Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

[Progress in application of targeting viral vector regulated by microRNA in gene therapy: a review].

PubMed

Zhang, Guohai; Wang, Qizhao; Zhang, Jinghong; Xu, Ruian

2010-06-01

A safe and effective targeting viral vector is the key factor for successful clinical gene therapy. microRNA, a class of small, single-stranded endogenous RNAs, act as post-transcriptional regulators of gene expression. The discovery of these kind regulatory elements provides a new approach to regulate gene expression more accurately. In this review, we elucidated the principle of microRNA in regulation of targeting viral vector. The applications of microRNA in the fields of elimination contamination from replication competent virus, reduction of transgene-specific immunity, promotion of cancer-targeted gene therapy and development of live attenuated vaccines were also discussed.

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis

PubMed Central

Santangeloyz, K.S.; Bertoneyz, A.L.

2011-01-01

summary Objective To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Methods Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RTPCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2−ΔΔCT) method. Results Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P= 0.0045) or >90% (P= 0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Conclusions Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. PMID:21945742

Development of recombinant adeno-associated virus vectors carrying small interfering RNA (shHec1)-mediated depletion of kinetochore Hec1 protein in tumor cells.

PubMed

Li, L; Yang, L; Scudiero, D A; Miller, S A; Yu, Z-X; Stukenberg, P T; Shoemaker, R H; Kotin, R M

2007-05-01

Transcript depletion using small interfering RNA (siRNA) technology represents a potentially valuable technique for the treatment of cancer. However, delivering therapeutic quantities of siRNA into solid tumors by chemical transfection is not feasible, whereas viral vectors efficiently transduce many human tumor cell lines. Yet producing sufficient quantities of viral vectors that elicit acute and selective cytotoxicity remains a major obstacle for preclinical and clinical trials. Using the invertebrate Spodoptera frugiperda (Sf9) cell line, we were able to produce high titer stocks of cytotoxic recombinant adeno-associated virus (rAAV) that express short hairpin RNA (shRNA) and that efficiently deplete Hec1 (highly expressed in cancer 1), or Kntc2 (kinetochore-associated protein 2), a kinetochore protein directly involved in kinetochore microtubule interactions, chromosome congression and spindle checkpoint signaling. Depletion of Hec1 protein results in persistent spindle checkpoint activation followed by cell death. Because Hec1 expression and activity are only present in mitotic cells, non-dividing cells were not affected by rAAV treatment. On the basis of the results of screening 56 human tumor cell lines with three different serotype vectors, we used a tumor xenograft model to test the effects in vivo. The effects of the shHec1 vector were evident in sectioned and stained tumors. The experiments with rAAV-shRNA vectors demonstrate the utility of producing vectors in invertebrate cells to obtain sufficient concentrations and quantities for solid tumor therapy. This addresses an important requirement for cancer gene therapy, to produce cytotoxic vectors in sufficient quantities and concentrations to enable quantitative transduction and selective killing of solid tumor cells.

Virus-Derived Gene Expression and RNA Interference Vector for Grapevine

PubMed Central

Kurth, Elizabeth G.; Peremyslov, Valera V.; Prokhnevsky, Alexey I.; Kasschau, Kristin D.; Miller, Marilyn; Carrington, James C.

2012-01-01

The improvement of the agricultural and wine-making qualities of the grapevine (Vitis vinifera) is hampered by adherence to traditional varieties, the recalcitrance of this plant to genetic modifications, and public resistance to genetically modified organism (GMO) technologies. To address these challenges, we developed an RNA virus-based vector for the introduction of desired traits into grapevine without heritable modifications to the genome. This vector expresses recombinant proteins in the phloem tissue that is involved in sugar transport throughout the plant, from leaves to roots to berries. Furthermore, the vector provides a powerful RNA interference (RNAi) capability of regulating the expression of endogenous genes via virus-induced gene-silencing (VIGS) technology. Additional advantages of this vector include superb genetic capacity and stability, as well as the swiftness of technology implementation. The most significant applications of the viral vector include functional genomics of the grapevine and disease control via RNAi-enabled vaccination against pathogens or invertebrate pests. PMID:22438553

Double-stranded RNA innate immune response activation from long-term adeno-associated virus vector transduction.

PubMed

Shao, Wenwei; Earley, Lauriel F; Chai, Zheng; Chen, Xiaojing; Sun, Junjiang; He, Ting; Deng, Meng; Hirsch, Matthew L; Ting, Jenny; Samulski, R Jude; Li, Chengwen

2018-06-21

Data from clinical trials for hemophilia B using adeno-associated virus (AAV) vectors have demonstrated decreased transgenic coagulation factor IX (hFIX) expression 6-10 weeks after administration of a high vector dose. While it is likely that capsid-specific cytotoxic T lymphocytes eliminate vector-transduced hepatocytes, thereby resulting in decreased hFIX, this observation is not intuitively consistent with restored hFIX levels following prednisone application. Although the innate immune response is immediately activated following AAV vector infection via TLR pathways, no studies exist regarding the role of the innate immune response at later time points after AAV vector transduction. Herein, activation of the innate immune response in cell lines, primary human hepatocytes, and hepatocytes in a human chimeric mouse model was observed at later time points following AAV vector transduction. Mechanistic analysis demonstrated that the double-stranded RNA (dsRNA) sensor MDA5 was necessary for innate immune response activation and that transient knockdown of MDA5, or MAVS, decreased IFN-β expression while increasing transgene production in AAV-transduced cells. These results both highlight the role of the dsRNA-triggered innate immune response in therapeutic transgene expression at later time points following AAV transduction and facilitate the execution of effective strategies to block the dsRNA innate immune response in future clinical trials.

Gene Suppression of Mouse Testis In Vivo Using Small Interfering RNA Derived from Plasmid Vectors

PubMed Central

Takizawa, Takami; Ishikawa, Tomoko; Kosuge, Takuji; Mizuguchi, Yoshiaki; Sato, Yoko; Koji, Takehiko; Araki, Yoshihiko; Takizawa, Toshihiro

2012-01-01

We evaluated whether inhibiting gene expression by small interfering RNA (siRNA) can be used for an in vivo model using a germ cell-specific gene (Tex101) as a model target in mouse testis. We generated plasmid-based expression vectors of siRNA targeting the Tex101 gene and transfected them into postnatal day 10 mouse testes by in vivo electroporation. After optimizing the electroporation conditions using a vector transfected into the mouse testis, a combination of high- and low-voltage pulses showed excellent transfection efficiency for the vectors with minimal tissue damage, but gene suppression was transient. Gene suppression by in vivo electroporation may be helpful as an alternative approach when designing experiments to unravel the basic role of testicular molecules. PMID:22489107

Tombusvirus-based vector systems to permit over-expression of genes or that serve as sensors of antiviral RNA silencing in plants.

PubMed

Shamekova, Malika; Mendoza, Maria R; Hsieh, Yi-Cheng; Lindbo, John; Omarov, Rustem T; Scholthof, Herman B

2014-03-01

A next generation Tomato bushy stunt virus (TBSV) coat protein gene replacement vector system is described that can be applied by either RNA inoculation or through agroinfiltration. A vector expressing GFP rapidly yields high levels of transient gene expression in inoculated leaves of various plant species, as illustrated for Nicotiana benthamiana, cowpea, tomato, pepper, and lettuce. A start-codon mutation to down-regulate the dose of the P19 silencing suppressor reduces GFP accumulation, whereas mutations that result in undetectable levels of P19 trigger rapid silencing of GFP. Compared to existing virus vectors the TBSV system has a unique combination of a very broad host range, rapid and high levels of replication and gene expression, and the ability to regulate its suppressor. These features are attractive for quick transient assays in numerous plant species for over-expression of genes of interest, or as a sensor to monitor the efficacy of antiviral RNA silencing. Copyright © 2014. Published by Elsevier Inc.

A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs.

PubMed

Romanienko, Peter J; Giacalone, Joseph; Ingenito, Joanne; Wang, Yijie; Isaka, Mayumi; Johnson, Thomas; You, Yun; Mark, Willie H

2016-01-01

The genomes of more than 50 organisms have now been manipulated due to rapid advancement of gene editing technology. One way to perform gene editing in the mouse using the CRISPR/CAS system, guide RNA (gRNA) and CAS9 mRNA transcribed in vitro are microinjected into fertilized eggs that are then allowed to develop to term. As a rule, gRNAs are tested first in tissue culture cells and the one with the highest locus-specific cleavage activity is chosen for microinjection. For cell transfections, gRNAs are typically expressed using the human U6 promoter (hU6). However, gRNAs for microinjection into zygotes are obtained by in vitro transcription from a T7 bacteriophage promoter in a separate plasmid vector. Here, we describe the design and construction of a combined U6T7 hybrid promoter from which the same gRNA sequence can be expressed. An expression vector containing such a hybrid promoter can now be used to generate gRNA for testing in mammalian cells as well as for microinjection purposes. The gRNAs expressed and transcribed from this vector are found to be functional in cells as well as in mice.

Efficiency of VIGS and gene expression in a novel bipartite potexvirus vector delivery system as a function of strength of TGB1 silencing suppression.

PubMed

Lim, Hyoun-Sub; Vaira, Anna Maria; Domier, Leslie L; Lee, Sung Chul; Kim, Hong Gi; Hammond, John

2010-06-20

We have developed plant virus-based vectors for virus-induced gene silencing (VIGS) and protein expression, based on Alternanthera mosaic virus (AltMV), for infection of a wide range of host plants including Nicotiana benthamiana and Arabidopsis thaliana by either mechanical inoculation of in vitro transcripts or via agroinfiltration. In vivo transcripts produced by co-agroinfiltration of bacteriophage T7 RNA polymerase resulted in T7-driven AltMV infection from a binary vector in the absence of the Cauliflower mosaic virus 35S promoter. An artificial bipartite viral vector delivery system was created by separating the AltMV RNA-dependent RNA polymerase and Triple Gene Block (TGB)123-Coat protein (CP) coding regions into two constructs each bearing the AltMV 5' and 3' non-coding regions, which recombined in planta to generate a full-length AltMV genome. Substitution of TGB1 L(88)P, and equivalent changes in other potexvirus TGB1 proteins, affected RNA silencing suppression efficacy and suitability of the vectors from protein expression to VIGS. Published by Elsevier Inc.

A Molecular Toolbox for Rapid Generation of Viral Vectors to Up- or Down-Regulate Neuronal Gene Expression in vivo

PubMed Central

White, Melanie D.; Milne, Ruth V. J.; Nolan, Matthew F.

2011-01-01

We introduce a molecular toolbox for manipulation of neuronal gene expression in vivo. The toolbox includes promoters, ion channels, optogenetic tools, fluorescent proteins, and intronic artificial microRNAs. The components are easily assembled into adeno-associated virus (AAV) or lentivirus vectors using recombination cloning. We demonstrate assembly of toolbox components into lentivirus and AAV vectors and use these vectors for in vivo expression of inwardly rectifying potassium channels (Kir2.1, Kir3.1, and Kir3.2) and an artificial microRNA targeted against the ion channel HCN1 (HCN1 miRNA). We show that AAV assembled to express HCN1 miRNA produces efficacious and specific in vivo knockdown of HCN1 channels. Comparison of in vivo viral transduction using HCN1 miRNA with mice containing a germ line deletion of HCN1 reveals similar physiological phenotypes in cerebellar Purkinje cells. The easy assembly and re-usability of the toolbox components, together with the ability to up- or down-regulate neuronal gene expression in vivo, may be useful for applications in many areas of neuroscience. PMID:21772812

Modular protein expression by RNA trans-splicing enables flexible expression of antibody formats in mammalian cells from a dual-host phage display vector.

PubMed

Shang, Yonglei; Tesar, Devin; Hötzel, Isidro

2015-10-01

A recently described dual-host phage display vector that allows expression of immunoglobulin G (IgG) in mammalian cells bypasses the need for subcloning of phage display clone inserts to mammalian vectors for IgG expression in large antibody discovery and optimization campaigns. However, antibody discovery and optimization campaigns usually need different antibody formats for screening, requiring reformatting of the clones in the dual-host phage display vector to an alternative vector. We developed a modular protein expression system mediated by RNA trans-splicing to enable the expression of different antibody formats from the same phage display vector. The heavy-chain region encoded by the phage display vector is directly and precisely fused to different downstream heavy-chain sequences encoded by complementing plasmids simply by joining exons in different pre-mRNAs by trans-splicing. The modular expression system can be used to efficiently express structurally correct IgG and Fab fragments or other antibody formats from the same phage display clone in mammalian cells without clone reformatting. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

A novel system for the production of high levels of functional human therapeutic proteins in stable cells with a Semliki Forest virus noncytopathic vector.

PubMed

Casales, Erkuden; Aranda, Alejandro; Quetglas, Jose I; Ruiz-Guillen, Marta; Rodriguez-Madoz, Juan R; Prieto, Jesus; Smerdou, Cristian

2010-05-31

Semliki Forest virus (SFV) vectors lead to high protein expression in mammalian cells, but expression is transient due to vector cytopathic effects, inhibition of host cell proteins and RNA-based expression. We have used a noncytopathic SFV mutant (ncSFV) RNA vector to generate stable cell lines expressing two human therapeutic proteins: insulin-like growth factor I (IGF-I) and cardiotrophin-1 (CT-1). Therapeutic genes were fused at the carboxy-terminal end of Puromycin N-acetyl-transferase gene by using as a linker the sequence coding for foot-and-mouth disease virus (FMDV) 2A autoprotease. These cassettes were cloned into the ncSFV vector. Recombinant ncSFV vectors allowed rapid and efficient selection of stable BHK cell lines with puromycin. These cells expressed IGF-I and CT-1 in supernatants at levels reaching 1.4 and 8.6 microg/10(6)cells/24 hours, respectively. Two cell lines generated with each vector were passaged ten times during 30 days, showing constant levels of protein expression. Recombinant proteins expressed at different passages were functional by in vitro signaling assays. Stability at RNA level was unexpectedly high, showing a very low mutation rate in the CT-1 sequence, which did not increase at high passages. CT-1 was efficiently purified from supernatants of ncSFV cell lines, obtaining a yield of approximately 2mg/L/24 hours. These results indicate that the ncSFV vector has a great potential for the production of recombinant proteins in mammalian cells. 2010 Elsevier B.V. All rights reserved.

Lentiviral vectors encoding shRNAs efficiently transduce and knockdown LINGO-1 but induce an interferon response and cytotoxicity in CNS neurons

PubMed Central

Hutson, Thomas H.; Foster, Edmund; Dawes, John M.; Hindges, Robert; Yáñez-Muñoz, Rafael J.; Moon, Lawrence D.F.

2017-01-01

Background Knocking down neuronal LINGO-1 using short hairpin RNAs (shRNAs) might enhance axon regeneration in the CNS. Integration-deficient lentiviral vectors have great potential as a therapeutic delivery system for CNS injuries. However, recent studies have revealed that shRNAs can induce an interferon response resulting in off-target effects and cytotoxicity. Methods CNS neurons were transduced with integration-deficient lentiviral vectors in vitro. The transcriptional effect of shRNA expression was analysed using qRT-PCR and northern blots were used to assess shRNA production. Results Integration-deficient lentiviral vectors efficiently transduced CNS neurons and knocked down LINGO-1 mRNA in vitro. However, an increase in cell death was observed when lentiviral vectors encoding an shRNA were applied or when high vector concentrations were used. We demonstrate that high doses of vector or the use of vectors encoding shRNAs can induce an up-regulation of interferon stimulated genes (OAS1 and PKR) and a down-regulation of off- target genes (including p75NTR and NgR1). Furthermore, the northern blot demonstrated that these negative consequences occur even when lentiviral vectors express low levels of shRNAs. Together, these results may explain why neurite outgrowth was not enhanced on an inhibitory substrate after transduction with lentiviral vectors encoding an shRNA targeting LINGO-1. Conclusions These findings highlight the importance of including appropriate controls to verify silencing specificity and the requirement to check for an interferon response when conducting RNA interference experiments. However, the potential benefits that RNA interference and viral vectors offer to gene-based therapies to CNS injuries cannot be overlooked and demand further investigation. PMID:22499506

Gene silencing in Escherichia coli using antisense RNAs expressed from doxycycline-inducible vectors.

PubMed

Nakashima, N; Tamura, T

2013-06-01

Here, we report on the construction of doxycycline (tetracycline analogue)-inducible vectors that express antisense RNAs in Escherichia coli. Using these vectors, the expression of genes of interest can be silenced conditionally. The expression of antisense RNAs from the vectors was more tightly regulated than the previously constructed isopropyl-β-D-galactopyranoside-inducible vectors. Furthermore, expression levels of antisense RNAs were enhanced by combining the doxycycline-inducible promoter with the T7 promoter-T7 RNA polymerase system; the T7 RNA polymerase gene, under control of the doxycycline-inducible promoter, was integrated into the lacZ locus of the genome without leaving any antibiotic marker. These vectors are useful for investigating gene functions or altering cell phenotypes for biotechnological and industrial applications. A gene silencing method using antisense RNAs in Escherichia coli is described, which facilitates the investigation of bacterial gene function. In particular, the method is suitable for comprehensive analyses or phenotypic analyses of genes essential for growth. Here, we describe expansion of vector variations for expressing antisense RNAs, allowing choice of a vector appropriate for the target genes or experimental purpose. © 2013 The Society for Applied Microbiology.

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis.

PubMed

Santangelo, K S; Bertone, A L

2011-12-01

To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RT-PCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2(-ΔΔCT)) method. Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P=0.0045) or >90% (P=0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. Copyright © 2011 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

Inhibition of HIV-1 gene expression by retroviral vector-mediated small-guide RNAs that direct specific RNA cleavage by tRNase ZL

PubMed Central

Habu, Yuichiro; Miyano-Kurosaki, Naoko; Kitano, Michiko; Endo, Yumihiko; Yukita, Masakazu; Ohira, Shigeru; Takaku, Hiroaki; Nashimoto, Masayuki; Takaku, Hiroshi

2005-01-01

The tRNA 3′-processing endoribonuclease (tRNase Z or 3′ tRNase; EC 3.1.26.11) is an essential enzyme that removes the 3′ trailer from pre-tRNA. The long form (tRNase ZL) can cleave a target RNA in vitro at the site directed by an appropriate small-guide RNA (sgRNA). Here, we investigated whether this sgRNA/tRNase ZL strategy could be applied to gene therapy for AIDS. We tested the ability of four sgRNA-expression plasmids to inhibit HIV-1 gene expression in COS cells, using a transient-expression assay. The three sgRNAs guide inhibition of HIV-1 gene expression in cultured COS cells. Analysis of the HIV-1 mRNA levels suggested that sgRNA directed the tRNase ZL to mediate the degradation of target RNA. The observation that sgRNA was localized primarily in nuclei suggests that tRNase ZL cleaves the HIV-1 mRNA when complexed with sgRNA in this location. We also examined the ability of two retroviral vectors expressing sgRNA to suppress HIV-1 expression in HIV-1-infected Jurkat T cells. sgRNA-SL4 suppressed HIV-1 expression almost completely in infected cells for up to 18 days. These results suggest that the sgRNA/tRNase ZL approach is effective in downregulating HIV-1 gene expression. PMID:15647506

A stable RNA virus-based vector for citrus trees

DOE Office of Scientific and Technical Information (OSTI.GOV)

Folimonov, Alexey S.; Folimonova, Svetlana Y.; Bar-Joseph, Moshe

Virus-based vectors are important tools in plant molecular biology and plant genomics. A number of vectors based on viruses that infect herbaceous plants are in use for expression or silencing of genes in plants as well as screening unknown sequences for function. Yet there is a need for useful virus-based vectors for woody plants, which demand much greater stability because of the longer time required for systemic infection and analysis. We examined several strategies to develop a Citrus tristeza virus (CTV)-based vector for transient expression of foreign genes in citrus trees using a green fluorescent protein (GFP) as a reporter.more » These strategies included substitution of the p13 open reading frame (ORF) by the ORF of GFP, construction of a self-processing fusion of GFP in-frame with the major coat protein (CP), or expression of the GFP ORF as an extra gene from a subgenomic (sg) mRNA controlled either by a duplicated CTV CP sgRNA controller element (CE) or an introduced heterologous CE of Beet yellows virus. Engineered vector constructs were examined for replication, encapsidation, GFP expression during multiple passages in protoplasts, and for their ability to infect, move, express GFP, and be maintained in citrus plants. The most successful vectors based on the 'add-a-gene' strategy have been unusually stable, continuing to produce GFP fluorescence after more than 4 years in citrus trees.« less

Akt/protein kinase B activation by adenovirus vectors contributes to NFkappaB-dependent CXCL10 expression.

PubMed

Liu, Qiang; White, Lindsay R; Clark, Sharon A; Heffner, Daniel J; Winston, Brent W; Tibbles, Lee Anne; Muruve, Daniel A

2005-12-01

In gene therapy, the innate immune system is a significant barrier to the effective application of adenovirus (Ad) vectors. In kidney epithelium-derived (REC) cells, serotype 5 Ad vectors induce the expression of the chemokine CXCL10 (IP-10), a response that is dependent on NFkappaB. Compared to the parental vector AdLuc, transduction with the RGD-deleted vector AdL.PB resulted in reduced CXCL10 activation despite increasing titers, implying that RGD-alpha(V) integrin interactions contribute to adenovirus induction of inflammatory genes. Akt, a downstream effector of integrin signaling, was activated within 10 min of transduction with Ad vectors in a dose-dependent manner. Akt activation was not present following transduction with AdL.PB, confirming the importance of capsid-alpha(V) integrin interactions in Ad vector Akt activation. Inhibition of the phosphoinositide-3-OH kinase/Akt pathway by Wortmannin or Ly294002 compounds decreased Ad vector induction of CXCL10 mRNA. Similarly, adenovirus-mediated overexpression of the dominant negative AktAAA decreased CXCL10 mRNA expression compared to the reporter vector AdLacZ alone. The effect of Akt on CXCL10 mRNA expression occurred via NFkappaB-dependent transcriptional activation, since AktAAA overexpression and Ly294002 both inhibited CXCL10 and NFkappaB promoter activation in luciferase reporter experiments. These results show that Akt plays a role in the Ad vector activation of NFkappaB and CXCL10 expression. Understanding the mechanism underlying the regulation of host immunomodulatory genes by adenovirus vectors will lead to strategies that will improve the efficacy and safety of these agents for clinical use.

[Sendai virus vector: vector development and its application to health care and biotechnology].

PubMed

Iida, Akihiro

2007-06-01

Sendai virus (SeV) is an enveloped virus with a nonsegmented negative-strand RNA genome and a member of the paramyxovirus family. We have developed SeV vector which has shown a high efficiently of gene transfer and expression of foreign genes to a wide range of dividing and non-dividing mammalian cells and tissues. One of the characteristics of the vector is that the genome is located exclusively in the cytoplasm of infected cells and does not go through a DNA phase; thus there is no concern about unwanted integration of foreign sequences into chromosomal DNA. Therefore, this new class of "cytoplasmic RNA vector", an RNA vector with cytoplasmic expression, is expected to be a safer and more efficient viral vector than existing vectors for application to human therapy in various fields including gene therapy and vaccination. In this review, I describe development of Sendai virus vector, its application in the field of biotechnology and clinical application aiming to treat for a large number of diseases including cancer, cardiovascular disease, infectious diseases and neurologic disorders.

Expression of the proto-oncogene Pokemon in colorectal cancer--inhibitory effects of an siRNA.

PubMed

Zhao, Gan-Ting; Yang, Li-Juan; Li, Xi-Xia; Cui, Hui-Lin; Guo, Rui

2013-01-01

This study aimed to investigate expression of the proto-oncogene POK erythroid myeloid ontogenic factor (Pokemon) in colorectal cancer (CRC), and assess inhibitory effects of a small interference RNA (siRNA) expression vector in SW480 and SW620 cells. Semi-quantitative reverse transcription-polymerase chain reaction (PCR) and immunohistochemistry were performed to determine mRNA and protein expression levels of Pokemon in CRC tissues. Indirect immunofluorescence staining was applied to investigate the location of Pokemon in SW480 and SW620 cells. The siRNA expression vectors that were constructed to express a short hairpin RNA against Pokemon were transfected to the SW480 and SW620 cells with a liposome. Expression levels of Pokemon mRNA and protein were examined by real-time quantitative-fluorescent PCR and western blot analysis. The effects of Pokemon silencing on proliferation of SW480 and SW620 cells were evaluated with reference to growth curves with MTT assays. The mRNA expression level of Pokemon in tumor tissues (0.845 ± 0.344) was significantly higher than that in adjacent tumor specimens (0.321 ± 0.197). The positive expression ratio of Pokemon protein in CRC (87.0%) was significantly higher than that in the adjacent tissues (19.6%). Strong fluorescence staining of Pokemon protein was observed in the cytoplasm of the SW480 and SW620 cells. The inhibition ratios of Pokemon mRNA and protein in the SW480 cells were 83.1% and 73.5% at 48 and 72 h, respectively, compared with those of the negative control cells with the siRNA. In the SW620 cells, the inhibition ratios of Pokemon mRNA and protein were 76.3% and 68.7% at 48 and 72 h, respectively. MTT showed that Pokemon gene silencing inhibited the proliferation of SW480 and SW620 cells. Overexpression of Pokemon in CRC may have a function in carcinogenesis and progression. siRNA expression vectors could effectively inhibit mRNA and protein expression of Pokemon in SW480 and SW620 cells, thereby reducing malignant cell proliferation.

Transduction of hematopoietic stem cells to stimulate RNA interference against feline infectious peritonitis.

PubMed

Anis, Eman A; Dhar, Madhu; Legendre, Alfred M; Wilkes, Rebecca P

2017-06-01

Objectives The goals of the study were: (1) to develop and evaluate non-replicating lentivirus vectors coding for feline coronavirus (FCoV)-specific micro (mi)RNA as a potential antiviral therapy for feline infectious peritonitis (FIP); (2) to assess the feasibility of transducing hematopoietic stem cells (HSCs) with ex vivo introduction of the miRNA-expressing lentivirus vector; and (3) to assess the ability of the expressed miRNA to inhibit FCoV replication in HSCs in vitro. Methods HSCs were obtained from feline bone marrow and replicated in vitro. Three lentiviruses were constructed, each expressing a different anti-FCoV miRNA. HSCs were stably transduced with the miRNA-expressing lentivirus vector that produced the most effective viral inhibition in a feline cell line. The effectiveness of the transduction and the expression of anti-FCoV miRNA were tested by infecting the HSCs with two different strains of FCoV. The inhibition of coronavirus replication was determined by relative quantification of the inhibition of intracellular viral genomic RNA synthesis using real-time, reverse-transcription PCR. The assessment of virus replication inhibition was determined via titration of extracellular virus using the TCID 50 assay. Results Inhibition of FCoV was most significant in feline cells expressing miRNA-L2 that targeted the viral leader sequence, 48 h postinfection. miRNA-L2 expression in stably transduced HSCs resulted in 90% and 92% reductions in FIPV WSU 79-1146 genomic RNA synthesis and extracellular virus production, respectively, as well as 74% and 80% reduction in FECV WSU 79-1683 genomic RNA synthesis and extracellular virus production, respectively, as compared with an infected negative control sample producing non-targeting miRNA. Conclusions and relevance These preliminary results show that genetic modification of HSCs for constitutive production of anti-coronavirus miRNA will reduce FCoV replication.

Enhancement or inhibition of PLCγ2 expression in rat hepatocytes by recombinant adenoviral vectors that contain full-length gene or siRNA.

PubMed

Chen, X G; Liu, Y M; Lv, Q X; Ma, J

2017-01-01

We investigated the effects of recombinant adenovirus vectors that overexpress or silence PLCγ2 on the expression of this gene during hepatocyte proliferation. Hepatocytes were isolated, identified by immunofluorescent cytochemical staining and infected by previously constructed Ad-PLCγ2 and Ad-PLCγ2 siRNA1, siRNA2 and siRNA3. Green fluorescent protein (GFP) expression was observed by fluorescence microscopy. Infection percentage was calculated by flow cytometry. mRNA and protein levels of PLCγ2 were detected by quantitative reverse transcription-PCR (qRT-PCR) and western blotting, respectively. The viability of the infected hepatocytes was measured by 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. We found that nearly 97% of cells were positive for the hepatocyte marker, CK18. After infection of Ad-PLCγ2 and Ad-PLCγ2 siRNA, more than 99% of hepatocytes expressed GFP significantly, and mRNA and protein expression of PLCγ2 was up-regulated significantly in Ad-PLCγ2 infected hepatocytes, but down-regulated in Ad-PLCγ2 siRNA2 infected cells. The cell proliferation rate decreased in PLCγ2-overexpressing cells, while the rate increased in PLCγ2-silencing cells. We verified that recombinant Ad-PLCγ2 and Ad-PLCγ2 siRNA2 were constructed successfully. These two recombinant vectors promoted or decreased the expression of PLCγ2 in rat hepatocytes and affected the cell proliferation rate, which provides a useful tool for further investigation of the role of PLCγ2 in hepatocyte apoptosis.

Development of a duplex real-time RT-qPCR assay to monitor genome replication, gene expression and gene insert stability during in vivo replication of a prototype live attenuated canine distemper virus vector encoding SIV gag.

PubMed

Coleman, John W; Wright, Kevin J; Wallace, Olivia L; Sharma, Palka; Arendt, Heather; Martinez, Jennifer; DeStefano, Joanne; Zamb, Timothy P; Zhang, Xinsheng; Parks, Christopher L

2015-03-01

Advancement of new vaccines based on live viral vectors requires sensitive assays to analyze in vivo replication, gene expression and genetic stability. In this study, attenuated canine distemper virus (CDV) was used as a vaccine delivery vector and duplex 2-step quantitative real-time RT-PCR (RT-qPCR) assays specific for genomic RNA (gRNA) or mRNA have been developed that concurrently quantify coding sequences for the CDV nucleocapsid protein (N) and a foreign vaccine antigen (SIV Gag). These amplicons, which had detection limits of about 10 copies per PCR reaction, were used to show that abdominal cavity lymphoid tissues were a primary site of CDV vector replication in infected ferrets, and importantly, CDV gRNA or mRNA was undetectable in brain tissue. In addition, the gRNA duplex assay was adapted for monitoring foreign gene insert genetic stability during in vivo replication by analyzing the ratio of CDV N and SIV gag genomic RNA copies over the course of vector infection. This measurement was found to be a sensitive probe for assessing the in vivo genetic stability of the foreign gene insert. Copyright © 2014 Elsevier B.V. All rights reserved.

[Lentiviral vector-mediated short hairpin RNA targeting survivin inhibits abdominal growth of human endometrium xenograft in nude mice].

PubMed

Peng, Dongxian; He, Yuanli

2015-02-01

To investigate the inhibitory effect of lentiviral vector-mediated short hairpin RNA targeting survivin (LV-survivin shRNA) on the growth of human endometrium xenograft in the abdominal cavity of nude mice. The endometrium xenografts from 8 women with endometriosis were injected into the peritoneal cavities of 45 nude mice. The mice were then randomly assigned to receive intraperitoneal injection of LV-survivin shRNA, pGCL-NC-GFP (negative control) or PBS (blank control). Two weeks later, the number and morphometry of endometriotic lesions were quantified and the expression of survivin protein were detected by immunohistochemistry. The formation of endometriotic lesions was significantly suppressed in mice receiving LV-survivin shRNA injection as compared with those in the two control groups (P/0.001). The mice in LV-survivin-shRNA group showed significantly down-regulated expression levels of survivin protein compared with those in the negative and blank control groups, presenting also necrosis in the endometriosis-like lesions in microscopic observation. Lentiviral vector-mediated shRNA can effectively inhibit the expression of survivin in human endometrium xengrafts and suppress the formation and growth of endometriotic lesions in the abdominal cavities of nude mice.

Correction of Murine Sickle Cell Disease Using γ-Globin Lentiviral Vectors to Mediate High-level Expression of Fetal Hemoglobin

PubMed Central

Pestina, Tamara I; Hargrove, Phillip W; Jay, Dennis; Gray, John T; Boyd, Kelli M; Persons, Derek A

2008-01-01

Increased levels of red cell fetal hemogloblin, whether due to hereditary persistence of expression or from induction with hydroxyurea therapy, effectively ameliorate sickle cell disease (SCD). Therefore, we developed erythroid-specific, γ-globin lentiviral vectors for hematopoietic stem cell (HSC)-targeted gene therapy with the goal of permanently increasing fetal hemoglobin (HbF) production in sickle red cells. We evaluated two different γ-globin lentiviral vectors for therapeutic efficacy in the BERK sickle cell mouse model. The first vector, V5, contained the γ-globin gene driven by 3.1 kb of β-globin regulatory sequences and a 130-bp β-globin promoter. The second vector, V5m3, was identical except that the γ-globin 3′-untranslated region (3′-UTR) was replaced with the β-globin 3′-UTR. Adult erythroid cells have β-globin mRNA 3′-UTR-binding proteins that enhance β-globin mRNA stability and we postulated this design might enhance γ-globin expression. Stem cell gene transfer was efficient and nearly all red cells in transplanted mice expressed human γ-globin. Both vectors demonstrated efficacy in disease correction, with the V5m3 vector producing a higher level of γ-globin mRNA which was associated with high-level correction of anemia and secondary organ pathology. These data support the rationale for a gene therapy approach to SCD by permanently enhancing HbF using a γ-globin lentiviral vector. PMID:19050697

Quantitative evaluation of first, second, and third generation hairpin systems reveals the limit of mammalian vector-based RNAi

PubMed Central

Watanabe, Colin; Cuellar, Trinna L.; Haley, Benjamin

2016-01-01

ABSTRACT Incorporating miRNA-like features into vector-based hairpin scaffolds has been shown to augment small RNA processing and RNAi efficiency. Therefore, defining an optimal, native hairpin context may obviate a need for hairpin-specific targeting design schemes, which confound the movement of functional siRNAs into shRNA/artificial miRNA backbones, or large-scale screens to identify efficacious sequences. Thus, we used quantitative cell-based assays to compare separate third generation artificial miRNA systems, miR-E (based on miR-30a) and miR-3G (based on miR-16-2 and first described in this study) to widely-adopted, first and second generation formats in both Pol-II and Pol-III expression vector contexts. Despite their unique structures and strandedness, and in contrast to first and second-generation RNAi triggers, the third generation formats operated with remarkable similarity to one another, and strong silencing was observed with a significant fraction of the evaluated target sequences within either promoter context. By pairing an established siRNA design algorithm with the third generation vectors we could readily identify targeting sequences that matched or exceeded the potency of those discovered through large-scale sensor-based assays. We find that third generation hairpin systems enable the maximal level of siRNA function, likely through enhanced processing and accumulation of precisely-defined guide RNAs. Therefore, we predict future gains in RNAi potency will come from improved hairpin expression and identification of optimal siRNA-intrinsic silencing properties rather than further modification of these scaffolds. Consequently, third generation systems should be the primary format for vector-based RNAi studies; miR-3G is advantageous due to its small expression cassette and simplified, cost-efficient cloning scheme. PMID:26786363

Tripartite polyionic complex (PIC) micelles as non-viral vectors for mesenchymal stem cell siRNA transfection.

PubMed

Raisin, Sophie; Morille, Marie; Bony, Claire; Noël, Danièle; Devoisselle, Jean-Marie; Belamie, Emmanuel

2017-08-22

In the context of regenerative medicine, the use of RNA interference mechanisms has already proven its efficiency in targeting specific gene expression with the aim of enhancing, accelerating or, more generally, directing stem cell differentiation. However, achievement of good transfection levels requires the use of a gene vector. For in vivo applications, synthetic vectors are an interesting option to avoid possible issues associated with viral vectors (safety, production costs, etc.). Herein, we report on the design of tripartite polyionic complex micelles as original non-viral polymeric vectors suited for mesenchymal stem cell transfection with siRNA. Three micelle formulations were designed to exhibit pH-triggered disassembly in an acidic pH range comparable to that of endosomes. One formulation was selected as the most promising with the highest siRNA loading capacity while clearly maintaining pH-triggered disassembly properties. A thorough investigation of the internalization pathway of micelles into cells with tagged siRNA was made before showing an efficient inhibition of Runx2 expression in primary bone marrow-derived stem cells. This work evidenced PIC micelles as promising synthetic vectors that allow efficient MSC transfection and control over their behavior, from the perspective of their clinical use.

Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

PubMed Central

2010-01-01

Background Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEXGM-CSF, we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. Methods To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Results Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. Conclusions This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials. PMID:20836854

Double-stranded RNA transcribed from vector-based oligodeoxynucleotide acts as transcription factor decoy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiao, Xiao; Gang, Yi; Department of Infectious Diseases, Tangdu Hospital, Fourth Military Medical University, Xi’an 710038, Shaanxi Province

2015-02-06

Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself.more » The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity.« less

Inhibition of prohormone convertase 1 (PC1) expression in cholecystokinin (CCK) expressing At-T20 cells decreased cellular content and secretion of CCK and caused a shift in molecular forms of CCK secreted.

PubMed

Beinfeld, Margery C; Vishnuvardhan, Daesety; Blum, Alissa; Reynolds, Nicole; Fannous, Sanya; Kitagawa, Kouki; Marchand, James E

2006-04-01

Two different RNAi methods were used to inhibit the expression of prohormone convertase 1 (PC1) in At-T20 cells. Transient transfection of double stranded RNA and stable expression of a vector expressing hairpin-loop RNA targeting PC1 reduced cholecystokinin (CCK) secretion from At-T20 cells. PC1 mRNA and protein were also decreased in the vector transfected cells. This treatment caused a shift in the forms of cholecystokinin (CCK) secreted, decreasing CCK 22 and increasing CCK 8. Stable expression of RNAi effectively decreased PC1 expression. The observed decrease in CCK seen with these RNAi treatments further supports a role for PC1 in CCK processing in these cells.

The developmental transcriptome of the mosquito Aedes aegypti, an invasive species and major arbovirus vector.

PubMed

Akbari, Omar S; Antoshechkin, Igor; Amrhein, Henry; Williams, Brian; Diloreto, Race; Sandler, Jeremy; Hay, Bruce A

2013-09-04

Mosquitoes are vectors of a number of important human and animal diseases. The development of novel vector control strategies requires a thorough understanding of mosquito biology. To facilitate this, we used RNA-seq to identify novel genes and provide the first high-resolution view of the transcriptome throughout development and in response to blood feeding in a mosquito vector of human disease, Aedes aegypti, the primary vector for Dengue and yellow fever. We characterized mRNA expression at 34 distinct time points throughout Aedes development, including adult somatic and germline tissues, by using polyA+ RNA-seq. We identify a total of 14,238 novel new transcribed regions corresponding to 12,597 new loci, as well as many novel transcript isoforms of previously annotated genes. Altogether these results increase the annotated fraction of the transcribed genome into long polyA+ RNAs by more than twofold. We also identified a number of patterns of shared gene expression, as well as genes and/or exons expressed sex-specifically or sex-differentially. Expression profiles of small RNAs in ovaries, early embryos, testes, and adult male and female somatic tissues also were determined, resulting in the identification of 38 new Aedes-specific miRNAs, and ~291,000 small RNA new transcribed regions, many of which are likely to be endogenous small-interfering RNAs and Piwi-interacting RNAs. Genes of potential interest for transgene-based vector control strategies also are highlighted. Our data have been incorporated into a user-friendly genome browser located at www.Aedes.caltech.edu, with relevant links to Vectorbase (www.vectorbase.org).

Effects of siRNA-mediated suppression of HPV-11 L1 expression on the proliferation and apoptosis of vaginal epithelial cells

PubMed Central

Zeng, Juan; Yang, Shumei; Wang, Xiaorui; Gao, Yan; Zhang, Mei

2017-01-01

The aim of the present study was to investigate the effects of human papillomavirus (HPV) infection on the gynecological disease of vaginitis and to demonstrate how the small interfering RNA (siRNA) method may be used for HPV prevention in the clinic. Human vaginal epithelial cells were transfected with HPV-11 L1 expression vector and siRNA-HPV-11 L1 vectors and a control group was transfected with scrambled siRNA. Cell proliferation in each group was analyzed using the MTT assay and the expression of apoptosis-associated proteins was measured by western blot analysis. Compared with the control group, HPV-11 L1 mRNA and protein levels were significantly increased following transfection with the HPV-11 L1 expression vector in cells (P<0.05), but this result was significantly reversed by silencing of HPV-11 L1 (P<0.05). In addition, cell proliferation in the HPV-11 group was lower than that in the control group; however, cell proliferation was significantly increased in cells transfected with silenced L1 compared with that in the control group (P<0.05). Furthermore, silencing of HPV-11 L1 significantly decreased caspase-3 and caspase-9 expressions in cells, whereas the expression was increased in the HPV-11 L1 group (P<0.05). The present study suggested that siRNA-mediated silencing of HPV-11 L1 may have potential therapeutic applications for treating gynecological diseases associated with HPV-11 infection. PMID:28413509

Isl-1 down-regulates DRG cell proliferation during chicken embryo development.

PubMed

Chen, Dawei; Wang, Guoxin; Luo, Haoshu; Liu, Jiali; Cui, Sheng

2010-01-01

Protein Isl-1 RNA interference and over expression in early chicken embryo dorsal root ganglia (DRG) were used to investigate the function of Isl-1 in DRG cell proliferation. Isl-1 targeted shRNA expression vector and Isl-1 over-expression vector were transfected into chicken embryo DRG by in ovo electroporation. Then, the DRG proliferation rate was detected by BrdU immunohistochemistry. The rate of DRG cell proliferation increased after Isl-1 knock-down and decreased after Isl-1 over-expression. In this study, we found that Isl-1 negatively modulates DRG cell proliferation.

Gene silencing efficiency and INF-β induction effects of splicing miRNA 155-based artificial miRNA with pre-miRNA stem-loop structures.

PubMed

Sin, Onsam; Mabiala, Prudence; Liu, Ye; Sun, Ying; Hu, Tao; Liu, Qingzhen; Guo, Deyin

2012-02-01

Artificial microRNA (miRNA) expression vectors have been developed and used for RNA interference. The secondary structure of artificial miRNA is important for RNA interference efficacy. We designed two groups of six artificial splicing miRNA 155-based miRNAs (SM155-based miRNAs) with the same target in the coding region or 3' UTR of a target gene and studied their RNA silencing efficiency and interferon β (IFN-β) induction effects. SM155-based miRNA with a mismatch at the +1 position and a bulge at the +11, +12 positions in a miRNA precursor stem-loop structure showed the highest gene silencing efficiency and lowest IFN-β induction effect (increased IFN-β mRNA level by 10% in both target cases), regardless of the specificity of the target sequence, suggesting that pSM155-based miRNA with this design could be a valuable miRNA expression vector.

A piggyBac-based reporter system for scalable in vitro and in vivo analysis of 3′ untranslated region-mediated gene regulation

PubMed Central

Chaudhury, Arindam; Kongchan, Natee; Gengler, Jon P.; Mohanty, Vakul; Christiansen, Audrey E.; Fachini, Joseph M.; Martin, James F.; Neilson, Joel R.

2014-01-01

Regulation of messenger ribonucleic acid (mRNA) subcellular localization, stability and translation is a central aspect of gene expression. Much of this control is mediated via recognition of mRNA 3′ untranslated regions (UTRs) by microRNAs (miRNAs) and RNA-binding proteins. The gold standard approach to assess the regulation imparted by a transcript's 3′ UTR is to fuse the UTR to a reporter coding sequence and assess the relative expression of this reporter as compared to a control. Yet, transient transfection approaches or the use of highly active viral promoter elements may overwhelm a cell's post-transcriptional regulatory machinery in this context. To circumvent this issue, we have developed and validated a novel, scalable piggyBac-based vector for analysis of 3′ UTR-mediated regulation in vitro and in vivo. The vector delivers three independent transcription units to the target genome—a selection cassette, a turboGFP control reporter and an experimental reporter expressed under the control of a 3′ UTR of interest. The pBUTR (piggyBac-based 3′ UnTranslated Region reporter) vector performs robustly as a siRNA/miRNA sensor, in established in vitro models of post-transcriptional regulation, and in both arrayed and pooled screening approaches. The vector is robustly expressed as a transgene during murine embryogenesis, highlighting its potential usefulness for revealing post-transcriptional regulation in an in vivo setting. PMID:24753411

Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli.

PubMed

Bernheim, Aude G; Libis, Vincent K; Lindner, Ariel B; Wintermute, Edwin H

2016-03-20

RNA-mediated knockdowns are widely used to control gene expression. This versatile family of techniques makes use of short RNA (sRNA) that can be synthesized with any sequence and designed to complement any gene targeted for silencing. Because sRNA constructs can be introduced to many cell types directly or using a variety of vectors, gene expression can be repressed in living cells without laborious genetic modification. The most common RNA knockdown technology, RNA interference (RNAi), makes use of the endogenous RNA-induced silencing complex (RISC) to mediate sequence recognition and cleavage of the target mRNA. Applications of this technique are therefore limited to RISC-expressing organisms, primarily eukaryotes. Recently, a new generation of RNA biotechnologists have developed alternative mechanisms for controlling gene expression through RNA, and so made possible RNA-mediated gene knockdowns in bacteria. Here we describe a method for silencing gene expression in E. coli that functionally resembles RNAi. In this system a synthetic phagemid is designed to express sRNA, which may designed to target any sequence. The expression construct is delivered to a population of E. coli cells with non-lytic M13 phage, after which it is able to stably replicate as a plasmid. Antisense recognition and silencing of the target mRNA is mediated by the Hfq protein, endogenous to E. coli. This protocol includes methods for designing the antisense sRNA, constructing the phagemid vector, packaging the phagemid into M13 bacteriophage, preparing a live cell population for infection, and performing the infection itself. The fluorescent protein mKate2 and the antibiotic resistance gene chloramphenicol acetyltransferase (CAT) are targeted to generate representative data and to quantify knockdown effectiveness.

Adenovirus small interfering RNA targeting ezrin induces apoptosis and inhibits metastasis of human osteosarcoma MG-63 cells.

PubMed

Tao, Zhi-Wei; Zou, Ping-An

2018-06-13

Osteosarcoma is a disease prone to recurrence and metastasis, and adenovirus expression vector is frequently studied as a therapeutic target of osteosarcoma in recent year. This study attempts to explore the effect of adenovirus-mediated small interfering RNA (siRNA) targeting ezrin on the proliferation, migration, invasion and apoptosis of human osteosarcoma MG-63 cells. Human osteosarcoma MG-63 cell line was selected for construction of recombinant adenovirus vector. The mRNA and protein levels of ezrin, Bcl2-associated X protein (Bax), B cell lymphoma-2 (Bcl-2), p21, p53, Caspase-3, matrix metalloproteinase 2 (MMP-2) and MMP-9, Cyclin D1, and cyclin-dependent kinase 4a (CDK4a) were determined. Through ELISA, the levels of Caspase-3, MMP-2 and MMP-9 were examined. Finally, human osteosarcoma MG-63 cell viability, growth, invasion, migration, and apoptosis were detected. Initially, adenovirus expression vector of ezrin was constructed by ezrin 2 siRNA sequence. Adenovirus-mediated siRNA targeting ezrin reduced expression of ezrin in MG-63 cells. The results revealed that adenovirus-mediated siRNA targeting ezrin elevated expression levels of Bax, P21, P53, and Caspase-3, Cyclin D1, and CDK4a and reduced expression levels of Bcl-2, MMP-2, and MMP-9. Furthermore, adenovirus-mediated siRNA targeting ezrin inhibited human osteosarcoma MG-63 cell viability, growth, invasion, and migration, and promoted apoptosis. Our study demonstrates that adenovirus-mediated siRNA targeting ezrin can induce apoptosis and inhibit the proliferation, migration and invasion of human osteosarcoma MG-63 cells. ©2018 The Author(s).

Doxycycline modulates VEGF-A expression: Failure of doxycycline-inducible lentivirus shRNA vector to knockdown VEGF-A expression in transgenic mice.

PubMed

Merentie, Mari; Rissanen, Riina; Lottonen-Raikaslehto, Line; Huusko, Jenni; Gurzeler, Erika; Turunen, Mikko P; Holappa, Lari; Mäkinen, Petri; Ylä-Herttuala, Seppo

2018-01-01

Vascular endothelial growth factor-A (VEGF-A) is the master regulator of angiogenesis, vascular permeability and growth. However, its role in mature blood vessels is still not well understood. To better understand the role of VEGF-A in the adult vasculature, we generated a VEGF-A knockdown mouse model carrying a doxycycline (dox)-regulatable short hairpin RNA (shRNA) transgene, which silences VEGF-A. The aim was to find the critical level of VEGF-A reduction for vascular well-being in vivo. In vitro, the dox-inducible lentiviral shRNA vector decreased VEGF-A expression efficiently and dose-dependently in mouse endothelial cells and cardiomyocytes. In the generated transgenic mice plasma VEGF-A levels decreased shortly after the dox treatment but returned back to normal after two weeks. VEGF-A expression decreased shortly after the dox treatment only in some tissues. Surprisingly, increasing the dox exposure time and dose led to elevated VEGF-A expression in some tissues of both wildtype and knockdown mice, suggesting that dox itself has an effect on VEGF-A expression. When the effect of dox on VEGF-A levels was further tested in naïve/non-transduced cells, the dox administration led to a decreased VEGF-A expression in endothelial cells but to an increased expression in cardiomyocytes. In conclusion, the VEGF-A knockdown was achieved in a dox-regulatable fashion with a VEGF-A shRNA vector in vitro, but not in the knockdown mouse model in vivo. Dox itself was found to regulate VEGF-A expression explaining the unexpected results in mice. The effect of dox on VEGF-A levels might at least partly explain its previously reported beneficial effects on myocardial and brain ischemia. Also, this effect on VEGF-A should be taken into account in all studies using dox-regulated vectors.

Improving the Transduction of Bone Marrow–Derived Cells with an Integrase-Defective Lentiviral Vector

PubMed Central

Pay, S. Louise; Qi, Xiaoping; Willard, Jeffrey F.; Godoy, Juliana; Sankhavaram, Kavya; Horton, Ranier; Mitter, Sayak K.; Quigley, Judith L.; Chang, Lung-Ji; Grant, Maria B.; Boulton, Michael E.

2018-01-01

In lentiviral vector (LV) applications where transient transgene expression is sufficient, integrase-defective lentiviral vectors (IDLVs) are beneficial for reducing the potential for off-target effects associated with insertional mutagenesis. It was previously demonstrated that human RPE65 mRNA expression from an integrating lentiviral vector (ILV) induces endogenous Rpe65 and Cralbp mRNA expression in murine bone marrow–derived cells (BMDCs), initiating programming of the cells to retinal pigment epithelium (RPE)-like cells. These cells regenerate RPE in retinal degeneration models when injected systemically. As transient expression of RPE65 is sufficient to activate endogenous RPE-associated genes for programming BMDCs, use of an ILV is an unnecessary risk. In this study, an IDLV expressing RPE65 (IDLV3-RPE65) was generated. Transduction with IDLV3-RPE65 is less efficient than the integrating vector (ILV3-RPE65). Therefore, IDLV3-RPE65 transduction was enhanced with a combination of preloading 20 × -concentrated viral supernatant on RetroNectin at a multiplicity of infection of 50 and transduction of BMDCs by low-speed centrifugation. RPE65 mRNA levels increased from ∼12-fold to ∼25-fold (p < 0.05) after modification of the IDLV3-RPE65 transduction protocol, achieving expression similar to the ∼27-fold (p < 0.05) increase observed with ILV3-RPE65. Additionally, the study shows that the same preparation of RetroNectin can be used to coat up to three wells with no reduction in transduction. Critically, IDLV3-RPE65 transduction initiates endogenous Rpe65 mRNA expression in murine BMDCs and Cralbp/CRALBP mRNA in both murine and human BMDCs, similar to expression observed in ILV3-RPE65-transduced cells. Systemic administration of ILV3-RPE65 or IDLV3-RPE65 programmed BMDCs in a mouse model of retinal degeneration is sufficient to retain visual function and reduce retinal degeneration compared to mice receiving no treatment or naïve BMDC. It is concluded that IDLV3-RPE65 is appropriate for programming BMDCs to RPE-like cells. PMID:29160102

RNA interference mediated in human primary cells via recombinant baculoviral vectors.

PubMed

Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T

2005-04-01

The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.

[Lentivirus-mediated shRNA silencing of LAMP2A inhibits the proliferation of multiple myeloma cells].

PubMed

Li, Lixuan; Li, Jia

2015-05-01

To study the effects of lentivirus-mediated short hairpin RNA (shRNA) silencing of lysosome-associated membrane protein type 2A (LAMP2A) expression on the proliferation of multiple myeloma cells. The constructed shRNA lentiviral vector was applied to infect human multiple myeloma cell line MM.1S, and stable expression cell line was obtained by puromycin screening. Western blotting was used to verify the inhibitory effect on LAMP2A protein expression. MTT assay was conducted to detect the effect of knocked-down LAMP2A on MM.1S cell proliferation, and the anti-tumor potency of suberoylanilide hydroxamic acid (SAHA) against the obtained MM.1S LAMP2A(shRNA) stable cell line. Lactate assay was performed to observe the impact of low LAMP2A expression on cell glycolysis. The stable cell line with low LAMP2A expression were obtained with the constructed human LAMP2A-shRNA lentiviral vector. Down-regulation of LAMP2A expression significantly inhibited MM.1S cell proliferation and enhanced the anti-tumor activity of SAHA. Interestingly, decreased LAMP2A expression also inhibited MM.1S cell lactic acid secretion. Down-regulation of LAMP2A expression could inhibit cell proliferation in multiple myeloma cells.

Design and cloning strategies for constructing shRNA expression vectors

PubMed Central

McIntyre, Glen J; Fanning, Gregory C

2006-01-01

Background Short hairpin RNA (shRNA) encoded within an expression vector has proven an effective means of harnessing the RNA interference (RNAi) pathway in mammalian cells. A survey of the literature revealed that shRNA vector construction can be hindered by high mutation rates and the ensuing sequencing is often problematic. Current options for constructing shRNA vectors include the use of annealed complementary oligonucleotides (74 % of surveyed studies), a PCR approach using hairpin containing primers (22 %) and primer extension of hairpin templates (4 %). Results We considered primer extension the most attractive method in terms of cost. However, in initial experiments we encountered a mutation frequency of 50 % compared to a reported 20 – 40 % for other strategies. By modifying the technique to be an isothermal reaction using the DNA polymerase Phi29, we reduced the error rate to 10 %, making primer extension the most efficient and cost-effective approach tested. We also found that inclusion of a restriction site in the loop could be exploited for confirming construct integrity by automated sequencing, while maintaining intended gene suppression. Conclusion In this study we detail simple improvements for constructing and sequencing shRNA that overcome current limitations. We also compare the advantages of our solutions against proposed alternatives. Our technical modifications will be of tangible benefit to researchers looking for a more efficient and reliable shRNA construction process. PMID:16396676

Clinical significance of proliferation, apoptosis and senescence of nasopharyngeal cells by the simultaneously blocking EGF, IGF-1 receptors and Bcl-xl genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dai, Guodong; Peng, Tao; Zhou, Xuhong

2013-11-01

Highlight: •Construction of shRNA segments expression vectors is valid by the investigation of RT-PCR for IGF1R, EGFR and Bcl-xl mRNA and protein expression. •Studies have suggested that the vectors in blocking these genes of the growth factor receptors and anti- apoptosis is capable of breaking the balance of tumor growth so that tumor trend apoptosis and senescence. •Simultaneously blocking multiple genes that are abnormally expressed may be more effective in treating cancer cells than silencing a single gene. -- Abstract: Background: In previous work, we constructed short hairpin RNA (shRNA) expression plasmids that targeted human EGF and IGF-1 receptors messengermore » RNA, respectively, and demonstrated that these vectors could induce apoptosis of human nasopharyngeal cell lines (CNE2) and inhibit ligand-induced pAkt and pErk activation. Method: We have constructed multiple shRNA expression vectors of targeting EGFR, IGF1R and Bcl-xl, which were transfected to the CNE2 cells. The mRNA expression was assessed by RT-PCR. The growth of the cells, cell cycle progression, apoptosis of the cells, senescent tumor cells and the proteins of EGFR, IGF1R and Bcl-xl were analyzed by MTT, flow cytometry, cytochemical therapy or Western blot. Results: In group of simultaneously blocking EGFR, IGF1R and Bcl-xl genes, the mRNA of EGFR, IGF1R and Bcl-xl expression was decreased by (66.66 ± 3.42)%, (73.97 ± 2.83)% and (64.79 ± 2.83)%, and the protein expressions was diminished to (67.69 ± 4.02)%, (74.32 ± 2.30)%, and (60.00 ± 3.34)%, respectively. Meanwhile, the cell apoptosis increased by 65.32 ± 0.18%, 65.16 ± 0.25% and 55.47 ± 0.45%, and senescent cells increased by 1.42 ± 0.15%, 2.26 ± 0.15% and 3.22 ± 0.15% in the second, third and fourth day cultures, respectively. Conclusions: Simultaneously blocking EGFR, IGF1R and Bcl-xl genes is capable of altering the balance between proliferating versus apoptotic and senescent cells in the favor of both of apoptosis and senescence and, therefore, the tumor cells regression.« less

Matrix Metallopeptidase 14 Plays an Important Role in Regulating Tumorigenic Gene Expression and Invasion Ability of HeLa Cells.

PubMed

Zhang, Ying-Hui; Wang, Juan-Juan; Li, Min; Zheng, Han-Xi; Xu, Lan; Chen, You-Guo

2016-03-01

The objectives of this study were to investigate the functional effect of matrix metallopeptidase 14 (MMP14) on cell invasion in cervical cancer cells (HeLa line) and to study the underlying molecular mechanisms. Expression vector of short hairpin RNA targeting MMP14 was treated in HeLa cells, and then, transfection efficiency was verified by a florescence microscope. Transwell assay was used to investigate cell invasion ability in HeLa cells. Quantitative polymerase chain reaction and Western blotting analysis were used to detect the expression of MMP14 and relative factors in messenger RNA and protein levels, respectively. Matrix metallopeptidase 14 short hairpin RNA expression vector transfection obviously decreased MMP14 expression in messenger RNA and protein levels. Down-regulation of MMP14 suppressed invasion ability of HeLa cells and reduced transforming growth factor β1 and vascular endothelial growth factor B expressions. Furthermore, MMP14 knockdown decreased bone sialoprotein and enhanced forkhead box protein L2 expression in both RNA and protein levels. Matrix metallopeptidase 14 plays an important role in regulating invasion of HeLa cells. Matrix metallopeptidase 14 knockdown contributes to attenuating the malignant phenotype of cervical cancer cell.

Puromycin-resistant lentiviral control shRNA vector, pLKO.1 induces unexpected cellular differentiation of P19 embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kanungo, Jyotshna

RNA silencing is used as a common method for investigating loss-of-function effects of genes of interest. In mammalian cells, RNA interference (RNAi) or RNA silencing can be achieved by transient siRNA (small or short interfering RNA) transfection or by stable shRNA (short hairpin RNA) systems. Various vectors are used for efficient delivery of shRNA. Lentiviral vectors offer an efficient delivery system for stable and long-term expression of the shRNA in mammalian cells. The widely used lentiviral pLKO.1 plasmid vector is very popular in RNAi studies. A large RNAi database, a TRC (the RNAi Consortium) library, was established based on themore » pLKO.1-TRC plasmid vector. This plasmid (also called pLKO.1-puro) has a puromycin-resistant gene for selection in mammalian cells along with designs for generating lentiviral particles as well for RNA silencing. While using the pLKO.1-puro TRC control shRNA plasmid for transfection in murine P19 embryonic stem (ES) cells, it was unexpectedly discovered that this plasmid vector induced robust endodermal differentiation. Since P19 ES cells are pluripotent and respond to external stimuli that have the potential to alter the phenotype and thus its stemness, other cell types used in RNA silencing studies do not display the obvious effect and therefore, may affect experiments in subtle ways that would go undetected. This study for the first time provides evidence that raises concern and warrants extreme caution while using the pLKO.1-puro control shRNA vector because of its unexpected non-specific effects on cellular integrity. - Highlights: • In P19 ES cells the pLKO.1-puro lentiviral control shRNA vector induced endodermal differentiation. • P19 ES cells harboring the pCDNA3 plasmid vector retained their stem-ness as opposed to those harboring the pLKO.1-puro vector. • P19 ES cells can serve as a sensor to determine vector safety. • Extreme caution is warranted while using the widely used pLKO.1-puro lentiviral vector for experimental and therapeutic designs.« less

Stable suppression of myostatin gene expression in goat fetal fibroblast cells by lentiviral vector-mediated RNAi.

PubMed

Patel, Utsav A; Patel, Amrutlal K; Joshi, Chaitanya G

2015-01-01

Myostatin (MSTN) is a secreted growth factor that negatively regulates skeletal muscle mass, and therefore, strategies to block myostatin-signaling pathway have been extensively pursued to increase the muscle mass in livestock. Here, we report a lentiviral vector-based delivery of shRNA to disrupt myostatin expression into goat fetal fibroblasts (GFFs) that were commonly used as karyoplast donors in somatic-cell nuclear transfer (SCNT) studies. Sh-RNA positive cells were screened by puromycin selection. Using real-time polymerase chain reaction (PCR), we demonstrated efficient knockdown of endogenous myostatin mRNA with 64% down-regulation in sh2 shRNA-treated GFF cells compared to GFF cells treated by control lentivirus without shRNA. Moreover, we have also demonstrated both the induction of interferon response and the expression of genes regulating myogenesis in GFF cells. The results indicate that myostatin-targeting siRNA produced endogenously could efficiently down-regulate myostatin expression. Therefore, targeted knockdown of the MSTN gene using lentivirus-mediated shRNA transgenics would facilitate customized cell engineering, allowing potential use in the establishment of stable cell lines to produce genetically engineered animals. © 2014 American Institute of Chemical Engineers.

Assessment of RNAi-induced silencing in banana (Musa spp.).

PubMed

Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

2014-09-18

In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target sequences (26-nt and 19-nt). RNAi-induced silencing was achieved in banana, both at transient and stable level, resulting in significant reduction of gene expression and enzyme activity. The success of silencing was dependent on the targeted region of the target gene. The successful generation of transgenic ECS for second transformation with (an)other construct(s) can be of value for functional genomics research in banana.

Multiple injections of electroporated autologous T cells expressing a chimeric antigen receptor mediate regression of human disseminated tumor.

PubMed

Zhao, Yangbing; Moon, Edmund; Carpenito, Carmine; Paulos, Chrystal M; Liu, Xiaojun; Brennan, Andrea L; Chew, Anne; Carroll, Richard G; Scholler, John; Levine, Bruce L; Albelda, Steven M; June, Carl H

2010-11-15

Redirecting T lymphocyte antigen specificity by gene transfer can provide large numbers of tumor-reactive T lymphocytes for adoptive immunotherapy. However, safety concerns associated with viral vector production have limited clinical application of T cells expressing chimeric antigen receptors (CAR). T lymphocytes can be gene modified by RNA electroporation without integration-associated safety concerns. To establish a safe platform for adoptive immunotherapy, we first optimized the vector backbone for RNA in vitro transcription to achieve high-level transgene expression. CAR expression and function of RNA-electroporated T cells could be detected up to a week after electroporation. Multiple injections of RNA CAR-electroporated T cells mediated regression of large vascularized flank mesothelioma tumors in NOD/scid/γc(-/-) mice. Dramatic tumor reduction also occurred when the preexisting intraperitoneal human-derived tumors, which had been growing in vivo for >50 days, were treated by multiple injections of autologous human T cells electroporated with anti-mesothelin CAR mRNA. This is the first report using matched patient tumor and lymphocytes showing that autologous T cells from cancer patients can be engineered to provide an effective therapy for a disseminated tumor in a robust preclinical model. Multiple injections of RNA-engineered T cells are a novel approach for adoptive cell transfer, providing flexible platform for the treatment of cancer that may complement the use of retroviral and lentiviral engineered T cells. This approach may increase the therapeutic index of T cells engineered to express powerful activation domains without the associated safety concerns of integrating viral vectors. Copyright © 2010 AACR.

Multiple injections of electroporated autologous T cells expressing a chimeric antigen receptor mediate regression of human disseminated tumor

PubMed Central

Zhao, Yangbing; Moon, Edmund; Carpenito, Carmine; Paulos, Chrystal M.; Liu, Xiaojun; Brennan, Andrea L; Chew, Anne; Carroll, Richard G.; Scholler, John; Levine, Bruce L.; Albelda, Steven M.; June, Carl H.

2010-01-01

Redirecting T lymphocyte antigen specificity by gene transfer can provide large numbers of tumor reactive T lymphocytes for adoptive immunotherapy. However, safety concerns associated with viral vector production have limited clinical application of T cells expressing chimeric antigen receptors (CARs). T lymphocytes can be gene modified by RNA electroporation without integration-associated safety concerns. To establish a safe platform for adoptive immunotherapy, we first optimized the vector backbone for RNA in vitro transcription to achieve high level transgene expression. CAR expression and function of RNA-electroporated T cells could be detected up to a week post electroporation. Multiple injections of RNA CAR electroporated T cells mediated regression of large vascularized flank mesothelioma tumors in NOD/scid/γc(−/−) mice. Dramatic tumor reduction also occurred when the pre-existing intraperitoneal human-derived tumors, that had been growing in vivo for over 50 days, were treated by multiple injections of autologous human T cells electroporated with anti-mesothelin CAR mRNA. This is the first report using matched patient tumor and lymphocytes demonstrating that autologous T cells from cancer patients can be engineered to provide an effective therapy for a disseminated tumor in a robust preclinical model. Multiple injections of RNA engineered T cells are a novel approach for adoptive cell transfer, providing flexible platform for the treatment of cancer that may complement the use of retroviral and lentiviral engineered T cells. This approach may increase the therapeutic index of T cells engineered to express powerful activation domains without the associated safety concerns of integrating viral vectors. PMID:20926399

Gene Overexpression and RNA Silencing Tools for the Genetic Manipulation of the S-(+)-Abscisic Acid Producing Ascomycete Botrytis cinerea

PubMed Central

Ding, Zhong-Tao; Zhang, Zhi; Luo, Di; Zhou, Jin-Yan; Zhong, Juan; Yang, Jie; Xiao, Liang; Shu, Dan; Tan, Hong

2015-01-01

The phytopathogenic ascomycete Botrytis cinerea produces several secondary metabolites that have biotechnical significance and has been particularly used for S-(+)-abscisic acid production at the industrial scale. To manipulate the expression levels of specific secondary metabolite biosynthetic genes of B. cinerea with Agrobacterium tumefaciens-mediated transformation system, two expression vectors (pCBh1 and pCBg1 with different selection markers) and one RNA silencing vector, pCBSilent1, were developed with the In-Fusion assembly method. Both expression vectors were highly effective in constitutively expressing eGFP, and pCBSilent1 effectively silenced the eGFP gene in B. cinerea. Bcaba4, a gene suggested to participate in ABA biosynthesis in B. cinerea, was then targeted for gene overexpression and RNA silencing with these reverse genetic tools. The overexpression of bcaba4 dramatically induced ABA formation in the B. cinerea wild type strain Bc-6, and the gene silencing of bcaba4 significantly reduced ABA-production in an ABA-producing B. cinerea strain. PMID:25955649

[Herpes simplex virus-mediated RNA interference targeting vesicular glutamate transporter 3 attenuates tactile allodynia in mice].

PubMed

Liu, Jie-Qiong; Li, Chen-Hong; Luo, Qiong; Yin, Ping-Ping; Lei, Tao; Luo, Fang

2016-11-20

To construct a replication-deficient herpes simplex virus (HSV-1) for delivering a short hairpin RNA (shRNA) targeting vesicular glutamate transporter 3 (VGLUT3) and observe its effect in alleviating allodynia in mice. The recombinant HSV-1 vector carrying the shRNA targeting Vglut3 (HSV-1-shvglut3) was constructed and inoculated in the sciatic nerve in a mouse model of mechanical allodynia to test its analgesia effect. Mechanical allodynia and heat hypersensitivity of the mice were tested by von Frey filaments and Hargreaves' test, respectively. VGLUT3 expression in the dorsal root ganglion (DRG) was evaluated by immunohistochemistry and Western blotting. Following inoculation in the sciatic nerve, the HSV vector HSV-1-shvglut3 was retrogradely transported to the DRG. Mechanical withdraw thresholds of the mouse models receiving HSV-1-shvglut3 inoculation were reversed to nearly the baseline level, and VGLUT3 expression in the DRG was down-regulated 2 weeks after vector inoculation. The analgesic effect lasted for over 2 weeks in these mice without obvious systematic side effects or changes in heat hypersensitivity threshold. Vglut3 in the DRG is a promising therapeutic target for alleviating mechanical allodynia, and HSV-1 vector-mediated RNA interference is safe and efficient for inducing long-lasting analgesia after peripheral inoculation of the vector.

Fibrinolysis in Tumor Associated Angiogenesis

DTIC Science & Technology

2005-07-01

tPA expression in mammary vessel assays and in animals with use of retroviral vectors to deliver antisense RNA . We still intend to use that strategy...pads of nude mice. RNA obtained from tumor- and mam- mary fat pad-associated endothelial cells was used to synthesize cDNA and cDNA libraries, which... RNA (mRNA) for tPA and MT1-MMP, with some upregulation of uPA expression. BODY 1. Confirm differential expression of tPA and MT1-MIP with GAPDH control

Down-regulation of CD19 expression inhibits proliferation, adhesion, migration and invasion and promotes apoptosis and the efficacy of chemotherapeutic agents and imatinib in SUP-B15 cells.

PubMed

Wu, Junqing; Liang, Bin; Qian, Yan; Tang, Liyuan; Xing, Chongyun; Zhuang, Qiang; Shen, Zhijian; Jiang, Songfu; Yu, Kang; Feng, Jianhua

2018-05-29

The survival rate of childhood acute lymphoblastic leukemia (ALL) has increased while that of Philadelphia-positive (Ph+) ALL remains low. CD19 is a B-cell specific molecule related to the survival and proliferation of normal B cells. However, there is little information available on the effects of CD19 on the biological behavior of Ph+ ALL cells. In this study, we explored a lentiviral vector-mediated short hairpin RNA (shRNA) expression vector to stably reduce CD19 expression in Ph+ ALL cell line SUP-B15 cells and investigated the effects of CD19 downregulation on cell proliferation, apoptosis, drug sensitivity, cell adhesion, cell migration and cell invasion in vitro. CD19 mRNA and protein expression levels were inhibited significantly by CD19 shRNA. Down-regulation of CD19 could inhibit cell proliferation, adhesion, migration and invasion, and increase cell apoptosis and the efficacy of chemotherapeutic agents and imatinib in SUP-B15 cells. Moreover, we found that down-regulation of CD19 expression inhibits cell proliferation and induces apoptosis in SUP-B15 cells in a p53-dependent manner. Taken together, our results suggest that lentiviral vector-mediated RNA interference of CD19 gene may be a promising strategy in the treatment of Ph+ ALL. This article is protected by copyright. All rights reserved.

Adeno-associated virus type 8 vector–mediated expression of siRNA targeting vascular endothelial growth factor efficiently inhibits neovascularization in a murine choroidal neovascularization model

PubMed Central

Igarashi, Tsutomu; Miyake, Noriko; Fujimoto, Chiaki; Yaguchi, Chiemi; Iijima, Osamu; Shimada, Takashi; Takahashi, Hiroshi

2014-01-01

Purpose To assess the feasibility of a gene therapeutic approach to treating choroidal neovascularization (CNV), we generated an adeno-associated virus type 8 vector (AAV2/8) encoding an siRNA targeting vascular endothelial growth factor (VEGF), and determined the AAV2/8 vector’s ability to inhibit angiogenesis. Methods We initially transfected 3T3 cells expressing VEGF with the AAV2/8 plasmid vector psiRNA-VEGF using the H1 promoter and found that VEGF expression was significantly diminished in the transfectants. We next injected 1 μl (3 × 1014 vg/ml) of AAV2/8 vector encoding siRNA targeting VEGF (AAV2/8/SmVEGF-2; n = 12) or control vector encoding green fluorescent protein (GFP) (AAV2/8/GFP; n = 14) into the subretinal space in C57BL/6 mice. One week later, CNV was induced by using a diode laser to make four separate choroidal burns around the optic nerve in each eye. After an additional 2 weeks, the eyes were removed for flat mount analysis of the CNV surface area. Results Subretinal delivery of AAV2/8/SmVEGF-2 significantly diminished CNV at the laser lesions, compared to AAV8/GFP (1597.3±2077.2 versus 5039.5±4055.9 µm2; p<0.05). Using an enzyme-linked immunosorbent assay, we found that VEGF levels were reduced by approximately half in the AAV2/8/SmVEGF-2 treated eyes. Conclusions These results suggest that siRNA-VEGF can be expressed across the retina and that long-term suppression of CNV is possible through the use of stable AAV2/8-mediated siRNA-VEGF expression. In vivo gene therapy may thus be a feasible approach to the clinical management of CNV in conditions such as age-related macular degeneration. PMID:24744609

Development of novel types of plastid transformation vectors and evaluation of factors controlling expression.

PubMed

Herz, Stefan; Füssl, Monika; Steiger, Sandra; Koop, Hans-Ulrich

2005-12-01

Two new vector types for plastid transformation were developed and uidA reporter gene expression was compared to standard transformation vectors. The first vector type does not contain any plastid promoter, instead it relies on extension of existing plastid operons and was therefore named "operon-extension" vector. When a strongly expressed plastid operon like psbA was extended by the reporter gene with this vector type, the expression level was superior to that of a standard vector under control of the 16S rRNA promoter. Different insertion sites, promoters and 5'-UTRs were analysed for their effect on reporter gene expression with standard and operon-extension vectors. The 5'-UTR of phage 7 gene 10 in combination with a modified N-terminus was found to yield the highest expression levels. Expression levels were also strongly dependent on external factors like plant or leaf age or light intensity. In the second vector type, named "split" plastid transformation vector, modules of the expression cassette were distributed on two separate vectors. Upon co-transformation of plastids with these vectors, the complete expression cassette became inserted into the plastome. This result can be explained by successive co-integration of the split vectors and final loop-out recombination of the duplicated sequences. The split vector concept was validated with different vector pairs.

Vector-based RNA interference against vascular endothelial growth factor-A significantly limits vascularization and growth of prostate cancer in vivo.

PubMed

Wannenes, Francesca; Ciafré, Silvia Anna; Niola, Francesco; Frajese, Gaetano; Farace, Maria Giulia

2005-12-01

RNA interference technology is emerging as a very potent tool to obtain a cellular knockdown of a desired gene. In this work we used vector-based RNA interference to inhibit vascular endothelial growth factor (VEGF) expression in prostate cancer in vitro and in vivo. We demonstrated that transduction with a plasmid carrying a small interfering RNA targeting all isoforms of VEGF, dramatically impairs the expression of this growth factor in the human prostate cancer cell line PC3. As a consequence, PC3 cells loose their ability to induce one of the fundamental steps of angiogenesis, namely the formation of a tube-like network in vitro. Most importantly, our "therapeutic" vector is able to impair tumor growth rate and vascularization in vivo. We show that a single injection of naked plasmid in developing neoplastic mass significantly decreases microvessel density in an androgen-refractory prostate xenograft and is able to sustain a long-term slowing down of tumor growth. In conclusion, our results confirm the basic role of VEGF in the angiogenic development of prostate carcinoma, and suggest that the use of our vector-based RNA interference approach to inhibit angiogenesis could be an effective tool in view of future gene therapy applications for prostate cancer.

Establishment of conditional vectors for hairpin siRNA knockdowns

PubMed Central

Matsukura, Shiro; Jones, Peter A.; Takai, Daiya

2003-01-01

Small interference RNA (siRNA) is an emerging methodology in reverse genetics. Here we report the development of a new tetracycline-inducible vector-based siRNA system, which uses a tetracycline-responsive derivative of the U6 promoter and the tetracycline repressor for conditional in vivo transcription of short hairpin RNA. This method prevents potential lethality immediately after transfection of a vector when the targeted gene is indispensable, or the phenotype of the knockdown is lethal or results in a growth abnormality. We show that the controlled knockdown of DNA methyltransferase 1 (DNMT1) in human cancer resulted in growth arrest. Removal of the inducer, doxycycline, from treated cells led to re-expression of the targeted gene. Thus the method allows for a highly controlled approach to gene knockdown. PMID:12888529

MicroRNA-Regulated Non-Viral Vectors with Improved Tumor Specificity in an Orthotopic Rat Model of Hepatocellular Carcinoma

PubMed Central

Ronald, John A.; Katzenberg, Regina; Nielsen, Carsten H.; Jae, Hwan Jun; Hofmann, Lawrence V.; Gambhir, Sanjiv S.

2013-01-01

In hepatocellular carcinoma, tumor specificity of gene therapy is of utmost importance to preserve liver function. MicroRNAs are powerful negative regulators of gene expression and many are down-regulated in human HCC. We identified seven miRNAs that are also down-regulated in tumors in a rat hepatoma model (p<0.05) and attempted to improve tumor specificity by constructing a panel of luciferase-expressing vectors containing binding sites for these microRNAs. Attenuation of luciferase expression by the corresponding microRNAs was confirmed across various cell lines and in mouse liver. We then tested our vectors in tumor-bearing rats and identified two microRNAs, miR-26a and miR-122, that significantly decreased expression in liver compared to control vector (6.40% and 0.26%, respectively; p<0.05). In tumor, miR-122 had a non-significant trend towards decreased (~50%) expression , while miR-26 had no significant effect on tumor expression. To our knowledge this is the first work using differentially expressed microRNAs to de-target transgene expression in an orthotopic hepatoma model and identification of miR-26a in addition to miR-122 for de-targeting liver. Considering the heterogeneity of microRNA expression in human HCC, this information will be important in guiding development of more personalized vectors for the treatment of this devastating disease. PMID:23719066

Silencing the HaHR3 Gene by Transgenic Plant-mediated RNAi to Disrupt Helicoverpa armigera Development

PubMed Central

Xiong, Yehui; Zeng, Hongmei; Zhang, Yuliang; Xu, Dawei; Qiu, Dewen

2013-01-01

RNA interference (RNAi) caused by exogenous double-stranded RNA (dsRNA) has developed into a powerful technique in functional genomics, and to date it is widely used to down-regulate crucial physiology-related genes to control pest insects. A molt-regulating transcription factor gene, HaHR3, of cotton bollworm (Helicoverpa armigera) was selected as the target gene. Four different fragments covering the coding sequence (CDS) of HaHR3 were cloned into vector L4440 to express dsRNAs in Escherichia coli. The most effective silencing fragment was then cloned into a plant over-expression vector to express a hairpin RNA (hpRNA) in transgenic tobacco (Nicotiana tabacum). When H. armigera larvae were fed the E. coli or transgenic plants, the HaHR3 mRNA and protein levels dramatically decreased, resulting developmental deformity and larval lethality. The results demonstrate that both recombinant bacteria and transgenic plants could induce HaHR3 silence to disrupt H. armigera development, transgenic plant-mediated RNAi is emerging as a powerful approach for controlling insect pests. PMID:23630449

An RGD-Modified MRI-Visible Polymeric Vector for Targeted siRNA Delivery to Hepatocellular Carcinoma in Nude Mice

PubMed Central

Shen, Min; Zhu, Kangshun; Cheng, Du; Liu, Zhihao; Shan, Hong

2013-01-01

RNA interference (RNAi) has significant therapeutic promise for the genetic treatment of hepatocellular carcinoma (HCC). Targeted vectors are able to deliver small interfering RNA (siRNA) into HCC cells with high transfection efficiency and stability. The tripeptide arginine glycine aspartic acid (RGD)-modified non-viral vector, polyethylene glycol-grafted polyethylenimine functionalized with superparamagnetic iron oxide nanoparticles (RGD-PEG-g-PEI-SPION), was constructed as a magnetic resonance imaging (MRI)-visible nanocarrier for the delivery of Survivin siRNA targeting the human HCC cell line Bel-7402. The biophysical characterization of the RGD-PEG-g-PEI-SPION was performed. The RGD-modified complexes exhibited a higher transfection efficiency in transferring Survivin siRNA into Bel-7402 cells compared with a non-targeted delivery system, which resulted in more significant gene suppression at both the Survivin mRNA and protein expression levels. Then, the level of caspase-3 activation was significantly elevated, and a remarkable level of tumor cell apoptosis was induced. As a result, the tumor growth in the nude mice Bel-7402 hepatoma model was significantly inhibited. The targeting ability of the RGD-PEG-g-PEI-SPION was successfully imaged by MRI scans performed in vitro and in vivo. Our results strongly indicated that the RGD-PEG-g-PEI-SPION can potentially be used as a targeted non-viral vector for altering gene expression in the treatment of hepatocellular carcinoma and for detecting the tumor in vivo as an effective MRI probe. PMID:23922634

RNAi as a tool to control the sex ratio of mouse offspring by interrupting Zfx/Zfy genes in the testis.

PubMed

Zhang, YongSheng; Xi, JiFeng; Jia, Bin; Wang, XiangZu; Wang, XuHai; Li, ChaoCheng; Li, YaQiang; Zeng, XianCun; Ying, RuiWen; Li, Xin; Jiang, Song; Yuan, FangYuan

2017-04-01

The objective of this study was to explore a novel method to alter the sex-ratio balance of mouse offspring by silencing the paralogous genes Zfx/Zfy (Zinc finger X/Y-chromosomal transcription factor gene) during spermatogenesis. Four recombined vectors PRZ1, PRZ2, PRZ3, and PRZ4 (RNAi-Ready-pSIREN-RetroQ-ZsGreen) were constructed for interrupting the Zfx gene. Additionally, a recombined vector Psilencer/Zfy-shRNA was constructed for interrupting the Zfy gene. Male mice were randomly divided into 8 groups, with 20 animals per group. Five groups of mice were injected with PRZ1, PRZ2, PRZ3, PRZ4, and Psilencer/Zfy-shRNA vectors, respectively. The three control groups were injected with an equal volume of physiological saline, empty RNAi-Ready-pSIREN-RetroQ-ZsGreen vector, and empty Psilencer/Zfy-shRNA vector, respectively. All groups were injected every 7 days for a total of four injections. Fourteen days after the fourth injection, 10 male mice from each group were mated individually with 10 females. Testicular tissue of 10 male mice in each group was collected, and the expression level of Zfx/Zfy mRNA was determined by qRT-PCR. Results showed that, compared with the empty RNAi-Ready-pSIREN-RetroQ-ZsGreen vector and the physiological saline group, expression of Zfx mRNA decreased significantly after injection of PRZ1 (p < 0.01), PRZ3 (p < 0.01), and PRZ4 (p < 0.01), and 78.75 ± 7.50% of the offspring were male in PRZ4 group, significantly higher than the offspring derived from the empty RNAi-Ready-pSIREN-RetroQ-ZsGreen vector and physiological saline group (p < 0.01). In the PRZ1 group, the expression of Zfx mRNA was also significantly lower (p < 0.01), but the male rate of offspring was not different (p > 0.05). Conversely, the expression of Zfy mRNA decreased significantly after injection of Psilencer/Zfy-shRNA (p < 0.01) and 31.00 ± 11.00% of the offspring were male, significantly lower than in the physiological saline group (p < 0.01). In conclusion, our findings show that RNAi-mediated disruption of Zfx/Zfy in mouse testis affected X/Y spermatogenesis. Additionally, results suggest that the paralogous genes Zfx/Zfy play an important role in the process of X and Y sperm development. The individual interference of Zfx/Zfy may predict the outcome of X and Y haploid sperms. Presented herein is an advanced method developed to control mouse X/Y spermatogenesis and sex ratio of offspring.

The effect of Pokemon on bladder cancer epithelial-mesenchymal transition.

PubMed

Guo, Changcheng; Zhu, Kai; Sun, Wei; Yang, Bin; Gu, Wenyu; Luo, Jun; Peng, Bo; Zheng, Junhua

2014-01-24

This study aimed at detecting Pokemon expression in bladder cancer cell and investigating the relationship between Pokemon and epithelial-mesenchymal transition. Furthermore, we investigated the functions of Pokemon in the carcinogenesis and development of bladder cancer. This study was also designed to observe the inhibitory effects of siRNA expression vector on Pokemon in bladder cancer cell. The siRNA expression vectors which were constructed to express a short hairpin RNA against Pokemon were transfected to the bladder cancer cells T24 with a liposome. Levels of Pokemon, E-cadherin and β-catenin mRNA and protein were examined by real-time quantitative-fluorescent PCR and Western blot analysis, respectively. The effects of Pokemon silencing on epithelial-mesenchymal transition of T24 cells were evaluated with wound-healing assay. Pokemon was strongly inhibited by siRNA treatment, especially siRNA3 treatment group, as it was reflected by Western blot and real-time PCR. The gene and protein of E-cadherin expression level showed increased markedly after Pokemon was inhibited by RNA interference. While there were no differences in the levels of gene and protein of β-catenin among five groups. The bladder cancer cell after Pokemon siRNA interference showed a significantly reduced wound-closing efficiency at 6, 12 and 24h. Our findings suggest Pokemon may inhibit the expression of E-cadherin. The low expression of E-cadherin lead to increasing the phenotype and apical-base polarity of epithelial cells. These changes of cells may result in the recurrence and progression of bladder cancer at last. Copyright © 2013 Elsevier Inc. All rights reserved.

A genome-wide inducible phenotypic screen identifies antisense RNA constructs silencing Escherichia coli essential genes

PubMed Central

Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K.; Crummer, Heather; Tain, Justina; Xu, H. Howard

2013-01-01

Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250,000 library transformants for conditional growth-inhibitory recombinant clones from two shot-gun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer-sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes while 18 originated from non-essential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12 fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. PMID:22268863

Virus-Based RNA Silencing Agents and Virus-Derived Expression Vectors as Gene Therapy Vehicles.

PubMed

Venkataraman, Srividhya; Ahmad, Tauqeer; AbouHaidar, Mounir G; Hefferon, Kathleen L

2017-01-01

In consideration of recent developments in understanding the genomics and proteomics of viruses, the use of viral DNA / RNA sequences as well as their gene expression schemes, have found new in-roads towards the prognosis and therapy of diseases. Correspondingly, the sphere of the patenting scenario has expanded significantly. The current review addresses patented inventions concerning the use of virus sequences as gene silencing machineries and inventions concerning the generation and application of viral sequences as expression vectors. Furthermore, this review also discusses the employment of these patents for clinical, agricultural and biotechnological applications. Considering these objectives, the Delphion Research Intellectual Property Network database was searched using keywords such as "gene silencing", "engineered viruses" and "expression vectors" and descriptions of recent patents on the said topics were discussed. Despite several recent advances in the use of viruses as disease therapy vehicles and biotechnological vectors, these developments have yet to be proven effective in practice, in clinical and field trials. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Incorporation of aptamers in the terminal loop of shRNAs yields an effective and novel combinatorial targeting strategy.

PubMed

Pang, Ka Ming; Castanotto, Daniela; Li, Haitang; Scherer, Lisa; Rossi, John J

2018-01-09

Gene therapy by engineering patient's own blood cells to confer HIV resistance can potentially lead to a functional cure for AIDS. Toward this goal, we have previously developed an anti-HIV lentivirus vector that deploys a combination of shRNA, ribozyme and RNA decoy. To further improve this therapeutic vector against viral escape, we sought an additional reagent to target HIV integrase. Here, we report the development of a new strategy for selection and expression of aptamer for gene therapy. We developed a SELEX protocol (multi-tag SELEX) for selecting RNA aptamers against proteins with low solubility or stability, such as integrase. More importantly, we expressed these aptamers in vivo by incorporating them in the terminal loop of shRNAs. This novel strategy allowed efficient expression of the shRNA-aptamer fusions that targeted RNAs and proteins simultaneously. Expressed shRNA-aptamer fusions targeting HIV integrase or reverse transcriptase inhibited HIV replication in cell cultures. Viral inhibition was further enhanced by combining an anti-integrase aptamer with an anti-HIV Tat-Rev shRNA. This construct exhibited efficacy comparable to that of integrase inhibitor Raltegravir. Our strategy for the selection and expression of RNA aptamers can potentially extend to other gene therapy applications. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

LC3-mediated fibronectin mRNA translation induces fibrosarcoma growth by increasing connective tissue growth factor

PubMed Central

Ying, Lihua; Lau, Agatha; Alvira, Cristina M.; West, Robert; Cann, Gordon M.; Zhou, Bin; Kinnear, Caroline; Jan, Eric; Sarnow, Peter; Van de Rijn, Matt; Rabinovitch, Marlene

2009-01-01

Summary Previously, we related fibronectin (Fn1) mRNA translation to an interaction between an AU-rich element in the Fn1 3′ UTR and light chain 3 (LC3) of microtubule-associated proteins 1A and 1B. Since human fibrosarcoma (HT1080) cells produce little fibronectin and LC3, we used these cells to investigate how LC3-mediated Fn1 mRNA translation might alter tumor growth. Transfection of HT1080 cells with LC3 enhanced fibronectin mRNA translation. Using polysome analysis and RNA-binding assays, we show that elevated levels of translation depend on an interaction between a triple arginine motif in LC3 and the AU-rich element in Fn1 mRNA. Wild-type but not mutant LC3 accelerated HT1080 cell growth in culture and when implanted in SCID mice. Comparison of WT LC3 with vector-transfected HT1080 cells revealed increased fibronectin-dependent proliferation, adhesion and invasion. Microarray analysis of genes differentially expressed in WT and vector-transfected control cells indicated enhanced expression of connective tissue growth factor (CTGF). Using siRNA, we show that enhanced expression of CTGF is fibronectin dependent and that LC3-mediated adhesion, invasion and proliferation are CTGF dependent. Expression profiling of soft tissue tumors revealed increased expression of both LC3 and CTGF in some locally invasive tumor types. PMID:19366727

Modulation of c-fms proto-oncogene in an ovarian carcinoma cell line by a hammerhead ribozyme.

PubMed Central

Yokoyama, Y.; Morishita, S.; Takahashi, Y.; Hashimoto, M.; Tamaya, T.

1997-01-01

Co-expression of macrophage colony-stimulating factor (M-CSF) and its receptor (c-fms) is often found in ovarian epithelial carcinoma, suggesting the existence of autocrine regulation of cell growth by M-CSF. To block this autocrine loop, we have developed hammerhead ribozymes against c-fms mRNA. As target sites of the ribozyme, we chose the GUC sequence in codon 18 and codon 27 of c-fms mRNA. Two kinds of ribozymes were able to cleave an artificial c-fms RNA substrate in a cell-free system, although the ribozyme against codon 18 was much more efficient than that against codon 27. We next constructed an expression vector carrying a ribozyme sequence that targeted the GUC sequence in codon 18 of c-fms mRNA. It was introduced into TYK-nu cells that expressed M-CSF and its receptor. Its transfectant showed a reduced growth potential. The expression levels of c-fms protein and mRNA in the transfectant were clearly decreased with the expression of ribozyme RNA compared with that of an untransfected control or a transfectant with the vector without the ribozyme sequence. These results suggest that the ribozyme against GUC in codon 18 of c-fms mRNA is a promising tool for blocking the autocrine loop of M-CSF in ovarian epithelial carcinoma. Images Figure 2 Figure 3 Figure 5 Figure 6 PMID:9376277

Design and construction of functional AAV vectors.

