lectins, but was always less than Man and Fuc; (3) in general, Gal and GalNAc were not bound. However, dectin-2, DCIR and MINCLE showed ability to bind Gal/GalNAc; (4) DC-SIGN, L-SIGN, mSIGNR1 and Langerin showed enhanced binding of Manα2Man over Man, whereas all others showed no enhancement; (5) DC-SIGN bound Lex trisaccharide structure, which has terminal Gal and Fuc residues, more avidly than Fuc, whereas L-SIGN, mSIGNR1, DCIR and MINCLE bound Lex less avidly than Fuc. BDCA-2, dectin-2, Langerin, MCL and mannose receptor did not bind Lex at all. PMID:21112966

  5. Survey of immune-related, mannose/fucose-binding C-type lectin receptors reveals widely divergent sugar-binding specificities.

    PubMed

    Lee, Reiko T; Hsu, Tsui-Ling; Huang, Shau Ku; Hsieh, Shie-Liang; Wong, Chi-Huey; Lee, Yuan C

    2011-04-01

    C-type lectins (CTLs) are proteins that contain one or more carbohydrate-recognition domains (CRDs) that require calcium for sugar binding and share high degree of sequence homology and tertiary structure. CTLs whose CRD contain EPN (Glu-Pro-Asn) tripeptide motifs have potential to bind mannose (Man), N-acetylglucosamine (GlcNAc), glucose (Glc) and l-fucose (Fuc), whereas those with QPD (Glu-Pro-Asp) tripeptide motifs bind galactose (Gal) and N-acetylgalactosamine (GalNAc). We report here for the first time a direct comparison of monosaccharide (and some di- and trisaccharides)-binding characteristics of 11 EPX-containing (X = N, S or D) immune-related CTLs using a competition assay and an enzyme-linked immunosorbent assay, and neoglycoproteins as ligand. The EPX CTLs studied are DC-SIGN, L-SIGN, mSIGNR1, human and mouse mannose receptors, Langerin, BDCA-2, DCIR, dectin-2, MCL and MINCLE. We found that: (1) they all bound Man and Fuc; (2) binding of Glc and GlcNAc varied considerably among these lectins, but was always less than Man and Fuc; (3) in general, Gal and GalNAc were not bound. However, dectin-2, DCIR and MINCLE showed ability to bind Gal/GalNAc; (4) DC-SIGN, L-SIGN, mSIGNR1 and Langerin showed enhanced binding of Manα2Man over Man, whereas all others showed no enhancement; (5) DC-SIGN bound Le(x) trisaccharide structure, which has terminal Gal and Fuc residues, more avidly than Fuc, whereas L-SIGN, mSIGNR1, DCIR and MINCLE bound Le(x) less avidly than Fuc. BDCA-2, dectin-2, Langerin, MCL and mannose receptor did not bind Le(x) at all.

  6. Reduction of GABA/sub B/ receptor binding induced by climbing fiber degeneration in the rat cerebellum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kato, K.; Fukuda, H.

    1985-07-22

    When the rat cerebellar climbing fibers degenerated, as induced by lesioning the inferior olive with 3-acetylpyridine (3-AP), GABA/sub B/ receptor binding determined with /sup 3/H-(+/-)baclofen was reduced in the cerebellum but not in the cerebral cortex of rats. Computer analysis of saturation data revealed two components of the binding sites, and indicated that decrease of the binding in the cerebellum was due to reduction in receptor density, mainly of the high-affinity sites, the B/sub max/ of which was reduced to one-third that in the control animals. In vitro treatment with 3-AP, of the membranes prepared from either the cerebellum ormore » the cerebral cortex, induced no alteration in the binding sites, thereby indicating that the alteration of GABA/sub B/ sites induced by in vivo treatment with 3-AP is not due to a direct action of 3-AP on the receptor. GABA/sub A/ and benzodiazepine receptor binding labelled with /sup 3/H-muscimol and /sup 3/H-diazepam, respectively, in both of brain regions was not affected by destruction of the inferior olive. These results provide evidence that some of the GABA/sub B/ sites but neither GABA/sub A/ nor benzodiazepine receptors in the cerebellum are located at the climbing fiber terminals. 28 references, 4 figures, 2 tables.« less

  7. Molecular mechanism of ATP binding and ion channel activation in P2X receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hattori, Motoyuki; Gouaux, Eric

    P2X receptors are trimeric ATP-activated ion channels permeable to Na{sup +}, K{sup +} and Ca{sup 2+}. The seven P2X receptor subtypes are implicated in physiological processes that include modulation of synaptic transmission, contraction of smooth muscle, secretion of chemical transmitters and regulation of immune responses. Despite the importance of P2X receptors in cellular physiology, the three-dimensional composition of the ATP-binding site, the structural mechanism of ATP-dependent ion channel gating and the architecture of the open ion channel pore are unknown. Here we report the crystal structure of the zebrafish P2X4 receptor in complex with ATP and a new structure ofmore » the apo receptor. The agonist-bound structure reveals a previously unseen ATP-binding motif and an open ion channel pore. ATP binding induces cleft closure of the nucleotide-binding pocket, flexing of the lower body {beta}-sheet and a radial expansion of the extracellular vestibule. The structural widening of the extracellular vestibule is directly coupled to the opening of the ion channel pore by way of an iris-like expansion of the transmembrane helices. The structural delineation of the ATP-binding site and the ion channel pore, together with the conformational changes associated with ion channel gating, will stimulate development of new pharmacological agents.« less

  8. Genome-Wide Identification of Chromatin Transitional Regions Reveals Diverse Mechanisms Defining the Boundary of Facultative Heterochromatin

    PubMed Central

    Li, Guangyao; Zhou, Lei

    2013-01-01

    Due to the self-propagating nature of the heterochromatic modification H3K27me3, chromatin barrier activities are required to demarcate the boundary and prevent it from encroaching into euchromatic regions. Studies in Drosophila and vertebrate systems have revealed several important chromatin barrier elements and their respective binding factors. However, epigenomic data indicate that the binding of these factors are not exclusive to chromatin boundaries. To gain a comprehensive understanding of facultative heterochromatin boundaries, we developed a two-tiered method to identify the Chromatin Transitional Region (CTR), i.e. the nucleosomal region that shows the greatest transition rate of the H3K27me3 modification as revealed by ChIP-Seq. This approach was applied to identify CTRs in Drosophila S2 cells and human HeLa cells. Although many insulator proteins have been characterized in Drosophila, less than half of the CTRs in S2 cells are associated with known insulator proteins, indicating unknown mechanisms remain to be characterized. Our analysis also revealed that the peak binding of insulator proteins are usually 1–2 nucleosomes away from the CTR. Comparison of CTR-associated insulator protein binding sites vs. those in heterochromatic region revealed that boundary-associated binding sites are distinctively flanked by nucleosome destabilizing sequences, which correlates with significant decreased nucleosome density and increased binding intensities of co-factors. Interestingly, several subgroups of boundaries have enhanced H3.3 incorporation but reduced nucleosome turnover rate. Our genome-wide study reveals that diverse mechanisms are employed to define the boundaries of facultative heterochromatin. In both Drosophila and mammalian systems, only a small fraction of insulator protein binding sites co-localize with H3K27me3 boundaries. However, boundary-associated insulator binding sites are distinctively flanked by nucleosome destabilizing sequences, which correlates with significantly decreased nucleosome density and increased binding of co-factors. PMID:23840609

  9. Elucidating the evolutionary conserved DNA-binding specificities of WRKY transcription factors by molecular dynamics and in vitro binding assays

    PubMed Central

    Brand, Luise H.; Fischer, Nina M.; Harter, Klaus; Kohlbacher, Oliver; Wanke, Dierk

    2013-01-01

    WRKY transcription factors constitute a large protein family in plants that is involved in the regulation of developmental processes and responses to biotic or abiotic stimuli. The question arises how stimulus-specific responses are mediated given that the highly conserved WRKY DNA-binding domain (DBD) exclusively recognizes the ‘TTGACY’ W-box consensus. We speculated that the W-box consensus might be more degenerate and yet undetected differences in the W-box consensus of WRKYs of different evolutionary descent exist. The phylogenetic analysis of WRKY DBDs suggests that they evolved from an ancestral group IIc-like WRKY early in the eukaryote lineage. A direct descent of group IIc WRKYs supports a monophyletic origin of all other group II and III WRKYs from group I by loss of an N-terminal DBD. Group I WRKYs are of paraphyletic descent and evolved multiple times independently. By homology modeling, molecular dynamics simulations and in vitro DNA–protein interaction-enzyme-linked immunosorbent assay with AtWRKY50 (IIc), AtWRKY33 (I) and AtWRKY11 (IId) DBDs, we revealed differences in DNA-binding specificities. Our data imply that other components are essentially required besides the W-box-specific binding to DNA to facilitate a stimulus-specific WRKY function. PMID:23975197

  10. The DNLZ/HEP zinc-binding subdomain is critical for regulation of the mitochondrial chaperone HSPA9

    PubMed Central

    Vu, Michael T; Zhai, Peng; Lee, Juhye; Guerra, Cecilia; Liu, Shirley; Gustin, Michael C; Silberg, Jonathan J

    2012-01-01

    Human mitochondrial DNLZ/HEP regulates the catalytic activity and solubility of the mitochondrial hsp70 chaperone HSPA9. Here, we investigate the role that the DNLZ zinc-binding and C-terminal subdomains play in regulating HSPA9. We show that truncations lacking portions of the zinc-binding subdomain (ZBS) do not affect the solubility of HSPA9 or its ATPase domain, whereas those containing the ZBS and at least 10 residues following this subdomain enhance chaperone solubility. Binding measurements further show that DNLZ requires its ZBS to form a stable complex with the HSPA9 ATPase domain, and ATP hydrolysis measurements reveal that the ZBS is critical for full stimulation of HSPA9 catalytic activity. We also examined if DNLZ is active in vivo. We found that DNLZ partially complements the growth of Δzim17Saccharomyces cerevisiae, and we discovered that a Zim17 truncation lacking a majority of the C-terminal subdomain strongly complements growth like full-length Zim17. These findings provide direct evidence that human DNLZ is a functional ortholog of Zim17. In addition, they implicate the pair of antiparallel β-strands that coordinate zinc in Zim17/DNLZ-type proteins as critical for binding and regulating hsp70 chaperones. PMID:22162012

  11. The DNLZ/HEP zinc-binding subdomain is critical for regulation of the mitochondrial chaperone HSPA9.

    PubMed

    Vu, Michael T; Zhai, Peng; Lee, Juhye; Guerra, Cecilia; Liu, Shirley; Gustin, Michael C; Silberg, Jonathan J

    2012-02-01

    Human mitochondrial DNLZ/HEP regulates the catalytic activity and solubility of the mitochondrial hsp70 chaperone HSPA9. Here, we investigate the role that the DNLZ zinc-binding and C-terminal subdomains play in regulating HSPA9. We show that truncations lacking portions of the zinc-binding subdomain (ZBS) do not affect the solubility of HSPA9 or its ATPase domain, whereas those containing the ZBS and at least 10 residues following this subdomain enhance chaperone solubility. Binding measurements further show that DNLZ requires its ZBS to form a stable complex with the HSPA9 ATPase domain, and ATP hydrolysis measurements reveal that the ZBS is critical for full stimulation of HSPA9 catalytic activity. We also examined if DNLZ is active in vivo. We found that DNLZ partially complements the growth of Δzim17 Saccharomyces cerevisiae, and we discovered that a Zim17 truncation lacking a majority of the C-terminal subdomain strongly complements growth like full-length Zim17. These findings provide direct evidence that human DNLZ is a functional ortholog of Zim17. In addition, they implicate the pair of antiparallel β-strands that coordinate zinc in Zim17/DNLZ-type proteins as critical for binding and regulating hsp70 chaperones. Copyright © 2011 The Protein Society.

  12. POZ domain transcription factor, FBI-1, represses transcription of ADH5/FDH by interacting with the zinc finger and interfering with DNA binding activity of Sp1.

    PubMed

    Lee, Dong-Kee; Suh, Dongchul; Edenberg, Howard J; Hur, Man-Wook

    2002-07-26

    The POZ domain is a protein-protein interaction motif that is found in many transcription factors, which are important for development, oncogenesis, apoptosis, and transcription repression. We cloned the POZ domain transcription factor, FBI-1, that recognizes the cis-element (bp -38 to -22) located just upstream of the core Sp1 binding sites (bp -22 to +22) of the ADH5/FDH minimal promoter (bp -38 to +61) in vitro and in vivo, as revealed by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. The ADH5/FDH minimal promoter is potently repressed by the FBI-1. Glutathione S-transferase fusion protein pull-down showed that the POZ domains of FBI-1, Plzf, and Bcl-6 directly interact with the zinc finger DNA binding domain of Sp1. DNase I footprinting assays showed that the interaction prevents binding of Sp1 to the GC boxes of the ADH5/FDH promoter. Gal4-POZ domain fusions targeted proximal to the GC boxes repress transcription of the Gal4 upstream activator sequence-Sp1-adenovirus major late promoter. Our data suggest that POZ domain represses transcription by interacting with Sp1 zinc fingers and by interfering with the DNA binding activity of Sp1.

  13. SOX10 Regulates Expression of the SH3-Domain Kinase Binding Protein 1 (Sh3kbp1) locus in Schwann Cells via an Alternative Promoter

    PubMed Central

    Hodonsky, Chani J.; Kleinbrink, Erica L.; Charney, Kira N.; Prasad, Megana; Bessling, Seneca L.; Jones, Erin A.; Srinivasan, Rajini; Svaren, John; McCallion, Andrew S.; Antonellis, Anthony

    2011-01-01

    The transcription factor SOX10 has essential roles in neural crest-derived cell populations, including myelinating Schwann cells—specialized glial cells responsible for ensheathing axons in the peripheral nervous system. Importantly, SOX10 directly regulates the expression of genes essential for proper myelin function. To date, only a handful of SOX10 target loci have been characterized in Schwann cells. Addressing this lack of knowledge will provide a better understanding of Schwann cell biology and candidate loci for relevant diseases such as demyelinating peripheral neuropathies. We have identified a highly-conserved SOX10 binding site within an alternative promoter at the SH3-domain kinase binding protein 1 (Sh3kbp1) locus. The genomic segment identified at Sh3kbp1 binds to SOX10 and displays strong promoter activity in Schwann cells in vitro and in vivo. Mutation of the SOX10 binding site ablates promoter activity, and ectopic expression of SOX10 in SOX10-negative cells promotes the expression of endogenous Sh3kbp1. Combined, these data reveal Sh3kbp1 as a novel target of SOX10 and raise important questions regarding the function of SH3KBP1 isoforms in Schwann cells. PMID:22037207

  14. Binding polarity of RPA to telomeric sequences and influence of G-quadruplex stability.

    PubMed

    Safa, Layal; Delagoutte, Emmanuelle; Petruseva, Irina; Alberti, Patrizia; Lavrik, Olga; Riou, Jean-François; Saintomé, Carole

    2014-08-01

    Replication protein A (RPA) is a single-stranded DNA binding protein that plays an essential role in telomere maintenance. RPA binds to and unfolds G-quadruplex (G4) structures formed in telomeric DNA, thus facilitating lagging strand DNA replication and telomerase activity. To investigate the effect of G4 stability on the interactions with human RPA (hRPA), we used a combination of biochemical and biophysical approaches. Our data revealed an inverse relationship between G4 stability and ability of hRPA to bind to telomeric DNA; notably small G4 ligands that enhance G4 stability strongly impaired G4 unfolding by hRPA. To gain more insight into the mechanism of binding and unfolding of telomeric G4 structures by RPA, we carried out photo-crosslinking experiments to elucidate the spatial arrangement of the RPA subunits along the DNA strands. Our results showed that RPA1 and RPA2 are arranged from 5' to 3' along the unfolded telomeric G4, as already described for unstructured single-stranded DNA, while no contact is possible with RPA3 on this short oligonucleotide. In addition, these data are compatible with a 5' to 3' directionality in G4 unfolding by hRPA. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  15. Interfacial metal and antibody recognition.

    PubMed

    Zhou, Tongqing; Hamer, Dean H; Hendrickson, Wayne A; Sattentau, Quentin J; Kwong, Peter D

    2005-10-11

    The unique ligation properties of metal ions are widely exploited by proteins, with approximately one-third of all proteins estimated to be metalloproteins. Although antibodies use various mechanisms for recognition, to our knowledge, none has ever been characterized that uses an interfacial metal. We previously described a family of CD4-reactive antibodies, the archetype being Q425. CD4:Q425 engagement does not interfere with CD4:HIV-1 gp120 envelope glycoprotein binding, but it blocks subsequent steps required for viral entry. Here, we use surface-plasmon resonance to show that Q425 requires calcium for recognition of CD4. Specifically, Q425 binding of calcium resulted in a 55,000-fold enhancement in affinity for CD4. X-ray crystallographic analyses of Q425 in the presence of Ca(2+), Ba(2+), or EDTA revealed an exposed metal-binding site, partially coordinated by five atoms contributed from four antibody complementarity-determining regions. The results suggest that Q425 recognition of CD4 involves direct ligation of antigen by the Q425-held calcium, with calcium binding each ligating atom of CD4 with approximately 1.5 kcal/mol of binding energy. This energetic contribution, which is greater than that from a typical protein atom, demonstrates how interfacial metal ligation can play a unique role in antigen recognition.

  16. Interfacial metal and antibody recognition

    PubMed Central

    Zhou, Tongqing; Hamer, Dean H.; Hendrickson, Wayne A.; Sattentau, Quentin J.; Kwong, Peter D.

    2005-01-01

    The unique ligation properties of metal ions are widely exploited by proteins, with approximately one-third of all proteins estimated to be metalloproteins. Although antibodies use various mechanisms for recognition, to our knowledge, none has ever been characterized that uses an interfacial metal. We previously described a family of CD4-reactive antibodies, the archetype being Q425. CD4:Q425 engagement does not interfere with CD4:HIV-1 gp120 envelope glycoprotein binding, but it blocks subsequent steps required for viral entry. Here, we use surface-plasmon resonance to show that Q425 requires calcium for recognition of CD4. Specifically, Q425 binding of calcium resulted in a 55,000-fold enhancement in affinity for CD4. X-ray crystallographic analyses of Q425 in the presence of Ca2+, Ba2+, or EDTA revealed an exposed metal-binding site, partially coordinated by five atoms contributed from four antibody complementarity-determining regions. The results suggest that Q425 recognition of CD4 involves direct ligation of antigen by the Q425-held calcium, with calcium binding each ligating atom of CD4 with ≈1.5 kcal/mol of binding energy. This energetic contribution, which is greater than that from a typical protein atom, demonstrates how interfacial metal ligation can play a unique role in antigen recognition. PMID:16195378

  17. Crystal Structure of the Neutralizing Llama VHH D7 and Its Mode of HIV-1 gp120 Interaction

    PubMed Central

    Hinz, Andreas; Lutje Hulsik, David; Forsman, Anna; Koh, Willie Wee-Lee; Belrhali, Hassan; Gorlani, Andrea; de Haard, Hans; Weiss, Robin A.; Verrips, Theo; Weissenhorn, Winfried

    2010-01-01

    HIV-1 entry into host cells is mediated by the sequential binding of the envelope glycoprotein gp120 to CD4 and a chemokine receptor. Antibodies binding to epitopes overlapping the CD4-binding site on gp120 are potent inhibitors of HIV entry, such as the llama heavy chain antibody fragment VHH D7, which has cross-clade neutralizing properties and competes with CD4 and mAb b12 for high affinity binding to gp120. We report the crystal structure of the D7 VHH at 1.5 Å resolution, which reveals the molecular details of the complementarity determining regions (CDR) and substantial flexibility of CDR3 that could facilitate an induced fit interaction with gp120. Structural comparison of CDRs from other CD4 binding site antibodies suggests diverse modes of interaction. Mutational analysis identified CDR3 as a key component of gp120 interaction as determined by surface plasmon resonance. A decrease in affinity is directly coupled to the neutralization efficiency since mutations that decrease gp120 interaction increase the IC50 required for HIV-1 IIIB neutralization. Thus the structural study identifies the long CDR3 of D7 as the key determinant of interaction and HIV-1 neutralization. Furthermore, our data confirm that the structural plasticity of gp120 can accommodate multiple modes of antibody binding within the CD4 binding site. PMID:20463957

  18. Mutational analysis reveals a noncontractile but interactive role of actin and profilin in viral RNA-dependent RNA synthesis.

