Science.gov

Sample records for rna aptamer sequences

  1. Direct selection of RNA beacon aptamers.

    PubMed

    Morse, Daniel P

    2007-07-20

    A method for the direct selection of RNA molecules that can be easily converted into beacon aptamers is presented. Beacon aptamers are fluorescently labeled nucleic acids that signal the presence of a specific ligand through changes in fluorescence intensity. Typically, ligand binding causes an increase in fluorescence intensity by inducing a conformational change that separates a fluorophore/quencher pair. The method presented here simultaneously selects for ligand binding and induction of an appropriate conformational change. The method was tested by selecting RNA molecules that can detect the aminoglycoside antibiotic tobramycin. After 14 rounds of selection, two sequence families emerged. Upon conversion into beacon aptamers, representatives of the two selected sequence families specifically detected tobramycin, while a negative control RNA that did not survive the selection protocol did not function as a tobramycin beacon aptamer.

  2. In silico selection of RNA aptamers

    PubMed Central

    Chushak, Yaroslav; Stone, Morley O.

    2009-01-01

    In vitro selection of RNA aptamers that bind to a specific ligand usually begins with a random pool of RNA sequences. We propose a computational approach for designing a starting pool of RNA sequences for the selection of RNA aptamers for specific analyte binding. Our approach consists of three steps: (i) selection of RNA sequences based on their secondary structure, (ii) generating a library of three-dimensional (3D) structures of RNA molecules and (iii) high-throughput virtual screening of this library to select aptamers with binding affinity to a desired small molecule. We developed a set of criteria that allows one to select a sequence with potential binding affinity from a pool of random sequences and developed a protocol for RNA 3D structure prediction. As verification, we tested the performance of in silico selection on a set of six known aptamer–ligand complexes. The structures of the native sequences for the ligands in the testing set were among the top 5% of the selected structures. The proposed approach reduces the RNA sequences search space by four to five orders of magnitude—significantly accelerating the experimental screening and selection of high-affinity aptamers. PMID:19465396

  3. RNA aptamer inhibitors of a restriction endonuclease

    PubMed Central

    Mondragón, Estefanía; Maher, L. James

    2015-01-01

    Restriction endonucleases (REases) recognize and cleave short palindromic DNA sequences, protecting bacterial cells against bacteriophage infection by attacking foreign DNA. We are interested in the potential of folded RNA to mimic DNA, a concept that might be applied to inhibition of DNA-binding proteins. As a model system, we sought RNA aptamers against the REases BamHI, PacI and KpnI using systematic evolution of ligands by exponential enrichment (SELEX). After 20 rounds of selection under different stringent conditions, we identified the 10 most enriched RNA aptamers for each REase. Aptamers were screened for binding and specificity, and assayed for REase inhibition. We obtained eight high-affinity (Kd ∼12-30 nM) selective competitive inhibitors (IC50 ∼20-150 nM) for KpnI. Predicted RNA secondary structures were confirmed by in-line attack assay and a 38-nt derivative of the best anti-KpnI aptamer was sufficient for inhibition. These competitive inhibitors presumably act as KpnI binding site analogs, but lack the primary consensus KpnI cleavage sequence and are not cleaved by KpnI, making their potential mode of DNA mimicry fascinating. Anti-REase RNA aptamers could have value in studies of REase mechanism and may give clues to a code for designing RNAs that competitively inhibit DNA binding proteins including transcription factors. PMID:26184872

  4. Structural computational modeling of RNA aptamers

    PubMed Central

    Xu, Xiaojun; Dickey, David D.; Chen, Shi-Jie; Giangrande, Paloma H.

    2016-01-01

    RNA aptamers represent an emerging class of biologics that can be easily adapted for personalized and precision medicine. Several therapeutic aptamers with desirable binding and functional properties have been developed and evaluated in preclinical studies over the past 25 years. However, for the majority of these aptamers, their clinical potential has yet to be realized. A significant hurdle to the clinical adoption of this novel class of biologicals is the limited information on their secondary and tertiary structure. Knowledge of the RNA’s structure would greatly facilitate and expedite the post-selection optimization steps required for translation, including truncation (to reduce costs of manufacturing), chemical modification (to enhance stability and improve safety) and chemical conjugation (to improve drug properties for combinatorial therapy). Here we describe a structural computational modeling methodology that when coupled to a standard functional assay, can be used to determine key sequence and structural motifs of an RNA aptamer. We applied this methodology to enable the truncation of an aptamer to prostate specific membrane antigen (PSMA) with great potential for targeted therapy that had failed previous truncation attempts. This methodology can be easily applied to optimize other aptamers with therapeutic potential. PMID:26972787

  5. Investigating the malleability of RNA aptamers

    SciTech Connect

    Ilgu, Muslum; Wang, Tianjiao; Lamm, Monica H.; Nilsen-Hamilton, Marit

    2013-03-25

    Aptamers are short, single-stranded nucleic acids with structures that frequently change upon ligand binding and are sensitive to the ionic environment. To achieve facile application of aptamers in controlling cellular activities, a better understanding is needed of aptamer ligand binding parameters, structures, intramolecular mobilities and how these structures adapt to different ionic environments with consequent effects on their ligand binding characteristics.The paper discusses the integration of biochemical analysis with NMR spectroscopy and computational modeling to explore the relation between ligand binding and structural malleability of some well-studied aptamers. Several methods for determining aptamer binding affinity and specificity are discussed, including isothermal titration calorimetry, steady state fluorescence of 2-aminopurine substituted aptamers, and dye displacement assays. Also considered are aspects of molecular dynamics simulations specific to aptamers including adding ions and simulating aptamer structure in the absence of ligand when NMR spectroscopy or X-ray crystallography structures of the unoccupied aptamer are not available. We focus specifically on RNA aptamers that bind small molecule ligands as would be applied in sensors or integrated into riboswitches such as to measure the products of metabolic activity.

  6. RNA aptamers: from basic science towards therapy.

    PubMed

    Ulrich, H

    2006-01-01

    The SELEX technique (systematic evolution of ligands by exponential enrichment) provides a powerful tool for the in vitro selection of nucleic acid ligands (aptamers) from combinatorial oligonucleotide libraries against a target molecule. In the beginning of the technique's use, RNA molecules were identified that bind to proteins that naturally interact with nucleic acids or to small organic molecules. In the following years, the use of the SELEX technique was extended to isolate oligonucleotide ligands (aptamers) for a wide range of proteins of importance for therapy and diagnostics, such as growth factors and cell surface antigens. These oligonucleotides bind their targets with similar affinities and specificities as antibodies do. The in vitro selection of oligonucleotides with enzymatic activity, denominated aptazymes, allows the direct transduction of molecular recognition to catalysis. Recently, the use of in vitro selection methods to isolate protein inhibitors has been extended to complex targets, such as membrane-bound receptors, and even entire cells. RNA aptamers have also been expressed in living cells. These aptamers, also called intramers, can be used to dissect intracellular signal transduction pathways. The utility of RNA aptamers for in vivo experiments, as well as for diagnostic and therapeutic purposes, is considerably enhanced by chemical modifications, such as substitutions of the 2'-OH groups of the ribose backbone in order to provide resistance against enzymatic degradation in biological fluids. In an alternative approach, Spiegelmers are identified through in vitro selection of an unmodified D-RNA molecule against a mirror-image (i.e. a D-peptide) of a selection target, followed by synthesis of the unnatural nuclease-resistant L-configuration of the RNA aptamer that recognizes the natural configuration of its selection target (i.e. a L-peptide). Recently, nuclease-resistant inhibitory RNA aptamers have been developed against a great variety

  7. RNA Fluorescence with Light-Up Aptamers.

    PubMed

    Ouellet, Jonathan

    2016-01-01

    Seeing is not only believing; it also includes understanding. Cellular imaging with GFP in live cells has been transformative in many research fields. Modulation of cellular regulation is tightly regulated and innovative imaging technologies contribute to further understand cellular signaling and physiology. New types of genetically encoded biosensors have been developed over the last decade. They are RNA aptamers that bind with their cognate fluorogen ligands and activate their fluorescence. The emergence and the evolution of these RNA aptamers as well as their conversion into a wide spectrum of applications are examined in a global way. PMID:27446908

  8. RNA Fluorescence with Light-Up Aptamers

    PubMed Central

    Ouellet, Jonathan

    2016-01-01

    Seeing is not only believing; it also includes understanding. Cellular imaging with GFP in live cells has been transformative in many research fields. Modulation of cellular regulation is tightly regulated and innovative imaging technologies contribute to further understand cellular signaling and physiology. New types of genetically encoded biosensors have been developed over the last decade. They are RNA aptamers that bind with their cognate fluorogen ligands and activate their fluorescence. The emergence and the evolution of these RNA aptamers as well as their conversion into a wide spectrum of applications are examined in a global way. PMID:27446908

  9. RNA fluorescence with light-up aptamers

    NASA Astrophysics Data System (ADS)

    Ouellet, Jonathan

    2016-06-01

    Seeing is not only believing; it also includes understanding. Cellular imaging with GFP in live cells has been transformative in many research fields. Modulation of cellular regulation is tightly regulated and innovative imaging technologies contribute to further understand cellular signaling and physiology. New types of genetically encoded biosensors have been developed over the last decade. They are RNA aptamers that bind with their cognate fluorogen ligands and activate their fluorescence. The emergence and the evolution of these RNA aptamers as well as their conversion into a wide spectrum of applications are examined in a global way.

  10. Nucleotide Bias Observed with a Short SELEX RNA Aptamer Library

    PubMed Central

    Thiel, William H.; Bair, Thomas; Thiel, Kristina Wyatt; Dassie, Justin P.; Rockey, William M.; Howell, Craig A.; Liu, Xiuying Y.; Dupuy, Adam J.; Huang, Lingyan; Owczarzy, Richard; Behlke, Mark A.; McNamara, James O.

    2011-01-01

    Systematic evolution of ligands by exponential enrichment (SELEX) is a powerful in vitro selection process used for over 2 decades to identify oligonucleotide sequences (aptamers) with desired properties (usually high affinity for a protein target) from randomized nucleic acid libraries. In the case of RNA aptamers, several highly complex RNA libraries have been described with RNA sequences ranging from 71 to 81 nucleotides (nt) in length. In this study, we used high-throughput sequencing combined with bioinformatics analysis to thoroughly examine the nucleotide composition of the sequence pools derived from several selections that employed an RNA library (Sel2N20) with an abbreviated variable region. The Sel2N20 yields RNAs 51 nt in length, which unlike longer RNAs, are more amenable to large-scale chemical synthesis for therapeutic development. Our analysis revealed a consistent and early bias against inclusion of adenine, resulting in aptamers with lower predicted minimum free energies (ΔG) (higher structural stability). This bias was also observed in control, “nontargeted” selections in which the partition step (against the target) was omitted, suggesting that the bias occurred in 1 or more of the amplification and propagation steps of the SELEX process. PMID:21793789

  11. Identification of RNA aptamers with riboswitching properties.

    PubMed

    Schneider, Christopher; Suess, Beatrix

    2016-03-15

    During the past years customized gene network design has become of tremendous interest among various disciplines in life science. The identification of artificial genetic elements sensitive to internal or external stimuli constitutes the foundation for the design and realization of conditional gene expression systems. Typically, strategies involving selection or screening steps are employed alongside approaches focusing on rational design to select for the desired functionality of a given element. Here we present a fluorescence-based in vivo screening approach that combines an initial in vitro selection with subsequent extensive screening steps and a final rational design to identify RNA based regulators in baker's yeast. These artificial RNA regulators, termed synthetic riboswitches, are derived from RNA aptamers. Our method allows for the separation of aptamers featuring the potential to be transformed into a riboswitch from those inherently unable to confer control over gene expression. The system may be applied to virtually all existing aptamer-ligand pairs and as such presents a powerful means to enhance the setup of switchable genetic circuits. PMID:26672481

  12. Galaxy Workflows for Web-based Bioinformatics Analysis of Aptamer High-throughput Sequencing Data

    PubMed Central

    Thiel, William H

    2016-01-01

    Development of RNA and DNA aptamers for diagnostic and therapeutic applications is a rapidly growing field. Aptamers are identified through iterative rounds of selection in a process termed SELEX (Systematic Evolution of Ligands by EXponential enrichment). High-throughput sequencing (HTS) revolutionized the modern SELEX process by identifying millions of aptamer sequences across multiple rounds of aptamer selection. However, these vast aptamer HTS datasets necessitated bioinformatics techniques. Herein, we describe a semiautomated approach to analyze aptamer HTS datasets using the Galaxy Project, a web-based open source collection of bioinformatics tools that were originally developed to analyze genome, exome, and transcriptome HTS data. Using a series of Workflows created in the Galaxy webserver, we demonstrate efficient processing of aptamer HTS data and compilation of a database of unique aptamer sequences. Additional Workflows were created to characterize the abundance and persistence of aptamer sequences within a selection and to filter sequences based on these parameters. A key advantage of this approach is that the online nature of the Galaxy webserver and its graphical interface allow for the analysis of HTS data without the need to compile code or install multiple programs.

  13. Fabrication and characterization of RNA aptamer microarrays for the study of protein–aptamer interactions with SPR imaging

    PubMed Central

    Li, Yuan; Lee, Hye Jin; Corn, Robert M.

    2006-01-01

    RNA microarrays were created on chemically modified gold surfaces using a novel surface ligation methodology and employed in a series of surface plasmon resonance imaging (SPRI) measurements of DNA–RNA hybridization and RNA aptamer–protein binding. Various unmodified single-stranded RNA (ssRNA) oligonucleotides were ligated onto identical 5′-phosphate-terminated ssDNA microarray elements with a T4 RNA ligase surface reaction. A combination of ex situ polarization modulation FTIR measurements of the RNA monolayer and in situ SPRI measurements of DNA hybridization adsorption onto the surface were used to determine an ssRNA surface density of 4.0 × 1012 molecules/cm2 and a surface ligation efficiency of 85 ± 10%. The surface ligation methodology was then used to create a five-component RNA microarray of potential aptamers for the protein factor IXa (fIXa). The relative surface coverages of the different aptamers were determined through a novel enzymatic method that employed SPRI measurements of a surface RNase H hydrolysis reaction. SPRI measurements were then used to correctly identify the best aptamer to fIXa, which was previously determined from SELEX measurements. A Langmuir adsorption coefficient of 1.6 × 107 M−1 was determined for fIXa adsorption to this aptamer. Single-base variations from this sequence were shown to completely destroy the aptamer–fIXa binding interaction. PMID:17130155

  14. Structure analysis of free and bound states of an RNA aptamer against ribosomal protein S8 from Bacillus anthracis.

    PubMed

    Davlieva, Milya; Donarski, James; Wang, Jiachen; Shamoo, Yousif; Nikonowicz, Edward P

    2014-01-01

    Several protein-targeted RNA aptamers have been identified for a variety of applications and although the affinities of numerous protein-aptamer complexes have been determined, the structural details of these complexes have not been widely explored. We examined the structural accommodation of an RNA aptamer that binds bacterial r-protein S8. The core of the primary binding site for S8 on helix 21 of 16S rRNA contains a pair of conserved base triples that mold the sugar-phosphate backbone to S8. The aptamer, which does not contain the conserved sequence motif, is specific for the rRNA binding site of S8. The protein-free RNA aptamer adopts a helical structure with multiple non-canonical base pairs. Surprisingly, binding of S8 leads to a dramatic change in the RNA conformation that restores the signature S8 recognition fold through a novel combination of nucleobase interactions. Nucleotides within the non-canonical core rearrange to create a G-(G-C) triple and a U-(A-U)-U quartet. Although native-like S8-RNA interactions are present in the aptamer-S8 complex, the topology of the aptamer RNA differs from that of the helix 21-S8 complex. This is the first example of an RNA aptamer that adopts substantially different secondary structures in the free and protein-bound states and highlights the remarkable plasticity of RNA secondary structure.

  15. Structure analysis of free and bound states of an RNA aptamer against ribosomal protein S8 from Bacillus anthracis

    PubMed Central

    Davlieva, Milya; Donarski, James; Wang, Jiachen; Shamoo, Yousif; Nikonowicz, Edward P.

    2014-01-01

    Several protein-targeted RNA aptamers have been identified for a variety of applications and although the affinities of numerous protein-aptamer complexes have been determined, the structural details of these complexes have not been widely explored. We examined the structural accommodation of an RNA aptamer that binds bacterial r-protein S8. The core of the primary binding site for S8 on helix 21 of 16S rRNA contains a pair of conserved base triples that mold the sugar-phosphate backbone to S8. The aptamer, which does not contain the conserved sequence motif, is specific for the rRNA binding site of S8. The protein-free RNA aptamer adopts a helical structure with multiple non-canonical base pairs. Surprisingly, binding of S8 leads to a dramatic change in the RNA conformation that restores the signature S8 recognition fold through a novel combination of nucleobase interactions. Nucleotides within the non-canonical core rearrange to create a G-(G-C) triple and a U-(A-U)-U quartet. Although native-like S8-RNA interactions are present in the aptamer-S8 complex, the topology of the aptamer RNA differs from that of the helix 21-S8 complex. This is the first example of an RNA aptamer that adopts substantially different secondary structures in the free and protein-bound states and highlights the remarkable plasticity of RNA secondary structure. PMID:25140011

  16. Conformationally selective RNA aptamers allosterically modulate the β2-adrenoceptor.

    PubMed

    Kahsai, Alem W; Wisler, James W; Lee, Jungmin; Ahn, Seungkirl; Cahill Iii, Thomas J; Dennison, S Moses; Staus, Dean P; Thomsen, Alex R B; Anasti, Kara M; Pani, Biswaranjan; Wingler, Laura M; Desai, Hemant; Bompiani, Kristin M; Strachan, Ryan T; Qin, Xiaoxia; Alam, S Munir; Sullenger, Bruce A; Lefkowitz, Robert J

    2016-09-01

    G-protein-coupled receptor (GPCR) ligands function by stabilizing multiple, functionally distinct receptor conformations. This property underlies the ability of 'biased agonists' to activate specific subsets of a given receptor's signaling profile. However, stabilizing distinct active GPCR conformations to enable structural characterization of mechanisms underlying GPCR activation remains difficult. These challenges have accentuated the need for receptor tools that allosterically stabilize and regulate receptor function through unique, previously unappreciated mechanisms. Here, using a highly diverse RNA library combined with advanced selection strategies involving state-of-the-art next-generation sequencing and bioinformatics analyses, we identify RNA aptamers that bind a prototypical GPCR, the β2-adrenoceptor (β2AR). Using biochemical, pharmacological, and biophysical approaches, we demonstrate that these aptamers bind with nanomolar affinity at defined surfaces of the receptor, allosterically stabilizing active, inactive, and ligand-specific receptor conformations. The discovery of RNA aptamers as allosteric GPCR modulators significantly expands the diversity of ligands available to study the structural and functional regulation of GPCRs. PMID:27398998

  17. Current Progress of RNA Aptamer-Based Therapeutics

    PubMed Central

    Zhou, Jiehua; Bobbin, Maggie L.; Burnett, John C.; Rossi, John J.

    2012-01-01

    Aptamers are single-stranded nucleic acids that specifically recognize and bind tightly to their cognate targets due to their stable three-dimensional structure. Nucleic acid aptamers have been developed for various applications, including diagnostics, molecular imaging, biomarker discovery, target validation, therapeutics, and drug delivery. Due to their high specificity and binding affinity, aptamers directly block or interrupt the functions of target proteins making them promising therapeutic agents for the treatment of human maladies. Additionally, aptamers that bind to cell surface proteins are well suited for the targeted delivery of other therapeutics, such as conjugated small interfering RNAs (siRNA) that induce RNA interference (RNAi). Thus, aptamer-siRNA chimeras may offer dual-functions, in which the aptamer inhibits a receptor function, while the siRNA internalizes into the cell to target a specific mRNA. This review focuses on the current progress and therapeutic potential of RNA aptamers, including the use of cell-internalizing aptamers as cell-type specific delivery vehicles for targeted RNAi. In particular, we discuss emerging aptamer-based therapeutics that provide unique clinical opportunities for the treatment various cancers and neurological diseases. PMID:23130020

  18. Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins

    PubMed Central

    Challa, Sreerupa; Tzipori, Saul; Sheoran, Abhineet

    2014-01-01

    Infection with Shiga toxin- (Stx-) producing E. coli causes life threatening hemolytic uremic syndrome (HUS), a leading cause of acute renal failure in children. Of the two antigenically distinct toxins, Stx1 and Stx2, Stx2 is more firmly linked with the development of HUS. In the present study, selective evolution of ligands by exponential enrichment (SELEX) was used in an attempt to identify RNA aptamers against Stx1 and Stx2. After 5 rounds of selection, significant enrichment of aptamer pool was obtained against Stx2, but not against Stx1, using a RNA aptamer library containing 56 random nucleotides (N56). Characterization of individual aptamer sequences revealed that six unique RNA aptamers (mA/pC, mB/pA, mC, mD, pB, and pD) recognized Stx2 in a filter binding assay. None of these aptamers bound Stx1. Aptamers mA/pC, mB/pA, mC, and mD, but not pB and pD, partially blocked binding of Alexa 488-labeled Stx2 with HeLa cells in a flow cytometry assay. However, none of the aptamers neutralized Stx2-mediated cytotoxicity and death of HeLa cells. PMID:24839553

  19. Aptamers and the RNA world, past and present.

    PubMed

    Gold, Larry; Janjic, Nebojsa; Jarvis, Thale; Schneider, Dan; Walker, Jeffrey J; Wilcox, Sheri K; Zichi, Dom

    2012-03-01

    Aptamers and the SELEX process were discovered over two decades ago. These discoveries have spawned a productive academic and commercial industry. The collective results provide insights into biology, past and present, through an in vitro evolutionary exploration of the nature of nucleic acids and their potential roles in ancient life. Aptamers have helped usher in an RNA renaissance. Here we explore some of the evolution of the aptamer field and the insights it has provided for conceptualizing an RNA world, from its nascence to our current endeavor employing aptamers in human proteomics to discover biomarkers of health and disease. PMID:21441582

  20. Aptamers and the RNA World, Past and Present

    PubMed Central

    Gold, Larry; Janjic, Nebojsa; Jarvis, Thale; Schneider, Dan; Walker, Jeffrey J.; Wilcox, Sheri K.; Zichi, Dom

    2012-01-01

    Summary Aptamers and the SELEX process were discovered over two decades ago. These discoveries have spawned a productive academic and commercial industry. The collective results provide insights into biology, past and present, through an in vitro evolutionary exploration of the nature of nucleic acids and their potential roles in ancient life. Aptamers have helped usher in an RNA renaissance. Here we explore some of the evolution of the aptamer field and the insights it has provided for conceptualizing an RNA world, from its nascence to our current endeavor employing aptamers in human proteomics to discover biomarkers of health and disease. PMID:21441582

  1. Rationally Designing Aptamer Sequences with Reduced Affinity for Controlled Sensor Performance

    PubMed Central

    Schoukroun-Barnes, Lauren R.; White, Ryan J.

    2015-01-01

    The relative ease of predicting the secondary structure of nucleic acid sequences lends itself to the design of sequences to perform desired functions. Here, we combine the utility of nucleic acid aptamers with predictable control over the secondary structure to rationally design sequences with controlled affinity towards a target analyte when employed as the recognition element in an electrochemical sensor. Specifically, we present a method to modify an existing high-gain aptamer sequence to create sequences that, when employed in an electrochemical, aptamer-based sensor, exhibit reduced affinity towards a small molecule analyte tobramycin. Sensors fabricated with the high-gain parent sequence saturate at concentrations much below the therapeutic window for tobramycin (7–18 µM). Accordingly, the rationale behind modifying this high-gain sequence to reduce binding affinity was to tune sensor performance for optimal sensitivity in the therapeutic window. Using secondary structure predictions and analysis of the NMR structure of an aminoglycoside RNA aptamer bound to tobramycin, we are able to successfully modify the aptamer sequence to tune the dissociation constants of electrochemical aptamer-based sensors between 0.17 and 3 µM. The guidelines we present represent a general strategy to lessening binding affinity of sensors employing aptamer-modified electrodes. PMID:25835184

  2. Aptaligner: automated software for aligning pseudorandom DNA X-aptamers from next-generation sequencing data.

    PubMed

    Lu, Emily; Elizondo-Riojas, Miguel-Angel; Chang, Jeffrey T; Volk, David E

    2014-06-10

    Next-generation sequencing results from bead-based aptamer libraries have demonstrated that traditional DNA/RNA alignment software is insufficient. This is particularly true for X-aptamers containing specialty bases (W, X, Y, Z, ...) that are identified by special encoding. Thus, we sought an automated program that uses the inherent design scheme of bead-based X-aptamers to create a hypothetical reference library and Markov modeling techniques to provide improved alignments. Aptaligner provides this feature as well as length error and noise level cutoff features, is parallelized to run on multiple central processing units (cores), and sorts sequences from a single chip into projects and subprojects.

  3. Structure and Sequence Search on Aptamer-Protein Docking

    NASA Astrophysics Data System (ADS)

    Xiao, Jiajie; Bonin, Keith; Guthold, Martin; Salsbury, Freddie

    2015-03-01

    Interactions between proteins and deoxyribonucleic acid (DNA) play a significant role in the living systems, especially through gene regulation. However, short nucleic acids sequences (aptamers) with specific binding affinity to specific proteins exhibit clinical potential as therapeutics. Our capillary and gel electrophoresis selection experiments show that specific sequences of aptamers can be selected that bind specific proteins. Computationally, given the experimentally-determined structure and sequence of a thrombin-binding aptamer, we can successfully dock the aptamer onto thrombin in agreement with experimental structures of the complex. In order to further study the conformational flexibility of this thrombin-binding aptamer and to potentially develop a predictive computational model of aptamer-binding, we use GPU-enabled molecular dynamics simulations to both examine the conformational flexibility of the aptamer in the absence of binding to thrombin, and to determine our ability to fold an aptamer. This study should help further de-novo predictions of aptamer sequences by enabling the study of structural and sequence-dependent effects on aptamer-protein docking specificity.

  4. Exploring the sequence space of a DNA aptamer using microarrays

    PubMed Central

    Katilius, Evaldas; Flores, Carole; Woodbury, Neal W.

    2007-01-01

    The relationship between sequence and binding properties of an aptamer for immunoglobulin E (IgE) was investigated using custom DNA microarrays. Single, double and some triple mutations of the aptamer sequence were created to evaluate the importance of specific base composition on aptamer binding. The majority of the positions in the aptamer sequence were found to be immutable, with changes at these positions resulting in more than a 100-fold decrease in binding affinity. Improvements in binding were observed by altering the stem region of the aptamer, suggesting that it plays a significant role in binding. Results obtained for the various mutations were used to estimate the information content and the probability of finding a functional aptamer sequence by selection from a random library. For the IgE-binding aptamer, this probability is on the order of 10−10 to 10−9. Results obtained for the double and triple mutations also show that there are no compensatory mutations within the space defined by those mutations. Apparently, at least for this particular aptamer, the functional sequence space can be represented as a rugged landscape with sharp peaks defined by highly constrained base compositions. This makes the rational optimization of aptamer sequences using step-wise mutagenesis approaches very challenging. PMID:17981839

  5. Structural basis for recognition of Co2+ by RNA aptamers.

    PubMed

    Wrzesinski, Jan; Jóźwiakowski, Stanisław K

    2008-04-01

    Co(2+) binding RNA aptamers were chosen as research models to reveal the structural basis underlying the recognition of Co(2+) by RNA, with the application of two distinct methods. Using the nucleotide analog interference mapping assay, we found strong interference effects after incorporation of the 7-deaza guanosine phosphorotioate analog into the RNA chain at equivalent positions G27 and G28 in aptamer no. 18 and G25 and G26 in aptamer no. 20. The results obtained by nucleotide analog interference mapping suggest that these guanine bases are crucial for the creation of Co(2+) binding sites and that they appear to be involved in the coordination of the ion to the exposed N7 atom of the tandem guanines. Additionally, most 7-deaza guanosine phosphorotioate and 7-deaza adenosine phosphorotioate interferences were located in the common motifs: loop E-like in aptamer no. 18 and kissing dimer in aptamer no. 20. We also found that purine-rich stretches containing guanines with the highest interference values were the targets for hybridization of 6-mers, which are members of the semi-random oligodeoxyribonucleotide library in both aptamers. It transpired that DNA oligomer directed RNase H digestions are sensitive to Co(2+) and, at an elevated metal ion concentration, the hybridization of oligomers to aptamer targets is inhibited, probably due to higher stability and complexity of the RNA structure. PMID:18312410

  6. Theophylline detection in serum using a self-assembling RNA aptamer-based gold nanoparticle sensor.

    PubMed

    Jiang, Hongyan; Ling, Kai; Tao, Xiaojun; Zhang, Qiqing

    2015-08-15

    Recently, DNA aptamer-gold nanoparticle (AuNP) conjugates have emerged as novel biosensing tools. Although RNA aptamers are more advantageous than DNA aptamers, their vulnerable nature during the construction of these conjugates restricts the development of RNA aptasensors. In this study, we developed an RNA aptamer-based AuNP sensor for the detection of theophylline in serum, combining the high binding affinity and selectivity of a theophylline RNA aptamer and the fluorescence quenching ability of AuNPs. In order to prevent nuclease degradation during the experimental process, the single strand of the theophylline RNA aptamer (33-mer) was split at the end loop region into two shorter halves, which were able to reassemble to form the theophylline-binding pocket. One fragment was linked to a DNA sequence that included a 15 thymine (T15) spacer and a polyadenine (polyA, A12) tail. The chimeric RNA/DNA oligonucleotide was attached to AuNPs within a few minutes via adsorption of the polyA tail. The other fragment was labeled with a fluorophore (Cy3). The two individual fragments self-assembled in the presence of theophylline. Upon ligand binding, the fragments came into close proximity, resulting in fluorescence quenching. This sensor exhibited a low detection limit of 0.05 µM, with a linear dynamic range from 0.1 to 10 µM in serum. Moreover, the sensor did not recognize theophylline-related compounds (e.g., caffeine and theobromine), demonstrating its high selectivity. This strategy offers new possibilities for the application of RNA aptasensors in clinical settings.

  7. Enhancing the analytical performance of electrochemical RNA aptamer-based sensors for sensitive detection of aminoglycoside antibiotics.

    PubMed

    Schoukroun-Barnes, Lauren R; Wagan, Samiullah; Wagan, Samuillah; White, Ryan J

    2014-01-21

    Folding-based electrochemical sensors utilizing structure-switching aptamers are specific, selective, sensitive, and widely applicable to the detection of a variety of target analytes. The specificity is achieved by the binding properties of an electrode-bound RNA or DNA aptamer biorecognition element. Signaling in this class of sensors arises from changes in electron transfer efficiency upon target-induced changes in the conformation/flexibility of the aptamer probe. These changes can be readily monitored electrochemically. Because of this signaling mechanism, there are several approaches to maximizing the analytical attributes (i.e., sensitivity, limit of detection, and observed binding affinity) of the aptamer sensor. Here, we present a systematic study of several approaches, including electrochemical interrogation parameters and biomolecular engineering of the aptamer sequence, to develop a sensor for the detection of aminoglycoside antibiotics. Specifically, through a combination of optimizing the electrochemical signal and engineering the parent 26-nucleotide RNA aptamer sequence to undergo larger conformation changes, we develop several improved sensors. These sensors exhibit binding affinities ranging from 220 nM to 42 μM, as much as a 100-fold improved limit of detection in comparison to previously reported sensors, and a variety of linear ranges including the therapeutic window for tobramycin. These data demonstrate that rational engineering of the aptamer structure to create large conformation changes upon target binding leads to improved sensor performance. We believe that the sensor design guidelines outlined here represent a general strategy for developing new aptamer folding-based electrochemical sensors.

  8. Anti-Transcription Factor RNA Aptamers as Potential Therapeutics

    PubMed Central

    Mondragón, Estefanía

    2016-01-01

    Transcription factors (TFs) are DNA-binding proteins that play critical roles in regulating gene expression. These proteins control all major cellular processes, including growth, development, and homeostasis. Because of their pivotal role, cells depend on proper TF function. It is, therefore, not surprising that TF deregulation is linked to disease. The therapeutic drug targeting of TFs has been proposed as a frontier in medicine. RNA aptamers make interesting candidates for TF modulation because of their unique characteristics. The products of in vitro selection, aptamers are short nucleic acids (DNA or RNA) that bind their targets with high affinity and specificity. Aptamers can be expressed on demand from transgenes and are intrinsically amenable to recognition by nucleic acid-binding proteins such as TFs. In this study, we review several natural prokaryotic and eukaryotic examples of RNAs that modulate the activity of TFs. These examples include 5S RNA, 6S RNA, 7SK, hepatitis delta virus-RNA (HDV-RNA), neuron restrictive silencer element (NRSE)-RNA, growth arrest-specific 5 (Gas5), steroid receptor RNA activator (SRA), trophoblast STAT utron (TSU), the 3′ untranslated region of caudal mRNA, and heat shock RNA-1 (HSR1). We then review examples of unnatural RNA aptamers selected to inhibit TFs nuclear factor-kappaB (NF-κB), TATA-binding protein (TBP), heat shock factor 1 (HSF1), and runt-related transcription factor 1 (RUNX1). The field of RNA aptamers for DNA-binding proteins continues to show promise. PMID:26509637

  9. Selection and characterization of anti-NF-κB p65 RNA aptamers

    PubMed Central

    Wurster, Susan E.; Maher, L. James

    2008-01-01

    NF-κB transcription factors include a group of five mammalian proteins that form hetero- or homodimers and regulate hundreds of target genes involved in acute inflammation, HIV-1 transcription activation, and resistance to cancer therapy. We previously used in vitro selection to develop a small RNA aptamer (anti-p50) that binds the DNA-binding domain of NF-κB p502 with low nanomolar affinity but does not bind NF-κB p652. Here, we report the in vitro selection of anti-NF-κB p65 RNA aptamers using parallel in vitro selections with either a fully randomized RNA library or a degenerate RNA library based on the primary sequence of the 31-nucleotide anti-p50 RNA aptamer. We report the characterization of these aptamers with respect to NF-κB target specificity, affinity, minimal sequence requirements, secondary structure, and competition with DNA κB sites. These results expand opportunities for artificial inhibition of NF-κB transcription factor dimers containing p65 subunits. PMID:18426920

  10. DNA and RNA aptamers as modulators of protein function.

    PubMed

    Ulrich, Henning

    2005-03-01

    The SELEX technique (systematic evolution of ligands by exponential enrichment) is a combinatorial library approach in which DNA or RNA molecules are selected by their ability to bind their protein targets with high affinity and specificity. The isolated molecules are referred to as aptamers (from aptus = Latin "to fit"). First, RNA and DNA aptamers were identified that bind to proteins naturally interacting with nucleic acids, or to small organic molecules such as ATP. In the following years, the use of the SELEX technique was extended to isolate oligonucleotide ligands for a wide range of proteins of importance for therapy, and diagnostics. Since these RNA and DNA molecules bind their targets with similar affinities as antibodies, and are able to distinguish between isotypes of an enzyme, aptamers have been also called synthetic antibodies. Recently, the use of in vitro selection methods to isolate protein inhibitors has been extended to complex targets, such as receptors that are only functional in their membrane-bound form, cells, and trypanosomes. RNA aptamers have been expressed in living cells where they inhibit a protein implicated in intracellular signal transduction. The utility of aptamers for in vivo experiments, and diagnostic and therapeutic purposes, is considerably enhanced by introducing chemical modifications into the oligonucleotides to provide resistance against enzymatic degradation in body fluids. Recently, such inhibitors have been evolved for a great variety of targets, including receptors, growth factors, and adhesion molecules implicated in disease. Furthermore, some results were already obtained in animal models and clinical trials. PMID:16787315

  11. Selection of RNA aptamers that bind specifically to the NS3 protease of hepatitis C virus.

    PubMed

    Urvil, P T; Kakiuchi, N; Zhou, D M; Shimotohno, K; Kumar, P K; Nishikawa, S

    1997-08-15

    The RNA genome of human hepatitis C virus (HCV) is translated into a large precursor polyprotein. The NS3 protease of HCV has a crucial role in the processing of the polyprotein into functional viral proteins. We have used an in vitro genetic-selection strategy to isolate high-affinity RNA aptamers that bind to the NS3 protein, especially to its protease domain. Starting from a RNA pool that had a random sequence core of 12-18 nucleotides, aptamers that bind specifically to the NS3 protein were selected after 10 rounds of selection and amplification. A single aptamer, 10G-1, was found predominantly (71%) in the selected pool. This aptamer could bind to the NS3 protein with a binding constant of 650 nM and inhibit the proteolytic activity in vitro. By phosphate-modification-interference analysis we showed that the phosphate residues that are critical for the binding of 10G-1 to NS3 lie within the selected regions of the aptamer and that binding involves electrostatic contacts with the phosphates of regions G28-U34 and A47-A55. The NS3-binding region in 10G-1 can serve as a basis for designing more potential inhibitors of the NS3 protein.

  12. Characterization of RNA aptamers that disrupt the RUNX1–CBFβ/DNA complex

    PubMed Central

    Barton, Jenny L.; Bunka, David H. J.; Knowling, Stuart E.; Lefevre, Pascal; Warren, Alan J.; Bonifer, Constanze; Stockley, Peter G.

    2009-01-01

    The transcription factor RUNX1 (AML1) is an important regulator of haematopoiesis, and an important fusion partner in leukaemic translocations. High-affinity DNA binding by RUNX1 requires the interaction of the RUNX1 Runt-Homology-Domain (RHD) with the core-binding factor β protein (CBFβ). To generate novel reagents for in vitro and in vivo studies of RUNX1 function, we have selected high-affinity RNA aptamers against a recombinant RHD–CBFβ complex. Selection yielded two sequence families, each dominated by a single consensus sequence. Aptamers from each family disrupt DNA binding by the RUNX1 protein in vitro and compete with sequence-specific dsDNA binding. Minimal, high-affinity (∼100–160 nM) active aptamer fragments 28 and 30 nts in length, consisting of simple short stem-loop structures, were then identified. These bind to the RHD subunit and disrupt its interaction with CBFβ, which is consistent with reduced DNA affinity in the presence of aptamer. These aptamers represent new reagents that target a novel surface on the RHD required to stabilize the recombinant RHD–CBFβ complex and thus will further aid exploring the functions of this key transcription factor. PMID:19740763

  13. An RNA-aptamer-based two-color CRISPR labeling system

    PubMed Central

    Wang, Siyuan; Su, Jun-Han; Zhang, Feng; Zhuang, Xiaowei

    2016-01-01

    The spatial organization and dynamics of chromatin play important roles in essential biological functions. However, direct visualization of endogenous genomic loci in living cells has proven to be laborious until the recent development of CRISPR-Cas9-based chromatin labeling methods. These methods rely on the recognition of specific DNA sequences by CRISPR single-guide RNAs (sgRNAs) and fluorescent–protein-fused catalytically inactive Cas9 to label specific chromatin loci in cells. Previously, multicolor chromatin labeling has been achieved using orthogonal Cas9 proteins from different bacterial species fused to different fluorescent proteins. Here we report the development of an alternative two-color CRISPR labeling method using only the well-characterized Streptococcus pyogenes Cas9, by incorporating MS2 or PP7 RNA aptamers into the sgRNA. The MS2 or PP7 aptamers then recruit the corresponding MS2 or PP7 coat proteins fused with different fluorescent proteins to the target genomic loci. Here we demonstrate specific and orthogonal two-color labeling of repetitive sequences in living human cells using this method. By attaching the MS2 or PP7 aptamers to different locations on the sgRNA, we found that extending the tetraloop and stem loop 2 of the sgRNA with MS2 or PP7 aptamers enhances the signal-to-background ratio of chromatin imaging. PMID:27229896

  14. An RNA-aptamer-based two-color CRISPR labeling system.

    PubMed

    Wang, Siyuan; Su, Jun-Han; Zhang, Feng; Zhuang, Xiaowei

    2016-01-01

    The spatial organization and dynamics of chromatin play important roles in essential biological functions. However, direct visualization of endogenous genomic loci in living cells has proven to be laborious until the recent development of CRISPR-Cas9-based chromatin labeling methods. These methods rely on the recognition of specific DNA sequences by CRISPR single-guide RNAs (sgRNAs) and fluorescent-protein-fused catalytically inactive Cas9 to label specific chromatin loci in cells. Previously, multicolor chromatin labeling has been achieved using orthogonal Cas9 proteins from different bacterial species fused to different fluorescent proteins. Here we report the development of an alternative two-color CRISPR labeling method using only the well-characterized Streptococcus pyogenes Cas9, by incorporating MS2 or PP7 RNA aptamers into the sgRNA. The MS2 or PP7 aptamers then recruit the corresponding MS2 or PP7 coat proteins fused with different fluorescent proteins to the target genomic loci. Here we demonstrate specific and orthogonal two-color labeling of repetitive sequences in living human cells using this method. By attaching the MS2 or PP7 aptamers to different locations on the sgRNA, we found that extending the tetraloop and stem loop 2 of the sgRNA with MS2 or PP7 aptamers enhances the signal-to-background ratio of chromatin imaging. PMID:27229896

  15. Cell-type Specific Aptamer and Aptamer-siRNA Conjugates for Targeted HIV-1 Therapy

    PubMed Central

    Zhou, Jiehua; Rossi, John

    2014-01-01

    Human immunodeficiency virus (HIV) is a virus that causes acquired immunodeficiency syndrome (AIDS), a chronic and incurable disease of the human immune system. As the standard of care for the patients with HIV-1, current highly active antiretroviral treatment (HAART) has been therapeutically effective in the majority of patients; however, it is not curative, and HAART is intolerable due to server side effects. Therefore, nucleic acid-based therapeutics, such as antisense oligonucleotide, ribozyme, mRNA, RNAi-based therapeutics, aptamer, etc., have been actively developed as alternative or adjuvant agents for those chemical antiviral drugs in order to surmount those drawbacks. The combinatorial use of various antiviral nucleic acids could be more efficacious in blocking viral replication and preventing the emergence of resistant variants. In this regard, RNA interference (RNAi) can function as a gene-specific therapeutic option for controlling HIV-1 replication. Another type of therapeutic nucleic acid – aptamers – shows promise as a new and potent class of anti-HIV agent and can additionally function as a cell-type-specific delivery vehicle for targeted RNAi. The combined use of small interfering RNA (siRNAs) and aptamers could effectively block viral replication and prevent the emergence of resistant variants. The present review offers a brief overview of the use of cell-type specific aptamer and aptamer-siRNA conjugates development in our group for the treatment of HIV-1. Their potentials for targeted delivering RNAi therapeutics (e.g. siRNA) and suppressing HIV-1 replication in vitro and in humanized animal model will be highlighted here. PMID:25118114

  16. RNA mango aptamer-fluorophore: a bright, high-affinity complex for RNA labeling and tracking.

    PubMed

    Dolgosheina, Elena V; Jeng, Sunny C Y; Panchapakesan, Shanker Shyam S; Cojocaru, Razvan; Chen, Patrick S K; Wilson, Peter D; Hawkins, Nancy; Wiggins, Paul A; Unrau, Peter J

    2014-10-17

    Because RNA lacks strong intrinsic fluorescence, it has proven challenging to track RNA molecules in real time. To address this problem and to allow the purification of fluorescently tagged RNA complexes, we have selected a high affinity RNA aptamer called RNA Mango. This aptamer binds a series of thiazole orange (fluorophore) derivatives with nanomolar affinity, while increasing fluorophore fluorescence by up to 1,100-fold. Visualization of RNA Mango by single-molecule fluorescence microscopy, together with injection and imaging of RNA Mango/fluorophore complex in C. elegans gonads demonstrates the potential for live-cell RNA imaging with this system. By inserting RNA Mango into a stem loop of the bacterial 6S RNA and biotinylating the fluorophore, we demonstrate that the aptamer can be used to simultaneously fluorescently label and purify biologically important RNAs. The high affinity and fluorescent properties of RNA Mango are therefore expected to simplify the study of RNA complexes. PMID:25101481

  17. Screening and Characterization of a Novel RNA Aptamer That Specifically Binds to Human Prostatic Acid Phosphatase and Human Prostate Cancer Cells

    PubMed Central

    Kong, Hoon Young; Byun, Jonghoe

    2015-01-01

    Prostatic acid phosphatase (PAP) expression increases proportionally with prostate cancer progression, making it useful in prognosticating intermediate to high-risk prostate cancers. A novel ligand that can specifically bind to PAP would be very helpful for guiding prostate cancer therapy. RNA aptamers bind to target molecules with high specificity and have key advantages such as low immunogenicity and easy synthesis. Here, human PAP-specific aptamers were screened from a 2′-fluoropyrimidine (FY)-modified RNA library by SELEX. The candidate aptamer families were identified within six rounds followed by analysis of their sequences and PAP-specific binding. A gel shift assay was used to identify PAP binding aptamers and the 6N aptamer specifically bound to PAP with a Kd value of 118 nM. RT-PCR and fluorescence labeling analyses revealed that the 6N aptamer bound to PAP-positive mammalian cells, such as PC-3 and LNCaP. IMR-90 negative control cells did not bind the 6N aptamer. Systematic minimization analyses revealed that 50 nucleotide sequences and their two hairpin structures in the 6N 2′-FY RNA aptamer were equally important for PAP binding. Renewed interest in PAP combined with the versatility of RNA aptamers, including conjugation of anti-cancer drugs and nano-imaging probes, could open up a new route for early theragnosis of prostate cancer. PMID:25591398

  18. Massively Parallel Interrogation of Aptamer Sequence, Structure and Function

    SciTech Connect

    Fischer, N O; Tok, J B; Tarasow, T M

    2008-02-08

    Optimization of high affinity reagents is a significant bottleneck in medicine and the life sciences. The ability to synthetically create thousands of permutations of a lead high-affinity reagent and survey the properties of individual permutations in parallel could potentially relieve this bottleneck. Aptamers are single stranded oligonucleotides affinity reagents isolated by in vitro selection processes and as a class have been shown to bind a wide variety of target molecules. Methodology/Principal Findings. High density DNA microarray technology was used to synthesize, in situ, arrays of approximately 3,900 aptamer sequence permutations in triplicate. These sequences were interrogated on-chip for their ability to bind the fluorescently-labeled cognate target, immunoglobulin E, resulting in the parallel execution of thousands of experiments. Fluorescence intensity at each array feature was well resolved and shown to be a function of the sequence present. The data demonstrated high intra- and interchip correlation between the same features as well as among the sequence triplicates within a single array. Consistent with aptamer mediated IgE binding, fluorescence intensity correlated strongly with specific aptamer sequences and the concentration of IgE applied to the array. The massively parallel sequence-function analyses provided by this approach confirmed the importance of a consensus sequence found in all 21 of the original IgE aptamer sequences and support a common stem:loop structure as being the secondary structure underlying IgE binding. The microarray application, data and results presented illustrate an efficient, high information content approach to optimizing aptamer function. It also provides a foundation from which to better understand and manipulate this important class of high affinity biomolecules.

  19. Spinach RNA aptamer detects lead (II) with high selectivity†

    PubMed Central

    DasGupta, Saurja; Shelke, Sandip A.; Li, Nan-sheng

    2015-01-01

    Spinach RNA aptamer contains a G-quadruplex motif that serves as a platform for binding and fluorescence activation of a GFP-like fluorophore. Here we show that Pb2+ induces formation of Spinach’s G-quadruplex and activates fluorescence with high selectivity and sensitivity. This device establishes the first example of an RNA-based sensor that provides a simple and inexpensive tool for Pb2+ detection. PMID:25940073

  20. In-gel imaging of RNA processing using Broccoli reveals optimal aptamer expression strategies

    PubMed Central

    Filonov, Grigory S.; Kam, Christina W.; Song, Wenjiao; Jaffrey, Samie R.

    2015-01-01

    SUMMARY RNA aptamers can be expressed in cells to influence and image cellular processes. Aptamer folding is maintained by inserting the aptamers into highly structured RNA scaffolds. Here we show that commonly used RNA scaffolds exhibit unexpected instability and cleavage in bacterial and mammalian cells. Using an in-gel staining approach for rapid and simple detection of Spinach- or Broccoli-tagged RNAs in cells, we monitored the processing of RNAs tagged with scaffolded aptamers, revealing endonucleolytic cleavage, RNA instability and poor expression. We reengineered a natural three-way junction structure to generate an alternative scaffold that enables stable aptamer expression in cells. This scaffold was used to create cassettes containing up to four Broccoli units, markedly enhancing the brightness of mammalian cells expressing cassette-tagged RNAs. These experiments describe methods for screening RNA cleavage events in cells, and identify cell-compatible scaffolds that enable efficient tagging of RNAs with aptamers for cellular expression. PMID:26000751

  1. Automated physics-based design of synthetic riboswitches from diverse RNA aptamers.

    PubMed

    Espah Borujeni, Amin; Mishler, Dennis M; Wang, Jingzhi; Huso, Walker; Salis, Howard M

    2016-01-01

    Riboswitches are shape-changing regulatory RNAs that bind chemicals and regulate gene expression, directly coupling sensing to cellular actuation. However, it remains unclear how their sequence controls the physics of riboswitch switching and activation, particularly when changing the ligand-binding aptamer domain. We report the development of a statistical thermodynamic model that predicts the sequence-structure-function relationship for translation-regulating riboswitches that activate gene expression, characterized inside cells and within cell-free transcription-translation assays. Using the model, we carried out automated computational design of 62 synthetic riboswitches that used six different RNA aptamers to sense diverse chemicals (theophylline, tetramethylrosamine, fluoride, dopamine, thyroxine, 2,4-dinitrotoluene) and activated gene expression by up to 383-fold. The model explains how aptamer structure, ligand affinity, switching free energy and macromolecular crowding collectively control riboswitch activation. Our model-based approach for engineering riboswitches quantitatively confirms several physical mechanisms governing ligand-induced RNA shape-change and enables the development of cell-free and bacterial sensors for diverse applications.

  2. Automated physics-based design of synthetic riboswitches from diverse RNA aptamers

    PubMed Central

    Espah Borujeni, Amin; Mishler, Dennis M.; Wang, Jingzhi; Huso, Walker; Salis, Howard M.

    2016-01-01

    Riboswitches are shape-changing regulatory RNAs that bind chemicals and regulate gene expression, directly coupling sensing to cellular actuation. However, it remains unclear how their sequence controls the physics of riboswitch switching and activation, particularly when changing the ligand-binding aptamer domain. We report the development of a statistical thermodynamic model that predicts the sequence-structure-function relationship for translation-regulating riboswitches that activate gene expression, characterized inside cells and within cell-free transcription–translation assays. Using the model, we carried out automated computational design of 62 synthetic riboswitches that used six different RNA aptamers to sense diverse chemicals (theophylline, tetramethylrosamine, fluoride, dopamine, thyroxine, 2,4-dinitrotoluene) and activated gene expression by up to 383-fold. The model explains how aptamer structure, ligand affinity, switching free energy and macromolecular crowding collectively control riboswitch activation. Our model-based approach for engineering riboswitches quantitatively confirms several physical mechanisms governing ligand-induced RNA shape-change and enables the development of cell-free and bacterial sensors for diverse applications. PMID:26621913

  3. Automated physics-based design of synthetic riboswitches from diverse RNA aptamers.

    PubMed

    Espah Borujeni, Amin; Mishler, Dennis M; Wang, Jingzhi; Huso, Walker; Salis, Howard M

    2016-01-01

    Riboswitches are shape-changing regulatory RNAs that bind chemicals and regulate gene expression, directly coupling sensing to cellular actuation. However, it remains unclear how their sequence controls the physics of riboswitch switching and activation, particularly when changing the ligand-binding aptamer domain. We report the development of a statistical thermodynamic model that predicts the sequence-structure-function relationship for translation-regulating riboswitches that activate gene expression, characterized inside cells and within cell-free transcription-translation assays. Using the model, we carried out automated computational design of 62 synthetic riboswitches that used six different RNA aptamers to sense diverse chemicals (theophylline, tetramethylrosamine, fluoride, dopamine, thyroxine, 2,4-dinitrotoluene) and activated gene expression by up to 383-fold. The model explains how aptamer structure, ligand affinity, switching free energy and macromolecular crowding collectively control riboswitch activation. Our model-based approach for engineering riboswitches quantitatively confirms several physical mechanisms governing ligand-induced RNA shape-change and enables the development of cell-free and bacterial sensors for diverse applications. PMID:26621913

  4. A self-assembling RNA aptamer-based graphene oxide sensor for the turn-on detection of theophylline in serum.

    PubMed

    Ling, Kai; Jiang, Hongyan; Li, Yang; Tao, Xiaojun; Qiu, Chen; Li, Fu-Rong

    2016-12-15

    To date, few effective fluorescent biosensors based on RNA aptamers have been developed because the intrinsic instability of RNA in the presence of nucleases precludes the application of RNA aptamers for the analysis of biological fluids. In this study, we developed a simple, sensitive, selective turn-on fluorescent aptasensor for theophylline detection in serum, utilizing ligand-induced self-assembling RNA aptamers and two different interaction stages of the aptamer fragments with graphene oxide (GO). A single strand of the theophylline RNA aptamer (33-mer) was split at the end loop region into two shorter fragments, one of which was labeled with a fluorophore (FAM). In the absence of theophylline, the adsorption of the two individual fragments on GO brought the fluorophore in close proximity to the GO surface, resulting in highly efficient quenching of fluorescence. The system showed very low background fluorescence. Conversely, the fragments self-assembled into an RNA aptamer/theophylline complex and were dissociated from GO. The quenched fluorescence was significantly recovered, and theophylline could be detected at a wide range of concentrations from 1 to 100μM, with a detection limit of 0.155μM and good selectivity in serum. Moreover, because of the shorter RNA fragments and the effective protection ability of GO from nuclease cleavage, the RNA sequences remained stable during the experiments. This design may serve as an example for the application of RNA aptasensors in the clinical setting.

  5. RNA-based networks: using RNA aptamers and ribozymes as synthetic genetic devices.

    PubMed

    Weigand, Julia E; Wittmann, Alexander; Suess, Beatrix

    2012-01-01

    Within the last few years, a set of synthetic riboswitches has been engineered, which expands the toolbox of genetic regulatory devices. Small molecule binding aptamers have been used for the design of such riboswitches by insertion into untranslated regions of mRNAs, exploiting the fact that upon ligand binding the RNA structure interferes either with translation initiation or pre-mRNA splicing in yeast. In combination with self-cleaving ribozymes, aptamers have been used to modulate RNA stability. In this chapter, we discuss the applicability of different aptamers, ways to identify novel genetic devices, the pros and cons of various insertion sites and the application of allosteric ribozymes. Our expertise help to apply synthetic riboswitches to engineer complex genetic circuits. PMID:22083741

  6. Cell-Internalization SELEX: Method for Identifying Cell-Internalizing RNA Aptamers for Delivering siRNAs to Target Cells

    PubMed Central

    Thiel, William H.; Thiel, Kristina W.; Flenker, Katie S.; Bair, Tom; Dupuy, Adam J.; McNamara, James O.; Miller, Francis J.; Giangrande, Paloma H.

    2015-01-01

    After a decade of work to address cellular uptake, the principal obstacle to RNAi-based therapeutics, there is now well-deserved, renewed optimism about RNAi-based drugs. Phase I and II studies have shown safe, strong, and durable-gene knockdown (80–90 %, lasting for a month after a single injection) and/or clinical benefit in treating several liver pathologies. Although promising, these studies have also highlighted the need for robust delivery techniques to develop RNAi therapeutics for treating other organ systems and diseases. Conjugation of siRNAs to cell-specific, synthetic RNA ligands (aptamers) is being proposed as a viable solution to this problem. While encouraging, the extended use of RNA aptamers as a delivery tool for siRNAs awaits the identification of RNA aptamer sequences capable of targeting and entering the cytoplasm of many different cell types. We describe a cell-based selection process for the rapid identification and characterization of RNA aptamers suited for delivering siRNA drugs into the cytoplasm of target cells. This process, termed “cell-internalization SELEX (Systematic Evolution of Ligands by Exponential Enrichment),” entails the combination of multiple sophisticated technologies, including cell culture-based SELEX procedures, next-generation sequencing (NGS), and novel bioinformatics tools. PMID:25319652

  7. Isolation of Endogenously Assembled RNA-Protein Complexes Using Affinity Purification Based on Streptavidin Aptamer S1

    PubMed Central

    Dong, Yangchao; Yang, Jing; Ye, Wei; Wang, Yuan; Ye, Chuantao; Weng, Daihui; Gao, Huan; Zhang, Fanglin; Xu, Zhikai; Lei, Yingfeng

    2015-01-01

    Efficient isolation of endogenously assembled viral RNA-protein complexes is essential for understanding virus replication mechanisms. We have developed an affinity purification strategy based on an RNA affinity tag that allows large-scale preparation of native viral RNA-binding proteins (RBPs). The streptavidin-binding aptamer S1 sequence was inserted into the 3′ end of dengue virus (DENV) 5′–3′ UTR RNA, and the DENV RNA UTR fused to the S1 RNA aptamer was expressed in living mammalian cells. This allowed endogenous viral ribonucleoprotein (RNP) assembly and isolation of RNPs from whole cell extract, through binding the S1 aptamer to streptavidin magnetic beads. Several novel host DENV RBPs were subsequently identified by liquid chromatography with tandem mass spectrometry (LC-MS/MS), including RPS8, which we further implicate in DENV replication. We proposed efficient S1 aptamer-based isolation of viral assembled RNPs from living mammalian cells will be generally applicable to the purification of high- and low-affinity RBPs and RNPs under endogenous conditions. PMID:26389898

  8. Isolation of Endogenously Assembled RNA-Protein Complexes Using Affinity Purification Based on Streptavidin Aptamer S1.

    PubMed

    Dong, Yangchao; Yang, Jing; Ye, Wei; Wang, Yuan; Ye, Chuantao; Weng, Daihui; Gao, Huan; Zhang, Fanglin; Xu, Zhikai; Lei, Yingfeng

    2015-09-16

    Efficient isolation of endogenously assembled viral RNA-protein complexes is essential for understanding virus replication mechanisms. We have developed an affinity purification strategy based on an RNA affinity tag that allows large-scale preparation of native viral RNA-binding proteins (RBPs). The streptavidin-binding aptamer S1 sequence was inserted into the 3' end of dengue virus (DENV) 5'-3' UTR RNA, and the DENV RNA UTR fused to the S1 RNA aptamer was expressed in living mammalian cells. This allowed endogenous viral ribonucleoprotein (RNP) assembly and isolation of RNPs from whole cell extract, through binding the S1 aptamer to streptavidin magnetic beads. Several novel host DENV RBPs were subsequently identified by liquid chromatography with tandem mass spectrometry (LC-MS/MS), including RPS8, which we further implicate in DENV replication. We proposed efficient S1 aptamer-based isolation of viral assembled RNPs from living mammalian cells will be generally applicable to the purification of high- and low-affinity RBPs and RNPs under endogenous conditions.

  9. An RNA aptamer-based electrochemical biosensor for detection of theophylline in serum.

    PubMed

    Ferapontova, Elena E; Olsen, Eva M; Gothelf, Kurt V

    2008-04-01

    An electrochemical RNA aptamer-based biosensor for rapid and label-free detection of the bronchodilator theophylline was developed. The 5'-disulfide-functionalized end of the RNA aptamer sequence was immobilized on a gold electrode, and the 3'-amino-functionalized end was conjugated with a ferrocene (Fc) redox probe. Upon binding of theophylline the aptamer switches conformation from an open unfolded state to a closed hairpin-type conformation, resulting in the increased electron-transfer efficiency between Fc and the electrode. The electrochemical response, which was measured by differential pulse voltammetry, reaches saturation within a few minutes after addition of theophylline, and the dynamic range for detecting theophylline is 0.2-10 muM. The electrode displays an inhibited response when applied directly in serum samples treated with RNase inhibitors; however a full response to the theophylline serum concentration was obtained by transferring the electrode to blank serum-free buffer solutions. It was demonstrated that theophylline is detected with high selectivity in the presence of caffeine and theobromine.

  10. Structural characterization of a 2'F-RNA aptamer that binds a HIV-1 SU glycoprotein, gp120.

    PubMed

    Sayer, N; Ibrahim, J; Turner, K; Tahiri-Alaoui, A; James, W

    2002-05-10

    Here we describe the isolation of specific 2'F-substituted RNA ligands for the SU glycoprotein, gp120, of HIV-1 strain HXB2. These aptamers bind the target protein with an affinity of the order of 10(-7) M. Binding was specific to SU glycoprotein and directed to a non-neutralizing epitope that was not shared with the related strain, HIV-1(BaL). The structure of one aptamer was defined by a combination of deletion analysis and enzymatic probing studies, revealing a 42 nt minimal element comprising a three-helix junction that retained the binding affinity of the parental sequence. Interestingly, binding to SU glycoprotein was accompanied by structural changes in the aptamer that stabilized the weakest of the 3 helices.

  11. Biocompatible hydrogel membranes for the protection of RNA aptamer-based electrochemical sensors

    NASA Astrophysics Data System (ADS)

    Schoukroun-Barnes, Lauren R.; Wagan, Samiullah; Liu, Juan; Leach, Jennie B.; White, Ryan J.

    2013-05-01

    Electrochemical-aptamer based (E-AB) sensors represent a universal specific, selective, and sensitive sensing platform for the detection of small molecule targets. Their specific detection abilities are afforded by oligonucleotide (RNA or DNA) aptamers employed as electrode-bound biorecognition elements. Sensor signaling is predicated on bindinginduced changes in conformation and/or flexibility of the aptamer that is readily measurable electrochemically. While sensors fabricated using DNA aptamers can achieve specific and selective detection even in unadulterated sample matrices, such as blood serum, RNA-based sensors fail when challenged in the same sample matrix without significant sample pretreatment. This failure is at least partially a result of enzymatic degradation of the RNA sensing element. This degradation destroys the sensing aptamer inhibiting the quantitative measurement of the target analyte and thus limits the application of E-AB sensors constructed with RNA aptamer. To circumvent this, we demonstrate that a biocompatible hydrogel membrane protects the RNA aptamer sensor surface from enzymatic degradation for at least 3 hours - a remarkable improvement over the rapid (~minutes) degradation of unprotected sensors. To demonstrate this, we characterize the response of sensors fabricated with representative DNA and RNA aptamers directed against the aminoglycoside antibiotic, tobramycin in blood serum both protected and unprotected by a polyacrylamide membrane. Furthermore, we find encapsulation of the sensor surface with the hydrogel does not significantly impede the detection ability of aptamer-based sensors. This hydrogel-aptamer interface will thus likely prove useful for the long-term monitoring of therapeutics in complex biological media.

  12. Selection, characterization and application of new RNA HIV gp 120 aptamers for facile delivery of Dicer substrate siRNAs into HIV infected cells

    PubMed Central

    Zhou, Jiehua; Swiderski, Piotr; Li, Haitang; Zhang, Jane; Neff, C. Preston; Akkina, Ramesh; Rossi, John J.

    2009-01-01

    The envelope glycoprotein of human immunodeficiency virus (HIV) consists of an exterior glycoprotein (gp120) and a trans-membrane domain (gp41) and has an important role in viral entry into cells. HIV-1 entry has been validated as a clinically relevant anti-viral strategy for drug discovery. In the present work, several 2′-F substituted RNA aptamers that bind to the HIV-1BaL gp120 protein with nanomole affinity were isolated from a RNA library by the SELEX (Systematic Evolution of Ligands by EXponential enrichment) procedure. From two of these aptamers we created a series of new dual inhibitory function anti-gp120 aptamer–siRNA chimeras. The aptamers and aptamer–siRNA chimeras specifically bind to and are internalized into cells expressing HIV gp160. The Dicer-substrate siRNA delivered by the aptamers is functionally processed by Dicer, resulting in specific inhibition of HIV-1 replication and infectivity in cultured CEM T-cells and primary blood mononuclear cells (PBMCs). Moreover, we have introduced a ‘sticky’ sequence onto a chemically synthesized aptamer which facilitates attachment of the Dicer substrate siRNAs for potential multiplexing. Our results provide a set of novel inhibitory agents for blocking HIV replication and further validate the use of aptamers for delivery of Dicer substrate siRNAs. PMID:19304999

  13. Regression of hepatocarcinoma cells using RNA aptamer specific to alpha-fetoprotein

    SciTech Connect

    Lee, Young Ju; Lee, Seong-Wook

    2012-01-06

    Highlights: Black-Right-Pointing-Pointer Identification of RNA aptamer specific to AFP with high affinity. Black-Right-Pointing-Pointer Specific induction of HCC proliferation by AFP. Black-Right-Pointing-Pointer Efficient increase in oncogene expression by AFP. Black-Right-Pointing-Pointer Efficient inhibition of AFP-mediated HCC proliferation by the aptamer. Black-Right-Pointing-Pointer Efficient suppression of AFP-induced oncogene expression of by the aptamer. -- Abstract: Alpha-fetoprotein (AFP) is a cancer-associated fetal protein and has long been utilized as a serum fetal defect/tumor marker to monitor distress/disease progression. In addition, AFP is closely associated with the proliferation of hepatocellular carcinoma. Thus, direct targeting of AFP has been recommended for a therapeutic strategy against hepatocellular carcinoma. In this study, we developed and characterized an RNA aptamer that specifically bound to the alpha-fetoprotein using SELEX technology. The aptamer interacted with the AFP with a K{sub D} of {approx}33 nM. Importantly, the identified aptamer specifically and efficiently inhibited the AFP-mediated proliferation of hepatocarcinoma cells in a dose dependent manner. Moreover, the aptamer efficiently down-regulated AFP-induced expression of oncogenes in the cells. These results indicate that an AFP-specific RNA aptamer could be a useful therapeutic and diagnostic agent against AFP-related hepatocellular carcinoma.

  14. Analytical applications of aptamers

    NASA Astrophysics Data System (ADS)

    Tombelli, S.; Minunni, M.; Mascini, M.

    2007-05-01

    Aptamers are single stranded DNA or RNA ligands which can be selected for different targets starting from a library of molecules containing randomly created sequences. Aptamers have been selected to bind very different targets, from proteins to small organic dyes. Aptamers are proposed as alternatives to antibodies as biorecognition elements in analytical devices with ever increasing frequency. This in order to satisfy the demand for quick, cheap, simple and highly reproducible analytical devices, especially for protein detection in the medical field or for the detection of smaller molecules in environmental and food analysis. In our recent experience, DNA and RNA aptamers, specific for three different proteins (Tat, IgE and thrombin), have been exploited as bio-recognition elements to develop specific biosensors (aptasensors). These recognition elements have been coupled to piezoelectric quartz crystals and surface plasmon resonance (SPR) devices as transducers where the aptamers have been immobilized on the gold surface of the crystals electrodes or on SPR chips, respectively.

  15. Toggled RNA Aptamers Against Aminoglycosides Allowing Facile Detection of Antibiotics Using Gold Nanoparticle Assays

    PubMed Central

    2012-01-01

    We have used systematic evolution of ligands by exponential enrichment (SELEX) to isolate RNA aptamers against aminoglycoside antibiotics. The SELEX rounds were toggled against four pairs of aminoglycosides with the goal of isolating reagents that recognize conserved structural features. The resulting aptamers bind both of their selection targets with nanomolar affinities. They also bind the less structurally related targets, although they show clear specificity for this class of antibiotics. We show that this lack of aminoglycoside specificity is a common property of aptamers previously selected against single compounds and described as “specific”. Broad target specificity aptamers would be ideal for sensors detecting the entire class of aminoglycosides. We have used ligand-induced aggregation of gold-nanoparticles coated with our aptamers as a rapid and sensitive assay for these compounds. In contrast to DNA aptamers, unmodified RNA aptamers cannot be used as the recognition ligand in this assay, whereas 2′-fluoro-pyrimidine derivatives work reliably. We discuss the possible application of these reagents as sensors for drug residues and the challenges for understanding the structural basis of aminoglycoside-aptamer recognition highlighted by the SELEX results. PMID:22793869

  16. Efficient HIV-1 inhibition by a 16 nt-long RNA aptamer designed by combining in vitro selection and in silico optimisation strategies

    PubMed Central

    Sánchez-Luque, Francisco J.; Stich, Michael; Manrubia, Susanna; Briones, Carlos; Berzal-Herranz, Alfredo

    2014-01-01

    The human immunodeficiency virus type-1 (HIV-1) genome contains multiple, highly conserved structural RNA domains that play key roles in essential viral processes. Interference with the function of these RNA domains either by disrupting their structures or by blocking their interaction with viral or cellular factors may seriously compromise HIV-1 viability. RNA aptamers are amongst the most promising synthetic molecules able to interact with structural domains of viral genomes. However, aptamer shortening up to their minimal active domain is usually necessary for scaling up production, what requires very time-consuming, trial-and-error approaches. Here we report on the in vitro selection of 64 nt-long specific aptamers against the complete 5′-untranslated region of HIV-1 genome, which inhibit more than 75% of HIV-1 production in a human cell line. The analysis of the selected sequences and structures allowed for the identification of a highly conserved 16 nt-long stem-loop motif containing a common 8 nt-long apical loop. Based on this result, an in silico designed 16 nt-long RNA aptamer, termed RNApt16, was synthesized, with sequence 5′-CCCCGGCAAGGAGGGG-3′. The HIV-1 inhibition efficiency of such an aptamer was close to 85%, thus constituting the shortest RNA molecule so far described that efficiently interferes with HIV-1 replication. PMID:25175101

  17. Efficient HIV-1 inhibition by a 16 nt-long RNA aptamer designed by combining in vitro selection and in silico optimisation strategies

    NASA Astrophysics Data System (ADS)

    Sánchez-Luque, Francisco J.; Stich, Michael; Manrubia, Susanna; Briones, Carlos; Berzal-Herranz, Alfredo

    2014-09-01

    The human immunodeficiency virus type-1 (HIV-1) genome contains multiple, highly conserved structural RNA domains that play key roles in essential viral processes. Interference with the function of these RNA domains either by disrupting their structures or by blocking their interaction with viral or cellular factors may seriously compromise HIV-1 viability. RNA aptamers are amongst the most promising synthetic molecules able to interact with structural domains of viral genomes. However, aptamer shortening up to their minimal active domain is usually necessary for scaling up production, what requires very time-consuming, trial-and-error approaches. Here we report on the in vitro selection of 64 nt-long specific aptamers against the complete 5'-untranslated region of HIV-1 genome, which inhibit more than 75% of HIV-1 production in a human cell line. The analysis of the selected sequences and structures allowed for the identification of a highly conserved 16 nt-long stem-loop motif containing a common 8 nt-long apical loop. Based on this result, an in silico designed 16 nt-long RNA aptamer, termed RNApt16, was synthesized, with sequence 5'-CCCCGGCAAGGAGGGG-3'. The HIV-1 inhibition efficiency of such an aptamer was close to 85%, thus constituting the shortest RNA molecule so far described that efficiently interferes with HIV-1 replication.