PubMed

Gray, John T; Zolotukhin, Serge

2011-01-01

Using the basic principles of molecular biology and laboratory techniques presented in this chapter, researchers should be able to create a wide variety of AAV vectors for both clinical and basic research applications. Basic vector design concepts are covered for both protein coding gene expression and small non-coding RNA gene expression cassettes. AAV plasmid vector backbones (available via AddGene) are described, along with critical sequence details for a variety of modular expression components that can be inserted as needed for specific applications. Protocols are provided for assembling the various DNA components into AAV vector plasmids in Escherichia coli, as well as for transferring these vector sequences into baculovirus genomes for large-scale production of AAV in the insect cell production system.

Retrovirus-based vectors for transient and permanent cell modification.

PubMed

Schott, Juliane W; Hoffmann, Dirk; Schambach, Axel

2015-10-01

Retroviral vectors are commonly employed for long-term transgene expression via integrating vector technology. However, three alternative retrovirus-based platforms are currently available that allow transient cell modification. Gene expression can be mediated from either episomal DNA or RNA templates, or selected proteins can be directly transferred through retroviral nanoparticles. The different technologies are functionally graded with respect to safety, expression magnitude and expression duration. Improvement of the initial technologies, including modification of vector designs, targeted increase in expression strength and duration as well as improved safety characteristics, has allowed maturation of retroviral systems into efficient and promising tools that meet the technological demands of a wide variety of potential application areas. Copyright © 2015 Elsevier Ltd. All rights reserved.

Reversal of multidrug resistance by magnetic Fe3O4 nanoparticle copolymerizating daunorubicin and MDR1 shRNA expression vector in leukemia cells.

PubMed

Chen, Bao-an; Mao, Pei-pei; Cheng, Jian; Gao, Feng; Xia, Guo-hua; Xu, Wen-lin; Shen, Hui-lin; Ding, Jia-hua; Gao, Chong; Sun, Qian; Chen, Wen-ji; Chen, Ning-na; Liu, Li-jie; Li, Xiao-mao; Wang, Xue-mei

2010-08-09

In many instances, multidrug resistance (MDR) is mediated by increasing the expression at the cell surface of the MDR1 gene product, P-glycoprotein (P-gp), a 170-kD energy-dependent efflux pump. The aim of this study was to investigate the potential benefit of combination therapy with magnetic Fe(3)O(4) nanoparticle [MNP (Fe(3)O(4))] and MDR1 shRNA expression vector in K562/A02 cells. For stable reversal of "classical" MDR by short hairpin RNA (shRNA) aiming directly at the target sequence (3491-3509, 1539-1557, and 3103-3121 nucleotide) of MDR1 mRNA. PGC silencer-U6-neo-GFP-shRNA/MDR1 called PGY1-1, PGY1-2, and PGY1-3 were constructed and transfected into K562/A02 cells by lipofectamine 2000. After transfected and incubated with or without MNP (Fe(3)O(4)) for 48 hours, the transcription of MDR1 mRNA and the expression of P-gp were detected by quantitative real-time PCR and Western-blot assay respectively. Meanwhile intracellular concentration of DNR in K562/A02 cells was detected by flow cytometry (FCM). PGC silencer-U6-neo-GFP-shRNA/MDR1 was successfully constructed, which was confirmed by sequencing and PGY1-2 had the greatest MDR1 gene inhibitory ratio. Analysis of the reversal ratio of MDR, the concentration of daunorubicin (DNR) and the transcription of MDR1 gene and expression of P-gp in K562/A02 showed that combination of DNR with either MNP (Fe(3)O(4)) or PGY1-2 exerted a potent cytotoxic effect on K562/A02 cells, while combination of MNP (Fe(3)O(4)) and PGY1-2 could synergistically reverse multidrug resistance. Thus our in vitro data strongly suggested that a combination of MNP (Fe(3)O(4)) and shRNA expression vector might be a more sufficient and less toxic anti-MDR method on leukemia.

Embedding siRNA sequences targeting Apolipoprotein B100 in shRNA and miRNA scaffolds results in differential processing and in vivo efficacy

PubMed Central

Maczuga, Piotr; Lubelski, Jacek; van Logtenstein, Richard; Borel, Florie; Blits, Bas; Fakkert, Erwin; Costessi, Adalberto; Butler, Derek; van Deventer, Sander; Petry, Harald; Koornneef, Annemart; Konstantinova, Pavlina

2013-01-01

Overexpression of short hairpin RNA (shRNA) often causes cytotoxicity and using microRNA (miRNA) scaffolds can circumvent this problem. In this study, identically predicted small interfering RNA (siRNA) sequences targeting apolipoprotein B100 (siApoB) were embedded in shRNA (shApoB) or miRNA (miApoB) scaffolds and a direct comparison of the processing and long-term in vivo efficacy was performed. Next generation sequencing of small RNAs originating from shApoB- or miApoB-transfected cells revealed substantial differences in processing, resulting in different siApoB length, 5′ and 3′ cleavage sites and abundance of the guide or passenger strands. Murine liver transduction with adeno-associated virus (AAV) vectors expressing shApoB or miApoB resulted in high levels of siApoB expression associated with strong decrease of plasma ApoB protein and cholesterol. Expression of miApoB from the liver-specific LP1 promoter was restricted to the liver, while the H1 promoter-expressed shApoB was ectopically present. Delivery of 1 × 1011 genome copies AAV-shApoB or AAV-miApoB led to a gradual loss of ApoB and plasma cholesterol inhibition, which was circumvented by delivering a 20-fold lower vector dose. In conclusion, incorporating identical siRNA sequences in shRNA or miRNA scaffolds results in differential processing patterns and in vivo efficacy that may have serious consequences for future RNAi-based therapeutics. PMID:23089734

Genetically Modifying the Insect Gut Microbiota to Control Chagas Disease Vectors through Systemic RNAi

PubMed Central

Taracena, Mabel L.; Oliveira, Pedro L.; Almendares, Olivia; Umaña, Claudia; Lowenberger, Carl; Dotson, Ellen M.; Paiva-Silva, Gabriela O.; Pennington, Pamela M.

2015-01-01

Technologies based on RNA interference may be used for insect control. Sustainable strategies are needed to control vectors of Chagas disease such as Rhodnius prolixus. The insect microbiota can be modified to deliver molecules to the gut. Here, Escherichia coli HT115(DE3) expressing dsRNA for the Rhodnius heme-binding protein (RHBP) and for catalase (CAT) were fed to nymphs and adult triatomine stages. RHBP is an egg protein and CAT is an antioxidant enzyme expressed in all tissues by all developmental stages. The RNA interference effect was systemic and temporal. Concentrations of E. coli HT115(DE3) above 3.35 × 107 CFU/mL produced a significant RHBP and CAT gene knockdown in nymphs and adults. RHBP expression in the fat body was reduced by 99% three days after feeding, returning to normal levels 10 days after feeding. CAT expression was reduced by 99% and 96% in the ovary and the posterior midgut, respectively, five days after ingestion. Mortality rates increased by 24-30% in first instars fed RHBP and CAT bacteria. Molting rates were reduced by 100% in first instars and 80% in third instars fed bacteria producing RHBP or CAT dsRNA. Oviposition was reduced by 43% (RHBP) and 84% (CAT). Embryogenesis was arrested in 16% (RHBP) and 20% (CAT) of laid eggs. Feeding females 105 CFU/mL of the natural symbiont, Rhodococcus rhodnii, transformed to express RHBP-specific hairpin RNA reduced RHBP expression by 89% and reduced oviposition. Modifying the insect microbiota to induce systemic RNAi in R. prolixus may result in a paratransgenic strategy for sustainable vector control. PMID:25675102

Blood-induced differential gene expression in Anopheles dirus evaluated using RNA sequencing.

PubMed

Mongkol, W; Nguitragool, W; Sattabongkot, J; Kubera, A

2018-06-08

Malaria parasites are transmitted through blood feeding by female Anopheline mosquitoes. Unveiling the blood-feeding process will improve understanding of vector biology. Anopheles dirus (Diptera: Culicidae) is one of the primary malaria vectors in the Greater Mekong Subregion, the epicentre of malaria drug resistance. In this study, differential gene expression between sugar- and blood-fed An. dirus was investigated by RNA sequencing (RNA-seq). A total of 589 transcripts were found to be upregulated and 703 transcripts downregulated as a result of blood feeding. Transcriptional differences were found in genes involved in blood digestion, peritrophic matrix formation, oogenesis and vitellogenesis. The expression levels of several genes were validated by quantitative reverse transcription polymerase chain reaction. The present results provide better understanding of An. dirus biology in relation to its blood feeding. © 2018 The Royal Entomological Society.

Armored long non-coding RNA MEG3 targeting EGFR based on recombinant MS2 bacteriophage virus-like particles against hepatocellular carcinoma.

PubMed

Chang, Le; Wang, Guojing; Jia, Tingting; Zhang, Lei; Li, Yulong; Han, Yanxi; Zhang, Kuo; Lin, Guigao; Zhang, Rui; Li, Jinming; Wang, Lunan

2016-04-26

Hepatocellular carcinoma (HCC) is one of the most frequently diagnosed cancers worldwide. However, the treatment of patients with HCC is particularly challenging. Long non-coding RNA maternally expressed gene 3 (MEG3) has been identified as a potential suppressor of several types of tumors, but the delivery of long RNA remains problematic, limiting its applications. In the present study, we designed a novel delivery system based on MS2 virus-like particles (VLPs) crosslinked with GE11 polypeptide. This vector was found to be fast, effective and safe for the targeted delivery of lncRNA MEG3 RNA to the epidermal growth factor receptor (EGFR)-positive HCC cell lines without the activation of EGFR downstream pathways, and significantly attenuated both in vitro and in vivo tumor cell growth. Our study also revealed that the targeted delivery was mainly dependent on clathrin-mediated endocytosis and MEG3 RNA suppresses tumor growth mainly via increasing the expression of p53 and its downstream gene GDF15, but decreasing the expression of MDM2. Thus, this vector is promising as a novel delivery system and may facilitate a new approach to lncRNA based cancer therapy.

Blocking of SMAD4 expression by shRNA effectively inhibits fibrogenesis of human hepatic stellate cells.

PubMed

Khanizadeh, Sayyad; Ravanshad, Mehrdad; Hosseini, SeyedYounes; Davoodian, Parivash; Nejati Zadeh, Azim; Sarvari, Jamal

2015-01-01

In this study, to clarify the SMAD4 blocking impact on fibrosis process, we investigated its down-regulation by shRNA on activated human LX-2 cell, in vitro. Liver fibrosis is a critical consequence of chronic damage to the liver that can progress toward advanced diseases, liver cirrhosis and hepatocellular carcinoma (HCC). Different SMAD proteins play as major mediators in the fibrogenesis activity of hepatic stellate cells through TGF-β pathways, but the extent of SMAD4 as a co-SMAD protein remained less clear. vector expressing verified shRNA targeting human SMAD4 gene was transfected into LX-2 cells. The GFP expressing plasmid was transfected in the same manner as a control group while leptin treated cells were employed as positive controls. Subsequently, total RNA was extracted and real-time PCR was performed to measure the mRNA levels of SMAD4, COL-1A1, α-SMA, TGF-β and TIMP-1. Furthermore, trypan blue exclusion was performed to test the effect of plasmid transfection and SMAD4 shutting-down on cellular viability. The results indicated that the expression of SMAD4was down-regulated following shRNA transfection intoLX-2 cells (P<0.001). The gene expression analysis of fibrotic genes in LX-2 cells showed that SMAD4 blocking by shRNA significantly reduced the expression level of fibrotic genes when compared to control plasmids (P<0.001). Vector expressing SMAD4-shRNA induced no significant cytotoxic or proliferative effects on LX-2 cells as determined by viability assay (P<0.05). The results of this study suggested that knockdown of SMAD4 expression in stellate cell can control the progression of fibrogenesis through TGF-β pathway blocking.

[Construction of recombinant lentiviral vector of Tie2-RNAi and its influence on malignant melanoma cells in vitro].

PubMed

Shan, Xiu-ying; Liu, Zhao-liang; Wang, Biao; Guo, Guo-xiang; Wang, Mei-shui; Zhuang, Fu-lian; Cai, Chuan-shu; Zhang, Ming-feng; Zhang, Yan-ding

2011-07-01

To construct lentivector carrying Tie2-Small interfering RNA (SiRNA), so as to study its influence on malignant melanoma cells. Recombinant plasmid pSilencer 1.0-U6-Tie2-siRNA and plasmid pNL-EGFP were digested with XbaI, ligated a target lentiviral transfer plasmid of pNL-EGFP-U6-Tie2-I or pNL-EGFP-U6-Tie2-II, and then the electrophoresis clones was sequenced. Plasmids of pNL-EGFP-U6-Tie2-I and pNL-EGFP-U6-Tie2-II were constructed and combined with pVSVG and pHelper, respectively, to constitute lentiviral vector system of three plasmids. The Lentiviral vector system was transfected into 293T cell to produce pNL-EGFP-U6-Tie2- I and pNL-EGFP-U6-Tie2-II lentivirus. Then the supernatant was collected to determine the titer. Malignant melanoma cells were infected by both lentiviruses and identified by Realtime RT-PCR to assess inhibitory efficiency. The recombinant lentiviral vectors of Tie2-RNAi were constructed successfully which were analyzed with restriction enzyme digestion and identified by sequencing. And the titer of lentiviral vector was 8.8 x 10(3)/ml, which was determined by 293T cell. The results of Realtime RT-PCR demonstrated that the lentiviral vectors of Tie2-RNAi could infect malignant melanoma cells and inhibit the expression of Tie2 genes in malignant melanoma cells (P<0.01). There was no significant difference in the expression level (P>0.05) between the two lentiviral vectors of Tie2-RNAi. Lentivector carrying Tie2-SiRNA can be constructed successfully and inhibit the expression of Tie2 gene in vitro significantly. The study will supply the theory basis for the further research on the inhibition of tumor growth in vivo.

Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

PubMed Central

Huang, Weizhe; He, Ziying

2013-01-01

RNA interference (RNAi) was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA) are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc.) of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system. PMID:24288498

Vectorology and Factor Delivery in Induced Pluripotent Stem Cell Reprogramming

PubMed Central

2014-01-01

Induced pluripotent stem cell (iPSC) reprogramming requires sustained expression of multiple reprogramming factors for a limited period of time (10–30 days). Conventional iPSC reprogramming was achieved using lentiviral or simple retroviral vectors. Retroviral reprogramming has flaws of insertional mutagenesis, uncontrolled silencing, residual expression and re-activation of transgenes, and immunogenicity. To overcome these issues, various technologies were explored, including adenoviral vectors, protein transduction, RNA transfection, minicircle DNA, excisable PiggyBac (PB) transposon, Cre-lox excision system, negative-sense RNA replicon, positive-sense RNA replicon, Epstein-Barr virus-based episomal plasmids, and repeated transfections of plasmids. This review provides summaries of the main vectorologies and factor delivery systems used in current reprogramming protocols. PMID:24625220

Inducible Transgenic Models of BRCA1 Function

DTIC Science & Technology

1999-10-01

inducible expression vectors were created to conditionally express four different hammerhead ribozymes designed to specifically cleave the Brca...transcript. Hammerhead ribozymes are catalytic RNAs that efficiently cleave RNA and thereby down- regulate gene expression. Hammerhead ribozymes can cleave...any RNA containing its 5’-UH-3’ consensus sequence where U can be replaced by a C, and H=C, U or A. Hammerhead ribozymes effectively and selectively

[Cloning of Chinese Banna minipig inbred-line alpha1,3-galactosyltransferase gene and construction of its recombinant eukaryotic expression vector].

PubMed

Zhu, Shengming; Wang, Yanping; Zheng, Hong; Cheng, Jingqiu; Lu, Yanrong; Zeng, Yangzhi; Wang, Yu; Wang, Zhu

2009-04-01

This study sought to clone Chinese Banna minipig inbred-line (BMI) alpha1,3-galactosyltransferase (alpha1,3-GT) gene and construct its recombinant eukaryotic expression vector. Total RNA was isolated from BMI liver. Full length cDNA of alpha1,3-GT gene was amplified by RT-PCR and cloned into pMD18-T vector to sequence. Subsequently, alpha1,3-GT gene was inserted into pEGFP-N1 to construct eukaryotic expression vector pEGFP-N1-GT. Then the reconstructed plasmid pEGFP-N1-GT was transiently transfected into human lung cancer cell line A549. The expression of alpha1,3-GT mRNA in transfected cells was detected by RT-PCR. FITC-BS-IB4 lectin was used in the direct immunofluorescence method, which was performed to observe the alpha-Gal synthesis function of BMI alpha1,3-GT in transfected cells. The results showed that full length of BMI alpha1,3-GT cDNA was 1116 bp. BMI alpha1,3-GT cDNA sequence was highly homogenous with those of mouse and bovine, and was exactly the same as the complete sequence of those of swine, pEGFP-N1-GT was confirmed by enzyme digestion and PCR. The expression of alpha1,3-GT mRNA was detected in A549 cells transfected by pEGFP-N1-GT. The expression of alpha-Gal was observed on the membrane of A549 cells transfected by pEGFP-N1-GT. Successful cloning of BMI alpha1,3-GT cDNA and construction of its eukaryotic expression vector have established a foundation for further research and application of BMI alpha1,3-GT in the fields of xenotransplantation and immunological therapy of cancer.

A genome-wide inducible phenotypic screen identifies antisense RNA constructs silencing Escherichia coli essential genes.

PubMed

Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K; Crummer, Heather; Tain, Justina; Xu, H Howard

2012-04-01

Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250 000 library transformants for conditional growth inhibitory recombinant clones from two shotgun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes, while 18 originated from nonessential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12-fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Firewalls Prevent Systemic Dissemination of Vectors Derived from Human Adenovirus Type 5 and Suppress Production of Transgene-Encoded Antigen in a Murine Model of Oral Vaccination

PubMed Central

Revaud, Julien; Unterfinger, Yves; Rol, Nicolas; Suleman, Muhammad; Shaw, Julia; Galea, Sandra; Gavard, Françoise; Lacour, Sandrine A.; Coulpier, Muriel; Versillé, Nicolas; Havenga, Menzo; Klonjkowski, Bernard; Zanella, Gina; Biacchesi, Stéphane; Cordonnier, Nathalie; Corthésy, Blaise; Ben Arous, Juliette; Richardson, Jennifer P.

2018-01-01

To define the bottlenecks that restrict antigen expression after oral administration of viral-vectored vaccines, we tracked vectors derived from the human adenovirus type 5 at whole body, tissue, and cellular scales throughout the digestive tract in a murine model of oral delivery. After intragastric administration of vectors encoding firefly luciferase or a model antigen, detectable levels of transgene-encoded protein or mRNA were confined to the intestine, and restricted to delimited anatomical zones. Expression of luciferase in the form of multiple small bioluminescent foci in the distal ileum, cecum, and proximal colon suggested multiple crossing points. Many foci were unassociated with visible Peyer's patches, implying that transduced cells lay in proximity to villous rather than follicle-associated epithelium, as supported by detection of transgene-encoded antigen in villous epithelial cells. Transgene-encoded mRNA but not protein was readily detected in Peyer's patches, suggesting that post-transcriptional regulation of viral gene expression might limit expression of transgene-encoded antigen in this tissue. To characterize the pathways by which the vector crossed the intestinal epithelium and encountered sentinel cells, a fluorescent-labeled vector was administered to mice by the intragastric route or inoculated into ligated intestinal loops comprising a Peyer's patch. The vector adhered selectively to microfold cells in the follicle-associated epithelium, and, after translocation to the subepithelial dome region, was captured by phagocytes that expressed CD11c and lysozyme. In conclusion, although a large number of crossing events took place throughout the intestine within and without Peyer's patches, multiple firewalls prevented systemic dissemination of vector and suppressed production of transgene-encoded protein in Peyer's patches. PMID:29423380

DOE Office of Scientific and Technical Information (OSTI.GOV)

Inoh, Yoshikazu; Furuno, Tadahide; Hirashima, Naohide

Highlights: Black-Right-Pointing-Pointer We use MEL-A-containing cationic liposomes for siRNA delivery. Black-Right-Pointing-Pointer MEL-A-containing cationic liposomes can efficiently and rapidly deliver siRNA into the cytoplasm. Black-Right-Pointing-Pointer Rapid delivery of siRNA is due to the membrane fusion between liposomes and plasma membrane. -- Abstract: The downregulation of gene expression by RNA interference holds great potential for genetic analysis and gene therapy. However, a more efficient delivery system for small interfering RNA (siRNA) into the target cells is required for wide fields such as cell biology, physiology, and clinical application. Non-viral vectors are stronger candidates than viral vectors because they are safer and easiermore » to prepare. We have previously used a new method for gene transfection by combining cationic liposomes with the biosurfactant mannosylerythritol lipid-A (MEL-A). The novel MEL-A-containing cationic liposomes rapidly delivered DNA (plasmids and oligonucleotides) into the cytosol and nucleus through membrane fusion between liposomes and the plasma membrane, and consequently, enhanced the gene transfection efficiency. In this study, we determined the efficiency of MEL-A-containing cationic liposomes for siRNA delivery. We observed that exogenous and endogenous protein expression was suppressed by approximately 60% at 24 h after brief (30 min) incubation of target cells with MEL-A-containing cationic liposome/siRNA complexes. Confocal microscopic analysis showed that suppression of protein expression was caused by rapid siRNA delivery into the cytosol. We found that the MEL-A-containing cationic liposomes directly delivered siRNA into the cytoplasm by the membrane fusion in addition to endocytotic pathway whereas Lipofectamine Trade-Mark-Sign RNAiMax delivered siRNA only by the endocytotic pathway. It seems that the ability to rapidly and directly deliver siRNA into the cytosol using MEL-A-containing cationic liposomes is able to reduce immune responses, cytotoxicity, and other side effects caused by viral vectors in clinical applications.« less

Preclinical Evaluation of An Anti-HCV miRNA Cluster for Treatment of HCV Infection

PubMed Central

Yang, Xiao; Marcucci, Katherine; Anguela, Xavier; Couto, Linda B.

2013-01-01

We developed a strategy to treat hepatitis C virus (HCV) infection by replacing five endogenous microRNA (miRNA) sequences of a natural miRNA cluster (miR-17–92) with sequences that are complementary to the HCV genome. This miRNA cluster (HCV-miR-Cluster 5) is delivered to cells using adeno-associated virus (AAV) vectors and the miRNAs are expressed in the liver, the site of HCV replication and assembly. AAV-HCV-miR-Cluster 5 inhibited bona fide HCV replication in vitro by up to 95% within 2 days, and the spread of HCV to uninfected cells was prevented by continuous expression of the anti-HCV miRNAs. Furthermore, the number of cells harboring HCV RNA replicons decreased dramatically by sustained expression of the anti-HCV miRNAs, suggesting that the vector is capable of curing cells of HCV. Delivery of AAV-HCV-miR-Cluster 5 to mice resulted in efficient transfer of the miRNA gene cluster and expression of all five miRNAs in liver tissue, at levels up to 1,300 copies/cell. These levels achieved up to 98% gene silencing of cognate HCV sequences, and no liver toxicity was observed, supporting the safety of this approach. Therefore, AAV-HCV-miR-Cluster 5 represents a different paradigm for the treatment of HCV infection. PMID:23295950

Hypoxia-response plasmid vector producing bcl-2 shRNA enhances the apoptotic cell death of mouse rectum carcinoma.

PubMed

Fujioka, Takashi; Matsunaga, Naoya; Okazaki, Hiroyuki; Koyanagi, Satoru; Ohdo, Shigehiro

2010-01-01

Hypoxia-induced gene expression frequently occurs in malignant solid tumors because they often have hypoxic areas in which circulation is compromised due to structurally disorganized blood vessels. Hypoxia-response elements (HREs) are responsible for activating gene transcription in response to hypoxia. In this study, we constructed a hypoxia-response plasmid vector producing short hairpin RNA (shRNA) against B-cell leukemia/lymphoma-2 (bcl-2), an anti-apoptotic factor. The hypoxia-response promoter was made by inserting tandem repeats of HREs upstream of cytomegalovirus (CMV) promoter (HRE-CMV). HRE-CMV shbcl-2 vector consisted of bcl-2 shRNA under the control of HRE-CMV promoter. In hypoxic mouse rectum carcinoma cells (colon-26), the production of bcl-2 shRNA driven by HRE-CMV promoter was approximately 2-fold greater than that driven by CMV promoter. A single intratumoral (i.t.) injection of 40 microg HRE-CMV shbcl-2 to colon-26 tumor-bearing mice caused apoptotic cell death, and repetitive treatment with HRE-CMV shbcl-2 (40 microg/mouse, i.t.) also significantly suppressed the growth of colon-26 tumor cells implanted in mice. Apoptotic and anti-tumor effects were not observed in tumor-bearing mice treated with CMV shbcl-2. These results reveal the ability of HRE-CMV shbcl-2 vector to suppress the expression of bcl-2 in hypoxic tumor cells and suggest the usefulness of our constructed hypoxia-response plasmid vector to treat malignant tumors. [Supplementary Figures: available only at http://dx.doi.org/10.1254/jphs.10054FP].

Viral and Synthetic RNA Vector Technologies and Applications

PubMed Central

Schott, Juliane W; Morgan, Michael; Galla, Melanie; Schambach, Axel

2016-01-01

Use of RNA is an increasingly popular method to transiently deliver genetic information for cell manipulation in basic research and clinical therapy. In these settings, viral and nonviral RNA platforms are employed for delivery of small interfering RNA and protein-coding mRNA. Technological advances allowing RNA modification for increased stability, improved translation and reduced immunogenicity have led to increased use of nonviral synthetic RNA, which is delivered in naked form or upon formulation. Alternatively, highly efficient viral entry pathways are exploited to transfer genes of interest as RNA incorporated into viral particles. Current viral RNA transfer technologies are derived from Retroviruses, nonsegmented negative-strand RNA viruses or positive-stranded Alpha- and Flaviviruses. In retroviral particles, the genes of interest can either be incorporated directly into the viral RNA genome or as nonviral RNA. Nonsegmented negative-strand virus-, Alpha- and Flavivirus-derived vectors support prolonged expression windows through replication of viral RNA encoding genes of interest. Mixed technologies combining viral and nonviral components are also available. RNA transfer is ideal for all settings that do not require permanent transgene expression and excludes potentially detrimental DNA integration into the target cell genome. Thus, RNA-based technologies are successfully applied for reprogramming, transdifferentiation, gene editing, vaccination, tumor therapy, and gene therapy. PMID:27377044

[Inhibitory effect of Mig-7 silencing by retrovirus-mediated shRNA on vasculogenic mimicry, invasion and metastasis of human hepatocellular carcinoma cells in vitro].

PubMed

Qu, Bo; Sheng, Guan-Nan; Yu, Fei; Chen, Guan-Nan; Lv, Qi; Mao, Zhong-Peng; Guo, Long; Lv, Yi

2016-11-20

To explore the inhibitory effect of migration-inducing gene 7 (Mig-7) gene silencing induced by retroviral-mediated small hairpin RNA (shRNA) on vasculogenic mimicry (VM), invasion and metastasis of human hepatocellular carcinoma (HCC) cells in vitro. Two target sequences (Mig-7 shRNA-1 and Mig-7 shRNA-2) and one negative control sequence (Mig-7 shRNA-N) were synthesized. The recombinant retroviral vectors carrying Mig-7 shRNA were constructed, and HCC cell line MHCC-97H were transfected with Mig-7 shRNA-1, Mig-7 shRNA-2, Mig-7 shRNA-N, or the empty vector, or treated with 125 µg/mL recombinant human endostatin (ES). Mig-7 expression in the treated cells was detected using semi-quantitative PCR and Western blotting. The inhibitory effect of Mig-7 silencing on VM formation was investigated in a 3-dimensional cell culture system; the changes in cell adhesion, invasion and migration were assessed with intercellular adhesion assay, Transwell invasion assay and Transwell migration assay, respectively. The expression of Mig-7 at both mRNA and protein levels decreased significantly, VM formation, invasion and metastasis were suppressed, while intercellular adhesion increased significantly in MHCC-97H cells in Mig-7 shRNA-1 and Mig-7 shRNA-2 groups (P<0.05); such changes were not observed in cells transfected with Mig-7 shRNA-N or the empty vector, nor in cells treated with ES. Mig-7 silencing by retroviral-mediated shRNA significantly inhibits VM formation, invasion and metastasis and increases the intercellular adhesion of the HCC cells, while ES does not have such inhibitory effects.

Highly specific gene silencing in a monocot species by artificial microRNAs derived from chimeric miRNA precursors

DOE PAGES

Carbonell, Alberto; Fahlgren, Noah; Mitchell, Skyler; ...

2015-05-20

Artificial microRNAs (amiRNAs) are used for selective gene silencing in plants. However, current methods to produce amiRNA constructs for silencing transcripts in monocot species are not suitable for simple, cost-effective and large-scale synthesis. Here, a series of expression vectors based on Oryza sativa MIR390 (OsMIR390) precursor was developed for high-throughput cloning and high expression of amiRNAs in monocots. Four different amiRNA sequences designed to target specifically endogenous genes and expressed from OsMIR390-based vectors were validated in transgenic Brachypodium distachyon plants. Surprisingly, amiRNAs accumulated to higher levels and were processed more accurately when expressed from chimeric OsMIR390-based precursors that include distalmore » stem-loop sequences from Arabidopsis thaliana MIR390a (AtMIR390a). In all cases, transgenic plants displayed the predicted phenotypes induced by target gene repression, and accumulated high levels of amiRNAs and low levels of the corresponding target transcripts. Genome-wide transcriptome profiling combined with 5-RLM-RACE analysis in transgenic plants confirmed that amiRNAs were highly specific. Finally, significance Statement A series of amiRNA vectors based on Oryza sativa MIR390 (OsMIR390) precursor were developed for simple, cost-effective and large-scale synthesis of amiRNA constructs to silence genes in monocots. Unexpectedly, amiRNAs produced from chimeric OsMIR390-based precursors including Arabidopsis thaliana MIR390a distal stem-loop sequences accumulated elevated levels of highly effective and specific amiRNAs in transgenic Brachypodium distachyon plants.« less

Tumor-specific expression of shVEGF and suicide gene as a novel strategy for esophageal cancer therapy.

PubMed

Liu, Ting; Wu, Hai-Jun; Liang, Yu; Liang, Xu-Jun; Huang, Hui-Chao; Zhao, Yan-Zhong; Liao, Qing-Chuan; Chen, Ya-Qi; Leng, Ai-Min; Yuan, Wei-Jian; Zhang, Gui-Ying; Peng, Jie; Chen, Yong-Heng

2016-06-21

To develop a potent and safe gene therapy for esophageal cancer. An expression vector carrying fusion suicide gene (yCDglyTK) and shRNA against vascular endothelial growth factor (VEGF) was constructed and delivered into EC9706 esophageal cancer cells by calcium phosphate nanoparticles (CPNP). To achieve tumor selectivity, expression of the fusion suicide gene was driven by a tumor-specific human telomerase reverse transcriptase (hTERT) promoter. The biologic properties and therapeutic efficiency of the vector, in the presence of prodrug 5-fluorocytosine (5-FC), were evaluated in vitro and in vivo. Both in vitro and in vivo testing showed that the expression vector was efficiently introduced by CPNP into tumor cells, leading to cellular expression of yCDglyTK and decreased VEGF level. With exposure to 5-FC, it exhibited strong anti-tumor effects against esophageal cancer. Combination of VEGF shRNA with the fusion suicide gene demonstrated strong anti-tumor activity. The shVEGF-hTERT-yCDglyTK/5-FC system provided a novel approach for esophageal cancer-targeted gene therapy.

[GPER silence inhibits the stimulation of growth and inhibition of apoptosis induced by tamoxifen in breast cancer-associated fibroblasts].

PubMed

Yan, Yuzhao; Yu, Tenghua; Tu, Gang; Liu, Manran; Yuan, Jie; Yang, Guanglun

2015-09-01

To construct a lentiviral vector (Lenti-GPER-shRNA) targeting G-protein coupled estrogen receptor (GPER) and explore the role of GPER in the effect of tamoxifen on cell proliferation and apoptosis in breast cancer associated fibroblasts (BCAFs). The target sequence of GPER gene and negative control were cloned into lentiviral vectors. The recombinant lentivirus and control were extracted after HEK293T cells were transfected with the recombinant vector and helper vectors. After infection of BCAFs with the GPER lentiviral vector under the best interfering condition, GPER expression was detected by real-time quantitative PCR and Western blotting. BCAFs were divided into negative control group, GPER-RNAi group, negative control combined with tamoxifen (10(-8) mmol/L) group and GPER-RNAi combined with tamoxifen (10(-8) mmol/L) group. CCK-8 assay was used to detect the proliferation and annexin V-fluorescein isothiocyanate/propidium iodide (annexin V-FITC/PI) combined with flow cytometry was used to detect the apoptosis of BCAFs after the treatment of tamoxifen. Lenti-GPER-shRNA significantly interfered the expression of GPER in BCAFs. Tamoxifen promoted the growth of BCAFs, which could be attenuated by knockdown of GPER. Moreover, the apoptosis of BCAFs was reduced by tamoxifen, which was also reversed by knockdown of GPER. Lenti-GPER-shRNA could effectively silence the GPER expression in BCAFs. The ability of tamoxifen to accelerate cell proliferation and decrease cell apoptosis could be weakened by knockdown of GPER.

RNAi-mediated mortality of the whitefly through transgenic expression of double-stranded RNA homologous to acetylcholinesterase and ecdysone receptor in tobacco plants

USDA-ARS?s Scientific Manuscript database

The whitefly Bemisia tabaci (Genn.) is a pest and vector of plant viruses affecting plants worldwide. Using RNA interference (RNAi) to downregulate whitefly genes by expressing their homologous double stranded RNAs in plants has great potential for management of whiteflies to reduce plant virus dise...

The metastasis suppressor gene KISS-1 regulates osteosarcoma apoptosis and autophagy processes.

PubMed

Yin, Yiran; Tang, Lian; Shi, Lei

2017-03-01

The expression of the metastasis suppressor gene KISS-1 in osteosarcoma cells during apoptosis and autophagy was evaluated. MG-63 osteosarcoma cells were transfected with either KISS-1 overexpression or KISS-1 knockdown expression vector in vitro, and compared with cell lines transfected with empty vector. After 12, 24, 48 and 72 h of cell culture, the cell proliferation was examined. The MTT method was used to detect apoptosis by flow cytometry, and the mRNA levels of apoptosis and autophagy markers caspase-3, Bcl-2, Bax, LC3 and Beclin1 were assessed by RT-PCR. Our results showed that cells in the control and low expression group kept proliferating during the cell culture period of 72 h, while the cells in the overexpression group progressively decreased in number. Also, the proliferation rate of the low expression group was significantly higher than that of the control group. The relative mRNA expression levels of caspase-3 and Bax mRNA in the control and low expression group showed no change (the expression was lowest in the low expression group). Moreover, the mRNA level of Bcl-2 increased in both cell groups. The mRNA expression levels of caspase-3 and Bax in the overexpression group were increased, and the level of Bcl-2 was reduced significantly. At the same time, the relative expression level of LC3 and Beclin1 mRNA in the control and low expression groups remained the same, and that of the overexpression group increased. The mRNA levels of LC3 and Beclin1 in the overexpression group were the highest, and that of the low expression group the lowest. The differences were statistically significant (P<0.05). Based on these results, we showed that KISS-1 inhibited the proliferation of osteosarcoma in vitro, probably by accelerating the processes of apoptosis and autophagy in the cells.

Inhibition of myostatin gene expression in skeletal muscle of fish by in vivo electrically mediated dsRNA and shRNAi delivery.

PubMed

Terova, Genciana; Rimoldi, Simona; Bernardini, Giovanni; Saroglia, Marco

2013-06-01

Myostatin (MSTN), previously referred to as growth differentiation factor 8 (GDF8), is a negative regulator of skeletal muscle growth. In accordance with this role, natural mutations that inactivate the gene disrupting the function of the protein are associated with excessive muscle growth and double-muscling phenotype in several mammalian species. Recent studies using transgenic MSTN deficient zebrafish and medaka support the idea that this gene inhibits skeletal muscle growth even in fish. If the atrophic actions of mammalian MSTN are indeed conserved in fish, strategies capable of inhibiting the expression of this gene could be applied to enhance growth performance in livestock production. Gene silencing by RNA interference has emerged as a promising new method of inhibiting the expression of targeted genes and inducing knockdown of associated proteins both in vitro and in vivo. Accordingly, we investigated here whether double-stranded RNA (dsRNA) or different plasmids expressing short-hairpin interfering RNAs (shRNAs) against myostatin and transduced by in vivo electroporation would increase skeletal muscle mass in reared European sea bass. After 7 weeks of intramuscular injections on a weekly basis followed by in vivo electrically mediated dsRNA delivery, no increase in the condition factor (K) of fish was observed as compared to the controls. Analogously, mean body weight and K of sea bass injected with three shRNAs were not higher than those of the control fish. On the other hand, MSTN transcript quantification via real-time RT-PCR revealed a significant inhibition of gene expression in the muscle of the dsRNA-injected fish and in the muscle of fish injected with one of the three tested shRNA-expressing vector constructs. In conclusion, in vivo electric-mediated delivery of dsRNA- or shRNA-expressing vectors against MSTN inhibits MSTN gene expression in adult sea bass muscle, but this is associated with an inconsistent double-muscle phenotype.

Citrus tristeza virus-based RNAi in citrus plants induces gene silencing in Diaphorina citri, a phloem-sap sucking insect vector of citrus greening disease (Huanglongbing).

PubMed

Hajeri, Subhas; Killiny, Nabil; El-Mohtar, Choaa; Dawson, William O; Gowda, Siddarame

2014-04-20

A transient expression vector based on Citrus tristeza virus (CTV) is unusually stable. Because of its stability it is being considered for use in the field to control Huanglongbing (HLB), which is caused by Candidatus Liberibacter asiaticus (CLas) and vectored by Asian citrus psyllid, Diaphorina citri. In the absence of effective control strategies for CLas, emphasis has been on control of D. citri. Coincident cohabitation in phloem tissue by CLas, D. citri and CTV was exploited to develop a novel method to mitigate HLB through RNA interference (RNAi). Since CTV has three RNA silencing suppressors, it was not known if CTV-based vector could induce RNAi in citrus. Yet, expression of sequences targeting citrus phytoene desaturase gene by CTV-RNAi resulted in photo-bleaching phenotype. CTV-RNAi vector, engineered with truncated abnormal wing disc (Awd) gene of D. citri, induced altered Awd expression when silencing triggers ingested by feeding D. citri nymphs. Decreased Awd in nymphs resulted in malformed-wing phenotype in adults and increased adult mortality. This impaired ability of D. citri to fly would potentially limit the successful vectoring of CLas bacteria between citrus trees in the grove. CTV-RNAi vector would be relevant for fast-track screening of candidate sequences for RNAi-mediated pest control. Copyright © 2014. Published by Elsevier B.V.

Development of two bacterial artificial chromosome shuttle vectors for a recombination-based cloning and regulated expression of large genes in mammalian cells.

PubMed

Hong, Y K; Kim, D H; Beletskii, A; Lee, C; Memili, E; Strauss, W M

2001-04-01

Most conditional expression vectors designed for mammalian cells have been valuable systems for studying genes of interest by regulating their expressions. The available vectors, however, are reliable for the short-length cDNA clones and not optimal for relatively long fragments of genomic DNA or long cDNAs. Here, we report the construction of two bacterial artificial chromosome (BAC) vectors, capable of harboring large inserts and shuttling among Escherichia coli, yeast, and mammalian cells. These two vectors, pEYMT and pEYMI, contain conditional expression systems which are designed to be regulated by tetracycline and mouse interferons, respectively. To test the properties of the vectors, we cloned in both vectors the green fluorescence protein (GFP) through an in vitro ligation reaction and the 17.8-kb-long X-inactive-specific transcript (Xist) cDNA through homologous recombination in yeast. Subsequently, we characterized their regulated expression properties using real-time quantitative RT-PCR (TaqMan) and RNA-fluorescent in situ hybridization (FISH). We demonstrate that these two BAC vectors are good systems for recombination-based cloning and regulated expression of large genes in mammalian cells. Copyright 2001 Academic Press.

Feeder-free reprogramming of human fibroblasts with messenger RNA.

PubMed

Warren, Luigi; Wang, Jiwu

2013-11-13

This unit describes a feeder-free protocol for deriving induced pluripotent stem cells (iPSCs) from human fibroblasts by transfection of synthetic mRNA. The reprogramming of somatic cells requires transient expression of a set of transcription factors that collectively activate an endogenous gene regulatory network specifying the pluripotent phenotype. The necessary ectopic factor expression was first effected using retroviruses; however, as viral integration into the genome is problematic for cell therapy applications, the use of footprint-free vectors such as mRNA is increasingly preferred. Strong points of the mRNA approach include high efficiency, rapid kinetics, and obviation of a clean-up phase to purge the vector. Still, the method is relatively laborious and has, up to now, involved the use of feeder cells, which brings drawbacks including poor applicability to clinically oriented iPSC derivation. Using the methods described here, mRNA reprogramming can be performed without feeders at much-reduced labor and material costs relative to established protocols. Copyright © 2013 John Wiley & Sons, Inc.

Episome-generated N-myc antisense RNA restricts the differentiation potential of primitive neuroectodermal cell lines.

PubMed Central

Whitesell, L; Rosolen, A; Neckers, L M

1991-01-01

Neuroectodermal tumors of childhood provide a unique opportunity to examine the role of genes potentially regulating neuronal growth and differentiation because many cell lines derived from these tumors are composed of at least two distinct morphologic cell types. These types display variant phenotypic characteristics and spontaneously interconvert, or transdifferentiate, in vitro. The factors that regulate transdifferentiation are unknown. Application of antisense approaches to the transdifferentiation process has allowed us to explore the precise role that N-myc may play in regulating developing systems. We now report construction of an episomally replicating expression vector designed to generate RNA antisense to part of the human N-myc gene. Such a vector is able to specifically inhibit N-myc expression in cell lines carrying both normal and amplified N-myc alleles. Inhibition of N-myc expression blocks transdifferentiation in these lines, with accumulation of cells of an intermediate phenotype. A concomitant decrease in growth rate but not loss of tumorigenicity was observed in the N-myc nonamplified cell line CHP-100. Vector-generated antisense RNA should allow identification of genes specifically regulated by the proto-oncogene N-myc. Images PMID:1996098

microRNA as a Potential Vector for the Propagation of Robustness in Protein Expression and Oscillatory Dynamics within a ceRNA Network

PubMed Central

Gérard, Claude; Novák, Béla

2013-01-01

microRNAs (miRNAs) are small noncoding RNAs that are important post-transcriptional regulators of gene expression. miRNAs can induce thresholds in protein synthesis. Such thresholds in protein output can be also achieved by oligomerization of transcription factors (TF) for the control of gene expression. First, we propose a minimal model for protein expression regulated by miRNA and by oligomerization of TF. We show that miRNA and oligomerization of TF generate a buffer, which increases the robustness of protein output towards molecular noise as well as towards random variation of kinetics parameters. Next, we extend the model by considering that the same miRNA can bind to multiple messenger RNAs, which accounts for the dynamics of a minimal competing endogenous RNAs (ceRNAs) network. The model shows that, through common miRNA regulation, TF can control the expression of all proteins formed by the ceRNA network, even if it drives the expression of only one gene in the network. The model further suggests that the threshold in protein synthesis mediated by the oligomerization of TF can be propagated to the other genes, which can increase the robustness of the expression of all genes in such ceRNA network. Furthermore, we show that a miRNA could increase the time delay of a “Goodwin-like” oscillator model, which may favor the occurrence of oscillations of large amplitude. This result predicts important roles of miRNAs in the control of the molecular mechanisms leading to the emergence of biological rhythms. Moreover, a model for the latter oscillator embedded in a ceRNA network indicates that the oscillatory behavior can be propagated, via the shared miRNA, to all proteins formed by such ceRNA network. Thus, by means of computational models, we show that miRNAs could act as vectors allowing the propagation of robustness in protein synthesis as well as oscillatory behaviors within ceRNA networks. PMID:24376695

Molecular dissection of the roles of the SOD genes in mammalian response to low dose irradiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eric Y. Chuang

2006-08-31

It has been long recognized that a significant fraction of the radiation-induced genetic damage to cells are caused by secondary oxidative species. Internal cellular defense systems against oxidative stress play significant roles in countering genetic damage induced by ionizing radiation. The role of the detoxifying enzymes may be even more prominent in the case of low-dose, low-LET irradiation, as the majority of genetic damage may be caused by secondary oxidative species. In this study we have attempted to decipher the roles of the superoxide dismutase (SOD) genes, which are responsible for detoxifying the superoxide anions. We used adenovirus vectors tomore » deliver RNA interference (RNAi or siRNA) technology to down-regulate the expression levels of the SOD genes. We have also over-expressed the SOD genes by use of recombinant adenovirus vectors. Cells infected with the vectors were then subjected to low dose γ-irradiation. Total RNA were extracted from the exposed cells and the expression of 9000 genes were profiled by use of cDNA microarrays. The result showed that low dose radiation had clear effects on gene expression in HCT116 cells. Both over-expression and down-regulation of the SOD1 gene can change the expression profiles of sub-groups of genes. Close to 200 of the 9000 genes examined showed over two-fold difference in expression under various conditions. Genes with changed expression pattern belong to many categories that include: early growth response, DNA-repair, ion transport, apoptosis, and cytokine response.« less

HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs

PubMed Central

Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

2015-01-01

Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses. PMID:25668122

HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs.

PubMed

Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

2015-01-01

Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses.

Strand antagonism in RNAi: an explanation of differences in potency between intracellularly expressed siRNA and shRNA

PubMed Central

Jin, Xin; Sun, Tingting; Zhao, Chuanke; Zheng, Yongxiang; Zhang, Yufan; Cai, Weijing; He, Qiuchen; Taira, Kaz; Zhang, Lihe; Zhou, Demin

2012-01-01

Strategies to regulate gene function frequently use small interfering RNAs (siRNAs) that can be made from their shRNA precursors via Dicer. However, when the duplex components of these siRNA effectors are expressed from their respective coding genes, the RNA interference (RNAi) activity is much reduced. Here, we explored the mechanisms of action of shRNA and siRNA and found the expressed siRNA, in contrast to short hairpin RNA (shRNA), exhibits strong strand antagonism, with the sense RNA negatively and unexpectedly regulating RNAi. Therefore, we altered the relative levels of strands of siRNA duplexes during their expression, increasing the level of the antisense component, reducing the level of the sense component, or both and, in this way we were able to enhance the potency of the siRNA. Such vector-delivered siRNA attacked its target effectively. These findings provide new insight into RNAi and, in particular, they demonstrate that strand antagonism is responsible for making siRNA far less potent than shRNA. PMID:22039150

Posttranscriptional mRNA processing as a mechanism for regulation of human A1 adenosine receptor expression.

PubMed Central

Ren, H; Stiles, G L

1994-01-01

The human A1 adenosine receptor gene contains six exons with exons 1, 2, 3, 4, and part of 5 representing 5' untranslated regions. Reverse transcription-PCR with exon-specific primers showed two distinct transcripts containing either exons 3, 5, and 6 or exons 4, 5, and 6, with exons 3 and 4 being mutually exclusive. No mature mRNAs containing exons 1 and 2 have been detected. All human tissues that express any A1 receptors contain mRNA with exons 4, 5, and 6. Tissues which express high levels of A1 receptors contain mRNA with exons 3, 5, and 6. Exon 4 contains two upstream ATG codons whereas exon 3 contains none. COS cells transfected with expression vectors containing exon 4 (exons 1-6, 3-6, or Ex4-6) express much lower levels of A1 receptors than vectors without exon 4 (exons 3, 5, and 6). Mutation of upstream ATG codons in exon 4 leads to 3- to 7-fold increased A1 receptor expression, up to the level seen with the construct containing exons 3, 5, and 6. Thus, in human tissues "basal" levels of A1 receptors can be expressed by use of mRNA containing exons 4, 5, and 6, but when high levels are needed, alternative transcripts with exons 3, 5, and 6 are produced. Images PMID:8197148

Downregulation of mouse CCR3 by lentiviral shRNA inhibits proliferation and induces apoptosis of mouse eosinophils.

PubMed

Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui

2017-02-01

RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.

Inhibition effect of small interfering RNA of connective tissue growth factor on the expression of extracellular matrix molecules in cultured human renal proximal tubular cells.

PubMed

Liu, Yuyuan; Li, Weiwei; Liu, Hong; Peng, Youming; Yang, Qiu; Xiao, Li; Liu, Yinghong; Liu, Fuyou

2014-03-01

In this study, we investigated the effect of small interfering RNA (siRNA) of connective tissue growth factor (CTGF) by pRetro-Super (PRS) retrovirus vector on the expression of CTGF and related extracellular matrix molecules in human renal proximal tubular cells (HKCs) induced by high glucose, to provide help for renal tubulointerstitial fibrosis therapy. HKCs were exposed to d-glucose to observe their dose and time effect, while the mannitol as osmotic control. Retrovirus producing CTGF siRNA were constructed from the inverted oligonucleotides and transferred into packaging cell line PT67 with lipofectamine, and the virus supernatant was used to infect HKC. The expression of CTGF, fibronectin (FN) and collagen-type I (col1) were measured by semi-quantitative RT-PCR and Western blot. In response to high glucose, CTGF expression in HKCs was increased in a dose- and time-dependent manner, whereas the increase did not occur in the osmotic control. Introduction of PRS-CTGF-siRNA resulted in the significant reduction of CTGF, FN, col1 mRNA (p < 0.01, respectively) and CTGF, col1 protein (p < 0.05, respectively) expression, while PRS void vector group did not have these effects (p > 0.05). CTGF siRNA therapy can effectively reduce the levels of CTGF, FN and col1 induced by high glucose in cultured HKCs, which suggested that it may be a potential therapeutic strategy to prevent the renal interstitial fibrosis in the future.

Combined antitumor gene therapy with herpes simplex virus-thymidine kinase and short hairpin RNA specific for mammalian target of rapamycin.

PubMed

Woo, Ha-Na; Lee, Won Il; Kim, Ji Hyun; Ahn, Jeonghyun; Han, Jeong Hee; Lim, Sue Yeon; Lee, Won Woo; Lee, Heuiran

2015-12-01

A proof-of-concept study is presented using dual gene therapy that employed a small hairpin RNA (shRNA) specific for mammalian target of rapamycin (mTOR) and a herpes simplex virus-thymidine kinase (HSV-TK) gene to inhibit the growth of tumors. Recombinant adeno-associated virus (rAAV) vectors containing a mutant TK gene (sc39TK) were transduced into HeLa cells, and the prodrug ganciclovir (GCV) was administered to establish a suicide gene-therapy strategy. Additionally, rAAV vectors expressing an mTOR-targeted shRNA were employed to suppress mTOR-dependent tumor growth. GCV selectively induced death in tumor cells expressing TK, and the mTOR-targeted shRNA altered the cell cycle to impair tumor growth. Combining the TK-GCV system with mTOR inhibition suppressed tumor growth to a greater extent than that achieved with either treatment alone. Furthermore, HSV-TK expression and mTOR inhibition did not mutually interfere with each other. In conclusion, gene therapy that combines the TK-GCV system and mTOR inhibition shows promise as a novel strategy for cancer therapy.

Polyamidoamine Dendrimer Conjugates with Cyclodextrins as Novel Carriers for DNA, shRNA and siRNA

PubMed Central

Arima, Hidetoshi; Motoyama, Keiichi; Higashi, Taishi

2012-01-01

Gene, short hairpin RNA (shRNA) and small interfering RNA (siRNA) delivery can be particularly used for the treatment of diseases by the entry of genetic materials mammalian cells either to express new proteins or to suppress the expression of proteins, respectively. Polyamidoamine (PAMAM) StarburstTM dendrimers are used as non-viral vectors (carriers) for gene, shRNA and siRNA delivery. Recently, multifunctional PAMAM dendrimers can be used for the wide range of biomedical applications including intracellular delivery of genes and nucleic acid drugs. In this context, this review paper provides the recent findings on PAMAM dendrimer conjugates with cyclodextrins (CyDs) for gene, shRNA and siRNA delivery. PMID:24300184

AAV Gene Therapy for Alcoholism: Inhibition of Mitochondrial Aldehyde Dehydrogenase Enzyme Expression in Hepatoma Cells.

PubMed

Sanchez, Anamaria C; Li, Chengwen; Andrews, Barbara; Asenjo, Juan A; Samulski, R Jude

2017-09-01

Most ethanol is broken down in the liver in two steps by alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH2) enzymes, which metabolize down ethanol into acetaldehyde and then acetate. Some individuals from the Asian population who carry a mutation in the aldehyde dehydrogenase gene (ALDH2*2) cannot metabolize acetaldehyde as efficiently, producing strong effects, including facial flushing, dizziness, hypotension, and palpitations. This results in an aversion to alcohol intake and protection against alcoholism. The large prevalence of this mutation in the human population strongly suggests that modulation of ALDH2 expression by genetic technologies could result in a similar phenotype. scAAV2 vectors encoding ALDH2 small hairpin RNA (shRNA) were utilized to validate this hypothesis by silencing ALDH2 gene expression in human cell lines. Human cell lines HEK-293 and HepG2 were transduced with scAAV2/shRNA, showing a reduction in ALDH2 RNA and protein expression with the two viral concentration assayed (1 × 10 4 and 1 × 10 5 vg/cell) at two different time points. In both cell lines, ALDH2 RNA levels were reduced by 90% and protein expression was inhibited by 90% and 52%, respectively, 5 days post infection. Transduced HepG2 VL17A cells (ADH+) exposed to ethanol resulted in a 50% increase in acetaldehyde levels. These results suggest that gene therapy could be a useful tool for the treatment of alcoholism by knocking down ALDH2 expression using shRNA technology delivered by AAV vectors.

Optimized paired-sgRNA/Cas9 cloning and expression cassette triggers high-efficiency multiplex genome editing in kiwifruit.

PubMed

Wang, Zupeng; Wang, Shuaibin; Li, Dawei; Zhang, Qiong; Li, Li; Zhong, Caihong; Liu, Yifei; Huang, Hongwen

2018-01-13

Kiwifruit is an important fruit crop; however, technologies for its functional genomic and molecular improvement are limited. The clustered regulatory interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) system has been successfully applied to genetic improvement in many crops, but its editing capability is variable depending on the different combinations of the synthetic guide RNA (sgRNA) and Cas9 protein expression devices. Optimizing conditions for its use within a particular species is therefore needed to achieve highly efficient genome editing. In this study, we developed a new cloning strategy for generating paired-sgRNA/Cas9 vectors containing four sgRNAs targeting the kiwifruit phytoene desaturase gene (AcPDS). Comparing to the previous method of paired-sgRNA cloning, our strategy only requires the synthesis of two gRNA-containing primers which largely reduces the cost. We further compared efficiencies of paired-sgRNA/Cas9 vectors containing different sgRNA expression devices, including both the polycistronic tRNA-sgRNA cassette (PTG) and the traditional CRISPR expression cassette. We found the mutagenesis frequency of the PTG/Cas9 system was 10-fold higher than that of the CRISPR/Cas9 system, coinciding with the relative expressions of sgRNAs in two different expression cassettes. In particular, we identified large chromosomal fragment deletions induced by the paired-sgRNAs of the PTG/Cas9 system. Finally, as expected, we found both systems can successfully induce the albino phenotype of kiwifruit plantlets regenerated from the G418-resistance callus lines. We conclude that the PTG/Cas9 system is a more powerful system than the traditional CRISPR/Cas9 system for kiwifruit genome editing, which provides valuable clues for optimizing CRISPR/Cas9 editing system in other plants. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Gene Therapy for Neuropathic Pain by Silencing of TNF-α Expression with Lentiviral Vectors Targeting the Dorsal Root Ganglion in Mice

PubMed Central

Ogawa, Nobuhiro; Kawai, Hiromichi; Terashima, Tomoya; Kojima, Hideto; Oka, Kazuhiro; Chan, Lawrence; Maegawa, Hiroshi

2014-01-01

Neuropathic pain can be a debilitating condition. Many types of drugs that have been used to treat neuropathic pain have only limited efficacy. Recent studies indicate that pro-inflammatory mediators including tumor necrosis factor α (TNF-α) are involved in the pathogenesis of neuropathic pain. In the present study, we engineered a gene therapy strategy to relieve neuropathic pain by silencing TNF-α expression in the dorsal root ganglion (DRG) using lentiviral vectors expressing TNF short hairpin RNA1-4 (LV-TNF-shRNA1-4) in mice. First, based on its efficacy in silencing TNF-α in vitro, we selected shRNA3 to construct LV-TNF-shRNA3 for in vivo study. We used L5 spinal nerve transection (SNT) mice as a neuropathic pain model. These animals were found to display up-regulated mRNA expression of activating transcription factor 3 (ATF3) and neuropeptide Y (NPY), injury markers, and interleukin (IL)-6, an inflammatory cytokine in the ipsilateral L5 DRG. Injection of LV-TNF-shRNA3 onto the proximal transected site suppressed significantly the mRNA levels of ATF3, NPY and IL-6, reduced mechanical allodynia and neuronal cell death of DRG neurons. These results suggest that lentiviral-mediated silencing of TNF-α in DRG relieves neuropathic pain and reduces neuronal cell death, and may constitute a novel therapeutic option for neuropathic pain. PMID:24642694

Lentivirus mediated RNA interference of EMMPRIN (CD147) gene inhibits the proliferation, matrigel invasion and tumor formation of breast cancer cells.

PubMed

Yang, Jing; Wang, Rong; Li, Hongjiang; Lv, Qing; Meng, Wentong; Yang, Xiaoqin

2016-07-08

Overexpression of extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), a glycoprotein enriched on the plasma membrane of tumor cells, promotes proliferation, invasion, metastasis, and survival of malignant tumor cells. In this study, we sought to examine the expression of EMMPRIN in breast tumors, and to identify the potential roles of EMMPRIN on breast cancer cells. EMMPRIN expression in breast cancer tissues was assessed by immunohistochemistry. We used a lentivirus vector-based RNA interference (RNAi) approach expressing short hairpin RNA (shRNA) to knockdown EMMPRIN gene in breast cancer cell lines MDA-MB-231 and MCF-7. In vitro, Cell proliferative, invasive potential were determined by Cell Counting Kit (CCK-8), cell cycle analysis and matrigel invasion assay, respectively. In vivo, tumorigenicity was monitored by inoculating tumor cells into breast fat pad of female nude mice. EMMPRIN was over-expressed in breast tumors and breast cancer cell lines. Down-regulation of EMMPRIN by lentivirus vector-based RNAi led to decreased cell proliferative, decreased matrigel invasion in vitro, and attenuated tumor formation in vivo. High expression of EMMPRIN plays a crucial role in breast cancer cell proliferation, matrigel invasion and tumor formation.

Effects of RNAi-mediated MUC4 gene silencing on the proliferation and migration of human pancreatic carcinoma BxPC-3 cells.

PubMed

Li, Yong; Wu, Changqiang; Chen, Tianwu; Zhang, Juanjuan; Liu, Gang; Pu, Yu; Zhu, Jiang; Shen, Chengyi; Zhang, Yang; Zeng, Nanlin; Zhang, Xiaoming

2016-12-01

It was previously demonstrated that mucin 4 (MUC4) is not expressed in normal pancreatic tissues or in chronic pancreatitis tissue but is highly expressed in pancreatic cancer (PC) tissue. Effective MUC4 gene knockdown in PC may contribute to the elucidation of pancreatic tumor development and metastasis, and may be valuable in new therapeutic approaches. Thus to confirm this, in the present study, the BxPC-3 cell line was transfected with eight pairs of shRNA lentiviral vectors for MUC4. The qPCR results showed that expression of MUC4 mRNA in the BxPC-3 cells was significantly decreased at 96 h after transfection. One of these shRNA lentiviral vectors (shRNA‑A141) had showed the strongest suppressive effect on MUC4 mRNA expression and was used for MUC4 knockdown in BxPC-3 cells. After stable transfection, BxPC-3 cells showed a significantly lower expression of MUC4 mRNA and MUC4 protein, and were suppressed on cell growth and migration. In vivo, lower tumor growth rates and tumor volume were observed in the tumors derived from the MUC4-knockdown cells, whereas the transplanted tumors derived from the control group cells, grew rapidly. Thus, inhibition of MUC4 expression may be an effective means for mitigating metastasis and invasion of PC.

On the efficient bio-incorporation of 5-hydroxy-tryptophan in recombinant proteins expressed in Escherichia coli with T7 RNA polymerase-based vectors.

PubMed

Oliveira-Souza, Wellington P; Bronze, Fellipe; Broos, Jaap; Marcondes, Marcelo F M; Oliveira, Vitor

2017-10-21

Biosynthetic incorporation of non-canonic amino acids is an attractive strategy to introduce new properties in recombinant proteins. Trp analogs can be incorporated in recombinant proteins replacing regular Trp during protein translation into a Trp-auxotrophic cell host. This straightforward method however, is limited to few analogs recognized and accepted by the cellular protein production machinery. 5-hydroxy-tryptophan (5OH-Trp) can be bio-incorporated using E. coli as expression host however; we have experienced very low incorporation yields - amount of protein containing regular Trp/amount of protein containing the Trp analog - during expressions of 5OH-Trp labeled proteins. Furthermore, this low incorporation yield were verified especially when the widely-used vectors based on the T7 RNA polymerase were used. Testing different 5OH-Trp incorporation protocols we verified that in these T7-based systems, the production of the T7 RNA polymerase is driven by the same elements - lac promoter/IPTG - as the target protein. Consequently, the bio-incorporation of the 5OH-Trp residues also occurs in this crucial enzyme, but, the produced T7 RNA polymerase labeled with 5OH-Trp is inactive or much less active. In the present work, we describe an efficient method to overcome this mentioned problem and bio-incorporate 5OH-Trp in proteins expressed in E. coli., using vectors based on the T7 RNA polymerase-T7 promoter. The two-step induction protocol here described showed incorporation efficiencies of 5OH-Trp higher than 90%. Copyright © 2017 Elsevier Inc. All rights reserved.

Vascular smooth muscle-specific knockdown of the noncardiac form of the L-type calcium channel by microRNA-based short hairpin RNA as a potential antihypertensive therapy.

PubMed

Rhee, Sung W; Stimers, Joseph R; Wang, Wenze; Pang, Li

2009-05-01

In different rodent models of hypertension, vascular voltage-gated L-type calcium channel (Ca(L)) current and vascular tone is increased because of increased expression of the noncardiac form of the Ca(L) (Ca(v)1.2). The objective of this study was to develop a small interfering RNA (siRNA) expression system against the noncardiac form of Ca(v)1.2 to reduce its expression in vascular smooth muscle cells (VSMCs). siRNAs expressing plasmids and appropriate controls were constructed and first screened in human embryonic kidney (HEK) 293 cells cotransfected with a rat Ca(v)1.2 expression vector. The most effective gene silencing was achieved with a modified mir-30a-based short hairpin RNA (shRNAmir) driven by the cytomegalovirus promoter. In A7r5 cells, a vascular smooth muscle cell line, two copies of shRNAmir driven by a chimeric VSMC-specific enhancer/promoter reduced endogenous Ca(v)1.2 expression by 61% and decreased the Ca(L) current carried by barium by 47%. Moreover, the chimeric vascular smooth muscle-specific enhancer/promoter displayed almost no activity in non-VSMCs (PC-12 and HEK 293). Because the proposed siRNA was designed to only target the noncardiac form of Ca(v)1.2, it did not affect the Ca(L) expression and function in cultured cardiomyocytes, even when driven by a stronger cytomegalovirus promoter. In conclusion, vascular Ca(v)1.2 expression and function were effectively reduced by VSMC-specific delivery of the noncardiac form of Ca(v)1.2 siRNA without similarly affecting cardiac Ca(L) expression and function. When coupled with a viral vector, this molecular intervention in vivo may provide a novel long-term vascular-specific gene therapy for hypertension.

Vascular Smooth Muscle-Specific Knockdown of the Noncardiac Form of the L-Type Calcium Channel by MicroRNA-Based Short Hairpin RNA as a Potential Antihypertensive Therapy

PubMed Central

Rhee, Sung W.; Stimers, Joseph R.; Wang, Wenze; Pang, Li

2009-01-01

In different rodent models of hypertension, vascular voltage-gated L-type calcium channel (CaL) current and vascular tone is increased because of increased expression of the noncardiac form of the CaL (Cav1.2). The objective of this study was to develop a small interfering RNA (siRNA) expression system against the noncardiac form of Cav1.2 to reduce its expression in vascular smooth muscle cells (VSMCs). siRNAs expressing plasmids and appropriate controls were constructed and first screened in human embryonic kidney (HEK) 293 cells cotransfected with a rat Cav1.2 expression vector. The most effective gene silencing was achieved with a modified mir-30a-based short hairpin RNA (shRNAmir) driven by the cytomegalovirus promoter. In A7r5 cells, a vascular smooth muscle cell line, two copies of shRNAmir driven by a chimeric VSMC-specific enhancer/promoter reduced endogenous Cav1.2 expression by 61% and decreased the CaL current carried by barium by 47%. Moreover, the chimeric vascular smooth muscle-specific enhancer/promoter displayed almost no activity in non-VSMCs (PC-12 and HEK 293). Because the proposed siRNA was designed to only target the noncardiac form of Cav1.2, it did not affect the CaL expression and function in cultured cardiomyocytes, even when driven by a stronger cytomegalovirus promoter. In conclusion, vascular Cav1.2 expression and function were effectively reduced by VSMC-specific delivery of the noncardiac form of Cav1.2 siRNA without similarly affecting cardiac CaL expression and function. When coupled with a viral vector, this molecular intervention in vivo may provide a novel long-term vascular-specific gene therapy for hypertension. PMID:19244098

[Construction of rAAV2-GPIIb/IIIa vector and test of its expression and function in vitro].

PubMed

Wang, Kai; Peng, Jian-Qiang; Chen, Fang-Ping; Wu, Xiao-Bin

2006-04-01

This study was aimed to explore the possibility of rAAV2 vector-mediating gene therapy for Glanzmann' s thrombasthenia. The rAAV2-GPIIb/IIIa vector was constructed. The GPIIb/IIIa gene expression in mammal cell were examined by different methods, such as: detection of mRNA expression in BHK-21 cells after 24 hours of infection (MOI = 1 x 10(5) v.g/cell) was performed by RT-PCR; the relation between MOI and quantity of GPII6/IIIa gene expression was detected by FACS after 48 hours of infection; GPIIb/IIIa protein expression in BHK-21 cells after 48 hours of infection (MOI = 10(5) v x g/cell) was assayed by Western blot, GPIIb/IIIa protein expression on cell surface was detected by immunofluorescence, and the biological function of expressing product was determined by PAC-1 conjunct experiments. The results showed that GPIIb/IIIa gene expression in mRNA level could be detected in BHK-21 cells after 24 hours of infection at MOI = 1 x 10(5) v x g/cell and the GPIIb/IIIa gene expression in protein level could be detected in BHK-21 cells after 48 hours of infection at MOI = 1 x 10(5) v x g/cell. In certain range, quantity of GPIIb/IIIa gene expression increased with MOI, but overdose of MOI decreased quantity of GPIIb/IIIa gene expression. Activated product of GPIIb/IIIa gene expression could combined with PAC-I, and possesed normal biological function. In conclusion, rAAV2 vactor can effectively mediate GPIIb and GPIIIa gene expressing in mammal cells, and the products of these genes exhibit biological function. This result may provide a basis for application of rAAV2 vector in Glanzmann's thrombasthenia gene therapy in furture.

A rapid and efficient branched DNA hybridization assay to titer lentiviral vectors.

PubMed

Nair, Ayyappan; Xie, Jinger; Joshi, Sarasijam; Harden, Paul; Davies, Joan; Hermiston, Terry

2008-11-01

A robust assay to titer lentiviral vectors is imperative to qualifying their use in drug discovery, target validation and clinical applications. In this study, a novel branched DNA based hybridization assay was developed to titer lentiviral vectors by quantifying viral RNA genome copy numbers from viral lysates without having to purify viral RNA, and this approach was compared with other non-functional (p24 protein ELISA and viral RT-qPCR) and a functional method (reporter gene expression) used commonly. The RT-qPCR method requires purification of viral RNA and the accuracy of titration therefore depends on the efficiency of purification; this requirement is ameliorated in the hybridization assay as RNA is measured directly in viral lysates. The present study indicates that the hybridization based titration assay performed on viral lysates was more accurate and has additional advantages of being rapid, robust and not dependent on transduction efficiency in different cell types.

The 3D protein of duck hepatitis A virus type 1 binds to a viral genomic 3' UTR and shows RNA-dependent RNA polymerase activity.

PubMed

Zhang, Yu; Cao, Qianda; Wang, Mingshu; Jia, Renyong; Chen, Shun; Zhu, Dekang; Liu, Mafeng; Sun, Kunfeng; Yang, Qiao; Wu, Ying; Zhao, Xinxin; Chen, Xiaoyue; Cheng, Anchun

2017-12-01

To explore the RNA-dependent RNA polymerase (RdRP) function of the 3D protein of duck hepatitis A virus type 1 (DHAV-1), the gene was cloned into the pET-32a(+) vector for prokaryotic expression. The 3' untranslated region (3' UTR) of DHAV-1 together with a T7 promoter was cloned into the pMD19-T vector for in vitro transcription of 3' UTR RNA, which was further used as a template in RNA-dependent RNA polymerization. In this study, three methods were applied to analyze the RdRP function of the 3D protein: (1) ammonium molybdate spectrophotometry to detect pyrophosphate produced during polymerization; (2) quantitative reverse transcription PCR (RT-qPCR) to investigate the changes in RNA quantity during polymerization; and (3) electrophoresis mobility shift assay to examine the interaction between the 3D protein and 3' UTR. The results showed the 3D protein was successfully expressed in bacteria culture supernatant in a soluble form, which could be purified by affinity chromatography. In 3D enzymatic activity assays, pyrophosphate and RNA were produced, the amounts of which increased based on approximative kinetics, and binding of the 3D protein to the 3' UTR was observed. These results indicate that prokaryotically expressed soluble DHAV-13D protein can bind to a viral genomic 3' UTR and exhibit RdRP activity.

Adenovirus vector infection of non-small-cell lung cancer cells is a trigger for multi-drug resistance mediated by P-glycoprotein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomono, Takumi; Kajita, Masahiro; Yano, Kentaro

P-glycoprotein (P-gp) is an ATP-binding cassette protein involved in cancer multi-drug resistance (MDR). It has been reported that infection with some bacteria and viruses induces changes in the activities of various drug-metabolizing enzymes and transporters, including P-gp. Although human adenoviruses (Ad) cause the common cold, the effect of Ad infection on MDR in cancer has not been established. In this study, we investigated whether Ad infection is a cause of MDR in A549, H441 and HCC827 non-small-cell lung cancer (NSCLC) cell lines, using an Ad vector system. We found that Ad vector infection of NSCLC cell lines induced P-gp mRNAmore » expression, and the extent of induction was dependent on the number of Ad vector virus particles and the infection time. Heat-treated Ad vector, which is not infectious, did not alter P-gp mRNA expression. Uptake experiments with doxorubicin (DOX), a P-gp substrate, revealed that DOX accumulation was significantly decreased in Ad vector-infected A549 cells. The decrease of DOX uptake was blocked by verapamil, a P-gp inhibitor. Our results indicated that Ad vector infection of NSCLC cells caused MDR mediated by P-gp overexpression. The Ad vector genome sequence is similar to that of human Ad, and therefore human Ad infection of lung cancer patients may lead to chemoresistance in the clinical environment. -- Highlights: •Adenovirus vector infection induced P-gp mRNA expression in three NSCLC cell lines. •Adenovirus vector infection enhanced P-gp-mediated doxorubicin efflux from the cells. •The increase of P-gp was not mediated by nuclear receptors (PXR, CAR) or COX-2.« less

Golden Gate Assembly of CRISPR gRNA expression array for simultaneously targeting multiple genes.

PubMed

Vad-Nielsen, Johan; Lin, Lin; Bolund, Lars; Nielsen, Anders Lade; Luo, Yonglun

2016-11-01

The engineered CRISPR/Cas9 technology has developed as the most efficient and broadly used genome editing tool. However, simultaneously targeting multiple genes (or genomic loci) in the same individual cells using CRISPR/Cas9 remain one technical challenge. In this article, we have developed a Golden Gate Assembly method for the generation of CRISPR gRNA expression arrays, thus enabling simultaneous gene targeting. Using this method, the generation of CRISPR gRNA expression array can be accomplished in 2 weeks, and contains up to 30 gRNA expression cassettes. We demonstrated in the study that simultaneously targeting 10 genomic loci or simultaneously inhibition of multiple endogenous genes could be achieved using the multiplexed gRNA expression array vector in human cells. The complete set of plasmids is available through the non-profit plasmid repository Addgene.

In vivo Assembly in Escherichia coli of Transformation Vectors for Plastid Genome Engineering

PubMed Central

Wu, Yuyong; You, Lili; Li, Shengchun; Ma, Meiqi; Wu, Mengting; Ma, Lixin; Bock, Ralph; Chang, Ling; Zhang, Jiang

2017-01-01

Plastid transformation for the expression of recombinant proteins and entire metabolic pathways has become a promising tool for plant biotechnology. However, large-scale application of this technology has been hindered by some technical bottlenecks, including lack of routine transformation protocols for agronomically important crop plants like rice or maize. Currently, there are no standard or commercial plastid transformation vectors available for the scientific community. Construction of a plastid transformation vector usually requires tedious and time-consuming cloning steps. In this study, we describe the adoption of an in vivo Escherichia coli cloning (iVEC) technology to quickly assemble a plastid transformation vector. The method enables simple and seamless build-up of a complete plastid transformation vector from five DNA fragments in a single step. The vector assembled for demonstration purposes contains an enhanced green fluorescent protein (GFP) expression cassette, in which the gfp transgene is driven by the tobacco plastid ribosomal RNA operon promoter fused to the 5′ untranslated region (UTR) from gene10 of bacteriophage T7 and the transcript-stabilizing 3′UTR from the E. coli ribosomal RNA operon rrnB. Successful transformation of the tobacco plastid genome was verified by Southern blot analysis and seed assays. High-level expression of the GFP reporter in the transplastomic plants was visualized by confocal microscopy and Coomassie staining, and GFP accumulation was ~9% of the total soluble protein. The iVEC method represents a simple and efficient approach for construction of plastid transformation vector, and offers great potential for the assembly of increasingly complex vectors for synthetic biology applications in plastids. PMID:28871270

In vivo Assembly in Escherichia coli of Transformation Vectors for Plastid Genome Engineering.

PubMed

Wu, Yuyong; You, Lili; Li, Shengchun; Ma, Meiqi; Wu, Mengting; Ma, Lixin; Bock, Ralph; Chang, Ling; Zhang, Jiang

2017-01-01

Plastid transformation for the expression of recombinant proteins and entire metabolic pathways has become a promising tool for plant biotechnology. However, large-scale application of this technology has been hindered by some technical bottlenecks, including lack of routine transformation protocols for agronomically important crop plants like rice or maize. Currently, there are no standard or commercial plastid transformation vectors available for the scientific community. Construction of a plastid transformation vector usually requires tedious and time-consuming cloning steps. In this study, we describe the adoption of an in vivo Escherichia coli cloning (iVEC) technology to quickly assemble a plastid transformation vector. The method enables simple and seamless build-up of a complete plastid transformation vector from five DNA fragments in a single step. The vector assembled for demonstration purposes contains an enhanced green fluorescent protein (GFP) expression cassette, in which the gfp transgene is driven by the tobacco plastid ribosomal RNA operon promoter fused to the 5' untranslated region (UTR) from gene10 of bacteriophage T7 and the transcript-stabilizing 3'UTR from the E. coli ribosomal RNA operon rrnB . Successful transformation of the tobacco plastid genome was verified by Southern blot analysis and seed assays. High-level expression of the GFP reporter in the transplastomic plants was visualized by confocal microscopy and Coomassie staining, and GFP accumulation was ~9% of the total soluble protein. The iVEC method represents a simple and efficient approach for construction of plastid transformation vector, and offers great potential for the assembly of increasingly complex vectors for synthetic biology applications in plastids.

The Development of a Viral Mediated CRISPR/Cas9 System with Doxycycline Dependent gRNA Expression for Inducible In vitro and In vivo Genome Editing

PubMed Central

de Solis, Christopher A.; Ho, Anthony; Holehonnur, Roopashri; Ploski, Jonathan E.

2016-01-01

The RNA-guided Cas9 nuclease, from the type II prokaryotic Clustered Regularly Interspersed Short Palindromic Repeats (CRISPR) adaptive immune system, has been adapted and utilized by scientists to edit the genomes of eukaryotic cells. Here, we report the development of a viral mediated CRISPR/Cas9 system that can be rendered inducible utilizing doxycycline (Dox) and can be delivered to cells in vitro and in vivo utilizing adeno-associated virus (AAV). Specifically, we developed an inducible gRNA (gRNAi) AAV vector that is designed to express the gRNA from a H1/TO promoter. This AAV vector is also designed to express the Tet repressor (TetR) to regulate the expression of the gRNAi in a Dox dependent manner. We show that H1/TO promoters of varying length and a U6/TO promoter can edit DNA with similar efficiency in vitro, in a Dox dependent manner. We also demonstrate that our inducible gRNAi vector can be used to edit the genomes of neurons in vivo within the mouse brain in a Dox dependent manner. Genome editing can be induced in vivo with this system by supplying animals Dox containing food for as little as 1 day. This system might be cross compatible with many existing S. pyogenes Cas9 systems (i.e., Cas9 mouse, CRISPRi, etc.), and therefore it likely can be used to render these systems inducible as well. PMID:27587996

Transcript characteristic of myostatin in sheep fibroblasts.

PubMed

Lu, Jian; Ren, Hangxing; Sheng, Xihui; Zhang, Xiaoning; Li, Shangang; Zhao, Fuping; Zhou, Xinlei; Zhang, Li; Wei, Caihong; Ding, Jiatong; Li, Bichun; Du, Lixin

2012-08-01

Myostatin, a secreted growth factor highly expressed in skeletal muscle, negatively regulates skeletal muscle growth and differentiation. Recently, myostatin is emerged as a potential target for anti-atrophy and anti-fibrotic therapies. Therefore, to investigate the regulation of myostatin in sheep adult fibroblasts, we used the RNA interference mediated by lentiviral vector to gene silence myostatin. Simultaneously, we also had constructed the sheep myostatin overexpression vector to further explore the function of myostatin in fibroblasts. The results here demonstrated that the lentiviral vector could significantly reduce myostatin gene both at mRNA and protein level by 71% and 67%, respectively (P < 0.01). Inhibition of myostatin also resulted in a remarkable increase of activin receptor 2B (ACV2B), p21, PPARγ, leptin, C/EBPβ, and MEF2A expression, and a decrease of Akt1, CDK2, MEF2C, and Myf5 expression. Ectopic myostatin mRNA and protein were also present in the fibroblasts transfection. Furthermore, we observed that overexpression of myostatin contributed to an increase of Akt1, CDK2, Myf5 and PPARγ, and a decrease of p21, C/EBPα and leptin at the transcript level. These results suggested that myostatin positively regulated Akt1, CDK2, Myf5, leptin, and C/EBPα, but negatively regulated p21 mRNA expression in adult fibroblasts, and it also expanded our understanding of the regulation mechanism of myostatin. Moreover, the lentiviral system inactivated myostatin gene in fibroblasts would be used to generate transgenic sheep and to ameliorate muscle fibrosis and atrophy by gene therapy in the future. Copyright © 2012 Wiley Periodicals, Inc.

A Multipurpose Toolkit to Enable Advanced Genome Engineering in Plants[OPEN

PubMed Central

Gil-Humanes, Javier; Čegan, Radim; Kono, Thomas J.Y.; Konečná, Eva; Belanto, Joseph J.; Starker, Colby G.

2017-01-01

We report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on transcription activator-like effector nucleases (TALENs) and the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A Web-based tool streamlines vector selection and construction. One advantage of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 (Csy4) and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing 12 gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare). PMID:28522548

A multi-purpose toolkit to enable advanced genome engineering in plants

DOE PAGES

Cermak, Tomas; Curtin, Shaun J.; Gil-Humanes, Javier; ...

2017-05-18

Here, we report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on Transcription Activator-Like Effector Nucleases TALENs and the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A web-based tool streamlines vector selection and construction. One advantagemore » of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 Csy4 and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing twelve gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare).« less

A multi-purpose toolkit to enable advanced genome engineering in plants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cermak, Tomas; Curtin, Shaun J.; Gil-Humanes, Javier

Here, we report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on Transcription Activator-Like Effector Nucleases TALENs and the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A web-based tool streamlines vector selection and construction. One advantagemore » of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 Csy4 and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing twelve gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare).« less

Genetic engineering of human embryonic stem cells with lentiviral vectors.

PubMed

Xiong, Chen; Tang, Dong-Qi; Xie, Chang-Qing; Zhang, Li; Xu, Ke-Feng; Thompson, Winston E; Chou, Wayne; Gibbons, Gary H; Chang, Lung-Ji; Yang, Li-Jun; Chen, Yuqing E

2005-08-01

Human embryonic stem (hES) cells present a valuable source of cells with a vast therapeutic potential. However, the low efficiency of directed differentiation of hES cells remains a major obstacle in their uses for regenerative medicine. While differentiation may be controlled by the genetic manipulation, effective and efficient gene transfer into hES cells has been an elusive goal. Here, we show stable and efficient genetic manipulations of hES cells using lentiviral vectors. This method resulted in the establishment of stable gene expression without loss of pluripotency in hES cells. In addition, lentiviral vectors were effective in conveying the expression of an U6 promoter-driven small interfering RNA (siRNA), which was effective in silencing its specific target. Taken together, our results suggest that lentiviral gene delivery holds great promise for hES cell research and application.

[MicroRNA in neurodegenerative disorders].

PubMed

Sobue, Gen

2013-01-01

MicroRNAs (miRNAs) bind to the 3'-untranslated region of mRNA, and thereby suppress the gene expression. Recent studies suggest that miRNAs modify the pathogenesis of cancer and neurodegeneration. Our study demonstrated that the expression levels of miR-196a is increased in a mouse model of spinal and bulbar muscular atrophy (SBMA), a neurodegenerative disease caused by the expansion of polyglutamine in androgen receptor (AR). In cultured neuronal cells, miR-196a decayed the mutant AR mRNA via silencing CUG triplet repeat RNA binding protein 2, a potent miR-196a targeting mRNA, which contributed to stabilize the mutant AR mRNA. Adeno-associated virus vector-mediated delivery of this miRNA attenuates the expression of the mutant AR, resulting in the mitigation of motor neuron degeneration in the SBMA mice. Introduction of miRNA appears to be a novel therapeutic strategy for devastating neurodegenerative diseases.

Metatranscriptomics of Soil Eukaryotic Communities.

PubMed

Yadav, Rajiv K; Bragalini, Claudia; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

2016-01-01

Functions expressed by eukaryotic organisms in soil can be specifically studied by analyzing the pool of eukaryotic-specific polyadenylated mRNA directly extracted from environmental samples. In this chapter, we describe two alternative protocols for the extraction of high-quality RNA from soil samples. Total soil RNA or mRNA can be converted to cDNA for direct high-throughput sequencing. Polyadenylated mRNA-derived full-length cDNAs can also be cloned in expression plasmid vectors to constitute soil cDNA libraries, which can be subsequently screened for functional gene categories. Alternatively, the diversity of specific gene families can also be explored following cDNA sequence capture using exploratory oligonucleotide probes.

Adeno-associated virus gene therapy vector scAAVIGF-I for transduction of equine articular chondrocytes and RNA-seq analysis.

PubMed

Hemphill, D D; McIlwraith, C W; Slayden, R A; Samulski, R J; Goodrich, L R

2016-05-01

IGF-I is one of several anabolic factors being investigated for the treatment of osteoarthritis (OA). Due to the short biological half-life, extended administration is required for more robust cartilage healing. Here we create a self-complimentary adeno-associated virus (AAV) gene therapy vector utilizing the transgene for IGF-I. Various biochemical assays were performed to investigate the cellular response to scAAVIGF-I treatment vs an scAAVGFP positive transduction control and a negative for transduction control culture. RNA-sequencing analysis was also performed to establish a differential regulation profile of scAAVIGF-I transduced chondrocytes. Biochemical analyses indicated an average media IGF-I concentration of 608 ng/ml in the scAAVIGF-I transduced chondrocytes. This increase in IGF-I led to increased expression of collagen type II and aggrecan and increased protein concentrations of cellular collagen type II and media glycosaminoglycan vs both controls. RNA-seq revealed a global regulatory pattern consisting of 113 differentially regulated GO categories including those for chondrocyte and cartilage development and regulation of apoptosis. This research substantiates that scAAVIGF-I gene therapy vector increased production of IGF-I to clinically relevant levels with a biological response by chondrocytes conducive to increased cartilage healing. The RNA-seq further established a set of differentially expressed genes and gene ontologies induced by the scAAVIGF-I vector while controlling for AAV infection. This dataset provides a static representation of the cellular transcriptome that, while only consisting of one time point, will allow for further gene expression analyses to compare additional cartilage healing therapeutics or a transient cellular response. Copyright © 2015. Published by Elsevier Ltd.

Development of Defective and Persistent Sendai Virus Vector

PubMed Central

Nishimura, Ken; Sano, Masayuki; Ohtaka, Manami; Furuta, Birei; Umemura, Yoko; Nakajima, Yoshiro; Ikehara, Yuzuru; Kobayashi, Toshihiro; Segawa, Hiroaki; Takayasu, Satoko; Sato, Hideyuki; Motomura, Kaori; Uchida, Eriko; Kanayasu-Toyoda, Toshie; Asashima, Makoto; Nakauchi, Hiromitsu; Yamaguchi, Teruhide; Nakanishi, Mahito

2011-01-01

The ectopic expression of transcription factors can reprogram differentiated tissue cells into induced pluripotent stem cells. However, this is a slow and inefficient process, depending on the simultaneous delivery of multiple genes encoding essential reprogramming factors and on their sustained expression in target cells. Moreover, once cell reprogramming is accomplished, these exogenous reprogramming factors should be replaced with their endogenous counterparts for establishing autoregulated pluripotency. Complete and designed removal of the exogenous genes from the reprogrammed cells would be an ideal option for satisfying this latter requisite as well as for minimizing the risk of malignant cell transformation. However, no single gene delivery/expression system has ever been equipped with these contradictory characteristics. Here we report the development of a novel replication-defective and persistent Sendai virus (SeVdp) vector based on a noncytopathic variant virus, which fulfills all of these requirements for cell reprogramming. The SeVdp vector could accommodate up to four exogenous genes, deliver them efficiently into various mammalian cells (including primary tissue cells and human hematopoietic stem cells) and express them stably in the cytoplasm at a prefixed balance. Furthermore, interfering with viral transcription/replication using siRNA could erase the genomic RNA of SeVdp vector from the target cells quickly and thoroughly. A SeVdp vector installed with Oct4/Sox2/Klf4/c-Myc could reprogram mouse primary fibroblasts quite efficiently; ∼1% of the cells were reprogrammed to Nanog-positive induced pluripotent stem cells without chromosomal gene integration. Thus, this SeVdp vector has potential as a tool for advanced cell reprogramming and for stem cell research. PMID:21138846

Direct and efficient transfection of mouse neural stem cells and mature neurons by in vivo mRNA electroporation.

PubMed

Bugeon, Stéphane; de Chevigny, Antoine; Boutin, Camille; Coré, Nathalie; Wild, Stefan; Bosio, Andreas; Cremer, Harold; Beclin, Christophe

2017-11-01

In vivo brain electroporation of DNA expression vectors is a widely used method for lineage and gene function studies in the developing and postnatal brain. However, transfection efficiency of DNA is limited and adult brain tissue is refractory to electroporation. Here, we present a systematic study of mRNA as a vector for acute genetic manipulation in the developing and adult brain. We demonstrate that mRNA electroporation is far more efficient than DNA electroporation, and leads to faster and more homogeneous protein expression in vivo Importantly, mRNA electroporation allows the manipulation of neural stem cells and postmitotic neurons in the adult brain using minimally invasive procedures. Finally, we show that this approach can be efficiently used for functional studies, as exemplified by transient overexpression of the neurogenic factor Myt1l and by stably inactivating Dicer nuclease in vivo in adult born olfactory bulb interneurons and in fully integrated cortical projection neurons. © 2017. Published by The Company of Biologists Ltd.

Two Distinct Approaches for CRISPR-Cas9-Mediated Gene Editing in Cryptococcus neoformans and Related Species.

PubMed

Wang, Ping

2018-06-27

Cryptococcus neoformans and related species are encapsulated basidiomycetous fungi that cause meningoencephalitis in individuals with immune deficiency. This pathogen has a tractable genetic system; however, gene disruption via electroporation remains difficult, while biolistic transformation is often limited by lack of multiple genetic markers and the high initial cost of equipment. The approach using clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated protein 9 (Cas9) has become the technology of choice for gene editing in many organisms due to its simplicity, efficiency, and versatility. The technique has been successfully demonstrated in C. neoformans and Cryptococcus deneoformans in which two DNA plasmids expressing either the Streptococcus pyogenes CAS9 gene or the guide RNA (gRNA) were employed. However, potential adverse effects due to constitutive expression and the time-consuming process of constructing vectors to express each gRNA remain as a primary barrier for wide adaptation. This report describes the delivery of preassembled CRISPR-Cas9-gRNA ribonucleoproteins (RNPs) via electroporation that is able to generate edited mutant alleles. RNP-mediated CRISPR-Cas9 was used to replace the wild-type GIB2 gene encoding a Gβ-like/RACK1 Gib2 protein with a gib2 :: NAT allele via homologous recombination in both C. neoformans and C. deneoformans In addition, a DNA plasmid (pCnCas9:U6-gRNA) that expresses both Cas9 and gRNA, allowing for convenient yet low-cost DNA-mediated gene editing, is described. pCnCas9:U6-gRNA contains an endogenous U6 promoter for gRNA expression and restriction sites for one-step insertion of a gRNA. These approaches and resources provide new opportunities to accelerate genetic studies of Cryptococcus species. IMPORTANCE For genetic studies of the Cryptococcus genus, generation of mutant strains is often hampered by a limited number of selectable genetic markers, the tedious process of vector construction, side effects, and other limitations, such as the high cost of acquiring a particle delivery system. CRISPR-Cas9 technology has been demonstrated in Cryptococcus for genome editing. However, it remains labor-intensive and time-consuming since it requires the identification of a suitable type III RNA polymerase promoter for gRNA expression. In addition, there may be potential adverse effects caused by constitutive expressions of Cas9 and gRNA. Here, I report the use of a ribonucleoprotein-mediated CRISPR-Cas9 technique for genome editing of C. neoformans and related species. Together with the custom-constructed pCnCas9:U6-gRNA vector that allows low-cost and time-saving DNA-based CRISPR-Cas9, my approach adds to the molecular toolbox for dissecting the molecular mechanism of pathogenesis in this important group of fungal pathogens. Copyright © 2018 Wang.

Retrovirus-mediated siRNA targeting TRPM7 gene induces apoptosis in RBL-2H3 cells.