    PubMed

    Harpen, Mary; Barik, Tiasha; Musiyenko, Alla; Barik, Sailen

    2009-11-01

    As obligatory parasites, viruses co-opt a variety of cellular functions for robust replication. The expression of the nonsegmented negative-strand RNA genome of respiratory syncytial virus (RSV), a significant pediatric pathogen, absolutely requires actin and is stimulated by the actin-regulatory protein profilin. As actin is a major contractile protein, it was important to determine whether the known functional domains of actin and profilin were important for their ability to activate RSV transcription. Analyses of recombinant mutants in a reconstituted RSV transcription system suggested that the divalent-cation-binding domain of actin is critically needed for binding to the RSV genome template and for the activation of viral RNA synthesis. In contrast, the nucleotide-binding domain and the N-terminal acidic domain were needed neither for template binding nor for transcription. Specific surface residues of actin, required for actin-actin contact during filamentation, were also nonessential for viral transcription. Unlike actin, profilin did not directly bind to the viral template but was recruited by actin. Mutation of the interactive residues of actin or profilin, resulting in the loss of actin-profilin binding, also abolished profilin's ability to stimulate viral transcription. Together, these results suggest that actin acts as a classical transcription factor for the virus by divalent-cation-dependent binding to the viral template and that profilin acts as a transcriptional cofactor, in part by associating with actin. This essential viral role of actin is independent of its contractile cellular role.

  19. Zinc-binding Domain of the Bacteriophage T7 DNA Primase Modulates Binding to the DNA Template*

    PubMed Central

    Lee, Seung-Joo; Zhu, Bin; Akabayov, Barak; Richardson, Charles C.

    2012-01-01

    The zinc-binding domain (ZBD) of prokaryotic DNA primases has been postulated to be crucial for recognition of specific sequences in the single-stranded DNA template. To determine the molecular basis for this role in recognition, we carried out homolog-scanning mutagenesis of the zinc-binding domain of DNA primase of bacteriophage T7 using a bacterial homolog from Geobacillus stearothermophilus. The ability of T7 DNA primase to catalyze template-directed oligoribonucleotide synthesis is eliminated by substitution of any five-amino acid residue-long segment within the ZBD. The most significant defect occurs upon substitution of a region (Pro-16 to Cys-20) spanning two cysteines that coordinate the zinc ion. The role of this region in primase function was further investigated by generating a protein library composed of multiple amino acid substitutions for Pro-16, Asp-18, and Asn-19 followed by genetic screening for functional proteins. Examination of proteins selected from the screening reveals no change in sequence-specific recognition. However, the more positively charged residues in the region facilitate DNA binding, leading to more efficient oligoribonucleotide synthesis on short templates. The results suggest that the zinc-binding mode alone is not responsible for sequence recognition, but rather its interaction with the RNA polymerase domain is critical for DNA binding and for sequence recognition. Consequently, any alteration in the ZBD that disturbs its conformation leads to loss of DNA-dependent oligoribonucleotide synthesis. PMID:23024359

  20. Comparison of Saccharomyces cerevisiae F-BAR domain structures reveals a conserved inositol phosphate binding site.

    PubMed

    Moravcevic, Katarina; Alvarado, Diego; Schmitz, Karl R; Kenniston, Jon A; Mendrola, Jeannine M; Ferguson, Kathryn M; Lemmon, Mark A

    2015-02-03

    F-BAR domains control membrane interactions in endocytosis, cytokinesis, and cell signaling. Although they are generally thought to bind curved membranes containing negatively charged phospholipids, numerous functional studies argue that differences in lipid-binding selectivities of F-BAR domains are functionally important. Here, we compare membrane-binding properties of the Saccharomyces cerevisiae F-BAR domains in vitro and in vivo. Whereas some F-BAR domains (such as Bzz1p and Hof1p F-BARs) bind equally well to all phospholipids, the F-BAR domain from the RhoGAP Rgd1p preferentially binds phosphoinositides. We determined X-ray crystal structures of F-BAR domains from Hof1p and Rgd1p, the latter bound to an inositol phosphate. The structures explain phospholipid-binding selectivity differences and reveal an F-BAR phosphoinositide binding site that is fully conserved in a mammalian RhoGAP called Gmip and is partly retained in certain other F-BAR domains. Our findings reveal previously unappreciated determinants of F-BAR domain lipid-binding specificity and provide a basis for its prediction from sequence. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Comparison of Saccharomyces cerevisiae F-BAR Domain Structures Reveals a Conserved Inositol Phosphate Binding Site

    DOE PAGES

    Moravcevic, Katarina; Alvarado, Diego; Schmitz, Karl R.; ...

    2015-01-22

    F-BAR domains control membrane interactions in endocytosis, cytokinesis, and cell signaling. Although they are generally thought to bind curved membranes containing negatively charged phospholipids, numerous functional studies argue that differences in lipid-binding selectivities of F-BAR domains are functionally important. Here in this paper, we compare membrane-binding properties of the Saccharomyces cerevisiae F-BAR domains in vitro and in vivo. Whereas some F-BAR domains (such as Bzz1p and Hof1p F-BARs) bind equally well to all phospholipids, the F-BAR domain from the RhoGAP Rgd1p preferentially binds phosphoinositides. We determined X-ray crystal structures of F-BAR domains from Hof1p and Rgd1p, the latter bound tomore » an inositol phosphate. The structures explain phospholipid-binding selectivity differences and reveal an F-BAR phosphoinositide binding site that is fully conserved in a mammalian RhoGAP called Gmip and is partly retained in certain other F-BAR domains. In conclusion, our findings reveal previously unappreciated determinants of F-BAR domain lipid-binding specificity and provide a basis for its prediction from sequence.« less

  2. EIN3 and ORE1 Accelerate Degreening during Ethylene-Mediated Leaf Senescence by Directly Activating Chlorophyll Catabolic Genes in Arabidopsis

    PubMed Central

    Qiu, Kai; Li, Zhongpeng; Yang, Zhen; Chen, Junyi; Wu, Shouxin; Zhu, Xiaoyu; Gao, Shan; Gao, Jiong; Ren, Guodong; Kuai, Benke; Zhou, Xin

    2015-01-01

    Degreening, caused by chlorophyll degradation, is the most obvious symptom of senescing leaves. Chlorophyll degradation can be triggered by endogenous and environmental cues, and ethylene is one of the major inducers. ETHYLENE INSENSITIVE3 (EIN3) is a key transcription factor in the ethylene signaling pathway. It was previously reported that EIN3, miR164, and a NAC (NAM, ATAF, and CUC) transcription factor ORE1/NAC2 constitute a regulatory network mediating leaf senescence. However, how this network regulates chlorophyll degradation at molecular level is not yet elucidated. Here we report a feed-forward regulation of chlorophyll degradation that involves EIN3, ORE1, and chlorophyll catabolic genes (CCGs). Gene expression analysis showed that the induction of three major CCGs, NYE1, NYC1 and PAO, by ethylene was largely repressed in ein3 eil1 double mutant. Dual-luciferase assay revealed that EIN3 significantly enhanced the promoter activity of NYE1, NYC1 and PAO in Arabidopsis protoplasts. Furthermore, Electrophoretic mobility shift assay (EMSA) indicated that EIN3 could directly bind to NYE1, NYC1 and PAO promoters. These results reveal that EIN3 functions as a positive regulator of CCG expression during ethylene-mediated chlorophyll degradation. Interestingly, ORE1, a senescence regulator which is a downstream target of EIN3, could also activate the expression of NYE1, NYC1 and PAO by directly binding to their promoters in EMSA and chromatin immunoprecipitation (ChIP) assays. In addition, EIN3 and ORE1 promoted NYE1 and NYC1 transcriptions in an additive manner. These results suggest that ORE1 is also involved in the direct regulation of CCG transcription. Moreover, ORE1 activated the expression of ACS2, a major ethylene biosynthesis gene, and subsequently promoted ethylene production. Collectively, our work reveals that EIN3, ORE1 and CCGs constitute a coherent feed-forward loop involving in the robust regulation of ethylene-mediated chlorophyll degradation during leaf senescence in Arabidopsis. PMID:26218222

  3. The Shine-Dalgarno sequence of riboswitch-regulated single mRNAs shows ligand-dependent accessibility bursts

    NASA Astrophysics Data System (ADS)

    Rinaldi, Arlie J.; Lund, Paul E.; Blanco, Mario R.; Walter, Nils G.

    2016-01-01

    In response to intracellular signals in Gram-negative bacteria, translational riboswitches--commonly embedded in messenger RNAs (mRNAs)--regulate gene expression through inhibition of translation initiation. It is generally thought that this regulation originates from occlusion of the Shine-Dalgarno (SD) sequence upon ligand binding; however, little direct evidence exists. Here we develop Single Molecule Kinetic Analysis of RNA Transient Structure (SiM-KARTS) to investigate the ligand-dependent accessibility of the SD sequence of an mRNA hosting the 7-aminomethyl-7-deazaguanine (preQ1)-sensing riboswitch. Spike train analysis reveals that individual mRNA molecules alternate between two conformational states, distinguished by `bursts' of probe binding associated with increased SD sequence accessibility. Addition of preQ1 decreases the lifetime of the SD's high-accessibility (bursting) state and prolongs the time between bursts. In addition, ligand-jump experiments reveal imperfect riboswitching of single mRNA molecules. Such complex ligand sensing by individual mRNA molecules rationalizes the nuanced ligand response observed during bulk mRNA translation.

  4. Structural basis for sorting mechanism of p62 in selective autophagy.

    PubMed

    Ichimura, Yoshinobu; Kumanomidou, Taichi; Sou, Yu-shin; Mizushima, Tsunehiro; Ezaki, Junji; Ueno, Takashi; Kominami, Eiki; Yamane, Takashi; Tanaka, Keiji; Komatsu, Masaaki

    2008-08-15

    Impairment of autophagic degradation of the ubiquitin- and LC3-binding protein "p62" leads to the formation of cytoplasmic inclusion bodies. However, little is known about the sorting mechanism of p62 to autophagic degradation. Here we identified a motif of murine p62 consisting of 11 amino acids (Ser334-Ser344) containing conserved acidic and hydrophobic residues across species, as an LC3 recognition sequence (LRS). The crystal structure of the LC3-LRS complex at 1.56 angstroms resolution revealed interaction of Trp340 and Leu343 of p62 with different hydrophobic pockets on the ubiquitin fold of LC3. In vivo analyses demonstrated that p62 mutants lacking LC3 binding ability accumulated without entrapping into autophagosomes in the cytoplasm and subsequently formed ubiquitin-positive inclusion bodies as in autophagy-deficient cells. These results demonstrate that the intracellular level of p62 is tightly regulated by autophagy through the direct interaction of LC3 with p62 and reveal that selective turnover of p62 via autophagy controls inclusion body formation.

  5. Structural and functional analysis of mRNA export regulation by the nuclear pore complex.

    PubMed

    Lin, Daniel H; Correia, Ana R; Cai, Sarah W; Huber, Ferdinand M; Jette, Claudia A; Hoelz, André

    2018-06-13

    The nuclear pore complex (NPC) controls the passage of macromolecules between the nucleus and cytoplasm, but how the NPC directly participates in macromolecular transport remains poorly understood. In the final step of mRNA export, the DEAD-box helicase DDX19 is activated by the nucleoporins Gle1, Nup214, and Nup42 to remove Nxf1•Nxt1 from mRNAs. Here, we report crystal structures of Gle1•Nup42 from three organisms that reveal an evolutionarily conserved binding mode. Biochemical reconstitution of the DDX19 ATPase cycle establishes that human DDX19 activation does not require IP 6 , unlike its fungal homologs, and that Gle1 stability affects DDX19 activation. Mutations linked to motor neuron diseases cause decreased Gle1 thermostability, implicating nucleoporin misfolding as a disease determinant. Crystal structures of human Gle1•Nup42•DDX19 reveal the structural rearrangements in DDX19 from an auto-inhibited to an RNA-binding competent state. Together, our results provide the foundation for further mechanistic analyses of mRNA export in humans.

  6. DNA methylation directs genomic localization of Mbd2 and Mbd3 in embryonic stem cells

    PubMed Central

    Hainer, Sarah J; McCannell, Kurtis N; Yu, Jun; Ee, Ly-Sha; Zhu, Lihua J; Rando, Oliver J; Fazzio, Thomas G

    2016-01-01

    Cytosine methylation is an epigenetic and regulatory mark that functions in part through recruitment of chromatin remodeling complexes containing methyl-CpG binding domain (MBD) proteins. Two MBD proteins, Mbd2 and Mbd3, were previously shown to bind methylated or hydroxymethylated DNA, respectively; however, both of these findings have been disputed. Here, we investigated this controversy using experimental approaches and re-analysis of published data and find no evidence for methylation-independent functions of Mbd2 or Mbd3. We show that chromatin localization of Mbd2 and Mbd3 is highly overlapping and, unexpectedly, we find Mbd2 and Mbd3 are interdependent for chromatin association. Further investigation reveals that both proteins are required for normal levels of cytosine methylation and hydroxymethylation in murine embryonic stem cells. Furthermore, Mbd2 and Mbd3 regulate overlapping sets of genes that are also regulated by DNA methylation/hydroxymethylation factors. These findings reveal an interdependent regulatory mechanism mediated by the DNA methylation machinery and its readers. DOI: http://dx.doi.org/10.7554/eLife.21964.001 PMID:27849519

  7. Beyond the binding site: in vivo identification of tbx2, smarca5 and wnt5b as molecular targets of CNBP during embryonic development.

    PubMed

    Armas, Pablo; Margarit, Ezequiel; Mouguelar, Valeria S; Allende, Miguel L; Calcaterra, Nora B

    2013-01-01

    CNBP is a nucleic acid chaperone implicated in vertebrate craniofacial development, as well as in myotonic dystrophy type 2 (DM2) and sporadic inclusion body myositis (sIBM) human muscle diseases. CNBP is highly conserved among vertebrates and has been implicated in transcriptional regulation; however, its DNA binding sites and molecular targets remain elusive. The main goal of this work was to identify CNBP DNA binding sites that might reveal target genes involved in vertebrate embryonic development. To accomplish this, we used a recently described yeast one-hybrid assay to identify DNA sequences bound in vivo by CNBP. Bioinformatic analyses revealed that these sequences are G-enriched and show high frequency of putative G-quadruplex DNA secondary structure. Moreover, an in silico approach enabled us to establish the CNBP DNA-binding site and to predict CNBP putative targets based on gene ontology terms and synexpression with CNBP. The direct interaction between CNBP and candidate genes was proved by EMSA and ChIP assays. Besides, the role of CNBP upon the identified genes was validated in loss-of-function experiments in developing zebrafish. We successfully confirmed that CNBP up-regulates tbx2b and smarca5, and down-regulates wnt5b gene expression. The highly stringent strategy used in this work allowed us to identify new CNBP target genes functionally important in different contexts of vertebrate embryonic development. Furthermore, it represents a novel approach toward understanding the biological function and regulatory networks involving CNBP in the biology of vertebrates.

  8. Lactate Utilization Is Regulated by the FadR-Type Regulator LldR in Pseudomonas aeruginosa

    PubMed Central

    Gao, Chao; Hu, Chunhui; Zheng, Zhaojuan; Jiang, Tianyi; Dou, Peipei; Zhang, Wen; Che, Bin; Wang, Yujiao; Lv, Min

    2012-01-01

    NAD-independent l-lactate dehydrogenase (l-iLDH) and NAD-independent d-lactate dehydrogenase (d-iLDH) activities are induced coordinately by either enantiomer of lactate in Pseudomonas strains. Inspection of the genomic sequences of different Pseudomonas strains revealed that the lldPDE operon comprises 3 genes, lldP (encoding a lactate permease), lldD (encoding an l-iLDH), and lldE (encoding a d-iLDH). Cotranscription of lldP, lldD, and lldE in Pseudomonas aeruginosa strain XMG starts with the base, C, that is located 138 bp upstream of the lldP ATG start codon. The lldPDE operon is located adjacent to lldR (encoding an FadR-type regulator, LldR). The gel mobility shift assays revealed that the purified His-tagged LldR binds to the upstream region of lldP. An XMG mutant strain that constitutively expresses d-iLDH and l-iLDH was found to contain a mutation in lldR that leads to an Ile23-to-serine substitution in the LldR protein. The mutated protein, LldRM, lost its DNA-binding activity. A motif with a hyphenated dyad symmetry (TGGTCTTACCA) was identified as essential for the binding of LldR to the upstream region of lldP by using site-directed mutagenesis. l-Lactate and d-lactate interfered with the DNA-binding activity of LldR. Thus, l-iLDH and d-iLDH were expressed when the operon was induced in the presence of l-lactate or d-lactate. PMID:22408166

  9. The high affinity of small-molecule antioxidants for hemoglobin.

    PubMed

    Puscas, Cristina; Radu, Luana; Carrascoza, Francisco; Mot, Augustin C; Amariei, Diana; Lungu, Oana; Scurtu, Florina; Podea, Paula; Septelean, Raluca; Matei, Alina; Mic, Mihaela; Attia, Amr A; Silaghi-Dumitrescu, Radu

    2018-06-18

    Hemoglobin has previously been shown to display ascorbate peroxidase and urate peroxidase activity, with measurable Michaelis-Menten parameters that reveal a particularly low Km for ascorbate as well as for urate - lower than the respective in vivo concentrations of these antioxidants in blood. Also, direct detection of a hemoglobin-ascorbate interaction was possible by monitoring the 1H-NMR spectrum of ascorbate in the presence of hemoglobin. The relative difference in structures between ascorbate and urate may raise the question as to exactly what the defining structural features would be, for a substrate that binds to hemoglobin with high affinity. Reported here are Michaelis-Menten parameters for hemoglobin acting as peroxidase against a number of other substrates of varying structures - gallate, caffeate, rutin, 3-hydroxyflavone, 3,6-dihydroxyflavone, quercetin, epicatechin, luteolin - all with high affinities (some higher than those of physiologically-relevant redox partners of Hb - ascorbate and urate). Moreover, this high affinity appears general to animal hemoglobins. 1 H-NMR and 13 C-NMR spectra reveal a general pattern wherein small hydrophilic antioxidants appear to all have their signals affected, presumably due to binding to hemoglobin. Fluorescence and calorimetry measurements confirm these conclusions. Docking calculations confirm the existence of binding sites on hemoglobin and on myoglobin for ascorbate as well as for other antioxidants. Support is found for involvement of Tyr42 in binding of three out of the four substrates investigated in the case of hemoglobin (including ascorbate and urate, as blood-contained relevant substrates), but also for Tyr145 (with urate and caffeate) and Tyr35 (with gallate). Copyright © 2018 Elsevier Inc. All rights reserved.