  18. Specific Inhibition of MicroRNA Processing Using L-RNA Aptamers.

    PubMed

    Sczepanski, Jonathan T; Joyce, Gerald F

    2015-12-30

    In vitro selection was used to obtain l-RNA aptamers that bind the distal stem-loop of various precursor microRNAs (pre-miRs). These l-aptamers, termed "aptamiRs", bind their corresponding pre-miR target through highly specific tertiary interactions rather than Watson-Crick pairing. Formation of a pre-miR-aptamiR complex inhibits Dicer-mediated processing of the pre-miR, which is required to form the mature functional microRNA. One of the aptamiRs, which was selected to bind oncogenic pre-miR-155, inhibits Dicer processing under simulated physiological conditions, with an IC50 of 87 nM. Given that l-RNAs are intrinsically resistant to nuclease degradation, these results suggest that aptamiRs might be pursued as a new class of miR inhibitors. PMID:26652064

  19. Highly Multiplexed RNA Aptamer Selection using a Microplate-based Microcolumn Device

    PubMed Central

    Reinholt, Sarah J.; Ozer, Abdullah; Lis, John T.; Craighead, Harold G.

    2016-01-01

    We describe a multiplexed RNA aptamer selection to 19 different targets simultaneously using a microcolumn-based device, MEDUSA (Microplate-based Enrichment Device Used for the Selection of Aptamers), as well as a modified selection process, that significantly reduce the time and reagents needed for selections. We exploited MEDUSA’s reconfigurable design between parallel and serially-connected microcolumns to enable the use of just 2 aliquots of starting library, and its 96-well microplate compatibility to enable the continued use of high-throughput techniques in downstream processes. Our modified selection protocol allowed us to perform the equivalent of a 10-cycle selection in the time it takes for 4 traditional selection cycles. Several aptamers were discovered with nanomolar dissociation constants. Furthermore, aptamers were identified that not only bound with high affinity, but also acted as inhibitors to significantly reduce the activity of their target protein, mouse decapping exoribonuclease (DXO). The aptamers resisted DXO’s exoribonuclease activity, and in studies monitoring DXO’s degradation of a 30-nucleotide substrate, less than 1 μM of aptamer demonstrated significant inhibition of DXO activity. This aptamer selection method using MEDUSA helps to overcome some of the major challenges with traditional aptamer selections, and provides a platform for high-throughput selections that lends itself to process automation. PMID:27432610

  20. An adaptable pentaloop defines a robust neomycin-B RNA aptamer with conditional ligand-bound structures

    PubMed Central

    Ilgu, Muslum; Fulton, D. Bruce; Yennamalli, Ragothaman M.; Lamm, Monica H.; Sen, Taner Z.; Nilsen-Hamilton, Marit

    2014-01-01

    Aptamers can be highly specific for their targets, which implies precise molecular recognition between aptamer and target. However, as small polymers, their structures are more subject to environmental conditions than the more constrained longer RNAs such as those that constitute the ribosome. To understand the balance between structural and environmental factors in establishing ligand specificity of aptamers, we examined the RNA aptamer (NEO1A) previously reported as specific for neomycin-B. We show that NEO1A can recognize other aminoglycosides with similar affinities as for neomycin-B and its aminoglycoside specificity is strongly influenced by ionic strength and buffer composition. NMR and 2-aminopurine (2AP) fluorescence studies of the aptamer identified a flexible pentaloop and a stable binding pocket. Consistent with a well-structured binding pocket, docking analysis results correlated with experimental measures of the binding energy for most ligands. Steady state fluorescence studies of 2AP-substituted aptamers confirmed that A16 moves to a more solvent accessible position upon ligand binding while A14 moves to a less solvent accessible position, which is most likely a base stack. Analysis of binding affinities of NEO1A sequence variants showed that the base in position 16 interacts differently with each ligand and the interaction is a function of the buffer constituents. Our results show that the pentaloop provides NEO1A with the ability to adapt to external influences on its structure, with the critical base at position 16 adjusting to incorporate each ligand into a stable pocket by hydrophobic interactions and/or hydrogen bonds depending on the ligand and the ionic environment. PMID:24757168

  1. Cell-specific RNA aptamer against human CCR5 specifically targets HIV-1 susceptible cells and inhibits HIV-1 infectivity.

    PubMed

    Zhou, Jiehua; Satheesan, Sangeetha; Li, Haitang; Weinberg, Marc S; Morris, Kevin V; Burnett, John C; Rossi, John J

    2015-03-19

    The C-C chemokine receptor type 5 (CCR5) is a receptor expressed by T cells and macrophages that serves as a coreceptor for macrophage-tropic HIV-1. Loss of CCR5 is associated with resistance to HIV-1. Here, we combine the live-cell-based SELEX with high-throughput sequencing technology to generate CCR5 RNA aptamers capable of specifically targeting HIV-1 susceptible cells (as small interfering RNA [siRNA] delivery agent) and inhibiting HIV-1 infectivity (as antiviral agent) via block of the CCR5 required for HIV-1 to enter cells. One of the best candidates, G-3, efficiently bound and was internalized into human CCR5-expressing cells. The G-3 specifically neutralized R5 virus infection in primary peripheral blood mononuclear cells, and in vivo generated human CD4(+) T cells with a nanomolar inhibitory concentration 50%. G-3 was also capable of transferring functional siRNAs to CCR5-expressing cells. Collectively, the cell-specific, internalizing, CCR5-targeted aptamers and aptamer-siRNA conjugates offer promise for overcoming some of the current challenges of drug resistance in HIV-1 by providing cell-type- or tissue-specific delivery of various therapeutic moieties.

  2. Thermodynamics and kinetics of adaptive binding in the malachite green RNA aptamer.

    PubMed

    Da Costa, Jason B; Andreiev, Aurelia I; Dieckmann, Thorsten

    2013-09-24

    Adaptive binding, the ability of molecules to fold themselves around the structure of a ligand and thereby incorporating it into their three-dimensional fold, is a key feature of most RNA aptamers. The malachite green aptamer (MGA) has been shown to bind several closely related triphenyl dyes with planar and nonplanar structures in this manner. Competitive binding studies using isothermal titration calorimetry and stopped flow kinetics have been conducted with the aim of understanding the adaptive nature of RNA-ligand interaction. The results of these studies reveal that binding of one ligand can reduce the ability of the aptamer pocket to adapt to another ligand, even if this second ligand has a significantly higher affinity to the free aptamer. A similar effect is observed in the presence of Mg(2+) ions which stabilize the binding pocket in a more ligand bound-like conformation.

  3. NMR structure of a kissing complex formed between the TAR RNA element of HIV-1 and a LNA-modified aptamer

    PubMed Central

    Lebars, Isabelle; Richard, Tristan; Di Primo, Carmelo; Toulmé, Jean-Jacques

    2007-01-01

    The trans-activating responsive (TAR) RNA element located in the 5′ untranslated region of the HIV-1 genome is a 57-nt imperfect stem-loop essential for the viral replication. TAR regulates transcription by interacting with both viral and cellular proteins. RNA hairpin aptamers specific for TAR were previously identified by in vitro selection [Ducongé,F. and Toulmé,J.J. (1999) In vitro selection identifies key determinants for loop-loop interactions: RNA aptamers selective for the TAR RNA element of HIV-1. RNA, 5, 1605–1614]. These aptamers display a 5′-GUCCCAGA-3′ consensus apical loop, partially complementary to the TAR one, leading to the formation of a TAR–aptamer kissing complex. The conserved GA combination (underlined in the consensus sequence) has been shown to be crucial for the formation of a highly stable complex. To improve the nuclease resistance of the aptamer and to increase its affinity for TAR, locked nucleic acid (LNA) nucleotides were introduced in the aptamer apical loop. LNA are nucleic acids analogues that contain a 2′-O,4′-C methylene linkage and that raise the thermostablity of duplexes. We solved the NMR solution structure of the TAR–LNA-modified aptamer kissing complex. Structural analysis revealed the formation of a non-canonical G•A pair leading to increased stacking at the stem-loop junction. Our data also showed that the introduction of LNA residues provides an enhanced stability while maintaining a normal Watson–Crick base pairing with a loop–loop conformation close to an A-type. PMID:17768146

  4. RNA Sequencing in Schizophrenia

    PubMed Central

    Li, Xin; Teng, Shaolei

    2015-01-01

    Schizophrenia (SCZ) is a serious psychiatric disorder that affects 1% of general population and places a heavy burden worldwide. The underlying genetic mechanism of SCZ remains unknown, but studies indicate that the disease is associated with a global gene expression disturbance across many genes. Next-generation sequencing, particularly of RNA sequencing (RNA-Seq), provides a powerful genome-scale technology to investigate the pathological processes of SCZ. RNA-Seq has been used to analyze the gene expressions and identify the novel splice isoforms and rare transcripts associated with SCZ. This paper provides an overview on the genetics of SCZ, the advantages of RNA-Seq for transcriptome analysis, the accomplishments of RNA-Seq in SCZ cohorts, and the applications of induced pluripotent stem cells and RNA-Seq in SCZ research. PMID:27053919

  5. Methods for Evaluating Cell-Specific, Cell-Internalizing RNA Aptamers

    PubMed Central

    Hernandez, Luiza I.; Flenker, Katie S.; Hernandez, Frank J.; Klingelhutz, Aloysius J.; II, James O. McNamara; Giangrande, Paloma H.

    2013-01-01

    Recent clinical trials of small interfering RNAs (siRNAs) highlight the need for robust delivery technologies that will facilitate the successful application of these therapeutics to humans. Arguably, cell targeting by conjugation to cell-specific ligands provides a viable solution to this problem. Synthetic RNA ligands (aptamers) represent an emerging class of pharmaceuticals with great potential for targeted therapeutic applications. For targeted delivery of siRNAs with aptamers, the aptamer-siRNA conjugate must be taken up by cells and reach the cytoplasm. To this end, we have developed cell-based selection approaches to isolate aptamers that internalize upon binding to their cognate receptor on the cell surface. Here we describe methods to monitor for cellular uptake of aptamers. These include: (1) antibody amplification microscopy, (2) microplate-based fluorescence assay, (3) a quantitative and ultrasensitive internalization method (“QUSIM”) and (4) a way to monitor for cytoplasmic delivery using the ribosome inactivating protein-based (RNA-RIP) assay. Collectively, these methods provide a toolset that can expedite the development of aptamer ligands to target and deliver therapeutic siRNAs in vivo. PMID:23894227

  6. Cell-specific RNA aptamer against human CCR5 specifically targets HIV-1 susceptible and inhibits HIV-1 infectivity

    PubMed Central

    Zhou, Jiehua; Satheesan, Sangeetha; Li, Haitang; Weinberg, Marc S.; Morris, Kevin V.; Burnett, John; Rossi, John

    2015-01-01

    SUMMARY The C-C chemokine receptor type 5 (CCR5) is a receptor expressed by T-cells and macrophages that serves as a co-receptor for macrophage-tropic HIV-1. Loss of CCR5 is associated with resistance to HIV-1. Here we combine the live cell-based SELEX with high throughput sequencing technology to generate CCR5 RNA aptamers capable of specifically targeting HIV-1 susceptible cells (as siRNA delivery agent) and inhibiting HIV-1 infectivity (as antiviral agent) via block of the CCR5 required for HIV-1 to enter cells. One of the best candidates, G-3, efficiently bound and was internalized into human CCR5 expressing cells. The G-3 specifically neutralized R5 virus infection in primary peripheral blood mononuclear cells, and in vivo generated human CD4+ T cells with a nanomolar IC50. G-3 was also capable of transferring functional siRNAs to CCR5 expressing cells. Collectively, the cell-specific, internalizing, CCR5-targeted aptamers and aptamer-siRNA conjugates offer promise for overcoming some of the current challenges of drug resistance in HIV-1 by providing cell-type- or tissue-specific delivery of various therapeutic moieties. PMID:25754473

  7. In Situ Live Cell Sensing of Multiple Nucleotides Exploiting DNA/RNA Aptamers and Graphene Oxide Nanosheets

    SciTech Connect

    Wang, Ying; Li, Zhaohui; Weber, Thomas J.; Hu, Dehong; Lin, Chiann Tso; Li, Jinghong; Lin, Yuehe

    2013-07-23

    Adenosine-5’-triphosphate (ATP) and guanosine-5’-triphosphate (GTP) are primary energy resources and function coordinately for numerous reactions such as microtubule assembly, insulin secretion and ion channel regulation. We have developed a novel DNA/RNA aptamer- graphene oxide nanosheet (GO-nS) sensing platform that can selectively and simultaneously detect ATP and GTP in live cells. A fluorescent tag is covalently attached to aptamers and fluorescence is quenched upon binding of aptamer to the GO-nS. Fluorescently tagged aptamers that selectively bind ATP or GTP were isolated from an aptamer library and were adsorbed onto GO-nS. Upon incubation with targets (ATP and/or GTP), the aptamers readily dissociated from GO-nS and the fluorescent signal was recovered. By covalently attaching fluorophores, both ATP and GTP sensing aptamers could be exploited to simultaneously visualize aptamer dissociation in live cells. In addition, the GO-nS appear to be biocompatible and protect the adsorbed DNA/RNA aptamers from enzymatic cleavage. Our results support the application of aptamer/GO-nS as a sensing platform for nucleotides in living cells and have implications for the development of additional sensor platforms for other bio-molecules that show selective interactions with aptamers and other biomarkers.

  8. Probing the biophysical interaction between Neocarzinostatin toxin and EpCAM RNA aptamer.

    PubMed

    Athyala, Prasanna Kumar; Kanwar, Jagat Rakesh; Alameen, Mohamed; Kanwar, Rupinder Kaur; Krishnakumar, Subramanian; Watson, Jon; Vetrivel, Umashankar; Narayanan, Janakiraman

    2016-01-01

    Neocarzinostatin (NCS) a potent DNA-damaging, anti-tumor toxin extracted from Streptomyces carzinostaticus that recognizes double-stranded DNA bulge and induces DNA damage. 2 Fluoro (2F) Modified EpCAM RNA aptamer is a 23-mer that targets EpCAM protein, expressed on the surface of epithelial tumor cells. Understanding the interaction between NCS and the ligand is important for carrying out the targeted tumor therapy. In this study, we have investigated the biophysical interactions between NCS and 2-fluro Modified EpCAM RNA aptamer using Circular Dichroism (CD) and Infra-Red (IR) spectroscopy. The aromatic amino acid residues spanning the β sheets of NCS are found to participate in intermolecular interactions with 2 F Modified EpCAM RNA aptamer. In-silico modeling and simulation studies corroborate with CD spectra data. Furthermore, it reinforces the involvement of C and D1 strand of NCS in intermolecular interactions with EpCAM RNA aptamer. This the first report on interactions involved in the stabilization of NCS-EpCAM aptamer complex and will aid in the development of therapeutic modalities towards targeted cancer therapy. PMID:26642954

  9. The effect of surface contact activation and temperature on plasma coagulation with an RNA aptamer directed against factor IXa.

    PubMed

    Krishnan, Anandi; Vogler, Erwin A; Sullenger, Bruce A; Becker, Richard C

    2013-01-01

    The anticoagulant properties of a novel RNA aptamer that binds FIXa depend collectively on the intensity of surface contact activation of human blood plasma, aptamer concentration, and its binding affinity for FIXa. Accordingly, anticoagulation efficiency of plasma containing any particular aptamer concentration is low when coagulation is strongly activated by hydrophilic surfaces compared to the anticoagulation efficiency in plasma that is weakly activated by hydrophobic surfaces. Anticoagulation efficiency is lower at hypothermic temperatures possibly because aptamer-FIXa binding decreases with decreasing temperatures. Experimental results demonstrating these trends are qualitatively interpreted in the context of a previously established model of anticoagulation efficiency of thrombin-binding DNA aptamers that exhibit anticoagulation properties similar to the FIXa aptamer. In principle, FIXa aptamer anticoagulants should be more efficient and therefore more clinically useful than thrombin-binding aptamers because aptamer binding to FIXa competes only with FX that is at much lower blood concentration than fibrinogen (FI) that competes with thrombin-binding aptamers. Our findings may have translatable relevance in the application of aptamer anticoagulants for clinical conditions in which blood is in direct contact with non-biological surfaces such as those encountered in cardiopulmonary bypass circuits. PMID:23054460

  10. Prostate-specific RNA aptamer: promising nucleic acid antibody-like cancer detection

    PubMed Central

    Marangoni, Karina; Neves, Adriana F.; Rocha, Rafael M.; Faria, Paulo R.; Alves, Patrícia T.; Souza, Aline G.; Fujimura, Patrícia T.; Santos, Fabiana A. A.; Araújo, Thaise G.; Ward, Laura S.; Goulart, Luiz R.

    2015-01-01

    We described the selection of a novel nucleic acid antibody-like prostate cancer (PCa) that specifically binds to the single-stranded DNA molecule from a 277-nt fragment that may have been partially paired and bound to the PCA3 RNA conformational structure. PCA3-277 aptamer ligands were obtained, and the best binding molecule, named CG3, was synthesized for validation. Aiming to prove its diagnostic utility, we used an apta-qPCR assay with CG3-aptamer conjugated to magnetic beads to capture PCA3 transcripts, which were amplified 97-fold and 7-fold higher than conventional qPCR in blood and tissue, respectively. Histopathologic analysis of 161 prostate biopsies arranged in a TMA and marked with biotin-labeled CG3-aptamer showed moderate staining in both cytoplasm and nucleus of PCa samples; in contrast, benign prostatic hyperplasia (BPH) samples presented strong nuclear staining (78% of the cases). No staining was observed in stromal cells. In addition, using an apta-qPCR, we demonstrated that CG3-aptamer specifically recognizes the conformational PCA3-277 molecule and at least three other transcript variants, indicating that long non-coding RNA (lncRNA) is processed after transcription. We suggest that CG3-aptamer may be a useful PCa diagnostic tool. In addition, this molecule may be used in drug design and drug delivery for PCa therapy. PMID:26174796

  11. A strategy to enhance the binding affinity of fluorophore-aptamer pairs for RNA tagging with neomycin conjugation.

    PubMed

    Jeon, Jongho; Lee, Kyung Hyun; Rao, Jianghong

    2012-10-14

    Fluorogenic sulforhodamine-neomycin conjugates have been designed and synthesized for RNA tagging. Conjugates were fluorescently activated by binding to RNA aptamers and exhibited greater than 250-400 fold enhancement in binding affinity relative to corresponding unconjugated fluorophores.

  12. LNA/DNA chimeric oligomers mimic RNA aptamers targeted to the TAR RNA element of HIV-1.

    PubMed

    Darfeuille, Fabien; Hansen, Jens Bo; Orum, Henrik; Di Primo, Carmelo; Toulmé, Jean-Jacques

    2004-01-01

    One of the major limitations of the use of phosphodiester oligonucleotides in cells is their rapid degradation by nucleases. To date, several chemical modifications have been employed to overcome this issue but insufficient efficacy and/or specificity have limited their in vivo usefulness. In this work conformationally restricted nucleotides, locked nucleic acid (LNA), were investigated to design nuclease resistant aptamers targeted against the HIV-1 TAR RNA. LNA/DNA chimeras were synthesized from a shortened version of the hairpin RNA aptamer identified by in vitro selection against TAR. The results indicate that these modifications confer good protection towards nuclease digestion. Electrophoretic mobility shift assays, thermal denaturation monitored by UV-spectroscopy and surface plasmon resonance experiments identified LNA/DNA TAR ligands that bind to TAR with a dissociation constant in the low nanomolar range as the parent RNA aptamer. The crucial G, A residues that close the aptamer loop remain a key structural determinant for stable LNA/DNA chimera-TAR complexes. This work provides evidence that LNA modifications alternated with DNA can generate stable structured RNA mimics for interacting with folded RNA targets. PMID:15181175

  13. Development of RNA aptamers as molecular probes for HER2+ breast cancer study using cell-SELEX

    PubMed Central

    Moosavian, Seyedeh Alia; Jaafari, Mahmoud Reza; Taghdisi, Seyed Mohammad; Mosaffa, Fatemeh; Badiee, Ali; Abnous, Khalil

    2015-01-01

    Objective(s): Development of molecules that specifically recognize cancer cells is one of the major areas in cancer research. Human epidermal growth factor receptor 2 (HER2) is specifically expressed on the surface of breast cancer cells. HER2 is associated with an aggressive phenotype and poor prognosis. In this study we aimed to isolate RNA aptamers that specifically bind to HER2 overexpressing TUBO cell line. Materials and Methods: Panel of aptamers was selected using cell-based systematic evolution of ligands by exponential enrichment (cell-SELEX). Results: Binding studies showed that selected aptamers can identify TUBO cell line with high affinity and selectivity. Our preliminary investigation of the target of aptamers suggested that aptamers bind with HER2 proteins on the surface of TUBO cells. Conclusion: We believe the selected aptamers could be useful ligands for targeted breast cancer therapy. PMID:26221481

  14. Inhibiting heat shock factor 1 in human cancer cells with a potent RNA aptamer.

    PubMed

    Salamanca, H Hans; Antonyak, Marc A; Cerione, Richard A; Shi, Hua; Lis, John T

    2014-01-01

    Heat shock factor 1 (HSF1) is a master regulator that coordinates chaperone protein expression to enhance cellular survival in the face of heat stress. In cancer cells, HSF1 drives a transcriptional program distinct from heat shock to promote metastasis and cell survival. Its strong association with the malignant phenotype implies that HSF1 antagonists may have general and effective utilities in cancer therapy. For this purpose, we had identified an avid RNA aptamer for HSF1 that is portable among different model organisms. Extending our previous work in yeast and Drosophila, here we report the activity of this aptamer in human cancer cell lines. When delivered into cells using a synthetic gene and strong promoter, this aptamer was able to prevent HSF1 from binding to its DNA regulation elements. At the cellular level, expression of this aptamer induced apoptosis and abolished the colony-forming capability of cancer cells. At the molecular level, it reduced chaperones and attenuated the activation of the MAPK signaling pathway. Collectively, these data demonstrate the advantage of aptamers in drug target validation and support the hypothesis that HSF1 DNA binding activity is a potential target for controlling oncogenic transformation and neoplastic growth.

  15. Organic additives stabilize RNA aptamer binding of malachite green.

    PubMed

    Zhou, Yubin; Chi, Hong; Wu, Yuanyuan; Marks, Robert S; Steele, Terry W J

    2016-11-01

    Aptamer-ligand binding has been utilized for biological applications due to its specific binding and synthetic nature. However, the applications will be limited if the binding or the ligand is unstable. Malachite green aptamer (MGA) and its labile ligand malachite green (MG) were found to have increasing apparent dissociation constants (Kd) as determined through the first order rate loss of emission intensity of the MGA-MG fluorescent complex. The fluorescent intensity loss was hypothesized to be from the hydrolysis of MG into malachite green carbinol base (MGOH). Random screening organic additives were found to reduce or retain the fluorescence emission and the calculated apparent Kd of MGA-MG binding. The protective effect became more apparent as the percentage of organic additives increased up to 10% v/v. The mechanism behind the organic additive protective effects was primarily from a ~5X increase in first order rate kinetics of MGOH→MG (kMGOH→MG), which significantly changed the equilibrium constant (Keq), favoring the generation of MG, versus MGOH without organic additives. A simple way has been developed to stabilize the apparent Kd of MGA-MG binding over 24h, which may be beneficial in stabilizing other triphenylmethane or carbocation ligand-aptamer interactions that are susceptible to SN1 hydrolysis.

  16. Organic additives stabilize RNA aptamer binding of malachite green.

    PubMed

    Zhou, Yubin; Chi, Hong; Wu, Yuanyuan; Marks, Robert S; Steele, Terry W J

    2016-11-01

    Aptamer-ligand binding has been utilized for biological applications due to its specific binding and synthetic nature. However, the applications will be limited if the binding or the ligand is unstable. Malachite green aptamer (MGA) and its labile ligand malachite green (MG) were found to have increasing apparent dissociation constants (Kd) as determined through the first order rate loss of emission intensity of the MGA-MG fluorescent complex. The fluorescent intensity loss was hypothesized to be from the hydrolysis of MG into malachite green carbinol base (MGOH). Random screening organic additives were found to reduce or retain the fluorescence emission and the calculated apparent Kd of MGA-MG binding. The protective effect became more apparent as the percentage of organic additives increased up to 10% v/v. The mechanism behind the organic additive protective effects was primarily from a ~5X increase in first order rate kinetics of MGOH→MG (kMGOH→MG), which significantly changed the equilibrium constant (Keq), favoring the generation of MG, versus MGOH without organic additives. A simple way has been developed to stabilize the apparent Kd of MGA-MG binding over 24h, which may be beneficial in stabilizing other triphenylmethane or carbocation ligand-aptamer interactions that are susceptible to SN1 hydrolysis. PMID:27591602

  17. The isolation of an RNA aptamer targeting to p53 protein with single amino acid mutation

    PubMed Central

    Chen, Liang; Rashid, Farooq; Shah, Abdullah; Awan, Hassaan M.; Wu, Mingming; Liu, An; Wang, Jun; Zhu, Tao; Luo, Zhaofeng; Shan, Ge

    2015-01-01

    p53, known as a tumor suppressor, is a DNA binding protein that regulates cell cycle, activates DNA repair proteins, and triggers apoptosis in multicellular animals. More than 50% of human cancers contain a mutation or deletion of the p53 gene, and p53R175 is one of the hot spots of p53 mutation. Nucleic acid aptamers are short single-stranded oligonucleotides that are able to bind various targets, and they are typically isolated from an experimental procedure called systematic evolution of ligand exponential enrichment (SELEX). Using a previously unidentified strategy of contrast screening with SELEX, we have isolated an RNA aptamer targeting p53R175H. This RNA aptamer (p53R175H-APT) has a significantly stronger affinity to p53R175H than to the wild-type p53 in both in vitro and in vivo assays. p53R175H-APT decreased the growth rate, weakened the migration capability, and triggered apoptosis in human lung cancer cells harboring p53R175H. Further analysis actually indicated that p53R175H-APT might partially rescue or correct the p53R175H to function more like the wild-type p53. In situ injections of p53R175H-APT to the tumor xenografts confirmed the effects of this RNA aptamer on p53R175H mutation in mice. PMID:26216949

  18. Synthesis and radiolabeling of chelator-RNA aptamer bioconjugates with copper-64 for targeted molecular imaging.

    PubMed

    Rockey, William M; Huang, Ling; Kloepping, Kyle C; Baumhover, Nicholas J; Giangrande, Paloma H; Schultz, Michael K

    2011-07-01

    Ribonucleic acid (RNA) aptamers with high affinity and specificity for cancer-specific cell-surface antigens are promising reagents for targeted molecular imaging of cancer using positron emission tomography (PET). For this application, aptamers must be conjugated to chelators capable of coordinating PET-radionuclides (e.g., copper-64, (64)Cu) to enable radiolabeling for in vivo imaging of tumors. This study investigates the choice of chelator and radiolabeling parameters such as pH and temperature for the development of (64)Cu-labeled RNA-based targeted agents for PET imaging. The characterization and optimization of labeling conditions are described for four chelator-aptamer complexes. Three commercially available bifunctional macrocyclic chelators (1,4,7,10-tetraazacyclododecane-1,4,7-triacetic acid mono N-hydroxysuccinimide [DOTA-NHS]; S-2-(4-isothiocyanatobenzyl)-1,4,7-triazacyclononane-1,4,7-triacetic acid [p-SCN-Bn-NOTA]; and p-SCN-Bn-3,6,9,15-tetraazabicyclo [9.3.1]pentadeca-1(15),11,13-triene-3,6,9-triacetic acid [p-SCN-Bn-PCTA]), as well as the polyamino-macrocyclic diAmSar (3,6,10,13,16,19-hexaazabicyclo[6.6.6] icosane-1,8-diamine) were conjugated to A10-3.2, a RNA aptamer which has been shown to bind specifically to a prostate cancer-specific cell-surface antigen (PSMA). Although a commercial bifunctional version of diAmSar was not available, RNA conjugation with this chelator was achieved in a two-step reaction by the addition of a disuccinimidyl suberate linker. Radiolabeling parameters (e.g., pH, temperature, and time) for each chelator-RNA conjugate were assessed in order to optimize specific activity and RNA stability. Furthermore, the radiolabeled chelator-coupled RNA aptamers were evaluated for binding specificity to their target antigen. In summary, key parameters were established for optimal radiolabeling of RNA aptamers for eventual PET imaging with (64)Cu.

  19. Identification and Characterization of an eIF4e DNA Aptamer That Inhibits Proliferation With High Throughput Sequencing

    PubMed Central

    Guo, Wei Mei; Kong, Kiat Whye; Brown, Christopher John; Quah, Soo Tng; Yeo, Hui Ling; Hoon, Shawn; Seow, Yiqi

    2014-01-01

    Development of DNA aptamer screens that are both simple and informative can increase the success rate of DNA aptamer selection and induce greater adoption. High eIF4e levels contribute to malignancies, thus eIF4e presents itself as a valuable target for DNA aptamer-based inhibition screen. Here, we demonstrate a method for the rapid selection of looped DNA aptamers against eIF4e by combining negative selection and purification in a single step, followed by characterization with high throughput sequencing. The resulting aptamers show functional binding to eIF4e and inhibit translation initiation in biochemical assays. When transfected into cells, eIF4e aptamers cause a dramatic loss of cell proliferation in tumor cells as seen with eIF4e knockdown with antisense oligonucleotides, shRNAs, and siRNAs, hinting at therapeutic possibilities. With the large data set provided by high throughput sequencing, we demonstrate that selection happens in waves and that sequencing data can be used to infer aptamer structure. Lastly, we show that ligation of looped aptamers can enhance their functional effects. These results demonstrate a rapid protocol to screen and optimize aptamers against macromolecules of interest. PMID:25514650

  20. In Vivo Selection Against Human Colorectal Cancer Xenografts Identifies an Aptamer That Targets RNA Helicase Protein DHX9

    PubMed Central

    Mi, Jing; Ray, Partha; Liu, Jenny; Kuan, Chien-Tsun; Xu, Jennifer; Hsu, David; Sullenger, Bruce A; White, Rebekah R; Clary, Bryan M

    2016-01-01

    The ability to selectively target disease-related tissues with molecules is critical to the design of effective therapeutic and diagnostic reagents. Recognizing the differences between the in vivo environment and in vitro conditions, we employed an in vivo selection strategy to identify RNA aptamers (targeting motifs) that could localize to tumor in situ. One of the selected molecules is an aptamer that binds to the protein DHX9, an RNA helicase that is known to be upregulated in colorectal cancer. Upon systemic administration, the aptamer preferentially localized to the nucleus of cancer cells in vivo and thus has the potential to be used for targeted delivery. PMID:27115840

  1. Challenges and Opportunities in the Development of Aptamers for TNFα.

    PubMed

    Nübel, Claudia; Appel, Bettina; Hospach, Ingeborg; Mai, Michaela; Krasteva, Nadejda; Nelles, Gabriele; Petruschka, Lothar; Müller, Sabine

    2016-06-01

    RNA aptamers for tumor necrosis factor-alpha (TNFα), for which functionality was demonstrated in L929 cells, show only little affinity for the protein in vitro. Detailed investigation of the aptamer-protein interaction by surface plasmon resonance and quartz crystal microbalance analysis revealed that affinity is not the only crucial parameter for efficacy and functionality of those aptamers. Instead, the sensitive equilibrium of the monomeric and homotrimeric form of soluble TNFα decides on aptamer binding. Our results show that the field of application and the source of TNFα have to be carefully defined before selection of aptamer sequences. PMID:26922730

  2. Using Spinach aptamer to correlate mRNA and protein levels in Escherichia coli.

    PubMed

    Pothoulakis, Georgios; Ellis, Tom

    2015-01-01

    In vivo gene expression measurements have traditionally relied on fluorescent proteins such as green fluorescent protein (GFP) with the help of high-sensitivity equipment such as flow cytometers. However, fluorescent proteins report only on the protein level inside the cell without giving direct information about messenger RNA (mRNA) production. In 2011, an aptamer termed Spinach was presented that acts as an RNA mimic of GFP when produced in Escherichia coli and mammalian cells. It was later shown that coexpression of a red fluorescent protein (mRFP1) and the Spinach aptamer, when included into the same gene expression cassette, could be utilized for parallel in vivo measurements of mRNA and protein production. As accurate characterization of component biological parts is becoming increasingly important for fields such as synthetic biology, Spinach in combination with mRFP1 provide a great tool for the characterization of promoters and ribosome binding sites. In this chapter, we discuss how live-cell imaging and flow cytometry can be used to detect and measure fluorescence produced in E. coli cells by different constructs that contain the Spinach aptamer and the mRFP1 gene.

  3. RNA aptamer-based electrochemical biosensor for selective and label-free analysis of dopamine.

    PubMed

    Farjami, Elaheh; Campos, Rui; Nielsen, Jesper S; Gothelf, Kurt V; Kjems, Jørgen; Ferapontova, Elena E

    2013-01-01

    The inherent redox activity of dopamine enables its direct electrochemical in vivo analysis ( Venton , B. J.; Wightman, M. R. Anal. Chem. 2003, 75, 414A). However, dopamine analysis is complicated by the interference from other electrochemically active endogenous compounds present in the brain, including dopamine precursors and metabolites and other neurotransmitters (NT). Here we report an electrochemical RNA aptamer-based biosensor for analysis of dopamine in the presence of other NT. The biosensor exploits a specific binding of dopamine by the RNA aptamer, immobilized at a cysteamine-modified Au electrode, and further electrochemical oxidation of dopamine. Specific recognition of dopamine by the aptamer allowed a selective amperometric detection of dopamine within the physiologically relevant 100 nM to 5 μM range in the presence of competitive concentrations of catechol, epinephrine, norepinephrine, 3,4-dihydroxy-phenylalanine (L-DOPA), 3,4-dihydroxyphenylacetic acid (DOPAC), methyldopamine, and tyramine, which gave negligible signals under conditions of experiments (electroanalysis at 0.185 V vs Ag/AgCl). The interference from ascorbic and uric acids was eliminated by application of a Nafion-coated membrane. The aptasensor response time was <1 s, and the sensitivity of analysis was 62 nA μM(-1) cm(-2). The proposed design of the aptasensor, based on electrostatic interactions between the positively charged cysteamine-modified electrode and the negatively charged aptamer, may be used as a general strategy not to restrict the conformational freedom and binding properties of surface-bound aptamers and, thus, be applicable for the development of other aptasensors.

  4. Crystal structure of Hfq from Bacillus subtilis in complex with SELEX-derived RNA aptamer: insight into RNA-binding properties of bacterial Hfq

    PubMed Central

    Someya, Tatsuhiko; Baba, Seiki; Fujimoto, Mai; Kawai, Gota; Kumasaka, Takashi; Nakamura, Kouji

    2012-01-01

    Bacterial Hfq is a protein that plays an important role in the regulation of genes in cooperation with sRNAs. Escherichia coli Hfq (EcHfq) has two or more sites that bind RNA(s) including U-rich and/or the poly(A) tail of mRNA. However, functional and structural information about Bacillus subtilis Hfq (BsHfq) including the RNA sequences that specifically bind to it remain unknown. Here, we describe RNA aptamers including fragment (AG)3A that are recognized by BsHfq and crystal structures of the BsHfq–(AG)3A complex at 2.2 Å resolution. Mutational and structural studies revealed that the RNA fragment binds to the distal site, one of the two binding sites on Hfq, and identified amino acid residues that are critical for sequence-specific interactions between BsHfq and (AG)3A. In particular, R32 appears to interact with G bases in (AG)3A. Poly(A) also binds to the distal site of EcHfq, but the overall RNA structure and protein–RNA interaction patterns engaged in the R32 residues of BsHfq–(AG)3A differ from those of EcHfq–poly(A). These findings provide novel insight into how the Hfq homologue recognizes RNA. PMID:22053080

  5. Trends in aptamer selection methods and applications.

    PubMed

    Yüce, Meral; Ullah, Naimat; Budak, Hikmet

    2015-08-21

    Aptamers are target specific ssDNA, RNA or peptide sequences generated by an in vitro selection and amplification method called SELEX (Systematic Evolution of Ligands by EXponential Enrichment), which involves repetitive cycles of binding, recovery and amplification steps. Aptamers have the ability to bind with a variety of targets such as drugs, proteins, heavy metals, and pathogens with high specificity and selectivity. Aptamers are similar to monoclonal antibodies regarding their binding affinities, but they offer a number of advantages over the existing antibody-based detection methods, which make the aptamers promising diagnostic and therapeutic tools for future biomedical and analytical applications. The aim of this review article is to provide an overview of the recent advancements in aptamer screening methods along with a concise description of the major application areas of aptamers including biomarker discovery, diagnostics, imaging and nanotechnology. PMID:26114391

  6. Electroanalysis of pM-levels of urokinase plasminogen activator in serum by phosphorothioated RNA aptamer.

    PubMed

    Jarczewska, Marta; Kékedy-Nagy, László; Nielsen, Jesper S; Campos, Rui; Kjems, Jørgen; Malinowska, Elżbieta; Ferapontova, Elena E

    2015-06-01

    Protein biomarkers of cancer allow a dramatic improvement in cancer diagnostics as compared to the traditional histological characterisation of tumours by enabling a non-invasive analysis of cancer development and treatment. Here, an electrochemical label-free assay for urokinase plasminogen activator (uPA), a universal biomarker of several cancers, has been developed based on the recently selected uPA-specific fluorinated RNA aptamer, tethered to a gold electrode via a phosphorothioated dA tag, and soluble redox indicators. The binding properties of the uPA-aptamer couple and interference from the non-specific adsorption of bovine serum albumin (BSA) were modulated by the electrode surface charge. A nM uPA electroanalysis at positively charged surfaces, complicated by the competitive adsorption of BSA, was tuned to the pM uPA analysis at negative surface charges of the electrode, being improved in the presence of negatively charged BSA. The aptamer affinity for uPA displayed via the binding/dissociation constant relationship correspondingly increased, ca. three orders of magnitude, from 0.441 to 367. Under optimal conditions, the aptasensor allowed 10(-12)-10(-9) M uPA analysis, also in serum, being practically useful for clinical applications. The proposed strategy for optimization of the electrochemical protein sensing is of particular importance for the assessment and optimization of in vivo protein ligand binding by surface-tethered aptamers.

  7. A RNA-DNA Hybrid Aptamer for Nanoparticle-Based Prostate Tumor Targeted Drug Delivery

    PubMed Central

    Leach, John C.; Wang, Andrew; Ye, Kaiming; Jin, Sha

    2016-01-01

    The side effects of radio- and chemo-therapy pose long-term challenges on a cancer patient’s health. It is, therefore, highly desirable to develop more effective therapies that can specifically target carcinoma cells without damaging normal and healthy cells. Tremendous efforts have been made in the past to develop targeted drug delivery systems for solid cancer treatment. In this study, a new aptamer, A10-3-J1, which recognizes the extracellular domain of the prostate specific membrane antigen (PSMA), was designed. A super paramagnetic iron oxide nanoparticle-aptamer-doxorubicin (SPIO-Apt-Dox) was fabricated and employed as a targeted drug delivery platform for cancer therapy. This DNA RNA hybridized aptamer antitumor agent was able to enhance the cytotoxicity of targeted cells while minimizing collateral damage to non-targeted cells. This SPIO-Apt-Dox nanoparticle has specificity to PSMA+ prostate cancer cells. Aptamer inhibited nonspecific uptake of membrane-permeable doxorubic to the non-target cells, leading to reduced untargeted cytotoxicity and endocytic uptake while enhancing targeted cytotoxicity and endocytic uptake. The experimental results indicate that the drug delivery platform can yield statistically significant effectiveness being more cytotoxic to the targeted cells as opposed to the non-targeted cells. PMID:26985893

  8. Nuclear RNA Isolation and Sequencing.

    PubMed

    Dhaliwal, Navroop K; Mitchell, Jennifer A

    2016-01-01

    Most transcriptome studies involve sequencing and quantification of steady-state mRNA by isolating and sequencing poly (A) RNA. Although this type of sequencing data is informative to determine steady-state mRNA levels it does not provide information on transcriptional output and thus may not always reflect changes in transcriptional regulation of gene expression. Furthermore, sequencing poly (A) RNA may miss transcribed regions of the genome not usually modified by polyadenylation which includes many long noncoding RNAs. Here, we describe nuclear-RNA sequencing (nucRNA-seq) which investigates the transcriptional landscape through sequencing and quantification of nuclear RNAs which are both unspliced and spliced transcripts for protein-coding genes and nuclear-retained long noncoding RNAs.

  9. Acyclic Identification of Aptamers for Human alpha-Thrombin Using Over-Represented Libraries and Deep Sequencing

    PubMed Central

    Kupakuwana, Gillian V.; Crill, James E.; McPike, Mark P.; Borer, Philip N.

    2011-01-01

    Background Aptamers are oligonucleotides that bind proteins and other targets with high affinity and selectivity. Twenty years ago elements of natural selection were adapted to in vitro selection in order to distinguish aptamers among randomized sequence libraries. The primary bottleneck in traditional aptamer discovery is multiple cycles of in vitro evolution. Methodology/Principal Findings We show that over-representation of sequences in aptamer libraries and deep sequencing enables acyclic identification of aptamers. We demonstrated this by isolating a known family of aptamers for human α-thrombin. Aptamers were found within a library containing an average of 56,000 copies of each possible randomized 15mer segment. The high affinity sequences were counted many times above the background in 2–6 million reads. Clustering analysis of sequences with more than 10 counts distinguished two sequence motifs with candidates at high abundance. Motif I contained the previously observed consensus 15mer, Thb1 (46,000 counts), and related variants with mostly G/T substitutions; secondary analysis showed that affinity for thrombin correlated with abundance (Kd = 12 nM for Thb1). The signal-to-noise ratio for this experiment was roughly 10,000∶1 for Thb1. Motif II was unrelated to Thb1 with the leading candidate (29,000 counts) being a novel aptamer against hexose sugars in the storage and elution buffers for Concanavilin A (Kd = 0.5 µM for α-methyl-mannoside); ConA was used to immobilize α-thrombin. Conclusions/Significance Over-representation together with deep sequencing can dramatically shorten the discovery process, distinguish aptamers having a wide range of affinity for the target, allow an exhaustive search of the sequence space within a simplified library, reduce the quantity of the target required, eliminate cycling artifacts, and should allow multiplexing of sequencing experiments and targets. PMID:21625587

  10. Cellular delivery of shRNA using aptamer-conjugated PLL-alkyl-PEI nanoparticles.

    PubMed

    Askarian, Saeedeh; Abnous, Khalil; Taghavi, Sahar; Oskuee, Reza Kazemi; Ramezani, Mohammad

    2015-12-01

    Introduction of an efficient gene delivery vector is still the main challenge of gene therapy. Both polyethylenimine (PEI) and poly(l-lysine) (PLL) comprise disadvantages which limited their application. To explore whether their deficiencies could be compensated by preparing copolymers consisting of both PLL and PEI, we generated several combinations of PLL-alkyl-PEI copolymers conjugated to aptamer and evaluated their both gene delivery efficiency and down-regulation of Bcl-XL, an anti-apoptotic gene, in lung cancer cell line. PLL was conjugated to either 10% or 50% of PEI by grafting different percentages of PEI to alkylated-PLL as core. The properties of modified polymers including size, surface charge density, DNA condensation ability, buffering capacity and cytotoxicity were evaluated. According to transfection results, aptamer conjugated PLL-alkyl-10%-PEI (PLPE8%) was selected for further gene silencing study by plasmid shRNA. Decrease in Bcl-XL gene expression was estimated by both RT-PCR and western-blot experiments. The obtained results revealed that the new copolymers had appropriate nano-scale size (117-128 nm) even after aptamer conjugation (168-183 nm). Moreover, they exhibited increased transfection efficiencies by up to 1.8-5 folds and acceptable cytotoxicity. The apoptosis was induced in transfected cells by shRNA-aptamer-copolymer due to the down-regulation of mRNA and protein levels. This study suggested a new vector for targeted non-viral gene delivery with high transfection efficiency in lung cancer or pulmonary systems.

  11. AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES

    EPA Science Inventory

    This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...

  12. iSpinach: a fluorogenic RNA aptamer optimized for in vitro applications

    PubMed Central

    Autour, Alexis; Westhof, Eric; Ryckelynck, Michael

    2016-01-01

    Using random mutagenesis and high throughput screening by microfluidic-assisted In Vitro Compartmentalization, we report the isolation of an order of magnitude times brighter mutants of the light-up RNA aptamers Spinach that are far less salt-sensitive and with a much higher thermal stability than the parent molecule. Further engineering gave iSpinach, a molecule with folding and fluorescence properties surpassing those of all currently known aptamer based on the fluorogenic co-factor 3,5-difluoro-4-hydroxybenzylidene imidazolinone (DFHBI). We illustrate the potential of iSpinach in a new sensitive and high throughput-compatible fluorogenic assay that measures co-transcriptionally the catalytic constant (kcat) of a model ribozyme. PMID:26932363

  13. Identification of sequence–structure RNA binding motifs for SELEX-derived aptamers

    PubMed Central

    Hoinka, Jan; Zotenko, Elena; Friedman, Adam; Sauna, Zuben E.; Przytycka, Teresa M.

    2012-01-01

    Motivation: Systematic Evolution of Ligands by EXponential Enrichment (SELEX) represents a state-of-the-art technology to isolate single-stranded (ribo)nucleic acid fragments, named aptamers, which bind to a molecule (or molecules) of interest via specific structural regions induced by their sequence-dependent fold. This powerful method has applications in designing protein inhibitors, molecular detection systems, therapeutic drugs and antibody replacement among others. However, full understanding and consequently optimal utilization of the process has lagged behind its wide application due to the lack of dedicated computational approaches. At the same time, the combination of SELEX with novel sequencing technologies is beginning to provide the data that will allow the examination of a variety of properties of the selection process. Results: To close this gap we developed, Aptamotif, a computational method for the identification of sequence–structure motifs in SELEX-derived aptamers. To increase the chances of identifying functional motifs, Aptamotif uses an ensemble-based approach. We validated the method using two published aptamer datasets containing experimentally determined motifs of increasing complexity. We were able to recreate the author's findings to a high degree, thus proving the capability of our approach to identify binding motifs in SELEX data. Additionally, using our new experimental dataset, we illustrate the application of Aptamotif to elucidate several properties of the selection process. Contact: przytyck@ncbi.nlm.nih.gov, Zuben.Sauna@fda.hhs.gov PMID:22689764

  14. A combinatorial approach to the repertoire of RNA kissing motifs; towards multiplex detection by switching hairpin aptamers

    PubMed Central

    Durand, Guillaume; Dausse, Eric; Goux, Emma; Fiore, Emmanuelle; Peyrin, Eric; Ravelet, Corinne; Toulmé, Jean-Jacques

    2016-01-01

    Loop–loop (also known as kissing) interactions between RNA hairpins are involved in several mechanisms in both prokaryotes and eukaryotes such as the regulation of the plasmid copy number or the dimerization of retroviral genomes. The stability of kissing complexes relies on loop parameters (base composition, sequence and size) and base combination at the loop–loop helix - stem junctions. In order to identify kissing partners that could be used as regulatory elements or building blocks of RNA scaffolds, we analysed a pool of 5.2 × 106 RNA hairpins with randomized loops. We identified more than 50 pairs of kissing RNA hairpins. Two kissing motifs, 5′CCNY and 5′RYRY, generate highly stable complexes with KDs in the low nanomolar range. Such motifs were introduced in the apical loop of hairpin aptamers that switch between unfolded and folded state upon binding to their cognate target molecule, hence their name aptaswitch. The aptaswitch–ligand complex is specifically recognized by a second RNA hairpin named aptakiss through loop–loop interaction. Taking advantage of our kissing motif repertoire we engineered aptaswitch–aptakiss modules for purine derivatives, namely adenosine, GTP and theophylline and demonstrated that these molecules can be specifically and simultaneously detected by surface plasmon resonance or by fluorescence anisotropy. PMID:27067541

  15. RNA aptamers for an essential prebiotic molecule: adenine

    NASA Astrophysics Data System (ADS)

    Meli, M.; Vergne, J.; Josse, T.; Décout, J.-L.; Maurel, M.-C.

    2001-08-01

    Among all known bio-organic molecules within the living cells, RNA molecules are the only ones storing genetic information and performing catalysis. The RNA world hypthesis assumes that livings on earth are derived from an RNA molecular ancestor where RNA both stored the genetic information and catalyzed the first metabolic reactions. Among diverse RNA worlds proposed, it is thought that the invention of translation and encoded peptide synthesis took place with a "breakthrough organism", then giving rise to a ribonucleoprotein (RNP) world. Finally, modern biochemistry arose with the invention of DNA and the birth of modern molecular biology where the information flows from DNA to RNA which directs protein synthesis. Considering modern metabolism, it is possible to assign biochemical traits to the last common ancestor by simple parsimony rules, and assumptions about earlier metabolisms are possible using chemical criteria. According to this point of view, modern metabolism is considered as a palimpsest that has to be read and deciphered in ordered to understand its origin and evolution.

  16. Characterization of an RNA aptamer against HPV-16 L1 virus-like particles.

    PubMed

    Leija-Montoya, Ana Gabriela; Benítez-Hess, María Luisa; Toscano-Garibay, Julia Dolores; Alvarez-Salas, Luis Marat

    2014-10-01

    The human papillomavirus (HPV) capsid is mainly composed of the L1 protein that can self-assemble into virus-like particles (VLPs) that are structurally and immunologically similar to the infectious virions. We report here the characterization of RNA aptamers that recognize baculovirus-produced HPV-16 L1 VLPs. Interaction and slot-blot binding assays showed that all isolated aptamers efficiently bound HPV-16 VLPs, although the Sc5-c3 aptamer showed the highest specificity and affinity (Kd=0.05 pM). Sc5-c3 secondary structure consisted of a hairpin with a symmetric bubble and an unstructured 3'end. Biochemical and genetic analyses showed that the Sc5-c3 main loop is directly involved on VLPs binding. In particular, binding specificity appeared mediated by five non-consecutive nucleotide positions. Experiments using bacterial-produced HPV-16 L1 resulted in low Sc5-c3 binding, suggesting that recognition of HPV-16 L1 VLPs relies on quaternary structure features not present in bacteria-produced L1 protein. Sc5-c3 produced specific and stable binding to HPV-16 L1 VLPs even in biofluid protein mixes and thus it may provide a potential diagnostic tool for active HPV infection. PMID:25111024

  17. Characterization of an RNA Aptamer Against HPV-16 L1 Virus-Like Particles

    PubMed Central

    Leija-Montoya, Ana Gabriela; Benítez-Hess, María Luisa; Toscano-Garibay, Julia Dolores

    2014-01-01

    The human papillomavirus (HPV) capsid is mainly composed of the L1 protein that can self-assemble into virus-like particles (VLPs) that are structurally and immunologically similar to the infectious virions. We report here the characterization of RNA aptamers that recognize baculovirus-produced HPV-16 L1 VLPs. Interaction and slot-blot binding assays showed that all isolated aptamers efficiently bound HPV-16 VLPs, although the Sc5-c3 aptamer showed the highest specificity and affinity (Kd=0.05 pM). Sc5-c3 secondary structure consisted of a hairpin with a symmetric bubble and an unstructured 3′end. Biochemical and genetic analyses showed that the Sc5-c3 main loop is directly involved on VLPs binding. In particular, binding specificity appeared mediated by five non-consecutive nucleotide positions. Experiments using bacterial-produced HPV-16 L1 resulted in low Sc5-c3 binding, suggesting that recognition of HPV-16 L1 VLPs relies on quaternary structure features not present in bacteria-produced L1 protein. Sc5-c3 produced specific and stable binding to HPV-16 L1 VLPs even in biofluid protein mixes and thus it may provide a potential diagnostic tool for active HPV infection. PMID:25111024

  18. Effect of serum on an RNA aptamer-based electrochemical sensor for theophylline.

    PubMed

    Ferapontova, Elena E; Gothelf, Kurt V

    2009-04-21

    Electrochemical performance of the ferrocene (Fc) redox-labeled RNA aptamer based sensor for theophylline (Th) is essentially inhibited in serum, but is restored in serum-free buffer solutions. This phenomenon is inconsistent with the data on methylene-blue-labeled aptamer beacon systems, which operational potential window is more negative compared to the Fc redox label. Electrochemical studies with a ferricyanide redox probe, having redox potential close to the Fc redox couple, and interfacial capacitance measurements unambiguously demonstrate that it is adsorption of serum proteins at positively charged electrode surface that slows down the kinetics of the electrode reactions in serum and interferes with the biosensor performance. In filtered serum solutions, in the absence of serum proteins, the Fc-labeled aptamer-based biosensor performed similarly to the pure buffer solutions, ad the signal for Th could be linearly calibrated versus Th concentration. These results on interfacial effects of serum are of particular importance for future research and development of the beacon-type biosensors for in vivo applications.

  19. Characterization of an RNA aptamer against HPV-16 L1 virus-like particles.

    PubMed

    Leija-Montoya, Ana Gabriela; Benítez-Hess, María Luisa; Toscano-Garibay, Julia Dolores; Alvarez-Salas, Luis Marat

    2014-10-01

    The human papillomavirus (HPV) capsid is mainly composed of the L1 protein that can self-assemble into virus-like particles (VLPs) that are structurally and immunologically similar to the infectious virions. We report here the characterization of RNA aptamers that recognize baculovirus-produced HPV-16 L1 VLPs. Interaction and slot-blot binding assays showed that all isolated aptamers efficiently bound HPV-16 VLPs, although the Sc5-c3 aptamer showed the highest specificity and affinity (Kd=0.05 pM). Sc5-c3 secondary structure consisted of a hairpin with a symmetric bubble and an unstructured 3'end. Biochemical and genetic analyses showed that the Sc5-c3 main loop is directly involved on VLPs binding. In particular, binding specificity appeared mediated by five non-consecutive nucleotide positions. Experiments using bacterial-produced HPV-16 L1 resulted in low Sc5-c3 binding, suggesting that recognition of HPV-16 L1 VLPs relies on quaternary structure features not present in bacteria-produced L1 protein. Sc5-c3 produced specific and stable binding to HPV-16 L1 VLPs even in biofluid protein mixes and thus it may provide a potential diagnostic tool for active HPV infection.

  20. Synthetic Polymer Hybridization with DNA and RNA Directs Nanoparticle Loading, Silencing Delivery, and Aptamer Function

    PubMed Central

    Zhou, Zhun; Xia, Xin; Bong, Dennis

    2015-01-01

    We report herein discrete triplex hybridization of DNA and RNA with polyacrylates. Length-monodisperse triazine-derivatized polymers were prepared on gram-scale by reversible addition–fragmentation chain-transfer polymerization. Despite stereoregio backbone heterogeneity, the triazine polymers bind T/U-rich DNA or RNA with nanomolar affinity upon mixing in a 1:1 ratio, as judged by thermal melts, circular dichroism, gel-shift assays, and fluorescence quenching. We call these polyacrylates “bifacial polymer nucleic acids” (bPoNAs). Nucleic acid hybridization with bPoNA enables DNA loading onto polymer nanoparticles, siRNA silencing delivery, and can further serve as an allosteric trigger of RNA aptamer function. Thus, bPoNAs can serve as tools for both non-covalent bioconjugation and structure–function nucleation. It is anticipated that bPoNAs will have utility in both bio- and nanotechnology. PMID:26138550

  1. Synthetic Polymer Hybridization with DNA and RNA Directs Nanoparticle Loading, Silencing Delivery, and Aptamer Function.

    PubMed

    Zhou, Zhun; Xia, Xin; Bong, Dennis

    2015-07-22

    We report herein discrete triplex hybridization of DNA and RNA with polyacrylates. Length-monodisperse triazine-derivatized polymers were prepared on gram-scale by reversible addition-fragmentation chain-transfer polymerization. Despite stereoregio backbone heterogeneity, the triazine polymers bind T/U-rich DNA or RNA with nanomolar affinity upon mixing in a 1:1 ratio, as judged by thermal melts, circular dichroism, gel-shift assays, and fluorescence quenching. We call these polyacrylates "bifacial polymer nucleic acids" (bPoNAs). Nucleic acid hybridization with bPoNA enables DNA loading onto polymer nanoparticles, siRNA silencing delivery, and can further serve as an allosteric trigger of RNA aptamer function. Thus, bPoNAs can serve as tools for both non-covalent bioconjugation and structure-function nucleation. It is anticipated that bPoNAs will have utility in both bio- and nanotechnology. PMID:26138550

  2. Molecular Mechanism for Inhibition of G Protein-Coupled Receptor Kinase 2 by a Selective RNA Aptamer

    SciTech Connect

    Tesmer, Valerie M.; Lennarz, Sabine; Mayer, Günter; Tesmer, John J.G.

    2012-08-31

    Cardiovascular homeostasis is maintained in part by the rapid desensitization of activated heptahelical receptors that have been phosphorylated by G protein-coupled receptor kinase 2 (GRK2). However, during chronic heart failure GRK2 is upregulated and believed to contribute to disease progression. We have determined crystallographic structures of GRK2 bound to an RNA aptamer that potently and selectively inhibits kinase activity. Key to the mechanism of inhibition is the positioning of an adenine nucleotide into the ATP-binding pocket and interactions with the basic {alpha}F-{alpha}G loop region of the GRK2 kinase domain. Constraints imposed on the RNA by the terminal stem of the aptamer also play a role. These results highlight how a high-affinity aptamer can be used to selectively trap a novel conformational state of a protein kinase.

  3. Molecular mechanism for inhibition of G protein-coupled receptor kinase 2 by a selective RNA aptamer

    PubMed Central

    Tesmer, Valerie M.; Lennarz, Sabine; Mayer, Günter; Tesmer, John J. G.

    2012-01-01

    SUMMARY Cardiovascular homeostasis is maintained in part by the rapid desensitization of activated heptahelical receptors that have been phosphorylated by G protein-coupled receptor kinase 2 (GRK2). However, during chronic heart failure GRK2 is upregulated and believed to contribute to disease progression. We have determined crystallographic structures of GRK2 bound to an RNA aptamer that potently and selectively inhibits kinase activity. Key to the mechanism of inhibition is the positioning of an adenine nucleotide into the ATP-binding pocket and interactions with the basic αF-αG loop region of the GRK2 kinase domain. Constraints imposed on the RNA by the terminal stem of the aptamer also play a role. These results highlight how a high affinity aptamer can be used to selectively trap a novel conformational state of a protein kinase. PMID:22727813

  4. Recent Progress in Aptamer-Based Functional Probes for Bioanalysis and Biomedicine.

    PubMed

    Zhang, Huimin; Zhou, Leiji; Zhu, Zhi; Yang, Chaoyong

    2016-07-11

    Nucleic acid aptamers are short synthetic DNA or RNA sequences that can bind to a wide range of targets with high affinity and specificity. In recent years, aptamers have attracted increasing research interest due to their unique features of high binding affinity and specificity, small size, excellent chemical stability, easy chemical synthesis, facile modification, and minimal immunogenicity. These properties make aptamers ideal recognition ligands for bioanalysis, disease diagnosis, and cancer therapy. This review highlights the recent progress in aptamer selection and the latest applications of aptamer-based functional probes in the fields of bioanalysis and biomedicine.

  5. A theophylline quartz crystal microbalance biosensor based on recognition of RNA aptamer and amplification of signal.

    PubMed

    Dong, Zong-Mu; Zhao, Guang-Chao

    2013-04-21

    A quartz crystal microbalance (QCM) biosensor for theophylline was developed by recognition of RNA aptamer and gold nanoparticle amplification technique. Firstly, a designed small single-stranded RNA, RNA1, was immobilized onto the QCM electrode through a thiol linker. Then, the complementary stranded RNA2, which can combine with RNA1 to form a double-stranded RNA with a recognition unit of theophylline, could be self-assembled on the QCM electrode surface through a hybrid reaction in the presence of theophylline. The recognition process could cause a frequency change of QCM to give the signal related to theophylline. When RNA2 was tethered to gold nanoparticles, the signal could be amplified to further enhance the sensitivity of the designed sensor. Under the optimal conditions, the QCM-based biosensor showed excellent sensitivity (limit of detection, 8.2 nM) and specificity with a dissociation constant of Kd = 5.26 × 10(-7) M. The sensor can be used to quantitatively detect theophylline in serum, suggesting that it can be applied in complex biological samples.

  6. Split Spinach Aptamer for Highly Selective Recognition of DNA and RNA at Ambient Temperatures.

    PubMed

    Kikuchi, Nanami; Kolpashchikov, Dmitry M

    2016-09-01

    Split spinach aptamer (SSA) probes for fluorescent analysis of nucleic acids were designed and tested. In SSA design, two RNA or RNA/DNA strands hybridized to a specific nucleic acid analyte and formed a binding site for low-fluorescent 3,5-difluoro-4-hydroxybenzylidene imidazolinone (DFHBI) dye, which resulted in up to a 270-fold increase in fluorescence. The major advantage of the SSA over state-of-the art fluorescent probes is high selectivity: it produces only background fluorescence in the presence of a single-base-mismatched analyte, even at room temperature. SSA is therefore a promising tool for label-free analysis of nucleic acids at ambient temperatures. PMID:27305425

  7. Nucleic Acid Aptamers: Research Tools in Disease Diagnostics and Therapeutics

    PubMed Central

    Yadava, Pramod K.

    2014-01-01

    Aptamers are short sequences of nucleic acid (DNA or RNA) or peptide molecules which adopt a conformation and bind cognate ligands with high affinity and specificity in a manner akin to antibody-antigen interactions. It has been globally acknowledged that aptamers promise a plethora of diagnostic and therapeutic applications. Although use of nucleic acid aptamers as targeted therapeutics or mediators of targeted drug delivery is a relatively new avenue of research, one aptamer-based drug “Macugen” is FDA approved and a series of aptamer-based drugs are in clinical pipelines. The present review discusses the aspects of design, unique properties, applications, and development of different aptamers to aid in cancer diagnosis, prevention, and/or treatment under defined conditions. PMID:25050359

  8. Targeted Delivery of C/EBPα -saRNA by Pancreatic Ductal Adenocarcinoma-specific RNA Aptamers Inhibits Tumor Growth In Vivo

    PubMed Central

    Yoon, Sorah; Huang, Kai-Wen; Reebye, Vikash; Mintz, Paul; Tien, Yu-Wen; Lai, Hong-Shiee; Sætrom, Pål; Reccia, Isabella; Swiderski, Piotr; Armstrong, Brian; Jozwiak, Agnieszka; Spalding, Duncan; Jiao, Long; Habib, Nagy; Rossi, John J

    2016-01-01

    The 5-year survival rate for pancreatic ductal adenocarcinoma (PDAC) remains dismal despite current chemotherapeutic agents and inhibitors of molecular targets. As the incidence of PDAC constantly increases, more effective multidrug approaches must be made. Here, we report a novel method of delivering antitumorigenic therapy in PDAC by upregulating the transcriptional factor CCAAT/enhancer-binding protein-α (C/EBPα), recognized for its antiproliferative effects. Small activating RNA (saRNA) duplexes designed to increase C/EBPα expression were linked onto PDAC-specific 2′-Fluropyrimidine RNA aptamers (2′F-RNA) - P19 and P1 for construction of a cell type–specific delivery vehicle. Both P19- and P1-C/EBPα-saRNA conjugates increased expression of C/EBPα and significantly suppressed cell proliferation. Tail vein injection of the saRNA/aptamer conjugates in PANC-1 and in gemcitabine-resistant AsPC-1 mouse-xenografts led to reduced tumor size with no observed toxicity. To exploit the specificity of the P19/P1 aptamers for PDAC cells, we also assessed if conjugation with Cy3 would allow it to be used as a diagnostic tool on archival human pancreatic duodenectomy tissue sections. Scoring pattern from 72 patients suggested a positive correlation between high fluorescent signal in the high mortality patient groups. We propose a novel aptamer-based strategy for delivery of targeted molecular therapy in advanced PDAC where current modalities fail. PMID:26983359

  9. A Universal Aptamer Chimera for the Delivery of Functional microRNA-126.

    PubMed

    Rohde, Jan-H; Weigand, Julia E; Suess, Beatrix; Dimmeler, Stefanie

    2015-06-01

    microRNAs (miRs) regulate vascular diseases such as atherosclerosis and cancer. miR-126 is important for endothelial cell signaling and promotes angiogenesis, protects against atherosclerosis, and reduces breast cancer cell growth and metastasis. The overexpression of miR-126, therefore, may be an attractive therapeutic strategy for the treatment of cardiovascular disease or cancer. Here we report a novel strategy to deliver miR-126 to endothelial and breast cancer cells. We tested three different strategies to deliver miR-126 by linking the miR to an aptamer for the ubiquitously expressed transferrin receptor (transferrin receptor aptamer, TRA). Linking the precursor of miR-126 (pre-miR-126) to the TRA by annealing of a complementary stick led to efficient uptake and processing of miR-126, resulting in the delivery of 1.6×10(6)±0.3×10(6) copies miR-126-3p per ng RNA in human endothelial cells and 7.4×10(5)±2×10(5) copies miR-126-3p per ng in MCF7 breast cancer cells. The functionality of the active TRA-miR-126 chimera was further demonstrated by showing that the chimera represses the known miR-126 target VCAM-1 and improved endothelial cell sprouting in a spheroid assay. Moreover, the TRA-miR-126 chimera reduced proliferation and paracrine endothelial cell recruitment of breast cancer cells to a similar extent as miR-126-3p mimics introduced by conventional liposome-based transfection. Together, this data demonstrates that pre-miR-126 can be delivered by a non-specific aptamer to exert biological functions in two different cell models. The use of the TRA-miR-126 chimera or the combination of the delivery strategy with other endothelial or tumor specific aptamers may provide an interesting therapeutic option to treat vascular disease or cancers.

  10. Co-targeting EGFR and survivin with a bivalent aptamer-dual siRNA chimera effectively suppresses prostate cancer.

    PubMed

    Liu, Hong Yan; Yu, Xiaolin; Liu, Haitao; Wu, Daqing; She, Jin-Xiong

    2016-01-01

    Current targeted therapies using small kinase inhibitors and antibodies have limited efficacy in treating prostate cancer (PCa), a leading cause of cancer death in American men. We have developed a novel strategy by engineering an RNA-based aptamer-siRNA chimera, in which a bivalent aptamer specifically binds prostate-specific membrane antigen (PSMA) via an antibody-like structure to promote siRNA internalization in PCa cells, and two siRNAs specific to EGFR and survivin are fused between two aptamers. The chimera is able to inhibit EGFR and survivin simultaneously and induce apoptosis effectively in vitro and in vivo. In the C4-2 PCa xenograft model, the treatment with the chimera significantly suppresses tumor growth and angiogenesis. The inhibition of angiogenesis is mediated by an EGFR-HIF1α-VEGF-dependent mechanism. Our results support that the bivalent aptamer-driven delivery of two siRNAs could be a new combination therapeutic strategy to effectively inhibit multiple and conventionally "undruggable" targets. PMID:27456457

  11. Co-targeting EGFR and survivin with a bivalent aptamer-dual siRNA chimera effectively suppresses prostate cancer

    PubMed Central

    Liu, Hong Yan; Yu, Xiaolin; Liu, Haitao; Wu, Daqing; She, Jin-Xiong

    2016-01-01

    Current targeted therapies using small kinase inhibitors and antibodies have limited efficacy in treating prostate cancer (PCa), a leading cause of cancer death in American men. We have developed a novel strategy by engineering an RNA-based aptamer-siRNA chimera, in which a bivalent aptamer specifically binds prostate-specific membrane antigen (PSMA) via an antibody-like structure to promote siRNA internalization in PCa cells, and two siRNAs specific to EGFR and survivin are fused between two aptamers. The chimera is able to inhibit EGFR and survivin simultaneously and induce apoptosis effectively in vitro and in vivo. In the C4-2 PCa xenograft model, the treatment with the chimera significantly suppresses tumor growth and angiogenesis. The inhibition of angiogenesis is mediated by an EGFR-HIF1α-VEGF-dependent mechanism. Our results support that the bivalent aptamer-driven delivery of two siRNAs could be a new combination therapeutic strategy to effectively inhibit multiple and conventionally “undruggable” targets. PMID:27456457

  12. Co-targeting EGFR and survivin with a bivalent aptamer-dual siRNA chimera effectively suppresses prostate cancer.

    PubMed

    Liu, Hong Yan; Yu, Xiaolin; Liu, Haitao; Wu, Daqing; She, Jin-Xiong

    2016-07-26

    Current targeted therapies using small kinase inhibitors and antibodies have limited efficacy in treating prostate cancer (PCa), a leading cause of cancer death in American men. We have developed a novel strategy by engineering an RNA-based aptamer-siRNA chimera, in which a bivalent aptamer specifically binds prostate-specific membrane antigen (PSMA) via an antibody-like structure to promote siRNA internalization in PCa cells, and two siRNAs specific to EGFR and survivin are fused between two aptamers. The chimera is able to inhibit EGFR and survivin simultaneously and induce apoptosis effectively in vitro and in vivo. In the C4-2 PCa xenograft model, the treatment with the chimera significantly suppresses tumor growth and angiogenesis. The inhibition of angiogenesis is mediated by an EGFR-HIF1α-VEGF-dependent mechanism. Our results support that the bivalent aptamer-driven delivery of two siRNAs could be a new combination therapeutic strategy to effectively inhibit multiple and conventionally "undruggable" targets.