PubMed

Ng, N-M; Jiang, S-P; Lv, Z-Q

2012-09-01

Calcium signaling is important for both normal physiologic processes and pathology of various diseases. Transient receptor potential melastatin 7 (TRPM7) gene has been reported to be a potential candidate for calcium influx. The present study aimed to investigate the possible role of TRPM7 channels in apoptosis in rat basophilic leukemia mast cell line (RBL-2H3), which is widely used in mast cell-associated studies. A recombinant retrovirus vector siRNA targeting rat TRPM7 gene was constructed and identified. Cellular survival was assessed by MTT. Cell apoptosis was evaluated by flow cytometry and TUNEL-FITC/Hoechst 33258 staining. The transfection efficiency by retrovirus vector was about 60%-70%. Transfection with TRPM7 siRNA significantly reduced TRPM7 expression both at mRNA and protein levels. Suppression of TRPM7 expression by siRNA led to significantly decreased cellular survival rates and increased apoptosis rates in RBL-2H3 cells. This study indicates that TRPM7 is involved in the apoptosis process in RBL-2H3 cells.

Tailor-made gene silencing of Staphylococcus aureus clinical isolates by CRISPR interference

PubMed Central

Sato’o, Yusuke; Hisatsune, Junzo; Yu, Liansheng; Sakuma, Tetsushi; Yamamoto, Takashi

2018-01-01

Preparing the genetically modified organisms have required much time and labor, making it the rate-limiting step but CRISPR/Cas9 technology appearance has changed this difficulty. Although reports on CRISPR/Cas9 technology such as genome editing and CRISPR interference (CRISPRi) in eukaryotes increased, those in prokaryotes especially in Staphylococci were limited. Thus, its potential in the bacteriology remains unexplored. This is attributed to ecological difference between eukaryotes and prokaryotes. Here, we constructed a novel CRISPRi plasmid vector, pBACi for Staphylococcus aureus. The transformation efficiency of S. aureus was ~104 CFU/μg DNA using a vector extracted from dcm negative, which encoded one of DNA modification genes, E. coli. Further, pBACi was introduced into various clinical isolates including that not accepting the conventional temperature-sensitive vector. dcas9 in the vector was expressed throughout the growth phases of S. aureus and this vector decreased various gene mRNA expressions based on the crRNA targeting sequences and altered the knockdown strains’ phenotypes. The targeted genes included various virulence and antibiotic resistant genes. Bioinformatics suggest this vector can be introduced into wide range of low-GC Gram-positive bacteria. Because this new CRISPR/Cas9-based vector can easily prepare knockdown strains, we believe the novel vector will facilitate the characterization of the function of genes from S. aureus and other Gram-positive bacteria. PMID:29377933

Versatile approach for functional analysis of human proteins and efficient stable cell line generation using FLP-mediated recombination system

PubMed Central

Szczesny, Roman J.; Kowalska, Katarzyna; Klosowska-Kosicka, Kamila; Chlebowski, Aleksander; Owczarek, Ewelina P.; Warkocki, Zbigniew; Kulinski, Tomasz M.; Adamska, Dorota; Affek, Kamila; Jedroszkowiak, Agata; Kotrys, Anna V.; Tomecki, Rafal; Krawczyk, Pawel S.; Borowski, Lukasz S.; Dziembowski, Andrzej

2018-01-01

Deciphering a function of a given protein requires investigating various biological aspects. Usually, the protein of interest is expressed with a fusion tag that aids or allows subsequent analyses. Additionally, downregulation or inactivation of the studied gene enables functional studies. Development of the CRISPR/Cas9 methodology opened many possibilities but in many cases it is restricted to non-essential genes. Recombinase-dependent gene integration methods, like the Flp-In system, are very good alternatives. The system is widely used in different research areas, which calls for the existence of compatible vectors and efficient protocols that ensure straightforward DNA cloning and generation of stable cell lines. We have created and validated a robust series of 52 vectors for streamlined generation of stable mammalian cell lines using the FLP recombinase-based methodology. Using the sequence-independent DNA cloning method all constructs for a given coding-sequence can be made with just three universal PCR primers. Our collection allows tetracycline-inducible expression of proteins with various tags suitable for protein localization, FRET, bimolecular fluorescence complementation (BiFC), protein dynamics studies (FRAP), co-immunoprecipitation, the RNA tethering assay and cell sorting. Some of the vectors contain a bidirectional promoter for concomitant expression of miRNA and mRNA, so that a gene can be silenced and its product replaced by a mutated miRNA-insensitive version. Our toolkit and protocols have allowed us to create more than 500 constructs with ease. We demonstrate the efficacy of our vectors by creating stable cell lines with various tagged proteins (numatrin, fibrillarin, coilin, centrin, THOC5, PCNA). We have analysed transgene expression over time to provide a guideline for future experiments and compared the effectiveness of commonly used inducers for tetracycline-responsive promoters. As proof of concept we examined the role of the exoribonuclease XRN2 in transcription termination by RNAseq. PMID:29590189

Single-Dose Intracardiac Injection of Pro-Regenerative MicroRNAs Improves Cardiac Function After Myocardial Infarction.

PubMed

Lesizza, Pierluigi; Prosdocimo, Giulia; Martinelli, Valentina; Sinagra, Gianfranco; Zacchigna, Serena; Giacca, Mauro

2017-04-14

Recent evidence indicates that a few human microRNAs (miRNAs), in particular hsa-miR-199a-3p and hsa-miR-590-3p, stimulate proliferation of cardiomyocytes and, once expressed in the mouse heart using viral vectors, induce cardiac regeneration after myocardial infarction. Viral vectors, however, are not devoid of safety issues and, more notably, drive expression of the encoded miRNAs for indefinite periods of time, which might not be desirable in light of human therapeutic application. As an alternative to the use of viral vectors, we wanted to assess the efficacy of synthetic miRNA mimics in inducing myocardial repair after single intracardiac injection using synthetic lipid formulations. We comparatively analyzed the efficacy of different lipid formulations in delivering hsa-miR-199a-3p and hsa-miR-590-3p both in primary neonatal mouse cardiomyocytes and in vivo. We established a transfection protocol allowing persistence of these 2 mimics for at least 12 days after a single intracardiac injection, with minimal dispersion to other organs and long-term preservation of miRNA functional activity, as assessed by monitoring the expression of 2 mRNA targets. Administration of this synthetic formulation immediately after myocardial infarction in mice resulted in marked reduction of infarct size and persistent recovery of cardiac function. A single administration of synthetic miRNA-lipid formulations is sufficient to stimulate cardiac repair and restoration of cardiac function. © 2017 American Heart Association, Inc.

RNAi knockdown of oxytocin receptor in the nucleus accumbens inhibits social attachment and parental care in monogamous female prairie voles

PubMed Central

Keebaugh, Alaine C.; Barrett, Catherine E.; LaPrairie, Jamie L.; Jenkins, Jasmine J.; Young, Larry J.

2015-01-01

Oxytocin modulates many aspects of social cognition and behaviors, including maternal nurturing, social recognition and bonding. Natural variation in oxytocin receptor (OXTR) density in the nucleus accumbens (NAcc) is associated with variation in alloparental behavior, and artificially enhancing OXTR expression in the NAcc enhances alloparental behavior and pair bonding in socially monogamous prairie voles. Furthermore, infusion of an OXTR antagonist into the nucleus accumbens (NAcc) inhibits alloparental behavior and partner preference formation. However, antagonists can promiscuously interact with other neuropeptide receptors. To directly examine the role of OXTR signaling in social bonding, we used RNA interference to selectively knockdown, but not eliminate, OXTR in the NAcc of female prairie voles and examined the impact on social behaviors. Using an adeno-associated viral vector expressing a short hairpin RNA (shRNA) targeting Oxtr mRNA, we reduced accumbal OXTR density in female prairie voles from juvenile age through adulthood. Females receiving the shRNA vector displayed a significant reduction in alloparental behavior and disrupted partner preference formation. These are the first direct demonstrations that OXTR plays a critical role in alloparental behavior and adult social attachment, and suggest that natural variation in OXTR expression in this region alone can create variation in social behavior. PMID:25874849

Intramuscular injection of AAV8 in mice and macaques is associated with substantial hepatic targeting and transgene expression.

PubMed

Greig, Jenny A; Peng, Hui; Ohlstein, Jason; Medina-Jaszek, C Angelica; Ahonkhai, Omua; Mentzinger, Anne; Grant, Rebecca L; Roy, Soumitra; Chen, Shu-Jen; Bell, Peter; Tretiakova, Anna P; Wilson, James M

2014-01-01

Intramuscular (IM) administration of adeno-associated viral (AAV) vectors has entered the early stages of clinical development with some success, including the first approved gene therapy product in the West called Glybera. In preparation for broader clinical development of IM AAV vector gene therapy, we conducted detailed pre-clinical studies in mice and macaques evaluating aspects of delivery that could affect performance. We found that following IM administration of AAV8 vectors in mice, a portion of the vector reached the liver and hepatic gene expression contributed significantly to total expression of secreted transgenes. The contribution from liver could be controlled by altering injection volume and by the use of traditional (promoter) and non-traditional (tissue-specific microRNA target sites) expression control elements. Hepatic distribution of vector following IM injection was also noted in rhesus macaques. These pre-clinical data on AAV delivery should inform safe and efficient development of future AAV products.

The Effects of HSP27 on Gemcitabine-Resistant Pancreatic Cancer Cell Line Through Snail.

PubMed

Zhang, Song; Zhang, Xiao-qi; Huang, Shu-ling; Chen, Min; Shen, Shan-shan; Ding, Xi-wei; Lv, Ying; Zou, Xiao-ping

2015-10-01

To evaluate the regulation mechanism of heat shock protein 27 (HSP27) on gemcitabine (GEM) resistance of pancreatic cancer cell. The expression vectors pEGFP-C1-HSP27 and the vectors of MicroRNA targeting Snail were introduced into GEM-sensitive pancreatic cancer SW1990 cells, and the vectors of small hairpin RNA targeting HSP27 were transfected into SW1990 and GEM-resistant SW1990/GEM cells. The expressions of HSP27, p-HSP27 (Ser82), Snail, ERCC1, and E-cadherin were evaluated by Western blotting. The sensitivity of transfected cells to GEM was detected by CCK-8 assay and Annexin V-FITC apoptosis assay. As compared to SW1990, SW1990/GEM showed significantly increased expressions of HSP27, p-HSP27, Snail and ERCC1 with decreased expression of E-cadherin. By increasing HSP27 expression, we found increase of Snail and ERCC1 with reduction of E-cadherin expressions, while reduction of HSP27 expression caused reduction of Snail and ERCC1 but increase of E-cadherin expressions. Downregulation of Snail resulted in the reduction of ERCC1 expression and increase of E-cadherin. Furthermore, downregulation of HSP27 or snail caused increased GEM sensitivity of pancreatic cancer cells, and upregulation of HSP27 showed the opposite results. There is an inverse correlation between HSP27 expression and GEM sensitivity of SW1990 cells, which might be realized by regulating E-cadherin and ERCC1 expressions through Snail.

RNA viruses and microRNAs: challenging discoveries for the 21st century

PubMed Central

Swaminathan, Gokul; Martin-Garcia, Julio

2013-01-01

RNA viruses represent the predominant cause of many clinically relevant viral diseases in humans. Among several evolutionary advantages acquired by RNA viruses, the ability to usurp host cellular machinery and evade antiviral immune responses is imperative. During the past decade, RNA interference mechanisms, especially microRNA (miRNA)-mediated regulation of cellular protein expression, have revolutionized our understanding of host-viral interactions. Although it is well established that several DNA viruses express miRNAs that play crucial roles in their pathogenesis, expression of miRNAs by RNA viruses remains controversial. However, modulation of the miRNA machinery by RNA viruses may confer multiple benefits for enhanced viral replication and survival in host cells. In this review, we discuss the current literature on RNA viruses that may encode miRNAs and the varied advantages of engineering RNA viruses to express miRNAs as potential vectors for gene therapy. In addition, we review how different families of RNA viruses can alter miRNA machinery for productive replication, evasion of antiviral immune responses, and prolonged survival. We underscore the need to further explore the complex interactions of RNA viruses with host miRNAs to augment our understanding of host-virus interplay. PMID:24046280

High-level recombinant protein expression in transgenic plants by using a double-inducible viral vector

PubMed Central

Werner, Stefan; Breus, Oksana; Symonenko, Yuri; Marillonnet, Sylvestre; Gleba, Yuri

2011-01-01

We describe here a unique ethanol-inducible process for expression of recombinant proteins in transgenic plants. The process is based on inducible release of viral RNA replicons from stably integrated DNA proreplicons. A simple treatment with ethanol releases the replicon leading to RNA amplification and high-level protein production. To achieve tight control of replicon activation and spread in the uninduced state, the viral vector has been deconstructed, and its two components, the replicon and the cell-to-cell movement protein, have each been placed separately under the control of an inducible promoter. Transgenic Nicotiana benthamiana plants incorporating this double-inducible system demonstrate negligible background expression, high (over 0.5 × 104-fold) induction multiples, and high absolute levels of protein expression upon induction (up to 4.3 mg/g fresh biomass). The process can be easily scaled up, supports expression of practically important recombinant proteins, and thus can be directly used for industrial manufacturing. PMID:21825158

Characterization of a Brome mosaic virus strain and its use as a vector for gene silencing in monocotyledonous hosts.

PubMed

Ding, Xin Shun; Schneider, William L; Chaluvadi, Srinivasa Rao; Mian, M A Rouf; Nelson, Richard S

2006-11-01

Virus-induced gene silencing (VIGS) is used to analyze gene function in dicotyledonous plants but less so in monocotyledonous plants (particularly rice and corn), partially due to the limited number of virus expression vectors available. Here, we report the cloning and modification for VIGS of a virus from Festuca arundinacea Schreb. (tall fescue) that caused systemic mosaic symptoms on barley, rice, and a specific cultivar of maize (Va35) under greenhouse conditions. Through sequencing, the virus was determined to be a strain of Brome mosaic virus (BMV). The virus was named F-BMV (F for Festuca), and genetic determinants that controlled the systemic infection of rice were mapped to RNAs 1 and 2 of the tripartite genome. cDNA from RNA 3 of the Russian strain of BMV (R-BMV) was modified to accept inserts from foreign genes. Coinoculation of RNAs 1 and 2 from F-BMV and RNA 3 from R-BMV expressing a portion of a plant gene to leaves of barley, rice, and maize plants resulted in visual silencing-like phenotypes. The visual phenotypes were correlated with decreased target host transcript levels in the corresponding leaves. The VIGS visual phenotype varied from maintained during silencing of actin 1 transcript expression to transient with incomplete penetration through affected tissue during silencing of phytoene desaturase expression. F-BMV RNA 3 was modified to allow greater accumulation of virus while minimizing virus pathogenicity. The modified vector C-BMV(A/G) (C for chimeric) was shown to be useful for VIGS. These BMV vectors will be useful for analysis of gene function in rice and maize for which no VIGS system is reported.

[Expression analysis of a transformer gene in Daphnia pulex after RNAi].

PubMed

Guo, C Y; Chen, P; Zhang, M M; Ning, J J; Wang, С L; Wang, D L; Zhao, Y L

2016-01-01

In order to explore the importance of the transformer (tra) gene in reproductive mode switching in Daphnia pulex, we studied the effect of silencing of this gene using RNA interference (RNAi). We obtained Dptra dsRNA by constructing and using a dsRNA expression vector and transcription method in vitro. D. pulex individuals in different reproductive modes were treated by soaking in a solution of Dptra dsRNA. We then assayed the expression of the endogenous Dptra mRNA after RNAi treatment using RT-PCR and obtained the suppression ratio. Expression of the tra gene in the RNAi groups was down-regulated compared with the controls after 16 h (p < 0.05). We also analyzed the effect of RNAi on the expression of the TRA protein using Western blot, which showed that the expression level of the TRA protein was reduced after RNAi treatment. Our experimental results showed that soaking of D. pulex adults in tra-specific dsRNA transcribed in vitro can specifically reduce the level of tra mRNA and also reduce the expression of the TRA protein, demonstrating effective in vivo silencing of the tra gene.

CRISPR/Cas9 delivery with one single adenoviral vector devoid of all viral genes.

PubMed

Ehrke-Schulz, Eric; Schiwon, Maren; Leitner, Theo; Dávid, Stephan; Bergmann, Thorsten; Liu, Jing; Ehrhardt, Anja

2017-12-07

The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system revolutionized the field of gene editing but viral delivery of the CRISPR/Cas9 system has not been fully explored. Here we adapted clinically relevant high-capacity adenoviral vectors (HCAdV) devoid of all viral genes for the delivery of the CRISPR/Cas9 machinery using a single viral vector. We present a platform enabling fast transfer of the Cas9 gene and gRNA expression units into the HCAdV genome including the option to choose between constitutive or inducible Cas9 expression and gRNA multiplexing. Efficacy and versatility of this pipeline was exemplified by producing different CRISPR/Cas9-HCAdV targeting the human papillomavirus (HPV) 18 oncogene E6, the dystrophin gene causing Duchenne muscular dystrophy (DMD) and the HIV co-receptor C-C chemokine receptor type 5 (CCR5). All CRISPR/Cas9-HCAdV proved to be efficient to deliver the respective CRISPR/Cas9 expression units and to introduce the desired DNA double strand breaks at their intended target sites in immortalized and primary cells.

Effects of Ghrelin miRNA on Inflammation and Calcium Pathway in Pancreatic Acinar Cells of Acute Pancreatitis.

PubMed

Tang, Xiping; Tang, Guodu; Liang, Zhihai; Qin, Mengbin; Fang, Chunyun; Zhang, Luyi

The study investigated the effects of endogenous targeted inhibition of ghrelin gene on inflammation and calcium pathway in an in vitro pancreatic acinar cell model of acute pancreatitis. Lentiviral expression vector against ghrelin gene was constructed and transfected into AR42J cells. The mRNA and protein expression of each gene were detected by reverse transcription polymerase chain reaction, Western blotting, or enzyme-linked immunosorbent assay. The concentration of intracellular calcium ([Ca]i) was determined by calcium fluorescence mark probe combined with laser scanning confocal microscopy. Compared with the control group, cerulein could upregulate mRNA and protein expression of inflammatory factors, calcium pathway, ghrelin, and [Ca]i. mRNA and protein expression of inflammatory factors increased significantly in cells transfected with ghrelin miRNA compared with the other groups. Intracellular calcium and expression of some calcium pathway proteins decreased significantly in cells transfected with ghrelin miRNA compared with the other groups. Targeted inhibition of ghrelin gene in pancreatic acinar cells of acute pancreatitis can upregulate the expression of the intracellular inflammatory factors and alleviate the intracellular calcium overload.

Both retinoic-acid-receptor- and retinoid-X-receptor-dependent signalling pathways mediate the induction of the brown-adipose-tissue-uncoupling-protein-1 gene by retinoids.

PubMed Central

Alvarez, R; Checa, M; Brun, S; Viñas, O; Mampel, T; Iglesias, R; Giralt, M; Villarroya, F

2000-01-01

The intracellular pathways and receptors mediating the effects of retinoic acid (RA) on the brown-fat-uncoupling-protein-1 gene (ucp-1) have been analysed. RA activates transcription of ucp-1 and the RA receptor (RAR) is known to be involved in this effect. However, co-transfection of an expression vector for retinoid-X receptor (RXR) increases the action of 9-cis RA but not the effects of all-trans RA on the ucp-1 promoter in brown adipocytes. Either RAR-specific ¿p-[(E)-2-(5,6,7,8,-tetrahydro-5,5,8, 8-tetramethyl-2-naphthalenyl)-1-propenyl]benzoic acid¿ or RXR-specific [isopropyl-(E,E)-(R,S)-11-methoxy-3,7, 11-trimethyldodeca-2,4-dienoate, or methoprene] synthetic compounds increase the expression of UCP-1 mRNA and the activity of chloramphenicol acetyltransferase expression vectors driven by the ucp-1 promoter. The RXR-mediated action of 9-cis RA requires the upstream enhancer region at -2469/-2318 in ucp-1. During brown-adipocyte differentiation RXRalpha and RXRgamma mRNA expression is induced in parallel with UCP-1 mRNA, whereas the mRNA for the three RAR subtypes, alpha, beta and gamma, decreases. Co-transfection of murine expression vectors for the different RAR and RXR subtypes indicates that RARalpha and RARbeta as well as RXRalpha are the major retinoid-receptor subtypes capable of mediating the responsiveness of ucp-1 to retinoids. It is concluded that the effects of retinoids on ucp-1 transcription involve both RAR- and RXR-dependent signalling pathways. The responsiveness of brown adipose tissue to retinoids in vivo relies on a complex combination of the capacity of RAR and RXR subtypes to mediate ucp-1 induction and their distinct expression in the differentiated brown adipocyte. PMID:10600643

The Role of Lymphangiogenesis in Orthotopic Prostatic Tumor-Environment on Regional and Systemic Metastasis

DTIC Science & Technology

2008-01-01

expressing Renilla luciferase and VEGF-C shRNA or irrelevant firefly luciferase shRNA (Ctrl) were implanted orthotopically as before. To determine the...on metastasis in Pten knockout model (Month 10-24): a) Generate Ubc/sVEGFR-3 and Ubc/ Renilla luciferase (RL) lentiviral vectors by subcloning...progression (month 10-12) c) Monitor efficiency of Ubc/lentiviral transduction and expression in Pten (-/-) prostate using optical imaging of Renilla

RNAi-dependent and -independent antiviral phenotypes of chromosomally integrated shRNA clones: role of VASP in respiratory syncytial virus growth.

PubMed

Musiyenko, Alla; Bitko, Vira; Barik, Sailen

2007-07-01

Stable RNA interference (RNAi) is commonly achieved by recombinant expression of short hairpin RNA (shRNA). To generate virus-resistant cell lines, we cloned a shRNA cassette against the phosphoprotein gene of respiratory syncytial virus (RSV) into a polIII-driven plasmid vector. Analysis of individual stable transfectants showed a spectrum of RSV resistance correlating with the levels of shRNA expressed from different chromosomal locations. Interestingly, resistance in a minority of clones was due to mono-allelic disruption of the cellular gene for vasodilator-stimulated phosphoprotein (VASP). Thus, pure clones of chromosomally integrated DNA-directed RNAi can exhibit gene disruption phenotypes resembling but unrelated to RNAi.

Deciphering the details of RNA aminoglycoside interactions: from atomistic models to biotechnological applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ilgu, Muslum

A detailed study was done of the neomycin-B RNA aptamer for determining its selectivity and binding ability to both neomycin– and kanamycin-class aminoglycosides. A novel method to increase drug concentrations in cells for more efficiently killing is described. To test the method, a bacterial model system was adopted and several small RNA molecules interacting with aminoglycosides were cloned downstream of T7 RNA polymerase promoter in an expression vector. Then, the growth analysis of E. coli expressing aptamers was observed for 12-hour period. Our analysis indicated that aptamers helped to increase the intracellular concentration of aminoglycosides thereby increasing their efficacy.

Engineered U7 snRNA mediates sustained splicing correction in erythroid cells from β-thalassemia/HbE patients.

PubMed

Preedagasamzin, Sarinthip; Nualkaew, Tiwaporn; Pongrujikorn, Tanjitti; Jinawath, Natini; Kole, Ryszard; Fucharoen, Suthat; Jearawiriyapaisarn, Natee; Svasti, Saovaros

2018-04-30

Repair of a splicing defect of β-globin pre-mRNA harboring hemoglobin E (HbE) mutation was successfully accomplished in erythroid cells from patients with β-thalassemia/HbE disorder by a synthetic splice-switching oligonucleotide (SSO). However, its application is limited by short-term effectiveness and requirement of lifelong periodic administration of SSO, especially for chronic diseases like thalassemias. Here, we engineered lentiviral vectors that stably express U7 small nuclear RNA (U7 snRNA) carrying the splice-switching sequence of the SSO that restores correct splicing of β E -globin pre-mRNA and achieves a long-term therapeutic effect. Using a two-step tiling approach, we systematically screened U7 snRNAs carrying splice-switching SSO sequences targeted to the cryptic 5' splice site created by HbE mutation. We tested this approach and identified the most responsive element for mediating splicing correction in engineered U7 snRNAs in HeLa-β E cell model cell line. Remarkably, the U7 snRNA lentiviral vector (U7 βE4+1) targeted to this region effectively restored the correctly-spliced β E -globin mRNA for at least 5 months. Moreover, the effects of the U7 βE4+1 snRNA lentiviral vector were also evident as upregulation of the correctly-spliced β E -globin mRNA in erythroid progenitor cells from β-thalassemia/HbE patients treated with the vector, which led to improvements of pathologies in erythroid progenitor cells from thalassemia patients. These results suggest that the splicing correction of β E -globin pre-mRNA by the engineered U7 snRNA lentiviral vector provides a promising, long-term treatment for β-thalassemia/HbE. Copyright © 2018 Elsevier Inc. All rights reserved.

Optimization of hCFTR Lung Expression in Mice Using DNA Nanoparticles

PubMed Central

Padegimas, Linas; Kowalczyk, Tomasz H; Adams, Sam; Gedeon, Chris R; Oette, Sharon M; Dines, Karla; Hyatt, Susannah L; Sesenoglu-Laird, Ozge; Tyr, Olena; Moen, Robert C; Cooper, Mark J

2012-01-01

Efficient and prolonged human cystic fibrosis transmembrane conductance regulator (hCFTR) expression is a major goal for cystic fibrosis (CF) lung therapy. A hCFTR expression plasmid was optimized as a payload for compacted DNA nanoparticles formulated with polyethylene glycol (PEG)-substituted 30-mer lysine peptides. A codon-optimized and CpG-reduced hCFTR synthetic gene (CO-CFTR) was placed in a polyubiquitin C expression plasmid. Compared to hCFTR complementary DNA (cDNA), CO-CFTR produced a ninefold increased level of hCFTR protein in transfected HEK293 cells and, when compacted as DNA nanoparticles, produced a similar improvement in lung mRNA expression in Balb/c and fatty acid binding protein promoter (FABP) CF mice, although expression duration was transient. Various vector modifications were tested to extend duration of CO-CFTR expression. A novel prolonged expression (PE) element derived from the bovine growth hormone (BGH) gene 3′ flanking sequence produced prolonged expression of CO-CFTR mRNA at biologically relevant levels. A time course study in the mouse lung revealed that CO-CFTR mRNA did not change significantly, with CO-CFTR/mCFTR geometric mean ratios of 94% on day 2, 71% on day 14, 53% on day 30, and 14% on day 59. Prolonged CO-CFTR expression is dependent on the orientation of the PE element and its transcription, is not specific to the UbC promoter, and is less dependent on other vector backbone elements. PMID:21952168

Cloning, Expression Analysis and Enzyme Activity Assays of the α-Carbonic Anhydrase Gene from Chlamydomonas sp. ICE-L.

PubMed

Qu, Changfeng; He, Yingying; Zheng, Zhou; An, Meiling; Li, Lulu; Wang, Xixi; He, Xiaodong; Wang, Yibin; Liu, Fangming; Miao, Jinlai

2018-01-01

The α-carbonic anhydrase (α-CA) is a zinc ion-containing enzyme that catalyzes the hydration of carbon dioxide. In this paper, a full-length α-CA gene was cloned from Chlamydomonas sp. ICE-L using RT-PCR and RACE-PCR for bioinformatic analysis. The α-CA open reading frame obtained by PCR was cloned into a vector and transformed into Escherichia coli to generate α-CA-producing bacteria. The α-CA was highly expressed upon induction with isopropyl-β-d-thiogalactoside (IPTG) at a final concentration of 0.8 mM. A single band with a molecular weight of approximate 40 kDa expressed in the recombinant E. coli strain harboring the α-CA vector was observed in SDS-PAGE analysis. The carbon dioxide hydration activity and esterase activity of α-CA expressed by the recombinant strain were 0.404 U/mg and 0.319 U, respectively. In addition, three conditions, temperature, salinity and UVB radiation exposure, were selected to analyze α-CA transcription levels by qRT-PCR. The results suggested UVB exposure increased the expression of relative mRNA; meanwhile, the α-CA mRNA expression was rapidly induced by temperature and salinity stress, indicating that Chlamydomonas sp. ICE-L might modulate the α-CA mRNA expression to adapt to the extreme environments.

A dual host vector for Fab phage display and expression of native IgG in mammalian cells.

PubMed

Tesar, Devin; Hötzel, Isidro

2013-10-01

A significant bottleneck in antibody discovery by phage display is the transfer of immunoglobulin variable regions from phage clones to vectors that express immunoglobulin G (IgG) in mammalian cells for screening. Here, we describe a novel phagemid vector for Fab phage display that allows expression of native IgG in mammalian cells without sub-cloning. The vector uses an optimized mammalian signal sequence that drives robust expression of Fab fragments fused to an M13 phage coat protein in Escherichia coli and IgG expression in mammalian cells. To allow the expression of Fab fragments fused to a phage coat protein in E.coli and full-length IgG in mammalian cells from the same vector without sub-cloning, the sequence encoding the phage coat protein was embedded in an optimized synthetic intron within the immunoglobulin heavy chain gene. This intron is removed from transcripts in mammalian cells by RNA splicing. Using this vector, we constructed a synthetic Fab phage display library with diversity in the heavy chain only and selected for clones binding different antigens. Co-transfection of mammalian cells with DNA from individual phage clones and a plasmid expressing the invariant light chain resulted in the expression of native IgG that was used to assay affinity, ligand blocking activity and specificity.

A universal reference sample derived from clone vector for improved detection of differential gene expression

PubMed Central

Khan, Rishi L; Gonye, Gregory E; Gao, Guang; Schwaber, James S

2006-01-01

Background Using microarrays by co-hybridizing two samples labeled with different dyes enables differential gene expression measurements and comparisons across slides while controlling for within-slide variability. Typically one dye produces weaker signal intensities than the other often causing signals to be undetectable. In addition, undetectable spots represent a large problem for two-color microarray designs and most arrays contain at least 40% undetectable spots even when labeled with reference samples such as Stratagene's Universal Reference RNAs™. Results We introduce a novel universal reference sample that produces strong signal for all spots on the array, increasing the average fraction of detectable spots to 97%. Maximizing detectable spots on the reference image channel also decreases the variability of microarray data allowing for reliable detection of smaller differential gene expression changes. The reference sample is derived from sequence contained in the parental EST clone vector pT7T3D-Pac and is called vector RNA (vRNA). We show that vRNA can also be used for quality control of microarray printing and PCR product quality, detection of hybridization anomalies, and simplification of spot finding and segmentation tasks. This reference sample can be made inexpensively in large quantities as a renewable resource that is consistent across experiments. Conclusion Results of this study show that vRNA provides a useful universal reference that yields high signal for almost all spots on a microarray, reduces variation and allows for comparisons between experiments and laboratories. Further, it can be used for quality control of microarray printing and PCR product quality, detection of hybridization anomalies, and simplification of spot finding and segmentation tasks. This type of reference allows for detection of small changes in differential expression while reference designs in general allow for large-scale multivariate experimental designs. vRNA in combination with reference designs enable systems biology microarray experiments of small physiologically relevant changes. PMID:16677381

Adenovirus vector infection of non-small-cell lung cancer cells is a trigger for multi-drug resistance mediated by P-glycoprotein.

PubMed

Tomono, Takumi; Kajita, Masahiro; Yano, Kentaro; Ogihara, Takuo

2016-08-05

P-glycoprotein (P-gp) is an ATP-binding cassette protein involved in cancer multi-drug resistance (MDR). It has been reported that infection with some bacteria and viruses induces changes in the activities of various drug-metabolizing enzymes and transporters, including P-gp. Although human adenoviruses (Ad) cause the common cold, the effect of Ad infection on MDR in cancer has not been established. In this study, we investigated whether Ad infection is a cause of MDR in A549, H441 and HCC827 non-small-cell lung cancer (NSCLC) cell lines, using an Ad vector system. We found that Ad vector infection of NSCLC cell lines induced P-gp mRNA expression, and the extent of induction was dependent on the number of Ad vector virus particles and the infection time. Heat-treated Ad vector, which is not infectious, did not alter P-gp mRNA expression. Uptake experiments with doxorubicin (DOX), a P-gp substrate, revealed that DOX accumulation was significantly decreased in Ad vector-infected A549 cells. The decrease of DOX uptake was blocked by verapamil, a P-gp inhibitor. Our results indicated that Ad vector infection of NSCLC cells caused MDR mediated by P-gp overexpression. The Ad vector genome sequence is similar to that of human Ad, and therefore human Ad infection of lung cancer patients may lead to chemoresistance in the clinical environment. Copyright © 2016 Elsevier Inc. All rights reserved.

Long non-coding RNA MEG3 inhibits the proliferation and metastasis of oral squamous cell carcinoma by regulating the WNT/β-catenin signaling pathway.

PubMed

Liu, Zongxiang; Wu, Cui; Xie, Nina; Wang, Penglai

2017-10-01

This study aimed to investigate how long non-coding RNA (lncRNA) maternally expressed gene 3 (MEG3) inhibits the growth and metastasis of oral squamous cell carcinoma (OSCC) by regulating WNT/β-catenin signaling pathway in order to explore the antitumor effect of MEG3 and to provide a potential molecular target for the treatment of OSCC. The RT-qPCR technique was used to quantitatively analyze the expression of MEG3 in cancer and adjacent tissues collected from the patients after surgery. Using the Lipofectamine method, the MEG3 overexpression vector and the siRNA interference vector were constructed and transfected into SCC15 and Cal27 cells, respectively, followed by cell proliferation, apoptosis and metastasis analyses. The semi-quantitative analysis of the expression of the β-catenin protein in transfected cells was performed by the western blot analysis, and the activity of the WNT/β-catenin signaling pathway was analyzed using the TOP/FOP flash reporters. In addition, the cells were treated with decitabine to investigate the correlation between the MEG3 expression and the DNA methylation. Results showed that the expression level of MEG3 was significantly decreased in OSCC (p<0.05) and overexpression of MEG3 inhibited the proliferation and metastasis of cancer cells and promoted apoptosis. Importantly, MEG3 played a role as a tumor suppressor by inhibiting the WNT/β-catenin signaling pathway. In addition, the expression of the MEG3 was significantly affected by the degree of DNA methylation. It was concluded that the lncRNA MEG3 can inhibit the growth and metastasis of OSCC by negatively regulating the WNT/β-catenin signaling pathway.

Kaposi's Sarcoma-Associated Herpesvirus MicroRNA Single-Nucleotide Polymorphisms Identified in Clinical Samples Can Affect MicroRNA Processing, Level of Expression, and Silencing Activity

PubMed Central

Han, Soo-Jin; Marshall, Vickie; Barsov, Eugene; Quiñones, Octavio; Ray, Alex; Labo, Nazzarena; Trivett, Matthew; Ott, David; Renne, Rolf

2013-01-01

Kaposi's sarcoma-associated herpesvirus (KSHV) encodes 12 pre-microRNAs that can produce 25 KSHV mature microRNAs. We previously reported single-nucleotide polymorphisms (SNPs) in KSHV-encoded pre-microRNA and mature microRNA sequences from clinical samples (V. Marshall et al., J. Infect. Dis., 195:645–659, 2007). To determine whether microRNA SNPs affect pre-microRNA processing and, ultimately, mature microRNA expression levels, we performed a detailed comparative analysis of (i) mature microRNA expression levels, (ii) in vitro Drosha/Dicer processing, and (iii) RNA-induced silencing complex-dependent targeting of wild-type (wt) and variant microRNA genes. Expression of pairs of wt and variant pre-microRNAs from retroviral vectors and measurement of KSHV mature microRNA expression by real-time reverse transcription-PCR (RT-PCR) revealed differential expression levels that correlated with the presence of specific sequence polymorphisms. Measurement of KSHV mature microRNA expression in a panel of primary effusion lymphoma cell lines by real-time RT-PCR recapitulated some observed expression differences but suggested a more complex relationship between sequence differences and expression of mature microRNA. Furthermore, in vitro maturation assays demonstrated significant SNP-associated changes in Drosha/DGCR8 and/or Dicer processing. These data demonstrate that SNPs within KSHV-encoded pre-microRNAs are associated with differential microRNA expression levels. Given the multiple reports on the involvement of microRNAs in cancer, the biological significance of these phenotypic and genotypic variants merits further studies in patients with KSHV-associated malignancies. PMID:24006441

RNA interference of pax2 inhibits growth of transplanted human endometrial cancer cells in nude mice

PubMed Central

Zhang, Li-Ping; Shi, Xiao-Yan; Zhao, Chang-Yin; Liu, Yong-Zhen; Cheng, Ping

2011-01-01

The development of human endometrial carcinoma (HEC) is a complex pathologic process involves several oncogenes and tumor suppressor genes. The full-length paired-box gene 2 (pax2), a recently discovered Oncogene, promotes cell proliferation and growth and inhibits apoptosis of HEC cells. Here, we examined the effect of pax2 small interfering RNA (siRNA) on the growth of transplanted HEC cells in nude mice. The expression of Pax2 in 21 cases of normal endometrium and 38 cases of HEC was examined by immohistochemistry (IHC). HEC models were developed by subcutaneously transferring HEC cells into nude mice, followed by treatment with empty lentivirus vector, lentivirus vector-based pax2 siRNA, and phosphate buffered saline, respectively. Four weeks later, tumor size was measured, tumor inhibition rate was calculated, and histological analyses were conducted after staining with hematoxylin and eosin. The expression of Pax2 and Bcl-2 was detected by Western blot; proliferating cell nuclear antigen (PCNA) was detected by IHC. Significant differences were observed in the positive rate of Pax2 between normal endometrium and HEC (14.2% vs. 60.5%, P < 0.01). The expression index of Pax2 in well differentiated tumors was 1.88 ± 1.68, much lower than that in tumors of moderate (3.07 ± 1.96, P < 0.05) or poor differentiation (5.45 ± 2.76, P < 0.01). Tumor necrosis increased, nuclear basophilia stain decreased, tumor growth was inhibited, and PCNA, Pax2, and Bcl-2 expression was reduced in HEC models treated with pax2 siRNA. These results indicate that Pax2 expression is related to HEC tumor biology with the increased expression of Pax2 correlated to malignancy. pax2 siRNA down-regulates Pax2 expression and inhibits tumorigenesis of HEC in nude mice, possibly due to cell apoptosis and the inhibition of tumor proliferation induced by down-regulation of Bcl-2. PMID:21627862

RNA replicons - a new approach for influenza virus immunoprophylaxis.

PubMed

Zimmer, Gert

2010-02-01

RNA replicons are derived from either positive- or negative-strand RNA viruses. They represent disabled virus vectors that are not only avirulent, but also unable to revert to virulence. Due to autonomous RNA replication, RNA replicons are able to drive high level, cytosolic expression of recombinant antigens stimulating both the humoral and the cellular branch of the immune system. This review provides an update on the available literature covering influenza virus vaccines based on RNA replicons. The pros and cons of these vaccine strategies will be discussed and future perspectives disclosed.

Phenotypic Screening for Friedreich Ataxia Using Random shRNA Selection.

PubMed

Cotticelli, M Grazia; Acquaviva, Fabio; Xia, Shujuan; Kaur, Avinash; Wang, Yongping; Wilson, Robert B

2015-10-01

Friedreich ataxia (FRDA) is an autosomal recessive neuro- and cardio-degenerative disorder for which there are no proven effective treatments. FRDA is caused by decreased expression and/or function of the protein frataxin. Frataxin chaperones iron in the mitochondrial matrix and regulates the iron-sulfur cluster (ISC) assembly complex. ISCs are prosthetic groups critical for the function of the Krebs cycle and the mitochondrial electron transport chain. Decreased expression of frataxin is associated with decreased ISC assembly, mitochondrial iron accumulation, and increased oxidative stress, all of which contribute to mitochondrial dysfunction. In media with beta-hydroxybutyrate (BHB) as carbon source, primary FRDA fibroblasts grow poorly and/or lose viability over several days. We screened a random, short-hairpin-RNA (shRNA)-expressing library in primary FRDA fibroblasts and identified two shRNAs that reverse the growth/viability defect in BHB media. One of these two clones increases frataxin expression in primary FRDA fibroblasts, either as a vector-expressed shRNA or as a transfected short-interfering RNA (siRNA). © 2015 Society for Laboratory Automation and Screening.

The tunable pReX expression vector enables optimizing the T7-based production of membrane and secretory proteins in E. coli.

PubMed

Kuipers, Grietje; Karyolaimos, Alexandros; Zhang, Zhe; Ismail, Nurzian; Trinco, Gianluca; Vikström, David; Slotboom, Dirk Jan; de Gier, Jan-Willem

2017-12-16

To optimize the production of membrane and secretory proteins in Escherichia coli, it is critical to harmonize the expression rates of the genes encoding these proteins with the capacity of their biogenesis machineries. Therefore, we engineered the Lemo21(DE3) strain, which is derived from the T7 RNA polymerase-based BL21(DE3) protein production strain. In Lemo21(DE3), the T7 RNA polymerase activity can be modulated by the controlled co-production of its natural inhibitor T7 lysozyme. This setup enables to precisely tune target gene expression rates in Lemo21(DE3). The t7lys gene is expressed from the pLemo plasmid using the titratable rhamnose promoter. A disadvantage of the Lemo21(DE3) setup is that the system is based on two plasmids, a T7 expression vector and pLemo. The aim of this study was to simplify the Lemo21(DE3) setup by incorporating the key elements of pLemo in a standard T7-based expression vector. By incorporating the gene encoding the T7 lysozyme under control of the rhamnose promoter in a standard T7-based expression vector, pReX was created (ReX stands for Regulated gene eXpression). For two model membrane proteins and a model secretory protein we show that the optimized production yields obtained with the pReX expression vector in BL21(DE3) are similar to the ones obtained with Lemo21(DE3) using a standard T7 expression vector. For another secretory protein, a c-type cytochrome, we show that pReX, in contrast to Lemo21(DE3), enables the use of a helper plasmid that is required for the maturation and hence the production of this heme c protein. Here, we created pReX, a T7-based expression vector that contains the gene encoding the T7 lysozyme under control of the rhamnose promoter. pReX enables regulated T7-based target gene expression using only one plasmid. We show that with pReX the production of membrane and secretory proteins can be readily optimized. Importantly, pReX facilitates the use of helper plasmids. Furthermore, the use of pReX is not restricted to BL21(DE3), but it can in principle be used in any T7 RNAP-based strain. Thus, pReX is a versatile alternative to Lemo21(DE3).

Development of a GFP expression vector for Cucurbit chlorotic yellows virus.

PubMed

Wei, Ying; Han, Xiaoyu; Wang, Zhenyue; Gu, Qinsheng; Li, Honglian; Chen, Linlin; Sun, Bingjian; Shi, Yan

2018-05-24

Cucurbit chlorotic yellows virus (CCYV), a bipartite crinivirus, causes chlorotic leaf spots and yellowing symptoms on cucurbit leaves. We previously developed an infectious clone of CCYV. Limited work has been conducted on the construction of a crinivirus green fluorescence protein (GFP) expression vector to date. We constructed a CCYV GFP expression vector using the "add a gene" strategy based on CCYV RNA2 cDNA constrcut. Three resultant clones, pCCYVGFP SGC , pCCYVGFP CGC , and pCCYVGFP CGS, were constructed with different promoters used to initiate GFP and CP expression. At 25 dpi GFP fluorescence was detectable not only in leaf veins but also in the surrounding cells. pCCYVGFP CGC -infected cucumber leaves exhibited cell spread at 25 dpi, whereas pCCYVGFP SGC and pCCYVGFP CGS were mainly found in single cells. Further observation of pCCYVGFP CGC GFP expression at 30 dpi, 40 dpi, and 50 dpi showed phloem-limited localization in the systemic leaves. We developed of a CCYV GFP expression vector that will be useful for further study of CCYV movement in cucurbits.

Effects of AAV-mediated knockdown of nNOS and GPx-1 gene expression in rat hippocampus after traumatic brain injury.

PubMed

Boone, Deborah R; Leek, Jeanna M; Falduto, Michael T; Torres, Karen E O; Sell, Stacy L; Parsley, Margaret A; Cowart, Jeremy C; Uchida, Tatsuo; Micci, Maria-Adelaide; DeWitt, Douglas S; Prough, Donald S; Hellmich, Helen L

2017-01-01

Virally mediated RNA interference (RNAi) to knock down injury-induced genes could improve functional outcome after traumatic brain injury (TBI); however, little is known about the consequences of gene knockdown on downstream cell signaling pathways and how RNAi influences neurodegeneration and behavior. Here, we assessed the effects of adeno-associated virus (AAV) siRNA vectors that target two genes with opposing roles in TBI pathogenesis: the allegedly detrimental neuronal nitric oxide synthase (nNOS) and the potentially protective glutathione peroxidase 1 (GPx-1). In rat hippocampal progenitor cells, three siRNAs that target different regions of each gene (nNOS, GPx-1) effectively knocked down gene expression. However, in vivo, in our rat model of fluid percussion brain injury, the consequences of AAV-siRNA were variable. One nNOS siRNA vector significantly reduced the number of degenerating hippocampal neurons and showed a tendency to improve working memory. GPx-1 siRNA treatment did not alter TBI-induced neurodegeneration or working memory deficits. Nevertheless, microarray analysis of laser captured, virus-infected neurons showed that knockdown of nNOS or GPx-1 was specific and had broad effects on downstream genes. Since nNOS knockdown only modestly ameliorated TBI-induced working memory deficits, despite widespread genomic changes, manipulating expression levels of single genes may not be sufficient to alter functional outcome after TBI.

On Relevance of Codon Usage to Expression of Synthetic and Natural Genes in Escherichia coli

PubMed Central

Supek, Fran; Šmuc, Tomislav

2010-01-01

A recent investigation concluded that codon bias did not affect expression of green fluorescent protein (GFP) variants in Escherichia coli, while stability of an mRNA secondary structure near the 5′ end played a dominant role. We demonstrate that combining the two variables using regression trees or support vector regression yields a biologically plausible model with better support in the GFP data set and in other experimental data: codon usage is relevant for protein levels if the 5′ mRNA structures are not strong. Natural E. coli genes had weaker 5′ mRNA structures than the examined set of GFP variants and did not exhibit a correlation between the folding free energy of 5′ mRNA structures and protein expression. PMID:20421604

Reduction of voltage gated sodium channel protein in DRG by vector mediated miRNA reduces pain in rats with painful diabetic neuropathy.

PubMed

Chattopadhyay, Munmun; Zhou, Zhigang; Hao, Shuanglin; Mata, Marina; Fink, David J

2012-03-22

Painful neuropathy is a common complication of diabetes. Previous studies have identified significant increases in the amount of voltage gated sodium channel isoforms Na(V)1.7 and Na(V)1.3 protein in the dorsal root ganglia (DRG) of rats with streptozotocin (STZ)-induced diabetes. We found that gene transfer-mediated release of the inhibitory neurotransmitters enkephalin or gamma amino butyric acid (GABA) from DRG neurons in diabetic animals reduced pain-related behaviors coincident with a reduction in Na(V)1.7 protein levels in DRG in vivo. To further evaluate the role of Na(V)α subunit levels in DRG in the pathogenesis of pain in diabetic neuropathy, we constructed a non-replicating herpes simplex virus (HSV)-based vector expressing a microRNA (miRNA) against Na(V)α subunits. Subcutaneous inoculation of the miRNA-expressing HSV vector into the feet of diabetic rats to transduce DRG resulted in a reduction in Na(V)α subunit levels in DRG neurons, coincident with a reduction in cold allodynia, thermal hyperalgesia and mechanical hyperalgesia. These data support the role of increased Na(V)α protein in DRG in the pathogenesis of pain in diabetic neuropathy, and provide a proof-of-principle demonstration for the development of a novel therapy that could be used to treat intractable pain in patients with diabetic neuropathy.

Decreased hepatocyte membrane potential differences and GABAA-beta3 expression in human hepatocellular carcinoma.

PubMed

Minuk, Gerald Y; Zhang, Manna; Gong, Yuewen; Minuk, Leonard; Dienes, Hans; Pettigrew, Norman; Kew, Michael; Lipschitz, Jeremy; Sun, Dongfeng

2007-03-01

To determine whether hepatocyte membrane potential differences (PDs) are depolarized in human HCC and whether depolarization is associated with changes in GABAA receptor expression, hepatocyte PDs and gamma-aminobutyric acid (GABA)A receptor messenger RNA (mRNA) and protein expression were documented in HCC tissues via microelectrode impalement, real-time reverse-transcriptase polymerase chain reaction, and Western blot analysis, respectively. HCC tissues were significantly depolarized (-19.8+/-1.3 versus -25.9+/-3.2 mV, respectively [P<0.05]), and GABAA-beta3 expression was down-regulated (GABAA-beta3 mRNA and protein expression in HCC; 5,693+/-1,385 and 0.29+/-0.11 versus 11,046+/-4,979 copies/100 mg RNA and 0.62+/-0.16 optical density in adjacent tumor tissues, respectively [P=0.002 and P<0.0001, respectively]) when compared with adjacent nontumor tissues. To determine the physiological relevance of the down-regulation, human malignant hepatocytes deficient in GABAA-beta3 receptor expression (Huh-7 cells) were transfected with GABAA-beta3 complementary DNA (cDNA) or vector alone and injected into nu/nu nude mice (n=16-17 group). Tumors developed after a mean (+/-SD) of 51+/-6 days (range: 41-60 days) in 7/16 (44%) mice injected with vector-transfected cells and 70+/-12 days (range: 59-86 days) in 4/17 (24%) mice injected with GABAA-beta3 cDNA-transfected cells (P<0.005). The results of this study indicate that (1) human HCC tissues are depolarized compared with adjacent nontumor tissues, (2) hepatic GABAA-beta3 receptor expression is down-regulated in human HCC, and (3) restoration of GABAA-beta3 receptor expression results in attenuated in vivo tumor growth in nude mice.

miR-Sens--a retroviral dual-luciferase reporter to detect microRNA activity in primary cells.

PubMed

Beillard, Emmanuel; Ong, Siau Chi; Giannakakis, Antonis; Guccione, Ernesto; Vardy, Leah A; Voorhoeve, P Mathijs

2012-05-01

MicroRNA-mRNA interactions are commonly validated and deconstructed in cell lines transfected with luciferase reporters. However, due to cell type-specific variations in microRNA or RNA-binding protein abundance, such assays may not reliably reflect microRNA activity in other cell types that are less easily transfected. In order to measure miRNA activity in primary cells, we constructed miR-Sens, a MSCV-based retroviral vector that encodes both a Renilla luciferase reporter gene controlled by microRNA binding sites in its 3' UTR and a Firefly luciferase normalization gene. miR-Sens sensors can be efficiently transduced in primary cells such as human fibroblasts and mammary epithelial cells, and allow the detection of overexpressed and, more importantly, endogenous microRNAs. Notably, we find that the relative luciferase activity is correlated to the miRNA expression, allowing quantitative measurement of microRNA activity. We have subsequently validated the miR-Sens 3' UTR vectors with known human miRNA-372, miRNA-373, and miRNA-31 targets (LATS2 and TXNIP). Overall, we observe that miR-Sens-based assays are highly reproducible, allowing detection of the independent contribution of multiple microRNAs to 3' UTR-mediated translational control of LATS2. In conclusion, miR-Sens is a new tool for the efficient study of microRNA activity in primary cells or panels of cell lines. This vector will not only be useful for studies on microRNA biology, but also more broadly on other factors influencing the translation of mRNAs.

Examination of the genetic basis for sexual dimorphism in the Aedes aegypti (dengue vector mosquito) pupal brain

PubMed Central

2014-01-01

Background Most animal species exhibit sexually dimorphic behaviors, many of which are linked to reproduction. A number of these behaviors, including blood feeding in female mosquitoes, contribute to the global spread of vector-borne illnesses. However, knowledge concerning the genetic basis of sexually dimorphic traits is limited in any organism, including mosquitoes, especially with respect to differences in the developing nervous system. Methods Custom microarrays were used to examine global differences in female vs. male gene expression in the developing pupal head of the dengue vector mosquito, Aedes aegypti. The spatial expression patterns of a subset of differentially expressed transcripts were examined in the developing female vs. male pupal brain through in situ hybridization experiments. Small interfering RNA (siRNA)-mediated knockdown studies were used to assess the putative role of Doublesex, a terminal component of the sex determination pathway, in the regulation of sex-specific gene expression observed in the developing pupal brain. Results Transcripts (2,527), many of which were linked to proteolysis, the proteasome, metabolism, catabolic, and biosynthetic processes, ion transport, cell growth, and proliferation, were found to be differentially expressed in A. aegypti female vs. male pupal heads. Analysis of the spatial expression patterns for a subset of dimorphically expressed genes in the pupal brain validated the data set and also facilitated the identification of brain regions with dimorphic gene expression. In many cases, dimorphic gene expression localized to the optic lobe. Sex-specific differences in gene expression were also detected in the antennal lobe and mushroom body. siRNA-mediated gene targeting experiments demonstrated that Doublesex, a transcription factor with consensus binding sites located adjacent to many dimorphically expressed transcripts that function in neural development, is required for regulation of sex-specific gene expression in the developing A. aegypti brain. Conclusions These studies revealed sex-specific gene expression profiles in the developing A. aegypti pupal head and identified Doublesex as a key regulator of sexually dimorphic gene expression during mosquito neural development. PMID:25729562

Permanent, lowered HLA class I expression using lentivirus vectors with shRNA constructs: Averting cytotoxicity by alloreactive T lymphocytes.

PubMed

Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C

2006-12-01

Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.

Inhibition of hepatitis B virus replication via HBV DNA cleavage by Cas9 from Staphylococcus aureus.

PubMed

Liu, Yu; Zhao, Miaoxian; Gong, Mingxing; Xu, Ying; Xie, Cantao; Deng, Haohui; Li, Xueying; Wu, Hongkai; Wang, Zhanhui

2018-04-01

Chronic hepatitis B virus (HBV) infection is difficult to cure due to the presence of covalently closed circular DNA (cccDNA). Accumulating evidence indicates that the CRISPR/Cas9 system effectively disrupts HBV genome, including cccDNA, in vitro and in vivo. However, efficient delivery of CRISPR/Cas9 system to the liver or hepatocytes using an adeno-associated virus (AAV) vector remains challenging due to the large size of Cas9 from Streptococcus pyogenes (Sp). The recently identified Cas9 protein from Staphylococcus aureus (Sa) is smaller than SpCas9 and thus is able to be packaged into the AAV vector. To examine the efficacy of SaCas9 system on HBV genome destruction, we designed 5 guide RNAs (gRNAs) that targeted different HBV genotypes, 3 of which were shown to be effective. The SaCas9 system significantly reduced HBV antigen expression, as well as pgRNA and cccDNA levels, in Huh7, HepG2.2.15 and HepAD38 cells. The dual expression of gRNAs/SaCas9 in these cell lines resulted in more efficient HBV genome cleavage. In the mouse model, hydrodynamic injection of gRNA/SaCas9 plasmids resulted in significantly lower levels of HBV protein expression. We also delivered the SaCas9 system into mice with persistent HBV replication using an AAV vector. Both the AAV vector and the mRNA of Cas9 could be detected in the C3H mouse liver cells. Decreased hepatitis B surface antigen (HBsAg), HBV DNA and pgRNA levels were observed when a higher titer of AAV was injected, although this decrease was not significantly different from the control. In summary, the SaCas9 system accurately and efficiently targeted the HBV genome and inhibited HBV replication both in vitro and in vivo. The system was delivered by an AAV vector and maybe used as a novel therapeutic strategy against chronic HBV infection. Copyright © 2018 Elsevier B.V. All rights reserved.

Efficient delivery of connective tissue growth factor shRNA using PAMAM nanoparticles.

PubMed

Huang, Z J; Yi, B; Yuan, H; Yang, G P

2014-08-28

The aim of this study was to detect the anti-fibrosis activity of connective tissue growth factor (CTGF) small hairpin RNA (shRNA) mediated by polyamidoamine dendrimer nanoparticles in rat myocardial cell lines and myocardium. CTGF shRNAs were constructed from inverted oligonucleotides and a polyamidoamine nanoparticle vector was used to transfer shRNA into H9c2 myocardial cells and spontaneously hypertensive rats. The expression of CTGF, transforming growth factor-b1, and laminin were measured by semi-quantitative reverse transcription-polymerase chain reaction, Western blotting, and immunohistochemistry. pCTGF-shRNA significantly reduced CTGF upregulation induced by angiotensin II in H9c2 myocardial cells. The mRNA and protein expression of CTGF and laminin in pCTGF-shRNA-transferred spontaneously hypertensive rats decreased significantly compared to the control group and pHK-shRNA group (P < 0.05). The expression of transforming growth factor-b1 showed no significant difference among the 3 groups (P > 0.05). pCTGF-shRNA mediated by polyamidoamine can be used to successfully reduce myocardial CTGF and laminin expression, suggesting that this system can be used to improve myocardial fibrosis therapy.

Sequencing and Validation of Reference Genes to Analyze Endogenous Gene Expression and Quantify Yellow Dwarf Viruses Using RT-qPCR in Viruliferous Rhopalosiphum padi

PubMed Central

Wu, Keke; Liu, Wenwen; Mar, Thithi; Liu, Yan; Wu, Yunfeng; Wang, Xifeng

2014-01-01

The bird cherry-oat aphid (Rhopalosiphum padi), an important pest of cereal crops, not only directly sucks sap from plants, but also transmits a number of plant viruses, collectively the yellow dwarf viruses (YDVs). For quantifying changes in gene expression in vector aphids, reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is a touchstone method, but the selection and validation of housekeeping genes (HKGs) as reference genes to normalize the expression level of endogenous genes of the vector and for exogenous genes of the virus in the aphids is critical to obtaining valid results. Such an assessment has not been done, however, for R. padi and YDVs. Here, we tested three algorithms (GeNorm, NormFinder and BestKeeper) to assess the suitability of candidate reference genes (EF-1α, ACT1, GAPDH, 18S rRNA) in 6 combinations of YDV and vector aphid morph. EF-1α and ACT1 together or in combination with GAPDH or with GAPDH and 18S rRNA could confidently be used to normalize virus titre and expression levels of endogenous genes in winged or wingless R. padi infected with Barley yellow dwarf virus isolates (BYDV)-PAV and BYDV-GAV. The use of only one reference gene, whether the most stably expressed (EF-1α) or the least stably expressed (18S rRNA), was not adequate for obtaining valid relative expression data from the RT-qPCR. Because of discrepancies among values for changes in relative expression obtained using 3 regions of the same gene, different regions of an endogenous aphid gene, including each terminus and the middle, should be analyzed at the same time with RT-qPCR. Our results highlight the necessity of choosing the best reference genes to obtain valid experimental data and provide several HKGs for relative quantification of virus titre in YDV-viruliferous aphids. PMID:24810421

Small Interfering RNA Pathway Modulates Initial Viral Infection in Midgut Epithelium of Insect after Ingestion of Virus.

PubMed

Lan, Hanhong; Chen, Hongyan; Liu, Yuyan; Jiang, Chaoyang; Mao, Qianzhuo; Jia, Dongsheng; Chen, Qian; Wei, Taiyun

2016-01-15

Numerous viruses are transmitted in a persistent manner by insect vectors. Persistent viruses establish their initial infection in the midgut epithelium, from where they disseminate to the midgut visceral muscles. Although propagation of viruses in insect vectors can be controlled by the small interfering RNA (siRNA) antiviral pathway, whether the siRNA pathway can control viral dissemination from the midgut epithelium is unknown. Infection by a rice virus (Southern rice black streaked dwarf virus [SRBSDV]) of its incompetent vector (the small brown planthopper [SBPH]) is restricted to the midgut epithelium. Here, we show that the siRNA pathway is triggered by SRBSDV infection in continuously cultured cells derived from the SBPH and in the midgut of the intact insect. Knockdown of the expression of the core component Dicer-2 of the siRNA pathway by RNA interference strongly increased the ability of SRBSDV to propagate in continuously cultured SBPH cells and in the midgut epithelium, allowing viral titers in the midgut epithelium to reach the threshold (1.99 × 10(9) copies of the SRBSDV P10 gene/μg of midgut RNA) needed for viral dissemination into the SBPH midgut muscles. Our results thus represent the first elucidation of the threshold for viral dissemination from the insect midgut epithelium. Silencing of Dicer-2 further facilitated the transmission of SRBSDV into rice plants by SBPHs. Taken together, our results reveal the new finding that the siRNA pathway can control the initial infection of the insect midgut epithelium by a virus, which finally affects the competence of the virus's vector. Many viral pathogens that cause significant global health and agricultural problems are transmitted via insect vectors. The first bottleneck in viral infection, the midgut epithelium, is a principal determinant of the ability of an insect species to transmit a virus. Southern rice black streaked dwarf virus (SRBSDV) is restricted exclusively to the midgut epithelium of an incompetent vector, the small brown planthopper (SBPH). Here, we show that silencing of the core component Dicer-2 of the small interfering RNA (siRNA) pathway increases viral titers in the midgut epithelium past the threshold (1.99 × 10(9) copies of the SRBSDV P10 gene/μg of midgut RNA) for viral dissemination into the midgut muscles and then into the salivary glands, allowing the SBPH to become a competent vector of SRBSDV. This result is the first evidence that the siRNA antiviral pathway has a direct role in the control of viral dissemination from the midgut epithelium and that it affects the competence of the virus's vector. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Small Interfering RNA Pathway Modulates Initial Viral Infection in Midgut Epithelium of Insect after Ingestion of Virus

PubMed Central

Lan, Hanhong; Chen, Hongyan; Liu, Yuyan; Jiang, Chaoyang; Mao, Qianzhuo; Jia, Dongsheng; Chen, Qian

2015-01-01

ABSTRACT Numerous viruses are transmitted in a persistent manner by insect vectors. Persistent viruses establish their initial infection in the midgut epithelium, from where they disseminate to the midgut visceral muscles. Although propagation of viruses in insect vectors can be controlled by the small interfering RNA (siRNA) antiviral pathway, whether the siRNA pathway can control viral dissemination from the midgut epithelium is unknown. Infection by a rice virus (Southern rice black streaked dwarf virus [SRBSDV]) of its incompetent vector (the small brown planthopper [SBPH]) is restricted to the midgut epithelium. Here, we show that the siRNA pathway is triggered by SRBSDV infection in continuously cultured cells derived from the SBPH and in the midgut of the intact insect. Knockdown of the expression of the core component Dicer-2 of the siRNA pathway by RNA interference strongly increased the ability of SRBSDV to propagate in continuously cultured SBPH cells and in the midgut epithelium, allowing viral titers in the midgut epithelium to reach the threshold (1.99 × 109 copies of the SRBSDV P10 gene/μg of midgut RNA) needed for viral dissemination into the SBPH midgut muscles. Our results thus represent the first elucidation of the threshold for viral dissemination from the insect midgut epithelium. Silencing of Dicer-2 further facilitated the transmission of SRBSDV into rice plants by SBPHs. Taken together, our results reveal the new finding that the siRNA pathway can control the initial infection of the insect midgut epithelium by a virus, which finally affects the competence of the virus's vector. IMPORTANCE Many viral pathogens that cause significant global health and agricultural problems are transmitted via insect vectors. The first bottleneck in viral infection, the midgut epithelium, is a principal determinant of the ability of an insect species to transmit a virus. Southern rice black streaked dwarf virus (SRBSDV) is restricted exclusively to the midgut epithelium of an incompetent vector, the small brown planthopper (SBPH). Here, we show that silencing of the core component Dicer-2 of the small interfering RNA (siRNA) pathway increases viral titers in the midgut epithelium past the threshold (1.99 × 109 copies of the SRBSDV P10 gene/μg of midgut RNA) for viral dissemination into the midgut muscles and then into the salivary glands, allowing the SBPH to become a competent vector of SRBSDV. This result is the first evidence that the siRNA antiviral pathway has a direct role in the control of viral dissemination from the midgut epithelium and that it affects the competence of the virus's vector. PMID:26537672

Integrative analysis of multi-omics data for identifying multi-markers for diagnosing pancreatic cancer

PubMed Central

2015-01-01

Background microRNA (miRNA) expression plays an influential role in cancer classification and malignancy, and miRNAs are feasible as alternative diagnostic markers for pancreatic cancer, a highly aggressive neoplasm with silent early symptoms, high metastatic potential, and resistance to conventional therapies. Methods In this study, we evaluated the benefits of multi-omics data analysis by integrating miRNA and mRNA expression data in pancreatic cancer. Using support vector machine (SVM) modelling and leave-one-out cross validation (LOOCV), we evaluated the diagnostic performance of single- or multi-markers based on miRNA and mRNA expression profiles from 104 PDAC tissues and 17 benign pancreatic tissues. For selecting even more reliable and robust markers, we performed validation by independent datasets from the Gene Expression Omnibus (GEO) and the Cancer Genome Atlas (TCGA) data depositories. For validation, miRNA activity was estimated by miRNA-target gene interaction and mRNA expression datasets in pancreatic cancer. Results Using a comprehensive identification approach, we successfully identified 705 multi-markers having powerful diagnostic performance for PDAC. In addition, these marker candidates annotated with cancer pathways using gene ontology analysis. Conclusions Our prediction models have strong potential for the diagnosis of pancreatic cancer. PMID:26328610

miR-Sens—a retroviral dual-luciferase reporter to detect microRNA activity in primary cells

PubMed Central

Beillard, Emmanuel; Ong, Siau Chi; Giannakakis, Antonis; Guccione, Ernesto; Vardy, Leah A.; Voorhoeve, P. Mathijs

2012-01-01

MicroRNA–mRNA interactions are commonly validated and deconstructed in cell lines transfected with luciferase reporters. However, due to cell type-specific variations in microRNA or RNA-binding protein abundance, such assays may not reliably reflect microRNA activity in other cell types that are less easily transfected. In order to measure miRNA activity in primary cells, we constructed miR-Sens, a MSCV-based retroviral vector that encodes both a Renilla luciferase reporter gene controlled by microRNA binding sites in its 3′ UTR and a Firefly luciferase normalization gene. miR-Sens sensors can be efficiently transduced in primary cells such as human fibroblasts and mammary epithelial cells, and allow the detection of overexpressed and, more importantly, endogenous microRNAs. Notably, we find that the relative luciferase activity is correlated to the miRNA expression, allowing quantitative measurement of microRNA activity. We have subsequently validated the miR-Sens 3′ UTR vectors with known human miRNA-372, miRNA-373, and miRNA-31 targets (LATS2 and TXNIP). Overall, we observe that miR-Sens-based assays are highly reproducible, allowing detection of the independent contribution of multiple microRNAs to 3′ UTR–mediated translational control of LATS2. In conclusion, miR-Sens is a new tool for the efficient study of microRNA activity in primary cells or panels of cell lines. This vector will not only be useful for studies on microRNA biology, but also more broadly on other factors influencing the translation of mRNAs. PMID:22417692

Rev-erb beta regulates the Srebp-1c promoter and mRNA expression in skeletal muscle cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ramakrishnan, Sathiya N.; Lau, Patrick; Crowther, Lisa M.

2009-10-30

The nuclear hormone receptor, Rev-erb beta operates as a transcriptional silencer. We previously demonstrated that exogenous expression of Rev-erb{beta}{Delta}E in skeletal muscle cells increased Srebp-1c mRNA expression. We validated these in vitro observations by injection of an expression vector driving Rev-erb{beta}{Delta}E expression into mouse tibialis muscle that resulted in increased Srebp-1c mRNA expression. Paradoxically, Rev-erb{beta} siRNA expression in skeletal muscle cells repressed Srebp-1c expression, and indicated that Rev-erb{beta} expression was necessary for Srebp-1c expression. ChIP analysis demonstrated that Rev-erb{beta} was recruited to the Srebp-1c promoter. Moreover, Rev-erb{beta} trans-activated the Srebp-1c promoter, in contrast, Rev-erb{beta} efficiently repressed the Rev-erb{alpha} promoter, amore » previously characterized target gene. Finally, treatment with the Rev-erb agonist (hemin) (i) increased the trans-activation of the Srebp-1c promoter by Rev-erb{beta}; and (ii) increased Rev-erb{beta} and Srebp-1c mRNA expression. These data suggest that Rev-erb{beta} has the potential to activate gene expression, and is a positive regulator of Srebp-1c, a regulator of lipogenesis.« less

Effect of transient receptor potential vanilloid 6 gene silencing on the expression of calcium transport genes in chicken osteoblasts.

PubMed

Zhang, Jie; Deng, Yifeng; Ma, Huijie; Hou, Jiafa; Zhou, ZhenLei

2015-03-01

Ca2+ plays a major role in the regulation of signal transduction. Transient receptor potential vanilloid 6 is a Ca2+-selective channel that serves as an important rate-limiting step in the facilitation of Ca2+ entry into cells, but little is known about the regulation of transient receptor potential vanilloid 6 in chickens. In this study, we evaluated the effects of transient receptor potential vanilloid 6 gene interference on the expression of calbindin-D28K, Na+/Ca2+ exchangers, and plasma membrane Ca2+ ATPase 1b to investigate the mechanism underlying the regulation of transient receptor potential vanilloid 6. Three hairpin siRNA expression vectors targeting transient receptor potential vanilloid 6 (pSIREN- transient receptor potential vanilloid 6) and a negative control (pSIREN-control) were constructed and transfected into chicken osteoblasts. The mRNA and protein expression levels were evaluated by quantitative reverse transcription polymerase chain reaction and Western blot, respectively. The mRNA expression levels of transient receptor potential vanilloid 6 and calbindin-D28K were reduced by 45.7% (P<0.01) and 27.9% (P<0.01), respectively, 48 h after transfection with one of the three constructs (pSIREN- transient receptor potential vanilloid 6-3) compared with the level obtained in the untreated group. There was no significant difference in the mRNA expression levels of Na+/Ca2+ exchangers and plasma membrane Ca2+ ATPase 1b. The protein expression levels of transient receptor potential vanilloid 6 and calbindin-D28K were reduced by 40.2% (P<0.01) and 29.8% (P<0.01), respectively, 48 h after transfection with pSIREN-transient receptor potential vanilloid 6-3 compared with the level obtained in the untreated group. In conclusion, the vector-based transient receptor potential vanilloid 6-shRNA can efficiently suppress the mRNA and protein expression of transient receptor potential vanilloid 6 in chicken osteoblasts, and transient receptor potential vanilloid 6 regulates the expression of calbindin-D28K during Ca2+ transport. © 2015 Poultry Science Association Inc.

[Zinc-dependent metalloprotease 1 promotes apoptosis of RAW264.7 macrophages].

PubMed

Li, Peng; He, Yonglin; Zhang, Jiming; Fang, Chencheng

2015-12-01

To construct the eukaryotic expression vector of zinc-dependent metalloprotease 1 (zmp1) gene from Bacillus Calmette-Guerin (BCG) and investigate its impact on the apoptosis of RAW264.7 macrophages. Zmp1 gene was amplified from the genome of BCG by PCR. The zmp1 gene fragment was inserted into multiple cloning sites of pEGFP-N1 to construct the eukaryotic expression vector pEGFP-N1-zmp1. The constructed pEGFP-N1-zmp1 was transfected into RAW264.7 cells by Lipofectamine(TM) 2000. The expression of green fluorescent protein (GFP) was observed by fluorescence microscopy. The zmp1 mRNA was detected by quantitative real-time PCR (qR-PCR). The effect of Zmp1 protein on the apoptosis of RAW264.7 macrophages was detected by flow cytometry (FCM). With zmp1 gene amplified by PCR, we successfully constructed the recombinant vector pEGFP-N1-zmp1 as demonstrated by restriction enzyme analysis and sequencing. GFP was seen in RAW264.7 cells 24 hours after transfected with the recombinant plasmid. As qRT-PCR showed, the expression level of zmp1 mRNA was up-regulated. The early apoptotic rate increased 48 hours after transfection. The increased expression of Zmp1 in RAW264.7 cells promotes the apoptosis of RAW264.7 cells.

Molecular interactions and immune responses between maize fine streak virus and the leafhopper vector G. nigrifrons through differential expression and RNA interference

USDA-ARS?s Scientific Manuscript database

Maize fine streak virus (MFSV) is an emerging virus of maize that is transmitted by an insect vector, the leafhopper called Graminella nigrifrons. Virus transmission by the leafhopper requires that the virus enter into and multiply in insect cells, tissues and organs before being transmitted to a ne...

Long Noncoding RNA (lncRNA) n379519 Promotes Cardiac Fibrosis in Post-Infarct Myocardium by Targeting miR-30.

PubMed

Wang, Xiaxia; Yong, Chunming; Yu, Kai; Yu, Renchao; Zhang, Rui; Yu, Lingfan; Li, Shan; Cai, Shanglang

2018-06-11

BACKGROUND Abnormally expressed long noncoding RNAs (lncRNAs) are recognized as one of the key causes of cardiac diseases. However, the role of lncRNA in cardiac fibrosis remains largely unknown. MATERIAL AND METHODS The experiment was divided into 4 groups: a sham operation group, a myocardial infarction (MI) group, a lentivirus group (LV-si-n379519), and a lentivirus control (LV-NC) group. The adenovirus expression vectors LV-si-n379519 and LV-NC were constructed and transfected into mice. Echocardiography, HE staining, and Masson staining were performed to detect the heart function and collagen volume fraction in each group. RT-PCR was used to detect the expression level of n379519, miR-30, collagen I, and collagen III. In vitro, cardiac fibroblasts (CFs) were cultured and the relationship between n379519 and miR-30 was verified using luciferase reporter vector, n379519 siRNA, and miR-30 inhibitor. RESULTS The expression of n379519 was markedly upregulated in the hearts of mice with MI and in the fibrotic CFs. Knockdown of endogenous n379519 by its siRNA improved the heart function and reduced collagen deposition and the process of cardiac fibrosis. Further experiments showed the opposite trend of expression between n379519 and miR-30. Bioinformatics analysis and luciferase reporter assay indicated that n379519 directly binds to miR-30. Moreover, miR-30 inhibitor abrogated the collagen synthesis inhibition induced by n379519. CONCLUSIONS These findings reveal a novel function of n379519-miR-30 axis as a negative regulator for the treatment of MI-induced cardiac fibrosis and the associated cardiac dysfunction.

CRISPR/Cas9-Mediated Deletion of C1EIS Inhibits Chicken Embryonic Stem Cell Differentiation Into Male Germ Cells (Gallus gallus).

PubMed

Zuo, Qisheng; Jin, Kai; Wang, Yingjie; Song, Jiuzhou; Zhang, Yani; Li, Bichun

2017-08-01

We previously found that C1EIS is preferentially expressed in Chicken spermatogonial stem cells (SSCs) by RNA sequencing (RNA-seq), so our current study focused on C1EIS's role in Chicken embryonic stem cells (ESCs) differentiation into male germ cells. We constructed a CRISPR/Cas9 vector targeting C1EIS. T7 endonuclease I (T7EI) digestion method and sequencing of TA cloning were used to detect the knock-out efficiency of the Single guide RNA (sgRNA) after the cas9/gRNA vector transfected into D fibroblasts 1(DF-1), ESCs, and Chicken embryos. The results showed that CRISPR/Cas9 gene knockout efficiency is about 40%. Differentiation of the targeted ESCs into SSCs was inhibited at the embryoid body stage due to C1EIS deficiency. Immunofluorescent staining revealed that the mutagenized ESCs (RA (Retinoic Acid) with C1EIS Knock out) expressed lower levels of integrin α6 and integrin β1 compared to wild type cells. Quantitative real-time PCR (QRT-PCR) revealed Oct4 and Sox2 expression significantly increased, contrarily integrin β1 and Stra8 expression significantly decreased than RA induced group and RA with C1EIS Overexpression. During retinoic acid-induced differentiation, knockout of C1EIS in ESCs inhibited formation of SSC-like cells, suggesting C1EIS plays a vital role in promoting differentiation of avian ESCs to SSCs by regulating expression of multiple pluripotency-related genes. J. Cell. Biochem. 118: 2380-2386, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Problem-Solving Test: Expression Cloning of the Erythropoietin Receptor

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2008-01-01

Terms to be familiar with before you start to solve the test: cytokines, cytokine receptors, cDNA library, cDNA synthesis, poly(A)[superscript +] RNA, primer, template, reverse transcriptase, restriction endonucleases, cohesive ends, expression vector, promoter, Shine-Dalgarno sequence, poly(A) signal, DNA helicase, DNA ligase, topoisomerases,…

MicroRNA Silencing Improves the Tumor Specificity of Adenoviral Transgene Expression

PubMed Central

Card, Paul B.; Hogg, Richard T.; del Alcazar, Carlos Gil

2012-01-01

Adenoviral technology has been thoroughly evaluated for delivering genetic material to tumor tissue and the surrounding microenvironment. Almost any gene can be cloned into an adenovirus (Ad) vector, which when combined with strong, constitutively active promoters permit up to a million-fold amplification of the transgene in a single adenoviral particle, thus facilitating their use in cancer therapy and imaging. However, widespread infection of the liver and other non-targeted tissues by Ad vectors is a substantial problem that often results in significant liver inflammation and hepatotoxicity at doses required to achieve efficient tumor transduction. miR-122 is a highly expressed liver-specific microRNA that provides a unique opportunity for down-regulating adenoviral transgene expression in liver tissue. The binding of endogenous miRNAs to complementary miRNA targeting elements (miRTs) incorporated into the 3′ untranslated region of adenoviral transgenes interferes with message stability and/or protein translation, and miRT elements against miR-122 (miRT-122) can selectively reduce adenoviral transgene expression in the liver. Previous studies using miR-122-based regulation, with and without other types of transcriptional targeting, have yielded promising preliminary results. However, investigations to date evaluating miRT-122 elements for improving tumor specificity have used either non-tumor bearing animals or direct intratumoral injection as the mode of delivery. In the present study, we confirmed the ability of miRT-122 sequences to selectively down-regulate adenoviral luciferase expression in the liver in vitro and in vivo, and show that this strategy can improve tumor specific transgene expression in a HT1080 human fibrosarcoma model. Rapid growth and the inefficient flow of blood through tumor neovasculature often results in profound hypoxia, which provides additional opportunities for targeting solid tumors and their microenvironment using vectors incorporating hypoxia-responsive promoters to drive transgene expression. We therefore employed a combinatorial approach using miRT-122 elements with hypoxia-responsive transcriptional targeting to further improve the tumor specific expression of an adenoviral reporter gene. Results from this investigation reveal that miRT122 elements alone decrease off-target liver expression and improve tumor specificity of adenoviral vectors. Furthermore, increased tumor specificity can be achieved by combining miRT-122 elements with hypoxia-responsive promoters. PMID:22555510

Generation of a non-transmissive Borna disease virus vector lacking both matrix and glycoprotein genes.

PubMed

Fujino, Kan; Yamamoto, Yusuke; Daito, Takuji; Makino, Akiko; Honda, Tomoyuki; Tomonaga, Keizo

2017-09-01

Borna disease virus (BoDV), a prototype of mammalian bornavirus, is a non-segmented, negative strand RNA virus that often causes severe neurological disorders in infected animals, including horses and sheep. Unique among animal RNA viruses, BoDV transcribes and replicates non-cytopathically in the cell nucleus, leading to establishment of long-lasting persistent infection. This striking feature of BoDV indicates its potential as an RNA virus vector system. It has previously been demonstrated by our team that recombinant BoDV (rBoDV) lacking an envelope glycoprotein (G) gene develops persistent infections in transduced cells without loss of the viral genome. In this study, a novel non-transmissive rBoDV, rBoDV ΔMG, which lacks both matrix (M) and G genes in the genome, is reported. rBoDV-ΔMG expressing green fluorescence protein (GFP), rBoDV ΔMG-GFP, was efficiently generated in Vero/MG cells stably expressing both BoDV M and G proteins. Infection with rBoDV ΔMG-GFP was persistently maintained in the parent Vero cells without propagation within cell culture. The optimal ratio of M and G for efficient viral particle production by transient transfection of M and G expression plasmids into cells persistently infected with rBoDV ΔMG-GFP was also demonstrated. These findings indicate that the rBoDV ΔMG-based BoDV vector may provide an extremely safe virus vector system and could be a novel strategy for investigating the function of M and G proteins and the host range of bornaviruses. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

Direct adenovirus-mediated gene delivery to the temporomandibular joint in guinea-pigs.

PubMed

Kuboki, T; Nakanishi, T; Kanyama, M; Sonoyama, W; Fujisawa, T; Kobayashi, K; Ikeda, T; Kubo, T; Yamashita, A; Takigawa, M

1999-09-01

Adenovirus vector system is expected to be useful for direct gene therapy for joint disease. This study first sought to confirm that foreign genes can be transferred to articular chondrocytes in primary culture. Next, recombinant adenovirus vectors harbouring beta-galactosidase gene (LacZ) was injected directly into the temporomandibular joints of Hartley guinea-pigs to clarify the in vivo transfer availability of the adenovirus vectors. Specifically, recombinant adenovirus harbouring LacZ gene (AxlCALacZ) was injected into the upper joint cavities of both mandibular joints of four male 6-week-old Hartley guinea-pigs. Either the same amount of recombinant adenovirus without LacZ gene (Axlw) suspension (placebo) or the same amount of phosphate-buffered saline solution (control) were injected into the upper joint cavities of both joints of another four male guinea-pigs. At 1, 2, 3 and 4 weeks after injection, the joints were dissected and the expression of delivered LacZ was examined by 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-gal) staining and reverse transcriptase-polymerase chain reaction (RT-PCR). To investigate the expression of transferred gene in other organs, total RNA was extracted from liver, kidney, heart and brain and the expression of LacZ mRNA and 18 S ribosomal RNA were analysed by RT-PCR. Clear expression of LacZ was observed in the articular surfaces of the temporal tubercle, articular disc and synovium of the temporomandibular joints even 4 weeks after injection in the AxlCALacZ-injected group, while no expression was detected in placebo and control groups. Histological examination confirmed that LacZ activity was clearly detected in a few cell layers of the articular surface tissues, which is much more efficient than in a previously study of the knee joint. In the other organs, expression of the delivered transgene was not observed. Based on these findings, direct gene delivery into the articular surface of the temporomandibular joint using the adenovirus vector is feasible as an effective in vivo method.

Isolation, molecular cloning and expression of cellobiohydrolase B (CbhB) from Aspergillus niger in Escherichia coli

NASA Astrophysics Data System (ADS)

Woon, J. S. K.; Murad, A. M. A.; Abu Bakar, F. D.

2015-09-01

A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-T Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.

RNA Interference for improving the Outcome of Islet Transplantation

PubMed Central

Li, Feng; Mahato, Ram I

2010-01-01

Islet transplantation has the potential to cure type 1 diabetes. Despite recent therapeutic success, it is still not common because a large number of transpanted islets get damaged by multiple challenges including instant blood mediated inflammatory reaction, hypoxia/reperfusion injury, inflammatory cytokines, and immune rejection. RNA interference (RNAi) is an novel strategy to selectively degrade target mRNA. The use of RNAi technologies to downregulate the expression of harmful genes has the potential to improve the outcome of islet transplantation. The aim of this review is to gain a thorough understanding of biological obstacles to islet transplantation and discuss how to overcome these barriers using different RNAi technologies. This eventually will help improve islet survival and function post transplantaion. Chemically synthesized small interferring RNA (siRNA), vector based short haripin RNA (shRNA), and their critical design elements (such as sequences, promoters, backbone) are discussed. The application of combinatorial RNAi in islet transplantation is also discussed. Last but not the least, several delivery strategies for enhanced gene silencing are discussed, including chemical modification of siRNA, complex formation, bioconjugation, and viral vectors. PMID:21156190

Temperature-dependent sRNA transcriptome of the Lyme disease spirochete.

PubMed

Popitsch, Niko; Bilusic, Ivana; Rescheneder, Philipp; Schroeder, Renée; Lybecker, Meghan

2017-01-05

Transmission of Borrelia burgdorferi from its tick vector to a vertebrate host requires extensive reprogramming of gene expression. Small regulatory RNAs (sRNA) have emerged in the last decade as important regulators of bacterial gene expression. Despite the widespread observation of sRNA-mediated gene regulation, only one sRNA has been characterized in the Lyme disease spirochete B. burgdorferi. We employed an sRNA-specific deep-sequencing approach to identify the small RNA transcriptome of B. burgdorferi at both 23 °C and 37 °C, which mimics in vitro the transmission from the tick vector to the mammalian host. We identified over 1000 sRNAs in B. burgdorferi revealing large amounts of antisense and intragenic sRNAs, as well as characteristic intergenic and 5' UTR-associated sRNAs. A large fraction of the novel sRNAs (43%) are temperature-dependent and differentially expressed at the two temperatures, suggesting a role in gene regulation for adaptation during transmission. In addition, many genes important for maintenance of Borrelia during its enzootic cycle are associated with antisense RNAs or 5' UTR sRNAs. RNA-seq data were validated for twenty-two of the sRNAs via Northern blot analyses. Our study demonstrates that sRNAs are abundant and differentially expressed by environmental conditions suggesting that gene regulation via sRNAs is a common mechanism utilized in B. burgdorferi. In addition, the identification of antisense and intragenic sRNAs impacts the broadly used loss-of-function genetic approach used to study gene function and increases the coding potential of a small genome. To facilitate access to the analyzed RNA-seq data we have set-up a website at http://www.cibiv.at/~niko/bbdb/ that includes a UCSC browser track hub. By clicking on the respective link, researchers can interactively inspect the data in the UCSC genome browser (Kent et al., Genome Res 12:996-1006, 2002).

Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.

PubMed

Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu

2016-01-01

It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes.

Lentiviral CRISPR/Cas9 vector mediated miR-21 gene editing inhibits the epithelial to mesenchymal transition in ovarian cancer cells.

PubMed

Huo, Wenying; Zhao, Guannan; Yin, Jinggang; Ouyang, Xuan; Wang, Yinan; Yang, Chuanhe; Wang, Baojing; Dong, Peixin; Wang, Zhixiang; Watari, Hidemichi; Chaum, Edward; Pfeffer, Lawrence M; Yue, Junming

2017-01-01

CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats) mediated genome editing is a powerful approach for loss of function studies. Here we report that lentiviral CRISPR/Cas9 vectors are highly efficient in introducing mutations in the precursor miRNA sequence, thus leading to the loss of miRNA expression and function. We constructed four different lentiviral CRISPR/Cas9 vectors that target different regions of the precursor miR-21 sequence and found that these lentiviral CRISPR/Cas9 miR-21 gRNA vectors induced mutations in the precursor sequences as shown by DNA surveyor mutation assay and Sanger sequencing. Two miR-21 lentiviral CRISPR/Cas9 gRNA vectors were selected to probe miR-21 function in ovarian cancer SKOV3 and OVCAR3 cell lines. Our data demonstrate that disruption of pre-miR-21 sequences leads to reduced cell proliferation, migration and invasion. Moreover, CRISPR/Cas9-mediated miR-21 gene editing sensitizes both SKOV3 and OVCAR3 cells to chemotherapeutic drug treatment. Disruption of miR-21 leads to the inhibition of epithelial to mesenchymal transition (EMT) in both SKOV3 and OVCAR3 cells as evidenced by the upregulation of epithelial cell marker E-cadherin and downregulation of mesenchymal marker genes, vimentin and Snai2. The miR-21 target genes PDCD4 and SPRY2 were upregulated in cells transduced with miR-21gRNAs compared to controls. Our study indicates that lentiviral CRISPR/Cas9-mediated miRNA gene editing is an effective approach to address miRNA function, and disruption of miR-21 inhibits EMT in ovarian cancer cells.

Lentiviral CRISPR/Cas9 vector mediated miR-21 gene editing inhibits the epithelial to mesenchymal transition in ovarian cancer cells

PubMed Central

Huo, Wenying; Zhao, Guannan; Yin, Jinggang; Ouyang, Xuan; Wang, Yinan; Yang, Chuanhe; Wang, Baojing; Dong, Peixin; Wang, Zhixiang; Watari, Hidemichi; Chaum, Edward; Pfeffer, Lawrence M.; Yue, Junming

2017-01-01

CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats) mediated genome editing is a powerful approach for loss of function studies. Here we report that lentiviral CRISPR/Cas9 vectors are highly efficient in introducing mutations in the precursor miRNA sequence, thus leading to the loss of miRNA expression and function. We constructed four different lentiviral CRISPR/Cas9 vectors that target different regions of the precursor miR-21 sequence and found that these lentiviral CRISPR/Cas9 miR-21 gRNA vectors induced mutations in the precursor sequences as shown by DNA surveyor mutation assay and Sanger sequencing. Two miR-21 lentiviral CRISPR/Cas9 gRNA vectors were selected to probe miR-21 function in ovarian cancer SKOV3 and OVCAR3 cell lines. Our data demonstrate that disruption of pre-miR-21 sequences leads to reduced cell proliferation, migration and invasion. Moreover, CRISPR/Cas9-mediated miR-21 gene editing sensitizes both SKOV3 and OVCAR3 cells to chemotherapeutic drug treatment. Disruption of miR-21 leads to the inhibition of epithelial to mesenchymal transition (EMT) in both SKOV3 and OVCAR3 cells as evidenced by the upregulation of epithelial cell marker E-cadherin and downregulation of mesenchymal marker genes, vimentin and Snai2. The miR-21 target genes PDCD4 and SPRY2 were upregulated in cells transduced with miR-21gRNAs compared to controls. Our study indicates that lentiviral CRISPR/Cas9-mediated miRNA gene editing is an effective approach to address miRNA function, and disruption of miR-21 inhibits EMT in ovarian cancer cells. PMID:28123598

[Knockdown of dopamine receptor D2 upregulates the expression of adiogenic genes in mouse primary mesencephalic neurons].

PubMed

Ding, Jiaqi; Chen, Xiaoli; Lin, Jiaji; Zhu, Junling; Li, Zhuyi

2018-01-01

Objective To study the effects of dopamine receptor D2 (DRD2) on the adipogenesis genes in mouse primary mesencephalic neurons. Methods The lentiviral vectors which expressed specific shRNA targeting DRD2 were constructed to decrease DRD2 expression in mouse primary mesencephalic neurons. High throughput sequencing (HTS) analysis was used to investigate gene expression changes between the DRD2 knock-down group and the negative control group. Real-time quantitative PCR (qRT-PCR) and Western blot analysis were applied to verify the differently expressed genes. Fatty acids were measured by fatty acid detection kit. Results DRD2 expression was effectively down-regulated in mouse primary mesencephalic neurons by lentiviral vectors. HTS revealed adipogenesis genes were significantly up-regulated after DRD2 down-regulation, mainly including delta(14)-sterol reductase, acetyl-coenzyme A synthetase, insulin-induced gene 1 protein and especially stearoyl-coenzyme A desaturase 1 (SCD1, 4-fold upregulated). The qRT-PCR and Western blot analysis verified that SCD1 was upregulated 2.6 folds and 2 folds respectively by lentiviral DRD2-shRNA vectors. Moreover, the SCD1-related free fatty acids were significantly more increased than the negative control group. Conclusion DRD2 in primary mesencephalic neurons had a significant regulative effect on the adipogenesis genes. The up-regulation of SCD1 can accelerate the conversion of saturated fatty acids to monounsaturated fatty acids and prevent the damage of lipid toxicity to cells.

Long-Term Behavioral Recovery in Parkinsonian Rats by an HSV Vector Expressing Tyrosine Hydroxylase

PubMed Central

Naegele, Janice R.; O’Malley, Karen L.; Geller, Alfred I.

2006-01-01

One therapeutic approach to treating Parkinson’s disease is to convert endogenous striatal cells into levo-3,4-dihydroxyphenylalanine (l-dopa)–producing cells. A defective herpes simplex virus type 1 vector expressing human tyrosine hydroxylase was delivered into the partially denervated striatum of 6-hydroxydopamine–lesioned rats, used as a model of Parkinson’s disease. Efficient behavioral and biochemical recovery was maintained for 1 year after gene transfer. Biochemical recovery included increases in both striatal tyrosine hydroxylase enzyme activity and in extracellular dopamine concentrations. Persistence of human tyrosine hydroxylase was revealed by expression of RNA and immunoreactivity. PMID:7669103

Regulation of adeno-associated virus gene expression in 293 cells: control of mRNA abundance and translation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trempe, J.P.; Carter, B.J.

