Enhancement or inhibition of PLCγ2 expression in rat hepatocytes by recombinant adenoviral vectors that contain full-length gene or siRNA.

PubMed

Chen, X G; Liu, Y M; Lv, Q X; Ma, J

2017-01-01

We investigated the effects of recombinant adenovirus vectors that overexpress or silence PLCγ2 on the expression of this gene during hepatocyte proliferation. Hepatocytes were isolated, identified by immunofluorescent cytochemical staining and infected by previously constructed Ad-PLCγ2 and Ad-PLCγ2 siRNA1, siRNA2 and siRNA3. Green fluorescent protein (GFP) expression was observed by fluorescence microscopy. Infection percentage was calculated by flow cytometry. mRNA and protein levels of PLCγ2 were detected by quantitative reverse transcription-PCR (qRT-PCR) and western blotting, respectively. The viability of the infected hepatocytes was measured by 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. We found that nearly 97% of cells were positive for the hepatocyte marker, CK18. After infection of Ad-PLCγ2 and Ad-PLCγ2 siRNA, more than 99% of hepatocytes expressed GFP significantly, and mRNA and protein expression of PLCγ2 was up-regulated significantly in Ad-PLCγ2 infected hepatocytes, but down-regulated in Ad-PLCγ2 siRNA2 infected cells. The cell proliferation rate decreased in PLCγ2-overexpressing cells, while the rate increased in PLCγ2-silencing cells. We verified that recombinant Ad-PLCγ2 and Ad-PLCγ2 siRNA2 were constructed successfully. These two recombinant vectors promoted or decreased the expression of PLCγ2 in rat hepatocytes and affected the cell proliferation rate, which provides a useful tool for further investigation of the role of PLCγ2 in hepatocyte apoptosis.

Establishment of conditional vectors for hairpin siRNA knockdowns

PubMed Central

Matsukura, Shiro; Jones, Peter A.; Takai, Daiya

2003-01-01

Small interference RNA (siRNA) is an emerging methodology in reverse genetics. Here we report the development of a new tetracycline-inducible vector-based siRNA system, which uses a tetracycline-responsive derivative of the U6 promoter and the tetracycline repressor for conditional in vivo transcription of short hairpin RNA. This method prevents potential lethality immediately after transfection of a vector when the targeted gene is indispensable, or the phenotype of the knockdown is lethal or results in a growth abnormality. We show that the controlled knockdown of DNA methyltransferase 1 (DNMT1) in human cancer resulted in growth arrest. Removal of the inducer, doxycycline, from treated cells led to re-expression of the targeted gene. Thus the method allows for a highly controlled approach to gene knockdown. PMID:12888529

Inhibition of HIV-1 gene expression by retroviral vector-mediated small-guide RNAs that direct specific RNA cleavage by tRNase ZL

PubMed Central

Habu, Yuichiro; Miyano-Kurosaki, Naoko; Kitano, Michiko; Endo, Yumihiko; Yukita, Masakazu; Ohira, Shigeru; Takaku, Hiroaki; Nashimoto, Masayuki; Takaku, Hiroshi

2005-01-01

The tRNA 3′-processing endoribonuclease (tRNase Z or 3′ tRNase; EC 3.1.26.11) is an essential enzyme that removes the 3′ trailer from pre-tRNA. The long form (tRNase ZL) can cleave a target RNA in vitro at the site directed by an appropriate small-guide RNA (sgRNA). Here, we investigated whether this sgRNA/tRNase ZL strategy could be applied to gene therapy for AIDS. We tested the ability of four sgRNA-expression plasmids to inhibit HIV-1 gene expression in COS cells, using a transient-expression assay. The three sgRNAs guide inhibition of HIV-1 gene expression in cultured COS cells. Analysis of the HIV-1 mRNA levels suggested that sgRNA directed the tRNase ZL to mediate the degradation of target RNA. The observation that sgRNA was localized primarily in nuclei suggests that tRNase ZL cleaves the HIV-1 mRNA when complexed with sgRNA in this location. We also examined the ability of two retroviral vectors expressing sgRNA to suppress HIV-1 expression in HIV-1-infected Jurkat T cells. sgRNA-SL4 suppressed HIV-1 expression almost completely in infected cells for up to 18 days. These results suggest that the sgRNA/tRNase ZL approach is effective in downregulating HIV-1 gene expression. PMID:15647506

RNA interference mediated in human primary cells via recombinant baculoviral vectors.

PubMed

Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T

2005-04-01

The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.

Viral and Synthetic RNA Vector Technologies and Applications

PubMed Central

Schott, Juliane W; Morgan, Michael; Galla, Melanie; Schambach, Axel

2016-01-01

Use of RNA is an increasingly popular method to transiently deliver genetic information for cell manipulation in basic research and clinical therapy. In these settings, viral and nonviral RNA platforms are employed for delivery of small interfering RNA and protein-coding mRNA. Technological advances allowing RNA modification for increased stability, improved translation and reduced immunogenicity have led to increased use of nonviral synthetic RNA, which is delivered in naked form or upon formulation. Alternatively, highly efficient viral entry pathways are exploited to transfer genes of interest as RNA incorporated into viral particles. Current viral RNA transfer technologies are derived from Retroviruses, nonsegmented negative-strand RNA viruses or positive-stranded Alpha- and Flaviviruses. In retroviral particles, the genes of interest can either be incorporated directly into the viral RNA genome or as nonviral RNA. Nonsegmented negative-strand virus-, Alpha- and Flavivirus-derived vectors support prolonged expression windows through replication of viral RNA encoding genes of interest. Mixed technologies combining viral and nonviral components are also available. RNA transfer is ideal for all settings that do not require permanent transgene expression and excludes potentially detrimental DNA integration into the target cell genome. Thus, RNA-based technologies are successfully applied for reprogramming, transdifferentiation, gene editing, vaccination, tumor therapy, and gene therapy. PMID:27377044

Double-stranded RNA innate immune response activation from long-term adeno-associated virus vector transduction.

PubMed

Shao, Wenwei; Earley, Lauriel F; Chai, Zheng; Chen, Xiaojing; Sun, Junjiang; He, Ting; Deng, Meng; Hirsch, Matthew L; Ting, Jenny; Samulski, R Jude; Li, Chengwen

2018-06-21

Data from clinical trials for hemophilia B using adeno-associated virus (AAV) vectors have demonstrated decreased transgenic coagulation factor IX (hFIX) expression 6-10 weeks after administration of a high vector dose. While it is likely that capsid-specific cytotoxic T lymphocytes eliminate vector-transduced hepatocytes, thereby resulting in decreased hFIX, this observation is not intuitively consistent with restored hFIX levels following prednisone application. Although the innate immune response is immediately activated following AAV vector infection via TLR pathways, no studies exist regarding the role of the innate immune response at later time points after AAV vector transduction. Herein, activation of the innate immune response in cell lines, primary human hepatocytes, and hepatocytes in a human chimeric mouse model was observed at later time points following AAV vector transduction. Mechanistic analysis demonstrated that the double-stranded RNA (dsRNA) sensor MDA5 was necessary for innate immune response activation and that transient knockdown of MDA5, or MAVS, decreased IFN-β expression while increasing transgene production in AAV-transduced cells. These results both highlight the role of the dsRNA-triggered innate immune response in therapeutic transgene expression at later time points following AAV transduction and facilitate the execution of effective strategies to block the dsRNA innate immune response in future clinical trials.

Gene Suppression of Mouse Testis In Vivo Using Small Interfering RNA Derived from Plasmid Vectors

PubMed Central

Takizawa, Takami; Ishikawa, Tomoko; Kosuge, Takuji; Mizuguchi, Yoshiaki; Sato, Yoko; Koji, Takehiko; Araki, Yoshihiko; Takizawa, Toshihiro

2012-01-01

We evaluated whether inhibiting gene expression by small interfering RNA (siRNA) can be used for an in vivo model using a germ cell-specific gene (Tex101) as a model target in mouse testis. We generated plasmid-based expression vectors of siRNA targeting the Tex101 gene and transfected them into postnatal day 10 mouse testes by in vivo electroporation. After optimizing the electroporation conditions using a vector transfected into the mouse testis, a combination of high- and low-voltage pulses showed excellent transfection efficiency for the vectors with minimal tissue damage, but gene suppression was transient. Gene suppression by in vivo electroporation may be helpful as an alternative approach when designing experiments to unravel the basic role of testicular molecules. PMID:22489107

Gene silencing in Escherichia coli using antisense RNAs expressed from doxycycline-inducible vectors.

PubMed

Nakashima, N; Tamura, T

2013-06-01

Here, we report on the construction of doxycycline (tetracycline analogue)-inducible vectors that express antisense RNAs in Escherichia coli. Using these vectors, the expression of genes of interest can be silenced conditionally. The expression of antisense RNAs from the vectors was more tightly regulated than the previously constructed isopropyl-β-D-galactopyranoside-inducible vectors. Furthermore, expression levels of antisense RNAs were enhanced by combining the doxycycline-inducible promoter with the T7 promoter-T7 RNA polymerase system; the T7 RNA polymerase gene, under control of the doxycycline-inducible promoter, was integrated into the lacZ locus of the genome without leaving any antibiotic marker. These vectors are useful for investigating gene functions or altering cell phenotypes for biotechnological and industrial applications. A gene silencing method using antisense RNAs in Escherichia coli is described, which facilitates the investigation of bacterial gene function. In particular, the method is suitable for comprehensive analyses or phenotypic analyses of genes essential for growth. Here, we describe expansion of vector variations for expressing antisense RNAs, allowing choice of a vector appropriate for the target genes or experimental purpose. © 2013 The Society for Applied Microbiology.

Reversal of multidrug resistance by magnetic Fe3O4 nanoparticle copolymerizating daunorubicin and MDR1 shRNA expression vector in leukemia cells.

PubMed

Chen, Bao-an; Mao, Pei-pei; Cheng, Jian; Gao, Feng; Xia, Guo-hua; Xu, Wen-lin; Shen, Hui-lin; Ding, Jia-hua; Gao, Chong; Sun, Qian; Chen, Wen-ji; Chen, Ning-na; Liu, Li-jie; Li, Xiao-mao; Wang, Xue-mei

2010-08-09

In many instances, multidrug resistance (MDR) is mediated by increasing the expression at the cell surface of the MDR1 gene product, P-glycoprotein (P-gp), a 170-kD energy-dependent efflux pump. The aim of this study was to investigate the potential benefit of combination therapy with magnetic Fe(3)O(4) nanoparticle [MNP (Fe(3)O(4))] and MDR1 shRNA expression vector in K562/A02 cells. For stable reversal of "classical" MDR by short hairpin RNA (shRNA) aiming directly at the target sequence (3491-3509, 1539-1557, and 3103-3121 nucleotide) of MDR1 mRNA. PGC silencer-U6-neo-GFP-shRNA/MDR1 called PGY1-1, PGY1-2, and PGY1-3 were constructed and transfected into K562/A02 cells by lipofectamine 2000. After transfected and incubated with or without MNP (Fe(3)O(4)) for 48 hours, the transcription of MDR1 mRNA and the expression of P-gp were detected by quantitative real-time PCR and Western-blot assay respectively. Meanwhile intracellular concentration of DNR in K562/A02 cells was detected by flow cytometry (FCM). PGC silencer-U6-neo-GFP-shRNA/MDR1 was successfully constructed, which was confirmed by sequencing and PGY1-2 had the greatest MDR1 gene inhibitory ratio. Analysis of the reversal ratio of MDR, the concentration of daunorubicin (DNR) and the transcription of MDR1 gene and expression of P-gp in K562/A02 showed that combination of DNR with either MNP (Fe(3)O(4)) or PGY1-2 exerted a potent cytotoxic effect on K562/A02 cells, while combination of MNP (Fe(3)O(4)) and PGY1-2 could synergistically reverse multidrug resistance. Thus our in vitro data strongly suggested that a combination of MNP (Fe(3)O(4)) and shRNA expression vector might be a more sufficient and less toxic anti-MDR method on leukemia.