  13. RNA Aptamer That Specifically Binds to Mycolactone and Serves as a Diagnostic Tool for Diagnosis of Buruli Ulcer

    PubMed Central

    Aboagye, Samuel Yaw; Otchere, Isaac Darko; Liao, Albert M.; Caltagirone, Thomas G.; Yeboah-Manu, Dorothy

    2016-01-01

    most promising aptamer, Apt-3683 showed a discernible cleavage difference relative to the non-specific autocatalysis over a 3-minute time course. Conclusion This preliminary proof-of-concept indicates that diagnosis of BUD with RNA aptamers is feasible and can be used as point of care upon incorporation into a diagnostic platform. PMID:27776120

  14. Deciphering the RNA landscape by RNAome sequencing.

    PubMed

    Derks, Kasper W J; Misovic, Branislav; van den Hout, Mirjam C G N; Kockx, Christel E M; Gomez, Cesar Payan; Brouwer, Rutger W W; Vrieling, Harry; Hoeijmakers, Jan H J; van IJcken, Wilfred F J; Pothof, Joris

    2015-01-01

    Current RNA expression profiling methods rely on enrichment steps for specific RNA classes, thereby not detecting all RNA species in an unperturbed manner. We report strand-specific RNAome sequencing that determines expression of small and large RNAs from rRNA-depleted total RNA in a single sequence run. Since current analysis pipelines cannot reliably analyze small and large RNAs simultaneously, we developed TRAP, Total Rna Analysis Pipeline, a robust interface that is also compatible with existing RNA sequencing protocols. RNAome sequencing quantitatively preserved all RNA classes, allowing cross-class comparisons that facilitates the identification of relationships between different RNA classes. We demonstrate the strength of RNAome sequencing in mouse embryonic stem cells treated with cisplatin. MicroRNA and mRNA expression in RNAome sequencing significantly correlated between replicates and was in concordance with both existing RNA sequencing methods and gene expression arrays generated from the same samples. Moreover, RNAome sequencing also detected additional RNA classes such as enhancer RNAs, anti-sense RNAs, novel RNA species and numerous differentially expressed RNAs undetectable by other methods. At the level of complete RNA classes, RNAome sequencing also identified a specific global repression of the microRNA and microRNA isoform classes after cisplatin treatment whereas all other classes such as mRNAs were unchanged. These characteristics of RNAome sequencing will significantly improve expression analysis as well as studies on RNA biology not covered by existing methods. PMID:25826412

  15. Deciphering the RNA landscape by RNAome sequencing

    PubMed Central

    Derks, Kasper WJ; Misovic, Branislav; van den Hout, Mirjam CGN; Kockx, Christel EM; Payan Gomez, Cesar; Brouwer, Rutger WW; Vrieling, Harry; Hoeijmakers, Jan HJ; van IJcken, Wilfred FJ; Pothof, Joris

    2015-01-01

    Current RNA expression profiling methods rely on enrichment steps for specific RNA classes, thereby not detecting all RNA species in an unperturbed manner. We report strand-specific RNAome sequencing that determines expression of small and large RNAs from rRNA-depleted total RNA in a single sequence run. Since current analysis pipelines cannot reliably analyze small and large RNAs simultaneously, we developed TRAP, Total Rna Analysis Pipeline, a robust interface that is also compatible with existing RNA sequencing protocols. RNAome sequencing quantitatively preserved all RNA classes, allowing cross-class comparisons that facilitates the identification of relationships between different RNA classes. We demonstrate the strength of RNAome sequencing in mouse embryonic stem cells treated with cisplatin. MicroRNA and mRNA expression in RNAome sequencing significantly correlated between replicates and was in concordance with both existing RNA sequencing methods and gene expression arrays generated from the same samples. Moreover, RNAome sequencing also detected additional RNA classes such as enhancer RNAs, anti-sense RNAs, novel RNA species and numerous differentially expressed RNAs undetectable by other methods. At the level of complete RNA classes, RNAome sequencing also identified a specific global repression of the microRNA and microRNA isoform classes after cisplatin treatment whereas all other classes such as mRNAs were unchanged. These characteristics of RNAome sequencing will significantly improve expression analysis as well as studies on RNA biology not covered by existing methods. PMID:25826412

  16. High throughput sequencing analysis of RNA libraries reveals the influences of initial library and PCR methods on SELEX efficiency

    PubMed Central

    Takahashi, Mayumi; Wu, Xiwei; Ho, Michelle; Chomchan, Pritsana; Rossi, John J.; Burnett, John C.; Zhou, Jiehua

    2016-01-01

    The systemic evolution of ligands by exponential enrichment (SELEX) technique is a powerful and effective aptamer-selection procedure. However, modifications to the process can dramatically improve selection efficiency and aptamer performance. For example, droplet digital PCR (ddPCR) has been recently incorporated into SELEX selection protocols to putatively reduce the propagation of byproducts and avoid selection bias that result from differences in PCR efficiency of sequences within the random library. However, a detailed, parallel comparison of the efficacy of conventional solution PCR versus the ddPCR modification in the RNA aptamer-selection process is needed to understand effects on overall SELEX performance. In the present study, we took advantage of powerful high throughput sequencing technology and bioinformatics analysis coupled with SELEX (HT-SELEX) to thoroughly investigate the effects of initial library and PCR methods in the RNA aptamer identification. Our analysis revealed that distinct “biased sequences” and nucleotide composition existed in the initial, unselected libraries purchased from two different manufacturers and that the fate of the “biased sequences” was target-dependent during selection. Our comparison of solution PCR- and ddPCR-driven HT-SELEX demonstrated that PCR method affected not only the nucleotide composition of the enriched sequences, but also the overall SELEX efficiency and aptamer efficacy. PMID:27652575

  17. RNAome sequencing delineates the complete RNA landscape.

    PubMed

    Derks, Kasper W J; Pothof, Joris

    2015-09-01

    Standard RNA expression profiling methods rely on enrichment steps for specific RNA classes, thereby not detecting all RNA species. For example, small and large RNAs from the same sample cannot be sequenced in a single sequence run. We designed RNAome sequencing, which is a strand-specific method to determine the expression of small and large RNAs from ribosomal RNA-depleted total RNA in a single sequence run. RNAome sequencing quantitatively preserves all RNA classes. This characteristic allows comparisons between RNA classes, thereby facilitating relationships between different RNA classes. Here, we describe in detail the experimental procedure associated with RNAome sequencing published by Derks and colleagues in RNA Biology (2015) [1]. We also provide the R code for the developed Total Rna Analysis Pipeline (TRAP), an algorithm to analyze RNAome sequencing datasets (deposited at the Gene Expression Omnibus data repository, accession number GSE48084). PMID:26484291

  18. RNA-acting antibiotics: in-vitro selection of RNA aptamers for the design of new bioactive molecules less susceptible to bacterial resistance.

    PubMed

    Maurel, M C; Biard, B; Moulinier, C; Braz, D; Nugier, J; Chaumas, I; Reboud-Ravaux, M; Décout, J L

    2002-08-01

    During the last few years, antibiotic multiresistance has been increasing, not only in hospitals, but also, more worryingly, in general medicine. Different ways are being explored to bypass this problem. RNA-acting antibiotics such as aminosides (aminoglycosides) bind to bacterial RNA causing premature termination of proteins and mistranslation in bacteria. It is now possible to study the interactions of such antibiotics with their target by in-vitro selection of RNA molecules that recognize these antibiotics (RNA aptamers, SELEX method). The knowledge of the antibiotic-RNA interactions represents a promising way for the rational design of new bioactive compounds less susceptible to bacterial resistance.

  19. Oligonucleotide-based systems: DNA, microRNAs, DNA/RNA aptamers

    PubMed Central

    Jolly, Pawan; Estrela, Pedro

    2016-01-01

    There are an increasing number of applications that have been developed for oligonucleotide-based biosensing systems in genetics and biomedicine. Oligonucleotide-based biosensors are those where the probe to capture the analyte is a strand of deoxyribonucleic acid (DNA), ribonucleic acid (RNA) or a synthetic analogue of naturally occurring nucleic acids. This review will shed light on various types of nucleic acids such as DNA and RNA (particularly microRNAs), their role and their application in biosensing. It will also cover DNA/RNA aptamers, which can be used as bioreceptors for a wide range of targets such as proteins, small molecules, bacteria and even cells. It will also highlight how the invention of synthetic oligonucleotides such as peptide nucleic acid (PNA) or locked nucleic acid (LNA) has pushed the limits of molecular biology and biosensor development to new perspectives. These technologies are very promising albeit still in need of development in order to bridge the gap between the laboratory-based status and the reality of biomedical applications. PMID:27365033

  20. Oligonucleotide-based systems: DNA, microRNAs, DNA/RNA aptamers.

    PubMed

    Jolly, Pawan; Estrela, Pedro; Ladomery, Michael

    2016-06-30

    There are an increasing number of applications that have been developed for oligonucleotide-based biosensing systems in genetics and biomedicine. Oligonucleotide-based biosensors are those where the probe to capture the analyte is a strand of deoxyribonucleic acid (DNA), ribonucleic acid (RNA) or a synthetic analogue of naturally occurring nucleic acids. This review will shed light on various types of nucleic acids such as DNA and RNA (particularly microRNAs), their role and their application in biosensing. It will also cover DNA/RNA aptamers, which can be used as bioreceptors for a wide range of targets such as proteins, small molecules, bacteria and even cells. It will also highlight how the invention of synthetic oligonucleotides such as peptide nucleic acid (PNA) or locked nucleic acid (LNA) has pushed the limits of molecular biology and biosensor development to new perspectives. These technologies are very promising albeit still in need of development in order to bridge the gap between the laboratory-based status and the reality of biomedical applications. PMID:27365033

  1. Aptamer-functionalized lipid nanoparticles targeting osteoblasts as a novel RNA interference-based bone anabolic strategy.

    PubMed

    Liang, Chao; Guo, Baosheng; Wu, Heng; Shao, Ningsheng; Li, Defang; Liu, Jin; Dang, Lei; Wang, Cheng; Li, Hui; Li, Shaohua; Lau, Wing Ki; Cao, Yu; Yang, Zhijun; Lu, Cheng; He, Xiaojuan; Au, D W T; Pan, Xiaohua; Zhang, Bao-Ting; Lu, Changwei; Zhang, Hongqi; Yue, Kinman; Qian, Airong; Shang, Peng; Xu, Jiake; Xiao, Lianbo; Bian, Zhaoxiang; Tan, Weihong; Liang, Zicai; He, Fuchu; Zhang, Lingqiang; Lu, Aiping; Zhang, Ge

    2015-03-01

    Currently, major concerns about the safety and efficacy of RNA interference (RNAi)-based bone anabolic strategies still exist because of the lack of direct osteoblast-specific delivery systems for osteogenic siRNAs. Here we screened the aptamer CH6 by cell-SELEX, specifically targeting both rat and human osteoblasts, and then we developed CH6 aptamer-functionalized lipid nanoparticles (LNPs) encapsulating osteogenic pleckstrin homology domain-containing family O member 1 (Plekho1) siRNA (CH6-LNPs-siRNA). Our results showed that CH6 facilitated in vitro osteoblast-selective uptake of Plekho1 siRNA, mainly via macropinocytosis, and boosted in vivo osteoblast-specific Plekho1 gene silencing, which promoted bone formation, improved bone microarchitecture, increased bone mass and enhanced mechanical properties in both osteopenic and healthy rodents. These results indicate that osteoblast-specific aptamer-functionalized LNPs could act as a new RNAi-based bone anabolic strategy, advancing the targeted delivery selectivity of osteogenic siRNAs from the tissue level to the cellular level.

  2. Label-free RNA aptamer-based capacitive biosensor for the detection of C-reactive protein.

    PubMed

    Qureshi, Anjum; Gurbuz, Yasar; Kallempudi, Saravan; Niazi, Javed H

    2010-08-28

    In this study, we report a novel aptamer-based capacitive label-free biosensor for monitoring transducing aptamer-protein recognition events, based on charge distribution under the applied frequency by non-Faradaic impedance spectroscopy (NFIS). This approach to capacitive biosensors is reported for the first time in this study, is reagent-less in processing and is developed using gold interdigitated (GID) capacitor arrays functionalized with synthetic RNA aptamers. The RNA atpamers served as biorecognition elements for C-reactive protein (CRP), a biomarker for cardiovascular disease risk (CVR). The signal is generated as a result of the change in relative capacitance occurring as a result of the formation of an RNA-CRP complex on GID capacitors with the applied AC electrical frequency (50-350 MHz). The dispersion peak of the capacitance curve was dependent on the CRP concentration and tends to shift toward lower frequencies, accompanied by the increase in relaxation time due to the increased size of the aptamer-CRP complex. The dissociation constant (K(d)) calculated from the non-linear regression analysis of the relative capacitance change with the applied frequency showed that strong binding of CRP occurred at 208 MHz (K(d) = 1.6 microM) followed by 150 MHz (K(d) = 4.2 microM) and 306 MHz (K(d) = 3.4 microM) frequencies. The dynamic detection range for CRP is determined to be within 100-500 pg ml(-1). Our results demonstrates the behavior of an RNA-protein complex on GID capacitors under an applied electric field, which can be extended to other pairs of affinity biomolecules as well as for the development of electrical biosensor systems for different applications, including the early diagnosis of diseases.

  3. Aptamer-miRNA-212 Conjugate Sensitizes NSCLC Cells to TRAIL

    PubMed Central

    Iaboni, Margherita; Russo, Valentina; Fontanella, Raffaela; Roscigno, Giuseppina; Fiore, Danilo; Donnarumma, Elvira; Esposito, Carla Lucia; Quintavalle, Cristina; Giangrande, Paloma H; de Franciscis, Vittorio; Condorelli, Gerolama

    2016-01-01

    TNF-related apoptosis-inducing ligand (TRAIL) is a promising antitumor agent for its remarkable ability to selectively induce apoptosis in cancer cells, without affecting the viability of healthy bystander cells. The TRAIL tumor suppressor pathway is deregulated in many human malignancies including lung cancer. In human non-small cell lung cancer (NSCLC) cells, sensitization to TRAIL therapy can be restored by increasing the expression levels of the tumor suppressor microRNA-212 (miR-212) leading to inhibition of the anti-apoptotic protein PED/PEA-15 implicated in treatment resistance. In this study, we exploited a previously described RNA aptamer inhibitor of the tyrosine kinase receptor Axl (GL21.T) expressed on lung cancer cells, as a means to deliver miR-212 into human NSCLC cells expressing Axl. We demonstrate efficient delivery of miR-212 following conjugation of the miR to GL21.T (GL21.T-miR212 chimera). We show that the chimera downregulates PED and restores TRAIL-mediate cytotoxicity in cancer cells. Importantly, treatment of Axl+ lung cancer cells with the chimera resulted in (i) an increase in caspase activation and (ii) a reduction of cell viability in combination with TRAIL therapy. In conclusion, we demonstrate that the GL21.T-miR212 chimera can be employed as an adjuvant to TRAIL therapy for the treatment of lung cancer. PMID:27111415

  4. RNA aptamers as genetic control devices: the potential of riboswitches as synthetic elements for regulating gene expression.

    PubMed

    Berens, Christian; Groher, Florian; Suess, Beatrix

    2015-02-01

    RNA utilizes many different mechanisms to control gene expression. Among the regulatory elements that respond to external stimuli, riboswitches are a prominent and elegant example. They consist solely of RNA and couple binding of a small molecule ligand to the so-called "aptamer domain" with a conformational change in the downstream "expression platform" which then determines system output. The modular organization of riboswitches and the relative ease with which ligand-binding RNA aptamers can be selected in vitro against almost any molecule have led to the rapid and widespread adoption of engineered riboswitches as artificial genetic control devices in biotechnology and synthetic biology over the past decade. This review highlights proof-of-principle applications to demonstrate the versatility and robustness of engineered riboswitches in regulating gene expression in pro- and eukaryotes. It then focuses on strategies and parameters to identify aptamers that can be integrated into synthetic riboswitches that are functional in vivo, before finishing with a reflection on how to improve the regulatory properties of engineered riboswitches, so that we can not only further expand riboswitch applicability, but also finally fully exploit their potential as control elements in regulating gene expression. PMID:25676052

  5. Chimeric aptamers in cancer cell-targeted drug delivery

    PubMed Central

    Kanwar, Jagat R; Roy, Kislay; Kanwar, Rupinder K

    2011-01-01

    Aptamers are single-stranded structured oligonucleotides (DNA or RNA) that can bind to a wide range of targets ("apatopes") with high affinity and specificity. These nucleic acid ligands, generated from pools of random-sequence by an in vitro selection process referred to as systematic evolution of ligands by exponential enrichment (SELEX), have now been identified as excellent tools for chemical biology, therapeutic delivery, diagnosis, research, and monitoring therapy in real-time imaging. Today, aptamers represent an interesting class of modern Pharmaceuticals which with their low immunogenic potential mimic extend many of the properties of monoclonal antibodies in diagnostics, research, and therapeutics. More recently, chimeric aptamer approach employing many different possible types of chimerization strategies has generated more stable and efficient chimeric aptamers with aptamer-aptamer, aptamer-nonaptamer biomacromolecules (siRNAs, proteins) and aptamer-nanoparticle chimeras. These chimeric aptamers when conjugated with various biomacromolecules like locked nucleic acid (LNA) to potentiate their stability, biodistribution, and targeting efficiency, have facilitated the accurate targeting in preclinical trials. We developed LNA-aptamer (anti-nucleolin and EpCAM) complexes which were loaded in iron-saturated bovine lactofeerin (Fe-blf)-coated dopamine modified surface of superparamagnetic iron oxide (Fe3O4) nanoparticles (SPIONs). This complex was used to deliver the specific aptamers in tumor cells in a co-culture model of normal and cancer cells. This review focuses on the chimeric aptamers, currently in development that are likely to find future practical applications in concert with other therapeutic molecules and modalities. PMID:21955150

  6. In vivo SELEX for Identification of Brain-penetrating Aptamers

    PubMed Central

    Cheng, Congsheng; Chen, Yong Hong; Lennox, Kim A; Behlke, Mark A; Davidson, Beverly L

    2013-01-01

    The physiological barriers of the brain impair drug delivery for treatment of many neurological disorders. One delivery approach that has not been investigated for their ability to penetrate the brain is RNA-based aptamers. These molecules can impart delivery to peripheral tissues and circulating immune cells, where they act as ligand mimics or can be modified to carry payloads. We developed a library of aptamers and an in vivo evolution protocol to determine whether specific aptamers could be identified that would home to the brain after injection into the peripheral vasculature. Unlike biopanning with recombinant bacteriophage libraries, we found that the aptamer library employed here required more than 15 rounds of in vivo selection for convergence to specific sequences. The aptamer species identified through this approach bound to brain capillary endothelia and penetrated into the parenchyma. The methods described may find general utility for targeting various payloads to the brain. PMID:23299833

  7. In silico selection of an aptamer to estrogen receptor alpha using computational docking employing estrogen response elements as aptamer-alike molecules

    PubMed Central

    Ahirwar, Rajesh; Nahar, Smita; Aggarwal, Shikha; Ramachandran, Srinivasan; Maiti, Souvik; Nahar, Pradip

    2016-01-01

    Aptamers, the chemical-antibody substitute to conventional antibodies, are primarily discovered through SELEX technology involving multi-round selections and enrichment. Circumventing conventional methodology, here we report an in silico selection of aptamers to estrogen receptor alpha (ERα) using RNA analogs of human estrogen response elements (EREs). The inverted repeat nature of ERE and the ability to form stable hairpins were used as criteria to obtain aptamer-alike sequences. Near-native RNA analogs of selected single stranded EREs were modelled and their likelihood to emerge as ERα aptamer was examined using AutoDock Vina, HADDOCK and PatchDock docking. These in silico predictions were validated by measuring the thermodynamic parameters of ERα -RNA interactions using isothermal titration calorimetry. Based on the in silico and in vitro results, we selected a candidate RNA (ERaptR4; 5′-GGGGUCAAGGUGACCCC-3′) having a binding constant (Ka) of 1.02 ± 0.1 × 108 M−1 as an ERα-aptamer. Target-specificity of the selected ERaptR4 aptamer was confirmed through cytochemistry and solid-phase immunoassays. Furthermore, stability analyses identified ERaptR4 resistant to serum and RNase A degradation in presence of ERα. Taken together, an efficient ERα-RNA aptamer is identified using a non-SELEX procedure of aptamer selection. The high-affinity and specificity can be utilized in detection of ERα in breast cancer and related diseases. PMID:26899418

  8. Blocking the maturation of OncomiRNAs using pri-miRNA-17∼92 aptamer in retinoblastoma.

    PubMed

    Subramanian, Nithya; Kanwar, Jagat R; Kanwar, Rupinder K; Krishnakumar, Subramanian

    2015-02-01

    The miR-17∼92. or oncomiR-1, cluster encodes oncogenic microRNAs (miRNAs), and it also promotes retinoblastoma (RB) tumor formation. Antagomir and miRNA mimics based approaches are widely tried against oncogenic and tumor suppressive miRNAs. Other methods for targeting cancer related miRNAs are still under development. In the current study, we focused on the pri-miRNA-17∼92 aptamer (pri-apt), which can potentially replace the mix of five antagomirs by one aptamer that function to abrogate the maturation of miR-17, miR-18a, and miR-19b (P<0.05) for targeting RB. We used RB cell lines WERI-Rb1 and Y79 as an in vitro model. Cellular changes upon transfecting the pri-apt led to S-phase arrest in WERI-Rb1 cells and onset of apoptosis in both Y79 and WERI-Rb1 cell lines. There was increased cytotoxicity as measured by lactate dehydrogenase activity in pri-apt treated Y79 cells (P<0.05), and significant inhibition of cell proliferation was observed in both of the cell lines. Thus we showed the antiproliferative property of pri-apt in RB cell lines, which can be readily modified by developing appropriate vectors for the delivery of the aptamer specifically to cancer cells. PMID:25513843

  9. Blocking the Maturation of OncomiRNAs Using pri-miRNA-17∼92 Aptamer in Retinoblastoma

    PubMed Central

    Subramanian, Nithya; Kanwar, Jagat R.; Kanwar, Rupinder K.

    2015-01-01

    The miR-17∼92. or oncomiR-1, cluster encodes oncogenic microRNAs (miRNAs), and it also promotes retinoblastoma (RB) tumor formation. Antagomir and miRNA mimics based approaches are widely tried against oncogenic and tumor suppressive miRNAs. Other methods for targeting cancer related miRNAs are still under development. In the current study, we focused on the pri-miRNA-17∼92 aptamer (pri-apt), which can potentially replace the mix of five antagomirs by one aptamer that function to abrogate the maturation of miR-17, miR-18a, and miR-19b (P<0.05) for targeting RB. We used RB cell lines WERI-Rb1 and Y79 as an in vitro model. Cellular changes upon transfecting the pri-apt led to S-phase arrest in WERI-Rb1 cells and onset of apoptosis in both Y79 and WERI-Rb1 cell lines. There was increased cytotoxicity as measured by lactate dehydrogenase activity in pri-apt treated Y79 cells (P<0.05), and significant inhibition of cell proliferation was observed in both of the cell lines. Thus we showed the antiproliferative property of pri-apt in RB cell lines, which can be readily modified by developing appropriate vectors for the delivery of the aptamer specifically to cancer cells. PMID:25513843

  10. Selection of RNA Aptamers Against Botulinum Neurotoxin Type A Light Chain Through a Non-Radioactive Approach.

    PubMed

    Chang, Tzuu-Wang; Janardhanan, Pavithra; Mello, Charlene M; Singh, Bal Ram; Cai, Shuowei

    2016-09-01

    Botulinum neurotoxin (BoNT), a category A agent, is the most toxic molecule known to mankind. The endopeptidase activity of light chain domain of BoNT is the cause for the inhibition of the neurotransmitter release and the flaccid paralysis that leads to lethality in botulism. Currently, antidotes are not available to reverse the flaccid paralysis caused by BoNT. In the present study, a non-radioactive-based systematic evolution of ligands by exponential enrichment (SELEX) process is developed by utilizing surface plasmon resonance to monitor the binding enrichment. Two RNA aptamers have been identified as strong binders against light chain of botulinum neurotoxin type A. These two aptamers showed strong inhibition activity on LCA, with IC50 in nanomolar range. Inhibition kinetic studies reveal mid nanomolar KI and non-competitive nature of their inhibition, suggesting that they have strong potential as antidotes that can reverse the symptom caused by BoNT/A. More importantly, we observed that the 2'-fluorine-pyrimidine-modified RNA aptamers identified here do not change their binding and biological activities. This observation could lead to a cost-effective way for SELEX, by using regular nucleotide during SELEX, and 2'-fluorine-pyrimidine-modified nucleotide for final application to enhance their RNase-resistance. PMID:27085355

  11. RNA aptamer based electrochemical biosensor for sensitive and selective detection of cAMP.

    PubMed

    Zhao, Fulin; Xie, Qingyun; Xu, Mingfei; Wang, Shouyu; Zhou, Jiyong; Liu, Fei

    2015-04-15

    Cyclic adenosine monophosphate (cAMP) is an important small biological molecule associated with the healthy state of living organism. In order to realize highly sensitive and specific detection of cAMP, here an RNA aptamer and electrochemical impedance spectroscopy (EIS) based biosensor enhanced by gold nanoparticles electrodeposited on the surface of gold electrode is designed. The designed aptasensor has a wide effective measuring range from 50pM to 250pM with a detection limit of 50pM in PBS buffer, and an effective measuring range from 50nM to 1μM with a detection limit of 50nM in serum. The designed biosensor is also able to detect cAMP with high sensitivity, specificity, and stability. Since the biosensor can be easily fabricated with low cost and repeatedly used for at least two times, it owns great potential in wide application fields such as clinical test and food inspection, etc.

  12. RNA sequencing: advances, challenges and opportunities

    PubMed Central

    Ozsolak, Fatih; Milos, Patrice M.

    2011-01-01

    In the few years since its initial application, massively parallel cDNA sequencing, or RNA-seq, has allowed many advances in the characterization and quantification of transcriptomes. Recently, several developments in RNA-seq methods have provided an even more complete characterization of RNA transcripts. These developments include improvements in transcription start site mapping, strand-specific measurements, gene fusion detection, small RNA characterization and detection of alternative splicing events. Ongoing developments promise further advances in the application of RNA-seq, particularly direct RNA sequencing and approaches that allow RNA quantification from very small amounts of cellular materials. PMID:21191423

  13. EpCAM Aptamer-siRNA Chimera Targets and Regress Epithelial Cancer

    PubMed Central

    Subramanian, Nithya; Kanwar, Jagat R.; Kanwar, Rupinder K.; Sreemanthula, JagadeeshBabu; Biswas, Jyotirmay; Khetan, Vikas; Krishnakumar, Subramanian

    2015-01-01

    Epithelial cell adhesion molecule (EpCAM), a cancer stem cell (CSC) marker is over expressed in epithelial cancers and in retinoblastoma (RB). We fabricated an EpCAM targeting aptamer-siRNA chimera and investigated its anti-tumor property and EpCAM intracellular domain (EpICD) mediated signaling in epithelial cancer. The anti-tumor efficacy of EpCAM aptamer-siEpCAM chimera (EpApt-siEp) was evaluated by qPCR, northern and Western blotting in WERI-Rb1- RB cell line, primary RB tumor cells and in MCF7- breast cancer cell line. Anti-tumor activity of EpApt-siEp was studied in vivo using epithelial cancer (MCF7) mice xenograft model. The mechanism and pathways involved in the anti-tumor activity was further studied using protein arrays and qPCR. EpApt-siEp chimera was processed in vitro by dicer enzyme. Treatment of the WERI-Rb1 and MCF7 cells with EpApt-siEp revealed statistically significant down regulation of EpCAM expression (P<0.005) and concomitant reduction in cellular proliferation. In primary RB cells cultured from RB tumors, EpApt-siEp silenced EpCAM, significantly inhibited (P<0.01) cell proliferation and induced cytotoxicity. Knockdown of EpICD expressed in RB primary tumors led to repression of pluripotency markers, SOX2, OCT4, NANOG, and CD133. In vivo studies showed complete tumor growth regression without any toxicity in animals (P<0.001) and tumor tissues showed significant downregulation (P<0.05) of EpCAM, MRP1, ABCG2, stathmin, survivin and upregulation of ATM (P<0.05) leading to apoptosis by intrinsic pathway with minor alteration in cytokines. Our results revealed that EpApt-siEp potentially eradicated EpCAM positive cancer cells through CSC marker suppression and apoptosis, while sparing normal EpCAM negative adjacent cells. PMID:26176230

  14. Aptamers in Therapeutics.

    PubMed

    Parashar, Abhishek

    2016-06-01

    Aptamers are single strand DNA or RNA molecules, selected by an iterative process known as Systematic Evolution of Ligands by Exponential Enrichment (SELEX). Due to various advantages of aptamers such as high temperature stability, animal free, cost effective production and its high affinity and selectivity for its target make them attractive alternatives to monoclonal antibody for use in diagnostic and therapeutic purposes. Aptamer has been generated against vesicular endothelial growth factor 165 involved in age related macular degeneracy. Macugen was the first FDA approved aptamer based drug that was commercialized. Later other aptamers were also developed against blood clotting proteins, cancer proteins, antibody E, agents involved in diabetes nephropathy, autoantibodies involved in autoimmune disorders, etc. Aptamers have also been developed against viruses and could work with other antiviral agents in treating infections. PMID:27504277

  15. Aptamers in Therapeutics

    PubMed Central

    2016-01-01

    Aptamers are single strand DNA or RNA molecules, selected by an iterative process known as Systematic Evolution of Ligands by Exponential Enrichment (SELEX). Due to various advantages of aptamers such as high temperature stability, animal free, cost effective production and its high affinity and selectivity for its target make them attractive alternatives to monoclonal antibody for use in diagnostic and therapeutic purposes. Aptamer has been generated against vesicular endothelial growth factor 165 involved in age related macular degeneracy. Macugen was the first FDA approved aptamer based drug that was commercialized. Later other aptamers were also developed against blood clotting proteins, cancer proteins, antibody E, agents involved in diabetes nephropathy, autoantibodies involved in autoimmune disorders, etc. Aptamers have also been developed against viruses and could work with other antiviral agents in treating infections. PMID:27504277

  16. Aptamers and their Applications in Nanomedicine

    PubMed Central

    Sun, Hongguang; Zu, Youli

    2015-01-01

    Aptamers are composed of short RNA or single-stranded DNA sequences that, when folded into their unique three-dimensional conformation, can specifically bind to their cognate targets with high specificity and affinity. Although functionally similar to protein antibodies, oligonucleotide aptamers offer several advantages over protein antibodies in biomedical and clinical applications. Additionally, through the enhanced permeability and retention (EPR) effect, nanomedicines can improve the therapeutic index of a treatment and reduce side effects by enhancing accumulation at the disease site. However, this EPR effect is “passive targeting” to tumors and thus, may not be an ideal approach for targeted cancer therapy. To construct ligand-directed “active targeting” nano-based delivery systems, aptamer technology has been widely studied. The aptamer-equipped nanomedicines have been tested for in vitro diagnosis, in vivo imaging, targeted cancer therapy, theranostic approaches, sub-cellular molecule detection, food safety, and environment monitoring. This review will focus on the development of aptamer-conjugated nanomedicines and their application for in vivo imaging, targeted therapy, and theranostics. In some applications, aptamers can also be used as drug carriers or ON/OFF switches. Herein, some outstanding therapeutic approaches are also discussed on a case-by-case basis, such as an “on-command” release system and a combinational therapy strategy. PMID:25677591

  17. SELEX Modifications and Bioanalytical Techniques for Aptamer-Target Binding Characterization.

    PubMed

    Tan, Sze Y; Acquah, Caleb; Sidhu, Amandeep; Ongkudon, Clarence M; Yon, L S; Danquah, Michael K

    2016-11-01

    The quest to improve the detection of biomolecules and cells in health and life sciences has led to the discovery and characterization of various affinity bioprobes. Libraries of synthetic oligonucleotides (ssDNA/ssRNA) with randomized sequences are employed during Systematic Evolution of Ligands by Exponential Enrichment (SELEX) to select highly specific affinity probes called aptamers. With much focus on the generation of aptamers for a variety of target molecules, conventional SELEX protocols have been modified to develop new and improved SELEX protocols yielding highly specific and stable aptamers. Various techniques have been used to analyze the binding interactions between aptamers and their cognate molecules with associated merits and limitations. This article comprehensively reviews research advancements in the generation of aptamers, analyses physicochemical conditions affecting their binding characteristics to cellular and biomolecular targets, and discusses various field applications of aptameric binding. Biophysical techniques employed in the characterization of the molecular and binding features of aptamers to their cognate targets are also discussed.

  18. Advancements in Aptamer Discovery Technologies.

    PubMed

    Gotrik, Michael R; Feagin, Trevor A; Csordas, Andrew T; Nakamoto, Margaret A; Soh, H Tom

    2016-09-20

    Affinity reagents that specifically bind to their target molecules are invaluable tools in nearly every field of modern biomedicine. Nucleic acid-based aptamers offer many advantages in this domain, because they are chemically synthesized, stable, and economical. Despite these compelling features, aptamers are currently not widely used in comparison to antibodies. This is primarily because conventional aptamer-discovery techniques such as SELEX are time-consuming and labor-intensive and often fail to produce aptamers with comparable binding performance to antibodies. This Account describes a body of work from our laboratory in developing advanced methods for consistently producing high-performance aptamers with higher efficiency, fewer resources, and, most importantly, a greater probability of success. We describe our efforts in systematically transforming each major step of the aptamer discovery process: selection, analysis, and characterization. To improve selection, we have developed microfluidic devices (M-SELEX) that enable discovery of high-affinity aptamers after a minimal number of selection rounds by precisely controlling the target concentration and washing stringency. In terms of improving aptamer pool analysis, our group was the first to use high-throughput sequencing (HTS) for the discovery of new aptamers. We showed that tracking the enrichment trajectory of individual aptamer sequences enables the identification of high-performing aptamers without requiring full convergence of the selected aptamer pool. HTS is now widely used for aptamer discovery, and open-source software has become available to facilitate analysis. To improve binding characterization, we used HTS data to design custom aptamer arrays to measure the affinity and specificity of up to ∼10(4) DNA aptamers in parallel as a means to rapidly discover high-quality aptamers. Most recently, our efforts have culminated in the invention of the "particle display" (PD) screening system, which

  19. Advancements in Aptamer Discovery Technologies.

    PubMed

    Gotrik, Michael R; Feagin, Trevor A; Csordas, Andrew T; Nakamoto, Margaret A; Soh, H Tom

    2016-09-20

    Affinity reagents that specifically bind to their target molecules are invaluable tools in nearly every field of modern biomedicine. Nucleic acid-based aptamers offer many advantages in this domain, because they are chemically synthesized, stable, and economical. Despite these compelling features, aptamers are currently not widely used in comparison to antibodies. This is primarily because conventional aptamer-discovery techniques such as SELEX are time-consuming and labor-intensive and often fail to produce aptamers with comparable binding performance to antibodies. This Account describes a body of work from our laboratory in developing advanced methods for consistently producing high-performance aptamers with higher efficiency, fewer resources, and, most importantly, a greater probability of success. We describe our efforts in systematically transforming each major step of the aptamer discovery process: selection, analysis, and characterization. To improve selection, we have developed microfluidic devices (M-SELEX) that enable discovery of high-affinity aptamers after a minimal number of selection rounds by precisely controlling the target concentration and washing stringency. In terms of improving aptamer pool analysis, our group was the first to use high-throughput sequencing (HTS) for the discovery of new aptamers. We showed that tracking the enrichment trajectory of individual aptamer sequences enables the identification of high-performing aptamers without requiring full convergence of the selected aptamer pool. HTS is now widely used for aptamer discovery, and open-source software has become available to facilitate analysis. To improve binding characterization, we used HTS data to design custom aptamer arrays to measure the affinity and specificity of up to ∼10(4) DNA aptamers in parallel as a means to rapidly discover high-quality aptamers. Most recently, our efforts have culminated in the invention of the "particle display" (PD) screening system, which

  20. Biases in small RNA deep sequencing data

    PubMed Central

    Raabe, Carsten A.; Tang, Thean-Hock; Brosius, Juergen; Rozhdestvensky, Timofey S.

    2014-01-01

    High-throughput RNA sequencing (RNA-seq) is considered a powerful tool for novel gene discovery and fine-tuned transcriptional profiling. The digital nature of RNA-seq is also believed to simplify meta-analysis and to reduce background noise associated with hybridization-based approaches. The development of multiplex sequencing enables efficient and economic parallel analysis of gene expression. In addition, RNA-seq is of particular value when low RNA expression or modest changes between samples are monitored. However, recent data uncovered severe bias in the sequencing of small non-protein coding RNA (small RNA-seq or sRNA-seq), such that the expression levels of some RNAs appeared to be artificially enhanced and others diminished or even undetectable. The use of different adapters and barcodes during ligation as well as complex RNA structures and modifications drastically influence cDNA synthesis efficacies and exemplify sources of bias in deep sequencing. In addition, variable specific RNA G/C-content is associated with unequal polymerase chain reaction amplification efficiencies. Given the central importance of RNA-seq to molecular biology and personalized medicine, we review recent findings that challenge small non-protein coding RNA-seq data and suggest approaches and precautions to overcome or minimize bias. PMID:24198247

  1. An RNA aptamer possessing a novel monovalent cation-mediated fold inhibits lysozyme catalysis by inhibiting the binding of long natural substrates.

    PubMed

    Padlan, Camille S; Malashkevich, Vladimir N; Almo, Steve C; Levy, Matthew; Brenowitz, Michael; Girvin, Mark E

    2014-04-01

    RNA aptamers are being developed as inhibitors of macromolecular and cellular function, diagnostic tools, and potential therapeutics. Our understanding of the physical nature of this emerging class of nucleic acid-protein complexes is limited; few atomic resolution structures have been reported for aptamers bound to their protein target. Guided by chemical mapping, we systematically minimized an RNA aptamer (Lys1) selected against hen egg white lysozyme. The resultant 59-nucleotide compact aptamer (Lys1.2minE) retains nanomolar binding affinity and the ability to inhibit lysozyme's catalytic activity. Our 2.0-Å crystal structure of the aptamer-protein complex reveals a helical stem stabilizing two loops to form a protein binding platform that binds lysozyme distal to the catalytic cleft. This structure along with complementary solution analyses illuminate a novel protein-nucleic acid interface; (1) only 410 Å(2) of solvent accessible surface are buried by aptamer binding; (2) an unusually small fraction (∼18%) of the RNA-protein interaction is electrostatic, consistent with the limited protein phosphate backbone contacts observed in the structure; (3) a single Na(+) stabilizes the loops that constitute the protein-binding platform, and consistent with this observation, Lys1.2minE-lysozyme complex formation takes up rather than displaces cations at low ionic strength; (4) Lys1.2minE inhibits catalysis of large cell wall substrates but not catalysis of small model substrates; and (5) the helical stem of Lys1.2minE can be shortened to four base pairs (Lys1.2minF) without compromising binding affinity, yielding a 45-nucleotide aptamer whose structure may be an adaptable protein binding platform.

  2. antaRNA: ant colony-based RNA sequence design

    PubMed Central

    Kleinkauf, Robert; Mann, Martin; Backofen, Rolf

    2015-01-01

    Motivation: RNA sequence design is studied at least as long as the classical folding problem. Although for the latter the functional fold of an RNA molecule is to be found, inverse folding tries to identify RNA sequences that fold into a function-specific target structure. In combination with RNA-based biotechnology and synthetic biology, reliable RNA sequence design becomes a crucial step to generate novel biochemical components. Results: In this article, the computational tool antaRNA is presented. It is capable of compiling RNA sequences for a given structure that comply in addition with an adjustable full range objective GC-content distribution, specific sequence constraints and additional fuzzy structure constraints. antaRNA applies ant colony optimization meta-heuristics and its superior performance is shown on a biological datasets. Availability and implementation: http://www.bioinf.uni-freiburg.de/Software/antaRNA Contact: backofen@informatik.uni-freiburg.de Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26023105

  3. Stem kernels for RNA sequence analyses.

    PubMed

    Sakakibara, Yasubumi; Popendorf, Kris; Ogawa, Nana; Asai, Kiyoshi; Sato, Kengo

    2007-10-01

    Several computational methods based on stochastic context-free grammars have been developed for modeling and analyzing functional RNA sequences. These grammatical methods have succeeded in modeling typical secondary structures of RNA, and are used for structural alignment of RNA sequences. However, such stochastic models cannot sufficiently discriminate member sequences of an RNA family from nonmembers and hence detect noncoding RNA regions from genome sequences. A novel kernel function, stem kernel, for the discrimination and detection of functional RNA sequences using support vector machines (SVMs) is proposed. The stem kernel is a natural extension of the string kernel, specifically the all-subsequences kernel, and is tailored to measure the similarity of two RNA sequences from the viewpoint of secondary structures. The stem kernel examines all possible common base pairs and stem structures of arbitrary lengths, including pseudoknots between two RNA sequences, and calculates the inner product of common stem structure counts. An efficient algorithm is developed to calculate the stem kernels based on dynamic programming. The stem kernels are then applied to discriminate members of an RNA family from nonmembers using SVMs. The study indicates that the discrimination ability of the stem kernel is strong compared with conventional methods. Furthermore, the potential application of the stem kernel is demonstrated by the detection of remotely homologous RNA families in terms of secondary structures. This is because the string kernel is proven to work for the remote homology detection of protein sequences. These experimental results have convinced us to apply the stem kernel in order to find novel RNA families from genome sequences. PMID:17933013

  4. HAPIscreen, a method for high-throughput aptamer identification

    PubMed Central

    2011-01-01

    Background Aptamers are oligonucleotides displaying specific binding properties for a predetermined target. They are selected from libraries of randomly synthesized candidates through an in vitro selection process termed SELEX (Systematic Evolution of Ligands by EXponential enrichment) alternating selection and amplification steps. SELEX is followed by cloning and sequencing of the enriched pool of oligonucleotides to enable comparison of the selected sequences. The most represented candidates are then synthesized and their binding properties are individually evaluated thus leading to the identification of aptamers. These post-selection steps are time consuming and introduce a bias to the expense of poorly amplified binders that might be of high affinity and are consequently underrepresented. A method that would circumvent these limitations would be highly valuable. Results We describe a novel homogeneous solution-based method for screening large populations of oligonucleotide candidates generated from SELEX. This approach, based on the AlphaScreen® technology, is carried out on the exclusive basis of the binding properties of the selected candidates without the needs of performing a priori sequencing. It therefore enables the functional identification of high affinity aptamers. We validated the HAPIscreen (High throughput APtamer Identification screen) methodology using aptamers targeted to RNA hairpins, previously identified in our laboratory. We then screened pools of candidates issued from SELEX rounds in a 384 well microplate format and identify new RNA aptamers to pre-microRNAs. Conclusions HAPIscreen, an Alphascreen®-based methodology for the identification of aptamers is faster and less biased than current procedures based on sequence comparison of selected oligonucleotides and sampling binding properties of few individuals. Moreover this methodology allows for screening larger number of candidates. Used here for selecting anti-premiR aptamers, HAPIscreen

  5. Assays for aptamer-based platforms.

    PubMed

    Citartan, Marimuthu; Gopinath, Subash C B; Tominaga, Junji; Tan, Soo-Choon; Tang, Thean-Hock

    2012-04-15

    Aptamers are single stranded DNA or RNA oligonucleotides that have high affinity and specificity towards a wide range of target molecules. Aptamers have low molecular weight, amenable to chemical modifications and exhibit stability undeterred by repetitive denaturation and renaturation. Owing to these indispensable advantages, aptamers have been implemented as molecular recognition element as alternative to antibodies in various assays for diagnostics. By amalgamating with a number of methods that can provide information on the aptamer-target complex formation, aptamers have become the elemental tool for numerous biosensor developments. In this review, administration of aptamers in applications involving assays of fluorescence, electrochemistry, nano-label and nano-constructs are discussed. Although detection strategies are different for various aptamer-based assays, the core of the design strategies is similar towards reporting the presence of specific target binding to the corresponding aptamers. It is prognosticated that aptamers will find even broader applications with the development of new methods of transducing aptamer target binding.

  6. CTLA4 aptamer delivers STAT3 siRNA to tumor-associated and malignant T cells

    PubMed Central

    Herrmann, Andreas; Priceman, Saul J.; Kujawski, Maciej; Xin, Hong; Cherryholmes, Gregory A.; Zhang, Wang; Zhang, Chunyan; Lahtz, Christoph; Kowolik, Claudia; Forman, Steve J.; Kortylewski, Marcin; Yu, Hua

    2014-01-01

    Intracellular therapeutic targets that define tumor immunosuppression in both tumor cells and T cells remain intractable. Here, we have shown that administration of a covalently linked siRNA to an aptamer (apt) that selectively binds cytotoxic T lymphocyte–associated antigen 4 (CTLA4apt) allows gene silencing in exhausted CD8+ T cells and Tregs in tumors as well as CTLA4-expressing malignant T cells. CTLA4 expression was upregulated in CD8+ T cells in the tumor milieu; therefore, CTLA4apt fused to a STAT3-targeting siRNA (CTLA4apt–STAT3 siRNA) resulted in internalization into tumor-associated CD8+ T cells and silencing of STAT3, which activated tumor antigen–specific T cells in murine models. Both local and systemic administration of CTLA4apt–STAT3 siRNA dramatically reduced tumor-associated Tregs. Furthermore, CTLA4apt–STAT3 siRNA potently inhibited tumor growth and metastasis in various mouse tumor models. Importantly, CTLA4 expression is observed in T cells of patients with blood malignancies, and CTLA4apt–STAT3 siRNA treatment of immunodeficient mice bearing human T cell lymphomas promoted tumor cell apoptosis and tumor growth inhibition. These data demonstrate that a CTLA4apt-based siRNA delivery strategy allows gene silencing in both tumor-associated T cells and tumor cells and inhibits tumor growth and metastasis. PMID:24892807

  7. An RNA aptamer possessing a novel monovalent cation-mediated fold inhibits lysozyme catalysis by inhibiting the binding of long natural substrates

    PubMed Central

    Padlan, Camille S.; Malashkevich, Vladimir N.; Almo, Steve C.; Levy, Matthew; Brenowitz, Michael; Girvin, Mark E.

    2014-01-01

    RNA aptamers are being developed as inhibitors of macromolecular and cellular function, diagnostic tools, and potential therapeutics. Our understanding of the physical nature of this emerging class of nucleic acid–protein complexes is limited; few atomic resolution structures have been reported for aptamers bound to their protein target. Guided by chemical mapping, we systematically minimized an RNA aptamer (Lys1) selected against hen egg white lysozyme. The resultant 59-nucleotide compact aptamer (Lys1.2minE) retains nanomolar binding affinity and the ability to inhibit lysozyme's catalytic activity. Our 2.0-Å crystal structure of the aptamer–protein complex reveals a helical stem stabilizing two loops to form a protein binding platform that binds lysozyme distal to the catalytic cleft. This structure along with complementary solution analyses illuminate a novel protein–nucleic acid interface; (1) only 410 Å2 of solvent accessible surface are buried by aptamer binding; (2) an unusually small fraction (∼18%) of the RNA-protein interaction is electrostatic, consistent with the limited protein phosphate backbone contacts observed in the structure; (3) a single Na+ stabilizes the loops that constitute the protein-binding platform, and consistent with this observation, Lys1.2minE–lysozyme complex formation takes up rather than displaces cations at low ionic strength; (4) Lys1.2minE inhibits catalysis of large cell wall substrates but not catalysis of small model substrates; and (5) the helical stem of Lys1.2minE can be shortened to four base pairs (Lys1.2minF) without compromising binding affinity, yielding a 45-nucleotide aptamer whose structure may be an adaptable protein binding platform. PMID:24570482

  8. Experimental investigation of an RNA sequence space

    NASA Technical Reports Server (NTRS)

    Lee, Youn-Hyung; Dsouza, Lisa; Fox, George E.

    1993-01-01

    Modern rRNAs are the historic consequence of an ongoing evolutionary exploration of a sequence space. These extant sequences belong to a special subset of the sequence space that is comprised only of those primary sequences that can validly perform the biological function(s) required of the particular RNA. If it were possible to readily identify all such valid sequences, stochastic predictions could be made about the relative likelihood of various evolutionary pathways available to an RNA. Herein an experimental system which can assess whether a particular sequence is likely to have validity as a eubacterial 5S rRNA is described. A total of ten naturally occurring, and hence known to be valid, sequences and two point mutants of unknown validity were used to test the usefulness of the approach. Nine of the ten valid sequences tested positive whereas both mutants tested as clearly defective. The tenth valid sequence gave results that would be interpreted as reflecting a borderline status were the answer not known. These results demonstrate that it is possible to experimentally determine which sequences in local regions of the sequence space are potentially valid 5S rRNAs.

  9. Quantitative Assessment of RNA-Protein Interactions with High Throughput Sequencing - RNA Affinity Profiling (HiTS-RAP)

    PubMed Central

    Ozer, Abdullah; Tome, Jacob M.; Friedman, Robin C.; Gheba, Dan; Schroth, Gary P.; Lis, John T.

    2016-01-01

    Because RNA-protein interactions play a central role in a wide-array of biological processes, methods that enable a quantitative assessment of these interactions in a high-throughput manner are in great demand. Recently, we developed the High Throughput Sequencing-RNA Affinity Profiling (HiTS-RAP) assay, which couples sequencing on an Illumina GAIIx with the quantitative assessment of one or several proteins’ interactions with millions of different RNAs in a single experiment. We have successfully used HiTS-RAP to analyze interactions of EGFP and NELF-E proteins with their corresponding canonical and mutant RNA aptamers. Here, we provide a detailed protocol for HiTS-RAP, which can be completed in about a month (8 days hands-on time) including the preparation and testing of recombinant proteins and DNA templates, clustering DNA templates on a flowcell, high-throughput sequencing and protein binding with GAIIx, and finally data analysis. We also highlight aspects of HiTS-RAP that can be further improved and points of comparison between HiTS-RAP and two other recently developed methods, RNA-MaP and RBNS. A successful HiTS-RAP experiment provides the sequence and binding curves for approximately 200 million RNAs in a single experiment. PMID:26182240

  10. Aptamer-hybrid nanoparticle bioconjugate efficiently delivers miRNA-29b to non-small-cell lung cancer cells and inhibits growth by downregulating essential oncoproteins

    PubMed Central

    Perepelyuk, Maryna; Maher, Christina; Lakshmikuttyamma, Ashakumary; Shoyele, Sunday A

    2016-01-01

    MicroRNAs (miRNAs) are potentially attractive candidates for cancer therapy. However, their therapeutic application is limited by lack of availability of an efficient delivery system to stably deliver these potent molecules intracellularly to cancer cells while avoiding healthy cells. We developed a novel aptamer-hybrid nanoparticle bioconjugate delivery system to selectively deliver miRNA-29b to MUC1-expressing cancer cells. Significant downregulation of oncoproteins DNMT3b and MCL1 was demonstrated by these MUC1 aptamer-functionalized hybrid nanoparticles in A549 cells. Furthermore, downregulation of these oncoproteins led to antiproliferative effect and induction of apoptosis in a superior version when compared with Lipofectamine 2000. This novel aptamer-hybrid nanoparticle bioconjugate delivery system could potentially serve as a platform for intracellular delivery of miRNAs to cancer cells, hence improving the therapeutic outcome of lung cancer. PMID:27555773

  11. Aptamer-hybrid nanoparticle bioconjugate efficiently delivers miRNA-29b to non-small-cell lung cancer cells and inhibits growth by downregulating essential oncoproteins.

    PubMed

    Perepelyuk, Maryna; Maher, Christina; Lakshmikuttyamma, Ashakumary; Shoyele, Sunday A

    2016-01-01

    MicroRNAs (miRNAs) are potentially attractive candidates for cancer therapy. However, their therapeutic application is limited by lack of availability of an efficient delivery system to stably deliver these potent molecules intracellularly to cancer cells while avoiding healthy cells. We developed a novel aptamer-hybrid nanoparticle bioconjugate delivery system to selectively deliver miRNA-29b to MUC1-expressing cancer cells. Significant downregulation of oncoproteins DNMT3b and MCL1 was demonstrated by these MUC1 aptamer-functionalized hybrid nanoparticles in A549 cells. Furthermore, downregulation of these oncoproteins led to antiproliferative effect and induction of apoptosis in a superior version when compared with Lipofectamine 2000. This novel aptamer-hybrid nanoparticle bioconjugate delivery system could potentially serve as a platform for intracellular delivery of miRNAs to cancer cells, hence improving the therapeutic outcome of lung cancer. PMID:27555773

  12. Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.

    PubMed

    Tan, M K

    1991-08-01

    A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.

  13. AptaTRACE Elucidates RNA Sequence-Structure Motifs from Selection Trends in HT-SELEX Experiments.

    PubMed

    Dao, Phuong; Hoinka, Jan; Takahashi, Mayumi; Zhou, Jiehua; Ho, Michelle; Wang, Yijie; Costa, Fabrizio; Rossi, John J; Backofen, Rolf; Burnett, John; Przytycka, Teresa M

    2016-07-01

    Aptamers, short RNA or DNA molecules that bind distinct targets with high affinity and specificity, can be identified using high-throughput systematic evolution of ligands by exponential enrichment (HT-SELEX), but scalable analytic tools for understanding sequence-function relationships from diverse HT-SELEX data are not available. Here we present AptaTRACE, a computational approach that leverages the experimental design of the HT-SELEX protocol, RNA secondary structure, and the potential presence of many secondary motifs to identify sequence-structure motifs that show a signature of selection. We apply AptaTRACE to identify nine motifs in C-C chemokine receptor type 7 targeted by aptamers in an in vitro cell-SELEX experiment. We experimentally validate two aptamers whose binding required both sequence and structural features. AptaTRACE can identify low-abundance motifs, and we show through simulations that, because of this, it could lower HT-SELEX cost and time by reducing the number of selection cycles required. PMID:27467247

  14. Light-up properties of complexes between thiazole orange-small molecule conjugates and aptamers.

    PubMed

    Pei, Renjun; Rothman, Jeffrey; Xie, Yuli; Stojanovic, Milan N

    2009-05-01

    The full understanding of dynamics of cellular processes hinges on the development of efficient and non-invasive labels for intracellular RNA species. Light-up aptamers binding fluorogenic ligands show promise as specific labels for RNA species containing those aptamers. Herein, we took advantage of existing, non-light-up aptamers against small molecules and demonstrated a new class of light-up probes in vitro. We synthesized two conjugates of thiazole orange dye to small molecules (GMP and AMP) and characterized in vitro their interactions with corresponding RNA aptamers. The conjugates preserved specific binding to aptamers while showing several 100-fold increase in fluorescence of the dye (the 'light-up' property). In the presence of free small molecules, conjugates can be displaced from aptamers serving also as fluorescent sensors. Our in vitro results provide the proof-of-concept that the small-molecule conjugates with light-up properties can serve as a general approach to label RNA sequences containing aptamers.

  15. Discovering New Biology through Sequencing of RNA.

    PubMed

    Weber, Andreas P M

    2015-11-01

    Sequencing of RNA (RNA-Seq) was invented approximately 1 decade ago and has since revolutionized biological research. This update provides a brief historic perspective on the development of RNA-Seq and then focuses on the application of RNA-Seq in qualitative and quantitative analyses of transcriptomes. Particular emphasis is given to aspects of data analysis. Since the wet-lab and data analysis aspects of RNA-Seq are still rapidly evolving and novel applications are continuously reported, a printed review will be rapidly outdated and can only serve to provide some examples and general guidelines for planning and conducting RNA-Seq studies. Hence, selected references to frequently update online resources are given.

  16. The Runt domain of AML1 (RUNX1) binds a sequence-conserved RNA motif that mimics a DNA element

    PubMed Central

    Fukunaga, Junichi; Nomura, Yusuke; Tanaka, Yoichiro; Amano, Ryo; Tanaka, Taku; Nakamura, Yoshikazu; Kawai, Gota; Sakamoto, Taiichi; Kozu, Tomoko

    2013-01-01

    AML1 (RUNX1) is a key transcription factor for hematopoiesis that binds to the Runt-binding double-stranded DNA element (RDE) of target genes through its N-terminal Runt domain. Aberrations in the AML1 gene are frequently found in human leukemia. To better understand AML1 and its potential utility for diagnosis and therapy, we obtained RNA aptamers that bind specifically to the AML1 Runt domain. Enzymatic probing and NMR analyses revealed that Apt1-S, which is a truncated variant of one of the aptamers, has a CACG tetraloop and two stem regions separated by an internal loop. All the isolated aptamers were found to contain the conserved sequence motif 5′-NNCCAC-3′ and 5′-GCGMGN′N′-3′ (M:A or C; N and N′ form Watson–Crick base pairs). The motif contains one AC mismatch and one base bulged out. Mutational analysis of Apt1-S showed that three guanines of the motif are important for Runt binding as are the three guanines of RDE, which are directly recognized by three arginine residues of the Runt domain. Mutational analyses of the Runt domain revealed that the amino acid residues used for Apt1-S binding were similar to those used for RDE binding. Furthermore, the aptamer competed with RDE for binding to the Runt domain in vitro. These results demonstrated that the Runt domain of the AML1 protein binds to the motif of the aptamer that mimics DNA. Our findings should provide new insights into RNA function and utility in both basic and applied sciences. PMID:23709277

  17. Alternative applications for distinct RNA sequencing strategies

    PubMed Central

    Han, Leng; Vickers, Kasey C.; Samuels, David C.

    2015-01-01

    Recent advances in RNA library preparation methods, platform accessibility and cost efficiency have allowed high-throughput RNA sequencing (RNAseq) to replace conventional hybridization microarray platforms as the method of choice for mRNA profiling and transcriptome analyses. RNAseq is a powerful technique to profile both long and short RNA expression, and the depth of information gained from distinct RNAseq methods is striking and facilitates discovery. In addition to expression analysis, distinct RNAseq approaches also allow investigators the ability to assess transcriptional elongation, DNA variance and exogenous RNA content. Here we review the current state of the art in transcriptome sequencing and address epigenetic regulation, quantification of transcription activation, RNAseq output and a diverse set of applications for RNAseq data. We detail how RNAseq can be used to identify allele-specific expression, single-nucleotide polymorphisms and somatic mutations and discuss the benefits and limitations of using RNAseq to monitor DNA characteristics. Moreover, we highlight the power of combining RNA- and DNAseq methods for genomic analysis. In summary, RNAseq provides the opportunity to gain greater insight into transcriptional regulation and output than simply miRNA and mRNA profiling. PMID:25246237

  18. Sequence fingerprints of microRNA conservation.

    PubMed

    Shi, Bing; Gao, Wei; Wang, Juan

    2012-01-01

    It is known that the conservation of protein-coding genes is associated with their sequences both various species, such as animals and plants. However, the association between microRNA (miRNA) conservation and their sequences in various species remains unexplored. Here we report the association of miRNA conservation with its sequence features, such as base content and cleavage sites, suggesting that miRNA sequences contain the fingerprints for miRNA conservation. More interestingly, different species show different and even opposite patterns between miRNA conservation and sequence features. For example, mammalian miRNAs show a positive/negative correlation between conservation and AU/GC content, whereas plant miRNAs show a negative/positive correlation between conservation and AU/GC content. Further analysis puts forward the hypothesis that the introns of protein-coding genes may be a main driving force for the origin and evolution of mammalian miRNAs. At the 5' end, conserved miRNAs have a preference for base U, while less-conserved miRNAs have a preference for a non-U base in mammals. This difference does not exist in insects and plants, in which both conserved miRNAs and less-conserved miRNAs have a preference for base U at the 5' end. We further revealed that the non-U preference at the 5' end of less-conserved mammalian miRNAs is associated with miRNA function diversity, which may have evolved from the pressure of a highly sophisticated environmental stimulus the mammals encountered during evolution. These results indicated that miRNA sequences contain the fingerprints for conservation, and these fingerprints vary according to species. More importantly, the results suggest that although species share common mechanisms by which miRNAs originate and evolve, mammals may develop a novel mechanism for miRNA origin and evolution. In addition, the fingerprint found in this study can be predictor of miRNA conservation, and the findings are helpful in achieving a

  19. Designing Anti-Influenza Aptamers: Novel Quantitative Structure Activity Relationship Approach Gives Insights into Aptamer – Virus Interaction

    PubMed Central

    Musafia, Boaz; Oren-Banaroya, Rony; Noiman, Silvia

    2014-01-01

    This study describes the development of aptamers as a therapy against influenza virus infection. Aptamers are oligonucleotides (like ssDNA or RNA) that are capable of binding to a variety of molecular targets with high affinity and specificity. We have studied the ssDNA aptamer BV02, which was designed to inhibit influenza infection by targeting the hemagglutinin viral protein, a protein that facilitates the first stage of the virus’ infection. While testing other aptamers and during lead optimization, we realized that the dominant characteristics that determine the aptamer’s binding to the influenza virus may not necessarily be sequence-specific, as with other known aptamers, but rather depend on general 2D structural motifs. We adopted QSAR (quantitative structure activity relationship) tool and developed computational algorithm that correlate six calculated structural and physicochemical properties to the aptamers’ binding affinity to the virus. The QSAR study provided us with a predictive tool of the binding potential of an aptamer to the influenza virus. The correlation between the calculated and actual binding was R2 = 0.702 for the training set, and R2 = 0.66 for the independent test set. Moreover, in the test set the model’s sensitivity was 89%, and the specificity was 87%, in selecting aptamers with enhanced viral binding. The most important properties that positively correlated with the aptamer’s binding were the aptamer length, 2D-loops and repeating sequences of C nucleotides. Based on the structure-activity study, we have managed to produce aptamers having viral affinity that was more than 20 times higher than that of the original BV02 aptamer. Further testing of influenza infection in cell culture and animal models yielded aptamers with 10 to 15 times greater anti-viral activity than the BV02 aptamer. Our insights concerning the mechanism of action and the structural and physicochemical properties that govern the interaction with the

  20. Peptide Aptamers: Development and Applications

    PubMed Central

    Reverdatto, Sergey; Burz, David S.; Shekhtman, Alexander

    2015-01-01

    Peptide aptamers are small combinatorial proteins that are selected to bind to specific sites on their target molecules. Peptide aptamers consist of short, 5-20 amino acid residues long sequences, typically embedded as a loop within a stable protein scaffold. Various peptide aptamer scaffolds and in vitro and in vivo selection techniques are reviewed with emphasis on specific biomedical, bioimaging, and bioanalytical applications. PMID:25866267

  1. Transcriptional profiling of Dictyostelium with RNA sequencing

    PubMed Central

    Miranda, Edward Roshan; Rot, Gregor; Toplak, Marko; Santhanam, Balaji; Curk, Tomaz; Shaulsky, Gad; Zupan, Blaz

    2014-01-01

    Summary Transcriptional profiling methods have been utilized in the analysis of various biological processes in Dictyostelium. Recent advances in high-throughput sequencing have increased the resolution and the dynamic range of transcriptional profiling. Here we describe the utility of RNA-sequencing with the Illumina technology for production of transcriptional profiles. We also describe methods for data mapping and storage as well as common and specialized tools for data analysis, both online and offline. PMID:23494306

  2. Molecular imaging of a cancer-targeting theragnostics probe using a nucleolin aptamer- and microRNA-221 molecular beacon-conjugated nanoparticle.

    PubMed

    Kim, Jin Kyeoung; Choi, Kyung-Ju; Lee, Minhyung; Jo, Mi-hee; Kim, Soonhag

    2012-01-01

    MicroRNAs (miRNA, miR) have been reported as cancer biomarkers that regulate tumor suppressor genes. Hence, simultaneous detecting and inhibiting of miRNA function will be useful as a cancer theragnostics probe to minimize side effects and invasiveness. In this study, we developed a cancer-targeting therangostics probe in a single system using an AS1411 aptamer - and miRNA-221 molecular beacon (miR-221 MB)-conjugated magnetic fluorescence (MF) nanoparticle (MFAS miR-221 MB) to simultaneously target to cancer tissue, image intracellularly expressed miRNA-221 and treat miRNA-221-involved carcinogenesis. AS1411 aptamer-conjugated MF (MFAS) nanoparticles displayed a great selectivity and delivery into various cancer cell lines. The miR-221 MB detached from the MFAS miR-221 MB in the cytoplasm of C6 cells clearly imaged miRNA-221 biogenesis and simultaneously resulted in antitumor therapeutic effects by inhibiting miRNA function, indicating a successful astrocytoma-targeting theragnostics. MFAS miRNA MB can be easily applied to other cancers by simply changing a targeted miRNA highly expressed in cancers.

  3. Compilation of tRNA sequences.

    PubMed

    Sprinzl, M; Grueter, F; Spelzhaus, A; Gauss, D H

    1980-01-11

    This compilation presents in a small space the tRNA sequences so far published. The numbering of tRNAPhe from yeast is used following the rules proposed by the participants of the Cold Spring Harbor Meeting on tRNA 1978 (1,2;Fig. 1). This numbering allows comparisons with the three dimensional structure of tRNAPhe. The secondary structure of tRNAs is indicated by specific underlining. In the primary structure a nucleoside followed by a nucleoside in brackets or a modification in brackets denotes that both types of nucleosides can occupy this position. Part of a sequence in brackets designates a piece of sequence not unambiguosly analyzed. Rare nucleosides are named according to the IUPACIUB rules (for complicated rare nucleosides and their identification see Table 1); those with lengthy names are given with the prefix x and specified in the footnotes. Footnotes are numbered according to the coordinates of the corresponding nucleoside and are indicated in the sequence by an asterisk. The references are restricted to the citation of the latest publication in those cases where several papers deal with one sequence. For additional information the reader is referred either to the original literature or to other tRNA sequence compilations (3-7). Mutant tRNAs are dealt with in a compilation by J. Celis (8). The compilers would welcome any information by the readers regarding missing material or erroneous presentation. On the basis of this numbering system computer printed compilations of tRNA sequences in a linear form and in cloverleaf form are in preparation. PMID:6986608

  4. Compilation of tRNA sequences.

    PubMed

    Gauss, D H; Grüter, F; Sprinzl, M

    1979-01-01

    This compilation presents in a small space the tRNA sequences so far published in order to enable rapid orientation and comparison. The numbering of tRNAPhe from yeast is used as has been done earlier (1) but following the rules proposed by the participants of the Cold Spring Harbor Meeting on tRNA 1978 (2) (Fig. 1). This numbering allows comparisons with the three dimensional structure of tRNAPhe, the only structure known from X-ray analysis. The secondary structure of tRNAs is indicated by specific underlining. In the primary structure a nucleoside followed by a nucleoside in brackets or a modification in brackets denotes that both types of nucleosides can occupy this position. Part of a sequence in brackets designates a piece of sequence not unambiguously analyzed. Rare nucleosides are named according to the IUPAC-IUB rules (for some more complicated rare nucleosides and their identification see Table 1); those with lengthy names are given with the prefix x and specified in the footnotes. Footnotes are numbered according to the coordinates of the corresponding nucleoside and are indicated in the sequence by an asterisk. The references are restricted to the citation of the latest publication in those cases where several papers deal with one sequence. For additional information the reader is referred either to the original literature or to other tRNA sequence compilations (3--7). Mutant tRNAs are dealt with in a separate compilation prepared by J. Celis (see below). The compilers would welcome any information by the readers regarding missing material or erroneous presentation. On the basis of this numbering system computer printed compilations of tRNA sequences in a linear form and in cloverleaf form are in preparation. PMID:424282

  5. Methods for Improving Aptamer Binding Affinity.

    PubMed

    Hasegawa, Hijiri; Savory, Nasa; Abe, Koichi; Ikebukuro, Kazunori

    2016-01-01

    Aptamers are single stranded oligonucleotides that bind a wide range of biological targets. Although aptamers can be isolated from pools of random sequence oligonucleotides using affinity-based selection, aptamers with high affinities are not always obtained. Therefore, further refinement of aptamers is required to achieve desired binding affinities. The optimization of primary sequences and stabilization of aptamer conformations are the main approaches to refining the binding properties of aptamers. In particular, sequence optimization using combined in silico sequence recombinations and in vitro functional evaluations is effective for the improvement of binding affinities, however, the binding affinities of aptamers are limited by the low hydrophobicity of nucleic acids. Accordingly, introduction of hydrophobic moieties into aptamers expands the diversity of interactions between aptamers and targets. Moreover, construction of multivalent aptamers by connecting aptamers that recognize distinct epitopes is an attractive approach to substantial increases in binding affinity. In addition, binding affinities can be tuned by optimizing the scaffolds of multivalent constructs. In this review, we summarize the various techniques for improving the binding affinities of aptamers. PMID:27043498

  6. Crystal structure of a mirror-image L-RNA aptamer (Spiegelmer) in complex with the natural L-protein target CCL2

    PubMed Central

    Oberthür, Dominik; Achenbach, John; Gabdulkhakov, Azat; Buchner, Klaus; Maasch, Christian; Falke, Sven; Rehders, Dirk; Klussmann, Sven; Betzel, Christian

    2015-01-01

    We report the crystal structure of a 40mer mirror-image RNA oligonucleotide completely built from nucleotides of the non-natural L-chirality in complex with the pro-inflammatory chemokine L-CLL2 (monocyte chemoattractant protein-1), a natural protein composed of regular L-amino acids. The L-oligonucleotide is an L-aptamer (a Spiegelmer) identified to bind L-CCL2 with high affinity, thereby neutralizing the chemokine's activity. CCL2 plays a key role in attracting and positioning monocytes; its overexpression in several inflammatory diseases makes CCL2 an interesting pharmacological target. The PEGylated form of the L-aptamer, NOX-E36 (emapticap pegol), already showed promising efficacy in clinical Phase II studies conducted in diabetic nephropathy patients. The structure of the L-oligonucleotide·L-protein complex was solved and refined to 2.05 Å. It unveils the L-aptamer's intramolecular contacts and permits a detailed analysis of its structure–function relationship. Furthermore, the analysis of the intermolecular drug–target interactions reveals insight into the selectivity of the L-aptamer for certain related chemokines. PMID:25901662

  7. Crystal structure of a mirror-image L-RNA aptamer (Spiegelmer) in complex with the natural L-protein target CCL2.

    PubMed

    Oberthür, Dominik; Achenbach, John; Gabdulkhakov, Azat; Buchner, Klaus; Maasch, Christian; Falke, Sven; Rehders, Dirk; Klussmann, Sven; Betzel, Christian

    2015-04-22

    We report the crystal structure of a 40 mer mirror-image RNA oligonucleotide completely built from nucleotides of the non-natural L-chirality in complex with the pro-inflammatory chemokine L-CLL2 (monocyte chemoattractant protein-1), a natural protein composed of regular L-amino acids. The L-oligonucleotide is an L-aptamer (a Spiegelmer) identified to bind L-CCL2 with high affinity, thereby neutralizing the chemokine's activity. CCL2 plays a key role in attracting and positioning monocytes; its overexpression in several inflammatory diseases makes CCL2 an interesting pharmacological target. The PEGylated form of the L-aptamer, NOX-E36 (emapticap pegol), already showed promising efficacy in clinical Phase II studies conducted in diabetic nephropathy patients. The structure of the L-oligonucleotide[Symbol: see text]L-protein complex was solved and refined to 2.05 Å. It unveils the L-aptamer's intramolecular contacts and permits a detailed analysis of its structure-function relationship. Furthermore, the analysis of the intermolecular drug-target interactions reveals insight into the selectivity of the L-aptamer for certain related chemokines.

  8. Crystal structure of a mirror-image L-RNA aptamer (Spiegelmer) in complex with the natural L-protein target CCL2

    NASA Astrophysics Data System (ADS)

    Oberthür, Dominik; Achenbach, John; Gabdulkhakov, Azat; Buchner, Klaus; Maasch, Christian; Falke, Sven; Rehders, Dirk; Klussmann, Sven; Betzel, Christian

    2015-04-01

    We report the crystal structure of a 40mer mirror-image RNA oligonucleotide completely built from nucleotides of the non-natural L-chirality in complex with the pro-inflammatory chemokine L-CLL2 (monocyte chemoattractant protein-1), a natural protein composed of regular L-amino acids. The L-oligonucleotide is an L-aptamer (a Spiegelmer) identified to bind L-CCL2 with high affinity, thereby neutralizing the chemokine's activity. CCL2 plays a key role in attracting and positioning monocytes; its overexpression in several inflammatory diseases makes CCL2 an interesting pharmacological target. The PEGylated form of the L-aptamer, NOX-E36 (emapticap pegol), already showed promising efficacy in clinical Phase II studies conducted in diabetic nephropathy patients. The structure of the L-oligonucleotide.L-protein complex was solved and refined to 2.05 Å. It unveils the L-aptamer's intramolecular contacts and permits a detailed analysis of its structure-function relationship. Furthermore, the analysis of the intermolecular drug-target interactions reveals insight into the selectivity of the L-aptamer for certain related chemokines.

  9. Ribosomal RNA sequence suggest microsporidia are extremely ancient eukaryotes

    NASA Technical Reports Server (NTRS)

    Vossbrinck, C. R.; Maddox, J. V.; Friedman, S.; Debrunner-Vossbrinck, B. A.; Woese, C. R.

    1987-01-01

    A comparative sequence analysis of the 18S small subunit ribosomal RNA (rRNA) of the microsporidium Vairimorpha necatrix is presented. The results show that this rRNA sequence is more unlike those of other eukaryotes than any known eukaryote rRNA sequence. It is concluded that the lineage leading to microsporidia branched very early from that leading to other eukaryotes.