1988-01-01

The authors studied the effects of the adeno-associated virus (AAV) rep gene on the control of gene expression from the AAV p/sub 40/ promoter in 293 cells in the absence of an adenovirus coinfection. AAV vectors containing the chloramphenicol acetyltransferase (cat) gene were used to measure the levels of cat expression and steady-state mRNA from p/sub 40/. When the rep gene was present in cis or in trans, cat expression from p/sub 40/ was decreased 3- to 10-fold, but there was a 2- to 10-fold increase in the level of p/sub 40/ mRNA. Conversely, cat expression increased and the p/submore » 40/ mRNA level decreased in the absence of the rep gene. Both wild-type and carboxyl-terminal truncated Rep proteins were capable of eliciting both effects. These data suggest two roles for the pleiotropic AAV rep gene: as a translational inhibitor and as a positive regulator of p/sub 40/ mRNA levels. They also provide additional evidence for a cis-acting negative regulatory region which decreases RNA from the AAV p/sub 5/ promoter in a fashion independent of rep.« less

Disclosing the Parameters Leading to High Productivity of Retroviral Producer Cells Lines: Evaluating Random Versus Targeted Integration.

PubMed

Bandeira, Vanessa S; Tomás, Hélio A; Alici, Evren; Carrondo, Manuel J T; Coroadinha, Ana S

2017-04-01

Gammaretrovirus and lentivirus are the preferred viral vectors to genetically modify T and natural killer cells to be used in immune cell therapies. The transduction efficiency of hematopoietic and T cells is more efficient using gibbon ape leukemia virus (GaLV) pseudotyping. In this context gammaretroviral vector producer cells offer competitive higher titers than transient lentiviral vectors productions. The main aim of this work was to identify the key parameters governing GaLV-pseudotyped gammaretroviral vector productivity in stable producer cells, using a retroviral vector expression cassette enabling positive (facilitating cell enrichment) and negative cell selection (allowing cell elimination). The retroviral vector contains a thymidine kinase suicide gene fused with a ouabain-resistant Na + ,K + -ATPase gene, a potential safer and faster marker. The establishment of retroviral vector producer cells is traditionally performed by randomly integrating the retroviral vector expression cassette codifying the transgene. More recently, recombinase-mediated cassette exchange methodologies have been introduced to achieve targeted integration. Herein we compared random and targeted integration of the retroviral vector transgene construct. Two retroviral producer cell lines, 293 OuaS and 293 FlexOuaS, were generated by random and targeted integration, respectively, producing high titers (on the order of 10 7 infectious particles·ml -1 ). Results showed that the retroviral vector transgene cassette is the key retroviral vector component determining the viral titers notwithstanding, single-copy integration is sufficient to provide high titers. The expression levels of the three retroviral constructs (gag-pol, GaLV env, and retroviral vector transgene) were analyzed. Although gag-pol and GaLV env gene expression levels should surpass a minimal threshold, we found that relatively modest expression levels of these two expression cassettes are required. Their levels of expression should not be maximized. We concluded, to establish a high producer retroviral vector cell line only the expression level of the genomic retroviral RNA, that is, the retroviral vector transgene cassette, should be maximized, both through (1) the optimization of its design (i.e., genetic elements composition) and (2) the selection of high expressing chromosomal locus for its integration. The use of methodologies identifying and promoting integration into high-expression loci, as targeted integration or high-throughput screening are in this perspective highly valuable.

Inhibition of CRISPR/Cas9-Mediated Genome Engineering by a Type I Interferon-Induced Reduction in Guide RNA Expression.

PubMed

Machitani, Mitsuhiro; Sakurai, Fuminori; Wakabayashi, Keisaku; Nakatani, Kosuke; Takayama, Kazuo; Tachibana, Masashi; Mizuguchi, Hiroyuki

2017-01-01

Clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9-mediated genome engineering technology is a powerful tool for generation of cells and animals with engineered mutations in their genomes. In order to introduce the CRISPR/Cas9 system into target cells, nonviral and viral vectors are often used; however, such vectors trigger innate immune responses associated with production of type I interferons (IFNs). We have recently demonstrated that type I IFNs inhibit short-hairpin RNA-mediated gene silencing, which led us to hypothesize that type I IFNs may also inhibit CRISPR/Cas9-mediated genome mutagenesis. Here we investigated this hypothesis. A single-strand annealing assay using a reporter plasmid demonstrated that CRISPR/Cas9-mediated cleavage efficiencies of the target double-stranded DNA were significantly reduced by IFNα. A mismatch recognition nuclease-dependent genotyping assay also demonstrated that IFNα reduced insertion or deletion (indel) mutation levels by approximately half. Treatment with IFNα did not alter Cas9 protein expression levels, whereas the copy numbers of guide RNA (gRNA) were significantly reduced by IFNα stimulation. These results indicate that type I IFNs significantly reduce gRNA expression levels following introduction of the CRISPR/Cas9 system in the cells, leading to a reduction in the efficiencies of CRISPR/Cas9-mediated genome mutagenesis. Our findings provide important clues for the achievement of efficient genome engineering using the CRISPR/Cas9 system.

Comparison of CRISPR/Cas9 expression constructs for efficient targeted mutagenesis in rice.

PubMed

Mikami, Masafumi; Toki, Seiichi; Endo, Masaki

2015-08-01

The CRISPR/Cas9 system is an efficient tool used for genome editing in a variety of organisms. Despite several recent reports of successful targeted mutagenesis using the CRISPR/Cas9 system in plants, in each case the target gene of interest, the Cas9 expression system and guide-RNA (gRNA) used, and the tissues used for transformation and subsequent mutagenesis differed, hence the reported frequencies of targeted mutagenesis cannot be compared directly. Here, we evaluated mutation frequency in rice using different Cas9 and/or gRNA expression cassettes under standardized experimental conditions. We introduced Cas9 and gRNA expression cassettes separately or sequentially into rice calli, and assessed the frequency of mutagenesis at the same endogenous targeted sequences. Mutation frequencies differed significantly depending on the Cas9 expression cassette used. In addition, a gRNA driven by the OsU6 promoter was superior to one driven by the OsU3 promoter. Using an all-in-one expression vector harboring the best combined Cas9/gRNA expression cassette resulted in a much improved frequency of targeted mutagenesis in rice calli, and bi-allelic mutant plants were produced in the T0 generation. The approach presented here could be adapted to optimize the construction of Cas9/gRNA cassettes for genome editing in a variety of plants.

Novel Nonreplicating Vaccinia Virus Vector Enhances Expression of Heterologous Genes and Suppresses Synthesis of Endogenous Viral Proteins.

PubMed

Wyatt, Linda S; Xiao, Wei; Americo, Jeffrey L; Earl, Patricia L; Moss, Bernard

2017-06-06

Viruses are used as expression vectors for protein synthesis, immunology research, vaccines, and therapeutics. Advantages of poxvirus vectors include the accommodation of large amounts of heterologous DNA, the presence of a cytoplasmic site of transcription, and high expression levels. On the other hand, competition of approximately 200 viral genes with the target gene for expression and immune recognition may be disadvantageous. We describe a vaccinia virus (VACV) vector that uses an early promoter to express the bacteriophage T7 RNA polymerase; has the A23R intermediate transcription factor gene deleted, thereby restricting virus replication to complementing cells; and has a heterologous gene regulated by a T7 promoter. In noncomplementing cells, viral early gene expression and DNA replication occurred normally but synthesis of intermediate and late proteins was prevented. Nevertheless, the progeny viral DNA provided templates for abundant expression of heterologous genes regulated by a T7 promoter. Selective expression of the Escherichia coli lac repressor gene from an intermediate promoter reduced transcription of the heterologous gene specifically in complementing cells, where large amounts might adversely impact VACV replication. Expression of heterologous proteins mediated by the A23R deletion vector equaled that of a replicating VACV, was higher than that of a nonreplicating modified vaccinia virus Ankara (MVA) vector used for candidate vaccines in vitro and in vivo , and was similarly immunogenic in mice. Unlike the MVA vector, the A23R deletion vector still expresses numerous early genes that can restrict immunogenicity as demonstrated here by the failure of the prototype vector to induce interferon alpha. By deleting immunomodulatory genes, we anticipate further improvements in the system. IMPORTANCE Vaccines provide an efficient and effective way of preventing infectious diseases. Nevertheless, new and better vaccines are needed. Vaccinia virus, which was used successfully as a live vaccine to eradicate smallpox, has been further attenuated and adapted as a recombinant vector for immunization against other pathogens. However, since the initial description of this vector system, only incremental improvements largely related to safety have been implemented. Here we described novel modifications of the platform that increased expression of the heterologous target gene and decreased expression of endogenous vaccinia virus genes while providing safety by preventing replication of the candidate vaccine except in complementing cells used for vector propagation. Copyright © 2017 Wyatt et al.

shRNA-Induced Gene Knockdown In Vivo to Investigate Neutrophil Function.

PubMed

Basit, Abdul; Tang, Wenwen; Wu, Dianqing

2016-01-01

To silence genes in neutrophils efficiently, we exploited the RNA interference and developed an shRNA-based gene knockdown technique. This method involves transfection of mouse bone marrow-derived hematopoietic stem cells with retroviral vector carrying shRNA directed at a specific gene. Transfected stem cells are then transplanted into irradiated wild-type mice. After engraftment of stem cells, the transplanted mice have two sets of circulating neutrophils. One set has a gene of interest knocked down while the other set has full complement of expressed genes. This efficient technique provides a unique way to directly compare the response of neutrophils with a knocked-down gene to that of neutrophils with the full complement of expressed genes in the same environment.

SASH1 regulates proliferation, apoptosis, and invasion of osteosarcoma cell.

PubMed

Meng, Qingbing; Zheng, Minqian; Liu, Hongbing; Song, Changzhi; Zhang, Wensheng; Yan, Juan; Qin, Ling; Liu, Xiaolan

2013-01-01

SASH1, a member of the SLY-family of signal adapter proteins, is a candidate tumor suppressor in breast and colon cancer. The SASH1 protein possesses both the SH3 and SAM domains, indicating that it may play an important role in intracellular signal transduction. Reduced expression of SASH1 is closely related to tumor growth, invasion, metastasis, and poor prognosis. However, the biological role of SASH1 remains unknown in osteosarcoma. To unravel the function of SASH1, we explored the expression of SASH1 in osteosarcoma tissues and its correlation to the clinical pathology of osteosarcoma and analyzed the relationship between SASH1 expression and cell cycle, apoptosis and invasion of osteosarcoma MG-63 cells, using the flow cytometry analysis and transwell invasion chamber experiments. Furthermore, the effect of SASH1 on the expression of cyclin D1, caspase-3, matrix metalloproteinase (MMP)-9 were observed by western blot. Our results showed that the expression rate of SASH1 mRNA in osteosarcoma tissues was significantly lower than that in normal bone tissue (p = 0.000), that the expression rate of SASH1 mRNA in the carcinoma tissues from patients with lung metastasis was significantly lower than that from patients without lung metastasis (p = 0.041), and that the expression rate of SASH1 mRNA also decreased with increasing Enneking stage (p = 0.032). However, the mRNA expression of SASH1 in osteosarcoma was independent of the patient's gender, age, and tumor size (p = 0.983, 0.343, 0.517, respectively). The SASH1 protein displayed a down-regulation in osteosarcoma tissues compared to normal bone tissue (p = 0.000), displayed a down-regulation in osteosarcoma tissues from patients with lung metastasis compared to from patients without lung metastasis (p = 0.000), and displayed a gradual decrease with increasing Enneking stage (p = 0.000). In addition, the MG-63 cells from pcDNA3.1-SASH1 group exhibited significantly reduced cell viability, proliferation, and invasive ability compared to the empty vector group and blank control group (p = 0.023, 0.001, respectively), and there was no difference between the empty vector group and blank control group. The pcDNA3.1-SASH1 group displayed significantly more apoptotic cells than the empty vector group and blank control group (p = 0.004). The expression of cyclin D1, MMP-9 displayed a down-regulation in MG-63 cells from pcDNA3.1-SASH1 group compared to the empty vector group and blank control group (p = 0.000, 0.001, respectively) and the expression levels of caspase-3 displayed an up-regulation in MG-63 cells from pcDNA3.1-SASH1 group compared to the empty vector group and blank control group (p = 0.000). Taken together, these data indicated that the overexpression of SASH1 might be associated with the inhibition of growth, proliferation, and invasion of MG-63 cells and the promotion of apoptosis of MG-63 cells.

Bacterial delivery of RNAi effectors: transkingdom RNAi.

PubMed

Lage, Hermann; Krühn, Andrea

2010-08-18

RNA interference (RNAi) represents a high effective mechanism for specific inhibition of mRNA expression. Besides its potential as a powerful laboratory tool, the RNAi pathway appears to be promising for therapeutic utilization. For development of RNA interference (RNAi)-based therapies, delivery of RNAi-mediating agents to target cells is one of the major obstacles. A novel strategy to overcome this hurdle is transkingdom RNAi (tkRNAi). This technology uses non-pathogenic bacteria, e.g. Escherichia coli, to produce and deliver therapeutic short hairpin RNA (shRNA) into target cells to induce RNAi. A first-generation tkRNAi-mediating vector, TRIP, contains the bacteriophage T7 promoter for expression regulation of a therapeutic shRNA of interest. Furthermore, TRIP has the Inv locus from Yersinia pseudotuberculosis that encodes invasin, which permits natural noninvasive bacteria to enter beta1-integrin-positive mammalian cells and the HlyA gene from Listeria monocytogenes, which produces listeriolysin O. This enzyme allows the therapeutic shRNA to escape from entry vesicles within the cytoplasm of the target cell. TRIP constructs are introduced into a competent non-pathogenic Escherichia coli strain, which encodes T7 RNA polymerase necessary for the T7 promoter-driven synthesis of shRNAs. A well-characterized cancer-associated target molecule for different RNAi strategies is ABCB1 (MDR1/P-glycoprotein, MDR1/P-gp). This ABC-transporter acts as a drug extrusion pump and mediates the "classical" ABCB1-mediated multidrug resistance (MDR) phenotype of human cancer cells which is characterized by a specific cross resistance pattern. Different ABCB1-expressing MDR cancer cells were treated with anti-ABCB1 shRNA expression vector bearing E. coli. This procedure resulted in activation of the RNAi pathways within the cancer cells and a considerable down regulation of the ABCB1 encoding mRNA as well as the corresponding drug extrusion pump. Accordingly, drug accumulation was enhanced in the pristine drug-resistant cancer cells and the MDR phenotype was reversed. By means of this model the data provide the proof-of-concept that tkRNAi is suitable for modulation of cancer-associated factors, e.g. ABCB1, in human cancer cells.

Transcriptomic response of the insect vector, Peregrinus maidis, to Maize mosaic rhabdovirus and identification of conserved responses to propagative viruses in hopper vectors.

PubMed

Martin, Kathleen M; Barandoc-Alviar, Karen; Schneweis, Derek J; Stewart, Catherine L; Rotenberg, Dorith; Whitfield, Anna E

2017-09-01

Maize mosaic virus (MMV) is a plant-pathogenic rhabdovirus that is transmitted by the corn planthopper, Peregrinus maidis, in a propagative manner. P. maidis supports long-term MMV infections with no negative effects on insect performance. To elucidate whole-body transcriptome responses to virus infection, RNA-Seq was used to examine differential gene expression of virus-infected adult insects, and libraries were prepared from replicated groups of virus-exposed insects and non-exposed insects. From the 68,003 de novo-assembled transcripts, 144 were differentially-expressed (DE) during viral infection with comparable numbers up- and down-regulated. DE transcripts with similarity to genes associated with transposable elements (i.e., RNA-directed DNA polymerases) were enriched and may represent a mechanisim for modulating virus infection. Comparison of the P. maidis DE transcripts to published propagative virus-responsive transcript databases for two other hopper vectors revealed that 16% of the DE transcripts were shared across the three systems and may represent conserved responses to propagative viruses. Copyright © 2017 Elsevier Inc. All rights reserved.

Identification of microRNA precursor with the degenerate K-tuple or Kmer strategy.

PubMed

Liu, Bin; Fang, Longyun; Wang, Shanyi; Wang, Xiaolong; Li, Hongtao; Chou, Kuo-Chen

2015-11-21

The microRNA (miRNA), a small non-coding RNA molecule, plays an important role in transcriptional and post-transcriptional regulation of gene expression. Its abnormal expression, however, has been observed in many cancers and other disease states, implying that the miRNA molecules are also deeply involved in these diseases, particularly in carcinogenesis. Therefore, it is important for both basic research and miRNA-based therapy to discriminate the real pre-miRNAs from the false ones (such as hairpin sequences with similar stem-loops). Most existing methods in this regard were based on the strategy in which RNA samples were formulated by a vector formed by their Kmer components. But the length of Kmers must be very short; otherwise, the vector's dimension would be extremely large, leading to the "high-dimension disaster" or overfitting problem. Inspired by the concept of "degenerate energy levels" in quantum mechanics, we introduced the "degenerate Kmer" (deKmer) to represent RNA samples. By doing so, not only we can accommodate long-range coupling effects but also we can avoid the high-dimension problem. Rigorous jackknife tests and cross-species experiments indicated that our approach is very promising. It has not escaped our notice that the deKmer approach can also be applied to many other areas of computational biology. A user-friendly web-server for the new predictor has been established at http://bioinformatics.hitsz.edu.cn/miRNA-deKmer/, by which users can easily get their desired results. Copyright © 2015 Elsevier Ltd. All rights reserved.

Cardiac gene transfer of short hairpin RNA directed against phospholamban effectively knocks down gene expression but causes cellular toxicity in canines.

PubMed

Bish, Lawrence T; Sleeper, Meg M; Reynolds, Caryn; Gazzara, Jeffrey; Withnall, Elanor; Singletary, Gretchen E; Buchlis, George; Hui, Daniel; High, Katherine A; Gao, Guangping; Wilson, James M; Sweeney, H Lee

2011-08-01

Derangements in calcium cycling have been described in failing hearts, and preclinical studies have suggested that therapies aimed at correcting this defect can lead to improvements in cardiac function and survival. One strategy to improve calcium cycling would be to inhibit phospholamban (PLB), the negative regulator of SERCA2a that is upregulated in failing hearts. The goal of this study was to evaluate the safety and efficacy of using adeno-associated virus (AAV)-mediated cardiac gene transfer of short hairpin RNA (shRNA) to knock down expression of PLB. Six dogs were treated with self-complementary AAV serotype 6 (scAAV6) expressing shRNA against PLB. Three control dogs were treated with empty AAV6 capsid, and two control dogs were treated with scAAV6 expressing dominant negative PLB. Vector was delivered via a percutaneously inserted cardiac injection catheter. PLB mRNA and protein expression were analyzed in three of six shRNA dogs between days 16 and 26. The other three shRNA dogs and five control dogs were monitored long-term to assess cardiac safety. PLB mRNA was reduced 16-fold, and PLB protein was reduced 5-fold, with treatment. Serum troponin elevation and depressed cardiac function were observed in the shRNA group only at 4 weeks. An enzyme-linked immunospot assay failed to detect any T cells reactive to AAV6 capsid in peripheral blood mononuclear cells, heart, or spleen. Microarray analysis revealed alterations in cardiac expression of several microRNAs with shRNA treatment. AAV6-mediated cardiac gene transfer of shRNA effectively knocks down PLB expression but is associated with severe cardiac toxicity. Toxicity may result from dysregulation of endogenous microRNA pathways.

Cardiac Gene Transfer of Short Hairpin RNA Directed Against Phospholamban Effectively Knocks Down Gene Expression but Causes Cellular Toxicity in Canines

PubMed Central

Sleeper, Meg M.; Reynolds, Caryn; Gazzara, Jeffrey; Withnall, Elanor; Singletary, Gretchen E.; Buchlis, George; Hui, Daniel; High, Katherine A.; Gao, Guangping; Wilson, James M.; Sweeney, H. Lee

2011-01-01

Abstract Derangements in calcium cycling have been described in failing hearts, and preclinical studies have suggested that therapies aimed at correcting this defect can lead to improvements in cardiac function and survival. One strategy to improve calcium cycling would be to inhibit phospholamban (PLB), the negative regulator of SERCA2a that is upregulated in failing hearts. The goal of this study was to evaluate the safety and efficacy of using adeno-associated virus (AAV)-mediated cardiac gene transfer of short hairpin RNA (shRNA) to knock down expression of PLB. Six dogs were treated with self-complementary AAV serotype 6 (scAAV6) expressing shRNA against PLB. Three control dogs were treated with empty AAV6 capsid, and two control dogs were treated with scAAV6 expressing dominant negative PLB. Vector was delivered via a percutaneously inserted cardiac injection catheter. PLB mRNA and protein expression were analyzed in three of six shRNA dogs between days 16 and 26. The other three shRNA dogs and five control dogs were monitored long-term to assess cardiac safety. PLB mRNA was reduced 16-fold, and PLB protein was reduced 5-fold, with treatment. Serum troponin elevation and depressed cardiac function were observed in the shRNA group only at 4 weeks. An enzyme-linked immunospot assay failed to detect any T cells reactive to AAV6 capsid in peripheral blood mononuclear cells, heart, or spleen. Microarray analysis revealed alterations in cardiac expression of several microRNAs with shRNA treatment. AAV6-mediated cardiac gene transfer of shRNA effectively knocks down PLB expression but is associated with severe cardiac toxicity. Toxicity may result from dysregulation of endogenous microRNA pathways. PMID:21542669

[Mechanism of protective effects of tumor necrosis factor receptor associated protein 1 on hypoxic cardiomyocytes of rats].

PubMed

Xiang, F; Zhang, D X; Ma, S Y; Huang, Y S

2016-12-20

Objective: To investigate the mechanism of protective effects of tumor necrosis factor receptor associated protein 1 (TRAP1) on hypoxic cardiomyocytes of rats. Methods: Primary cultured cardiomyocytes were obtained from neonatal Sprague-Dawley rats (aged 1 to 3 days) and then used in the following experiments. (1) Cells were divided into group TRAP1 and control group according to the random number table (the same grouping method below), and then the total protein of cells was extracted. Total protein of cells in group TRAP1 was added with mouse anti-rat TRAP1 monoclonal antibody, while that in control group was added with the same type of IgG from mouse. Co-immunoprecipitation and protein mass spectrography analysis were used to determine the possible proteins interacted with TRAP1. (2) Cells were divided into normoxia blank control group (NBC), normoxia+ TRAP1 interference control group (NTIC), normoxia+ TRAP1 interference group (NTI), normoxia+ TRAP1 over-expression control group (NTOC), and normoxia+ TRAP1 over-expression group (NTO), with 1 well in each group. Cells in group NBC were routinely cultured, while cells in the latter four groups were respectively added with TRAP1 RNA interference empty virus vector, TRAP1 RNA interference adenovirus vector, TRAP1 over-expression empty virus vector, and TRAP1 over-expression adenovirus vector. Another batch of cells were divided into group NBC, hypoxic blank control group (HBC), hypoxic+ TRAP1 interference control group (HTIC), hypoxic+ TRAP1 interference group (HTI), hypoxic+ TRAP1 over-expression control group (HTOC), and hypoxic+ TRAP1 over-expression group (HTO), with 1 well in each group. Cells in hypoxic groups were under hypoxic condition for 6 hours after being treated as those in the corresponding normoxia groups, respectively. The mRNA expression of cytochrome c oxidase subunit Ⅱ (COXⅡ) of cells in each group was detected by real time fluorescent quantitive reverse transcription polymerase chain reaction. Experiments were repeated for three times. (3) Cells were divided into group NBC, group HBC, group HTOC, group HTO, hypoxic+ TRAP1 over-expression+ COXⅡinterference control group (HTOCIC), and hypoxic+ TRAP1 over-expression+ COXⅡinterference group (HTOCI), with 3 wells in each group. Cells in the previous 4 groups were treated as those in experiment (2). Cells in group HTOCIC and HTOCI were respectively transfected with COXⅡ RNA interference empty virus vector and COXⅡ RNA interference adenovirus vector, and then both added with TRAP1 over-expression adenovirus vector. The proliferation activity of cells was determined by cell counting kit 8 and microplate reader, and the ratio of death cells was measured by propidium lodide and Hoechst 33342 staining. Another batch of cells were divided into group NBC, group HBC, group HTIC, group HTI, hypoxic+ TRAP1 interference+ COXⅡover-expression control group (HTICOC), and hypoxic+ TRAP1 interference+ COXⅡ over-expression group (HTICO), with 3 wells in each group. Cells in the previous 4 groups were treated as those in experiment (2). Cells in group HTICOC and HTICO were both transfected with TRAP1 RNA interference adenovirus vector, and then respectively added with COXⅡ over-expression empty virus vector and COXⅡ over-expression adenovirus vector. The proliferation activity of cells and the ratio of death cells were detected as before. Experiments were repeated for three times. Data were processed with one-way analysis of variance and LSD test. Results: (1) The expression of TRAP1 was found in cells of group TRAP1, while that was not found in cells of control group. The possible proteins interacted with TRAP1 were keratin, COXⅡ, and an unknown protein with predicted molecular weight 13×10 3 . (2) Compared with that in group NBC, the mRNA expression of COXⅡof cells had no significant change in group NTIC and group NTOC (with P values above 0.05), but significantly decreased in group NTI ( P <0.01), and significantly increased in group NTO ( P <0.01). Compared with that in group NBC, the mRNA expression of COXⅡof cells in group HBC was significantly decreased ( P <0.01). Compared with that in group HBC, the mRNA expression of COXⅡof cells had no significant change in group HTIC and group HTOC (with P values above 0.05), but significantly decreased in group HTI ( P <0.01), and significantly increased in group HTO ( P <0.01). (3) The proliferation activity of cells in group NBC, group HBC, group HTOC, group HTO, group HTOCIC, and group HTOCI was respectively 0.498±0.022, 0.303±0.018, 0.313±0.032, 0.456±0.031, 0.448±0.034, and 0.335±0.026, and the ratios of death cells in above groups were respectively (4.7±1.5)%, (24.7±3.1)%, (26.0±2.7)%, (13.3±2.5)%, (12.7±2.1)%, and (21.0±1.7)%. Compared with those in group NBC, the proliferation activity of cells in HBC was decreased, while the ratio of death cells was increased (with P values below 0.01). Compared with those in group HBC, the proliferation activity of cells and the ratio of death cells in group HTOC had no significant change (with P values above 0.05), while the proliferation activity of cells was increased and the ratio of death cells was decreased in group HTO (with P values below 0.01). Compared with those in group HTO, the proliferation activity of cells and the ratio of death cells in group HTOCIC had no significant change (with P values above 0.05), while the proliferation activity of cells was decreased and the ratio of death cells was increased in group HTOCI (with P values below 0.01). (4) The proliferation activity of cells in group NBC, group HBC, group HTIC, group HTI, group HTICOC, and group HTICO was respectively 0.444±0.025, 0.275±0.016, 0.283±0.021, 0.150±0.009, 0.135±0.011, and 0.237±0.017, and the ratios of death cells in above groups were respectively (3.7±0.6)%, (21.0±2.7)%, (20.3±3.1)%, (31.7±2.5)%, (33.3±3.2)%, and (19.3±1.5)%. Compared with those in group HBC, the proliferation activity of cells and the ratio of death cells in group HTIC had no significant change (with P values above 0.05). Compared with those in group HBC and group HTIC, the proliferation activity of cells was decreased and the ratio of death cells was significantly increased in group HTI (with P values below 0.01). Compared with those in group HTI, the proliferation activity of cells and the ratio of death cells in group HTICOC had no significant change (with P values above 0.05), while the proliferation activity of cells was increased and the ratio of death cells was significantly decreased in group HTICO (with P values below 0.01). Conclusions: TRAP1 can up-regulate the expression of COXⅡ mRNA, and COXⅡ is one of the downstream effector molecules that TRAP1 mediates its protective effects on hypoxic cardiomyocytes.

Small RNA Deep Sequencing and the Effects of microRNA408 on Root Gravitropic Bending in Arabidopsis

NASA Astrophysics Data System (ADS)

Li, Huasheng; Lu, Jinying; Sun, Qiao; Chen, Yu; He, Dacheng; Liu, Min

2015-11-01

MicroRNA (miRNA) is a non-coding small RNA composed of 20 to 24 nucleotides that influences plant root development. This study analyzed the miRNA expression in Arabidopsis root tip cells using Illumina sequencing and real-time PCR before (sample 0) and 15 min after (sample 15) a 3-D clinostat rotational treatment was administered. After stimulation was performed, the expression levels of seven miRNA genes, including Arabidopsis miR160, miR161, miR394, miR402, miR403, miR408, and miR823, were significantly upregulated. Illumina sequencing results also revealed two novel miRNAsthat have not been previously reported, The target genes of these miRNAs included pentatricopeptide repeat-containing protein and diadenosine tetraphosphate hydrolase. An overexpression vector of Arabidopsis miR408 was constructed and transferred to Arabidopsis plant. The roots of plants over expressing miR408 exhibited a slower reorientation upon gravistimulation in comparison with those of wild-type. This result indicate that miR408 could play a role in root gravitropic response.

RNA-seq de novo Assembly Reveals Differential Gene Expression in Glossina palpalis gambiensis Infected with Trypanosoma brucei gambiense vs. Non-Infected and Self-Cured Flies

PubMed Central

Hamidou Soumana, Illiassou; Klopp, Christophe; Ravel, Sophie; Nabihoudine, Ibouniyamine; Tchicaya, Bernadette; Parrinello, Hugues; Abate, Luc; Rialle, Stéphanie; Geiger, Anne

2015-01-01

Trypanosoma brucei gambiense (Tbg), causing the sleeping sickness chronic form, completes its developmental cycle within the tsetse fly vector Glossina palpalis gambiensis (Gpg) before its transmission to humans. Within the framework of an anti-vector disease control strategy, a global gene expression profiling of trypanosome infected (susceptible), non-infected, and self-cured (refractory) tsetse flies was performed, on their midguts, to determine differential genes expression resulting from in vivo trypanosomes, tsetse flies (and their microbiome) interactions. An RNAseq de novo assembly was achieved. The assembled transcripts were mapped to reference sequences for functional annotation. Twenty-four percent of the 16,936 contigs could not be annotated, possibly representing untranslated mRNA regions, or Gpg- or Tbg-specific ORFs. The remaining contigs were classified into 65 functional groups. Only a few transposable elements were present in the Gpg midgut transcriptome, which may represent active transpositions and play regulatory roles. One thousand three hundred and seventy three genes differentially expressed (DEGs) between stimulated and non-stimulated flies were identified at day-3 post-feeding; 52 and 1025 between infected and self-cured flies at 10 and 20 days post-feeding, respectively. The possible roles of several DEGs regarding fly susceptibility and refractoriness are discussed. The results provide new means to decipher fly infection mechanisms, crucial to develop anti-vector control strategies. PMID:26617594

Muscle-specific CRISPR/Cas9 dystrophin gene editing ameliorates pathophysiology in a mouse model for Duchenne muscular dystrophy

PubMed Central

Bengtsson, Niclas E.; Hall, John K.; Odom, Guy L.; Phelps, Michael P.; Andrus, Colin R.; Hawkins, R. David; Hauschka, Stephen D.; Chamberlain, Joel R.; Chamberlain, Jeffrey S.

2017-01-01

Gene replacement therapies utilizing adeno-associated viral (AAV) vectors hold great promise for treating Duchenne muscular dystrophy (DMD). A related approach uses AAV vectors to edit specific regions of the DMD gene using CRISPR/Cas9. Here we develop multiple approaches for editing the mutation in dystrophic mdx4cv mice using single and dual AAV vector delivery of a muscle-specific Cas9 cassette together with single-guide RNA cassettes and, in one approach, a dystrophin homology region to fully correct the mutation. Muscle-restricted Cas9 expression enables direct editing of the mutation, multi-exon deletion or complete gene correction via homologous recombination in myogenic cells. Treated muscles express dystrophin in up to 70% of the myogenic area and increased force generation following intramuscular delivery. Furthermore, systemic administration of the vectors results in widespread expression of dystrophin in both skeletal and cardiac muscles. Our results demonstrate that AAV-mediated muscle-specific gene editing has significant potential for therapy of neuromuscular disorders. PMID:28195574

The small non-coding RNA response to virus infection in the Leishmania vector Lutzomyia longipalpis.

PubMed

Ferreira, Flávia Viana; Aguiar, Eric Roberto Guimarães Rocha; Olmo, Roenick Proveti; de Oliveira, Karla Pollyanna Vieira; Silva, Emanuele Guimarães; Sant'Anna, Maurício Roberto Viana; Gontijo, Nelder de Figueiredo; Kroon, Erna Geessien; Imler, Jean Luc; Marques, João Trindade

2018-06-01

Sandflies are well known vectors for Leishmania but also transmit a number of arthropod-borne viruses (arboviruses). Few studies have addressed the interaction between sandflies and arboviruses. RNA interference (RNAi) mechanisms utilize small non-coding RNAs to regulate different aspects of host-pathogen interactions. The small interfering RNA (siRNA) pathway is a broad antiviral mechanism in insects. In addition, at least in mosquitoes, another RNAi mechanism mediated by PIWI interacting RNAs (piRNAs) is activated by viral infection. Finally, endogenous microRNAs (miRNA) may also regulate host immune responses. Here, we analyzed the small non-coding RNA response to Vesicular stomatitis virus (VSV) infection in the sandfly Lutzoymia longipalpis. We detected abundant production of virus-derived siRNAs after VSV infection in adult sandflies. However, there was no production of virus-derived piRNAs and only mild changes in the expression of vector miRNAs in response to infection. We also observed abundant production of virus-derived siRNAs against two other viruses in Lutzomyia Lulo cells. Together, our results suggest that the siRNA but not the piRNA pathway mediates an antiviral response in sandflies. In agreement with this hypothesis, pre-treatment of cells with dsRNA against VSV was able to inhibit viral replication while knock-down of the central siRNA component, Argonaute-2, led to increased virus levels. Our work begins to elucidate the role of RNAi mechanisms in the interaction between L. longipalpis and viruses and should also open the way for studies with other sandfly-borne pathogens.

Validation of a recombinant human bactericidal/permeability-increasing protein (hBPI) expression vector using murine mammary gland tumor cells and the early development of hBPI transgenic goat embryos.

PubMed

Gui, Tao; Liu, Xing; Tao, Jia; Chen, Jianwen; Li, Yunsheng; Zhang, Meiling; Wu, Ronghua; Zhang, Yuanliang; Peng, Kaisong; Liu, Ya; Zhang, Xiaorong; Zhang, Yunhai

2013-12-01

Human bactericidal/permeability-increasing protein (hBPI) is the only antibacterial peptide which acts against both gram-negative bacteria and neutralizes endotoxins in human polymorphonuclear neutrophils; therefore, hBPI is of great value in clinical applications. In the study, we constructed a hBPI expression vector (pBC1-Loxp-Neo-Loxp-hBPI) containing the full-length hBPI coding sequence which could be specifically expressed in the mammary gland. To validate the function of the vector, in vitro cultured C127 (mouse mammary Carcinoma Cells) were transfected with the vector, and the transgenic cell clones were selected to express hBPI by hormone induction. The mRNA and protein expression of hBPI showed that the constructed vector was effective and suitable for future application in producing mammary gland bioreactor. Then, female and male goat fibroblasts were transfected with the vector, and two male and two female transgenic clonal cell lines were obtained. Using the transgenic cell lines as nuclear donors for somatic cell nuclear transfer, the reconstructed goat embryos produced from all four clones could develop to blastocysts in vitro. In conclusion, we constructed and validated an efficient mammary gland-specific hBPI expression vector, pBC1-Loxp-Neo-Loxp-hBPI, and transgenic hBPI goat embryos were successfully produced, laying foundations for future production of recombinant hBPI in goat mammary gland. Copyright © 2013 Elsevier B.V. All rights reserved.

Constitutive Expression of Short Hairpin RNA in Vivo Triggers Buildup of Mature Hairpin Molecules

PubMed Central

Ahn, M.; Witting, S.R.; Ruiz, R.; Saxena, R.

2011-01-01

Abstract RNA interference (RNAi) has become the cornerstone technology for studying gene function in mammalian cells. In addition, it is a promising therapeutic treatment for multiple human diseases. Virus-mediated constitutive expression of short hairpin RNA (shRNA) has the potential to provide a permanent source of silencing molecules to tissues, and it is being devised as a strategy for the treatment of liver conditions such as hepatitis B and hepatitis C virus infection. Unintended interaction between silencing molecules and cellular components, leading to toxic effects, has been described in vitro. Despite the enormous interest in using the RNAi technology for in vivo applications, little is known about the safety of constitutively expressing shRNA for multiple weeks. Here we report the effects of in vivo shRNA expression, using helper-dependent adenoviral vectors. We show that gene-specific knockdown is maintained for at least 6 weeks after injection of 1 × 1011 viral particles. Nonetheless, accumulation of mature shRNA molecules was observed up to weeks 3 and 4, and then declined gradually, suggesting the buildup of mature shRNA molecules induced cell death with concomitant loss of viral DNA and shRNA expression. No evidence of well-characterized innate immunity activation (such as interferon production) or saturation of the exportin-5 pathway was observed. Overall, our data suggest constitutive expression of shRNA results in accumulation of mature shRNA molecules, inducing cellular toxicity at late time points, despite the presence of gene silencing. PMID:21780944

Vero/BC-F: an efficient packaging cell line stably expressing F protein to generate single round-infectious human parainfluenza virus type 2 vector.

PubMed

Ohtsuka, J; Fukumura, M; Tsurudome, M; Hara, K; Nishio, M; Kawano, M; Nosaka, T

2014-08-01

A stable packaging cell line (Vero/BC-F) constitutively expressing fusion (F) protein of the human parainfluenza virus type 2 (hPIV2) was established for production of the F-defective and single round-infectious hPIV2 vector in a strategy for recombinant vaccine development. The F gene expression has not evoked cytostatic or cytotoxic effects on the Vero/BC-F cells and the F protein was physiologically active to induce syncytial formation with giant polykaryocytes when transfected with a plasmid expressing hPIV2 hemagglutinin-neuraminidase (HN). Transduction of the F-defective replicon RNA into the Vero/BC-F cells led to the release of the infectious particles that packaged the replicon RNA (named as hPIV2ΔF) without detectable mutations, limiting the infectivity to a single round. The maximal titer of the hPIV2ΔF was 6.0 × 10(8) median tissue culture infections dose per ml. The influenza A virus M2 gene was inserted into hPIV2ΔF, and the M2 protein was found to be highly expressed in a human lung cancer cell line after transduction. Furthermore, in vivo airway infection experiments revealed that the hPIV2ΔF was capable of delivering transgenes to hamster tracheal cells. Thus, non-transmissible or single round-infectious hPIV2 vector will be potentially applicable to human gene therapy or recombinant vaccine development.

MicroRNA-mediated non-viral direct conversion of embryonic fibroblasts to cardiomyocytes: comparison of commercial and synthetic non-viral vectors.

PubMed

Kim, Hyosuk; Kim, Dongkyu; Ku, Sook Hee; Kim, Kwangmeyung; Kim, Sun Hwa; Kwon, Ick Chan

Technological advances opened up new ways of directing cell fate conversion from one cell lineage to another. The direct cell conversion technique has recently attracted much attention in regenerative medicine to treat devastated organs and tissues, particularly having limited regenerative capacity such as the heart and brain. Unfortunately, its clinical application is severely limited due to a safety concern and immunogenicity of viral vectors, as human gene therapy did in the beginning stages. In this study, we examined the possibility of adopting non-viral vectors to direct cell conversion from mouse embryonic fibroblasts to induced cardiomyocytes (iCM) by transient transfection of four types of chemically synthesized micro-RNA mimics (miRNA-1, 133, 208, and 499). Herein, we tested several commercial and synthetic non-viral gene delivery carriers, which could be divided into three different categories: polymers [branched PEI (bPEI), bioreducible PEI (PEI-SS), deoxycholic acid-conjugated PEI (DA-PEI), jetPEI™, SuperFect™], lipids (Lipofectamine 2000™), and peptides (PepMute™). According to the analyses of physicochemical properties, cellular uptake, and cytotoxicity of the carrier/miRNA complexes, DA-PEI exhibited excellent miRNA delivery efficiency to mouse embryonic fibroblasts. One week after a single treatment of DA-PEI/miRNA without other adjuvants, the cells started to express cardiomyocyte-specific markers, such as α-actinin and α-MHC, indicating the formation of cardiomyocyte-like cells. Although the overall frequency of non-viral vector induced cardiomyogenic transdifferentiation was quite low (ca. 0.2%), this study can provide compelling support to develop clinically applicable transdifferentiation techniques.

Long non-coding RNA discovery across the genus anopheles reveals conserved secondary structures within and beyond the Gambiae complex.

PubMed

Jenkins, Adam M; Waterhouse, Robert M; Muskavitch, Marc A T

2015-04-23

Long non-coding RNAs (lncRNAs) have been defined as mRNA-like transcripts longer than 200 nucleotides that lack significant protein-coding potential, and many of them constitute scaffolds for ribonucleoprotein complexes with critical roles in epigenetic regulation. Various lncRNAs have been implicated in the modulation of chromatin structure, transcriptional and post-transcriptional gene regulation, and regulation of genomic stability in mammals, Caenorhabditis elegans, and Drosophila melanogaster. The purpose of this study is to identify the lncRNA landscape in the malaria vector An. gambiae and assess the evolutionary conservation of lncRNAs and their secondary structures across the Anopheles genus. Using deep RNA sequencing of multiple Anopheles gambiae life stages, we have identified 2,949 lncRNAs and more than 300 previously unannotated putative protein-coding genes. The lncRNAs exhibit differential expression profiles across life stages and adult genders. We find that across the genus Anopheles, lncRNAs display much lower sequence conservation than protein-coding genes. Additionally, we find that lncRNA secondary structure is highly conserved within the Gambiae complex, but diverges rapidly across the rest of the genus Anopheles. This study offers one of the first lncRNA secondary structure analyses in vector insects. Our description of lncRNAs in An. gambiae offers the most comprehensive genome-wide insights to date into lncRNAs in this vector mosquito, and defines a set of potential targets for the development of vector-based interventions that may further curb the human malaria burden in disease-endemic countries.

Suppression of hedgehog signaling regulates hepatic stellate cell activation and collagen secretion.

PubMed

Li, Tao; Leng, Xi-Sheng; Zhu, Ji-Ye; Wang, Gang

2015-01-01

Hepatic stellate cells (HSCs) play an important role in liver fibrosis. This study investigates the expression of hedgehog in HSC and the role of hedgehog signaling on activation and collagen secretion of HSC. Liver ex vivo perfusion with collagenase IV and density gradient centrifugation were used to isolate HSC. Expression of hedgehog signaling components Ihh, Smo, Ptc, Gli2 and Gli3 in HSC were detected by RT-PCR. Hedgehog siRNA vectors targeting Ihh, Smo and Gli2 were constructed and transfected into HSC respectively. Suppression of hedgehog signaling were detected by SYBR Green fluorescence quantitative RT-PCR. Effects of hedgehog signaling inhibition on HSC activation and collagen I secretion were analyzed. Hedgehog signaling components Ihh, Smo, Ptc, Gli2 and Gli3 were expressed in HSC. siRNA vectors targeting Ihh, Smo and Gli2 were successfully constructed and decreased target gene expression. Suppression of hedgehog signaling significantly decreased the expression of α-SMA in HSC (P<0.01). Collagen type I secretion of HSC were also significantly decreased (P<0.01). In summary, HSC activation and collagen secretion can be regulated by hedgehog signaling. Hedgehog may play a role in the pathogenesis of liver fibrosis.

Increased proliferation of endothelial cells with overexpression of soluble TNF-alpha receptor I gene.

PubMed

Sugano, Masahiro; Tsuchida, Keiko; Tomita, Hideharu; Makino, Naoki

2002-05-01

Vascular endothelial growth factor (VEGF) can overcome a potential anti-angiogenic effect of TNF-alpha by inhibiting endothelial apoptosis induced by this cytokine. Soluble TNF-alpha receptor I (sTNFRI) is an extracellular domain of TNFRI and antagonizes the activity of TNF-alpha. Here we report that sTNFRI is able to stimulate the growth of endothelial cells not by antagonizing TNF-alpha. Exogenously added recombinant human sTNFRI stimulated significantly more cell growth of human umbilical venous endothelial cells (HUVEC) with a low dose (50-200 pg/ml) compared with smooth muscle cells. In contrast, monoclonal antibody against TNF-alpha did not stimulate growth of human HUVEC. The sTNFRI expression plasmid (pcDNA3.1 plasmid) was introduced into the cell culture using OPTI-MEM, lipofectin and transferrin. Growth of HUVEC transfected with sTNFRI vector also increased significantly compared with those transfected with control vector. HUVEC transfected with sTNFRI vector increased the extracellular domain of TNFRI mRNA levels, but did not affect the intracellular domain of TNFRI mRNA levels. Accumulation of sTNFRI significantly increased in conditioned medium from HUVEC transfected with sTNFRI vector compared with those transfected with control vector. HUVEC transfected with sTNFRI vector not only increased sTNFRI but also prevented shedding of sTNFRI from TNFRI. The TNF-alpha -induced internucleosomic fragmentation was also significantly prevented in HUVEC transfected with sTNFRI vector compared with those transfected with control vector. These results suggest that instead of growth factors such as VEGF, local transfection of the sTNFRI gene may have potential therapeutic value in vascular diseases in which TNF-alpha is also usually highly expressed.

Combination therapy utilizing shRNA knockdown and an optimized resistant transgene for rescue of diseases caused by misfolded proteins.

PubMed

Li, Chengwen; Xiao, Pingjie; Gray, Steven James; Weinberg, Marc Scott; Samulski, R Jude

2011-08-23

Molecular knockdown of disease proteins and restoration of wild-type activity represent a promising but challenging strategy for the treatment of diseases that result from the accumulation of misfolded proteins (i.e., Huntington disease, amyotrophic lateral sclerosis, and α-1 antitrypsin deficiency). In this study we used alpha-1 antitrypsin (AAT) deficiency with the piZZ mutant phenotype as a model system to evaluate the efficiency of gene-delivery approaches that both silence the piZZ transcript (e.g., shRNA) and restore circulating wild-type AAT expression from resistant codon-optimized AAT (AAT-opt) transgene cassette using adeno-associated virus (AAV) vector delivery. After systemic injection of a self-complimentary AAV serotype 8 (scAAV8) vector encoding shRNA in piZZ transgenic mice, both mutant AAT mRNA in the liver and defected serum protein level were inhibited by 95%, whereas liver pathology, as monitored by dPAS and fibrosis staining, reversed. To restore blood AAT levels in AAV8/shRNA-treated mice, several strategies to restore functional AAT levels were tested, including using AAV AAT-opt transgene cassettes targeted to muscle and liver, or combination vectors carrying piZZ shRNA and AAT-opt transgenes separately, or a single bicistronic AAV vector. With these molecular approaches, we observed over 90% knockdown of mutant AAT with a 13- to 30-fold increase of circulating wild-type AAT protein from the shRNA-resistant AAT-opt cassette. The molecular approaches applied in this study can simultaneously prevent liver pathology and restore blood AAT concentration in AAT deficiencies. Based on these observations, similar gene-therapy strategies could be considered for any diseases caused by accumulation of misfolded proteins.

Reduction of adenovirus E1A mRNA by RNAi results in enhanced recombinant protein expression in transiently transfected HEK293 cells.

PubMed

Hacker, David L; Bertschinger, Martin; Baldi, Lucia; Wurm, Florian M

2004-10-27

Human embryonic kidney 293 (HEK293) cells, a widely used host for large-scale transient expression of recombinant proteins, are transformed with the adenovirus E1A and E1B genes. Because the E1A proteins function as transcriptional activators or repressors, they may have a positive or negative effect on transient transgene expression in this cell line. Suspension cultures of HEK293 EBNA (HEK293E) cells were co-transfected with a reporter plasmid expressing the GFP gene and a plasmid expressing a short hairpin RNA (shRNA) targeting the E1A mRNAs for degradation by RNA interference (RNAi). The presence of the shRNA in HEK293E cells reduced the steady state level of E1A mRNA up to 75% and increased transient GFP expression from either the elongation factor-1alpha (EF-1alpha) promoter or the human cytomegalovirus (HCMV) immediate early promoter up to twofold. E1A mRNA depletion also resulted in a twofold increase in transient expression of a recombinant IgG in both small- and large-scale suspension cultures when the IgG light and heavy chain genes were controlled by the EF-1alpha promoter. Finally, transient IgG expression was enhanced 2.5-fold when the anti-E1A shRNA was expressed from the same vector as the IgG light chain gene. These results demonstrated that E1A has a negative effect on transient gene expression in HEK293E cells, and they established that RNAi can be used to enhance recombinant protein expression in mammalian cells.

Role of caspase-9 in the effector caspases and genome expressions, and growth of bovine skeletal myoblasts.

PubMed

Van Ba, Hoa; Hwang, Inho

2014-02-01

Caspase-9 has been reported as the key regulator of apoptosis, however, its role in skeletal myoblast development and molecular involvements during cell growth still remains unknown. The current study aimed to present the key role of caspase-9 in the expressions of apoptotic caspases and genome, and cell viability during myoblast growth using RNA interference mediated silencing. Three small interference RNA sequences (siRNAs) targeting caspase-9 gene was designed and ligated into pSilencer plasmid vector to construct shRNA expression constructs. Cells were transfected with the constructs for 48 h. Results indicated that all three siRNAs could silence the caspase-9 mRNA expression significantly. Particularly, the mRNA expression level of caspase-9 in the cells transfected by shRNA1, shRNA2 and shRNA3 constructs were reduced by 37.85%, 68.20% and 58.14%, respectively. Suppression of caspase-9 led to the significant increases in the mRNA and protein expressions of effector caspase-3, whereas the reduction in mRNA and protein expressions of caspase-7. The microarray results showed that the suppression of caspase-9 resulted in significant upregulations of cell proliferation-, adhesion-, growth-, development- and division-regulating genes, whereas the reduction in the expressions of cell death program- and stress response-regulating genes. Furthermore, cell viability was significantly increased following the transfection. These data suggest that caspase-9 could play an important role in the control of cell growth, and knockdown of caspase-9 may have genuine potential in the treatment of skeletal muscle atrophy. © 2013 The Authors Development, Growth & Differentiation © 2013 Japanese Society of Developmental Biologists.

Preparation of anti-mouse caspase-12 mRNA hammerhead ribozyme and identification of its activity in vitro

PubMed Central

Jiang, Shan; Xie, Qing; Zhang, Wei; Zhou, Xia-Qiu; Jin, You-Xin

2005-01-01

AIM: To prepare and identify specific anti-mouse caspase-12 hammerhead ribozymes in vitro, in order to select a more effective ribozyme against mouse caspase-12 as a potential tool to rescue cells from endoplasmic reticulum stress induced apoptosis. METHODS: Two hammerhead ribozymes directed separately against 138 and 218 site of nucleotide of mouse caspase-12 mRNA were designed by computer software, and their DNA sequences were synthesized. The synthesized ribozymes were cloned into an eukaryotic expression vector-neorpBSKU6 and embedded in U6 SnRNA context for further study. Mouse caspase-12 gene segment was cloned into PGEM-T vector under the control of T7 RNA polymerase promoter (containing gene sequence from positions nt 41 to nt 894) as target. In vitro transcription both the ribozymes and target utilize T7 promoter. The target was labeled with [α-32P]UTP, while ribozymes were not labeled. After gel purification the RNAs were dissolved in RNase free water. Ribozyme and target were incubated for 90 min at 37°C in reaction buffer (40 mmol/L Tris-HCL, pH 7.5, 10 mmol/L Mg2+). Molar ratio of ribozyme vs target was 30:1. Samples were analyzed on 6% PAGE (containing 8 mol/L urea). RESULTS: Both caspase-12 and ribozyme gene sequences were successfully cloned into expression vector confirmed by sequencing. Ribozymes and caspase-12 mRNA were obtained by in vitro transcription. Cleavage experiment showed that in a physiological similar condition (37°C, pH 7.5), Rz138 and Rz218 both cleaved targets at predicted sites, for Rz138 the cleavage efficiency was about 100%, for Rz218 the value was 36.66%. CONCLUSION: Rz138 prepared in vitro can site specific cleave mouse caspase-12 mRNA with an excellent efficiency. It shows a potential to suppress the expression of caspase-12 in vivo, thus provided a new way to protect cells from ER stress induced apoptosis. PMID:15996037

An efficient Foxtail mosaic virus vector system with reduced environmental risk

PubMed Central

2010-01-01

Background Plant viral vectors offer high-yield expression of pharmaceutical and commercially important proteins with a minimum of cost and preparation time. The use of Agrobacterium tumefaciens has been introduced to deliver the viral vector as a transgene to each plant cell via a simple, nonsterile infiltration technique called "agroinoculation". With agroinoculation, a full length, systemically moving virus is no longer necessary for excellent protein yield, since the viral transgene is transcribed and replicates in every infiltrated cell. Viral genes may therefore be deleted to decrease the potential for accidental spread and persistence of the viral vector in the environment. Results In this study, both the coat protein (CP) and triple gene block (TGB) genetic segments were eliminated from Foxtail mosaic virus to create the "FECT" vector series, comprising a deletion of 29% of the genome. This viral vector is highly crippled and expresses little or no marker gene within the inoculated leaf. However, when co-agroinoculated with a silencing suppressor (p19 or HcPro), FECT expressed GFP at 40% total soluble protein in the tobacco host, Nicotiana benthamiana. The modified FoMV vector retained the full-length replicase ORF, the TGB1 subgenomic RNA leader sequence and either 0, 22 or 40 bases of TGB1 ORF (in vectors FECT0, FECT22 and FECT40, respectively). As well as N. benthamiana, infection of legumes was demonstrated. Despite many attempts, expression of GFP via syringe agroinoculation of various grass species was very low, reflecting the low Agrobacterium-mediated transformation rate of monocots. Conclusions The FECT/40 vector expresses foreign genes at a very high level, and yet has a greatly reduced biohazard potential. It can form no virions and can effectively replicate only in a plant with suppressed silencing. PMID:21162736

[Impact of siRNA-mediated down-regulation of CD147 on human breast cancer cells].

PubMed

Li, Zhenqian; Li, Daoming; Li, Jiangwei; Huang, Pei; Qin, Hui

2015-10-01

To investigate the influence of siRNA-mediated down-regulation of CD147 on growth, proliferation and movement of human breast cancer cell line MDA-MB-231. The protein expression of CD147, MMP-2 and TIMP-2 of the MDA-MB-231 cells were analyzed by ABC. Lentiviral expression vector of CD147 gene was constructed and transfected into MDA-MB-231 cells. RT-PCR and Western blot were used to detect the mRNA and protein level changes of CD147 genes to identify the optimal time point, followed by detection of changes of mRNA and protein expression of MMP-2 and TIMP-2 genes. CCK-8 reagent method and cell scratch test were used to detect the proliferation and migration change of MDA-MB-231 cells. The nude mouse model of breast cancer by hypodermic injection with MDA-MB-231 cells was established to document the effect of CD147 siRNA on the tumor transplants. After transfection of lentiviral expression vector of CD147 gene, protein of CD147, MMP-2 and TIMP-2 were weakly or negative expressed, significantly weaker than those of control group (P < 0.01). After 72 hours of transfection, average down-regulation rate of CD147 and MMP-2 were 96.03% ± 0.84% and 96.03% ± 0.84%, respectively. Both CD147 mRNA and MMP-2 mRNA expression were down-regulated (P < 0.05), while TIMP-2 mRNA expression showed no significant deference (P > 0.05). No less than 2 days after transfection, cell growth of MDA-MB-231 cell line was found significantly inhibited (P < 0.05). After 24 hours of transection, average migration distance of MDA-MB-231 cell line and control group were (0.64 ± 0.12) mm and (4.69 ± 0.85) mm, respectively, which indicated a lower migrate speed. Down regulation of CD147 led to reduction of volume and mass of nude mouses. The growth of the carcinoma transplant was inhibited upon siRNA-mediated down-regulation of CD147 (P < 0.05), with an average tumor mass of (1.85 ± 0.98) g and both reduction of tumor size and tumor mass. CD147 may alter the MMP-2/TIMP-2 balance in MDA-MB-231 cells. CD147 gene silencing inhibits the proliferation and migration of MDA-MB-231 cells and the growth of carcinoma transplants in nude mice.

Isolation, molecular cloning and expression of cellobiohydrolase B (CbhB) from Aspergillus niger in Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woon, J. S. K., E-mail: jameswoon@siswa.ukm.edu.my; Murad, A. M. A., E-mail: munir@ukm.edu.my; Abu Bakar, F. D., E-mail: fabyff@ukm.edu.my

A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-Tmore » Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.« less

Non-transmissible Sendai virus vector encoding c-myc suppressor FBP-interacting repressor for cancer therapy

PubMed Central

Matsushita, Kazuyuki; Shimada, Hideaki; Ueda, Yasuji; Inoue, Makoto; Hasegawa, Mamoru; Tomonaga, Takeshi; Matsubara, Hisahiro; Nomura, Fumio

2014-01-01

AIM: To investigate a novel therapeutic strategy to target and suppress c-myc in human cancers using far up stream element (FUSE)-binding protein-interacting repressor (FIR). METHODS: Endogenous c-Myc suppression and apoptosis induction by a transient FIR-expressing vector was examined in vivo via a HA-tagged FIR (HA-FIR) expression vector. A fusion gene-deficient, non-transmissible, Sendai virus (SeV) vector encoding FIR cDNA, SeV/dF/FIR, was prepared. SeV/dF/FIR was examined for its gene transduction efficiency, viral dose dependency of antitumor effect and apoptosis induction in HeLa (cervical squamous cell carcinoma) cells and SW480 (colon adenocarcinoma) cells. Antitumor efficacy in a mouse xenograft model was also examined. The molecular mechanism of the anti-tumor effect and c-Myc suppression by SeV/dF/FIR was examined using Spliceostatin A (SSA), a SAP155 inhibitor, or SAP155 siRNA which induce c-Myc by increasing FIR∆exon2 in HeLa cells. RESULTS: FIR was found to repress c-myc transcription and in turn the overexpression of FIR drove apoptosis through c-myc suppression. Thus, FIR expressing vectors are potentially applicable for cancer therapy. FIR is alternatively spliced by SAP155 in cancer cells lacking the transcriptional repression domain within exon 2 (FIR∆exon2), counteracting FIR for c-Myc protein expression. Furthermore, FIR forms a complex with SAP155 and inhibits mutual well-established functions. Thus, both the valuable effects and side effects of exogenous FIR stimuli should be tested for future clinical application. SeV/dF/FIR, a cytoplasmic RNA virus, was successfully prepared and showed highly efficient gene transduction in in vivo experiments. Furthermore, in nude mouse tumor xenograft models, SeV/dF/FIR displayed high antitumor efficiency against human cancer cells. SeV/dF/FIR suppressed SSA-activated c-Myc. SAP155 siRNA, potentially produces FIR∆exon2, and led to c-Myc overexpression with phosphorylation at Ser62. HA-FIR suppressed endogenous c-Myc expression and induced apoptosis in HeLa and SW480 cells. A c-myc transcriptional suppressor FIR expressing SeV/dF/FIR showed high gene transduction efficiency with significant antitumor effects and apoptosis induction in HeLa and SW480 cells. CONCLUSION: SeV/dF/FIR showed strong tumor growth suppression with no significant side effects in an animal xenograft model, thus SeV/dF/FIR is potentially applicable for future clinical cancer treatment. PMID:24764668

Effect of Hammerhead Ribozyme against Human Thymidylate Synthase on the Cytotoxicity of Thymidylate Synthase Inhibitors

PubMed Central

Takemura, Yuzuru; Miyachi, Hayato; Skelton, Lorraine; Jackman, Ann L.

1995-01-01

One of the resistance mechanisms to folate‐based thymidylate synthase (TS) inhibitors is the increase in TS activity in tumor cells. Human B lymphoblastoid cell line (W1L2) was made resistant to a lipophilic non‐polyglutamatable TS inhibitor (ZM249148), and the subline (W1L2:R179) showed a 20‐fold increase in TS enzyme activity with concomitant overexpression of TS mRNA. To overcome the resistance, we designed a ribozyme that can cleave the CUC sequences in a triple tandemly repeated sequence of TS mRNA. Expression of this ribozyme in W1L2:R179 cells transfected with Epstein Barr virus‐based expression vector resulted in sensitization to TS inhibitors concomitantly with a decrease of TS expression. The ribozyme expressed in transfectants was shown to be functional in cleaving artificial TS RNA in vitro. PMID:8567390

Effect of NeuroD gene silencing on the migration and invasion of human pancreatic cancer cells PANC-1.

PubMed

Wang, Yang; Su, Dong Wei; Gao, Li; Ding, Gui Ling; Ni, Can Rong; Zhu, Ming Hua

2014-07-01

The aim of this study is to investigate the influence of Lenti-EGFP-NeuroD-miR, RNAi lentiviral expression vector, on the expression level of NeuroD and migration, and invasion of PANC-1 cell line. PANC-1 cells were cultured and cotransfected with Lenti-EGFP-NeuroD-miR and Lenti-GFP. The infection rate of lentivirus was determined by fluorescence. The interfering effection by the expression of NeuroD mRNA in PANC-1 cells was analyzed by real-time PCR after transfected. Biological behavior of PANC-1 cells transinfected was observed, and the migration and invasion were studied by transwell assay. Intrapancreatic allografts model in nude mice was established to observe the effects of NeuroD on tumorigenesis, tumor growth, and invasion in vivo. The expression of NeuroD mRNA decreased significantly after RNAi lentivirus transinfecting PANC-1 cell. The cell's migration and invasion ability decreased obviously as soon as down regulate of NeuroD in PANC-1 cells. Comparing with control group, the tumors were smaller in size and the invasiveness was inhibited after 8 weeks intrapancreatic allografts in nude mice. Lenti-EGFP-NeuroD-miR transfected into PANC-1 cells shows a stable, effective, and especial blocking expression of NeuroD in mRNA level. The RNAi of lentiviral vector target NeuroD can reduce the migration and invasion abilities of PANC-1 cells.

Silencing of p53 RNA through transarterial delivery ameliorates renal tubular injury and downregulates GSK-3β expression after ischemia-reperfusion injury.

PubMed

Fujino, Takayuki; Muhib, Sharifi; Sato, Nobuyuki; Hasebe, Naoyuki

2013-12-01

p53, a pivotal protein in the apoptotic pathway, has been identified as a mediator of transcriptional responses to ischemia-reperfusion (IR) injury. The characteristics and functional significance of the p53 response in vivo are largely unknown in IR-induced kidney injury. Therapeutic opportunities of delivering small interfering RNA (siRNA) via venous injection have gained recognition; however, systemic adverse effects of siRNA therapy should be considered. To prevent IR-induced kidney injury, we tested the efficacy of transarterial administration of siRNA targeting p53 (p53 siRNA). Female C57BL/6 mice underwent unilateral renal artery ischemia for 30 min, followed by reperfusion. siRNA experiments utilized short hairpin (sh) RNA plasmid-based approaches. Transfection of shRNA was performed using cationic polymer transfection reagent. Injection of synthetic p53 shRNA into the left renal artery just after ischemia improved tubular injury, apoptosis, and the swelling of mitochondria in cells of the thick ascending limb of Henle (mTALH) at the outer medullary regions. Staining of upregulated p53 was colocalized with the inducible expression of glycogen synthase kinase-3β (GSK-3β) at mTALH after IR injury. p53 shRNA inhibited GSK-3β expression and restored β-catenin expression at mTALH. For IR-induced kidney injury, transarterial delivery of p53 siRNA is an effective pharmacological intervention. Targeting siRNA to p53 leads to an attenuation of apoptosis and mitochondrial damage through the downregulation of GSK-3β expression and upregulation of β-catenin. Local delivery of vectors such as p53 siRNA through a transaortic catheter is clinically useful in reducing the adverse effect of siRNA-related therapy.

SPARC Expression Is Selectively Suppressed in Tumor Initiating Urospheres Isolated from As+3- and Cd+2-Transformed Human Urothelial Cells (UROtsa) Stably Transfected with SPARC.

PubMed

Slusser-Nore, Andrea; Larson-Casey, Jennifer L; Zhang, Ruowen; Zhou, Xu Dong; Somji, Seema; Garrett, Scott H; Sens, Donald A; Dunlevy, Jane R

2016-01-01

This laboratory previously analyzed the expression of SPARC in the parental UROtsa cells, their arsenite (As(+3)) and cadmium (Cd(+2))-transformed cell lines, and tumor transplants generated from the transformed cells. It was demonstrated that SPARC expression was down-regulated to background levels in Cd(+2)-and As(+3)-transformed UROtsa cells and tumor transplants compared to parental cells. In the present study, the transformed cell lines were stably transfected with a SPARC expression vector to determine the effect of SPARC expression on the ability of the cells to form tumors in immune-compromised mice. Real time PCR, western blotting, immunohistochemistry, and immunofluorescence were used to define the expression of SPARC in the As(+3)-and Cd(+2)-transformed cell lines, and urospheres isolated from these cell lines, following their stable transfection with an expression vector containing the SPARC open reading frame (ORF). Transplantation of the cultured cells into immune-compromised mice by subcutaneous injection was used to assess the effect of SPARC expression on tumors generated from the above cell lines and urospheres. It was shown that the As(+3)-and Cd(+2)-transformed UROtsa cells could undergo stable transfection with a SPARC expression vector and that the transfected cells expressed both SPARC mRNA and secreted protein. Tumors formed from these SPARC-transfected cells were shown to have no expression of SPARC. Urospheres isolated from cultures of the SPARC-transfected As(+3)-and Cd(+2)-transformed cell lines were shown to have only background expression of SPARC. Urospheres from both the non-transfected and SPARC-transfected cell lines were tumorigenic and thus fit the definition for a population of tumor initiating cells. Tumor initiating cells isolated from SPARC-transfected As(+3)-and Cd(+2)-transformed cell lines have an inherent mechanism to suppress the expression of SPARC mRNA.

SPARC Expression Is Selectively Suppressed in Tumor Initiating Urospheres Isolated from As+3- and Cd+2-Transformed Human Urothelial Cells (UROtsa) Stably Transfected with SPARC

PubMed Central

Slusser-Nore, Andrea; Larson-Casey, Jennifer L.; Zhang, Ruowen; Zhou, Xu Dong; Somji, Seema; Garrett, Scott H.; Sens, Donald A.; Dunlevy, Jane R.

2016-01-01

Background This laboratory previously analyzed the expression of SPARC in the parental UROtsa cells, their arsenite (As+3) and cadmium (Cd+2)-transformed cell lines, and tumor transplants generated from the transformed cells. It was demonstrated that SPARC expression was down-regulated to background levels in Cd+2-and As+3-transformed UROtsa cells and tumor transplants compared to parental cells. In the present study, the transformed cell lines were stably transfected with a SPARC expression vector to determine the effect of SPARC expression on the ability of the cells to form tumors in immune-compromised mice. Methods Real time PCR, western blotting, immunohistochemistry, and immunofluorescence were used to define the expression of SPARC in the As+3-and Cd+2-transformed cell lines, and urospheres isolated from these cell lines, following their stable transfection with an expression vector containing the SPARC open reading frame (ORF). Transplantation of the cultured cells into immune-compromised mice by subcutaneous injection was used to assess the effect of SPARC expression on tumors generated from the above cell lines and urospheres. Results It was shown that the As+3-and Cd+2-transformed UROtsa cells could undergo stable transfection with a SPARC expression vector and that the transfected cells expressed both SPARC mRNA and secreted protein. Tumors formed from these SPARC-transfected cells were shown to have no expression of SPARC. Urospheres isolated from cultures of the SPARC-transfected As+3-and Cd+2-transformed cell lines were shown to have only background expression of SPARC. Urospheres from both the non-transfected and SPARC-transfected cell lines were tumorigenic and thus fit the definition for a population of tumor initiating cells. Conclusions Tumor initiating cells isolated from SPARC-transfected As+3-and Cd+2-transformed cell lines have an inherent mechanism to suppress the expression of SPARC mRNA. PMID:26783756

Metastasis-associated gene 1 expression in human medulloblastoma and its association with invasion and metastasis in medulloblastoma Daoy cell lines.

PubMed

Chen, Y S; Li, S P; Xiao, H; Xie, Z Y; Tan, M X; Liu, B; Zhang, W M

2016-06-17

This study aims to investigate the expression of metastasis-associated gene 1 (MTA1) in human medulloblastoma, and its significance in the invasion and metastasis in a medulloblastoma cell line. Positive expression rate of MTA1 protein in medulloblastoma and adjacent normal tissues collected from 29 medulloblastoma patients was detected by immunohistochemistry assay in vivo. In in vitro experiments, Daoy cells were transfected with MTA1-targeted small interfering RNA (siRNA, MTA1-siRNA group), niRNA (MTA1-niRNA group), and plasmid vectors (control group). Transfection efficiency was evaluated by PT-PCR and western blot; cell adhesion, migration, and invasion capacity was assessed by adhesion assays, scratch assays, and transwell chamber invasion assays, respectively. Results indicated that the positive expression rate of MTA1 protein in the medulloblastoma tissues was higher as compared with that of the adjacent normal tissues (P < 0.05). In addition, mRNA and protein expression of MTA1 in the MTA1-siRNA group was lower than that in the control and MTA1- niRNA groups (P < 0.05). Adhesion, migration, and invasion capacity of Daoy cells in the MTA1-siRNA group was inhibited as compared with the control and MTA1-niRNA groups (P < 0.05). In conclusion, MTA1 expression was increased in medulloblastoma cells, while MTA1 knockdown in medulloblastoma cells inhibited MTA1 expression. In addition, MTA1 knockdown inhibited the adhesion, migration, and invasive capabilities of medulloblastoma cells. It is possible that MTA1 can serve as a biomarker and a potential therapeutic target for medulloblastoma.

[Cloning of human CD45 gene and its expression in Hela cells].

PubMed

Li, Jie; Xu, Tianyu; Wu, Lulin; Zhang, Liyun; Lu, Xiao; Zuo, Daming; Chen, Zhengliang

2015-11-01

To clone human CD45 gene PTPRC and establish Hela cells overexpressing recombinant human CD45 protein. The intact cDNA encoding human CD45 amplified using RT-PCR from the total RNA extracted from peripheral blood mononuclear cells (PBMCs) of a healthy donor was cloned into pMD-18T vector. The CD45 cDNA fragment amplified from the pMD-18T-CD45 by PCR was inserted to the coding region of the PcDNA3.1-3xflag vector, and the resultant recombinant expression vector PcDNA3.1-3xflag-CD45 was transfected into Hela cells. The expression of CD45 in Hela cells was detected by flow cytometry and Western blotting, and the phosphastase activity of CD45 was quantified using an alkaline phosphatase assay kit. The cDNA fragment of about 3 900 bp was amplified from human PBMCs and cloned into pMD-18T vector. The recombinant expression vector PcDNA3.1-3xflag-CD45 was constructed, whose restriction maps and sequence were consistent with those expected. The expression of CD45 in transfected Hela cells was detected by flow cytometry and Western blotting, and the expressed recombinant CD45 protein in Hela cells showed a phosphastase activity. The cDNA of human CD45 was successfully cloned and effectively expressed in Hela cells, which provides a basis for further exploration of the functions of CD45.

Generation of stable human cell lines with Tetracycline-inducible (Tet-on) shRNA or cDNA expression.

PubMed

Gomez-Martinez, Marta; Schmitz, Debora; Hergovich, Alexander

2013-03-05

A major approach in the field of mammalian cell biology is the manipulation of the expression of genes of interest in selected cell lines, with the aim to reveal one or several of the gene's function(s) using transient/stable overexpression or knockdown of the gene of interest. Unfortunately, for various cell biological investigations this approach is unsuitable when manipulations of gene expression result in cell growth/proliferation defects or unwanted cell differentiation. Therefore, researchers have adapted the Tetracycline repressor protein (TetR), taken from the E. coli tetracycline resistance operon(1), to generate very efficient and tight regulatory systems to express cDNAs in mammalian cells(2,3). In short, TetR has been modified to either (1) block initiation of transcription by binding to the Tet-operator (TO) in the promoter region upon addition of tetracycline (termed Tet-off system) or (2) bind to the TO in the absence of tetracycline (termed Tet-on system) (Figure 1). Given the inconvenience that the Tet-off system requires the continuous presence of tetracycline (which has a half-life of about 24 hr in tissue cell culture medium) the Tet-on system has been more extensively optimized, resulting in the development of very tight and efficient vector systems for cDNA expression as used here. Shortly after establishment of RNA interference (RNAi) for gene knockdown in mammalian cells(4), vectors expressing short-hairpin RNAs (shRNAs) were described that function very similar to siRNAs(5-11). However, these shRNA-mediated knockdown approaches have the same limitation as conventional knockout strategies, since stable depletion is not feasible when gene targets are essential for cellular survival. To overcome this limitation, van de Wetering et al.(12) modified the shRNA expression vector pSUPER(5) by inserting a TO in the promoter region, which enabled them to generate stable cell lines with tetracycline-inducible depletion of their target genes of interest. Here, we describe a method to efficiently generate stable human Tet-on cell lines that reliably drive either inducible overexpression or depletion of the gene of interest. Using this method, we have successfully generated Tet-on cell lines which significantly facilitated the analysis of the MST/hMOB/NDR cascade in centrosome(13,14) and apoptosis signaling(15,16). In this report, we describe our vectors of choice, in addition to describing the two consecutive manipulation steps that are necessary to efficiently generate human Tet-on cell lines (Figure 2). Moreover, besides outlining a protocol for the generation of human Tet-on cell lines, we will discuss critical aspects regarding the technical procedures and the characterization of Tet-on cells.

Human HOXA5 homeodomain enhances protein transduction and its application to vascular inflammation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Ji Young; Park, Kyoung sook; Cho, Eun Jung

2011-07-01

Highlights: {yields} We have developed an E. coli protein expression vector including human specific gene sequences for protein cellular delivery. {yields} The plasmid was generated by ligation the nucleotides 770-817 of the homeobox A5 mRNA sequence. {yields} HOXA5-APE1/Ref-1 inhibited TNF-alpha-induced monocyte adhesion to endothelial cells. {yields} Human HOXA5-PTD vector provides a powerful research tools for uncovering cellular functions of proteins or for the generation of human PTD-containing proteins. -- Abstract: Cellular protein delivery is an emerging technique by which exogenous recombinant proteins are delivered into mammalian cells across the membrane. We have developed an Escherichia coli expression vector including humanmore » specific gene sequences for protein cellular delivery. The plasmid was generated by ligation the nucleotides 770-817 of the homeobox A5 mRNA sequence which was matched with protein transduction domain (PTD) of homeodomain protein A5 (HOXA5) into pET expression vector. The cellular uptake of HOXA5-PTD-EGFP was detected in 1 min and its transduction reached a maximum at 1 h within cell lysates. The cellular uptake of HOXA5-EGFP at 37 {sup o}C was greater than in 4 {sup o}C. For study for the functional role of human HOXA5-PTD, we purified HOXA5-APE1/Ref-1 and applied it on monocyte adhesion. Pretreatment with HOXA5-APE1/Ref-1 (100 nM) inhibited TNF-{alpha}-induced monocyte adhesion to endothelial cells, compared with HOXA5-EGFP. Taken together, our data suggested that human HOXA5-PTD vector provides a powerful research tools for uncovering cellular functions of proteins or for the generation of human PTD-containing proteins.« less

EWS Knockdown and Taxifolin Treatment Induced Differentiation and Removed DNA Methylation from p53 Promoter to Promote Expression of Puma and Noxa for Apoptosis in Ewing’s Sarcoma

PubMed Central

Hossain, Mohammad Motarab; Ray, Swapan Kumar

2016-01-01

Ewing’s sarcoma is a pediatric tumor that mainly occurs in soft tissues and bones. Malignant characteristics of Ewing’s sarcoma are correlated with expression of EWS oncogene. We achieved knockdown of EWS expression using a plasmid vector encoding EWS short hairpin RNA (shRNA) to increase anti-tumor mechanisms of taxifolin (TFL), a new flavonoid, in human Ewing’s sarcoma cells in culture and animal models. Immunofluorescence microscopy and flow cytometric analysis showed high expression of EWS in human Ewing’s sarcoma SK-N-MC and RD-ES cell lines. EWS shRNA plus TFL inhibited 80% cell viability and caused the highest decreases in EWS expression at mRNA and protein levels in both cell lines. Knockdown of EWS expression induced morphological features of differentiation. EWS shRNA plus TFL caused more alterations in molecular markers of differentiation than either agent alone. EWS shRNA plus TFL caused the highest decreases in cell migration with inhibition of survival, angiogenic and invasive factors. Knockdown of EWS expression was associated with removal of DNA methylation from p53 promoter, promoting expression of p53, Puma, and Noxa. EWS shRNA plus TFL induced the highest amounts of apoptosis with activation of extrinsic and intrinsic pathways in both cell lines in culture. EWS shRNA plus TFL also inhibited growth of Ewing’s sarcoma tumors in animal models due to inhibition of differentiation inhibitors and angiogenic and invasive factors and also induction of activation of caspase-3 for apoptosis. Collectively, knockdown of EWS expression increased various anti-tumor mechanisms of TFL in human Ewing’s sarcoma in cell culture and animal models. PMID:27547487

EWS Knockdown and Taxifolin Treatment Induced Differentiation and Removed DNA Methylation from p53 Promoter to Promote Expression of Puma and Noxa for Apoptosis in Ewing's Sarcoma.

PubMed

Hossain, Mohammad Motarab; Ray, Swapan Kumar

2014-10-01

Ewing's sarcoma is a pediatric tumor that mainly occurs in soft tissues and bones. Malignant characteristics of Ewing's sarcoma are correlated with expression of EWS oncogene. We achieved knockdown of EWS expression using a plasmid vector encoding EWS short hairpin RNA (shRNA) to increase anti-tumor mechanisms of taxifolin (TFL), a new flavonoid, in human Ewing's sarcoma cells in culture and animal models. Immunofluorescence microscopy and flow cytometric analysis showed high expression of EWS in human Ewing's sarcoma SK-N-MC and RD-ES cell lines. EWS shRNA plus TFL inhibited 80% cell viability and caused the highest decreases in EWS expression at mRNA and protein levels in both cell lines. Knockdown of EWS expression induced morphological features of differentiation. EWS shRNA plus TFL caused more alterations in molecular markers of differentiation than either agent alone. EWS shRNA plus TFL caused the highest decreases in cell migration with inhibition of survival, angiogenic and invasive factors. Knockdown of EWS expression was associated with removal of DNA methylation from p53 promoter, promoting expression of p53, Puma, and Noxa. EWS shRNA plus TFL induced the highest amounts of apoptosis with activation of extrinsic and intrinsic pathways in both cell lines in culture. EWS shRNA plus TFL also inhibited growth of Ewing's sarcoma tumors in animal models due to inhibition of differentiation inhibitors and angiogenic and invasive factors and also induction of activation of caspase-3 for apoptosis. Collectively, knockdown of EWS expression increased various anti-tumor mechanisms of TFL in human Ewing's sarcoma in cell culture and animal models.

Aquaporin water channel AgAQP1 in the malaria vector mosquito Anopheles gambiae during blood feeding and humidity adaptation

PubMed Central

Liu, Kun; Tsujimoto, Hitoshi; Cha, Sung-Jae; Agre, Peter; Rasgon, Jason L.

2011-01-01

Altered patterns of malaria endemicity reflect, in part, changes in feeding behavior and climate adaptation of mosquito vectors. Aquaporin (AQP) water channels are found throughout nature and confer high-capacity water flow through cell membranes. The genome of the major malaria vector mosquito Anopheles gambiae contains at least seven putative AQP sequences. Anticipating that transmembrane water movements are important during the life cycle of A. gambiae, we identified and characterized the A. gambiae aquaporin 1 (AgAQP1) protein that is homologous to AQPs known in humans, Drosophila, and sap-sucking insects. When expressed in Xenopus laevis oocytes, AgAQP1 transports water but not glycerol. Similar to mammalian AQPs, water permeation of AgAQP1 is inhibited by HgCl2 and tetraethylammonium, with Tyr185 conferring tetraethylammonium sensitivity. AgAQP1 is more highly expressed in adult female A. gambiae mosquitoes than in males. Expression is high in gut, ovaries, and Malpighian tubules where immunofluorescence microscopy reveals that AgAQP1 resides in stellate cells but not principal cells. AgAQP1 expression is up-regulated in fat body and ovary by blood feeding but not by sugar feeding, and it is reduced by exposure to a dehydrating environment (42% relative humidity). RNA interference reduces AgAQP1 mRNA and protein levels. In a desiccating environment (<20% relative humidity), mosquitoes with reduced AgAQP1 protein survive significantly longer than controls. These studies support a role for AgAQP1 in water homeostasis during blood feeding and humidity adaptation of A. gambiae, a major mosquito vector of human malaria in sub-Saharan Africa. PMID:21444767

Intraperitoneal AAV9-shRNA inhibits target expression in neonatal skeletal and cardiac muscles.

PubMed

Mayra, Azat; Tomimitsu, Hiroyuki; Kubodera, Takayuki; Kobayashi, Masaki; Piao, Wenying; Sunaga, Fumiko; Hirai, Yukihiko; Shimada, Takashi; Mizusawa, Hidehiro; Yokota, Takanori

2011-02-11

Systemic injections of AAV vectors generally transduce to the liver more effectively than to cardiac and skeletal muscles. The short hairpin RNA (shRNA)-expressing AAV9 (shRNA-AAV9) can also reduce target gene expression in the liver, but not enough in cardiac or skeletal muscles. Higher doses of shRNA-AAV9 required for inhibiting target genes in cardiac and skeletal muscles often results in shRNA-related toxicity including microRNA oversaturation that can induce fetal liver failure. In this study, we injected high-dose shRNA-AAV9 to neonates and efficiently silenced genes in cardiac and skeletal muscles without inducing liver toxicity. This is because AAV is most likely diluted or degraded in the liver than in cardiac or skeletal muscle during cell division after birth. We report that this systemically injected shRNA-AAV method does not induce any major side effects, such as liver dysfunction, and the dose of shRNA-AAV is sufficient for gene silencing in skeletal and cardiac muscle tissues. This novel method may be useful for generating gene knockdown in skeletal and cardiac mouse tissues, thus providing mouse models useful for analyzing diseases caused by loss-of-function of target genes. Copyright © 2011 Elsevier Inc. All rights reserved.

Construction of Hyaluronic Tetrasaccharide Clusters Modified Polyamidoamine siRNA Delivery System.

PubMed

Ma, Yingcong; Sha, Meng; Cheng, Shixuan; Yao, Wang; Li, Zhongjun; Qi, Xian-Rong

2018-06-14

The CD44 protein, as a predominant receptor for hyaluronan (HA), is highly expressed on the surface of multiple tumor cells. HA, as a targeting molecule for a CD44-contained delivery system, increases intracellular drug concentration in tumor tissue. However, due to the weak binding ability of hyaluronan oligosaccharide to CD44, targeting for tumor drug delivery has been restricted. In this study, we first use a HA tetrasaccharide cluster as the target ligand to enhance the binding ability to CD44. A polyamidoamine (PAMAM) dendrimer was modified by a HA tetrasaccharide cluster as a nonviral vector for small interfering RNA (siRNA) delivery. The dendrimer/siRNA nanocomplexes increased the cellular uptake capacity of siRNA through the CD44 receptor-mediated endocytosis pathway, allowing the siRNA to successfully escape the endosome/lysosome. Compared with the control group, nanocomplexes effectively reduced the expression of GFP protein and mRNA in MDA-MB-231-GFP cells. This delivery system provides a foundation to increase the clinical applications of PAMAM nanomaterials.

Molecular interactions and immune responses between Maize fine streak virus and the leafhopper vector Graminella nigrifrons through differential expression and RNA interference.

PubMed

Chen, Y; Redinbaugh, M G; Michel, A P

2015-06-01

Graminella nigrifrons is the only known vector for Maize fine streak virus (MFSV). In this study, we used real-time quantitative PCR to compare the expression profiles of transcripts that putatively function in the insect immune response: four peptidoglycan recognition proteins (PGRP-SB1, -SD, -LC and LB), Toll, spaetzle, defensin, Dicer-2 (Dcr-2), Argonaut-2 (Ago-2) and Arsenic resistance protein 2 (Ars-2). Except for PGRP-LB and defensin, transcripts involved in humoral pathways were significantly suppressed in G. nigrifrons fed on MFSV-infected maize. The abundance of three RNA interference (RNAi) pathway transcripts (Dcr-2, Ago-2, Ars-2) was significantly lower in nontransmitting relative to transmitting G. nigrifrons. Injection with double-stranded RNA (dsRNA) encoding segments of the PGRP-LC and Dcr-2 transcripts effectively reduced transcript levels by 90 and 75% over 14 and 22 days, respectively. MFSV acquisition and transmission were not significantly affected by injection of either dsRNA. Knock-down of PGRP-LC resulted in significant mortality (greater than 90%) at 27 days postinjection, and resulted in more abnormal moults relative to those injected with Dcr-2 or control dsRNA. The use of RNAi to silence G. nigrifrons transcripts will facilitate the study of gene function and pathogen transmission, and may provide approaches for developing novel targets of RNAi-based pest control. © 2015 The Royal Entomological Society.

Chitosan nanoparticle carrying small interfering RNA to platelet-derived growth factor B mRNA inhibits proliferation of smooth muscle cells in rabbit injured arteries.

PubMed

Xia, He; Jun, Ji; Wen-Ping, Ling; Yi-Feng, Pan; Xiao-Ling, Chen

2013-10-01

The purpose of this study was to elucidate the transfection of chitosan nanoparticle carrying small interfering RNA against platelet-derived growth factor B (PDGF-B) to inhibit the expression of PDGF-B mRNA and proliferation of smooth muscle cells. A rabbit iliac artery injury model was constructed. A small interfering RNA (siRNA) against PDGF-B mRNA expression vector was constructed and packaged by chitosan nanoparticle to transfect into the vascular smooth muscle cells (vSMCs) of balloon catheter-injured rabbit iliac artery wall, using a therapeutic ultrasound for the gene delivery. The experiment was divided into two groups: experimental group, denudation and nano-PDGF-B siRNA treated, and only single denudation as control. Effects of the siRNA on the expressions of proliferating cell nuclear antigen (PCNA) and PDGF-B mRNA by vSMCs and the proliferation of vSMCs were observed with the methods of routine pathological, immunohistochemical staining, in situ hybridization and morphometry. The nano siRNA against PDGF-B was successfully transfected. The nano siRNA significantly inhibited the expressions of PCNA and PDGF-B mRNA in intimal vSMCs. The local intimal thickness and area were also reduced remarkably. In conclusion, transfection of chitosan nanoparticle carrying siRNA against PDGF-B mRNA could inhibit proliferation of vSMCs in the rabbit iliac artery injury model. © The Author(s) 2013 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

Use and comparison of different internal ribosomal entry sites (IRES) in tricistronic retroviral vectors

PubMed Central

Douin, Victorine; Bornes, Stephanie; Creancier, Laurent; Rochaix, Philippe; Favre, Gilles; Prats, Anne-Catherine; Couderc, Bettina

2004-01-01

Background Polycistronic retroviral vectors that contain several therapeutic genes linked via internal ribosome entry sites (IRES), provide new and effective tools for the co-expression of exogenous cDNAs in clinical gene therapy protocols. For example, tricistronic retroviral vectors could be used to genetically modify antigen presenting cells, enabling them to express different co-stimulatory molecules known to enhance tumor cell immunogenicity. Results We have constructed and compared different retroviral vectors containing two co-stimulatory molecules (CD70, CD80) and selectable marker genes linked to different IRES sequences (IRES from EMCV, c-myc, FGF-2 and HTLV-1). The tricistronic recombinant amphotropic viruses containing the IRES from EMCV, FGF-2 or HTLV-1 were equally efficient in inducing the expression of an exogenous gene in the transduced murine or human cells, without displaying any cell type specificity. The simultaneous presence of several IRESes on the same mRNA, however, can induce the differential expression of the various cistrons. Here we show that the IRESes of HTLV-1 and EMCV interfere with the translation induced by other IRESes in mouse melanoma cells. The IRES from FGF-2 did however induce the expression of exogenous cDNA in human melanoma cells without any positive or negative regulation from the other IRESs present within the vectors. Tumor cells that were genetically modified with the tricistronic retroviral vectors, were able to induce an in vivo anti-tumor immune response in murine models. Conclusion Translation of the exogenous gene is directed by the IRES and its high level of expression not only depends on the type of cell that is transduced but also on the presence of other genetic elements within the vector. PMID:15279677

CRISPR/Cas9 mediates efficient conditional mutagenesis in Drosophila.

PubMed

Xue, Zhaoyu; Wu, Menghua; Wen, Kejia; Ren, Menda; Long, Li; Zhang, Xuedi; Gao, Guanjun

2014-09-05

Existing transgenic RNA interference (RNAi) methods greatly facilitate functional genome studies via controlled silencing of targeted mRNA in Drosophila. Although the RNAi approach is extremely powerful, concerns still linger about its low efficiency. Here, we developed a CRISPR/Cas9-mediated conditional mutagenesis system by combining tissue-specific expression of Cas9 driven by the Gal4/upstream activating site system with various ubiquitously expressed guide RNA transgenes to effectively inactivate gene expression in a temporally and spatially controlled manner. Furthermore, by including multiple guide RNAs in a transgenic vector to target a single gene, we achieved a high degree of gene mutagenesis in specific tissues. The CRISPR/Cas9-mediated conditional mutagenesis system provides a simple and effective tool for gene function analysis, and complements the existing RNAi approach. Copyright © 2014 Xue et al.

Suppression of the Epidermal Growth Factor-like Domain 7 and Inhibition of Migration and Epithelial-Mesenchymal Transition in Human Pancreatic Cancer PANC-1 Cells.

PubMed

Wang, Yun-Liang; Dong, Feng-Lin; Yang, Jian; Li, Zhi; Zhi, Qiao-Ming; Zhao, Xin; Yang, Yong; Li, De-Chun; Shen, Xiao-Chun; Zhou, Jin

2015-01-01

Epidermal growth factor-like domain multiple 7 (EGFL7), a secreted protein specifically expressed by endothelial cells during embryogenesis, recently was identified as a critical gene in tumor metastasis. Epithelial-mesenchymal transition (EMT) was found to be closely related with tumor progression. Accordingly, it is important to investigate the migration and EMT change after knock-down of EGFL7 gene expression in human pancreatic cancer cells. EGFL7 expression was firstly testified in 4 pancreatic cancer cell lines by real-time polymerase chain reaction (Real-time PCR) and western blot, and the highest expression of EGFL7 was found in PANC-1 cell line. Then, PANC-1 cells transfected with small interference RNA (siRNA) of EGFL7 using plasmid vector were named si-PANC-1, while transfected with negative control plasmid vector were called NC-PANC-1. Transwell assay was used to analyze the migration of PANC-1 cells. Real-time PCR and western blotting were used to detect the expression change of EGFL7 gene, EMT markers like E-Cadherin, N-Cadherin, Vimentin, Fibronectin and transcription factors like snail, slug in PANC-1, NC- PANC-1, and si-PANC-1 cells, respectively. After successful plasmid transfection, EGFL7 gene were dramatically knock-down by RNA interference in si-PANC-1 group. Meanwhile, migration ability decreased significantly, compared with PANC-1 and NC-PANC-1 group. Meanwhile, the expression of epithelial phenotype marker E-Cadherin increased and that of mesenchymal phenotype markers N-Cadherin, Vimentin, Fibronectin dramatically decreased in si-PANC-1 group, indicating a reversion of EMT. Also, transcription factors snail and slug decreased significantly after RNA interference. Current study suggested that highly-expressed EGFL7 promotes migration of PANC-1 cells and acts through transcription factors snail and slug to induce EMT, and further study is needed to confirm this issue.