  10. Beyond the Binding Site: In Vivo Identification of tbx2, smarca5 and wnt5b as Molecular Targets of CNBP during Embryonic Development

    PubMed Central

    Mouguelar, Valeria S.; Allende, Miguel L.; Calcaterra, Nora B.

    2013-01-01

    CNBP is a nucleic acid chaperone implicated in vertebrate craniofacial development, as well as in myotonic dystrophy type 2 (DM2) and sporadic inclusion body myositis (sIBM) human muscle diseases. CNBP is highly conserved among vertebrates and has been implicated in transcriptional regulation; however, its DNA binding sites and molecular targets remain elusive. The main goal of this work was to identify CNBP DNA binding sites that might reveal target genes involved in vertebrate embryonic development. To accomplish this, we used a recently described yeast one-hybrid assay to identify DNA sequences bound in vivo by CNBP. Bioinformatic analyses revealed that these sequences are G-enriched and show high frequency of putative G-quadruplex DNA secondary structure. Moreover, an in silico approach enabled us to establish the CNBP DNA-binding site and to predict CNBP putative targets based on gene ontology terms and synexpression with CNBP. The direct interaction between CNBP and candidate genes was proved by EMSA and ChIP assays. Besides, the role of CNBP upon the identified genes was validated in loss-of-function experiments in developing zebrafish. We successfully confirmed that CNBP up-regulates tbx2b and smarca5, and down-regulates wnt5b gene expression. The highly stringent strategy used in this work allowed us to identify new CNBP target genes functionally important in different contexts of vertebrate embryonic development. Furthermore, it represents a novel approach toward understanding the biological function and regulatory networks involving CNBP in the biology of vertebrates. PMID:23667590

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leenheer, J.A.; Brown, G.K.; Cabaniss, S.E.

    Fulvic acid, isolated from the Suwannee River, Georgia, was assessed for its ability to bind Ca{sup 2+}, Cd{sup 2+}, Cu{sup 2+}, Ni{sup 2+}, and Zn{sup 2+} ions at pH 6 before and after extensive fractionation that was designed to reveal the nature of metal binding functional groups. The binding constant for Ca{sup 2+} ion had the greatest increase of all the ions in a metal binding fraction that was selected for intensive characterization for the purpose of building quantitative average model structures. The metal binding fraction was characterized by quantitative {sup 13}C NMR, {sup 1}H NMR, and FT-IR spectrometry andmore » elemental, titrimetric, and molecular weight determinations. The characterization data revealed that carboxyl groups were clustered in short-chain aliphatic dibasic acid structures. The Ca{sup 2+} binding data suggested that ether-substituted oxysuccinic acid structures are good models for the metal binding sites at pH 6. Structural models were derived based upon oxidation and photolytic rearrangements of cutin, lignin, and tannin precursors. These structural models rich in substituted dibasic acid structures revealed polydentate binding sites with the potential for both inner-sphere and outer-sphere type binding. The majority of the fulvic acid molecule was involved with metal binding rather than a small substructural unit.« less

  12. A polybasic motif in ErbB3-binding protein 1 (EBP1) has key functions in nucleolar localization and polyphosphoinositide interaction

    PubMed Central

    Karlsson, Thomas; Altankhuyag, Altanchimeg; Dobrovolska, Olena; Turcu, Diana C.; Lewis, Aurélia E.

    2016-01-01

    Polyphosphoinositides (PPIns) are present in the nucleus where they participate in crucial nuclear processes, such as chromatin remodelling, transcription and mRNA processing. In a previous interactomics study, aimed to gain further insight into nuclear PPIns functions, we identified ErbB3 binding protein 1 (EBP1) as a potential nuclear PPIn-binding protein in a lipid pull-down screen. EBP1 is a ubiquitous and conserved protein, located in both the cytoplasm and nucleolus, and associated with cell proliferation and survival. In the present study, we show that EBP1 binds directly to several PPIns via two distinct PPIn-binding sites consisting of clusters of lysine residues and positioned at the N- and C-termini of the protein. Using interaction mutants, we show that the C-terminal PPIn-binding motif contributes the most to the localization of EBP1 in the nucleolus. Importantly, a K372N point mutation, located within the C-terminal motif and found in endometrial tumours, is sufficient to alter the nucleolar targeting of EBP1. Our study reveals also the presence of the class I phosphoinositide 3-kinase (PI3K) catalytic subunit p110β and its product PtdIns(3,4,5)P3 together with EBP1 in the nucleolus. Using NMR, we further demonstrate an association between EBP1 and PtdIns(3,4,5)P3 via both electrostatic and hydrophobic interactions. Taken together, these results show that EBP1 interacts directly with PPIns and associate with PtdIns(3,4,5)P3 in the nucleolus. The presence of p110β and PtdIns(3,4,5)P3 in the nucleolus indicates their potential role in regulating nucleolar processes, at least via EBP1. PMID:27118868

  13. Characterization of the high affinity binding of epsilon toxin from Clostridium perfringens to the renal system.

    PubMed

    Dorca-Arévalo, Jonatan; Martín-Satué, Mireia; Blasi, Juan

    2012-05-25

    Epsilon toxin (ε-toxin), produced by Clostridium perfringens types B and D, causes fatal enterotoxaemia in livestock. In the renal system, the toxin binds to target cells before oligomerization, pore formation and cell death. Still, there is little information about the cellular and molecular mechanism involved in the initial steps of the cytotoxic action of ε-toxin, including the specific binding to the target sensitive cells. In the present report, the binding step of ε-toxin to the MDCK cell line is characterized by means of an ELISA-based binding assay with recombinant ε-toxin-green fluorescence protein (ε-toxin-GFP) and ε-prototoxin-GFP. In addition, different treatments with Pronase E, detergents, N-glycosidase F and beta-elimination on MDCK cells and renal cryosections have been performed to further characterize the ε-toxin binding. The ELISA assays revealed a single binding site with a similar dissociation constant (K(d)) for ε-toxin-GFP and ε-prototoxin-GFP, but a three-fold increase in B(max) levels in the case of ε-toxin-GFP. Double staining on kidney cryoslices with lectins and ε-prototoxin-GFP revealed specific binding to distal and collecting tubule cells. In addition, experiments on kidney and bladder cryoslices demonstrated the specific binding to distal tubule of a range of mammalian renal systems. Pronase E and beta-elimination treatments on kidney cryoslices and MDCK cells revealed that the binding of ε-toxin in renal system is mediated by a O-glycoprotein. Detergent treatments revealed that the integrity of the plasma membrane is required for the binding of ε-toxin to its receptor. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. The amino acid motif L/IIxxFE defines a novel actin-binding sequence in PDZ-RhoGEF

    PubMed Central

    Banerjee, Jayashree; Fischer, Christopher C.; Wedegaertner, Philip B.

    2009-01-01

    PDZ-RhoGEF is a member of the regulator of G protein signaling (RGS) domain-containing RhoGEFs (RGS-RhoGEFs) that link activated heterotrimeric G protein α subunits of the G12 family to activation of the small GTPase RhoA. Unique among the RGS-RhoGEFs, PDZ-RhoGEF contains a short sequence that localizes the protein to the actin cytoskeleton. In this report, we demonstrate that the actin-binding domain, located between amino acids 561–585, directly binds to F-actin in vitro. Extensive mutagenesis identifies isoleucine 568, isoleucine 569, phenylalanine 572, and glutamic acid 573 as necessary for binding to actin and for co-localization with the actin cytoskeleton in cells. These results define a novel actin-binding sequence in PDZ-RhoGEF with a critical amino acid motif of IIxxFE. Moreover, sequence analysis identifies a similar actin-binding motif in the N-terminus of the RhoGEF frabin, and, as with PDZ-RhoGEF, mutagenesis and actin interaction experiments demonstrate a motif of LIxxFE, consisting of the key amino acids leucine 23, isoleucine 24, phenylalanine 27, and glutamic acid 28. Taken together, results with PDZ-RhoGEF and frabin identify a novel actin binding sequence. Lastly, inducible dimerization of the actin-binding region of PDZ-RhoGEF revealed a dimerization-dependent actin bundling activity in vitro. PDZ-RhoGEF exists in cells as a dimer, raising the possibility that PDZ-RhoGEF could influence actin structure independent of its ability to activate RhoA. PMID:19618964

  15. NF-{kappa}B p65 represses {beta}-catenin-activated transcription of cyclin D1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hwang, Injoo; Choi, Yong Seok; Jeon, Mi-Ya

    2010-12-03

    Research highlights: {yields} Cyclin D1 transcription is directly activated by {beta}-catenin; however, {beta}-catenin-induced cyclin D1 transcription is reduced by NF-{kappa}B p65. {yields} Protein-protein interaction between NF-{kappa}B p65 and {beta}-catenin might be responsible for p65-mediated repression of cyclin D1. {yields} One of five putative binding sites, located further upstream of other sites, is the major {beta}-catenin binding site in the cyclin D1 promoter. {yields} NF-{kappa}B binding site in cyclin D1 is occupied not only by p65 but also by {beta}-catenin, which is dynamically regulated by the signal. -- Abstract: Signaling crosstalk between the {beta}-catenin and NF-{kappa}B pathways represents a functional network.more » To test whether the crosstalk also occurs on their common target genes, the cyclin D1 promoter was used as a model because it contains binding sites for both proteins. {beta}-catenin activated transcription from the cyclin D1 promoter, while co-expression of NF-{kappa}B p65 reduced {beta}-catenin-induced transcription. Chromatin immunoprecipitation revealed lithium chloride-induced binding of {beta}-catenin on one of the T-cell activating factor binding sites. More interestingly, {beta}-catenin binding was greatly reduced by NF-{kappa}B p65, possibly by the protein-protein interaction between the two proteins. Such a dynamic and complex binding of {beta}-catenin and NF-{kappa}B on promoters might contribute to the regulated expression of their target genes.« less

  16. Sugar-binding and crystallographic studies of an arabinose-binding protein mutant (Met108Leu) that exhibits enhanced affinity and altered specificity.

    PubMed

    Vermersch, P S; Lemon, D D; Tesmer, J J; Quiocho, F A

    1991-07-16

    In addition to hydrogen bonds, van der Waals forces contribute to the affinity of protein-carbohydrate interactions. Nonpolar van der Waals contacts in the complexes of the L-arabinose-binding protein (ABP) with monosaccharides have been studied by means of site-directed mutagenesis, equilibrium and rapid kinetic binding techniques, and X-ray crystallography. ABP, a periplasmic transport receptor of Escherichia coli, binds L-arabinose, D-galactose, and D-fucose with preferential affinity in the order of Ara greater than Gal much greater than Fuc. Well-refined, high-resolution structures of ABP complexed with the three sugars revealed that the structural differences in the ABP-sugar complexes are localized around C5 of the sugars, where the equatorial H of Ara has been substituted for CH3 (Fuc) or CH2OH (Gal). The side chain of Met108 undergoes a sterically dictated, ligand-specific, conformational change to optimize nonpolar interactions between its methyl group and the sugar. We found that the Met108Leu ABP binds Gal tighter than wild-type ABP binds Ara and exhibits a preference for ligand in the order of Gal much greater than Fuc greater than Ara. The differences in affinity can be attributed to differences in the dissociation rates of the ABP-sugar complexes. We have refined at better than 1.7-A resolution the crystal structures of the Met108Leu ABP complexed with each of the sugars and offer a molecular explanation for the altered binding properties.

  17. Analysis of DNA binding by human factor xeroderma pigmentosum complementation group A (XPA) provides insight into its interactions with nucleotide excision repair substrates.

    PubMed

    Sugitani, Norie; Voehler, Markus W; Roh, Michelle S; Topolska-Woś, Agnieszka M; Chazin, Walter J

    2017-10-13

    Xeroderma pigmentosum (XP) complementation group A (XPA) is an essential scaffolding protein in the multiprotein nucleotide excision repair (NER) machinery. The interaction of XPA with DNA is a core function of this protein; a number of mutations in the DNA-binding domain (DBD) are associated with XP disease. Although structures of the central globular domain of human XPA and data on binding of DNA substrates have been reported, the structural basis for XPA's DNA-binding activity remains unknown. X-ray crystal structures of the central globular domain of yeast XPA (Rad14) with lesion-containing DNA duplexes have provided valuable insights, but the DNA substrates used for this study do not correspond to the substrates of XPA as it functions within the NER machinery. To better understand the DNA-binding activity of human XPA in NER, we used NMR to investigate the interaction of its DBD with a range of DNA substrates. We found that XPA binds different single-stranded/double-stranded junction DNA substrates with a common surface. Comparisons of our NMR-based mapping of binding residues with the previously reported Rad14-DNA crystal structures revealed similarities and differences in substrate binding between XPA and Rad14. This includes direct evidence for DNA contacts to the residues extending C-terminally from the globular core, which are lacking in the Rad14 construct. Moreover, mutation of the XPA residue corresponding to Phe-262 in Rad14, previously reported as being critical for DNA binding, had only a moderate effect on the DNA-binding activity of XPA. The DNA-binding properties of several disease-associated mutations in the DBD were investigated. These results suggest that for XPA mutants exhibiting altered DNA-binding properties, a correlation exists between the extent of reduction in DNA-binding affinity and the severity of symptoms in XP patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. A binding site for non-steroidal anti-inflammatory drugs in FAAH

    PubMed Central

    Bertolacci, Laura; Romeo, Elisa; Veronesi, Marina; Magotti, Paola; Albani, Clara; Dionisi, Mauro; Lambruschini, Chiara; Scarpelli, Rita; Cavalli, Andrea; Vivo, Marco De; Piomelli, Daniele; Garau, Gianpiero

    2013-01-01

    In addition to inhibiting the cyclooxygenasemediated biosynthesis of prostanoids, various widely used non-steroidal anti-inflammatory drugs (NSAIDs) enhance endocannabinoid signaling by blocking the anandamidedegrading membrane enzyme, fatty acid amide hydrolase (FAAH). The X-ray structure of FAAH in complex with the NSAID carprofen, along with studies of site-directed mutagenesis, enzyme activity assays, and nuclear magnetic resonance, now reveal the molecular details of this interaction, providing information that may guide the design of dual FAAH-cyclooxygenase inhibitors with superior analgesic efficacy. PMID:23240907

  19. Energy- and k -resolved mapping of the magnetic circular dichroism in threshold photoemission from Co films on Pt(111)

    NASA Astrophysics Data System (ADS)

    Staab, Maximilian; Kutnyakhov, Dmytro; Wallauer, Robert; Chernov, Sergey; Medjanik, Katerina; Elmers, Hans Joachim; Kläui, Mathias; Schönhense, Gerd

    2017-04-01

    The magnetic circular dichroism in threshold photoemission (TPMCD) for perpendicularly magnetized fcc Co films on Pt(111) has been revisited. A complete mapping of the spectral function I (EB,kx,ky) (binding energy EB, momentum parallel to surface kx, ky) and the corresponding TPMCD asymmetry distribution AMCD(EB,kx,ky) has been performed for one-photon and two-photon photoemission using time-of-flight momentum microscopy. The experimental results allow distinguishing direct from indirect transitions. The measurements reveal clear band features of direct transitions from bulk bands that show a nontrivial asymmetry pattern. A significant homogeneous background with substantial asymmetry stemming from indirect transitions superposes direct transitions. Two-photon photoemission reveals enhanced emission intensity via an image potential state, acting as intermediate state. The image potential state enhances not only intensity but also asymmetry. The present results demonstrate that two-photon photoemission is a powerful method for mapping the spin-polarized unoccupied band structures and points out pathways for applying TPMCD as a contrast mechanism for various classes of magnetic materials.