  10. RNA Target Sequences Promote Spreading of RNA Silencing1

    PubMed Central

    Van Houdt, Helena; Bleys, Annick; Depicker, Anna

    2003-01-01

    It is generally recognized that a silencing-inducing locus can efficiently reduce the expression of genes that give rise to transcripts partially homologous to those produced by the silencing-inducing locus (primary targets). Interestingly, the expression of genes that produce transcripts without homology to the silencing-inducing locus (secondary targets) can also be decreased dramatically via transitive RNA silencing. This phenomenon requires primary target RNAs that contain sequences homologous to secondary target RNAs. Sequences upstream from the region homologous to the silencing inducer in the primary target transcripts give rise to approximately 22-nucleotide small RNAs, coinciding with the region homologous to the secondary target. The presence of these small RNAs corresponds with reduced expression of the secondary target whose transcripts are not homologous to the silencing inducer. The data suggest that in transgenic plants, targets of RNA silencing are involved in the expansion of the pool of functional small interfering RNAs. Furthermore, methylation of target genes in sequences without homology to the initial silencing inducer indicates not only that RNA silencing can expand across target RNAs but also that methylation can spread along target genes. PMID:12529532

  11. Advanced Applications of RNA Sequencing and Challenges.

    PubMed

    Han, Yixing; Gao, Shouguo; Muegge, Kathrin; Zhang, Wei; Zhou, Bing

    2015-01-01

    Next-generation sequencing technologies have revolutionarily advanced sequence-based research with the advantages of high-throughput, high-sensitivity, and high-speed. RNA-seq is now being used widely for uncovering multiple facets of transcriptome to facilitate the biological applications. However, the large-scale data analyses associated with RNA-seq harbors challenges. In this study, we present a detailed overview of the applications of this technology and the challenges that need to be addressed, including data preprocessing, differential gene expression analysis, alternative splicing analysis, variants detection and allele-specific expression, pathway analysis, co-expression network analysis, and applications combining various experimental procedures beyond the achievements that have been made. Specifically, we discuss essential principles of computational methods that are required to meet the key challenges of the RNA-seq data analyses, development of various bioinformatics tools, challenges associated with the RNA-seq applications, and examples that represent the advances made so far in the characterization of the transcriptome.

  12. Advanced Applications of RNA Sequencing and Challenges

    PubMed Central

    Han, Yixing; Gao, Shouguo; Muegge, Kathrin; Zhang, Wei; Zhou, Bing

    2015-01-01

    Next-generation sequencing technologies have revolutionarily advanced sequence-based research with the advantages of high-throughput, high-sensitivity, and high-speed. RNA-seq is now being used widely for uncovering multiple facets of transcriptome to facilitate the biological applications. However, the large-scale data analyses associated with RNA-seq harbors challenges. In this study, we present a detailed overview of the applications of this technology and the challenges that need to be addressed, including data preprocessing, differential gene expression analysis, alternative splicing analysis, variants detection and allele-specific expression, pathway analysis, co-expression network analysis, and applications combining various experimental procedures beyond the achievements that have been made. Specifically, we discuss essential principles of computational methods that are required to meet the key challenges of the RNA-seq data analyses, development of various bioinformatics tools, challenges associated with the RNA-seq applications, and examples that represent the advances made so far in the characterization of the transcriptome. PMID:26609224

  13. Calculation of absolute free energy of binding for theophylline and its analogs to RNA aptamer using nonequilibrium work values

    NASA Astrophysics Data System (ADS)

    Tanida, Yoshiaki; Ito, Masakatsu; Fujitani, Hideaki

    2007-08-01

    The massively parallel computation of absolute binding free energy with a well-equilibrated system (MP-CAFEE) has been developed [H. Fujitani, Y. Tanida, M. Ito, G. Jayachandran, C.D. Snow, M.R. Shirts, E.J. Sorin, V.S. Pande, J. Chem. Phys. 123 (2005) 084108]. As an application, we perform the binding affinity calculations of six theophylline-related ligands with RNA aptamer. Basically, our method is applicable when using many compute nodes to accelerate simulations, thus a parallel computing system is also developed. To further reduce the computational cost, the adequate non-uniform intervals of coupling constant λ, connecting two equilibrium states, namely bound and unbound, are determined. The absolute binding energies Δ G thus obtained have effective linear relation between the computed and experimental values. If the results of two other different methods are compared, thermodynamic integration (TI) and molecular mechanics Poisson-Boltzmann surface area (MM-PBSA) by the paper of Gouda et al. [H. Gouda, I.D. Kuntz, D.A. Case, P.A. Kollman, Biopolymers 68 (2003) 16], the predictive accuracy of the relative values ΔΔ G is almost comparable to that of TI: the correlation coefficients ( R) obtained are 0.99 (this work), 0.97 (TI), and 0.78 (MM-PBSA). On absolute binding energies meanwhile, a constant energy shift of ˜-7 kcal/mol against the experimental values is evident. To solve this problem, several presumable reasons are investigated.

  14. Targeted inhibition of {alpha}v{beta}3 integrin with an RNA aptamer impairs endothelial cell growth and survival

    SciTech Connect

    Mi Jing; Zhang Xiuwu; Giangrande, Paloma H.; McNamara, James O.; Nimjee, Shahid M.; Sarraf-Yazdi, Shiva; Sullenger, Bruce A.; Clary, Bryan M. . E-mail: mi001@duke.edu

    2005-12-16

    {alpha}v{beta}3 integrin is a crucial factor involved in a variety of physiological processes, such as cell growth and migration, tumor invasion and metastasis, angiogenesis, and wound healing. {alpha}v{beta}3 integrin exerts its effect by regulating endothelial cell (EC) migration, proliferation, and survival. Inhibiting the function of {alpha}v{beta}3 integrin, therefore, represents a potential anti-cancer, anti-thrombotic, and anti-inflammatory strategy. In this study, we tested an RNA aptamer, Apt-{alpha}v{beta}3 that binds recombinant {alpha}v{beta}3 integrin, for its ability to bind endogenous {alpha}v{beta}3 integrin on the surface of cells in culture and to subsequently affect cellular response. Our data illustrate that Apt-{alpha}v{beta}3 binds {alpha}v{beta}3 integrin expressed on the surface of live HUVECs. This interaction significantly decreases both basal and PDGF-induced cell proliferation as well as inhibition of cell adhesion. Apt-{alpha}v{beta}3 can also reduce PDGF-stimulated tube formation and increase HUVEC apoptosis through inhibition of FAK phosphorylation pathway. Our results demonstrate that by binding to its target, Apt-{alpha}v{beta}3 can efficiently inhibit human EC proliferation and survival, resulting in reduced angiogenesis. It predicts that Apt-{alpha}v{beta}3 could become useful in both tumor imaging and the treatment of tumor growth, atherosclerosis, thrombosis, and inflammation.

  15. Reagentless measurement of aminoglycoside antibiotics in blood serum via an electrochemical, ribonucleic acid aptamer-based biosensor.

    PubMed

    Rowe, Aaron A; Miller, Erin A; Plaxco, Kevin W

    2010-09-01

    Biosensors built using ribonucleic acid (RNA) aptamers show promise as tools for point-of-care medical diagnostics, but they remain vulnerable to nuclease degradation when deployed in clinical samples. To explore methods for protecting RNA-based biosensors from such degradation we have constructed and characterized an electrochemical, aptamer-based sensor for the detection of aminoglycosidic antibiotics. We find that while this sensor achieves low micromolar detection limits and subminute equilibration times when challenged in buffer, it deteriorates rapidly when immersed directly in blood serum. In order to circumvent this problem, we have developed and tested sensors employing modified versions of the same aptamer. Our first effort to this end entailed the methylation of all of the 2'-hydroxyl groups outside of the aptamer's antibiotic binding pocket. However, while devices employing this modified aptamer are as sensitive as those employing an unmodified parent, the modification fails to confer greater stability when the sensor is challenged directly in blood serum. As a second potentially naive alternative, we replaced the RNA bases in the aptamer with their more degradation-resistant deoxyribonucleic acid (DNA) equivalents. Surprisingly and unlike control DNA-stem loops employing other sequences, this DNA aptamer retains the ability to bind aminoglycosides, albeit with poorer affinity than the parent RNA aptamer. Unfortunately, however, while sensors fabricated using this DNA aptamer are stable in blood serum, its lower affinity pushes their detection limits above the therapeutically relevant range. Finally, we find that ultrafiltration through a low-molecular-weight-cutoff spin column rapidly and efficiently removes the relevant nucleases from serum samples spiked with gentamicin, allowing the convenient detection of this aminoglycoside at clinically relevant concentrations using the original RNA-based sensor.

  16. Determining structures of RNA aptamers and riboswitches by X-ray crystallography.

    PubMed

    Edwards, Andrea L; Garst, Andrew D; Batey, Robert T

    2009-01-01

    Structural biology plays a central role in gaining a full understanding of the myriad roles of RNA in biology. In recent years, innovative approaches in RNA purification and crystallographic methods have lead to the visualization of an increasing number of unique structures, providing new insights into its function at the atomic level. This article presents general protocols which have streamlined the process of obtaining a homogeneous sample of properly folded and active RNA in high concentrations that crystallizes well in the presence of a suitable heavy-atom for phasing. Of particular importance are approaches toward RNA crystallography that include exploring "construct space" as opposed to "condition space". Moreover, development of a highly flexible method for experimentally phasing RNA crystals may open the door to a relatively simple means of solving these structures. PMID:19377976

  17. Determining Structures of RNA Aptamers and Riboswitches by X-Ray Crystallography

    PubMed Central

    Edwards, Andrea L.; Garst, Andrew D.; Batey, Robert T.

    2011-01-01

    Structural biology plays a central role in gaining a full understanding of the myriad roles of RNA in biology. In recent years, innovative approaches in RNA purification and crystallographic methods have lead to the visualization of an increasing number of unique structures, providing new insights into its function at the atomic level. This article presents general protocols which have streamlined the process of obtaining a homogeneous sample of properly folded and active RNA in high concentrations that crystallizes well in the presence of a suitable heavy-atom for phasing. Of particular importance are approaches toward RNA crystallography that include exploring “construct space” as opposed to “condition space”. Moreover, development of a highly flexible method for experimentally phasing RNA crystals may open the door to a relatively simple means of solving these structures. PMID:19377976

  18. In vitro selection of ssDNA aptamers using biotinylated target proteins.

    PubMed

    Mayer, Günter; Höver, Thomas

    2009-01-01

    Aptamers are single-stranded nucleic acids that bind specifically to a target molecule and thus often inhibit target-associated biological functions. Aptamers have been described for a series of target molecules including peptides, proteins, and even living cells. Besides RNA and 20-modified RNA molecules also ssDNA molecules can be subjected to in vitro selection protocols aiming at the enrichment of ssDNA aptamers. ssDNA aptamers can be selected using the SELEX procedure (systematic enrichment of ligands by exponential amplification) from libraries of randomized single-stranded DNA with a diversity of up to 10(16) different molecules. In repetitive selection cycles, the library is incubated with the target of choice and separation of non-binding sequences from bound sequences is achieved by distinct separation methods. The bound molecules are specifically eluted and amplified, thus representing the starting library for the next cycle. Thereby, an enriched population of aptamers is evolved. Here we describe a generalized in vitro selection experiment aiming at the enrichment of ssDNA aptamers using biotinylated target molecules. This procedure allows the application of streptavidin-biotin chemistry to separate bound from unbound DNA species during the selection process.

  19. De novo assembly of a bell pepper endornavirus genome sequence using RNA sequencing data.

    PubMed

    Jo, Yeonhwa; Choi, Hoseng; Cho, Won Kyong

    2015-03-19

    The genus Endornavirus is a double-stranded RNA virus that infects a wide range of hosts. In this study, we report on the de novo assembly of a bell pepper endornavirus genome sequence by RNA sequencing (RNA-Seq). Our result demonstrates the successful application of RNA-Seq to obtain a complete viral genome sequence from the transcriptome data.

  20. De novo assembly of a bell pepper endornavirus genome sequence using RNA sequencing data.

    PubMed

    Jo, Yeonhwa; Choi, Hoseng; Cho, Won Kyong

    2015-01-01

    The genus Endornavirus is a double-stranded RNA virus that infects a wide range of hosts. In this study, we report on the de novo assembly of a bell pepper endornavirus genome sequence by RNA sequencing (RNA-Seq). Our result demonstrates the successful application of RNA-Seq to obtain a complete viral genome sequence from the transcriptome data. PMID:25792042

  1. Nucleic Acid Aptamers as Potential Therapeutic and Diagnostic Agents for Lymphoma

    PubMed Central

    Shum, Ka-To; Zhou, Jiehua; Rossi, John J.

    2014-01-01

    Lymphomas are cancers that arise from white blood cells and usually present as solid tumors. Treatment of lymphoma often involves chemotherapy, and can also include radiotherapy and/or bone marrow transplantation. There is an un-questioned need for more effective therapies and diagnostic tool for lymphoma. Aptamers are single stranded DNA or RNA oligonucleotides whose three-dimensional structures are dictated by their sequences. The immense diversity in function and structure of nucleic acids enable numerous aptamers to be generated through an iterative in vitro selection technique known as Systematic Evolution of Ligands by EXponential enrichment (SELEX). Aptamers have several biochemical properties that make them attractive tools for use as potential diagnostic and pharmacologic agents. Isolated aptamers may directly inhibit the function of target proteins, or they can also be formulated for use as delivery agents for other therapeutic or imaging cargoes. More complex aptamer identification methods, using whole cancer cells (Cell-SELEX), may identify novel targets and aptamers to affect them. This review focuses on recent advances in the use of nucleic acid aptamers as diagnostic and therapeutic agents and as targeted delivery carriers that are relevant to lymphoma. Some representative examples are also discussed. PMID:25057429

  2. Applications of aptamers as sensors.

    PubMed

    Cho, Eun Jeong; Lee, Joo-Woon; Ellington, Andrew D

    2009-01-01

    Aptamers are ligand-binding nucleic acids whose affinities and selectivities can rival those of antibodies. They have been adapted to analytical applications not only as alternatives to antibodies, but as unique reagents in their own right. In particular, aptamers can be readily site-specifically modified during chemical or enzymatic synthesis to incorporate particular reporters, linkers, or other moieties. Also, aptamer secondary structures can be engineered to undergo analyte-dependent conformational changes, which, in concert with the ability to specifically place chemical agents, opens up a wealth of possible signal transduction schemas, irrespective of whether the detection modality is optical, electrochemical, or mass based. Finally, because aptamers are nucleic acids, they are readily adapted to sequence- (and hence signal-) amplification methods. However, application of aptamers without a basic knowledge of their biochemistry or technical requirements can cause serious analytical difficulties.

  3. High-throughput sequence analysis reveals structural diversity and improved potency among RNA inhibitors of HIV reverse transcriptase

    PubMed Central

    Ditzler, Mark A.; Lange, Margaret J.; Bose, Debojit; Bottoms, Christopher A.; Virkler, Katherine F.; Sawyer, Andrew W.; Whatley, Angela S.; Spollen, William; Givan, Scott A.; Burke, Donald H.

    2013-01-01

    Systematic evolution of ligands through exponential enrichment (SELEX) is a well-established method for generating nucleic acid populations that are enriched for specified functions. High-throughput sequencing (HTS) enhances the power of comparative sequence analysis to reveal details of how RNAs within these populations recognize their targets. We used HTS analysis to evaluate RNA populations selected to bind type I human immunodeficiency virus reverse transcriptase (RT). The populations are enriched in RNAs of independent lineages that converge on shared motifs and in clusters of RNAs with nearly identical sequences that share common ancestry. Both of these features informed inferences of the secondary structures of enriched RNAs, their minimal structural requirements and their stabilities in RT-aptamer complexes. Monitoring population dynamics in response to increasing selection pressure revealed RNA inhibitors of RT that are more potent than the previously identified pseudoknots. Improved potency was observed for inhibition of both purified RT in enzymatic assays and viral replication in cell-based assays. Structural and functional details of converged motifs that are obscured by simple consensus descriptions are also revealed by the HTS analysis. The approach presented here can readily be generalized for the efficient and systematic post-SELEX development of aptamers for down-stream applications. PMID:23241386

  4. Blocking interaction of viral gp120 and CD4-expressing T cells by single-stranded DNA aptamers

    PubMed Central

    Zhao, Nianxi; Pei, Sung-nan; Parekh, Parag; Salazar, Eric; Zu, Youli

    2014-01-01

    To investigate the potential clinical application of aptamers to prevention of HIV infection, single- stranded DNA (ssDNA) aptamers specific for CD4 were developed using the systematic evolution of ligands by exponential enrichment approach and next generation sequencing. In contrast to RNA-based aptamers, the developed ssDNA aptamers were stable in human serum up to 12 hr. Cell binding assays revealed that the aptamers specifically targeted CD4-expressing cells with high binding affinity (Kd=1.59 nM), a concentration within the range required for therapeutic application. Importantly, the aptamers selectively bound CD4 on human cells and disrupted the interaction of viral gp120 to CD4 receptors, which is a prerequisite step of HIV-1 infection. Functional studies showed that the aptamer polymers significantly blocked binding of viral gp120 to CD4-expressing cells by up to 70% inhibition. These findings provide a new approach to prevent HIV-1 transmission using oligonucleotide aptamers. PMID:24661998

  5. Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications

    PubMed Central

    Hong, Ka Lok; Sooter, Letha J.

    2015-01-01

    Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

  6. Single-stranded DNA aptamer that specifically binds to the influenza virus NS1 protein suppresses interferon antagonism.

    PubMed

    Woo, Hye-Min; Kim, Ki-Sun; Lee, Jin-Moo; Shim, Hee-Sup; Cho, Seong-Je; Lee, Won-Kyu; Ko, Hyuk Wan; Keum, Young-Sam; Kim, Soo-Youl; Pathinayake, Prabuddha; Kim, Chul-Joong; Jeong, Yong-Joo

    2013-11-01

    Non-structural protein 1 (NS1) of the influenza A virus (IAV) inhibits the host's innate immune response by suppressing the induction of interferons (IFNs). Therefore, blocking NS1 activity can be a potential strategy in the development of antiviral agents against IAV infection. In the present study, we selected a single-stranded DNA aptamer specific to the IAV NS1 protein after 15 cycles of systematic evolution of ligands by exponential enrichment (SELEX) procedure and examined the ability of the selected aptamer to inhibit the function of NS1. The selected aptamer binds to NS1 with a Kd of 18.91±3.95nM and RNA binding domain of NS1 is determined to be critical for the aptamer binding. The aptamer has a G-rich sequence in the random sequence region and forms a G-quadruplex structure. The localization of the aptamer bound to NS1 in cells was determined by confocal images, and flow cytometry analysis further demonstrated that the selected aptamer binds specifically to NS1. In addition, luciferase reporter gene assay, quantitative RT-PCR, and enzyme-linked immunosorbent assay (ELISA) experiments demonstrated that the selected aptamer had the ability to induce IFN-β by suppressing the function of NS1. Importantly, we also found that the selected aptamer was able to inhibit the viral replication without affecting cell viability. These results indicate that the selected ssDNA aptamer has strong potential to be further developed as a therapeutic agent against IAV.

  7. Engineering a ribozyme cleavage-induced split fluorescent aptamer complementation assay

    PubMed Central

    Ausländer, Simon; Fuchs, David; Hürlemann, Samuel; Ausländer, David; Fussenegger, Martin

    2016-01-01

    Hammerhead ribozymes are self-cleaving RNA molecules capable of regulating gene expression in living cells. Their cleavage performance is strongly influenced by intra-molecular loop–loop interactions, a feature not readily accessible through modern prediction algorithms. Ribozyme engineering and efficient implementation of ribozyme-based genetic switches requires detailed knowledge of individual self-cleavage performances. By rational design, we devised fluorescent aptamer-ribozyme RNA architectures that allow for the real-time measurement of ribozyme self-cleavage activity in vitro. The engineered nucleic acid molecules implement a split Spinach aptamer sequence that is made accessible for strand displacement upon ribozyme self-cleavage, thereby complementing the fluorescent Spinach aptamer. This fully RNA-based ribozyme performance assay correlates ribozyme cleavage activity with Spinach fluorescence to provide a rapid and straightforward technology for the validation of loop–loop interactions in hammerhead ribozymes. PMID:26939886

  8. Sequencing Degraded RNA Addressed by 3' Tag Counting

    PubMed Central

    Sigurgeirsson, Benjamín; Emanuelsson, Olof; Lundeberg, Joakim

    2014-01-01

    RNA sequencing has become widely used in gene expression profiling experiments. Prior to any RNA sequencing experiment the quality of the RNA must be measured to assess whether or not it can be used for further downstream analysis. The RNA integrity number (RIN) is a scale used to measure the quality of RNA that runs from 1 (completely degraded) to 10 (intact). Ideally, samples with high RIN (8) are used in RNA sequencing experiments. RNA, however, is a fragile molecule which is susceptible to degradation and obtaining high quality RNA is often hard, or even impossible when extracting RNA from certain clinical tissues. Thus, occasionally, working with low quality RNA is the only option the researcher has. Here we investigate the effects of RIN on RNA sequencing and suggest a computational method to handle data from samples with low quality RNA which also enables reanalysis of published datasets. Using RNA from a human cell line we generated and sequenced samples with varying RINs and illustrate what effect the RIN has on the basic procedure of RNA sequencing; both quality aspects and differential expression. We show that the RIN has systematic effects on gene coverage, false positives in differential expression and the quantification of duplicate reads. We introduce 3' tag counting (3TC) as a computational approach to reliably estimate differential expression for samples with low RIN. We show that using the 3TC method in differential expression analysis significantly reduces false positives when comparing samples with different RIN, while retaining reasonable sensitivity. PMID:24632678

  9. RNA-sequencing from single nuclei.

    PubMed

    Grindberg, Rashel V; Yee-Greenbaum, Joyclyn L; McConnell, Michael J; Novotny, Mark; O'Shaughnessy, Andy L; Lambert, Georgina M; Araúzo-Bravo, Marcos J; Lee, Jun; Fishman, Max; Robbins, Gillian E; Lin, Xiaoying; Venepally, Pratap; Badger, Jonathan H; Galbraith, David W; Gage, Fred H; Lasken, Roger S

    2013-12-01

    It has recently been established that synthesis of double-stranded cDNA can be done from a single cell for use in DNA sequencing. Global gene expression can be quantified from the number of reads mapping to each gene, and mutations and mRNA splicing variants determined from the sequence reads. Here we demonstrate that this method of transcriptomic analysis can be done using the extremely low levels of mRNA in a single nucleus, isolated from a mouse neural progenitor cell line and from dissected hippocampal tissue. This method is characterized by excellent coverage and technical reproducibility. On average, more than 16,000 of the 24,057 mouse protein-coding genes were detected from single nuclei, and the amount of gene-expression variation was similar when measured between single nuclei and single cells. Several major advantages of the method exist: first, nuclei, compared with whole cells, have the advantage of being easily isolated from complex tissues and organs, such as those in the CNS. Second, the method can be widely applied to eukaryotic species, including those of different kingdoms. The method also provides insight into regulatory mechanisms specific to the nucleus. Finally, the method enables dissection of regulatory events at the single-cell level; pooling of 10 nuclei or 10 cells obscures some of the variability measured in transcript levels, implying that single nuclei and cells will be extremely useful in revealing the physiological state and interconnectedness of gene regulation in a manner that avoids the masking inherent to conventional transcriptomics using bulk cells or tissues.

  10. DNA aptamers for the detection of Haemophilus influenzae type b by cell SELEX.

    PubMed

    Bitaraf, F S; Rasooli, I; Mousavi Gargari, S L

    2016-03-01

    Haemophilus influenzae type b (Hib) causes acute bacterial meningitis (ABM) in children, with a mortality rate of about 3-6 % of the affected patients. ABM can lead to death during a period of hours to several days and, hence, rapid and early detection of the infection is crucial. Aptamers, the short single-stranded DNA or RNA with high affinity to target molecules, are selected by a high-flux screening technique known as in vitro screening and systematic evolution of ligands by exponential enrichment technology (SELEX). In this study, whole-cell SELEX was applied for the selection of target-specific aptamers with high affinity to Hib. ssDNA aptamers prepared by lambda exonuclease were incubated with the target cells (Hib). The aptameric binding rate to Hib was characterized for binding affinity after seven SELEX rounds by flow cytometry. The aptamers with higher binding affinity were cloned. Four of 68 aptamer clones were selected for sequencing. The dissociation constant (Kd) of the high-affinity aptamer clones 45 and 63 were 47.10 and 28.46 pM, respectively. These aptamers did not bind to other bacterial species, including the seven meningitis-causing bacteria. They showed distinct affinity to various H. influenzae strains only. These aptamers showed the highest affinity to Hib and the lowest affinity to H. influenzae type c and to other meningitis-causing bacteria. Clone 63 could detect Hib in patients' cerebrospinal fluid (CSF) samples at 60 colony-forming units (CFU)/mL. The results indicate applicability of the aptamers for rapid and early detection of infections brought about by Hib.

  11. A naturally occurring, noncanonical GTP aptamer made of simple tandem repeats.

    PubMed

    Curtis, Edward A; Liu, David R

    2014-01-01

    Recently, we used in vitro selection to identify a new class of naturally occurring GTP aptamer called the G motif. Here we report the discovery and characterization of a second class of naturally occurring GTP aptamer, the "CA motif." The primary sequence of this aptamer is unusual in that it consists entirely of tandem repeats of CA-rich motifs as short as three nucleotides. Several active variants of the CA motif aptamer lack the ability to form consecutive Watson-Crick base pairs in any register, while others consist of repeats containing only cytidine and adenosine residues, indicating that noncanonical interactions play important roles in its structure. The circular dichroism spectrum of the CA motif aptamer is distinct from that of A-form RNA and other major classes of nucleic acid structures. Bioinformatic searches indicate that the CA motif is absent from most archaeal and bacterial genomes, but occurs in at least 70 percent of approximately 400 eukaryotic genomes examined. These searches also uncovered several phylogenetically conserved examples of the CA motif in rodent (mouse and rat) genomes. Together, these results reveal the existence of a second class of naturally occurring GTP aptamer whose sequence requirements, like that of the G motif, are not consistent with those of a canonical secondary structure. They also indicate a new and unexpected potential biochemical activity of certain naturally occurring tandem repeats.

  12. Detection of biomolecule by aptamer beacon.

    PubMed

    Nishihira, Akifumi; Ozaki, Hiroaki; Wakabayashi, Masayuki; Kuwahara, Masayasu; Sawai, Hiroaki

    2004-01-01

    Labeled oligodeoxyribonucleotide bearing fluorescent dyes at both ends and aptamer sequence for adenosine 5'-monophosphate (AMP) was synthesized. Fluorescence spectra of labeled aptamer were not so much different between with and without AMP. This result suggests the binding of AMP didn't cause the global structural change to the aptamer. Therefore, we used short complementary DNA (SCD) as an assistant DNA, which is an unmodified 11mer and have a complementary sequence of 5'-region of the labeled aptamer. In the presence of SCD, the fluorescence intensities decrease with increasing the concentration of AMP compared with a change in absence of SCD.

  13. Aptamer Microarrays

    SciTech Connect

    Angel-Syrett, Heather; Collett, Jim; Ellington, Andrew D.

    2009-01-02

    In vitro selection can yield specific, high-affinity aptamers. We and others have devised methods for the automated selection of aptamers, and have begun to use these reagents for the construction of arrays. Arrayed aptamers have proven to be almost as sensitive as their solution phase counterparts, and when ganged together can provide both specific and general diagnostic signals for proteins and other analytes. We describe here technical details regarding the production and processing of aptamer microarrays, including blocking, washing, drying, and scanning. We will also discuss the challenges involved in developing standardized and reproducible methods for binding and quantitating protein targets. While signals from fluorescent analytes or sandwiches are typically captured, it has proven possible for immobilized aptamers to be uniquely coupled to amplification methods not available to protein reagents, thus allowing for protein-binding signals to be greatly amplified. Into the future, many of the biosensor methods described in this book can potentially be adapted to array formats, thus further expanding the utility of and applications for aptamer arrays.

  14. Sequence of Echinochloa hoja blanca tenuivirus RNA-4.

    PubMed

    de Miranda, J R; Muñoz, M; Wu, R; Espinoza, A M

    1996-01-01

    The sequence is presented of RNA-4 of Echinochloa hoja blanca tenuivirus (EHBV), one of two tenuiviruses associated with rice cultivation in Latin America (together with rice hoja blanca virus; RHBV). Analysis of the sequence shows that the coding regions of EHBV RNA-4 are closely related to those of RHBV RNA-4. However, the intergenic region separating the two ambisense open reading frames, are highly distinct for the two viruses. The features of the RNA and the comparisons with the sequences of RNA-4 of RHBV, rice stripe virus (RStV) and maize stripe virus (MStV) are discussed. PMID:8938980

  15. Aptamers and riboswitches: perspectives in biotechnology.

    PubMed

    Weigand, Julia E; Suess, Beatrix

    2009-11-01

    Aptamers are short, single stranded nucleic acids which bind a wide range of different ligands with extraordinary high binding affinity and specificity. The steadily increasing number of aptamers is accompanied by an expanding range of applications in biotechnology. We will describe new developments in the field including the use of aptamers for conditional gene regulation and as biosensors. In addition, we will discuss the potential of aptamers as tags to visualize RNA and protein distribution in living cells and as therapeutics. Furthermore, we will consider biotechnological applications of riboswitches for gene regulation and as drug target. PMID:19756582

  16. Sequence complementarity-driven nonenzymatic ligation of RNA.

    PubMed

    Pino, Samanta; Costanzo, Giovanna; Giorgi, Alessandra; Di Mauro, Ernesto

    2011-04-12

    We report two reactions of RNA G:C sequences occurring nonenzymatically in water in the absence of any added cofactor or metal ion: (a) sequence complementarity-driven terminal ligation and (b) complementary sequence adaptor-driven multiple tandemization. The two abiotic reactions increase the chemical complexity of the resulting pool of RNA molecules and change the Shannon information of the initial population of sequences.

  17. Evolution of tRNA-like sequences and genome variability.

    PubMed

    Frenkel, Felix E; Chaley, Maria B; Korotkov, Eugene V; Skryabin, Konstantin G

    2004-06-23

    Transfer RNA (tRNA)-like sequences were searched for in the nine basic taxonomic divisions of GenBank-121 (viruses, phages, bacteria, plants, invertebrates, vertebrates, rodents, mammals, and primates) by an original program package implementing a dynamic profile alignment approach for the genetic texts' analysis, in using 22 profiles of tRNAs of different isotypes. In total, 175,901 previously unknown tRNA-like sequences were revealed. The locations of the tRNA-likes were considered over the regions whose functional meaning is described by standard Feature Keys in GenBank. Many regions containing the tRNA-like sequences were recognized as known repeats. A mode of distribution of the tRNA-like sequences in a genome was proposed as expansion in a content of the various transposable elements. An analysis of the integrity of RNA polymerase III inner promoters in the tRNA-like sequences over the GenBank divisions has shown a high possibility of generating new copies of short interspersed nuclear element (SINE) repeats in all divisions, excepting primates. The numerous tRNA-likes found in the regions of RNA polymerase II promoters have suggested an adaptation of RNA polymerase III promoter to a binding of RNA polymerase II. PMID:15194190

  18. Empirical insights into the stochasticity of small RNA sequencing.

    PubMed

    Qin, Li-Xuan; Tuschl, Thomas; Singer, Samuel

    2016-01-01

    The choice of stochasticity distribution for modeling the noise distribution is a fundamental assumption for the analysis of sequencing data and consequently is critical for the accurate assessment of biological heterogeneity and differential expression. The stochasticity of RNA sequencing has been assumed to follow Poisson distributions. We collected microRNA sequencing data and observed that its stochasticity is better approximated by gamma distributions, likely because of the stochastic nature of exponential PCR amplification. We validated our findings with two independent datasets, one for microRNA sequencing and another for RNA sequencing. Motivated by the gamma distributed stochasticity, we provided a simple method for the analysis of RNA sequencing data and showed its superiority to three existing methods for differential expression analysis using three data examples of technical replicate data and biological replicate data. PMID:27052356

  19. Empirical insights into the stochasticity of small RNA sequencing

    NASA Astrophysics Data System (ADS)

    Qin, Li-Xuan; Tuschl, Thomas; Singer, Samuel

    2016-04-01

    The choice of stochasticity distribution for modeling the noise distribution is a fundamental assumption for the analysis of sequencing data and consequently is critical for the accurate assessment of biological heterogeneity and differential expression. The stochasticity of RNA sequencing has been assumed to follow Poisson distributions. We collected microRNA sequencing data and observed that its stochasticity is better approximated by gamma distributions, likely because of the stochastic nature of exponential PCR amplification. We validated our findings with two independent datasets, one for microRNA sequencing and another for RNA sequencing. Motivated by the gamma distributed stochasticity, we provided a simple method for the analysis of RNA sequencing data and showed its superiority to three existing methods for differential expression analysis using three data examples of technical replicate data and biological replicate data.

  20. Molecular Evolution of Multi-subunit RNA Polymerases: Sequence Analysis

    PubMed Central

    Lane, William J.; Darst, Seth A.

    2009-01-01

    Transcription in all cellular organisms is performed by multi-subunit, DNA-dependent RNA polymerases that synthesize RNA from DNA templates. Previous sequence and structural studies have elucidated the importance of shared regions common to all multi-subunit RNA polymerases. In addition RNA polymerases contain multiple lineage-specific domain insertions involved in protein-protein and protein-nucleic acid interactions. We have created comprehensive multiple sequence alignments using all available sequence data for the multi-subunit RNA polymerase large subunits, including the bacterial β and β′ subunits and their homologues from archaebacterial RNA polymerases, the eukaryotic RNA polymerases I, II, and III, the nuclear-cytoplasmic large double-stranded DNA Virus RNA polymerases, and plant plastid RNA polymerases. In order to overcome technical difficulties inherent to the large subunit sequences, including large sequence length, small and large lineage-specific insertions, split subunits, and fused proteins, we created an automated and customizable sequence retrieval and processing system. In addition, we used our alignments to create a more expansive set of shared sequence regions and bacterial lineage-specific domain insertions. We also analyzed the intergenic gap between the bacterial β and β′ genes. PMID:19895820

  1. Genome sequence-independent identification of RNA editing sites.

    PubMed

    Zhang, Qing; Xiao, Xinshu

    2015-04-01

    RNA editing generates post-transcriptional sequence changes that can be deduced from RNA-seq data, but detection typically requires matched genomic sequence or multiple related expression data sets. We developed the GIREMI tool (genome-independent identification of RNA editing by mutual information; https://www.ibp.ucla.edu/research/xiao/GIREMI.html) to predict adenosine-to-inosine editing accurately and sensitively from a single RNA-seq data set of modest sequencing depth. Using GIREMI on existing data, we observed tissue-specific and evolutionary patterns in editing sites in the human population.

  2. Characterisation of aptamer–target interactions by branched selection and high-throughput sequencing of SELEX pools

    PubMed Central

    Dupont, Daniel M.; Larsen, Niels; Jensen, Jan. K.; Andreasen, Peter A.; Kjems, Jørgen

    2015-01-01

    Nucleic acid aptamer selection by systematic evolution of ligands by exponential enrichment (SELEX) has shown great promise for use in the development of research tools, therapeutics and diagnostics. Typically, aptamers are identified from libraries containing up to 1016 different RNA or DNA sequences by 5–10 rounds of affinity selection towards a target of interest. Such library screenings can result in complex pools of many target-binding aptamers. New high-throughput sequencing techniques may potentially revolutionise aptamer selection by allowing quantitative assessment of the dynamic changes in the pool composition during the SELEX process and by facilitating large-scale post-SELEX characterisation. In the present study, we demonstrate how high-throughput sequencing of SELEX pools, before and after a single round of branched selection for binding to different target variants, can provide detailed information about aptamer binding sites, preferences for specific target conformations, and functional effects of the aptamers. The procedure was applied on a diverse pool of 2′-fluoropyrimidine-modified RNA enriched for aptamers specific for the serpin plasminogen activator inhibitor-1 (PAI-1) through five rounds of standard selection. The results demonstrate that it is possible to perform large-scale detailed characterisation of aptamer sequences directly in the complex pools obtained from library selection methods, thus without the need to produce individual aptamers. PMID:26163061

  3. Novel Approach to Analyzing MFE of Noncoding RNA Sequences

    PubMed Central

    George, Tina P.; Thomas, Tessamma

    2016-01-01

    Genomic studies have become noncoding RNA (ncRNA) centric after the study of different genomes provided enormous information on ncRNA over the past decades. The function of ncRNA is decided by its secondary structure, and across organisms, the secondary structure is more conserved than the sequence itself. In this study, the optimal secondary structure or the minimum free energy (MFE) structure of ncRNA was found based on the thermodynamic nearest neighbor model. MFE of over 2600 ncRNA sequences was analyzed in view of its signal properties. Mathematical models linking MFE to the signal properties were found for each of the four classes of ncRNA analyzed. MFE values computed with the proposed models were in concordance with those obtained with the standard web servers. A total of 95% of the sequences analyzed had deviation of MFE values within ±15% relative to those obtained from standard web servers. PMID:27695341

  4. Next-Generation Sequencing RNA-Seq Library Construction.

    PubMed

    Podnar, Jessica; Deiderick, Heather; Huerta, Gabriella; Hunicke-Smith, Scott

    2014-01-01

    This unit presents protocols for construction of next-generation sequencing (NGS) directional RNA sequencing libraries for the Illumina HiSeq and MiSeq from a wide variety of input RNA sources. The protocols are based on the New England Biolabs (NEB) small RNA library preparation set for Illumina, although similar kits exist from different vendors. The protocol preserves the orientation of the original RNA in the final sequencing library, enabling strand-specific analysis of the resulting data. These libraries have been used for differential gene expression analysis and small RNA discovery and are currently being tested for de novo transcriptome assembly. The protocol is robust and applicable to a broad range of RNA input types and RNA quality, making it ideal for high-throughput laboratories.

  5. Novel Approach to Analyzing MFE of Noncoding RNA Sequences

    PubMed Central

    George, Tina P.; Thomas, Tessamma

    2016-01-01

    Genomic studies have become noncoding RNA (ncRNA) centric after the study of different genomes provided enormous information on ncRNA over the past decades. The function of ncRNA is decided by its secondary structure, and across organisms, the secondary structure is more conserved than the sequence itself. In this study, the optimal secondary structure or the minimum free energy (MFE) structure of ncRNA was found based on the thermodynamic nearest neighbor model. MFE of over 2600 ncRNA sequences was analyzed in view of its signal properties. Mathematical models linking MFE to the signal properties were found for each of the four classes of ncRNA analyzed. MFE values computed with the proposed models were in concordance with those obtained with the standard web servers. A total of 95% of the sequences analyzed had deviation of MFE values within ±15% relative to those obtained from standard web servers.

  6. The Subcellular Localisation of the Human Papillomavirus (HPV) 16 E7 Protein in Cervical Cancer Cells and Its Perturbation by RNA Aptamers

    PubMed Central

    Cesur, Özlem; Nicol, Clare; Groves, Helen; Mankouri, Jamel; Blair, George Eric; Stonehouse, Nicola J.

    2015-01-01

    Human papillomavirus (HPV) is the most common viral infection of the reproductive tract, affecting both men and women. High-risk oncogenic types are responsible for almost 90% of anogenital and oropharyngeal cancers including cervical cancer. Some of the HPV “early” genes, particularly E6 and E7, are known to act as oncogenes that promote tumour growth and malignant transformation. Most notably, HPV-16 E7 interacts with the tumour suppressor protein pRb, promoting its degradation, leading to cell cycle dysregulation in infected cells. We have previously shown that an RNA aptamer (termed A2) selectively binds to HPV16 E7 and is able to induce apoptosis in HPV16-transformed cervical carcinoma cell lines (SiHa) through reduction of E7 levels. In this study, we investigated the effects of the A2 aptamer on E7 localisation in order to define its effects on E7 activity. We demonstrate for the first time that E7 localised to the plasma membrane. In addition, we show that A2 enhanced E7 localisation in the ER and that the A2-mediated reduction of E7 was not associated with proteasomal degradation. These data suggest that A2 perturbs normal E7 trafficking through promoting E7 ER retention. PMID:26131956

  7. Quality Control and Analysis of NGS RNA Sequencing Data.

    PubMed

    Quinn, Emma M; McManus, Ross

    2015-01-01

    Transcriptome sequencing, where RNA is isolated, converted to library of cDNA fragments, and sequenced using next-generation sequencing technology, has become the method of choice for the genome-wide characterization of mRNA levels. It offers a more accurate quantification of transcript levels than array-based methods, but also has the added benefit of allowing the discovery of novel gene/transcripts, alternative splice junctions, and novel RNAs. In addition, RNA sequencing may be used to investigate differential gene expression, allelic imbalance, eQTL mapping, RNA editing, RNA-protein interactions, and alternative splicing. A number of statistical methods and tools are available for differential expression analysis using RNA sequencing data and these are continually being developed and improved to handle more complex experimental designs. This chapter describes an example workflow for the quality control and analysis of raw RNA sequencing reads for the purposes of differential gene expression analysis, followed by pathway/enrichment analysis of significantly different genes. The methods and tools described are just one example of how this analysis can be conducted, but they can be applied to most standard RNA sequencing studies of differential gene expression. The methods covered are based on Illumina HiSeq single-end 50 bp reads. However, all programs used are capable of working with paired-end data, subsequent to minor adaptations.

  8. Structural basis for the targeting of complement anaphylatoxin C5a using a mixed L-RNA/L-DNA aptamer

    NASA Astrophysics Data System (ADS)

    Yatime, Laure; Maasch, Christian; Hoehlig, Kai; Klussmann, Sven; Andersen, Gregers R.; Vater, Axel

    2015-04-01

    L-Oligonucleotide aptamers (Spiegelmers) consist of non-natural L-configured nucleotides and are of particular therapeutic interest due to their high resistance to plasma nucleases. The anaphylatoxin C5a, a potent inflammatory mediator generated during complement activation that has been implicated with organ damage, can be efficiently targeted by Spiegelmers. Here, we present the first crystallographic structures of an active Spiegelmer, NOX-D20, bound to its physiological targets, mouse C5a and C5a-desArg. The structures reveal a complex 3D architecture for the L-aptamer that wraps around C5a, including an intramolecular G-quadruplex stabilized by a central Ca2+ ion. Functional validation of the observed L-aptamer:C5a binding mode through mutational studies also rationalizes the specificity of NOX-D20 for mouse and human C5a against macaque and rat C5a. Finally, our structural model provides the molecular basis for the Spiegelmer affinity improvement through positional L-ribonucleotide to L-deoxyribonucleotide exchanges and for its inhibition of the C5a:C5aR interaction.

  9. Structural basis for the targeting of complement anaphylatoxin C5a using a mixed L-RNA/L-DNA aptamer

    PubMed Central

    Yatime, Laure; Maasch, Christian; Hoehlig, Kai; Klussmann, Sven; Andersen, Gregers R.; Vater, Axel

    2015-01-01

    L-Oligonucleotide aptamers (Spiegelmers) consist of non-natural L-configured nucleotides and are of particular therapeutic interest due to their high resistance to plasma nucleases. The anaphylatoxin C5a, a potent inflammatory mediator generated during complement activation that has been implicated with organ damage, can be efficiently targeted by Spiegelmers. Here, we present the first crystallographic structures of an active Spiegelmer, NOX-D20, bound to its physiological targets, mouse C5a and C5a-desArg. The structures reveal a complex 3D architecture for the L-aptamer that wraps around C5a, including an intramolecular G-quadruplex stabilized by a central Ca2+ ion. Functional validation of the observed L-aptamer:C5a binding mode through mutational studies also rationalizes the specificity of NOX-D20 for mouse and human C5a against macaque and rat C5a. Finally, our structural model provides the molecular basis for the Spiegelmer affinity improvement through positional L-ribonucleotide to L-deoxyribonucleotide exchanges and for its inhibition of the C5a:C5aR interaction. PMID:25901944

  10. Prediction of Secondary Structures Conserved in Multiple RNA Sequences.

    PubMed

    Xu, Zhenjiang Zech; Mathews, David H

    2016-01-01

    RNA structure is conserved by evolution to a greater extent than sequence. Predicting the conserved structure for multiple homologous sequences can be much more accurate than predicting the structure for a single sequence. RNAstructure is a software package that includes the programs Dynalign, Multilign, TurboFold, and PARTS for predicting conserved RNA secondary structure. This chapter provides protocols for using these programs. PMID:27665591

  11. RNA self-processing towards changed topology and sequence oligomerization.

    PubMed

    Pieper, Stefan; Vauléon, Stéphanie; Müller, Sabine

    2007-07-01

    Reversible chemistry, allowing for chain-forming as well as chain-breaking steps, is important for biological self-organization. In this context, ribozymes, catalyzing both RNA cleavage and ligation, may have significantly contributed to extending the sequence space and length of RNA molecules in early life forms. Here we present an engineered RNA that self-processes by passing through a number of cleavage and ligation steps. Intermolecular reactions compete with intramolecular reactions, resulting in a variety of products. Our results demonstrate that RNA can undergo self-oligomerization, which may have been important for extending the RNA genome size in RNA world scenarios.

  12. DSAP: deep-sequencing small RNA analysis pipeline.

    PubMed

    Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus

    2010-07-01

    DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (http://rfam.sanger.ac.uk/); and (iv) known miRNA matching: detection of known miRNAs in miRBase (http://www.mirbase.org/) based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at http://dsap.cgu.edu.tw.

  13. RNase P-Mediated Sequence-Specific Cleavage of RNA by Engineered External Guide Sequences.

    PubMed

    Derksen, Merel; Mertens, Vicky; Pruijn, Ger J M

    2015-11-09

    The RNA cleavage activity of RNase P can be employed to decrease the levels of specific RNAs and to study their function or even to eradicate pathogens. Two different technologies have been developed to use RNase P as a tool for RNA knockdown. In one of these, an external guide sequence, which mimics a tRNA precursor, a well-known natural RNase P substrate, is used to target an RNA molecule for cleavage by endogenous RNase P. Alternatively, a guide sequence can be attached to M1 RNA, the (catalytic) RNase P RNA subunit of Escherichia coli. The guide sequence is specific for an RNA target, which is subsequently cleaved by the bacterial M1 RNA moiety. These approaches are applicable in both bacteria and eukaryotes. In this review, we will discuss the two technologies in which RNase P is used to reduce RNA expression levels.

  14. Unbiased Deep Sequencing of RNA Viruses from Clinical Samples.

    PubMed

    Matranga, Christian B; Gladden-Young, Adrianne; Qu, James; Winnicki, Sarah; Nosamiefan, Dolo; Levin, Joshua Z; Sabeti, Pardis C

    2016-01-01

    Here we outline a next-generation RNA sequencing protocol that enables de novo assemblies and intra-host variant calls of viral genomes collected from clinical and biological sources. The method is unbiased and universal; it uses random primers for cDNA synthesis and requires no prior knowledge of the viral sequence content. Before library construction, selective RNase H-based digestion is used to deplete unwanted RNA - including poly(rA) carrier and ribosomal RNA - from the viral RNA sample. Selective depletion improves both the data quality and the number of unique reads in viral RNA sequencing libraries. Moreover, a transposase-based 'tagmentation' step is used in the protocol as it reduces overall library construction time. The protocol has enabled rapid deep sequencing of over 600 Lassa and Ebola virus samples-including collections from both blood and tissue isolates-and is broadly applicable to other microbial genomics studies. PMID:27403729

  15. Unbiased Deep Sequencing of RNA Viruses from Clinical Samples

    PubMed Central

    Matranga, Christian B.; Gladden-Young, Adrianne; Qu, James; Winnicki, Sarah; Nosamiefan, Dolo; Levin, Joshua Z.; Sabeti, Pardis C.

    2016-01-01

    Here we outline a next-generation RNA sequencing protocol that enables de novo assemblies and intra-host variant calls of viral genomes collected from clinical and biological sources. The method is unbiased and universal; it uses random primers for cDNA synthesis and requires no prior knowledge of the viral sequence content. Before library construction, selective RNase H-based digestion is used to deplete unwanted RNA — including poly(rA) carrier and ribosomal RNA — from the viral RNA sample. Selective depletion improves both the data quality and the number of unique reads in viral RNA sequencing libraries. Moreover, a transposase-based 'tagmentation' step is used in the protocol as it reduces overall library construction time. The protocol has enabled rapid deep sequencing of over 600 Lassa and Ebola virus samples-including collections from both blood and tissue isolates-and is broadly applicable to other microbial genomics studies. PMID:27403729

  16. Construction of an Aptamer-SiRNA Chimera-Modified Tissue-Engineered Blood Vessel for Cell-Type-Specific Capture and Delivery.

    PubMed

    Chen, Wen; Zeng, Wen; Sun, Jiansen; Yang, Mingcan; Li, Li; Zhou, Jingting; Wu, Yangxiao; Sun, Jun; Liu, Ge; Tang, Rui; Tan, Ju; Zhu, Chuhong

    2015-06-23

    The application of tissue-engineered blood vessels (TEBVs) is the main developmental direction of vascular replacement therapy. Due to few and/or dysfunctional endothelial progenitor cells (EPCs), it is difficult to successfully construct EPC capture TEBVs in diabetes. RNA has a potential application in cell protection and diabetes treatment, but poor specificity and low efficiency of RNA transfection in vivo limit the application of RNA. On the basis of an acellular vascular matrix, we propose an aptamer-siRNA chimera-modified TEBV that can maintain a satisfactory patency in diabetes. This TEBV consists of two parts, CD133-adenosine kinase (ADK) chimeras and a TEBV scaffold. Our results showed that CD133-ADK chimeras could selectively capture the CD133-positive cells in vivo, and then captured cells can internalize the bound chimeras to achieve RNA self-transfection. Subsequently, CD133-ADK chimeras were cut into ADK siRNA by a dicer, resulting in depletion of ADK. An ADK-deficient cell may act as a bioreactor that sustainably releases adenosine. To reduce nonspecific RNA transfection, we increased the proportion of HAuCl4 during the material preparation, through which the transfection capacity of polyethylenimine (PEI)/polyethylene glycol (PEG)-capped gold nanoparticles (PEI/PEG-AuNPs) was significantly decreased and the ability of TEBV to resist tensile and liquid shear stress was greatly enhanced. PEG and 2'-O-methyl modification was used to enhance the in vivo stability of RNA chimeras. At day 30 postgrafting, the patency rate of CD133-ADK chimera-modified TEBVs reached 90% in diabetic rats and good endothelialization was observed.

  17. The primary nucleotide sequence of U4 RNA.

    PubMed

    Reddy, R; Henning, D; Busch, H

    1981-04-10

    U4 RNA is one of the "capped" nuclear snRNAs recently found to be precipitable by anti-Sm antibodies as ribonucleoprotein particles. U4 RNA, along with other snRNAs, has been implicated in hnRNA processing, mRNA transport, or both (Lerner, M. R., Boyle, J., Mount, S., Wolin, S., and Steitz, J. A. (1980) Nature 283, 220-224). Since the proteins bound to different snRNAs appear to be the same, the functions of different snRNPs might be dependent on the RNA components. To help understand the function of U4 RNP, the nucleotide sequence of U4 RNA was determined. The sequence is (formula see text) In addition to the modified nucleotides in the "cap," U4 RNA contains Am at position 63 and m6A at position 98. It also exhibited A-C microheterogeneity at position 97. PMID:6162848

  18. Sequence of Echinochloa hoja blanca tenuivirus RNA-3.

    PubMed

    de Miranda, J R; Muñoz, M; Madriz, J; Wu, R; Espinoza, A M

    1996-01-01

    Analysis of the sequence of the 2336 nucleotide RNA-3 of Echinochloa hoja blanca tenuivirus shows that it is closely related to RNA-3 of rice hoja blanca tenuivirus, the principal virus disease of rice in Latin America. This is especially true for the coding regions, where the viruses are almost 90% similar. However, the non-coding regions of RNA-3 of these viruses, principally the intergenic region separating the two ambisense open reading frames, are only about 50% similar, suggesting that these are distinct viruses. The results closely resemble those obtained for the analysis of RNA-4 of these viruses, both in the absolute and relative percentage similarities of the coding and non-coding regions. This implies a coordinated evolution of the different tenuivirus RNA segments. The features of the RNA and the comparisons with the sequences of RNA-3 of RHBV, rice stripe virus (RStV) and maize stripe virus (MStV) are discussed. PMID:8938981

  19. Annotating RNA motifs in sequences and alignments

    PubMed Central

    Gardner, Paul P.; Eldai, Hisham

    2015-01-01

    RNA performs a diverse array of important functions across all cellular life. These functions include important roles in translation, building translational machinery and maturing messenger RNA. More recent discoveries include the miRNAs and bacterial sRNAs that regulate gene expression, the thermosensors, riboswitches and other cis-regulatory elements that help prokaryotes sense their environment and eukaryotic piRNAs that suppress transposition. However, there can be a long period between the initial discovery of a RNA and determining its function. We present a bioinformatic approach to characterize RNA motifs, which are critical components of many RNA structure–function relationships. These motifs can, in some instances, provide researchers with functional hypotheses for uncharacterized RNAs. Moreover, we introduce a new profile-based database of RNA motifs—RMfam—and illustrate some applications for investigating the evolution and functional characterization of RNA. All the data and scripts associated with this work are available from: https://github.com/ppgardne/RMfam. PMID:25520192

  20. Aptamers for Targeted Drug Delivery

    PubMed Central

    Ray, Partha; White, Rebekah R.

    2010-01-01

    Aptamers are a class of therapeutic oligonucleotides that form specific three-dimensional structures that are dictated by their sequences. They are typically generated by an iterative screening process of complex nucleic acid libraries employing a process termed Systemic Evolution of Ligands by Exponential Enrichment (SELEX). SELEX has traditionally been performed using purified proteins, and cell surface receptors may be challenging to purify in their properly folded and modified conformations. Therefore, relatively few aptamers have been generated that bind cell surface receptors. However, improvements in recombinant fusion protein technology have increased the availability of receptor extracellular domains as purified protein targets, and the development of cell-based selection techniques has allowed selection against surface proteins in their native configuration on the cell surface. With cell-based selection, a specific protein target is not always chosen, but selection is performed against a target cell type with the goal of letting the aptamer choose the target. Several studies have demonstrated that aptamers that bind cell surface receptors may have functions other than just blocking receptor-ligand interactions. All cell surface proteins cycle intracellularly to some extent, and many surface receptors are actively internalized in response to ligand binding. Therefore, aptamers that bind cell surface receptors have been exploited for the delivery of a variety of cargoes into cells. This review focuses on recent progress and current challenges in the field of aptamer-mediated delivery. PMID:27713328

  1. Aptamers for Targeted Drug Delivery

    PubMed Central

    Ray, Partha; White, Rebekah R.

    2010-01-01

    Aptamers are a class of therapeutic oligonucleotides that form specific three-dimensional structures that are dictated by their sequences. They are typically generated by an iterative screening process of complex nucleic acid libraries employing a process termed Systemic Evolution of Ligands by Exponential Enrichment (SELEX). SELEX has traditionally been performed using purified proteins, and cell surface receptors may be challenging to purify in their properly folded and modified conformations. Therefore, relatively few aptamers have been generated that bind cell surface receptors. However, improvements in recombinant fusion protein technology have increased the availability of receptor extracellular domains as purified protein targets, and the development of cell-based selection techniques has allowed selection against surface proteins in their native configuration on the cell surface. With cell-based selection, a specific protein target is not always chosen, but selection is performed against a target cell type with the goal of letting the aptamer choose the target. Several studies have demonstrated that aptamers that bind cell surface receptors may have functions other than just blocking receptor-ligand interactions. All cell surface proteins cycle intracellularly to some extent, and many surface receptors are actively internalized in response to ligand binding. Therefore, aptamers that bind cell surface receptors have been exploited for the delivery of a variety of cargoes into cells. This review focuses on recent progress and current challenges in the field of aptamer-mediated delivery.

  2. The In Vitro Synthesis of Avian Myeloblastosis Viral RNA Sequences

    PubMed Central

    Jacquet, Michel; Groner, Yoram; Monroy, Gladys; Hurwitz, Jerard

    1974-01-01

    Isolated nuclei, prepared from myeloblasts of chicks infected with avian myeloblastosis virus, synthesize RNA sequences present in avian myeloblastosis viral RNA. These sequences are also formed during transcription of chromatin, isolated from myeloblasts, by DNA-dependent RNA polymerases purified from Escherichia coli or calfthymus. In the latter case, transcription is α-amanitin sensitive. Formation of hybrids between RNA and avian myeloblastosis virus DNA probes has been monitored by the combined use of ribonucleases A, T1, and H, and ribonucleases specific for single strands. PMID:4370472

  3. Sequence of echinochloa hoja blanca tenuivirus RNA-5.

    PubMed

    de Miranda, J R; Muñoz, M; Wu, R; Espinoza, A M

    1996-01-01

    The sequence is presented of RNA-5 of Echinochloa hoja blanca tenuivirus, a second tenuivirus associated with rice cultivation in Latin America (after rice hoja blanca virus). The RNA is 1334 nucleotides long and contains in the complementary sense RNA a single long open reading frame. The deduced amino acid sequence of this open reading frame shows that it encodes a highly basic and hydrophilic 44 kD protein (pc5) with about 50% similarity to the pc5 protein of maize stripe virus (MStV). This and other features of the RNA are discussed. PMID:8879129

  4. Quantifying RNA allelic ratios by microfluidic multiplex PCR and sequencing.

    PubMed

    Zhang, Rui; Li, Xin; Ramaswami, Gokul; Smith, Kevin S; Turecki, Gustavo; Montgomery, Stephen B; Li, Jin Billy

    2014-01-01

    We developed a targeted RNA sequencing method that couples microfluidics-based multiplex PCR and deep sequencing (mmPCR-seq) to uniformly and simultaneously amplify up to 960 loci in 48 samples independently of their gene expression levels and to accurately and cost-effectively measure allelic ratios even for low-quantity or low-quality RNA samples. We applied mmPCR-seq to RNA editing and allele-specific expression studies. mmPCR-seq complements RNA-seq for studying allelic variations in the transcriptome.

  5. Cell-Specific Aptamer-Mediated Targeted Drug Delivery

    PubMed Central

    Zhou, Jiehua

    2011-01-01

    Nucleic acid aptamers are in vitro-selected small, single-stranded DNA or RNA oligonucleotides that can specifically recognize their target on the basis of their unique 3-dimensional structures. Recent advances in the development of escort aptamers to deliver and enhance the efficacy of other therapeutic agents have drawn enthusiasm in exploiting cell-type-specific aptamers as drug delivery vehicles. This review mainly focuses on the recent developments of aptamer-mediated targeted delivery systems. We also place particular emphasis on aptamers evolved against cell membrane receptors and possibilities for translation to clinical applications. PMID:21182455

  6. RNAcentral: an international database of ncRNA sequences

    DOE PAGESBeta

    Williams, Kelly Porter

    2014-10-28

    The field of non-coding RNA biology has been hampered by the lack of availability of a comprehensive, up-to-date collection of accessioned RNA sequences. Here we present the first release of RNAcentral, a database that collates and integrates information from an international consortium of established RNA sequence databases. The initial release contains over 8.1 million sequences, including representatives of all major functional classes. A web portal (http://rnacentral.org) provides free access to data, search functionality, cross-references, source code and an integrated genome browser for selected species.

  7. Nucleotide sequence of a human tRNA gene heterocluster

    SciTech Connect

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

    1986-05-01

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both (3'-/sup 32/P)-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these ..gamma..-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues.

  8. Aptamer Selection Technology and Recent Advances

    PubMed Central

    Blind, Michael; Blank, Michael

    2015-01-01

    Over the last decade, aptamers have begun to find their way from basic research to diverse commercial applications. The development of diagnostics is even more widespread than clinical applications because aptamers do not have to be extensively modified to enhance their in vivo stability and pharmacokinetics in diagnostic assays. The increasing attention has propelled the technical progress of the in vitro selection technology (SELEX) to enhance the efficiency of developing aptamers for commercially interesting targets. This review highlights recent progress in the technical steps of a SELEX experiment with a focus on high-throughput next-generation sequencing and bioinformatics. Achievements have been made in the optimization of aptamer libraries, separation schemes, amplification of the selected libraries and the identification of aptamer sequences from enriched libraries.

  9. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.

    1990-01-01

    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  10. Complete sequence of RNA1 and subgenomic RNA3 of Atlantic halibut nodavirus (AHNV).

    PubMed

    Sommerset, Ingunn; Nerland, Audun H

    2004-03-10

    The Nodaviridae are divided into the alphanodavirus genus, which infects insects, and the betanodavirus genus, which infects fishes. Betanodaviruses are the causative agent of viral encephalopathy and retinopathy (VER) in a number of cultivated marine fish species. The Nodaviridae are small non-enveloped RNA viruses that contain a genome consisting of 2 single-stranded positivesense RNA segments: RNA1 (3.1 kb), which encodes the viral part of the RNA-dependent RNA polymerase (RdRp); and RNA2 (1.4 kb), which encodes the capsid protein. In addition to RNA1 and RNA2, a subgenomic transcript of RNA1, RNA3, is present in infected cells. We have cloned and sequenced RNA1 from the Atlantic halibut Hippoglossus hippoglossus nodavirus (AHNV), and for the first time, the sequence of a betanodaviral subgenomic RNA3 has been determined. AHNV RNA1 was 3100 nucleotides in length and contained a main open reading frame encoding a polypeptide of 981 amino acids. Conservative motifs for RdRp were found in the deduced amino acid sequence. RNA3 was 371 nucleotides in length, and contained an open reading frame encoding a peptide of 75 amino acids corresponding to a hypothetical B2 protein, although sequence alignments with the alphanodavirus B2 proteins showed only marginal similarities. AHNV RNA replication in the fish cell-line SSN-1 (derived from striped snakehead) was analysed by Northern blot analysis, which indicated that RNA3 was synthesised in large amounts (compared to RNA1) at an early point in time post-infection. PMID:15109133

  11. Translating RNA sequencing into clinical diagnostics: opportunities and challenges.

    PubMed

    Byron, Sara A; Van Keuren-Jensen, Kendall R; Engelthaler, David M; Carpten, John D; Craig, David W

    2016-05-01

    With the emergence of RNA sequencing (RNA-seq) technologies, RNA-based biomolecules hold expanded promise for their diagnostic, prognostic and therapeutic applicability in various diseases, including cancers and infectious diseases. Detection of gene fusions and differential expression of known disease-causing transcripts by RNA-seq represent some of the most immediate opportunities. However, it is the diversity of RNA species detected through RNA-seq that holds new promise for the multi-faceted clinical applicability of RNA-based measures, including the potential of extracellular RNAs as non-invasive diagnostic indicators of disease. Ongoing efforts towards the establishment of benchmark standards, assay optimization for clinical conditions and demonstration of assay reproducibility are required to expand the clinical utility of RNA-seq.

  12. Oligonucleotide Aptamers: New Tools for Targeted Cancer Therapy

    PubMed Central

    Sun, Hongguang; Zhu, Xun; Lu, Patrick Y; Rosato, Roberto R; Tan, Wen; Zu, Youli

    2014-01-01

    Aptamers are a class of small nucleic acid ligands that are composed of RNA or single-stranded DNA oligonucleotides and have high specificity and affinity for their targets. Similar to antibodies, aptamers interact with their targets by recognizing a specific three-dimensional structure and are thus termed “chemical antibodies.” In contrast to protein antibodies, aptamers offer unique chemical and biological characteristics based on their oligonucleotide properties. Hence, they are more suitable for the development of novel clinical applications. Aptamer technology has been widely investigated in various biomedical fields for biomarker discovery, in vitro diagnosis, in vivo imaging, and targeted therapy. This review will discuss the potential applications of aptamer technology as a new tool for targeted cancer therapy with emphasis on the development of aptamers that are able to specifically target cell surface biomarkers. Additionally, we will describe several approaches for the use of aptamers in targeted therapeutics, including aptamer-drug conjugation, aptamer-nanoparticle conjugation, aptamer-mediated targeted gene therapy, aptamer-mediated immunotherapy, and aptamer-mediated biotherapy. PMID:25093706

  13. Profiling tissue-resident T cell repertoires by RNA sequencing.

    PubMed

    Brown, Scott D; Raeburn, Lisa A; Holt, Robert A

    2015-01-01

    Deep sequencing of recombined T cell receptor (TCR) genes and transcripts has provided a view of T cell repertoire diversity at an unprecedented resolution. Beyond profiling peripheral blood, analysis of tissue-resident T cells provides further insight into immune-related diseases. We describe the extraction of TCR sequence information directly from RNA-sequencing data from 6738 tumor and 604 control tissues, with a typical yield of 1 TCR per 10 million reads. This method circumvents the need for PCR amplification of the TCR template and provides TCR information in the context of global gene expression, allowing integrated analysis of extensive RNA-sequencing data resources. PMID:26620832

  14. Using Aptamers for Cancer Biomarker Discovery

    PubMed Central

    Chang, Yun Min; Donovan, Michael J.; Tan, Weihong

    2013-01-01

    Aptamers are single-stranded synthetic DNA- or RNA-based oligonucleotides that fold into various shapes to bind to a specific target, which includes proteins, metals, and molecules. Aptamers have high affinity and high specificity that are comparable to that of antibodies. They are obtained using iterative method, called (Systematic Evolution of Ligands by Exponential Enrichment) SELEX and cell-based SELEX (cell-SELEX). Aptamers can be paired with recent advances in nanotechnology, microarray, microfluidics, and other technologies for applications in clinical medicine. One particular area that aptamers can shed a light on is biomarker discovery. Biomarkers are important in diagnosis and treatment of cancer. In this paper, we will describe ways in which aptamers can be used to discover biomarkers for cancer diagnosis and therapeutics. PMID:23401749

  15. Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision

    PubMed Central

    Denise, Hubert; Moschos, Sterghios A.; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu

    2014-01-01

    TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034–encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5′ RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC). PMID:24496437

  16. FLDS: A Comprehensive dsRNA Sequencing Method for Intracellular RNA Virus Surveillance

    PubMed Central

    Urayama, Syun-ichi; Takaki, Yoshihiro; Nunoura, Takuro

    2016-01-01

    Knowledge of the distribution and diversity of RNA viruses is still limited in spite of their possible environmental and epidemiological impacts because RNA virus-specific metagenomic methods have not yet been developed. We herein constructed an effective metagenomic method for RNA viruses by targeting long double-stranded (ds)RNA in cellular organisms, which is a hallmark of infection, or the replication of dsRNA and single-stranded (ss)RNA viruses, except for retroviruses. This novel dsRNA targeting metagenomic method is characterized by an extremely high recovery rate of viral RNA sequences, the retrieval of terminal sequences, and uniform read coverage, which has not previously been reported in other metagenomic methods targeting RNA viruses. This method revealed a previously unidentified viral RNA diversity of more than 20 complete RNA viral genomes including dsRNA and ssRNA viruses associated with an environmental diatom colony. Our approach will be a powerful tool for cataloging RNA viruses associated with organisms of interest. PMID:26877136

  17. Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.

    PubMed

    Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu

    2014-01-01

    TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.

  18. Sequence-non-specific effects of RNA interference triggers and microRNA regulators

    PubMed Central

    Olejniczak, Marta; Galka, Paulina; Krzyzosiak, Wlodzimierz J.

    2010-01-01

    RNA reagents of diverse lengths and structures, unmodified or containing various chemical modifications are powerful tools of RNA interference and microRNA technologies. These reagents which are either delivered to cells using appropriate carriers or are expressed in cells from suitable vectors often cause unintended sequence-non-specific immune responses besides triggering intended sequence-specific silencing effects. This article reviews the present state of knowledge regarding the cellular sensors of foreign RNA, the signaling pathways these sensors mobilize and shows which specific features of the RNA reagents set the responsive systems on alert. The representative examples of toxic effects caused in the investigated cell lines and tissues by the RNAs of specific types and structures are collected and may be instructive for further studies of sequence-non-specific responses to foreign RNA in human cells. PMID:19843612

  19. Post-SELEX optimization of aptamers.

    PubMed

    Gao, Shunxiang; Zheng, Xin; Jiao, Binghua; Wang, Lianghua

    2016-07-01

    Aptamers are functional single-stranded DNA or RNA oligonucleotides, selected in vitro by SELEX (Systematic Evolution of Ligands by Exponential Enrichment), which can fold into stable unique three-dimensional structures that bind their target ligands with high affinity and specificity. Although aptamers show a number of favorable advantages such as better stability and easier modification when compared with the properties of antibodies, only a handful of aptamers have entered clinical trials and only one, pegaptanib, has received US Food and Drug Administration approval for clinical use. The main reasons that limit the practical application of aptamers are insufficient nuclease stability, bioavailability, thermal stability, or even affinity. Some aptamers obtained from modified libraries show better properties; however, polymerase amplification of nucleic acids containing non-natural bases is currently a primary drawback of the SELEX process. This review focuses on several post-SELEX optimization strategies of aptamers identified in recent years. We describe four common methods in detail: truncation, chemical modification, bivalent or multivalent aptamer construction, and mutagenesis. We believe that these optimization strategies should improve one or more specific properties of aptamers, and the type of feature(s) selected for improvement will be dependent on the application purpose. PMID:27173394

  20. Post-SELEX optimization of aptamers.

    PubMed

    Gao, Shunxiang; Zheng, Xin; Jiao, Binghua; Wang, Lianghua

    2016-07-01

    Aptamers are functional single-stranded DNA or RNA oligonucleotides, selected in vitro by SELEX (Systematic Evolution of Ligands by Exponential Enrichment), which can fold into stable unique three-dimensional structures that bind their target ligands with high affinity and specificity. Although aptamers show a number of favorable advantages such as better stability and easier modification when compared with the properties of antibodies, only a handful of aptamers have entered clinical trials and only one, pegaptanib, has received US Food and Drug Administration approval for clinical use. The main reasons that limit the practical application of aptamers are insufficient nuclease stability, bioavailability, thermal stability, or even affinity. Some aptamers obtained from modified libraries show better properties; however, polymerase amplification of nucleic acids containing non-natural bases is currently a primary drawback of the SELEX process. This review focuses on several post-SELEX optimization strategies of aptamers identified in recent years. We describe four common methods in detail: truncation, chemical modification, bivalent or multivalent aptamer construction, and mutagenesis. We believe that these optimization strategies should improve one or more specific properties of aptamers, and the type of feature(s) selected for improvement will be dependent on the application purpose.