[Effect of Golgi α-mannosidase 2 (GM2) gene knockdown on adhesion abilities of human gastric carcinoma cell line BGC-823 and its mechanism].

PubMed

Zeng, Bo; Zeng, Zhen; Liu, Chang; Yang, Yaying

2017-06-01

Objective To investigate the effect of Golgi α-mannosidase II (GM2) gene knockdown on adhesion abilities of BGC-823 human gastric carcinoma cells. Methods Three plasmid vectors expressing GM2 shRNAs and a negative control plasmid vector were designed, constructed and then transfected into BGC-823 cells by Lipofectamine TM 2000. After transfection, the mRNA and protein levels of GM2 in BGC-823 cells were detected by real-time quantitative PCR (qRT-PCR) and Western blotting to evaluate the transfection efficacy. The best plasmid for GM2 gene knockdown was selected and stably transfected into BGC-823 cells. Adhesion abilities of BGC-823 cells after GM2 gene silencing were observed by cell-cell, cell-matrix and cell-endothelial cell adhesion assays. At the same time, the expressions of E-cadherin, P-selectin, CD44v6 and intercellular adhesion molecule-1 (ICAM-1) proteins were detected by Western blotting after GM2 gene knockdown. Results The expression of GM2 was effectively knockdown in GM2-shRNA-2-transfected BGC-823 cells. Compared with the blank control group and the negative control group, the intercellular adhesion ability of the GM2-shRNA-2-transfected cells increased significantly, while their cell-matrix and cell-endothelium adhesion abilities markedly decreased. In GM2-shRNA-2 transfection group, E-cadherin expression was significantly elevated and the P-selectin expression was significantly reduced, while the expression levels of CD44v6 and ICAM-1 were not obviously changed. Conclusion After GM2 gene knockdown, the intercellular adhesion ability of gastric carcinoma BGC-823 cells is enhanced, while the adhesion abilities with the extracellular matrix and endothelial cells are weakened. The changes might be related to the up-regulated expression of E-cadherin and the down-regulation of P-selectin.

MRI roadmap-guided transendocardial delivery of exon-skipping recombinant adeno-associated virus restores dystrophin expression in a canine model of Duchenne muscular dystrophy.

PubMed

Barbash, I M; Cecchini, S; Faranesh, A Z; Virag, T; Li, L; Yang, Y; Hoyt, R F; Kornegay, J N; Bogan, J R; Garcia, L; Lederman, R J; Kotin, R M

2013-03-01

Duchenne muscular dystrophy (DMD) cardiomyopathy patients currently have no therapeutic options. We evaluated catheter-based transendocardial delivery of a recombinant adeno-associated virus (rAAV) expressing a small nuclear U7 RNA (U7smOPT) complementary to specific cis-acting splicing signals. Eliminating specific exons restores the open reading frame resulting in translation of truncated dystrophin protein. To test this approach in a clinically relevant DMD model, golden retriever muscular dystrophy (GRMD) dogs received serotype 6 rAAV-U7smOPT via the intracoronary or transendocardial route. Transendocardial injections were administered with an injection-tipped catheter and fluoroscopic guidance using X-ray fused with magnetic resonance imaging (XFM) roadmaps. Three months after treatment, tissues were analyzed for DNA, RNA, dystrophin protein, and histology. Whereas intracoronary delivery did not result in effective transduction, transendocardial injections, XFM guidance, enabled 30±10 non-overlapping injections per animal. Vector DNA was detectable in all samples tested and ranged from <1 to >3000 vector genome copies per cell. RNA analysis, western blot analysis, and immunohistology demonstrated extensive expression of skipped RNA and dystrophin protein in the treated myocardium. Left ventricular function remained unchanged over a 3-month follow-up. These results demonstrated that effective transendocardial delivery of rAAV-U7smOPT was achieved using XFM. This approach restores an open reading frame for dystrophin in affected dogs and has potential clinical utility.

[Knockdown of STAT3 inhibits proliferation and migration of HepG2 hepatoma cells induced by IFN1].

PubMed

Li, Xiaofang; Wang, Yuqi; Yan, Ben; Fang, Peipei; Ma, Chao; Xu, Ning; Fu, Xiaoyan; Liang, Shujuan

2018-02-01

Objective To prepare lentiviruses expressing shRNA sequences targeting human signal transducer and activator of transcription 3 (STAT3) and detect the effect of STAT3 knockdown on type I interferon (IFN1)-induced proliferation and migration in HepG2 cells. Methods Four STAT3-targeting shRNA sequences (shRNA1-shRNA4) and one control sequence (Ctrl shRNA) were selected and cloned respectively into pLKO.1-sp6-pgk-GFP to construct shRNA-expressing vectors. Along with backbone psPAX2 and pMD2.G vectors, they were separately transfected into HEK293T cells to prepare lentiviruses. HepG2 cells were infected with the lentiviruses. Cytoplastic STAT3 level was detected by Western blotting to screen effective shRNA sequence(s) targeting STAT3. Proliferation and migration of HepG2 cells were analyzed by CCK-8 assay and Transwell TM migration and scratching assay, respectively. To detect the effect of IFN1 on cell proliferation and migration of HepG2 cells, the cells were treated with 2000 U/mL IFNα2b for indicated time and the activation of IFN-triggered STAT1 signal transduction was assayed by Western blotting. Results Two most effective STAT3-targeting shRNA sequences shRNA1 and shRNA2 were selected, and the expression of both STAT3 shRNA significantly decreased proliferation and migration of HepG2 cells. When treated with IFNα2b, 2000 U/mL of IFN1 showed more competent in attenuating growth and migration of HepG2 cells. Our data further proved that knockdown of STAT3 increased the phosphorylation of STAT1, and IFNα2b further enhanced the activation of STAT1 signaling in HepG2 cells. Conclusion Knockdown of STAT3 inhibits cell migration and growth, and rescues IFN response through up-regulating STAT1 signal transduction in HepG2 hepatoma cells.

Reverse genetics of measles virus and resulting multivalent recombinant vaccines: applications of recombinant measles viruses.

PubMed

Billeter, M A; Naim, H Y; Udem, S A

2009-01-01

An overview is given on the development of technologies to allow reverse genetics of RNA viruses, i.e., the rescue of viruses from cDNA, with emphasis on nonsegmented negative-strand RNA viruses (Mononegavirales), as exemplified for measles virus (MV). Primarily, these technologies allowed site-directed mutagenesis, enabling important insights into a variety of aspects of the biology of these viruses. Concomitantly, foreign coding sequences were inserted to (a) allow localization of virus replication in vivo through marker gene expression, (b) develop candidate multivalent vaccines against measles and other pathogens, and (c) create candidate oncolytic viruses. The vector use of these viruses was experimentally encouraged by the pronounced genetic stability of the recombinants unexpected for RNA viruses, and by the high load of insertable genetic material, in excess of 6 kb. The known assets, such as the small genome size of the vector in comparison to DNA viruses proposed as vectors, the extensive clinical experience of attenuated MV as vaccine with a proven record of high safety and efficacy, and the low production cost per vaccination dose are thus favorably complemented.

Involvement of LeMDR, an ATP-binding cassette protein gene, in shikonin transport and biosynthesis in Lithospermum erythrorhizon.

PubMed

Zhu, Yu; Lu, Gui-Hua; Bian, Zhuo-Wu; Wu, Feng-Yao; Pang, Yan-Jun; Wang, Xiao-Ming; Yang, Rong-Wu; Tang, Cheng-Yi; Qi, Jin-Liang; Yang, Yong-Hua

2017-11-13

Shikonin is a naphthoquinone secondary metabolite with important medicinal value and is found in Lithospermum erythrorhizon. Considering the limited knowledge on the membrane transport mechanism of shikonin, this study investigated such molecular mechanism. We successfully isolated an ATP-binding cassette protein gene, LeMDR, from L. erythrorhizon. LeMDR is predominantly expressed in L. erythrorhizon roots, where shikonin accumulated. Functional analysis of LeMDR by using the yeast cell expression system revealed that LeMDR is possibly involved in the shikonin efflux transport. The accumulation of shikonin is lower in yeast cells transformed with LeMDR-overexpressing vector than that with empty vector. The transgenic hairy roots of L. erythrorhizon overexpressing LeMDR (MDRO) significantly enhanced shikonin production, whereas the RNA interference of LeMDR (MDRi) displayed a reverse trend. Moreover, the mRNA expression level of LeMDR was up-regulated by treatment with shikonin and shikonin-positive regulators, methyl jasmonate and indole-3-acetic acid. There might be a relationship of mutual regulation between the expression level of LeMDR and shikonin biosynthesis. Our findings demonstrated the important role of LeMDR in transmembrane transport and biosynthesis of shikonin.

Effects of Homology Length in the Repeat Region on Minus-Strand DNA Transfer and Retroviral Replication

PubMed Central

Dang, Que; Hu, Wei-Shau

2001-01-01

Homology between the two repeat (R) regions in the retroviral genome mediates minus-strand DNA transfer during reverse transcription. We sought to define the effects of R homology lengths on minus-strand DNA transfer. We generated five murine leukemia virus (MLV)-based vectors that contained identical sequences but different lengths of the 3′ R (3, 6, 12, 24 and 69 nucleotides [nt]); 69 nt is the full-length MLV R. After one round of replication, viral titers from the vector with a full-length downstream R were compared with viral titers generated from the other four vectors with reduced R lengths. Viral titers generated from vectors with R lengths reduced to one-third (24 nt) or one-sixth (12 nt) that of the wild type were not significantly affected; however, viral titers generated from vectors with only 3- or 6-nt homology in the R region were significantly lower. Because expression and packaging of the RNA were similar among all the vectors, the differences in the viral titers most likely reflected the impact of the homology lengths on the efficiency of minus-strand DNA transfer. The molecular nature of minus-strand DNA transfer was characterized in 63 proviruses. Precise R-to-R transfer was observed in most proviruses generated from vectors with 12-, 24-, or 69-nt homology in R, whereas aberrant transfers were predominantly used to generate proviruses from vectors with 3- or 6-nt homology. Reverse transcription using RNA transcribed from an upstream promoter, termed read-in RNA transcripts, resulted in most of the aberrant transfers. These data demonstrate that minus-strand DNA transfer is homology driven and a minimum homology length is required for accurate and efficient minus-strand DNA transfer. PMID:11134294

The Heterologous Expression of the p22 RNA Silencing Suppressor of the Crinivirus Tomato Chlorosis Virus from Tobacco Rattle Virus and Potato Virus X Enhances Disease Severity but Does Not Complement Suppressor-Defective Mutant Viruses.

PubMed

Landeo-Ríos, Yazmín; Navas-Castillo, Jesús; Moriones, Enrique; Cañizares, M. Carmen

2017-11-24

To counteract host antiviral RNA silencing, plant viruses express suppressor proteins that function as pathogenicity enhancers. The genome of the Tomato chlorosis virus (ToCV) (genus Crinivirus , family Closteroviridae ) encodes an RNA silencing suppressor, the protein p22, that has been described as having one of the longest lasting local suppressor activities when assayed in Nicotiana benthamiana . Since suppression of RNA silencing and the ability to enhance disease severity are closely associated, we analyzed the effect of expressing p22 in heterologous viral contexts. Thus, we studied the effect of the expression of ToCV p22 from viral vectors Tobacco rattle virus (TRV) and Potato virus X (PVX), and from attenuated suppressor mutants in N. benthamiana plants. Our results show that although an exacerbation of disease symptoms leading to plant death was observed in the heterologous expression of ToCV p22 from both viruses, only in the case of TRV did increased viral accumulation occur. The heterologous expression of ToCV p22 could not complement suppressor-defective mutant viruses.

CCR5 Gene Disruption via Lentiviral Vectors Expressing Cas9 and Single Guided RNA Renders Cells Resistant to HIV-1 Infection

PubMed Central

Liu, Jingjing; Zhang, Di; Kimata, Jason T.; Zhou, Paul

2014-01-01

CCR5, a coreceptor for HIV-1 entry, is a major target for drug and genetic intervention against HIV-1. Genetic intervention strategies have knocked down CCR5 expression levels by shRNA or disrupted the CCR5 gene using zinc finger nucleases (ZFN) or Transcription activator-like effector nuclease (TALEN). In the present study, we silenced CCR5 via CRISPR associated protein 9 (Cas9) and single guided RNAs (sgRNAs). We constructed lentiviral vectors expressing Cas9 and CCR5 sgRNAs. We show that a single round transduction of lentiviral vectors expressing Cas9 and CCR5 sgRNAs into HIV-1 susceptible human CD4+ cells yields high frequencies of CCR5 gene disruption. CCR5 gene-disrupted cells are not only resistant to R5-tropic HIV-1, including transmitted/founder (T/F) HIV-1 isolates, but also have selective advantage over CCR5 gene-undisrupted cells during R5-tropic HIV-1 infection. Importantly, using T7 endonuclease I assay we did not detect genome mutations at potential off-target sites that are highly homologous to these CCR5 sgRNAs in stably transduced cells even at 84 days post transduction. Thus we conclude that silencing of CCR5 via Cas9 and CCR5-specific sgRNAs could be a viable alternative strategy for engineering resistance against HIV-1. PMID:25541967

Persistent interferon transgene expression by RNA interference-mediated silencing of interferon receptors.

PubMed

Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu

2010-09-01

The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.

A modular toolset for recombination transgenesis and neurogenetic analysis of Drosophila.

PubMed

Wang, Ji-Wu; Beck, Erin S; McCabe, Brian D

2012-01-01

Transgenic Drosophila have contributed extensively to our understanding of nervous system development, physiology and behavior in addition to being valuable models of human neurological disease. Here, we have generated a novel series of modular transgenic vectors designed to optimize and accelerate the production and analysis of transgenes in Drosophila. We constructed a novel vector backbone, pBID, that allows both phiC31 targeted transgene integration and incorporates insulator sequences to ensure specific and uniform transgene expression. Upon this framework, we have built a series of constructs that are either backwards compatible with existing restriction enzyme based vectors or utilize Gateway recombination technology for high-throughput cloning. These vectors allow for endogenous promoter or Gal4 targeted expression of transgenic proteins with or without fluorescent protein or epitope tags. In addition, we have generated constructs that facilitate transgenic splice isoform specific RNA inhibition of gene expression. We demonstrate the utility of these constructs to analyze proteins involved in nervous system development, physiology and neurodegenerative disease. We expect that these reagents will facilitate the proficiency and sophistication of Drosophila genetic analysis in both the nervous system and other tissues.

Interplays between Soil-Borne Plant Viruses and RNA Silencing-Mediated Antiviral Defense in Roots

PubMed Central

Andika, Ida Bagus; Kondo, Hideki; Sun, Liying

2016-01-01

Although the majority of plant viruses are transmitted by arthropod vectors and invade the host plants through the aerial parts, there is a considerable number of plant viruses that infect roots via soil-inhabiting vectors such as plasmodiophorids, chytrids, and nematodes. These soil-borne viruses belong to diverse families, and many of them cause serious diseases in major crop plants. Thus, roots are important organs for the life cycle of many viruses. Compared to shoots, roots have a distinct metabolism and particular physiological characteristics due to the differences in development, cell composition, gene expression patterns, and surrounding environmental conditions. RNA silencing is an important innate defense mechanism to combat virus infection in plants, but the specific information on the activities and molecular mechanism of RNA silencing-mediated viral defense in root tissue is still limited. In this review, we summarize and discuss the current knowledge regarding RNA silencing aspects of the interactions between soil-borne viruses and host plants. Overall, research evidence suggests that soil-borne viruses have evolved to adapt to the distinct mechanism of antiviral RNA silencing in roots. PMID:27695446

Stabilization of Clostridium perfringens collagenase mRNA by VR-RNA-dependent cleavage in 5' leader sequence.

PubMed

Obana, Nozomu; Shirahama, Yu; Abe, Kimihiro; Nakamura, Kouji

2010-09-01

The small RNA (sRNA), VR-RNA that is directly regulated by the VirR/VirS two-component system, regulates many genes including toxin genes such as collagenase (colA) and phospholipase C (plc) in Clostridium perfringens. Although the VR-RNA 3' region is sufficient to regulate the colA and plc genes, the molecular mechanism of toxin gene regulation by VR-RNA remains unclear. Here, we found that colA mRNA is cleaved at position -79 and -78 from the A of the first codon (ATG) in the presence of VR-RNA. The processed transcripts were stable compared with longer intact transcripts. On the other hand, colA mRNA was labile in a VR-RNA-deficient strain, and processed transcripts were undetectable. The stability and processing of colA mRNA were restored by transformation of the 3' region of VR-RNA-expression vector. The 3' region of VR-RNA and colA mRNA had significant complementation and interacted in vitro. These results show that VR-RNA base pairs with colA mRNA and induces cleavage in the 5' untranslated region (UTR) of colA mRNA, which leads to the stabilization of colA mRNA and the activation of colA expression. © 2010 Blackwell Publishing Ltd.

Characterization of retroviral infectivity and superinfection resistance during retrovirus-mediated transduction of mammalian cells.

PubMed

Liao, J; Wei, Q; Fan, J; Zou, Y; Song, D; Liu, J; Liu, F; Ma, C; Hu, X; Li, L; Yu, Y; Qu, X; Chen, L; Yu, X; Zhang, Z; Zhao, C; Zeng, Z; Zhang, R; Yan, S; Wu, T; Wu, X; Shu, Y; Lei, J; Li, Y; Zhang, W; Wang, J; Reid, R R; Lee, M J; Huang, W; Wolf, J M; He, T-C; Wang, J

2017-06-01

Retroviral vectors including lentiviral vectors are commonly used tools to stably express transgenes or RNA molecules in mammalian cells. Their utilities are roughly divided into two categories, stable overexpression of transgenes and RNA molecules, which requires maximal transduction efficiency, or functional selection with retrovirus (RV)-based libraries, which takes advantage of retroviral superinfection resistance. However, the dynamic features of RV-mediated transduction are not well characterized. Here, we engineered two murine stem cell virus-based retroviral vectors expressing dual fluorescence proteins and antibiotic markers, and analyzed virion production efficiency and virion stability, dynamic infectivity and superinfection resistance in different cell types, and strategies to improve transduction efficiency. We found that the highest virion production occurred between 60 and 72 h after transfection. The stability of the collected virion supernatant decreased by >60% after 3 days in storage. We found that RV infectivity varied drastically in the tested human cancer lines, while low transduction efficiency was partially overcome with increased virus titer, prolonged infection duration and/or repeated infections. Furthermore, we demonstrated that RV receptors PIT1 and PIT2 were lowly expressed in the analyzed cells, and that PIT1 and/or PIT2 overexpression significantly improved transduction efficiency in certain cell lines. Thus, our findings provide resourceful information for the optimal conditions of retroviral-mediated gene delivery.

Development of novel cardiovascular therapeutics from small regulatory RNA molecules--an outline of key requirements.

PubMed

Poller, W; Fechner, H

2010-01-01

Understanding of the roles of RNAs within the cell has changed and expanded dramatically during the past few years. Based on fundamentally new insights it is now increasingly possible to employ RNAs as highly valuable tools in molecular biology and medicine. At present, the most important therapeutic strategies are based on non-coding regulatory RNAs inducing RNA interference (RNAi) to silence single genes, and on modulation of cellular microRNAs (miRNAs) to alter complex gene expression patterns in diseased organs. Only recently it became possible to target therapeutic RNAi to specific organs via organotropic viral vector systems and we discuss the most recent strategies in this field, e.g. heart failure treatment by cardiac-targeted RNAi. Due to the peculiar biochemical properties of small RNA molecules, true therapeutic translation of results in vitro is more demanding than with small molecule drugs or proteins. Specifically, there is a critical requirement for extensive studies in animal models of human disease after pre-testing of the RNAi tools in vitro. This requirement likewise applies for miRNA modulations which have complex consequences in the recipient dependent on biochemical stability and distribution of the therapeutic RNA. Problems not yet fully solved are the prediction of targets and specificity of the RNA tools. However, major progress has been made to achieve their tissue-specific and regulatable expression, and breakthroughs in vector technologies from the gene therapy field have fundamentally improved safety and efficacy of RNA-based therapeutic approaches, too. In summary, insight into the molecular mechanisms of action of regulatory RNAs in combination with new delivery tools for RNA therapeutics will significantly expand our cardiovascular therapeutic repertoire beyond classical pharmacology.

pHg/pSILBAγ vector system for efficient gene silencing in homobasidiomycetes: optimization of ihpRNA – triggering in the mycorrhizal fungus Laccaria bicolor

PubMed Central

Kemppainen, Minna J.; Pardo, Alejandro G.

2010-01-01

Summary pSILBAγ silencing vector was constructed for efficient RNA silencing triggering in the model mycorrhizal fungus Laccaria bicolor. This cloning vector carries the Agaricus bisporus gpdII promoter, two multiple cloning sites separated by a L. bicolor nitrate reductase intron and the Aspergillus nidulans trpC terminator. pSILBAγ allows an easy oriented two‐step PCR cloning of hairpin sequences to be expressed in basidiomycetes. With one further cloning step into pHg, a pCAMBIA1300‐based binary vector carrying a hygromycin resistance cassette, the pHg/pSILBAγ plasmid is used for Agrobacterium‐mediated transformation. The pHg/pSILBAγ system results in predominantly single integrations of RNA silencing triggering T‐DNAs in the fungal genome and the integration sites of the transgenes can be resolved by plasmid rescue. pSILBAγ construct and two other pSILBA plasmid variants (pSILBA and pSILBAα) were evaluated for their capacity to silence Laccaria nitrate reductase gene. While all pSILBA variants tested resulted in up to 65–76% of transformants with reduced growth on nitrate, pSILBAγ produced the highest number (65%) of strongly affected fungal strains. The strongly silenced phenotype was shown to correlate with T‐DNA integration in transcriptionally active genomic sites. pHg/pSILBAγ was shown to produce T‐DNAs with minimum CpG methylation in transgene promoter regions which assures the maximum silencing trigger production in Laccaria. Methylation of the target endogene was only slight in RNA silencing triggered with constructs carrying an intronic spacer hairpin sequence. The silencing capacity of the pHg/pSILBAγ was further tested with Laccaria inositol‐1,4,5‐triphosphate 5‐phosphatase gene. Besides its use in silencing triggering, the herein described plasmid system can also be used for transgene expression in Laccaria. pHg/pSILBAγ silencing system is optimized for L. bicolor but it should be highly useful also for other homobasidiomycetes, group of fungi currently lacking molecular tools for RNA silencing. PMID:21255319

HBx drives alpha fetoprotein expression to promote initiation of liver cancer stem cells through activating PI3K/AKT signal pathway.

PubMed

Zhu, Mingyue; Li, Wei; Lu, Yan; Dong, Xu; Lin, Bo; Chen, Yi; Zhang, Xueer; Guo, Junli; Li, Mengsen

2017-03-15

Hepatitis B virus (HBV)-X protein (HBx) plays critical role in inducing the malignant transformation of liver cells. Alpha fetoprotein (AFP) expression is closely related to hepatocarcinogenesis. We report that Oct4, Klf4, Sox2 and c-myc expression positively associated with AFP(+)/HBV(+) hepatocellular carcinoma(HCC) tissues, and the expression of the stemness markers CD44, CD133 and EpCAM was significantly higher in AFP(+)/HBV(+) HCC tissues compared to normal liver tissues or AFP (-)/HBV(-) HCC tissues. AFP expression turned on prior to expression of Oct4, Klf4, Sox2 and c-myc, and the stemness markers CD44, CD133 and EpCAM in the normal human liver L-02 cell line or CHL cell lines upon transfection with MCV-HBx vectors. Stem-like cells generated more tumour colonies compared to primary cells, and xenografts induced tumourigenesis in nude mice. Expression of reprogramming-related proteins was significantly enhanced in HLE cells while transfected with pcDNA3.1-afp vectors. The specific PI3K inhibitor Ly294002 inhibited the effects of pcDNA3.1-afp vectors. AFP-siRNA vectors were able to inhibit tumour colony formation and reprogramming-related gene expression. Altogether, HBx stimulates AFP expression to induce natural reprogramming of liver cells, and AFP plays a critical role in promoting the initiation of HCC progenitor/stem cells. AFP may be a potential novel biotarget for combating HBV-induced hepatocarcinogenesis. © 2016 UICC.

Potential applications of RNA interference-based therapeutics in the treatment of cardiovascular disease.

PubMed

Hassan, Ali

2006-06-01

RNA interference (RNAi) in eukaryotes is a recently identified phenomenon in which small double stranded RNA molecules called short interfering RNA (siRNA) interact with messenger RNA (mRNA) containing homologous sequences in a sequence-specific manner. Ultimately, this interaction results in degradation of the target mRNA. Because of the high sequence specificity of the RNAi process, and the apparently ubiquitous expression of the endogenous protein components necessary for RNAi, there appears to be little limitation to the genes that can be targeted for silencing by RNAi. Thus, RNAi has enormous potential, both as a research tool and as a mode of therapy. Several recent patents have described advances in RNAi technology that are likely to lead to new treatments for cardiovascular disease. These patents have described methods for increased delivery of siRNA to cardiovascular target tissues, chemical modifications of siRNA that improve their pharmacokinetic characteristics, and expression vectors capable of expressing RNAi effectors in situ. Though RNAi has only recently been demonstrated to occur in mammalian tissues, work has advanced rapidly in the development of RNAi-based therapeutics. Recently, therapeutic silencing of apoliporotein B, the ligand for the low density lipoprotein receptor, has been demonstrated in adult mice by systemic administration of chemically modified siRNA. This demonstrates the potential for RNAi-based therapeutics, and suggests that the future for RNAi in the treatment of cardiovascular disease is bright.

The relationship between the plant-encoded RNA-dependent RNA polymerase 1 and alternative oxidase in tomato basal defense against Tobacco mosaic virus.

PubMed

Liao, Yang-Wen-Ke; Liu, Ya-Ru; Liang, Jia-Yang; Wang, Wen-Ping; Zhou, Jie; Xia, Xiao-Jian; Zhou, Yan-Hong; Yu, Jing-Quan; Shi, Kai

2015-03-01

Salicylic acid (SA) plays a critical role in plant defense against pathogen attack. The SA-induced viral defense in plants is distinct from the pathways mediating bacterial and fungal defense, which is pathogenesis-related protein-independent but involves an RNA-dependent RNA polymerase 1 (RDR1)-mediated RNA silencing mechanism and/or an alternative oxidase (AOX)-associated defense pathway. However, the relationship between these two viral defense-related pathways remains unclear. In this study, Tobacco mosaic virus (TMV) inoculation onto Solanum lycopersicum (tomato) leaves induced a rapid induction of the SlAOX1a transcript level as well as the total and CN-resistant respiration at 0.5 dpi, followed by an increase in SlRDR1 gene expression at 1 dpi in the upper uninoculated leaves. Silencing SlRDR1 using virus-induced gene silencing system significantly reduced SlRDR1 expression and tomato defense against TMV but had no evident effect on SlAOX1a transcription. Conversely, silencing SlAOX1a not only effectively reduced the AOX1a transcript level, but also blocked the TMV-induced SlRDR1 expression and decreased the basal defense against TMV. Furthermore, the application of an exogenous AOX activator on empty vector-silenced control plants greatly induced the accumulation of SlRDR1 and SlAOX1a transcript and reduced TMV viral RNA accumulation, but failed to have such effects on SlRDR1-silenced plants. Moreover, RDR1-overexpressed transgenic Nicotiana benthamiana plants enhanced defense against TMV than the empty vector-transformed plants, but these effects were not affected by the exogenous AOX activator or inhibitor. These results indicate that RDR1 is involved in the AOX-mediated defense pathway against TMV infection and plays a crucial role in enhancing RNA silencing to limit virus systemic spread.

An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS1[OPEN

PubMed Central

2018-01-01

Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 (HSP70-1) inserts in Nicotiana benthamiana and maize (Zea mays). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70, silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. PMID:29127260

Small silencing RNAs: state-of-the-art.

PubMed

Grimm, Dirk

2009-07-25

Over just a single decade, we have witnessed the rapid maturation of the field of RNA interference - the sequence-specific gene silencing mediated by small double-stranded RNAs - directly from its infancy into adulthood. With exciting data currently emerging from first clinical trials, it is now more likely than ever that RNAi drugs will soon provide another potent class of agents in our battle against infectious and genetic diseases. Accelerating this process and adding to RNAi's promise is our steadily expanding arsenal of innovative RNAi-based experimental tools and clinically applicable technologies. This article will critically review a selection of relevant recent advances in RNAi therapeutics, from novel asymmetric or bi-functional siRNA designs, deliberate use of small RNAs to regulate nuclear transcription, engineering of potent adeno-associated viral vectors for shRNA expression, exploitation of endogenous miRNAs to control transgene expression or vector tropism, to elegant attempts to inhibit cellular miRNAs involved in human disease. This review will also present cautionary notes on the potential risks inherent to in vivo RNAi applications, before discussing the latest surprising findings on circulating miRNAs in human body fluids, and concluding with an outlook into the possible future of RNAi as an increasingly powerful biomedical tool.

Inhibition of KLF7-Targeting MicroRNA 146b Promotes Sciatic Nerve Regeneration.

PubMed

Li, Wen-Yuan; Zhang, Wei-Ting; Cheng, Yong-Xia; Liu, Yan-Cui; Zhai, Feng-Guo; Sun, Ping; Li, Hui-Ting; Deng, Ling-Xiao; Zhu, Xiao-Feng; Wang, Ying

2018-06-01

A previous study has indicated that Krüppel-like factor 7 (KLF7), a transcription factor that stimulates Schwann cell (SC) proliferation and axonal regeneration after peripheral nerve injury, is a promising therapeutic transcription factor in nerve injury. We aimed to identify whether inhibition of microRNA-146b (miR-146b) affected SC proliferation, migration, and myelinated axon regeneration following sciatic nerve injury by regulating its direct target KLF7. SCs were transfected with miRNA lentivirus, miRNA inhibitor lentivirus, or KLF7 siRNA lentivirus in vitro. The expression of miR146b and KLF7, as well as SC proliferation and migration, were subsequently evaluated. In vivo, an acellular nerve allograft (ANA) followed by injection of GFP control vector or a lentiviral vector encoding an miR-146b inhibitor was used to assess the repair potential in a model of sciatic nerve gap. miR-146b directly targeted KLF7 by binding to the 3'-UTR, suppressing KLF7. Up-regulation of miR-146b and KLF7 knockdown significantly reduced the proliferation and migration of SCs, whereas silencing miR-146b resulted in increased proliferation and migration. KLF7 protein was localized in SCs in which miR-146b was expressed in vivo. Similarly, 4 weeks after the ANA, anti-miR-146b increased KLF7 and its target gene nerve growth factor cascade, promoting axonal outgrowth. Closer analysis revealed improved nerve conduction and sciatic function index score, and enhanced expression of neurofilaments, P0 (anti-peripheral myelin), and myelinated axon regeneration. Our findings provide new insight into the regulation of KLF7 by miR-146b during peripheral nerve regeneration and suggest a potential therapeutic strategy for peripheral nerve injury.

Effects of Notch2 and Notch3 on Cell Proliferation and Apoptosis of Trophoblast Cell Lines.

PubMed

Zhao, Wei-Xiu; Zhuang, Xu; Huang, Tao-Tao; Feng, Ran; Lin, Jian-Hua

2015-01-01

To investigate the effect of Notch2 and Notch3 on cell proliferation and apoptosis of two trophoblast cell lines, BeWo and JAR. Notch2 and Notch3 expression in BeWo and JAR cells was upregulated or downregulated using lentivirus-mediated overexpression or RNA interference. The effect of Notch2 and Notch3 on cell proliferation was assessed by the CCK-8 assay. The effect of Notch2 and Notch3 on the apoptosis of BeWo and JAR cells was evaluated by flow cytometry using the Annexin V-PE Apoptosis kit. Lentivirus-based overexpression vectors were constructed by cloning the full-length coding sequences of human Notch2 and Notch3 C-terminally tagged with GFP or GFP alone (control) into a lentivirus-based expression vector. Lentivirus-based gene silencing vectors were prepared by cloning small interfering sequences targeting human Notch2 and Notch3 and scrambled control RNA sequence into a lentivirus-based gene knockdown vector. The effect of Notch2 and Notch3 on cell proliferation was assessed by the CCK-8 assay. And the effect of Notch2 and Notch3 on the apoptosis of BeWo and JAR cells was evaluated by flow cytometry using the Annexin V PE Apoptosis kit. We found that the downregulation of Notch2 and Notch3 gene expression in BeWo and JAR cells resulted in an increase in cell proliferation, while upregulation of Notch3 and Notch2 expression led to a decrease in cell proliferation. Moreover, the overexpression of Notch3 and Notch2 in BeWo and JAR cells reduced apoptosis in these trophoblast cell lines, whereas apoptosis was increased in the cells in which the expression of Notch3 and Notch2 was downregulated. Notch2 and Notch3 inhibited both cell proliferation and cell apoptosis in BeWo and JAR trophoblast cell lines.

Stable Dispersions of Covalently Tethered Polymer Improved Graphene Oxide Nanoconjugates as an Effective Vector for siRNA Delivery.

PubMed

Yadav, Nisha; Kumar, Naveen; Prasad, Peeyush; Shirbhate, Shivani; Sehrawat, Seema; Lochab, Bimlesh

2018-05-02

Conjugates of poly(amidoamine) (PAMAM) with modified graphene oxide (GO) are attractive nonviral vectors for gene-based cancer therapeutics. GO protects siRNA from enzymatic cleavage and showed reasonable transfection efficiency along with simultaneous benefits of low cost and large scale production. PAMAM is highly effective in siRNA delivery but suffers from high toxicity with poor in vivo efficacy. Co-reaction of GO and PAMAM led to aggregation and more importantly, have detrimental effect on stability of dispersion at physiological pH preventing their exploration at clinical level. In the current work, we have designed, synthesized, characterized and explored a new type of hybrid vector (GPD), using GO synthesized via improved method which was covalently tethered with poly(ethylene glycol) (PEG) and PAMAM. The existence of covalent linkage, relative structural changes and properties of GPD is well supported by Fourier transform infrared (FTIR), UV-visible (UV-vis), Raman, X-ray photoelectron (XPS), elemental analysis, powder X-ray diffraction (XRD), thermogravimetry analysis (TGA), dynamic light scattering (DLS), and zeta potential. Scanning electron microscopy (SEM), and transmission electron microscopy (TEM) of GPD showed longitudinally aligned columnar self-assembled ∼10 nm thick polymeric nanoarchitectures onto the GO surface accounting to an average size reduction to ∼20 nm. GPD revealed an outstanding stability in both phosphate buffer saline (PBS) and serum containing cell medium. The binding efficiency of EPAC1 siRNA to GPD was supported by gel retardation assay, DLS, zeta potential and photoluminescence (PL) studies. A lower cytotoxicity with enhanced cellular uptake and homogeneous intracellular distribution of GPD/siRNA complex is confirmed by imaging studies. GPD exhibited a higher transfection efficiency with remarkable inhibition of cell migration and lower invasion than PAMAM and Lipofectamine 2000 suggesting its role in prevention of breast cancer progression and metastasis. A significant reduction in the expression of the specific protein against which siRNA was delivered is revealed by Western blot assay. Furthermore, a pH-triggered release of siRNA from the GPD/siRNA complex was studied to provide a mechanistic insight toward unloading of siRNA from the vector. Current strategy is a way forward for designing effective therapeutic vectors for gene-based antitumor therapy.

STAT3 Knockdown Reduces Pancreatic Cancer Cell Invasiveness and Matrix Metalloproteinase-7 Expression in Nude Mice

PubMed Central

Huang, Ke jian; Wu, Wei dong; Jiang, Tao; Cao, Jun; Feng, Zhen zhong; Qiu, Zheng jun

2011-01-01

Aims Transducer and activator of transcription-3 (STAT3) plays an important role in tumor cell invasion and metastasis. The aim of the present study was to investigate the effects of STAT3 knockdown in nude mouse xenografts of pancreatic cancer cells and underlying gene expression. Methods A STAT3 shRNA lentiviral vector was constructed and infected into SW1990 cells. qRT-PCR and western immunoblot were performed to detect gene expression. Nude mouse xenograft assays were used to assess changes in phenotypes of these stable cells in vivo. HE staining was utilized to evaluate tumor cell invasion and immunohistochemistry was performed to analyze gene expression. Results STAT3 shRNA successfully silenced expression of STAT3 mRNA and protein in SW1990 cells compared to control cells. Growth rate of the STAT3-silenced tumor cells in nude mice was significantly reduced compared to in the control vector tumors and parental cells-generated tumors. Tumor invasion into the vessel and muscle were also suppressed in the STAT3-silenced tumors compared to controls. Collagen IV expression was complete and continuous surrounding the tumors of STAT3-silenced SW1990 cells, whereas collagen IV expression was incomplete and discontinuous surrounding the control tumors. Moreover, microvessel density was significantly lower in STAT3-silenced tumors than parental or control tumors of SW1990 cells. In addition, MMP-7 expression was reduced in STAT3-silenced tumors compared to parental SW1990 xenografts and controls. In contrast, expression of IL-1β and IgT7α was not altered. Conclusion These data clearly demonstrate that STAT3 plays an important role in regulation of tumor growth, invasion, and angiogenesis, which could be act by reducing MMP-7 expression in pancreatic cancer cells. PMID:21991388

Shine-Dalgarno sequence enhances the efficiency of lacZ repression by artificial anti-lac antisense RNAs in Escherichia coli.

PubMed

Stefan, Alessandra; Schwarz, Flavio; Bressanin, Daniela; Hochkoeppler, Alejandro

2010-11-01

Silencing of the lacZ gene in Escherichia coli was attempted by means of the expression of antisense RNAs (asRNAs) in vivo. A short fragment of lacZ was cloned into the pBAD expression vector, in reverse orientation, using the EcoRI and PstI restriction sites. This construct (pBAD-Zcal1) was used to transform E. coli cells, and the antisense transcription was induced simply by adding arabinose to the culture medium. We demonstrated that the Zcal1 asRNA effectively silenced lacZ using β-galactosidase activity determinations, SDS-PAGE, and Western blotting. Because the concentration of the lac mRNA was always high in cells that expressed Zcal1, we hypothesize that this antisense acts by inhibiting messenger translation. Similar analyses, performed with a series of site-specific Zcal1 mutants, showed that the Shine-Dalgarno sequence, which is conferred by the pBAD vector, is an essential requisite for silencing competence. Indeed, the presence of the intact Shine-Dalgarno sequence positively affects asRNA stability and, hence, silencing effectiveness. Our observations will contribute to the understanding of the main determinants of silencing as exerted by asRNAs as well as provide useful support for the design of robust and efficient prokaryotic gene silencers. Copyright © 2010 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

A versatile Multisite Gateway-compatible promoter and transgenic line collection for cell type-specific functional genomics in Arabidopsis

PubMed Central

Platre, Matthieu Pierre; Barberon, Marie; Caillieux, Erwann; Colot, Vincent

2016-01-01

Summary Multicellular organisms are composed of many cell types that acquire their specific fate through a precisely controlled pattern of gene expression in time and space dictated in part by cell type-specific promoter activity. Understanding the contribution of highly specialized cell types in the development of a whole organism requires the ability to isolate or analyze different cell types separately. We have characterized and validated a large collection of root cell type-specific promoters and have generated cell type-specific marker lines. These benchmarked promoters can be readily used to evaluate cell type-specific complementation of mutant phenotypes, or to knockdown gene expression using targeted expression of artificial miRNA. We also generated vectors and characterized transgenic lines for cell type-specific induction of gene expression and cell type-specific isolation of nuclei for RNA and chromatin profiling. Vectors and seeds from transgenic Arabidopsis plants will be freely available, and will promote rapid progress in cell type-specific functional genomics. We demonstrate the power of this promoter set for analysis of complex biological processes by investigating the contribution of root cell types in the IRT1-dependent root iron uptake. Our findings revealed the complex spatial expression pattern of IRT1 in both root epidermis and phloem companion cells and the requirement for IRT1 to be expressed in both cell types for proper iron homeostasis. PMID:26662936

A multisite gateway-based toolkit for targeted gene expression and hairpin RNA silencing in tomato fruits.

PubMed

Estornell, Leandro Hueso; Orzáez, Diego; López-Peña, Lucas; Pineda, Benito; Antón, María Teresa; Moreno, Vicente; Granell, Antonio

2009-04-01

A collection of fruit promoters, reporter genes and protein tags has been constructed in a triple-gateway format, a recombination-based cloning system that facilitates the tandem assembly of three DNA fragments into plant expression vectors. The new pENFRUIT collection includes, among others, the classical tomato-ripening promoters E8 and 2A11 and a set of six new tomato promoters. The new promoter activities were characterized in both transient assays and stable transgenic plants. The range of expression of the new promoters comprises strong (PNH, PLI), medium (PLE, PFF, PHD) and weak (PSN) promoters driving gene expression preferentially in the fruit, and covering a wide range of tissues and developmental stages. Together, a total of 78 possible combinations for the expression of a gene of interest in the fruit, plus a set of five reporters for new promoter analysis, was made available in the current collection. Moreover, the pENFRUIT promoter collection is adaptable to hairpin RNA strategies aimed at tissue/organ-specific gene silencing with only an additional cloning step. The pENFRUIT toolkit broadens the spectrum of promoter activities available for fruit biotechnology and fundamental research, and bypasses technical difficulties of current ligase-dependent cloning techniques in the construction of fruit expression cassettes. The pENFRUIT vector collection is available for the research community in a plasmid repository, facilitating its accessibility.

[Construction and functional identification of eukaryotic expression vector carrying Sprague-Dawley rat MSX-2 gene].

PubMed

Yang, Xian-Xian; Zhang, Mei; Yan, Zhao-Wen; Zhang, Ru-Hong; Mu, Xiong-Zheng

2008-01-01

To construct a high effective eukaryotic expressing plasmid PcDNA 3.1-MSX-2 encoding Sprague-Dawley rat MSX-2 gene for the further study of MSX-2 gene function. The full length SD rat MSX-2 gene was amplified by PCR, and the full length DNA was inserted in the PMD1 8-T vector. It was isolated by restriction enzyme digest with BamHI and Xhol, then ligated into the cloning site of the PcDNA3.1 expression plasmid. The positive recombinant was identified by PCR analysis, restriction endonudease analysis and sequence analysis. Expression of RNA and protein was detected by RT-PCR and Western blot analysis in PcDNA3.1-MSX-2 transfected HEK293 cells. Sequence analysis and restriction endonudease analysis of PcDNA3.1-MSX-2 demonstrated that the position and size of MSX-2 cDNA insertion were consistent with the design. RT-PCR and Western blot analysis showed specific expression of mRNA and protein of MSX-2 in the transfected HEK293 cells. The high effective eukaryotic expression plasmid PcDNA3.1-MSX-2 encoding Sprague-Dawley Rat MSX-2 gene which is related to craniofacial development can be successfully reconstructed. It may serve as the basis for the further study of MSX-2 gene function.

Circular RNA HIPK3 promotes gallbladder cancer cell growth by sponging microRNA-124.

PubMed

Kai, Ding; Yannian, Liao; Yitian, Chen; Dinghao, Gong; Xin, Zhao; Wu, Ji

2018-06-18

Recent studies have implied that circHIPK3, an abundant circular RNA (circRNA), participates in tumorigenesis and cancer progression. Its expression and potential functions in human gallbladder cancer were examined in this study. We show that circHIPK3 is upregulated in human gallbladder cancer cells. But its level is low in gallbladder epithelial cells. circHIPK3 silencing by targeted siRNA potently inhibited survival and proliferation of established and primary human gallbladder cancer cells, while inducing cell apoptosis. Conversely, ectopic over-expression of circHIPK3 can further promote cancer cell proliferation. In gallbladder cancer cells, circHIPK3 sponged the tumor-suppressive microRNA-124 (miR-124) to sequester and inhibit its activity, thereby leading to increased expression of miR-124 targets, including ROCK1 (rho-associated protein kinase 1) and CDK6 (rho-associated protein kinase). Ectopic over-expression of miR-124 b y a lentiviral vector mimicked and abolished actions by circHIPK3 siRNA in gallbladder cancer cells. At last, we show that circHIPK3 is upregulated in human gallbladder cancer tissues, which is correlated with miR-124 downregulation and ROCK1-CDK6 upregulation. Together, we conclude that circHIPK3 promotes gallbladder cancer cell growth possibly by sponging miR-124. The over-expressed circHIPK3 could be a novel therapeutic target and diagnosis marker of human gallbladder cancer. Copyright © 2018. Published by Elsevier Inc.

Expression of chicken parvovirus VP2 in chicken embryo fibroblasts requires codon optimization for production of naked DNA and vectored meleagrid herpesvirus type 1 vaccines.

PubMed

Spatz, Stephen J; Volkening, Jeremy D; Mullis, Robert; Li, Fenglan; Mercado, John; Zsak, Laszlo

2013-10-01

Meleagrid herpesvirus type 1 (MeHV-1) is an ideal vector for the expression of antigens from pathogenic avian organisms in order to generate vaccines. Chicken parvovirus (ChPV) is a widespread infectious virus that causes serious disease in chickens. It is one of the etiological agents largely suspected in causing Runting Stunting Syndrome (RSS) in chickens. Initial attempts to express the wild-type gene encoding the capsid protein VP2 of ChPV by insertion into the thymidine kinase gene of MeHV-1 were unsuccessful. However, transient expression of a codon-optimized synthetic VP2 gene cloned into the bicistronic vector pIRES2-Ds-Red2, could be demonstrated by immunocytochemical staining of transfected chicken embryo fibroblasts (CEFs). Red fluorescence could also be detected in these transfected cells since the red fluorescent protein gene is downstream from the internal ribosome entry site (IRES). Strikingly, fluorescence could not be demonstrated in cells transiently transfected with the bicistronic vector containing the wild-type or non-codon-optimized VP2 gene. Immunocytochemical staining of these cells also failed to demonstrate expression of wild-type VP2, indicating that the lack of expression was at the RNA level and the VP2 protein was not toxic to CEFs. Chickens vaccinated with a DNA vaccine consisting of the bicistronic vector containing the codon-optimized VP2 elicited a humoral immune response as measured by a VP2-specific ELISA. This VP2 codon-optimized bicistronic cassette was rescued into the MeHV-1 genome generating a vectored vaccine against ChPV disease.

Effect of Circular ANRIL on the Inflammatory Response of Vascular Endothelial Cells in a Rat Model of Coronary Atherosclerosis.

PubMed

Song, Chun-Li; Wang, Jin-Peng; Xue, Xin; Liu, Ning; Zhang, Xiao-Hao; Zhao, Zhuo; Liu, Jian-Gen; Zhang, Chun-Peng; Piao, Zhe-Hao; Liu, Yang; Yang, Yi-Bo

2017-01-01

This study aims to investigate the role of circular antisense non-coding RNA at the INK4 locus (cANRIL) in the inflammatory response of vascular endothelial cells (ECs) in a rat model of coronary atherosclerosis (AS). A rat model of AS was established with rats that were injected with a large dose of vitamin D3 and fed a high-fat diet. Sixty Wistar rats were randomly assigned into control, model, empty vector, over-expressed cANRIL and low-expressed cANRIL groups (12 rats in each group). Sixteen weeks later, the ultrastructure of their coronary arteries was observed via transmission electron microscopy. Rat serum lipid levels were analyzed using an automatic biochemical analyzer, and their atherogenic index (AI) values were calculated. Hematoxylin and eosin staining was used to observe the endothelial morphology of rats. Additionally, rat EC apoptosis was tested via a TUNEL assay. Enzyme-linked immunosorbent assays (ELISAs) were applied to measure serum levels of interleukin-1 (IL-1), IL-6, matrix metalloproteinase-9 (MMP-9) and C-reactive protein (CRP). The cANRIL, Bax, bcl-2 and caspase-3 mRNA expression levels were measured with a quantitative real-time polymerase chain reaction (qRT-PCR). The protein expression levels of Bax, bcl-2 and caspase-3 were detected using immunohistochemistry. In the control group, ECs were closely arranged with normal structures, and there was no proliferation. In the model, empty vector and over-expressed cANRIL groups, some cells were not present, and atherosclerotic plaques and thrombi appeared. However, in the under-expressed cANRIL group, the cells had a normal structure. Compared with the model and empty vector groups, the levels of total cholesterol (CHOL), triglycerides (TGs), low density lipoprotein (LDL), IL-1, IL-6, MMP-9, CRP, cANRIL, Bax, and caspase-3, AI values, and rates of EC apoptosis decreased in the low-expressed cANRIL group, while HDL (high density lipoprotein) levels and mRNA and protein expression levels of bcl-2 were increased. The changes in expression levels in the over-expressed cANRIL group were the opposite of those in the low-expressed cANRIL group. Our study provides evidence that reduced cANRIL expression could prevent coronary AS by reducing vascular EC apoptosis and inflammatory factor expression. © 2017 The Author(s). Published by S. Karger AG, Basel.

Differential RNA-seq analysis comparing APC-defective and APC-restored SW480 colorectal cancer cells.

PubMed

King, Lauren E; Love, Christopher G; Sieber, Oliver M; Faux, Maree C; Burgess, Antony W

2016-03-01

The adenomatous polyposis coli (APC) tumour suppressor gene is mutated in about 80% of colorectal cancers (CRC) Brannon et al. (2014) [1]. APC is a large multifunctional protein that regulates many biological functions including Wnt signalling (through the regulation of beta-catenin stability) Reya and Clevers (2005) [2], cell migration Kroboth et al. (2007), Sansom et al. (2004) [3], [4], mitosis Kaplan et al. (2001) [5], cell adhesion Faux et al. (2004), Carothers et al. (2001) [6], [7] and differentiation Sansom et al. (2004) [4]. Although the role of APC in CRC is often described as the deregulation of Wnt signalling, its other biological functions suggest that there are other factors at play that contribute to the onset of adenomas and the progression of CRC upon the truncation of APC. To identify genes and pathways that are dysregulated as a consequence of loss of function of APC, we compared the gene expression profiles of the APC mutated human CRC cell line SW480 following reintroduction of wild-type APC (SW480 + APC) or empty control vector (SW480 + vector control) Faux et al. (2004) . Here we describe the RNA-seq data derived for three biological replicates of parental SW480, SW480 + vector control and SW480 + APC cells, and present the bioinformatics pipeline used to test for differential gene expression and pathway enrichment analysis. A total of 1735 genes showed significant differential expression when APC was restored and were enriched for genes associated with cell polarity, Wnt signalling and the epithelial to mesenchymal transition. There was additional enrichment for genes involved in cell-cell adhesion, cell-matrix junctions, angiogenesis, axon morphogenesis and cell movement. The raw and analysed RNA-seq data have been deposited in the Gene Expression Omnibus (GEO) database under accession number GSE76307. This dataset is useful for further investigations of the impact of APC mutation on the properties of colorectal cancer cells.

Engineered external guide sequences are highly effective in inhibiting gene expression and replication of hepatitis B virus in cultured cells.

PubMed

Zhang, Zhigang; Vu, Gia-Phong; Gong, Hao; Xia, Chuan; Chen, Yuan-Chuan; Liu, Fenyong; Wu, Jianguo; Lu, Sangwei

2013-01-01

External guide sequences (EGSs) are RNA molecules that consist of a sequence complementary to a target mRNA and recruit intracellular ribonuclease P (RNase P), a tRNA processing enzyme, for specific degradation of the target mRNA. We have previously used an in vitro selection procedure to generate EGS variants that efficiently induce human RNase P to cleave a target mRNA in vitro. In this study, we constructed EGSs from a variant to target the overlapping region of the S mRNA, pre-S/L mRNA, and pregenomic RNA (pgRNA) of hepatitis B virus (HBV), which are essential for viral replication and infection. The EGS variant was about 50-fold more efficient in inducing human RNase P to cleave the mRNA in vitro than the EGS derived from a natural tRNA. Following Salmonella-mediated gene delivery, the EGSs were expressed in cultured HBV-carrying cells. A reduction of about 97% and 75% in the level of HBV RNAs and proteins and an inhibition of about 6,000- and 130-fold in the levels of capsid-associated HBV DNA were observed in cells treated with Salmonella vectors carrying the expression cassette for the variant and the tRNA-derived EGS, respectively. Our study provides direct evidence that the EGS variant is more effective in blocking HBV gene expression and DNA replication than the tRNA-derived EGS. Furthermore, these results demonstrate the feasibility of developing Salmonella-mediated gene delivery of highly active EGS RNA variants as a novel approach for gene-targeting applications such as anti-HBV therapy.

A feedback regulatory loop involving microRNA-9 and nuclear receptor TLX in neural stem cell fate determination.

PubMed

Zhao, Chunnian; Sun, GuoQiang; Li, Shengxiu; Shi, Yanhong

2009-04-01

MicroRNAs have been implicated as having important roles in stem cell biology. MicroRNA-9 (miR-9) is expressed specifically in neurogenic areas of the brain and may be involved in neural stem cell self-renewal and differentiation. We showed previously that the nuclear receptor TLX is an essential regulator of neural stem cell self-renewal. Here we show that miR-9 suppresses TLX expression to negatively regulate neural stem cell proliferation and accelerate neural differentiation. Introducing a TLX expression vector that is not prone to miR-9 regulation rescued miR-9-induced proliferation deficiency and inhibited precocious differentiation. In utero electroporation of miR-9 in embryonic brains led to premature differentiation and outward migration of the transfected neural stem cells. Moreover, TLX represses expression of the miR-9 pri-miRNA. By forming a negative regulatory loop with TLX, miR-9 provides a model for controlling the balance between neural stem cell proliferation and differentiation.

A feedback regulatory loop involving microRNA-9 and nuclear receptor TLX in neural stem cell fate determination

PubMed Central

Zhao, Chunnian; Sun, GuoQiang; Li, Shengxiu; Shi, Yanhong

2009-01-01

Summary MicroRNAs are important players in stem cell biology. Among them, microRNA-9 (miR-9) is expressed specifically in neurogenic areas of the brain. Whether miR-9 plays a role in neural stem cell self-renewal and differentiation is unknown. We showed previously that nuclear receptor TLX is an essential regulator of neural stem cell self-renewal. Here we show that miR-9 suppresses TLX expression to negatively regulate neural stem cell proliferation and accelerate neural differentiation. Introducing a TLX expression vector lacking the miR-9 recognition site rescued miR-9-induced proliferation deficiency and inhibited precocious differentiation. In utero electroporation of miR-9 in embryonic brains led to premature differentiation and outward migration of the transfected neural stem cells. Moreover, TLX represses miR-9 pri-miRNA expression. MiR-9, by forming a negative regulatory loop with TLX, establishes a model for controlling the balance between neural stem cell proliferation and differentiation. PMID:19330006

MIDAS/GPP34, a nuclear gene product, regulates total mitochondrial mass in response to mitochondrial dysfunction.

PubMed

Nakashima-Kamimura, Naomi; Asoh, Sadamitsu; Ishibashi, Yoshitomo; Mukai, Yuri; Shidara, Yujiro; Oda, Hideaki; Munakata, Kae; Goto, Yu-Ichi; Ohta, Shigeo

2005-11-15

To investigate the regulatory system in mitochondrial biogenesis involving crosstalk between the mitochondria and nucleus, we found a factor named MIDAS (mitochondrial DNA absence sensitive factor) whose expression was enhanced by the absence of mitochondrial DNA (mtDNA). In patients with mitochondrial diseases, MIDAS expression was increased only in dysfunctional muscle fibers. A majority of MIDAS localized to mitochondria with a small fraction in the Golgi apparatus in HeLa cells. To investigate the function of MIDAS, we stably transfected HeLa cells with an expression vector carrying MIDAS cDNA or siRNA. Cells expressing the MIDAS protein and the siRNA constitutively showed an increase and decrease in the total mass of mitochondria, respectively, accompanying the regulation of a mitochondria-specific phospholipid, cardiolipin. In contrast, amounts of the mitochondrial DNA, RNA and proteins did not depend upon MIDAS. Thus, MIDAS is involved in the regulation of mitochondrial lipids, leading to increases of total mitochondrial mass in response to mitochondrial dysfunction.

Efficient disruption of Zebrafish genes using a Gal4-containing gene trap

PubMed Central

2013-01-01

Background External development and optical transparency of embryos make zebrafish exceptionally suitable for in vivo insertional mutagenesis using fluorescent proteins to visualize expression patterns of mutated genes. Recently developed Gene Breaking Transposon (GBT) vectors greatly improve the fidelity and mutagenicity of transposon-based gene trap vectors. Results We constructed and tested a bipartite GBT vector with Gal4-VP16 as the primary gene trap reporter. Our vector also contains a UAS:eGFP cassette for direct detection of gene trap events by fluorescence. To confirm gene trap events, we generated a UAS:mRFP tester line. We screened 270 potential founders and established 41 gene trap lines. Three of our gene trap alleles display homozygous lethal phenotypes ranging from embryonic to late larval: nsf tpl6, atp1a3atpl10 and flrtpl19. Our gene trap cassette is flanked by direct loxP sites, which enabled us to successfully revert nsf tpl6, atp1a3atpl10 and flrtpl19 gene trap alleles by injection of Cre mRNA. The UAS:eGFP cassette is flanked by direct FRT sites. It can be readily removed by injection of Flp mRNA for use of our gene trap alleles with other tissue-specific GFP-marked lines. The Gal4-VP16 component of our vector provides two important advantages over other GBT vectors. The first is increased sensitivity, which enabled us to detect previously unnoticed expression of nsf in the pancreas. The second advantage is that all our gene trap lines, including integrations into non-essential genes, can be used as highly specific Gal4 drivers for expression of other transgenes under the control of Gal4 UAS. Conclusions The Gal4-containing bipartite Gene Breaking Transposon vector presented here retains high specificity for integrations into genes, high mutagenicity and revertibility by Cre. These features, together with utility as highly specific Gal4 drivers, make gene trap mutants presented here especially useful to the research community. PMID:24034702

Chronic Cardiac-Targeted RNA Interference for the Treatment of Heart Failure Restores Cardiac Function and Reduces Pathological Hypertrophy

PubMed Central

Suckau, Lennart; Fechner, Henry; Chemaly, Elie; Krohn, Stefanie; Hadri, Lahouaria; Kockskämper, Jens; Westermann, Dirk; Bisping, Egbert; Ly, Hung; Wang, Xiaomin; Kawase, Yoshiaki; Chen, Jiqiu; Liang, Lifan; Sipo, Isaac; Vetter, Roland; Weger, Stefan; Kurreck, Jens; Erdmann, Volker; Tschope, Carsten; Pieske, Burkert; Lebeche, Djamel; Schultheiss, Heinz-Peter; Hajjar, Roger J.; Poller, Wolfgang Ch.

2009-01-01

Background RNA interference (RNAi) has the potential to be a novel therapeutic strategy in diverse areas of medicine. We report on targeted RNAi for the treatment of heart failure (HF), an important disorder in humans resulting from multiple etiologies. Successful treatment of HF is demonstrated in a rat model of transaortic banding by RNAi targeting of phospholamban (PLB), a key regulator of cardiac Ca2+ homeostasis. Whereas gene therapy rests on recombinant protein expression as its basic principle, RNAi therapy employs regulatory RNAs to achieve its effect. Methods and Results We describe structural requirements to obtain high RNAi activity from adenoviral (AdV) and adeno-associated virus (AAV9) vectors and show that an AdV short hairpin RNA vector (AdV-shRNA) silenced PLB in cardiomyocytes (NRCMs) and improved hemodynamics in HF rats 1 month after aortic root injection. For simplified long-term therapy we developed a dimeric cardiotropic AAV vector (rAAV9-shPLB) delivering RNAi activity to the heart via intravenous injection. Cardiac PLB protein was reduced to 25% and SERCA2a suppression in the HF groups was rescued. In contrast to traditional vectors rAAV9 shows high affinity for myocardium, but low affinity for liver and other organs. rAAV9-shPLB therapy restored diastolic (LVEDP, dp/dtmin, Tau) and systolic (fractional shortening) functional parameters to normal range. The massive cardiac dilation was normalized and the cardiac hypertrophy, cardiomyocyte diameter and cardiac fibrosis significantly reduced. Importantly, there was no evidence of microRNA deregulation or hepatotoxicity during these RNAi therapies. Conclusion Our data show, for the first time, high efficacy of an RNAi therapeutic strategy in a cardiac disease. PMID:19237664

Oncogene GAEC1 regulates CAPN10 expression which predicts survival in esophageal squamous cell carcinoma

PubMed Central

Chan, Dessy; Tsoi, Miriam Yuen-Tung; Liu, Christina Di; Chan, Sau-Hing; Law, Simon Ying-Kit; Chan, Kwok-Wah; Chan, Yuen-Piu; Gopalan, Vinod; Lam, Alfred King-Yin; Tang, Johnny Cheuk-On

2013-01-01

AIM: To identify the downstream regulated genes of GAEC1 oncogene in esophageal squamous cell carcinoma and their clinicopathological significance. METHODS: The anti-proliferative effect of knocking down the expression of GAEC1 oncogene was studied by using the RNA interference (RNAi) approach through transfecting the GAEC1-overexpressed esophageal carcinoma cell line KYSE150 with the pSilencer vector cloned with a GAEC1-targeted sequence, followed by MTS cell proliferation assay and cell cycle analysis using flow cytometry. RNA was then extracted from the parental, pSilencer-GAEC1-targeted sequence transfected and pSilencer negative control vector transfected KYSE150 cells for further analysis of different patterns in gene expression. Genes differentially expressed with suppressed GAEC1 expression were then determined using Human Genome U133 Plus 2.0 cDNA microarray analysis by comparing with the parental cells and normalized with the pSilencer negative control vector transfected cells. The most prominently regulated genes were then studied by immunohistochemical staining using tissue microarrays to determine their clinicopathological correlations in esophageal squamous cell carcinoma by statistical analyses. RESULTS: The RNAi approach of knocking down gene expression showed the effective suppression of GAEC1 expression in esophageal squamous cell carcinoma cell line KYSE150 that resulted in the inhibition of cell proliferation and increase of apoptotic population. cDNA microarray analysis for identifying differentially expressed genes detected the greatest levels of downregulation of calpain 10 (CAPN10) and upregulation of trinucleotide repeat containing 6C (TNRC6C) transcripts when GAEC1 expression was suppressed. At the tissue level, the high level expression of calpain 10 protein was significantly associated with longer patient survival (month) of esophageal squamous cell carcinoma compared to the patients with low level of calpain 10 expression (37.73 ± 16.33 vs 12.62 ± 12.44, P = 0.032). No significant correction was observed among the TNRC6C protein expression level and the clinocopathologcial features of esophageal squamous cell carcinoma. CONCLUSION: GAEC1 regulates the expression of CAPN10 and TNRC6C downstream. Calpain 10 expression is a potential prognostic marker in patients with esophageal squamous cell carcinoma. PMID:23687414

A Vector Library for Silencing Central Carbon Metabolism Genes with Antisense RNAs in Escherichia coli

PubMed Central

Ohno, Satoshi; Yoshikawa, Katsunori; Shimizu, Hiroshi; Tamura, Tomohiro

2014-01-01

We describe here the construction of a series of 71 vectors to silence central carbon metabolism genes in Escherichia coli. The vectors inducibly express antisense RNAs called paired-terminus antisense RNAs, which have a higher silencing efficacy than ordinary antisense RNAs. By measuring mRNA amounts, measuring activities of target proteins, or observing specific phenotypes, it was confirmed that all the vectors were able to silence the expression of target genes efficiently. Using this vector set, each of the central carbon metabolism genes was silenced individually, and the accumulation of metabolites was investigated. We were able to obtain accurate information on ways to increase the production of pyruvate, an industrially valuable compound, from the silencing results. Furthermore, the experimental results of pyruvate accumulation were compared to in silico predictions, and both sets of results were consistent. Compared to the gene disruption approach, the silencing approach has an advantage in that any E. coli strain can be used and multiple gene silencing is easily possible in any combination. PMID:24212579

Biodegradable Nanoparticles of mPEG-PLGA-PLL Triblock Copolymers as Novel Non-Viral Vectors for Improving siRNA Delivery and Gene Silencing

PubMed Central

Du, Jing; Sun, Ying; Shi, Qiu-Sheng; Liu, Pei-Feng; Zhu, Ming-Jie; Wang, Chun-Hui; Du, Lian-Fang; Duan, You-Rong

2012-01-01

Degradation of mRNA by RNA interference is one of the most powerful and specific mechanisms for gene silencing. However, insufficient cellular uptake and poor stability have limited its usefulness. Here, we report efficient delivery of siRNA via the use of biodegradable nanoparticles (NPs) made from monomethoxypoly(ethylene glycol)-poly(lactic-co-glycolic acid)-poly-l-lysine (mPEG-PLGA-PLL) triblock copolymers. Various physicochemical properties of mPEG-PLGA-PLL NPs, including morphology, size, surface charge, siRNA encapsulation efficiency, and in vitro release profile of siRNA from NPs, were characterized by scanning electron microscope, particle size and zeta potential analyzer, and high performance liquid chromatography. The levels of siRNA uptake and targeted gene inhibition were detected in human lung cancer SPC-A1-GFP cells stably expressing green fluorescent protein. Examination of the cultured SPC-A1-GFP cells with fluorescent microscope and flow cytometry showed NPs loading Cy3-labeled siRNA had much higher intracellular siRNA delivery efficiencies than siRNA alone and Lipofectamine-siRNA complexes. The gene silencing efficiency of mPEG-PLGA-PLL NPs was higher than that of commercially available transfecting agent Lipofectamine while showing no cytotoxicity. Thus, the current study demonstrates that biodegradable NPs of mPEG-PLGA-PLL triblock copolymers can be potentially applied as novel non-viral vectors for improving siRNA delivery and gene silencing. PMID:22312268

Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

NASA Astrophysics Data System (ADS)

Travella, Silvia; Keller, Beat

Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

Construction and characterization of VL-VH tail-parallel genetically engineered antibodies against staphylococcal enterotoxins.

PubMed

He, Xianzhi; Zhang, Lei; Liu, Pengchong; Liu, Li; Deng, Hui; Huang, Jinhai

2015-03-01

Staphylococcal enterotoxins (SEs) produced by Staphylococcus aureus have increasingly given rise to human health and food safety. Genetically engineered small molecular antibody is a useful tool in immuno-detection and treatment for clinical illness caused by SEs. In this study, we constructed the V(L)-V(H) tail-parallel genetically engineered antibody against SEs by using the repertoire of rearranged germ-line immunoglobulin variable region genes. Total RNA were extracted from six hybridoma cell lines that stably express anti-SEs antibodies. The variable region genes of light chain (V(L)) and heavy chain (V(H)) were cloned by reverse transcription PCR, and their classical murine antibody structure and functional V(D)J gene rearrangement were analyzed. To construct the eukaryotic V(H)-V(L) tail-parallel co-expression vectors based on the "5'-V(H)-ivs-IRES-V(L)-3'" mode, the ivs-IRES fragment and V(L) genes were spliced by two-step overlap extension PCR, and then, the recombined gene fragment and V(H) genes were inserted into the pcDNA3.1(+) expression vector sequentially. And then the constructed eukaryotic expression clones termed as p2C2HILO and p5C12HILO were transfected into baby hamster kidney 21 cell line, respectively. Two clonal cell lines stably expressing V(L)-V(H) tail-parallel antibodies against SEs were obtained, and the antibodies that expressed intracytoplasma were evaluated by enzyme-linked immunosorbent assay, immunofluorescence assay, and flow cytometry. SEs can stimulate the expression of some chemokines and chemokine receptors in porcine IPEC-J2 cells; mRNA transcription level of four chemokines and chemokine receptors can be blocked by the recombinant SE antibody prepared in this study. Our results showed that it is possible to get functional V(L)-V(H) tail-parallel genetically engineered antibodies in same vector using eukaryotic expression system.

Modulation of microRNA-mRNA Target Pairs by Human Papillomavirus 16 Oncoproteins

PubMed Central

Harden, Mallory E.; Prasad, Nripesh; Griffiths, Anthony

2017-01-01

ABSTRACT The E6 and E7 proteins are the major oncogenic drivers encoded by high-risk human papillomaviruses (HPVs). While many aspects of the transforming activities of these proteins have been extensively studied, there are fewer studies that have investigated how HPV E6/E7 expression affects the expression of cellular noncoding RNAs. The goal of our study was to investigate HPV16 E6/E7 modulation of cellular microRNA (miR) levels and to determine the potential consequences for cellular gene expression. We performed deep sequencing of small and large cellular RNAs in primary undifferentiated cultures of human foreskin keratinocytes (HFKs) with stable expression of HPV16 E6/E7 or a control vector. After integration of the two data sets, we identified 51 differentially expressed cellular miRs associated with the modulation of 1,456 potential target mRNAs in HPV16 E6/E7-expressing HFKs. We discovered that the degree of differential miR expression in HFKs expressing HPV16 E6/E7 was not necessarily predictive of the number of corresponding mRNA targets or the potential impact on gene expression. Additional analyses of the identified miR-mRNA pairs suggest modulation of specific biological activities and biochemical pathways. Overall, our study supports the model that perturbation of cellular miR expression by HPV16 E6/E7 importantly contributes to the rewiring of cellular regulatory circuits by the high-risk HPV E6 and E7 proteins that contribute to oncogenic transformation. PMID:28049151

Transient Expression of an LEDGF/p75 Chimera Retargets Lentivector Integration and Functionally Rescues in a Model for X-CGD

PubMed Central

Vets, Sofie; De Rijck, Jan; Brendel, Christian; Grez, Manuel; Bushman, Frederic; Debyser, Zeger; Gijsbers, Rik

2013-01-01

Retrovirus-based vectors are commonly used as delivery vehicles to correct genetic diseases because of their ability to integrate new sequences stably. However, adverse events in which vector integration activates proto-oncogenes, leading to clonal expansion and leukemogenesis hamper their application. The host cell-encoded lens epithelium-derived growth factor (LEDGF/p75) binds lentiviral integrase and targets integration to active transcription units. We demonstrated earlier that replacing the LEDGF/p75 chromatin interaction domain with an alternative DNA-binding protein could retarget integration. Here, we show that transient expression of the chimeric protein using mRNA electroporation efficiently redirects lentiviral vector (LV) integration in wild-type (WT) cells. We then employed this technology in a model for X-linked chronic granulomatous disease (X-CGD) using myelomonocytic PLB-985 gp91−/− cells. Following electroporation with mRNA encoding the LEDGF-chimera, the cells were treated with a therapeutic lentivector encoding gp91phox. Integration site analysis revealed retargeted integration away from genes and towards heterochromatin-binding protein 1β (CBX1)-binding sites, in regions enriched in marks associated with gene silencing. Nevertheless, gp91phox expression was stable for at least 6 months after electroporation and NADPH-oxidase activity was restored to normal levels as determined by superoxide production. Together, these data provide proof-of-principle that transient expression of engineered LEDGF-chimera can retarget lentivector integration and rescues the disease phenotype in a cell model, opening perspectives for safer gene therapy. PMID:23462964

Ascl1-induced neuronal differentiation of P19 cells requires expression of a specific inhibitor protein of cAMP-dependent protein kinase

PubMed Central

Huang, Holly S.; Turner, David L.; Thompson, Robert C.; Uhler, Michael D.

2011-01-01

cAMP-dependent protein kinase (PKA) plays a critical role in nervous system development by modulating sonic hedgehog and bone morphogenetic protein signaling. In the current studies, P19 embryonic carcinoma cells were neuronally differentiated by expression of the proneural basic helix-loop-helix transcription factor Ascl1. After expression of Ascl1, but prior to expression of neuronal markers such as microtubule associated protein 2 and neuronal β-tubulin, P19 cells demonstrated a large, transient increase in both mRNA and protein for the endogenous protein kinase inhibitor (PKI)β. PKIβ-targeted shRNA constructs both reduced the levels of PKIβ expression and blocked the neuronal differentiation of P19 cells. This inhibition of differentiation was rescued by transfection of a shRNA-resistant expression vector for the PKIβ protein, and this rescue required the PKA-specific inhibitory sequence of the PKIβprotein. PKIβ played a very specific role in the Ascl1-mediated differentiation process since other PKI isoforms were unable to rescue the deficit conferred by shRNA-mediated knockdown of PKIβ. Our results define a novel requirement for PKIβ and its inhibition of PKA during neuronal differentiation of P19 cells. PMID:21623794

Identification of novel, highly expressed retroviral microRNAs in cells infected by bovine foamy virus.

PubMed

Whisnant, Adam W; Kehl, Timo; Bao, Qiuying; Materniak, Magdalena; Kuzmak, Jacek; Löchelt, Martin; Cullen, Bryan R

2014-05-01

While numerous viral microRNAs (miRNAs) expressed by DNA viruses, especially herpesvirus family members, have been reported, there have been very few reports of miRNAs derived from RNA viruses. Here we describe three miRNAs expressed by bovine foamy virus (BFV), a member of the spumavirus subfamily of retroviruses, in both BFV-infected cultured cells and BFV-infected cattle. All three viral miRNAs are initially expressed in the form of an ∼ 122-nucleotide (nt) pri-miRNA, encoded within the BFV long terminal repeat U3 region, that is subsequently cleaved to generate two pre-miRNAs that are then processed to yield three distinct, biologically active miRNAs. The BFV pri-miRNA is transcribed by RNA polymerase III, and the three resultant mature miRNAs were found to contribute a remarkable ∼ 70% of all miRNAs expressed in BFV-infected cells. These data document the second example of a retrovirus that is able to express viral miRNAs by using embedded proviral RNA polymerase III promoters. Foamy viruses are a ubiquitous family of nonpathogenic retroviruses that have potential as gene therapy vectors in humans. Here we demonstrate that bovine foamy virus (BFV) expresses high levels of three viral microRNAs (miRNAs) in BFV-infected cells in culture and also in infected cattle. The BFV miRNAs are unusual in that they are initially transcribed by RNA polymerase III as a single, ∼ 122-nt pri-miRNA that is subsequently processed to release three fully functional miRNAs. The observation that BFV, a foamy virus, is able to express viral miRNAs in infected cells adds to emerging evidence that miRNA expression is a common, albeit clearly not universal, property of retroviruses and suggests that these miRNAs may exert a significant effect on viral replication in vivo.

Identification of Novel, Highly Expressed Retroviral MicroRNAs in Cells Infected by Bovine Foamy Virus

PubMed Central

Whisnant, Adam W.; Kehl, Timo; Bao, Qiuying; Materniak, Magdalena; Kuzmak, Jacek; Löchelt, Martin

2014-01-01

ABSTRACT While numerous viral microRNAs (miRNAs) expressed by DNA viruses, especially herpesvirus family members, have been reported, there have been very few reports of miRNAs derived from RNA viruses. Here we describe three miRNAs expressed by bovine foamy virus (BFV), a member of the spumavirus subfamily of retroviruses, in both BFV-infected cultured cells and BFV-infected cattle. All three viral miRNAs are initially expressed in the form of an ∼122-nucleotide (nt) pri-miRNA, encoded within the BFV long terminal repeat U3 region, that is subsequently cleaved to generate two pre-miRNAs that are then processed to yield three distinct, biologically active miRNAs. The BFV pri-miRNA is transcribed by RNA polymerase III, and the three resultant mature miRNAs were found to contribute a remarkable ∼70% of all miRNAs expressed in BFV-infected cells. These data document the second example of a retrovirus that is able to express viral miRNAs by using embedded proviral RNA polymerase III promoters. IMPORTANCE Foamy viruses are a ubiquitous family of nonpathogenic retroviruses that have potential as gene therapy vectors in humans. Here we demonstrate that bovine foamy virus (BFV) expresses high levels of three viral microRNAs (miRNAs) in BFV-infected cells in culture and also in infected cattle. The BFV miRNAs are unusual in that they are initially transcribed by RNA polymerase III as a single, ∼122-nt pri-miRNA that is subsequently processed to release three fully functional miRNAs. The observation that BFV, a foamy virus, is able to express viral miRNAs in infected cells adds to emerging evidence that miRNA expression is a common, albeit clearly not universal, property of retroviruses and suggests that these miRNAs may exert a significant effect on viral replication in vivo. PMID:24522910

Stable integration and expression of heterologous genes in several lactobacilli using an integration vector constructed from the integrase and attP sequences of phage ΦAT3 isolated from Lactobacillus casei ATCC 393.

PubMed

Lin, Chao-Fen; Lo, Ta-Chun; Kuo, Yang-Cheng; Lin, Thy-Hou

2013-04-01

An integration vector capable of stably integrating and maintaining in the chromosomes of several lactobacilli over hundreds of generations has been constructed. The major integration machinery used is based on the ΦAT3 integrase (int) and attP sequences determined previously. A novel core sequence located at the 3' end of the tRNA(leu) gene is identified in Lactobacillus fermentum ATCC 14931 as the integration target by the integration vector though most of such sequences found in other lactobacilli are similar to that determined previously. Due to the lack of an appropriate attB site in Lactococcus lactis MG1363, the integration vector is found to be unable to integrate into the chromosome of the strain. However, such integration can be successfully restored by cotransforming the integration vector with a replicative one harboring both attB and erythromycin resistance sequences into the strain. Furthermore, the integration vector constructed carries a promoter region of placT from the chromosome of Lactobacillus rhamnosus TCELL-1 which is used to express green fluorescence and luminance protein genes in the lactobacilli studied.

TLR4-NOX4-AP-1 signaling mediates lipopolysaccharide-induced CXCR6 expression in human aortic smooth muscle cells.

PubMed

Patel, Devang N; Bailey, Steven R; Gresham, John K; Schuchman, David B; Shelhamer, James H; Goldstein, Barry J; Foxwell, Brian M; Stemerman, Michael B; Maranchie, Jodi K; Valente, Anthony J; Mummidi, Srinivas; Chandrasekar, Bysani

2006-09-08

CXCL16 is a transmembrane non-ELR CXC chemokine that signals via CXCR6 to induce aortic smooth muscle cell (ASMC) proliferation. While bacterial lipopolysaccharide (LPS) has been shown to stimulate CXCL16 expression in SMC, its effects on CXCR6 are not known. Here, we demonstrate that LPS upregulates CXCR6 mRNA, protein, and surface expression in human ASMC. Inhibition of TLR4 with neutralizing antibodies or specific siRNA interference blocked LPS-mediated CXCR6 expression. LPS stimulated both AP-1 (c-Fos, c-Jun) and NF-kappaB (p50 and p65) activation, but only inhibition of AP-1 attenuated LPS-induced CXCR6 expression. Using dominant negative expression vectors and siRNA interference, we demonstrate that LPS induces AP-1 activation via MyD88, TRAF6, ERK1/2, and JNK signaling pathways. Furthermore, the flavoprotein inhibitor diphenyleniodonium chloride significantly attenuated LPS-mediated AP-1-dependent CXCR6 expression, as did inhibition of NOX4 NADPH oxidase by siRNA. Finally, CXCR6 knockdown inhibited CXCL16-induced ASMC proliferation. These results demonstrate that LPS-TLR4-NOX4-AP-1 signaling can induce CXCR6 expression in ASMC, and suggest that the CXCL16-CXCR6 axis may be an important proinflammatory pathway in the pathogenesis of atherosclerosis.

TLR4-NOX4-AP-1 signaling mediates lipopolysaccharide-induced CXCR6 expression in human aortic smooth muscle cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patel, Devang N.; Bailey, Steven R.; Gresham, John K.

2006-09-08

CXCL16 is a transmembrane non-ELR CXC chemokine that signals via CXCR6 to induce aortic smooth muscle cell (ASMC) proliferation. While bacterial lipopolysaccharide (LPS) has been shown to stimulate CXCL16 expression in SMC, its effects on CXCR6 are not known. Here, we demonstrate that LPS upregulates CXCR6 mRNA, protein, and surface expression in human ASMC. Inhibition of TLR4 with neutralizing antibodies or specific siRNA interference blocked LPS-mediated CXCR6 expression. LPS stimulated both AP-1 (c-Fos, c-Jun) and NF-{kappa}B (p50 and p65) activation, but only inhibition of AP-1 attenuated LPS-induced CXCR6 expression. Using dominant negative expression vectors and siRNA interference, we demonstrate thatmore » LPS induces AP-1 activation via MyD88, TRAF6, ERK1/2, and JNK signaling pathways. Furthermore, the flavoprotein inhibitor diphenyleniodonium chloride significantly attenuated LPS-mediated AP-1-dependent CXCR6 expression, as did inhibition of NOX4 NADPH oxidase by siRNA. Finally, CXCR6 knockdown inhibited CXCL16-induced ASMC proliferation. These results demonstrate that LPS-TLR4-NOX4-AP-1 signaling can induce CXCR6 expression in ASMC, and suggest that the CXCL16-CXCR6 axis may be an important proinflammatory pathway in the pathogenesis of atherosclerosis.« less

[Construction of lentiviral mediated CyPA siRNA and its functions in non-small cell lung cancer].

PubMed

FENG, Yan-ming; WU, Yi-ming; TU, Xin-ming; XU, Zheng-shun; WU, Wei-dong

2010-02-01

To construct a lentiviral-vector-mediated CyPA small interference RNA (siRNA) and study its function in non-small cell lung cancer. First, four target sequences were selected according to CyPA mRNA sequence, the complementary DNA contained both sense and antisense oligonucleotides were designed, synthesized and cloned into the pGCL-GFP vector, which contained U6 promoter and green fluorescent protein (GFP). The resulting lentiviral vector containing CyPA shRNA was named Lv-shCyPA, and it was confirmed by PCR and sequencing. Next, it was cotransfected by Lipofectamine 2000 along with pHelper1.0 and pHelper 2.0 into 293T cells to package lentivirus particles. At the same time, the packed virus infected non-small cell lung cancer cell (A549), the level of CyPA protein at 5 d after infection was detected by Western Blot to screen the target of CyPA. A549 were infected with Lv-shCyPA and grown as xenografts in severe combined immunodeficient mice. Cell cycle and apoptosis were measured by FCM. It was confirmed by PCR and DNA sequencing that lentiviral-vector-mediated CyPA siRNA (Lv-shCyPA) producing CyPA shRNA was constructed successfully. The titer of concentrated virus were 1 x 10(7) TU/ml. Flow cytometric analysis demonstrated G2-M phase (11.40% +/- 0.68%) was decreased relatively in A549/LvshCyPA compared with control groups (14.52% +/- 1.19%) (P<0.05). The apoptosis rate of A549/Lv-shCyPA (5.01% +/- 0.5%) was higher than control groups (0.35% +/- 0.17%) (P<0.05). Visible tumors were only detectable at 6th day after inoculated by A549/Lv-shCyPA. The xenograft tumors of A549/Lv-shCyPA remarkably delayed tumor growth and remained at a similarly small average size at 38th days after inoculation compared with the control group (P < 0.05). Lentiviral-vector-mediated siRNA technique effectively inhibits the expression of CyPA, induces the NSCLC cell apoptosis, inhibits the tumor growth. Elucidation of the precise role of CypA in these pathways may lead to new targeted therapies for non-small cell lung cancer.

Downregulation of CD147 expression by RNA interference inhibits HT29 cell proliferation, invasion and tumorigenicity in vitro and in vivo.

PubMed

Li, Rui; Pan, Yuqin; He, Bangshun; Xu, Yeqiong; Gao, Tianyi; Song, Guoqi; Sun, Huiling; Deng, Qiwen; Wang, Shukui

2013-12-01

We investigated the effect of CD147 silencing on HT29 cell proliferation and invasion. We constructed a novel short hairpin RNA (shRNA) expression vector pYr-mir30-shRNA. The plasmid was transferred to HT29 cells. The expression of CD147, MCT1 (lactate transporters monocarboxylate transporter 1) and MCT4 (lactate transporters monocarboxylate transporter 4) were monitored by quantitative PCR and western blotting, respectively. The MMP-2 (matrix metalloproteinase-2) and MMP-9 (matrix metalloproteinase-9) activities were determined by gelatin zymography assay, while the intracellular lactate concentration was determined by the lactic acid assay kit. WST-8 assay was used to determine the HT29 cell proliferation and the chemosensitivity. Invasion assay was used to determine the invasion of HT29 cells. In addition, we established a colorectal cancer model, and detected CD147 expression in vivo. The results showed that the expression of CD147 and MCT1 was significantly reduced at both mRNA and protein levels, and also the activity of MMP-2 and MMP-9 was reduced. The proliferation and invasion were decreased, but chemosensitivity to cisplatin was increased. In vivo, the CD147 expression was also significantly decreased, and reduced the tumor growth after CD147 gene silencing. The results demonstrated that silencing of CD147 expression inhibited the proliferation and invasion, suggesting CD147 silencing might be an adjuvant gene therapy strategy to chemotherapy.

Targeted Elimination of PCDH-PC Expressing Prostate Cancer Cells for Control of Hormone-Resistant Prostate Cancer

DTIC Science & Technology

2009-11-01

expression knockout by shRNAs or antisense oligonucleotides ( ASOs ) might be useful in preventing the development of castration-recurrent prostate...cancer in prostate cancer patients. To this end, we have created functional shRNA vectors and ASOs capable of suppressing PCDH-PC expression and we have...containing PCDH-PC cDNA. Cell extracts were prepared 48 hrs after co-transfection and were electrophoresed on an SDS-PAGE gel and blotted onto a

Genome-Based Genetic Tool Development for Bacillus methanolicus: Theta- and Rolling Circle-Replicating Plasmids for Inducible Gene Expression and Application to Methanol-Based Cadaverine Production.

PubMed

Irla, Marta; Heggeset, Tonje M B; Nærdal, Ingemar; Paul, Lidia; Haugen, Tone; Le, Simone B; Brautaset, Trygve; Wendisch, Volker F

2016-01-01

Bacillus methanolicus is a thermophilic methylotroph able to overproduce amino acids from methanol, a substrate not used for human or animal nutrition. Based on our previous RNA-seq analysis a mannitol inducible promoter and a putative mannitol activator gene mtlR were identified. The mannitol inducible promoter was applied for controlled gene expression using fluorescent reporter proteins and a flow cytometry analysis, and improved by changing the -35 promoter region and by co-expression of the mtlR regulator gene. For independent complementary gene expression control, the heterologous xylose-inducible system from B. megaterium was employed and a two-plasmid gene expression system was developed. Four different replicons for expression vectors were compared with respect to their copy number and stability. As an application example, methanol-based production of cadaverine was shown to be improved from 11.3 to 17.5 g/L when a heterologous lysine decarboxylase gene cadA was expressed from a theta-replicating rather than a rolling-circle replicating vector. The current work on inducible promoter systems and compatible theta- or rolling circle-replicating vectors is an important extension of the poorly developed B. methanolicus genetic toolbox, valuable for genetic engineering and further exploration of this bacterium.

Genome-Based Genetic Tool Development for Bacillus methanolicus: Theta- and Rolling Circle-Replicating Plasmids for Inducible Gene Expression and Application to Methanol-Based Cadaverine Production

PubMed Central

Irla, Marta; Heggeset, Tonje M. B.; Nærdal, Ingemar; Paul, Lidia; Haugen, Tone; Le, Simone B.; Brautaset, Trygve; Wendisch, Volker F.

2016-01-01

Bacillus methanolicus is a thermophilic methylotroph able to overproduce amino acids from methanol, a substrate not used for human or animal nutrition. Based on our previous RNA-seq analysis a mannitol inducible promoter and a putative mannitol activator gene mtlR were identified. The mannitol inducible promoter was applied for controlled gene expression using fluorescent reporter proteins and a flow cytometry analysis, and improved by changing the -35 promoter region and by co-expression of the mtlR regulator gene. For independent complementary gene expression control, the heterologous xylose-inducible system from B. megaterium was employed and a two-plasmid gene expression system was developed. Four different replicons for expression vectors were compared with respect to their copy number and stability. As an application example, methanol-based production of cadaverine was shown to be improved from 11.3 to 17.5 g/L when a heterologous lysine decarboxylase gene cadA was expressed from a theta-replicating rather than a rolling-circle replicating vector. The current work on inducible promoter systems and compatible theta- or rolling circle-replicating vectors is an important extension of the poorly developed B. methanolicus genetic toolbox, valuable for genetic engineering and further exploration of this bacterium. PMID:27713731

siRNA blocking the RAS signalling pathway and inhibits the growth of oesophageal squamous cell carcinoma in nude mice.

PubMed

Wang, Xinjie; Zheng, Yuling; Fan, Qingxia; Zhang, Xudong; Shi, Yonggang

2014-12-01

The aim of this study was to study RAS-siRNA blocking RAS pathway and suppressing cell growth in human oesophageal squamous cell carcinoma in nude mice. The methods in this study was to construct RAS-siRNA expression vector, establish 40 oesophageal squamous cell carcinoma xenograft animal models and divided them into five groups: control group, siRNA control group, RAS-siRNA group, paclitaxel group and RAS-siRNA and paclitaxel group. We observed tumour growth in nude mice, studied histology by HE staining, tumour growth inhibition by TUNEL assay and detected the RAS, MAPK and cyclin D1 protein expression by immunohistochemistry and western blot. We have obtained the following results: (i) successfully established animal models; (ii) nude mice in each group after treatment inhibited tumour volume was significantly reduced compared with the control group (p < 0.05); (iii) compared with the control group, the number of apoptotic cells were significantly increased in the siRNA control group and the RAS-siRNA group, and the number of apoptosis cells in the paclitaxel and RAS-siRNA group is significantly most than the paclitaxel group and RAS-siRNA group (p < 0.05); and (iv) after treatment, RAS, MAPK and cyclin D1 expression in five groups was decreasing gradually. After adding paclitaxel, the protein expression in the paclitaxel and RAS-siRNA group was significantly lower than that of paclitaxel group, negative control and paclitaxel group (p < 0.05). We therefore conclude that RAS-siRNA can block the RAS signal transduction pathway, reduce the activity of tumour cells, arrest tumour cell cycle, promote apoptosis, inhibit cell proliferation and increase tumour cell sensitivity to chemotherapeutic drugs. Copyright © 2014 John Wiley & Sons, Ltd.

An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS.

PubMed

Ding, Xin Shun; Mannas, Stephen W; Bishop, Bethany A; Rao, Xiaolan; Lecoultre, Mitchell; Kwon, Soonil; Nelson, Richard S

2018-01-01

Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 ( HSP70-1 ) inserts in Nicotiana benthamiana and maize ( Zea mays ). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70 , silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. © 2018 American Society of Plant Biologists. All Rights Reserved.

Soil-borne wheat mosaic virus infectious clone and manipulation for gene-carrying capacity

USDA-ARS?s Scientific Manuscript database

Soilborne wheat mosaic virus (SBWMV) is a bipartite single stranded positive sense RNA virus with rigid-rod shaped virions. Taxonomically the virus is in the family Viragviridae, as are commonly used gene silencing or expression viral vectors, Tobacco rattle virus (TRV) and Barley stripe mosaic viru...