  20. Integrative genome-wide analysis reveals HLP1, a novel RNA-binding protein, regulates plant flowering by targeting alternative polyadenylation

    PubMed Central

    Zhang, Yong; Gu, Lianfeng; Hou, Yifeng; Wang, Lulu; Deng, Xian; Hang, Runlai; Chen, Dong; Zhang, Xiansheng; Zhang, Yi; Liu, Chunyan; Cao, Xiaofeng

    2015-01-01

    Alternative polyadenylation (APA) is a widespread mechanism for gene regulation and has been implicated in flowering, but the molecular basis governing the choice of a specific poly(A) site during the vegetative-to-reproductive growth transition remains unclear. Here we characterize HLP1, an hnRNP A/B protein as a novel regulator for pre-mRNA 3′-end processing in Arabidopsis. Genetic analysis reveals that HLP1 suppresses Flowering Locus C (FLC), a key repressor of flowering in Arabidopsis. Genome-wide mapping of HLP1-RNA interactions indicates that HLP1 binds preferentially to A-rich and U-rich elements around cleavage and polyadenylation sites, implicating its role in 3′-end formation. We show HLP1 is significantly enriched at transcripts involved in RNA metabolism and flowering. Comprehensive profiling of the poly(A) site usage reveals that HLP1 mutations cause thousands of poly(A) site shifts. A distal-to-proximal poly(A) site shift in the flowering regulator FCA, a direct target of HLP1, leads to upregulation of FLC and delayed flowering. Our results elucidate that HLP1 is a novel factor involved in 3′-end processing and controls reproductive timing via targeting APA. PMID:26099751

  1. Crystal structure and biochemical characterization of beta-keto thiolase B from polyhydroxyalkanoate-producing bacterium Ralstonia eutropha H16

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Eun-Jung; Son, Hyeoncheol Francis; Kim, Sangwoo

    Highlights: • We determined a crystal structure of β-keto thiolase from Ralstonia eutropha H16 (ReBktB). • Distinct substrate binding mode ReBktB was elucidated. • Enzymatic kinetic parameters of ReBktB were revealed. - Abstract: ReBktB is a β-keto thiolase from Ralstonia eutropha H16 that catalyzes condensation reactions between acetyl-CoA with acyl-CoA molecules that contains different numbers of carbon atoms, such as acetyl-CoA, propionyl-CoA, and butyryl-CoA, to produce valuable bioproducts, such as polyhydroxybutyrate, polyhydroxybutyrate-hydroxyvalerate, and hexanoate. We solved a crystal structure of ReBktB at 2.3 Å, and the overall structure has a similar fold to that of type II biosynthetic thiolases, suchmore » as PhbA from Zoogloea ramigera (ZrPhbA). The superposition of this structure with that of ZrPhbA complexed with CoA revealed the residues that comprise the catalytic and substrate binding sites of ReBktB. The catalytic site of ReBktB contains three conserved residues, Cys90, His350, and Cys380, which may function as a covalent nucleophile, a general base, and second nucleophile, respectively. For substrate binding, ReBktB stabilized the ADP moiety of CoA in a distinct way compared to ZrPhbA with His219, Arg221, and Asp228 residues, whereas the stabilization of β-mercaptoethyamine and pantothenic acid moieties of CoA was quite similar between these two enzymes. Kinetic study of ReBktB revealed that K{sub m}, V{sub max}, and K{sub cat} values of 11.58 μM, 1.5 μmol/min, and 102.18 s{sup −1}, respectively, and the catalytic and substrate binding sites of ReBktB were further confirmed by site-directed mutagenesis experiments.« less

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Mi; University of Chinese Academy of Sciences, Beijing 100049; Liu, Lianqing, E-mail: lqliu@sia.cn

    Highlights: •Nanoscale cellular ultra-structures of macrophages were observed. •The binding affinities of FcγRs were measured directly on macrophages. •The nanoscale distributions of FcγRs were mapped on macrophages. -- Abstract: Fc gamma receptors (FcγR), widely expressed on effector cells (e.g., NK cells, macrophages), play an important role in clinical cancer immunotherapy. The binding of FcγRs to the Fc portions of antibodies that are attached to the target cells can activate the antibody-dependent cell-mediated cytotoxicity (ADCC) killing mechanism which leads to the lysis of target cells. In this work, we used atomic force microscopy (AFM) to observe the cellular ultra-structures and measuremore » the biophysical properties (affinity and distribution) of FcγRs on single macrophages in aqueous environments. AFM imaging was used to obtain the topographies of macrophages, revealing the nanoscale cellular fine structures. For molecular interaction recognition, antibody molecules were attached onto AFM tips via a heterobifunctional polyethylene glycol (PEG) crosslinker. With AFM single-molecule force spectroscopy, the binding affinities of FcγRs were quantitatively measured on single macrophages. Adhesion force mapping method was used to localize the FcγRs, revealing the nanoscale distribution of FcγRs on local areas of macrophages. The experimental results can improve our understanding of FcγRs on macrophages; the established approach will facilitate further research on physiological activities involved in antibody-based immunotherapy.« less

  3. Interaction of S17 Antibody with the Functional Binding Region of the Hepatitis B Virus Pre-S2 Epitope.

    PubMed

    Chang, Chang-Yu; Chang, Fu-Ling; Chiang, Chen-Wei; Lo, Yan-Ni; Lin, Tsai-Yu; Chen, Wang-Chuan; Tsai, Keng-Chang; Lee, Yu-Ching

    2018-05-30

    To understand the mechanism for inhibition of hepatitis B virus (HBV) infection is important. In this study, single-chain variable fragment (scFv) antibodies were generated and directed to the pre-S2 epitope of HBV surface antigen (HBsAg). These human scFvs were isolated from a person with history of HBV infection by phage display technology. An evaluation of panning efficiency revealed that the eluted phage titer was increased, indicating that specific clones were enriched after panning. Selected scFvs were characterized with the recombinant HBsAg through Western blotting and enzyme-linked immunosorbent assay to confirm the binding ability. Flow cytometry analysis and immunocytochemical staining revealed that one scFv, S17, could recognize endogenous HBsAg expressed on the HepG2215 cell membrane. Moreover, the binding affinity of scFv S17 to the pre-S2 epitope was determined to be 4.2 × 10 -8 M. Two ion interactions were observed as the major driving forces for scFv S17 interacting with pre-S2 by performing a rational molecular docking analysis. This study provides insights into the structural basis to understand the interactions between an antibody and the pre-S2 epitope. The functional scFv format can potentially be used in future immunotherapeutic applications.

  4. Selenium nanoparticles synthesized in aqueous extract of Allium sativum perturbs the structural integrity of Calf thymus DNA through intercalation and groove binding.

    PubMed

    Ezhuthupurakkal, Preedia Babu; Polaki, Lokeswara Rao; Suyavaran, Arumugam; Subastri, Ariraman; Sujatha, Venugopal; Thirunavukkarasu, Chinnasamy

    2017-05-01

    Biomedical application of selenium nanoparticles (SeNPs) demands the eco-friendly composite for synthesis of SeNPs. The present study reports an aqueous extract of Allium sativum (AqEAS) plug-up the current need. Modern spectroscopic, microscopic and gravimetric techniques were employed to characterize the synthesized nanoparticles. Characterization studies revealed the formation of crystalline spherical shaped SeNPs. FTIR spectrum brings out the presence of different functional groups in AqEAS, which influence the SeNPs formation and stabilization. Furthermore the different aspects of the interaction between SeNPs and CT-DNA were scrutinized by various spectroscopic and cyclic voltametric studies. The results reveals the intercalation and groove binding mode of interaction of SeNPs with stacked base pair of CT-DNA. The Stern-Volmer quenching constant (K SV ) were found to be 7.02×10 6 M- 1 (ethidium bromide), 4.22×10 6 M- 1 (acridine orange) and 7.6×10 6 M- 1 (Hoechst) indicating strong binding of SeNPs with CT-DNA. The SeNPs - CT-DNA interactions were directly visualized by atomic force microscopy. The present study unveils the cost effective, innocuous, highly stable SeNPs intricate mechanism of DNA interaction, which will be a milestone in DNA targeted chemotherapy. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Evidence for halogen bond covalency in acyclic and interlocked halogen-bonding receptor anion recognition

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Robinson, Sean W.; Mustoe, Chantal L.; White, Nicholas G.

    The synthesis and anion binding properties of novel halogen-bonding (XB) bis-iodotriazole-pyridinium-containing acyclic and [2]catenane anion host systems are described. The XB acyclic receptor displays selectivity for acetate over halides with enhanced anion recognition properties compared to the analogous hydrogen-bonding (HB) acyclic receptor. A reversal in halide selectivity is observed in the XB [2]catenane, in comparison to the acyclic XB receptor, due to the interlocked host’s unique three-dimensional binding cavity, and no binding is observed for oxoanions. Notable halide anion association constant values determined for the [2]catenane in competitive organic–aqueous solvent mixtures demonstrate considerable enhancement of anion recognition as compared tomore » the HB catenane analogue. X-ray crystallographic analysis of a series of halide catenane complexes reveal strong XB interactions in the solid state. These interactions were studied using Cl and Br K-edge X-ray Absorption Spectroscopy (XAS) indicating intense pre-edge features characteristic of charge transfer from the halide to its bonding partner (σ AX←X–* ← X1s), and providing a direct measure of the degree of covalency in the halogen bond(s). Lastly, the data reveal that the degree of covalency is similar to that which is observed in transition metal coordinate covalent bonds. These results are supported by DFT results, which correlate well with the experimental data.« less

  6. Evidence for halogen bond covalency in acyclic and interlocked halogen-bonding receptor anion recognition

    DOE PAGES

    Robinson, Sean W.; Mustoe, Chantal L.; White, Nicholas G.; ...

    2014-12-05

    The synthesis and anion binding properties of novel halogen-bonding (XB) bis-iodotriazole-pyridinium-containing acyclic and [2]catenane anion host systems are described. The XB acyclic receptor displays selectivity for acetate over halides with enhanced anion recognition properties compared to the analogous hydrogen-bonding (HB) acyclic receptor. A reversal in halide selectivity is observed in the XB [2]catenane, in comparison to the acyclic XB receptor, due to the interlocked host’s unique three-dimensional binding cavity, and no binding is observed for oxoanions. Notable halide anion association constant values determined for the [2]catenane in competitive organic–aqueous solvent mixtures demonstrate considerable enhancement of anion recognition as compared tomore » the HB catenane analogue. X-ray crystallographic analysis of a series of halide catenane complexes reveal strong XB interactions in the solid state. These interactions were studied using Cl and Br K-edge X-ray Absorption Spectroscopy (XAS) indicating intense pre-edge features characteristic of charge transfer from the halide to its bonding partner (σ AX←X–* ← X1s), and providing a direct measure of the degree of covalency in the halogen bond(s). Lastly, the data reveal that the degree of covalency is similar to that which is observed in transition metal coordinate covalent bonds. These results are supported by DFT results, which correlate well with the experimental data.« less

  7. Binding of DNA-binding alkaloids berberine and palmatine to tRNA and comparison to ethidium: Spectroscopic and molecular modeling studies

    NASA Astrophysics Data System (ADS)

    Islam, Md. Maidul; Pandya, Prateek; Chowdhury, Sebanti Roy; Kumar, Surat; Kumar, Gopinatha Suresh

    2008-11-01

    The interaction of two natural protoberberine plant alkaloids berberine and palmatine with tRNA phe was studied using various biophysical techniques and molecular modeling and the data were compared with the binding of the classical DNA intercalator, ethidium. Circular dichroic studies revealed that the tRNA conformation was moderately perturbed on binding of the alkaloids. The cooperative binding of both the alkaloids and ethidium to tRNA was revealed from absorbance and fluorescence studies. Fluorescence quenching studies advanced a conclusion that while berberine and palmatine are partially intercalated, ethidium is fully intercalated on the tRNA molecule. The binding of the alkaloids as well as ethidium stabilized the tRNA melting, and the binding constant evaluated from the averaged optical melting temperature data was in agreement with fluorescence spectral-binding data. Differential scanning calorimetry revealed that the tRNA melting showed three close transitions that were affected on binding of these small molecules. Molecular docking calculations performed showed the preferred regions of binding of these small molecules on the tRNA. Taken together, the results suggest that the binding of the alkaloids berberine and palmatine on the tRNA structure appears to be mostly by partial intercalation while ethidium intercalates fully on the tRNA. These results further advance our knowledge on the molecular aspects on the interaction of these alkaloids to tRNA.

  8. Binding of PLD2-Generated Phosphatidic Acid to KIF5B Promotes MT1-MMP Surface Trafficking and Lung Metastasis of Mouse Breast Cancer Cells.

    PubMed

    Wang, Ziqing; Zhang, Feng; He, Jingquan; Wu, Ping; Tay, Li Wei Rachel; Cai, Ming; Nian, Weiqi; Weng, Yuanyuan; Qin, Li; Chang, Jeffrey T; McIntire, Laura B; Di Paolo, Gilbert; Xu, Jianming; Peng, Junmin; Du, Guangwei

    2017-10-23

    Little is known about the cellular events promoting metastasis. We show that knockout of phospholipase D 2 (PLD2), which generates the signaling lipid phosphatidic acid (PA), inhibits lung metastases in the mammary tumor virus (MMTV)-Neu transgenic mouse breast cancer model. PLD2 promotes local invasion through the regulation of the plasma membrane targeting of MT1-MMP and its associated invadopodia. A liposome pull-down screen identifies KIF5B, the heavy chain of the motor protein kinesin-1, as a new PA-binding protein. In vitro assays reveal that PA specifically and directly binds to the C terminus of KIF5B. The binding between PLD2-generated PA and KIF5B is required for the vesicular association of KIF5B, surface localization of MT1-MMP, invadopodia, and invasion in cancer cells. Taken together, these results identify a role of PLD2-generated PA in the regulation of kinesin-1 motor functions and breast cancer metastasis and suggest PLD2 as a potential therapeutic target for metastatic breast cancer. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Domain wise docking analyses of the modular chitin binding protein CBP50 from Bacillus thuringiensis serovar konkukian S4.

    PubMed

    Sehar, Ujala; Mehmood, Muhammad Aamer; Hussain, Khadim; Nawaz, Salman; Nadeem, Shahid; Siddique, Muhammad Hussnain; Nadeem, Habibullah; Gull, Munazza; Ahmad, Niaz; Sohail, Iqra; Gill, Saba Shahid; Majeed, Summera

    2013-01-01

    This paper presents an in silico characterization of the chitin binding protein CBP50 from B. thuringiensis serovar konkukian S4 through homology modeling and molecular docking. The CBP50 has shown a modular structure containing an N-terminal CBM33 domain, two consecutive fibronectin-III (Fn-III) like domains and a C-terminal CBM5 domain. The protein presented a unique modular structure which could not be modeled using ordinary procedures. So, domain wise modeling using MODELLER and docking analyses using Autodock Vina were performed. The best conformation for each domain was selected using standard procedure. It was revealed that four amino acid residues Glu-71, Ser-74, Glu-76 and Gln-90 from N-terminal domain are involved in protein-substrate interaction. Similarly, amino acid residues Trp-20, Asn-21, Ser-23 and Val-30 of Fn-III like domains and Glu-15, Ala-17, Ser-18 and Leu-35 of C-terminal domain were involved in substrate binding. Site-directed mutagenesis of these proposed amino acid residues in future will elucidate the key amino acids involved in chitin binding activity of CBP50 protein.

  10. Characterization of the Saccharomyces cerevisiae ATP-Interactome using the iTRAQ-SPROX Technique

    NASA Astrophysics Data System (ADS)

    Geer, M. Ariel; Fitzgerald, Michael C.

    2016-02-01

    The stability of proteins from rates of oxidation (SPROX) technique was used in combination with an isobaric mass tagging strategy to identify adenosine triphosphate (ATP) interacting proteins in the Saccharomyces cerevisiae proteome. The SPROX methodology utilized in this work enabled 373 proteins in a yeast cell lysate to be assayed for ATP interactions (both direct and indirect) using the non-hydrolyzable ATP analog, adenylyl imidodiphosphate (AMP-PNP). A total of 28 proteins were identified with AMP-PNP-induced thermodynamic stability changes. These protein hits included 14 proteins that were previously annotated as ATP-binding proteins in the Saccharomyces Genome Database (SGD). The 14 non-annotated ATP-binding proteins included nine proteins that were previously found to be ATP-sensitive in an earlier SPROX study using a stable isotope labeling with amino acids in cell culture (SILAC)-based approach. A bioinformatics analysis of the protein hits identified here and in the earlier SILAC-SPROX experiments revealed that many of the previously annotated ATP-binding protein hits were kinases, ligases, and chaperones. In contrast, many of the newly discovered ATP-sensitive proteins were not from these protein classes, but rather were hydrolases, oxidoreductases, and nucleic acid-binding proteins.

  11. Rce1, a novel transcriptional repressor, regulates cellulase gene expression by antagonizing the transactivator Xyr1 in Trichoderma reesei.

    PubMed

    Cao, Yanli; Zheng, Fanglin; Wang, Lei; Zhao, Guolei; Chen, Guanjun; Zhang, Weixin; Liu, Weifeng

    2017-07-01

    Cellulase gene expression in the model cellulolytic fungus Trichoderma reesei is supposed to be controlled by an intricate regulatory network involving multiple transcription factors. Here, we identified a novel transcriptional repressor of cellulase gene expression, Rce1. Disruption of the rce1 gene not only facilitated the induced expression of cellulase genes but also led to a significant delay in terminating the induction process. However, Rce1 did not participate in Cre1-mediated catabolite repression. Electrophoretic mobility shift (EMSA) and DNase I footprinting assays in combination with chromatin immunoprecipitation (ChIP) demonstrated that Rce1 could bind directly to a cbh1 (cellobiohydrolase 1-encoding) gene promoter region containing a cluster of Xyr1 binding sites. Furthermore, competitive binding assays revealed that Rce1 antagonized Xyr1 from binding to the cbh1 promoter. These results indicate that intricate interactions exist between a variety of transcription factors to ensure tight and energy-efficient regulation of cellulase gene expression in T. reesei. This study also provides important clues regarding increased cellulase production in T. reesei. © 2017 John Wiley & Sons Ltd.

  12. A comparison of the effect of lead nitrate on rat liver chromatin, DNA and histone proteins in solution.

    PubMed

    Rabbani-Chadegani, Azra; Abdosamadi, Sayeh; Fani, Nesa; Mohammadian, Shayesteh

    2009-06-01

    Although lead is widely recognized as a toxic substance in the environment and directly damage DNA, no studies are available on lead interaction with chromatin and histone proteins. In this work, we have examined the effect of lead nitrate on EDTA-soluble chromatin (SE chromatin), DNA and histones in solution using absorption and fluorescence spectroscopy, thermal denaturation and gel electrophoresis techniques. The results demonstrate that lead nitrate binds with higher affinity to chromatin than to DNA and produces an insoluble complex as monitored at 400 nm. Binding of lead to DNA decreases its Tm, increases its fluorescence intensity and exhibits hypochromicity at 210 nm which reveal that both DNA bases and the backbone participate in the lead-DNA interaction. Lead also binds strongly to histone proteins in the absence of DNA. The results suggest that although lead destabilizes DNA structure, in the chromatin, the binding of lead introduces some sort of compaction and aggregation, and the histone proteins play a key role in this aspect. This chromatin condensation, upon lead exposure, in turn may decrease fidelity of DNA, and inhibits DNA and RNA synthesis, the process that introduces lead toxicity at the chromatin level.

  13. The actinobacterial transcription factor RbpA binds to the principal sigma subunit of RNA polymerase

    PubMed Central

    Tabib-Salazar, Aline; Liu, Bing; Doughty, Philip; Lewis, Richard A.; Ghosh, Somadri; Parsy, Marie-Laure; Simpson, Peter J.; O’Dwyer, Kathleen; Matthews, Steve J.; Paget, Mark S.

    2013-01-01

    RbpA is a small non–DNA-binding transcription factor that associates with RNA polymerase holoenzyme and stimulates transcription in actinobacteria, including Streptomyces coelicolor and Mycobacterium tuberculosis. RbpA seems to show specificity for the vegetative form of RNA polymerase as opposed to alternative forms of the enzyme. Here, we explain the basis of this specificity by showing that RbpA binds directly to the principal σ subunit in these organisms, but not to more diverged alternative σ factors. Nuclear magnetic resonance spectroscopy revealed that, although differing in their requirement for structural zinc, the RbpA orthologues from S. coelicolor and M. tuberculosis share a common structural core domain, with extensive, apparently disordered, N- and C-terminal regions. The RbpA–σ interaction is mediated by the C-terminal region of RbpA and σ domain 2, and S. coelicolor RbpA mutants that are defective in binding σ are unable to stimulate transcription in vitro and are inactive in vivo. Given that RbpA is essential in M. tuberculosis and critical for growth in S. coelicolor, these data support a model in which RbpA plays a key role in the σ cycle in actinobacteria. PMID:23605043

  14. Dispersion of single-wall carbon nanotubes with supramolecular Congo red - properties of the complexes and mechanism of the interaction.