  1. Aptamer-functionalized peptide H3CR5C as a novel nanovehicle for codelivery of fasudil and miRNA-195 targeting hepatocellular carcinoma

    PubMed Central

    Liu, Ying; Wu, Xin; Gao, Yuan; Zhang, Jigang; Zhang, Dandan; Gu, Shengying; Zhu, Guanhua; Liu, Gaolin; Li, Xiaoyu

    2016-01-01

    Liver cancer is the fifth most commonly diagnosed malignancy, of which hepatocellular carcinoma (HCC) represents the dominating histological subtype. Antiangiogenic therapy aimed at vascular endothelial growth factor (VEGF) has shown promising but deficient clinical prospects on account of vasculogenic mimicry, a highly patterned vascular channel distinguished from the endothelium-dependent blood vessel, which may function as blood supply networks occurring in aggressive tumors including HCC. In this study, we used a new cationic peptide, disulfide cross-linked stearylated polyarginine peptide modified with histidine (H3R5), as a reducible vector, cell penetrating peptide-modified aptamer (ST21) with specific binding to HCC cells to conjugate to peptide H3R5 as the targeting probe, miRNA-195 (miR195) as a powerful gene drug to inhibit VEGF, and fasudil to suppress vasculogenic mimicry by blocking ROCK2, all of which were simultaneously encapsulated in the same nanoparticles. Fasudil was loaded by ammonium sulfate-induced transmembrane electrochemical gradient and miR195 was condensed through electrostatic interaction. ST21-H3R5-polyethylene glycol (PEG) exhibited excellent loading capacities for both fasudil and miR195 with adjustable dosing ratios. Western blot analysis showed that FasudilST21-H3R5-PEGmiR195 had strong silencing activity of ROCK2 and VEGF, as compared with FasudilH3R5-PEGmiR195. In vitro and in vivo experiments confirmed that ST21-modified nanoparticles showed significantly higher cellular uptake and therapeutic efficacy in tumor cells or tumor tissues than the unmodified counterparts. These findings suggest that aptamer-conjugated peptide holds great promise for delivering chemical drugs and gene drugs simultaneously to overcome HCC. PMID:27574422

  2. Aptamer-functionalized peptide H3CR5C as a novel nanovehicle for codelivery of fasudil and miRNA-195 targeting hepatocellular carcinoma.

    PubMed

    Liu, Ying; Wu, Xin; Gao, Yuan; Zhang, Jigang; Zhang, Dandan; Gu, Shengying; Zhu, Guanhua; Liu, Gaolin; Li, Xiaoyu

    2016-01-01

    Liver cancer is the fifth most commonly diagnosed malignancy, of which hepatocellular carcinoma (HCC) represents the dominating histological subtype. Antiangiogenic therapy aimed at vascular endothelial growth factor (VEGF) has shown promising but deficient clinical prospects on account of vasculogenic mimicry, a highly patterned vascular channel distinguished from the endothelium-dependent blood vessel, which may function as blood supply networks occurring in aggressive tumors including HCC. In this study, we used a new cationic peptide, disulfide cross-linked stearylated polyarginine peptide modified with histidine (H3R5), as a reducible vector, cell penetrating peptide-modified aptamer (ST21) with specific binding to HCC cells to conjugate to peptide H3R5 as the targeting probe, miRNA-195 (miR195) as a powerful gene drug to inhibit VEGF, and fasudil to suppress vasculogenic mimicry by blocking ROCK2, all of which were simultaneously encapsulated in the same nanoparticles. Fasudil was loaded by ammonium sulfate-induced transmembrane electrochemical gradient and miR195 was condensed through electrostatic interaction. ST21-H3R5-polyethylene glycol (PEG) exhibited excellent loading capacities for both fasudil and miR195 with adjustable dosing ratios. Western blot analysis showed that (Fasudil)ST21-H3R5-PEGmiR195 had strong silencing activity of ROCK2 and VEGF, as compared with (Fasudil)H3R5-PEGmiR195. In vitro and in vivo experiments confirmed that ST21-modified nanoparticles showed significantly higher cellular uptake and therapeutic efficacy in tumor cells or tumor tissues than the unmodified counterparts. These findings suggest that aptamer-conjugated peptide holds great promise for delivering chemical drugs and gene drugs simultaneously to overcome HCC. PMID:27574422

  3. The chemical structure of DNA sequence signals for RNA transcription

    NASA Technical Reports Server (NTRS)

    George, D. G.; Dayhoff, M. O.

    1982-01-01

    The proposed recognition sites for RNA transcription for E. coli NRA polymerase, bacteriophage T7 RNA polymerase, and eukaryotic RNA polymerase Pol II are evaluated in the light of the requirements for efficient recognition. It is shown that although there is good experimental evidence that specific nucleic acid sequence patterns are involved in transcriptional regulation in bacteria and bacterial viruses, among the sequences now available, only in the case of the promoters recognized by bacteriophage T7 polymerase does it seem likely that the pattern is sufficient. It is concluded that the eukaryotic pattern that is investigated is not restrictive enough to serve as a recognition site.

  4. Aptamer photoregulation in vivo

    PubMed Central

    Li, Lele; Tong, Rong; Chu, Hunghao; Wang, Weiping; Langer, Robert; Kohane, Daniel S.

    2014-01-01

    The in vivo application of aptamers as therapeutics could be improved by enhancing target-specific accumulation while minimizing off-target uptake. We designed a light-triggered system that permits spatiotemporal regulation of aptamer activity in vitro and in vivo. Cell binding by the aptamer was prevented by hybridizing the aptamer to a photo-labile complementary oligonucleotide. Upon irradiation at the tumor site, the aptamer was liberated, leading to prolonged intratumoral retention. The relative distribution of the aptamer to the liver and kidney was also significantly decreased, compared to that of the free aptamer. PMID:25404344

  5. The genome of RNA tumor viruses contains polyadenylic acid sequences.

    PubMed

    Green, M; Cartas, M

    1972-04-01

    The 70S genome of two RNA tumor viruses, murine sarcoma virus and avian myeloblastosis virus, binds to Millipore filters in buffer with high salt concentration and to glass fiber filters containing poly(U). These observations suggest that 70S RNA contains adenylic acid-rich sequences. When digested by pancreatic RNase, 70S RNA of murine sarcoma virus yielded poly(A) sequences that contain 91% adenylic acid. These poly(A) sequences sedimented as a relatively homogenous peak in sucrose gradients with a sedimentation coefficient of 4-5 S, but had a mobility during polyacrylamide gel electrophoresis that corresponds to molecules that sediment at 6-7 S. If we estimate a molecular weight for each sequence of 30,000-60,000 (100-200 nucleotides) and a molecular weight for viral 70S RNA of 3-12 million, each viral genome could contain 1-8 poly(A) sequences. Possible functions of poly(A) in the infecting viral RNA may include a role in the initiation of viral DNA or RNA synthesis, in protein maturation, or in the assembly of the viral genome.

  6. Fluorescence-Based Strategies to Investigate the Structure and Dynamics of Aptamer-Ligand Complexes.

    PubMed

    Perez-Gonzalez, Cibran; Lafontaine, Daniel A; Penedo, J Carlos

    2016-01-01

    In addition to the helical nature of double-stranded DNA and RNA, single-stranded oligonucleotides can arrange themselves into tridimensional structures containing loops, bulges, internal hairpins and many other motifs. This ability has been used for more than two decades to generate oligonucleotide sequences, so-called aptamers, that can recognize certain metabolites with high affinity and specificity. More recently, this library of artificially-generated nucleic acid aptamers has been expanded by the discovery that naturally occurring RNA sequences control bacterial gene expression in response to cellular concentration of a given metabolite. The application of fluorescence methods has been pivotal to characterize in detail the structure and dynamics of these aptamer-ligand complexes in solution. This is mostly due to the intrinsic high sensitivity of fluorescence methods and also to significant improvements in solid-phase synthesis, post-synthetic labeling strategies and optical instrumentation that took place during the last decade. In this work, we provide an overview of the most widely employed fluorescence methods to investigate aptamer structure and function by describing the use of aptamers labeled with a single dye in fluorescence quenching and anisotropy assays. The use of 2-aminopurine as a fluorescent analog of adenine to monitor local changes in structure and fluorescence resonance energy transfer (FRET) to follow long-range conformational changes is also covered in detail. The last part of the review is dedicated to the application of fluorescence techniques based on single-molecule microscopy, a technique that has revolutionized our understanding of nucleic acid structure and dynamics. We finally describe the advantages of monitoring ligand-binding and conformational changes, one molecule at a time, to decipher the complexity of regulatory aptamers and summarize the emerging folding and ligand-binding models arising from the application of these

  7. Fluorescence-Based Strategies to Investigate the Structure and Dynamics of Aptamer-Ligand Complexes

    PubMed Central

    Perez-Gonzalez, Cibran; Lafontaine, Daniel A.; Penedo, J. Carlos

    2016-01-01

    In addition to the helical nature of double-stranded DNA and RNA, single-stranded oligonucleotides can arrange themselves into tridimensional structures containing loops, bulges, internal hairpins and many other motifs. This ability has been used for more than two decades to generate oligonucleotide sequences, so-called aptamers, that can recognize certain metabolites with high affinity and specificity. More recently, this library of artificially-generated nucleic acid aptamers has been expanded by the discovery that naturally occurring RNA sequences control bacterial gene expression in response to cellular concentration of a given metabolite. The application of fluorescence methods has been pivotal to characterize in detail the structure and dynamics of these aptamer-ligand complexes in solution. This is mostly due to the intrinsic high sensitivity of fluorescence methods and also to significant improvements in solid-phase synthesis, post-synthetic labeling strategies and optical instrumentation that took place during the last decade. In this work, we provide an overview of the most widely employed fluorescence methods to investigate aptamer structure and function by describing the use of aptamers labeled with a single dye in fluorescence quenching and anisotropy assays. The use of 2-aminopurine as a fluorescent analog of adenine to monitor local changes in structure and fluorescence resonance energy transfer (FRET) to follow long-range conformational changes is also covered in detail. The last part of the review is dedicated to the application of fluorescence techniques based on single-molecule microscopy, a technique that has revolutionized our understanding of nucleic acid structure and dynamics. We finally describe the advantages of monitoring ligand-binding and conformational changes, one molecule at a time, to decipher the complexity of regulatory aptamers and summarize the emerging folding and ligand-binding models arising from the application of these

  8. Fluorescence-based strategies to investigate the structure and dynamics of aptamer-ligand complexes

    NASA Astrophysics Data System (ADS)

    Perez-Gonzalez, Cibran; Lafontaine, Daniel; Penedo, J.

    2016-08-01

    In addition to the helical nature of double-stranded DNA and RNA, single-stranded oligonucleotides can arrange themselves into tridimensional structures containing loops, bulges, internal hairpins and many other motifs. This ability has been used for more than two decades to generate oligonucleotide sequences, so-called aptamers, that can recognize certain metabolites with high affinity and specificity. More recently, this library of artificially-generated nucleic acid aptamers has been expanded by the discovery that naturally occurring RNA sequences control bacterial gene expression in response to cellular concentration of a given metabolite. The application of fluorescence methods has been pivotal to characterize in detail the structure and dynamics of these aptamer-ligand complexes in solution. This is mostly due to the intrinsic high sensitivity of fluorescence methods and also to significant improvements in solid-phase synthesis, post-synthetic labelling strategies and optical instrumentation that took place during the last decade. In this work, we provide an overview of the most widely employed fluorescence methods to investigate aptamer structure and function by describing the use of aptamers labelled with a single dye in fluorescence quenching and anisotropy assays. The use of 2-aminopurine as a fluorescent analog of adenine to monitor local changes in structure and fluorescence resonance energy transfer (FRET) to follow long-range conformational changes is also covered in detail. The last part of the review is dedicated to the application of fluorescence techniques based on single-molecule microscopy, a technique that has revolutionized our understanding of nucleic acid structure and dynamics. We finally describe the advantages of monitoring ligand-binding and conformational changes, one molecule at a time, to decipher the complexity of regulatory aptamers and summarize the emerging folding and ligand-binding models arising from the application of these

  9. Spliced synthetic genes as internal controls in RNA sequencing experiments.

    PubMed

    Hardwick, Simon A; Chen, Wendy Y; Wong, Ted; Deveson, Ira W; Blackburn, James; Andersen, Stacey B; Nielsen, Lars K; Mattick, John S; Mercer, Tim R

    2016-09-01

    RNA sequencing (RNA-seq) can be used to assemble spliced isoforms, quantify expressed genes and provide a global profile of the transcriptome. However, the size and diversity of the transcriptome, the wide dynamic range in gene expression and inherent technical biases confound RNA-seq analysis. We have developed a set of spike-in RNA standards, termed 'sequins' (sequencing spike-ins), that represent full-length spliced mRNA isoforms. Sequins have an entirely artificial sequence with no homology to natural reference genomes, but they align to gene loci encoded on an artificial in silico chromosome. The combination of multiple sequins across a range of concentrations emulates alternative splicing and differential gene expression, and it provides scaling factors for normalization between samples. We demonstrate the use of sequins in RNA-seq experiments to measure sample-specific biases and determine the limits of reliable transcript assembly and quantification in accompanying human RNA samples. In addition, we have designed a complementary set of sequins that represent fusion genes arising from rearrangements of the in silico chromosome to aid in cancer diagnosis. RNA sequins provide a qualitative and quantitative reference with which to navigate the complexity of the human transcriptome. PMID:27502218

  10. RNA-Pareto: interactive analysis of Pareto-optimal RNA sequence-structure alignments.

    PubMed

    Schnattinger, Thomas; Schöning, Uwe; Marchfelder, Anita; Kestler, Hans A

    2013-12-01

    Incorporating secondary structure information into the alignment process improves the quality of RNA sequence alignments. Instead of using fixed weighting parameters, sequence and structure components can be treated as different objectives and optimized simultaneously. The result is not a single, but a Pareto-set of equally optimal solutions, which all represent different possible weighting parameters. We now provide the interactive graphical software tool RNA-Pareto, which allows a direct inspection of all feasible results to the pairwise RNA sequence-structure alignment problem and greatly facilitates the exploration of the optimal solution set.

  11. The nucleotide sequence of cowpea mosaic virus B RNA

    PubMed Central

    Lomonossoff, G.P.; Shanks, M.

    1983-01-01

    The complete sequence of the bottom component RNA (B RNA) of cowpea mosaic virus (CPMV) has been determined. Restriction enzyme fragments of double-stranded cDNA were cloned in M13 and the sequence of the inserts was determined by a combination of enzymatic and chemical sequencing techniques. Additional sequence information was obtained by primed synthesis on first strand cDNA. The complete sequence deduced is 5889 nucleotides long excluding the 3' poly(A), and contains an open reading frame sufficient to code for a polypeptide of mol. wt. 207 760. The coding region is flanked by a 5' leader sequence of 206 nucleotides and a 3' non-coding region of 82 residues which does not contain a polyadenylation signal. PMID:16453487

  12. Statistical design and analysis of RNA sequencing data.

    PubMed

    Auer, Paul L; Doerge, R W

    2010-06-01

    Next-generation sequencing technologies are quickly becoming the preferred approach for characterizing and quantifying entire genomes. Even though data produced from these technologies are proving to be the most informative of any thus far, very little attention has been paid to fundamental design aspects of data collection and analysis, namely sampling, randomization, replication, and blocking. We discuss these concepts in an RNA sequencing framework. Using simulations we demonstrate the benefits of collecting replicated RNA sequencing data according to well known statistical designs that partition the sources of biological and technical variation. Examples of these designs and their corresponding models are presented with the goal of testing differential expression.

  13. Identifying novel sequence variants of RNA 3D motifs

    PubMed Central

    Zirbel, Craig L.; Roll, James; Sweeney, Blake A.; Petrov, Anton I.; Pirrung, Meg; Leontis, Neocles B.

    2015-01-01

    Predicting RNA 3D structure from sequence is a major challenge in biophysics. An important sub-goal is accurately identifying recurrent 3D motifs from RNA internal and hairpin loop sequences extracted from secondary structure (2D) diagrams. We have developed and validated new probabilistic models for 3D motif sequences based on hybrid Stochastic Context-Free Grammars and Markov Random Fields (SCFG/MRF). The SCFG/MRF models are constructed using atomic-resolution RNA 3D structures. To parameterize each model, we use all instances of each motif found in the RNA 3D Motif Atlas and annotations of pairwise nucleotide interactions generated by the FR3D software. Isostericity relations between non-Watson–Crick basepairs are used in scoring sequence variants. SCFG techniques model nested pairs and insertions, while MRF ideas handle crossing interactions and base triples. We use test sets of randomly-generated sequences to set acceptance and rejection thresholds for each motif group and thus control the false positive rate. Validation was carried out by comparing results for four motif groups to RMDetect. The software developed for sequence scoring (JAR3D) is structured to automatically incorporate new motifs as they accumulate in the RNA 3D Motif Atlas when new structures are solved and is available free for download. PMID:26130723

  14. IVT-seq reveals extreme bias in RNA sequencing

    PubMed Central

    2014-01-01

    Background RNA-seq is a powerful technique for identifying and quantifying transcription and splicing events, both known and novel. However, given its recent development and the proliferation of library construction methods, understanding the bias it introduces is incomplete but critical to realizing its value. Results We present a method, in vitro transcription sequencing (IVT-seq), for identifying and assessing the technical biases in RNA-seq library generation and sequencing at scale. We created a pool of over 1,000 in vitro transcribed RNAs from a full-length human cDNA library and sequenced them with polyA and total RNA-seq, the most common protocols. Because each cDNA is full length, and we show in vitro transcription is incredibly processive, each base in each transcript should be equivalently represented. However, with common RNA-seq applications and platforms, we find 50% of transcripts have more than two-fold and 10% have more than 10-fold differences in within-transcript sequence coverage. We also find greater than 6% of transcripts have regions of dramatically unpredictable sequencing coverage between samples, confounding accurate determination of their expression. We use a combination of experimental and computational approaches to show rRNA depletion is responsible for the most significant variability in coverage, and several sequence determinants also strongly influence representation. Conclusions These results show the utility of IVT-seq for promoting better understanding of bias introduced by RNA-seq. We find rRNA depletion is responsible for substantial, unappreciated biases in coverage introduced during library preparation. These biases suggest exon-level expression analysis may be inadvisable, and we recommend caution when interpreting RNA-seq results. PMID:24981968

  15. Library preparation for highly accurate population sequencing of RNA viruses

    PubMed Central

    Acevedo, Ashley; Andino, Raul

    2015-01-01

    Circular resequencing (CirSeq) is a novel technique for efficient and highly accurate next-generation sequencing (NGS) of RNA virus populations. The foundation of this approach is the circularization of fragmented viral RNAs, which are then redundantly encoded into tandem repeats by ‘rolling-circle’ reverse transcription. When sequenced, the redundant copies within each read are aligned to derive a consensus sequence of their initial RNA template. This process yields sequencing data with error rates far below the variant frequencies observed for RNA viruses, facilitating ultra-rare variant detection and accurate measurement of low-frequency variants. Although library preparation takes ~5 d, the high-quality data generated by CirSeq simplifies downstream data analysis, making this approach substantially more tractable for experimentalists. PMID:24967624

  16. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage.

  17. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    PubMed Central

    Herzog, Michel; Maroteaux, Luc

    1986-01-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  18. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  19. Evaluation of commercially available RNA amplification kits for RNA sequencing using very low input amounts of total RNA.

    PubMed

    Shanker, Savita; Paulson, Ariel; Edenberg, Howard J; Peak, Allison; Perera, Anoja; Alekseyev, Yuriy O; Beckloff, Nicholas; Bivens, Nathan J; Donnelly, Robert; Gillaspy, Allison F; Grove, Deborah; Gu, Weikuan; Jafari, Nadereh; Kerley-Hamilton, Joanna S; Lyons, Robert H; Tepper, Clifford; Nicolet, Charles M

    2015-04-01

    This article includes supplemental data. Please visit http://www.fasebj.org to obtain this information.Multiple recent publications on RNA sequencing (RNA-seq) have demonstrated the power of next-generation sequencing technologies in whole-transcriptome analysis. Vendor-specific protocols used for RNA library construction often require at least 100 ng total RNA. However, under certain conditions, much less RNA is available for library construction. In these cases, effective transcriptome profiling requires amplification of subnanogram amounts of RNA. Several commercial RNA amplification kits are available for amplification prior to library construction for next-generation sequencing, but these kits have not been comprehensively field evaluated for accuracy and performance of RNA-seq for picogram amounts of RNA. To address this, 4 types of amplification kits were tested with 3 different concentrations, from 5 ng to 50 pg, of a commercially available RNA. Kits were tested at multiple sites to assess reproducibility and ease of use. The human total reference RNA used was spiked with a control pool of RNA molecules in order to further evaluate quantitative recovery of input material. Additional control data sets were generated from libraries constructed following polyA selection or ribosomal depletion using established kits and protocols. cDNA was collected from the different sites, and libraries were synthesized at a single site using established protocols. Sequencing runs were carried out on the Illumina platform. Numerous metrics were compared among the kits and dilutions used. Overall, no single kit appeared to meet all the challenges of small input material. However, it is encouraging that excellent data can be recovered with even the 50 pg input total RNA. PMID:25649271

  20. Small RNA cloning and sequencing strategy affects host and viral microRNA expression signatures.

    PubMed

    Stik, Grégoire; Muylkens, Benoît; Coupeau, Damien; Laurent, Sylvie; Dambrine, Ginette; Messmer, Mélanie; Chane-Woon-Ming, Béatrice; Pfeffer, Sébastien; Rasschaert, Denis

    2014-07-10

    The establishment of the microRNA (miRNA) expression signatures is the basic element to investigate the role played by these regulatory molecules in the biology of an organism. Marek's disease virus 1 (MDV-1) is an avian herpesvirus that naturally infects chicken and induces T cells lymphomas. During latency, MDV-1, like other herpesviruses, expresses a limited subset of transcripts. These include three miRNA clusters. Several studies identified the expression of virus and host encoded miRNAs from MDV-1 infected cell cultures and chickens. But a high discrepancy was observed when miRNA cloning frequencies obtained from different cloning and sequencing protocols were compared. Thus, we analyzed the effect of small RNA library preparation and sequencing on the miRNA frequencies obtained from the same RNA samples collected during MDV-1 infection of chicken at different steps of the oncoviral pathogenesis. Qualitative and quantitative variations were found in the data, depending on the strategy used. One of the mature miRNA derived from the latency-associated-transcript (LAT), mdv1-miR-M7-5p, showed the highest variation. Its cloning frequency was 50% of the viral miRNA counts when a small scale sequencing approach was used. Its frequency was 100 times less abundant when determined through the deep sequencing approach. Northern blot analysis showed a better correlation with the miRNA frequencies found by the small scale sequencing approach. By analyzing the cellular miRNA repertoire, we also found a gap between the two sequencing approaches. Collectively, our study indicates that next-generation sequencing data considered alone are limited for assessing the absolute copy number of transcripts. Thus, the quantification of small RNA should be addressed by compiling data obtained by using different techniques such as microarrays, qRT-PCR and NB analysis in support of high throughput sequencing data. These observations should be considered when miRNA variations are studied

  1. Transcriptome and small RNA deep sequencing reveals deregulation of miRNA biogenesis in human glioma.

    PubMed

    Moore, Lynette M; Kivinen, Virpi; Liu, Yuexin; Annala, Matti; Cogdell, David; Liu, Xiuping; Liu, Chang-Gong; Sawaya, Raymond; Yli-Harja, Olli; Shmulevich, Ilya; Fuller, Gregory N; Zhang, Wei; Nykter, Matti

    2013-02-01

    Altered expression of oncogenic and tumour-suppressing microRNAs (miRNAs) is widely associated with tumourigenesis. However, the regulatory mechanisms underlying these alterations are poorly understood. We sought to shed light on the deregulation of miRNA biogenesis promoting the aberrant miRNA expression profiles identified in these tumours. Using sequencing technology to perform both whole-transcriptome and small RNA sequencing of glioma patient samples, we examined precursor and mature miRNAs to directly evaluate the miRNA maturation process, and examined expression profiles for genes involved in the major steps of miRNA biogenesis. We found that ratios of mature to precursor forms of a large number of miRNAs increased with the progression from normal brain to low-grade and then to high-grade gliomas. The expression levels of genes involved in each of the three major steps of miRNA biogenesis (nuclear processing, nucleo-cytoplasmic transport, and cytoplasmic processing) were systematically altered in glioma tissues. Survival analysis of an independent data set demonstrated that the alteration of genes involved in miRNA maturation correlates with survival in glioma patients. Direct quantification of miRNA maturation with deep sequencing demonstrated that deregulation of the miRNA biogenesis pathway is a hallmark for glioma genesis and progression.

  2. Transcriptome and Small RNA Deep Sequencing Reveals Deregulation of miRNA Biogenesis in Human Glioma

    PubMed Central

    Moore, Lynette M.; Kivinen, Virpi; Liu, Yuexin; Annala, Matti; Cogdell, David; Liu, Xiuping; Liu, Chang-Gong; Sawaya, Raymond; Yli-Harja, Olli; Shmulevich, Ilya; Fuller, Gregory N.; Zhang, Wei; Nykter, Matti

    2013-01-01

    Altered expression of oncogenic and tumor-suppressing microRNAs (miRNAs) is widely associated with tumorigenesis. However, the regulatory mechanisms underlying these alterations are poorly understood. We sought to shed light on the deregulation of miRNA biogenesis promoting the aberrant miRNA expression profiles identified in these tumors. Using sequencing technology to perform both whole-transcriptome and small RNA sequencing of glioma patient samples, we examined precursor and mature miRNAs to directly evaluate the miRNA maturation process, and interrogated expression profiles for genes involved in the major steps of miRNA biogenesis. We found that ratios of mature to precursor forms of a large number of miRNAs increased with the progression from normal brain to low-grade and then to high-grade gliomas. The expression levels of genes involved in each of the three major steps of miRNA biogenesis (nuclear processing, nucleo-cytoplasmic transport, and cytoplasmic processing) were systematically altered in glioma tissues. Survival analysis of an independent data set demonstrated that the alteration of genes involved in miRNA maturation correlates with survival in glioma patients. Direct quantification of miRNA maturation with deep sequencing demonstrated that deregulation of the miRNA biogenesis pathway is a hallmark for glioma genesis and progression. PMID:23007860

  3. Method for rapid base sequencing in DNA and RNA

    DOEpatents

    Jett, J.H.; Keller, R.A.; Martin, J.C.; Moyzis, R.K.; Ratliff, R.L.; Shera, E.B.; Stewart, C.C.

    1990-10-09

    A method is provided for the rapid base sequencing of DNA or RNA fragments wherein a single fragment of DNA or RNA is provided with identifiable bases and suspended in a moving flow stream. An exonuclease sequentially cleaves individual bases from the end of the suspended fragment. The moving flow stream maintains the cleaved bases in an orderly train for subsequent detection and identification. In a particular embodiment, individual bases forming the DNA or RNA fragments are individually tagged with a characteristic fluorescent dye. The train of bases is then excited to fluorescence with an output spectrum characteristic of the individual bases. Accordingly, the base sequence of the original DNA or RNA fragment can be reconstructed. 2 figs.

  4. Method for rapid base sequencing in DNA and RNA

    DOEpatents

    Jett, J.H.; Keller, R.A.; Martin, J.C.; Moyzis, R.K.; Ratliff, R.L.; Shera, E.B.; Stewart, C.C.

    1987-10-07

    A method is provided for the rapid base sequencing of DNA or RNA fragments wherein a single fragment of DNA or RNA is provided with identifiable bases and suspended in a moving flow stream. An exonuclease sequentially cleaves individual bases from the end of the suspended fragment. The moving flow stream maintains the cleaved bases in an orderly train for subsequent detection and identification. In a particular embodiment, individual bases forming the DNA or RNA fragments are individually tagged with a characteristic fluorescent dye. The train of bases is then excited to fluorescence with an output spectrum characteristic of the individual bases. Accordingly, the base sequence of the original DNA or RNA fragment can be reconstructed. 2 figs.

  5. Method for rapid base sequencing in DNA and RNA

    DOEpatents

    Jett, James H.; Keller, Richard A.; Martin, John C.; Moyzis, Robert K.; Ratliff, Robert L.; Shera, E. Brooks; Stewart, Carleton C.

    1990-01-01

    A method is provided for the rapid base sequencing of DNA or RNA fragments wherein a single fragment of DNA or RNA is provided with identifiable bases and suspended in a moving flow stream. An exonuclease sequentially cleaves individual bases from the end of the suspended fragment. The moving flow stream maintains the cleaved bases in an orderly train for subsequent detection and identification. In a particular embodiment, individual bases forming the DNA or RNA fragments are individually tagged with a characteristic fluorescent dye. The train of bases is then excited to fluorescence with an output spectrum characteristic of the individual bases. Accordingly, the base sequence of the original DNA or RNA fragment can be reconstructed.

  6. Reentrant Melting of RNA with Quenched Sequence Randomness

    NASA Astrophysics Data System (ADS)

    Hayrapetyan, G. N.; Iannelli, F.; Lekscha, J.; Morozov, V. F.; Netz, R. R.; Mamasakhlisov, Y. Sh.

    2014-08-01

    The effect of quenched sequence disorder on the thermodynamics of RNA secondary structure formation is investigated for two- and four-letter alphabet models using the constrained annealing approach, from which the temperature behavior of the free energy, specific heat, and helicity is analytically obtained. For competing base pairing energies, the calculations reveal reentrant melting at low temperatures, in excellent agreement with numerical results. Our results suggest an additional mechanism for the experimental phenomenon of RNA cold denaturation.

  7. Sequence determinants of improved CRISPR sgRNA design

    PubMed Central

    Xu, Han; Xiao, Tengfei; Chen, Chen-Hao; Li, Wei; Meyer, Clifford A.; Wu, Qiu; Wu, Di; Cong, Le; Zhang, Feng; Liu, Jun S.; Brown, Myles; Liu, X. Shirley

    2015-01-01

    The CRISPR/Cas9 system has revolutionized mammalian somatic cell genetics. Genome-wide functional screens using CRISPR/Cas9-mediated knockout or dCas9 fusion-mediated inhibition/activation (CRISPRi/a) are powerful techniques for discovering phenotype-associated gene function. We systematically assessed the DNA sequence features that contribute to single guide RNA (sgRNA) efficiency in CRISPR-based screens. Leveraging the information from multiple designs, we derived a new sequence model for predicting sgRNA efficiency in CRISPR/Cas9 knockout experiments. Our model confirmed known features and suggested new features including a preference for cytosine at the cleavage site. The model was experimentally validated for sgRNA-mediated mutation rate and protein knockout efficiency. Tested on independent data sets, the model achieved significant results in both positive and negative selection conditions and outperformed existing models. We also found that the sequence preference for CRISPRi/a is substantially different from that for CRISPR/Cas9 knockout and propose a new model for predicting sgRNA efficiency in CRISPRi/a experiments. These results facilitate the genome-wide design of improved sgRNA for both knockout and CRISPRi/a studies. PMID:26063738

  8. Quantifying sequence and structural features of protein-RNA interactions.

    PubMed

    Li, Songling; Yamashita, Kazuo; Amada, Karlou Mar; Standley, Daron M

    2014-09-01

    Increasing awareness of the importance of protein-RNA interactions has motivated many approaches to predict residue-level RNA binding sites in proteins based on sequence or structural characteristics. Sequence-based predictors are usually high in sensitivity but low in specificity; conversely structure-based predictors tend to have high specificity, but lower sensitivity. Here we quantified the contribution of both sequence- and structure-based features as indicators of RNA-binding propensity using a machine-learning approach. In order to capture structural information for proteins without a known structure, we used homology modeling to extract the relevant structural features. Several novel and modified features enhanced the accuracy of residue-level RNA-binding propensity beyond what has been reported previously, including by meta-prediction servers. These features include: hidden Markov model-based evolutionary conservation, surface deformations based on the Laplacian norm formalism, and relative solvent accessibility partitioned into backbone and side chain contributions. We constructed a web server called aaRNA that implements the proposed method and demonstrate its use in identifying putative RNA binding sites. PMID:25063293

  9. Phylogenetic relationships of Cryptosporidium determined by ribosomal RNA sequence comparison.

    PubMed

    Johnson, A M; Fielke, R; Lumb, R; Baverstock, P R

    1990-04-01

    Reverse transcription of total cellular RNA was used to obtain a partial sequence of the small subunit ribosomal RNA of Cryptosporidium, a protist currently placed in the phylum Apicomplexa. The semi-conserved regions were aligned with homologous sequences in a range of other eukaryotes, and the evolutionary relationships of Cryptosporidium were determined by two different methods of phylogenetic analysis. The prokaryotes Escherichia coli and Halobacterium cuti were included as outgroups. The results do not show an especially close relationship of Cryptosporidium to other members of the phylum Apicomplexa. PMID:2332273

  10. The technology and biology of single-cell RNA sequencing.

    PubMed

    Kolodziejczyk, Aleksandra A; Kim, Jong Kyoung; Svensson, Valentine; Marioni, John C; Teichmann, Sarah A

    2015-05-21

    The differences between individual cells can have profound functional consequences, in both unicellular and multicellular organisms. Recently developed single-cell mRNA-sequencing methods enable unbiased, high-throughput, and high-resolution transcriptomic analysis of individual cells. This provides an additional dimension to transcriptomic information relative to traditional methods that profile bulk populations of cells. Already, single-cell RNA-sequencing methods have revealed new biology in terms of the composition of tissues, the dynamics of transcription, and the regulatory relationships between genes. Rapid technological developments at the level of cell capture, phenotyping, molecular biology, and bioinformatics promise an exciting future with numerous biological and medical applications. PMID:26000846

  11. Modeling RNA loops using sequence homology and geometric constraints

    PubMed Central

    Schudoma, Christian; May, Patrick; Walther, Dirk

    2010-01-01

    Summary: RNA loop regions are essential structural elements of RNA molecules influencing both their structural and functional properties. We developed RLooM, a web application for homology-based modeling of RNA loops utilizing template structures extracted from the PDB. RLooM allows the insertion and replacement of loop structures of a desired sequence into an existing RNA structure. Furthermore, a comprehensive database of loops in RNA structures can be accessed through the web interface. Availability and Implementation: The application was implemented in Python, MySQL and Apache. A web interface to the database and loop modeling application is freely available at http://rloom.mpimp-golm.mpg.de Contact: schudoma@mpimp-golm.mpg.de; may@mpimp-golm.mpg.de; walther@mpimp-golm.mpg.de PMID:20427516

  12. Probing dimensionality beyond the linear sequence of mRNA.

    PubMed

    Del Campo, Cristian; Ignatova, Zoya

    2016-05-01

    mRNA is a nexus entity between DNA and translating ribosomes. Recent developments in deep sequencing technologies coupled with structural probing have revealed new insights beyond the classic role of mRNA and place it more centrally as a direct effector of a variety of processes, including translation, cellular localization, and mRNA degradation. Here, we highlight emerging approaches to probe mRNA secondary structure on a global transcriptome-wide level and compare their potential and resolution. Combined approaches deliver a richer and more complex picture. While our understanding on the effect of secondary structure for various cellular processes is quite advanced, the next challenge is to unravel more complex mRNA architectures and tertiary interactions. PMID:26650615

  13. Replication and packaging of Turnip yellow mosaic virus RNA containing Flock house virus RNA1 sequence.

    PubMed

    Kim, Hui-Bae; Kim, Do-Yeong; Cho, Tae-Ju

    2014-06-01

    Turnip yellow mosaic virus (TYMV) is a spherical plant virus that has a single 6.3 kb positive strand RNA as a genome. In this study, RNA1 sequence of Flock house virus (FHV) was inserted into the TYMV genome to test whether TYMV can accommodate and express another viral entity. In the resulting construct, designated TY-FHV, the FHV RNA1 sequence was expressed as a TYMV subgenomic RNA. Northern analysis of the Nicotiana benthamiana leaves agroinfiltrated with the TY-FHV showed that both genomic and subgenomic FHV RNAs were abundantly produced. This indicates that the FHV RNA1 sequence was correctly expressed and translated to produce a functional FHV replicase. Although these FHV RNAs were not encapsidated, the FHV RNA having a TYMV CP sequence at the 3'-end was efficiently encapsidated. When an eGFP gene was inserted into the B2 ORF of the FHV sequence, a fusion protein of B2-eGFP was produced as expected.

  14. High-throughput RNA interference screening using pooled shRNA libraries and next generation sequencing

    PubMed Central

    2011-01-01

    RNA interference (RNAi) screening is a state-of-the-art technology that enables the dissection of biological processes and disease-related phenotypes. The commercial availability of genome-wide, short hairpin RNA (shRNA) libraries has fueled interest in this area but the generation and analysis of these complex data remain a challenge. Here, we describe complete experimental protocols and novel open source computational methodologies, shALIGN and shRNAseq, that allow RNAi screens to be rapidly deconvoluted using next generation sequencing. Our computational pipeline offers efficient screen analysis and the flexibility and scalability to quickly incorporate future developments in shRNA library technology. PMID:22018332

  15. Studying RNA Homology and Conservation with Infernal: From Single Sequences to RNA Families.

    PubMed

    Barquist, Lars; Burge, Sarah W; Gardner, Paul P

    2016-01-01

    Emerging high-throughput technologies have led to a deluge of putative non-coding RNA (ncRNA) sequences identified in a wide variety of organisms. Systematic characterization of these transcripts will be a tremendous challenge. Homology detection is critical to making maximal use of functional information gathered about ncRNAs: identifying homologous sequence allows us to transfer information gathered in one organism to another quickly and with a high degree of confidence. ncRNA presents a challenge for homology detection, as the primary sequence is often poorly conserved and de novo secondary structure prediction and search remain difficult. This unit introduces methods developed by the Rfam database for identifying "families" of homologous ncRNAs starting from single "seed" sequences, using manually curated sequence alignments to build powerful statistical models of sequence and structure conservation known as covariance models (CMs), implemented in the Infernal software package. We provide a step-by-step iterative protocol for identifying ncRNA homologs and then constructing an alignment and corresponding CM. We also work through an example for the bacterial small RNA MicA, discovering a previously unreported family of divergent MicA homologs in genus Xenorhabdus in the process. © 2016 by John Wiley & Sons, Inc. PMID:27322404

  16. Assessment of microRNA differential expression and detection in multiplexed small RNA sequencing data.

    PubMed

    Campbell, Joshua D; Liu, Gang; Luo, Lingqi; Xiao, Ji; Gerrein, Joseph; Juan-Guardela, Brenda; Tedrow, John; Alekseyev, Yuriy O; Yang, Ivana V; Correll, Mick; Geraci, Mark; Quackenbush, John; Sciurba, Frank; Schwartz, David A; Kaminski, Naftali; Johnson, W Evan; Monti, Stefano; Spira, Avrum; Beane, Jennifer; Lenburg, Marc E

    2015-02-01

    Small RNA sequencing can be used to gain an unprecedented amount of detail into the microRNA transcriptome. The relatively high cost and low throughput of sequencing bases technologies can potentially be offset by the use of multiplexing. However, multiplexing involves a trade-off between increased number of sequenced samples and reduced number of reads per sample (i.e., lower depth of coverage). To assess the effect of different sequencing depths owing to multiplexing on microRNA differential expression and detection, we sequenced the small RNA of lung tissue samples collected in a clinical setting by multiplexing one, three, six, nine, or 12 samples per lane using the Illumina HiSeq 2000. As expected, the numbers of reads obtained per sample decreased as the number of samples in a multiplex increased. Furthermore, after normalization, replicate samples included in distinct multiplexes were highly correlated (R > 0.97). When detecting differential microRNA expression between groups of samples, microRNAs with average expression >1 reads per million (RPM) had reproducible fold change estimates (signal to noise) independent of the degree of multiplexing. The number of microRNAs detected was strongly correlated with the log2 number of reads aligning to microRNA loci (R = 0.96). However, most additional microRNAs detected in samples with greater sequencing depth were in the range of expression which had lower fold change reproducibility. These findings elucidate the trade-off between increasing the number of samples in a multiplex with decreasing sequencing depth and will aid in the design of large-scale clinical studies exploring microRNA expression and its role in disease.

  17. Nicotiana Small RNA Sequences Support a Host Genome Origin of Cucumber Mosaic Virus Satellite RNA

    PubMed Central

    Smith, Neil A.; Schumann, Ulrike; Fang, Yuan-Yuan; Dennis, Elizabeth S.; Zhang, Ren; Guo, Hui-Shan; Wang, Ming-Bo

    2015-01-01

    Satellite RNAs (satRNAs) are small noncoding subviral RNA pathogens in plants that depend on helper viruses for replication and spread. Despite many decades of research, the origin of satRNAs remains unknown. In this study we show that a β-glucuronidase (GUS) transgene fused with a Cucumber mosaic virus (CMV) Y satellite RNA (Y-Sat) sequence (35S-GUS:Sat) was transcriptionally repressed in N. tabacum in comparison to a 35S-GUS transgene that did not contain the Y-Sat sequence. This repression was not due to DNA methylation at the 35S promoter, but was associated with specific DNA methylation at the Y-Sat sequence. Both northern blot hybridization and small RNA deep sequencing detected 24-nt siRNAs in wild-type Nicotiana plants with sequence homology to Y-Sat, suggesting that the N. tabacum genome contains Y-Sat-like sequences that give rise to 24-nt sRNAs capable of guiding RNA-directed DNA methylation (RdDM) to the Y-Sat sequence in the 35S-GUS:Sat transgene. Consistent with this, Southern blot hybridization detected multiple DNA bands in Nicotiana plants that had sequence homology to Y-Sat, suggesting that Y-Sat-like sequences exist in the Nicotiana genome as repetitive DNA, a DNA feature associated with 24-nt sRNAs. Our results point to a host genome origin for CMV satRNAs, and suggest novel approach of using small RNA sequences for finding the origin of other satRNAs. PMID:25568943

  18. In vitro RNA SELEX for the generation of chemically-optimized therapeutic RNA drugs

    PubMed Central

    Urak, Kevin T.; Shore, Sabrina; Rockey, William M.; Chen, Shi-Jie; McCaffrey, Anton P.; Giangrande, Paloma H.

    2016-01-01

    Aptamers are single-stranded DNA or RNA oligonucleotides that can bind with exquisitely high affinity and specificity to target molecules and are thus often referred to as ‘nucleic acid’ antibodies. Oligonucleotide aptamers are derived through a process of directed chemical evolution called SELEX (Systematic Evolution of Ligands by Exponential enrichment). This chemical equivalent of Darwinian evolution was first described in 1990 by Tuerk & Gold and Ellington & Szostak and has since yielded aptamers for a wide-range of applications, including biosensor technologies, in vitro diagnostics, biomarker discovery, and therapeutics. Since the inception of the original SELEX method, numerous modifications to the protocol have been described to fit the choice of target, specific conditions or applications. Technologies such as high-throughput sequencing methods and microfluidics have also been adapted for SELEX. In this chapter, we outline key steps in the SELEX process for enabling the rapid identification of RNA aptamers for in vivo applications. Specifically, we provide a detailed protocol for the selection of chemically-optimized RNA aptamers using the original in vitro SELEX methodology. In addition, methods for performing next-generation sequencing of the RNAs from each round of selection, based on Illumina sequencing technology, are discussed. PMID:26972786

  19. Identification of ssDNA aptamers specific to clinical isolates of Streptococcus mutans strains with different cariogenicity.

    PubMed

    Cui, Wei; Liu, Jiaojiao; Su, Donghua; Hu, Danyang; Hou, Shuai; Hu, Tongnan; Yang, Jiyong; Luo, Yanping; Xi, Qing; Chu, Bingfeng; Wang, Chenglong

    2016-06-01

    Streptococcus mutans, a Gram-positive facultative anaerobic bacterium, is considered to be a major etiological factor for dental caries. In this study, plaques from dental enamel surfaces of caries-active and caries-free individuals were obtained and cultivated for S. mutans isolation. Morphology examination, biochemical characterization, and polymerase chain reaction were performed to identify S. mutans The cariogenicity of S. mutans strains isolated from clinical specimens was evaluated by testing the acidogenicity, aciduricity, extracellular polysaccharide production, and adhesion ability of the bacteria. Finally, subtractive SELEX (systematic evolution of ligands by exponential enrichment) technology targeting whole intact cells was used to screen for ssDNA aptamers specific to the strains with high cariogenicity. After nine rounds of subtractive SELEX, sufficient pool enrichment was achieved as shown by radioactive isotope analysis. The enriched pool was cloned and sequenced randomly, followed by MEME online and RNA structure software analysis of the sequences. Results from the flow cytometry indicated that aptamers H1, H16, H4, L1, L10, and H19 could discriminate highly cariogenic S. mutans strains from poorly cariogenic strains. Among these, Aptamer H19 had the strongest binding capacity with cariogenic S. mutans strains with a dissociation constant of 69.45 ± 38.53 nM. In conclusion, ssDNA aptamers specific to highly cariogenic clinical S. mutans strains were successfully obtained. These ssDNA aptamers might be used for the early diagnosis and treatment of dental caries. PMID:27151293

  20. Selection of aptamers against inactive Vibrio alginolyticus and application in a qualitative detection assay.

    PubMed

    Tang, Xuemin; Zheng, Jiang; Yan, Qinpi; Li, Zhongbao; Li, Yubao

    2013-06-01

    Aptamers against inactive Vibrio alginolyticus were selected from an 82-nt ssDNA random library by systematic evolution of ligands by exponential enrichment. After 15 rounds of selection, the final pool of aptamers was highly specific for inactivated V. alginolyticus and had a dissociation constant of 27.5 ± 9.2 nM. Using these aptamers and PCR, V. alginolyticus could be detected at 100 cells/ml. Sequencing of the final pool of aptamers revealed that some sequences, termed high-frequency aptamers, appeared more than once; these may be of practical application. All sequences obtained were divided into nine families according to their homology tree, some conserved sequences were also found in each of the six families. One sequence was found in significant proportions of the aptamers, suggesting that this conserved sequence might be important for forming the three-dimensional aptamer structure.

  1. Using RNA Sequencing to Classify Organisms into Three Primary Kingdoms.

    ERIC Educational Resources Information Center

    Evans, Robert H.

    1983-01-01

    Using the biochemical record to class archaebacteria, eukaryotes, and eubacteria involves abstractions difficult for the concrete learner. Therefore, a method is provided in which students discover some basic tenets of biochemical classification and apply them in a "hands-on" classification problem. The method involves use of RNA sequencing. (JN)

  2. Sequence specificity of mRNA N6-adenosine methyltransferase.

    PubMed

    Csepany, T; Lin, A; Baldick, C J; Beemon, K

    1990-11-25

    The sequence specificity of chicken mRNA N6-adenosine methyltransferase has been investigated in vivo. Localization of six new N6-methyladenosine sites on Rous sarcoma virus (RSV) virion RNA has confirmed our extended consensus sequence for methylation: RGACU, where R is usually a G (7/12). We have also observed A (2/12) and U (3/12) at the -2 position (relative to m6A at +1) but never a C. At the +3 position, the U was observed 10/12 times; an A and a C were observed once each in weakly methylated sequences. The extent of methylation varied between the different sites up to a maximum of about 90%. To test the significance of this consensus sequence, it was altered by site-specific mutagenesis, and methylation was assayed after transfection of mutated RSV DNA into chicken embryo fibroblasts. We found that changing the G at -1 or the U at +3 to any other residue inhibited methylation. However, inhibition of methylation at all four of the major sites in the RSV src gene did not detectably alter the steady-state levels of the three viral RNA species or viral infectivity. Additional mutants that inactivated the src protein kinase activity produced less virus and exhibited relatively less src mRNA in infected cells. PMID:2173695

  3. Toward Rare Blood Cell Preservation for RNA Sequencing.

    PubMed

    Vickovic, Sanja; Ahmadian, Afshin; Lewensohn, Rolf; Lundeberg, Joakim

    2015-07-01

    Cancer is driven by various events leading to cell differentiation and disease progression. Molecular tools are powerful approaches for describing how and why these events occur. With the growing field of next-generation DNA sequencing, there is an increasing need for high-quality nucleic acids derived from human cells and tissues-a prerequisite for successful cell profiling. Although advances in RNA preservation have been made, some of the largest biobanks still do not employ RNA blood preservation as standard because of limitations in low blood-input volume and RNA stability over the whole gene body. Therefore, we have developed a robust protocol for blood preservation and long-term storage while maintaining RNA integrity. Furthermore, we explored the possibility of using the protocol for preserving rare cell samples, such as circulating tumor cells. The results of our study confirmed that gene expression was not impacted by the preservation procedure (r(2) > 0.88) or by long-term storage (r(2) = 0.95), with RNA integrity number values averaging over 8. Similarly, cell surface antigens were still available for antibody selection (r(2) = 0.95). Lastly, data mining for fusion events showed that it was possible to detect rare tumor cells among a background of other cells present in blood irrespective of fixation. Thus, the developed protocol would be suitable for rare blood cell preservation followed by RNA sequencing analysis.

  4. Ribosomal RNA sequence suggests microsporidia are extremely ancient eukaryotes.

    PubMed

    Vossbrinck, C R; Maddox, J V; Friedman, S; Debrunner-Vossbrinck, B A; Woese, C R

    The microsporidia are a group of unusual, obligately parasitic protists that infect a great variety of other eukaryotes, including vertebrates, arthropods, molluscs, annelids, nematodes, cnidaria and even various ciliates, myxosporidia and gregarines. They possess a number of unusual cytological and molecular characteristics. Their nuclear division is considered to be primitive, they have no mitochondria, their ribosomes and ribosomal RNAs are reported to be of prokaryotic size and their large ribosomal subunit contains no 5.8S rRNA. The uniqueness of the microsporidia may reflect their phylogenetic position, because comparative sequence analysis shows that the small subunit rRNA of the microsporidium Vairimorpha necatrix is more unlike those of other eukaryotes than any known eukaryote 18S rRNA sequence. We conclude that the lineage leading to microsporidia branched very early from that leading to other eukaryotes.

  5. siRNA release from pri-miRNA scaffolds is controlled by the sequence and structure of RNA.

    PubMed

    Galka-Marciniak, Paulina; Olejniczak, Marta; Starega-Roslan, Julia; Szczesniak, Michal W; Makalowska, Izabela; Krzyzosiak, Wlodzimierz J

    2016-04-01

    shmiRs are pri-miRNA-based RNA interference triggers from which exogenous siRNAs are expressed in cells to silence target genes. These reagents are very promising tools in RNAi in vivo applications due to their good activity profile and lower toxicity than observed for other vector-based reagents such as shRNAs. In this study, using high-resolution northern blotting and small RNA sequencing, we investigated the precision with which RNases Drosha and Dicer process shmiRs. The fidelity of siRNA release from the commonly used pri-miRNA shuttles was found to depend on both the siRNA insert and the pri-miR scaffold. Then, we searched for specific factors that may affect the precision of siRNA release and found that both the structural features of shmiR hairpins and the nucleotide sequence at Drosha and Dicer processing sites contribute to cleavage site selection and cleavage precision. An analysis of multiple shRNA intermediates generated from several reagents revealed the complexity of shmiR processing by Drosha and demonstrated that Dicer selects substrates for further processing. Aside from providing new basic knowledge regarding the specificity of nucleases involved in miRNA biogenesis, our results facilitate the rational design of more efficient genetic reagents for RNAi technology. PMID:26921501

  6. Learning to Predict miRNA-mRNA Interactions from AGO CLIP Sequencing and CLASH Data

    PubMed Central

    Lu, Yuheng; Leslie, Christina S.

    2016-01-01

    Recent technologies like AGO CLIP sequencing and CLASH enable direct transcriptome-wide identification of AGO binding and miRNA target sites, but the most widely used miRNA target prediction algorithms do not exploit these data. Here we use discriminative learning on AGO CLIP and CLASH interactions to train a novel miRNA target prediction model. Our method combines two SVM classifiers, one to predict miRNA-mRNA duplexes and a second to learn a binding model of AGO’s local UTR sequence preferences and positional bias in 3’UTR isoforms. The duplex SVM model enables the prediction of non-canonical target sites and more accurately resolves miRNA interactions from AGO CLIP data than previous methods. The binding model is trained using a multi-task strategy to learn context-specific and common AGO sequence preferences. The duplex and common AGO binding models together outperform existing miRNA target prediction algorithms on held-out binding data. Open source code is available at https://bitbucket.org/leslielab/chimiric. PMID:27438777

  7. Learning to Predict miRNA-mRNA Interactions from AGO CLIP Sequencing and CLASH Data.

    PubMed

    Lu, Yuheng; Leslie, Christina S

    2016-07-01

    Recent technologies like AGO CLIP sequencing and CLASH enable direct transcriptome-wide identification of AGO binding and miRNA target sites, but the most widely used miRNA target prediction algorithms do not exploit these data. Here we use discriminative learning on AGO CLIP and CLASH interactions to train a novel miRNA target prediction model. Our method combines two SVM classifiers, one to predict miRNA-mRNA duplexes and a second to learn a binding model of AGO's local UTR sequence preferences and positional bias in 3'UTR isoforms. The duplex SVM model enables the prediction of non-canonical target sites and more accurately resolves miRNA interactions from AGO CLIP data than previous methods. The binding model is trained using a multi-task strategy to learn context-specific and common AGO sequence preferences. The duplex and common AGO binding models together outperform existing miRNA target prediction algorithms on held-out binding data. Open source code is available at https://bitbucket.org/leslielab/chimiric. PMID:27438777

  8. Dynamics in Sequence Space for RNA Secondary Structure Design.

    PubMed

    Matthies, Marco C; Bienert, Stefan; Torda, Andrew E

    2012-10-01

    We have implemented a method for the design of RNA sequences that should fold to arbitrary secondary structures. A popular energy model allows one to take the derivative with respect to composition, which can then be interpreted as a force and used for Newtonian dynamics in sequence space. Combined with a negative design term, one can rapidly sample sequences which are compatible with a desired secondary structure via simulated annealing. Results for 360 structures were compared with those from another nucleic acid design program using measures such as the probability of the target structure and an ensemble-weighted distance to the target structure.

  9. Aptamers in hematological malignancies and their potential therapeutic implications.

    PubMed

    Ouyang, Wanyan; Yu, Ziqiang; Zhao, Xiaohong; Lu, Shiyun; Wang, Zhi

    2016-10-01

    Aptamers are short DNA/RNA oligonucleotides selected by the process called Systematic Evolution of Ligands by Exponential Enrichment (SELEX). Due to their functional similarity to monoclonal antibodies with some superior characters, such as high specificity and affinity, flexible modification and stability, and lack of toxicity and immunogenicity, they are promising alternative and complementary targeted therapy for hematologic malignancies. The trends in aptamer technology including production, selection, modifications are briefly discussed in this review. The key aspect is to illustrate aptamers against cancer cells in hematologic malignancies especially those that have entered clinical trials. We also discuss some challenges remain in the application of aptamers. PMID:27637356

  10. Direct Sequence Detection of Structured H5 Influenza Viral RNA

    PubMed Central

    Kerby, Matthew B.; Freeman, Sarah; Prachanronarong, Kristina; Artenstein, Andrew W.; Opal, Steven M.; Tripathi, Anubhav

    2008-01-01

    We describe the development of sequence-specific molecular beacons (dual-labeled DNA probes) for identification of the H5 influenza subtype, cleavage motif, and receptor specificity when hybridized directly with in vitro transcribed viral RNA (vRNA). The cloned hemagglutinin segment from a highly pathogenic H5N1 strain, A/Hanoi/30408/2005(H5N1), isolated from humans was used as template for in vitro transcription of sense-strand vRNA. The hybridization behavior of vRNA and a conserved subtype probe was characterized experimentally by varying conditions of time, temperature, and Mg2+ to optimize detection. Comparison of the hybridization rates of probe to DNA and RNA targets indicates that conformational switching of influenza RNA structure is a rate-limiting step and that the secondary structure of vRNA dominates the binding kinetics. The sensitivity and specificity of probe recognition of other H5 strains was calculated from sequence matches to the National Center for Biotechnology Information influenza database. The hybridization specificity of the subtype probes was experimentally verified with point mutations within the probe loop at five locations corresponding to the other human H5 strains. The abundance frequencies of the hemagglutinin cleavage motif and sialic acid recognition sequences were experimentally tested for H5 in all host viral species. Although the detection assay must be coupled with isothermal amplification on the chip, the new probes form the basis of a portable point-of-care diagnostic device for influenza subtyping. PMID:18403607

  11. Principles of miRNA-mRNA interactions: beyond sequence complementarity.

    PubMed

    Afonso-Grunz, Fabian; Müller, Sören

    2015-08-01

    MicroRNAs (miRNAs) are small non-coding RNAs that post-transcriptionally regulate gene expression by altering the translation efficiency and/or stability of targeted mRNAs. In vertebrates, more than 50% of all protein-coding RNAs are assumed to be subject to miRNA-mediated control, but current high-throughput methods that reliably measure miRNA-mRNA interactions either require prior knowledge of target mRNAs or elaborate preparation procedures. Consequently, experimentally validated interactions are relatively rare. Furthermore, in silico prediction based on sequence complementarity of miRNAs and their corresponding target sites suffers from extremely high false positive rates. Apparently, sequence complementarity alone is often insufficient to reflect the complex post-transcriptional regulation of mRNAs by miRNAs, which is especially true for animals. Therefore, combined analysis of small non-coding and protein-coding RNAs is indispensable to better understand and predict the complex dynamics of miRNA-regulated gene expression. Single-nucleotide polymorphisms (SNPs) and alternative polyadenylation (APA) can affect miRNA binding of a given transcript from different individuals and tissues, and especially APA is currently emerging as a major factor that contributes to variations in miRNA-mRNA interplay in animals. In this review, we focus on the influence of APA and SNPs on miRNA-mediated gene regulation and discuss the computational approaches that take these mechanisms into account.

  12. Computer-aided design of aptamers for cytochrome p450.

    PubMed

    Shcherbinin, Dmitrii S; Gnedenko, Oksana V; Khmeleva, Svetlana A; Usanov, Sergey A; Gilep, Andrei A; Yantsevich, Aliaksei V; Shkel, Tatsiana V; Yushkevich, Ivan V; Radko, Sergey P; Ivanov, Alexis S; Veselovsky, Alexander V; Archakov, Alexander I

    2015-08-01

    Aptamers are short single-stranded DNA or RNA oligonucleotides that can bind to their targets with high affinity and specificity. Usually, they are experimentally selected using the SELEX method. Here, we describe an approach toward the in silico selection of aptamers for proteins. This approach involves three steps: finding a potential binding site, designing the recognition and structural parts of the aptamers and evaluating the experimental affinity. Using this approach, a set of 15-mer aptamers for cytochrome P450 51A1 was designed using docking and molecular dynamics simulation. An experimental evaluation of the synthesized aptamers using SPR biosensor showed that these aptamers interact with cytochrome P450 51A1 with Kd values in the range of 10(-6)-10(-7) M. PMID:26166326

  13. Structurally complex and highly active RNA ligases derived from random RNA sequences

    NASA Technical Reports Server (NTRS)

    Ekland, E. H.; Szostak, J. W.; Bartel, D. P.

    1995-01-01

    Seven families of RNA ligases, previously isolated from random RNA sequences, fall into three classes on the basis of secondary structure and regiospecificity of ligation. Two of the three classes of ribozymes have been engineered to act as true enzymes, catalyzing the multiple-turnover transformation of substrates into products. The most complex of these ribozymes has a minimal catalytic domain of 93 nucleotides. An optimized version of this ribozyme has a kcat exceeding one per second, a value far greater than that of most natural RNA catalysts and approaching that of comparable protein enzymes. The fact that such a large and complex ligase emerged from a very limited sampling of sequence space implies the existence of a large number of distinct RNA structures of equivalent complexity and activity.

  14. DNA module platform for developing colorimetric aptamer sensors.

    PubMed

    Tomita, Yasuyuki; Morita, Yuji; Suga, Hiroaki; Fujiwara, Daisuke

    2016-01-01

    Here we present a DNA module platform for developing simple aptamer sensors based on a microarray format combined with secondary structure prediction in silico. The platform comprises four parts: (i) aptamer, (ii) joint module, (iii) terminal stem, and (iv) a DNAzyme that catalyzes a redox reaction controlled by a structural change induced by aptamer/target binding. First, we developed a joint module, capable of sensing a conformational change in the aptamer region, that was linked to the signal transmission activity of a DNAzyme as the reporter in a concentration-dependent manner with the AMP aptamer. This module design was then used to generate an arginine sensor simply by replacing the AMP aptamer region with a previously reported arginine aptamer. Using this DNA module platform, we were also able to customize a microarray containing >10,000 sequences designed by in silico secondary structure prediction and successfully identify a new aptamer against patulin. Our results show that the DNA module platform can be used to readily devise sensors based on known aptamers as well as create new aptamer sensors by array-based screening. PMID:27286805

  15. Hybridization-based aptamer labeling using complementary oligonucleotide platform for PET and optical imaging.

    PubMed

    Park, Jun Young; Lee, Tae Sup; Song, In Ho; Cho, Ye Lim; Chae, Ju Ri; Yun, Mijin; Kang, Hyungu; Lee, Jung Hwan; Lim, Jong Hoon; Cho, Won Gil; Kang, Won Jun

    2016-09-01

    Aptamers are promising next-generation ligands used in molecular imaging and theragnosis. Aptamers are synthetic nucleic acids that can be held together with complementary sequences by base-pair hybridization. In this study, the complementary oligonucleotide (cODN) hybridization-based aptamer conjugation platform was developed to use aptamers as the molecular imaging agent. The cODN was pre-labeled with fluorescent dye or radioisotope and hybridized with a matched sequence containing aptamers in aqueous conditions. The cODN platform-hybridized aptamers exhibited good serum stability and specific binding affinity towards target cancer cells both in vitro and in vivo. These results suggest that the newly designed aptamer conjugation platform offers great potential for the versatile application of aptamers as molecular imaging agents. PMID:27258484

  16. Finding the most significant common sequence and structure motifs in a set of RNA sequences.

    PubMed Central

    Gorodkin, J; Heyer, L J; Stormo, G D

    1997-01-01

    We present a computational scheme to locally align a collection of RNA sequences using sequence and structure constraints. In addition, the method searches for the resulting alignments with the most significant common motifs, among all possible collections. The first part utilizes a simplified version of the Sankoff algorithm for simultaneous folding and alignment of RNA sequences, but maintains tractability by constructing multi-sequence alignments from pairwise comparisons. The algorithm finds the multiple alignments using a greedy approach and has similarities to both CLUSTAL and CONSENSUS, but the core algorithm assures that the pairwise alignments are optimized for both sequence and structure conservation. The choice of scoring system and the method of progressively constructing the final solution are important considerations that are discussed. Example solutions, and comparisons with other approaches, are provided. The solutions include finding consensus structures identical to published ones. PMID:9278497

  17. Cell growth inhibition by sequence-specific RNA minihelices.

    PubMed Central

    Hipps, D; Schimmel, P

    1995-01-01

    RNA minihelices which reconstruct the 12 base pair acceptor-T psi C domains of transfer RNAs interact with their cognate tRNA synthetases. These substrates lack the anticodons of the genetic code and, therefore, cannot participate in steps of protein synthesis subsequent to aminoacylation. We report here that expression in Escherichia coli of either of two minihelices, each specific for a different amino acid, inhibited cell growth. Inhibition appears to be due to direct competition between the minihelix and its related tRNA for binding to their common synthetase. This competition, in turn, sharply lowers the pool of the specific charged tRNA for protein synthesis. Inhibition is relieved by single nucleotide changes which disrupt the minihelix-synthetase interaction. The results suggest that sequence-specific RNA minihelix substrates bind to cognate synthetases in vivo and can, in principle, act as cell growth regulators. Naturally occurring non-tRNA substrates for aminoacylation may serve a similar purpose. Images PMID:7664744

  18. Using Small RNA Deep Sequencing Data to Detect Human Viruses.

    PubMed

    Wang, Fang; Sun, Yu; Ruan, Jishou; Chen, Rui; Chen, Xin; Chen, Chengjie; Kreuze, Jan F; Fei, ZhangJun; Zhu, Xiao; Gao, Shan

    2016-01-01

    Small RNA sequencing (sRNA-seq) can be used to detect viruses in infected hosts without the necessity to have any prior knowledge or specialized sample preparation. The sRNA-seq method was initially used for viral detection and identification in plants and then in invertebrates and fungi. However, it is still controversial to use sRNA-seq in the detection of mammalian or human viruses. In this study, we used 931 sRNA-seq runs of data from the NCBI SRA database to detect and identify viruses in human cells or tissues, particularly from some clinical samples. Six viruses including HPV-18, HBV, HCV, HIV-1, SMRV, and EBV were detected from 36 runs of data. Four viruses were consistent with the annotations from the previous studies. HIV-1 was found in clinical samples without the HIV-positive reports, and SMRV was found in Diffuse Large B-Cell Lymphoma cells for the first time. In conclusion, these results suggest the sRNA-seq can be used to detect viruses in mammals and humans. PMID:27066498

  19. Using Small RNA Deep Sequencing Data to Detect Human Viruses

    PubMed Central

    Wang, Fang; Sun, Yu; Ruan, Jishou; Chen, Rui; Chen, Xin; Chen, Chengjie; Kreuze, Jan F.; Fei, ZhangJun; Zhu, Xiao

    2016-01-01

    Small RNA sequencing (sRNA-seq) can be used to detect viruses in infected hosts without the necessity to have any prior knowledge or specialized sample preparation. The sRNA-seq method was initially used for viral detection and identification in plants and then in invertebrates and fungi. However, it is still controversial to use sRNA-seq in the detection of mammalian or human viruses. In this study, we used 931 sRNA-seq runs of data from the NCBI SRA database to detect and identify viruses in human cells or tissues, particularly from some clinical samples. Six viruses including HPV-18, HBV, HCV, HIV-1, SMRV, and EBV were detected from 36 runs of data. Four viruses were consistent with the annotations from the previous studies. HIV-1 was found in clinical samples without the HIV-positive reports, and SMRV was found in Diffuse Large B-Cell Lymphoma cells for the first time. In conclusion, these results suggest the sRNA-seq can be used to detect viruses in mammals and humans. PMID:27066498

  20. Aptamer-based immunosensor on the ZnO nanorods networks.

    PubMed

    Nam, Yoonkyung; Park, Jungil; Pak, Youngmi Kim; Pak, James Jungho

    2012-07-01

    This paper presents the fabrication and characteristics of a new aptamer-based electrochemical immunosensor on the patterned zinc oxide nanorod networks (ZNNs) for detecting thrombin. Aptamers are single-stranded RNA or DNA sequence that binds to target materials with high specificity and affinity. An antibody-antigen-aptamer sandwich structure was employed to this immunosensor for detecting thrombin. First, hydrothermally grown ZNNs were patterned on the patterned 0.02 cm2 Au/Ti electrodes on a glass substrate by lift-off process. The high isoelectric point (IEP, approximately 9.5) of nanostructured ZnO makes it suitable for immobilizing proteins with low IEP. Then 5 microL of the 500 nM antibody was immobilized on the ZNNs electrode. 5 micro/L of the mixture of 1 microM aptamer labeled by ferrocene (Fc) and thrombin was dropped on the electrode for antibody-antigen binding. The peak oxidation currents of the immunosensors at various thrombin concentrations were measured by using cyclic voltammetry. The peak oxidation current was observed at 340 mV versus Ag/AgCl electrode, and the peak oxidation current increased linearly from 62.26 nA to 354.13 nA with the logarithmic concentration of thrombin in the range from 100 pM to 250 nM. Fabrication of an aptamer-based immunosensor for thrombin detection is a new attempt and the characteristics of the fabricated immunosensors showed that the fabricated aptamer-baded immunosensor worked electrochemically well and had a low detection limit (approximately 91.04 pM) and good selectivity.

  1. HLA typing from RNA-Seq sequence reads.

    PubMed

    Boegel, Sebastian; Löwer, Martin; Schäfer, Michael; Bukur, Thomas; de Graaf, Jos; Boisguérin, Valesca; Türeci, Ozlem; Diken, Mustafa; Castle, John C; Sahin, Ugur

    2012-01-01

    We present a method, seq2HLA, for obtaining an individual's human leukocyte antigen (HLA) class I and II type and expression using standard next generation sequencing RNA-Seq data. RNA-Seq reads are mapped against a reference database of HLA alleles, and HLA type, confidence score and locus-specific expression level are determined. We successfully applied seq2HLA to 50 individuals included in the HapMap project, yielding 100% specificity and 94% sensitivity at a P-value of 0.1 for two-digit HLA types. We determined HLA type and expression for previously un-typed Illumina Body Map tissues and a cohort of Korean patients with lung cancer. Because the algorithm uses standard RNA-Seq reads and requires no change to laboratory protocols, it can be used for both existing datasets and future studies, thus adding a new dimension for HLA typing and biomarker studies. PMID:23259685

  2. Understanding mechanisms underlying human gene expression variation with RNA sequencing

    PubMed Central

    Pickrell, Joseph K.; Marioni, John C.; Pai, Athma A.; Degner, Jacob F.; Engelhardt, Barbara E.; Nkadori, Everlyne; Veyrieras, Jean-Baptiste; Stephens, Matthew; Gilad, Yoav; Pritchard, Jonathan K.

    2011-01-01

    Understanding the genetic mechanisms underlying natural variation in gene expression is a central goal of both medical and evolutionary genetics, and studies of expression quantitative trait loci (eQTLs) have become an important tool for achieving this goal1. Although all eQTL studies so far have assayed messenger RNA levels using expression microarrays, recent advances in RNA sequencing enable the analysis of transcript variation at unprecedented resolution. We sequenced RNA from 69 lymphoblastoid cell lines derived from unrelated Nigerian individuals that have been extensively genotyped by the International HapMap Project2. By pooling data from all individuals, we generated a map of the transcriptional landscape of these cells, identifying extensive use of unannotated untranslated regions and more than 100 new putative protein-coding exons. Using the genotypes from the HapMap project, we identified more than a thousand genes at which genetic variation influences overall expression levels or splicing. We demonstrate that eQTLs near genes generally act by a mechanism involving allele-specific expression, and that variation that influences the inclusion of an exon is enriched within and near the consensus splice sites. Our results illustrate the power of high-throughput sequencing for the joint analysis of variation in transcription, splicing and allele-specific expression across individuals. PMID:20220758

  3. Aptamers: A Feasible Technology in Cancer Immunotherapy.

    PubMed

    Soldevilla, M M; Villanueva, H; Pastor, F

    2016-01-01

    Aptamers are single-chained RNA or DNA oligonucleotides (ODNs) with three-dimensional folding structures which allow them to bind to their targets with high specificity. Aptamers normally show affinities comparable to or higher than that of antibodies. They are chemically synthesized and therefore less expensive to manufacture and produce. A variety of aptamers described to date have been shown to be reliable in modulating immune responses against cancer by either blocking or activating immune receptors. Some of them have been conjugated to other molecules to target the immune system and reduce off-target side effects. Despite the success of first-line treatments against cancer, the elevated number of relapsing cases and the tremendous side effects shown by the commonly used agents hinder conventional treatments against cancer. The advantages provided by aptamers could enhance the therapeutic index of a given strategy and therefore enhance the antitumor effect. Here we recapitulate the provided benefits of aptamers with immunomodulatory activity described to date in cancer therapy and the benefits that aptamer-based immunotherapy could provide either alone or combined with first-line treatments in cancer therapy.

  4. Aptamers: A Feasible Technology in Cancer Immunotherapy

    PubMed Central

    Villanueva, H.; Pastor, F.