Expression of short hairpin RNAs using the compact architecture of retroviral microRNA genes.

PubMed

Burke, James M; Kincaid, Rodney P; Aloisio, Francesca; Welch, Nicole; Sullivan, Christopher S

2017-09-29

Short hairpin RNAs (shRNAs) are effective in generating stable repression of gene expression. RNA polymerase III (RNAP III) type III promoters (U6 or H1) are typically used to drive shRNA expression. While useful for some knockdown applications, the robust expression of U6/H1-driven shRNAs can induce toxicity and generate heterogeneous small RNAs with undesirable off-target effects. Additionally, typical U6/H1 promoters encompass the majority of the ∼270 base pairs (bp) of vector space required for shRNA expression. This can limit the efficacy and/or number of delivery vector options, particularly when delivery of multiple gene/shRNA combinations is required. Here, we develop a compact shRNA (cshRNA) expression system based on retroviral microRNA (miRNA) gene architecture that uses RNAP III type II promoters. We demonstrate that cshRNAs coded from as little as 100 bps of total coding space can precisely generate small interfering RNAs (siRNAs) that are active in the RNA-induced silencing complex (RISC). We provide an algorithm with a user-friendly interface to design cshRNAs for desired target genes. This cshRNA expression system reduces the coding space required for shRNA expression by >2-fold as compared to the typical U6/H1 promoters, which may facilitate therapeutic RNAi applications where delivery vector space is limiting. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

[Progress in application of targeting viral vector regulated by microRNA in gene therapy: a review].

PubMed

Zhang, Guohai; Wang, Qizhao; Zhang, Jinghong; Xu, Ruian

2010-06-01

A safe and effective targeting viral vector is the key factor for successful clinical gene therapy. microRNA, a class of small, single-stranded endogenous RNAs, act as post-transcriptional regulators of gene expression. The discovery of these kind regulatory elements provides a new approach to regulate gene expression more accurately. In this review, we elucidated the principle of microRNA in regulation of targeting viral vector. The applications of microRNA in the fields of elimination contamination from replication competent virus, reduction of transgene-specific immunity, promotion of cancer-targeted gene therapy and development of live attenuated vaccines were also discussed.

Vector design for liver specific expression of multiple interfering RNAs that target hepatitis B virus transcripts

PubMed Central

Snyder, Lindsey L.; Esser, Jonathan M.; Pachuk, Catherine J.; Steel, Laura F.

2008-01-01

RNA interference (RNAi) is a process that can target intracellular RNAs for degradation in a highly sequence specific manner, making it a powerful tool that is being pursued in both research and therapeutic applications. Hepatitis B virus (HBV) is a serious public health problem in need of better treatment options, and aspects of its life cycle make it an excellent target for RNAi-based therapeutics. We have designed a vector that expresses interfering RNAs that target HBV transcripts, including both viral RNA replicative intermediates and mRNAs encoding viral proteins. Our vector design incorporates many features of endogenous microRNA (miRNA) gene organization that are proving useful for the development of reagents for RNAi. In particular, our vector contains an RNA pol II driven gene cassette that leads to tissue specific expression and efficient processing of multiple interfering RNAs from a single transcript, without the co-expression of any protein product. This vector shows potent silencing of HBV targets in cell culture models of HBV infection. The vector design will be applicable to silencing of additional cellular or disease-related genes. PMID:18499277

Double-stranded RNA transcribed from vector-based oligodeoxynucleotide acts as transcription factor decoy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiao, Xiao; Gang, Yi; Department of Infectious Diseases, Tangdu Hospital, Fourth Military Medical University, Xi’an 710038, Shaanxi Province

2015-02-06

Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself.more » The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity.« less

Simple and effective generation of transgene-free induced pluripotent stem cells using an auto-erasable Sendai virus vector responding to microRNA-302.

PubMed

Nishimura, Ken; Ohtaka, Manami; Takada, Hitomi; Kurisaki, Akira; Tran, Nhi Vo Kieu; Tran, Yen Thi Hai; Hisatake, Koji; Sano, Masayuki; Nakanishi, Mahito

2017-08-01

Transgene-free induced pluripotent stem cells (iPSCs) are valuable for both basic research and potential clinical applications. We previously reported that a replication-defective and persistent Sendai virus (SeVdp) vector harboring four reprogramming factors (SeVdp-iPS) can efficiently induce generation of transgene-free iPSCs. This vector can express all four factors stably and simultaneously without chromosomal integration and can be eliminated completely from reprogrammed cells by suppressing vector-derived RNA-dependent RNA polymerase. Here, we describe an improved SeVdp-iPS vector (SeVdp(KOSM)302L) that is automatically erased in response to microRNA-302 (miR-302), uniquely expressed in pluripotent stem cells (PSCs). Gene expression and genome replication of the SeVdp-302L vector, which contains miRNA-302a target sequences at the 3' untranslated region of L mRNA, are strongly suppressed in PSCs. Consequently, SeVdp(KOSM)302L induces expression of reprogramming factors in somatic cells, while it is automatically erased from cells successfully reprogrammed to express miR-302. As this vector can reprogram somatic cells into transgene-free iPSCs without the aid of exogenous short interfering RNA (siRNA), the results we present here demonstrate that this vector may become an invaluable tool for the generation of human iPSCs for future clinical applications. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

repRNA: a web server for generating various feature vectors of RNA sequences.

PubMed

Liu, Bin; Liu, Fule; Fang, Longyun; Wang, Xiaolong; Chou, Kuo-Chen

2016-02-01

With the rapid growth of RNA sequences generated in the postgenomic age, it is highly desired to develop a flexible method that can generate various kinds of vectors to represent these sequences by focusing on their different features. This is because nearly all the existing machine-learning methods, such as SVM (support vector machine) and KNN (k-nearest neighbor), can only handle vectors but not sequences. To meet the increasing demands and speed up the genome analyses, we have developed a new web server, called "representations of RNA sequences" (repRNA). Compared with the existing methods, repRNA is much more comprehensive, flexible and powerful, as reflected by the following facts: (1) it can generate 11 different modes of feature vectors for users to choose according to their investigation purposes; (2) it allows users to select the features from 22 built-in physicochemical properties and even those defined by users' own; (3) the resultant feature vectors and the secondary structures of the corresponding RNA sequences can be visualized. The repRNA web server is freely accessible to the public at http://bioinformatics.hitsz.edu.cn/repRNA/ .

Tripartite polyionic complex (PIC) micelles as non-viral vectors for mesenchymal stem cell siRNA transfection.

PubMed

Raisin, Sophie; Morille, Marie; Bony, Claire; Noël, Danièle; Devoisselle, Jean-Marie; Belamie, Emmanuel

2017-08-22

In the context of regenerative medicine, the use of RNA interference mechanisms has already proven its efficiency in targeting specific gene expression with the aim of enhancing, accelerating or, more generally, directing stem cell differentiation. However, achievement of good transfection levels requires the use of a gene vector. For in vivo applications, synthetic vectors are an interesting option to avoid possible issues associated with viral vectors (safety, production costs, etc.). Herein, we report on the design of tripartite polyionic complex micelles as original non-viral polymeric vectors suited for mesenchymal stem cell transfection with siRNA. Three micelle formulations were designed to exhibit pH-triggered disassembly in an acidic pH range comparable to that of endosomes. One formulation was selected as the most promising with the highest siRNA loading capacity while clearly maintaining pH-triggered disassembly properties. A thorough investigation of the internalization pathway of micelles into cells with tagged siRNA was made before showing an efficient inhibition of Runx2 expression in primary bone marrow-derived stem cells. This work evidenced PIC micelles as promising synthetic vectors that allow efficient MSC transfection and control over their behavior, from the perspective of their clinical use.

On the efficient bio-incorporation of 5-hydroxy-tryptophan in recombinant proteins expressed in Escherichia coli with T7 RNA polymerase-based vectors.

PubMed

Oliveira-Souza, Wellington P; Bronze, Fellipe; Broos, Jaap; Marcondes, Marcelo F M; Oliveira, Vitor

2017-10-21

Biosynthetic incorporation of non-canonic amino acids is an attractive strategy to introduce new properties in recombinant proteins. Trp analogs can be incorporated in recombinant proteins replacing regular Trp during protein translation into a Trp-auxotrophic cell host. This straightforward method however, is limited to few analogs recognized and accepted by the cellular protein production machinery. 5-hydroxy-tryptophan (5OH-Trp) can be bio-incorporated using E. coli as expression host however; we have experienced very low incorporation yields - amount of protein containing regular Trp/amount of protein containing the Trp analog - during expressions of 5OH-Trp labeled proteins. Furthermore, this low incorporation yield were verified especially when the widely-used vectors based on the T7 RNA polymerase were used. Testing different 5OH-Trp incorporation protocols we verified that in these T7-based systems, the production of the T7 RNA polymerase is driven by the same elements - lac promoter/IPTG - as the target protein. Consequently, the bio-incorporation of the 5OH-Trp residues also occurs in this crucial enzyme, but, the produced T7 RNA polymerase labeled with 5OH-Trp is inactive or much less active. In the present work, we describe an efficient method to overcome this mentioned problem and bio-incorporate 5OH-Trp in proteins expressed in E. coli., using vectors based on the T7 RNA polymerase-T7 promoter. The two-step induction protocol here described showed incorporation efficiencies of 5OH-Trp higher than 90%. Copyright © 2017 Elsevier Inc. All rights reserved.

Akt/protein kinase B activation by adenovirus vectors contributes to NFkappaB-dependent CXCL10 expression.

PubMed

Liu, Qiang; White, Lindsay R; Clark, Sharon A; Heffner, Daniel J; Winston, Brent W; Tibbles, Lee Anne; Muruve, Daniel A

2005-12-01

In gene therapy, the innate immune system is a significant barrier to the effective application of adenovirus (Ad) vectors. In kidney epithelium-derived (REC) cells, serotype 5 Ad vectors induce the expression of the chemokine CXCL10 (IP-10), a response that is dependent on NFkappaB. Compared to the parental vector AdLuc, transduction with the RGD-deleted vector AdL.PB resulted in reduced CXCL10 activation despite increasing titers, implying that RGD-alpha(V) integrin interactions contribute to adenovirus induction of inflammatory genes. Akt, a downstream effector of integrin signaling, was activated within 10 min of transduction with Ad vectors in a dose-dependent manner. Akt activation was not present following transduction with AdL.PB, confirming the importance of capsid-alpha(V) integrin interactions in Ad vector Akt activation. Inhibition of the phosphoinositide-3-OH kinase/Akt pathway by Wortmannin or Ly294002 compounds decreased Ad vector induction of CXCL10 mRNA. Similarly, adenovirus-mediated overexpression of the dominant negative AktAAA decreased CXCL10 mRNA expression compared to the reporter vector AdLacZ alone. The effect of Akt on CXCL10 mRNA expression occurred via NFkappaB-dependent transcriptional activation, since AktAAA overexpression and Ly294002 both inhibited CXCL10 and NFkappaB promoter activation in luciferase reporter experiments. These results show that Akt plays a role in the Ad vector activation of NFkappaB and CXCL10 expression. Understanding the mechanism underlying the regulation of host immunomodulatory genes by adenovirus vectors will lead to strategies that will improve the efficacy and safety of these agents for clinical use.