Production of SV40-derived vectors.

PubMed

Strayer, David S; Mitchell, Christine; Maier, Dawn A; Nichols, Carmen N

2010-06-01

Recombinant simian virus 40 (rSV40)-derived vectors are particularly useful for gene delivery to bone marrow progenitor cells and their differentiated derivatives, certain types of epithelial cells (e.g., hepatocytes), and central nervous system neurons and microglia. They integrate rapidly into cellular DNA to provide long-term gene expression in vitro and in vivo in both resting and dividing cells. Here we describe a protocol for production and purification of these vectors. These procedures require only packaging cells (e.g., COS-7) and circular vector genome DNA. Amplification involves repeated infection of packaging cells with vector produced by transfection. Cotransfection is not required in any step. Viruses are purified by centrifugation using discontinuous sucrose or cesium chloride (CsCl) gradients and resulting vectors are replication-incompetent and contain no detectable wild-type SV40 revertants. These approaches are simple, give reproducible results, and may be used to generate vectors that are deleted only for large T antigen (Tag), or for all SV40-coding sequences capable of carrying up to 5 kb of foreign DNA. These vectors are best applied to long-term expression of proteins normally encoded by mammalian cells or by viruses that infect mammalian cells, or of untranslated RNAs (e.g., RNA interference). The preparative approaches described facilitate application of these vectors and allow almost any laboratory to exploit their strengths for diverse gene delivery applications.

Targeted genome editing in a quail cell line using a customized CRISPR/Cas9 system.

PubMed

Ahn, Jinsoo; Lee, Joonbum; Park, Ju Yeon; Oh, Keon Bong; Hwang, Seongsoo; Lee, Chang-Won; Lee, Kichoon

2017-05-01

Soon after RNA-guided Cas9 (CRISPR-associated protein 9) endonuclease opened a new era of targeted genome editing, the CRISPR/Cas9 platform began to be extensively used to modify genes in various types of cells and organisms. However, successful CRISPR/Cas9-mediated insertion/deletion (indel) mutation remains to be demonstrated in avian cell lines. The objective of this study was to design a poultry-specific CRISPR/Cas9 system to efficiently introduce targeted deletion mutation in chromosomes of the quail muscle clone 7 (QM7) cell line using a customized quail CRISPR vector. In this study, two avian-specific promoters, quail 7SK (q7SK) promoter and CBh promoter, the hybrid form of cytomegalovirus and chicken β-actin promoters, were cloned into a CRISPR vector for the expression of guide RNA and Cas9 protein, respectively. Then, guide RNA, which was designed to target 20-base pair (bp) nucleotides in the quail melanophilin (MLPH) locus, was ligated to the modified CRISPR vector and transfected to QM7 cells. Our results showed multiple indel mutations in the quail MLPH locus in nearly half of the alleles being tested, suggesting the high efficiency of the system for targeted gene modification. The new CRISPR vector developed from this study has the potential application to generate knockout avian cell lines and knockout poultry. © 2016 Poultry Science Association Inc.

Knockdown of Pokemon protein expression inhibits hepatocellular carcinoma cell proliferation by suppression of AKT activity.

PubMed

Zhu, Xiaosan; Dai, Yichen; Chen, Zhangxin; Xie, Junpei; Zeng, Wei; Lin, Yuanyuan

2013-01-01

Overexpression of Pokemon, which is an erythroid myeloid ontogenic factor protein, occurs in different cancers, including hepatocellular carcinoma (HCC). Pokemon is also reported to have an oncogenic activity in various human cancers. This study investigated the effect of Pokemon knockdown on the regulation of HCC growth. POK shRNA suppressed the expression of Pokemon protein in HepG2 cells compared to the negative control vector-transfected HCC cells. Pokemon knockdown also reduced HCC cell viability and enhanced cisplatin-induced apoptosis in HCC cells. AKT activation and the expression of various cell cycle-related genes were inhibited following Pokemon knockdown. These data demonstrate that Pokemon may play a role in HCC progression, suggesting that inhibition of Pokemon expression using Pokemon shRNA should be further evaluated as a novel target for the control of HCC.

Tumor-specific RNA interference targeting Pokemon suppresses tumor growth and induces apoptosis in prostate cancer.

PubMed

Li, Yining; Xu, Shuxiong; Wang, Xiangwei; Shi, Hua; Sun, Zhaolin; Yang, Zhao

2013-02-01

To explore the exact mechanism of Pokemon in prostate cancer. Pokemon is a member of the POK family of transcriptional repressors. Its main function is suppression of the p14ARF (alternate reading frame) tumor suppressor gene. Although Pokemon expression has been found to be increased in various types of lymphoma, the exact mechanism of the gene in prostate cancer is not clear. In the present study, prostate cancer cells were transfected with the specific short hairpin ribonucleic acid (RNA) expression vector targeting Pokemon. The expression of Pokemon messenger RNA and its protein was detected by semiquantitative reverse transcriptase-polymerase chain reaction and Western blotting, respectively. The cell growth and cell apoptosis were also examined using the methyl thiazolyl tetrazolium assay and flow cytometry. The results demonstrated that specific RNA interference (RNAi) could decrease the expression levels of Pokemon gene messenger RNA and protein in prostate cancer cells. In addition, that specific RNAi significantly inhibited the cell proliferation and increased the apoptotic rate. In vivo experiments showed that specific RNAi inhibited the tumorigenicity of prostate cancer cells and significantly suppressed tumor growth. Therefore, an RNAi-targeted Pokemon gene strategy could be a potential approach to prostate cancer therapy. Copyright © 2013 Elsevier Inc. All rights reserved.

Newcastle disease virus vectored vaccines as bivalent or antigen delivery vaccines

PubMed Central

2017-01-01

Recent advances in reverse genetics techniques make it possible to manipulate the genome of RNA viruses such as Newcastle disease virus (NDV). Several NDV vaccine strains have been used as vaccine vectors in poultry, mammals, and humans to express antigens of different pathogens. The safety, immunogenicity, and protective efficacy of these NDV-vectored vaccines have been evaluated in pre-clinical and clinical studies. The vaccines are safe in mammals, humans, and poultry. Bivalent NDV-vectored vaccines against pathogens of economic importance to the poultry industry have been developed. These bivalent vaccines confer solid protective immunity against NDV and other foreign antigens. In most cases, NDV-vectored vaccines induce strong local and systemic immune responses against the target foreign antigen. This review summarizes the development of NDV-vectored vaccines and their potential use as a base for designing other effective vaccines for veterinary and human use. PMID:28775971

Characterization of polyethylene glycol-grafted polyethylenimine and superparamagnetic iron oxide nanoparticles (PEG-g-PEI-SPION) as an MRI-visible vector for siRNA delivery in gastric cancer in vitro and in vivo.

PubMed

Chen, Yinting; Lian, Guoda; Liao, Chengde; Wang, Weiwei; Zeng, Linjuan; Qian, Chenchen; Huang, Kaihong; Shuai, Xintao

2013-07-01

Gene therapy is a promising therapeutic method but is severely hampered due to its lack of an ideal delivery system. Therefore, in this study, a nonviral and magnetic resonance imaging (MRI) visible vector, polyethylene glycol-grafted polyethylenimine and superparamagnetic iron oxide nanoparticles (PEG-g-PEI-SPION) was used as a nanocarrier for small interfering RNA (siRNA) delivery in gastric cancer. Biophysical characterization of PEG-g-PEI-SPION was systematically analyzed, including size, zeta potential, siRNA condensation capacity, cell viability, transfection efficiency, cellular uptake, and MRI-visible function in vivo. Besides, CD44 variant isoform 6 (CD44v6), a protein marker for metastatic behavior in gastric cancer, and was chose as the target gene to further analyze the siRNA delivery function of PEG-g-PEI-SPION. Under comprehensive analysis, the appropriate N/P ratio of PEG-g-PEI-SPION/siRNA was 10, and siRNA targeting at human CD44v6 (siCD44v6) transferred by PEG-g-PEI-SPION was effective at downregulating the CD44v6 expression of gastric carcinoma cell line SGC-7901 in vitro. Moreover, knockdown of CD44v6 impaired migrating and invasive abilities of SGC-7901 cells. Furthermore, PEG-g-PEI-SPION was a highly efficient contrast agent for MRI scan in vivo. PEG-g-PEI-SPION was a promising nonviral vector with molecular image tracing capacity for cancer gene therapy. And CD44v6 was a potential target gene for the prevention and detection of metastatic behavior in gastric cancer.

All-in-One CRISPR-Cas9/FokI-dCas9 Vector-Mediated Multiplex Genome Engineering in Cultured Cells.

PubMed

Sakuma, Tetsushi; Sakamoto, Takuya; Yamamoto, Takashi

2017-01-01

CRISPR-Cas9 enables highly convenient multiplex genome engineering in cultured cells, because it utilizes generic Cas9 nuclease and an easily customizable single-guide RNA (sgRNA) for site-specific DNA double-strand break induction. We previously established a multiplex CRISPR-Cas9 assembly system for constructing an all-in-one vector simultaneously expressing multiple sgRNAs and Cas9 nuclease or other Cas9 variants including FokI-dCas9, which supersedes the wild-type Cas9 with regard to high specificity. In this chapter, we describe a streamlined protocol to design and construct multiplex CRISPR-Cas9 or FokI-dCas9 vectors, to introduce them into cultured cells by lipofection or electroporation, to enrich the genomically edited cells with a transient puromycin selection, to validate the mutation efficiency by Surveyor nuclease assay, and to perform off-target analyses. We show that our protocol enables highly efficient multiplex genome engineering even in hard-to-transfect HepG2 cells.

Optimization of a nonviral transfection system to evaluate Cox-2 controlled interleukin-4 expression for osteoarthritis gene therapy in vitro.

PubMed

Lang, Annemarie; Neuhaus, Johannes; Pfeiffenberger, Moritz; Schröder, Erik; Ponomarev, Igor; Weber, Yvonne; Gaber, Timo; Schmidt, Michael F G

2014-01-01

Gene therapy appears to have the potential for achieving a long-term remedy for osteoarthritis (OA). However, there is a risk of adverse reactions, especially when using cytomegalovirus-controlled expression. To provide a safe application, we focused on the expression of therapeutic cytokines [e.g. interleukin (IL)-4] in a disease-responsive manner by use of the previously cloned Cox-2 promoter as 'genetic switch'. In the present study, we report the functionality of a controlled gene therapeutic system in an equine osteoarthritic cell model. Different nonviral transfection reagents were tested for their efficiency on equine chondrocytes stimulated with equine IL-1β or lipopolysaccharide to create an inflammatory environment. To optimize the transfection, we successfully redesigned the vector by excluding the internal ribosomal entry site (IRES). The functionality of our Cox-2 promoter construct with respect to expressing IL-4 was proven at the mRNA and protein levels and the anti-inflammatory potential of IL-4 was confirmed by analyzing the expression of IL-1β, IL-6, IL-8, matrix metalloproteinase (MMP)-1, MMP-3 and tumor necrosis factor (TNF)-α using a quantitative polymerase chain reaction. Nonviral transfection reagents yielded transfection rates from 21% to 44% with control vectors with and without IRES, respectively. Stimulation of equine chondrocytes resulted in a 20-fold increase of mRNA expression of IL-1β. Such exogenous stimulation of chondrocytes transfected with pNCox2-IL4 led to an increase of IL-4 mRNA expression, whereas expression of inflammatory mediators decreased. The timely link between these events confirms the anti-inflammatory potential of synthesized IL-4. We consider that this approach has significant potential for translation into a useful anti-inflammation therapy. Molecular tools such as the described therapeutic plasmid pave the way for a local-controlled, self-limiting gene therapy. Copyright © 2014 John Wiley & Sons, Ltd.

A Modular Toolset for Recombination Transgenesis and Neurogenetic Analysis of Drosophila

PubMed Central

Wang, Ji-Wu; Beck, Erin S.; McCabe, Brian D.

2012-01-01

Transgenic Drosophila have contributed extensively to our understanding of nervous system development, physiology and behavior in addition to being valuable models of human neurological disease. Here, we have generated a novel series of modular transgenic vectors designed to optimize and accelerate the production and analysis of transgenes in Drosophila. We constructed a novel vector backbone, pBID, that allows both phiC31 targeted transgene integration and incorporates insulator sequences to ensure specific and uniform transgene expression. Upon this framework, we have built a series of constructs that are either backwards compatible with existing restriction enzyme based vectors or utilize Gateway recombination technology for high-throughput cloning. These vectors allow for endogenous promoter or Gal4 targeted expression of transgenic proteins with or without fluorescent protein or epitope tags. In addition, we have generated constructs that facilitate transgenic splice isoform specific RNA inhibition of gene expression. We demonstrate the utility of these constructs to analyze proteins involved in nervous system development, physiology and neurodegenerative disease. We expect that these reagents will facilitate the proficiency and sophistication of Drosophila genetic analysis in both the nervous system and other tissues. PMID:22848718

[Overexpressed miRNA-134b inhibits proliferation and invasion of CD133+ U87 glioma stem cells].

PubMed

Liu, Yifeng; Zhang, Baochao; Wen, Changming; Wen, Gongling; Zhou, Guoping; Zhang, Jingwei; He, Haifa; Wang, Ning; Li, Wei

2017-05-01

Objective To investigate the role of microRNA-134b (miR-134b) in the tumorigenesis of glioma stem cells (GSCs) and the possible molecular mechanism. Methods Real-time quantitative PCR (qRT-PCR) was used to evalate the expression of miR-134b in CD133 + and CD133 - U87 GSCs. A lentiviral vector overexpressing miR-134b in U87 GSCs was constructed, and the effect of miR-134b overexpression on matrix metalloproteinase-2 (MMP-2), MMP-9 and MMP-12 expressions at both mRNA and protein levels were detected by qRT-PCR and Western blotting, respectively. Transwell TM assay was performed to determine the effect of miR-134b overexpression on GSCs invasion ability. Tumor xenograft models in nude mice were established to evaluate the effect of miR-134b overexpression on tumorgenesis in vivo. Results The qRT-PCR showed that, compared with CD133 - cells, miR-134b was significantly down-regulated in CD133 + cells. Cell line over-expressing miR-134b was successfully established, and miR-134b was up-regulated significantly compared with empty vector control. Overexpression of miR-134b remarkably inhibited the invasion of U87 GSCs and the expression of MMP-12. However, overexpression of miR-134b did not affect MMP-2 and MMP-9 expressions. miR-134b also suppressed U87 GSCs xenograft growth in vivo. Tumor volume in tumor xenograft model group was significantly lower than that in control group, and tumor weight decreased by 42% in the former group. Conclusion Overexpression of miR-134b inhibits the growth and invasion of CD133 + GSCs.

Interactions between IGF-I, estrogen receptor-α (ERα), and ERβ in regulating growth/apoptosis of MCF-7 human breast cancer cells.

PubMed

Mendoza, Rhone A; Enriquez, Marlene I; Mejia, Sylvia M; Moody, Emily E; Thordarson, Gudmundur

2011-01-01

Understanding of the interactions between estradiol (E₂) and IGF-I is still incomplete. Cell lines derived from the MCF-7 breast cancer cells were generated with suppressed expression of the IGF-I receptor (IGF-IR), termed IGF-IR.low cells, by stable transfection using small interfering RNA (siRNA) expression vector. Vector for control cells carried sequence generating noninterfering RNA. Concomitant with reduction in the IGF-IR levels, the IGF-IR.low cells also showed a reduction in estrogen receptor α (ERα) and progesterone receptor expressions, and an elevation in the expression of ERβ. The number of the IGF-IR.low cells was reduced in response to IGF-I and human GH plus epidermal growth factor, but E₂ did not cause an increase in the number of the IGF-IR.low cells compared to controls. The proliferation rate of IGF-IR.low cells was only reduced in response to E₂ compared to controls, whereas their basal and hormone-stimulated apoptosis rate was increased. Phosphorylation of p38 mitogen-activated protein kinase (p38 MAPK) was increased in the IGF-IR.low cells after treatment with E₂, without affecting control cells. Furthermore, phosphorylation of the tumor suppressor protein p53 was elevated in the IGF-IR.low cells compared to the controls. In conclusion, suppressing IGF-IR expression decreased the level of ERα but increased the level of ERβ. Overall growth rate of the IGF-IR.low cells was reduced mostly through an increase in apoptosis without affecting proliferation substantially. We hypothesize that a decreased ERα:ERβ ratio triggered a rapid phosphorylation of p38 MAPK, which in turn phosphorylated the p53 tumor suppressor and accelerated apoptosis rate.

Bcl-2 silencing attenuates hypoxia-induced apoptosis resistance in pulmonary microvascular endothelial cells.

PubMed

Cao, Yongmei; Jiang, Zhen; Zeng, Zhen; Liu, Yujing; Gu, Yuchun; Ji, Yingying; Zhao, Yupeng; Li, Yingchuan

2016-01-01

Pulmonary arterial hypertension (PAH) is a life-threatening disorder that ultimately causes heart failure. While the underlying causes of this condition are not well understood, previous studies suggest that the anti-apoptotic nature of pulmonary microvascular endothelial cells (PMVECs) in hypoxic environments contributes to PAH pathogenesis. In this study, we focus on the contribution of Bcl-2 and hypoxia response element (HRE) to apoptosis-resistant endothelial cells and investigate the mechanism. PMVECs obtained from either normal rats or apoptosis-resistant PMVECs obtained from PAH rats were transduced with recombinant lentiviral vectors carrying either Bcl-2-shRNA or HRE combined Bcl-2-shRNA, and then cultured these cells for 24 h under hypoxic (5% O2) or normoxic (21% O2) conditions. In normal PMVECs, Bcl-2-shRNA or HRE combined with Bcl-2-shRNA transduction successfully decreased Bcl-2 expression, while increasing apoptosis as well as caspase-3 and P53 expression in a normoxic environment. In a hypoxic environment, the effects of Bcl-2-shRNA treatment on cell apoptosis, and on Bcl-2, caspase-3, P53 expression were significantly suppressed. Conversely, HRE activation combined with Bcl-2-shRNA transduction markedly enhanced cell apoptosis and upregulated caspase-3 and P53 expression, while decreasing Bcl-2 expression. Furthermore, in apoptosis-resistant PMVECs, HRE-mediated Bcl-2 silencing effectively enhanced cell apoptosis and caspase-3 activity. The apoptosis rate was significantly depressed when Lv-HRE-Bcl-2-shRNA was combined with Lv-P53-shRNA or Lv-caspase3-shRNA transduction in a hypoxic environment. These results suggest that HRE-mediated Bcl-2 inhibition can effectively attenuate hypoxia-induced apoptosis resistance in PMVECs by downregulating Bcl-2 expression and upregulating caspase-3 and P53 expression. This study therefore reveals critical insight into potential therapeutic targets for treating PAH.

Ubiquitin fusion constructs allow the expression and purification of multi-KOW domain complexes of the Saccharomyces cerevisiae transcription elongation factor Spt4/5.

PubMed

Blythe, Amanda; Gunasekara, Sanjika; Walshe, James; Mackay, Joel P; Hartzog, Grant A; Vrielink, Alice

2014-08-01

Spt4/5 is a hetero-dimeric transcription elongation factor that can both inhibit and promote transcription elongation by RNA polymerase II (RNAPII). However, Spt4/5's mechanism of action remains elusive. Spt5 is an essential protein and the only universally-conserved RNAP-associated transcription elongation factor. The protein contains multiple Kyrpides, Ouzounis and Woese (KOW) domains. These domains, in other proteins, are thought to bind RNA although there is little direct evidence in the literature to support such a function in Spt5. This could be due, at least in part, to difficulties in expressing and purifying recombinant Spt5. When expressed in Escherichia coli (E. coli), Spt5 is innately insoluble. Here we report a new approach for the successful expression and purification of milligram quantities of three different multi-KOW domain complexes of Saccharomyces cerevisiae Spt4/5 for use in future functional studies. Using the E. coli strain Rosetta2 (DE3) we have developed strategies for co-expression of Spt4 and multi-KOW domain Spt5 complexes from the bi-cistronic pET-Duet vector. In a second strategy, Spt4/5 was expressed via co-transformation of Spt4 in the vector pET-M11 with Spt5 ubiquitin fusion constructs in the vector pHUE. We characterized the multi-KOW domain Spt4/5 complexes by Western blot, limited proteolysis, circular dichroism, SDS-PAGE and size exclusion chromatography-multiangle light scattering and found that the proteins are folded with a Spt4:Spt5 hetero-dimeric stoichiometry of 1:1. These expression constructs encompass a larger region of Spt5 than has previously been reported, and will provide the opportunity to elucidate the biological function of the multi-KOW containing Spt5. Copyright © 2014 Elsevier Inc. All rights reserved.

Gene silencing in primary and metastatic tumors by small interfering RNA delivery in mice: quantitative analysis using melanoma cells expressing firefly and sea pansy luciferases.

PubMed

Takahashi, Yuki; Nishikawa, Makiya; Kobayashi, Naoki; Takakura, Yoshinobu

2005-07-20

Silencing of oncogenes or other genes contributing to tumor malignancy or progression by RNA interference (RNAi) offers a promising approach to treating tumor patients. To achieve RNAi-based tumor therapy, a small interfering RNA (siRNA) or siRNA-expressing vector needs to be delivered to tumor cells, but little information about its in vivo delivery has been reported. In this study, we examined whether the expression of the target gene in tumor cells can be suppressed by the delivery of RNAi effectors to primary and metastatic tumor cells. To quantitatively evaluate the RNAi effects in tumor cells, mouse melanoma B16-BL6 cells were stably transfected with both firefly (a model target gene) and sea pansy (an internal standard gene) luciferase genes to obtain B16-BL6/dual Luc cells. The target gene expression in subcutaneous primary tumors of B16-BL6/dual Luc cells was significantly suppressed by direct injection of the RNAi effectors followed by electroporation. The expression in metastatic hepatic tumors was also significantly reduced by an intravenous injection of either RNAi effector by the hydrodynamics-based procedure. These results indicate that the both RNAi effectors have a potential to silence target gene in tumor cells in vivo when successfully delivered to tumor cells.

RNA interference targeting CD147 inhibits metastasis and invasion of human breast cancer MCF-7 cells by downregulating MMP-9/VEGF expression.

PubMed

Li, Fang; Zhang, Junping; Guo, Jiqiang; Jia, Yuan; Han, Yaping; Wang, Zhuanhua

2018-06-12

Breast cancer is one of the most common malignancies. It is necessary to identify new markers for predicting tumor progression and therapeutic molecular targets. It has been reported that CD147 is one of the most commonly expressed proteins in primary tumors and in metastatic cells. In this study, we investigated the role of CD147 in human breast cancer metastasis and invasion, and examined its underlying molecular mechanisms. Immunohistochemistry results revealed high expression of CD147 in human breast tumor tissues, which was positively correlated with the malignancy of breast cancer. MCF-7 cells were transfected with CD147 siRNA eukaryotic expression vector, which resulted in significant knockdown of CD147. We found that CD147 siRNA dramatically inhibited cell proliferation, metastasis, and invasion. Furthermore, our results demonstrated that CD147 siRNA inhibited the synthesis of matrix metalloproteinase 9 (MMP-9) but had no significant effect on matrix metalloproteinase 2 (MMP-2). In addition, CD147 siRNA significantly inhibited the production of vascular endothelial growth factor (VEGF). Taken together, these data indicate that CD147 promotes breast cancer cell proliferation, metastasis, and invasion by modulating MMP-9 and VEGF expression. Thus, CD147 may be used as an important indicator for the judgment of malignant behavior of breast cancer, and may be a potential novel target for breast cancer therapy.

Generation of a stable cell line for constitutive miRNA expression.

PubMed

Lieber, Diana

2013-01-01

miRNAs have in recent years emerged as novel players in virus-host interactions. While individual miRNAs are capable of regulating many targets simultaneously, not much is known about the role of distinct host or viral miRNAs in the context of infection. Analysis of the function of a miRNA is often hampered by the complexity of virus-host interactions and the enormous changes in the host cell during infection. Many viral miRNAs as for example from Kaposi sarcoma-associated Herpesvirus (KSHV) are probably exclusively expressed in latent infection. This might lead to a steady-state situation with offense and defense mechanisms counteracting each other. Cellular miRNAs involved in defense against pathogens on the other hand might be suppressed in infection. A cell culture system allowing for constitutive expression of individual miRNAs at high levels is a useful tool to enhance miRNA-specific functions and to uncouple viral miRNA function from other infection-related mechanisms. Here, a protocol is described to generate stable cell lines for constitutive expression of single cellular or viral miRNA precursors in absence of infection. The procedure comprises cloning of the precursor sequence, generation of the lentiviral expression vector, transduction of the cells of interest, selection for polyclonal cell lines, and isolation of monoclonal cell lines by limiting dilution.

SiRNA-Mediated Down-Regulation of CLIC4 Gene Inhibits Cell Proliferation and Accelerates Cell Apoptosis of Mouse Liver Cancer Hca-F and Hca-P Cells.

PubMed

Yu, Qiu-Yun; Zhou, Xin-Feng; Xia, Qing; Shen, Jia; Yan, Jia; Zhu, Jiu-Ting; Li, Xiang; Shu, Ming

2018-01-01

This study explored the effects involved in silencing CLIC4 on apoptosis and proliferation of mouse liver cancer Hca-F and Hca-P cells. A CLIC4-target small interfering RNA (siRNA) was designed to compound into two individual complementary oligonucleotide chains. A process of annealing and connection to a pSilencer vector was followed by transfection with Hca-F and Hca-P cells. Quantitative real-time polymerase chain reaction and Western blotting techniques were used to determine CLIC4 mRNA and protein expressions. CCK8 assay and flow cytometry were employed for analysis of the survival and apoptosis rate as well as the cell cycle in an octreotide-induced apoptosis model. Expressions of caspase 3, caspase 9, and cleaved PARP were measured using Western blotting. The CLIC4 mRNA and protein expressions in Hca-F and Hca-P cells transfected by pSilencer-CLIC4 siRNA plasmid in the blank group displayed remarkably decreased levels of expression, when compared with both the control and negative control (NC) groups. Decreased survival rates and cleaved PARP expression, increased cell apoptosis rate,expressions of caspase 3 and caspase 9 in Hca-F and Hca-P cells were detected in groups that had been cultured in a medium containing octreotide. The pSilencer-CLIC4 siRNA-2 group when compared with the control and NC groups exhibited decreased survival rates, cleaved PARP expression, increased cell apoptosis rates, and increased expressions of caspase 3 and caspase 9 of Hca-F and Hca-P cells. The results demonstrated that siRNA-induced down-regulation of CLIC4 could proliferation, while in turn promoting apoptosis of mouse liver cancer Hca-F and Hca-P cells. J. Cell. Biochem. 119: 659-668, 2018. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Highly abundant and stage-specific mRNAs in the obligate pathogen Bremia lactucae.

PubMed

Judelson, H S; Michelmore, R W

1990-01-01

Germinating spores of the obligate pathogen Bremia lactucae (lettuce downy mildew) contain several unusually abundant species of mRNA. Thirty-nine cDNA clones corresponding to prevalent transcripts were isolated from a library synthesized using poly(A)+ RNA from germinating spores; these clones represented only five distinct classes. Each corresponding mRNA accounted for from 0.4 to 9 percent by mass of poly(A)+ RNA from germinating spores and together represented greater than 20 percent of the mRNA. The expression of the corresponding genes, and a gene encoding Hsp70, was analyzed in spores during germination and during growth in planta. The Hsp70 mRNA and mRNA from one abundant cDNA clone (ham34) were expressed constitutively. Two clones (ham9 and ham12) hybridized only to mRNA from spores and germinating spores. Two clones (ham37 and ham27) showed hybridization specific to germinating spores. Quantification of the number of genes homologous to each cDNA clone indicated that four clones corresponded to one or two copies per haploid genome, and one hybridized to an approximately 11-member family of genes. A sequence of the gene corresponding to ham34 was obtained to investigate its function and to identify sequences conferring high levels of gene expression for use in constructing vectors for the transformation of B. lactucae.

[RS-1 enhanced the efficiency of CRISPR-Cas9 mediated knock-in of human lactoferrin].

PubMed

Zhou, Wenjun; Guo, Rihong; Deng, Mingtian; Wang, Feng; Zhang, Yanli

2017-08-25

This study aims to knock out the goat β-lactoglobulin (BLG) gene using CRISPR-Cas9 system and knock in human lactoferrin (hLF) at the BLG locus, and further study the effect of RAD51 stimulatory compound (RS-1) on homologous recombination efficiency. First, we designed an sgRNA targeting the first exon of goat BLG gene and constructed a co-expression vector pCas9-sgBLG. This sgRNA vector was then transfected into goat ear fibroblasts (GEFs), and the target region was examined by T7EN1 assay and sequencing. Second, we constructed a targeting vector pBHA-hLF-NIE including NEO and EGFP genes based on BLG gene locus. This targeting vector together with pCas9-sgBLG expression vector was co-transfected into GEFs. Transfected cells were then treated with 0, 5, 10 and 20 μmol/L RS-1 for 72 h to analyse the EGFP expression efficiency. Next, we used 800 μg/mL G418 to screen G418-resistent cell clones, and studied hLF site-specific knock-in cell clones by PCR and sequencing. The editing efficiency of sgBLG was between 25% and 31%. The EGFP expression efficiency indicated that the gene knock-in efficiency was improved by RS-1 in a dose-dependent manner, which could reach 3.5-fold compared to the control group. The percentage of positive cells with hLF knock-in was increased to 32.61% when 10 μmol/L RS-1 was used. However, when the concentration of RS-1 increased to 20 μmol/L, the percentage of positive cells decreased to 22.22% and resulted in an increase of senescent cell clone number. These results suggested that hLF knock-in and BLG knock-out in GEFs were achieved by using CRISPR/Cas9 system, and optimum concentration of RS-1 could improve knock-in efficiency, which provides a reference for efficiently obtaining gene knock-in cells using CRISPR/Cas9 in the future.

An alternative approach in regulation of expression of a transgene by endogenous miR-145 in carcinoma and normal breast cell lines.

PubMed

Ghanbari Safari, Maryam; Baesi, Kazem; Hosseinkhani, Saman

2017-03-01

MicroRNAs are small noncoding RNAs that regulate gene expression by repressing translation of target cellular transcripts. Increasing evidences indicate that miRNAs have different expression profiles and play crucial roles in numerous cellular processes. Delivery and expression of transgenes for cancer therapy must be specific for tumors to avoid killing of healthy tissues. Many investigators have shown that transgene expression can be suppressed in normal cells using vectors that are responsive to microRNA regulation. To overcome this problem, miR-145 that exhibits downregulation in many types of cancer cells was chosen for posttranscriptional regulatory systems mediated by microRNAs. In this study, a psiCHECK-145T vector carrying four tandem copies of target sequences of miR-145 into 3'-UTR of the Renilla luciferase gene was constructed. Renilla luciferase activity from the psiCHECK-145T vector was 57% lower in MCF10A cells with high miR-145 expression as compared to a control condition. Additionally, overexpression of miR-145 in MCF-7 cells with low expression level of miR-145 showed more than 76% reduction in the Renilla luciferase activity from the psiCHECK-145T vector. Inclusion of miR-145 target sequences into the 3'-UTR of the Renilla luciferase gene is a feasible strategy for restricting transgene expression in a breast cancer cell line while sparing a breast normal cell line. © 2015 International Union of Biochemistry and Molecular Biology, Inc.

Robust RNAi enhancement via human Argonaute-2 overexpression from plasmids, viral vectors and cell lines

PubMed Central

Börner, Kathleen; Niopek, Dominik; Cotugno, Gabriella; Kaldenbach, Michaela; Pankert, Teresa; Willemsen, Joschka; Zhang, Xian; Schürmann, Nina; Mockenhaupt, Stefan; Serva, Andrius; Hiet, Marie-Sophie; Wiedtke, Ellen; Castoldi, Mirco; Starkuviene, Vytaute; Erfle, Holger; Gilbert, Daniel F.; Bartenschlager, Ralf; Boutros, Michael; Binder, Marco; Streetz, Konrad; Kräusslich, Hans-Georg; Grimm, Dirk

2013-01-01

As the only mammalian Argonaute protein capable of directly cleaving mRNAs in a small RNA-guided manner, Argonaute-2 (Ago2) is a keyplayer in RNA interference (RNAi) silencing via small interfering (si) or short hairpin (sh) RNAs. It is also a rate-limiting factor whose saturation by si/shRNAs limits RNAi efficiency and causes numerous adverse side effects. Here, we report a set of versatile tools and widely applicable strategies for transient or stable Ago2 co-expression, which overcome these concerns. Specifically, we engineered plasmids and viral vectors to co-encode a codon-optimized human Ago2 cDNA along with custom shRNAs. Furthermore, we stably integrated this Ago2 cDNA into a panel of standard human cell lines via plasmid transfection or lentiviral transduction. Using various endo- or exogenous targets, we demonstrate the potential of all three strategies to boost mRNA silencing efficiencies in cell culture by up to 10-fold, and to facilitate combinatorial knockdowns. Importantly, these robust improvements were reflected by augmented RNAi phenotypes and accompanied by reduced off-targeting effects. We moreover show that Ago2/shRNA-co-encoding vectors can enhance and prolong transgene silencing in livers of adult mice, while concurrently alleviating hepatotoxicity. Our customizable reagents and avenues should broadly improve future in vitro and in vivo RNAi experiments in mammalian systems. PMID:24049077

repRNA: a web server for generating various feature vectors of RNA sequences.

PubMed

Liu, Bin; Liu, Fule; Fang, Longyun; Wang, Xiaolong; Chou, Kuo-Chen

2016-02-01

With the rapid growth of RNA sequences generated in the postgenomic age, it is highly desired to develop a flexible method that can generate various kinds of vectors to represent these sequences by focusing on their different features. This is because nearly all the existing machine-learning methods, such as SVM (support vector machine) and KNN (k-nearest neighbor), can only handle vectors but not sequences. To meet the increasing demands and speed up the genome analyses, we have developed a new web server, called "representations of RNA sequences" (repRNA). Compared with the existing methods, repRNA is much more comprehensive, flexible and powerful, as reflected by the following facts: (1) it can generate 11 different modes of feature vectors for users to choose according to their investigation purposes; (2) it allows users to select the features from 22 built-in physicochemical properties and even those defined by users' own; (3) the resultant feature vectors and the secondary structures of the corresponding RNA sequences can be visualized. The repRNA web server is freely accessible to the public at http://bioinformatics.hitsz.edu.cn/repRNA/ .

Targeted knockout of TNF-α by injection of lentivirus-mediated siRNA into the subacromial bursa for the treatment of subacromial bursitis in rats.

PubMed

Wang, Yi; Li, Quan; Wei, Xianzhao; Xu, Jie; Chen, Qi; Song, Shuang; Lu, Zhe; Wang, Zimin

2015-09-01

Subacromial bursitis (SAB) is the major source of pain in rotator cuff disease. Although multiple investigations have provided support for the role of inflammatory cytokines in SAB, few have focussed on the use these cytokines in the treatment of SAB. The aim of the present study was to observe the therapeutic efficacy of lentivirus‑mediated RNA interference (RNAi) on carrageenan‑induced SAB by injecting lentivirus‑tumor necrosis factor (TNF)‑α‑RNAi expressing TNF‑α small interfering (si)RNA. Using screened siRNA segments, an siRNA was designed. A lentivirus vector expressing siRNA was established and packed as lentivirus particles. A lentivirus that expressed the negative sequence was used as a lentivirus‑negative control (NC). The carrageenan‑induced SAB model was established in 32 male Sprague‑Dawley rats. The modeled rats were randomly assigned to four groups: Lentivirus‑RNAi treatment group, lentivirus‑NC group, SAB group and phosphate‑buffered saline (PBS) blank control group. The lentivirus was injected (1x10(7) transducing units) into the subacromial bursa of the rats in the lentivirus‑RNAi group and lentivirus‑NC group, whereas 100 µl PBS was injected at the same site in the SAB group and the PBS blank control group. At 5 weeks following injection, the animals were sacrificed and venous blood was obtained. The effect of TNF‑α interference and the expression of inflammatory cytokines were determined by reverse transcription‑quantitative polymerase chain reaction, western blotting, hematoxylin and eosin staining, Van Gieson's staining and immunofluorescence. The expression of TNF‑α was decreased in the lentivirus‑TNF‑α‑RNAi group compared with that in the SAB group. Morphological observations revealed that the number of inflammatory cells were reduced and damage to tendon fibers was attenuated in this group, suggesting that the downregulation of the protein expression levels of TNF‑α‑associated nuclear factor‑κB, matrix metalloproteinase (MMP)1, MMP9, cyclooxygenase (COX)‑1 and COX‑2 may exert a therapeutic effect on inflammation of the SAB caused by rheumatoid arthritis. It was also found that the expression of stromal cell‑derived growth factor‑1 was downregulated in the lentivirus‑TNF‑α‑RNAi group. Therefore, the present study demonstrated that lentivirus‑mediated TNF‑α RNAi effectively inhibited the inflammatory response in SAB, and that injection of a lentivirus vector into the affected region is an effective way of achieving RNAi in vivo.

Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector

PubMed Central

Kabadi, Ami M.; Ousterout, David G.; Hilton, Isaac B.; Gersbach, Charles A.

2014-01-01

Engineered DNA-binding proteins that manipulate the human genome and transcriptome have enabled rapid advances in biomedical research. In particular, the RNA-guided CRISPR/Cas9 system has recently been engineered to create site-specific double-strand breaks for genome editing or to direct targeted transcriptional regulation. A unique capability of the CRISPR/Cas9 system is multiplex genome engineering by delivering a single Cas9 enzyme and two or more single guide RNAs (sgRNAs) targeted to distinct genomic sites. This approach can be used to simultaneously create multiple DNA breaks or to target multiple transcriptional activators to a single promoter for synergistic enhancement of gene induction. To address the need for uniform and sustained delivery of multiplex CRISPR/Cas9-based genome engineering tools, we developed a single lentiviral system to express a Cas9 variant, a reporter gene and up to four sgRNAs from independent RNA polymerase III promoters that are incorporated into the vector by a convenient Golden Gate cloning method. Each sgRNA is efficiently expressed and can mediate multiplex gene editing and sustained transcriptional activation in immortalized and primary human cells. This delivery system will be significant to enabling the potential of CRISPR/Cas9-based multiplex genome engineering in diverse cell types. PMID:25122746

RNA interference mediated pten knock-down inhibit the formation of polycystic ovary.

PubMed

Ouyang, Jie-Xiu; Luo, Tao; Sun, Hui-Yun; Huang, Jian; Tang, Dan-Feng; Wu, Lei; Zheng, Yue-Hui; Zheng, Li-Ping

2013-08-01

Pten (phosphatase and tensin homolog deleted on chromosome 10), a kind of tumor suppressor gene, plays important roles in female reproductive system. But its expression and roles in the formation of polycystic ovaries are yet to be known. In this study, we constructed a rat model of PCOS using norethindrone and HCG injections and found the expressions of pten mRNA and PTEN protein increased significantly in the polycystic ovary tissue by immunohistochemistry, RT-PCR, and western blot. Furthermore, the results showed that in vivo ovaries could be effectively transfected by lentiviral vectors through the ovarian microinjection method and indicated that pten shRNA may inhibit the formation of polycystic ovaries by pten down-regulation. Our study provides new information regarding the role of PTEN in female reproductive disorders, such as polycystic ovary syndrome.

Antiviral effects of herpes simplex virus specific anti-sense nucleic acids.

PubMed

Cantin, E M; Podsakoff, G; Willey, D E; Openshaw, H

1992-01-01

We have targeted mRNA sequences encompassing the translation initiation codon of the essential herpes simplex virus type 1 (HSV-1) IE3 gene with three kinds of anti-sense molecule. Addition of a 15mer oligodeoxyribonucleoside methylphosphonate to tissue culture cells resulted in suppression of viral replication. HSV-1 replication was also inhibited in cultured cells containing anti-sense vectors expressing transcripts complementary to the IE3 mRNA. We have also constructed a ribozyme which upon base pairing with the target IE3 mRNA induces cleavage at the predicted GUC site. A major obstacle to anti-sense studies in animals is drug delivery of preformed antisense molecules to ganglionic neurons, the site of HSV latency and reactivation. We speculate as to how this may be accomplished through carrier compounds which are taken up by nerve terminals and transported by retrograde axoplasmic flow. By the same route, HSV itself may be used as an anti-sense vector.

A quick and efficient method to generate mammalian stable cell lines based on a novel inducible alphavirus DNA/RNA layered system.

PubMed

Aranda, Alejandro; Bezunartea, Jaione; Casales, Erkuden; Rodriguez-Madoz, Juan R; Larrea, Esther; Prieto, Jesus; Smerdou, Cristian

2014-12-01

We report a new method to generate high-expressing mammalian cell lines in a quick and efficient way. For that purpose, we developed a master cell line (MCL) containing an inducible alphavirus vector expressing GFP integrated into the genome. In the MCL, recombinant RNA levels increased >4,600-fold after induction, due to a doxycycline-dependent RNA amplification loop. The MCL maintained inducibility and expression during 50 passages, being more efficient for protein expression than a conventional cell line. To generate new cell lines, mutant LoxP sites were inserted into the MCL, allowing transgene and selection gene exchange by Cre-directed recombination, leading to quick generation of inducible cell lines expressing proteins of therapeutic interest, like human cardiotrophin-1 and oncostatin-M at several mg/l/24 h. These proteins contained posttranslational modifications, showed bioactivity, and were efficiently purified. Remarkably, this system allowed production of toxic proteins, like oncostatin-M, since cells able to express it could be grown to the desired amount before induction. These cell lines were easily adapted to growth in suspension, making this methodology very attractive for therapeutic protein production.

Role of the 2 adenine (g.11293_11294insAA) insertion polymorphism in the 3' untranslated region of the factor VII (FVII) gene: molecular characterization of a patient with severe FVII deficiency.

PubMed

Peyvandi, F; Garagiola, I; Palla, R; Marziliano, N; Mannucci, P M

2005-11-01

Polymorphic variants in the gene encoding factor VII (F7) affect the plasma levels of this coagulation protein and modify the clinical phenotype of FVII deficiency in some patients. In this study we report the in vitro functional analysis of a novel polymorphic variant located in the 3' untranslated region of F7: g.11293_11294insAA. To determine whether this variant regulates FVII expression, we initially compared an expression vector containing FVII cDNA with g.11293_11294insAA with the FVII wild-type (WT) construct. The kinetics of mRNA production showed that the insertion decreases the steady-state FVII mRNA levels. To assess whether the insertion influences the phenotype of FVII-deficient patients, we evaluated its effect on the expression of FVII in a patient with severe FVII deficiency (undetectable FVII activity and antigen) carrying two additional homozygous missense variations (p.Arg277Cys and p.Arg353Gln). The two substitutions alone reduced the expression of FVII activity and antigen in vitro, but with the insertion polymorphism in our expression vector the patient's phenotype of undetectable plasma FVII was recapitulated. The insertion polymorphism in the 3' untranslated region of F7 is another modifier of FVII expression that might explain the poor genotype-phenotype correlation in some FVII-deficient patients. Copyright 2005 Wiley-Liss, Inc.

Ribozyme-mediated cleavage of c-fos mRNA reduces gene expression of DNA synthesis enzymes and metallothionein.

PubMed Central

Scanlon, K J; Jiao, L; Funato, T; Wang, W; Tone, T; Rossi, J J; Kashani-Sabet, M

1991-01-01

The c-fos gene product Fos has been implicated in many cellular processes, including signal transduction, DNA synthesis, and resistance to antineoplastic agents. A fos ribozyme (catalytic RNA) was designed to evaluate the effects of suppressing Fos protein synthesis on expression of enzymes involved in DNA synthesis, DNA repair, and drug resistance. DNA encoding the fos ribozyme (fosRb) was cloned into the pMAMneo expression plasmid, and the resultant vector was transfected into A2780DDP cells resistant to the chemotherapeutic agent cisplatin. The parental drug-sensitive A2780S cells were transfected with the pMMV vector containing the c-fos gene. Morphological alterations were accompanied by significant changes in pharmacological sensitivity in both c-fos- and fosRb-transfected cells. pMAMneo fosRb transfectants revealed decreased c-fos gene expression, concomitant with reduced thymidylate (dTMP) synthase, DNA polymerase beta, topoisomerase I, and metallothionein IIA mRNAs. In contrast, c-myc expression was elevated after fos ribozyme action. Insertion of a mutant ribozyme, mainly capable of antisense activity, into A2780DDP cells resulted in smaller reductions in c-fos gene expression and in cisplatin resistance than the active ribozyme. These studies establish a role for c-fos in drug resistance and in mediating DNA synthesis and repair processes by modulating expression of genes such as dTMP synthase, DNA polymerase beta, and topoisomerase I. These studies also suggest the utility of ribozymes in the analysis of cellular gene expression. Images PMID:1660142

Alphavirus vector-based replicon particles expressing multivalent cross-protective Lassa virus glycoproteins

PubMed Central

Wang, Min; Jokinen, Jenny; Tretyakova, Irina; Pushko, Peter; Lukashevich, Igor S.

2018-01-01

Lassa virus (LASV) is the most prevalent rodent-borne arenavirus circulated in West Africa. With population at risk from Senegal to Nigeria, LASV causes Lassa fever and is responsible for thousands of deaths annually. High genetic diversity of LASV is one of the challenges for vaccine R&D. We developed multivalent virus-like particle vectors (VLPVs) derived from the human Venezuelan equine encephalitis TC-83 IND vaccine (VEEV) as the next generation of alphavirus-based bicistronic RNA replicon particles. The genes encoding VEEV structural proteins were replaced with LASV glycoproteins (GPC) from distantly related clades I and IV with individual 26S promoters. Bicistronic RNA replicons encoding wild-type LASV GPC (GPCwt) and C-terminally deleted, non-cleavable modified glycoprotein (ΔGPfib), were encapsidated into VLPV particles using VEEV capsid and glycoproteins provided in trans. In transduced cells, VLPVs induced simultaneous expression of LASV GPCwt and ΔGPfib from 26S alphavirus promoters. LASV ΔGPfib was predominantly expressed as trimers, accumulated in the endoplasmic reticulum, induced ER stress and apoptosis promoting antigen cross-priming. VLPV vaccines were immunogenic and protective in mice and upregulated CD11c+/CD8+ dendritic cells playing the major role in cross-presentation. Notably, VLPV vaccination resulted in induction of cross-reactive multifunctional T cell responses after stimulation of immune splenocytes with peptide cocktails derived from LASV from clades I-IV. Multivalent RNA replicon-based LASV vaccines can be applicable for first responders, international travelers visiting endemic areas, military and lab personnel. PMID:29287681

A simple method for construction of artificial microRNA vector in plant.

PubMed

Li, Yang; Li, Yang; Zhao, Sunping; Zhong, Sheng; Wang, Zhaohai; Ding, Bo; Li, Yangsheng

2014-10-01

Artificial microRNA (amiRNA) is a powerful tool for silencing genes in many plant species. Here we provide an easy method to construct amiRNA vectors that reinvents the Golden Gate cloning approach and features a novel system called top speed amiRNA construction (TAC). This speedy approach accomplishes one restriction-ligation step in only 5 min, allowing easy and high-throughput vector construction. Three primers were annealed to be a specific adaptor, then digested and ligated on our novel vector pTAC. Importantly, this method allows the recombined amiRNA constructs to maintain the precursor of osa-miR528 with exception of the desired amiRNA/amiRNA* sequences. Using this method, our results showed the expected decrease of targeted genes in Nicotiana benthamiana and Oryza sativa.

RNA interference of carboxyesterases causes nymph mortality in the Asian citrus psyllid, Diaphorina citri.

PubMed

Kishk, Abdelaziz; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Gowda, Siddarame; Killiny, Nabil

2017-03-01

Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is an important pest of citrus. In addition, D. citri is the vector of Huanglongbing, a destructive disease in citrus, also known as citrus greening disease caused by Candidatus Liberibacter asiaticus. Huanglongbing causes huge losses for citrus industries. Insecticide application for D. citri is the major strategy to prevent disease spread. The heavy use of insecticides causes development of insecticide resistance. We used RNA interference (RNAi) to silence genes implicated in pesticide resistance in order to increase the susceptibility. The activity of dsRNA to reduce the expression of carboxyesterases including esterases FE4 (EstFE4) and acetylcholinesterases (AChe) in D. citri was investigated. The dsRNA was applied topically to the fourth and fifth instars of nymphs. We targeted several EstFE4 and AChe genes using dsRNA against a consensus sequence for each of them. Five concentrations (25, 50, 75, 100, 125 ng/μl) from both dsRNAs were used. The treatments with the dsRNA caused concentration dependent nymph mortality. The highest gene expression levels of both AChe and EstFE4 were found in the fourth and fifth nymphal instars. Gene expression analysis showed that AChe genes were downregulated in emerged adults from dsRNA-AChe-treated nymphs compared to controls. However, EstFE4 genes were not affected. In the same manner, treatment with dsRNA-EstFE4 reduced expression level of EstFE4 genes in emerged adults from treated nymphs, but did not affect the expression of AChe genes. In the era of environmentally friendly control strategies, RNAi is a new promising venue to reduce pesticide applications. © 2017 Wiley Periodicals, Inc.

The dose can make the poison: lessons learned from adverse in vivo toxicities caused by RNAi overexpression.

PubMed

Grimm, Dirk

2011-10-26

For the past five years, evidence has accumulated that vector-mediated robust RNA interference (RNAi) expression can trigger severe side effects in small and large animals, from cytotoxicity and accelerated tumorigenesis to organ failure and death. The recurring notions in these studies that a critical parameter is the strength of RNAi expression and that Exportin-5 and the Argonaute proteins are rate-limiting mammalian RNAi, strongly imply dose-dependent saturation of the endogenous miRNA pathway as one of the underlying mechanisms. This minireview summarizes the relevant work and data leading to this intriguing model and highlights potential avenues by which to alleviate RNAi-induced toxicities in future clinical applications.

Targeted nanobubbles in low-frequency ultrasound-mediated gene transfection and growth inhibition of hepatocellular carcinoma cells.

PubMed

Wu, Bolin; Qiao, Qiang; Han, Xue; Jing, Hui; Zhang, Hao; Liang, Hongjian; Cheng, Wen

2016-09-01

The use of SonoVue combined with ultrasound exposure increases the transfection efficiency of short interfering RNA (siRNA). The objective of this study was to prepare targeted nanobubbles (TNB) conjugated with NET-1 siRNA and an antibody GPC3 to direct nanobubbles to hepatocellular carcinoma cells. SMMC-7721 human hepatocellular carcinoma cells were treated with six different groups. The transfection efficiency and cellular apoptosis were measured by flow cytometry. The protein and messenger RNA (mRNA) expression were measured by Western blot and quantitative real-time PCR, respectively. The migration and invasion potential of the cells were determined by Transwell analysis. The results show that US-guided siRNA-TNB transfection effectively enhanced gene silencing. In summary, siRNA-TNB may be an effective delivery vector to mediate highly effective RNA interference in tumor treatment.

Small RNA sequencing and functional characterization reveals microRNA-143 tumor suppressor activity in liposarcoma

PubMed Central

Ugras, Stacy; Brill, Elliott; Jacobsen, Anders; Hafner, Markus; Socci, Nicholas D.; DeCarolis, Penelope L.; Khanin, Raya; O'Connor, Rachael; Mihailovic, Aleksandra; Taylor, Barry S.; Sheridan, Robert; Gimble, Jeffrey M.; Viale, Agnes; Crago, Aimee; Antonescu, Cristina R.; Sander, Chris; Tuschl, Thomas; Singer, Samuel

2011-01-01

Liposarcoma remains the most common mesenchymal cancer, with a mortality rate of 60% among patients with this disease. To address the present lack of therapeutic options, we embarked upon a study of microRNA (miRNA) expression alterations associated with liposarcomagenesis with the goal of exploiting differentially expressed miRNAs and the gene products they regulate as potential therapeutic targets. MicroRNA expression was profiled in samples of normal adipose tissue, well-differentiated liposarcoma, and dedifferentiated liposarcoma by both deep sequencing of small RNA libraries and hybridization-based Agilent microarrays. The expression profiles discriminated liposarcoma from normal adipose tissue and well-differentiated from dedifferentiated disease. We defined over 40 miRNAs that were dysregulated in dedifferentiated liposarcomas in both the sequencing and the microarray analysis. The upregulated miRNAs included two cancer-associated species (miR-21, miR-26a), and the downregulated miRNAs included two species that were highly abundant in adipose tissue (miR-143, miR-145). Restoring miR-143 expression in dedifferentiated liposarcoma cells inhibited proliferation, induced apoptosis, and decreased expression of BCL2, TOP2A, PRC1, and PLK1. The downregulation of PRC1 and its docking partner PLK1 suggests that miR-143 inhibits cytokinesis in these cells. In support of this idea, treatment with a PLK1 inhibitor potently induced G2/M growth arrest and apoptosis in liposarcoma cells. Taken together, our findings suggest that miR-143 re-expression vectors or selective agents directed at miR-143 or its targets may have therapeutic value in dedifferentiated liposarcoma. PMID:21693658

Heterologous viral expression systems in fosmid vectors increase the functional analysis potential of metagenomic libraries.

PubMed

Terrón-González, L; Medina, C; Limón-Mortés, M C; Santero, E

2013-01-01

The extraordinary potential of metagenomic functional analyses to identify activities of interest present in uncultured microorganisms has been limited by reduced gene expression in surrogate hosts. We have developed vectors and specialized E. coli strains as improved metagenomic DNA heterologous expression systems, taking advantage of viral components that prevent transcription termination at metagenomic terminators. One of the systems uses the phage T7 RNA-polymerase to drive metagenomic gene expression, while the other approach uses the lambda phage transcription anti-termination protein N to limit transcription termination. A metagenomic library was constructed and functionally screened to identify genes conferring carbenicillin resistance to E. coli. The use of these enhanced expression systems resulted in a 6-fold increase in the frequency of carbenicillin resistant clones. Subcloning and sequence analysis showed that, besides β-lactamases, efflux pumps are not only able contribute to carbenicillin resistance but may in fact be sufficient by themselves to convey carbenicillin resistance.

Analysis of miRNA expression profile based on SVM algorithm

NASA Astrophysics Data System (ADS)

Ting-ting, Dai; Chang-ji, Shan; Yan-shou, Dong; Yi-duo, Bian

2018-05-01

Based on mirna expression spectrum data set, a new data mining algorithm - tSVM - KNN (t statistic with support vector machine - k nearest neighbor) is proposed. the idea of the algorithm is: firstly, the feature selection of the data set is carried out by the unified measurement method; Secondly, SVM - KNN algorithm, which combines support vector machine (SVM) and k - nearest neighbor (k - nearest neighbor) is used as classifier. Simulation results show that SVM - KNN algorithm has better classification ability than SVM and KNN alone. Tsvm - KNN algorithm only needs 5 mirnas to obtain 96.08 % classification accuracy in terms of the number of mirna " tags" and recognition accuracy. compared with similar algorithms, tsvm - KNN algorithm has obvious advantages.

Efficient generation of transgene-free human induced pluripotent stem cells (iPSCs) by temperature-sensitive Sendai virus vectors

PubMed Central

Ban, Hiroshi; Nishishita, Naoki; Fusaki, Noemi; Tabata, Toshiaki; Saeki, Koichi; Shikamura, Masayuki; Takada, Nozomi; Inoue, Makoto; Hasegawa, Mamoru; Kawamata, Shin; Nishikawa, Shin-Ichi

2011-01-01

After the first report of induced pluripotent stem cells (iPSCs), considerable efforts have been made to develop more efficient methods for generating iPSCs without foreign gene insertions. Here we show that Sendai virus vector, an RNA virus vector that carries no risk of integrating into the host genome, is a practical solution for the efficient generation of safer iPSCs. We improved the Sendai virus vectors by introducing temperature-sensitive mutations so that the vectors could be easily removed at nonpermissive temperatures. Using these vectors enabled the efficient production of viral/factor-free iPSCs from both human fibroblasts and CD34+ cord blood cells. Temperature-shift treatment was more effective in eliminating remaining viral vector-related genes. The resulting iPSCs expressed human embryonic stem cell markers and exhibited pluripotency. We suggest that generation of transgene-free iPSCs from cord blood cells should be an important step in providing allogeneic iPSC-derived therapy in the future. PMID:21821793

CD10-bearing fibroblast inhibits matrigel invasive potency of interleukin-1α-producing squamous cell carcinoma by diminishing substance P levels in the tumor microenvironment.

PubMed

Xie, Lining; Moroi, Yoichi; Tsuji, Gaku; Liu, Min; Hayashida, Sayaka; Takahara, Masakazu; Fukagawa, Shuji; Takeuchi, Satoshi; Shan, Baoen; Nakahara, Takeshi; Uchi, Hiroshi; Yokomizo, Takehiko; Furue, Masutaka

2010-12-01

CD10 is a neutral endopeptidase, which cleaves various peptide substrates including substance P. CD10 expression has been detected in peritumoral fibroblasts (Fb) within the invasive area of various cancers such as squamous cell carcinoma (SCC). However, the biological significance of CD10-bearing Fb remains largely unknown. We examined dynamic interactions of Fb with tumorigenic A431 SCC cells or non-tumorigenic HaCaT squamous cells. The SCC and HaCaT cells did not synthesize CD10, while Fb constitutively expressed CD10. When co-cultured, SCC markedly upregulated fibroblastic CD10 expression compared with HaCaT, which was mainly attributable to SCC-derived interleukin-1α (IL-1α). Both SCC and Fb autonomously secreted substance P, which eventually enhanced the invasive capacity of SCC in a matrigel invasion assay by upregulating matrix metalloproteinase (MMP)-1 and MMP-2, but not MMP-9. Transfection of siRNA for CD10 successfully knocked down the CD10 expression in Fb (CD10ND-Fb). In the presence of CD10ND-Fb, substance P levels in supernatants as well as MMP production and the invasive potency of SCC were significantly augmented compared with control scramble RNA-transfected Fb. We also transfected CD10 vector to Fb and found that the matrigel invasive ability of SCC cells was downregulated co-cultured with CD10 vector-transfected Fb rather than empty vector-transfected Fb. In conclusion, the CD10-bearing Fb generated by SCC-derived IL-1 inhibited the invasive capacity of SCC by diminishing the microenvironmental concentration of substance P. © 2010 Japanese Cancer Association.

Transient Expression of an LEDGF/p75 Chimera Retargets Lentivector Integration and Functionally Rescues in a Model for X-CGD.

PubMed

Vets, Sofie; De Rijck, Jan; Brendel, Christian; Grez, Manuel; Bushman, Frederic; Debyser, Zeger; Gijsbers, Rik

2013-03-05

Retrovirus-based vectors are commonly used as delivery vehicles to correct genetic diseases because of their ability to integrate new sequences stably. However, adverse events in which vector integration activates proto-oncogenes, leading to clonal expansion and leukemogenesis hamper their application. The host cell-encoded lens epithelium-derived growth factor (LEDGF/p75) binds lentiviral integrase and targets integration to active transcription units. We demonstrated earlier that replacing the LEDGF/p75 chromatin interaction domain with an alternative DNA-binding protein could retarget integration. Here, we show that transient expression of the chimeric protein using mRNA electroporation efficiently redirects lentiviral vector (LV) integration in wild-type (WT) cells. We then employed this technology in a model for X-linked chronic granulomatous disease (X-CGD) using myelomonocytic PLB-985 gp91(-/-) cells. Following electroporation with mRNA encoding the LEDGF-chimera, the cells were treated with a therapeutic lentivector encoding gp91(phox). Integration site analysis revealed retargeted integration away from genes and towards heterochromatin-binding protein 1β (CBX1)-binding sites, in regions enriched in marks associated with gene silencing. Nevertheless, gp91(phox) expression was stable for at least 6 months after electroporation and NADPH-oxidase activity was restored to normal levels as determined by superoxide production. Together, these data provide proof-of-principle that transient expression of engineered LEDGF-chimera can retarget lentivector integration and rescues the disease phenotype in a cell model, opening perspectives for safer gene therapy.Molecular Therapy - Nucleic Acids (2013) 2, e77; doi:10.1038/mtna.2013.4; published online 5 March 2013.

Use of a bacterial expression vector to map the varicella-zoster virus major glycoprotein gene, gC.

PubMed Central

Ellis, R W; Keller, P M; Lowe, R S; Zivin, R A

1985-01-01

The genome of varicella-zoster virus (VZV) encodes at least three major glycoprotein genes. Among viral gene products, the gC gene products are the most abundant glycoproteins and induce a substantial humoral immune response (Keller et al., J. Virol. 52:293-297, 1984). We utilized two independent approaches to map the gC gene. Small fragments of randomly digested VZV DNA were inserted into a bacterial expression vector. Bacterial colonies transformed by this vector library were screened serologically for antigen expression with monoclonal antibodies to gC. Hybridization of the plasmid DNA from a gC antigen-positive clone revealed homology to the 3' end of the VZV Us segment. In addition, mRNA from VZV-infected cells was hybrid selected by a set of VZV DNA recombinant plasmids and translated in vitro, and polypeptide products were immunoprecipitated by convalescent zoster serum or by monoclonal antibodies to gC. This analysis revealed that the mRNA encoding a 70,000-dalton polypeptide precipitable by anti-gC antibodies mapped to the HindIII C fragment, which circumscribes the entire Us region. We conclude that the VZV gC glycoprotein gene maps to the 3' end of the Us region and is expressed as a 70,000-dalton primary translational product. These results are consistent with the recently reported DNA sequence of Us (A.J. Davison, EMBO J. 2:2203-2209, 1983). Furthermore, glycosylation appears not to be required for a predominant portion of the antigenicity of gC glycoproteins. We also report the tentative map assignments for eight other VZV primary translational products. Images PMID:2981365

Intratumoral injection of INGN 241, a nonreplicating adenovector expressing the melanoma-differentiation associated gene-7 (mda-7/IL24): biologic outcome in advanced cancer patients.

PubMed

Tong, Alex W; Nemunaitis, John; Su, Dan; Zhang, Yuan; Cunningham, Casey; Senzer, Neil; Netto, George; Rich, Dawn; Mhashilkar, Abner; Parker, Karen; Coffee, Keith; Ramesh, Rajagopal; Ekmekcioglu, Suhendan; Grimm, Elizabeth A; van Wart Hood, Jill; Merritt, James; Chada, Sunil

2005-01-01

The mda-7 gene (approved gene symbol IL24) is a novel tumor suppressor gene with tumor-apoptotic and immune-activating properties. We completed a Phase I dose-escalation clinical trial, in which a nonreplicating adenoviral construct expressing the mda-7 transgene (INGN 241; Ad-mda7) was administered intratumorally to 22 patients with advanced cancer. Excised tumors were evaluated for vector-specific DNA and RNA, transgenic MDA-7 expression, and biological effects. Successful gene transfer as assessed by DNA- and RT-PCR was demonstrated in 100% of patients evaluated. DNA analyses demonstrated a dose-dependent penetration of INGN 241 (up to 4 x 10(8) copies/mug DNA at the 2 x 10(12) vp dose). A parallel distribution of vector DNA, vector RNA, MDA-7 protein expression, and apoptosis induction was observed in all tumors, with signals decreasing with distance away from the injection site. Additional evidence for bioactivity of INGN 241 was illustrated via regulation of the MDA-7 target genes beta-catenin, iNOS, and CD31. Transient increases (up to 20-fold) of serum IL-6, IL-10, and TNF-alpha were observed. Significantly higher elevations of IL-6 and TNF-alpha were observed in patients who responded clinically to INGN 241. Patients also showed marked increases of CD3+CD8+ T cells posttreatment, suggesting that INGN 241 increased systemic TH1 cytokine production and mobilized CD8+ T cells. Intratumoral delivery of INGN 241 induced apoptosis in a large volume of tumor and elicited tumor-regulatory and immune-activating events that are consistent with the preclinical features of MDA-7/IL-24.

[Effect of DOT1L gene silence on proliferation of acute monocytic leukemia cell line THP-1].

PubMed

Zhang, Yu-Juan; Li, Hua-Wen; Chang, Guo-Qiang; Zhang, Hong-Ju; Wang, Jian; Lin, Ya-Ni; Zhou, Jia-Xi; Li, Qing-Hua; Pang, Tian-Xiang

2013-08-01

This study was aimed to investigate the influence of short hairpin RNA (shRNA) on proliferation of human leukemia cell line THP-1. The shRNA targeting the site 732-752 of DOT1L mRNA was designed and chemically synthesized, then a single-vector lentiviral, tet-inducible shRNA-DOT1L system (Plko-Tet-On) was generated. Thereafter, the THP-1 cells with lentivirus were infected to create stable cell line with regulatable shRNA expression. The expression of DOT1L in the THP-1 cell line was assayed by RT-PCR. Effect of shRNA-DOT1L on the proliferation of THP-1 cells was detected with MTT method,and the change of colony forming potential of THP-1 cells was analyzed by colony forming unit test. Cell cycle distribution was tested by flow cytometry. The results indicated that the expression of DOT1L was statistically lower than that in the control groups. The proliferation and colony forming capacity of THP-1 cells were significantly inhibited. The percentage of cells at G0/G1 phase increased in THP-1/shRNA cells treated with Dox while the percentage of cells at S phase significantly decreased as compared with that in the control group. It is concluded that the shRNA targeting DOT1L can effectively inhibit the proliferation of acute monocytic leukemia cell line THP-1.

Higher miRNA Tolerance in Immortal Li-Fraumeni Fibroblasts with Abrogated Interferon Signaling Pathway

PubMed Central

Li, Qunfang; Tainsky, Michael A.

2013-01-01

The IFN pathway is abrogated in fibroblasts from Li-Fraumeni syndrome (LFS) patients during spontaneous cellular immortalization, a necessary step in carcinogenesis. Microarray profiling of differentially expressed microRNAs (miRNA) revealed that most miRNAs were upregulated in IFN pathway–defective MDAH087-10 fibroblasts compared with MDAH087-N cells with relatively normal IFN signaling. Overexpression of Dicer, a critical enzyme in miRNA biogenesis, promoted cell growth and colony formation in MDAH087-10 cells. However, double-stranded miRNA produced by Dicer enhanced the expression of IFN-stimulated genes in MDAH087-N cells resulting in significant cell death and reduced cell growth. Furthermore, manipulation of the IFN pathway in immortal LFS fibroblasts through transcription factor IRF7 reversed their response to Dicer overexpression due to changed IFN pathway activity. Dicer overexpressing MDAH087-N cells contained lower levels of miRNA than vector control, and conversely much higher miRNA expression was detected in Dicertransfected MDAH087-10 cells. Therefore, cells with a defective IFN pathway have a higher miRNA tolerance than cells with normal IFN pathway. This work indicates for the first time that the IFN pathway as mediated through the transcription factor IRF7 must be disrupted to permit miRNA upregulation to occur in early carcinogenesis. The IFN pathway appears to provide a checkpoint for miRNA level tolerance and its abrogation leads to cellular immortalization. PMID:21199806

Higher miRNA tolerance in immortal Li-Fraumeni fibroblasts with abrogated interferon signaling pathway.

PubMed

Li, Qunfang; Tainsky, Michael A

2011-01-01

The IFN pathway is abrogated in fibroblasts from Li-Fraumeni syndrome (LFS) patients during spontaneous cellular immortalization, a necessary step in carcinogenesis. Microarray profiling of differentially expressed microRNAs (miRNA) revealed that most miRNAs were upregulated in IFN pathway-defective MDAH087-10 fibroblasts compared with MDAH087-N cells with relatively normal IFN signaling. Overexpression of Dicer, a critical enzyme in miRNA biogenesis, promoted cell growth and colony formation in MDAH087-10 cells. However, double-stranded miRNA produced by Dicer enhanced the expression of IFN-stimulated genes in MDAH087-N cells resulting in significant cell death and reduced cell growth. Furthermore, manipulation of the IFN pathway in immortal LFS fibroblasts through transcription factor IRF7 reversed their response to Dicer overexpression due to changed IFN pathway activity. Dicer overexpressing MDAH087-N cells contained lower levels of miRNA than vector control, and conversely much higher miRNA expression was detected in Dicer-transfected MDAH087-10 cells. Therefore, cells with a defective IFN pathway have a higher miRNA tolerance than cells with normal IFN pathway. This work indicates for the first time that the IFN pathway as mediated through the transcription factor IRF7 must be disrupted to permit miRNA upregulation to occur in early carcinogenesis. The IFN pathway appears to provide a checkpoint for miRNA level tolerance and its abrogation leads to cellular immortalization. © 2011 AACR.

A modular and optimized single marker system for generating Trypanosoma brucei cell lines expressing T7 RNA polymerase and the tetracycline repressor.

PubMed

Poon, S K; Peacock, L; Gibson, W; Gull, K; Kelly, S

2012-02-01

Here, we present a simple modular extendable vector system for introducing the T7 RNA polymerase and tetracycline repressor genes into Trypanosoma brucei. This novel system exploits developments in our understanding of gene expression and genome organization to produce a streamlined plasmid optimized for high levels of expression of the introduced transgenes. We demonstrate the utility of this novel system in bloodstream and procyclic forms of Trypanosoma brucei, including the genome strain TREU927/4. We validate these cell lines using a variety of inducible experiments that recapture previously published lethal and non-lethal phenotypes. We further demonstrate the utility of the single marker (SmOx) TREU927/4 cell line for in vivo experiments in the tsetse fly and provide a set of plasmids that enable both whole-fly and salivary gland-specific inducible expression of transgenes.

A modular and optimized single marker system for generating Trypanosoma brucei cell lines expressing T7 RNA polymerase and the tetracycline repressor

PubMed Central

Poon, S. K.; Peacock, L.; Gibson, W.; Gull, K.; Kelly, S.

2012-01-01

Here, we present a simple modular extendable vector system for introducing the T7 RNA polymerase and tetracycline repressor genes into Trypanosoma brucei. This novel system exploits developments in our understanding of gene expression and genome organization to produce a streamlined plasmid optimized for high levels of expression of the introduced transgenes. We demonstrate the utility of this novel system in bloodstream and procyclic forms of Trypanosoma brucei, including the genome strain TREU927/4. We validate these cell lines using a variety of inducible experiments that recapture previously published lethal and non-lethal phenotypes. We further demonstrate the utility of the single marker (SmOx) TREU927/4 cell line for in vivo experiments in the tsetse fly and provide a set of plasmids that enable both whole-fly and salivary gland-specific inducible expression of transgenes. PMID:22645659

Potent Immune Responses in Rhesus Macaques Induced by Nonviral Delivery of a Self-amplifying RNA Vaccine Expressing HIV Type 1 Envelope With a Cationic Nanoemulsion

PubMed Central

Bogers, Willy M.; Oostermeijer, Herman; Mooij, Petra; Koopman, Gerrit; Verschoor, Ernst J.; Davis, David; Ulmer, Jeffrey B.; Brito, Luis A.; Cu, Yen; Banerjee, Kaustuv; Otten, Gillis R.; Burke, Brian; Dey, Antu; Heeney, Jonathan L.; Shen, Xiaoying; Tomaras, Georgia D.; Labranche, Celia; Montefiori, David C.; Liao, Hua-Xin; Haynes, Barton; Geall, Andrew J.; Barnett, Susan W.

2015-01-01

Self-amplifying messenger RNA (mRNA) of positive-strand RNA viruses are effective vectors for in situ expression of vaccine antigens and have potential as a new vaccine technology platform well suited for global health applications. The SAM vaccine platform is based on a synthetic, self-amplifying mRNA delivered by a nonviral delivery system. The safety and immunogenicity of an HIV SAM vaccine encoding a clade C envelope glycoprotein formulated with a cationic nanoemulsion (CNE) delivery system was evaluated in rhesus macaques. The HIV SAM vaccine induced potent cellular immune responses that were greater in magnitude than those induced by self-amplifying mRNA packaged in a viral replicon particle (VRP) or by a recombinant HIV envelope protein formulated with MF59 adjuvant, anti-envelope binding (including anti-V1V2), and neutralizing antibody responses that exceeded those induced by the VRP vaccine. These studies provide the first evidence in nonhuman primates that HIV vaccination with a relatively low dose (50 µg) of formulated self-amplifying mRNA is safe and immunogenic. PMID:25234719

Effects of Light and Temperature on Daily Activity and Clock Gene Expression in Two Mosquito Disease Vectors.

PubMed

Rivas, Gustavo B S; Teles-de-Freitas, Rayane; Pavan, Márcio G; Lima, José B P; Peixoto, Alexandre A; Bruno, Rafaela Vieira

2018-06-01

Most organisms feature an endogenous circadian clock capable of synchronization with their environment. The most well-known synchronizing agents are light and temperature. The circadian clock of mosquitoes, vectors of many pathogens, drives important behaviors related to vectoral capacity, including oviposition, host seeking, and hematophagy. Main clock gene expression, as well as locomotor activity patterns, has been identified in Aedes aegypti and Culex quinquefasciatus under artificial light-dark cycles. Given that these mosquito species thrive in tropical areas, it is reasonable to speculate that temperature plays an important role in the circadian clock. Here, we provide data supporting a different hierarchy of light and temperature as zeitgebers of two mosquito species. We recorded their locomotor activity and quantified mRNA expression of the main clock genes in several combinations of light and temperature cycles. We observed that A. aegypti is more sensitive to temperature, while C. quinquefasciatus is more responsive to light. These variations in clock gene expression and locomotor activity may have affected the mosquito species' metabolism, energy expenditure, fitness cost, and pathogen transmission efficiency. Our findings are relevant to chronobiology studies and also have epidemiological implications.

Biological significance of PinX1 telomerase inhibitor in esophageal carcinoma treatment

PubMed Central

Fan, Xiang-Kui; Yan, Rui-Hua; Geng, Xiang-Qun; Li, Jing-Shan; Chen, Xiang-Ming; Li, Jian-Zhe

2016-01-01

In the present study, to investigate the expression of PinX1 gene and its functional effects in human esophageal carcinoma (Eca)-109 cell line, expression vectors of human PinX1 (pEGFP-C3-PinX1) and its small interfering RNA (PinX1-FAM-siRNA) were constructed and transfected into Eca-109 cells using Lipofectamine 2000. Firstly, the mRNA expression level of PinX1 was examined using reverse transcription-polymerase chain reaction (RT-PCR). Once successful transfection was achieved, the effects on the mRNA level of human telomerase reverse transcriptase (hTERT), telomerase activity, cell proliferation and apoptosis were examined by semi-quantitative RT-PCR, stretch PCR, MTT assay and flow cytometry, respectively. Analysis of restriction and sequencing demonstrated that the recombining plasmids were successfully constructed. The results also indicated that transfection with pEGFP-C3-PinX1 and PinX1-FAM-siRNA into Eca-109 cells significantly increased PinX1 mRNA, decreased hTERT mRNA by 29.9% (P<0.05), and significantly reduced telomerase activity (P<0.05), inhibited cell growth, and increased the cell apoptotic index from 19.27±0.76 to 49.73±2%. The transfected PinX1-FAM-SiRNA exhibited PinX1 mRNA expression levels that were significantly decreased by 70% (P<0.05), whereas the remaining characteristics of Eca-109 cells, including cell growth, mRNA level of hTERT, telomerase activity and cell apoptotic index were not altered. Exogenous PinX1 has been demonstrated to be highly expressed in human Eca. PinX1 can inhibit human telomerase activity and the expression of hTERT mRNA, reduce tumor cell growth and induce apoptosis. Notably, these inhibitory functions were inhibited by silencing PinX1 in Eca with PinX1-FAM-siRNA. PinX1 was successfully increased and decreased in the present study, demonstrating that it may be a potential telomerase activity inhibitor. As PinX1 is an endogenous telomerase inhibitor, it may be used as a novel tumor-targeted gene therapy. PMID:27698711

LINC01121 Inhibits Cell Apoptosis While Facilitating Proliferation, Migration, and Invasion Though Negative Regulation of the Camp/PKA Signaling Pathway via GLP1R.

PubMed

Qian, Yi-Gang; Ye, Zhou; Chen, Hai-Yong; Lv, Zhen; Zhang, Ai-Bin; Fan, Le; Zhou, Jie; Zheng, Shu-Sen; Wang, Wei-Lin

2018-05-24

Pancreatic cancer is an aggressive malignancy as a result of highly metastatic potential. The current study was carried out to alter the expression of LINC01121 in pancreatic cancer, with the aim of elucidating its effects on the biological processes of cell proliferation, migration, invasion, and apoptosis. We hypothesized that both the GLP1R gene and cAMP/PKA signaling pathway participate in the aforementioned process. Microarray data (GSE14245, GSE27890 and GSE16515) and annotating probe files linked to pancreatic cancer were downloaded through the GEO database. The Multi Experiment Matrix (MEM) site was used to predict the target gene of lncRNA. Both pancreatic cancer tissues (n = 56) and paracancerous tissues (n = 45) were collected from patients diagnosed with pancreatic cancer. Immunohistochemistry was applied to identify the positive expression rate of GLP1R protein. Isolated pancreatic cancer cells and PANC-1 cells were independently classified into the blank, negative control (NC), LINC01121 vector, siRNA-LINC01121, siRNA-GLP1R and siRNA-LINC01121 + siRNA-GLP1R groups. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) and Western blot analysis were applied to detect the expressions of LINC01121, GLP1R, cAMP, PKA, CREB, Bcl-2, Bad and PCNA. Cell proliferation, migration, invasion, cycle progression, and apoptosis were examined by MTT assay, scratch test, Transwell assay and flow cytometry analyses of Annexin V-FITC/PI staining. Observations were made indicating that LINC01121 was highly expressed, while low expressions of GLP1R in pancreatic cancer were detected based on microarray data, which was largely in consistent with the data collected of LINC01121 and GLP1R within the tissues. The target prediction program and luciferase activity analysis was testament to the notion suggesting that GLP1R was indeed a target of LINC01121. In contrast to the blank and NC groups, the LINC01121 vector group exhibited increased expressions of LINC01121; decreased mRNA and protein levels of GLP1R, Bad, cAMP, and PKA; increased protein levels of CREB, Bcl-2, PCNA, p-PKA and p-CREB; increased cell proliferation, migration and invasion; and decreased cell apoptosis. There was no significant difference detected among the blank, NC, and siRNA-LINC01121 + siRNA-GLP1R groups, except that decreased LINC01121 expression was determined in the siRNA-LINC01121 + siRNA-GLP1R group. Parallel data were observed in the pancreatic cancer cells and PANC-1 cells. The current study presents evidence indicating that LINC01121 might inhibit apoptosis while acting to promote proliferation, migration, and invasion of pancreatic cancer cells, supplementing the stance held that LINC01121 functions as a tumor promoter by means of its involvement in the process of translational repression of the GLP1R and inhibition of the cAMP/PKA signaling pathway. © 2018 The Author(s). Published by S. Karger AG, Basel.

Effects of Human Metapneumovirus and Respiratory Syncytial Virus Antigen Insertion in Two 3′ Proximal Genome Positions of Bovine/Human Parainfluenza Virus Type 3 on Virus Replication and Immunogenicity

PubMed Central

Tang, Roderick S.; Schickli, Jeanne H.; MacPhail, Mia; Fernandes, Fiona; Bicha, Leenas; Spaete, Joshua; Fouchier, Ron A. M.; Osterhaus, Albert D. M. E.; Spaete, Richard; Haller, Aurelia A.

2003-01-01

A live attenuated bovine parainfluenza virus type 3 (PIV3), harboring the fusion (F) and hemagglutinin-neuraminidase (HN) genes of human PIV3, was used as a virus vector to express surface glycoproteins derived from two human pathogens, human metapneumovirus (hMPV) and respiratory syncytial virus (RSV). RSV and hMPV are both paramyxoviruses that cause respiratory disease in young children, the elderly, and immunocompromised individuals. RSV has been known for decades to cause acute lower respiratory tract infections in young children, which often result in hospitalization, while hMPV has only been recently identified as a novel human respiratory pathogen. In this study, the ability of bovine/human PIV3 to express three different foreign transmembrane surface glycoproteins and to induce a protective immune response was evaluated. The RNA-dependent RNA polymerase of paramyxoviruses binds to a single site at the 3′ end of the viral RNA genome to initiate transcription of viral genes. The genome position of the viral gene determines its level of gene expression. The promoter-proximal gene is transcribed with the highest frequency, and each downstream gene is transcribed less often due to attenuation of transcription at each gene junction. This feature of paramyxoviruses was exploited using the PIV3 vector by inserting the foreign viral genes at the 3′ terminus, at position 1 or 2, of the viral RNA genome. These locations were expected to yield high levels of foreign viral protein expression stimulating a protective immune response. The immunogenicity and protection results obtained with a hamster model showed that bovine/human PIV3 can be employed to generate bivalent PIV3/RSV or PIV3/hMPV vaccine candidates that will be further evaluated for safety and efficacy in primates. PMID:14512532

Addition of poly (propylene glycol) to multiblock copolymer to optimize siRNA delivery.

PubMed

Dai, Zhi; Arévalo, Maria T; Li, Junwei; Zeng, Mingtao

2014-01-01

Previous studies have examined different strategies for siRNA delivery with varying degrees of success. These include use of viral vectors, cationic liposomes, and polymers. Several copolymers were designed and synthesized based on blocks of poly(ethylene glycol) PEG, poly(propylene glycol) PPG, and poly(l-lysine). These were designated as P1, P2, and P3. We studied the copolymer self-assembly, siRNA binding, particle size, surface potential, architecture of the complexes, and siRNA delivery. Silencing of GFP using copolymer P3 to deliver GFP-specific siRNA to Neuro-2a cells expressing GFP was almost as effective as using Lipofectamine 2000, with minimal cytotoxicity. Thus, we have provided a new copolymer platform for siRNA delivery that we can continue to modify for improved delivery of siRNA in vitro and eventually in vivo.

An efficient protocol for the production of tRNA-free recombinant Selenocysteine Synthase (SELA) from Escherichia coli and its biophysical characterization.

PubMed

Manzine, Livia Regina; Cassago, Alexandre; da Silva, Marco Túlio Alves; Thiemann, Otavio Henrique

2013-03-01

Selenocysteine Synthase (SELA, E.C. 2.9.1.1) from Escherichia coli is a homodecamer pyridoxal-5'-phosphate containing enzyme responsible for the conversion of seryl-tRNA(sec) into selenocysteyl-tRNA(sec) in the biosynthesis of the 21th amino acid, selenocysteine (Sec or U). This paper describes the cloning of the E. coli selA gene into a modified pET29a(+) vector and its expression in E. coli strain WL81460, a crucial modification allowing SELA expression without bound endogenous tRNA(sec). This expression strategy enabled the purification and additional biochemical and biophysical characterization of the SELA decamer. The homogeneous SELA protein was obtained using three chromatographic steps. Size Exclusion Chromatography and Native Gel Electrophoresis showed that SELA maintains a decameric state with molecular mass of approximately 500 kDa with an isoelectric point of 6,03. A predominance of α-helix structures was detected by circular dichroism with thermal stability up to 45 °C. The oligomeric assemblage of SELA was investigated by glutaraldehyde crosslinking experiments indicate that SELA homodecameric structure is the result of a stepwise addition of intermediate oligomeric states and not a direct monomer to homodecamer transition. Our results have contributed to the establishment of a robust expression model for the enzyme free of bound RNA and are of general interest to be taken into consideration in all cases of heterologous/homologous expressions of RNA-binding proteins avoiding the carryover of endogenous RNAs, which may interfere with further biochemical characterizations. Copyright © 2012 Elsevier Inc. All rights reserved.

Suppression of the epidermal growth factor receptor inhibits epithelial-mesenchymal transition in human pancreatic cancer PANC-1 cells.

PubMed

Chang, Zhi-Gang; Wei, Jun-Min; Qin, Chang-Fu; Hao, Kun; Tian, Xiao-Dong; Xie, Kun; Xie, Xue-Hai; Yang, Yin-Mo

2012-05-01

Aberrant expression of epidermal growth factor receptor (EGFR) has been detected in pancreatic cancer; however, the mechanisms of EGFR in inducing pancreatic cancer development have not been adequately elucidated. The objective of this study was to determine the role of EGFR in mediating epithelial-mesenchymal transition (EMT) in pancreatic cancer cells. Pancreatic cancer cell line PANC-1 was transfected with small interfering RNA of EGFR by use of a lentiviral expression vector to establish an EGFR-knockdown cell line (si-PANC-1). PANC-1 cells transfected with lentiviral vector expressing negative control sequence were used as negative control (NC-PANC-1). Scratch assay and transwell study were used to analyze cell migration and invasion. Real-time PCR and Western blotting were used to detect the expression of EMT markers E-cadherin, N-cadherin, vimentin, and fibronectin and transcription factors snail, slug, twist1, and sip1 in PANC-1, NC-PANC-1, and si-PANC-1 cells. Immunofluorescent staining with these antibodies and confocal microscopy were used to observe their cellular location and morphologic changes. After RNA interference of EGFR, the migration and invasion ability of si-PANC-1 cells decreased significantly. The expression of epithelial phenotype marker E-cadherin increased and the expression of mesenchymal phenotype markers N-cadherin, vimentin, and fibronectin decreased, indicating reversion of EMT. We also observed intracellular translocation of E-cadherin. Expression of transcription factors snail and slug in si-PANC-1 cells decreased significantly. Suppression of EGFR expression can significantly inhibit EMT of pancreatic cancer PANC-1 cells. The mechanism may be related with the down-regulation of the expression of transcription factors snail and slug.

[Construction and expression of recombinant lentiviral vectors of AKT2,PDK1 and BAD].

PubMed

Zhu, Jing; Chen, Bo-Jiang; Huang, Na; Li, Wei-Min

2014-03-01

To construct human protein kinase B (ATK2), phosphoinositide-dependent kinase 1 (PDK1) and bcl-2-associated death protein (BAD) lentiviral expression vector, and to determine their expressions in 293T cells. Total RNA was extracted from lung cancer tissues. The full-length coding regions of human ATK2, BAD and PDK1 cDNA were amplified via RT-PCR using specific primers, subcloned into PGEM-Teasy and then sequenced for confirmation. The full-length coding sequence was cut out with a specific restriction enzyme digest and subclone into pCDF1-MCS2-EF1-copGFP. The plasmids were transfected into 293T cells using the calcium phosphate method. The over expression of AKT2, BAD and PDK1 were detected by Western blot. AKT2, PDK1 and BAD were subcloned into pCDF1-MCS2-EF1-copGFP, with an efficiency of transfection of 100%, 95%, and 90% respectively. The virus titers were 6.7 x 10(6) PFU/mL in the supernatant. After infection, the proteins of AKT2, PDK1 and BAD were detected by Western blot. The lentivial vector pCDF1-MCS2-EF1-copGFP containing AKT2, BAD and PDK1 were successfully constructed and expressed in 293T cells.

Pathogenic effects of Rift Valley fever virus NSs gene are alleviated in cultured cells by expressed antiviral short hairpin RNAs.

PubMed

Scott, Tristan; Paweska, Janusz T; Arbuthnot, Patrick; Weinberg, Marc S

2012-01-01

Rift Valley fever virus (RVFV), a member of the Bunyaviridae family, may cause severe hepatitis, encephalitis and haemorrhagic fever in humans. There are currently no available licensed vaccines or therapies to treat the viral infection in humans. RNA interference (RNAi)-based viral gene silencing offers a promising approach to inhibiting replication of this highly pathogenic virus. The small (S) segment of the RVFV tripartite genome carries the genetic determinates for pathogenicity during infection. This segment encodes the non-structural S (NSs) and essential nucleocapsid (N) genes. To advance RNAi-based inhibition of RVFV replication, we designed several Pol III short hairpin RNA (shRNA) expression cassettes against the NSs and N genes, including a multimerized plasmid vector that included four shRNA expression cassettes. Effective target silencing was demonstrated using full- and partial-length target reporter assays, and confirmed by western blot analysis of exogenous N and NSs expression. Small RNA northern blots showed detectable RNAi guide strand formation from single and multimerized shRNA constructs. Using a cell culture model of RVFV replication, shRNAs targeting the N gene decreased intracellular nucleocapsid protein concentration and viral replication. The shRNAs directed against the NSs gene reduced NSs protein concentrations and alleviated NSs-mediated cytotoxicity, which may be caused by host transcription suppression. These data are the first demonstration that RNAi activators have a potential therapeutic benefit for countering RVFV infection.

The Antisense RNA Approach: a New Application for In Vivo Investigation of the Stress Response of Oenococcus oeni, a Wine-Associated Lactic Acid Bacterium

PubMed Central

Darsonval, Maud; Msadek, Tarek; Alexandre, Hervé

2015-01-01

Oenococcus oeni is a wine-associated lactic acid bacterium mostly responsible for malolactic fermentation in wine. In wine, O. oeni grows in an environment hostile to bacterial growth (low pH, low temperature, and ethanol) that induces stress response mechanisms. To survive, O. oeni is known to set up transitional stress response mechanisms through the synthesis of heat stress proteins (HSPs) encoded by the hsp genes, notably a unique small HSP named Lo18. Despite the availability of the genome sequence, characterization of O. oeni genes is limited, and little is known about the in vivo role of Lo18. Due to the lack of genetic tools for O. oeni, an efficient expression vector in O. oeni is still lacking, and deletion or inactivation of the hsp18 gene is not presently practicable. As an alternative approach, with the goal of understanding the biological function of the O. oeni hsp18 gene in vivo, we have developed an expression vector to produce antisense RNA targeting of hsp18 mRNA. Recombinant strains were exposed to multiple stresses inducing hsp18 gene expression: heat shock and acid shock. We showed that antisense attenuation of hsp18 affects O. oeni survival under stress conditions. These results confirm the involvement of Lo18 in heat and acid tolerance of O. oeni. Results of anisotropy experiments also confirm a membrane-protective role for Lo18, as previous observations had already suggested. This study describes a new, efficient tool to demonstrate the use of antisense technology for modulating gene expression in O. oeni. PMID:26452552

Inhibition of HBV replication in vivo using helper-dependent adenovirus vectors to deliver antiviral RNA interference expression cassettes.

PubMed

Crowther, Carol; Mowa, Mohube B; Ely, Abdullah; Arbuthnot, Patrick B

2014-01-01

HBV is hyperendemic to southern Africa and parts of Asia, but licensed antivirals have little effect on limiting life-threatening complications of the infection. Although RNA interference (RNAi)-based gene silencing has shown therapeutic potential, difficulties with delivery of anti-HBV RNAi effectors remain an obstacle to their clinical use. To address concerns about the transient nature of transgene expression and toxicity resulting from immunostimulation by recombinant adenovirus vectors (Ads), utility of RNAi-activating anti-HBV helper-dependent (HD) Ads were assessed in this study. Following intravenous administration of 5×10(9) unmodified or pegylated HD Ad infectious particles to HBV transgenic mice, HBV viral loads and serum HBV surface antigen levels were monitored for 12 weeks. Immunostimulation of HD Ads was assessed by measuring inflammatory cytokines, hepatic function and immune response to the co-delivered LacZ reporter gene. Unmodified and pegylated HD Ads transduced 80-90% of hepatocytes and expressed short hairpin RNAs (shRNAs) were processed to generate intended HBV-targeting guides. Markers of HBV replication were decreased by approximately 95% and silencing was sustained for 8 weeks. Unmodified HD Ads induced release of proinflammatory cytokines and there was evidence of an adaptive immune response to β-galactosidase. However the HD Ad-induced innate immune response was minimal in preparations that were enriched with infectious particles. HD Ads have potential utility for delivery of therapeutic HBV-silencing sequences and alterations of these vectors to attenuate their immune responses may further improve their efficacy.

lncRNA CCAT1 promotes cell proliferation, migration, and invasion by down-regulation of miR-143 in FTC-133 thyroid carcinoma cell line.