    2016-01-01

    Aptamers are single-chained RNA or DNA oligonucleotides (ODNs) with three-dimensional folding structures which allow them to bind to their targets with high specificity. Aptamers normally show affinities comparable to or higher than that of antibodies. They are chemically synthesized and therefore less expensive to manufacture and produce. A variety of aptamers described to date have been shown to be reliable in modulating immune responses against cancer by either blocking or activating immune receptors. Some of them have been conjugated to other molecules to target the immune system and reduce off-target side effects. Despite the success of first-line treatments against cancer, the elevated number of relapsing cases and the tremendous side effects shown by the commonly used agents hinder conventional treatments against cancer. The advantages provided by aptamers could enhance the therapeutic index of a given strategy and therefore enhance the antitumor effect. Here we recapitulate the provided benefits of aptamers with immunomodulatory activity described to date in cancer therapy and the benefits that aptamer-based immunotherapy could provide either alone or combined with first-line treatments in cancer therapy. PMID:27413756

  5. Sequence of rice hoja blanca tenuivirus RNA-2.

    PubMed

    De Miranda, J R; Muñoz, M; Wu, R; Hull, R; Espinoza, A M

    1996-01-01

    The sequence of rice hoja blanca tenuivirus RNA-2 is analysed and compared to its counter-part in rice stripe tenuivirus. The RNA encodes two proteins, in an ambisense arrangement. The 94 kD pc2, located in the complementary sense RNA, has several features typical of viral membrane (glyco)proteins, and also has regions of local homology to the glycoproteins of the Phleboviruses (Bunyaviridae). The 23 kD pv2 lies in the viral sense RNA and has two small conserved domains that are almost exclusively found in retro-viral membrane glycoproteins. Its genome location is analogous to the NSm protein of several of the Bunyaviridae species, which is thought to have a membrane-related function. The two open reading frames are separated by a large intergenic region which, in common with the other tenuivirus ambisense RNA segments, has a short region that is highly conserved between RStV and RHBV. The significance of these results with respect to the virus structure and gene expression is discussed. PMID:8883360

  6. tRNA-Related Sequences Trigger Systemic mRNA Transport in Plants[OPEN

    PubMed Central

    Zhang, Wenna; Kollwig, Gregor; Apelt, Federico; Walther, Dirk

    2016-01-01

    In plants, protein-coding mRNAs can move via the phloem vasculature to distant tissues, where they may act as non-cell-autonomous signals. Emerging work has identified many phloem-mobile mRNAs, but little is known regarding RNA motifs triggering mobility, the extent of mRNA transport, and the potential of transported mRNAs to be translated into functional proteins after transport. To address these aspects, we produced reporter transcripts harboring tRNA-like structures (TLSs) that were found to be enriched in the phloem stream and in mRNAs moving over chimeric graft junctions. Phenotypic and enzymatic assays on grafted plants indicated that mRNAs harboring a distinctive TLS can move from transgenic roots into wild-type leaves and from transgenic leaves into wild-type flowers or roots; these mRNAs can also be translated into proteins after transport. In addition, we provide evidence that dicistronic mRNA:tRNA transcripts are frequently produced in Arabidopsis thaliana and are enriched in the population of graft-mobile mRNAs. Our results suggest that tRNA-derived sequences with predicted stem-bulge-stem-loop structures are sufficient to mediate mRNA transport and seem to be necessary for the mobility of a large number of endogenous transcripts that can move through graft junctions. PMID:27268430

  7. Nucleic acid aptamers stabilize proteins against different types of stress conditions.

    PubMed

    Jetani, Hardik C; Bhadra, Ankan Kumar; Jain, Nishant Kumar; Roy, Ipsita

    2014-01-01

    It has been observed that the same osmolyte cannot provide protection to a protein exposed to more than one stress condition. We wanted to study the effect of nucleic acid aptamers on the stabilization of proteins against a variety of stress conditions. Adjuvanted tetanus toxoid was exposed to thermal, freeze-thawing, and agitation stress. The stability and antigenicity of the toxoid were measured. Using nucleic acid aptamers selected against tetanus toxoid, we show that these specific RNA sequences were able to stabilize alumina-adsorbed tetanus toxoid against thermal-, agitation-, and freeze-thawing-induced stress. Binding affinity of the aptamer-protein complex did not show any significant change at elevated temperature as compared with that at room temperature, indicating that the aptamer protected the protein by remaining bound to it under stress conditions and did not allow either the protein to unfold or to promote protein-protein interaction. Thus, we show that by changing the stabilization strategy from a solvent-centric to a protein-centric approach, the same molecule can be employed as a stabilizer against more than one stress condition and thus probably reduce the cost of the product during its formulation.

  8. Sequence and expression of ferredoxin mRNA in barley

    SciTech Connect

    Zielinski, R.; Funder, P.M.; Ling, V. )

    1990-05-01

    We have isolated and structurally characterized a full-length cDNA clone encoding ferredoxin from a {lambda}gt10 cDNA library prepared from barley leaf mRNA. The ferredoxin clone (pBFD-1) was fused head-to-head with a partial-length cDNA clone encoding calmodulin, and was fortuitously isolated by screening the library with a calmodulin-specific oligonucleotide probe. The mRNA sequence from which pBFD-1 was derived is expressed exclusively in the leaf tissues of 7-d old barley seedlings. Barley pre-ferredoxin has a predicted size of 15.3 kDal, of which 4.6 kDal are accounted for by the transit peptide. The polypeptide encoded by pBFD-1 is identical to wheat ferredoxin, and shares slightly more amino acid sequence similarity with spinach ferredoxin I than with ferredoxin II. Ferredoxin mRNA levels are rapidly increased 10-fold by white light in etiolated barley leaves.

  9. Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood

    PubMed Central

    2010-01-01

    Background MicroRNAs are a class of small non-coding RNAs that regulate mRNA expression at the post - transcriptional level and thereby many fundamental biological processes. A number of methods, such as multiplex polymerase chain reaction, microarrays have been developed for profiling levels of known miRNAs. These methods lack the ability to identify novel miRNAs and accurately determine expression at a range of concentrations. Deep or massively parallel sequencing methods are providing suitable platforms for genome wide transcriptome analysis and have the ability to identify novel transcripts. Results The results of analysis of small RNA sequences obtained by Solexa technology of normal peripheral blood mononuclear cells, tumor cell lines K562 and HL60 are presented. In general K562 cells displayed overall low level of miRNA population and also low levels of DICER. Some of the highly expressed miRNAs in the leukocytes include several members of the let-7 family, miR-21, 103, 185, 191 and 320a. Comparison of the miRNA profiles of normal versus K562 or HL60 cells revealed a specific set of differentially expressed molecules. Correlation of the miRNA with that of mRNA expression profiles, obtained by microarray, revealed a set of target genes showing inverse correlation with miRNA levels. Relative expression levels of individual miRNAs belonging to a cluster were found to be highly variable. Our computational pipeline also predicted a number of novel miRNAs. Some of the predictions were validated by Real-time RT-PCR and or RNase protection assay. Organization of some of the novel miRNAs in human genome suggests that these may also be part of existing clusters or form new clusters. Conclusions We conclude that about 904 miRNAs are expressed in human leukocytes. Out of these 370 are novel miRNAs. We have identified miRNAs that are differentially regulated in normal PBMC with respect to cancer cells, K562 and HL60. Our results suggest that post - transcriptional

  10. Importance of rigorous in vitro evaluation of prospective cell binding aptamers.

    PubMed

    Avci-Adali, Meltem; Mludek, Katherina; Perle, Nadja; Stoll, Heidi; Schlensak, Christian; Wendel, Hans P

    2014-08-01

    Hitherto, several aptamers have been selected against cell surface molecules. The use of these aptamers for in vivo applications requires the prior in-depth in vitro evaluation of cell specific binding. Here, we demonstrate the in vitro tests, which are imperatively necessary to evaluate aptamers prior to in vivo applications. Exemplarily, the target binding of a chemically synthesized model aptamer containing phosphorothioate linkages was tested after the induction of the target protein expression on the cell surface by using flow cytometry. Furthermore, different cell types were used to compare the binding of the aptamer. Different single stranded DNA oligonucleotides were selected as negative controls to evaluate sequence specific binding of the aptamer to the cells. In further experiments, the aptamer binding to the target cells was determined in a mixture containing human plasma and peripheral blood cells to simulate the binding of the aptamer to target cells in human whole blood. In this study, we demonstrated the compelling necessity of the in vitro binding tests with the selected aptamers using target and non-target cells, the use of appropriate nonsense aptamers to validate the sequence specific binding of aptamers, and the evaluation of target binding in human plasma containing blood proteins and cells. Thus, we recommend the use of described methods to validate the target specific binding of newly selected aptamers prior to in vivo applications.

  11. Adenylylation of small RNA sequencing adapters using the TS2126 RNA ligase I.

    PubMed

    Lama, Lodoe; Ryan, Kevin

    2016-01-01

    Many high-throughput small RNA next-generation sequencing protocols use 5' preadenylylated DNA oligonucleotide adapters during cDNA library preparation. Preadenylylation of the DNA adapter's 5' end frees from ATP-dependence the ligation of the adapter to RNA collections, thereby avoiding ATP-dependent side reactions. However, preadenylylation of the DNA adapters can be costly and difficult. The currently available method for chemical adenylylation of DNA adapters is inefficient and uses techniques not typically practiced in laboratories profiling cellular RNA expression. An alternative enzymatic method using a commercial RNA ligase was recently introduced, but this enzyme works best as a stoichiometric adenylylating reagent rather than a catalyst and can therefore prove costly when several variant adapters are needed or during scale-up or high-throughput adenylylation procedures. Here, we describe a simple, scalable, and highly efficient method for the 5' adenylylation of DNA oligonucleotides using the thermostable RNA ligase 1 from bacteriophage TS2126. Adapters with 3' blocking groups are adenylylated at >95% yield at catalytic enzyme-to-adapter ratios and need not be gel purified before ligation to RNA acceptors. Experimental conditions are also reported that enable DNA adapters with free 3' ends to be 5' adenylylated at >90% efficiency. PMID:26567315

  12. Adenylylation of small RNA sequencing adapters using the TS2126 RNA ligase I.

    PubMed

    Lama, Lodoe; Ryan, Kevin

    2016-01-01

    Many high-throughput small RNA next-generation sequencing protocols use 5' preadenylylated DNA oligonucleotide adapters during cDNA library preparation. Preadenylylation of the DNA adapter's 5' end frees from ATP-dependence the ligation of the adapter to RNA collections, thereby avoiding ATP-dependent side reactions. However, preadenylylation of the DNA adapters can be costly and difficult. The currently available method for chemical adenylylation of DNA adapters is inefficient and uses techniques not typically practiced in laboratories profiling cellular RNA expression. An alternative enzymatic method using a commercial RNA ligase was recently introduced, but this enzyme works best as a stoichiometric adenylylating reagent rather than a catalyst and can therefore prove costly when several variant adapters are needed or during scale-up or high-throughput adenylylation procedures. Here, we describe a simple, scalable, and highly efficient method for the 5' adenylylation of DNA oligonucleotides using the thermostable RNA ligase 1 from bacteriophage TS2126. Adapters with 3' blocking groups are adenylylated at >95% yield at catalytic enzyme-to-adapter ratios and need not be gel purified before ligation to RNA acceptors. Experimental conditions are also reported that enable DNA adapters with free 3' ends to be 5' adenylylated at >90% efficiency.

  13. Avian retroviral RNA encapsidation: reexamination of functional 5' RNA sequences and the role of nucleocapsid Cys-His motifs.

    PubMed Central

    Aronoff, R; Hajjar, A M; Linial, M L

    1993-01-01

    RNA packaging signals (psi) from the 5' ends of murine and avian retroviral genomes have previously been shown to direct encapsidation of heterologous mRNA into the retroviral virion. The avian 5' packaging region has now been further characterized, and we have defined a 270-nucleotide sequence, A psi, which is sufficient to direct packaging of heterologous RNA. Identification of the A psi sequence suggests that several retroviral cis-acting sequences contained in psi+ (the primer binding site, the putative dimer linkage sequence, and the splice donor site) are dispensable for specific RNA encapsidation. Subgenomic env mRNA is not efficiently encapsidated into particles, even though the A psi sequence is present in this RNA. In contrast, spliced heterologous psi-containing RNA is packaged into virions as efficiently as unspliced species; thus splicing per se is not responsible for the failure of env mRNA to be encapsidated. We also found that an avian retroviral mutant deleted for both nucleocapsid Cys-His boxes retains the capacity to encapsidate RNA containing psi sequences, although this RNA is unstable and is thus difficult to detect in mature particles. Electron microscopy reveals that virions produced by this mutant lack a condensed core, which may allow the RNA to be accessible to nucleases. Images PMID:8380070

  14. Analysis on the preference for sequence matching between mRNA sequences and the corresponding introns in ribosomal protein genes.

    PubMed

    Zhang, Qiang; Li, Hong; Zhao, Xiaoqing; Zheng, Yan; Meng, Hu; Jia, Yun; Xue, Hui; Bo, Sulin

    2016-03-01

    Introns after splicing still play an important role. Introns can accomplish gene expression and regulation by interaction with corresponding mRNA sequences. Based on the Smith-Waterman method, local comparing makes us get the optimal matched segments between intron sequences and mRNA sequences. Analyzing the distribution regulation of the optimal matching region on mRNA sequences of ribosomal protein genes about 27 species, we find a strong interaction between UTR region sequences and introns. There are a lot of the optimal matching regions and low matching ones, and the latter are supposed to be the combined regions of protein complexes. The optimal matching frequency distributions have obvious differences nearby the mRNA functional sites such as translation initiation and termination sites, exon-exon joints and EJC regions. This conclusion shows that intron sequences and mature mRNA sequences are co-evolved and interactive to play their functions. PMID:26707402

  15. Legume genomics: understanding biology through DNA and RNA sequencing

    PubMed Central

    O'Rourke, Jamie A.; Bolon, Yung-Tsi; Bucciarelli, Bruna; Vance, Carroll P.

    2014-01-01

    Background The legume family (Leguminosae) consists of approx. 17 000 species. A few of these species, including, but not limited to, Phaseolus vulgaris, Cicer arietinum and Cajanus cajan, are important dietary components, providing protein for approx. 300 million people worldwide. Additional species, including soybean (Glycine max) and alfalfa (Medicago sativa), are important crops utilized mainly in animal feed. In addition, legumes are important contributors to biological nitrogen, forming symbiotic relationships with rhizobia to fix atmospheric N2 and providing up to 30 % of available nitrogen for the next season of crops. The application of high-throughput genomic technologies including genome sequencing projects, genome re-sequencing (DNA-seq) and transcriptome sequencing (RNA-seq) by the legume research community has provided major insights into genome evolution, genomic architecture and domestication. Scope and Conclusions This review presents an overview of the current state of legume genomics and explores the role that next-generation sequencing technologies play in advancing legume genomics. The adoption of next-generation sequencing and implementation of associated bioinformatic tools has allowed researchers to turn each species of interest into their own model organism. To illustrate the power of next-generation sequencing, an in-depth overview of the transcriptomes of both soybean and white lupin (Lupinus albus) is provided. The soybean transcriptome focuses on analysing seed development in two near-isogenic lines, examining the role of transporters, oil biosynthesis and nitrogen utilization. The white lupin transcriptome analysis examines how phosphate deficiency alters gene expression patterns, inducing the formation of cluster roots. Such studies illustrate the power of next-generation sequencing and bioinformatic analyses in elucidating the gene networks underlying biological processes. PMID:24769535

  16. Assessing long-distance RNA sequence connectivity via RNA-templated DNA–DNA ligation

    PubMed Central

    Roy, Christian K; Olson, Sara; Graveley, Brenton R; Zamore, Phillip D; Moore, Melissa J

    2015-01-01

    Many RNAs, including pre-mRNAs and long non-coding RNAs, can be thousands of nucleotides long and undergo complex post-transcriptional processing. Multiple sites of alternative splicing within a single gene exponentially increase the number of possible spliced isoforms, with most human genes currently estimated to express at least ten. To understand the mechanisms underlying these complex isoform expression patterns, methods are needed that faithfully maintain long-range exon connectivity information in individual RNA molecules. In this study, we describe SeqZip, a methodology that uses RNA-templated DNA–DNA ligation to retain and compress connectivity between distant sequences within single RNA molecules. Using this assay, we test proposed coordination between distant sites of alternative exon utilization in mouse Fn1, and we characterize the extraordinary exon diversity of Drosophila melanogaster Dscam1. DOI: http://dx.doi.org/10.7554/eLife.03700.001 PMID:25866926

  17. Rapid ribosomal RNA sequencing and the phylogenetic analysis of protists.

    PubMed

    Johnson, A M; Baverstock, P R

    1989-04-01

    A newly described technique for rapidly obtaining the partial nucleotide sequence of ribosomal RNA is being applied to investigate phylogenetic relationships among living organisms. Alan Johnson and Peter Boverstock describe the importance of this method to parasitology in providing new information on the phylogenetic relationships of parasitic organisms previously placed in groups of convenience. The phylum Apicomplexo in particular, has been the object of much study using this technique, but the technology is likely to extend soon to the restructuring of the phylogenetic trees of many groups of parasites.

  18. Preliminary Development of a DNA Aptamer-Magnetic Bead Capture Electrochemiluminescence Sandwich Assay for Brain Natriuretic Peptide

    PubMed Central

    Bruno, John G.; Richarte, Alicia M.; Phillips, Taylor

    2014-01-01

    Fifty-two candidate DNA aptamer sequences were selected for binding to the cardiovascular biomarker B-type or brain natriuretic peptide (BNP). Candidate aptamers were screened to rank their relative affinities against BNP by an aptamer-based ELISA-like aptamer microplate assay (ELASA). The highest affinity aptamers from ELASA screening were also paired in all possible combinations and screened for electrochemiluminescence (ECL) assay potential in capture aptamer-magnetic bead and ruthenium trisbipyridine (Ru(bpy)32+)-reporter aptamer sandwich formats. The top ECL sandwich combinations utilized the same aptamer pair in either capture or reporting roles with nanogram to low picogram per mL levels of detection even in 50% human serum. ECL assay sensitivity and linearity even in 50% human serum suggest that the aptamer-based assay is at least comparable to other reported immunoassays for BNP. PMID:24764602

  19. Small RNA sequencing identifies miRNA roles in ovule and fibre development.

    PubMed

    Xie, Fuliang; Jones, Don C; Wang, Qinglian; Sun, Runrun; Zhang, Baohong

    2015-04-01

    MicroRNAs (miRNAs) have been found to be differentially expressed during cotton fibre development. However, which specific miRNAs and how they are involved in fibre development is unclear. Here, using deep sequencing, 65 conserved miRNA families were identified and 32 families were differentially expressed between leaf and ovule. At least 40 miRNAs were either leaf or ovule specific, whereas 62 miRNAs were shared in both leaf and ovule. qRT-PCR confirmed these miRNAs were differentially expressed during fibre early development. A total of 820 genes were potentially targeted by the identified miRNAs, whose functions are involved in a series of biological processes including fibre development, metabolism and signal transduction. Many predicted miRNA-target pairs were subsequently validated by degradome sequencing analysis. GO and KEGG analyses showed that the identified miRNAs and their targets were classified to 1027 GO terms including 568 biological processes, 324 molecular functions and 135 cellular components and were enriched to 78 KEGG pathways. At least seven unique miRNAs participate in trichome regulatory interaction network. Eleven trans-acting siRNA (tasiRNA) candidate genes were also identified in cotton. One has never been found in other plant species and two of them were derived from MYB and ARF, both of which play important roles in cotton fibre development. Sixteen genes were predicted to be tasiRNA targets, including sucrose synthase and MYB2. Together, this study discovered new miRNAs in cotton and offered evidences that miRNAs play important roles in cotton ovule/fibre development. The identification of tasiRNA genes and their targets broadens our understanding of the complicated regulatory mechanism of miRNAs in cotton.

  20. Long Non-Coding RNA and Alternative Splicing Modulations in Parkinson's Leukocytes Identified by RNA Sequencing

    PubMed Central

    Soreq, Lilach; Guffanti, Alessandro; Salomonis, Nathan; Simchovitz, Alon; Israel, Zvi; Bergman, Hagai; Soreq, Hermona

    2014-01-01

    The continuously prolonged human lifespan is accompanied by increase in neurodegenerative diseases incidence, calling for the development of inexpensive blood-based diagnostics. Analyzing blood cell transcripts by RNA-Seq is a robust means to identify novel biomarkers that rapidly becomes a commonplace. However, there is lack of tools to discover novel exons, junctions and splicing events and to precisely and sensitively assess differential splicing through RNA-Seq data analysis and across RNA-Seq platforms. Here, we present a new and comprehensive computational workflow for whole-transcriptome RNA-Seq analysis, using an updated version of the software AltAnalyze, to identify both known and novel high-confidence alternative splicing events, and to integrate them with both protein-domains and microRNA binding annotations. We applied the novel workflow on RNA-Seq data from Parkinson's disease (PD) patients' leukocytes pre- and post- Deep Brain Stimulation (DBS) treatment and compared to healthy controls. Disease-mediated changes included decreased usage of alternative promoters and N-termini, 5′-end variations and mutually-exclusive exons. The PD regulated FUS and HNRNP A/B included prion-like domains regulated regions. We also present here a workflow to identify and analyze long non-coding RNAs (lncRNAs) via RNA-Seq data. We identified reduced lncRNA expression and selective PD-induced changes in 13 of over 6,000 detected leukocyte lncRNAs, four of which were inversely altered post-DBS. These included the U1 spliceosomal lncRNA and RP11-462G22.1, each entailing sequence complementarity to numerous microRNAs. Analysis of RNA-Seq from PD and unaffected controls brains revealed over 7,000 brain-expressed lncRNAs, of which 3,495 were co-expressed in the leukocytes including U1, which showed both leukocyte and brain increases. Furthermore, qRT-PCR validations confirmed these co-increases in PD leukocytes and two brain regions, the amygdala and substantia

  1. Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity

    SciTech Connect

    Wang, Deng-Liang; Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan; Yang, Hai-Tao; Wang, Jiang-Jie; Yao, Pei-Sen; Pan, Ru-Jun; Yang, Chaoyong James; Kang, De-Zhi

    2014-10-31

    Highlights: • This is the first report of DNA aptamer against EGFR in vitro. • Aptamer can bind targets with high affinity and selectivity. • DNA aptamers are more stable, cheap and efficient than RNA aptamers. • Our selected DNA aptamer against EGFR has high affinity with K{sub d} 56 ± 7.3 nM. • Our selected DNA aptamer against EGFR has high selectivity. - Abstract: Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher’s attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with K{sub d} 56 ± 7.3 nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy.

  2. A colorimetric detection method of pesticide acetamiprid by fine-tuning aptamer length.

    PubMed

    Tian, Yu; Wang, Yuan; Sheng, Zhi; Li, Tingting; Li, Xu

    2016-11-15

    This work investigates the effect of shortening aptamer sequences on the colorimetric detection of acetamiprid using aptamer-wrapped gold nanoparticles (AuNPs). Truncated 37-mer and 25-mer aptamers were generated by deleting excess flanking nucleotides from parental 49-mer acetamiprid-target aptamer. In comparing the responses of the three sequences, truncated aptamers did not improve the ability to discriminate against other tested pesticides. However, comparison between 49-mer and other shorter aptamers showed that shortening aptamer sequences through removing excess flanking nucleotides outsides of binding region improved colorimetric sensitivity for acetamiprid by 3.3 fold. Due to excess bases, the target-bound aptamer might still adhere to AuNPs, resulting in incomplete dissociation of aptamer from AuNPs and therefore the suppression of aggregation responses. This work provides further insight to the effects of aptamer structure on detection of the target, as well as a method by fine-tuning aptamer length for rapid detection of pesticide residues in environments or food.

  3. A colorimetric detection method of pesticide acetamiprid by fine-tuning aptamer length.

    PubMed

    Tian, Yu; Wang, Yuan; Sheng, Zhi; Li, Tingting; Li, Xu

    2016-11-15

    This work investigates the effect of shortening aptamer sequences on the colorimetric detection of acetamiprid using aptamer-wrapped gold nanoparticles (AuNPs). Truncated 37-mer and 25-mer aptamers were generated by deleting excess flanking nucleotides from parental 49-mer acetamiprid-target aptamer. In comparing the responses of the three sequences, truncated aptamers did not improve the ability to discriminate against other tested pesticides. However, comparison between 49-mer and other shorter aptamers showed that shortening aptamer sequences through removing excess flanking nucleotides outsides of binding region improved colorimetric sensitivity for acetamiprid by 3.3 fold. Due to excess bases, the target-bound aptamer might still adhere to AuNPs, resulting in incomplete dissociation of aptamer from AuNPs and therefore the suppression of aggregation responses. This work provides further insight to the effects of aptamer structure on detection of the target, as well as a method by fine-tuning aptamer length for rapid detection of pesticide residues in environments or food. PMID:27612649

  4. Use of Unamplified RNA/cDNA–Hybrid Nanopore Sequencing for Rapid Detection and Characterization of RNA Viruses

    PubMed Central

    Kilianski, Andy; Roth, Pierce A.; Liem, Alvin T.; Hill, Jessica M.; Willis, Kristen L.; Rossmaier, Rebecca D.; Marinich, Andrew V.; Maughan, Michele N.; Karavis, Mark A.; Kuhn, Jens H.; Honko, Anna N.

    2016-01-01

    Nanopore sequencing, a novel genomics technology, has potential applications for routine biosurveillance, clinical diagnosis, and outbreak investigation of virus infections. Using rapid sequencing of unamplified RNA/cDNA hybrids, we identified Venezuelan equine encephalitis virus and Ebola virus in 3 hours from sample receipt to data acquisition, demonstrating a fieldable technique for RNA virus characterization. PMID:27191483

  5. Use of Unamplified RNA/cDNA-Hybrid Nanopore Sequencing for Rapid Detection and Characterization of RNA Viruses.

    PubMed

    Kilianski, Andy; Roth, Pierce A; Liem, Alvin T; Hill, Jessica M; Willis, Kristen L; Rossmaier, Rebecca D; Marinich, Andrew V; Maughan, Michele N; Karavis, Mark A; Kuhn, Jens H; Honko, Anna N; Rosenzweig, C Nicole

    2016-08-01

    Nanopore sequencing, a novel genomics technology, has potential applications for routine biosurveillance, clinical diagnosis, and outbreak investigation of virus infections. Using rapid sequencing of unamplified RNA/cDNA hybrids, we identified Venezuelan equine encephalitis virus and Ebola virus in 3 hours from sample receipt to data acquisition, demonstrating a fieldable technique for RNA virus characterization. PMID:27191483

  6. PlantMirnaT: miRNA and mRNA integrated analysis fully utilizing characteristics of plant sequencing data.

    PubMed

    Rhee, S; Chae, H; Kim, S

    2015-07-15

    miRNA is known to regulate up to several hundreds coding genes, thus the integrated analysis of miRNA and mRNA expression data is an important problem. Unfortunately, the integrated analysis is challenging since it needs to consider expression data of two different types, miRNA and mRNA, and target relationship between miRNA and mRNA is not clear, especially when microarray data is used. Fortunately, due to the low sequencing cost, small RNA and RNA sequencing are routinely processed and we may be able to infer regulation relationships between miRNAs and mRNAs more accurately by using sequencing data. However, no method is developed specifically for sequencing data. Thus we developed PlantMirnaT, a new miRNA-mRNA integrated analysis system. To fully leverage the power of sequencing data, three major features are developed and implemented in PlantMirnaT. First, we implemented a plant-specific short read mapping tool based on recent discoveries on miRNA target relationship in plant. Second, we designed and implemented an algorithm considering miRNA targets in the full intragenic region, not just 3' UTR. Lastly but most importantly, our algorithm is designed to consider quantity of miRNA expression and its distribution on target mRNAs. The new algorithm was used to characterize rice under drought condition using our proprietary data. Our algorithm successfully discovered that two miRNAs, miRNA1425-5p, miRNA 398b, that are involved in suppression of glucose pathway in a naturally drought resistant rice, Vandana. The system can be downloaded at https://sites.google.com/site/biohealthinformaticslab/resources. PMID:25863133

  7. Molecular subtyping of leiomyosarcoma with 3′ end RNA sequencing

    PubMed Central

    Guo, Xiangqian; Forgó, Erna; van de Rijn, Matt

    2015-01-01

    Leiomyosarcoma (LMS) is a malignant neoplasm with smooth muscle differentiation. Little is known about its molecular heterogeneity and no targeted therapy currently exists for LMS. We performed expression profiling on 99 cases of LMS with 3′ end RNA sequencing (3SEQ) and demonstrated the existence of 3 molecular subtypes in this cohort. We consequently showed that these molecular subtypes are reproducible using an independent cohort of 82 LMS cases from TCGA. Two new formalin-fixed, paraffin-embedded (FFPE) tissue-compatible diagnostic immunohistochemical markers were identified for two of the three subtypes: LMOD1 for subtype I LMS and ARL4C for subtype II LMS. Subtype I LMS and subtype II LMS were associated with good and poor prognosis, respectively. Here, we describe the details of LMS diagnosis, RNA isolation, 3SEQ library construction, 3SEQ sequencing data analysis and molecular subtype determination. The 3SEQ data produced in this study was deposited into Gene Expression Omnibus (GEO) under GSE45510. PMID:26240788

  8. Nascent RNA sequencing reveals distinct features in plant transcription

    PubMed Central

    Hetzel, Jonathan; Duttke, Sascha H.; Benner, Christopher; Chory, Joanne

    2016-01-01

    Transcriptional regulation of gene expression is a major mechanism used by plants to confer phenotypic plasticity, and yet compared with other eukaryotes or bacteria, little is known about the design principles. We generated an extensive catalog of nascent and steady-state transcripts in Arabidopsis thaliana seedlings using global nuclear run-on sequencing (GRO-seq), 5′GRO-seq, and RNA-seq and reanalyzed published maize data to capture characteristics of plant transcription. De novo annotation of nascent transcripts accurately mapped start sites and unstable transcripts. Examining the promoters of coding and noncoding transcripts identified comparable chromatin signatures, a conserved “TGT” core promoter motif and unreported transcription factor-binding sites. Mapping of engaged RNA polymerases showed a lack of enhancer RNAs, promoter-proximal pausing, and divergent transcription in Arabidopsis seedlings and maize, which are commonly present in yeast and humans. In contrast, Arabidopsis and maize genes accumulate RNA polymerases in proximity of the polyadenylation site, a trend that coincided with longer genes and CpG hypomethylation. Lack of promoter-proximal pausing and a higher correlation of nascent and steady-state transcripts indicate Arabidopsis may regulate transcription predominantly at the level of initiation. Our findings provide insight into plant transcription and eukaryotic gene expression as a whole. PMID:27729530

  9. Aptamer-based biosensors: biomedical applications.

    PubMed

    Deisingh, A K

    2006-01-01

    This chapter considers the use of aptamer-based biosensors (generally termed 'aptasensors') in various biomedical applications. A comparison of antibodies and aptamers is made with respect to their use in the development of biosensors. A brief introduction to biosensor design and theory is provided to illustrate the principles of the field. Various transduction approaches, viz. optical, fluorescence, acoustic wave and electrochemical, are discussed. Specific biomedical applications described include RNA folding, high-throughput screening of drugs, use as receptors for measuring biological concentrations, detection of platelet-derived growth factor, protein binding and detection of HIV-1 Tat protein.

  10. Aptamers in Affinity Separations: Stationary Separation

    NASA Astrophysics Data System (ADS)

    Ravelet, Corinne; Peyrin, Eric

    The use of DNA or RNA aptamers as tools in analytical chemistry is a very promising field of research because of their capabilities to bind specifically the target molecules with an affinity similar to that of antibodies. Notably, they appear to be of great interest as target-specific ligands for the separation and capture of various analytes in affinity chromatography and related affinity-based methods such as magnetic bead technology. In this chapter, the recent developments of these aptamer-based separation/capture approaches are addressed.

  11. A method for clustering of miRNA sequences using fragmented programming.

    PubMed

    Ivashchenko, Anatoly; Pyrkova, Anna; Niyazova, Raigul

    2016-01-01

    Clustering of miRNA sequences is an important problem in molecular genetics associated cellular biology. Thousands of such sequences are known today through advancement in sophisticated molecular tools, sequencing techniques, computational resources and rule based mathematical models. Analysis of such large-scale miRNA sequences for inferring patterns towards deducing cellular function is a great challenge in modern molecular biology. Therefore, it is of interest to develop mathematical models specific for miRNA sequences. The process is to group (cluster) such miRNA sequences using well-defined known features. We describe a method for clustering of miRNA sequences using fragmented programming. Subsequently, we illustrated the utility of the model using a dendrogram (a tree diagram) for publically known A.thaliana miRNA nucleotide sequences towards the inference of observed conserved patterns. PMID:27212839

  12. A method for clustering of miRNA sequences using fragmented programming

    PubMed Central

    Ivashchenko, Anatoly; Pyrkova, Anna; Niyazova, Raigul

    2016-01-01

    Clustering of miRNA sequences is an important problem in molecular genetics associated cellular biology. Thousands of such sequences are known today through advancement in sophisticated molecular tools, sequencing techniques, computational resources and rule based mathematical models. Analysis of such large-scale miRNA sequences for inferring patterns towards deducing cellular function is a great challenge in modern molecular biology. Therefore, it is of interest to develop mathematical models specific for miRNA sequences. The process is to group (cluster) such miRNA sequences using well-defined known features. We describe a method for clustering of miRNA sequences using fragmented programming. Subsequently, we illustrated the utility of the model using a dendrogram (a tree diagram) for publically known A.thaliana miRNA nucleotide sequences towards the inference of observed conserved patterns PMID:27212839

  13. Complete nucleotide sequence of a 16S ribosomal RNA gene from Escherichia coli.

    PubMed Central

    Brosius, J; Palmer, M L; Kennedy, P J; Noller, H F

    1978-01-01

    The complete nucleotide sequence of the 16S RNA gene from the rrnB cistron of Escherichia coli has been determined by using three rapid DNA sequencing methods. Nearly all of the structure has been confirmed by two to six independent sequence determinations on both DNA strands. The length of the 16S rRNA chain inferred from the DNA sequence is 1541 nucleotides, in close agreement with previous estimates. We note discrepancies between this sequence and the most recent version of it reported from direct RNA sequencing [Ehresmann, C., Stiegler, P., Carbon, P. & Ebel, J.P. (1977) FEBS Lett. 84, 337-341]. A few of these may be explained by heterogeneity among 16S rRNA sequences from different cistrons. No nucleotide sequences were found in the 16S rRNA gene that cannot be reconciled with RNase digestion products of mature 16S rRNA. Images PMID:368799

  14. A selective adenosine sensor derived from a triplex DNA aptamer.

    PubMed

    Patel, Mayurbhai; Dutta, Avishek; Huang, Haidong

    2011-07-01

    The aim of this study is to develop a selective adenosine aptamer sensor using a rational approach. Unlike traditional RNA aptamers developed from SELEX, duplex DNA containing an abasic site can function as a general scaffold to rationally design aptamers for small aromatic molecules. We discovered that abasic site-containing triplex DNA can also function as an aptamer and provide better affinity than duplex DNA aptamers. A novel adenosine aptamer sensor was designed using such a triplex. The aptamer is modified with furano-dU in the binding site to sense the binding. The sensor bound adenosine has a dissociation constant of 400 nM, more than tenfold stronger than the adenosine aptamer developed from SELEX. The binding quenched furano-dU fluorescence by 40%. It was also demonstrated in this study that this sensor is selective for adenosine over uridine, cytidine, guanosine, ATP, and AMP. The detection limit of this sensor is about 50 nM. The sensor can be used to quantify adenosine concentrations between 50 nM and 2 μM. PMID:21547431

  15. Enhancing aptamer function and stability via in vitro selection using modified nucleic acids.

    PubMed

    Meek, Kirsten N; Rangel, Alexandra E; Heemstra, Jennifer M

    2016-08-15

    Nucleic acid aptamers have emerged as a promising alternative to antibodies for use as recognition elements in therapeutics, bioimaging, and analytical applications. A key benefit that aptamers possess relative to antibodies is their ability to be chemically synthesized. This advantage, coupled with the broad range of modified nucleotide building blocks that can be constructed using chemical synthesis, has enabled the discovery and development of modified aptamers having extraordinary affinity, specificity, and biostability. Early efforts to generate modified aptamers focused on selection of a native DNA or RNA aptamer, followed by post-selection trial-and-error testing of modifications. However, recent advances in polymerase engineering and templated nucleic acid synthesis have enabled the direct selection of aptamers having modified backbones and nucleobases. This review will discuss these technological advances and highlight the improvements in aptamer function that have been realized through in vitro selection of non-natural nucleic acids.

  16. Enhancing aptamer function and stability via in vitro selection using modified nucleic acids.

    PubMed

    Meek, Kirsten N; Rangel, Alexandra E; Heemstra, Jennifer M

    2016-08-15

    Nucleic acid aptamers have emerged as a promising alternative to antibodies for use as recognition elements in therapeutics, bioimaging, and analytical applications. A key benefit that aptamers possess relative to antibodies is their ability to be chemically synthesized. This advantage, coupled with the broad range of modified nucleotide building blocks that can be constructed using chemical synthesis, has enabled the discovery and development of modified aptamers having extraordinary affinity, specificity, and biostability. Early efforts to generate modified aptamers focused on selection of a native DNA or RNA aptamer, followed by post-selection trial-and-error testing of modifications. However, recent advances in polymerase engineering and templated nucleic acid synthesis have enabled the direct selection of aptamers having modified backbones and nucleobases. This review will discuss these technological advances and highlight the improvements in aptamer function that have been realized through in vitro selection of non-natural nucleic acids. PMID:27012179

  17. Aptamers against prion proteins and prions.

    PubMed

    Gilch, Sabine; Schätzl, Hermann M

    2009-08-01

    Prion diseases are fatal neurodegenerative and infectious disorders of humans and animals, characterized by structural transition of the host-encoded cellular prion protein (PrP(c)) into the aberrantly folded pathologic isoform PrP(Sc). RNA, DNA or peptide aptamers are classes of molecules which can be selected from complex combinatorial libraries for high affinity and specific binding to prion proteins and which might therefore be useful in diagnosis and therapy of prion diseases. Nucleic acid aptamers, which can be chemically synthesized, stabilized and immobilized, appear more suitable for diagnostic purposes, allowing use of PrP(Sc) as selection target. Peptide aptamers facilitate appropriate intracellular expression, targeting and re-routing without losing their binding properties to PrP, a requirement for potential therapeutic gene transfer experiments in vivo. Elucidation of structural properties of peptide aptamers might be used as basis for rational drug design, providing another attractive application of peptide aptamers in the search for effective anti-prion strategies.

  18. Improved definition of the mouse transcriptome via targeted RNA sequencing.

    PubMed

    Bussotti, Giovanni; Leonardi, Tommaso; Clark, Michael B; Mercer, Tim R; Crawford, Joanna; Malquori, Lorenzo; Notredame, Cedric; Dinger, Marcel E; Mattick, John S; Enright, Anton J

    2016-05-01

    Targeted RNA sequencing (CaptureSeq) uses oligonucleotide probes to capture RNAs for sequencing, providing enriched read coverage, accurate measurement of gene expression, and quantitative expression data. We applied CaptureSeq to refine transcript annotations in the current murine GRCm38 assembly. More than 23,000 regions corresponding to putative or annotated long noncoding RNAs (lncRNAs) and 154,281 known splicing junction sites were selected for targeted sequencing across five mouse tissues and three brain subregions. The results illustrate that the mouse transcriptome is considerably more complex than previously thought. We assemble more complete transcript isoforms than GENCODE, expand transcript boundaries, and connect interspersed islands of mapped reads. We describe a novel filtering pipeline that identifies previously unannotated but high-quality transcript isoforms. In this set, 911 GENCODE neighboring genes are condensed into 400 expanded gene models. Additionally, 594 GENCODE lncRNAs acquire an open reading frame (ORF) when their structure is extended with CaptureSeq. Finally, we validate our observations using current FANTOM and Mouse ENCODE resources. PMID:27197243

  19. Improved definition of the mouse transcriptome via targeted RNA sequencing.

    PubMed

    Bussotti, Giovanni; Leonardi, Tommaso; Clark, Michael B; Mercer, Tim R; Crawford, Joanna; Malquori, Lorenzo; Notredame, Cedric; Dinger, Marcel E; Mattick, John S; Enright, Anton J

    2016-05-01

    Targeted RNA sequencing (CaptureSeq) uses oligonucleotide probes to capture RNAs for sequencing, providing enriched read coverage, accurate measurement of gene expression, and quantitative expression data. We applied CaptureSeq to refine transcript annotations in the current murine GRCm38 assembly. More than 23,000 regions corresponding to putative or annotated long noncoding RNAs (lncRNAs) and 154,281 known splicing junction sites were selected for targeted sequencing across five mouse tissues and three brain subregions. The results illustrate that the mouse transcriptome is considerably more complex than previously thought. We assemble more complete transcript isoforms than GENCODE, expand transcript boundaries, and connect interspersed islands of mapped reads. We describe a novel filtering pipeline that identifies previously unannotated but high-quality transcript isoforms. In this set, 911 GENCODE neighboring genes are condensed into 400 expanded gene models. Additionally, 594 GENCODE lncRNAs acquire an open reading frame (ORF) when their structure is extended with CaptureSeq. Finally, we validate our observations using current FANTOM and Mouse ENCODE resources.

  20. A novel electrochemical detection method for aptamer biosensors.

    PubMed

    Bang, Gyeong Sook; Cho, Suhyeong; Kim, Byung-Gee

    2005-12-15

    A beacon aptamer-based biosensor for the detection of thrombin was developed using electrochemical transduction method. Gold surface was modified with a beacon aptamer covalently linked at 5'-terminus with a linker containing a primary aliphatic amine. Methylene blue (MB) was intercalated into the beacon sequence, and used as an electrochemical marker. When the beacon aptamer immobilized on gold surface encounters thrombin, the hairpin forming beacon aptamer is conformationally changed to release the intercalated MB, resulting a decrease in electrical current intensity in voltamogram. The peak signal of the MB is clearly decreased by the binding of thrombin onto the beacon aptamer. The linear range of the signal was observed between 0 and 50.8 nM of thrombin with 0.999 correlation factor. This method was able to linearly and selectively detect thrombin with a detection limit of 11 nM.

  1. Genome-wide analyses of Epstein-Barr virus reveal conserved RNA structures and a novel stable intronic sequence RNA

    PubMed Central

    2013-01-01

    Background Epstein-Barr virus (EBV) is a human herpesvirus implicated in cancer and autoimmune disorders. Little is known concerning the roles of RNA structure in this important human pathogen. This study provides the first comprehensive genome-wide survey of RNA and RNA structure in EBV. Results Novel EBV RNAs and RNA structures were identified by computational modeling and RNA-Seq analyses of EBV. Scans of the genomic sequences of four EBV strains (EBV-1, EBV-2, GD1, and GD2) and of the closely related Macacine herpesvirus 4 using the RNAz program discovered 265 regions with high probability of forming conserved RNA structures. Secondary structure models are proposed for these regions based on a combination of free energy minimization and comparative sequence analysis. The analysis of RNA-Seq data uncovered the first observation of a stable intronic sequence RNA (sisRNA) in EBV. The abundance of this sisRNA rivals that of the well-known and highly expressed EBV-encoded non-coding RNAs (EBERs). Conclusion This work identifies regions of the EBV genome likely to generate functional RNAs and RNA structures, provides structural models for these regions, and discusses potential functions suggested by the modeled structures. Enhanced understanding of the EBV transcriptome will guide future experimental analyses of the discovered RNAs and RNA structures. PMID:23937650

  2. Optimization of shRNA inhibitors by variation of the terminal loop sequence.

    PubMed

    Schopman, Nick C T; Liu, Ying Poi; Konstantinova, Pavlina; ter Brake, Olivier; Berkhout, Ben

    2010-05-01

    Gene silencing by RNA interference (RNAi) can be achieved by intracellular expression of a short hairpin RNA (shRNA) that is processed into the effective small interfering RNA (siRNA) inhibitor by the RNAi machinery. Previous studies indicate that shRNA molecules do not always reflect the activity of corresponding synthetic siRNAs that attack the same target sequence. One obvious difference between these two effector molecules is the hairpin loop of the shRNA. Most studies use the original shRNA design of the pSuper system, but no extensive study regarding optimization of the shRNA loop sequence has been performed. We tested the impact of different hairpin loop sequences, varying in size and structure, on the activity of a set of shRNAs targeting HIV-1. We were able to transform weak inhibitors into intermediate or even strong shRNA inhibitors by replacing the loop sequence. We demonstrate that the efficacy of these optimized shRNA inhibitors is improved significantly in different cell types due to increased siRNA production. These results indicate that the loop sequence is an essential part of the shRNA design. The optimized shRNA loop sequence is generally applicable for RNAi knockdown studies, and will allow us to develop a more potent gene therapy against HIV-1. PMID:20188764

  3. Aptamers: Active Targeting Ligands for Cancer Diagnosis and Therapy

    PubMed Central

    Wu, Xu; Chen, Jiao; Wu, Min; Zhao, Julia Xiaojun

    2015-01-01

    Aptamers, including DNA, RNA and peptide aptamers, are a group of promising recognition units that can specifically bind to target molecules and cells. Due to their excellent specificity and high affinity to targets, aptamers have attracted great attention in various fields in which selective recognition units are required. They have been used in biosensing, drug delivery, disease diagnosis and therapy (especially for cancer treatment). In this review, we summarized recent applications of DNA and RNA aptamers in cancer theranostics. The specific binding ability of aptamers to cancer-related markers and cancer cells ensured their high performance for early diagnosis of cancer. Meanwhile, the efficient targeting ability of aptamers to cancer cells and tissues provided a promising way to deliver imaging agents and drugs for cancer imaging and therapy. Furthermore, with the development of nanoscience and nanotechnology, the conjugation of aptamers with functional nanomaterials paved an exciting way for the fabrication of theranostic agents for different types of cancers, which might be a powerful tool for cancer treatment. PMID:25699094

  4. An aptamer beacon responsive to botulinum toxins.

    PubMed

    Bruno, John G; Richarte, Alicia M; Carrillo, Maria P; Edge, Allison

    2012-01-15

    Sixty candidate DNA aptamers were developed against botulinum neurotoxin (BoNT) type A light chain (LC) from ten rounds of selection, resulting in several identical sequences. Secondary structures of the identical aptamers were compared to structures of previously reported BoNT A DNA aptamers. A series of ten candidate loop structures were selected from this comparison as potential binding pockets and aptamer beacons. These candidate beacons were synthesized with 5'-TYE 665 and 3'-Iowa Black quencher labels for comparison of fluorescence levels as a function of BoNT A LC concentration. Only three of the ten candidates exhibited any fluorescence response to increasing levels of BoNT A LC. However, of the two most responsive candidates, one represented a subset loop of the larger more intensely fluorescent double-looped structure, designated Beacon 10. This beacon yielded a lower limit of detection of 1 ng/mL in buffer using a spectrofluorometer and a portable handheld fluorometer, but also responded substantially to BoNT A, B, E holotoxins and heavy or light chain components even in a dilute soil suspension, but not in 50% human serum. Beacon 10 did not respond strongly to a variety of other divergent peptides, suggesting that it is relatively specific to the level of botulinum toxins and is only useful for environmental testing. Beacon 10 also shared short sequence segments with other published BoNT aptamer DNA sequences, suggesting that these may be points of physical contact between the aptamers and BoNTs.

  5. Comparative RNA sequencing reveals substantial genetic variation in endangered primates

    PubMed Central

    Perry, George H.; Melsted, Páll; Marioni, John C.; Wang, Ying; Bainer, Russell; Pickrell, Joseph K.; Michelini, Katelyn; Zehr, Sarah; Yoder, Anne D.; Stephens, Matthew; Pritchard, Jonathan K.; Gilad, Yoav

    2012-01-01

    Comparative genomic studies in primates have yielded important insights into the evolutionary forces that shape genetic diversity and revealed the likely genetic basis for certain species-specific adaptations. To date, however, these studies have focused on only a small number of species. For the majority of nonhuman primates, including some of the most critically endangered, genome-level data are not yet available. In this study, we have taken the first steps toward addressing this gap by sequencing RNA from the livers of multiple individuals from each of 16 mammalian species, including humans and 11 nonhuman primates. Of the nonhuman primate species, five are lemurs and two are lorisoids, for which little or no genomic data were previously available. To analyze these data, we developed a method for de novo assembly and alignment of orthologous gene sequences across species. We assembled an average of 5721 gene sequences per species and characterized diversity and divergence of both gene sequences and gene expression levels. We identified patterns of variation that are consistent with the action of positive or directional selection, including an 18-fold enrichment of peroxisomal genes among genes whose regulation likely evolved under directional selection in the ancestral primate lineage. Importantly, we found no relationship between genetic diversity and endangered status, with the two most endangered species in our study, the black and white ruffed lemur and the Coquerel's sifaka, having the highest genetic diversity among all primates. Our observations imply that many endangered lemur populations still harbor considerable genetic variation. Timely efforts to conserve these species alongside their habitats have, therefore, strong potential to achieve long-term success. PMID:22207615

  6. The Microglial Sensome Revealed by Direct RNA Sequencing

    PubMed Central

    Hickman, Suzanne E.; Kingery, Nathan D.; Ohsumi, Toshiro; Borowsky, Mark; Wang, Li-chong; Means, Terry K.; Khoury, Joseph El

    2013-01-01

    Microglia, the principal neuroimmune sentinels of the brain, continuously sense changes in their environment and respond to invading pathogens, toxins and cellular debris. Microglia exhibit plasticity and can assume neurotoxic or neuroprotective priming states that determine their responses to danger. We used direct RNA sequencing, without amplification or cDNA synthesis, to determine the quantitative transcriptomes of microglia of healthy adult and aged mice. We validated our findings by fluorescent dual in-situ hybridization, unbiased proteomic analysis and quantitative PCR. We report here that microglia have a distinct transcriptomic signature and express a unique cluster of transcripts encoding proteins for sensing endogenous ligands and microbes that we term the “sensome”. With aging, sensome transcripts for endogenous ligand recognition are downregulated, whereas those involved in microbe recognition and host defense are upregulated. In addition, aging is associated with an overall increase in expression of microglial genes involved in neuroprotection. PMID:24162652

  7. Modulations of RNA sequences by cytokinin in pumpkin cotyledons

    SciTech Connect

    Chang, C.; Ertl, J.; Chen, C.

    1987-04-01

    Polyadenylated mRNAs from excised pumpkin cotyledons treated with or without 10/sup -4/ M benzyladenine (BA) for various time periods in suspension culture were assayed by in vitro translation in the presence of (/sup 35/S) methionine. The radioactive polypeptides were analyzed by one- and two-dimensional polyacrylamide gel electrophoresis. Specific sequences of mRNAs were enhanced, reduced, induced, or suppressed by the hormone within 60 min of the application of BA to the cotyledons. Four independent cDNA clones of cytokinin-modulated mRNAs have been selected and characterized. RNA blot hybridization using the four cDNA probes also indicates that the levels of specific mRNAs are modulated upward or downward by the hormone.

  8. Aptamers as a novel tool for diagnostics and therapy.

    PubMed

    Kadioglu, Onat; Malczyk, Anna Helena; Greten, Henry Johannes; Efferth, Thomas

    2015-04-01

    Aptamers are short single-stranded DNA or RNA oligonucleotides that are capable of binding small molecules, proteins, or nucleotides with high specificity. They show a stable conformation and high binding affinity for their target molecules. There are numerous applications for aptamers in biotechnology, molecular diagnostics and targeted therapy of diseases. Their production is cheap, and they generally display lower immunogenicity than monoclonal antibodies. In the present review, we give an introduction to the preparation of aptamers and provide examples for their use in biotechnology, diagnostics and therapy of diseases. PMID:25637166

  9. Sequence of the 16S ribosomal RNA from Halobacterium volcanii, an archaebacterium

    NASA Technical Reports Server (NTRS)

    Gupta, R.; Lanter, J. M.; Woese, C. R.

    1983-01-01

    The sequence of the 16S ribosomal RNA (rRNA) from the archaebacterium Halobacterium volcanii has been determined by DNA sequencing methods. The archaebacterial rRNA is similar to its eubacterial counterpart in secondary structure. Although it is closer in sequence to the eubacterial 16S rRNA than to the eukaryotic 16S-like rRNA, the H. volcanii sequence also shows certain points of specific similarity to its eukaryotic counterpart. Since the H. volcanii sequence is closer to both the eubacterial and the eukaryotic sequences than these two are to one another, it follows that the archaebacterial sequence resembles their common ancestral sequence more closely than does either of the other two versions.

  10. High-throughput illumina strand-specific RNA sequencing library preparation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Conventional Illumina RNA-Seq does not have the resolution to decode the complex eukaryote transcriptome due to the lack of RNA polarity information. Strand-specific RNA sequencing (ssRNA-Seq) can overcome these limitations and as such is better suited for genome annotation, de novo transcriptome as...

  11. Sequence complementarity of sonchus yellow net virus RNA with RNA isolated from the polysomes of infected tobacco.

    PubMed

    Milner, J J; Jackson, A O

    1979-08-01

    Polyribosomal RNA from tobacco infected with sonchus yellow net virus (SYNV) contained sequences which hybridized to 125I-labeled SYNV RNA and which were complementary to 80 to 100% of the viral RNA genome. The poly(A)-containing RNA from polyribosomes was complementary to over 90% of the viral genome but the polyribosomal RNA lacking poly(A) hybridized to approximately 40-60% of the genome. The kinetics of hybridization of all three fractions are best explained by the presence of a single abundance class of viral-complementary RNA. However, titration hybridization of poly(A)+ RNA to an excess of SYNV RNA suggested that viral-complementary sequences which contain poly(A) may vary in concentration over a factor of about fivefold. About 1.5 to 4.6% of the fraction containing poly(A), 0.02 to 0.06% of the fraction lacking poly(A) and 0.04 to 0.18% of the total polyribosomal RNA was complementary to viral RNA as estimated from the kinetics of hybridization. The viral complementary RNA(vcRNA) was heterogeneous in size with a modal sedimentation coefficient of 12 S and a profile in sucrose density gradients similar to the polyadenylated polyribosomal RNA.

  12. PASTA: splice junction identification from RNA-Sequencing data

    PubMed Central

    2013-01-01

    Background Next generation transcriptome sequencing (RNA-Seq) is emerging as a powerful experimental tool for the study of alternative splicing and its regulation, but requires ad-hoc analysis methods and tools. PASTA (Patterned Alignments for Splicing and Transcriptome Analysis) is a splice junction detection algorithm specifically designed for RNA-Seq data, relying on a highly accurate alignment strategy and on a combination of heuristic and statistical methods to identify exon-intron junctions with high accuracy. Results Comparisons against TopHat and other splice junction prediction software on real and simulated datasets show that PASTA exhibits high specificity and sensitivity, especially at lower coverage levels. Moreover, PASTA is highly configurable and flexible, and can therefore be applied in a wide range of analysis scenarios: it is able to handle both single-end and paired-end reads, it does not rely on the presence of canonical splicing signals, and it uses organism-specific regression models to accurately identify junctions. Conclusions PASTA is a highly efficient and sensitive tool to identify splicing junctions from RNA-Seq data. Compared to similar programs, it has the ability to identify a higher number of real splicing junctions, and provides highly annotated output files containing detailed information about their location and characteristics. Accurate junction data in turn facilitates the reconstruction of the splicing isoforms and the analysis of their expression levels, which will be performed by the remaining modules of the PASTA pipeline, still under development. Use of PASTA can therefore enable the large-scale investigation of transcription and alternative splicing. PMID:23557086

  13. Tracking Cryptosporidium parvum by sequence analysis of small double-stranded RNA.

    PubMed Central

    Xiao, L.; Limor, J.; Bern, C.; Lal, A. A.

    2001-01-01

    We sequenced a 173-nucleotide fragment of the small double-stranded viruslike RNA of Cryptosporidium parvum isolates from 23 calves and 38 humans. Sequence diversity was detected at 17 sites. Isolates from the same outbreak had identical double-stranded RNA sequences, suggesting that this technique may be useful for tracking Cryptosporidium infection sources. PMID:11266306

  14. Light-up and FRET aptamer reporters; evaluating their applications for imaging transcription in eukaryotic cells

    SciTech Connect

    Ilgu, Muslum; Ray, Judhajeet; Bendickson, Lee; Wang, Tianjiao; Geraskin, Ivan M.; Kraus, George A.; Nilsen-Hamilton, Marit

    2015-12-17

    The regulation of RNA transcription is central to cellular function. Changes in gene expression drive differentiation and cellular responses to events such as injury. RNA trafficking can also have a large impact on protein expression and its localization. Thus, the ability to image RNA transcription and trafficking in real time and in living cells is a worthwhile goal that has been difficult to achieve. The availability of “light-up” aptamers that cause an increase in fluorescence of their ligands when bound by the aptamer have shown promise for reporting on RNA production and localization in vivo. Here we have investigated two light-up aptamers (the malachite green aptamer and the Spinach aptamers) for their suitabilities as reporters of RNA expression in vivo using two eukaryotic cell types, yeast and mammalian. Our analysis focused on the aptamer ligands, their contributions to background noise, and the impact of tandem aptamer strings on signal strength and ligand affinity. Whereas the background fluorescence is very low in vitro, this is not always true for cell imaging. Our results suggest the need for caution in using light-up aptamers as reporters for imaging RNA. In particular, images should be collected and analyzed by operators blinded to the sample identities. The appropriate control condition of ligand with the cells in the absence of aptamer expression must be included in each experiment. This control condition establishes that the specific interaction of ligand with aptamer, rather than nonspecific interactions with unknown cell elements, is responsible for the observed fluorescent signals. As a result, high background signals due to nonspecific interactions of aptamer ligands with cell components can be minimized by using IMAGEtags (Intracellular Multiaptamer GEnetic tags), which signal by FRET and are promising RNA reporters for imaging transcription.

  15. Light-up and FRET aptamer reporters; evaluating their applications for imaging transcription in eukaryotic cells

    DOE PAGESBeta

    Ilgu, Muslum; Ray, Judhajeet; Bendickson, Lee; Wang, Tianjiao; Geraskin, Ivan M.; Kraus, George A.; Nilsen-Hamilton, Marit

    2015-12-17

    The regulation of RNA transcription is central to cellular function. Changes in gene expression drive differentiation and cellular responses to events such as injury. RNA trafficking can also have a large impact on protein expression and its localization. Thus, the ability to image RNA transcription and trafficking in real time and in living cells is a worthwhile goal that has been difficult to achieve. The availability of “light-up” aptamers that cause an increase in fluorescence of their ligands when bound by the aptamer have shown promise for reporting on RNA production and localization in vivo. Here we have investigated twomore » light-up aptamers (the malachite green aptamer and the Spinach aptamers) for their suitabilities as reporters of RNA expression in vivo using two eukaryotic cell types, yeast and mammalian. Our analysis focused on the aptamer ligands, their contributions to background noise, and the impact of tandem aptamer strings on signal strength and ligand affinity. Whereas the background fluorescence is very low in vitro, this is not always true for cell imaging. Our results suggest the need for caution in using light-up aptamers as reporters for imaging RNA. In particular, images should be collected and analyzed by operators blinded to the sample identities. The appropriate control condition of ligand with the cells in the absence of aptamer expression must be included in each experiment. This control condition establishes that the specific interaction of ligand with aptamer, rather than nonspecific interactions with unknown cell elements, is responsible for the observed fluorescent signals. As a result, high background signals due to nonspecific interactions of aptamer ligands with cell components can be minimized by using IMAGEtags (Intracellular Multiaptamer GEnetic tags), which signal by FRET and are promising RNA reporters for imaging transcription.« less

  16. Light-up and FRET aptamer reporters; evaluating their applications for imaging transcription in eukaryotic cells.

    PubMed

    Ilgu, Muslum; Ray, Judhajeet; Bendickson, Lee; Wang, Tianjiao; Geraskin, Ivan M; Kraus, George A; Nilsen-Hamilton, Marit

    2016-04-01

    The regulation of RNA transcription is central to cellular function. Changes in gene expression drive differentiation and cellular responses to events such as injury. RNA trafficking can also have a large impact on protein expression and its localization. Thus, the ability to image RNA transcription and trafficking in real time and in living cells is a worthwhile goal that has been difficult to achieve. The availability of "light-up" aptamers that cause an increase in fluorescence of their ligands when bound by the aptamer have shown promise for reporting on RNA production and localization in vivo. Here we have investigated two light-up aptamers (the malachite green aptamer and the Spinach aptamers) for their suitabilities as reporters of RNA expression in vivo using two eukaryotic cell types, yeast and mammalian. Our analysis focused on the aptamer ligands, their contributions to background noise, and the impact of tandem aptamer strings on signal strength and ligand affinity. Whereas the background fluorescence is very low in vitro, this is not always true for cell imaging. Our results suggest the need for caution in using light-up aptamers as reporters for imaging RNA. In particular, images should be collected and analyzed by operators blinded to the sample identities. The appropriate control condition of ligand with the cells in the absence of aptamer expression must be included in each experiment. This control condition establishes that the specific interaction of ligand with aptamer, rather than nonspecific interactions with unknown cell elements, is responsible for the observed fluorescent signals. High background signals due to nonspecific interactions of aptamer ligands with cell components can be minimized by using IMAGEtags (Intracellular Multiaptamer GEnetic tags), which signal by FRET and are promising RNA reporters for imaging transcription.

  17. Light-up and FRET aptamer reporters; evaluating their applications for imaging transcription in eukaryotic cells.

    PubMed

    Ilgu, Muslum; Ray, Judhajeet; Bendickson, Lee; Wang, Tianjiao; Geraskin, Ivan M; Kraus, George A; Nilsen-Hamilton, Marit

    2016-04-01

    The regulation of RNA transcription is central to cellular function. Changes in gene expression drive differentiation and cellular responses to events such as injury. RNA trafficking can also have a large impact on protein expression and its localization. Thus, the ability to image RNA transcription and trafficking in real time and in living cells is a worthwhile goal that has been difficult to achieve. The availability of "light-up" aptamers that cause an increase in fluorescence of their ligands when bound by the aptamer have shown promise for reporting on RNA production and localization in vivo. Here we have investigated two light-up aptamers (the malachite green aptamer and the Spinach aptamers) for their suitabilities as reporters of RNA expression in vivo using two eukaryotic cell types, yeast and mammalian. Our analysis focused on the aptamer ligands, their contributions to background noise, and the impact of tandem aptamer strings on signal strength and ligand affinity. Whereas the background fluorescence is very low in vitro, this is not always true for cell imaging. Our results suggest the need for caution in using light-up aptamers as reporters for imaging RNA. In particular, images should be collected and analyzed by operators blinded to the sample identities. The appropriate control condition of ligand with the cells in the absence of aptamer expression must be included in each experiment. This control condition establishes that the specific interaction of ligand with aptamer, rather than nonspecific interactions with unknown cell elements, is responsible for the observed fluorescent signals. High background signals due to nonspecific interactions of aptamer ligands with cell components can be minimized by using IMAGEtags (Intracellular Multiaptamer GEnetic tags), which signal by FRET and are promising RNA reporters for imaging transcription. PMID:26707205

  18. FASTR: A novel data format for concomitant representation of RNA sequence and secondary structure information.

    PubMed

    Bose, Tungadri; Dutta, Anirban; Mh, Mohammed; Gandhi, Hemang; Mande, Sharmila S

    2015-09-01

    Given the importance of RNA secondary structures in defining their biological role, it would be convenient for researchers seeking RNA data if both sequence and structural information pertaining to RNA molecules are made available together. Current nucleotide data repositories archive only RNA sequence data. Furthermore, storage formats which can frugally represent RNA sequence as well as structure data in a single file, are currently unavailable. This article proposes a novel storage format, 'FASTR', for concomitant representation of RNA sequence and structure. The storage efficiency of the proposed FASTR format has been evaluated using RNA data from various microorganisms. Results indicate that the size of FASTR formatted files (containing both RNA sequence as well as structure information) are equivalent to that of FASTA-format files, which contain only RNA sequence information. RNA secondary structure is typically represented using a combination of a string of nucleotide characters along with the corresponding dot-bracket notation indicating structural attributes. 'FASTR' - the novel storage format proposed in the present study enables a frugal representation of both RNA sequence and structural information in the form of a single string. In spite of having a relatively smaller storage footprint, the resultant 'fastr' string(s) retain all sequence as well as secondary structural information that could be stored using a dot-bracket notation. An implementation of the 'FASTR' methodology is available for download at http://metagenomics.atc.tcs.com/compression/fastr.

  19. Improved Aptamers for the Diagnosis and Potential Treatment of HER2-Positive Cancer

    PubMed Central

    Gijs, Marlies; Penner, Gregory; Blackler, Garth B.; Impens, Nathalie R.E.N.; Baatout, Sarah; Luxen, André; Aerts, An M.

    2016-01-01

    Aptamers provide a potential source of alternative targeting molecules for existing antibody diagnostics and therapeutics. In this work, we selected novel DNA aptamers targeting the HER2 receptor by an adherent whole-cell SELEX approach. Individual aptamers were identified by next generation sequencing and bioinformatics analysis. Two aptamers, HeA2_1 and HeA2_3, were shown to bind the HER2 protein with affinities in the nanomolar range. In addition, both aptamers were able to bind with high specificity to HER2-overexpressing cells and HER2-positive tumor tissue samples. Furthermore, we demonstrated that aptamer HeA2_3 is being internalized into cancer cells and has an inhibitory effect on cancer cell growth and viability. In the end, we selected novel DNA aptamers with great potential for the diagnosis and possible treatment of HER2-positive cancer. PMID:27213406

  20. Targeted RNA Sequencing Assay to Characterize Gene Expression and Genomic Alterations.

    PubMed

    Martin, Dorrelyn P; Miya, Jharna; Reeser, Julie W; Roychowdhury, Sameek

    2016-01-01

    RNA sequencing (RNAseq) is a versatile method that can be utilized to detect and characterize gene expression, mutations, gene fusions, and noncoding RNAs. Standard RNAseq requires 30 - 100 million sequencing reads and can include multiple RNA products such as mRNA and noncoding RNAs. We demonstrate how targeted RNAseq (capture) permits a focused study on selected RNA products using a desktop sequencer. RNAseq capture can characterize unannotated, low, or transiently expressed transcripts that may otherwise be missed using traditional RNAseq methods. Here we describe the extraction of RNA from cell lines, ribosomal RNA depletion, cDNA synthesis, preparation of barcoded libraries, hybridization and capture of targeted transcripts and multiplex sequencing on a desktop sequencer. We also outline the computational analysis pipeline, which includes quality control assessment, alignment, fusion detection, gene expression quantification and identification of single nucleotide variants. This assay allows for targeted transcript sequencing to characterize gene expression, gene fusions, and mutations. PMID:27585245

  1. Rationally manipulating aptamer binding affinities in a stem-loop molecular beacon.

    PubMed

    Armstrong, Rachel E; Strouse, Geoffrey F

    2014-10-15

    Single-stranded DNA sequences that are highly specific for a target ligand are called aptamers. While the incorporation of aptamer sequences into stem-loop molecular beacons has become an essential tool in optical biosensors, the design principles that determine the magnitude of binding affinity and its relationship to placement of the aptamer sequence in the stem-loop architecture are not well defined. By controlled placement of the aptamer along the loop region of the molecular beacon, it is observed that the binding affinity can be tuned over 4 orders of magnitude (1.3 nM - 203 μM) for the Huizenga and Szostak ATP DNA aptamer sequence. It is observed that the Kd is enhanced for the fully exposed sequence, with reduced binding affinity when the aptamer is part of the stem region of the beacon. Analysis of the ΔG values indicate a clear correlation between the aptamer hybridized length in the stem and its observed Kd. The use of a nanometal surface energy transfer probe method for monitoring ATP binding to the aptamer sequence allows the observation of negative cooperativity between the two ATP binding events. Maintenance of the high binding affinity of this ATP aptamer and the observation of two separate Kd's for ATP binding indicate NSET as an effective, nonmanipulative, optical method for tracking biomolecular changes.

  2. The nucleotide sequence of spinach chloroplast tryptophan transfer RNA.

    PubMed Central

    Canaday, J; Guillemaut, P; Gloeckler, R; Weil, J H

    1981-01-01

    Spinach chloroplast tRNATrp, purified by column chromatography and two-dimensional gel electrophoresis, has been sequenced using in vitro labeling techniques. The sequence is : pG-C-G-C-U-C-U-U-A-G-U-U-C-A-G-U-U-C-Gm-G-D-A-G-A-A-C-m2G-psi-G-G-G-psi-C-U-C-A-A*-A-A-C-C-C-G-A-U-G-N-C-G-U-A-G-G-T-psi-C-A-A-G-U-C-C-U-A-C-A-G-A-G-C-G-U-G -C-C-AOH. Like the E. coli suppressor tRNA psu+UGA which translates both the opal terminator codon U-G-A and the tryptophan codon U-G-G, spinach chloroplast tRNATrp has C-C-A as an anticodon and contains an A-U pair in the D-stem. Images PMID:6907845

  3. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    PubMed

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  4. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    PubMed

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  5. The structure of the yeast ribosomal RNA genes. I. The complete nucleotide sequence of the 18S ribosomal RNA gene from Saccharomyces cerevisiae.

    PubMed

    Rubtsov, P M; Musakhanov, M M; Zakharyev, V M; Krayev, A S; Skryabin, K G; Bayev, A A

    1980-12-11

    The cloned 18 S ribosomal RNA gene from Saccharomyces cerevisiae have been sequenced, using the Maxam-Gilbert procedure. From this data the complete sequence of 1789 nucleotides of the 18 S RNA was deduced. Extensive homology with many eucaryotic as well as E. coli ribosomal small subunit rRNA (S-rRNA) has been observed in the 3'-end region of the rRNA molecule. Comparison of the yeast 18 S rRNA sequences with partial sequence data, available for rRNAs of the other eucaryotes provides strong evidence that a substantial portion of the 18 S RNA sequence has been conserved in evolution.

  6. Two sequence classes of kinetoplastid 5S ribosomal RNA gene revealed among bodonid spliced leader RNA gene arrays.

    PubMed

    Santana, D M; Lukes, J; Sturm, N R; Campbell, D A

    2001-11-13

    The spliced leader RNA genes of Bodo saltans, Cryptobia helicis and Dimastigella trypaniformis were analyzed as molecular markers for additional taxa within the suborder Bodonina. The non-transcribed spacer regions were distinctive for each organism, and 5S rRNA genes were present in Bodo and Dimastigella but not in C. helicis. Two sequence classes of 5S rRNA were evident from analysis of the bodonid genes. The two classes of 5S rRNA genes were found in other Kinetoplastids independent of co-localization with the spliced leader RNA gene.

  7. Comparison of Ribosomal RNA Removal Methods for Transcriptome Sequencing Workflows in Teleost Fish.

    PubMed

    Abernathy, Jason; Overturf, Ken

    2016-01-01

    RNA sequencing (RNA-Seq) is becoming the standard for transcriptome analysis. Removal of contaminating ribosomal RNA (rRNA) is a priority in the preparation of libraries suitable for sequencing. These methods have been well documented in mammals but typically require some optimization for lower vertebrates. Three commercial kits, including Dynabeads mRNA Purification Kit, RiboMinus Eukaryote System v2, and Ribo-Zero Gold rRNA Removal Kit were examined for the ability to remove rRNAs from rainbow trout (Oncorhynchus mykiss) RNA isolations. Total RNA was isolated from liver and muscle tissue samples (n = 24) and rRNAs removed using one of the three kits. Samples were analyzed visually on the Agilent Bioanalyzer and by Illumina RNA-seq, screening for Oncorhynchus rRNAs. There were significant differences between the kits in regards to their ability to remove rRNA, ranging from 2.74% - 10.94% rRNA sequences left behind per kit on average. Using the Bioanalyzer to evaluate ribosomal contamination in rRNA-depleted samples for RNA-Seq was good for detecting samples with higher concentrations of rRNA (>5%), but not very accurate at lower levels. Although all three kits were able to remove a substantial portion of the rRNA from different fish tissues, the Ribo-Zero Gold rRNA Removal Kit eliminated significantly more contaminating ribosomal RNAs than the others.