Development of novel types of plastid transformation vectors and evaluation of factors controlling expression.

PubMed

Herz, Stefan; Füssl, Monika; Steiger, Sandra; Koop, Hans-Ulrich

2005-12-01

Two new vector types for plastid transformation were developed and uidA reporter gene expression was compared to standard transformation vectors. The first vector type does not contain any plastid promoter, instead it relies on extension of existing plastid operons and was therefore named "operon-extension" vector. When a strongly expressed plastid operon like psbA was extended by the reporter gene with this vector type, the expression level was superior to that of a standard vector under control of the 16S rRNA promoter. Different insertion sites, promoters and 5'-UTRs were analysed for their effect on reporter gene expression with standard and operon-extension vectors. The 5'-UTR of phage 7 gene 10 in combination with a modified N-terminus was found to yield the highest expression levels. Expression levels were also strongly dependent on external factors like plant or leaf age or light intensity. In the second vector type, named "split" plastid transformation vector, modules of the expression cassette were distributed on two separate vectors. Upon co-transformation of plastids with these vectors, the complete expression cassette became inserted into the plastome. This result can be explained by successive co-integration of the split vectors and final loop-out recombination of the duplicated sequences. The split vector concept was validated with different vector pairs.

Permanent, lowered HLA class I expression using lentivirus vectors with shRNA constructs: Averting cytotoxicity by alloreactive T lymphocytes.

PubMed

Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C

2006-12-01

Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.

[New strategy for RNA vectorization in mammalian cells. Use of a peptide vector].

PubMed

Vidal, P; Morris, M C; Chaloin, L; Heitz, F; Divita, G

1997-04-01

A major barrier for gene delivery is the low permeability of nucleic acids to cellular membranes. The development of antisenses and gene therapy has focused mainly on improving methods of oligonucleotide or gene delivery to the cell. In this report we described a new strategy for RNA cell delivery, based on a short single peptide. This peptide vector is derived from both the fusion domain of the gp41 protein of HIV and the nuclear localization sequence of the SV40 large T antigen. This peptide vector localizes rapidly to the cytoplasm then to the nucleus of human fibroblasts (HS-68) within a few minutes and exhibits a high affinity for a single-stranded mRNA encoding the p66 subunit of the HIV-1 reverse transcriptase (in a 100 nM range). The peptide/RNA complex formation involves mainly electrostatic interactions between the basic residues of the peptide and the charges on the phosphate group of the RNA. In the presence of the peptide-vector fluorescently-labelled mRNA is delivered into the cytoplasm of mammalian cells (HS68 human fibroblasts) in less than 1 h with a relatively high efficiency (80%). This new concept based on a peptide-derived vector offers several advantages compared to other compounds commonly used in gene delivery. This vector is highly soluble and exhibits no cytotoxicity at the concentrations used for optimal gene delivery. This result clearly supports the fact that this peptide vector is a powerful tool and that it can be used widely, as much for laboratory research as for new applications and development in gene and/or antisense therapy.

Interferon-α Silencing by Small Interference RNA Increases Adenovirus Transduction and Transgene Expression in Huh7 Cells.

PubMed

Sobrevilla-Navarro, Ana Alondra; Sandoval-Rodríguez, Ana; García-Bañuelos, Jesús Javier; Armendariz-Borunda, Juan; Salazar-Montes, Adriana María

2018-04-01

Adenoviruses are the most common vectors used in clinical trials of gene therapy. In 2017, 21.2% of clinical trials used rAds as vectors. Systemic administration of rAds results in high tropism in the liver. Interferon types α and β are the major antiviral cytokines which orchestrate the host's immune response against rAd, limiting therapeutic gene expression and preventing subsequent vector administration. siRNA is small double-strand RNAs that temporally inhibit the expression of a specific gene. The aim is to evaluate the effect of IFN-α blocking by a specific siRNA on Ad-GFP transduction and on transgene expression in Huh7 cells in culture. Huh7 cells were cultured in DMEM and transfected with 70 nM of siRNA-IFN-α. Six hours later, the cells were exposed to 1 × 10 9  vp/ml of rAd-GFP for 24 h. Expression of IFN-α, TNF-α and the PKR gene was determined by RT-qPCR. Percentage of transduction was analyzed by flow cytometry and by qPCR. GFP expression was determined by western blot. 70 nM of siRNA-IFN-α inhibited 96% of IFN-α and 65% of TNF-α gene expression compared to an irrelevant siRNA. Percentage of transduction and transgene expression increased in these cells compared to an irrelevant siRNA. Inhibition of IFN-α expression by siRNA-IFN-α enabled a higher level of transduction and transgene expression GFP, highlighting the role of IFN-α in the elimination of adenovirus in transduced cells and thus suggesting that its inhibition could be an important strategy for gene therapy in clinical trials using adenovirus as a vector directed to liver diseases.

A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs.

PubMed

Romanienko, Peter J; Giacalone, Joseph; Ingenito, Joanne; Wang, Yijie; Isaka, Mayumi; Johnson, Thomas; You, Yun; Mark, Willie H

2016-01-01

The genomes of more than 50 organisms have now been manipulated due to rapid advancement of gene editing technology. One way to perform gene editing in the mouse using the CRISPR/CAS system, guide RNA (gRNA) and CAS9 mRNA transcribed in vitro are microinjected into fertilized eggs that are then allowed to develop to term. As a rule, gRNAs are tested first in tissue culture cells and the one with the highest locus-specific cleavage activity is chosen for microinjection. For cell transfections, gRNAs are typically expressed using the human U6 promoter (hU6). However, gRNAs for microinjection into zygotes are obtained by in vitro transcription from a T7 bacteriophage promoter in a separate plasmid vector. Here, we describe the design and construction of a combined U6T7 hybrid promoter from which the same gRNA sequence can be expressed. An expression vector containing such a hybrid promoter can now be used to generate gRNA for testing in mammalian cells as well as for microinjection purposes. The gRNAs expressed and transcribed from this vector are found to be functional in cells as well as in mice.

Expression of the proto-oncogene Pokemon in colorectal cancer--inhibitory effects of an siRNA.

PubMed

Zhao, Gan-Ting; Yang, Li-Juan; Li, Xi-Xia; Cui, Hui-Lin; Guo, Rui

2013-01-01

This study aimed to investigate expression of the proto-oncogene POK erythroid myeloid ontogenic factor (Pokemon) in colorectal cancer (CRC), and assess inhibitory effects of a small interference RNA (siRNA) expression vector in SW480 and SW620 cells. Semi-quantitative reverse transcription-polymerase chain reaction (PCR) and immunohistochemistry were performed to determine mRNA and protein expression levels of Pokemon in CRC tissues. Indirect immunofluorescence staining was applied to investigate the location of Pokemon in SW480 and SW620 cells. The siRNA expression vectors that were constructed to express a short hairpin RNA against Pokemon were transfected to the SW480 and SW620 cells with a liposome. Expression levels of Pokemon mRNA and protein were examined by real-time quantitative-fluorescent PCR and western blot analysis. The effects of Pokemon silencing on proliferation of SW480 and SW620 cells were evaluated with reference to growth curves with MTT assays. The mRNA expression level of Pokemon in tumor tissues (0.845 ± 0.344) was significantly higher than that in adjacent tumor specimens (0.321 ± 0.197). The positive expression ratio of Pokemon protein in CRC (87.0%) was significantly higher than that in the adjacent tissues (19.6%). Strong fluorescence staining of Pokemon protein was observed in the cytoplasm of the SW480 and SW620 cells. The inhibition ratios of Pokemon mRNA and protein in the SW480 cells were 83.1% and 73.5% at 48 and 72 h, respectively, compared with those of the negative control cells with the siRNA. In the SW620 cells, the inhibition ratios of Pokemon mRNA and protein were 76.3% and 68.7% at 48 and 72 h, respectively. MTT showed that Pokemon gene silencing inhibited the proliferation of SW480 and SW620 cells. Overexpression of Pokemon in CRC may have a function in carcinogenesis and progression. siRNA expression vectors could effectively inhibit mRNA and protein expression of Pokemon in SW480 and SW620 cells, thereby reducing

Strand antagonism in RNAi: an explanation of differences in potency between intracellularly expressed siRNA and shRNA

PubMed Central

Jin, Xin; Sun, Tingting; Zhao, Chuanke; Zheng, Yongxiang; Zhang, Yufan; Cai, Weijing; He, Qiuchen; Taira, Kaz; Zhang, Lihe; Zhou, Demin

2012-01-01

Strategies to regulate gene function frequently use small interfering RNAs (siRNAs) that can be made from their shRNA precursors via Dicer. However, when the duplex components of these siRNA effectors are expressed from their respective coding genes, the RNA interference (RNAi) activity is much reduced. Here, we explored the mechanisms of action of shRNA and siRNA and found the expressed siRNA, in contrast to short hairpin RNA (shRNA), exhibits strong strand antagonism, with the sense RNA negatively and unexpectedly regulating RNAi. Therefore, we altered the relative levels of strands of siRNA duplexes during their expression, increasing the level of the antisense component, reducing the level of the sense component, or both and, in this way we were able to enhance the potency of the siRNA. Such vector-delivered siRNA attacked its target effectively. These findings provide new insight into RNAi and, in particular, they demonstrate that strand antagonism is responsible for making siRNA far less potent than shRNA. PMID:22039150

[Lentiviral vector-mediated short hairpin RNA targeting survivin inhibits abdominal growth of human endometrium xenograft in nude mice].

PubMed

Peng, Dongxian; He, Yuanli

2015-02-01

To investigate the inhibitory effect of lentiviral vector-mediated short hairpin RNA targeting survivin (LV-survivin shRNA) on the growth of human endometrium xenograft in the abdominal cavity of nude mice. The endometrium xenografts from 8 women with endometriosis were injected into the peritoneal cavities of 45 nude mice. The mice were then randomly assigned to receive intraperitoneal injection of LV-survivin shRNA, pGCL-NC-GFP (negative control) or PBS (blank control). Two weeks later, the number and morphometry of endometriotic lesions were quantified and the expression of survivin protein were detected by immunohistochemistry. The formation of endometriotic lesions was significantly suppressed in mice receiving LV-survivin shRNA injection as compared with those in the two control groups (P/0.001). The mice in LV-survivin-shRNA group showed significantly down-regulated expression levels of survivin protein compared with those in the negative and blank control groups, presenting also necrosis in the endometriosis-like lesions in microscopic observation. Lentiviral vector-mediated shRNA can effectively inhibit the expression of survivin in human endometrium xengrafts and suppress the formation and growth of endometriotic lesions in the abdominal cavities of nude mice.

A Molecular Toolbox for Rapid Generation of Viral Vectors to Up- or Down-Regulate Neuronal Gene Expression in vivo

PubMed Central

White, Melanie D.; Milne, Ruth V. J.; Nolan, Matthew F.

2011-01-01

We introduce a molecular toolbox for manipulation of neuronal gene expression in vivo. The toolbox includes promoters, ion channels, optogenetic tools, fluorescent proteins, and intronic artificial microRNAs. The components are easily assembled into adeno-associated virus (AAV) or lentivirus vectors using recombination cloning. We demonstrate assembly of toolbox components into lentivirus and AAV vectors and use these vectors for in vivo expression of inwardly rectifying potassium channels (Kir2.1, Kir3.1, and Kir3.2) and an artificial microRNA targeted against the ion channel HCN1 (HCN1 miRNA). We show that AAV assembled to express HCN1 miRNA produces efficacious and specific in vivo knockdown of HCN1 channels. Comparison of in vivo viral transduction using HCN1 miRNA with mice containing a germ line deletion of HCN1 reveals similar physiological phenotypes in cerebellar Purkinje cells. The easy assembly and re-usability of the toolbox components, together with the ability to up- or down-regulate neuronal gene expression in vivo, may be useful for applications in many areas of neuroscience. PMID:21772812

Development of a GFP expression vector for Cucurbit chlorotic yellows virus.