    PubMed

    Jagusiak, Anna; Piekarska, Barbara; Pańczyk, Tomasz; Jemioła-Rzemińska, Małgorzata; Bielańska, Elżbieta; Stopa, Barbara; Zemanek, Grzegorz; Rybarska, Janina; Roterman, Irena; Konieczny, Leszek

    2017-01-01

    A method of dispersion of single-wall carbon nanotubes (SWNTs) in aqueous media using Congo red (CR) is proposed. Nanotubes covered with CR constitute the high capacity system that provides the possibility of binding and targeted delivery of different drugs, which can intercalate into the supramolecular, ribbon-like CR structure. The study revealed the presence of strong interactions between CR and the surface of SWNTs. The aim of the study was to explain the mechanism of this interaction. The interaction of CR and carbon nanotubes was studied using spectral analysis of the SWNT-CR complex, dynamic light scattering (DLS), differential scanning calorimetry (DSC) and microscopic methods: atomic force microscopy (AFM), transmission (TEM), scanning (SEM) and optical microscopy. The results indicate that the binding of supramolecular CR structures to the surface of the nanotubes is based on the "face to face stacking". CR molecules attached directly to the surface of the nanotubes can bind further, parallel-oriented molecules and form supramolecular and protruding structures. This explains the high CR binding capacity of carbon nanotubes. The presented system - containing SWNTs covered with CR - offers a wide range of biomedical applications.

  15. Predicting DNA binding proteins using support vector machine with hybrid fractal features.

    PubMed

    Niu, Xiao-Hui; Hu, Xue-Hai; Shi, Feng; Xia, Jing-Bo

    2014-02-21

    DNA-binding proteins play a vitally important role in many biological processes. Prediction of DNA-binding proteins from amino acid sequence is a significant but not fairly resolved scientific problem. Chaos game representation (CGR) investigates the patterns hidden in protein sequences, and visually reveals previously unknown structure. Fractal dimensions (FD) are good tools to measure sizes of complex, highly irregular geometric objects. In order to extract the intrinsic correlation with DNA-binding property from protein sequences, CGR algorithm, fractal dimension and amino acid composition are applied to formulate the numerical features of protein samples in this paper. Seven groups of features are extracted, which can be computed directly from the primary sequence, and each group is evaluated by the 10-fold cross-validation test and Jackknife test. Comparing the results of numerical experiments, the group of amino acid composition and fractal dimension (21-dimension vector) gets the best result, the average accuracy is 81.82% and average Matthew's correlation coefficient (MCC) is 0.6017. This resulting predictor is also compared with existing method DNA-Prot and shows better performances. © 2013 The Authors. Published by Elsevier Ltd All rights reserved.

  16. An Amphipathic Helix Directs Cellular Membrane Curvature Sensing and Function of the BAR Domain Protein PICK1.

    PubMed

    Herlo, Rasmus; Lund, Viktor K; Lycas, Matthew D; Jansen, Anna M; Khelashvili, George; Andersen, Rita C; Bhatia, Vikram; Pedersen, Thomas S; Albornoz, Pedro B C; Johner, Niklaus; Ammendrup-Johnsen, Ina; Christensen, Nikolaj R; Erlendsson, Simon; Stoklund, Mikkel; Larsen, Jannik B; Weinstein, Harel; Kjærulff, Ole; Stamou, Dimitrios; Gether, Ulrik; Madsen, Kenneth L

    2018-05-15

    BAR domains are dimeric protein modules that sense, induce, and stabilize lipid membrane curvature. Here, we show that membrane curvature sensing (MCS) directs cellular localization and function of the BAR domain protein PICK1. In PICK1, and the homologous proteins ICA69 and arfaptin2, we identify an amphipathic helix N-terminal to the BAR domain that mediates MCS. Mutational disruption of the helix in PICK1 impaired MCS without affecting membrane binding per se. In insulin-producing INS-1E cells, super-resolution microscopy revealed that disruption of the helix selectively compromised PICK1 density on insulin granules of high curvature during their maturation. This was accompanied by reduced hormone storage in the INS-1E cells. In Drosophila, disruption of the helix compromised growth regulation. By demonstrating size-dependent binding on insulin granules, our finding highlights the function of MCS for BAR domain proteins in a biological context distinct from their function, e.g., at the plasma membrane during endocytosis. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  17. Mg2+ -Dependent High Mechanical Anisotropy of Three-Way-Junction pRNA as Revealed by Single-Molecule Force Spectroscopy.

    PubMed

    Sun, Yang; Di, Weishuai; Li, Yiran; Huang, Wenmao; Wang, Xin; Qin, Meng; Wang, Wei; Cao, Yi

    2017-08-01

    Mechanical anisotropy is ubiquitous in biological tissues but is hard to reproduce in synthetic biomaterials. Developing molecular building blocks with anisotropic mechanical response is the key towards engineering anisotropic biomaterials. The three-way-junction (3WJ) pRNA, derived from ϕ29 DNA packaging motor, shows strong mechanical anisotropy upon Mg 2+ binding. In the absence of Mg 2+ , 3WJ-pRNA is mechanically weak without noticeable mechanical anisotropy. In the presence of Mg 2+ , the unfolding forces can differ by more than 4-fold along different pulling directions, ranging from about 47 pN to about 219 pN. Mechanical anisotropy of 3WJ-pRNA stems from pulling direction dependent cooperativity for the rupture of two Mg 2+ binding sites, which is a novel mechanism for the mechanical anisotropy of biomacromolecules. It is anticipated that 3WJ-pRNA can be used as a key element for the construction of biomaterials with controllable mechanical anisotropy. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Comprehensive Identification of RNA-Binding Proteins by RNA Interactome Capture.

    PubMed

    Castello, Alfredo; Horos, Rastislav; Strein, Claudia; Fischer, Bernd; Eichelbaum, Katrin; Steinmetz, Lars M; Krijgsveld, Jeroen; Hentze, Matthias W

    2016-01-01

    RNA associates with RNA-binding proteins (RBPs) from synthesis to decay, forming dynamic ribonucleoproteins (RNPs). In spite of the preeminent role of RBPs regulating RNA fate, the scope of cellular RBPs has remained largely unknown. We have recently developed a novel and comprehensive method to identify the repertoire of active RBPs of cultured cells, called RNA interactome capture. Using in vivo UV cross-linking on cultured cells, proteins are covalently bound to RNA if the contact between the two is direct ("zero distance"). Protein-RNA complexes are purified by poly(A) tail-dependent oligo(dT) capture and analyzed by quantitative mass spectrometry. Because UV irradiation is applied to living cells and purification is performed using highly stringent washes, RNA interactome capture identifies physiologic and direct protein-RNA interactions. Applied to HeLa cells, this protocol revealed the near-complete repertoire of RBPs, including hundreds of novel RNA binders. Apart from its RBP discovery capacity, quantitative and comparative RNA interactome capture can also be used to study the responses of the RBP repertoire to different physiological cues and processes, including metabolic stress, differentiation, development, or the response to drugs.

  19. The Scaffold Protein TANK/I-TRAF Inhibits NF-κB Activation by Recruiting Polo-like Kinase 1

    PubMed Central

    Zhang, Wanqiao; Zhang, Ying; Yuan, Yanzhi; Guan, Wei; Jin, Chaozhi; Chen, Hui; Wang, Xiaohui

    2010-01-01

    TANK/I-TRAF is a TRAF-binding protein that negatively regulates NF-κB activation. The underlying mechanism of this activity remains unclear. Here we show that TANK directly interacts with PLK1, a conserved cell cycle–regulated kinase. PLK1 inhibits NF-κB transcriptional activation induced by TNF-α, IL-1β, or several activators, but not by nuclear transcription factor p65. PLK1 expression reduces the DNA-binding activity of NF-κB induced by TNF-α. Moreover, endogenous activation of PLK1 reduces the TNF-induced phosphorylation of endogenous IκBα. PLK1 is bound to NEMO (IKKγ) through TANK to form a ternary complex in vivo. We describe a new regulatory mechanism for PLK1: PLK1 negatively regulates TNF-induced IKK activation by inhibiting the ubiquitination of NEMO. These findings reveal that the scaffold protein TANK recruits PLK1 to negatively regulate NF-κB activation and provide direct evidence that PLK1 is required for the repression function of TANK. PMID:20484576

  20. Comparison of techniques of detecting immunoglobulin-binding protein reactivity to immunoglobulin produced by different avian and mammalian species.

    PubMed

    Justiz-Vaillant, A A; Akpaka, P E; McFarlane-Anderson, N; Smikle, M F

    2013-01-01

    The rationale of this study was to use several immunological assays to investigate the reactivity of immunoglobulin binding protein (IBP) to immunoglobulins from various avian and mammalian species. The IBP studied were Staphylococcal protein A (SpA), Streptococcal protein G (SpG), Peptostreptococcal protein L (SpL) and recombinant protein LA (SpLA). The various immunological techniques used were double immunodiffusion (Ouchterlony technique) that tested positive high protein reactivities, direct and competitive enzyme-linked immunosorbent assays (ELISAs) that tested moderate and low positive protein binding capacities, respectively. In addition to sandwich ELISAs, immunoblot analyses and Ig-purification by SpA-affinity chromatography, which were sensitive tests and helpful in the screening and confirmatory tests were also used. The Ouchterlony technique showed that compared to the other proteins, SpLA had the highest range of reactivity with animal sera and purified immunoglobulins while SpL was least reactive. With the direct ELISA, SpL reacted with the raccoon sera, rabbit IgG and with IgY from bantam hens and pigeons. While with the direct ELISA, SpA reacted with sera from skunk, coyote, raccoon, mule, donkey and human. The sandwich ELISA revealed high reactivity of both SpG and SpLA with mammalian sera titres ranging from 1:32 (raccoon serum) to 1:1024 (mule and donkey sera). These results suggest that IBP can be used for the detection of immunoglobulin using various immunological assays and this is important for the diagnosis of infectious diseases in animal and bird populations studied and in the purification of immunoglobulins.

  1. Different mechanisms are involved in the antibody mediated inhibition of ligand binding to the urokinase receptor: a study based on biosensor technology.

    PubMed

    List, K; Høyer-Hansen, G; Rønne, E; Danø, K; Behrendt, N

    1999-01-01

    Certain monoclonal antibodies are capable of inhibiting the biological binding reactions of their target proteins. At the molecular level, this type of effect may be brought about by completely different mechanisms, such as competition for common binding determinants, steric hindrance or interference with conformational properties of the receptor critical for ligand binding. This distinction is central when employing the antibodies as tools in the elucidation of the structure-function relationship of the protein in question. We have studied the effect of monoclonal antibodies against the urokinase plasminogen activator receptor (uPAR), a protein located on the surface of various types of malignant and normal cells which is involved in the direction of proteolytic degradation reactions in the extracellular matrix. We show that surface plasmon resonance/biomolecular interaction analysis (BIA) can be employed as a highly useful tool to characterize the inhibitory mechanism of specific antagonist antibodies. Two inhibitory antibodies against uPAR, mAb R3 and mAb R5, were shown to exhibit competitive and non-competitive inhibition, respectively, of ligand binding to the receptor. The former antibody efficiently blocked the receptor against subsequent ligand binding but was unable to promote the dissociation of a preformed receptor-ligand complex. The latter antibody was capable of binding the preformed complex, forming a transient trimolecular assembly, and promoting the dissociation of the uPA/uPAR complex. The continuous recording of binding and dissociation, obtained in BIA, is central in characterizing these phenomena. The identification of a non-competitive inhibitory mechanism against this receptor reveals the presence of a determinant which influences the binding properties of a remote site in the molecular structure and which could be an important target for a putative synthetic antagonist.

  2. Molecular Control of Polyene Macrolide Biosynthesis

    PubMed Central

    Santos-Aberturas, Javier; Vicente, Cláudia M.; Guerra, Susana M.; Payero, Tamara D.; Martín, Juan F.; Aparicio, Jesús F.

    2011-01-01

    Control of polyene macrolide production in Streptomyces natalensis is mediated by the transcriptional activator PimM. This regulator, which combines an N-terminal PAS domain with a C-terminal helix-turn-helix motif, is highly conserved among polyene biosynthetic gene clusters. PimM, truncated forms of the protein without the PAS domain (PimMΔPAS), and forms containing just the DNA-binding domain (DBD) (PimMDBD) were overexpressed in Escherichia coli as GST-fused proteins. GST-PimM binds directly to eight promoters of the pimaricin cluster, as demonstrated by electrophoretic mobility shift assays. Assays with truncated forms of the protein revealed that the PAS domain does not mediate specificity or the distinct recognition of target genes, which rely on the DBD domain, but significantly reduces binding affinity up to 500-fold. Transcription start points were identified by 5′-rapid amplification of cDNA ends, and the binding regions of PimMDBD were investigated by DNase I protection studies. In all cases, binding took place covering the −35 hexamer box of each promoter, suggesting an interaction of PimM and RNA polymerase to cause transcription activation. Information content analysis of the 16 sequences protected in target promoters was used to deduce the structure of the PimM-binding site. This site displays dyad symmetry, spans 14 nucleotides, and adjusts to the consensus TVGGGAWWTCCCBA. Experimental validation of this binding site was performed by using synthetic DNA duplexes. Binding of PimM to the promoter region of one of the polyketide synthase genes from the Streptomyces nodosus amphotericin cluster containing the consensus binding site was also observed, thus proving the applicability of the findings reported here to other antifungal polyketides. PMID:21187288

  3. Direct Binding of the Corrector VX-809 to Human CFTR NBD1: Evidence of an Allosteric Coupling between the Binding Site and the NBD1:CL4 Interface.

    PubMed

    Hudson, Rhea P; Dawson, Jennifer E; Chong, P Andrew; Yang, Zhengrong; Millen, Linda; Thomas, Philip J; Brouillette, Christie G; Forman-Kay, Julie D

    2017-08-01

    Understanding the mechanism of action of modulator compounds for the cystic fibrosis transmembrane conductance regulator (CFTR) is key for the optimization of therapeutics as well as obtaining insights into the molecular mechanisms of CFTR function. We demonstrate the direct binding of VX-809 to the first nucleotide-binding domain (NBD1) of human CFTR. Disruption of the interaction between C-terminal helices and the NBD1 core upon VX-809 binding is observed from chemical shift changes in the NMR spectra of residues in the helices and on the surface of β -strands S3, S9, and S10. Binding to VX-809 leads to a significant negative shift in NBD1 thermal melting temperature (T m ), pointing to direct VX-809 interaction shifting the NBD1 conformational equilibrium. An inter-residue correlation analysis of the chemical shift changes provides evidence of allosteric coupling between the direct binding site and the NBD1:CL4 interface, thus enabling effects on the interface in the absence of direct binding in that location. These NMR binding data and the negative T m shifts are very similar to those previously reported by us for binding of the dual corrector-potentiator CFFT-001 to NBD1 (Hudson et al., 2012), suggesting that the two compounds may share some aspects of their mechanisms of action. Although previous studies have shown an important role for VX-809 in modulating the conformation of the first membrane spanning domain (Aleksandrov et al., 2012; Ren et al., 2013), this additional mode of VX-809 binding provides insight into conformational dynamics and allostery within CFTR. Copyright © 2017 by The Author(s).

  4. Novel Scabies Mite Serpins Inhibit the Three Pathways of the Human Complement System

    PubMed Central

    Mika, Angela; Reynolds, Simone L.; Mohlin, Frida C.; Willis, Charlene; Swe, Pearl M.; Pickering, Darren A.; Halilovic, Vanja; Wijeyewickrema, Lakshmi C.; Pike, Robert N.; Blom, Anna M.; Kemp, David J.; Fischer, Katja

    2012-01-01

    Scabies is a parasitic infestation of the skin by the mite Sarcoptes scabiei that causes significant morbidity worldwide, in particular within socially disadvantaged populations. In order to identify mechanisms that enable the scabies mite to evade human immune defenses, we have studied molecules associated with proteolytic systems in the mite, including two novel scabies mite serine protease inhibitors (SMSs) of the serpin superfamily. Immunohistochemical studies revealed that within mite-infected human skin SMSB4 (54 kDa) and SMSB3 (47 kDa) were both localized in the mite gut and feces. Recombinant purified SMSB3 and SMSB4 did not inhibit mite serine and cysteine proteases, but did inhibit mammalian serine proteases, such as chymotrypsin, albeit inefficiently. Detailed functional analysis revealed that both serpins interfered with all three pathways of the human complement system at different stages of their activation. SMSB4 inhibited mostly the initial and progressing steps of the cascades, while SMSB3 showed the strongest effects at the C9 level in the terminal pathway. Additive effects of both serpins were shown at the C9 level in the lectin pathway. Both SMSs were able to interfere with complement factors without protease function. A range of binding assays showed direct binding between SMSB4 and seven complement proteins (C1, properdin, MBL, C4, C3, C6 and C8), while significant binding of SMSB3 occurred exclusively to complement factors without protease function (C4, C3, C8). Direct binding was observed between SMSB4 and the complement proteases C1s and C1r. However no complex formation was observed between either mite serpin and the complement serine proteases C1r, C1s, MASP-1, MASP-2 and MASP-3. No catalytic inhibition by either serpin was observed for any of these enzymes. In summary, the SMSs were acting at several levels mediating overall inhibition of the complement system and thus we propose that they may protect scabies mites from complement-mediated gut damage. PMID:22792350

  5. MicroRNA-19b promotes macrophage cholesterol accumulation and aortic atherosclerosis by targeting ATP-binding cassette transporter A1.

    PubMed

    Lv, Yun-Cheng; Tang, Yan-Yan; Peng, Juan; Zhao, Guo-Jun; Yang, Jing; Yao, Feng; Ouyang, Xin-Ping; He, Ping-Ping; Xie, Wei; Tan, Yu-Lin; Zhang, Min; Liu, Dan; Tang, Deng-Pei; Cayabyab, Francisco S; Zheng, Xi-Long; Zhang, Da-Wei; Tian, Guo-Ping; Tang, Chao-Ke

    2014-09-01

    Macrophage accumulation of cholesterol leads to foam cell formation which is a major pathological event of atherosclerosis. Recent studies have shown that microRNA (miR)-19b might play an important role in cholesterol metabolism and atherosclerotic diseases. Here, we have identified miR-19b binding to the 3'UTR of ATP-binding cassette transporter A1 (ABCA1) transporters, and further determined the potential roles of this novel interaction in atherogenesis. To investigate the molecular mechanisms involved in a miR-19b promotion of macrophage cholesterol accumulation and the development of aortic atherosclerosis. We performed bioinformatics analysis using online websites, and found that miR-19b was highly conserved during evolution and directly bound to ABCA1 mRNA with very low binding free energy. Luciferase reporter assay confirmed that miR-19b bound to 3110-3116 sites within ABCA1 3'UTR. MiR-19b directly regulated the expression levels of endogenous ABCA1 in foam cells derived from human THP-1 macrophages and mouse peritoneal macrophages (MPMs) as determined by qRT-PCR and western blot. Cholesterol transport assays revealed that miR-19b dramatically suppressed apolipoprotein AI-mediated ABCA1-dependent cholesterol efflux, resulting in the increased levels of total cholesterol (TC), free cholesterol (FC) and cholesterol ester (CE) as revealed by HPLC. The excretion of (3)H-cholesterol originating from cholesterol-laden MPMs into feces was decreased in mice overexpressing miR-19b. Finally, we evaluated the proatherosclerotic role of miR-19b in apolipoprotein E deficient (apoE(-/-)) mice. Treatment with miR-19b precursor reduced plasma high-density lipoprotein (HDL) levels, but increased plasma low-density lipoprotein (LDL) levels. Consistently, miR-19b precursor treatment increased aortic plaque size and lipid content, but reduced collagen content and ABCA1 expression. In contrast, treatment with the inhibitory miR-19b antisense oligonucleotides (ASO) prevented or reversed these effects. MiR-19b promotes macrophage cholesterol accumulation, foam cell formation and aortic atherosclerotic development by targeting ABCA1. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  6. A critical role for alternative polyadenylation factor CPSF6 in targeting HIV-1 integration to transcriptionally active chromatin

    PubMed Central

    Sowd, Gregory A.; Serrao, Erik; Wang, Hao; Wang, Weifeng; Fadel, Hind J.; Poeschla, Eric M.; Engelman, Alan N.