  8. Selection of an aptamer against mouse GP2 by SELEX.

    PubMed

    Hanazato, Misaho; Nakato, Gaku; Nishikawa, Fumiko; Hase, Koji; Nishikawa, Satoshi; Ohno, Hiroshi

    2014-01-01

    Microfold (M) cells are intestinal epithelial cells specialized for sampling and transport of luminal antigens to gut-associated lymphoid tissue for initiation of both mucosal and systemic immune responses. Therefore, M-cell targeted vaccination has the potential to be a better immunization strategy. Glycoprotein 2 (GP2), an antigen uptake receptor for FimH(+) bacteria on M cells, can be a good target for this purpose. Aptamers are oligonucleotides that bind to a variety of target molecules with high specificity and affinity. Together with its low toxic feature, aptamers serves as a tool of molecular-targeted delivery. In this study, we used Systematic Evolution of Ligands by EXponential enrichment (SELEX) to isolate aptamers specific to murine GP2 (mGP2). After ten rounds of SELEX, eleven different aptamer sequences were selected. Among them, the most frequently appeared sequence (~60%) were aptamer NO. 1 (Apt1), and the second most (~7%) were aptamer NO. 5 (Apt5). In vitro binding experiment confirmed that only Apt1 and Apt5 specifically bound to mGP2 among eleven aptamers initially selected. Apt1 showed the strongest affinity with mGP2, with the Kd value of 110±2.6 nM evaluated by BIACORE. Binding assays with mutants of Apt1 suggest that, in addition to the loop structure, the nucleotide sequence, AAAUA, in the loop is important for binding to mGP2. Furthermore, this aptamer was able to bind to mGP2 expressed on the cell surface. These results suggest that this mGP2-specific aptamer could serve as a valuable tool for testing M-cell-targeted vaccine delivery in the murine model system. PMID:24334484

  9. Nucleolar localization elements in U8 snoRNA differ from sequences required for rRNA processing.

    PubMed Central

    Lange, T S; Borovjagin, A V; Gerbi, S A

    1998-01-01

    U8 small nucleolar RNA (snoRNA) is essential for metazoan ribosomal RNA (rRNA) processing in nucleoli. The sequences and structural features in Xenopus U8 snoRNA that are required for its nucleolar localization were analyzed. Fluorescein-labeled U8 snoRNA was injected into Xenopus oocyte nuclei, and fluorescence microscopy of nucleolar preparations revealed that wild-type Xenopus U8 snoRNA localized to nucleoli, regardless of the presence or nature of the 5' cap on the injected U8 snoRNA. Nucleolar localization was observed when loops or stems in the 5' portion of U8 that are critical for U8 snoRNA function in rRNA processing were mutated. Therefore, sites of interaction in U8 snoRNA that potentially tether it to pre-rRNA are not essential for nucleolar localization of U8. Boxes C and D are known to be nucleolar localization elements (NoLEs) for U8 snoRNA and other snoRNAs of the Box C/D family. However, the spatial relationship of Box C to Box D was not crucial for U8 nucleolar localization, as demonstrated here by deletion of sequences in the two stems that separate them. These U8 mutants can localize to nucleoli and function in rRNA processing as well. The single-stranded Cup region in U8, adjacent to evolutionarily conserved Box C, functions as a NoLE in addition to Boxes C and D. Cup is unique to U8 snoRNA and may help bind putative protein(s) needed for nucleolar localization. Alternatively, Cup may help to retain U8 snoRNA within the nucleolus. PMID:9671052

  10. A modified RNA-Seq approach for whole genome sequencing of RNA viruses from faecal and blood samples.

    PubMed

    Batty, Elizabeth M; Wong, T H Nicholas; Trebes, Amy; Argoud, Karène; Attar, Moustafa; Buck, David; Ip, Camilla L C; Golubchik, Tanya; Cule, Madeleine; Bowden, Rory; Manganis, Charis; Klenerman, Paul; Barnes, Eleanor; Walker, A Sarah; Wyllie, David H; Wilson, Daniel J; Dingle, Kate E; Peto, Tim E A; Crook, Derrick W; Piazza, Paolo

    2013-01-01

    To date, very large scale sequencing of many clinically important RNA viruses has been complicated by their high population molecular variation, which creates challenges for polymerase chain reaction and sequencing primer design. Many RNA viruses are also difficult or currently not possible to culture, severely limiting the amount and purity of available starting material. Here, we describe a simple, novel, high-throughput approach to Norovirus and Hepatitis C virus whole genome sequence determination based on RNA shotgun sequencing (also known as RNA-Seq). We demonstrate the effectiveness of this method by sequencing three Norovirus samples from faeces and two Hepatitis C virus samples from blood, on an Illumina MiSeq benchtop sequencer. More than 97% of reference genomes were recovered. Compared with Sanger sequencing, our method had no nucleotide differences in 14,019 nucleotides (nt) for Noroviruses (from a total of 2 Norovirus genomes obtained with Sanger sequencing), and 8 variants in 9,542 nt for Hepatitis C virus (1 variant per 1,193 nt). The three Norovirus samples had 2, 3, and 2 distinct positions called as heterozygous, while the two Hepatitis C virus samples had 117 and 131 positions called as heterozygous. To confirm that our sample and library preparation could be scaled to true high-throughput, we prepared and sequenced an additional 77 Norovirus samples in a single batch on an Illumina HiSeq 2000 sequencer, recovering >90% of the reference genome in all but one sample. No discrepancies were observed across 118,757 nt compared between Sanger and our custom RNA-Seq method in 16 samples. By generating viral genomic sequences that are not biased by primer-specific amplification or enrichment, this method offers the prospect of large-scale, affordable studies of RNA viruses which could be adapted to routine diagnostic laboratory workflows in the near future, with the potential to directly characterize within-host viral diversity.

  11. Selection of 2′-deoxy-2′-fluoroarabinonucleotide (FANA) aptamers that bind HIV-1 reverse transcriptase with picomolar affinity

    PubMed Central

    Alves Ferreira-Bravo, Irani; Cozens, Christopher; Holliger, Philipp; DeStefano, Jeffrey J.

    2015-01-01

    Using a Systematic Evolution of Ligands by Exponential Enrichment (SELEX) protocol capable of selecting xeno-nucleic acid (XNA) aptamers, a 2′-deoxy-2′-fluoroarabinonucleotide (FANA) aptamer (referred to as FA1) to HIV-1 reverse transcriptase (HIV-1 RT) was selected. FA1 bound HIV-1 RT with KD,app values in the low pM range under different ionic conditions. Comparisons to published HIV-1 RT RNA and DNA aptamers indicated that FA1 bound at least as well as these aptamers. FA1 contained a 20 nucleotide 5′ DNA sequence followed by a 57 nucleotide region of FANA nucleotides. Removal of the fourteen 5′ DNA nucleotides did not affect binding. FA1's predicted structure was composed of four stems and four loops. All stem nucleotides could be modified to G-C base pairs (14 total changes) with a small effect on binding. Eliminating or altering most loop sequences reduced or abolished tight binding. Overall, results suggested that the structure and the sequence of FA1 were important for binding. FA1 showed strong inhibition of HIV-1 RT in extension assays while no specific binding to avian myeloblastosis or Moloney murine leukemia RTs was detected. A complete DNA version of FA1 showed low binding to HIV-1 RT, emphasizing the unique properties of FANA in HIV-1 RT binding. PMID:26476448

  12. Analysis of minimal promoter sequences for plus-strand synthesis by the Cucumber necrosis virus RNA-dependent RNA polymerase.

    PubMed

    Panavas, T; Pogany, J; Nagy, P D

    2002-05-10

    Tombusviruses are small, plus-sense, single-stranded RNA viruses of plants. A partially purified RNA-dependent RNA polymerase (RdRp) preparation of Cucumber necrosis virus (CNV), which is capable of de novo initiation of complementary RNA synthesis from either plus-strand or minus-strand templates, was used to dissect minimal promoter sequences for tombusviruses and their defective interfering (DI) RNAs. In vitro RdRp assay revealed that the core plus-strand initiation promoter included only the 3'-terminal 11 nucleotides. A hypothetical promoter-like sequence, which has been termed consensus sequence by Wu and White (1998, J. Virol. 72, 9897-9905), is recognized less efficiently by the CNV RdRp than the core plus-strand initiation promoter. The CNV RdRp can efficiently recognize the core plus-strand initiation promoter for a satellite RNA associated with the distantly related Turnip crinkle virus, while artificial AU- or GC-rich 3'-terminal sequences make poor templates in the in vitro assays. Comparison of the "strength" of minimal plus-strand and minus-strand initiation promoters reveals that the latter is almost twice as efficient in promoting complementary RNA synthesis. Template competition experiments, however, suggest that the minimal plus-strand initiation promoter makes an RNA template more competitive than the minimal minus-strand initiation promoter. Taken together, these results demonstrate that promoter recognition by the tombusvirus RdRp requires only short sequences present at the 3' end of templates.

  13. Optimal terminal sequences for continuous or serial isothermal amplification of dsRNA with norovirus RNA replicase.

    PubMed

    Arai, Hidenao; Nishigaki, Koichi; Nemoto, Naoto; Suzuki, Miho; Husimi, Yuzuru

    2014-01-01

    The norovirus RNA replicase (NV3D(pol), 56 kDa, single chain monomeric protein) can amplify double-stranded (ds) RNA isothermally. It will play an alternative role in the in vitro evolution against traditional Qβ RNA replicase, which cannot amplify dsRNA and consists of four subunits, three of which are borrowed from host E.coli. In order to identify the optimal 3'-terminal sequence of the RNA template for NV3D(pol), an in vitro selection using the serial transfer was performed for a random library having the 3'-terminal sequence of ---UUUUUUNNNN-3'. The population landscape on the 4-dimensional sequence space of the 17(th) round of transfer gave a main peak around ---CAAC-3'. In the preceding studies on the batch amplification reaction starting from a single-stranded RNA, a template with 3'-terminal C-stretch was amplified effectively. It was confirmed that in the batch amplification the ---CCC-3' was much more effective than the ---CAAC-3', but in the serial transfer condition in which the ----CAAC-3' was sustained stably, the ---CCC-3' was washed out. Based on these results we proposed the existence of the "shuttle mode" replication of dsRNA. We also proposed the optimal terminal sequences of RNA for in vitro evolution with NV3D(pol). PMID:27493494

  14. Dual-colour imaging of RNAs using quencher- and fluorophore-binding aptamers.

    PubMed

    Arora, Ankita; Sunbul, Murat; Jäschke, Andres

    2015-12-01

    In order to gain deeper insight into the functions and dynamics of RNA in cells, the development of methods for imaging multiple RNAs simultaneously is of paramount importance. Here, we describe a modular approach to image RNA in living cells using an RNA aptamer that binds to dinitroaniline, an efficient general contact quencher. Dinitroaniline quenches the fluorescence of different fluorophores when directly conjugated to them via ethylene glycol linkers by forming a non-fluorescent intramolecular complex. Since the binding of the RNA aptamer to the quencher destroys the fluorophore-quencher complex, fluorescence increases dramatically upon binding. Using this principle, a series of fluorophores were turned into fluorescent turn-on probes by conjugating them to dinitroaniline. These probes ranged from fluorescein-dinitroaniline (green) to TexasRed-dinitroaniline (red) spanning across the visible spectrum. The dinitroaniline-binding aptamer (DNB) was generated by in vitro selection, and was found to bind all probes, leading to fluorescence increase in vitro and in living cells. When expressed in E. coli, the DNB aptamer could be labelled and visualized with different-coloured fluorophores and therefore it can be used as a genetically encoded tag to image target RNAs. Furthermore, combining contact-quenched fluorogenic probes with orthogonal DNB (the quencher-binding RNA aptamer) and SRB-2 aptamers (a fluorophore-binding RNA aptamer) allowed dual-colour imaging of two different fluorescence-enhancing RNA tags in living cells, opening new avenues for studying RNA co-localization and trafficking.

  15. Equally parsimonious pathways through an RNA sequence space are not equally likely

    NASA Technical Reports Server (NTRS)

    Lee, Y. H.; DSouza, L. M.; Fox, G. E.

    1997-01-01

    An experimental system for determining the potential ability of sequences resembling 5S ribosomal RNA (rRNA) to perform as functional 5S rRNAs in vivo in the Escherichia coli cellular environment was devised previously. Presumably, the only 5S rRNA sequences that would have been fixed by ancestral populations are ones that were functionally valid, and hence the actual historical paths taken through RNA sequence space during 5S rRNA evolution would have most likely utilized valid sequences. Herein, we examine the potential validity of all sequence intermediates along alternative equally parsimonious trajectories through RNA sequence space which connect two pairs of sequences that had previously been shown to behave as valid 5S rRNAs in E. coli. The first trajectory requires a total of four changes. The 14 sequence intermediates provide 24 apparently equally parsimonious paths by which the transition could occur. The second trajectory involves three changes, six intermediate sequences, and six potentially equally parsimonious paths. In total, only eight of the 20 sequence intermediates were found to be clearly invalid. As a consequence of the position of these invalid intermediates in the sequence space, seven of the 30 possible paths consisted of exclusively valid sequences. In several cases, the apparent validity/invalidity of the intermediate sequences could not be anticipated on the basis of current knowledge of the 5S rRNA structure. This suggests that the interdependencies in RNA sequence space may be more complex than currently appreciated. If ancestral sequences predicted by parsimony are to be regarded as actual historical sequences, then the present results would suggest that they should also satisfy a validity requirement and that, in at least limited cases, this conjecture can be tested experimentally.

  16. Identification and characterization of microRNA sequences from bovine mammary epithelial cells.

    PubMed

    Bu, D P; Nan, X M; Wang, F; Loor, J J; Wang, J Q

    2015-03-01

    The bovine mammary gland is composed of various cell types including bovine mammary epithelial cells (BMEC). The use of BMEC to uncover the microRNA (miRNA) profile would allow us to obtain a more specific profile of miRNA sequences that could be associated with lactation and avoid interference from other cell types. The objective of this study was to characterize the miRNA sequences expressed in isolated BMEC. The miRNA were identified by Solexa sequencing technology (Illumina Inc., San Diego, CA). Furthermore, novel miRNA were uncovered by stem-loop reverse transcription-PCR and sequencing of PCR products. To detect tissue specificity, expression of novel miRNA sequences was measured by stem-loop RT-PCR and sequencing of PCR products in mammary gland, liver, adipose, ileum, spleen and kidney tissue from 3 lactating Holstein cows (50±10 d postpartum). After bioinformatics analysis, 12,323,451 reads were obtained by Solexa sequencing, of which 11,979,706 were clean reads, matching the bovine genome. Among clean reads, 9,428,122 belonged to miRNA sequences. Further analysis revealed that the miRNA bta-mir-184 had the most abundant expression, and 388 loci possessed the typical stem-loop structures matching known miRNA hairpins. In total, 38 loci with novel hairpins were identified as novel miRNA and were numbered from bta-U1 to bta-U38. One novel miRNA (bta-U21) was specific to mammary gland. Seven novel miRNA, including bta-U21, had tissue-restricted distribution. Uncovering the specific roles of these novel miRNA during lactation appears warranted.

  17. Aptamers against pathogenic microorganisms

    PubMed Central

    Davydova, Anna; Vorobjeva, Maria; Pyshnyi, Dmitrii; Altman, Sidney; Vlassov, Valentin; Venyaminova, Alya

    2016-01-01

    Abstract An important current issue of modern molecular medicine and biotechnology is the search for new approaches to early diagnostic assays and adequate therapy of infectious diseases. One of the promising solutions to this problem might be a development of nucleic acid aptamers capable of interacting specifically with bacteria, protozoa, and viruses. Such aptamers can be used for the specific recognition of infectious agents as well as for blocking of their functions. The present review summarizes various modern SELEX techniques used in this field, and of several currently identified aptamers against viral particles and unicellular organisms, and their applications. The prospects of applying nucleic acid aptamers for the development of novel detection systems and antibacterial and antiviral drugs are discussed. PMID:26258445

  18. Identification of extracellular miRNA in human cerebrospinal fluid by next-generation sequencing.

    PubMed

    Burgos, Kasandra Lovette; Javaherian, Ashkan; Bomprezzi, Roberto; Ghaffari, Layla; Rhodes, Susan; Courtright, Amanda; Tembe, Waibhav; Kim, Seungchan; Metpally, Raghu; Van Keuren-Jensen, Kendall

    2013-05-01

    There has been a growing interest in using next-generation sequencing (NGS) to profile extracellular small RNAs from the blood and cerebrospinal fluid (CSF) of patients with neurological diseases, CNS tumors, or traumatic brain injury for biomarker discovery. Small sample volumes and samples with low RNA abundance create challenges for downstream small RNA sequencing assays. Plasma, serum, and CSF contain low amounts of total RNA, of which small RNAs make up a fraction. The purpose of this study was to maximize RNA isolation from RNA-limited samples and apply these methods to profile the miRNA in human CSF by small RNA deep sequencing. We systematically tested RNA isolation efficiency using ten commercially available kits and compared their performance on human plasma samples. We used RiboGreen to quantify total RNA yield and custom TaqMan assays to determine the efficiency of small RNA isolation for each of the kits. We significantly increased the recovery of small RNA by repeating the aqueous extraction during the phenol-chloroform purification in the top performing kits. We subsequently used the methods with the highest small RNA yield to purify RNA from CSF and serum samples from the same individual. We then prepared small RNA sequencing libraries using Illumina's TruSeq sample preparation kit and sequenced the samples on the HiSeq 2000. Not surprisingly, we found that the miRNA expression profile of CSF is substantially different from that of serum. To our knowledge, this is the first time that the small RNA fraction from CSF has been profiled using next-generation sequencing.

  19. Maternal Plasma DNA and RNA Sequencing for Prenatal Testing.

    PubMed

    Tamminga, Saskia; van Maarle, Merel; Henneman, Lidewij; Oudejans, Cees B M; Cornel, Martina C; Sistermans, Erik A

    2016-01-01

    Cell-free DNA (cfDNA) testing has recently become indispensable in diagnostic testing and screening. In the prenatal setting, this type of testing is often called noninvasive prenatal testing (NIPT). With a number of techniques, using either next-generation sequencing or single nucleotide polymorphism-based approaches, fetal cfDNA in maternal plasma can be analyzed to screen for rhesus D genotype, common chromosomal aneuploidies, and increasingly for testing other conditions, including monogenic disorders. With regard to screening for common aneuploidies, challenges arise when implementing NIPT in current prenatal settings. Depending on the method used (targeted or nontargeted), chromosomal anomalies other than trisomy 21, 18, or 13 can be detected, either of fetal or maternal origin, also referred to as unsolicited or incidental findings. For various biological reasons, there is a small chance of having either a false-positive or false-negative NIPT result, or no result, also referred to as a "no-call." Both pre- and posttest counseling for NIPT should include discussing potential discrepancies. Since NIPT remains a screening test, a positive NIPT result should be confirmed by invasive diagnostic testing (either by chorionic villus biopsy or by amniocentesis). As the scope of NIPT is widening, professional guidelines need to discuss the ethics of what to offer and how to offer. In this review, we discuss the current biochemical, clinical, and ethical challenges of cfDNA testing in the prenatal setting and its future perspectives including novel applications that target RNA instead of DNA.

  20. Maternal Plasma DNA and RNA Sequencing for Prenatal Testing.

    PubMed

    Tamminga, Saskia; van Maarle, Merel; Henneman, Lidewij; Oudejans, Cees B M; Cornel, Martina C; Sistermans, Erik A

    2016-01-01

    Cell-free DNA (cfDNA) testing has recently become indispensable in diagnostic testing and screening. In the prenatal setting, this type of testing is often called noninvasive prenatal testing (NIPT). With a number of techniques, using either next-generation sequencing or single nucleotide polymorphism-based approaches, fetal cfDNA in maternal plasma can be analyzed to screen for rhesus D genotype, common chromosomal aneuploidies, and increasingly for testing other conditions, including monogenic disorders. With regard to screening for common aneuploidies, challenges arise when implementing NIPT in current prenatal settings. Depending on the method used (targeted or nontargeted), chromosomal anomalies other than trisomy 21, 18, or 13 can be detected, either of fetal or maternal origin, also referred to as unsolicited or incidental findings. For various biological reasons, there is a small chance of having either a false-positive or false-negative NIPT result, or no result, also referred to as a "no-call." Both pre- and posttest counseling for NIPT should include discussing potential discrepancies. Since NIPT remains a screening test, a positive NIPT result should be confirmed by invasive diagnostic testing (either by chorionic villus biopsy or by amniocentesis). As the scope of NIPT is widening, professional guidelines need to discuss the ethics of what to offer and how to offer. In this review, we discuss the current biochemical, clinical, and ethical challenges of cfDNA testing in the prenatal setting and its future perspectives including novel applications that target RNA instead of DNA. PMID:27117661

  1. Aptamer-Gated Nanoparticles for Smart Drug Delivery

    PubMed Central

    Ozalp, Veli Cengiz; Eyidogan, Fusun; Oktem, Huseyin Avni

    2011-01-01

    Aptamers are functional nucleic acid sequences which can bind specific targets. An artificial combinatorial methodology can identify aptamer sequences for any target molecule, from ions to whole cells. Drug delivery systems seek to increase efficacy and reduce side-effects by concentrating the therapeutic agents at specific disease sites in the body. This is generally achieved by specific targeting of inactivated drug molecules. Aptamers which can bind to various cancer cell types selectively and with high affinity have been exploited in a variety of drug delivery systems for therapeutic purposes. Recent progress in selection of cell-specific aptamers has provided new opportunities in targeted drug delivery. Especially functionalization of nanoparticles with such aptamers has drawn major attention in the biosensor and biomedical areas. Moreover, nucleic acids are recognized as an attractive building materials in nanomachines because of their unique molecular recognition properties and structural features. A active controlled delivery of drugs once targeted to a disease site is a major research challenge. Stimuli-responsive gating is one way of achieving controlled release of nanoparticle cargoes. Recent reports incorporate the structural properties of aptamers in controlled release systems of drug delivering nanoparticles. In this review, the strategies for using functional nucleic acids in creating smart drug delivery devices will be explained. The main focus will be on aptamer-incorporated nanoparticle systems for drug delivery purposes in order to assess the future potential of aptamers in the therapeutic area. Special emphasis will be given to the very recent progress in controlled drug release based on molecular gating achieved with aptamers.

  2. Characterization of MazF-Mediated Sequence-Specific RNA Cleavage in Pseudomonas putida Using Massive Parallel Sequencing.

    PubMed

    Miyamoto, Tatsuki; Kato, Yuka; Sekiguchi, Yuji; Tsuneda, Satoshi; Noda, Naohiro

    2016-01-01

    Under environmental stress, microbes are known to alter their translation patterns using sequence-specific endoribonucleases that we call RNA interferases. However, there has been limited insight regarding which RNAs are specifically cleaved by these RNA interferases, hence their physiological functions remain unknown. In the current study, we developed a novel method to effectively identify cleavage specificities with massive parallel sequencing. This approach uses artificially designed RNAs composed of diverse sequences, which do not form extensive secondary structures, and it correctly identified the cleavage sequence of a well-characterized Escherichia coli RNA interferase, MazF, as ACA. In addition, we also determined that an uncharacterized MazF homologue isolated from Pseudomonas putida specifically recognizes the unique triplet, UAC. Using a real-time fluorescence resonance energy transfer assay, the UAC triplet was further proved to be essential for cleavage in P. putida MazF. These results highlight an effective method to determine cleavage specificity of RNA interferases.

  3. Distinct tmRNA sequence elements facilitate RNase R engagement on rescued ribosomes for selective nonstop mRNA decay.

    PubMed

    Venkataraman, Krithika; Zafar, Hina; Karzai, A Wali

    2014-01-01

    trans-Translation, orchestrated by SmpB and tmRNA, is the principal eubacterial pathway for resolving stalled translation complexes. RNase R, the leading nonstop mRNA surveillance factor, is recruited to stalled ribosomes in a trans-translation dependent process. To elucidate the contributions of SmpB and tmRNA to RNase R recruitment, we evaluated Escherichia coli-Francisella tularensis chimeric variants of tmRNA and SmpB. This evaluation showed that while the hybrid tmRNA supported nascent polypeptide tagging and ribosome rescue, it suffered defects in facilitating RNase R recruitment to stalled ribosomes. To gain further insights, we used established tmRNA and SmpB variants that impact distinct stages of the trans-translation process. Analysis of select tmRNA variants revealed that the sequence composition and positioning of the ultimate and penultimate codons of the tmRNA ORF play a crucial role in recruiting RNase R to rescued ribosomes. Evaluation of defined SmpB C-terminal tail variants highlighted the importance of establishing the tmRNA reading frame, and provided valuable clues into the timing of RNase R recruitment to rescued ribosomes. Taken together, these studies demonstrate that productive RNase R-ribosomes engagement requires active trans-translation, and suggest that RNase R captures the emerging nonstop mRNA at an early stage after establishment of the tmRNA ORF as the surrogate mRNA template.

  4. Evaluating methods for isolating total RNA and predicting the success of sequencing phylogenetically diverse plant transcriptomes.

    PubMed

    Johnson, Marc T J; Carpenter, Eric J; Tian, Zhijian; Bruskiewich, Richard; Burris, Jason N; Carrigan, Charlotte T; Chase, Mark W; Clarke, Neil D; Covshoff, Sarah; Depamphilis, Claude W; Edger, Patrick P; Goh, Falicia; Graham, Sean; Greiner, Stephan; Hibberd, Julian M; Jordon-Thaden, Ingrid; Kutchan, Toni M; Leebens-Mack, James; Melkonian, Michael; Miles, Nicholas; Myburg, Henrietta; Patterson, Jordan; Pires, J Chris; Ralph, Paula; Rolf, Megan; Sage, Rowan F; Soltis, Douglas; Soltis, Pamela; Stevenson, Dennis; Stewart, C Neal; Surek, Barbara; Thomsen, Christina J M; Villarreal, Juan Carlos; Wu, Xiaolei; Zhang, Yong; Deyholos, Michael K; Wong, Gane Ka-Shu

    2012-01-01

    Next-generation sequencing plays a central role in the characterization and quantification of transcriptomes. Although numerous metrics are purported to quantify the quality of RNA, there have been no large-scale empirical evaluations of the major determinants of sequencing success. We used a combination of existing and newly developed methods to isolate total RNA from 1115 samples from 695 plant species in 324 families, which represents >900 million years of phylogenetic diversity from green algae through flowering plants, including many plants of economic importance. We then sequenced 629 of these samples on Illumina GAIIx and HiSeq platforms and performed a large comparative analysis to identify predictors of RNA quality and the diversity of putative genes (scaffolds) expressed within samples. Tissue types (e.g., leaf vs. flower) varied in RNA quality, sequencing depth and the number of scaffolds. Tissue age also influenced RNA quality but not the number of scaffolds ≥ 1000 bp. Overall, 36% of the variation in the number of scaffolds was explained by metrics of RNA integrity (RIN score), RNA purity (OD 260/230), sequencing platform (GAIIx vs HiSeq) and the amount of total RNA used for sequencing. However, our results show that the most commonly used measures of RNA quality (e.g., RIN) are weak predictors of the number of scaffolds because Illumina sequencing is robust to variation in RNA quality. These results provide novel insight into the methods that are most important in isolating high quality RNA for sequencing and assembling plant transcriptomes. The methods and recommendations provided here could increase the efficiency and decrease the cost of RNA sequencing for individual labs and genome centers.

  5. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.

    PubMed

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  6. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules

    PubMed Central

    McDonald, James E.; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J.; Hall, Neil; McCarthy, Alan J.; Allison, Heather E.

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, ‘universal’ SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by ‘universal’ primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  7. Post-ExSELEX stabilization of an unnatural-base DNA aptamer targeting VEGF165 toward pharmaceutical applications

    PubMed Central

    Kimoto, Michiko; Nakamura, Mana; Hirao, Ichiro

    2016-01-01

    A new technology, genetic alphabet expansion using artificial bases (unnatural bases), has created high-affinity DNA ligands (aptamers) that specifically bind to target proteins by ExSELEX (genetic alphabet Expansion for Systematic Evolution of Ligands by EXponential enrichment). We recently found that the unnatural-base DNA aptamers can be stabilized against nucleases, by introducing an extraordinarily stable, unique hairpin DNA (mini-hairpin DNA) and by reinforcing the stem region with G–C pairs. Here, to establish this aptamer generation method, we examined the stabilization of a high-affinity anti-VEGF165 unnatural-base DNA aptamer. The stabilized aptamers displayed significantly increased thermal and nuclease stabilities, and furthermore, exhibited higher affinity to the target. As compared to the well-known anti-VEGF165 RNA aptamer, pegaptanib (Macugen), our aptamers did not require calcium ions for binding to VEGF165. Biological experiments using cultured cells revealed that our stabilized aptamers efficiently inhibited the interaction between VEGF165 and its receptor, with the same or slightly higher efficiency than that of the pegaptanib RNA aptamer. The development of cost-effective and calcium ion-independent high-affinity anti-VEGF165 DNA aptamers encourages further progress in diagnostic and therapeutic applications. In addition, the stabilization process provided additional information about the key elements required for aptamer binding to VEGF165. PMID:27387284

  8. Post-ExSELEX stabilization of an unnatural-base DNA aptamer targeting VEGF165 toward pharmaceutical applications.

    PubMed

    Kimoto, Michiko; Nakamura, Mana; Hirao, Ichiro

    2016-09-01

    A new technology, genetic alphabet expansion using artificial bases (unnatural bases), has created high-affinity DNA ligands (aptamers) that specifically bind to target proteins by ExSELEX (genetic alphabet Expansion for Systematic Evolution of Ligands by EXponential enrichment). We recently found that the unnatural-base DNA aptamers can be stabilized against nucleases, by introducing an extraordinarily stable, unique hairpin DNA (mini-hairpin DNA) and by reinforcing the stem region with G-C pairs. Here, to establish this aptamer generation method, we examined the stabilization of a high-affinity anti-VEGF165 unnatural-base DNA aptamer. The stabilized aptamers displayed significantly increased thermal and nuclease stabilities, and furthermore, exhibited higher affinity to the target. As compared to the well-known anti-VEGF165 RNA aptamer, pegaptanib (Macugen), our aptamers did not require calcium ions for binding to VEGF165 Biological experiments using cultured cells revealed that our stabilized aptamers efficiently inhibited the interaction between VEGF165 and its receptor, with the same or slightly higher efficiency than that of the pegaptanib RNA aptamer. The development of cost-effective and calcium ion-independent high-affinity anti-VEGF165 DNA aptamers encourages further progress in diagnostic and therapeutic applications. In addition, the stabilization process provided additional information about the key elements required for aptamer binding to VEGF165. PMID:27387284

  9. Post-ExSELEX stabilization of an unnatural-base DNA aptamer targeting VEGF165 toward pharmaceutical applications.

    PubMed

    Kimoto, Michiko; Nakamura, Mana; Hirao, Ichiro

    2016-09-01

    A new technology, genetic alphabet expansion using artificial bases (unnatural bases), has created high-affinity DNA ligands (aptamers) that specifically bind to target proteins by ExSELEX (genetic alphabet Expansion for Systematic Evolution of Ligands by EXponential enrichment). We recently found that the unnatural-base DNA aptamers can be stabilized against nucleases, by introducing an extraordinarily stable, unique hairpin DNA (mini-hairpin DNA) and by reinforcing the stem region with G-C pairs. Here, to establish this aptamer generation method, we examined the stabilization of a high-affinity anti-VEGF165 unnatural-base DNA aptamer. The stabilized aptamers displayed significantly increased thermal and nuclease stabilities, and furthermore, exhibited higher affinity to the target. As compared to the well-known anti-VEGF165 RNA aptamer, pegaptanib (Macugen), our aptamers did not require calcium ions for binding to VEGF165 Biological experiments using cultured cells revealed that our stabilized aptamers efficiently inhibited the interaction between VEGF165 and its receptor, with the same or slightly higher efficiency than that of the pegaptanib RNA aptamer. The development of cost-effective and calcium ion-independent high-affinity anti-VEGF165 DNA aptamers encourages further progress in diagnostic and therapeutic applications. In addition, the stabilization process provided additional information about the key elements required for aptamer binding to VEGF165.

  10. The genomic RNA1 and RNA2 sequences of the tobacco rattle virus isolates found in Polish potato fields.

    PubMed

    Yin, Zhimin; Pawełkowicz, Magdalena; Michalak, Krystyna; Chrzanowska, Mirosława; Zimnoch-Guzowska, Ewa

    2014-06-24

    Four tobacco rattle virus (TRV) isolates were identified from tobacco bait seedlings planted in soil samples from Polish potato fields. Sequence analysis of the genomic RNA1 of the isolates revealed significant similarity to the isolates Ho and AL recently found in Germany. Multiple sequence alignments of the genomic RNA2 indicated that the two isolates from northern Poland (Deb57 and Slu24) are in a cluster with the isolates PSG and PLB found in the Netherlands. The remaining two isolates, from central Poland (11r21 and Mlo7), are in a distinct group with the unique isolate SYM found in England. The RNA2 sequences of the studied isolates range from 1998 nt to 2739 nt in length, and all carry deletions of the 2b and/or 2c genes. The isolate Mlo7 has an atypical RNA2 structure, having its cp gene located in its central region. PMID:24637409

  11. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed

    Hori, H; Osawa, S; Iwabuchi, M

    1980-12-11

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  12. Tetrathiobacter kashmirensis Strain CA-1 16S rRNA gene complete sequence.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1326 base pair 16S rRNA gene sequence methods to confirm the identification of a bacterium as Tetrathiobacter kashmirensis. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification of the bacterium. The isolate...

  13. DNA Aptamers Selectively Target Leishmania infantum H2A Protein

    PubMed Central

    Martín, M. Elena; García-Hernández, Marta; García-Recio, Eva M.; Gómez-Chacón, Gerónimo F.; Sánchez-López, Marta; González, Víctor M.

    2013-01-01

    Parasites of the genus Leishmania produce leishmaniasis which affects millions people around the world. Understanding the molecular characteristics of the parasite can increase the knowledge about the mechanisms underlying disease development and progression. Thus, the study of the molecular features of histones has been considered of particular interest because Leishmania does not condense the chromatin during mitosis and, consequently, a different role for these proteins in the biology of the parasite can be expected. Furthermore, the sequence divergences in the amino and in the carboxy-terminal domains of the kinetoplastid core histones convert them in potential diagnostic and/or therapeutics targets. Aptamers are oligonucleotide ligands that are selected in vitro by their affinity and specificity for the target as a consequence of the particular tertiary structure that they are able to acquire depending on their sequence. Development of high-affinity molecules with the ability to recognize specifically Leishmania histones is essential for the progress of this kind of study. Two aptamers which specifically recognize Leishmania infantum H2A histone were cloned from a previously obtained ssDNA enriched population. These aptamers were sequenced and subjected to an in silico analysis. ELONA, slot blot and Western blot were performed to establish aptamer affinity and specificity for LiH2A histone and ELONA assays using peptides corresponding to overlapped sequences of LiH2A were made mapping the aptamers:LiH2A interaction. As “proofs of concept”, aptamers were used to determine the number of parasites in an ELONA platform and to purify LiH2A from complex mixtures. The aptamers showed different secondary structures among them; however, both of them were able to recognize the same peptides located in a side of the protein. In addition, we demonstrate that these aptamers are useful for LiH2A identification and also may be of potential application as diagnostic

  14. MicroRNA Target Site Identification by Integrating Sequence and Binding Information

    PubMed Central

    Majoros, William H.; Lekprasert, Parawee; Mukherjee, Neelanjan; Skalsky, Rebecca L.; Corcoran, David L.; Cullen, Bryan R.; Ohler, Uwe

    2013-01-01

    High-throughput sequencing has opened numerous possibilities for the identification of regulatory RNA-binding events. Cross-linking and immunoprecipitation of Argonaute protein members can pinpoint microRNA target sites within tens of bases, but leaves the identity of the microRNA unresolved. A flexible computational framework that integrates sequence with cross-linking features reliably identifies the microRNA family involved in each binding event, considerably outperforms sequence-only approaches, and quantifies the prevalence of noncanonical binding modes. PMID:23708386

  15. Transcription profile of boar spermatozoa as revealed by RNA-sequencing

    Technology Transfer Automated Retrieval System (TEKTRAN)

    High-throughput RNA sequencing (RNA-Seq) overcomes the limitations of the current hybridization-based techniques to detect the actual pool of RNA transcripts in spermatozoa. The application of this technology in livestock can speed the discovery of potential predictors of male fertility. As a first ...

  16. Strand-specific libraries for high throughput RNA sequencing (RNA-Seq) prepared without poly(A) selection

    PubMed Central

    2012-01-01

    Background High throughput DNA sequencing technology has enabled quantification of all the RNAs in a cell or tissue, a method widely known as RNA sequencing (RNA-Seq). However, non-coding RNAs such as rRNA are highly abundant and can consume >70% of sequencing reads. A common approach is to extract only polyadenylated mRNA; however, such approaches are blind to RNAs with short or no poly(A) tails, leading to an incomplete view of the transcriptome. Another challenge of preparing RNA-Seq libraries is to preserve the strand information of the RNAs. Design Here, we describe a procedure for preparing RNA-Seq libraries from 1 to 4 μg total RNA without poly(A) selection. Our method combines the deoxyuridine triphosphate (dUTP)/uracil-DNA glycosylase (UDG) strategy to achieve strand specificity with AMPure XP magnetic beads to perform size selection. Together, these steps eliminate gel purification, allowing a library to be made in less than two days. We barcode each library during the final PCR amplification step, allowing several samples to be sequenced in a single lane without sacrificing read length. Libraries prepared using this protocol are compatible with Illumina GAII, GAIIx and HiSeq 2000 platforms. Discussion The RNA-Seq protocol described here yields strand-specific transcriptome libraries without poly(A) selection, which provide approximately 90% mappable sequences. Typically, more than 85% of mapped reads correspond to protein-coding genes and only 6% derive from non-coding RNAs. The protocol has been used to measure RNA transcript identity and abundance in tissues from flies, mice, rats, chickens, and frogs, demonstrating its general applicability. PMID:23273270

  17. Sequence analysis of 16S rRNA from mycoplasmas by direct solid-phase DNA sequencing.

    PubMed Central

    Pettersson, B; Johansson, K E; Uhlén, M

    1994-01-01

    Automated solid-phase DNA sequencing was used for determination of partial 16S ribosomal DNA sequences of mycoplasmas. The sequence information was used to establish phylogenetic relationships of 11 different mycoplasmas whose 16S rRNA sequences had not been determined earlier. A biotinylated fragment corresponding to positions 344 to 939 in the Escherichia coli sequence was generated by PCR. The PCR product was immobilized onto streptavidin-coated paramagnetic beads, and direct sequencing was performed in both directions. One previously unclassified avian mycoplasma was found to belong to the Mycoplasma lipophilum cluster of the hominis group. Microheterogeneities were discovered in the rRNA operons of Mycoplasma mycoides subsp. mycoides (SC type), confirming the existence of two different rRNA operons. The 16S rRNA sequence of M. mycoides subsp. capri was identical to that of M. mycoides subsp. mycoides (type SC), except that no microheterogeneities were revealed. Furthermore, automated solid-phase DNA sequencing was used to identify a mycoplasmal contamination of a cell culture as Mycoplasma hyorhinis, which proved to be very difficult by conventional methods. The results suggest that the direct solid-phase DNA sequencing procedure is a powerful tool for identification of mycoplasmas and is also useful in taxonomic studies. Images PMID:7521158

  18. Role of the 5' leader sequence of alfalfa mosaic virus RNA 3 in replication and translation of the viral RNA.

    PubMed Central

    van der Vossen, E A; Neeleman, L; Bol, J F

    1993-01-01

    RNA 3 of alfalfa mosaic virus (AIMV) encodes the movement protein P3 and the viral coat protein which is translated from the subgenomic RNA 4. The 5'-leader sequences of RNA 3 of AIMV strains S, A, and Y differ in length from 314 to 392 nucleotides and contain a variable number of internal control regions of type 2 (ICR2 motifs) each located in a 27 nt repeat. Infectious cDNA clones were used to exchange the leader sequences of the three strains. This revealed that the leader sequence controls the specific ratio in which RNAs 3 and 4 are synthesized for each strain. In addition, it specifies strain specific differences in the kinetics of P3 accumulation in plants. Subsequent deletion analysis revealed that a 5'-sequence of 112 nt containing one ICR2 motif was sufficient for a 10 to 20% level of RNA 3 accumulation in protoplasts and a delayed accumulation in plants. An additional leader sequence of maximally 114 nt, containing two ICR2 motifs, was required to permit wildtype levels of RNA 3 accumulation. The effect of deletions in the leader sequence on P3 synthesis in vitro and in vivo was investigated. Images PMID:8464726

  19. Identification of Epithelial Ovarian Tumor-Specific Aptamers

    PubMed Central

    Benedetto, Gregory; Hamp, Timothy J.; Wesselman, Peter J.

    2015-01-01

    Ovarian cancer is often diagnosed in late stages with few treatment options and poor long-term prognosis. New clinical tools for early detection of ovarian malignancies will significantly help reduce mortality and improve current long-term survival rates. The objective of this work was to identify ovarian tumor-specific single-stranded DNA aptamers that bind to malignant ovarian tumor cells and internalize with high affinity and specificity. Aptamers can identify unique tumor biomarkers, can aid in early detection and diagnosis of neoplastic disorders, and can be functionalized by conjugation to small molecules. To identify aptamers from random single-stranded DNA pools (60 bases long), we used whole Cell-SELEX (systematic evolution of ligands by exponential enrichment) to enrich and isolate tumor-specific aptamers that bind to tumor-specific receptors in their native state on the cell surface. Next-Generation sequencing identified seven novel aptamers and detailed analyses of three are described. Aptamers bound to, and were internalized by, target Caov-3 cell populations, but not nontarget nonmalignant ovarian epithelial HOSE 6-3 cells or multiple other epithelial tumor cell lines. Furthermore, aptamers showed unique binding affinities with apparent dissociation constants (Kd) measuring in the submicromolar range supporting their physiological relevance and potential use in clinical applications. PMID:25894736

  20. Aptamers: A promising chemical antibody for cancer therapy

    PubMed Central

    Zhou, Gang; Wilson, George; Hebbard, Lionel; Duan, Wei; Liddle, Christopher; George, Jacob; Qiao, Liang

    2016-01-01

    Aptamers, also known as chemical antibodies, are single-stranded nucleic acid oligonucleotides which bind to their targets with high specificity and affinity. They are typically selected by repetitive in vitro process termed systematic evolution of ligands by exponential enrichment (SELEX). Owing to their excellent properties compared to conventional antibodies, notably their smaller physical size and lower immunogenicity and toxicity, aptamers have recently emerged as a new class of agents to deliver therapeutic drugs to cancer cells by targeting specific cancer-associated hallmarks. Aptamers can also be structurally modified to make them more flexible in order to conjugate other agents such as nano-materials and therapeutic RNA agents, thus extending their applications for cancer therapy. This review presents the current knowledge on the practical applications of aptamers in the treatment of a variety of cancers. PMID:26863567

  1. JAR3D Webserver: Scoring and aligning RNA loop sequences to known 3D motifs

    PubMed Central

    Roll, James; Zirbel, Craig L.; Sweeney, Blake; Petrov, Anton I.; Leontis, Neocles

    2016-01-01

    Many non-coding RNAs have been identified and may function by forming 2D and 3D structures. RNA hairpin and internal loops are often represented as unstructured on secondary structure diagrams, but RNA 3D structures show that most such loops are structured by non-Watson–Crick basepairs and base stacking. Moreover, different RNA sequences can form the same RNA 3D motif. JAR3D finds possible 3D geometries for hairpin and internal loops by matching loop sequences to motif groups from the RNA 3D Motif Atlas, by exact sequence match when possible, and by probabilistic scoring and edit distance for novel sequences. The scoring gauges the ability of the sequences to form the same pattern of interactions observed in 3D structures of the motif. The JAR3D webserver at http://rna.bgsu.edu/jar3d/ takes one or many sequences of a single loop as input, or else one or many sequences of longer RNAs with multiple loops. Each sequence is scored against all current motif groups. The output shows the ten best-matching motif groups. Users can align input sequences to each of the motif groups found by JAR3D. JAR3D will be updated with every release of the RNA 3D Motif Atlas, and so its performance is expected to improve over time. PMID:27235417

  2. Replicating satellite RNA induces sequence-specific DNA methylation and truncated transcripts in plants.

    PubMed Central

    Wang, M B; Wesley, S V; Finnegan, E J; Smith, N A; Waterhouse, P M

    2001-01-01

    Tobacco plants were transformed with a chimeric transgene comprising sequences encoding beta-glucuronidase (GUS) and the satellite RNA (satRNA) of cereal yellow dwarf luteovirus. When transgenic plants were infected with potato leafroll luteovirus (PLRV), which replicated the transgene-derived satRNA to a high level, the satellite sequence of the GUS:Sat transgene became densely methylated. Within the satellite region, all 86 cytosines in the upper strand and 73 of the 75 cytosines in the lower strand were either partially or fully methylated. In contrast, very low levels of DNA methylation were detected in the satellite sequence of the transgene in uninfected plants and in the flanking nonsatellite sequences in both infected and uninfected plants. Substantial amounts of truncated GUS:Sat RNA accumulated in the satRNA-replicating plants, and most of the molecules terminated at nucleotides within the first 60 bp of the satellite sequence. Whereas this RNA truncation was associated with high levels of satRNA replication, it appeared to be independent of the levels of DNA methylation in the satellite sequence, suggesting that it is not caused by methylation. All the sequenced GUS:Sat DNA molecules were hypermethylated in plants with replicating satRNA despite the phloem restriction of the helper PLRV. Also, small, sense and antisense approximately 22 nt RNAs, derived from the satRNA, were associated with the replicating satellite. These results suggest that the sequence-specific DNA methylation spread into cells in which no satRNA replication occurred and that this was mediated by the spread of unamplified satRNA and/or its associated 22 nt RNA molecules. PMID:11214177

  3. Highly efficient ligation of small RNA molecules for microRNA quantitation by high-throughput sequencing.

    PubMed

    Lee, Jerome E; Yi, Rui

    2014-01-01

    MiRNA cloning and high-throughput sequencing, termed miR-Seq, stands alone as a transcriptome-wide approach to quantify miRNAs with single nucleotide resolution. This technique captures miRNAs by attaching 3' and 5' oligonucleotide adapters to miRNA molecules and allows de novo miRNA discovery. Coupling with powerful next-generation sequencing platforms, miR-Seq has been instrumental in the study of miRNA biology. However, significant biases introduced by oligonucleotide ligation steps have prevented miR-Seq from being employed as an accurate quantitation tool. Previous studies demonstrate that biases in current miR-Seq methods often lead to inaccurate miRNA quantification with errors up to 1,000-fold for some miRNAs. To resolve these biases imparted by RNA ligation, we have developed a small RNA ligation method that results in ligation efficiencies of over 95% for both 3' and 5' ligation steps. Benchmarking this improved library construction method using equimolar or differentially mixed synthetic miRNAs, consistently yields reads numbers with less than two-fold deviation from the expected value. Furthermore, this high-efficiency miR-Seq method permits accurate genome-wide miRNA profiling from in vivo total RNA samples. PMID:25490151

  4. Integration of Expressed Sequence Tag Data Flanking Predicted RNA Secondary Structures Facilitates Novel Non-Coding RNA Discovery

    PubMed Central

    Krzyzanowski, Paul M.; Price, Feodor D.; Muro, Enrique M.; Rudnicki, Michael A.; Andrade-Navarro, Miguel A.

    2011-01-01

    Many computational methods have been used to predict novel non-coding RNAs (ncRNAs), but none, to our knowledge, have explicitly investigated the impact of integrating existing cDNA-based Expressed Sequence Tag (EST) data that flank structural RNA predictions. To determine whether flanking EST data can assist in microRNA (miRNA) prediction, we identified genomic sites encoding putative miRNAs by combining functional RNA predictions with flanking ESTs data in a model consistent with miRNAs undergoing cleavage during maturation. In both human and mouse genomes, we observed that the inclusion of flanking ESTs adjacent to and not overlapping predicted miRNAs significantly improved the performance of various methods of miRNA prediction, including direct high-throughput sequencing of small RNA libraries. We analyzed the expression of hundreds of miRNAs predicted to be expressed during myogenic differentiation using a customized microarray and identified several known and predicted myogenic miRNA hairpins. Our results indicate that integrating ESTs flanking structural RNA predictions improves the quality of cleaved miRNA predictions and suggest that this strategy can be used to predict other non-coding RNAs undergoing cleavage during maturation. PMID:21698286

  5. The use of exome capture RNA-seq for highly degraded RNA with application to clinical cancer sequencing

    PubMed Central

    Cieslik, Marcin; Chugh, Rashmi; Wu, Yi-Mi; Wu, Ming; Brennan, Christine; Lonigro, Robert; Su, Fengyun; Wang, Rui; Siddiqui, Javed; Mehra, Rohit; Cao, Xuhong; Lucas, David; Chinnaiyan, Arul M.; Robinson, Dan

    2015-01-01

    RNA-seq by poly(A) selection is currently the most common protocol for whole transcriptome sequencing as it provides a broad, detailed, and accurate view of the RNA landscape. Unfortunately, the utility of poly(A) libraries is greatly limited when the input RNA is degraded, which is the norm for research tissues and clinical samples, especially when specimens are formalin-fixed. To facilitate the use of RNA sequencing beyond cell lines and in the clinical setting, we developed an exome-capture transcriptome protocol with greatly improved performance on degraded RNA. Capture transcriptome libraries enable measuring absolute and differential gene expression, calling genetic variants, and detecting gene fusions. Through validation against gold-standard poly(A) and Ribo-Zero libraries from intact RNA, we show that capture RNA-seq provides accurate and unbiased estimates of RNA abundance, uniform transcript coverage, and broad dynamic range. Unlike poly(A) selection and Ribo-Zero depletion, capture libraries retain these qualities regardless of RNA quality and provide excellent data from clinical specimens including formalin-fixed paraffin-embedded (FFPE) blocks. Systematic improvements across key applications of RNA-seq are shown on a cohort of prostate cancer patients and a set of clinical FFPE samples. Further, we demonstrate the utility of capture RNA-seq libraries in a patient with a highly malignant solitary fibrous tumor (SFT) enrolled in our clinical sequencing program called MI-ONCOSEQ. Capture transcriptome profiling from FFPE revealed two oncogenic fusions: the pathognomonic NAB2-STAT6 inversion and a therapeutically actionable BRAF fusion, which may drive this specific cancer's aggressive phenotype. PMID:26253700

  6. The use of exome capture RNA-seq for highly degraded RNA with application to clinical cancer sequencing.

    PubMed

    Cieslik, Marcin; Chugh, Rashmi; Wu, Yi-Mi; Wu, Ming; Brennan, Christine; Lonigro, Robert; Su, Fengyun; Wang, Rui; Siddiqui, Javed; Mehra, Rohit; Cao, Xuhong; Lucas, David; Chinnaiyan, Arul M; Robinson, Dan

    2015-09-01

    RNA-seq by poly(A) selection is currently the most common protocol for whole transcriptome sequencing as it provides a broad, detailed, and accurate view of the RNA landscape. Unfortunately, the utility of poly(A) libraries is greatly limited when the input RNA is degraded, which is the norm for research tissues and clinical samples, especially when specimens are formalin-fixed. To facilitate the use of RNA sequencing beyond cell lines and in the clinical setting, we developed an exome-capture transcriptome protocol with greatly improved performance on degraded RNA. Capture transcriptome libraries enable measuring absolute and differential gene expression, calling genetic variants, and detecting gene fusions. Through validation against gold-standard poly(A) and Ribo-Zero libraries from intact RNA, we show that capture RNA-seq provides accurate and unbiased estimates of RNA abundance, uniform transcript coverage, and broad dynamic range. Unlike poly(A) selection and Ribo-Zero depletion, capture libraries retain these qualities regardless of RNA quality and provide excellent data from clinical specimens including formalin-fixed paraffin-embedded (FFPE) blocks. Systematic improvements across key applications of RNA-seq are shown on a cohort of prostate cancer patients and a set of clinical FFPE samples. Further, we demonstrate the utility of capture RNA-seq libraries in a patient with a highly malignant solitary fibrous tumor (SFT) enrolled in our clinical sequencing program called MI-ONCOSEQ. Capture transcriptome profiling from FFPE revealed two oncogenic fusions: the pathognomonic NAB2-STAT6 inversion and a therapeutically actionable BRAF fusion, which may drive this specific cancer's aggressive phenotype.

  7. The use of exome capture RNA-seq for highly degraded RNA with application to clinical cancer sequencing.

    PubMed

    Cieslik, Marcin; Chugh, Rashmi; Wu, Yi-Mi; Wu, Ming; Brennan, Christine; Lonigro, Robert; Su, Fengyun; Wang, Rui; Siddiqui, Javed; Mehra, Rohit; Cao, Xuhong; Lucas, David; Chinnaiyan, Arul M; Robinson, Dan

    2015-09-01

    RNA-seq by poly(A) selection is currently the most common protocol for whole transcriptome sequencing as it provides a broad, detailed, and accurate view of the RNA landscape. Unfortunately, the utility of poly(A) libraries is greatly limited when the input RNA is degraded, which is the norm for research tissues and clinical samples, especially when specimens are formalin-fixed. To facilitate the use of RNA sequencing beyond cell lines and in the clinical setting, we developed an exome-capture transcriptome protocol with greatly improved performance on degraded RNA. Capture transcriptome libraries enable measuring absolute and differential gene expression, calling genetic variants, and detecting gene fusions. Through validation against gold-standard poly(A) and Ribo-Zero libraries from intact RNA, we show that capture RNA-seq provides accurate and unbiased estimates of RNA abundance, uniform transcript coverage, and broad dynamic range. Unlike poly(A) selection and Ribo-Zero depletion, capture libraries retain these qualities regardless of RNA quality and provide excellent data from clinical specimens including formalin-fixed paraffin-embedded (FFPE) blocks. Systematic improvements across key applications of RNA-seq are shown on a cohort of prostate cancer patients and a set of clinical FFPE samples. Further, we demonstrate the utility of capture RNA-seq libraries in a patient with a highly malignant solitary fibrous tumor (SFT) enrolled in our clinical sequencing program called MI-ONCOSEQ. Capture transcriptome profiling from FFPE revealed two oncogenic fusions: the pathognomonic NAB2-STAT6 inversion and a therapeutically actionable BRAF fusion, which may drive this specific cancer's aggressive phenotype. PMID:26253700

  8. Globin mRNA reduction for whole-blood transcriptome sequencing

    PubMed Central

    Krjutškov, Kaarel; Koel, Mariann; Roost, Anne Mari; Katayama, Shintaro; Einarsdottir, Elisabet; Jouhilahti, Eeva-Mari; Söderhäll, Cilla; Jaakma, Ülle; Plaas, Mario; Vesterlund, Liselotte; Lohi, Hannes; Salumets, Andres; Kere, Juha

    2016-01-01

    The transcriptome analysis of whole-blood RNA by sequencing holds promise for the identification and tracking of biomarkers; however, the high globin mRNA (gmRNA) content of erythrocytes hampers whole-blood and buffy coat analyses. We introduce a novel gmRNA locking assay (GlobinLock, GL) as a robust and simple gmRNA reduction tool to preserve RNA quality, save time and cost. GL consists of a pair of gmRNA-specific oligonucleotides in RNA initial denaturation buffer that is effective immediately after RNA denaturation and adds only ten minutes of incubation to the whole cDNA synthesis procedure when compared to non-blood RNA analysis. We show that GL is fully effective not only for human samples but also for mouse and rat, and so far incompletely studied cow, dog and zebrafish. PMID:27515369

  9. Globin mRNA reduction for whole-blood transcriptome sequencing.

    PubMed

    Krjutškov, Kaarel; Koel, Mariann; Roost, Anne Mari; Katayama, Shintaro; Einarsdottir, Elisabet; Jouhilahti, Eeva-Mari; Söderhäll, Cilla; Jaakma, Ülle; Plaas, Mario; Vesterlund, Liselotte; Lohi, Hannes; Salumets, Andres; Kere, Juha

    2016-01-01

    The transcriptome analysis of whole-blood RNA by sequencing holds promise for the identification and tracking of biomarkers; however, the high globin mRNA (gmRNA) content of erythrocytes hampers whole-blood and buffy coat analyses. We introduce a novel gmRNA locking assay (GlobinLock, GL) as a robust and simple gmRNA reduction tool to preserve RNA quality, save time and cost. GL consists of a pair of gmRNA-specific oligonucleotides in RNA initial denaturation buffer that is effective immediately after RNA denaturation and adds only ten minutes of incubation to the whole cDNA synthesis procedure when compared to non-blood RNA analysis. We show that GL is fully effective not only for human samples but also for mouse and rat, and so far incompletely studied cow, dog and zebrafish. PMID:27515369

  10. Sequence-specific cleavage of dsRNA by Mini-III RNase

    PubMed Central

    Głów, Dawid; Pianka, Dariusz; Sulej, Agata A.; Kozłowski, Łukasz P.; Czarnecka, Justyna; Chojnowski, Grzegorz; Skowronek, Krzysztof J.; Bujnicki, Janusz M.

    2015-01-01

    Ribonucleases (RNases) play a critical role in RNA processing and degradation by hydrolyzing phosphodiester bonds (exo- or endonucleolytically). Many RNases that cut RNA internally exhibit substrate specificity, but their target sites are usually limited to one or a few specific nucleotides in single-stranded RNA and often in a context of a particular three-dimensional structure of the substrate. Thus far, no RNase counterparts of restriction enzymes have been identified which could cleave double-stranded RNA (dsRNA) in a sequence-specific manner. Here, we present evidence for a sequence-dependent cleavage of long dsRNA by RNase Mini-III from Bacillus subtilis (BsMiniIII). Analysis of the sites cleaved by this enzyme in limited digest of bacteriophage Φ6 dsRNA led to the identification of a consensus target sequence. We defined nucleotide residues within the preferred cleavage site that affected the efficiency of the cleavage and were essential for the discrimination of cleavable versus non-cleavable dsRNA sequences. We have also determined that the loop α5b-α6, a distinctive structural element in Mini-III RNases, is crucial for the specific cleavage, but not for dsRNA binding. Our results suggest that BsMiniIII may serve as a prototype of a sequence-specific dsRNase that could possibly be used for targeted cleavage of dsRNA. PMID:25634891

  11. Discriminative Prediction of A-To-I RNA Editing Events from DNA Sequence

    PubMed Central

    Sun, Jiangming; Singh, Pratibha; Bagge, Annika; Valtat, Bérengère; Vikman, Petter; Spégel, Peter; Mulder, Hindrik

    2016-01-01

    RNA editing is a post-transcriptional alteration of RNA sequences that, via insertions, deletions or base substitutions, can affect protein structure as well as RNA and protein expression. Recently, it has been suggested that RNA editing may be more frequent than previously thought. A great impediment, however, to a deeper understanding of this process is the paramount sequencing effort that needs to be undertaken to identify RNA editing events. Here, we describe an in silico approach, based on machine learning, that ameliorates this problem. Using 41 nucleotide long DNA sequences, we show that novel A-to-I RNA editing events can be predicted from known A-to-I RNA editing events intra- and interspecies. The validity of the proposed method was verified in an independent experimental dataset. Using our approach, 203 202 putative A-to-I RNA editing events were predicted in the whole human genome. Out of these, 9% were previously reported. The remaining sites require further validation, e.g., by targeted deep sequencing. In conclusion, the approach described here is a useful tool to identify potential A-to-I RNA editing events without the requirement of extensive RNA sequencing. PMID:27764195

  12. Modified AS1411 Aptamer Suppresses Hepatocellular Carcinoma by Up-Regulating Galectin-14

    PubMed Central

    Lee, Jeong-Hoon; Lee, Dong Hyeon; Cho, Eun Ju; Yu, Su Jong; Kim, Yoon Jun; Kim, Jong In; Im, Jong Hun; Lee, Jung Hwan; Oh, Eun Ju; Yoon, Jung-Hwan

    2016-01-01

    Aptamers are small synthetic oligonucleotides that bind to target proteins with high specificity and affinity. AS1411 is an aptamer that binds to nucleolin, which is overexpressed in the cytoplasm and occurs on the surface of cancer cells. We investigated the therapeutic potential of aptamers in hepatocellular carcinoma (HCC) by evaluating anti-tumor effects and confirming the affinity and specificity of AS1411- and modified AS1411-aptamers in HCC cells. Cell growth was assessed using the MTS assay, and cell death signaling was explored by immunoblot analysis. Fluorescence-activated cell sorting was performed to evaluate the affinity and specificity of AS1411-aptamers in SNU-761 HCC cells. We investigated the in vivo effects of the AS1411-aptamer using BALB/c nude mice in a subcutaneous xenograft model with SNU-761 cells. Treatment with a modified AS1411-aptamer significantly decreased in vitro (under normoxic [P = 0.035] and hypoxic [P = 0.018] conditions) and in vivo (under normoxic conditions, P = 0.041) HCC cell proliferation compared to control aptamers. AS1411- and control aptamers failed to control HCC cell proliferation. However, AS1411- and the modified AS1411-aptamer did not induce caspase activation. Decrease in cell growth by AS1411 or modified AS1411 was not prevented by caspase or necrosis inhibitors. In a microarray, AS1411 significantly enhanced galectin-14 expression. Suppression of HCC cell proliferation by the modified AS1411-aptamer was attenuated by galectin-14 siRNA transfection. Modified AS1411-aptamer suppressed HCC cell growth in vitro and in vivo by up-regulating galectin-14 expressions. Modified AS1411-aptamers may have therapeutic potential as a novel targeted therapy for HCC. PMID:27494117

  13. RNA Sequencing of the Exercise Transcriptome in Equine Athletes

    PubMed Central

    Verini-Supplizi, Andrea; Barcaccia, Gianni; Albiero, Alessandro; D'Angelo, Michela; Campagna, Davide; Valle, Giorgio; Felicetti, Michela; Silvestrelli, Maurizio; Cappelli, Katia

    2013-01-01

    The horse is an optimal model organism for studying the genomic response to exercise-induced stress, due to its natural aptitude for athletic performance and the relative homogeneity of its genetic and environmental backgrounds. Here, we applied RNA-sequencing analysis through the use of SOLiD technology in an experimental framework centered on exercise-induced stress during endurance races in equine athletes. We monitored the transcriptional landscape by comparing gene expression levels between animals at rest and after competition. Overall, we observed a shift from coding to non-coding regions, suggesting that the stress response involves the differential expression of not annotated regions. Notably, we observed significant post-race increases of reads that correspond to repeats, especially the intergenic and intronic L1 and L2 transposable elements. We also observed increased expression of the antisense strands compared to the sense strands in intronic and regulatory regions (1 kb up- and downstream) of the genes, suggesting that antisense transcription could be one of the main mechanisms for transposon regulation in the horse under stress conditions. We identified a large number of transcripts corresponding to intergenic and intronic regions putatively associated with new transcriptional elements. Gene expression and pathway analysis allowed us to identify several biological processes and molecular functions that may be involved with exercise-induced stress. Ontology clustering reflected mechanisms that are already known to be stress activated (e.g., chemokine-type cytokines, Toll-like receptors, and kinases), as well as “nucleic acid binding” and “signal transduction activity” functions. There was also a general and transient decrease in the global rates of protein synthesis, which would be expected after strenuous global stress. In sum, our network analysis points toward the involvement of specific gene clusters in equine exercise-induced stress

  14. RNA sequencing of the exercise transcriptome in equine athletes.

    PubMed

    Capomaccio, Stefano; Vitulo, Nicola; Verini-Supplizi, Andrea; Barcaccia, Gianni; Albiero, Alessandro; D'Angelo, Michela; Campagna, Davide; Valle, Giorgio; Felicetti, Michela; Silvestrelli, Maurizio; Cappelli, Katia

    2013-01-01

    The horse is an optimal model organism for studying the genomic response to exercise-induced stress, due to its natural aptitude for athletic performance and the relative homogeneity of its genetic and environmental backgrounds. Here, we applied RNA-sequencing analysis through the use of SOLiD technology in an experimental framework centered on exercise-induced stress during endurance races in equine athletes. We monitored the transcriptional landscape by comparing gene expression levels between animals at rest and after competition. Overall, we observed a shift from coding to non-coding regions, suggesting that the stress response involves the differential expression of not annotated regions. Notably, we observed significant post-race increases of reads that correspond to repeats, especially the intergenic and intronic L1 and L2 transposable elements. We also observed increased expression of the antisense strands compared to the sense strands in intronic and regulatory regions (1 kb up- and downstream) of the genes, suggesting that antisense transcription could be one of the main mechanisms for transposon regulation in the horse under stress conditions. We identified a large number of transcripts corresponding to intergenic and intronic regions putatively associated with new transcriptional elements. Gene expression and pathway analysis allowed us to identify several biological processes and molecular functions that may be involved with exercise-induced stress. Ontology clustering reflected mechanisms that are already known to be stress activated (e.g., chemokine-type cytokines, Toll-like receptors, and kinases), as well as "nucleic acid binding" and "signal transduction activity" functions. There was also a general and transient decrease in the global rates of protein synthesis, which would be expected after strenuous global stress. In sum, our network analysis points toward the involvement of specific gene clusters in equine exercise-induced stress, including

  15. High-throughput cellular RNA device engineering.

    PubMed

    Townshend, Brent; Kennedy, Andrew B; Xiang, Joy S; Smolke, Christina D

    2015-10-01

    Methods for rapidly assessing sequence-structure-function landscapes and developing conditional gene-regulatory devices are critical to our ability to manipulate and interface with biology. We describe a framework for engineering RNA devices from preexisting aptamers that exhibit ligand-responsive ribozyme tertiary interactions. Our methodology utilizes cell sorting, high-throughput sequencing and statistical data analyses to enable parallel measurements of the activities of hundreds of thousands of sequences from RNA device libraries in the absence and presence of ligands. Our tertiary-interaction RNA devices performed better in terms of gene silencing, activation ratio and ligand sensitivity than optimized RNA devices that rely on secondary-structure changes. We applied our method to build biosensors for diverse ligands and determine consensus sequences that enable ligand-responsive tertiary interactions. These methods advance our ability to develop broadly applicable genetic tools and to elucidate the underlying sequence-structure-function relationships that empower rational design of complex biomolecules. PMID:26258292

  16. DNA Aptamers against the Lup an 1 Food Allergen

    PubMed Central

    Nadal, Pedro; Pinto, Alessandro; Svobodova, Marketa; Canela, Nuria; O'Sullivan, Ciara K.

    2012-01-01

    Using in vitro selection, high affinity DNA aptamers to the food allergen Lup an 1, ß-conglutin, were selected from a pool of DNA, 93 bases in length, containing a randomised sequence of 49 bases. ß-conglutin was purified from lupin flour and chemically crosslinked to carboxylated magnetic beads. Peptide mass fingerprinting was used to confirm the presence of the ß-conglutin. Single stranded DNA was generated from the randomised pool using T7 Gene 6 Exonuclease and was subsequently incubated with the magnetic beads and the captured DNA was released and amplified prior to a further round of Systematic Evolution of Ligands by Exponential Enrichment (SELEX). Evolution was monitored using enzyme linked oligonucleotide assay and surface plasmon resonance. Once a plateau in evolution was reached, the isolated DNA sequences were cloned and sequenced. The consensus motif was identified via alignment of the sequences and the affinities of these sequences for immobilised ß-conglutin were determined using surface plasmon resonance. The selected aptamer was demonstrated to be highly specific, showing no cross-reactivity with other flour ingredients or with other conglutin fractions of lupin. The secondary structures of the selected aptamers were predicted using m-fold. Finally, the functionality of the selected aptamers was demonstrated using a competitive assay for the quantitative detection of ß-conglutin. . Future work will focus on structure elucidation and truncation of the selected sequences to generate a smaller aptamer for application to the analysis of the Lup an 1 allergen in foodstuffs. PMID:22529997

  17. High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases.

    PubMed

    Qin, Yidan; Yao, Jun; Wu, Douglas C; Nottingham, Ryan M; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M

    2016-01-01

    Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from <1 ng of plasma RNA in <5 h. TGIRT-seq of RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling.

  18. Identification of Dirofilaria immitis miRNA using illumina deep sequencing

    PubMed Central

    2013-01-01

    The heartworm Dirofilaria immitis is the causative agent of cardiopulmonary dirofilariosis in dogs and cats, which also infects a wide range of wild mammals and humans. The complex life cycle of D. immitis with several developmental stages in its invertebrate mosquito vectors and its vertebrate hosts indicates the importance of miRNA in growth and development, and their ability to regulate infection of mammalian hosts. This study identified the miRNA profiles of D. immitis of zoonotic significance by deep sequencing. A total of 1063 conserved miRNA candidates, including 68 anti-sense miRNA (miRNA*) sequences, were predicted by computational methods and could be grouped into 808 miRNA families. A significant bias towards family members, family abundance and sequence nucleotides was observed. Thirteen novel miRNA candidates were predicted by alignment with the Brugia malayi genome. Eleven out of 13 predicted miRNA candidates were verified by using a PCR-based method. Target genes of the novel miRNA candidates were predicted by using the heartworm transcriptome dataset. To our knowledge, this is the first report of miRNA profiles in D. immitis, which will contribute to a better understanding of the complex biology of this zoonotic filarial nematode and the molecular regulation roles of miRNA involved. Our findings may also become a useful resource for small RNA studies in other filarial parasitic nematodes. PMID:23331513

  19. RPI-Pred: predicting ncRNA-protein interaction using sequence and structural information

    PubMed Central

    Suresh, V.; Liu, Liang; Adjeroh, Donald; Zhou, Xiaobo

    2015-01-01

    RNA-protein complexes are essential in mediating important fundamental cellular processes, such as transport and localization. In particular, ncRNA-protein interactions play an important role in post-transcriptional gene regulation like mRNA localization, mRNA stabilization, poly-adenylation, splicing and translation. The experimental methods to solve RNA-protein interaction prediction problem remain expensive and time-consuming. Here, we present the RPI-Pred (RNA-protein interaction predictor), a new support-vector machine-based method, to predict protein-RNA interaction pairs, based on both the sequences and structures. The results show that RPI-Pred can correctly predict RNA-protein interaction pairs with ∼94% prediction accuracy when using sequence and experimentally determined protein and RNA structures, and with ∼83% when using sequences and predicted protein and RNA structures. Further, our proposed method RPI-Pred was superior to other existing ones by predicting more experimentally validated ncRNA-protein interaction pairs from different organisms. Motivated by the improved performance of RPI-Pred, we further applied our method for reliable construction of ncRNA-protein interaction networks. The RPI-Pred is publicly available at: http://ctsb.is.wfubmc.edu/projects/rpi-pred. PMID:25609700

  20. New perspectives on the diversification of the RNA interference system: insights from comparative genomics and small RNA sequencing.