PubMed

Wei, Ying; Han, Xiaoyu; Wang, Zhenyue; Gu, Qinsheng; Li, Honglian; Chen, Linlin; Sun, Bingjian; Shi, Yan

2018-05-24

Cucurbit chlorotic yellows virus (CCYV), a bipartite crinivirus, causes chlorotic leaf spots and yellowing symptoms on cucurbit leaves. We previously developed an infectious clone of CCYV. Limited work has been conducted on the construction of a crinivirus green fluorescence protein (GFP) expression vector to date. We constructed a CCYV GFP expression vector using the "add a gene" strategy based on CCYV RNA2 cDNA constrcut. Three resultant clones, pCCYVGFP SGC , pCCYVGFP CGC , and pCCYVGFP CGS, were constructed with different promoters used to initiate GFP and CP expression. At 25 dpi GFP fluorescence was detectable not only in leaf veins but also in the surrounding cells. pCCYVGFP CGC -infected cucumber leaves exhibited cell spread at 25 dpi, whereas pCCYVGFP SGC and pCCYVGFP CGS were mainly found in single cells. Further observation of pCCYVGFP CGC GFP expression at 30 dpi, 40 dpi, and 50 dpi showed phloem-limited localization in the systemic leaves. We developed of a CCYV GFP expression vector that will be useful for further study of CCYV movement in cucurbits.

Development of recombinant adeno-associated virus vectors carrying small interfering RNA (shHec1)-mediated depletion of kinetochore Hec1 protein in tumor cells.

PubMed

Li, L; Yang, L; Scudiero, D A; Miller, S A; Yu, Z-X; Stukenberg, P T; Shoemaker, R H; Kotin, R M

2007-05-01

Transcript depletion using small interfering RNA (siRNA) technology represents a potentially valuable technique for the treatment of cancer. However, delivering therapeutic quantities of siRNA into solid tumors by chemical transfection is not feasible, whereas viral vectors efficiently transduce many human tumor cell lines. Yet producing sufficient quantities of viral vectors that elicit acute and selective cytotoxicity remains a major obstacle for preclinical and clinical trials. Using the invertebrate Spodoptera frugiperda (Sf9) cell line, we were able to produce high titer stocks of cytotoxic recombinant adeno-associated virus (rAAV) that express short hairpin RNA (shRNA) and that efficiently deplete Hec1 (highly expressed in cancer 1), or Kntc2 (kinetochore-associated protein 2), a kinetochore protein directly involved in kinetochore microtubule interactions, chromosome congression and spindle checkpoint signaling. Depletion of Hec1 protein results in persistent spindle checkpoint activation followed by cell death. Because Hec1 expression and activity are only present in mitotic cells, non-dividing cells were not affected by rAAV treatment. On the basis of the results of screening 56 human tumor cell lines with three different serotype vectors, we used a tumor xenograft model to test the effects in vivo. The effects of the shHec1 vector were evident in sectioned and stained tumors. The experiments with rAAV-shRNA vectors demonstrate the utility of producing vectors in invertebrate cells to obtain sufficient concentrations and quantities for solid tumor therapy. This addresses an important requirement for cancer gene therapy, to produce cytotoxic vectors in sufficient quantities and concentrations to enable quantitative transduction and selective killing of solid tumor cells.

Puromycin-resistant lentiviral control shRNA vector, pLKO.1 induces unexpected cellular differentiation of P19 embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kanungo, Jyotshna

RNA silencing is used as a common method for investigating loss-of-function effects of genes of interest. In mammalian cells, RNA interference (RNAi) or RNA silencing can be achieved by transient siRNA (small or short interfering RNA) transfection or by stable shRNA (short hairpin RNA) systems. Various vectors are used for efficient delivery of shRNA. Lentiviral vectors offer an efficient delivery system for stable and long-term expression of the shRNA in mammalian cells. The widely used lentiviral pLKO.1 plasmid vector is very popular in RNAi studies. A large RNAi database, a TRC (the RNAi Consortium) library, was established based on themore » pLKO.1-TRC plasmid vector. This plasmid (also called pLKO.1-puro) has a puromycin-resistant gene for selection in mammalian cells along with designs for generating lentiviral particles as well for RNA silencing. While using the pLKO.1-puro TRC control shRNA plasmid for transfection in murine P19 embryonic stem (ES) cells, it was unexpectedly discovered that this plasmid vector induced robust endodermal differentiation. Since P19 ES cells are pluripotent and respond to external stimuli that have the potential to alter the phenotype and thus its stemness, other cell types used in RNA silencing studies do not display the obvious effect and therefore, may affect experiments in subtle ways that would go undetected. This study for the first time provides evidence that raises concern and warrants extreme caution while using the pLKO.1-puro control shRNA vector because of its unexpected non-specific effects on cellular integrity. - Highlights: • In P19 ES cells the pLKO.1-puro lentiviral control shRNA vector induced endodermal differentiation. • P19 ES cells harboring the pCDNA3 plasmid vector retained their stem-ness as opposed to those harboring the pLKO.1-puro vector. • P19 ES cells can serve as a sensor to determine vector safety. • Extreme caution is warranted while using the widely used pLKO.1-puro lentiviral vector

Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli.

PubMed

Bernheim, Aude G; Libis, Vincent K; Lindner, Ariel B; Wintermute, Edwin H

2016-03-20

RNA-mediated knockdowns are widely used to control gene expression. This versatile family of techniques makes use of short RNA (sRNA) that can be synthesized with any sequence and designed to complement any gene targeted for silencing. Because sRNA constructs can be introduced to many cell types directly or using a variety of vectors, gene expression can be repressed in living cells without laborious genetic modification. The most common RNA knockdown technology, RNA interference (RNAi), makes use of the endogenous RNA-induced silencing complex (RISC) to mediate sequence recognition and cleavage of the target mRNA. Applications of this technique are therefore limited to RISC-expressing organisms, primarily eukaryotes. Recently, a new generation of RNA biotechnologists have developed alternative mechanisms for controlling gene expression through RNA, and so made possible RNA-mediated gene knockdowns in bacteria. Here we describe a method for silencing gene expression in E. coli that functionally resembles RNAi. In this system a synthetic phagemid is designed to express sRNA, which may designed to target any sequence. The expression construct is delivered to a population of E. coli cells with non-lytic M13 phage, after which it is able to stably replicate as a plasmid. Antisense recognition and silencing of the target mRNA is mediated by the Hfq protein, endogenous to E. coli. This protocol includes methods for designing the antisense sRNA, constructing the phagemid vector, packaging the phagemid into M13 bacteriophage, preparing a live cell population for infection, and performing the infection itself. The fluorescent protein mKate2 and the antibiotic resistance gene chloramphenicol acetyltransferase (CAT) are targeted to generate representative data and to quantify knockdown effectiveness.

An RGD-Modified MRI-Visible Polymeric Vector for Targeted siRNA Delivery to Hepatocellular Carcinoma in Nude Mice

PubMed Central

Shen, Min; Zhu, Kangshun; Cheng, Du; Liu, Zhihao; Shan, Hong

2013-01-01

RNA interference (RNAi) has significant therapeutic promise for the genetic treatment of hepatocellular carcinoma (HCC). Targeted vectors are able to deliver small interfering RNA (siRNA) into HCC cells with high transfection efficiency and stability. The tripeptide arginine glycine aspartic acid (RGD)-modified non-viral vector, polyethylene glycol-grafted polyethylenimine functionalized with superparamagnetic iron oxide nanoparticles (RGD-PEG-g-PEI-SPION), was constructed as a magnetic resonance imaging (MRI)-visible nanocarrier for the delivery of Survivin siRNA targeting the human HCC cell line Bel-7402. The biophysical characterization of the RGD-PEG-g-PEI-SPION was performed. The RGD-modified complexes exhibited a higher transfection efficiency in transferring Survivin siRNA into Bel-7402 cells compared with a non-targeted delivery system, which resulted in more significant gene suppression at both the Survivin mRNA and protein expression levels. Then, the level of caspase-3 activation was significantly elevated, and a remarkable level of tumor cell apoptosis was induced. As a result, the tumor growth in the nude mice Bel-7402 hepatoma model was significantly inhibited. The targeting ability of the RGD-PEG-g-PEI-SPION was successfully imaged by MRI scans performed in vitro and in vivo. Our results strongly indicated that the RGD-PEG-g-PEI-SPION can potentially be used as a targeted non-viral vector for altering gene expression in the treatment of hepatocellular carcinoma and for detecting the tumor in vivo as an effective MRI probe. PMID:23922634

A simple method for construction of artificial microRNA vector in plant.

PubMed

Li, Yang; Li, Yang; Zhao, Sunping; Zhong, Sheng; Wang, Zhaohai; Ding, Bo; Li, Yangsheng

2014-10-01

Artificial microRNA (amiRNA) is a powerful tool for silencing genes in many plant species. Here we provide an easy method to construct amiRNA vectors that reinvents the Golden Gate cloning approach and features a novel system called top speed amiRNA construction (TAC). This speedy approach accomplishes one restriction-ligation step in only 5 min, allowing easy and high-throughput vector construction. Three primers were annealed to be a specific adaptor, then digested and ligated on our novel vector pTAC. Importantly, this method allows the recombined amiRNA constructs to maintain the precursor of osa-miR528 with exception of the desired amiRNA/amiRNA* sequences. Using this method, our results showed the expected decrease of targeted genes in Nicotiana benthamiana and Oryza sativa.

Correction of Murine Sickle Cell Disease Using γ-Globin Lentiviral Vectors to Mediate High-level Expression of Fetal Hemoglobin

PubMed Central

Pestina, Tamara I; Hargrove, Phillip W; Jay, Dennis; Gray, John T; Boyd, Kelli M; Persons, Derek A

2008-01-01

Increased levels of red cell fetal hemogloblin, whether due to hereditary persistence of expression or from induction with hydroxyurea therapy, effectively ameliorate sickle cell disease (SCD). Therefore, we developed erythroid-specific, γ-globin lentiviral vectors for hematopoietic stem cell (HSC)-targeted gene therapy with the goal of permanently increasing fetal hemoglobin (HbF) production in sickle red cells. We evaluated two different γ-globin lentiviral vectors for therapeutic efficacy in the BERK sickle cell mouse model. The first vector, V5, contained the γ-globin gene driven by 3.1 kb of β-globin regulatory sequences and a 130-bp β-globin promoter. The second vector, V5m3, was identical except that the γ-globin 3′-untranslated region (3′-UTR) was replaced with the β-globin 3′-UTR. Adult erythroid cells have β-globin mRNA 3′-UTR-binding proteins that enhance β-globin mRNA stability and we postulated this design might enhance γ-globin expression. Stem cell gene transfer was efficient and nearly all red cells in transplanted mice expressed human γ-globin. Both vectors demonstrated efficacy in disease correction, with the V5m3 vector producing a higher level of γ-globin mRNA which was associated with high-level correction of anemia and secondary organ pathology. These data support the rationale for a gene therapy approach to SCD by permanently enhancing HbF using a γ-globin lentiviral vector. PMID:19050697

Inhibition of HBV replication in vivo using helper-dependent adenovirus vectors to deliver antiviral RNA interference expression cassettes.