    2016-01-01

    Integration is vital to retroviral replication and influences the establishment of the latent HIV reservoir. HIV-1 integration favors active genes, which is in part determined by the interaction between integrase and lens epithelium-derived growth factor (LEDGF)/p75. Because gene targeting remains significantly enriched, relative to random in LEDGF/p75 deficient cells, other host factors likely contribute to gene-tropic integration. Nucleoporins 153 and 358, which bind HIV-1 capsid, play comparatively minor roles in integration targeting, but the influence of another capsid binding protein, cleavage and polyadenylation specificity factor 6 (CPSF6), has not been reported. In this study we knocked down or knocked out CPSF6 in parallel or in tandem with LEDGF/p75. CPSF6 knockout changed viral infectivity kinetics, decreased proviral formation, and preferentially decreased integration into transcriptionally active genes, spliced genes, and regions of chromatin enriched in genes and activating histone modifications. LEDGF/p75 depletion by contrast preferentially altered positional integration targeting within gene bodies. Dual factor knockout reduced integration into genes to below the levels observed with either single knockout and revealed that CPSF6 played a more dominant role than LEDGF/p75 in directing integration to euchromatin. CPSF6 complementation rescued HIV-1 integration site distribution in CPSF6 knockout cells, but complementation with a capsid binding mutant of CPSF6 did not. We conclude that integration targeting proceeds via two distinct mechanisms: capsid-CPSF6 binding directs HIV-1 to actively transcribed euchromatin, where the integrase-LEDGF/p75 interaction drives integration into gene bodies. PMID:26858452

  7. Botulinum Neurotoxins and Botulism: A Novel Therapeutic Approach

    PubMed Central

    Thanongsaksrikul, Jeeraphong; Chaicumpa, Wanpen

    2011-01-01

    Specific treatment is not available for human botulism. Current remedial mainstay is the passive administration of polyclonal antibody to botulinum neurotoxin (BoNT) derived from heterologous species (immunized animal or mouse hybridoma) together with supportive and symptomatic management. The antibody works extracellularly, probably by blocking the binding of receptor binding (R) domain to the neuronal receptors; thus inhibiting cellular entry of the holo-BoNT. The antibody cannot neutralize the intracellular toxin. Moreover, a conventional antibody with relatively large molecular size (150 kDa) is not accessible to the enzymatic groove and, thus, cannot directly inhibit the BoNT zinc metalloprotease activity. Recently, a 15–20 kDa single domain antibody (VHH) that binds specifically to light chain of BoNT serotype A was produced from a humanized-camel VH/VHH phage display library. The VHH has high sequence homology (>80%) to the human VH and could block the enzymatic activity of the BoNT. Molecular docking revealed not only the interface binding between the VHH and the toxin but also an insertion of the VHH CDR3 into the toxin enzymatic pocket. It is envisaged that, by molecular linking the VHH to a cell penetrating peptide (CPP), the CPP-VHH fusion protein would be able to traverse the hydrophobic cell membrane into the cytoplasm and inhibit the intracellular BoNT. This presents a novel and safe immunotherapeutic strategy for botulism by using a cell penetrating, humanized-single domain antibody that inhibits the BoNT by means of a direct blockade of the groove of the menace enzyme. PMID:22069720

  8. Mechanism of human antibody-mediated neutralization of Marburg virus.

    PubMed

    Flyak, Andrew I; Ilinykh, Philipp A; Murin, Charles D; Garron, Tania; Shen, Xiaoli; Fusco, Marnie L; Hashiguchi, Takao; Bornholdt, Zachary A; Slaughter, James C; Sapparapu, Gopal; Klages, Curtis; Ksiazek, Thomas G; Ward, Andrew B; Saphire, Erica Ollmann; Bukreyev, Alexander; Crowe, James E

    2015-02-26

    The mechanisms by which neutralizing antibodies inhibit Marburg virus (MARV) are not known. We isolated a panel of neutralizing antibodies from a human MARV survivor that bind to MARV glycoprotein (GP) and compete for binding to a single major antigenic site. Remarkably, several of the antibodies also bind to Ebola virus (EBOV) GP. Single-particle EM structures of antibody-GP complexes reveal that all of the neutralizing antibodies bind to MARV GP at or near the predicted region of the receptor-binding site. The presence of the glycan cap or mucin-like domain blocks binding of neutralizing antibodies to EBOV GP, but not to MARV GP. The data suggest that MARV-neutralizing antibodies inhibit virus by binding to infectious virions at the exposed MARV receptor-binding site, revealing a mechanism of filovirus inhibition. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. CXCL4 is a novel nickel-binding protein and augments nickel allergy.

    PubMed

    Kuroishi, T; Bando, K; Tanaka, Y; Shishido, K; Kinbara, M; Ogawa, T; Muramoto, K; Endo, Y; Sugawara, S

    2017-08-01

    Nickel (Ni) is the most frequent metal allergen and induces a TH 1 -dependent type-IV allergy. Although Ni 2+ is considered to bind to endogenous proteins, it currently remains unclear whether these Ni-binding proteins are involved in Ni allergy in vivo. We previously reported the adjuvant effects of lipopolysaccharide (LPS) in a Ni allergy mouse model. As LPS induces a number of inflammatory mediators, we hypothesized that Ni-binding protein(s) are also induced by LPS. The objective of this study was to purify and identify Ni-binding protein(s) from serum taken from LPS-injected mice (referred as LPS serum) and examined the augmenting effects of these Ni-binding protein(s) on Ni allergy in an in vivo model. BALB/cA mice were sensitized with an i.p. injection of NiCl 2 and LPS. Ten days after sensitization, mice were challenged with NiCl 2 by an i.d. injection into ear pinnae. Ni-binding protein(s) were purified by Ni-affinity column chromatography and gel filtration. Lipopolysaccharide serum, but not serum taken from saline-injected mice, augmented ear swelling induced by Ni-allergic inflammation. Ni-binding, but not non-binding fraction, purified from LPS serum augmented Ni-allergic inflammation. Mass spectrometry and Western blotting detected CXCL4 in the active fraction. A batch analysis with Ni-sepharose and a surface plasmon resonance analysis revealed direct binding between CXCL4 and Ni 2+ . Recombinant CXCL4 augmented Ni-allergic inflammation and exerted adjuvant effects at the sensitization phase. These results indicate that CXCL4 is a novel Ni-binding protein that augments Ni allergy at the elicitation and sensitization phases. This is the first study to demonstrate that the Ni-binding protein augments Ni allergy in vivo. © 2017 John Wiley & Sons Ltd.

  10. Fragile X mental retardation protein controls ion channel expression and activity.

    PubMed

    Ferron, Laurent

    2016-10-15

    Fragile X-associated disorders are a family of genetic conditions resulting from the partial or complete loss of fragile X mental retardation protein (FMRP). Among these disorders is fragile X syndrome, the most common cause of inherited intellectual disability and autism. FMRP is an RNA-binding protein involved in the control of local translation, which has pleiotropic effects, in particular on synaptic function. Analysis of the brain FMRP transcriptome has revealed hundreds of potential mRNA targets encoding postsynaptic and presynaptic proteins, including a number of ion channels. FMRP has been confirmed to bind voltage-gated potassium channels (K v 3.1 and K v 4.2) mRNAs and regulates their expression in somatodendritic compartments of neurons. Recent studies have uncovered a number of additional roles for FMRP besides RNA regulation. FMRP was shown to directly interact with, and modulate, a number of ion channel complexes. The sodium-activated potassium (Slack) channel was the first ion channel shown to directly interact with FMRP; this interaction alters the single-channel properties of the Slack channel. FMRP was also shown to interact with the auxiliary β4 subunit of the calcium-activated potassium (BK) channel; this interaction increases calcium-dependent activation of the BK channel. More recently, FMRP was shown to directly interact with the voltage-gated calcium channel, Ca v 2.2, and reduce its trafficking to the plasma membrane. Studies performed on animal models of fragile X syndrome have revealed links between modifications of ion channel activity and changes in neuronal excitability, suggesting that these modifications could contribute to the phenotypes observed in patients with fragile X-associated disorders. © 2016 The Authors. The Journal of Physiology © 2016 The Physiological Society.

  11. Activation of p115-RhoGEF Requires Direct Association of G[alpha subscript 13] and the Dbl Homology Domain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Zhe; Guo, Liang; Hadas, Jana

    2012-09-05

    RGS-containing RhoGEFs (RGS-RhoGEFs) represent a direct link between the G{sub 12} class of heterotrimeric G proteins and the monomeric GTPases. In addition to the canonical Dbl homology (DH) and pleckstrin homology domains that carry out the guanine nucleotide exchange factor (GEF) activity toward RhoA, these RhoGEFs also possess RGS homology (RH) domains that interact with activated {alpha} subunits of G{sub 12} and G{sub 13}. Although the GEF activity of p115-RhoGEF (p115), an RGS-RhoGEF, can be stimulated by G{alpha}{sub 13}, the exact mechanism of the stimulation has remained unclear. Using combined studies with small angle x-ray scattering, biochemistry, and mutagenesis, wemore » identify an additional binding site for activated G{alpha}{sub 13} in the DH domain of p115. Small angle x-ray scattering reveals that the helical domain of G{alpha}{sub 13} docks onto the DH domain, opposite to the surface of DH that binds RhoA. Mutation of a single tryptophan residue in the {alpha}3b helix of DH reduces binding to activated G{alpha}{sub 13} and ablates the stimulation of p115 by G{alpha}{sub 13}. Complementary mutations at the predicted DH-binding site in the {alpha}B-{alpha}C loop of the helical domain of G{alpha}{sub 13} also affect stimulation of p115 by G{alpha}{sub 13}. Although the GAP activity of p115 is not required for stimulation by G{alpha}{sub 13}, two hydrophobic motifs in RH outside of the consensus RGS box are critical for this process. Therefore, the binding of G{alpha}{sub 13} to the RH domain facilitates direct association of G{alpha}{sub 13} to the DH domain to regulate its exchange activity. This study provides new insight into the mechanism of regulation of the RGS-RhoGEF and broadens our understanding of G protein signaling.« less

  12. Transcription factor FBI-1 acts as a dual regulator in adipogenesis by coordinated regulation of cyclin-A and E2F-4.

    PubMed

    Laudes, Matthias; Bilkovski, Roman; Oberhauser, Frank; Droste, Andrea; Gomolka, Matthias; Leeser, Uschi; Udelhoven, Michael; Krone, Wilhelm

    2008-05-01

    Generation of new adipocytes plays a major role in the development of obesity. We previously have shown that transcriptional repressor factor that binds to IST (FBI)-1 exerts a dual effect in the process of adipogenesis by inhibiting proliferation and promoting differentiation of preadipocytes. The aim of the present study was to identify FBI-1 regulated molecular effectors that could account for these effects. Overexpressing FBI-1 in preadipocytes resulted in reduced expression of the cell cycle regulator cyclin A, which may explain FBI-1 induced inhibition of proliferation. Interestingly, FBI-1 repressed cyclin A promoter activity through an indirect mechanisms that did not involve direct binding of FBI-1 to the promoter sequence, but rather FBI-1 inhibition of transcriptional activator Sp1 binding to a regulatory element at -452 to -443. We also show that FBI-1 promotes terminal preadipocyte differentiation through a mechanism involving decreased levels of expression of the PPARgamma inhibitor E2F-4. FBI-1 significantly reduced E2F-4 promoter activity. Contrary to cyclin A, we found FBI-1-induced repression of E2F-4 is mediated by a direct mechanism via a FBI-1 regulatory element at -11 to -5. As function of transcriptional repressors normally depends on the presence of regulatory co-factors we also performed expression profiling of potential FBI-1 co-repressors throughout adipogenesis. In these experiments Sin3A and histon deacetylase (HDAC)-1 showed a similar expression pattern compared to FBI-1. Strikingly, co-immunoprecipitation studies revealed that FBI-1 binds Sin3A and HDAC-1 to form a repressor complex. Furthermore, by mutational analysis the amino terminal Poxvirus (POZ) domain of FBI-1 was found to be important for Sin3A and HDAC-1 binding. Taken together, FBI-1 is the first transcriptional repressor shown to act as a dual regulator in adipogenesis exerting repressor activities on target genes by both, direct and indirect mechanisms.

  13. Mechanism of Mitochondrial Transcription Factor A Attenuation of CpG-Induced Antibody Production

    PubMed Central

    Saifee, Jessica F.; Torres, Raul M.; Janoff, Edward N.

    2016-01-01

    Mitochondrial transcription factor A (TFAM) had previously been shown to act as a damage associated molecular pattern with the ability to enhance CpG-A phosphorothioate oligodeoxynucleotide (ODN)-mediated stimulation of IFNα production from human plasmacytoid dendritic cells. Examination of the mechanism by which TFAM might influence CpG ODN mediated innate immune responses revealed that TFAM binds directly, tightly and selectively to the structurally related CpG-A, -B, and -C ODN. TFAM also modulated the ability of the CpG-B or -C to stimulate the production of antibodies from human B cells. TFAM showed a dose-dependent modulation of CpG-B, and -C -induced antibody production from human B cells in vitro, with enhancement of high dose and inhibition of low doses of CpG stimulation. This effect was linked to the ability of TFAM to directly inhibit the binding of CpG ODNs to B cells, in a manner consistent with the relative binding affinities of TFAM for the ODNs. These data suggest that TFAM alters the free concentration of the CpG available to stimulate B cells by sequestering this ODN in a TFAM-CpG complex. Thus, TFAM has the potential to decrease the pathogenic consequences of exposure to natural CpG-like hypomethylated DNA in vivo, as well as such as that found in traumatic injury, infection, autoimmune disease and during pregnancy. PMID:27280778

  14. Cys Site-Directed Mutagenesis of the Human SLC1A5 (ASCT2) Transporter: Structure/Function Relationships and Crucial Role of Cys467 for Redox Sensing and Glutamine Transport

    PubMed Central

    Scalise, Mariafrancesca; Pochini, Lorena; Console, Lara; Pappacoda, Gilda; Pingitore, Piero; Hedfalk, Kristina; Indiveri, Cesare

    2018-01-01

    The human plasma membrane transporter ASCT2 is responsible for mediating Na- dependent antiport of neutral amino acids. New insights into structure/function relationships were unveiled by a combined approach of recombinant over-expression, site-directed mutagenesis, transport assays in proteoliposomes and bioinformatics. WT and Cys mutants of hASCT2 were produced in P. pastoris and purified for functional assay. The reactivity towards SH reducing and oxidizing agents of WT protein was investigated and opposite effects were revealed; transport activity increased upon treatment with the Cys reducing agent DTE, i.e., when Cys residues were in thiol (reduced) state. Methyl-Hg, which binds to SH groups, was able to inhibit WT and seven out of eight Cys to Ala mutants. On the contrary, C467A loses the sensitivity to both DTE activation and Methyl-Hg inhibition. The C467A mutant showed a Km for Gln one order of magnitude higher than that of WT. Moreover, the C467 residue is localized in the substrate binding region of the protein, as suggested by bioinformatics on the basis of the EAAT1 structure comparison. Taken together, the experimental data allowed identifying C467 residue as crucial for substrate binding and for transport activity modulation of hASCT2. PMID:29495336

  15. Elucidation of the glucose transport pathway in glucose transporter 4 via steered molecular dynamics simulations.

    PubMed

    Sheena, Aswathy; Mohan, Suma S; Haridas, Nidhina Pachakkil A; Anilkumar, Gopalakrishnapillai

    2011-01-01

    GLUT4 is a predominant insulin regulated glucose transporter expressed in major glucose disposal tissues such as adipocytes and muscles. Under the unstimulated state, GLUT4 resides within intracellular vesicles. Various stimuli such as insulin translocate this protein to the plasma membrane for glucose transport. In the absence of a crystal structure for GLUT4, very little is known about the mechanism of glucose transport by this protein. Earlier we proposed a homology model for GLUT4 and performed a conventional molecular dynamics study revealing the conformational rearrangements during glucose and ATP binding. However, this study could not explain the transport of glucose through the permeation tunnel. To elucidate the molecular mechanism of glucose transport and its energetic, a steered molecular dynamics study (SMD) was used. Glucose was pulled from the extracellular end of GLUT4 to the cytoplasm along the pathway using constant velocity pulling method. We identified several key residues within the tunnel that interact directly with either the backbone ring or the hydroxyl groups of glucose. A rotation of glucose molecule was seen near the sugar binding site facilitating the sugar recognition process at the QLS binding site. This study proposes a possible glucose transport pathway and aids the identification of several residues that make direct interactions with glucose during glucose transport. Mutational studies are required to further validate the observation made in this study.

  16. Modulation of Enhancer Looping and Differential Gene Targeting by Epstein-Barr Virus Transcription Factors Directs Cellular Reprogramming

    PubMed Central

    McClellan, Michael J.; Wood, C. David; Ojeniyi, Opeoluwa; Cooper, Tim J.; Kanhere, Aditi; Arvey, Aaron; Webb, Helen M.; Palermo, Richard D.; Harth-Hertle, Marie L.; Kempkes, Bettina; Jenner, Richard G.; West, Michelle J.