PubMed

Yang, Tianzheng; Zhai, Hongyan; Yan, Ruihong; Zhou, Zhenhu; Gao, Lei; Wang, Luqing

2018-01-01

Thyroid cancer is a common malignant tumor. Long non-coding RNA colon cancer-associated transcript 1 (lncRNA CCAT1) is highly expressed in many cancers; however, the molecular mechanism of CCAT1 in thyroid cancer remains unclear. Hence, this study aimed to investigate the effect of CCAT1 on human thyroid cancer cell line FTC-133. FTC-133 cells were transfected with CCAT1 expressing vector, CCAT1 shRNA, miR-143 mimic, and miR-143 inhibitor, respectively. After different treatments, cell viability, proliferation, migration, invasion, and apoptosis were measured. Moreover, the regulatory relationship of CCAT1 and miR-143, as well as miR-143 and VEGF were tested using dual-luciferase reporter assay. The relative expressions of CCAT1, miR-143, and VEGF were tested by qRT-PCR. The expressions of apoptosis-related factors and corresponding proteins in PI3K/AKT and MAPK pathways were analyzed using western blot analysis. The results suggested that CCAT1 was up-regulated in the FTC-133 cells. CCAT1 suppression decreased FTC-133 cell viability, proliferation, migration, invasion, and miR-143 expression, while it increased apoptosis and VEGF expression. CCAT1 might act as a competing endogenous RNA (ceRNA) for miR-143. Moreover, CCAT1 activated PI3K/AKT and MAPK signaling pathways through inhibition of miR-143. This study demonstrated that CCAT1 exhibited pro-proliferative and pro-metastasis functions on FTC-133 cells and activated PI3K/AKT and MAPK signaling pathways via down-regulation of miR-143. These findings will provide a possible target for clinical treatment of thyroid cancer.

mRNA secondary structure engineering of Thermobifida fusca endoglucanase (Cel6A) for enhanced expression in Escherichia coli.

PubMed

Ali, Imran; Asghar, Rehana; Ahmed, Sajjad; Sajjad, Muhammad; Tariq, Muhammad; Waheed Akhtar, M

2015-03-01

The sequence and structure of mRNA plays an important role in solubility and expression of the translated protein. To divulge the role of mRNA secondary structure and its thermodynamics in the expression level of the recombinant endoglucanase in Escherichia coli, 5'-end of the mRNA was thermodynamically optimized. Molecular engineering was done by introducing two silent synonymous mutations at positions +5 (UCU with UCC) and +7 (UUC with UUU) of the 5'-end of mRNA to relieve hybridization with ribosomal binding site. Two variants of glycoside hydrolase family six endoglucanase, wild type (cel6A.wt) and mutant (cel6A.mut) from Thermobifida fusca were expressed and characterized in E. coli using T7 promoter-based expression vector; pET22b(+). Enhanced expression level of engineered construct (Cel6A.mut) with ∆G = -2.7 kcal mol(-1)was observed. It showed up to ~45 % higher expression as compared to the wild type construct (Cel6A.wt) having ∆G = -7.8 kcal mol(-1) and ~25 % expression to the total cell proteins. Heterologous protein was purified by heating the recombinant E. coli BL21 (DE3) CodonPlus at 60 °C. The optimum pH for enzyme activity was six and optimum temperature was 60 °C. Maximum activity was observed 4.5 Umg(-1) on CMC. Hydrolytic activity was also observed on insoluble substrates, i.e. RAC (2.8 Umg(-1)), alkali treated bagass (1.7 Umg(-1)), filter paper (1.2 Umg(-1)) and BMCC (0.3 Umg(-1)). Metal ions affect endoglucanase activity in different ways. Only Fe(2+) exhibited 20.8 % stimulatory effects on enzyme activity. Enzyme activity was profoundly inhibited by Hg2(+) (91.8 %).

Functions of MiRNA-128 on the regulation of head and neck squamous cell carcinoma growth and apoptosis.

PubMed

Hauser, Belinda; Zhao, Yuan; Pang, Xiaowu; Ling, Zhiqiang; Myers, Ernest; Wang, Paul; Califano, Joseph; Gu, Xinbin

2015-01-01

Incidence of head and neck squamous cell carcinoma (HNSCC) has continuously increased in past years while its survival rate has not been significantly improved. There is a critical need to better understand the genetic regulation of HNSCC tumorigenesis and progression. In this study, we comprehensively analyzed the function of miRNA-128 (miR-128) in the regulation of HNSCC growth and its putative targets in vitro and in vivo systems. The function and targets of miR-128 were investigated in human HNSCC cell lines (JHU-13 and JHU-22), which were stably transfected with the miR-128 gene using a lentiviral delivery system. The expression levels of miR-128 and its targeted proteins were analyzed with qRT-PCR, Western blotting and flow cytometry. The binding capacity of miRNA-128 to its putative targets was determined using a luciferase report assay. MTT, colony formation, and a tumor xenograft model further evaluated the effects of miR-128 on HNSCC growth. We generated two miR-128 stably transfected human HNSCC cell lines (JHU-13miR-128 and JHU-22miR-128). Enforced expression of miR-128 was detected in both cultured JHU-13miR-128 and JHU-22miR-128 cell lines, approximately seventeen to twenty folds higher than in vector control cell lines. miRNA-128 was able to bind with the 3'-untranslated regions of BMI-1, BAG-2, BAX, H3f3b, and Paip2 mRNAs, resulting in significant reduction of the targeted protein levels. We found that upregulated miR-128 expression significantly inhibited both JHU-13miR-128 and JHU-22miR-128 cell viability approximately 20 to 40%, and the JHU-22miR-128 tumor xenograft growth compared to the vector control groups. miR-128 acted as a tumor suppressor inhibiting the HNSCC growth by directly mediating the expression of putative targets. Our results provide a better understanding of miRNA-128 function and its potential targets, which may be valuable for developing novel diagnostic markers and targeted therapy.

Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

PubMed Central

Kon, Tatsuya; Yoshikawa, Nobuyuki

2014-01-01

Apple latent spherical virus (ALSV) is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation) system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS) is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the cauliflower mosaic virus 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation zero plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A) was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification. PMID:25426109

Development of Genome Engineering Tools from Plant-Specific PPR Proteins Using Animal Cultured Cells.

PubMed

Kobayashi, Takehito; Yagi, Yusuke; Nakamura, Takahiro

2016-01-01

The pentatricopeptide repeat (PPR) motif is a sequence-specific RNA/DNA-binding module. Elucidation of the RNA/DNA recognition mechanism has enabled engineering of PPR motifs as new RNA/DNA manipulation tools in living cells, including for genome editing. However, the biochemical characteristics of PPR proteins remain unknown, mostly due to the instability and/or unfolding propensities of PPR proteins in heterologous expression systems such as bacteria and yeast. To overcome this issue, we constructed reporter systems using animal cultured cells. The cell-based system has highly attractive features for PPR engineering: robust eukaryotic gene expression; availability of various vectors, reagents, and antibodies; highly efficient DNA delivery ratio (>80 %); and rapid, high-throughput data production. In this chapter, we introduce an example of such reporter systems: a PPR-based sequence-specific translational activation system. The cell-based reporter system can be applied to characterize plant genes of interested and to PPR engineering.

v-src induces clonal sarcomas and rapid metastasis following transduction with a replication-defective retrovirus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stoker, A.W.; Sieweke, M.H.

1989-12-01

v-src is an effective carcinogen when expressed from Rous sarcoma virus (RSV) in vivo. Whereas RSV tumors require sustained oncogene expression, their growth is largely a balance between viral recruitment of tissues and host immune destruction of infected cells. The authors have therefore examined the tumorigenic potential of v-src in the absence of viral recruitment and viral antigen expression. v-src was introduced with high efficiency into chicken wing web tissues using replication-defective (rd) retroviral vectors. Clonal sarcomas were induced rapidly, and furthermore, v-src potentiated metastatic progression in {approx} 0.1%-1% of tumor clones with unexpectedly short latency. rd vectors proved effectivemore » not only in transducing v-src into tissues but also as insertional markers of tumor clonality. The rd vector present in most primary and metastatic tumors was a highly truncated form of RSV derived by viral transmission of spliced v-src mRNA; this vector should thus avoid viral recruitment and host anti-viral immune reaction through its complete lack of viral structural genes. Under such conditions v-src maintains strong carcinogenicity in vivo when restricted to clonal tumor growth and can confer rapid metastatic potential on a discrete subset of tumor clones.« less

Mutation-adapted U1 snRNA corrects a splicing error of the dopa decarboxylase gene.

PubMed

Lee, Ni-Chung; Lee, Yu-May; Chen, Pin-Wen; Byrne, Barry J; Hwu, Wuh-Liang

2016-12-01

Aromatic l-amino acid decarboxylase (AADC) deficiency is an inborn error of monoamine neurotransmitter synthesis, which results in dopamine, serotonin, epinephrine and norepinephrine deficiencies. The DDC gene founder mutation IVS6 + 4A > T is highly prevalent in Chinese patients with AADC deficiency. In this study, we designed several U1 snRNA vectors to adapt U1 snRNA binding sequences of the mutated DDC gene. We found that only the modified U1 snRNA (IVS-AAA) that completely matched both the intronic and exonic U1 binding sequences of the mutated DDC gene could correct splicing errors of either the mutated human DDC minigene or the mouse artificial splicing construct in vitro. We further injected an adeno-associated viral (AAV) vector to express IVS-AAA in the brain of a knock-in mouse model. This treatment was well tolerated and improved both the survival and brain dopamine and serotonin levels of mice with AADC deficiency. Therefore, mutation-adapted U1 snRNA gene therapy can be a promising method to treat genetic diseases caused by splicing errors, but the efficiency of such a treatment still needs improvements. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

SRD5A1 Genetic Variation and Prostate Cancer Epidemiology

DTIC Science & Technology

2005-05-01

DATES COVERED (Leave blank) May 2005 Annual Summary (1 May 2004 - 30 Apr 2005) 4. TITLE AND SUBTITLE 5. FUNDING NUMBERS SRD5A1 Genetic Variation and...secondary structure of the luciferase+ SRD5A1 3’-UTR mRNA was so different from the native SRD5Al message, that the 3’-UTR variants should be tested...in the context of a native mRNA. A eukaryotic expression vector containing 850bp of the human SRD5A1 promoter was seamlessly cloned onto the 5’ end of

Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver.

PubMed

Piras, Bryan A; O'Connor, Daniel M; French, Brent A

2013-01-01

AAV9 is a powerful gene delivery vehicle capable of providing long-term gene expression in a variety of cell types, particularly cardiomyocytes. The use of AAV-delivery for RNA interference is an intense area of research, but a comprehensive analysis of knockdown in cardiac and liver tissues after systemic delivery of AAV9 has yet to be reported. We sought to address this question by using AAV9 to deliver a short-hairpin RNA targeting the enhanced green fluorescent protein (GFP) in transgenic mice that constitutively overexpress GFP in all tissues. The expression cassette was initially tested in vitro and we demonstrated a 61% reduction in mRNA and a 90% reduction in GFP protein in dual-transfected 293 cells. Next, the expression cassette was packaged as single-stranded genomes in AAV9 capsids to test cardiac GFP knockdown with several doses ranging from 1.8×10(10) to 1.8×10(11) viral genomes per mouse and a dose-dependent response was obtained. We then analyzed GFP expression in both heart and liver after delivery of 4.4×10(11) viral genomes per mouse. We found that while cardiac knockdown was highly efficient, with a 77% reduction in GFP mRNA and a 71% reduction in protein versus control-treated mice, there was no change in liver expression. This was despite a 4.5-fold greater number of viral genomes in the liver than in the heart. This study demonstrates that single-stranded AAV9 vectors expressing shRNA can be used to achieve highly efficient cardiac-selective knockdown of GFP expression that is sustained for at least 7 weeks after the systemic injection of 8 day old mice, with no change in liver expression and no evidence of liver damage despite high viral genome presence in the liver.

Using adenovirus armed short hairpin RNA targeting transforming growth factor β1 inhibits melanoma growth and metastasis in an ex vivo animal model.

PubMed

Tai, Kuo-Feng; Wang, Chien-Hsing

2013-12-01

The transforming growth factor β (TGF-β) is the key molecule implicated in impaired immune function in human patients with malignant melanoma. TGF-β can promote tumor growth, invasion, and metastasis in advanced stages of melanoma. Blocking these tumor-promoting effects of TGF-β provides a potentially important therapeutic strategy for the treatment of melanoma. In this study, we used an adenovirus-based shRNA expression system and successfully constructed Ad/TGF-β1-RNA interference (RNAi) which mediated the RNAi for TGF-β1 gene silencing. We examined the effects of TGF-β1 protein knockdown by RNAi on the growth and metastasis of melanoma in C57BL/6 mice induced by the B16F0 cell line. The TGF-β1 hairpin oligonucleotide was cloned into adenoviral vector. The resulting recombinant adenoviruses infected murine melanoma cell line, B16F0, and designated as B16F0/TGF-β1-RNAi cells. The blank adenoviral vector also infected B16F0 cells and designed as B16F0/vector-control cells served as a control. TGF-β1 expression was reduced in B16F0/TGF-β1-RNAi cells compared with B16F0 cells and B16F0/vector-control cells. Three million wild-type B16F0 cells, B16F0/vector-control cells, and B16F0/TGF-β1-RNAi cells were injected subcutaneously into the right flanks of adult female syngeneic mice C57BL/6. The tumor sizes were 756.09 (65.35), 798.48 (78.77), and 203.55 (24.56) mm at the 14th day in the mice receiving B16F0 cells, B16F0/vector-control cells, and B16F0/TGFβ1-RNAi cells, respectively. The P value was less than 0.01 by 1-way analysis of variance. TGF-β1 knockdown in B16F0 cells enhanced the infiltration of CD4 and CD8 T cells in the tumor regions. C57BL/6 mice were evaluated for pulmonary metastasis after tail vein injection of 2 million B16F0 cells, B16F0/vector-control cells, and B16F0/TGF-β1-RNAi cells. The pulmonary metastasis also reduced significantly on days 14 day and 21 in mice injected with B16F0/TGF-β1-RNAi tumors. The blood vessel density of the tumors markedly reduced in B16F0/TGF-β1-RNAi tumors. Our results showed that Ad/TGF-β1-RNAi could induce silencing of the TGF-β1 gene effectively. Silencing of TGF-β1 expression in B16F0 cells by RNAi technology can inhibit the growth and metastasis of this tumor after being transplanted to C57BL/6 mice. This kind of adenoviral vector based on RNAi might be a promising vector for cancer therapy.

Long noncoding AFAP1-antisense RNA 1 is upregulated and promotes tumorigenesis in gastric cancer.

PubMed

Ye, Fei; Gong, Yi; Chen, Xiangheng; Yu, Meiying; Zuo, Zhongkun; Pei, Dongni; Liu, Wei; Wang, Qunwei; Zhou, Jun; Duan, Lunxi; Zhang, Leiyi; Li, Xiaojing; Tang, Tenglong; Huang, Jiangsheng

2018-05-01

Long noncoding RNA serves important roles in gastric cancer (GC). However, the prognostic significance and tumorigenesis effect of AFAP1-antisense RNA 1 (AS1) in GC remain to be clarified. The present study was conducted in order to determine the expression level of AFAP1-AS1 by reverse transcription-quantitative polymerase chain reaction. It was demonstrated that AFAP1-AS1 expression level was higher in GC tissues in comparison with adjacent tissues. By analyzing 66 GC tissue specimens, AFAP1-AS1 expression level was found to be markedly associated with tumor size, clinical stage and differentiation. By performing multivariate Cox regression test, AFAP1-AS1 expression level was confirmed to be an independent factor for poor prognosis in patients with GC. Furthermore, SGC-7901 and BGC-823 cells were used for further investigation following transfection of an AFAP1-AS1 short hairpin RNA lentiviral vector. Knockdown of AFAP1-AS1 significantly inhibited GC cell proliferation, migration and invasion abilities in vitro . Finally, nude mice experiments confirmed that downregulation of AFAP1-AS1 in GC cells suppressed tumor growth in vivo . In conclusion, the results of the present study suggested that AFAP1-AS1 may serve as a valuable prognostic indicator and therapeutic target for GC.

Pathology Associated with AAV Mediated Expression of Beta Amyloid or C100 in Adult Mouse Hippocampus and Cerebellum

PubMed Central

Drummond, Eleanor S.; Muhling, Jill; Martins, Ralph N.; Wijaya, Linda K.; Ehlert, Erich M.; Harvey, Alan R.

2013-01-01

Accumulation of beta amyloid (Aβ) in the brain is a primary feature of Alzheimer’s disease (AD) but the exact molecular mechanisms by which Aβ exerts its toxic actions are not yet entirely clear. We documented pathological changes 3 and 6 months after localised injection of recombinant, bi-cistronic adeno-associated viral vectors (rAAV2) expressing human Aβ40-GFP, Aβ42-GFP, C100-GFP or C100V717F-GFP into the hippocampus and cerebellum of 8 week old male mice. Injection of all rAAV2 vectors resulted in wide-spread transduction within the hippocampus and cerebellum, as shown by expression of transgene mRNA and GFP protein. Despite the lack of accumulation of Aβ protein after injection with AAV vectors, injection of rAAV2-Aβ42-GFP and rAAV2- C100V717F-GFP into the hippocampus resulted in significantly increased microgliosis and altered permeability of the blood brain barrier, the latter revealed by high levels of immunoglobulin G (IgG) around the injection site and the presence of IgG positive cells. In comparison, injection of rAAV2-Aβ40-GFP and rAAV2-C100-GFP into the hippocampus resulted in substantially less neuropathology. Injection of rAAV2 vectors into the cerebellum resulted in similar types of pathological changes, but to a lesser degree. The use of viral vectors to express different types of Aβ and C100 is a powerful technique with which to examine the direct in vivo consequences of Aβ expression in different regions of the mature nervous system and will allow experimentation and analysis of pathological AD-like changes in a broader range of species other than mouse. PMID:23516609

Improvement of In Vivo Expression of Genes Delivered by Self-Amplifying RNA Using Vaccinia Virus Immune Evasion Proteins

PubMed Central

Beissert, Tim; Koste, Lars; Perkovic, Mario; Walzer, Kerstin C.; Erbar, Stephanie; Selmi, Abderraouf; Diken, Mustafa; Kreiter, Sebastian; Türeci, Özlem; Sahin, Ugur

2017-01-01

Among nucleic acid–based delivery platforms, self-amplifying RNA (saRNA) vectors are of increasing interest for applications such as transient expression of recombinant proteins and vaccination. saRNA is safe and, due to its capability to amplify intracellularly, high protein levels can be produced from even minute amounts of transfected templates. However, it is an obstacle to full exploitation of this platform that saRNA induces a strong innate host immune response. In transfected cells, pattern recognition receptors sense double-stranded RNA intermediates and via activation of protein kinase R (PKR) and interferon signaling initiate host defense measures including a translational shutdown. To reduce pattern recognition receptor stimulation and unleash suppressed saRNA translation, this study co-delivered non-replicating mRNA encoding vaccinia virus immune evasion proteins E3, K3, and B18. It was shown that E3 is far superior to K3 or B18 as a highly potent blocker of PKR activation and of interferon (IFN)-β upregulation. B18, in contrast, is superior in controlling OAS1, a key IFN-inducible gene involved in viral RNA degradation. By combining all three vaccinia proteins, the study achieved significant suppression of PKR and IFN pathway activation in vitro and enhanced expression of saRNA-encoded genes of interest both in vitro and in vivo. This approach promises to overcome key hurdles of saRNA gene delivery. Its application may improve the bioavailability of the encoded protein, and reduce the effective dose and correspondingly the cost of goods of manufacture in the various fields where saRNA utilization is envisioned. PMID:28877647

Improvement of In Vivo Expression of Genes Delivered by Self-Amplifying RNA Using Vaccinia Virus Immune Evasion Proteins.

PubMed

Beissert, Tim; Koste, Lars; Perkovic, Mario; Walzer, Kerstin C; Erbar, Stephanie; Selmi, Abderraouf; Diken, Mustafa; Kreiter, Sebastian; Türeci, Özlem; Sahin, Ugur

2017-12-01

Among nucleic acid-based delivery platforms, self-amplifying RNA (saRNA) vectors are of increasing interest for applications such as transient expression of recombinant proteins and vaccination. saRNA is safe and, due to its capability to amplify intracellularly, high protein levels can be produced from even minute amounts of transfected templates. However, it is an obstacle to full exploitation of this platform that saRNA induces a strong innate host immune response. In transfected cells, pattern recognition receptors sense double-stranded RNA intermediates and via activation of protein kinase R (PKR) and interferon signaling initiate host defense measures including a translational shutdown. To reduce pattern recognition receptor stimulation and unleash suppressed saRNA translation, this study co-delivered non-replicating mRNA encoding vaccinia virus immune evasion proteins E3, K3, and B18. It was shown that E3 is far superior to K3 or B18 as a highly potent blocker of PKR activation and of interferon (IFN)-β upregulation. B18, in contrast, is superior in controlling OAS1, a key IFN-inducible gene involved in viral RNA degradation. By combining all three vaccinia proteins, the study achieved significant suppression of PKR and IFN pathway activation in vitro and enhanced expression of saRNA-encoded genes of interest both in vitro and in vivo. This approach promises to overcome key hurdles of saRNA gene delivery. Its application may improve the bioavailability of the encoded protein, and reduce the effective dose and correspondingly the cost of goods of manufacture in the various fields where saRNA utilization is envisioned.

Maternal Germline-Specific Genes in the Asian Malaria Mosquito Anopheles stephensi: Characterization and Application for Disease Control

PubMed Central

Biedler, James K.; Qi, Yumin; Pledger, David; Macias, Vanessa M.; James, Anthony A.; Tu, Zhijian

2014-01-01

Anopheles stephensi is a principal vector of urban malaria on the Indian subcontinent and an emerging model for molecular and genetic studies of mosquito biology. To enhance our understanding of female mosquito reproduction, and to develop new tools for basic research and for genetic strategies to control mosquito-borne infectious diseases, we identified 79 genes that displayed previtellogenic germline-specific expression based on RNA-Seq data generated from 11 life stage–specific and sex-specific samples. Analysis of this gene set provided insights into the biology and evolution of female reproduction. Promoters from two of these candidates, vitellogenin receptor and nanos, were used in independent transgenic cassettes for the expression of artificial microRNAs against suspected mosquito maternal-effect genes, discontinuous actin hexagon and myd88. We show these promoters have early germline-specific expression and demonstrate 73% and 42% knockdown of myd88 and discontinuous actin hexagon mRNA in ovaries 48 hr after blood meal, respectively. Additionally, we demonstrate maternal-specific delivery of mRNA and protein to progeny embryos. We discuss the application of this system of maternal delivery of mRNA/miRNA/protein in research on mosquito reproduction and embryonic development, and for the development of a gene drive system based on maternal-effect dominant embryonic arrest. PMID:25480960

Cloning and high level expression of gene encoding ES antigen from Trichinella spiralis muscle larvae.

PubMed

Yan, Y; Xu, W; Chen, H; Ma, Z; Zhu, Y; Cai, S

1994-01-01

The partial structure gene encoding ES antigen derived from Trichinella spiralis (TSP) muscle larvae was cloned, characterized, and expressed in E. coli. The target DNA (0.7 kb) was directly obtained from the TSP total RNA by using RNA PCR technique. Based on the analysis with the RE digestion, the fragment was cloned into the fusion expression vector pEX31C. It was shown that a kind of 37kDa fusion protein was expressed in E. coli containing the recombinant plasmid by SDS-PAGE electrophoresis. The expressed protein was over 22% of the total cell protein, and it was aggregated in the form of inclusion bodies in E. coli. The purified protein could be recognized in ELISA both by sera from swine-infected with TSP and by the monoclonal antibody against TSP. These findings suggest that the recombinant protein is a potentially valuable antigen both for immunodiagnosis and vaccine development of trichinellosis.

Highly repressible expression system for cloning genes that specify potentially toxic proteins.

PubMed Central

O'Connor, C D; Timmis, K N

1987-01-01

A highly repressible expression vector system that allows the cloning of potentially deleterious genes has been constructed. Undesired expression of a cloned gene was prevented (i) at the level of initiation of transcription, by the presence of the strong but highly repressible leftward promoter of bacteriophage lambda, lambda pL, and (ii) at the level of transcript elongation or translation, through synthesis of antisense RNA complementary to the mRNA of the cloned gene. The system was tested by measuring the inhibition of expression of traT, the gene for the TraT major outer membrane lipoprotein. Direct detection and functional assays indicated that an essentially complete inhibition of traT expression was obtained. As a further test of the system, the gene encoding the EcoRI restriction endonuclease was cloned in the absence of the gene of the corresponding protective EcoRI modification methylase. Transformants harboring this construct were only viable when both repression controls were operational. Images PMID:2443481

SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans.

PubMed

Schwartz, Matthew L; Jorgensen, Erik M

2016-04-01

In principle, clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 allows genetic tags to be inserted at any locus. However, throughput is limited by the laborious construction of repair templates and guide RNA constructs and by the identification of modified strains. We have developed a reagent toolkit and plasmid assembly pipeline, called "SapTrap," that streamlines the production of targeting vectors for tag insertion, as well as the selection of modified Caenorhabditis elegans strains. SapTrap is a high-efficiency modular plasmid assembly pipeline that produces single plasmid targeting vectors, each of which encodes both a guide RNA transcript and a repair template for a particular tagging event. The plasmid is generated in a single tube by cutting modular components with the restriction enzyme SapI, which are then "trapped" in a fixed order by ligation to generate the targeting vector. A library of donor plasmids supplies a variety of protein tags, a selectable marker, and regulatory sequences that allow cell-specific tagging at either the N or the C termini. All site-specific sequences, such as guide RNA targeting sequences and homology arms, are supplied as annealed synthetic oligonucleotides, eliminating the need for PCR or molecular cloning during plasmid assembly. Each tag includes an embedded Cbr-unc-119 selectable marker that is positioned to allow concurrent expression of both the tag and the marker. We demonstrate that SapTrap targeting vectors direct insertion of 3- to 4-kb tags at six different loci in 10-37% of injected animals. Thus SapTrap vectors introduce the possibility for high-throughput generation of CRISPR/Cas9 genome modifications. Copyright © 2016 by the Genetics Society of America.

Argonaute proteins are key determinants of RNAi efficacy, toxicity, and persistence in the adult mouse liver.

PubMed

Grimm, Dirk; Wang, Lora; Lee, Joyce S; Schürmann, Nina; Gu, Shuo; Börner, Kathleen; Storm, Theresa A; Kay, Mark A

2010-09-01

shRNA overexpression from viral gene therapy vectors can trigger cytotoxicity leading to organ failure and lethality in mice and rats. This process likely involves saturation of endogenous cellular RNAi factors including exportin-5 (Xpo-5). Here, we have shown that Xpo-5 overexpression enhanced shRNA efficiency in the liver of adult mice but increased hepatotoxicity. We identified the 4 members of the human Argonaute (Ago) protein family as downstream factors involved in saturation of endogenous cellular RNAi, all of which were able to interact with shRNAs in cells and mice. In Ago/shRNA coexpression studies, Ago-2 (Slicer) was the primary rate-limiting determinant of both in vitro and in vivo RNAi efficacy, toxicity, and persistence. In adult mice, vector-based Ago-2/Xpo-5 coexpression enhanced U6-driven shRNA silencing of exogenous and endogenous hepatic targets, reduced hepatotoxicity, and extended RNAi stability by more than 3 months. Use of weaker RNA polymerase III promoters to minimize shRNA expression likewise alleviated in vivo toxicity and permitted greater than 95% persistent knockdown of hepatitis B virus and other transgenes in mouse liver for more than 1 year. Our studies substantiate that abundant small RNAs can overload the endogenous RNAi pathway and reveal possible strategies for reducing hepatotoxicity of short- and long-term clinical gene silencing in humans.

Visualizing the activity of Escherichia coli divergent promoters and probing their dependence on superhelical density using dual-colour fluorescent reporter vector

PubMed Central

Masulis, Irina S.; Babaeva, Zaira Sh.; Chernyshov, Sergey V.; Ozoline, Olga N.

2015-01-01

Mosaic pattern of transcription in alternating directions is a common feature of prokaryotic and eukaryotic genomes which rationality and origin remain enigmatic. In Escherichia coli approximately 25% of genes comprise pairs of topologically linked divergently transcribed units. Given that transcriptional complex formation at each promoter in the pair induces topological changes and is itself sensitive to DNA structural perturbations, study of the functional anatomy in such areas requires special approaches. Here we suggested the dual-colour promoter probe vector which may become an ideal tool for divergent transcription profiling. The vector was used to characterize the specific genomic region nearby appY with multiple bidirectional promoters predicted in silico. Only three promoters of this region were shown to be engaged in the transcription initiation resulting in the expression of reporter genes. RNA product transcribed in antisense direction is suggested as a novel RNA. Nalidixin-induced topological modulation differentially affected transcription in sense and antisense directions thus exemplifying anticooperative mode in the response to topological alterations. PMID:26081797

Reversion of multidrug resistance in the P-glycoprotein-positive human pancreatic cell line (EPP85-181RDB) by introduction of a hammerhead ribozyme.

PubMed Central

Holm, P. S.; Scanlon, K. J.; Dietel, M.

1994-01-01

A major problem in cytostatic treatment of many tumours is the development of multidrug resistance (MDR4). This is most often accompanied by the overexpression of a membrane transport protein, P-glycoprotein, and its encoding mRNA. In order to reverse the resistant phenotype in cell cultures, we constructed a specific hammerhead ribozyme possessing catalytic activity that cleaves the 3'-end of the GUC sequence in codon 880 of the mdr1 mRNA. We demonstrated that the constructed ribozyme is able to cleave a reduced substrate mdr1 mRNA at the GUC position under physiological conditions in a cell-free system. A DNA sequence encoding the ribozyme gene was then incorporated into a mammalian expression vector (pH beta APr-1 neo) and transfected into the human pancreatic carcinoma cell line EPP85-181RDB, which is resistant to daunorubicin and expresses the MDR phenotype. The expressed ribozyme decreased the level of mdr1 mRNA expression, inhibited the formation of P-glycoprotein and reduced the cell's resistance to daunorubicin dramatically; this means that the resistant cells were 1,600-fold more resistant than the parental cell line (EPP85-181P), whereas those cell clones that showed ribozyme expression were only 5.3-fold more resistant than the parental cell line. Images Figure 1 Figure 3 Figure 2 PMID:7914421

In vivo, cardiac-specific knockdown of target protein, Malic Enzyme-1, in rat via adenoviral delivery of DNA for non-native miRNA

PubMed Central

O'Donnell, J. Michael; Kalichira, Asha; Bi, Jian; Lewandowski, E. Douglas

2013-01-01

This study examines the feasibility of using the adenoviral delivery of DNA for a non-native microRNA to suppress expression of a target protein (cytosolic NADP+-dependent malic-enzyme 1, ME1) in whole heart in vivo, via an isolated-heart coronary perfusion approach. Complementary DNA constructs for ME1 microRNA were inserted into adenoviral vectors. Viral gene transfer to neonatal rat cardiomyocytes yielded 65% suppression of ME1 protein. This viral package was delivered to rat hearts in vivo (Adv.miR_ME1, 1013 vp/ml PBS) via coronary perfusion, using a cardiac-specific isolation technique. ME1 mRNA was reduced by 73% at 2-6 days post-surgery in heart receiving the Adv.miR_ME1. Importantly, ME1 protein was reduced by 66% (p<0.0002) at 5-6 days relative to sham-operated control hearts. Non-target protein expression for GAPDH, calsequestrin, and mitochondrial malic enzyme, ME3, were all unchanged. The non-target isoform, ME2, was unchanged at 2-5 days and reduced at day 6. This new approach demonstrates for the first time significant and acute silencing of target RNA translation and protein content in whole heart, in vivo, via non-native microRNA expression. PMID:22974418

Inhibition of apoptosis by knockdown of caspase-3 with siRNA in rat bone marrow mesenchymal stem cells.

PubMed

Hua, Ping; Liu, Li-Bao; Liu, Jia-Liang; Wang, Meng; Jiang, Hui-Qi; Zeng, Kuan; Yang, Yan-Qi; Yang, Song-Ran

2013-09-01

Transplantation of bone marrow mesenchymal stem cells is a promising new strategy for the repair of infarcted cardiac tissue. However, the majority of transplanted bone marrow mesenchymal stem cells (BMSCs) die soon after transplantation, due in part to oxidative stress in the ischemic region. Oxidative stress is known to induce apoptosis through the activation of caspase-3. The aim of this study is to determine whether small interfering RNA targeting caspase-3 can inhibit the apoptosis of rat BMSCs in vitro. Caspase-3 siRNA expression vectors were prepared and transfected into rat BMSCs in the presence of liposomes. Western blot assay and real-time polymerase chain reaction (RT-PCR) were performed to detect caspase-3 expression. A retrovirus packaging system was employed to package 293FT cells producing caspase-3 siRNA virus, which were transfected into rat BMSCs. Those stably expressing caspase-3 siRNA were screened by Western blot assay and RT-PCR to determine caspase-3 expression levels. Stable transfection of caspase-3 siRNA significantly decreased caspase-3 protein (0.26 ± 0.001 vs. 0.42 ± 0.004, P < 0.05) and mRNA expression (0.19 ± 0.002 vs. 1, P < 0.05) in BMSCs compared to non-transfected BMSCs. Cells were incubated in H2O2 to induce apoptosis, which was detected by TUNEL staining, and BMSC morphology was not altered by either transient or stable transfection of caspase-3 siRNA. H2O2-induced apoptosis of BMSCs stably transfected with caspase-3 siRNA was dramatically reduced compared to that of normal BMSCs (11.0 ± 3.2 vs. 25.8 ± 4.2, P < 0.05). Caspase-3 knockdown BMSCs are thus more resistant to apoptosis than normal BMSCs, potentially increasing their survival rates under conditions that cause oxidative stress.

miR-26b enhances radiosensitivity of hepatocellular carcinoma cells by targeting EphA2.

PubMed

Jin, Qiao; Li, Xiang Jun; Cao, Pei Guo

2016-08-01

Although low-dose radiotherapy (RT) that involves low collateral damage is more suitable for hepatocellular carcinoma (HCC) than traditional high-dose RT, but to achieve satisfactory therapeutic effect with low-dose RT, it is necessary to sensitize HCC cells to irradiation. This study was aimed to determine whether radiosensitivity of HCC cells can be enhanced using miR-26b by targeting erythropoietin producing human hepatocelluar A2 (EphA2). The levels of miR-26b and EphA2 expression in multiple HCC cell lines were assessed by qPCR and western blotting, respectively, and compared with those in a hepatic cell line. HCC 97H cells were transfected with miR-26b mimics, EphA2-ShRNA or EphA2 over-expression vector before exposure to low-dose irradiation. Different degrees of miR-26b down-regulation and EphA2 up-regulation were observed in all HCC cell lines, among which the HCC 97H cell line expressed the lowest level of miR-26b and highest level of EphA2. EphA2 was verified as the target of miR-26b by dual luciferase reporter assay. HCC 97H cells transfected with miR-26b mimics or EphA2-ShRNA reduced the expression of EphA2 protein, with significantly lower cell proliferation rate and cell invasion ability and higher apoptosis rate in response to low-dose irradiation than those in the non-transfected cells. These results were reversed after EphA2 was overexpressed by transfection with the EphA2 overexpression vector. Co-transfection with miR-26b mimics and EphA2 overexpression vector barely altered EphA2 expression level and cell response to low-dose irradiation. These data suggest that miR-26b enhances radiosensitivity of HCC 97H cells by targeting EphA2 protein.

Analysis of expressed sequence tags for Frankliniella occidentalis, the western flower thrips.

PubMed

Rotenberg, D; Whitfield, A E

2010-08-01

Thrips are members of the insect order Thysanoptera and Frankliniella occidentalis (the western flower thrips) is the most economically important pest within this order. F. occidentalis is both a direct pest of crops and an efficient vector of plant viruses, including Tomato spotted wilt virus (TSWV). Despite the world-wide importance of thrips in agriculture, there is little knowledge of the F. occidentalis genome or gene functions at this time. A normalized cDNA library was constructed from first instar thrips and 13 839 expressed sequence tags (ESTs) were obtained. Our EST data assembled into 894 contigs and 11 806 singletons (12 700 nonredundant sequences). We found that 31% of these sequences had significant similarity (E< or = 10(-10)) to protein sequences in the National Center for Biotechnology Information nonredundant (nr) protein database, and 25% were functionally annotated using Blast 2GO. We identified 74 sequences with putative homology to proteins associated with insect innate immunity. Sixteen sequences had significant similarity to proteins associated with small RNA-mediated gene silencing pathways (RNA interference; RNAi), including the antiviral pathway (short interfering RNA-mediated pathway). Our EST collection provides new sequence resources for characterizing gene functions in F. occidentalis and other thrips species with regards to vital biological processes, studying the mechanism of interactions with the viruses harboured and transmitted by the vector, and identifying new insect gene-centred targets for plant disease and insect control.

Influence of 5'-flanking sequence on 4.5SI RNA gene transcription by RNA polymerase III.

PubMed

Gogolevskaya, Irina K; Stasenko, Danil V; Tatosyan, Karina A; Kramerov, Dmitri A

2018-05-01

Short nuclear 4.5SI RNA can be found in three related rodent families. Its function remains unknown. The genes of 4.5SI RNA contain an internal promoter of RNA polymerase III composed of the boxes A and B. Here, the effect of the sequence immediately upstream of the mouse 4.5SI RNA gene on its transcription was studied. The gene with deletions and substitutions in the 5'-flanking sequence was used to transfect HeLa cells and its transcriptional activity was evaluated from the cellular level of 4.5SI RNA. Single-nucleotide substitutions in the region adjacent to the transcription start site (positions -2 to -8) decreased the expression activity of the gene down to 40%-60% of the control. The substitution of the conserved pentanucleotide AGAAT (positions -14 to -18) could either decrease (43%-56%) or increase (134%) the gene expression. A TATA-like box (TACATGA) was found at positions -24 to -30 of the 4.5SI RNA gene. Its replacement with a polylinker fragment of the vector did not decrease the transcription level, while its replacement with a GC-rich sequence almost completely (down to 2%-5%) suppressed the transcription of the 4.5SI RNA gene. The effect of plasmid sequences bordering the gene on its transcription by RNA polymerase III is discussed.

Targeted Elimination of PCDH-PC Expressing Prostate Cancer Cells for Control of Hormone-Resistant Prostate Cancer

DTIC Science & Technology

2008-11-01

or antisense oligonucleotides ( ASOs ) might be useful in preventing the development of castration- recurrent prostate cancer in prostate cancer...patients. To this end, we have created functional shRNA vectors and ASOs capable of suppressing PCDH-PC expression and we have also created a monoclonal...electrophoresed on an SDS-PAGE gel and blotted onto a filter. The filter was probed with an anti-myc antibody. The levels of myc-tagged PCDH-PC protein

Differentially Expressed Genes Associated with Low-Dose Gamma Radiation

NASA Astrophysics Data System (ADS)

Hegyesi, Hargita; Sándor, Nikolett; Schilling, Boglárka; Kis, Enikő; Lumniczky, Katalin; Sáfrány, Géza

We have studied low dose radiation induced gene expression alterations in a primary human fibroblast cell line using Agilent's whole human genome microarray. Cells were irradiated with 60Co γ-rays (0; 0.1; 0.5 Gy) and 2 hours later total cellular RNA was isolated. We observed differential regulation of approximately 300-500 genes represented on the microarray. Of these, 126 were differentially expressed at both doses, among them significant elevation of GDF-15 and KITLG was confirmed by qRT-PCR. Based on the transcriptional studies we selected GDF-15 to assess its role in radiation response, since GDF-15 is one of the p53 gene targets and is believed to participate in mediating p53 activities. First we confirmed gamma-radiation induced dose-dependent changes in GDF-15 expression by qRT-PCR. Next we determined the effect of GDF-15 silencing on radiosensitivity. Four GDF-15 targeting shRNA expressing lentiviral vectors were transfected into immortalized human fibroblast cells. We obtained efficient GDF-15 silencing in one of the four constructs. RNA interference inhibited GDF-15 gene expression and enhanced the radiosensitivity of the cells. Our studies proved that GDF-15 plays an essential role in radiation response and may serve as a promising target in radiation therapy.

Characterization of constitutive and putative differentially expressed mRNAs by means of expressed sequence tags, differential display reverse transcriptase-PCR and randomly amplified polymorphic DNA-PCR from the sand fly vector Lutzomyia longipalpis.

PubMed

Ramalho-Ortigão, J M; Temporal, P; de Oliveira , S M; Barbosa, A F; Vilela, M L; Rangel, E F; Brazil, R P; Traub-Cseko, Y M

2001-01-01

Molecular studies of insect disease vectors are of paramount importance for understanding parasite-vector relationship. Advances in this area have led to important findings regarding changes in vectors' physiology upon blood feeding and parasite infection. Mechanisms for interfering with the vectorial capacity of insects responsible for the transmission of diseases such as malaria, Chagas disease and dengue fever are being devised with the ultimate goal of developing transgenic insects. A primary necessity for this goal is information on gene expression and control in the target insect. Our group is investigating molecular aspects of the interaction between Leishmania parasites and Lutzomyia sand flies. As an initial step in our studies we have used random sequencing of cDNA clones from two expression libraries made from head/thorax and abdomen of sugar fed L. longipalpis for the identification of expressed sequence tags (EST). We applied differential display reverse transcriptase-PCR and randomly amplified polymorphic DNA-PCR to characterize differentially expressed mRNA from sugar and blood fed insects, and, in one case, from a L. (V.) braziliensis-infected L. longipalpis. We identified 37 cDNAs that have shown homology to known sequences from GeneBank. Of these, 32 cDNAs code for constitutive proteins such as zinc finger protein, glutamine synthetase, G binding protein, ubiquitin conjugating enzyme. Three are putative differentially expressed cDNAs from blood fed and Leishmania-infected midgut, a chitinase, a V-ATPase and a MAP kinase. Finally, two sequences are homologous to Drosophila melanogaster gene products recently discovered through the Drosophila genome initiative.

[Expression of SLP-2 mRNA in endometrial cancer and its significance].

PubMed

Feng, Wang-qin; Cui, Zhu-mei; Feng, Feng-zhi; Qi, Xiu-juan; Ding, Fang; Li, Wen-dong; Liu, Zhi-hua

2005-08-01

To characterize the differential expression of SLP-2 in endometrial cancer, and to study the effect of human SLP-2 gene on human endometrial cancer cell line. The expression of SLP-2 gene in 32 cases of endometrial cancer and 28 cases of normal endometrial tissues was examined by semi-quantitative RT-PCR. Eukaryotic expression vectors of sense and antisense SLP-2 were constructed and transfected into HEC-1B cell line using lipofectamine 2000 respectively. The morphological changes of the cell were observed by phase contrast microscopy. The cell growth was detected by methyl thiazolyl tetrazolium (MTT) assay, and the cell cycles were analyzed by flow cytometry. The expression of SLP-2 mRNA in endometrial cancer tissues was higher than that in normal endometrial tissues (1.6 +/- 0.7 vs 0.7 +/- 0.3, P < 0.05). Sense and antisense human SLP-2 constructs were transfected into HEC-1B cell line respectively. After being transfected with sense SLP-2, the expression of SLP-2 mRNA in HEC-1B cell line was increased by about 2.4 times that of the control group, the cell growth was accelerated, and the number of cells in G(1) phase was decreased by 12.5%, S phase was increased by 8.0%. After being transfected with antisense SLP-2, the expression of SLP-2 mRNA was declined 50%. The transfected cells showed slower growth, and the number of cells in G(1) phase was significantly increased by 10.5%, and S phase was declined by 9.8%. SLP-2 mRNA shows up-regulation in endometrial cancer tissues, and it may have some relationship with carcinogenesis of endometrial cancer.

Inhibition of West Nile Virus replication by retrovirus-delivered small interfering RNA in human neuroblastoma cells.

PubMed

Yang, Yongbo; Wu, Chengxiang; Wu, Jianguo; Nerurkar, Vivek R; Yanagihara, Richard; Lu, Yuanan

2008-05-01

West Nile virus (WNV) has been responsible for the largest outbreaks of arboviral encephalitis in U.S. history. No specific drug is currently available for the effective treatment of WNV infection. To exploit RNA interference as a potential therapeutic approach, a Moloney murine leukemia virus-based retrovirus vector was used to effectively deliver WNV-specific small interfering RNA (siRNA) into human neuroblastoma HTB-11 cells. Viral plaque assays demonstrated that transduced cells were significantly refractory to WNV replication, as compared to untransduced control cells (P < 0.05), which correlated with the reduced expression of target viral genes and respective viral proteins. Therefore, retrovirus-mediated delivery of siRNA for gene silencing can be used to study the specific functions of viral genes associated with replication and may have potential therapeutic applications.

RNA interference targeting the ACE gene reduced blood pressure and improved myocardial remodelling in SHRs.

PubMed

He, Junhua; Bian, Yunfei; Gao, Fen; Li, Maolian; Qiu, Ling; Wu, Weidong; Zhou, Hua; Liu, Gaizhen; Xiao, Chuanshi

2009-02-01

The purpose of the present study was to investigate the effects on blood pressure and myocardial hypertrophy in SHRs (spontaneously hypertensive rats) of RNAi (RNA interference) targeting ACE (angiotensin-converting enzyme). SHRs were treated with normal saline as vehicle controls, with Ad5-EGFP as vector controls, and with recombinant adenoviral vectors Ad5-EGFP-ACE-shRNA, carrying shRNA (small hairpin RNA) for ACE as ACE-RNAi. WKY (Wistar-Kyoto) rats were used as normotensive controls treated with normal saline. The systolic blood pressure of the caudal artery was recorded. Serum levels of ACE and AngII (angiotensin II) were determined using ELISA. ACE mRNA and protein levels were determined in aorta, myocardium, kidney and lung. On day 32 of the experiment, the heart was pathologically examined. The ratios of heart weight/body weight and left ventricular weight/body weight were calculated. The serum concentration of ACE was lower in ACE-RNAi rats (16.37+/-3.90 ng/ml) compared with vehicle controls and vector controls (48.26+/-1.50 ng/ml and 46.67+/-2.82 ng/ml respectively; both P<0.05), but comparable between ACE-RNAi rats and WKY rats (14.88+/-3.15 ng/ml; P>0.05). The serum concentration of AngII was also significantly lower in ACE-RNAi rats (18.24+/-3.69 pg/ml) compared with vehicle controls and vector controls (46.21+/-5.06 pg/ml and 44.93+/-4.12 pg/ml respectively; both P<0.05), but comparable between ACE-RNAi rats and WKY rats (16.06+/-3.11 pg/ml; P>0.05). The expression of ACE mRNA and ACE protein were significantly reduced in the myocardium, aorta, kidney and lung in ACE-RNAi rats compared with that in vehicle controls and in vector controls (all P<0.05). ACE-RNAi treatment resulted in a reduction in systolic blood pressure by 22+/-3 mmHg and the ACE-RNAi-induced reduction lasted for more than 14 days. In contrast, blood pressure was continuously increased in the vehicle controls as well as in the vector controls. The ratios of heart weight/body weight and left ventricular weight/body weight were significantly lower in ACE-RNAi rats (3.12+/-0.23 mg/g and 2.24+/-0.19 mg/g) compared with the vehicle controls (4.29+/-0.24 mg/g and 3.21+/-0.13 mg/g; P<0.05) and the vector controls (4.43+/-0.19 mg/g and 3.13+/-0.12 mg/g; P<0.05). The conclusion of the present study is that ACE-silencing had significant antihypertensive effects and reversed hypertensive-induced cardiac hypertrophy in SHRs, and therefore RNAi might be a new strategy in controlling hypertension.

The effect of myostatin silencing by lentiviral-mediated RNA interference on goat fetal fibroblasts.

PubMed

Lu, Jian; Wei, Caihong; Zhang, Xiaoning; Xu, Lingyang; Zhang, Shifang; Liu, Jiasen; Cao, Jiaxue; Zhao, Fuping; Zhang, Li; Li, Bichun; Du, Lixin

2013-06-01

Myostatin is a transforming growth factor-β family member that acts as a negative regulator of skeletal muscle mass. To identify possible myostatin inhibitors that may promote muscle growth, we used RNA interference mediated by a lentiviral vector to knockdown myostatin in goat fetal fibroblast cells. We also investigated the expression changes in relevant myogenic regulatory factors (MRFs) and adipogenic regulatory factors in the absence of myostatin in goat fetal fibroblasts. Quantitative RT-PCR revealed that myostatin transcripts were significantly reduced by 75 % (P < 0.01). Western blot showed that myostatin protein expression was reduced by 95 % (P < 0.01). We also found that the mRNA expression of activin receptor IIB (ACVR2B) significantly increased by 350 % (P < 0.01), and p21 increased 172 % (P < 0.01). Furthermore, myostatin inhibition decreased Myf5 and increased MEF2C mRNA expression in goat fetal fibroblasts, suggesting that myostatin regulates MRFs differently in fibroblasts compared to muscle. In addition, the expression of adipocyte marker genes peroxisome proliferator-activated receptor (PPAR) γ and leptin, but not CCAAT/enhance-binding protein (C/EBP) α and C/EBPβ, were upregulated at the transcript level after myostatin silencing. These results suggest that we have generated a novel way to block myostatin in vitro, which could be used to improve livestock meat production and gene therapy of musculoskeletal diseases. This also suggests that myostatin plays a negative role in regulating the expression of adipogenesis related genes in goat fetal fibroblasts.

In vivo reduction or blockade of interleukin-1β in primary osteoarthritis influences expression of mediators implicated in pathogenesis

PubMed Central

Santangelo, K. S.; Nuovo, G. J.; Bertone, A. L.

2012-01-01

Summary Objective Diminish interleukin-1β (IL-1β) signaling in a model of primary osteoarthritis by RNA interference-based transcript reduction or receptor blockade, and quantify changes incurred on transcript expression of additional mediators. Methods Knees of Hartley guinea pigs were collected at 120 and 180 days of age following injection with viral vectors (N=4/treatment group/date) at 60 days. Two groups received either adeno-associated viral serotype 5 vector containing a knockdown sequence (TV), or adenoviral vector encoding for IL-1 receptor antagonist protein (Ad-IRAP); treatments were contrasted with opposite knees administered corresponding vector controls. A third group evaluated TV relative to saline-only injected knees. Chondropathy and immunohistochemistry findings were compared to untreated guinea pigs. Transcript expression levels in cartilage were calculated using the comparative CT (2−ΔΔCT) method and analyzed by one-way ANOVA with pairwise comparisons using Tukey 95% confidence intervals. Results Vector transduction was confirmed at both harvest dates. TV and Ad-IRAP, relative to vector controls, significantly decreased IL-1β. Inflammatory mediators [tumor necrosis factor-α (TNF-α), interleukin-8 (IL-8), interferon-γ (IFN-γ)], and catabolic matrix metalloproteinase 13 (MMP13) were also decreased, while anabolic transforming growth factor-β1 (TGF-β1) was increased. IL-1β was also decreased by TV versus saline, with a decrease in MMP13 and increase TGF-β1; TNF-α, IL-8, and IFN-γ were transiently increased. Conclusions This work confirmed that a reduction in IL-1β signaling was accomplished by either method, resulting in decreased expression of three inflammatory mediators and one catabolic agent, and increased expression of an anabolic molecule. Thus, evidence is provided that IL-1β serves a role in vivo in spontaneous osteoarthritis and that these translational tools may provide beneficial disease modification. PMID:22935786

A self-initiating eukaryotic transient gene expression system based on contransfection of bacteriophage T7 RNA polymerase and DNA vectors containing a T7 autogene.

PubMed Central

Chen, X; Li, Y; Xiong, K; Wagner, T E

1994-01-01

A novel cytoplasmic gene expression system has been developed. This system differs from other expression systems in that it relies on the co-delivery of plasmid DNA and T7 RNA polymerase (RNAP) during transfection. The plasmid contains a T7 RNAP gene driven by the T7 promoter (T7 autogene) and a functional/reporter gene driven by another T7 promoter (T7T7/T7-gene construct). Once this DNA-enzyme complex is introduced into eukaryotic cells, the transcription of the T7 RNAP and the functional/reporter genes is initiated by the co-delivered T7 RNAP. The T7 RNAP, which is responsible for the initiation and maintenance of expression of both T7 and functional/reporter genes, is replenished by translation of newly synthesized T7 mRNA. This T7 system was designed in such a manner that the expression of the functional/reporter genes can occur in the cytoplasm and does not require any nuclear involvement. When transfected by either a pT7T7/T7Luc or a pT7T7/T7hGH plasmids with the cointroduced T7 RNAP, mouse L cells were found to express high levels of luciferase immediately after transfection, apparently due to the cytoplasmic gene expression; the expression of human growth hormone (hGH) could be sustained for at least 6 days. Both T7 and hGH mRNA were expressed by the cells transfected with pT7T7/T7hGH. These results suggest that this cytoplasmic expression system may be used for certain targets of somatic gene therapy. Images PMID:8029020

Overexpression of cystatin C in synovium does not reduce synovitis or cartilage degradation in established osteoarthritis.

PubMed

Kyostio-Moore, Sirkka; Piraino, Susan; Berthelette, Patricia; Moran, Nance; Serriello, Joseph; Bendele, Alison; Sookdeo, Cathleen; Nambiar, Bindu; Ewing, Patty; Armentano, Donna; Matthews, Gloria L

2015-01-16

Cathepsin K (catK) expression is increased in cartilage, bone and synovium during osteoarthritis (OA). To study the role of catK expression and elevated cathepsin activity in the synovium on cartilage destruction in established OA, we overexpressed cystatin C (cysC), a natural cysteine protease inhibitor, in the synovium of rabbit OA joints. The ability of cysC to inhibit activity of cathepsins in rabbit OA synovium lysates was tested in vitro using protease activity assay. In vivo, the tissue localization of recombinant adeno-associated virus (rAAV) with LacZ gene after intra-articular injection was determined by β-galactosidase staining of rabbit joints 4 weeks later. To inhibit cathepsin activity in the synovium, a rAAV2-encoding cysC was delivered intra-articularly into rabbit joints 4 weeks after OA was induced by anterior cruciate ligament transection (ACLT). Seven weeks postinjection, endogenous catK and cysC levels as well as the vector-derived cysC expression in the synovium of normal and OA joints were examined by RNA quantification. Synovial cathepsin activity and catK, catB and catL protein levels were determined by activity and Western blot analyses, respectively. Synovitis and cartilage degradation were evaluated by histopathological scoring. In vitro, the ability of cysC to efficiently inhibit activity of purified catK and OA-induced cathepsins in rabbit synovial lysates was demonstrated. In vivo, the intra-articular delivery of rAAV2/LacZ showed transduction of mostly synovium. Induction of OA in rabbit joints resulted in fourfold increase in catK mRNA compared to sham controls while no change was detected in endogenous cysC mRNA levels in the synovium. Protein levels for catK, catB and catL were also increased in the synovium with a concomitant fourfold increase in cathepsin activity. Joints treated with rAAV2/cysC showed both detection of vector genomes and vector-derived cysC transcripts in the synovium. Production of functional cysC by the vector was demonstrated by complete block of cathepsin activity in the synovium. However, this did not decrease synovitis, bone sclerosis or progression of cartilage degradation. Increased production of natural cathepsin inhibitor, cysC, in OA synovium does not alleviate synovitis or cartilage pathology during a preexisting OA.

Highly efficient in vitro and in vivo delivery of functional RNAs using new versatile MS2-chimeric retrovirus-like particles

PubMed Central

Prel, Anne; Caval, Vincent; Gayon, Régis; Ravassard, Philippe; Duthoit, Christine; Payen, Emmanuel; Maouche-Chretien, Leila; Creneguy, Alison; Nguyen, Tuan Huy; Martin, Nicolas; Piver, Eric; Sevrain, Raphaël; Lamouroux, Lucille; Leboulch, Philippe; Deschaseaux, Frédéric; Bouillé, Pascale; Sensébé, Luc; Pagès, Jean-Christophe

2015-01-01

RNA delivery is an attractive strategy to achieve transient gene expression in research projects and in cell- or gene-based therapies. Despite significant efforts investigating vector-directed RNA transfer, there is still a requirement for better efficiency of delivery to primary cells and in vivo. Retroviral platforms drive RNA delivery, yet retrovirus RNA-packaging constraints limit gene transfer to two genome-molecules per viral particle. To improve retroviral transfer, we designed a dimerization-independent MS2-driven RNA packaging system using MS2-Coat-retrovirus chimeras. The engineered chimeric particles promoted effective packaging of several types of RNAs and enabled efficient transfer of biologically active RNAs in various cell types, including human CD34+ and iPS cells. Systemic injection of high-titer particles led to gene expression in mouse liver and transferring Cre-recombinase mRNA in muscle permitted widespread editing at the ROSA26 locus. We could further show that the VLPs were able to activate an osteoblast differentiation pathway by delivering RUNX2- or DLX5-mRNA into primary human bone-marrow mesenchymal-stem cells. Thus, the novel chimeric MS2-lentiviral particles are a versatile tool for a wide range of applications including cellular-programming or genome-editing. PMID:26528487

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abraitiene, Asta; US Department of Agriculture, Agricultural Research Service, Molecular Plant Pathology Laboratory, Room 214 Building 004 BARC-West, 10300 Baltimore Avenue, Beltsville, MD 20705; Zhao Yan

Transient expression of engineered reporter RNAs encoding an intron-containing green fluorescent protein (GFP) from a Potato virus X-based expression vector previously demonstrated the nuclear targeting capability of the 359 nucleotide Potato spindle tuber viroid (PSTVd) RNA genome. To further delimit the putative nuclear-targeting signal, PSTVd subgenomic fragments were embedded within the intron, and recombinant reporter RNAs were inoculated onto Nicotiana benthamiana plants. Appearance of green fluorescence in leaf tissue inoculated with PSTVd-fragment-containing constructs indicated shuttling of the RNA into the nucleus by fragments as short as 80 nucleotides in length. Plant-to-plant variation in the timing of intron removal and subsequentmore » GFP fluorescence was observed; however, earliest and most abundant GFP expression was obtained with constructs containing the conserved hairpin I palindrome structure and embedded upper central conserved region. Our results suggest that this conserved sequence and/or the stem-loop structure it forms is sufficient for import of PSTVd into the nucleus.« less

Selective gene silencing by viral delivery of short hairpin RNA

PubMed Central

2010-01-01

RNA interference (RNAi) technology has not only become a powerful tool for functional genomics, but also allows rapid drug target discovery and in vitro validation of these targets in cell culture. Furthermore, RNAi represents a promising novel therapeutic option for treating human diseases, in particular cancer. Selective gene silencing by RNAi can be achieved essentially by two nucleic acid based methods: i) cytoplasmic delivery of short double-stranded (ds) interfering RNA oligonucleotides (siRNA), where the gene silencing effect is only transient in nature, and possibly not suitable for all applications; or ii) nuclear delivery of gene expression cassettes that express short hairpin RNA (shRNA), which are processed like endogenous interfering RNA and lead to stable gene down-regulation. Both processes involve the use of nucleic acid based drugs, which are highly charged and do not cross cell membranes by free diffusion. Therefore, in vivo delivery of RNAi therapeutics must use technology that enables the RNAi therapeutic to traverse biological membrane barriers in vivo. Viruses and the vectors derived from them carry out precisely this task and have become a major delivery system for shRNA. Here, we summarize and compare different currently used viral delivery systems, give examples of in vivo applications, and indicate trends for new developments, such as replicating viruses for shRNA delivery to cancer cells. PMID:20858246

Anaerobically controlled expression system derived from the arcDABC operon of Pseudomonas aeruginosa: application to lipase production.

PubMed Central

Winteler, H V; Schneidinger, B; Jaeger, K E; Haas, D

1996-01-01

The anaerobically inducible arcDABC operon encodes the enzymes of the arginine deiminase pathway in Pseudomonas aeruginosa. Upon induction, the arcAB mRNAs and proteins reach high intracellular levels, because of a strong anaerobically controlled promoter and mRNA processing in arcD, leading to stable downstream transcripts. We explored the usefulness of this system for the construction of expression vectors. The lacZ gene of Escherichia coli was expressed to the highest levels when fused close to the arc promoter. Insertion of lacZ further downstream into arcA or arcB did not stabilize the intrinsically unstable lacZ mRNA. On the contrary, lacZ mRNA appeared to be a vulnerable endonuclease target destabilizing arcAB mRNAs in the 5'-to-3' direction in P. aeruginosa. The native arc promoter was modified for optional expression in the -10 sequence and in the -40 region, which is a binding site for the anaerobic regulator ANR. In P. aeruginosa grown either anaerobically or with oxygen limitation in unshaken cultures, this promoter was stronger than the induced tac promoter. The P. aeruginosa lipAH genes, which encode extracellular lipase and lipase foldase, respectively, were fused directly to the modified arc promoter in an IncQ vector plasmid. Semianaerobic static cultures of P. aeruginosa PAO1 carrying this recombinant plasmid overproduced extracellular lipase 30-fold during stationary phase compared with the production by strain PAO1 without the plasmid. Severe oxygen limitation, in contrast, resulted in poor lipase productivity despite effective induction of the ANR-dependent promoter, suggesting that secretion of active lipase is blocked by the absence of oxygen. In conclusion, the modified arc promoter is useful for driving the expression of cloned genes in P. aeruginosa during oxygen-limited growth and stationary phase. PMID:8795231

Interactions between insulin-like growth factor-I, estrogen receptor-α (ERα) and ERβ in regulating growth/apoptosis of MCF-7 human breast cancer cells

PubMed Central

Mendoza, Rhone A.; Enriquez, Marlene I; Mejia, Sylvia M; Moody, Emily E; Thordarson, Gudmundur

2011-01-01

Understanding of the interactions between estradiol (E2) and insulin-like growth factor-I (IGF-I) is still incomplete. Cell lines derived from the MCF-7 breast cancer cells were generated with suppressed expression of the IGF-I receptor (IGF-IR), termed IGF-IR.low cells, by stable transfection using small interfering RNA (siRNA) expression vector. Vector for control cells carried sequence generating non-interfering RNA. Concomitant with reduction in the IGF-IR levels, the IGF-IR.low cells also showed a reduction in estrogen receptor α (ERα) and progesterone receptor expressions and an elevation in the expression of ERβ. The number of the IGF-IR.low cells was reduced in response to IGF-I and human growth hormone plus epidermal growth factor, but E2 did not cause increase in the number of the IGF-IR.low cells compared to controls. Proliferation rate of IGF-IR.low cells was only reduced in response to E2 compared to controls, whereas their basal and hormone stimulated apoptosis rate was increased. Phosphorylation of p38 mitogen activated protein kinase (p38 MAPK) was increased in the IGF-IR.low cells after treatment with E2, without affecting control cells. Further, phosphorylation of the tumor suppressor protein p53 was elevated in the IGF-IR.low cells compared to the controls. Summary, suppressing the IGF-IR expression decreased the level of ERα but increased the level of ERβ. Overall growth rate of the IGF-IR.low cells was reduced mostly through an increase in apoptosis without affecting proliferation substantially. We hypothesize that a decreased ERα:ERβ ratio triggered a rapid phosphorylation of p38 MAPK which in turn phosphorylated the p53 tumor suppressor and accelerated apoptosis rate. PMID:20974640

Gene transfer to brain using herpes simplex virus vectors.

PubMed

Glorioso, J C; Goins, W F; Meaney, C A; Fink, D J; DeLuca, N A

1994-01-01

Herpes simplex virus type 1 represents an ideal candidate for development as a vehicle for gene transfer to postmitotic neurons of the central nervous system. The natural biology of this virus makes it well suited for this purpose as it is capable of infecting a variety of neuronal cell types in the brain where the viral genome can persist indefinitely in a latent state. In latency, the viral lytic genes are transcriptionally silent and a unique set of latency-associated transcripts are expressed. Two impediments to using herpes simplex virus vectors must be overcome: (1) A noncytotoxic mutant virus backbone must be engineered, and (2) a suitable promoter-regulator that stably expresses foreign genes from the vector genome during latency must be constructed. Deletion of specific immediate early genes from the vector can render the virus nontoxic to neurons in culture and in vivo following stereotactic inoculation into specific regions of the brain. Because these viruses cannot replicate, they enter latency on infection of central nervous system neurons. A number of viral and cellular promoters have been tested for their ability to express genes during latency. Strong viral promoters and neurospecific promoters display transient activity. Although the promoter regions for the latency-associated transcripts are highly active in the peripheral nervous system, they show low-level but persistent activity in the brain. Experiments are in progress to exploit RNA polymerase III gene promoters or novel recombinant promoters capable of auto-inducing their own expression in order to increase gene expression during latency in brain neurons.

[Molecular cloning and expression of the severe acute respiratory syndrome-associated coronavirus nucleocapsid protein and its clinical application].

PubMed

Lu, Jian; Zhou, Bai-ping; Zhou, Yu-sen; Jiang, Xiao-ling; Wen, Li-xia; Le, Xiao-hua; Li, Bing; Xu, Liu-mei; Li, Li-xiong

2005-03-01

To clone and express nucleocapsid (N) protein of the severe acute respiratory syndrome (SARS)-associated coronavirus, and to evaluate its antigenicity and application value in the development of serological diagnostic test for SARS. SARS-associated coronavirus N protein gene was amplified from its genomic RNA by reverse transcript nested polymerase chain reaction (RT-nested-PCR) and cloned into pBAD/Thio-TOPO prokaryotic expression vector. The recombinant N fusion protein was expressed and purified, and its antigenicity and specificity was analyzed by Western Blot, to establish the recombinant N protein-based ELISA for detection of IgG antibodies to SARS-associated coronavirus, and SARS-associated coronavirus lysates-based ELISA was compared parallelly. The recombinant expression vector produced high level of the N fusion protein after induction, and that protein was purified successfully by affinity chromatography and displayed higher antigenicity and specificity as compared with whole virus lysates. The recombinant SARS-associated coronavirus N protein possessed better antigenicity and specificity and could be employed to establish a new, sensitive, and specific ELISA for SARS diagnosis.

A DNA replicon system for rapid high-level production of virus-like particles in plants.

PubMed

Huang, Zhong; Chen, Qiang; Hjelm, Brooke; Arntzen, Charles; Mason, Hugh

2009-07-01

Recombinant virus-like particles (VLPs) represent a safe and effective vaccine strategy. We previously described a stable transgenic plant system for inexpensive production and oral delivery of VLP vaccines. However, the relatively low-level antigen accumulation and long-time frame to produce transgenic plants are the two major roadblocks in the practical development of plant-based VLP production. In this article, we describe the optimization of geminivirus-derived DNA replicon vectors for rapid, high-yield plant-based production of VLPs. Co-delivery of bean yellow dwarf virus (BeYDV)-derived vector and Rep/RepA-supplying vector by agroinfiltration of Nicotiana benthamiana leaves resulted in efficient replicon amplification and robust protein production within 5 days. Co-expression of the P19 protein of tomato bush stunt virus, a gene silencing inhibitor, further enhanced VLP accumulation by stabilizing the mRNA. With this system, hepatitis B core antigen (HBc) and Norwalk virus capsid protein (NVCP) were produced at 0.80 and 0.34 mg/g leaf fresh weight, respectively. Sedimentation analysis and electron microscopy of transiently expressed antigens verified the efficient assembly of VLPs. Furthermore, a single replicon vector containing a built-in Rep/RepA cassette without P19 drove protein expression at similar levels as the three-component system. These results demonstrate the advantages of fast and high-level production of VLP-based vaccines using the BeYDV-derived DNA replicon system for transient expression in plants. (c) 2009 Wiley Periodicals, Inc.

A DNA replicon system for rapid high-level production of virus-like particles in plants

PubMed Central

Huang, Zhong; Chen, Qiang; Hjelm, Brooke; Arntzen, Charles

2009-01-01

Recombinant virus-like particles (VLPs) represent a safe and effective vaccine strategy. We previously described a stable transgenic plant system for inexpensive production and oral delivery of VLP vaccines. However, the relatively low level antigen accumulation and long time frame to produce transgenic plants are the two major roadblocks in the practical development of plant-based VLP production. In this paper, we describe the optimization of geminivirus-derived DNA replicon vectors for rapid, high-yield plant-based production of VLPs. Co-delivery of bean yellow dwarf virus (BeYDV)-derived vector and Rep/RepA-supplying vector by agroinfiltration of Nicotiana benthamiana leaves resulted in efficient replicon amplification and robust protein production within five days. Co-expression of the P19 protein of tomato bush stunt virus, a gene silencing inhibitor, further enhanced VLP accumulation by stabilizing the mRNA. With this system, hepatitis B core antigen (HBc) and Norwalk virus capsid protein (NVCP) were produced at 0.80 and 0.34 mg/g leaf fresh weight, respectively. Sedimentation analysis and electron microscopy of transiently expressed antigens verified the efficient assembly of VLPs. Furthermore, a single replicon vector containing a built-in Rep/RepA cassette without p19 drove protein expression at similar levels as the three-component system. These results demonstrate the advantages of fast and high-level production of VLP-based vaccines using the BeYDV-derived DNA replicon system for transient expression in plants. PMID:19309755

Tissue-specific expression of silkmoth chorion genes in vivo using Bombyx mori nuclear polyhedrosis virus as a transducing vector.

PubMed Central

Iatrou, K; Meidinger, R G

1990-01-01

A pair of silkmoth chorion chromosomal genes, HcA.12-HcB.12, was inserted into a baculovirus transfer vector, pBmp2, derived from the nuclear polyhedrosis virus of Bombyx mori. This vector, which permits the insertion of foreign genetic material in the vicinity of a mutationally inactivated polyhedrin gene, was used to acquire the corresponding recombinant virus. Injection of mutant silkmoth pupae that lack all Hc chorion genes with the recombinant virus resulted in the infection of all internal organs including follicular tissue. Analysis of RNA from infected tissues has demonstrated that the two chorion genes present in the viral genome are correctly transcribed under the control of their own promoter in follicular cells, the tissue in which chorion genes are normally expressed. The chorion primary transcripts are also correctly processed in the infected follicular cells and yield mature mRNAs indistinguishable from authentic chorion mRNAs present in wild-type follicles. These results demonstrate that recombinant nuclear polyhedrosis viruses can be used as transducing vectors for introducing genetic material of host origin into the cells of the organism and that the transduced genes are transiently expressed in a tissue-specific manner under the control of their resident regulatory sequences. Thus we show the in vivo expression of cloned genes under cellular promoter control in an insect other than Drosophila melanogaster. The approach should be applicable to all insect systems that are subject to nuclear polyhedrosis virus infection. Images PMID:2187186

A plasmid-based reverse genetics system for influenza A virus.

PubMed Central

Pleschka, S; Jaskunas, R; Engelhardt, O G; Zürcher, T; Palese, P; García-Sastre, A

1996-01-01

A reverse genetics system for negative-strand RNA viruses was first successfully developed for influenza viruses. This technology involved the transfection of in vitro-reconstituted ribonucleoprotein (RNP) complexes into influenza virus-infected cells. We have now developed a method that allows intracellular reconstitution of RNP complexes from plasmid-based expression vectors. Expression of a viral RNA-like transcript is achieved from a plasmid containing a truncated human polymerase I (polI) promoter and a ribozyme sequence that generates the desired 3' end by autocatalytic cleavage. The polI-driven plasmid is cotransfected into human 293 cells with polII-responsive plasmids that express the viral PB1, PB2, PA, and NP proteins. This exclusively plasmid-driven system results in the efficient transcription and replication of the viral RNA-like reporter and allows the study of cis- and trans-acting signals involved in the transcription and replication of influenza virus RNAs. Using this system, we have also been able to rescue a synthetic neuraminidase gene into a recombinant influenza virus. This method represents a convenient alternative to the previously established RNP transfection system. PMID:8648766

MicroRNA-132 targets HB-EGF upon IgE-mediated activation in murine and human mast cells.

PubMed

Molnár, Viktor; Érsek, Barbara; Wiener, Zoltán; Tömböl, Zsófia; Szabó, Péter M; Igaz, Péter; Falus, András

2012-03-01

MicroRNAs provide an additional layer in the regulation of gene expression acting as repressors with several targets at the posttranscriptional level. This study describes microRNA expression patterns during differentiation and activation of mast cells. The expression levels of 567 different mouse miRNAs were compared by microarray between c-Kit+ committed progenitors, mucosal mast cells, resting and IgE-crosslinked BMMCs in vitro. The strongest upregulation of miR-132 upon IgE-mediated activation was validated in human cord blood-derived mast cells as well. HB-EGF growth factor also upregulated upon activation and was ranked high by more prediction algorithms. Co-transfection of miR-132 mimicking precursor and the 3'UTR of human Hbegf-containing luciferase vector proves that the predicted binding site is functional. In line with this, neutralization of miR-132 by anti-miR inhibitor leads to sustained production of HB-EGF protein in activated mast cells. Our data provide a novel example for negative regulation of a growth factor by an upregulated miRNA. © Springer Basel AG 2011

Immune responses in pigs induced by recombinant canine adenovirus 2 expressing the glycoprotein 5 of porcine reproductive and respiratory syndrome virus.

PubMed

Zhou, J-X; Xue, J-D; Yu, T; Zhang, J-B; Liu, Y; Jiang, N; Li, Y-L; Hu, R-L

2010-04-01

To develop a new type vaccine for porcine reproductive and respiratory syndrome (PRRS) prevention by using canine adenovirus 2(CAV-2) as vector, the Glycoprotein 5(GP5) gene from PRRSV strain JL was amplified by RT-PCR, and the expression cassette of GP5 was constructed using the human cytomegalovirus (HCMV) promoter and the simian virus 40 (SV40) early mRNA polyadenylation signal. The expression cassette of Glycoprotein 5 was cloned into the CAV-2 genome in which E3 region had been partly deleted, and the recombinant virus (CAV-2-GP5) was obtained by transfecting the recombinant CAV-2-GP5 genome into MDCK cells together with Lipofectamine 2000. Immunization trial in pigs with the recombinant virus CAV-2-GP5 showed that CAV-2-GP5 could stimulate a specific immune response to PRRSV. Immune response to the GP5 and PRRSV was confirmed by ELISA, neutralization test and lymphocyte proliferative responses, and western blotting confirmed expression of GP5 by the vector in cells. These results indicated that CAV-2 may serve as a vector for development of PRRSV vaccine in pigs, and the CAV-2-GP5 might be a candidate vaccine to be tested for preventing PRRSV infection.

Expression of bacteriocin LsbB is dependent on a transcription terminator.

PubMed

Uzelac, Gordana; Miljkovic, Marija; Lozo, Jelena; Radulovic, Zorica; Tosic, Natasa; Kojic, Milan

2015-10-01

The production of LsbB, leaderless class II bacteriocin, is encoded by genes (lsbB and lmrB) located on plasmid pMN5 in Lactococcus lactis BGMN1-5. Heterologous expression of the lsbB gene using the pAZIL vector (pAZIL-lsbB) in L. lactis subsp. cremoris MG7284 resulted in a significant reduction (more than 30 times) of bacteriocin LsbB expression. Subcloning and deletion experiments with plasmid pMN5 revealed that full expression of LsbB requires the presence of a complete transcription terminator located downstream of the lsbB gene. RNA stability analysis revealed that the presence of a transcription terminator increased the RNA stability by three times and the expression of LsbB by 30 times. The study of the influence of transcription terminator on the expression of other bacteriocin genes (lcnB, for lactococcin B production) indicated that this translational terminator likely functions in a lsbB-specific manner rather than in a general manner. Copyright © 2015 Elsevier GmbH. All rights reserved.

[Inhibiting target gene expression and controlling growth of Epstein-Barr virus transformed cells by antisense RNA transcripts].

PubMed

Chen, Jian-jing; Raab-Traub, Nancy; Yao, Qing-yun; Zhang, Feng; Huang, Mei-ling; Kuang, Zhu-ji; Zhang, Xiao-shi; Ye, Yan-li; Gu, Li

2002-01-01

The latent membrane protein gene (LMP) of Epstein-Barr virus (EBV) was thought to play an important role in the carcinogenesis of nasopharyngeal carcinoma (NPC). In this study, the authors investigated the effects of antisense RNA (AsRNA) on LMP for down regulating at the target gene over expression in EBV transformed lymphoid cells, and set up an antisense system to inhibit LMP expression. Constructing the single strand antisense transcription system in vitro, the authors have got large amount of AsRNA. Designing and setting up an antisense tracing system in situ (ATSIS), the authors could observe the living particles of AsRNA/sense RNA duplex dimer. With time lapse phase-contrast microscopy, the agglutination phenotype on living cells was easily detected by MTT test, the inhibition rate on EBV transformed cells was calculated. LMP 1.9 fragment ligated into pGEM vector in reverse orientation have been constructed and produced a plentiful amount of AsLMPmRNA which could incorporated into both B95-8 and C1936 cell lines by endophagocytosis and formed the duplex dimer of As/Sense RNA. This particles have been visualized in situ when labelling 35S isotope by ATSIS. When AsLMPmRNA acted as agents for specific inhibition to LMP over expression, the transform phenotype of cell agglutination have been suppressed and MTT particle formatin was apparently reduced both two EBV tansformed cell lines. AsLMPmRNA targets at sense strand have a high effectiveness of down-regulation on EBV-LMP overexpression. This down regulating function of LMP and growth inhibition on transformed cell is demonstrated by the antisenes tracing system in situ (ATSIS). The results provide a clue to overcome the latent EBV infection in human bodies all living long time and to prevent it inducing NPC in high incidence area by antisense strategies.

Analysis of Antisense Expression by Whole Genome Tiling Microarrays and siRNAs Suggests Mis-Annotation of Arabidopsis Orphan Protein-Coding Genes

PubMed Central

Richardson, Casey R.; Luo, Qing-Jun; Gontcharova, Viktoria; Jiang, Ying-Wen; Samanta, Manoj; Youn, Eunseog; Rock, Christopher D.

2010-01-01

Background MicroRNAs (miRNAs) and trans-acting small-interfering RNAs (tasi-RNAs) are small (20–22 nt long) RNAs (smRNAs) generated from hairpin secondary structures or antisense transcripts, respectively, that regulate gene expression by Watson-Crick pairing to a target mRNA and altering expression by mechanisms related to RNA interference. The high sequence homology of plant miRNAs to their targets has been the mainstay of miRNA prediction algorithms, which are limited in their predictive power for other kingdoms because miRNA complementarity is less conserved yet transitive processes (production of antisense smRNAs) are active in eukaryotes. We hypothesize that antisense transcription and associated smRNAs are biomarkers which can be computationally modeled for gene discovery. Principal Findings We explored rice (Oryza sativa) sense and antisense gene expression in publicly available whole genome tiling array transcriptome data and sequenced smRNA libraries (as well as C. elegans) and found evidence of transitivity of MIRNA genes similar to that found in Arabidopsis. Statistical analysis of antisense transcript abundances, presence of antisense ESTs, and association with smRNAs suggests several hundred Arabidopsis ‘orphan’ hypothetical genes are non-coding RNAs. Consistent with this hypothesis, we found novel Arabidopsis homologues of some MIRNA genes on the antisense strand of previously annotated protein-coding genes. A Support Vector Machine (SVM) was applied using thermodynamic energy of binding plus novel expression features of sense/antisense transcription topology and siRNA abundances to build a prediction model of miRNA targets. The SVM when trained on targets could predict the “ancient” (deeply conserved) class of validated Arabidopsis MIRNA genes with an accuracy of 84%, and 76% for “new” rapidly-evolving MIRNA genes. Conclusions Antisense and smRNA expression features and computational methods may identify novel MIRNA genes and other non-coding RNAs in plants and potentially other kingdoms, which can provide insight into antisense transcription, miRNA evolution, and post-transcriptional gene regulation. PMID:20520764

Assignment of chromosomal locus and evidence for alternatively spliced mRNAs of a human sperm membrane protein (hSMP-1).

PubMed

Wang, H; Miao, S; Chen, D; Wang, L; Koide, S S

1999-10-06

The gene (HSD-1) coding a human sperm membrane protein (hSMP-1) was isolated from a human testis cDNA expression library using antibodies found in the serum of an infertile woman. HSD-1 was localized to a single locus on chromosome 9 and assigned to band 9p12-p13 by fluorescent in situ hybridization (FISH) mapping and DAPI (4,6-diamidino-2-phenylindole) banding, using rat/human somatic cell hybrids and metaphase chromosomes of human lymphocytes. In rescreening a testis lambdagt10 cDNA expression library, the full-length cDNA (HSD-1) and several truncated cDNAs with heterologous regions were isolated from positive clones. The heterology consisted of deletion, insertion and alteration of the 5'-end. These heterologous truncated fragments may be produced by alternative splicing of mRNAs. Two recombinant prokaryotic expression vectors were constructed with one of the heterologous fragment (clone #26) with and without the alternative 5'-end. Escherichia coli transfected with the construct containing the alternative 5'-end failed to produce the recombinant product, whereas those transfected with the vector lacking the 5'-end produced hSMP-1. DNASIS analysis of the structure of #26 mRNA suggests that the 5'-end has a stable secondary configuration that may maintain the mRNA in an inactivated state, whereby hindering its translation and preventing the expression of the gene.

Gene Editing Vectors for Studying Nicotinic Acetylcholine Receptors in Cholinergic Transmission.

PubMed

Peng, Can; Yan, Yijin; Kim, Veronica J; Engle, Staci E; Berry, Jennifer N; McIntosh, J Michael; Neve, Rachael L; Drenan, Ryan M

2018-05-19

Nicotinic acetylcholine receptors (nAChRs), prototype members of the cys-loop ligand gated ion channel family, are key mediators of cholinergic transmission in the central nervous system. Despite their importance, technical gaps exist in our ability to dissect the function of individual subunits in the brain. To overcome these barriers, we designed CRISPR/Cas9 small guide RNA sequences (sgRNAs) for production of loss-of-function alleles in mouse nAChR genes. These sgRNAs were validated in vitro via deep sequencing. We subsequently targeted candidate nAChR genes in vivo by creating herpes simplex virus (HSV) vectors delivering sgRNAs and Cas9 expression to mouse brain. Production of loss-of-function insertions or deletions (indels) by these "all-in-one" HSV vectors was confirmed using brain slice patch clamp electrophysiology coupled with pharmacological analysis. Next, we developed a scheme for cell type-specific gene editing in mouse brain. Knockin mice expressing Cas9 in a Cre-dependent manner were validated using viral microinjections and genetic crosses to common Cre-driver mouse lines. We subsequently confirmed functional Cas9 activity by targeting the ubiquitous neuronal protein, NeuN, using adeno associated virus (AAV) delivery of sgRNAs. Finally, the mouse β2 nAChR gene was successfully targeted in dopamine transporter (DAT) positive neurons via CRISPR/Cas9. The sgRNA sequences and viral vectors, including our scheme for Cre-dependent gene editing, should be generally useful to the scientific research community. These tools could lead to new discoveries related to the function of nAChRs in neurotransmission and behavioral processes. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

An equine herpesvirus type 1 (EHV-1) vector expressing Rift Valley fever virus (RVFV) Gn and Gc induces neutralizing antibodies in sheep.

PubMed

Said, Abdelrahman; Elmanzalawy, Mona; Ma, Guanggang; Damiani, Armando Mario; Osterrieder, Nikolaus

2017-08-14

Rift Valley fever virus (RVFV) is an arthropod-borne bunyavirus that can cause serious and fatal disease in humans and animals. RVFV is a negative-sense RNA virus of the Phlebovirus genus in the Bunyaviridae family. The main envelope RVFV glycoproteins, Gn and Gc, are encoded on the M segment of RVFV and known inducers of protective immunity. In an attempt to develop a safe and efficacious RVF vaccine, we constructed and tested a vectored equine herpesvirus type 1 (EHV-1) vaccine that expresses RVFV Gn and Gc. The Gn and Gc genes were custom-synthesized after codon optimization and inserted into EHV-1 strain RacH genome. The rH_Gn-Gc recombinant virus grew in cultured cells with kinetics that were comparable to those of the parental virus and stably expressed Gn and Gc. Upon immunization of sheep, the natural host, neutralizing antibodies against RVFV were elicited by rH_Gn-Gc and protective titers reached to 1:320 at day 49 post immunization but not by parental EHV-1, indicating that EHV-1 is a promising vector alternative in the development of a safe marker RVFV vaccine.

Targeted gene knock-in by homology-directed genome editing using Cas9 ribonucleoprotein and AAV donor delivery.

PubMed

Gaj, Thomas; Staahl, Brett T; Rodrigues, Gonçalo M C; Limsirichai, Prajit; Ekman, Freja K; Doudna, Jennifer A; Schaffer, David V

2017-06-20

Realizing the full potential of genome editing requires the development of efficient and broadly applicable methods for delivering programmable nucleases and donor templates for homology-directed repair (HDR). The RNA-guided Cas9 endonuclease can be introduced into cells as a purified protein in complex with a single guide RNA (sgRNA). Such ribonucleoproteins (RNPs) can facilitate the high-fidelity introduction of single-base substitutions via HDR following co-delivery with a single-stranded DNA oligonucleotide. However, combining RNPs with transgene-containing donor templates for targeted gene addition has proven challenging, which in turn has limited the capabilities of the RNP-mediated genome editing toolbox. Here, we demonstrate that combining RNP delivery with naturally recombinogenic adeno-associated virus (AAV) donor vectors enables site-specific gene insertion by homology-directed genome editing. Compared to conventional plasmid-based expression vectors and donor templates, we show that combining RNP and AAV donor delivery increases the efficiency of gene addition by up to 12-fold, enabling the creation of lineage reporters that can be used to track the conversion of striatal neurons from human fibroblasts in real time. These results thus illustrate the potential for unifying nuclease protein delivery with AAV donor vectors for homology-directed genome editing. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Targeting caspase-3 as dual therapeutic benefits by RNAi facilitating brain-targeted nanoparticles in a rat model of Parkinson's disease.

PubMed

Liu, Yang; Guo, Yubo; An, Sai; Kuang, Yuyang; He, Xi; Ma, Haojun; Li, Jianfeng; Lu, Jing; Lv, Jing; Zhang, Ning; Jiang, Chen

2013-01-01

The activation of caspase-3 is an important hallmark in Parkinson's disease. It could induce neuron death by apoptosis and microglia activation by inflammation. As a result, inhibition the activation of caspase-3 would exert synergistic dual effect in brain in order to prevent the progress of Parkinson's disease. Silencing caspase-3 genes by RNA interference could inhibit the activation of caspase-3. We developed a brain-targeted gene delivery system based on non-viral gene vector, dendrigraft poly-L-lysines. A rabies virus glycoprotein peptide with 29 amino-acid linked to dendrigraft poly-L-lysines could render gene vectors the ability to get across the blood brain barrier by specific receptor mediated transcytosis. The resultant brain-targeted vector was complexed with caspase-3 short hairpin RNA coding plasmid DNA, yielding nanoparticles. In vivo imaging analysis indicated the targeted nanoparticles could accumulate in brain more efficiently than non-targeted ones. A multiple dosing regimen by weekly intravenous administration of the nanoparticles could reduce activated casapse-3 levels, significantly improve locomotor activity and rescue dopaminergic neuronal loss and in Parkinson's disease rats' brain. These results indicated the rabies virus glycoprotein peptide modified brain-targeted nanoparticles were promising gene delivery system for RNA interference to achieve anti-apoptotic and anti-inflammation synergistic therapeutic effects by down-regulation the expression and activation of caspase-3.

Expression of versican 3'-untranslated region modulates endogenous microRNA functions.

PubMed

Lee, Daniel Y; Jeyapalan, Zina; Fang, Ling; Yang, Jennifer; Zhang, Yaou; Yee, Albert Y; Li, Minhui; Du, William W; Shatseva, Tatiana; Yang, Burton B

2010-10-25

Mature microRNAs (miRNAs) are single-stranded RNAs that regulate post-transcriptional gene expression. In our previous study, we have shown that versican 3'UTR, a fragment of non-coding transcript, has the ability to antagonize miR-199a-3p function thereby regulating expression of the matrix proteins versican and fibronectin, and thus resulting in enhanced cell-cell adhesion and organ adhesion. However, the impact of this non-coding fragment on tumorigenesis is yet to be determined. Using computational prediction confirmed with in vitro and in vivo experiments, we report that the expression of versican 3'UTR not only antagonizes miR-199a-3p but can also lower its steady state expression. We found that expression of versican 3'UTR in a mouse breast carcinoma cell line, 4T1, decreased miR-199a-3p levels. The decrease in miRNA activity consequently translated into differences in tumor growth. Computational analysis indicated that both miR-199a-3p and miR-144 targeted a cell cycle regulator, Rb1. In addition, miR-144 and miR-136, which have also been shown to interact with versican 3'UTR, was found to target PTEN. Expression of Rb1 and PTEN were up-regulated synergistically in vitro and in vivo, suggesting that the 3'UTR binds and modulates miRNA activities, freeing Rb1 and PTEN mRNAs for translation. In tumor formation assays, cells transfected with the 3'UTR formed smaller tumors compared with cells transfected with a control vector. Our results demonstrated that a 3'UTR fragment can be used to modulate miRNA functions. Our study also suggests that miRNAs in the cancer cells are more susceptible to degradation, due to its interaction with a non-coding 3'UTR. This non-coding component of mRNA may be used retrospectively to modulate miRNA activities.

Chicken ovalbumin upstream promoter-transcription factor II regulates nuclear receptor, myogenic, and metabolic gene expression in skeletal muscle cells.

PubMed

Crowther, Lisa M; Wang, Shu-Ching Mary; Eriksson, Natalie A; Myers, Stephen A; Murray, Lauren A; Muscat, George E O

2011-02-24

We demonstrate that chicken ovalbumin upstream promoter-transcription factor II (COUP-TFII) mRNA is more abundantly expressed (than COUP-TFI mRNA) in skeletal muscle C2C12 cells and in (type I and II) skeletal muscle tissue from C57BL/10 mice. Consequently, we have utilized the ABI TaqMan Low Density Array (TLDA) platform to analyze gene expression changes specifically attributable to ectopic COUP-TFII (relative to vector only) expression in muscle cells. Utilizing a TLDA-based platform and 5 internal controls, we analyze the entire NR superfamily, 96 critical metabolic genes, and 48 important myogenic regulatory genes on the TLDA platform utilizing 5 internal controls. The low density arrays were analyzed by rigorous statistical analysis (with Genorm normalization, Bioconductor R, and the Empirical Bayes statistic) using the (integromics) statminer software. In addition, we validated the differentially expressed patho-physiologically relevant gene (identified on the TLDA platform) glucose transporter type 4 (Glut4). We demonstrated that COUP-TFII expression increased the steady state levels of Glut4 mRNA and protein, while ectopic expression of truncated COUP-TFII lacking helix 12 (COUP-TFΔH12) reduced Glut4 mRNA expression in C2C12 cells. Moreover, COUP-TFII expression trans-activated the Glut4 promoter (-997/+3), and ChIP analysis identified selective recruitment of COUP-TFII to a region encompassing a highly conserved SP1 binding site (in mouse, rat, and human) at nt positions -131/-118. Mutation of the SpI site ablated COUP-TFII mediated trans-activation of the Glut4 promoter. In conclusion, this study demonstrates that in skeletal muscle cells, COUP-TFII regulates several nuclear hormone receptors, and critical metabolic and muscle specific genes.