PubMed

Crowther, Carol; Mowa, Mohube B; Ely, Abdullah; Arbuthnot, Patrick B

2014-01-01

HBV is hyperendemic to southern Africa and parts of Asia, but licensed antivirals have little effect on limiting life-threatening complications of the infection. Although RNA interference (RNAi)-based gene silencing has shown therapeutic potential, difficulties with delivery of anti-HBV RNAi effectors remain an obstacle to their clinical use. To address concerns about the transient nature of transgene expression and toxicity resulting from immunostimulation by recombinant adenovirus vectors (Ads), utility of RNAi-activating anti-HBV helper-dependent (HD) Ads were assessed in this study. Following intravenous administration of 5×10(9) unmodified or pegylated HD Ad infectious particles to HBV transgenic mice, HBV viral loads and serum HBV surface antigen levels were monitored for 12 weeks. Immunostimulation of HD Ads was assessed by measuring inflammatory cytokines, hepatic function and immune response to the co-delivered LacZ reporter gene. Unmodified and pegylated HD Ads transduced 80-90% of hepatocytes and expressed short hairpin RNAs (shRNAs) were processed to generate intended HBV-targeting guides. Markers of HBV replication were decreased by approximately 95% and silencing was sustained for 8 weeks. Unmodified HD Ads induced release of proinflammatory cytokines and there was evidence of an adaptive immune response to β-galactosidase. However the HD Ad-induced innate immune response was minimal in preparations that were enriched with infectious particles. HD Ads have potential utility for delivery of therapeutic HBV-silencing sequences and alterations of these vectors to attenuate their immune responses may further improve their efficacy.

Blood-induced differential gene expression in Anopheles dirus evaluated using RNA sequencing.

PubMed

Mongkol, W; Nguitragool, W; Sattabongkot, J; Kubera, A

2018-06-08

Malaria parasites are transmitted through blood feeding by female Anopheline mosquitoes. Unveiling the blood-feeding process will improve understanding of vector biology. Anopheles dirus (Diptera: Culicidae) is one of the primary malaria vectors in the Greater Mekong Subregion, the epicentre of malaria drug resistance. In this study, differential gene expression between sugar- and blood-fed An. dirus was investigated by RNA sequencing (RNA-seq). A total of 589 transcripts were found to be upregulated and 703 transcripts downregulated as a result of blood feeding. Transcriptional differences were found in genes involved in blood digestion, peritrophic matrix formation, oogenesis and vitellogenesis. The expression levels of several genes were validated by quantitative reverse transcription polymerase chain reaction. The present results provide better understanding of An. dirus biology in relation to its blood feeding. © 2018 The Royal Entomological Society.

Hypoxia-response plasmid vector producing bcl-2 shRNA enhances the apoptotic cell death of mouse rectum carcinoma.

PubMed

Fujioka, Takashi; Matsunaga, Naoya; Okazaki, Hiroyuki; Koyanagi, Satoru; Ohdo, Shigehiro

2010-01-01

Hypoxia-induced gene expression frequently occurs in malignant solid tumors because they often have hypoxic areas in which circulation is compromised due to structurally disorganized blood vessels. Hypoxia-response elements (HREs) are responsible for activating gene transcription in response to hypoxia. In this study, we constructed a hypoxia-response plasmid vector producing short hairpin RNA (shRNA) against B-cell leukemia/lymphoma-2 (bcl-2), an anti-apoptotic factor. The hypoxia-response promoter was made by inserting tandem repeats of HREs upstream of cytomegalovirus (CMV) promoter (HRE-CMV). HRE-CMV shbcl-2 vector consisted of bcl-2 shRNA under the control of HRE-CMV promoter. In hypoxic mouse rectum carcinoma cells (colon-26), the production of bcl-2 shRNA driven by HRE-CMV promoter was approximately 2-fold greater than that driven by CMV promoter. A single intratumoral (i.t.) injection of 40 microg HRE-CMV shbcl-2 to colon-26 tumor-bearing mice caused apoptotic cell death, and repetitive treatment with HRE-CMV shbcl-2 (40 microg/mouse, i.t.) also significantly suppressed the growth of colon-26 tumor cells implanted in mice. Apoptotic and anti-tumor effects were not observed in tumor-bearing mice treated with CMV shbcl-2. These results reveal the ability of HRE-CMV shbcl-2 vector to suppress the expression of bcl-2 in hypoxic tumor cells and suggest the usefulness of our constructed hypoxia-response plasmid vector to treat malignant tumors. [Supplementary Figures: available only at http://dx.doi.org/10.1254/jphs.10054FP].

[Sendai virus vector: vector development and its application to health care and biotechnology].

PubMed

Iida, Akihiro

2007-06-01

Sendai virus (SeV) is an enveloped virus with a nonsegmented negative-strand RNA genome and a member of the paramyxovirus family. We have developed SeV vector which has shown a high efficiently of gene transfer and expression of foreign genes to a wide range of dividing and non-dividing mammalian cells and tissues. One of the characteristics of the vector is that the genome is located exclusively in the cytoplasm of infected cells and does not go through a DNA phase; thus there is no concern about unwanted integration of foreign sequences into chromosomal DNA. Therefore, this new class of "cytoplasmic RNA vector", an RNA vector with cytoplasmic expression, is expected to be a safer and more efficient viral vector than existing vectors for application to human therapy in various fields including gene therapy and vaccination. In this review, I describe development of Sendai virus vector, its application in the field of biotechnology and clinical application aiming to treat for a large number of diseases including cancer, cardiovascular disease, infectious diseases and neurologic disorders.

CCR5 Gene Disruption via Lentiviral Vectors Expressing Cas9 and Single Guided RNA Renders Cells Resistant to HIV-1 Infection

PubMed Central

Liu, Jingjing; Zhang, Di; Kimata, Jason T.; Zhou, Paul

2014-01-01

CCR5, a coreceptor for HIV-1 entry, is a major target for drug and genetic intervention against HIV-1. Genetic intervention strategies have knocked down CCR5 expression levels by shRNA or disrupted the CCR5 gene using zinc finger nucleases (ZFN) or Transcription activator-like effector nuclease (TALEN). In the present study, we silenced CCR5 via CRISPR associated protein 9 (Cas9) and single guided RNAs (sgRNAs). We constructed lentiviral vectors expressing Cas9 and CCR5 sgRNAs. We show that a single round transduction of lentiviral vectors expressing Cas9 and CCR5 sgRNAs into HIV-1 susceptible human CD4+ cells yields high frequencies of CCR5 gene disruption. CCR5 gene-disrupted cells are not only resistant to R5-tropic HIV-1, including transmitted/founder (T/F) HIV-1 isolates, but also have selective advantage over CCR5 gene-undisrupted cells during R5-tropic HIV-1 infection. Importantly, using T7 endonuclease I assay we did not detect genome mutations at potential off-target sites that are highly homologous to these CCR5 sgRNAs in stably transduced cells even at 84 days post transduction. Thus we conclude that silencing of CCR5 via Cas9 and CCR5-specific sgRNAs could be a viable alternative strategy for engineering resistance against HIV-1. PMID:25541967

Vector-based RNA interference against vascular endothelial growth factor-A significantly limits vascularization and growth of prostate cancer in vivo.

PubMed

Wannenes, Francesca; Ciafré, Silvia Anna; Niola, Francesco; Frajese, Gaetano; Farace, Maria Giulia

2005-12-01

RNA interference technology is emerging as a very potent tool to obtain a cellular knockdown of a desired gene. In this work we used vector-based RNA interference to inhibit vascular endothelial growth factor (VEGF) expression in prostate cancer in vitro and in vivo. We demonstrated that transduction with a plasmid carrying a small interfering RNA targeting all isoforms of VEGF, dramatically impairs the expression of this growth factor in the human prostate cancer cell line PC3. As a consequence, PC3 cells loose their ability to induce one of the fundamental steps of angiogenesis, namely the formation of a tube-like network in vitro. Most importantly, our "therapeutic" vector is able to impair tumor growth rate and vascularization in vivo. We show that a single injection of naked plasmid in developing neoplastic mass significantly decreases microvessel density in an androgen-refractory prostate xenograft and is able to sustain a long-term slowing down of tumor growth. In conclusion, our results confirm the basic role of VEGF in the angiogenic development of prostate carcinoma, and suggest that the use of our vector-based RNA interference approach to inhibit angiogenesis could be an effective tool in view of future gene therapy applications for prostate cancer.

Golden Gate Assembly of CRISPR gRNA expression array for simultaneously targeting multiple genes.

PubMed

Vad-Nielsen, Johan; Lin, Lin; Bolund, Lars; Nielsen, Anders Lade; Luo, Yonglun

2016-11-01

The engineered CRISPR/Cas9 technology has developed as the most efficient and broadly used genome editing tool. However, simultaneously targeting multiple genes (or genomic loci) in the same individual cells using CRISPR/Cas9 remain one technical challenge. In this article, we have developed a Golden Gate Assembly method for the generation of CRISPR gRNA expression arrays, thus enabling simultaneous gene targeting. Using this method, the generation of CRISPR gRNA expression array can be accomplished in 2 weeks, and contains up to 30 gRNA expression cassettes. We demonstrated in the study that simultaneously targeting 10 genomic loci or simultaneously inhibition of multiple endogenous genes could be achieved using the multiplexed gRNA expression array vector in human cells. The complete set of plasmids is available through the non-profit plasmid repository Addgene.

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis

PubMed Central

Santangeloyz, K.S.; Bertoneyz, A.L.

2011-01-01

summary Objective To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Methods Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RTPCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2−ΔΔCT) method. Results Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis.

PubMed

Santangelo, K S; Bertone, A L

2011-12-01

To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RT-PCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2(-ΔΔCT)) method. Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted

MicroRNA Silencing Improves the Tumor Specificity of Adenoviral Transgene Expression

PubMed Central

Card, Paul B.; Hogg, Richard T.; del Alcazar, Carlos Gil

2012-01-01

Adenoviral technology has been thoroughly evaluated for delivering genetic material to tumor tissue and the surrounding microenvironment. Almost any gene can be cloned into an adenovirus (Ad) vector, which when combined with strong, constitutively active promoters permit up to a million-fold amplification of the transgene in a single adenoviral particle, thus facilitating their use in cancer therapy and imaging. However, widespread infection of the liver and other non-targeted tissues by Ad vectors is a substantial problem that often results in significant liver inflammation and hepatotoxicity at doses required to achieve efficient tumor transduction. miR-122 is a highly expressed liver-specific microRNA that provides a unique opportunity for down-regulating adenoviral transgene expression in liver tissue. The binding of endogenous miRNAs to complementary miRNA targeting elements (miRTs) incorporated into the 3′ untranslated region of adenoviral transgenes interferes with message stability and/or protein translation, and miRT elements against miR-122 (miRT-122) can selectively reduce adenoviral transgene expression in the liver. Previous studies using miR-122-based regulation, with and without other types of transcriptional targeting, have yielded promising preliminary results. However, investigations to date evaluating miRT-122 elements for improving tumor specificity have used either non-tumor bearing animals or direct intratumoral injection as the mode of delivery. In the present study, we confirmed the ability of miRT-122 sequences to selectively down-regulate adenoviral luciferase expression in the liver in vitro and in vivo, and show that this strategy can improve tumor specific transgene expression in a HT1080 human fibrosarcoma model. Rapid growth and the inefficient flow of blood through tumor neovasculature often results in profound hypoxia, which provides additional opportunities for targeting solid tumors and their microenvironment using vectors

Blocking of SMAD4 expression by shRNA effectively inhibits fibrogenesis of human hepatic stellate cells.