    2013-01-01

    Epstein-Barr virus (EBV) epigenetically reprogrammes B-lymphocytes to drive immortalization and facilitate viral persistence. Host-cell transcription is perturbed principally through the actions of EBV EBNA 2, 3A, 3B and 3C, with cellular genes deregulated by specific combinations of these EBNAs through unknown mechanisms. Comparing human genome binding by these viral transcription factors, we discovered that 25% of binding sites were shared by EBNA 2 and the EBNA 3s and were located predominantly in enhancers. Moreover, 80% of potential EBNA 3A, 3B or 3C target genes were also targeted by EBNA 2, implicating extensive interplay between EBNA 2 and 3 proteins in cellular reprogramming. Investigating shared enhancer sites neighbouring two new targets (WEE1 and CTBP2) we discovered that EBNA 3 proteins repress transcription by modulating enhancer-promoter loop formation to establish repressive chromatin hubs or prevent assembly of active hubs. Re-ChIP analysis revealed that EBNA 2 and 3 proteins do not bind simultaneously at shared sites but compete for binding thereby modulating enhancer-promoter interactions. At an EBNA 3-only intergenic enhancer site between ADAM28 and ADAMDEC1 EBNA 3C was also able to independently direct epigenetic repression of both genes through enhancer-promoter looping. Significantly, studying shared or unique EBNA 3 binding sites at WEE1, CTBP2, ITGAL (LFA-1 alpha chain), BCL2L11 (Bim) and the ADAMs, we also discovered that different sets of EBNA 3 proteins bind regulatory elements in a gene and cell-type specific manner. Binding profiles correlated with the effects of individual EBNA 3 proteins on the expression of these genes, providing a molecular basis for the targeting of different sets of cellular genes by the EBNA 3s. Our results therefore highlight the influence of the genomic and cellular context in determining the specificity of gene deregulation by EBV and provide a paradigm for host-cell reprogramming through modulation of enhancer-promoter interactions by viral transcription factors. PMID:24068937

  17. Rutin inhibits B[a]PDE-induced cyclooxygenase-2 expression by targeting EGFR kinase activity.

    PubMed

    Choi, Seunghwan; Lim, Tae-Gyu; Hwang, Mun Kyung; Kim, Yoon-A; Kim, Jiyoung; Kang, Nam Joo; Jang, Tae Su; Park, Jun-Seong; Yeom, Myeong Hun; Lee, Ki Won

    2013-11-15

    Rutin is a well-known flavonoid that exists in various natural sources. Accumulative studies have represented the biological effects of rutin, such as anti-oxidative and anti-inflammatory effects. However, the underlying mechanisms of rutin and its direct targets are not understood. We investigated whether rutin reduced B[a]PDE-induced-COX-2 expression. The transactivation of AP-1 and NF-κB were inhibited by rutin. Rutin also attenuated B[a]PDE-induced Raf/MEK/ERK and Akt activation, but had no effect on the phosphorylation of EGFR. An in vitro kinase assay revealed rutin suppressed EGFR kinase activity. We also confirmed direct binding between rutin and EGFR, and found that the binding was regressed by ATP. The EGFR inhibitor also inhibited the B[a]PDE-induced MEK/ERK and Akt signaling pathways and subsequently, suppressed COX-2 expression and promoter activity, in addition to suppressing the transactivation of AP-1 and NF-κB. In EGFR(-/-)mouse embryonic fibroblast cells, B[a]PDE-induced COX-2 expression was also diminished. Collectively, rutin inhibits B[a]PDE-induced COX-2 expression by suppressing the Raf/MEK/ERK and Akt signaling pathways. EGFR appeared to be the direct target of rutin. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Quantum Mechanics/Molecular Mechanics Modeling of Drug Metabolism: Mexiletine N-Hydroxylation by Cytochrome P450 1A2.

    PubMed

    Lonsdale, Richard; Fort, Rachel M; Rydberg, Patrik; Harvey, Jeremy N; Mulholland, Adrian J

    2016-06-20

    The mechanism of cytochrome P450(CYP)-catalyzed hydroxylation of primary amines is currently unclear and is relevant to drug metabolism; previous small model calculations have suggested two possible mechanisms: direct N-oxidation and H-abstraction/rebound. We have modeled the N-hydroxylation of (R)-mexiletine in CYP1A2 with hybrid quantum mechanics/molecular mechanics (QM/MM) methods, providing a more detailed and realistic model. Multiple reaction barriers have been calculated at the QM(B3LYP-D)/MM(CHARMM27) level for the direct N-oxidation and H-abstraction/rebound mechanisms. Our calculated barriers indicate that the direct N-oxidation mechanism is preferred and proceeds via the doublet spin state of Compound I. Molecular dynamics simulations indicate that the presence of an ordered water molecule in the active site assists in the binding of mexiletine in the active site, but this is not a prerequisite for reaction via either mechanism. Several active site residues play a role in the binding of mexiletine in the active site, including Thr124 and Phe226. This work reveals key details of the N-hydroxylation of mexiletine and further demonstrates that mechanistic studies using QM/MM methods are useful for understanding drug metabolism.

  19. Identification of ERdj3 and OBF-1/BOB-1/OCA-B as direct targets of XBP-1 during plasma cell differentiation.

    PubMed

    Shen, Ying; Hendershot, Linda M

    2007-09-01

    Plasma cell differentiation is accompanied by a modified unfolded protein response (UPR), which involves activation of the Ire1 and activating transcription factor 6 branches, but not the PKR-like endoplasmic reticulum kinase branch. Ire1-mediated splicing of XBP-1 (XBP-1(S)) is required for terminal differentiation, although the direct targets of XBP-1(S) in this process have not been identified. We demonstrate that XBP-1(S) binds to the promoter of ERdj3 in plasmacytoma cells and in LPS-stimulated primary splenic B cells, which corresponds to increased expression of ERdj3 transcripts in both cases. When small hairpin RNA was used to decrease XBP-1 expression in plasmacytoma lines, ERdj3 transcripts were concomitantly reduced. The accumulation of Ig gamma H chain protein was also diminished, but unexpectedly this occurred at the transcriptional level as opposed to effects on H chain stability. The decrease in H chain transcripts correlated with a reduction in mRNA encoding the H chain transcription factor, OBF-1/BOB-1/OCA-B. Chromatin immunoprecipitation experiments revealed that XBP-1(S) binds to the OBF-1/BOB-1/OCA-B promoter in the plasmacytoma line and in primary B cells not only during plasma cell differentiation, but also in response to classical UPR activation. Gel shift assays suggest that XBP-1(S) binding occurs through a UPR element conserved in both murine and human OBF-1/BOB-1/OCA-B promoters as opposed to endoplasmic reticulum stress response elements. Our studies are the first to identify direct downstream targets of XBP-1(S) during either plasma cell differentiation or the UPR. In addition, our data further define the XBP-1(S)-binding sequence and provide yet another role for this protein as a master regulator of plasma cell differentiation.

  20. Oxysterol-binding protein-related protein (ORP) 9 is a PDK-2 substrate and regulates Akt phosphorylation.

    PubMed

    Lessmann, Eva; Ngo, Mike; Leitges, Michael; Minguet, Susana; Ridgway, Neale D; Huber, Michael

    2007-02-01

    The oxysterol-binding protein and oxysterol-binding protein-related protein family has been implicated in lipid transport and metabolism, vesicle trafficking and cell signaling. While investigating the phosphorylation of Akt/protein kinase B in stimulated bone marrow-derived mast cells, we observed that a monoclonal antibody directed against phospho-S473 Akt cross-reacted with oxysterol-binding protein-related protein 9 (ORP9). Further analysis revealed that mast cells exclusively express ORP9S, an N-terminal truncated version of full-length ORP9L. A PDK-2 consensus phosphorylation site in ORP9L and OPR9S at S287 (VPEFS(287)Y) was confirmed by site-directed mutagenesis. In contrast to Akt, increased phosphorylation of ORP9S S287 in stimulated mast cells was independent of phosphatidylinositol 3-kinase but sensitive to inhibition of conventional PKC isotypes. PKC-beta dependence was confirmed by lack of ORP9S phosphorylation at S287 in PKC-beta-deficient, but not PKC-alpha-deficient, mast cells. Moreover, co-immunoprecipitation of PKC-beta and ORP9S, and in vitro phosphorylation of ORP9S in this complex, argued for direct phosphorylation of ORP9S by PKC-beta, introducing ORP9S as a novel PKC-beta substrate. Akt was also detected in a PKC-beta/ORP9S immune complex and phosphorylation of Akt on S473 was delayed in PKC-deficient mast cells. In HEK293 cells, RNAi experiments showed that depletion of ORP9L increased Akt S473 phosphorylation 3-fold without affecting T308 phosphorylation in the activation loop. Furthermore, mammalian target of rapamycin was implicated in ORP9L phosphorylation in HEK293 cells. These studies identify ORP9 as a PDK-2 substrate and negative regulator of Akt phosphorylation at the PDK-2 site.

  1. Direct binding of F actin to the cytoplasmic domain of the alpha 2 integrin chain in vitro

    NASA Technical Reports Server (NTRS)

    Kieffer, J. D.; Plopper, G.; Ingber, D. E.; Hartwig, J. H.; Kupper, T. S.

    1995-01-01

    The transmembrane integrins have been shown to interact with the cytoskeleton via noncovalent binding between cytoplasmic domains (CDs) of integrin beta chains and various actin binding proteins within the focal adhesion complex. Direct or indirect integrin alpha chain CD binding to the actin cytoskeleton has not been reported. We show here that actin, as an abundant constituent of focal adhesion complex proteins isolated from fibroblasts, binds strongly and specifically to alpha 2 CD, but not to alpha 1 CD peptide. Similar specific binding to alpha 2 CD peptide was seen for highly purified F actin, free of putative actin-binding proteins. The bound complex of actin and peptide was visualized directly by coprecipitation, and actin binding was abrogated by removal of a five amino acid sequence from the alpha 2 CD peptide. Our findings may explain the earlier observation that, while integrins alpha 2 beta 1 and alpha 1 beta 1 both bind to collagen, only alpha 2 beta 1 can mediate contraction of extracellular collagen matrices.

  2. Genome-wide analysis of murine renal distal convoluted tubular cells for the target genes of mineralocorticoid receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ueda, Kohei; Fujiki, Katsunori; Shirahige, Katsuhiko

    Highlights: • We define a target gene of MR as that with MR-binding to the adjacent region of DNA. • We use ChIP-seq analysis in combination with microarray. • We, for the first time, explore the genome-wide binding profile of MR. • We reveal 5 genes as the direct target genes of MR in the renal epithelial cell-line. - Abstract: Background and objective: Mineralocorticoid receptor (MR) is a member of nuclear receptor family proteins and contributes to fluid homeostasis in the kidney. Although aldosterone-MR pathway induces several gene expressions in the kidney, it is often unclear whether the gene expressionsmore » are accompanied by direct regulations of MR through its binding to the regulatory region of each gene. The purpose of this study is to identify the direct target genes of MR in a murine distal convoluted tubular epithelial cell-line (mDCT). Methods: We analyzed the DNA samples of mDCT cells overexpressing 3xFLAG-hMR after treatment with 10{sup −7} M aldosterone for 1 h by chromatin immunoprecipitation with deep-sequence (ChIP-seq) and mRNA of the cell-line with treatment of 10{sup −7} M aldosterone for 3 h by microarray. Results: 3xFLAG-hMR overexpressed in mDCT cells accumulated in the nucleus in response to 10{sup −9} M aldosterone. Twenty-five genes were indicated as the candidate target genes of MR by ChIP-seq and microarray analyses. Five genes, Sgk1, Fkbp5, Rasl12, Tns1 and Tsc22d3 (Gilz), were validated as the direct target genes of MR by quantitative RT-qPCR and ChIP-qPCR. MR binding regions adjacent to Ctgf and Serpine1 were also validated. Conclusions: We, for the first time, captured the genome-wide distribution of MR in mDCT cells and, furthermore, identified five MR target genes in the cell-line. These results will contribute to further studies on the mechanisms of kidney diseases.« less

  3. Revealing interaction between sulfobutylether-β-cyclodextrin and reserpine by chemiluminescence and site-directed molecular docking.

    PubMed

    Xiong, Xunyu; Wu, Min; Zhao, Xinfeng; Song, Zhenghua

    2014-09-01

    The host-guest interaction between sulfobutylether-β-cyclodextrin (SBE-β-CD) and reserpine (RSP) is described using flow injection-chemiluminescence (FI-CL) and site-directed molecular docking methods. It was found that RSP could inhibit the CL intensity produced by a luminol/SBE-β-CD system. The decrease in CL intensity was logarithmic over an RSP concentration range of 0.03 to 700.0 nM, giving a regression equation of ∆I = 107.1lgCRES  + 186.1 with a detection limit of 10 pM (3σ). The CL assay was successfully applied in the determination of RSP in injection, saliva and urine samples with recoveries in the range 93.5-106.1%. Using the proposed CL model, the binding constant (KCD-R ) and the stoichiometric ratio of SBE-β-CD/RSP were calculated to be 7.4 × 10(6)  M(-1) and 1 : 1, respectively. Using molecular docking, it was confirmed that luminol binds to the small cavity of SBE-β-CD with a nonpolar interaction, while RSP targeted the larger cavity of SBE-β-CD and formed a 1 : 1 complex with hydrogen bonds. The proposed new CL method has the potential to become a powerful tool for revealing the host-guest interaction between CDs and drugs, as well as monitoring drugs with high sensitivity. Copyright © 2013 John Wiley & Sons, Ltd.

  4. Dynamic and Differential Regulation of Stem Cell Factor FoxD3 in the Neural Crest Is Encrypted in the Genome

    PubMed Central

    Tan-Cabugao, Joanne; Sauka-Spengler, Tatjana; Bronner, Marianne E.

    2012-01-01

    The critical stem cell transcription factor FoxD3 is expressed by the premigratory and migrating neural crest, an embryonic stem cell population that forms diverse derivatives. Despite its important role in development and stem cell biology, little is known about what mediates FoxD3 activity in these cells. We have uncovered two FoxD3 enhancers, NC1 and NC2, that drive reporter expression in spatially and temporally distinct manners. Whereas NC1 activity recapitulates initial FoxD3 expression in the cranial neural crest, NC2 activity recapitulates initial FoxD3 expression at vagal/trunk levels while appearing only later in migrating cranial crest. Detailed mutational analysis, in vivo chromatin immunoprecipitation, and morpholino knock-downs reveal that transcription factors Pax7 and Msx1/2 cooperate with the neural crest specifier gene, Ets1, to bind to the cranial NC1 regulatory element. However, at vagal/trunk levels, they function together with the neural plate border gene, Zic1, which directly binds to the NC2 enhancer. These results reveal dynamic and differential regulation of FoxD3 in distinct neural crest subpopulations, suggesting that heterogeneity is encrypted at the regulatory level. Isolation of neural crest enhancers not only allows establishment of direct regulatory connections underlying neural crest formation, but also provides valuable tools for tissue specific manipulation and investigation of neural crest cell identity in amniotes. PMID:23284303

  5. Vitamin D binding protein-macrophage activating factor (DBP-maf) inhibits angiogenesis and tumor growth in mice.

    PubMed

    Kisker, Oliver; Onizuka, Shinya; Becker, Christian M; Fannon, Michael; Flynn, Evelyn; D'Amato, Robert; Zetter, Bruce; Folkman, Judah; Ray, Rahul; Swamy, Narasimha; Pirie-Shepherd, Steven

    2003-01-01

    We have isolated a selectively deglycosylated form of vitamin D binding protein (DBP-maf) generated from systemically available DBP by a human pancreatic cancer cell line. DBP-maf is antiproliferative for endothelial cells and antiangiogenic in the chorioallantoic membrane assay. DBP-maf administered daily was able to potently inhibit the growth of human pancreatic cancer in immune compromised mice (T/C=0.09). At higher doses, DBP-maf caused tumor regression. Histological examination revealed that treated tumors had a higher number of infiltrating macrophages as well as reduced microvessel density, and increased levels of apoptosis relative to untreated tumors. Taken together, these data suggest that DBP-maf is an antiangiogenic molecule that can act directly on endothelium as well as stimulate macrophages to attack both the endothelial and tumor cell compartment of a growing malignancy.

  6. Cis-acting elements in the promoter region of the human aldolase C gene.

    PubMed

    Buono, P; de Conciliis, L; Olivetta, E; Izzo, P; Salvatore, F

    1993-08-16

    We investigated the cis-acting sequences involved in the expression of the human aldolase C gene by transient transfections into human neuroblastoma cells (SKNBE). We demonstrate that 420 bp of the 5'-flanking DNA direct at high efficiency the transcription of the CAT reporter gene. A deletion between -420 bp and -164 bp causes a 60% decrease of CAT activity. Gel shift and DNase I footprinting analyses revealed four protected elements: A, B, C and D. Competition analyses indicate that Sp1 or factors sharing a similar sequence specificity bind to elements A and B, but not to elements C and D. Sequence analysis shows a half palindromic ERE motif (GGTCA), in elements B and D. Region D binds a transactivating factor which appears also essential to stabilize the initiation complex.

  7. Binding of fluorescent acridine dyes acridine orange and 9-aminoacridine to hemoglobin: Elucidation of their molecular recognition by spectroscopy, calorimetry and molecular modeling techniques.

    PubMed

    Chatterjee, Sabyasachi; Kumar, Gopinatha Suresh

    2016-06-01

    The molecular interaction between hemoglobin (HHb), the major human heme protein, and the acridine dyes acridine orange (AO) and 9-aminoacridine (9AA) was studied by various spectroscopic, calorimetric and molecular modeling techniques. The dyes formed stable ground state complex with HHb as revealed from spectroscopic data. Temperature dependent fluorescence data showed the strength of the dye-protein complexation to be inversely proportional to temperature and the fluorescence quenching was static in nature. The binding-induced conformational change in the protein was investigated using circular dichroism, synchronous fluorescence, 3D fluorescence and FTIR spectroscopy results. Circular dichroism data also quantified the α-helicity change in hemoglobin due to the binding of acridine dyes. Calorimetric studies revealed the binding to be endothermic in nature for both AO and 9AA, though the latter had higher affinity, and this was also observed from spectroscopic data. The binding of both dyes was entropy driven. pH dependent fluorescence studies revealed the existence of electrostatic interaction between the protein and dye molecules. Molecular modeling studies specified the binding site and the non-covalent interactions involved in the association. Overall, the results revealed that a small change in the acridine chromophore leads to remarkable alteration in the structural and thermodynamic aspects of binding to HHb. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. NMR Studies of Protein Hydration and Protein-Ligand Interactions

    NASA Astrophysics Data System (ADS)

    Chong, Yuan

    Water on the surface of a protein is called hydration water. Hydration water is known to play a crucial role in a variety of biological processes including protein folding, enzymatic activation, and drug binding. Although the significance of hydration water has been recognized, the underlying mechanism remains far from being understood. This dissertation employs a unique in-situ nuclear magnetic resonance (NMR) technique to study the mechanism of protein hydration and the role of hydration in alcohol-protein interactions. Water isotherms in proteins are measured at different temperatures via the in-situ NMR technique. Water is found to interact differently with hydrophilic and hydrophobic groups on the protein. Water adsorption on hydrophilic groups is hardly affected by the temperature, while water adsorption on hydrophobic groups strongly depends on the temperature around 10 C, below which the adsorption is substantially reduced. This effect is induced by the dramatic decrease in the protein flexibility below 10 C. Furthermore, nanosecond to microsecond protein dynamics and the free energy, enthalpy, and entropy of protein hydration are studied as a function of hydration level and temperature. A crossover at 10 C in protein dynamics and thermodynamics is revealed. The effect of water at hydrophilic groups on protein dynamics and thermodynamics shows little temperature dependence, whereas water at hydrophobic groups has stronger effect above 10 C. In addition, I investigate the role of water in alcohol binding to the protein using the in-situ NMR detection. The isotherms of alcohols are first measured on dry proteins, then on proteins with a series of controlled hydration levels. The free energy, enthalpy, and entropy of alcohol binding are also determined. Two distinct types of alcohol binding are identified. On the one hand, alcohols can directly bind to a few specific sites on the protein. This type of binding is independent of temperature and can be facilitated by hydration. On the other hand, alcohols can bind to many nonspecific sites on the protein. In dry proteins, this type of binding only occurs above a threshold of alcohol vapor pressure. Such a threshold is gradually reduced by increasing the hydration level and can be removed above a critical hydration level. Hydration also shifts the nonspecific alcohol binding from an entropy-driven to an enthalpy-driven process. This dissertation reveals the mechanism of protein hydration and the detailed roles of hydration in ligand binding, with important implications for the understanding of protein functions.