[Anti-HBV effects of genetically engineered replication-defective HBV with combined expression of antisense RNA and dominant negative mutants of core protein and construction of first-generation packaging cell line for HBV vector].

PubMed

Sun, Dian Xing; Hu, Da Rong; Wu, Guang Hui; Hu, Xue Ling; Li, Juan; Fan, Gong Ren

2002-08-01

To explore the possibility of using HBV as a gene delivery vector, and to test the anti-HBV effects by intracellular combined expression of antisense RNA and dominant negative mutants of core protein. Full length of mutant HBV genome, which expresses core-partial P fusion protein and/or antisense RNA, was transfected into HepG2.2.15 cell lines. Positive clones were selected and mixed in respective groups with hygromycin in the culture medium. HBsAg and HBeAg, which exist in the culture medium, were tested by ELISA method. Intracellular HBc related HBV DNA was examined by dot blot hybridization. The existence of recombinant HBV virion in the culture medium was examined by PCR. Free of packaging signal, HBV genome, which express the HBV structural proteins including core, pol and preS/S proteins, was inserted into pCI-neo vector. HepG2 cell lines were employed to transfect with the construct. G418 selection was done at the concentration of 400mug/ml in the culture medium. The G418-resistant clones with the best expression of HBsAg and HBcAg were theoretically considered as packaging cell lines and propagated under the same conditions. It was transfected with plasmid pMEP-CPAS and then selected with G418 and hygromycin in the culture medium. The existence of recombinant HBV virion in the culture medium was examined by PCR. The mean inhibitory rates of HBsAg were 2.74% 3.83%, 40.08 2.05% (t=35.5, P<0.01), 66.54% 4.45% (t=42.3, P<0.01), and 73.68% 5.07% (t=51.9, P<0.01) in group 2.2.15-pMEP4, 2.2.15-CP, 2.2.15-SAS, and 2.2.15-CPAS, respectively. The mean inhibitory rates of HBeAg were 4.46% 4.25%, 52.86% 1.32% (t=36.2, P<0.01), 26.36% 1.69% (t=22.3, P<0.01), and 59.28% 2.10% (t=39.0, P<0.01), respectively. The inhibitory rates of HBc related HBV DNA were 0, 82.0%, 59.9%, and 96.6%, respectively. Recombinant HB virion was detectable in the culture medium of all the three treatment groups. G418-resistant HBV packaging cell line, which harbored an HBV mutant whose packaging signal had been deleted, was generated. Expression of HBsAg and HBcAg was detectable. Transfected with plasmid pMEP-CPAS, it was found to secrete recombinant HB virion and no wild-type HBV was detectable in the culture medium. It has stronger anti-HBV effects by combined expression of antisense RNA and dominant negative mutants than by individual expression of them. With the help of wild-type HBV, the modified HBV genome can form and secret HBV like particles, which provides evidence that the antiviral gene will be hepatotropic expression and the antiviral effects will be amplified. The packaging cell line can provide packaging for replication-defective HBV, but with low efficiency.

RNAi or overexpression: Alternative therapies for Spinocerebellar Ataxia Type 1

PubMed Central

Keiser, Megan S.; Geoghegan, James C.; Boudreau, Ryan L.; Lennox, Kim A.; Davidson, Beverly L.

2014-01-01

Spinocerebellar Ataxia Type 1 (SCA1) is an autosomal dominant late onset neurodegenerative disease caused by an expanded polyglutamine tract in ataxin-1. Here, we compared the protective effects of overexpressing ataxin-1-like using recombinant AAVs, or reducing expression of mutant ataxin-1 using virally delivered RNA interference (RNAi), in a transgenic mouse model of SCA1. For the latter, we used an artificial microRNA (miR) design that optimizes potency, efficacy and safety to suppress ataxin-1 expression (miS1). Delivery of either ataxin-1-like or miS1 viral vectors to SCA1 mice cerebella resulted in widespread cerebellar Purkinje cell transduction and improved behavioral and histological phenotypes. Our data indicate the utility of either approach as a possible therapy for SCA1 patients. PMID:23583610

pKAMA-ITACHI Vectors for Highly Efficient CRISPR/Cas9-Mediated Gene Knockout in Arabidopsis thaliana

PubMed Central

2017-01-01

The CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated 9) system is widely used as a tool for genome engineering in various organisms. A complex consisting of Cas9 and single guide RNA (sgRNA) induces a DNA double-strand break in a sequence-specific manner, resulting in knockout. Some binary vectors for CRISPR/Cas9 in plants have been reported, but there is a problem with low efficiency. Here, we present a newly developed, highly efficient CRISPR/Cas9 vector for Arabidopsis thaliana, pKAMA-ITACHI Red (pKIR), harboring the RIBOSOMAL PROTEIN S5 A (RPS5A) promoter to drive Cas9. The RPS5A promoter maintains high constitutive expression at all developmental stages starting from the egg cell and including meristematic cells. Even in the T1 generation, pKIR induced null phenotypes in some genes: PHYTOENE DESATURASE 3 (PDS3), AGAMOUS (AG) and DUO POLLEN 1 (DUO1). Mutations induced by pKIR were carried in the germ cell line of the T1 generation. Surprisingly, in some lines, 100% of the T2 plants had the adh1 (ALCOHOL DEHYDROGENASE 1) null phenotype, indicating that pKIR strongly induced heritable mutations. Cas9-free T2 mutant plants were obtained by removing T2 seeds expressing a fluorescent marker in pKIR. Our results suggest that the pKIR system is a powerful molecular tool for genome engineering in Arabidopsis. PMID:27856772

Effect of small hairpin RNA targeting endothelin-converting enzyme-1 in monocrotaline-induced pulmonary hypertensive rats.

PubMed

Son, Jae Sung; Kim, Kwan Chang; Kim, Bo Kyung; Cho, Min-Sun; Hong, Young Mi

2012-12-01

The purpose of this study was to investigate the therapeutic effects of small hairpin RNA (shRNA) targeting endothelin-converting enzyme (ECE)-1 in monocrotaline (MCT)-induced pulmonary hypertensive rats. Ninty-four Sprague-Dawley rats were divided into three groups: control (n = 24), MCT (n = 35) and shRNA (n = 35). Four-week survival rate in the shRNA group was significantly increased compared to that in the MCT group. The shRNA group showed a significant improvement of right ventricular (RV) pressure compared with the MCT group. The MCT and shRNA groups also showed an increase in RV/(left ventricle + septum) ratio and lung/body weight. Plasma endothelin (ET)-1 concentrations in the shRNA group were lower than those in the MCT group. Medial wall thickness of pulmonary arterioles were increased after MCT injection and was significantly decreased in the shRNA group. The number of intra-acinar muscular pulmonary arteries was decreased in the shRNA group. The mRNA expressions of ET-1 and ET receptor A (ET(A)) were significantly decreased in the shRNA group in week 4. The protein levels of ET(A) were decreased in the shRNA group in week 2. The protein levels of tumor necrosis factor-α and vascular endothelial growth factor were decreased in the shRNA group in week 4. In conclusion, the gene silencing with lentiviral vector targeting ECE-1 could be effective against hemodynamic, histopathological and gene expression changes in pulmonary hypertension.

Real-time functional imaging for monitoring miR-133 during myogenic differentiation.

PubMed

Kato, Yoshio; Miyaki, Shigeru; Yokoyama, Shigetoshi; Omori, Shin; Inoue, Atsushi; Horiuchi, Machiko; Asahara, Hiroshi

2009-11-01

MicroRNAs (miRNAs) are a class of non-coding small RNAs that act as negative regulators of gene expression through sequence-specific interactions with the 3' untranslated regions (UTRs) of target mRNA and play various biological roles. miR-133 was identified as a muscle-specific miRNA that enhanced the proliferation of myoblasts during myogenic differentiation, although its activity in myogenesis has not been fully characterized. Here, we developed a novel retroviral vector system for monitoring muscle-specific miRNA in living cells by using a green fluorescent protein (GFP) that is connected to the target sequence of miR-133 via the UTR and a red fluorescent protein for normalization. We demonstrated that the functional promotion of miR-133 during myogenesis is visualized by the reduction of GFP carrying the miR-133 target sequence, suggesting that miR-133 specifically down-regulates its targets during myogenesis in accordance with its expression. Our cell-based miRNA functional assay monitoring miR-133 activity should be a useful tool in elucidating the role of miRNAs in various biological events.

Chimeric RNase H–Competent Oligonucleotides Directed to the HIV-1 Rev Response Element

PubMed Central

Prater, Chrissy E.; Saleh, Anthony D.; Wear, Maggie P.; Miller, Paul S.

2007-01-01

Chimeric oligo-2′-O-methylribonucleotides containing centrally located patches of contiguous 2′-deoxyribonucleotides and terminating in a nuclease resistant 3′-methylphosphonate internucleotide linkage were prepared. The oligonucleotides were targeted to the 3′-side of HIV Rev response element (RRE) stem-loop IIB RNA, which is adjacent to the high affinity Rev protein binding site and is critical to virus function. Thermal denaturation experiments showed that chimeric oligonucleotides form very stable duplexes with a complementary single-stranded RNA, and gel electrophoretic mobility shift assays (EMSA) showed that they bind with high affinity and specificity to RRE stem-loop II RNA (KD approximately 200 nM). The chimeric oligonucleotides promote RNase H-mediated hydrolysis of RRE stem-loop II RNA and have half lives exceeding 24 h when incubated in cell culture medium containing 10% fetal calf serum. One of the chimeric oligonucleotides inhibited RRE mediated expression of chloramphenicol acetyl transferase (CAT) approximately 60% at a concentration of 300 nM in HEK 293T cells co-transfected with p-RRE/CAT and p-Rev mammalian expression vectors. PMID:17566743

Trojan Horse Strategy for Non-invasive Interference of Clock Gene in the Oyster Crassostrea gigas.

PubMed

Payton, Laura; Perrigault, Mickael; Bourdineaud, Jean-Paul; Marcel, Anjara; Massabuau, Jean-Charles; Tran, Damien

2017-08-01

RNA interference is a powerful method to inhibit specific gene expression. Recently, silencing target genes by feeding has been successfully carried out in nematodes, insects, and small aquatic organisms. A non-invasive feeding-based RNA interference is reported here for the first time in a mollusk bivalve, the pacific oyster Crassostrea gigas. In this Trojan horse strategy, the unicellular alga Heterocapsa triquetra is the food supply used as a vector to feed oysters with Escherichia coli strain HT115 engineered to express the double-stranded RNA targeting gene. To test the efficacy of the method, the Clock gene, a central gene of the circadian clock, was targeted for knockout. Results demonstrated specific and systemic efficiency of the Trojan horse strategy in reducing Clock mRNA abundance. Consequences of Clock disruption were observed in Clock-related genes (Bmal, Tim1, Per, Cry1, Cry2, Rev.-erb, and Ror) and triploid oysters were more sensitive than diploid to the interference. This non-invasive approach shows an involvement of the circadian clock in oyster bioaccumulation of toxins produced by the harmful alga Alexandrium minutum.

Histone-derived piRNA biogenesis depends on the ping-pong partners Piwi5 and Ago3 in Aedes aegypti

PubMed Central

Girardi, Erika; Miesen, Pascal; Pennings, Bas; Frangeul, Lionel; Saleh, Maria-Carla

2017-01-01

Abstract The piRNA pathway is of key importance in controlling transposable elements in most animal species. In the vector mosquito Aedes aegypti, the presence of eight PIWI proteins and the accumulation of viral piRNAs upon arbovirus infection suggest additional functions of the piRNA pathway beyond genome defense. To better understand the regulatory potential of this pathway, we analyzed in detail host-derived piRNAs in A. aegypti Aag2 cells. We show that a large repertoire of protein-coding genes and non-retroviral integrated RNA virus elements are processed into genic piRNAs by different combinations of PIWI proteins. Among these, we identify a class of genes that produces piRNAs from coding sequences in an Ago3- and Piwi5-dependent fashion. We demonstrate that the replication-dependent histone gene family is a genic source of ping-pong dependent piRNAs and that histone-derived piRNAs are dynamically expressed throughout the cell cycle, suggesting a role for the piRNA pathway in the regulation of histone gene expression. Moreover, our results establish the Aag2 cell line as an accessible experimental model to study gene-derived piRNAs. PMID:28115625

RNAi screening of subtracted transcriptomes reveals tumor suppression by taurine-activated GABAA receptors involved in volume regulation

PubMed Central

van Nierop, Pim; Vormer, Tinke L.; Foijer, Floris; Verheij, Joanne; Lodder, Johannes C.; Andersen, Jesper B.; Mansvelder, Huibert D.; te Riele, Hein

2018-01-01

To identify coding and non-coding suppressor genes of anchorage-independent proliferation by efficient loss-of-function screening, we have developed a method for enzymatic production of low complexity shRNA libraries from subtracted transcriptomes. We produced and screened two LEGO (Low-complexity by Enrichment for Genes shut Off) shRNA libraries that were enriched for shRNA vectors targeting coding and non-coding polyadenylated transcripts that were reduced in transformed Mouse Embryonic Fibroblasts (MEFs). The LEGO shRNA libraries included ~25 shRNA vectors per transcript which limited off-target artifacts. Our method identified 79 coding and non-coding suppressor transcripts. We found that taurine-responsive GABAA receptor subunits, including GABRA5 and GABRB3, were induced during the arrest of non-transformed anchor-deprived MEFs and prevented anchorless proliferation. We show that taurine activates chloride currents through GABAA receptors on MEFs, causing seclusion of cell volume in large membrane protrusions. Volume seclusion from cells by taurine correlated with reduced proliferation and, conversely, suppression of this pathway allowed anchorage-independent proliferation. In human cholangiocarcinomas, we found that several proteins involved in taurine signaling via GABAA receptors were repressed. Low GABRA5 expression typified hyperproliferative tumors, and loss of taurine signaling correlated with reduced patient survival, suggesting this tumor suppressive mechanism operates in vivo. PMID:29787571

The novel protein C3orf43 accelerates hepatocyte proliferation.

PubMed

Zhang, Chunyan; Chang, Cuifang; Li, Deming; Zhang, Fuchun; Xu, Cunshuan

2017-01-01

Our previous study found that single-pass membrane protein with coiled-coil domains 1 (C3orf43; XM_006248472.3) was significantly upregulated in the proliferative phase during liver regeneration. This indicates that C3orf43 plays a vital role in liver cell proliferation. However, its physiological functions remains unclear. The expressions of C3orf43 in BRL-3A cells transfected with C3orf43-siRNA (C3-siRNA) or overexpressing the vector plasmid pCDH-C3orf43 (pCDH-C3) were measured via RT-qPCR and western blot. Cell growth and proliferation were determined using MTT and flow cytometry. Cell proliferation-related gene expression was measured using RT-qPCR and western blot. It was found that upregulation of C3orf43 by pCDH-C3 promoted hepatocyte proliferation, and inhibition of C3orf43 by C3-siRNA led to the reduction of cell proliferation. The results of qRT-PCR and western blot assay showed that the C3-siRNA group downregulated the expression of cell proliferation-related genes like JUN, MYC, CCND1 and CCNA2, and the pCDH-C3 group upregulated the expression of those genes. These findings reveal that C3orf43 may contribute to hepatocyte proliferation and may have the potential to promote liver repair and regeneration.

Non-viral RNA chimeric antigen receptor modified T cells in patients with Hodgkin lymphoma.

PubMed

Svoboda, Jakub; Rheingold, Susan R; Gill, Saar I; Grupp, Stephan A; Lacey, Simon F; Kulikovskaya, Irina; Suhoski, Megan M; Melenhorst, J Joseph; Loudon, Brandon; Mato, Anthony R; Nasta, Sunita Dwivedy; Landsburg, Daniel J; Youngman, Matthew R; Levine, Bruce L; Porter, David L; June, Carl H; Schuster, Stephen J

2018-06-20

Chimeric antigen receptor (CAR) modified T cells are being investigated in many settings including classical Hodgkin lymphoma (cHL). The unique biology of cHL, characterized by scant Hodgkin and Reed-Sternberg (HRS) cells within an immunosuppressive tumor microenvironment (TME), may pose challenges for cellular therapies directly targeting antigens expressed on HRS. We hypothesized that eradicating CD19 positive (+) B cells within the TME and the putative circulating CD19+ HRS clonotypic cells using anti-CD19 directed CAR modified T cells (CART19) may indirectly affect HRS cells, which do not express CD19. Here we describe our pilot trial using CART19 in patients with relapsed and refractory cHL. To limit potential toxicities, we used non-viral RNA CART19 cells which are expected to express CAR protein only a few days, as opposed to CART19 generated by viral vector transduction, which expand in vivo and retain CAR expression. All 5 enrolled patients underwent successful manufacturing of non-viral RNA CART19 and 4 were infused with protocol specified cell dose. There were no severe toxicities. Responses were seen, but these were transient. To our knowledge, this is the first CART19 clinical trial to use non-viral RNA gene delivery. This trial was registered at www.clinicaltrials.gov as NCT02277522 (adult) and NCT02624258 (pediatric). Copyright © 2018 American Society of Hematology.

In Vivo Delivery of Cytoplasmic RNA Virus-derived miRNAs

PubMed Central

Langlois, Ryan A; Shapiro, Jillian S; Pham, Alissa M; tenOever, Benjamin R

2012-01-01

The discovery of microRNAs (miRNAs) revealed an unappreciated level of post-transcriptional control used by the cell to maintain optimal protein levels. This process has represented an attractive strategy for therapeutics that is currently limited by in vivo delivery constraints. Here, we describe the generation of a single-stranded, cytoplasmic virus of negative polarity capable of producing functional miRNAs. Cytoplasmic RNA virus-derived miRNAs accumulated to high levels in vitro, generated significant amounts of miRNA star strand, associated with the RNA-induced silencing complex (RISC), and conferred post transcriptional gene silencing in a sequence-specific manner. Furthermore, we demonstrate that these vectors could deliver miRNAs to a wide range of tissues, and sustain prolonged expression capable of achieving measurable knockdown of physiological targets in vivo. Taken together, these results validate noncanonical processing of cytoplasmic-derived miRNAs and provide a novel platform for small RNA delivery. PMID:22086233

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization.

PubMed

Moss, Caitlin E; Robson, Andrew; Fikrig, Erol; Narasimhan, Sukanya

2018-06-01

Infectious diseases transmitted by arthropod vectors continue to pose a significant threat to human health worldwide. The pathogens causing these diseases, do not exist in isolation when they colonize the vector; rather, they likely engage in interactions with resident microorganisms in the gut lumen. The vector microbiota has been demonstrated to play an important role in pathogen transmission for several vector-borne diseases. Whether resident bacteria in the gut of the Ixodes scapularis tick, the vector of several human pathogens including Borrelia burgdorferi, influence tick transmission of pathogens is not determined. We require methods for characterizing the composition of the bacteria associated with the tick gut to facilitate a better understanding of potential interspecies interactions in the tick gut. Using whole-mount in situ hybridization to visualize RNA transcripts associated with particular bacterial species allows for the collection of qualitative data regarding the abundance and distribution of the microbiota in intact tissue. This technique can be used to examine changes in the gut microbiota milieu over the course of tick feeding and can also be applied to analyze expression of tick genes. Staining of whole tick guts yield information about the gross spatial distribution of target RNA in the tissue without the need for three-dimensional reconstruction and is less affected by environmental contamination, which often confounds the sequencing-based methods frequently used to study complex microbial communities. Overall, this technique is a valuable tool that can be used to better understand vector-pathogen-microbiota interactions and their role in disease transmission.

Mating-Induced Transcriptome Changes in the Reproductive Tract of Female Aedes aegypti

PubMed Central

Degner, Ethan C.; Avila, Frank W.; Villarreal, Susan M.; Pleiss, Jeffrey A.; Wolfner, Mariana F.; Harrington, Laura C.

2016-01-01

The Aedes aegypti mosquito is a significant public health threat, as it is the main vector of dengue and chikungunya viruses. Disease control efforts could be enhanced through reproductive manipulation of these vectors. Previous work has revealed a relationship between male seminal fluid proteins transferred to females during mating and female post-mating physiology and behavior. To better understand this interplay, we used short-read RNA sequencing to identify gene expression changes in the lower reproductive tract of females in response to mating. We characterized mRNA expression in virgin and mated females at 0, 6 and 24 hours post-mating (hpm) and identified 364 differentially abundant transcripts between mating status groups. Surprisingly, 60 transcripts were more abundant at 0hpm compared to virgin females, suggesting transfer from males. Twenty of these encode known Ae. aegypti seminal fluid proteins. Transfer and detection of male accessory gland-derived mRNA in females at 0hpm was confirmed by measurement of eGFP mRNA in females mated to eGFP-expressing males. In addition, 150 transcripts were up-regulated at 6hpm and 24hpm, while 130 transcripts were down-regulated at 6hpm and 24hpm. Gene Ontology (GO) enrichment analysis revealed that proteases, a protein class broadly known to play important roles in reproduction, were among the most enriched protein classes. RNAs associated with immune system and antimicrobial function were also up-regulated at 24hpm. Collectively, our results suggest that copulation initiates broad transcriptome changes across the mosquito female reproductive tract, “priming” her for important subsequent processes of blood feeding, egg development and immune defense. Our transcriptome analysis provides a vital foundation for future studies of the consequences of mating on female biology and will aid studies seeking to identify specific gene families, molecules and pathways that support key reproductive processes in the female mosquito. PMID:26901677

Evaluation and rational design of guide RNAs for efficient CRISPR/Cas9-mediated mutagenesis in Ciona

PubMed Central

Gandhi, Shashank; Haeussler, Maximilian; Razy-Krajka, Florian; Christiaen, Lionel; Stolfi, Alberto

2017-01-01

The CRISPR/Cas9 system has emerged as an important tool for various genome engineering applications. A current obstacle to high throughput applications of CRISPR/Cas9 is the imprecise prediction of highly active single guide RNAs (sgRNAs). We previously implemented the CRISPR/Cas9 system to induce tissue-specific mutations in the tunicate Ciona. In the present study, we designed and tested 83 single guide RNA (sgRNA) vectors targeting 23 genes expressed in the cardiopharyngeal progenitors and surrounding tissues of Ciona embryo. Using high-throughput sequencing of mutagenized alleles, we identified guide sequences that correlate with sgRNA mutagenesis activity and used this information for the rational design of all possible sgRNAs targeting the Ciona transcriptome. We also describe a one-step cloning-free protocol for the assembly of sgRNA expression cassettes. These cassettes can be directly electroporated as unpurified PCR products into Ciona embryos for sgRNA expression in vivo, resulting in high frequency of CRISPR/Cas9-mediated mutagenesis in somatic cells of electroporated embryos. We found a strong correlation between the frequency of an Ebf loss-of-function phenotype and the mutagenesis efficacies of individual Ebf-targeting sgRNAs tested using this method. We anticipate that our approach can be scaled up to systematically design and deliver highly efficient sgRNAs for the tissue-specific investigation of gene functions in Ciona. PMID:28341547

Functional characterization of three MicroRNAs of the Asian Tiger Mosquito, Aedes albopictus

PubMed Central

2013-01-01

Background Temporal and stage specific expression of microRNAs (miRNAs) in embryos, larvae, pupae and adults of Aedes albopictus showed differential expression levels across the four developmental stages, indicating their potential regulatory roles in mosquito development. The functional characterization of these miRNAs was not known. Accordingly our study evaluated the functional characterization of three miRNAs, which are temporally up-regulated in the various developmental stages of Ae. albopictus mosquitoes. Methods miRNA mimics, inhibitors and negative controls were designed and their knock-in and knock-down efficiency were analyzed by qRT-PCR after transfecting the mosquito cell lines C6/36, and also by injecting in their specific developmental stages. The functional role of each individual miRNA was analyzed with various parameters of development such as, hatching rate and hatching time in embryos, eclosion rate in larvae, longevity and fecundity in the adult mosquitoes. Results The knock-in with the specifically designed miRNA mimics showed increased levels of expression of miRNA compared with their normal controls. We confirmed these findings using qRT-PCR, both by in vitro expression in C6/36 mosquito cell lines after transfection as well as in in vivo expression in developmental stages of mosquitoes by microinjection. The knock-down of expression with the corresponding inhibitors showed a considerable decrease in the expression levels of these miRNAs and obvious functional effects in Ae. albopictus development, detected by a decrease in the hatching rate of embryos and eclosion rate in larvae and a marked reduction in longevity and fecundity in adults. Conclusion This study carried out by knock-in and knock-down of specifically and temporally expressed miRNAs in Ae. albopictus by microinjection is a novel study to delineate the importance of the miRNA expression in regulating mosquito development. The knock-down and loss of function of endogenously expressed miRNAs by the miRNA inhibitors in specific developmental stages had considerable effects on development, but enhancement of their gain of function was not observed on knock-in of these specific miRNAs. Hence, our study indicates that an optimal level of endogenous expression of miRNA is indispensable for the normal development and maintenance of the vectorial population density and pathogen transmissibility of this mosquito vector. PMID:23924583

Morphine Preconditioning Downregulates MicroRNA-134 Expression Against Oxygen-Glucose Deprivation Injuries in Cultured Neurons of Mice.

PubMed

Meng, Fanjun; Li, Yan; Chi, Wenying; Li, Junfa

2016-07-01

Brain protection by narcotics such as morphine is clinically relevant due to the extensive use of narcotics in the perioperative period. Morphine preconditioning induces neuroprotection in neurons, but it remains uncertain whether microRNA-134 (miR-134) is involved in morphine preconditioning against oxygen-glucose deprivation-induced injuries in primary cortical neurons of mice. The present study examined this issue. After cortical neurons of mice were cultured in vitro for 6 days, the neurons were transfected by respective virus vector, such as lentiviral vector (LV)-miR-control-GFP, LV-pre-miR-134-GFP, LV-pre-miR-134-inhibitor-GFP for 24 hours; after being normally cultured for 3 days again, morphine preconditioning was performed by incubating the transfected primary neurons with morphine (3 μM) for 1 hour, and then neuronal cells were exposed to oxygen-glucose deprivation (OGD) for 1 hour and oxygen-glucose recovery for 12 hours. The neuronal cells survival rate and the amount of apoptotic neurons were determined by MTT assay or TUNEL staining at designated time; and the expression levels of miR-134 were detected using real-time reverse transcription polymerase chain reaction at the same time. The neuronal cell survival rate was significantly higher, and the amount of apoptotic neurons was significantly decreased in neurons preconditioned with morphine before OGD than that of OGD alone. The neuroprotection induced by morphine preconditioning was partially blocked by upregulating miR-134 expression, and was enhanced by downregulating miR-134 expression. The expression of miR-134 was significantly decreased in morphine-preconditioned neurons alone without transfection. By downregulating miR-134 expression, morphine preconditioning protects primary cortical neurons of mice against injuries induced by OGD.

In Vivo Functional Genomic Studies of Sterol Carrier Protein-2 Gene in the Yellow Fever Mosquito

PubMed Central

Peng, Rong; Maklokova, Vilena I.; Chandrashekhar, Jayadevi H.; Lan, Que

2011-01-01

A simple and efficient DNA delivery method to introduce extrachromosomal DNA into mosquito embryos would significantly aid functional genomic studies. The conventional method for delivery of DNA into insects is to inject the DNA directly into the embryos. Taking advantage of the unique aspects of mosquito reproductive physiology during vitellogenesis and an in vivo transfection reagent that mediates DNA uptake in cells via endocytosis, we have developed a new method to introduce DNA into mosquito embryos vertically via microinjection of DNA vectors in vitellogenic females without directly manipulating the embryos. Our method was able to introduce inducible gene expression vectors transiently into F0 mosquitoes to perform functional studies in vivo without transgenic lines. The high efficiency of expression knockdown was reproducible with more than 70% of the F0 individuals showed sufficient gene expression suppression (<30% of the controls' levels). At the cohort level, AeSCP-2 expression knockdown in early instar larvae resulted in detectable phenotypes of the expression deficiency such as high mortality, lowered fertility, and distorted sex ratio after induction of AeSCP-2 siRNA expression in vivo. The results further confirmed the important role of AeSCP-2 in the development and reproduction of A. aegypti. In this study, we proved that extrachromosaomal transient expression of an inducible gene from a DNA vector vertically delivered via vitellogenic females can be used to manipulate gene expression in F0 generation. This new method will be a simple and efficient tool for in vivo functional genomic studies in mosquitoes. PMID:21437205

Improved Innate and Adaptive Immunostimulation by Genetically Modified HIV-1 Protein Expressing NYVAC Vectors

PubMed Central

Quakkelaar, Esther D.; Redeker, Anke; Haddad, Elias K.; Harari, Alexandre; McCaughey, Stella Mayo; Duhen, Thomas; Filali-Mouhim, Abdelali; Goulet, Jean-Philippe; Loof, Nikki M.; Ossendorp, Ferry; Perdiguero, Beatriz; Heinen, Paul; Gomez, Carmen E.; Kibler, Karen V.; Koelle, David M.; Sékaly, Rafick P.; Sallusto, Federica; Lanzavecchia, Antonio; Pantaleo, Giuseppe; Esteban, Mariano; Tartaglia, Jim; Jacobs, Bertram L.; Melief, Cornelis J. M.

2011-01-01

Attenuated poxviruses are safe and capable of expressing foreign antigens. Poxviruses are applied in veterinary vaccination and explored as candidate vaccines for humans. However, poxviruses express multiple genes encoding proteins that interfere with components of the innate and adaptive immune response. This manuscript describes two strategies aimed to improve the immunogenicity of the highly attenuated, host-range restricted poxvirus NYVAC: deletion of the viral gene encoding type-I interferon-binding protein and development of attenuated replication-competent NYVAC. We evaluated these newly generated NYVAC mutants, encoding HIV-1 env, gag, pol and nef, for their ability to stimulate HIV-specific CD8 T-cell responses in vitro from blood mononuclear cells of HIV-infected subjects. The new vectors were evaluated and compared to the parental NYVAC vector in dendritic cells (DCs), RNA expression arrays, HIV gag expression and cross-presentation assays in vitro. Deletion of type-I interferon-binding protein enhanced expression of interferon and interferon-induced genes in DCs, and increased maturation of infected DCs. Restoration of replication competence induced activation of pathways involving antigen processing and presentation. Also, replication-competent NYVAC showed increased Gag expression in infected cells, permitting enhanced cross-presentation to HIV-specific CD8 T cells and proliferation of HIV-specific memory CD8 T-cells in vitro. The recombinant NYVAC combining both modifications induced interferon-induced genes and genes involved in antigen processing and presentation, as well as increased Gag expression. This combined replication-competent NYVAC is a promising candidate for the next generation of HIV vaccines. PMID:21347234

Establishment of MicroRNA delivery system by PP7 bacteriophage-like particles carrying cell-penetrating peptide.

PubMed

Sun, Yanli; Sun, Yanhua; Zhao, Ronglan

2017-08-01

MicroRNAs have great therapeutic potential in cancer and other diseases. However, their instability and low in vivo delivery efficiency limits their application. Recombinant PP7 bacteriophage-based virus-like particles (VLPs) could protect microRNAs against rapid degradation by RNase by packaging specific exogenous pre-microRNAs using the pac site. Insertion of a cell-penetrating peptide (CPP) into the AB-loop of VLPs could significantly improve the delivery efficiency of microRNAs into mammalian cells. Unlike other microRNA delivery methods (viral or non-viral vectors), recombinant PP7 VLPs carrying a CPP and microRNA could be efficiently expressed in Escherichia coli using the one-plasmid double expression system. Here we showed that PP7 VLPs carrying a CPP penetrated hepatoma SK-HEP-1 cells and delivered the pre-microRNA-23b, which was processed into a mature product within 24 h; a concentration of 10 nM was sufficient for the inhibition of hepatoma cell migration via the downregulation of liver-intestine cadherin expression. Furthermore, PP7 VLPs carrying a CPP and a pre-microRNA were not infectious, replicative, or cytotoxic. Therefore, recombinant PP7 VLPs can be used for simultaneous and targeted delivery of both microRNAs and peptides because of their ability to package specific exogenous RNA using the pac site and to display peptides. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Self-Amplifying mRNA Vaccines Expressing Multiple Conserved Influenza Antigens Confer Protection against Homologous and Heterosubtypic Viral Challenge

PubMed Central

Magini, Diletta; Giovani, Cinzia; Mangiavacchi, Simona; Maccari, Silvia; Cecchi, Raffaella; Ulmer, Jeffrey B.; De Gregorio, Ennio; Geall, Andrew J.; Brazzoli, Michela; Bertholet, Sylvie

2016-01-01

Current hemagglutinin (HA)-based seasonal influenza vaccines induce vaccine strain-specific neutralizing antibodies that usually fail to provide protection against mismatched circulating viruses. Inclusion in the vaccine of highly conserved internal proteins such as the nucleoprotein (NP) and the matrix protein 1 (M1) was shown previously to increase vaccine efficacy by eliciting cross-reactive T-cells. However, appropriate delivery systems are required for efficient priming of T-cell responses. In this study, we demonstrated that administration of novel self-amplifying mRNA (SAM®) vectors expressing influenza NP (SAM(NP)), M1 (SAM(M1)), and NP and M1 (SAM(M1-NP)) delivered with lipid nanoparticles (LNP) induced robust polyfunctional CD4 T helper 1 cells, while NP-containing SAM also induced cytotoxic CD8 T cells. Robust expansions of central memory (TCM) and effector memory (TEM) CD4 and CD8 T cells were also measured. An enhanced recruitment of NP-specific cytotoxic CD8 T cells was observed in the lungs of SAM(NP)-immunized mice after influenza infection that paralleled with reduced lung viral titers and pathology, and increased survival after homologous and heterosubtypic influenza challenge. Finally, we demonstrated for the first time that the co-administration of RNA (SAM(M1-NP)) and protein (monovalent inactivated influenza vaccine (MIIV)) was feasible, induced simultaneously NP-, M1- and HA-specific T cells and HA-specific neutralizing antibodies, and enhanced MIIV efficacy against a heterologous challenge. In conclusion, systemic administration of SAM vectors expressing conserved internal influenza antigens induced protective immune responses in mice, supporting the SAM® platform as another promising strategy for the development of broad-spectrum universal influenza vaccines. PMID:27525409

Androgen receptor activity modulates responses to cisplatin treatment in bladder cancer.

PubMed

Kashiwagi, Eiji; Ide, Hiroki; Inoue, Satoshi; Kawahara, Takashi; Zheng, Yichun; Reis, Leonardo O; Baras, Alexander S; Miyamoto, Hiroshi

2016-08-02

Cisplatin (CDDP)-based combination chemotherapy remains the mainstream treatment for advanced bladder cancer. However, its efficacy is often limited due to the development of resistance for which underlying mechanisms are poorly understood. Meanwhile, emerging evidence has indicated the involvement of androgen-mediated androgen receptor (AR) signals in bladder cancer progression. In this study, we aimed to investigate whether AR signals have an impact on sensitivity to CDDP in bladder cancer cells. UMUC3-control-short hairpin RNA (shRNA) cells with endogenous AR and AR-negative 647V/5637 cells stably expressing AR were significantly more resistant to CDDP treatment at its pharmacological concentrations, compared with UMUC3-AR-shRNA and 647V-vector/5637-vector control cells, respectively. A synthetic androgen R1881 significantly reduced CDDP sensitivity in UMUC3, 647V-AR, or 5637-AR cells, and the addition of an anti-androgen hydroxyflutamide inhibited the effect of R1881. In these AR-positive cells, R1881 treatment also induced the expression levels of NF-κB, which is known to involve CDDP resistance, and its phosphorylated form, as well as nuclear translocation of NF-κB. In CDDP-resistant bladder cancer sublines established following long-term culture with CDDP, the expression levels of AR as well as NF-κB and phospho-NF-κB were considerably elevated, compared with respective control sublines. In bladder cancer specimens, there was a strong trend to correlate between AR positivity and chemoresistance. These results suggest that AR activation correlates with CDDP resistance presumably via modulating NF-κB activity in bladder cancer cells. Targeting AR during chemotherapy may thus be a useful strategy to overcome CDDP resistance in patients with AR-positive bladder cancer.

The targeting expression of the vascular endothelial growth factor gene in endothelial cells regulated by HRE.ppET-1.

PubMed

Zheng, Xiangrong; Zhang, Shangshang; Yang, Yujia; Wang, Xia; Zhong, Le; Yu, Xiaohe

2008-11-01

The success of gene therapy depends largely on the efficacy of gene delivery vector systems that can deliver genes to target organs or cells selectively and efficiently with minimal toxicity. Here, we show that by using the HRE.ppET-1 regulatory element, we were able to restrict expression of the transgene of vascular endothelial growth factor (VEGF) to endothelial cells exclusively in hypoxic conditions. Eukaryotic expression vectors such as pEGFP-HRE.ppET-1, pcDNA3.1-VEGF+Pa, pcDNA3.1-ppET-1+ EGF+Pa, and pcDNA3.1-HRE.ppET-1+VEGF+Pa were constructed by using a series of nuclear molecule handling methods like PCR, enzyme digestion. The recombinant vectors were transfected into HUVEC cells and HL7702 cells by the lipofectin method. GFP expression was observed with a fluorescence microscope to validate the specificity of expression in endothelial cells under the regulation of HRE.ppET-1 element. Cobalt chloride (final concentration 100 mumol/L) was added to the medium to mimic hypoxia in vitro. After transfection of vectors, the expression of VEGF mRNA was detected by RT-PCR, and the expression of VEGF was detected by Western blotting and ELISA methods under normoxia and hypoxia, respectively. The cell proliferation rate was detected by the MTT test. The expression of GFP revealed that the exterior gene was transcripted effectively in endothelial cells regulated by the HRE.ppET-1 element, while the expression of GFP was very weak in nonendothelial cells. The results of RT-PCR, Western blotting and ELISA showed that VEGF gene expression in the pcDNA3.1-HRE.ppET-1+VEGF+Pa group and in the pcDNA3.1-ppET-1+VEGF+Pa group was higher in hypoxia than it was in normoxia (P<0.05). The MTT test showed that the proliferation rate of HUVEC transfected with HPVA under hypoxia exceeded that of the control group. We conclude that the HRE.ppET-1 element was expressed specifically in endothelial cells, and can increase the expression of VEGF in hypoxia and stimulate proliferation of endothelial cells. Taking advantage of these facts could greatly improve the efficiency of gene therapy. The vector would be valuable for various gene transfer studies targeting endothelial cells.

Downstream targets of HOXB4 in a cell line model of primitive hematopoietic progenitor cells.

PubMed

Lee, Han M; Zhang, Hui; Schulz, Vincent; Tuck, David P; Forget, Bernard G

2010-08-05

Enforced expression of the homeobox transcription factor HOXB4 has been shown to enhance hematopoietic stem cell self-renewal and expansion ex vivo and in vivo. To investigate the downstream targets of HOXB4 in hematopoietic progenitor cells, HOXB4 was constitutively overexpressed in the primitive hematopoietic progenitor cell line EML. Two genome-wide analytical techniques were used: RNA expression profiling using microarrays and chromatin immunoprecipitation (ChIP)-chip. RNA expression profiling revealed that 465 gene transcripts were differentially expressed in KLS (c-Kit(+), Lin(-), Sca-1(+))-EML cells that overexpressed HOXB4 (KLS-EML-HOXB4) compared with control KLS-EML cells that were transduced with vector alone. In particular, erythroid-specific gene transcripts were observed to be highly down-regulated in KLS-EML-HOXB4 cells. ChIP-chip analysis revealed that the promoter region for 1910 genes, such as CD34, Sox4, and B220, were occupied by HOXB4 in KLS-EML-HOXB4 cells. Side-by-side comparison of the ChIP-chip and RNA expression profiling datasets provided correlative information and identified Gp49a and Laptm4b as candidate "stemness-related" genes. Both genes were highly ranked in both dataset lists and have been previously shown to be preferentially expressed in hematopoietic stem cells and down-regulated in mature hematopoietic cells, thus making them attractive candidates for future functional studies in hematopoietic cells.

A Novel Expression Cassette of Lyssavirus Shows that the Distantly Related Mokola Virus Can Rescue a Defective Rabies Virus Genome

PubMed Central

Le Mercier, Philippe; Jacob, Yves; Tanner, Kyle; Tordo, Noël

2002-01-01

By comparing three expression vectors for the rabies virus (Rv) minigenome, we show that the characteristic of the Rv RNA is important for efficient rescue despite its not being crucial for replication. Moreover, we show that the coexpression of the viral proteins from helper Rv and Mokola virus could rescue the Rv minigenome while Rv-related European bat lyssavirus 1 could not, suggesting that the signals controlling transcription and replication are conserved in the distantly related Rv and Mokola virus. PMID:11799201

Characterization of biomolecular nanoconjugates by high-throughput delivery and spectroscopic difference

PubMed Central

DeLong, Robert K; Risor, Azure; Kanomata, Masaaki; Laymon, Amanda; Jones, Brooke; Zimmerman, Scott D; Williams, Joseph; Witkowski, Colette; Warner, Mathew; Ruff, Michael; Garrad, Richard; Fallon, John K; Hickey, Anthony J; Sedaghat-Herati, Reza

2013-01-01

Aims Nanoparticle conjugates have the potential for delivering siRNA, splice-shifting oligomers or nucleic acid vaccines, and can be applicable to anticancer therapeutics. This article compares tripartite conjugates with gold nanoparticles or synthetic methoxypoly(ethylene glycol)-block-polyamidoamine dendrimers. Materials & methods Interactions with model liposomes of a 1:1 molar ratio of tripalmitin:cholesterol or phospholipid:cholesterol were investigated by high-throughput absorbance, as well as fluorescence difference and cellular luminescence assays. Results Spectral differences and dynamic light-scattering spectroscopy shifts demonstrated the interaction of conjugates with liposomes. Biological activity was demonstrated by upregulation of gene expression via splice-shifting oligomers, delivery of anti-B-Raf siRNA in cultured human cancer cells or tuberculosis antigen 85B plasmid expression vector in a coculture model of antigen presentation. Conclusion The data suggests that gold nanoparticles and methoxypoly(ethylene glycol)-block-polyamidoamine dendrimer nanoconjugates may have potential for binding, stabilization and delivery of splice-shifting oligomers, siRNA and nucleic acid vaccines for preclinical trials. PMID:22943129

Adenovirus vector-mediated ex vivo gene transfer of brain-derived neurotrophic factor (BDNF) tohuman umbilical cord blood-derived mesenchymal stem cells (UCB-MSCs) promotescrush-injured rat sciatic nerve regeneration.

PubMed

Hei, Wei-Hong; Almansoori, Akram A; Sung, Mi-Ae; Ju, Kyung-Won; Seo, Nari; Lee, Sung-Ho; Kim, Bong-Ju; Kim, Soung-Min; Jahng, Jeong Won; He, Hong; Lee, Jong-Ho

2017-03-16

This study was designed toinvestigate the efficacy of adenovirus vector-mediated brain-derived neurotrophic factor (BDNF) ex vivo gene transfer to human umbilical cord blood-derived mesenchymal stem cells (UCB-MSCs) in a rat sciatic nerve crush injury model. BDNF protein and mRNA expression after infection was checked through an enzyme-linked immunosorbent assay (ELISA) and quantitative real-time polymerase chain reaction (qRT-PCR). Male Sprague-Dawley rats (200-250g, 6 weeks old) were distributed into threegroups (n=20 each): the control group, UCB-MSC group, and BDNF-adenovirus infected UCB-MSC (BDNF-Ad+UCB-MSC) group. UCB-MSCs (1×10 6 cells/10μl/rat) or BDNF-Ad+UCB-MSCs (1×10 6 cells/10μl/rat)were transplantedinto the rats at the crush site immediately after sciatic nerve injury. Cell tracking was done with PKH26-labeled UCB-MSCs and BDNF-Ad+UCB-MSCs (1×10 6 cells/10μl/rat). The rats were monitored for 4 weeks post-surgery. Results showed that expression of BDNF at both the protein and mRNA levels was higher inthe BDNF-Ad+UCB-MSC group compared to theUCB-MSC group in vitro.Moreover, BDNF mRNA expression was higher in both UCB-MSC group and BDNF-Ad+ UCB-MSC group compared tothe control group, and BDNF mRNA expression in theBDNF-Ad+UCB-MSC group was higher than inboth other groups 5days after surgeryin vivo. Labeled neurons in the dorsal root ganglia (DRG), axon counts, axon density, and sciatic function index were significantly increased in the UCB-MSC and BDNF-Ad+ UCB-MSCgroupscompared to the controlgroup four weeksaftercell transplantation. Importantly,the BDNF-Ad+UCB-MSCgroup exhibited more peripheral nerve regeneration than the other two groups.Our results indicate thatboth UCB-MSCs and BDNF-Ad+UCB-MSCscan improve rat sciatic nerve regeneration, with BDNF-Ad+UCB-MSCsshowing a greater effectthan UCB-MSCs. Copyright © 2017 Elsevier B.V. All rights reserved.

Nucleotide Sequence of the Hantaan Virus S RNA Segment and Expression of Encoded Proteins

DTIC Science & Technology

1987-11-03

human vaccinia vaccination ). A second dose of virus was given in the same ...vaccinia vector. A necessary first step in vaccine investigation woul d be to determine if animals infected with the two HTV recombinant viruses can ...vaccinia virus (Buller et al., 1985). Mice were infected by tail scarification since it is identical to the method used to vaccinate 169 humans

A New Direction of Cancer Classification: Positive Effect of Low-Ranking MicroRNAs.

PubMed

Li, Feifei; Piao, Minghao; Piao, Yongjun; Li, Meijing; Ryu, Keun Ho

2014-10-01

Many studies based on microRNA (miRNA) expression profiles showed a new aspect of cancer classification. Because one characteristic of miRNA expression data is the high dimensionality, feature selection methods have been used to facilitate dimensionality reduction. The feature selection methods have one shortcoming thus far: they just consider the problem of where feature to class is 1:1 or n:1. However, because one miRNA may influence more than one type of cancer, human miRNA is considered to be ranked low in traditional feature selection methods and are removed most of the time. In view of the limitation of the miRNA number, low-ranking miRNAs are also important to cancer classification. We considered both high- and low-ranking features to cover all problems (1:1, n:1, 1:n, and m:n) in cancer classification. First, we used the correlation-based feature selection method to select the high-ranking miRNAs, and chose the support vector machine, Bayes network, decision tree, k-nearest-neighbor, and logistic classifier to construct cancer classification. Then, we chose Chi-square test, information gain, gain ratio, and Pearson's correlation feature selection methods to build the m:n feature subset, and used the selected miRNAs to determine cancer classification. The low-ranking miRNA expression profiles achieved higher classification accuracy compared with just using high-ranking miRNAs in traditional feature selection methods. Our results demonstrate that the m:n feature subset made a positive impression of low-ranking miRNAs in cancer classification.

Short Hairpin RNA Gene Silencing of Prolyl Hydroxylase-2 with a Minicircle Vector Improves Neovascularization of Hindlimb Ischemia

PubMed Central

Lijkwan, Maarten A.; Hellingman, Alwine A.; Bos, Ernst J.; van der Bogt, Koen E.A.; Huang, Mei; Kooreman, Nigel G.; de Vries, Margreet R.; Peters, Hendrika A.B.; Robbins, Robert C.; Quax, Paul H.A.

2014-01-01

Abstract In this study, we target the hypoxia inducible factor-1 alpha (HIF-1-alpha) pathway by short hairpin RNA interference therapy targeting prolyl hydroxylase-2 (shPHD2). We use the minicircle (MC) vector technology as an alternative for conventional nonviral plasmid (PL) vectors in order to improve neovascularization after unilateral hindlimb ischemia in a murine model. Gene expression and transfection efficiency of MC and PL, both in vitro and in vivo, were assessed using bioluminescence imaging (BLI) and firefly luciferase (Luc) reporter gene. C57Bl6 mice underwent unilateral electrocoagulation of the femoral artery and gastrocnemic muscle injection with MC-shPHD2, PL-shPHD2, or phosphate-buffered saline (PBS) as control. Blood flow recovery was monitored using laser Doppler perfusion imaging, and collaterals were visualized by immunohistochemistry and angiography. MC-Luc showed a 4.6-fold higher in vitro BLI signal compared with PL-Luc. BLI signals in vivo were 4.3×105±3.3×105 (MC-Luc) versus 0.4×105±0.3×105 (PL-Luc) at day 28 (p=0.016). Compared with PL-shPHD2 or PBS, MC-shPHD2 significantly improved blood flow recovery, up to 50% from day 3 until day 14 after ischemia induction. MC-shPHD2 significantly increased collateral density and capillary density, as monitored by alpha-smooth muscle actin expression and CD31+ expression, respectively. Angiography data confirmed the histological findings. Significant downregulation of PHD2 mRNA levels by MC-shPHD2 was confirmed by quantitative polymerase chain reaction. Finally, Western blot analysis confirmed significantly higher levels of HIF-1-alpha protein by MC-shPHD2, compared with PL-shPHD2 and PBS. This study provides initial evidence of a new potential therapeutic approach for peripheral artery disease. The combination of HIF-1-alpha pathway targeting by shPHD2 with the robust nonviral MC plasmid improved postischemic neovascularization, making this approach a promising potential treatment option for critical limb ischemia. PMID:24090375

A Higher-Order Generalized Singular Value Decomposition for Comparison of Global mRNA Expression from Multiple Organisms

PubMed Central

Ponnapalli, Sri Priya; Saunders, Michael A.; Van Loan, Charles F.; Alter, Orly

2011-01-01

The number of high-dimensional datasets recording multiple aspects of a single phenomenon is increasing in many areas of science, accompanied by a need for mathematical frameworks that can compare multiple large-scale matrices with different row dimensions. The only such framework to date, the generalized singular value decomposition (GSVD), is limited to two matrices. We mathematically define a higher-order GSVD (HO GSVD) for N≥2 matrices , each with full column rank. Each matrix is exactly factored as Di = UiΣiVT, where V, identical in all factorizations, is obtained from the eigensystem SV = VΛ of the arithmetic mean S of all pairwise quotients of the matrices , i≠j. We prove that this decomposition extends to higher orders almost all of the mathematical properties of the GSVD. The matrix S is nondefective with V and Λ real. Its eigenvalues satisfy λk≥1. Equality holds if and only if the corresponding eigenvector vk is a right basis vector of equal significance in all matrices Di and Dj, that is σi,k/σj,k = 1 for all i and j, and the corresponding left basis vector ui,k is orthogonal to all other vectors in Ui for all i. The eigenvalues λk = 1, therefore, define the “common HO GSVD subspace.” We illustrate the HO GSVD with a comparison of genome-scale cell-cycle mRNA expression from S. pombe, S. cerevisiae and human. Unlike existing algorithms, a mapping among the genes of these disparate organisms is not required. We find that the approximately common HO GSVD subspace represents the cell-cycle mRNA expression oscillations, which are similar among the datasets. Simultaneous reconstruction in the common subspace, therefore, removes the experimental artifacts, which are dissimilar, from the datasets. In the simultaneous sequence-independent classification of the genes of the three organisms in this common subspace, genes of highly conserved sequences but significantly different cell-cycle peak times are correctly classified. PMID:22216090

Armored RNA Technology for Production of Ribonuclease-Resistant Viral RNA Controls and Standards

PubMed Central

Pasloske, Brittan L.; Walkerpeach, Cindy R.; Obermoeller, R. Dawn; Winkler, Matthew; DuBois, Dwight B.

1998-01-01

The widespread use of sensitive assays for the detection of viral and cellular RNA sequences has created a need for stable, well-characterized controls and standards. We describe the development of a versatile, novel system for creating RNase-resistant RNA. “Armored RNA” is a complex of MS2 bacteriophage coat protein and RNA produced in Escherichia coli by the induction of an expression plasmid that encodes the coat protein and an RNA standard sequence. The RNA sequences are completely protected from RNase digestion within the bacteriophage-like complexes. As a prototype, a 172-base consensus sequence from a portion of the human immunodeficiency virus type 1 (HIV-1) gag gene was synthesized and cloned into the packaging vector used to produce the bacteriophage-like particles. After production and purification, the resulting HIV-1 Armored RNA particles were shown to be resistant to degradation in human plasma and produced reproducible results in the Amplicor HIV-1 Monitor assay for 180 days when stored at −20°C or for 60 days at 4°C. Additionally, Armored RNA preparations are homogeneous and noninfectious. PMID:9817878

Protein arginine Methyltransferase 8 gene is expressed in pluripotent stem cells and its expression is modulated by the transcription factor Sox2.

PubMed

Solari, Claudia; Echegaray, Camila Vázquez; Luzzani, Carlos; Cosentino, María Soledad; Waisman, Ariel; Petrone, María Victoria; Francia, Marcos; Sassone, Alina; Canizo, Jésica; Sevlever, Gustavo; Barañao, Lino; Miriuka, Santiago; Guberman, Alejandra

2016-04-22

Addition of methyl groups to arginine residues is catalyzed by a group of enzymes called Protein Arginine Methyltransferases (Prmt). Although Prmt1 is essential in development, its paralogue Prmt8 has been poorly studied. This gene was reported to be expressed in nervous system and involved in neurogenesis. In this work, we found that Prmt8 is expressed in mouse embryonic stem cells (ESC) and in induced pluripotent stem cells, and modulated along differentiation to neural precursor cells. We found that Prmt8 promoter activity is induced by the pluripotency transcription factors Oct4, Sox2 and Nanog. Moreover, endogenous Prmt8 mRNA levels were reduced in ESC transfected with Sox2 shRNA vector. As a whole, our results indicate that Prmt8 is expressed in pluripotent stem cells and its transcription is modulated by pluripotency transcription factors. These findings suggest that besides its known function in nervous system, Prmt8 could play a role in pluripotent stem cells. Copyright © 2016 Elsevier Inc. All rights reserved.

Targeted expression of suicide gene by tissue-specific promoter and microRNA regulation for cancer gene therapy.

PubMed

Danda, Ravikanth; Krishnan, Gopinath; Ganapathy, Kalaivani; Krishnan, Uma Maheswari; Vikas, Khetan; Elchuri, Sailaja; Chatterjee, Nivedita; Krishnakumar, Subramanian

2013-01-01

In order to realise the full potential of cancer suicide gene therapy that allows the precise expression of suicide gene in cancer cells, we used a tissue specific Epithelial cell adhesion molecule (EpCAM) promoter (EGP-2) that directs transgene Herpes simplex virus-thymidine kinase (HSV-TK) expression preferentially in EpCAM over expressing cancer cells. EpCAM levels are considerably higher in retinoblastoma (RB), a childhood eye cancer with limited expression in normal cells. Use of miRNA regulation, adjacent to the use of the tissue-specific promoter, would provide the second layer of control to the transgene expression only in the tumor cells while sparing the normal cells. To test this hypothesis we cloned let-7b miRNA targets in the 3'UTR region of HSV-TK suicide gene driven by EpCAM promoter because let-7 family miRNAs, including let-7b, were found to be down regulated in the RB tumors and cell lines. We used EpCAM over expressing and let-7 down regulated RB cell lines Y79, WERI-Rb1 (EpCAM (+ve)/let-7b(down-regulated)), EpCAM down regulated, let-7 over expressing normal retinal Müller glial cell line MIO-M1(EpCAM (-ve)/let-7b(up-regulated)), and EpCAM up regulated, let-7b up-regulated normal thyroid cell line N-Thy-Ori-3.1(EpCAM (+ve)/let-7b(up-regulated)) in the study. The cell proliferation was measured by MTT assay, apoptosis was measured by probing cleaved Caspase3, EpCAM and TK expression were quantified by Western blot. Our results showed that the EGP2-promoter HSV-TK (EGP2-TK) construct with 2 or 4 copies of let-7b miRNA targets expressed TK gene only in Y79, WERI-Rb-1, while the TK gene did not express in MIO-M1. In summary, we have developed a tissue-specific, miRNA-regulated dual control vector, which selectively expresses the suicide gene in EpCAM over expressing cells.

The NS3 protein of Rice hoja blanca tenuivirus suppresses RNA silencing in plant and insect hosts by efficiently binding both siRNAs and miRNAs

PubMed Central

Hemmes, Hans; Lakatos, Lóránt; Goldbach, Rob; Burgyán, József; Prins, Marcel

2007-01-01

RNA silencing plays a key role in antiviral defense as well as in developmental processes in plants and insects. Negative strand RNA viruses such as the plant virus Rice hoja blanca tenuivirus (RHBV) replicate in plants and in their insect transmission vector. Like most plant-infecting viruses, RHBV encodes an RNA silencing suppressor, the NS3 protein, and here it is demonstrated that this protein is capable of suppressing RNA silencing in both plants and insect cells. Biochemical analyses showed that NS3 efficiently binds siRNA as well as miRNA molecules. Binding of NS3 is greatly influenced by the size of small RNA molecules, as 21 nucleotide (nt) siRNA molecules are bound > 100 times more efficiently than 26 nt species. Competition assays suggest that the activity of NS3 is based on binding to siRNAs prior to strand separation during the assembly of the RNA-induced silencing complex. In addition, NS3 has a high affinity for miRNA/miRNA* duplexes, indicating that its activity might also interfere with miRNA-regulated gene expression in both insects and plants. PMID:17513697

Knockdown of Progesterone Receptor (PGR) in Macaque Granulosa Cells Disrupts Ovulation and Progesterone Production.

PubMed

Bishop, Cecily V; Hennebold, Jon D; Kahl, Christoph A; Stouffer, Richard L

2016-05-01

Adenoviral vectors (vectors) expressing short-hairpin RNAs complementary to macaque nuclear progesterone (P) receptor PGR mRNA (shPGR) or a nontargeting scrambled control (shScram) were used to determine the role PGR plays in ovulation/luteinization in rhesus monkeys. Nonluteinized granulosa cells collected from monkeys (n = 4) undergoing controlled ovarian stimulation protocols were exposed to either shPGR, shScram, or no virus for 24 h; human chorionic gonadotropin (hCG) was then added to half of the wells to induce luteinization (luteinized granulosa cells [LGCs]; n = 4-6 wells/treatment/monkey). Cells/media were collected 48, 72, and 120 h postvector for evaluation of PGR mRNA and P levels. Addition of hCG increased (P < 0.05) PGR mRNA and medium P levels in controls. However, a time-dependent decline (P < 0.05) in PGR mRNA and P occurred in shPGR vector groups. Injection of shPGR, but not shScram, vector into the preovulatory follicle 20 h before hCG administration during controlled ovulation protocols prevented follicle rupture in five of six monkeys as determined by laparoscopic evaluation, with a trapped oocyte confirmed in three of four follicles of excised ovaries. Injection of shPGR also prevented the rise in serum P levels following the hCG bolus compared to shScram (P < 0.05). Nuclear PGR immunostaining was undetectable in granulosa cells from shPGR-injected follicles, compared to intense staining in shScram controls. Thus, the nuclear PGR appears to mediate P action in the dominant follicle promoting ovulation in primates. In vitro and in vivo effects of PGR knockdown in LGCs also support the hypothesis that P enhances its own synthesis in the primate corpus luteum by promoting luteinization. © 2016 by the Society for the Study of Reproduction, Inc.

[Regulatory effect and mechanism of RNA binding motif protein 38 on the expression of progesterone receptor in human breast cancer ZR-75-1 cells].

PubMed

Lou, P P; Li, C L; Xia, T S; Shi, L; Wu, J; Zhou, X J; Wang, Y; Ding, Q

2016-06-23

To investigate the regulatory mechanism of RNA binding motif protein 38 (RNPC1) on the expression of progesterone receptor (PR) in breast cancer cell line ZR-75-1. Lentiviral vector was used to induce overexpression of RNPC1 in ZR-75-1 cells. qRT-PCR and Western blot were used to assess the regulatory effect of RNPC1 on PR expression. Actinomycin was used to detect the regulatory mechanism involved. Immunohistochemical (IHC) staining was used to determine the protein expression of RNPC1 and PR in 80 breast cancer tissues. IHC staining showed that the expression of RNPC1 was significantly higher in the PR positive breast cancer tissues than that in the PR negative breast cancer tissues (P<0.05). The qRT-PCR results showed that overexpression of RNPC1 in ZR-75-1 cells significantly upregulated the mRNA level of PR (1.764±0.028 vs. 1.001±0.037, P<0.01), whereas knockdown of RNPC1 did the opposite (0.579± 0.007 vs. 1.000±0.002, P<0.01). The Western blot results also showed that overexpression of RNPC1 up-regulated PR levels, while knockdown of RNPC1 resulted in down-regulation of PR levels in the ZR-75-1 cells.The actinomycin assay showed that overexpression of RNPC1 increased the mRNA stability of PR. The half-life of PR mRNA was increased from 4.0 h to 6.5 h. Knockdown of RNPC1 decreased the mRNA stability of PR and the half-life of PR transcript was decreased from 4.1 h to 3.0 h. RNPC1 plays a crucial role in regulating the expression of PR in breast cancer ZR-75-1 cells.

Avian Paramyxovirus Type-3 as a Vaccine Vector: Identification of a Genome Location for High Level Expression of a Foreign Gene

PubMed Central

Yoshida, Asuka; Samal, Siba K.

2017-01-01

Avian paramyxovirus serotype 3 (APMV-3) causes infection in a wide variety of avian species, but it does not cause apparent diseases in chickens. On the contrary, APMV-1, also known as Newcastle disease virus (NDV), can cause severe disease in chickens. Currently, natural low virulence strains of NDV are used as live-attenuated vaccines throughout the world. NDV is also being evaluated as a vaccine vector against poultry pathogens. However, due to routine vaccination programs, chickens often possess pre-existing antibodies against NDV, which may cause the chickens to be less sensitive to recombinant NDV vaccines expressing antigens of other avian pathogens. Therefore, it may be possible for an APMV-3 vector vaccine to circumvent this issue. In this study, we determined the optimal insertion site in the genome of APMV-3 for high level expression of a foreign gene. We generated recombinant APMV-3 viruses expressing the green fluorescent protein (GFP) by inserting the GFP gene at five different intergenic regions in the genome. The levels of GFP transcription and translation were evaluated. Interestingly, the levels of GFP transcription and translation did not follow the 3′-to-5′ attenuation mechanism of non-segmented, negative-sense RNA viruses. The insertion of GFP gene into the P-M gene junction resulted in higher level of expression of GFP than when the gene was inserted into the upstream N-P gene junction. Unlike NDV, insertion of GFP did not attenuate the growth efficiency of AMPV-3. Thus, APMV-3 could be a more useful vaccine vector for avian pathogens than NDV. PMID:28473820

Avian Paramyxovirus Type-3 as a Vaccine Vector: Identification of a Genome Location for High Level Expression of a Foreign Gene.

PubMed

Yoshida, Asuka; Samal, Siba K

2017-01-01

Avian paramyxovirus serotype 3 (APMV-3) causes infection in a wide variety of avian species, but it does not cause apparent diseases in chickens. On the contrary, APMV-1, also known as Newcastle disease virus (NDV), can cause severe disease in chickens. Currently, natural low virulence strains of NDV are used as live-attenuated vaccines throughout the world. NDV is also being evaluated as a vaccine vector against poultry pathogens. However, due to routine vaccination programs, chickens often possess pre-existing antibodies against NDV, which may cause the chickens to be less sensitive to recombinant NDV vaccines expressing antigens of other avian pathogens. Therefore, it may be possible for an APMV-3 vector vaccine to circumvent this issue. In this study, we determined the optimal insertion site in the genome of APMV-3 for high level expression of a foreign gene. We generated recombinant APMV-3 viruses expressing the green fluorescent protein (GFP) by inserting the GFP gene at five different intergenic regions in the genome. The levels of GFP transcription and translation were evaluated. Interestingly, the levels of GFP transcription and translation did not follow the 3'-to-5' attenuation mechanism of non-segmented, negative-sense RNA viruses. The insertion of GFP gene into the P-M gene junction resulted in higher level of expression of GFP than when the gene was inserted into the upstream N-P gene junction. Unlike NDV, insertion of GFP did not attenuate the growth efficiency of AMPV-3. Thus, APMV-3 could be a more useful vaccine vector for avian pathogens than NDV.

Application of Mutated miR-206 Target Sites Enables Skeletal Muscle-specific Silencing of Transgene Expression of Cardiotropic AAV9 Vectors

PubMed Central

Geisler, Anja; Schön, Christian; Größl, Tobias; Pinkert, Sandra; Stein, Elisabeth A; Kurreck, Jens; Vetter, Roland; Fechner, Henry

2013-01-01

Insertion of completely complementary microRNA (miR) target sites (miRTS) into a transgene has been shown to be a valuable approach to specifically repress transgene expression in non-targeted tissues. miR-122TS have been successfully used to silence transgene expression in the liver following systemic application of cardiotropic adeno-associated virus (AAV) 9 vectors. For miR-206–mediated skeletal muscle-specific silencing of miR-206TS–bearing AAV9 vectors, however, we found this approach failed due to the expression of another member (miR-1) of the same miR family in heart tissue, the intended target. We introduced single-nucleotide substitutions into the miR-206TS and searched for those which prevented miR-1–mediated cardiac repression. Several mutated miR-206TS (m206TS), in particular m206TS-3G, were resistant to miR-1, but remained fully sensitive to miR-206. All these variants had mismatches in the seed region of the miR/m206TS duplex in common. Furthermore, we found that some m206TS, containing mismatches within the seed region or within the 3′ portion of the miR-206, even enhanced the miR-206– mediated transgene repression. In vivo expression of m206TS-3G– and miR-122TS–containing transgene of systemically applied AAV9 vectors was strongly repressed in both skeletal muscle and the liver but remained high in the heart. Thus, site-directed mutagenesis of miRTS provides a new strategy to differentiate transgene de-targeting of related miRs. PMID:23439498

Improved photobio-H2 production regulated by artificial miRNA targeting psbA in green microalga Chlamydomonas reinhardtii.

PubMed

Li, Hui; Liu, Yanmei; Wang, Yuting; Chen, Meirong; Zhuang, Xiaoshan; Wang, Chaogang; Wang, Jiangxin; Hu, Zhangli

2018-01-01

Sulfur-deprived cultivation of Chlamydomonas reinhardtii , referred as "two-stage culture" transferring the cells from regular algal medium to sulfur-deplete one, has been extensively studied to improve photobio-H 2 production in this green microalga. During sulfur-deprivation treatment, the synthesis of a key component of photosystem II complex, D1 protein, was inhibited and improved photobio-H 2 production could be established in C. reinhardtii . However, separation of algal cells from a regular liquid culture medium to a sulfur-deprived one is not only a discontinuous process, but also a cost- and time-consuming operation. More applicable and economic alternatives for sustained H 2 production by C. reinhardtii are still highly required. In the present study, a significant improvement in photobio-H 2 production was observed in the transgenic green microalga C. reinhardtii , which employed a newly designed strategy based on a heat-inducible artificial miRNA (amiRNA) expression system targeting D1-encoded gene, psbA . A transgenic algal strain referred as "amiRNA-D1" has been successfully obtained by transforming the expression vector containing a heat-inducible promoter. After heat shock conducted in the same algal cultures, the expression of amiRNA-D1 was detected increased 15-fold accompanied with a 73% decrease of target gene psbA . More interestingly, this transgenic alga accumulated about 60% more H 2 content than the wild-type strain CC-849 at the end of 7-day cultivation. The photobio-H 2 production in the engineered transgenic alga was significantly improved. Without imposing any nutrient-deprived stress, this novel strategy provided a convenient and efficient way for regulation of photobio-H 2 production in green microalga by simply "turn on" the expression of a designed amiRNA.

Retroviral gene transfer of an antisense construct against membrane type 1 matrix metalloproteinase reduces the invasiveness of rheumatoid arthritis synovial fibroblasts.

PubMed

Rutkauskaite, Edita; Volkmer, Dagmar; Shigeyama, Yukio; Schedel, Jörg; Pap, Geza; Müller-Ladner, Ulf; Meinecke, Ingmar; Alexander, Dorothea; Gay, Renate E; Drynda, Susanne; Neumann, Wolfram; Michel, Beat A; Aicher, Wilhelm K; Gay, Steffen; Pap, Thomas

2005-07-01

Membrane type 1 matrix metalloproteinase (MT1-MMP) is expressed prominently in rheumatoid arthritis synovial fibroblasts (RASFs), but the specific contribution of MT1-MMP to fibroblast-mediated destruction of articular cartilage is incompletely understood. This study used gene transfer of an antisense expression construct to assess the effects of MT1-MMP inhibition on the invasiveness of RASFs. Retroviral gene transfer of a pLXIN vector-based antisense RNA expression construct (MT1-MMPalphaS) to MT1-MMP was used to stably transduce RASFs. Levels of MT1-MMP RNA and protein were determined by quantitative polymerase chain reaction, Western blotting, and immunocytochemistry in MT1-MMPalphaS-transduced RASFs as well as in control cells, with monitoring for 60 days. The effects of MT1-MMPalphaS on the invasiveness of RASFs were analyzed in the SCID mouse co-implantation model of RA. MT1-MMPalphaS-transduced RASFs produced high levels of antisense RNA that exceeded endogenous levels of MT1-MMP messenger RNA by 15-fold and resulted in a down-regulation of MT1-MMP at the protein level. Inhibition of MT1-MMP production was maintained for 60 days and significantly reduced the invasiveness of RASFs in the SCID mouse model. Whereas prominent invasion into cartilage by non-transduced and mock-transduced RASFs was observed (mean invasion scores 3.0 and 3.1, respectively), MT1-MMPalphaS-transduced cells showed only moderate invasiveness (mean invasion score 1.8; P < 0.05). The data demonstrate that an antisense RNA expression construct against MT1-MMP can be generated and expressed in RASFs for at least 60 days. Inhibition of MT1-MMP significantly reduces the cartilage degradation by RASFs.

Regulation of peroxisome proliferator-activated receptor gamma on milk fat synthesis in dairy cow mammary epithelial cells.

PubMed

Liu, Lili; Lin, Ye; Liu, Lixin; Wang, Lina; Bian, Yanjie; Gao, Xuejun; Li, Qingzhang

2016-12-01

Peroxisome proliferator-activated receptor gamma (PPARγ) participates in lipogenesis in rats, goats, and humans. However, the exact mechanism of PPARγ regulation on milk fat synthesis in dairy cow mammary epithelial cells (DCMECs) remains largely unexplored. The aim of this study was to investigate the role of PPARγ regarding milk fat synthesis in DCMECs and to ascertain whether milk fat precursor acetic acid and palmitic acid could interact with PPARγ signaling to regulate milk fat synthesis. For this study, we examined the effects of PPARγ overexpression and gene silencing on cell growth, triacylglycerol synthesis, and the messenger RNA (mRNA) and protein expression levels of genes involved in milk fat synthesis in DCMECs. In addition, we investigated the influences of acetic acid and palmitic acid on the mRNA and protein levels of milk lipogenic genes and triacylglycerol synthesis in DCMECs transfected with PPARγ small interfering RNA (siRNA) and PPARγ expression vector. The results showed that when PPARγ was silenced, cell viability, proliferation, and triacylglycerol secretion were obviously reduced. Gene silencing of PPARγ significantly downregulated the expression levels of milk fat synthesis-related genes in DCMECs. PPARγ overexpression improved cell viability, proliferation, and triacylglycerol secretion. The expression levels of milk lipogenic genes were significantly increased when PPARγ was overexpressed. Acetic acid and palmitic acid could markedly improve triacylglycerol synthesis and upregulate the expression levels of PPARγ and other lipogenic genes in DCMECs. These results suggest that PPARγ is a positive regulator of milk fat synthesis in DCMECs and that acetic acid and palmitic acid could partly regulate milk fat synthesis in DCMECs via PPARγ signaling.

Gene Silencing by Gold Nanoshell-Mediated Delivery and Laser-Triggered Release of Antisense Oligonucleotide and siRNA

PubMed Central

Huschka, Ryan; Barhoumi, Aoune; Liu, Qing; Roth, Jack A.; Ji, Lin; Halas, Naomi J.

2013-01-01

The approach of RNA interference (RNAi)- using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein- is very useful in dissecting genetic function and holds significant promise as a molecular therapeutic. A major obstacle in achieving gene silencing with RNAi technology is the systemic delivery of therapeutic oligonucleotides. Here we demonstrate an engineered gold nanoshell (NS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer covalently attached to the NS surface (NS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotides, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. Controlled release of the captured therapeutic oligonucleotides in each case is accomplished by continuous wave NIR laser irradiation at 800 nm, near the resonance wavelength of the nanoshell. Fluorescently tagged oligonucleotides were used to monitor the time-dependent release process and light-triggered endosomal release. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and gene silencing mediated by the NS-PLL carrying GFP gene-specific single-stranded DNA antisense oligonucleotide (AON-GFP), or a double-stranded siRNA (siRNA-GFP), in vitro. Light-triggered delivery resulted in ∼ 47% and ∼49% downregulation of the targeted GFP expression by AON-GFP and siRNA-GFP, respectively. Cytotoxicity induced by both the NS-PLL delivery vector and by laser irradiation is minimal, as demonstrated by a XTT cell proliferation assay. PMID:22862291

Caspase-3 short hairpin RNAs: a potential therapeutic agent in neurodegeneration of aluminum-exposed animal model.

PubMed

Zhang, Qinli; Li, Na; Jiao, Xia; Qin, Xiujun; Kaur, Ramanjit; Lu, Xiaoting; Song, Jing; Wang, Linping; Wang, Junming; Niu, Qiao

2014-01-01

There is abundant evidence supporting the role of caspases in the development of neurodegenerative disease, including Alzheimer's disease (AD). Therefore, regulating the activity of caspases has been considered as a therapeutic target. However, all the efforts on AD therapy using pan-caspase inhibitors have failed because of uncontrolled adverse effects. Alternatively, the specific knockdown of caspase-3 gene through RNA interference (RNAi) could serve as a future potential therapeutic strategy. The aim of the present study is to down-regulate the expression of caspase-3 gene using lentiviral vector-mediated caspase-3 short hairpin RNA (LV-Caspase-3 shRNA). The effect of LV-Caspase-3 shRNA on apoptosis induced by aluminum (Al) was investigated in primary cultured cortical neurons and validated in C57BL/6J mice. The results indicated an increase in apoptosis and caspase-3 expression in primary cultured neurons and the cortex ofmice exposed to Al, which could be down-regulated by LV-Caspase-3 shRNA. Furthermore, LV-Caspase-3 shRNA reduced neural cell death and improved learning and memory in C57BL/6J mice treated with Al. Our results suggest that LV-caspase-3 shRNA is a potential therapeutic agent to prevent neurodegeneration and cognitive dysfunction in aluminum- exposed animal models. The findings provide a rational gene therapy strategy for AD.

Manipulation and Biological Applications of Gold Nanorods

NASA Astrophysics Data System (ADS)

Rostro-Kohanloo, Betty Catalina

This thesis compared anionic polyelectrolyte wrapping stabilization with poly(sodium 4-stryene-sulfonate), (PSS), polyelectrolyte and methoxy (polyethylene glycol)-thiol (mPEG(5000)-SH) strategies. From this data the critical gold nanorod (GNR) and cetyl-trimethylammonium bromide (CTAB) concentration ratio needed for GNR stabilization was determined using optical and chemical extraction methods. This was followed by functionalization with a heterobifunctional Polyethylene glycol (PEG) linker, such as a-thio-w-carboxy poly(ethylene glycol) termed t-PEG-c and carbodiimide chemistries for antibody linkage with Immunoglobulin G (IgG), and epidermal growth factor receptor (EGFR) based Human Epidermal growth factor Receptor 2 (Her2), and Cetuximab (C225) antibodies, for in vitro cancer cell targeting. Confocal, two-photon luminescence (TPL), and dark scattering microscopy, and fluorescence, zeta potential, and Nanoparticle Enzyme-linked immunosorbent assay (ELISA) were used to monitor changes to the GNR surface. An untreatable form of bladder cancer was then studied using the t-GNR-PEG-c-Ab bioconjugates with C225 antibody, which housed a glyceraldehyde-3-phosphate (GAPDH), Fluorescein isothiocyanate (FITC) labeled siRNA, termed GAPDH-siRNA-FITC, which was included within a Luciferase based plasmid. A salt based electrostatic heating method was used to trap the GAPDH-siRNA-FITC from the PEG layer by activating the PEG polymer pour point, while a laser based heating system was used for in vitro release inside cancer cells. The down regulation of the GAPDH gene was targeted by the siRNA. as GAPDH has been shown to be up-regulated in many cancers and down-regulated by chemotherapeutic drugs. Cell culture, and subsequent imaging by transmission electron microscopy (TEM), TPL and confocal microscopy were used to view the internalized conjugates, and reverse transcriptase polymerase chain reaction (RT-PCR) were used to determine if the release of the GAPDH-siRNA caused a reduction in the expression of GAPDH-mRNA. Plasmonic gene silencing of the gene by the GAPDH-siRNA was then compared to a lipid based Dharmafect control in terms of transfection ability. RT-PCR results evidenced gene silencing of the plasmonic-GAPDH-siRNA vector when compared to the Dharmafect control. Silencing likely resulted from the zwitterionic charges of the plasmonic vector and the encapsulated GAPDH-siRNA, which yielded near neutral charge tendencies. This differs significantly from the Dharmafect lipid vector, which is cationic in nature. Endosomal release of the plasmonic vector is further enhanced by the laser excitation of the GNR at the longitudinal surface plasmon resonance (LSPR), which allows for the endosomal release of the GAPDH-siRNA through pore formation leading to cytoplasmic transport and subsequent gene silencing. Near neutral charges were welcomed in this plasmonic gene therapy study as they tend to favor endosomal release, pore formation, and transport.

Cell-penetrating cationic siRNA and lipophilic derivatives efficient at nanomolar concentrations in the presence of serum and albumin.

PubMed

Perche, Phanélie; Nothisen, Marc; Bagilet, Jérémy; Behr, Jean-Paul; Kotera, Mitsuharu; Remy, Jean-Serge

2013-08-28

Despite its considerable interest in human therapy, in vivo siRNA delivery is still suffering from hurdles of vectorization. We have shown recently efficient gene silencing by non-vectorized cationic siRNA. Here, we describe the synthesis and in vitro evaluation of new amphiphilic cationic siRNA. C₁₂-, (C₁₂)₂- and cholesteryl-spermine(x)-siRNA were capable of luciferase knockdown at nanomolar concentrations without vectorization (i.e. one to two orders of magnitude more potent than commercially available cholesteryl siRNA). Moreover, incubation in the presence of serum did not impair their efficiency. Finally, amphiphilic cationic siRNA was pre-loaded on albumin. In A549Luc cells in the presence of serum, these siRNA conjugates were highly effective and had low toxicity. Copyright © 2013. Published by Elsevier B.V.

Polymer nanoassemblies with hydrophobic pendant groups in the core induce false positive siRNA transfection in luciferase reporter assays.

PubMed

Rheiner, Steven; Reichel, Derek; Rychahou, Piotr; Izumi, Tadahide; Yang, Hsin-Sheng; Bae, Younsoo

2017-08-07

Poly(ethylene glycol)-conjugated polyethylenimine (PEG-PEI) is a widely studied cationic polymer used to develop non-viral vectors for siRNA therapy of genetic disorders including cancer. Cell lines stably expressing luciferase reporter protein typically evaluate the transfection efficacy of siRNA/PEG-PEI complexes, however recent findings revealed that PEG-PEI can reduce luciferase expression independent of siRNA. This study elucidates a cause of the false positive effect in luciferase assays by using polymer nanoassemblies (PNAs) made from PEG, PEI, poly-(l-lysine) (PLL), palmitate (PAL), and deoxycholate (DOC): PEG-PEI (2P), PEG-PEI-PAL (3P), PEG-PLL (2P'), PEG-PLL-PAL (3P'), and PEG-PEI-DOC (2PD). In vitro transfection and western blot assays of luciferase using a colorectal cancer cell line expressing luciferase (HT29/LUC) concluded that 2P and 2P' caused no luciferase expression reduction while hydrophobically modified PNAs induced a 35-50% reduction (3P'<2PD<3P). Although cell viability remained stagnant, 3P triggered cellular stress responses including increased membrane porosity and decreased ATP and cellular protein concentrations. Raman spectroscopy suggested that hydrophobic groups influence PNA conformation changes, which may have caused over-ubiquitination and degradation of luciferase in the cells. These results indicate that hydrophobically modified PEG-PEI induces cellular distress causing over-ubiquitination of the luciferase protein, producing false positive siRNA transfection in the luciferase assay. Copyright © 2017 Elsevier B.V. All rights reserved.

Downregulation of TLX induces TET3 expression and inhibits glioblastoma stem cell self-renewal and tumorigenesis.

PubMed

Cui, Qi; Yang, Su; Ye, Peng; Tian, E; Sun, Guoqiang; Zhou, Jiehua; Sun, Guihua; Liu, Xiaoxuan; Chen, Chao; Murai, Kiyohito; Zhao, Chunnian; Azizian, Krist T; Yang, Lu; Warden, Charles; Wu, Xiwei; D'Apuzzo, Massimo; Brown, Christine; Badie, Behnam; Peng, Ling; Riggs, Arthur D; Rossi, John J; Shi, Yanhong

2016-02-03

Glioblastomas have been proposed to be maintained by highly tumorigenic glioblastoma stem cells (GSCs) that are resistant to current therapy. Therefore, targeting GSCs is critical for developing effective therapies for glioblastoma. In this study, we identify the regulatory cascade of the nuclear receptor TLX and the DNA hydroxylase Ten eleven translocation 3 (TET3) as a target for human GSCs. We show that knockdown of TLX expression inhibits human GSC tumorigenicity in mice. Treatment of human GSC-grafted mice with viral vector-delivered TLX shRNA or nanovector-delivered TLX siRNA inhibits tumour development and prolongs survival. Moreover, we identify TET3 as a potent tumour suppressor downstream of TLX to regulate the growth and self-renewal in GSCs. This study identifies the TLX-TET3 axis as a potential therapeutic target for glioblastoma.

[New strategy for RNA vectorization in mammalian cells. Use of a peptide vector].

PubMed

Vidal, P; Morris, M C; Chaloin, L; Heitz, F; Divita, G

1997-04-01

A major barrier for gene delivery is the low permeability of nucleic acids to cellular membranes. The development of antisenses and gene therapy has focused mainly on improving methods of oligonucleotide or gene delivery to the cell. In this report we described a new strategy for RNA cell delivery, based on a short single peptide. This peptide vector is derived from both the fusion domain of the gp41 protein of HIV and the nuclear localization sequence of the SV40 large T antigen. This peptide vector localizes rapidly to the cytoplasm then to the nucleus of human fibroblasts (HS-68) within a few minutes and exhibits a high affinity for a single-stranded mRNA encoding the p66 subunit of the HIV-1 reverse transcriptase (in a 100 nM range). The peptide/RNA complex formation involves mainly electrostatic interactions between the basic residues of the peptide and the charges on the phosphate group of the RNA. In the presence of the peptide-vector fluorescently-labelled mRNA is delivered into the cytoplasm of mammalian cells (HS68 human fibroblasts) in less than 1 h with a relatively high efficiency (80%). This new concept based on a peptide-derived vector offers several advantages compared to other compounds commonly used in gene delivery. This vector is highly soluble and exhibits no cytotoxicity at the concentrations used for optimal gene delivery. This result clearly supports the fact that this peptide vector is a powerful tool and that it can be used widely, as much for laboratory research as for new applications and development in gene and/or antisense therapy.

Identification of germline transcriptional regulatory elements in Aedes aegypti.

PubMed

Akbari, Omar S; Papathanos, Philippos A; Sandler, Jeremy E; Kennedy, Katie; Hay, Bruce A

2014-02-04

The mosquito Aedes aegypti is the principal vector for the yellow fever and dengue viruses, and is also responsible for recent outbreaks of the alphavirus chikungunya. Vector control strategies utilizing engineered gene drive systems are being developed as a means of replacing wild, pathogen transmitting mosquitoes with individuals refractory to disease transmission, or bringing about population suppression. Several of these systems, including Medea, UD(MEL), and site-specific nucleases, which can be used to drive genes into populations or bring about population suppression, utilize transcriptional regulatory elements that drive germline-specific expression. Here we report the identification of multiple regulatory elements able to drive gene expression specifically in the female germline, or in the male and female germline, in the mosquito Aedes aegypti. These elements can also be used as tools with which to probe the roles of specific genes in germline function and in the early embryo, through overexpression or RNA interference.

Identification of germline transcriptional regulatory elements in Aedes aegypti

NASA Astrophysics Data System (ADS)

Akbari, Omar S.; Papathanos, Philippos A.; Sandler, Jeremy E.; Kennedy, Katie; Hay, Bruce A.

2014-02-01

The mosquito Aedes aegypti is the principal vector for the yellow fever and dengue viruses, and is also responsible for recent outbreaks of the alphavirus chikungunya. Vector control strategies utilizing engineered gene drive systems are being developed as a means of replacing wild, pathogen transmitting mosquitoes with individuals refractory to disease transmission, or bringing about population suppression. Several of these systems, including Medea, UDMEL, and site-specific nucleases, which can be used to drive genes into populations or bring about population suppression, utilize transcriptional regulatory elements that drive germline-specific expression. Here we report the identification of multiple regulatory elements able to drive gene expression specifically in the female germline, or in the male and female germline, in the mosquito Aedes aegypti. These elements can also be used as tools with which to probe the roles of specific genes in germline function and in the early embryo, through overexpression or RNA interference.

Cancer survival classification using integrated data sets and intermediate information.

PubMed

Kim, Shinuk; Park, Taesung; Kon, Mark

2014-09-01

Although numerous studies related to cancer survival have been published, increasing the prediction accuracy of survival classes still remains a challenge. Integration of different data sets, such as microRNA (miRNA) and mRNA, might increase the accuracy of survival class prediction. Therefore, we suggested a machine learning (ML) approach to integrate different data sets, and developed a novel method based on feature selection with Cox proportional hazard regression model (FSCOX) to improve the prediction of cancer survival time. FSCOX provides us with intermediate survival information, which is usually discarded when separating survival into 2 groups (short- and long-term), and allows us to perform survival analysis. We used an ML-based protocol for feature selection, integrating information from miRNA and mRNA expression profiles at the feature level. To predict survival phenotypes, we used the following classifiers, first, existing ML methods, support vector machine (SVM) and random forest (RF), second, a new median-based classifier using FSCOX (FSCOX_median), and third, an SVM classifier using FSCOX (FSCOX_SVM). We compared these methods using 3 types of cancer tissue data sets: (i) miRNA expression, (ii) mRNA expression, and (iii) combined miRNA and mRNA expression. The latter data set included features selected either from the combined miRNA/mRNA profile or independently from miRNAs and mRNAs profiles (IFS). In the ovarian data set, the accuracy of survival classification using the combined miRNA/mRNA profiles with IFS was 75% using RF, 86.36% using SVM, 84.09% using FSCOX_median, and 88.64% using FSCOX_SVM with a balanced 22 short-term and 22 long-term survivor data set. These accuracies are higher than those using miRNA alone (70.45%, RF; 75%, SVM; 75%, FSCOX_median; and 75%, FSCOX_SVM) or mRNA alone (65.91%, RF; 63.64%, SVM; 72.73%, FSCOX_median; and 70.45%, FSCOX_SVM). Similarly in the glioblastoma multiforme data, the accuracy of miRNA/mRNA using IFS was 75.51% (RF), 87.76% (SVM) 85.71% (FSCOX_median), 85.71% (FSCOX_SVM). These results are higher than the results of using miRNA expression and mRNA expression alone. In addition we predict 16 hsa-miR-23b and hsa-miR-27b target genes in ovarian cancer data sets, obtained by SVM-based feature selection through integration of sequence information and gene expression profiles. Among the approaches used, the integrated miRNA and mRNA data set yielded better results than the individual data sets. The best performance was achieved using the FSCOX_SVM method with independent feature selection, which uses intermediate survival information between short-term and long-term survival time and the combination of the 2 different data sets. The results obtained using the combined data set suggest that there are some strong interactions between miRNA and mRNA features that are not detectable in the individual analyses. Copyright © 2014 Elsevier B.V. All rights reserved.

An infectious recombinant equine arteritis virus expressing green fluorescent protein from its replicase gene.

PubMed

van den Born, Erwin; Posthuma, Clara C; Knoops, Kèvin; Snijder, Eric J

2007-04-01

Thus far, systems developed for heterologous gene expression from the genomes of nidoviruses (arteriviruses and coronaviruses) have relied mainly on the translation of foreign genes from subgenomic mRNAs, whose synthesis is a key feature of the nidovirus life cycle. In general, such expression vectors often suffered from relatively low and unpredictable expression levels, as well as genome instability. In an attempt to circumvent these disadvantages, the possibility to express a foreign gene [encoding enhanced green fluorescent protein (eGFP)] from within the nidovirus replicase gene, which encodes two large polyproteins that are processed proteolytically into the non-structural proteins (nsps) required for viral RNA synthesis, has now been explored. A viable recombinant of the arterivirus Equine arteritis virus, EAV-GFP2, was obtained, which contained the eGFP insert at the site specifying the junction between the two most N-proximal replicase-cleavage products, nsp1 and nsp2. EAV-GFP2 replication could be launched by transfection of cells with either in vitro-generated RNA transcripts or a DNA launch plasmid. EAV-GFP2 displayed growth characteristics similar to those of the wild-type virus and was found to maintain the insert stably for at least eight passages. It is proposed that EAV-GFP2 has potential for arterivirus vector development and as a tool in inhibitor screening. It can also be used for fundamental studies into EAV replication, which was illustrated by the fact that the eGFP signal of EAV-GFP2, which largely originated from an eGFP-nsp2 fusion protein, could be used to monitor the formation of the membrane-bound EAV replication complex in real time.

The Aryl Hydrocarbon Receptor Binds to E2F1 and Inhibits E2F1-induced Apoptosis

PubMed Central

Marlowe, Jennifer L.; Fan, Yunxia; Chang, Xiaoqing; Peng, Li; Knudsen, Erik S.; Xia, Ying

2008-01-01

Cellular stress by DNA damage induces checkpoint kinase-2 (CHK2)-mediated phosphorylation and stabilization of the E2F1 transcription factor, leading to induction of apoptosis by activation of a subset of proapoptotic E2F1 target genes, including Apaf1 and p73. This report characterizes an interaction between the aryl hydrocarbon (Ah) receptor (AHR), a ligand-activated transcription factor, and E2F1 that results in the attenuation of E2F1-mediated apoptosis. In Ahr−/− fibroblasts stably transfected with a doxycycline-regulated AHR expression vector, inhibition of AHR expression causes a significant elevation of oxidative stress, γH2A.X histone phosphorylation, and E2F1-dependent apoptosis, which can be blocked by small interfering RNA-mediated knockdown of E2F1 expression. In contrast, ligand-dependent AHR activation protects these cells from etoposide-induced cell death. In cells expressing both proteins, AHR and E2F1 interact independently of the retinoblastoma protein (RB), because AHR and E2F1 coimmunoprecipitate from extracts of RB-negative cells. Additionally, chromatin immunoprecipitation assays indicate that AHR and E2F1 bind to the Apaf1 promoter at a region containing a consensus E2F1 binding site but no AHR binding sites. AHR activation represses Apaf1 and TAp73 mRNA induction by a constitutively active CHK2 expression vector. Furthermore, AHR overexpression blocks the transcriptional induction of Apaf1 and p73 and the accumulation of sub-G0/G1 cells resulting from ectopic overexpression of E2F1. These results point to a proproliferative, antiapoptotic function of the Ah receptor that likely plays a role in tumor progression. PMID:18524851