PubMed

Khanizadeh, Sayyad; Ravanshad, Mehrdad; Hosseini, SeyedYounes; Davoodian, Parivash; Nejati Zadeh, Azim; Sarvari, Jamal

2015-01-01

In this study, to clarify the SMAD4 blocking impact on fibrosis process, we investigated its down-regulation by shRNA on activated human LX-2 cell, in vitro. Liver fibrosis is a critical consequence of chronic damage to the liver that can progress toward advanced diseases, liver cirrhosis and hepatocellular carcinoma (HCC). Different SMAD proteins play as major mediators in the fibrogenesis activity of hepatic stellate cells through TGF-β pathways, but the extent of SMAD4 as a co-SMAD protein remained less clear. vector expressing verified shRNA targeting human SMAD4 gene was transfected into LX-2 cells. The GFP expressing plasmid was transfected in the same manner as a control group while leptin treated cells were employed as positive controls. Subsequently, total RNA was extracted and real-time PCR was performed to measure the mRNA levels of SMAD4, COL-1A1, α-SMA, TGF-β and TIMP-1. Furthermore, trypan blue exclusion was performed to test the effect of plasmid transfection and SMAD4 shutting-down on cellular viability. The results indicated that the expression of SMAD4was down-regulated following shRNA transfection intoLX-2 cells (P<0.001). The gene expression analysis of fibrotic genes in LX-2 cells showed that SMAD4 blocking by shRNA significantly reduced the expression level of fibrotic genes when compared to control plasmids (P<0.001). Vector expressing SMAD4-shRNA induced no significant cytotoxic or proliferative effects on LX-2 cells as determined by viability assay (P<0.05). The results of this study suggested that knockdown of SMAD4 expression in stellate cell can control the progression of fibrogenesis through TGF-β pathway blocking.

Using artificial microRNA sponges to achieve microRNA loss-of-function in cancer cells.

PubMed

Tay, Felix Chang; Lim, Jia Kai; Zhu, Haibao; Hin, Lau Cia; Wang, Shu

2015-01-01

Widely observed dysregulation of microRNAs (miRNAs) in human cancer has led to substantial speculation regarding possible functions of these short, non-coding RNAs in cancer development and manipulation of miRNA expression to treat cancer. To achieve miRNA loss-of-function, miRNA sponge technology has been developed to use plasmid or viral vectors for intracellular expression of tandemly arrayed, bulged miRNA binding sites complementary to a miRNA target to saturate its ability to regulate natural mRNAs. A strong viral promoter can be used in miRNA sponge vectors to generate high-level expression of the competitive inhibitor transcripts for either transient or long-term inhibition of miRNA function. Taking the advantage of sharing a common seed sequence by members of a miRNA family, this technology is especially useful in knocking down the expression of a family of miRNAs, providing a powerful means for simultaneous inhibition of multiple miRNAs of interest with a single inhibitor. Knockdown of overexpressed oncogenic miRNAs with the technology can be a rational therapeutic strategy for cancer, whereas inhibition of tumor-suppressive miRNAs by the sponges will be useful in deciphering functions of miRNAs in oncogenesis. Herein, we discuss the design of miRNA sponge expression vectors and the use of the vectors to gain better understanding of miRNA's roles in cancer biology and as an alternative tool for anticancer gene therapy. Copyright © 2014 Elsevier B.V. All rights reserved.

Effects of siRNA-mediated suppression of HPV-11 L1 expression on the proliferation and apoptosis of vaginal epithelial cells

PubMed Central

Zeng, Juan; Yang, Shumei; Wang, Xiaorui; Gao, Yan; Zhang, Mei

2017-01-01

The aim of the present study was to investigate the effects of human papillomavirus (HPV) infection on the gynecological disease of vaginitis and to demonstrate how the small interfering RNA (siRNA) method may be used for HPV prevention in the clinic. Human vaginal epithelial cells were transfected with HPV-11 L1 expression vector and siRNA-HPV-11 L1 vectors and a control group was transfected with scrambled siRNA. Cell proliferation in each group was analyzed using the MTT assay and the expression of apoptosis-associated proteins was measured by western blot analysis. Compared with the control group, HPV-11 L1 mRNA and protein levels were significantly increased following transfection with the HPV-11 L1 expression vector in cells (P<0.05), but this result was significantly reversed by silencing of HPV-11 L1 (P<0.05). In addition, cell proliferation in the HPV-11 group was lower than that in the control group; however, cell proliferation was significantly increased in cells transfected with silenced L1 compared with that in the control group (P<0.05). Furthermore, silencing of HPV-11 L1 significantly decreased caspase-3 and caspase-9 expressions in cells, whereas the expression was increased in the HPV-11 L1 group (P<0.05). The present study suggested that siRNA-mediated silencing of HPV-11 L1 may have potential therapeutic applications for treating gynecological diseases associated with HPV-11 infection. PMID:28413509

Kaposi's Sarcoma-Associated Herpesvirus MicroRNA Single-Nucleotide Polymorphisms Identified in Clinical Samples Can Affect MicroRNA Processing, Level of Expression, and Silencing Activity

PubMed Central

Han, Soo-Jin; Marshall, Vickie; Barsov, Eugene; Quiñones, Octavio; Ray, Alex; Labo, Nazzarena; Trivett, Matthew; Ott, David; Renne, Rolf

2013-01-01

Kaposi's sarcoma-associated herpesvirus (KSHV) encodes 12 pre-microRNAs that can produce 25 KSHV mature microRNAs. We previously reported single-nucleotide polymorphisms (SNPs) in KSHV-encoded pre-microRNA and mature microRNA sequences from clinical samples (V. Marshall et al., J. Infect. Dis., 195:645–659, 2007). To determine whether microRNA SNPs affect pre-microRNA processing and, ultimately, mature microRNA expression levels, we performed a detailed comparative analysis of (i) mature microRNA expression levels, (ii) in vitro Drosha/Dicer processing, and (iii) RNA-induced silencing complex-dependent targeting of wild-type (wt) and variant microRNA genes. Expression of pairs of wt and variant pre-microRNAs from retroviral vectors and measurement of KSHV mature microRNA expression by real-time reverse transcription-PCR (RT-PCR) revealed differential expression levels that correlated with the presence of specific sequence polymorphisms. Measurement of KSHV mature microRNA expression in a panel of primary effusion lymphoma cell lines by real-time RT-PCR recapitulated some observed expression differences but suggested a more complex relationship between sequence differences and expression of mature microRNA. Furthermore, in vitro maturation assays demonstrated significant SNP-associated changes in Drosha/DGCR8 and/or Dicer processing. These data demonstrate that SNPs within KSHV-encoded pre-microRNAs are associated with differential microRNA expression levels. Given the multiple reports on the involvement of microRNAs in cancer, the biological significance of these phenotypic and genotypic variants merits further studies in patients with KSHV-associated malignancies. PMID:24006441

MicroRNA-Regulated Non-Viral Vectors with Improved Tumor Specificity in an Orthotopic Rat Model of Hepatocellular Carcinoma

PubMed Central

Ronald, John A.; Katzenberg, Regina; Nielsen, Carsten H.; Jae, Hwan Jun; Hofmann, Lawrence V.; Gambhir, Sanjiv S.

2013-01-01

In hepatocellular carcinoma, tumor specificity of gene therapy is of utmost importance to preserve liver function. MicroRNAs are powerful negative regulators of gene expression and many are down-regulated in human HCC. We identified seven miRNAs that are also down-regulated in tumors in a rat hepatoma model (p<0.05) and attempted to improve tumor specificity by constructing a panel of luciferase-expressing vectors containing binding sites for these microRNAs. Attenuation of luciferase expression by the corresponding microRNAs was confirmed across various cell lines and in mouse liver. We then tested our vectors in tumor-bearing rats and identified two microRNAs, miR-26a and miR-122, that significantly decreased expression in liver compared to control vector (6.40% and 0.26%, respectively; p<0.05). In tumor, miR-122 had a non-significant trend towards decreased (~50%) expression , while miR-26 had no significant effect on tumor expression. To our knowledge this is the first work using differentially expressed microRNAs to de-target transgene expression in an orthotopic hepatoma model and identification of miR-26a in addition to miR-122 for de-targeting liver. Considering the heterogeneity of microRNA expression in human HCC, this information will be important in guiding development of more personalized vectors for the treatment of this devastating disease. PMID:23719066

The small non-coding RNA response to virus infection in the Leishmania vector Lutzomyia longipalpis.

PubMed

Ferreira, Flávia Viana; Aguiar, Eric Roberto Guimarães Rocha; Olmo, Roenick Proveti; de Oliveira, Karla Pollyanna Vieira; Silva, Emanuele Guimarães; Sant'Anna, Maurício Roberto Viana; Gontijo, Nelder de Figueiredo; Kroon, Erna Geessien; Imler, Jean Luc; Marques, João Trindade

2018-06-01

Sandflies are well known vectors for Leishmania but also transmit a number of arthropod-borne viruses (arboviruses). Few studies have addressed the interaction between sandflies and arboviruses. RNA interference (RNAi) mechanisms utilize small non-coding RNAs to regulate different aspects of host-pathogen interactions. The small interfering RNA (siRNA) pathway is a broad antiviral mechanism in insects. In addition, at least in mosquitoes, another RNAi mechanism mediated by PIWI interacting RNAs (piRNAs) is activated by viral infection. Finally, endogenous microRNAs (miRNA) may also regulate host immune responses. Here, we analyzed the small non-coding RNA response to Vesicular stomatitis virus (VSV) infection in the sandfly Lutzoymia longipalpis. We detected abundant production of virus-derived siRNAs after VSV infection in adult sandflies. However, there was no production of virus-derived piRNAs and only mild changes in the expression of vector miRNAs in response to infection. We also observed abundant production of virus-derived siRNAs against two other viruses in Lutzomyia Lulo cells. Together, our results suggest that the siRNA but not the piRNA pathway mediates an antiviral response in sandflies. In agreement with this hypothesis, pre-treatment of cells with dsRNA against VSV was able to inhibit viral replication while knock-down of the central siRNA component, Argonaute-2, led to increased virus levels. Our work begins to elucidate the role of RNAi mechanisms in the interaction between L. longipalpis and viruses and should also open the way for studies with other sandfly-borne pathogens.

A dual host vector for Fab phage display and expression of native IgG in mammalian cells.

PubMed

Tesar, Devin; Hötzel, Isidro

2013-10-01

A significant bottleneck in antibody discovery by phage display is the transfer of immunoglobulin variable regions from phage clones to vectors that express immunoglobulin G (IgG) in mammalian cells for screening. Here, we describe a novel phagemid vector for Fab phage display that allows expression of native IgG in mammalian cells without sub-cloning. The vector uses an optimized mammalian signal sequence that drives robust expression of Fab fragments fused to an M13 phage coat protein in Escherichia coli and IgG expression in mammalian cells. To allow the expression of Fab fragments fused to a phage coat protein in E.coli and full-length IgG in mammalian cells from the same vector without sub-cloning, the sequence encoding the phage coat protein was embedded in an optimized synthetic intron within the immunoglobulin heavy chain gene. This intron is removed from transcripts in mammalian cells by RNA splicing. Using this vector, we constructed a synthetic Fab phage display library with diversity in the heavy chain only and selected for clones binding different antigens. Co-transfection of mammalian cells with DNA from individual phage clones and a plasmid expressing the invariant light chain resulted in the expression of native IgG that was used to assay affinity, ligand blocking activity and specificity.