  9. Mechanism of Transport Modulation by an Extracellular Loop in an Archaeal Excitatory Amino Acid Transporter (EAAT) Homolog*

    PubMed Central

    Mulligan, Christopher; Mindell, Joseph A.

    2013-01-01

    Secondary transporters in the excitatory amino acid transporter family terminate glutamatergic synaptic transmission by catalyzing Na+-dependent removal of glutamate from the synaptic cleft. Recent structural studies of the aspartate-specific archaeal homolog, GltPh, suggest that transport is achieved by a rigid body, piston-like movement of the transport domain, which houses the substrate-binding site, between the extracellular and cytoplasmic sides of the membrane. This transport domain is connected to an immobile scaffold by three loops, one of which, the 3–4 loop (3L4), undergoes substrate-sensitive conformational change. Proteolytic cleavage of the 3L4 was found to abolish transport activity indicating an essential function for this loop in the transport mechanism. Here, we demonstrate that despite the presence of fully cleaved 3L4, GltPh is still able to sample conformations relevant for transport. Optimized reconstitution conditions reveal that fully cleaved GltPh retains some transport activity. Analysis of the kinetics and temperature dependence of transport accompanied by direct measurements of substrate binding reveal that this decreased transport activity is not due to alteration of the substrate binding characteristics but is caused by the significantly reduced turnover rate. By measuring solute counterflow activity and cross-link formation rates, we demonstrate that cleaving 3L4 severely and specifically compromises one or more steps contributing to the movement of the substrate-loaded transport domain between the outward- and inward-facing conformational states, sparing the equivalent step(s) during the movement of the empty transport domain. These results reveal a hitherto unknown role for the 3L4 in modulating an essential step in the transport process. PMID:24155238

  10. Lipoxygenase directed anti-inflammatory and anti-cancerous secondary metabolites: ADMET-based screening, molecular docking and dynamics simulation.

    PubMed

    Singh, Swati; Awasthi, Manika; Pandey, Veda P; Dwivedi, Upendra N

    2017-02-01

    Lipoxygenases (LOXs), key enzymes involved in the biosynthesis of leukotrienes, are well known to participate in the inflammatory and immune responses. With the recent reports of involvement of 5-LOX (one of the isozymes of LOX in human) in cancer, there is a need to find out selective inhibitors of 5-LOX for their therapeutic application. In the present study, plant-derived 300 anti-inflammatory and anti-cancerous secondary metabolites (100 each of alkaloids, flavonoids and terpenoids) have been screened for their pharmacokinetic properties and subsequently docked for identification of potent inhibitors of 5-LOX. Pharmacokinetic analyses revealed that only 18 alkaloids, 26 flavonoids, and 9 terpenoids were found to fulfill all the absorption, distribution, metabolism, excretion, and toxicity descriptors as well as those of Lipinski's Rule of Five. Docking analyses of pharmacokinetically screened metabolites and their comparison with a known inhibitor (drug), namely zileuton revealed that only three alkaloids, six flavonoids and three terpenoids were found to dock successfully with 5-LOX with the flavonoid, velutin being the most potent inhibitor among all. The results of the docking analyses were further validated by performing molecular dynamics simulation and binding energy calculations for the complexes of 5-LOX with velutin, galangin, chrysin (in order of LibDock scores), and zileuton. The data revealed stabilization of all the complexes within 15 ns of simulation with velutin complex exhibiting least root-mean-square deviation value (.285 ± .007 nm) as well as least binding energy (ΔG bind  = -203.169 kJ/mol) as compared to others during the stabilization phase of simulation.

  11. Conservation of tubulin-binding sequences in TRPV1 throughout evolution.

    PubMed

    Sardar, Puspendu; Kumar, Abhishek; Bhandari, Anita; Goswami, Chandan

    2012-01-01

    Transient Receptor Potential Vanilloid sub type 1 (TRPV1), commonly known as capsaicin receptor can detect multiple stimuli ranging from noxious compounds, low pH, temperature as well as electromagnetic wave at different ranges. In addition, this receptor is involved in multiple physiological and sensory processes. Therefore, functions of TRPV1 have direct influences on adaptation and further evolution also. Availability of various eukaryotic genomic sequences in public domain facilitates us in studying the molecular evolution of TRPV1 protein and the respective conservation of certain domains, motifs and interacting regions that are functionally important. Using statistical and bioinformatics tools, our analysis reveals that TRPV1 has evolved about ∼420 million years ago (MYA). Our analysis reveals that specific regions, domains and motifs of TRPV1 has gone through different selection pressure and thus have different levels of conservation. We found that among all, TRP box is the most conserved and thus have functional significance. Our results also indicate that the tubulin binding sequences (TBS) have evolutionary significance as these stretch sequences are more conserved than many other essential regions of TRPV1. The overall distribution of positively charged residues within the TBS motifs is conserved throughout evolution. In silico analysis reveals that the TBS-1 and TBS-2 of TRPV1 can form helical structures and may play important role in TRPV1 function. Our analysis identifies the regions of TRPV1, which are important for structure-function relationship. This analysis indicates that tubulin binding sequence-1 (TBS-1) near the TRP-box forms a potential helix and the tubulin interactions with TRPV1 via TBS-1 have evolutionary significance. This interaction may be required for the proper channel function and regulation and may also have significance in the context of Taxol®-induced neuropathy.

  12. The allosteric switching mechanism in bacteriophage MS2

    NASA Astrophysics Data System (ADS)

    Perkett, Matthew R.; Mirijanian, Dina T.; Hagan, Michael F.

    2016-07-01

    We use all-atom simulations to elucidate the mechanisms underlying conformational switching and allostery within the coat protein of the bacteriophage MS2. Assembly of most icosahedral virus capsids requires that the capsid protein adopts different conformations at precise locations within the capsid. It has been shown that a 19 nucleotide stem loop (TR) from the MS2 genome acts as an allosteric effector, guiding conformational switching of the coat protein during capsid assembly. Since the principal conformational changes occur far from the TR binding site, it is important to understand the molecular mechanism underlying this allosteric communication. To this end, we use all-atom simulations with explicit water combined with a path sampling technique to sample the MS2 coat protein conformational transition, in the presence and absence of TR-binding. The calculations find that TR binding strongly alters the transition free energy profile, leading to a switch in the favored conformation. We discuss changes in molecular interactions responsible for this shift. We then identify networks of amino acids with correlated motions to reveal the mechanism by which effects of TR binding span the protein. We find that TR binding strongly affects residues located at the 5-fold and quasi-sixfold interfaces in the assembled capsid, suggesting a mechanism by which the TR binding could direct formation of the native capsid geometry. The analysis predicts amino acids whose substitution by mutagenesis could alter populations of the conformational substates or their transition rates.

  13. Identification of the components of a glycolytic enzyme metabolon on the human red blood cell membrane.

    PubMed

    Puchulu-Campanella, Estela; Chu, Haiyan; Anstee, David J; Galan, Jacob A; Tao, W Andy; Low, Philip S

    2013-01-11

    Glycolytic enzymes (GEs) have been shown to exist in multienzyme complexes on the inner surface of the human erythrocyte membrane. Because no protein other than band 3 has been found to interact with GEs, and because several GEs do not bind band 3, we decided to identify the additional membrane proteins that serve as docking sites for GE on the membrane. For this purpose, a method known as "label transfer" that employs a photoactivatable trifunctional cross-linking reagent to deliver a biotin from a derivatized GE to its binding partner on the membrane was used. Mass spectrometry analysis of membrane proteins that were biotinylated following rebinding and photoactivation of labeled GAPDH, aldolase, lactate dehydrogenase, and pyruvate kinase revealed not only the anticipated binding partner, band 3, but also the association of GEs with specific peptides in α- and β-spectrin, ankyrin, actin, p55, and protein 4.2. More importantly, the labeled GEs were also found to transfer biotin to other GEs in the complex, demonstrating for the first time that GEs also associate with each other in their membrane complexes. Surprisingly, a new GE binding site was repeatedly identified near the junction of the membrane-spanning and cytoplasmic domains of band 3, and this binding site was confirmed by direct binding studies. These results not only identify new components of the membrane-associated GE complexes but also provide molecular details on the specific peptides that form the interfacial contacts within each interaction.

  14. The allosteric switching mechanism in bacteriophage MS2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Perkett, Matthew R.; Mirijanian, Dina T.; Hagan, Michael F., E-mail: hagan@brandeis.edu

    2016-07-21

    We use all-atom simulations to elucidate the mechanisms underlying conformational switching and allostery within the coat protein of the bacteriophage MS2. Assembly of most icosahedral virus capsids requires that the capsid protein adopts different conformations at precise locations within the capsid. It has been shown that a 19 nucleotide stem loop (TR) from the MS2 genome acts as an allosteric effector, guiding conformational switching of the coat protein during capsid assembly. Since the principal conformational changes occur far from the TR binding site, it is important to understand the molecular mechanism underlying this allosteric communication. To this end, we usemore » all-atom simulations with explicit water combined with a path sampling technique to sample the MS2 coat protein conformational transition, in the presence and absence of TR-binding. The calculations find that TR binding strongly alters the transition free energy profile, leading to a switch in the favored conformation. We discuss changes in molecular interactions responsible for this shift. We then identify networks of amino acids with correlated motions to reveal the mechanism by which effects of TR binding span the protein. We find that TR binding strongly affects residues located at the 5-fold and quasi-sixfold interfaces in the assembled capsid, suggesting a mechanism by which the TR binding could direct formation of the native capsid geometry. The analysis predicts amino acids whose substitution by mutagenesis could alter populations of the conformational substates or their transition rates.« less

  15. How Robust Is the Mechanism of Folding-Upon-Binding for an Intrinsically Disordered Protein?

    PubMed

    Bonetti, Daniela; Troilo, Francesca; Brunori, Maurizio; Longhi, Sonia; Gianni, Stefano

    2018-04-24

    The mechanism of interaction of an intrinsically disordered protein (IDP) with its physiological partner is characterized by a disorder-to-order transition in which a recognition and a binding step take place. Even if the mechanism is quite complex, IDPs tend to bind their partner in a cooperative manner such that it is generally possible to detect experimentally only the disordered unbound state and the structured complex. The interaction between the disordered C-terminal domain of the measles virus nucleoprotein (N TAIL ) and the X domain (XD) of the viral phosphoprotein allows us to detect and quantify the two distinct steps of the overall reaction. Here, we analyze the robustness of the folding of N TAIL upon binding to XD by measuring the effect on both the folding and binding steps of N TAIL when the structure of XD is modified. Because it has been shown that wild-type XD is structurally heterogeneous, populating an on-pathway intermediate under native conditions, we investigated the binding to 11 different site-directed variants of N TAIL of one particular variant of XD (I504A XD) that populates only the native state. Data reveal that the recognition and the folding steps are both affected by the structure of XD, indicating a highly malleable pathway. The experimental results are briefly discussed in the light of previous experiments on other IDPs. Copyright © 2018 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  16. Structure of a Pheromone Receptor-Associated Mhc Molecule With An Open And Empty Groove

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Olson, R.; Huey-Tubman, K.E.; Dulac, C.

    2006-10-06

    Neurons in the murine vomeronasal organ (VNO) express a family of class Ib major histocompatibility complex (MHC) proteins (M10s) that interact with the V2R class of VNO receptors. This interaction may play a direct role in the detection of pheromonal cues that initiate reproductive and territorial behaviors. The crystal structure of M10.5, an M10 family member, is similar to that of classical MHC molecules. However, the M10.5 counterpart of the MHC peptide-binding groove is open and unoccupied, revealing the first structure of an empty class I MHC molecule. Similar to empty MHC molecules, but unlike peptide-filled MHC proteins and non-peptide-bindingmore » MHC homologs, M10.5 is thermally unstable, suggesting that its groove is normally occupied. However, M10.5 does not bind endogenous peptides when expressed in mammalian cells or when offered a mixture of class I-binding peptides. The F pocket side of the M10.5 groove is open, suggesting that ligands larger than 8-10-mer class I-binding peptides could fit by extending out of the groove. Moreover, variable residues point up from the groove helices, rather than toward the groove as in classical MHC structures. These data suggest that M10s are unlikely to provide specific recognition of class I MHC-binding peptides, but are consistent with binding to other ligands, including proteins such as the V2Rs.« less

  17. Negative Factor from SIV Binds to the Catalytic Subunit of the V-ATPase to Internalize CD4 and to Increase Viral Infectivity

    PubMed Central

    Mandic, Robert; Fackler, Oliver T.; Geyer, Matthias; Linnemann, Thomas; Zheng, Yong-Hui; Peterlin, B. Matija

    2001-01-01

    The accessory protein negative factor (Nef) from human immunodeficiency virus (HIV) and simian immunodeficiency virus (SIV) is required for optimal viral infectivity and the progression to acquired immunodeficiency syndrome (AIDS). Nef interacts with the endocytic machinery, resulting in the down-regulation of cluster of differentiation antigen 4 (CD4) and major histocompatibility complex class I (MHCI) molecules on the surface of infected cells. Mutations in the C-terminal flexible loop of Nef result in a lower rate of internalization by this viral protein. However, no loop-dependent binding of Nef to adaptor protein-2 (AP-2), which is the adaptor protein complex that is required for the internalization of proteins from the plasma membrane, could be demonstrated. In this study we investigated the relevance of different motifs in Nef from SIVmac239 for its internalization, CD4 down-regulation, binding to components of the trafficking machinery, and viral infectivity. Our data suggest that the binding of Nef to the catalytic subunit H of the vacuolar membrane ATPase (V-ATPase) facilitates its internalization. This binding depends on the integrity of the whole flexible loop. Subsequent studies on Nef mutant viruses revealed that the flexible loop is essential for optimal viral infectivity. Therefore, our data demonstrate how Nef contacts the endocytic machinery in the absence of its direct binding to AP-2 and suggest an important role for subunit H of the V-ATPase in viral infectivity. PMID:11179428

  18. Identification of the Components of a Glycolytic Enzyme Metabolon on the Human Red Blood Cell Membrane*

    PubMed Central

    Puchulu-Campanella, Estela; Chu, Haiyan; Anstee, David J.; Galan, Jacob A.; Tao, W. Andy; Low, Philip S.

    2013-01-01

    Glycolytic enzymes (GEs) have been shown to exist in multienzyme complexes on the inner surface of the human erythrocyte membrane. Because no protein other than band 3 has been found to interact with GEs, and because several GEs do not bind band 3, we decided to identify the additional membrane proteins that serve as docking sites for GE on the membrane. For this purpose, a method known as “label transfer” that employs a photoactivatable trifunctional cross-linking reagent to deliver a biotin from a derivatized GE to its binding partner on the membrane was used. Mass spectrometry analysis of membrane proteins that were biotinylated following rebinding and photoactivation of labeled GAPDH, aldolase, lactate dehydrogenase, and pyruvate kinase revealed not only the anticipated binding partner, band 3, but also the association of GEs with specific peptides in α- and β-spectrin, ankyrin, actin, p55, and protein 4.2. More importantly, the labeled GEs were also found to transfer biotin to other GEs in the complex, demonstrating for the first time that GEs also associate with each other in their membrane complexes. Surprisingly, a new GE binding site was repeatedly identified near the junction of the membrane-spanning and cytoplasmic domains of band 3, and this binding site was confirmed by direct binding studies. These results not only identify new components of the membrane-associated GE complexes but also provide molecular details on the specific peptides that form the interfacial contacts within each interaction. PMID:23150667

  19. Malachite green mediates homodimerization of antibody VL domains to form a fluorescent ternary complex with singular symmetric interfaces

    PubMed Central

    Szent-Gyorgyi, Chris; Stanfield, Robyn L.; Andreko, Susan; Dempsey, Alison; Ahmed, Mushtaq; Capek, Sara; Waggoner, Alan; Wilson, Ian A.; Bruchez, Marcel P.

    2013-01-01

    We report that a symmetric small molecule ligand mediates the assembly of antibody light chain variable domains (VLs) into a correspondent symmetric ternary complex with novel interfaces. The L5* Fluorogen Activating Protein (FAP) is a VL domain that binds malachite green dye (MG) to activate intense fluorescence. Crystallography of liganded L5* reveals a 2:1 protein:ligand complex with inclusive C2 symmetry, where MG is almost entirely encapsulated between an antiparallel arrangement of the two VL domains. Unliganded L5* VL domains crystallize as a similar antiparallel VL/VL homodimer. The complementarity determining regions (CDRs) are spatially oriented to form novel VL/VL and VL/ligand interfaces that tightly constrain a propeller conformer of MG. Binding equilibrium analysis suggests highly cooperative assembly to form a very stable VL/MG/VL complex, such that MG behaves as a strong chemical inducer of dimerization. Fusion of two VL domains into a single protein tightens MG binding over 1,000-fold to low picomolar affinity without altering the large binding enthalpy, suggesting that bonding interactions with ligand and restriction of domain movements make independent contributions to binding. Fluorescence activation of a symmetrical fluorogen provides a selection mechanism for the isolation and directed evolution of ternary complexes where unnatural symmetric binding interfaces are favored over canonical antibody interfaces. As exemplified by L5*, these self-reporting complexes may be useful as modulators of protein association or as high affinity protein tags and capture reagents. PMID:23978698

  20. C-Terminal β9-Strand of the Cyclic Nucleotide-Binding Homology Domain Stabilizes Activated States of Kv11.1 Channels

    PubMed Central

    Ng, Chai Ann; Ke, Ying; Perry, Matthew D.; Tan, Peter S.; Hill, Adam P.; Vandenberg, Jamie I.

    2013-01-01

    Kv11.1 potassium channels are important for regulation of the normal rhythm of the heartbeat. Reduced activity of Kv11.1 channels causes long QT syndrome type 2, a disorder that increases the risk of cardiac arrhythmias and sudden cardiac arrest. Kv11.1 channels are members of the KCNH subfamily of voltage-gated K+ channels. However, they also share many similarities with the cyclic nucleotide gated ion channel family, including having a cyclic nucleotide-binding homology (cNBH) domain. Kv11.1 channels, however, are not directly regulated by cyclic nucleotides. Recently, crystal structures of the cNBH domain from mEAG and zELK channels, both members of the KCNH family of voltage-gated potassium channels, revealed that a C-terminal β9-strand in the cNBH domain occupied the putative cyclic nucleotide-binding site thereby precluding binding of cyclic nucleotides. Here we show that mutations to residues in the β9-strand affect the stability of the open state relative to the closed state of Kv11.1 channels. We also show that disrupting the structure of the β9-strand reduces the stability of the inactivated state relative to the open state. Clinical mutations located in this β9-strand result in reduced trafficking efficiency, which suggests that binding of the C-terminal β9-strand to the putative cyclic nucleotide-binding pocket is also important for assembly and trafficking of Kv11.1 channels. PMID:24204727

Top