    PubMed

    Burroughs, Alexander Maxwell; Ando, Yoshinari; Aravind, L

    2014-01-01

    Our understanding of the pervasive involvement of small RNAs in regulating diverse biological processes has been greatly augmented by recent application of deep-sequencing technologies to small RNA across diverse eukaryotes. We review the currently known small RNA classes and place them in context of the reconstructed evolutionary history of the RNA interference (RNAi) protein machinery. This synthesis indicates that the earliest versions of eukaryotic RNAi systems likely utilized small RNA processed from three types of precursors: (1) sense-antisense transcriptional products, (2) genome-encoded, imperfectly complementary hairpin sequences, and (3) larger noncoding RNA precursor sequences. Structural dissection of PIWI proteins along with recent discovery of novel families (including Med13 of the Mediator complex) suggest that emergence of a distinct architecture with the N-terminal domains (also occurring separately fused to endoDNases in prokaryotes) formed via duplication of an ancestral unit was key to their recruitment as primary RNAi effectors and use of small RNAs of certain preferred lengths. Prokaryotic PIWI proteins are typically components of several RNA-directed DNA restriction or CRISPR/Cas systems. However, eukaryotic versions appear to have emerged from a subset that evolved RNA-directed RNAi. They were recruited alongside RNaseIII domains and RNA-dependent RNA polymerase (RdRP) domains, also from prokaryotic systems, to form the core eukaryotic RNAi system. Like certain regulatory systems, RNAi diversified into two distinct but linked arms concomitant with eukaryotic nucleocytoplasmic compartmentalization. Subsequent elaboration of RNAi proceeded via diversification of the core protein machinery through lineage-specific expansions and recruitment of new components from prokaryotes (nucleases and small RNA-modifying enzymes), allowing for diversification of associating small RNAs. PMID:24311560

  1. Nucleotide sequence of 3' untranslated portion of human alpha globin mRNA.

    PubMed Central

    Wilson, J T; deRiel, J K; Forget, B G; Marotta, C A; Weissman, S M

    1977-01-01

    We have determined the nucleotide sequence of 75 nucleotides of the 3'-untranslated portion of normal human alpha globin mRNA which corresponds to the elongated amino acid sequence of the chain termination mutant Hb Constant Spring. This was accomplished by sequence analysis of cDNA fragments obtained by restriction endonuclease or T4 endonuclease IV cleavage of human globin cDNA synthesized from globin mRNA by use of viral reverse transcriptase. Analysis of cRNA synthesized from cDNA by use of RNA polymerase provided additional confirmatory sequence information. Possible polymorphism has been identified at one site of the sequence. Our sequence overlaps with, and extends the sequence of 43 nucleotides determined by Proudfood and coworkers for the very 3'-terminal portion of human alpha globin mRNA. The complete 3'-untranslated sequence of human alpha globin mRNA (112 nucleotides including termination codon) shows little homology to that of the human or rabbit beta globin mRNAs except for the presence of the hexanucleotide sequence AAUAAA which is found in most eukaryotic mRNAs near the 3'-terminal poly (A). Images PMID:909779

  2. Effect of structure variation of the aptamer-DNA duplex probe on the performance of displacement-based electrochemical aptamer sensors.

    PubMed

    Pang, Jie; Zhang, Ziping; Jin, Haizhu

    2016-03-15

    Electrochemical aptamer-based (E-AB) sensors employing electrode-immobilized, redox-tagged aptamer probes have emerged as a promising platform for the sensitive and quick detection of target analytes ranging from small molecules to proteins. Signal generation in this class of sensor is linked to change in electron transfer efficiency upon binding-induced change in flexibility/conformation of the aptamer probe. Because of this signaling mechanism, signal gains of these sensors can be improved by employing a displacement-based recognition system, which links target binding with a large-scale flexibility/conformation shift from the aptamer-DNA duplex to the single-stranded DNA or the native aptamer. Despite the relatively large number of displacement-based E-AB sensor samples, little attention has been paid to the structure variation of the aptamer-DNA duplex probe. Here we detail the effects of complementary length and position of the aptamer-DNA duplex probe on the performance of a model displacement-based E-AB sensor for ATP. We find that, greater background suppression and signal gain are observed with longer complementary length of the aptamer-DNA duplex probe. However, sensor equilibration time slows monotonically with increasing complementary length; and with too many target binding sites in aptamer sequence being occupied by the complementary DNA, the aptamer-target binding does not occur and no signal gain observed. We also demonstrate that signal gain of the displacement-based E-AB sensor is strongly dependent on the complementary position of the aptamer-DNA duplex probe, with complementary position located at the electrode-attached or redox-tagged end of the duplex probe, larger background suppression and signal increase than that of the middle position are observed. These results highlight the importance of rational structure design of the aptamer-DNA duplex probe and provide new insights into the optimization of displacement-based E-AB sensors.

  3. Genome-Wide Probing of RNA Structures In Vitro Using Nucleases and Deep Sequencing.

    PubMed

    Wan, Yue; Qu, Kun; Ouyang, Zhengqing; Chang, Howard Y

    2016-01-01

    RNA structure probing is an important technique that studies the secondary and tertiary conformations of an RNA. While it was traditionally performed on one RNA at a time, recent advances in deep sequencing has enabled the secondary structure mapping of thousands of RNAs simultaneously. Here, we describe the method Parallel Analysis for RNA Structures (PARS), which couples double and single strand specific nuclease probing to high throughput sequencing. Upon cloning of the cleavage sites into a cDNA library, deep sequencing and mapping of reads to the transcriptome, the position of paired and unpaired bases along cellular RNAs can be identified. PARS can be performed under diverse solution conditions and on different organismal RNAs to provide genome-wide RNA structural information. This information can also be further used to constrain computational predictions to provide better RNA structure models under different conditions. PMID:26483021

  4. Sequence specific detection of bacterial 23S ribosomal RNA by TLR13

    PubMed Central

    Li, Xiao-Dong; Chen, Zhijian J

    2012-01-01

    Toll-like receptors (TLRs) detect microbial infections and trigger innate immune responses. Among vertebrate TLRs, the role of TLR13 and its ligand are unknown. Here we show that TLR13 detects the 23S ribosomal RNA of both gram-positive and gram-negative bacteria. A sequence containing 13 nucleotides near the active site of 23S rRNA ribozyme, which catalyzes peptide bond synthesis, was both necessary and sufficient to trigger TLR13-dependent interleukin-1β production. Single point mutations within this sequence destroyed the ability of the 23S rRNA to stimulate the TLR13 pathway. Knockout of TLR13 in mice abolished the induction of interleukin-1β and other cytokines by the 23S rRNA sequence. Thus, TLR13 detects bacterial RNA with exquisite sequence specificity. DOI: http://dx.doi.org/10.7554/eLife.00102.001 PMID:23110254

  5. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin

    NASA Astrophysics Data System (ADS)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-01

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  6. Sequence arrangement of the rRNA genes of the dipteran Sarcophaga bullata.

    PubMed

    French, C K; Fouts, D L; Manning, J E

    1981-06-11

    Velocity sedimentation studies of RNA of Sarcophaga bullata show that the major rRNA species have sedimentation values of 26S and 18S. Analysis of the rRNA under denaturing conditions indicates that there is a hidden break centrally located in the 26S rRNA species. Saturation hybridization studies using total genomic DNA and rRNA show that 0.08% of the nuclear DNA is occupied by rRNA coding sequences and that the average repetition frequency of these coding sequences is approximately 144. The arrangement of the rRNA genes and their spacer sequences on long strands of purified rDNA was determined by the examination of the structure of rRNa:DNA hybrids in the electron microscope. Long DNA strands contain several gene sets (18S + 26S) with one repeat unit containing the following sequences in order given: (a) An 18S gene of length 2.12 kb, (b) an internal transcribed spacer of length 2.01 kb, which contains a short sequence that may code for a 5.8S rRNA, (c) A 26S gene of length 4.06 kb which, in 20% of the cases, contains an intron with an average length of 5.62 kb, and (d) an external spacer of average length of 9.23 kb.

  7. Translation and Clinical Development of Antithrombotic Aptamers.

    PubMed

    Nimjee, Shahid M; Povsic, Thomas J; Sullenger, Bruce A; Becker, Richard C

    2016-06-01

    Thrombosis is a necessary physiological process to protect the body from uncontrolled bleeding. Pathological thrombus formation can lead to devastating clinical events including heart attack, stroke, deep vein thrombosis, pulmonary embolism, and disseminated intravascular coagulation. Numerous drugs have been developed to inhibit thrombosis. These have been targeted to coagulation factors along with proteins and receptors that activate platelets. While these drugs are effective at preventing blood clotting, their major side effect is inadvertent hemorrhage that can result in significant morbidity and mortality. There exists a need for anticoagulants that are not only effective at preventing thrombosis but can also be readily reversed. Aptamers offer a potential solution, representing a new class of drug agents that can be isolated to any protein and where antidote oligonucleotides can be designed based on the sequence of the aptamer. We present a summary of the anticoagulant and antithrombotic aptamers that have been identified and their stage of development and comment on the future of aptamer-based drug development to treat thrombosis. PMID:26882082

  8. Plant RNA virus sequences identified in kimchi by microbial metatranscriptome analysis.

    PubMed

    Kim, Dong Seon; Jung, Ji Young; Wang, Yao; Oh, Hye Ji; Choi, Dongjin; Jeon, Che Ok; Hahn, Yoonsoo

    2014-07-01

    Plant pathogenic RNA viruses are present in a variety of plant-based foods. When ingested by humans, these viruses can survive the passage through the digestive tract, and are frequently detected in human feces. Kimchi is a traditional fermented Korean food made from cabbage or vegetables, with a variety of other plant-based ingredients, including ground red pepper and garlic paste. We analyzed microbial metatranscriptome data from kimchi at five fermentation stages to identify plant RNA virus-derived sequences. We successfully identified a substantial amount of plant RNA virus sequences, especially during the early stages of fermentation: 23.47% and 16.45% of total clean reads on days 7 and 13, respectively. The most abundant plant RNA virus sequences were from pepper mild mottle virus, a major pathogen of red peppers; this constituted 95% of the total RNA virus sequences identified throughout the fermentation period. We observed distinct sequencing read-depth distributions for plant RNA virus genomes, possibly implying intrinsic and/or technical biases during the metatranscriptome generation procedure. We also identified RNA virus sequences in publicly available microbial metatranscriptome data sets. We propose that metatranscriptome data may serve as a valuable resource for RNA virus detection, and a systematic screening of the ingredients may help prevent the use of virus-infected low-quality materials for food production. PMID:24836186

  9. Plant RNA virus sequences identified in kimchi by microbial metatranscriptome analysis.

    PubMed

    Kim, Dong Seon; Jung, Ji Young; Wang, Yao; Oh, Hye Ji; Choi, Dongjin; Jeon, Che Ok; Hahn, Yoonsoo

    2014-07-01

    Plant pathogenic RNA viruses are present in a variety of plant-based foods. When ingested by humans, these viruses can survive the passage through the digestive tract, and are frequently detected in human feces. Kimchi is a traditional fermented Korean food made from cabbage or vegetables, with a variety of other plant-based ingredients, including ground red pepper and garlic paste. We analyzed microbial metatranscriptome data from kimchi at five fermentation stages to identify plant RNA virus-derived sequences. We successfully identified a substantial amount of plant RNA virus sequences, especially during the early stages of fermentation: 23.47% and 16.45% of total clean reads on days 7 and 13, respectively. The most abundant plant RNA virus sequences were from pepper mild mottle virus, a major pathogen of red peppers; this constituted 95% of the total RNA virus sequences identified throughout the fermentation period. We observed distinct sequencing read-depth distributions for plant RNA virus genomes, possibly implying intrinsic and/or technical biases during the metatranscriptome generation procedure. We also identified RNA virus sequences in publicly available microbial metatranscriptome data sets. We propose that metatranscriptome data may serve as a valuable resource for RNA virus detection, and a systematic screening of the ingredients may help prevent the use of virus-infected low-quality materials for food production.

  10. Deep Sequencing of RNA from Ancient Maize Kernels

    PubMed Central

    Rasmussen, Morten; Cappellini, Enrico; Romero-Navarro, J. Alberto; Wales, Nathan; Alquezar-Planas, David E.; Penfield, Steven; Brown, Terence A.; Vielle-Calzada, Jean-Philippe; Montiel, Rafael; Jørgensen, Tina; Odegaard, Nancy; Jacobs, Michael; Arriaza, Bernardo; Higham, Thomas F. G.; Ramsey, Christopher Bronk; Willerslev, Eske; Gilbert, M. Thomas P.

    2013-01-01

    The characterization of biomolecules from ancient samples can shed otherwise unobtainable insights into the past. Despite the fundamental role of transcriptomal change in evolution, the potential of ancient RNA remains unexploited – perhaps due to dogma associated with the fragility of RNA. We hypothesize that seeds offer a plausible refuge for long-term RNA survival, due to the fundamental role of RNA during seed germination. Using RNA-Seq on cDNA synthesized from nucleic acid extracts, we validate this hypothesis through demonstration of partial transcriptomal recovery from two sources of ancient maize kernels. The results suggest that ancient seed transcriptomics may offer a powerful new tool with which to study plant domestication. PMID:23326310

  11. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  12. Sequencing 16S rRNA gene fragments using the PacBio SMRT DNA sequencing system

    PubMed Central

    Jenior, Matthew L.; Koumpouras, Charles C.; Westcott, Sarah L.; Highlander, Sarah K.

    2016-01-01

    Over the past 10 years, microbial ecologists have largely abandoned sequencing 16S rRNA genes by the Sanger sequencing method and have instead adopted highly parallelized sequencing platforms. These new platforms, such as 454 and Illumina’s MiSeq, have allowed researchers to obtain millions of high quality but short sequences. The result of the added sequencing depth has been significant improvements in experimental design. The tradeoff has been the decline in the number of full-length reference sequences that are deposited into databases. To overcome this problem, we tested the ability of the PacBio Single Molecule, Real-Time (SMRT) DNA sequencing platform to generate sequence reads from the 16S rRNA gene. We generated sequencing data from the V4, V3–V5, V1–V3, V1–V5, V1–V6, and V1–V9 variable regions from within the 16S rRNA gene using DNA from a synthetic mock community and natural samples collected from human feces, mouse feces, and soil. The mock community allowed us to assess the actual sequencing error rate and how that error rate changed when different curation methods were applied. We developed a simple method based on sequence characteristics and quality scores to reduce the observed error rate for the V1–V9 region from 0.69 to 0.027%. This error rate is comparable to what has been observed for the shorter reads generated by 454 and Illumina’s MiSeq sequencing platforms. Although the per base sequencing cost is still significantly more than that of MiSeq, the prospect of supplementing reference databases with full-length sequences from organisms below the limit of detection from the Sanger approach is exciting. PMID:27069806

  13. Sequencing 16S rRNA gene fragments using the PacBio SMRT DNA sequencing system.

    PubMed

    Schloss, Patrick D; Jenior, Matthew L; Koumpouras, Charles C; Westcott, Sarah L; Highlander, Sarah K

    2016-01-01

    Over the past 10 years, microbial ecologists have largely abandoned sequencing 16S rRNA genes by the Sanger sequencing method and have instead adopted highly parallelized sequencing platforms. These new platforms, such as 454 and Illumina's MiSeq, have allowed researchers to obtain millions of high quality but short sequences. The result of the added sequencing depth has been significant improvements in experimental design. The tradeoff has been the decline in the number of full-length reference sequences that are deposited into databases. To overcome this problem, we tested the ability of the PacBio Single Molecule, Real-Time (SMRT) DNA sequencing platform to generate sequence reads from the 16S rRNA gene. We generated sequencing data from the V4, V3-V5, V1-V3, V1-V5, V1-V6, and V1-V9 variable regions from within the 16S rRNA gene using DNA from a synthetic mock community and natural samples collected from human feces, mouse feces, and soil. The mock community allowed us to assess the actual sequencing error rate and how that error rate changed when different curation methods were applied. We developed a simple method based on sequence characteristics and quality scores to reduce the observed error rate for the V1-V9 region from 0.69 to 0.027%. This error rate is comparable to what has been observed for the shorter reads generated by 454 and Illumina's MiSeq sequencing platforms. Although the per base sequencing cost is still significantly more than that of MiSeq, the prospect of supplementing reference databases with full-length sequences from organisms below the limit of detection from the Sanger approach is exciting. PMID:27069806

  14. Sequencing 16S rRNA gene fragments using the PacBio SMRT DNA sequencing system.

    PubMed

    Schloss, Patrick D; Jenior, Matthew L; Koumpouras, Charles C; Westcott, Sarah L; Highlander, Sarah K

    2016-01-01

    Over the past 10 years, microbial ecologists have largely abandoned sequencing 16S rRNA genes by the Sanger sequencing method and have instead adopted highly parallelized sequencing platforms. These new platforms, such as 454 and Illumina's MiSeq, have allowed researchers to obtain millions of high quality but short sequences. The result of the added sequencing depth has been significant improvements in experimental design. The tradeoff has been the decline in the number of full-length reference sequences that are deposited into databases. To overcome this problem, we tested the ability of the PacBio Single Molecule, Real-Time (SMRT) DNA sequencing platform to generate sequence reads from the 16S rRNA gene. We generated sequencing data from the V4, V3-V5, V1-V3, V1-V5, V1-V6, and V1-V9 variable regions from within the 16S rRNA gene using DNA from a synthetic mock community and natural samples collected from human feces, mouse feces, and soil. The mock community allowed us to assess the actual sequencing error rate and how that error rate changed when different curation methods were applied. We developed a simple method based on sequence characteristics and quality scores to reduce the observed error rate for the V1-V9 region from 0.69 to 0.027%. This error rate is comparable to what has been observed for the shorter reads generated by 454 and Illumina's MiSeq sequencing platforms. Although the per base sequencing cost is still significantly more than that of MiSeq, the prospect of supplementing reference databases with full-length sequences from organisms below the limit of detection from the Sanger approach is exciting.

  15. The RNA structurome: transcriptome-wide structure probing with next-generation sequencing.

    PubMed

    Kwok, Chun Kit; Tang, Yin; Assmann, Sarah M; Bevilacqua, Philip C

    2015-04-01

    RNA folds into intricate structures that enable its pivotal roles in biology, ranging from regulation of gene expression to ligand sensing and enzymatic functions. Therefore, elucidating RNA structure can provide profound insights into living systems. A recent marriage between in vivo RNA structure probing and next-generation sequencing (NGS) has revolutionized the RNA field by enabling transcriptome-wide structure determination in vivo, which has been applied to date to human cells, yeast cells, and Arabidopsis seedlings. Analysis of resultant in vivo 'RNA structuromes' provides new and important information regarding myriad cellular processes, including control of translation, alternative splicing, alternative polyadenylation, energy-dependent unfolding of mRNA, and effects of proteins on RNA structure. An emerging view suggests potential links between RNA structure and stress and disease physiology across the tree of life. As we discuss here, these exciting findings open new frontiers into RNA biology, genome biology, and beyond.

  16. DNApi: A De Novo Adapter Prediction Algorithm for Small RNA Sequencing Data

    PubMed Central

    Tsuji, Junko; Weng, Zhiping

    2016-01-01

    With the rapid accumulation of publicly available small RNA sequencing datasets, third-party meta-analysis across many datasets is becoming increasingly powerful. Although removing the 3´ adapter is an essential step for small RNA sequencing analysis, the adapter sequence information is not always available in the metadata. The information can be also erroneous even when it is available. In this study, we developed DNApi, a lightweight Python software package that predicts the 3´ adapter sequence de novo and provides the user with cleansed small RNA sequences ready for down stream analysis. Tested on 539 publicly available small RNA libraries accompanied with 3´ adapter sequences in their metadata, DNApi shows near-perfect accuracy (98.5%) with fast runtime (~2.85 seconds per library) and efficient memory usage (~43 MB on average). In addition to 3´ adapter prediction, it is also important to classify whether the input small RNA libraries were already processed, i.e. the 3´ adapters were removed. DNApi perfectly judged that given another batch of datasets, 192 publicly available processed libraries were “ready-to-map” small RNA sequence. DNApi is compatible with Python 2 and 3, and is available at https://github.com/jnktsj/DNApi. The 731 small RNA libraries used for DNApi evaluation were from human tissues and were carefully and manually collected. This study also provides readers with the curated datasets that can be integrated into their studies. PMID:27736901

  17. Combinatorial Library of Improved Peptide Aptamers, CLIPs to Inhibit RAGE Signal Transduction in Mammalian Cells

    PubMed Central

    Reverdatto, Sergey; Rai, Vivek; Xue, Jing; Burz, David S.; Schmidt, Ann Marie; Shekhtman, Alexander

    2013-01-01

    Peptide aptamers are small proteins containing a randomized peptide sequence embedded into a stable protein scaffold, such as Thioredoxin. We developed a robust method for building a Combinatorial Library of Improved Peptide aptamers (CLIPs) of high complexity, containing ≥3×1010 independent clones, to be used as a molecular tool in the study of biological pathways. The Thioredoxin scaffold was modified to increase solubility and eliminate aggregation of the peptide aptamers. The CLIPs was used in a yeast two-hybrid screen to identify peptide aptamers that bind to various domains of the Receptor for Advanced Glycation End products (RAGE). NMR spectroscopy was used to identify interaction surfaces between the peptide aptamers and RAGE domains. Cellular functional assays revealed that in addition to directly interfering with known binding sites, peptide aptamer binding distal to ligand sites also inhibits RAGE ligand-induced signal transduction. This finding underscores the potential of using CLIPs to select allosteric inhibitors of biological targets. PMID:23785412

  18. a Simple Symmetric Algorithm Using a Likeness with Introns Behavior in RNA Sequences

    NASA Astrophysics Data System (ADS)

    Regoli, Massimo

    2009-02-01

    The RNA-Crypto System (shortly RCS) is a symmetric key algorithm to cipher data. The idea for this new algorithm starts from the observation of nature. In particular from the observation of RNA behavior and some of its properties. The RNA sequences has some sections called Introns. Introns, derived from the term "intragenic regions", are non-coding sections of precursor mRNA (pre-mRNA) or other RNAs, that are removed (spliced out of the RNA) before the mature RNA is formed. Once the introns have been spliced out of a pre-mRNA, the resulting mRNA sequence is ready to be translated into a protein. The corresponding parts of a gene are known as introns as well. The nature and the role of Introns in the pre-mRNA is not clear and it is under ponderous researches by Biologists but, in our case, we will use the presence of Introns in the RNA-Crypto System output as a strong method to add chaotic non coding information and an unnecessary behaviour in the access to the secret key to code the messages. In the RNA-Crypto System algoritnm the introns are sections of the ciphered message with non-coding information as well as in the precursor mRNA.

  19. Intervening sequences in ribosomal RNA genes and bobbed phenotype in Drosophila hydei.

    PubMed

    Franz, G; Kunz, W

    1981-08-13

    The "bobbed' (bb) mutation in Drosophila is represented phenotypically by shortened and abnormally thin scutellar bristles and by delayed development. There is a direct correlation between bristle size and ribosomal RNA (rRNA) synthesis, and the bb mutation was at first explained as a deficiency of rRNA genes (rDNA). However, the bb phenotype can occur in Drosophila melanogaster and Drosophila hydei with high rDNA content, while phenotypically wild-type flies are known with few rRNA genes, suggesting that what matters is not the number of rRNA genes but their transcriptional activity. In D. melanogaster, it has recently emerged that rRNA genes interrupted by an intervening sequence are not transcribed. We now report that in D. hydei, the length of the scutellar bristle is directly proportional to the number of rRNA genes without this intervening sequence.

  20. Building a Multifunctional Aptamer-Based DNA Nanoassembly for Targeted Cancer Therapy

    PubMed Central

    Wu, Cuichen; Han, Da; Chen, Tao; Peng, Lu; Zhu, Guizhi; You, Mingxu; Qiu, Liping; Sefah, Kwame; Zhang, Xiaobing; Tan, Weihong

    2014-01-01

    The ability to self-assemble one-dimensional DNA building blocks into two- and three-dimensional nanostructures via DNA/RNA nanotechnology has led to broad applications in bioimaging, basic biological mechanism studies, disease diagnosis and drug delivery. However, the cellular uptake of most nucleic acid nanostructures is dependent on passive delivery or the enhanced permeability and retention effect, which may not be suitable for certain types of cancers, especially for treatment in vivo. To meet this need, we have constructed a multifunctional aptamer-based DNA nanoassembly (AptNA) for targeted cancer therapy. In particular, we first designed various Y-shaped functional DNA domains through predesigned base pair hybridization, including targeting aptamers, intercalated anticancer drugs and therapeutic antisense oligonucleotides. Then these functional DNA domains were linked to an X-shaped DNA core connector, termed a building unit, through the complementary sequences in the arms of functional domains and connector. Finally, hundreds (~100–200) of these basic building units with 5′-modification of acrydite groups were further photocrosslinked into a multifunctional and programmable aptamer-based nanoassembly structure able to take advantage of facile modular design and assembly, high programmability, excellent biostability and biocompatibility, as well as selective recognition and transportation. With these properties, AptNAs were demonstrated to have specific cytotoxic effect against leukemia cells. Moreover, the incorporation of therapeutic antisense oligonucleotides resulted in the inhibition of P-gp expression (a drug efflux pump to increase excretion of anticancer drugs), as well as a decrease in drug resistance. Therefore, these multifunctional and programmable aptamer-based DNA nanoassemblies show promise as candidates for targeted drug delivery and cancer therapy. PMID:24245521

  1. Combined DECS Analysis and Next-Generation Sequencing Enable Efficient Detection of Novel Plant RNA Viruses.

    PubMed

    Yanagisawa, Hironobu; Tomita, Reiko; Katsu, Koji; Uehara, Takuya; Atsumi, Go; Tateda, Chika; Kobayashi, Kappei; Sekine, Ken-Taro

    2016-03-01

    The presence of high molecular weight double-stranded RNA (dsRNA) within plant cells is an indicator of infection with RNA viruses as these possess genomic or replicative dsRNA. DECS (dsRNA isolation, exhaustive amplification, cloning, and sequencing) analysis has been shown to be capable of detecting unknown viruses. We postulated that a combination of DECS analysis and next-generation sequencing (NGS) would improve detection efficiency and usability of the technique. Here, we describe a model case in which we efficiently detected the presumed genome sequence of Blueberry shoestring virus (BSSV), a member of the genus Sobemovirus, which has not so far been reported. dsRNAs were isolated from BSSV-infected blueberry plants using the dsRNA-binding protein, reverse-transcribed, amplified, and sequenced using NGS. A contig of 4,020 nucleotides (nt) that shared similarities with sequences from other Sobemovirus species was obtained as a candidate of the BSSV genomic sequence. Reverse transcription (RT)-PCR primer sets based on sequences from this contig enabled the detection of BSSV in all BSSV-infected plants tested but not in healthy controls. A recombinant protein encoded by the putative coat protein gene was bound by the BSSV-antibody, indicating that the candidate sequence was that of BSSV itself. Our results suggest that a combination of DECS analysis and NGS, designated here as "DECS-C," is a powerful method for detecting novel plant viruses. PMID:27072419

  2. Combined DECS Analysis and Next-Generation Sequencing Enable Efficient Detection of Novel Plant RNA Viruses

    PubMed Central

    Yanagisawa, Hironobu; Tomita, Reiko; Katsu, Koji; Uehara, Takuya; Atsumi, Go; Tateda, Chika; Kobayashi, Kappei; Sekine, Ken-Taro

    2016-01-01

    The presence of high molecular weight double-stranded RNA (dsRNA) within plant cells is an indicator of infection with RNA viruses as these possess genomic or replicative dsRNA. DECS (dsRNA isolation, exhaustive amplification, cloning, and sequencing) analysis has been shown to be capable of detecting unknown viruses. We postulated that a combination of DECS analysis and next-generation sequencing (NGS) would improve detection efficiency and usability of the technique. Here, we describe a model case in which we efficiently detected the presumed genome sequence of Blueberry shoestring virus (BSSV), a member of the genus Sobemovirus, which has not so far been reported. dsRNAs were isolated from BSSV-infected blueberry plants using the dsRNA-binding protein, reverse-transcribed, amplified, and sequenced using NGS. A contig of 4,020 nucleotides (nt) that shared similarities with sequences from other Sobemovirus species was obtained as a candidate of the BSSV genomic sequence. Reverse transcription (RT)-PCR primer sets based on sequences from this contig enabled the detection of BSSV in all BSSV-infected plants tested but not in healthy controls. A recombinant protein encoded by the putative coat protein gene was bound by the BSSV-antibody, indicating that the candidate sequence was that of BSSV itself. Our results suggest that a combination of DECS analysis and NGS, designated here as “DECS-C,” is a powerful method for detecting novel plant viruses. PMID:27072419

  3. Predicting RNA secondary structures from sequence and probing data.

    PubMed

    Lorenz, Ronny; Wolfinger, Michael T; Tanzer, Andrea; Hofacker, Ivo L

    2016-07-01

    RNA secondary structures have proven essential for understanding the regulatory functions performed by RNA such as microRNAs, bacterial small RNAs, or riboswitches. This success is in part due to the availability of efficient computational methods for predicting RNA secondary structures. Recent advances focus on dealing with the inherent uncertainty of prediction by considering the ensemble of possible structures rather than the single most stable one. Moreover, the advent of high-throughput structural probing has spurred the development of computational methods that incorporate such experimental data as auxiliary information.

  4. Developing trends in aptamer-based biosensor devices and their applications.

    PubMed

    MacKay, Scott; Wishart, David; Xing, James Z; Chen, Jie

    2014-02-01

    Aptamers are, in general, easier to produce, easier to store and are able to bind to a wider variety of targets than antibodies. For these reasons, aptamers are gaining increasing popularity in environmental monitoring as well as disease detection and disease management applications. This review article examines the research and design of RNA and DNA aptamer based biosensor systems and applications as well as their potential for integration in effective biosensor devices. As single stranded DNA or RNA molecules that can bind to specific targets, aptamers are well suited for biomolecular recognition and sensing applications. Beyond being able to be designed for a near endless number of specific targets, aptamers can also be made which change their conformation in a predictable and consistent way upon binding. This can lead to many unique and effective detection methods using a variety of optical and electrochemical means.

  5. RNA sequencing of Sleeping Beauty transposon-induced tumors detects transposon-RNA fusions in forward genetic cancer screens

    PubMed Central

    Temiz, Nuri A.; Moriarity, Branden S.; Wolf, Natalie K.; Riordan, Jesse D.; Dupuy, Adam J.; Largaespada, David A.; Sarver, Aaron L.

    2016-01-01

    Forward genetic screens using Sleeping Beauty (SB)-mobilized T2/Onc transposons have been used to identify common insertion sites (CISs) associated with tumor formation. Recurrent sites of transposon insertion are commonly identified using ligation-mediated PCR (LM-PCR). Here, we use RNA sequencing (RNA-seq) data to directly identify transcriptional events mediated by T2/Onc. Surprisingly, the majority (∼80%) of LM-PCR identified junction fragments do not lead to observable changes in RNA transcripts. However, in CIS regions, direct transcriptional effects of transposon insertions are observed. We developed an automated method to systematically identify T2/Onc-genome RNA fusion sequences in RNA-seq data. RNA fusion-based CISs were identified corresponding to both DNA-based CISs (Cdkn2a, Mycl1, Nf2, Pten, Sema6d, and Rere) and additional regions strongly associated with cancer that were not observed by LM-PCR (Myc, Akt1, Pth, Csf1r, Fgfr2, Wisp1, Map3k5, and Map4k3). In addition to calculating recurrent CISs, we also present complementary methods to identify potential driver events via determination of strongly supported fusions and fusions with large transcript level changes in the absence of multitumor recurrence. These methods independently identify CIS regions and also point to cancer-associated genes like Braf. We anticipate RNA-seq analyses of tumors from forward genetic screens will become an efficient tool to identify causal events. PMID:26553456

  6. RNA sequencing of Sleeping Beauty transposon-induced tumors detects transposon-RNA fusions in forward genetic cancer screens.

    PubMed

    Temiz, Nuri A; Moriarity, Branden S; Wolf, Natalie K; Riordan, Jesse D; Dupuy, Adam J; Largaespada, David A; Sarver, Aaron L

    2016-01-01

    Forward genetic screens using Sleeping Beauty (SB)-mobilized T2/Onc transposons have been used to identify common insertion sites (CISs) associated with tumor formation. Recurrent sites of transposon insertion are commonly identified using ligation-mediated PCR (LM-PCR). Here, we use RNA sequencing (RNA-seq) data to directly identify transcriptional events mediated by T2/Onc. Surprisingly, the majority (∼80%) of LM-PCR identified junction fragments do not lead to observable changes in RNA transcripts. However, in CIS regions, direct transcriptional effects of transposon insertions are observed. We developed an automated method to systematically identify T2/Onc-genome RNA fusion sequences in RNA-seq data. RNA fusion-based CISs were identified corresponding to both DNA-based CISs (Cdkn2a, Mycl1, Nf2, Pten, Sema6d, and Rere) and additional regions strongly associated with cancer that were not observed by LM-PCR (Myc, Akt1, Pth, Csf1r, Fgfr2, Wisp1, Map3k5, and Map4k3). In addition to calculating recurrent CISs, we also present complementary methods to identify potential driver events via determination of strongly supported fusions and fusions with large transcript level changes in the absence of multitumor recurrence. These methods independently identify CIS regions and also point to cancer-associated genes like Braf. We anticipate RNA-seq analyses of tumors from forward genetic screens will become an efficient tool to identify causal events.

  7. RNA sequencing of Sleeping Beauty transposon-induced tumors detects transposon-RNA fusions in forward genetic cancer screens.

    PubMed

    Temiz, Nuri A; Moriarity, Branden S; Wolf, Natalie K; Riordan, Jesse D; Dupuy, Adam J; Largaespada, David A; Sarver, Aaron L

    2016-01-01

    Forward genetic screens using Sleeping Beauty (SB)-mobilized T2/Onc transposons have been used to identify common insertion sites (CISs) associated with tumor formation. Recurrent sites of transposon insertion are commonly identified using ligation-mediated PCR (LM-PCR). Here, we use RNA sequencing (RNA-seq) data to directly identify transcriptional events mediated by T2/Onc. Surprisingly, the majority (∼80%) of LM-PCR identified junction fragments do not lead to observable changes in RNA transcripts. However, in CIS regions, direct transcriptional effects of transposon insertions are observed. We developed an automated method to systematically identify T2/Onc-genome RNA fusion sequences in RNA-seq data. RNA fusion-based CISs were identified corresponding to both DNA-based CISs (Cdkn2a, Mycl1, Nf2, Pten, Sema6d, and Rere) and additional regions strongly associated with cancer that were not observed by LM-PCR (Myc, Akt1, Pth, Csf1r, Fgfr2, Wisp1, Map3k5, and Map4k3). In addition to calculating recurrent CISs, we also present complementary methods to identify potential driver events via determination of strongly supported fusions and fusions with large transcript level changes in the absence of multitumor recurrence. These methods independently identify CIS regions and also point to cancer-associated genes like Braf. We anticipate RNA-seq analyses of tumors from forward genetic screens will become an efficient tool to identify causal events. PMID:26553456

  8. Highly parallel single-molecule amplification approach based on agarose droplet polymerase chain reaction for efficient and cost-effective aptamer selection.

    PubMed

    Zhang, Wei Yun; Zhang, Wenhua; Liu, Zhiyuan; Li, Cong; Zhu, Zhi; Yang, Chaoyong James

    2012-01-01

    We have developed a novel method for efficiently screening affinity ligands (aptamers) from a complex single-stranded DNA (ssDNA) library by employing single-molecule emulsion polymerase chain reaction (PCR) based on the agarose droplet microfluidic technology. In a typical systematic evolution of ligands by exponential enrichment (SELEX) process, the enriched library is sequenced first, and tens to hundreds of aptamer candidates are analyzed via a bioinformatic approach. Possible candidates are then chemically synthesized, and their binding affinities are measured individually. Such a process is time-consuming, labor-intensive, inefficient, and expensive. To address these problems, we have developed a highly efficient single-molecule approach for aptamer screening using our agarose droplet microfluidic technology. Statistically diluted ssDNA of the pre-enriched library evolved through conventional SELEX against cancer biomarker Shp2 protein was encapsulated into individual uniform agarose droplets for droplet PCR to generate clonal agarose beads. The binding capacity of amplified ssDNA from each clonal bead was then screened via high-throughput fluorescence cytometry. DNA clones with high binding capacity and low K(d) were chosen as the aptamer and can be directly used for downstream biomedical applications. We have identified an ssDNA aptamer that selectively recognizes Shp2 with a K(d) of 24.9 nM. Compared to a conventional sequencing-chemical synthesis-screening work flow, our approach avoids large-scale DNA sequencing and expensive, time-consuming DNA synthesis of large populations of DNA candidates. The agarose droplet microfluidic approach is thus highly efficient and cost-effective for molecular evolution approaches and will find wide application in molecular evolution technologies, including mRNA display, phage display, and so on.

  9. RNA editing generates cellular subsets with diverse sequence within populations

    PubMed Central

    Harjanto, Dewi; Papamarkou, Theodore; Oates, Chris J.; Rayon-Estrada, Violeta; Papavasiliou, F. Nina; Papavasiliou, Anastasia

    2016-01-01

    RNA editing is a mutational mechanism that specifically alters the nucleotide content in transcribed RNA. However, editing rates vary widely, and could result from equivalent editing amongst individual cells, or represent an average of variable editing within a population. Here we present a hierarchical Bayesian model that quantifies the variance of editing rates at specific sites using RNA-seq data from both single cells, and a cognate bulk sample to distinguish between these two possibilities. The model predicts high variance for specific edited sites in murine macrophages and dendritic cells, findings that we validated experimentally by using targeted amplification of specific editable transcripts from single cells. The model also predicts changes in variance in editing rates for specific sites in dendritic cells during the course of LPS stimulation. Our data demonstrate substantial variance in editing signatures amongst single cells, supporting the notion that RNA editing generates diversity within cellular populations. PMID:27418407

  10. Aptamers Binding to c-Met Inhibiting Tumor Cell Migration.

    PubMed

    Piater, Birgit; Doerner, Achim; Guenther, Ralf; Kolmar, Harald; Hock, Bjoern

    2015-01-01

    The human receptor tyrosine kinase c-Met plays an important role in the control of critical cellular processes. Since c-Met is frequently over expressed or deregulated in human malignancies, blocking its activation is of special interest for therapy. In normal conditions, the c-Met receptor is activated by its bivalent ligand hepatocyte growth factor (HGF). Also bivalent antibodies can activate the receptor by cross linking, limiting therapeutic applications. We report the generation of the RNA aptamer CLN64 containing 2'-fluoro pyrimidine modifications by systematic evolution of ligands by exponential enrichment (SELEX). CLN64 and a previously described single-stranded DNA (ssDNA) aptamer CLN3 exhibited high specificities and affinities to recombinant and cellular expressed c-Met. Both aptamers effectively inhibited HGF-dependent c-Met activation, signaling and cell migration. We showed that these aptamers did not induce c-Met activation, revealing an advantage over bivalent therapeutic molecules. Both aptamers were shown to bind overlapping epitopes but only CLN3 competed with HGF binding to cMet. In addition to their therapeutic and diagnostic potential, CLN3 and CLN64 aptamers exhibit valuable tools to further understand the structural and functional basis for c-Met activation or inhibition by synthetic ligands and their interplay with HGF binding. PMID:26658271

  11. miRBase: integrating microRNA annotation and deep-sequencing data.

    PubMed

    Kozomara, Ana; Griffiths-Jones, Sam

    2011-01-01

    miRBase is the primary online repository for all microRNA sequences and annotation. The current release (miRBase 16) contains over 15,000 microRNA gene loci in over 140 species, and over 17,000 distinct mature microRNA sequences. Deep-sequencing technologies have delivered a sharp rise in the rate of novel microRNA discovery. We have mapped reads from short RNA deep-sequencing experiments to microRNAs in miRBase and developed web interfaces to view these mappings. The user can view all read data associated with a given microRNA annotation, filter reads by experiment and count, and search for microRNAs by tissue- and stage-specific expression. These data can be used as a proxy for relative expression levels of microRNA sequences, provide detailed evidence for microRNA annotations and alternative isoforms of mature microRNAs, and allow us to revisit previous annotations. miRBase is available online at: http://www.mirbase.org/.

  12. Sequence variation between 462 human individuals fine-tunes functional sites of RNA processing.

    PubMed

    Ferreira, Pedro G; Oti, Martin; Barann, Matthias; Wieland, Thomas; Ezquina, Suzana; Friedländer, Marc R; Rivas, Manuel A; Esteve-Codina, Anna; Rosenstiel, Philip; Strom, Tim M; Lappalainen, Tuuli; Guigó, Roderic; Sammeth, Michael

    2016-01-01

    Recent advances in the cost-efficiency of sequencing technologies enabled the combined DNA- and RNA-sequencing of human individuals at the population-scale, making genome-wide investigations of the inter-individual genetic impact on gene expression viable. Employing mRNA-sequencing data from the Geuvadis Project and genome sequencing data from the 1000 Genomes Project we show that the computational analysis of DNA sequences around splice sites and poly-A signals is able to explain several observations in the phenotype data. In contrast to widespread assessments of statistically significant associations between DNA polymorphisms and quantitative traits, we developed a computational tool to pinpoint the molecular mechanisms by which genetic markers drive variation in RNA-processing, cataloguing and classifying alleles that change the affinity of core RNA elements to their recognizing factors. The in silico models we employ further suggest RNA editing can moonlight as a splicing-modulator, albeit less frequently than genomic sequence diversity. Beyond existing annotations, we demonstrate that the ultra-high resolution of RNA-Seq combined from 462 individuals also provides evidence for thousands of bona fide novel elements of RNA processing-alternative splice sites, introns, and cleavage sites-which are often rare and lowly expressed but in other characteristics similar to their annotated counterparts. PMID:27617755

  13. Sequence variation between 462 human individuals fine-tunes functional sites of RNA processing

    NASA Astrophysics Data System (ADS)

    2016-09-01

    Recent advances in the cost-efficiency of sequencing technologies enabled the combined DNA- and RNA-sequencing of human individuals at the population-scale, making genome-wide investigations of the inter-individual genetic impact on gene expression viable. Employing mRNA-sequencing data from the Geuvadis Project and genome sequencing data from the 1000 Genomes Project we show that the computational analysis of DNA sequences around splice sites and poly-A signals is able to explain several observations in the phenotype data. In contrast to widespread assessments of statistically significant associations between DNA polymorphisms and quantitative traits, we developed a computational tool to pinpoint the molecular mechanisms by which genetic markers drive variation in RNA-processing, cataloguing and classifying alleles that change the affinity of core RNA elements to their recognizing factors. The in silico models we employ further suggest RNA editing can moonlight as a splicing-modulator, albeit less frequently than genomic sequence diversity. Beyond existing annotations, we demonstrate that the ultra-high resolution of RNA-Seq combined from 462 individuals also provides evidence for thousands of bona fide novel elements of RNA processing—alternative splice sites, introns, and cleavage sites—which are often rare and lowly expressed but in other characteristics similar to their annotated counterparts.

  14. Sequence variation between 462 human individuals fine-tunes functional sites of RNA processing

    PubMed Central

    Ferreira, Pedro G.; Oti, Martin; Barann, Matthias; Wieland, Thomas; Ezquina, Suzana; Friedländer, Marc R.; Rivas, Manuel A.; Esteve-Codina, Anna; Estivill, Xavier; Guigó, Roderic; Dermitzakis, Emmanouil; Antonarakis, Stylianos; Meitinger, Thomas; Strom, Tim M; Palotie, Aarno; François Deleuze, Jean; Sudbrak, Ralf; Lerach, Hans; Gut, Ivo; Syvänen, Ann-Christine; Gyllensten, Ulf; Schreiber, Stefan; Rosenstiel, Philip; Brunner, Han; Veltman, Joris; Hoen, Peter A.C.T; Jan van Ommen, Gert; Carracedo, Angel; Brazma, Alvis; Flicek, Paul; Cambon-Thomsen, Anne; Mangion, Jonathan; Bentley, David; Hamosh, Ada; Rosenstiel, Philip; Strom, Tim M; Lappalainen, Tuuli; Guigó, Roderic; Sammeth, Michael

    2016-01-01

    Recent advances in the cost-efficiency of sequencing technologies enabled the combined DNA- and RNA-sequencing of human individuals at the population-scale, making genome-wide investigations of the inter-individual genetic impact on gene expression viable. Employing mRNA-sequencing data from the Geuvadis Project and genome sequencing data from the 1000 Genomes Project we show that the computational analysis of DNA sequences around splice sites and poly-A signals is able to explain several observations in the phenotype data. In contrast to widespread assessments of statistically significant associations between DNA polymorphisms and quantitative traits, we developed a computational tool to pinpoint the molecular mechanisms by which genetic markers drive variation in RNA-processing, cataloguing and classifying alleles that change the affinity of core RNA elements to their recognizing factors. The in silico models we employ further suggest RNA editing can moonlight as a splicing-modulator, albeit less frequently than genomic sequence diversity. Beyond existing annotations, we demonstrate that the ultra-high resolution of RNA-Seq combined from 462 individuals also provides evidence for thousands of bona fide novel elements of RNA processing—alternative splice sites, introns, and cleavage sites—which are often rare and lowly expressed but in other characteristics similar to their annotated counterparts. PMID:27617755

  15. Aptamer-functionalized hydrogel diffraction gratings for the human thrombin detection.

    PubMed

    Wang, Xiaoqi; Wang, Xiaogong

    2013-07-01

    The aptamer-functionalized hydrogel diffraction gratings were successfully fabricated by incorporating an aptamer and its complementary sequence as crosslinking junctions in the network structure. The gratings showed a sensitive response to human thrombin as read out from the diffracted light.

  16. MicroRNA Expression Profile in Penile Cancer Revealed by Next-Generation Small RNA Sequencing

    PubMed Central

    Zhang, Yuanwei; Xu, Bo; Zhou, Jun; Fan, Song; Hao, Zongyao; Shi, Haoqiang; Zhang, Xiansheng; Kong, Rui; Xu, Lingfan; Gao, Jingjing; Zou, Duohong; Liang, Chaozhao

    2015-01-01

    Penile cancer (PeCa) is a relatively rare tumor entity but possesses higher morbidity and mortality rates especially in developing countries. To date, the concrete pathogenic signaling pathways and core machineries involved in tumorigenesis and progression of PeCa remain to be elucidated. Several studies suggested miRNAs, which modulate gene expression at posttranscriptional level, were frequently mis-regulated and aberrantly expressed in human cancers. However, the miRNA profile in human PeCa has not been reported before. In this present study, the miRNA profile was obtained from 10 fresh penile cancerous tissues and matched adjacent non-cancerous tissues via next-generation sequencing. As a result, a total of 751 and 806 annotated miRNAs were identified in normal and cancerous penile tissues, respectively. Among which, 56 miRNAs with significantly different expression levels between paired tissues were identified. Subsequently, several annotated miRNAs were selected randomly and validated using quantitative real-time PCR. Compared with the previous publications regarding to the altered miRNAs expression in various cancers and especially genitourinary (prostate, bladder, kidney, testis) cancers, the most majority of deregulated miRNAs showed the similar expression pattern in penile cancer. Moreover, the bioinformatics analyses suggested that the putative target genes of differentially expressed miRNAs between cancerous and matched normal penile tissues were tightly associated with cell junction, proliferation, growth as well as genomic instability and so on, by modulating Wnt, MAPK, p53, PI3K-Akt, Notch and TGF-β signaling pathways, which were all well-established to participate in cancer initiation and progression. Our work presents a global view of the differentially expressed miRNAs and potentially regulatory networks of their target genes for clarifying the pathogenic transformation of normal penis to PeCa, which research resource also provides new insights

  17. Informatics for RNA Sequencing: A Web Resource for Analysis on the Cloud.

    PubMed

    Griffith, Malachi; Walker, Jason R; Spies, Nicholas C; Ainscough, Benjamin J; Griffith, Obi L

    2015-08-01

    Massively parallel RNA sequencing (RNA-seq) has rapidly become the assay of choice for interrogating RNA transcript abundance and diversity. This article provides a detailed introduction to fundamental RNA-seq molecular biology and informatics concepts. We make available open-access RNA-seq tutorials that cover cloud computing, tool installation, relevant file formats, reference genomes, transcriptome annotations, quality-control strategies, expression, differential expression, and alternative splicing analysis methods. These tutorials and additional training resources are accompanied by complete analysis pipelines and test datasets made available without encumbrance at www.rnaseq.wiki.

  18. Phylogenetic analysis of oryx species using partial sequences of mitochondrial rRNA genes.

    PubMed

    Khan, H A; Arif, I A; Al Farhan, A H; Al Homaidan, A A

    2008-01-01

    We conducted a comparative evaluation of 12S rRNA and 16S rRNA genes of the mitochondrial genome for molecular differentiation among three oryx species (Oryx leucoryx, Oryx dammah and Oryx gazella) with respect to two closely related outgroups, addax and roan. Our findings showed the failure of 12S rRNA gene to differentiate between the genus Oryx and addax, whereas a 342-bp partial sequence of 16S rRNA accurately grouped all five taxa studied, suggesting the utility of 16S rRNA segment for molecular phylogeny of oryx at the genus and possibly species levels. PMID:19048493

  19. Informatics for RNA Sequencing: A Web Resource for Analysis on the Cloud

    PubMed Central

    Griffith, Malachi; Walker, Jason R.; Spies, Nicholas C.; Ainscough, Benjamin J.; Griffith, Obi L.

    2015-01-01

    Massively parallel RNA sequencing (RNA-seq) has rapidly become the assay of choice for interrogating RNA transcript abundance and diversity. This article provides a detailed introduction to fundamental RNA-seq molecular biology and informatics concepts. We make available open-access RNA-seq tutorials that cover cloud computing, tool installation, relevant file formats, reference genomes, transcriptome annotations, quality-control strategies, expression, differential expression, and alternative splicing analysis methods. These tutorials and additional training resources are accompanied by complete analysis pipelines and test datasets made available without encumbrance at www.rnaseq.wiki. PMID:26248053

  20. Analysis of a marine picoplankton community by 16S rRNA gene cloning and sequencing.

    PubMed Central

    Schmidt, T M; DeLong, E F; Pace, N R

    1991-01-01

    The phylogenetic diversity of an oligotrophic marine picoplankton community was examined by analyzing the sequences of cloned ribosomal genes. This strategy does not rely on cultivation of the resident microorganisms. Bulk genomic DNA was isolated from picoplankton collected in the north central Pacific Ocean by tangential flow filtration. The mixed-population DNA was fragmented, size fractionated, and cloned into bacteriophage lambda. Thirty-eight clones containing 16S rRNA genes were identified in a screen of 3.2 x 10(4) recombinant phage, and portions of the rRNA gene were amplified by polymerase chain reaction and sequenced. The resulting sequences were used to establish the identities of the picoplankton by comparison with an established data base of rRNA sequences. Fifteen unique eubacterial sequences were obtained, including four from cyanobacteria and eleven from proteobacteria. A single eucaryote related to dinoflagellates was identified; no archaebacterial sequences were detected. The cyanobacterial sequences are all closely related to sequences from cultivated marine Synechococcus strains and with cyanobacterial sequences obtained from the Atlantic Ocean (Sargasso Sea). Several sequences were related to common marine isolates of the gamma subdivision of proteobacteria. In addition to sequences closely related to those of described bacteria, sequences were obtained from two phylogenetic groups of organisms that are not closely related to any known rRNA sequences from cultivated organisms. Both of these novel phylogenetic clusters are proteobacteria, one group within the alpha subdivision and the other distinct from known proteobacterial subdivisions. The rRNA sequences of the alpha-related group are nearly identical to those of some Sargasso Sea picoplankton, suggesting a global distribution of these organisms. Images PMID:2066334

  1. New perspectives on the diversification of the RNA interference system: insights from comparative genomics and small RNA sequencing

    PubMed Central

    Burroughs, Alexander Maxwell; Ando, Yoshinari; Aravind, L

    2014-01-01

    Our understanding of the pervasive involvement of small RNAs in regulating diverse biological processes has been greatly augmented by recent application of deep-sequencing technologies to small RNA across diverse eukaryotes. We review the currently-known small RNA classes and place them in context of the reconstructed evolutionary history of the RNAi protein machinery. This synthesis indicates the earliest versions of eukaryotic RNAi systems likely utilized small RNA processed from three types of precursors: 1) sense-antisense transcriptional products, 2) genome-encoded, imperfectly-complementary hairpin sequences, and 3) larger non-coding RNA precursor sequences. Structural dissection of PIWI proteins along with recent discovery of novel families (including Med13 of the Mediator complex) suggest that emergence of a distinct architecture with the N-terminal domains (also occurring separately fused to endoDNases in prokaryotes) formed via duplication of an ancestral unit was key to their recruitment as primary RNAi effectors and use of small RNAs of certain preferred lengths. Prokaryotic PIWI proteins are typically components of several RNA-directed DNA restriction or CRISPR/Cas systems. However, eukaryotic versions appear to have emerged from a subset that evolved RNA-directed RNA interference. They were recruited alongside RNaseIII domains and RdRP domains, also from prokaryotic systems, to form the core eukaryotic RNAi system. Like certain regulatory systems, RNAi diversified into two distinct but linked arms concomitant with eukaryotic nucleo-cytoplasmic compartmentalization. Subsequent elaboration of RNAi proceeded via diversification of the core protein machinery through lineage-specific expansions and recruitment of new components from prokaryotes (nucleases and small RNA-modifying enzymes), allowing for diversification of associating small RNAs. PMID:24311560

  2. Empirical analysis of RNA robustness and evolution using high-throughput sequencing of ribozyme reactions.

    PubMed

    Hayden, Eric J

    2016-08-15

    RNA molecules provide a realistic but tractable model of a genotype to phenotype relationship. This relationship has been extensively investigated computationally using secondary structure prediction algorithms. Enzymatic RNA molecules, or ribozymes, offer access to genotypic and phenotypic information in the laboratory. Advancements in high-throughput sequencing technologies have enabled the analysis of sequences in the lab that now rivals what can be accomplished computationally. This has motivated a resurgence of in vitro selection experiments and opened new doors for the analysis of the distribution of RNA functions in genotype space. A body of computational experiments has investigated the persistence of specific RNA structures despite changes in the primary sequence, and how this mutational robustness can promote adaptations. This article summarizes recent approaches that were designed to investigate the role of mutational robustness during the evolution of RNA molecules in the laboratory, and presents theoretical motivations, experimental methods and approaches to data analysis. PMID:27215494

  3. miRNA Nomenclature: A View Incorporating Genetic Origins, Biosynthetic Pathways, and Sequence Variants.

    PubMed

    Desvignes, T; Batzel, P; Berezikov, E; Eilbeck, K; Eppig, J T; McAndrews, M S; Singer, A; Postlethwait, J H

    2015-11-01

    High-throughput sequencing of miRNAs has revealed the diversity and variability of mature and functional short noncoding RNAs, including their genomic origins, biogenesis pathways, sequence variability, and newly identified products such as miRNA-offset RNAs (moRs). Here we review known cases of alternative mature miRNA-like RNA fragments and propose a revised definition of miRNAs to encompass this diversity. We then review nomenclature guidelines for miRNAs and propose to extend nomenclature conventions to align with those for protein-coding genes established by international consortia. Finally, we suggest a system to encompass the full complexity of sequence variations (i.e., isomiRs) in the analysis of small RNA sequencing experiments.

  4. RNA sequence and transcriptional properties of the 3' end of the Newcastle disease virus genome

    SciTech Connect

    Kurilla, M.G.; Stone, H.O.; Keene, J.D.

    1985-09-01

    The 3' end of the genomic RNA of Newcastle disease virus (NDV) has been sequenced and the leader RNA defined. Using hybridization to a 3'-end-labeled genome, leader RNA species from in vitro transcription reactions and from infected cell extracts were found to be 47 and 53 nucleotides long. In addition, the start site of the 3'-proximal mRNA was determined by sequence analysis of in vitro (beta-32P)GTP-labeled transcription products. The genomic sequence extending beyond the leader region demonstrated an open reading frame for at least 42 amino acids and probably represents the amino terminus of the nucleocapsid protein (NP). The terminal 8 nucleotides of the NDV genome were identical to those of measles virus and Sendai virus while the sequence of the distal half of the leader region was more similar to that of vesicular stomatitis virus. These data argue for strong evolutionary relatedness between the paramyxovirus and rhabdovirus groups.

  5. Nucleotide sequence of the SrRNA gene and phylogenetic analysis of Trichomonas tenax.

    PubMed

    Fukura, K; Yamamoto, A; Hashimoto, T; Goto, N

    1996-01-01

    The small subunit ribosomal RNA (SrRNA) gene of Trichomonas tenax ATCC30207 was amplified by PCR and the 1.55-kb product was cloned into plasmid vector pUC18. Four clones were isolated and sequenced. The insert DNAs were 1,552 bp long and their G+C contents were 48.1%; three of them had exactly the same DNA sequences and one had only one nucleotide change. A representative SrRNA sequence was analyzed and a phylogenetic tree was estimated by the neighbor-joining (NJ) method. Among the protists examined, T. tenax was placed as the closest relative of Tritrichomonas foetus, as expected from the traditional taxonomy. The total homology between the two SrRNA sequences was 89.2%.

  6. Complete Sequence Construction of the Highly Repetitive Ribosomal RNA Gene Repeats in Eukaryotes Using Whole Genome Sequence Data.

    PubMed

    Agrawal, Saumya; Ganley, Austen R D

    2016-01-01

    The ribosomal RNA genes (rDNA) encode the major rRNA species of the ribosome, and thus are essential across life. These genes are highly repetitive in most eukaryotes, forming blocks of tandem repeats that form the core of nucleoli. The primary role of the rDNA in encoding rRNA has been long understood, but more recently the rDNA has been implicated in a number of other important biological phenomena, including genome stability, cell cycle, and epigenetic silencing. Noncoding elements, primarily located in the intergenic spacer region, appear to mediate many of these phenomena. Although sequence information is available for the genomes of many organisms, in almost all cases rDNA repeat sequences are lacking, primarily due to problems in assembling these intriguing regions during whole genome assemblies. Here, we present a method to obtain complete rDNA repeat unit sequences from whole genome assemblies. Limitations of next generation sequencing (NGS) data make them unsuitable for assembling complete rDNA unit sequences; therefore, the method we present relies on the use of Sanger whole genome sequence data. Our method makes use of the Arachne assembler, which can assemble highly repetitive regions such as the rDNA in a memory-efficient way. We provide a detailed step-by-step protocol for generating rDNA sequences from whole genome Sanger sequence data using Arachne, for refining complete rDNA unit sequences, and for validating the sequences obtained. In principle, our method will work for any species where the rDNA is organized into tandem repeats. This will help researchers working on species without a complete rDNA sequence, those working on evolutionary aspects of the rDNA, and those interested in conducting phylogenetic footprinting studies with the rDNA. PMID:27576718

  7. Comprehensive analysis of human small RNA sequencing data provides insights into expression profiles and miRNA editing

    PubMed Central

    Gong, Jing; Wu, Yuliang; Zhang, Xiantong; Liao, Yifang; Sibanda, Vusumuzi Leroy; Liu, Wei; Guo, An-Yuan

    2014-01-01

    MicroRNAs (miRNAs) play key regulatory roles in various biological processes and diseases. A comprehensive analysis of large scale small RNA sequencing data (smRNA-seq) will be very helpful to explore tissue or disease specific miRNA markers and uncover miRNA variants. Here, we systematically analyzed 410 human smRNA-seq datasets, which samples are from 24 tissue/disease/cell lines. We tested the mapping strategies and found that it was necessary to make multiple-round mappings with different mismatch parameters. miRNA expression profiles revealed that on average ∼70% of known miRNAs were expressed at low level or not expressed (RPM < 1) in a sample and only ∼9% of known miRNAs were relatively highly expressed (RPM > 100). About 30% known miRNAs were not expressed in all of our used samples. The miRNA expression profiles were compiled into an online database (HMED, http://bioinfo.life.hust.edu.cn/smallRNA/). Dozens of tissue/disease specific miRNAs, disease/control dysregulated miRNAs and miRNAs with arm switching events were discovered. Further, we identified some highly confident editing sites including 24 A-to-I sites and 23 C-to-U sites. About half of them were widespread miRNA editing sites in different tissues. We characterized that the 2 types of editing sites have different features with regard to location, editing level and frequency. Our analyses for expression profiles, specific miRNA markers, arm switching, and editing sites, may provide valuable information for further studies of miRNA function and biomarker finding. PMID:25692236

  8. Next-generation Sequencing of 16S Ribosomal RNA Gene Amplicons

    PubMed Central

    Sanschagrin, Sylvie; Yergeau, Etienne

    2014-01-01

    One of the major questions in microbial ecology is “who is there?” This question can be answered using various tools, but one of the long-lasting gold standards is to sequence 16S ribosomal RNA (rRNA) gene amplicons generated by domain-level PCR reactions amplifying from genomic DNA. Traditionally, this was performed by cloning and Sanger (capillary electrophoresis) sequencing of PCR amplicons. The advent of next-generation sequencing has tremendously simplified and increased the sequencing depth for 16S rRNA gene sequencing. The introduction of benchtop sequencers now allows small labs to perform their 16S rRNA sequencing in-house in a matter of days. Here, an approach for 16S rRNA gene amplicon sequencing using a benchtop next-generation sequencer is detailed. The environmental DNA is first amplified by PCR using primers that contain sequencing adapters and barcodes. They are then coupled to spherical particles via emulsion PCR. The particles are loaded on a disposable chip and the chip is inserted in the sequencing machine after which the sequencing is performed. The sequences are retrieved in fastq format, filtered and the barcodes are used to establish the sample membership of the reads. The filtered and binned reads are then further analyzed using publically available tools. An example analysis where the reads were classified with a taxonomy-finding algorithm within the software package Mothur is given. The method outlined here is simple, inexpensive and straightforward and should help smaller labs to take advantage from the ongoing genomic revolution. PMID:25226019

  9. Method for rapid base sequencing in DNA and RNA with two base labeling

    DOEpatents

    Jett, James H.; Keller, Richard A.; Martin, John C.; Posner, Richard G.; Marrone, Babetta L.; Hammond, Mark L.; Simpson, Daniel J.

    1995-01-01

    Method for rapid-base sequencing in DNA and RNA with two-base labeling and employing fluorescent detection of single molecules at two wavelengths. Bases modified to accept fluorescent labels are used to replicate a single DNA or RNA strand to be sequenced. The bases are then sequentially cleaved from the replicated strand, excited with a chosen spectrum of electromagnetic radiation, and the fluorescence from individual, tagged bases detected in the order of cleavage from the strand.

  10. Method for rapid base sequencing in DNA and RNA with two base labeling

    DOEpatents

    Jett, J.H.; Keller, R.A.; Martin, J.C.; Posner, R.G.; Marrone, B.L.; Hammond, M.L.; Simpson, D.J.

    1995-04-11

    A method is described for rapid-base sequencing in DNA and RNA with two-base labeling and employing fluorescent detection of single molecules at two wavelengths. Bases modified to accept fluorescent labels are used to replicate a single DNA or RNA strand to be sequenced. The bases are then sequentially cleaved from the replicated strand, excited with a chosen spectrum of electromagnetic radiation, and the fluorescence from individual, tagged bases detected in the order of cleavage from the strand. 4 figures.

  11. ARM-Seq: AlkB-facilitated RNA methylation sequencing reveals a complex landscape of modified tRNA fragments

    PubMed Central

    Cozen, Aaron E.; Quartley, Erin; Holmes, Andrew D.; Robinson, Eva H.; Phizicky, Eric M.; Lowe, Todd M.

    2015-01-01

    High throughput RNA sequencing has accelerated discovery of the complex regulatory roles of small RNAs, but RNAs containing modified nucleosides may escape detection when those modifications interfere with reverse transcription during RNA-seq library preparation. Here we describe AlkB-facilitated RNA Methylation sequencing (ARM-Seq) which uses pre-treatment with Escherichia coli AlkB to demethylate 1-methyladenosine, 3-methylcytidine, and 1-methylguanosine, all commonly found in transfer RNAs. Comparative methylation analysis using ARM-Seq provides the first detailed, transcriptome-scale map of these modifications, and reveals an abundance of previously undetected, methylated small RNAs derived from tRNAs. ARM-Seq demonstrates that tRNA-derived small RNAs accurately recapitulate the m1A modification state for well-characterized yeast tRNAs, and generates new predictions for a large number of human tRNAs, including tRNA precursors and mitochondrial tRNAs. Thus, ARM-Seq provides broad utility for identifying previously overlooked methyl-modified RNAs, can efficiently monitor methylation state, and may reveal new roles for tRNA-derived RNAs as biomarkers or signaling molecules. PMID:26237225

  12. A novel mRNA 3' untranslated region translational control sequence regulates Xenopus Wee1 mRNA translation.

    PubMed

    Wang, Yi Ying; Charlesworth, Amanda; Byrd, Shannon M; Gregerson, Robert; MacNicol, Melanie C; MacNicol, Angus M

    2008-05-15

    Cell cycle progression during oocyte maturation requires the strict temporal regulation of maternal mRNA translation. The intrinsic basis of this temporal control has not been fully elucidated but appears to involve distinct mRNA 3' UTR regulatory elements. In this study, we identify a novel translational control sequence (TCS) that exerts repression of target mRNAs in immature oocytes of the frog, Xenopus laevis, and can direct early cytoplasmic polyadenylation and translational activation during oocyte maturation. The TCS is functionally distinct from the previously characterized Musashi/polyadenylation response element (PRE) and the cytoplasmic polyadenylation element (CPE). We report that TCS elements exert translational repression in both the Wee1 mRNA 3' UTR and the pericentriolar material-1 (Pcm-1) mRNA 3' UTR in immature oocytes. During oocyte maturation, TCS function directs the early translational activation of the Pcm-1 mRNA. By contrast, we demonstrate that CPE sequences flanking the TCS elements in the Wee1 3' UTR suppress the ability of the TCS to direct early translational activation. Our results indicate that a functional hierarchy exists between these distinct 3' UTR regulatory elements to control the timing of maternal mRNA translational activation during oocyte maturation.

  13. Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity.

    PubMed

    Wang, Deng-Liang; Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan; Yang, Hai-Tao; Wang, Jiang-Jie; Yao, Pei-Sen; Pan, Ru-Jun; Yang, Chaoyong James; Kang, De-Zhi

    2014-10-31

    Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher's attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with Kd 56±7.3nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy.

  14. Inhibition of pre-mRNA splicing by a synthetic Blom7α-interacting small RNA.

    PubMed

    Löscher, Marlies; Schosserer, Markus; Dausse, Eric; Lee, Kiseok; Ajuh, Paul; Grillari-Voglauer, Regina; Lamond, Angus I; Toulmé, Jean-Jacques; Grillari, Johannes

    2012-01-01

    Originally the novel protein Blom7α was identified as novel pre-mRNA splicing factor that interacts with SNEV(Prp19/Pso4), an essential protein involved in extension of human endothelial cell life span, DNA damage repair, the ubiquitin-proteasome system, and pre-mRNA splicing. Blom7α belongs to the heteronuclear ribonucleoprotein K homology (KH) protein family, displaying 2 KH domains, a well conserved and widespread RNA-binding motif. In order to identify specific sequence binding motifs, we here used Systematic Evolution of Ligands by Exponential Enrichment (SELEX) with a synthetic RNA library. Besides sequence motifs like (U/A)(1-4) C(2-6) (U/A)(1-5), we identified an AC-rich RNA-aptamer that we termed AK48 (Aptamer KH-binding 48), binding to Blom7α with high affinity. Addition of AK48 to pre-mRNA splicing reactions in vitro inhibited the formation of mature spliced mRNA and led to a slight accumulation of the H complex of the spliceosome. These results suggest that the RNA binding activity of Blom7α might be required for pre-mRNA splicing catalysis. The inhibition of in-vitro splicing by the small RNA AK48 indicates the potential use of small RNA molecules in targeting the spliceosome complex as a novel target for drug development. PMID:23144703

  15. Binding of an RNA aptamer and a partial peptide of a prion protein: crucial importance of water entropy in molecular recognition.

    PubMed

    Hayashi, Tomohiko; Oshima, Hiraku; Mashima, Tsukasa; Nagata, Takashi; Katahira, Masato; Kinoshita, Masahiro

    2014-06-01

    It is a central issue to elucidate the new type of molecular recognition accompanied by a global structural change of a molecule upon binding to its targets. Here we investigate the driving force for the binding of R12 (a ribonucleic acid aptamer) and P16 (a partial peptide of a prion protein) during which P16 exhibits the global structural change. We calculate changes in thermodynamic quantities upon the R12-P16 binding using a statistical-mechanical approach combined with molecular models for water which is currently best suited to studies on hydration of biomolecules. The binding is driven by a water-entropy gain originating primarily from an increase in the total volume available to the translational displacement of water molecules in the system. The energy decrease due to the gain of R12-P16 attractive (van der Waals and electrostatic) interactions is almost canceled out by the energy increase related to the loss of R12-water and P16-water attractive interactions. We can explain the general experimental result that stacking of flat moieties, hydrogen bonding and molecular-shape and electrostatic complementarities are frequently observed in the complexes. It is argued that the water-entropy gain is largely influenced by the geometric characteristics (overall shapes, sizes and detailed polyatomic structures) of the biomolecules.

  16. A tale of two sequences: microRNA-target chimeric reads.

    PubMed

    Broughton, James P; Pasquinelli, Amy E

    2016-04-04

    In animals, a functional interaction between a microRNA (miRNA) and its target RNA requires only partial base pairing. The limited number of base pair interactions required for miRNA targeting provides miRNAs with broad regulatory potential and also makes target prediction challenging. Computational approaches to target prediction have focused on identifying miRNA target sites based on known sequence features that are important for canonical targeting and may miss non-canonical targets. Current state-of-the-art experimental approaches, such as CLIP-seq (cross-linking immunoprecipitation with sequencing), PAR-CLIP (photoactivatable-ribonucleoside-enhanced CLIP), and iCLIP (individual-nucleotide resolution CLIP), require inference of which miRNA is bound at each site. Recently, the development of methods to ligate miRNAs to their target RNAs during the preparation of sequencing libraries has provided a new tool for the identification of miRNA target sites. The chimeric, or hybrid, miRNA-target reads that are produced by these methods unambiguously identify the miRNA bound at a specific target site. The information provided by these chimeric reads has revealed extensive non-canonical interactions between miRNAs and their target mRNAs, and identified many novel interactions between miRNAs and noncoding RNAs.

  17. High-Throughput Mapping of Single-Neuron Projections by Sequencing of Barcoded RNA.

    PubMed

    Kebschull, Justus M; Garcia da Silva, Pedro; Reid, Ashlan P; Peikon, Ian D; Albeanu, Dinu F; Zador, Anthony M

    2016-09-01

    Neurons transmit information to distant brain regions via long-range axonal projections. In the mouse, area-to-area connections have only been systematically mapped using bulk labeling techniques, which obscure the diverse projections of intermingled single neurons. Here we describe MAPseq (Multiplexed Analysis of Projections by Sequencing), a technique that can map the projections of thousands or even millions of single neurons by labeling large sets of neurons with random RNA sequences ("barcodes"). Axons are filled with barcode mRNA, each putative projection area is dissected, and the barcode mRNA is extracted and sequenced. Applying MAPseq to the locus coeruleus (LC), we find that individual LC neurons have preferred cortical targets. By recasting neuroanatomy, which is traditionally viewed as a problem of microscopy, as a problem of sequencing, MAPseq harnesses advances in sequencing technology to permit high-throughput interrogation of brain circuits.