Efficiency of VIGS and gene expression in a novel bipartite potexvirus vector delivery system as a function of strength of TGB1 silencing suppression.

PubMed

Lim, Hyoun-Sub; Vaira, Anna Maria; Domier, Leslie L; Lee, Sung Chul; Kim, Hong Gi; Hammond, John

2010-06-20

We have developed plant virus-based vectors for virus-induced gene silencing (VIGS) and protein expression, based on Alternanthera mosaic virus (AltMV), for infection of a wide range of host plants including Nicotiana benthamiana and Arabidopsis thaliana by either mechanical inoculation of in vitro transcripts or via agroinfiltration. In vivo transcripts produced by co-agroinfiltration of bacteriophage T7 RNA polymerase resulted in T7-driven AltMV infection from a binary vector in the absence of the Cauliflower mosaic virus 35S promoter. An artificial bipartite viral vector delivery system was created by separating the AltMV RNA-dependent RNA polymerase and Triple Gene Block (TGB)123-Coat protein (CP) coding regions into two constructs each bearing the AltMV 5' and 3' non-coding regions, which recombined in planta to generate a full-length AltMV genome. Substitution of TGB1 L(88)P, and equivalent changes in other potexvirus TGB1 proteins, affected RNA silencing suppression efficacy and suitability of the vectors from protein expression to VIGS. Published by Elsevier Inc.

Persistent interferon transgene expression by RNA interference-mediated silencing of interferon receptors.

PubMed

Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu

2010-09-01

The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.

Molecular interactions and immune responses between Maize fine streak virus and the leafhopper vector Graminella nigrifrons through differential expression and RNA interference.

PubMed

Chen, Y; Redinbaugh, M G; Michel, A P

2015-06-01

Graminella nigrifrons is the only known vector for Maize fine streak virus (MFSV). In this study, we used real-time quantitative PCR to compare the expression profiles of transcripts that putatively function in the insect immune response: four peptidoglycan recognition proteins (PGRP-SB1, -SD, -LC and LB), Toll, spaetzle, defensin, Dicer-2 (Dcr-2), Argonaut-2 (Ago-2) and Arsenic resistance protein 2 (Ars-2). Except for PGRP-LB and defensin, transcripts involved in humoral pathways were significantly suppressed in G. nigrifrons fed on MFSV-infected maize. The abundance of three RNA interference (RNAi) pathway transcripts (Dcr-2, Ago-2, Ars-2) was significantly lower in nontransmitting relative to transmitting G. nigrifrons. Injection with double-stranded RNA (dsRNA) encoding segments of the PGRP-LC and Dcr-2 transcripts effectively reduced transcript levels by 90 and 75% over 14 and 22 days, respectively. MFSV acquisition and transmission were not significantly affected by injection of either dsRNA. Knock-down of PGRP-LC resulted in significant mortality (greater than 90%) at 27 days postinjection, and resulted in more abnormal moults relative to those injected with Dcr-2 or control dsRNA. The use of RNAi to silence G. nigrifrons transcripts will facilitate the study of gene function and pathogen transmission, and may provide approaches for developing novel targets of RNAi-based pest control. © 2015 The Royal Entomological Society.

[Cloning of Chinese Banna minipig inbred-line alpha1,3-galactosyltransferase gene and construction of its recombinant eukaryotic expression vector].

PubMed

Zhu, Shengming; Wang, Yanping; Zheng, Hong; Cheng, Jingqiu; Lu, Yanrong; Zeng, Yangzhi; Wang, Yu; Wang, Zhu

2009-04-01

This study sought to clone Chinese Banna minipig inbred-line (BMI) alpha1,3-galactosyltransferase (alpha1,3-GT) gene and construct its recombinant eukaryotic expression vector. Total RNA was isolated from BMI liver. Full length cDNA of alpha1,3-GT gene was amplified by RT-PCR and cloned into pMD18-T vector to sequence. Subsequently, alpha1,3-GT gene was inserted into pEGFP-N1 to construct eukaryotic expression vector pEGFP-N1-GT. Then the reconstructed plasmid pEGFP-N1-GT was transiently transfected into human lung cancer cell line A549. The expression of alpha1,3-GT mRNA in transfected cells was detected by RT-PCR. FITC-BS-IB4 lectin was used in the direct immunofluorescence method, which was performed to observe the alpha-Gal synthesis function of BMI alpha1,3-GT in transfected cells. The results showed that full length of BMI alpha1,3-GT cDNA was 1116 bp. BMI alpha1,3-GT cDNA sequence was highly homogenous with those of mouse and bovine, and was exactly the same as the complete sequence of those of swine, pEGFP-N1-GT was confirmed by enzyme digestion and PCR. The expression of alpha1,3-GT mRNA was detected in A549 cells transfected by pEGFP-N1-GT. The expression of alpha-Gal was observed on the membrane of A549 cells transfected by pEGFP-N1-GT. Successful cloning of BMI alpha1,3-GT cDNA and construction of its eukaryotic expression vector have established a foundation for further research and application of BMI alpha1,3-GT in the fields of xenotransplantation and immunological therapy of cancer.

Packaging of HCV-RNA into lentiviral vector

DOE Office of Scientific and Technical Information (OSTI.GOV)

Caval, Vincent; Piver, Eric; Service de Biochimie et Biologie Moleculaire, CHRU de Tours

2011-11-04

Highlights: Black-Right-Pointing-Pointer Description of HCV-RNA Core-D1 interactions. Black-Right-Pointing-Pointer In vivo evaluation of the packaging of HCV genome. Black-Right-Pointing-Pointer Determination of the role of the three basic sub-domains of D1. Black-Right-Pointing-Pointer Heterologous system involving HIV-1 vector particles to mobilise HCV genome. Black-Right-Pointing-Pointer Full length mobilisation of HCV genome and HCV-receptor-independent entry. -- Abstract: The advent of infectious molecular clones of Hepatitis C virus (HCV) has unlocked the understanding of HCV life cycle. However, packaging of the genomic RNA, which is crucial to generate infectious viral particles, remains poorly understood. Molecular interactions of the domain 1 (D1) of HCV Core protein andmore » HCV RNA have been described in vitro. Since compaction of genetic information within HCV genome has hampered conventional mutational approach to study packaging in vivo, we developed a novel heterologous system to evaluate the interactions between HCV RNA and Core D1. For this, we took advantage of the recruitment of Vpr fusion-proteins into HIV-1 particles. By fusing HCV Core D1 to Vpr we were able to package and transfer a HCV subgenomic replicon into a HIV-1 based lentiviral vector. We next examined how deletion mutants of basic sub-domains of Core D1 influenced HCV RNA recruitment. The results emphasized the crucial role of the first and third basic regions of D1 in packaging. Interestingly, the system described here allowed us to mobilise full-length JFH1 genome in CD81 defective cells, which are normally refractory to HCV infection. This finding paves the way to an evaluation of the replication capability of HCV in various cell types.« less

Posttranscriptional mRNA processing as a mechanism for regulation of human A1 adenosine receptor expression.

PubMed Central

Ren, H; Stiles, G L

1994-01-01

The human A1 adenosine receptor gene contains six exons with exons 1, 2, 3, 4, and part of 5 representing 5' untranslated regions. Reverse transcription-PCR with exon-specific primers showed two distinct transcripts containing either exons 3, 5, and 6 or exons 4, 5, and 6, with exons 3 and 4 being mutually exclusive. No mature mRNAs containing exons 1 and 2 have been detected. All human tissues that express any A1 receptors contain mRNA with exons 4, 5, and 6. Tissues which express high levels of A1 receptors contain mRNA with exons 3, 5, and 6. Exon 4 contains two upstream ATG codons whereas exon 3 contains none. COS cells transfected with expression vectors containing exon 4 (exons 1-6, 3-6, or Ex4-6) express much lower levels of A1 receptors than vectors without exon 4 (exons 3, 5, and 6). Mutation of upstream ATG codons in exon 4 leads to 3- to 7-fold increased A1 receptor expression, up to the level seen with the construct containing exons 3, 5, and 6. Thus, in human tissues "basal" levels of A1 receptors can be expressed by use of mRNA containing exons 4, 5, and 6, but when high levels are needed, alternative transcripts with exons 3, 5, and 6 are produced. Images PMID:8197148

Stable suppression of myostatin gene expression in goat fetal fibroblast cells by lentiviral vector-mediated RNAi.

PubMed

Patel, Utsav A; Patel, Amrutlal K; Joshi, Chaitanya G

2015-01-01

Myostatin (MSTN) is a secreted growth factor that negatively regulates skeletal muscle mass, and therefore, strategies to block myostatin-signaling pathway have been extensively pursued to increase the muscle mass in livestock. Here, we report a lentiviral vector-based delivery of shRNA to disrupt myostatin expression into goat fetal fibroblasts (GFFs) that were commonly used as karyoplast donors in somatic-cell nuclear transfer (SCNT) studies. Sh-RNA positive cells were screened by puromycin selection. Using real-time polymerase chain reaction (PCR), we demonstrated efficient knockdown of endogenous myostatin mRNA with 64% down-regulation in sh2 shRNA-treated GFF cells compared to GFF cells treated by control lentivirus without shRNA. Moreover, we have also demonstrated both the induction of interferon response and the expression of genes regulating myogenesis in GFF cells. The results indicate that myostatin-targeting siRNA produced endogenously could efficiently down-regulate myostatin expression. Therefore, targeted knockdown of the MSTN gene using lentivirus-mediated shRNA transgenics would facilitate customized cell engineering, allowing potential use in the establishment of stable cell lines to produce genetically engineered animals. © 2014 American Institute of Chemical Engineers.

RNA Interference in Insect Vectors for Plant Viruses.

PubMed

Kanakala, Surapathrudu; Ghanim, Murad

2016-12-12

Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists.

RNA Interference in Insect Vectors for Plant Viruses

PubMed Central

Kanakala, Surapathrudu; Ghanim, Murad

2016-01-01

Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists. PMID:27973446

Generation of a stable cell line for constitutive miRNA expression.

PubMed

Lieber, Diana

2013-01-01

miRNAs have in recent years emerged as novel players in virus-host interactions. While individual miRNAs are capable of regulating many targets simultaneously, not much is known about the role of distinct host or viral miRNAs in the context of infection. Analysis of the function of a miRNA is often hampered by the complexity of virus-host interactions and the enormous changes in the host cell during infection. Many viral miRNAs as for example from Kaposi sarcoma-associated Herpesvirus (KSHV) are probably exclusively expressed in latent infection. This might lead to a steady-state situation with offense and defense mechanisms counteracting each other. Cellular miRNAs involved in defense against pathogens on the other hand might be suppressed in infection. A cell culture system allowing for constitutive expression of individual miRNAs at high levels is a useful tool to enhance miRNA-specific functions and to uncouple viral miRNA function from other infection-related mechanisms. Here, a protocol is described to generate stable cell lines for constitutive expression of single cellular or viral miRNA precursors in absence of infection. The procedure comprises cloning of the precursor sequence, generation of the lentiviral expression vector, transduction of the cells of interest, selection for polyclonal cell lines, and isolation of monoclonal cell lines by limiting dilution.

Constitutive Expression of Short Hairpin RNA in Vivo Triggers Buildup of Mature Hairpin Molecules

PubMed Central

Ahn, M.; Witting, S.R.; Ruiz, R.; Saxena, R.

2011-01-01

Abstract RNA interference (RNAi) has become the cornerstone technology for studying gene function in mammalian cells. In addition, it is a promising therapeutic treatment for multiple human diseases. Virus-mediated constitutive expression of short hairpin RNA (shRNA) has the potential to provide a permanent source of silencing molecules to tissues, and it is being devised as a strategy for the treatment of liver conditions such as hepatitis B and hepatitis C virus infection. Unintended interaction between silencing molecules and cellular components, leading to toxic effects, has been described in vitro. Despite the enormous interest in using the RNAi technology for in vivo applications, little is known about the safety of constitutively expressing shRNA for multiple weeks. Here we report the effects of in vivo shRNA expression, using helper-dependent adenoviral vectors. We show that gene-specific knockdown is maintained for at least 6 weeks after injection of 1 × 1011 viral particles. Nonetheless, accumulation of mature shRNA molecules was observed up to weeks 3 and 4, and then declined gradually, suggesting the buildup of mature shRNA molecules induced cell death with concomitant loss of viral DNA and shRNA expression. No evidence of well-characterized innate immunity activation (such as interferon production) or saturation of the exportin-5 pathway was observed. Overall, our data suggest constitutive expression of shRNA results in accumulation of mature shRNA molecules, inducing cellular toxicity at late time points, despite the presence of gene silencing. PMID:21780944

[Construction of rAAV2-GPIIb/IIIa vector and test of its expression and function in vitro].

PubMed

Wang, Kai; Peng, Jian-Qiang; Chen, Fang-Ping; Wu, Xiao-Bin

2006-04-01

This study was aimed to explore the possibility of rAAV2 vector-mediating gene therapy for Glanzmann' s thrombasthenia. The rAAV2-GPIIb/IIIa vector was constructed. The GPIIb/IIIa gene expression in mammal cell were examined by different methods, such as: detection of mRNA expression in BHK-21 cells after 24 hours of infection (MOI = 1 x 10(5) v.g/cell) was performed by RT-PCR; the relation between MOI and quantity of GPII6/IIIa gene expression was detected by FACS after 48 hours of infection; GPIIb/IIIa protein expression in BHK-21 cells after 48 hours of infection (MOI = 10(5) v x g/cell) was assayed by Western blot, GPIIb/IIIa protein expression on cell surface was detected by immunofluorescence, and the biological function of expressing product was determined by PAC-1 conjunct experiments. The results showed that GPIIb/IIIa gene expression in mRNA level could be detected in BHK-21 cells after 24 hours of infection at MOI = 1 x 10(5) v x g/cell and the GPIIb/IIIa gene expression in protein level could be detected in BHK-21 cells after 48 hours of infection at MOI = 1 x 10(5) v x g/cell. In certain range, quantity of GPIIb/IIIa gene expression increased with MOI, but overdose of MOI decreased quantity of GPIIb/IIIa gene expression. Activated product of GPIIb/IIIa gene expression could combined with PAC-I, and possesed normal biological function. In conclusion, rAAV2 vactor can effectively mediate GPIIb and GPIIIa gene expressing in mammal cells, and the products of these genes exhibit biological function. This result may provide a basis for application of rAAV2 vector in Glanzmann's thrombasthenia gene therapy in furture.

Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

NASA Astrophysics Data System (ADS)

Travella, Silvia; Keller, Beat

Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

Adeno-associated virus gene therapy vector scAAVIGF-I for transduction of equine articular chondrocytes and RNA-seq analysis.

PubMed

Hemphill, D D; McIlwraith, C W; Slayden, R A; Samulski, R J; Goodrich, L R

2016-05-01

IGF-I is one of several anabolic factors being investigated for the treatment of osteoarthritis (OA). Due to the short biological half-life, extended administration is required for more robust cartilage healing. Here we create a self-complimentary adeno-associated virus (AAV) gene therapy vector utilizing the transgene for IGF-I. Various biochemical assays were performed to investigate the cellular response to scAAVIGF-I treatment vs an scAAVGFP positive transduction control and a negative for transduction control culture. RNA-sequencing analysis was also performed to establish a differential regulation profile of scAAVIGF-I transduced chondrocytes. Biochemical analyses indicated an average media IGF-I concentration of 608 ng/ml in the scAAVIGF-I transduced chondrocytes. This increase in IGF-I led to increased expression of collagen type II and aggrecan and increased protein concentrations of cellular collagen type II and media glycosaminoglycan vs both controls. RNA-seq revealed a global regulatory pattern consisting of 113 differentially regulated GO categories including those for chondrocyte and cartilage development and regulation of apoptosis. This research substantiates that scAAVIGF-I gene therapy vector increased production of IGF-I to clinically relevant levels with a biological response by chondrocytes conducive to increased cartilage healing. The RNA-seq further established a set of differentially expressed genes and gene ontologies induced by the scAAVIGF-I vector while controlling for AAV infection. This dataset provides a static representation of the cellular transcriptome that, while only consisting of one time point, will allow for further gene expression analyses to compare additional cartilage healing therapeutics or a transient cellular response. Copyright © 2015. Published by Elsevier Ltd.

Tissue-specific mRNA expression profiling in grape berry tissues

PubMed Central

Grimplet, Jerome; Deluc, Laurent G; Tillett, Richard L; Wheatley, Matthew D; Schlauch, Karen A; Cramer, Grant R; Cushman, John C

2007-01-01

Background Berries of grape (Vitis vinifera) contain three major tissue types (skin, pulp and seed) all of which contribute to the aroma, color, and flavor characters of wine. The pericarp, which is composed of the exocarp (skin) and mesocarp (pulp), not only functions to protect and feed the developing seed, but also to assist in the dispersal of the mature seed by avian and mammalian vectors. The skin provides volatile and nonvolatile aroma and color compounds, the pulp contributes organic acids and sugars, and the seeds provide condensed tannins, all of which are important to the formation of organoleptic characteristics of wine. In order to understand the transcriptional network responsible for controlling tissue-specific mRNA expression patterns, mRNA expression profiling was conducted on each tissue of mature berries of V. vinifera Cabernet Sauvignon using the Affymetrix GeneChip® Vitis oligonucleotide microarray ver. 1.0. In order to monitor the influence of water-deficit stress on tissue-specific expression patterns, mRNA expression profiles were also compared from mature berries harvested from vines subjected to well-watered or water-deficit conditions. Results Overall, berry tissues were found to express approximately 76% of genes represented on the Vitis microarray. Approximately 60% of these genes exhibited significant differential expression in one or more of the three major tissue types with more than 28% of genes showing pronounced (2-fold or greater) differences in mRNA expression. The largest difference in tissue-specific expression was observed between the seed and pulp/skin. Exocarp tissue, which is involved in pathogen defense and pigment production, showed higher mRNA abundance relative to other berry tissues for genes involved with flavonoid biosynthesis, pathogen resistance, and cell wall modification. Mesocarp tissue, which is considered a nutritive tissue, exhibited a higher mRNA abundance of genes involved in cell wall function and

Gene silencing efficiency and INF-β induction effects of splicing miRNA 155-based artificial miRNA with pre-miRNA stem-loop structures.

PubMed

Sin, Onsam; Mabiala, Prudence; Liu, Ye; Sun, Ying; Hu, Tao; Liu, Qingzhen; Guo, Deyin

2012-02-01

Artificial microRNA (miRNA) expression vectors have been developed and used for RNA interference. The secondary structure of artificial miRNA is important for RNA interference efficacy. We designed two groups of six artificial splicing miRNA 155-based miRNAs (SM155-based miRNAs) with the same target in the coding region or 3' UTR of a target gene and studied their RNA silencing efficiency and interferon β (IFN-β) induction effects. SM155-based miRNA with a mismatch at the +1 position and a bulge at the +11, +12 positions in a miRNA precursor stem-loop structure showed the highest gene silencing efficiency and lowest IFN-β induction effect (increased IFN-β mRNA level by 10% in both target cases), regardless of the specificity of the target sequence, suggesting that pSM155-based miRNA with this design could be a valuable miRNA expression vector.

Novel Nonreplicating Vaccinia Virus Vector Enhances Expression of Heterologous Genes and Suppresses Synthesis of Endogenous Viral Proteins.

PubMed

Wyatt, Linda S; Xiao, Wei; Americo, Jeffrey L; Earl, Patricia L; Moss, Bernard

2017-06-06

Viruses are used as expression vectors for protein synthesis, immunology research, vaccines, and therapeutics. Advantages of poxvirus vectors include the accommodation of large amounts of heterologous DNA, the presence of a cytoplasmic site of transcription, and high expression levels. On the other hand, competition of approximately 200 viral genes with the target gene for expression and immune recognition may be disadvantageous. We describe a vaccinia virus (VACV) vector that uses an early promoter to express the bacteriophage T7 RNA polymerase; has the A23R intermediate transcription factor gene deleted, thereby restricting virus replication to complementing cells; and has a heterologous gene regulated by a T7 promoter. In noncomplementing cells, viral early gene expression and DNA replication occurred normally but synthesis of intermediate and late proteins was prevented. Nevertheless, the progeny viral DNA provided templates for abundant expression of heterologous genes regulated by a T7 promoter. Selective expression of the Escherichia coli lac repressor gene from an intermediate promoter reduced transcription of the heterologous gene specifically in complementing cells, where large amounts might adversely impact VACV replication. Expression of heterologous proteins mediated by the A23R deletion vector equaled that of a replicating VACV, was higher than that of a nonreplicating modified vaccinia virus Ankara (MVA) vector used for candidate vaccines in vitro and in vivo , and was similarly immunogenic in mice. Unlike the MVA vector, the A23R deletion vector still expresses numerous early genes that can restrict immunogenicity as demonstrated here by the failure of the prototype vector to induce interferon alpha. By deleting immunomodulatory genes, we anticipate further improvements in the system. IMPORTANCE Vaccines provide an efficient and effective way of preventing infectious diseases. Nevertheless, new and better vaccines are needed. Vaccinia virus, which

Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

PubMed Central

2010-01-01

Background Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEXGM-CSF, we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. Methods To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Results Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. Conclusions This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical

Development of two bacterial artificial chromosome shuttle vectors for a recombination-based cloning and regulated expression of large genes in mammalian cells.

PubMed

Hong, Y K; Kim, D H; Beletskii, A; Lee, C; Memili, E; Strauss, W M

2001-04-01

Most conditional expression vectors designed for mammalian cells have been valuable systems for studying genes of interest by regulating their expressions. The available vectors, however, are reliable for the short-length cDNA clones and not optimal for relatively long fragments of genomic DNA or long cDNAs. Here, we report the construction of two bacterial artificial chromosome (BAC) vectors, capable of harboring large inserts and shuttling among Escherichia coli, yeast, and mammalian cells. These two vectors, pEYMT and pEYMI, contain conditional expression systems which are designed to be regulated by tetracycline and mouse interferons, respectively. To test the properties of the vectors, we cloned in both vectors the green fluorescence protein (GFP) through an in vitro ligation reaction and the 17.8-kb-long X-inactive-specific transcript (Xist) cDNA through homologous recombination in yeast. Subsequently, we characterized their regulated expression properties using real-time quantitative RT-PCR (TaqMan) and RNA-fluorescent in situ hybridization (FISH). We demonstrate that these two BAC vectors are good systems for recombination-based cloning and regulated expression of large genes in mammalian cells. Copyright 2001 Academic Press.

Stable Dispersions of Covalently Tethered Polymer Improved Graphene Oxide Nanoconjugates as an Effective Vector for siRNA Delivery.

PubMed

Yadav, Nisha; Kumar, Naveen; Prasad, Peeyush; Shirbhate, Shivani; Sehrawat, Seema; Lochab, Bimlesh

2018-05-02

cancer progression and metastasis. A significant reduction in the expression of the specific protein against which siRNA was delivered is revealed by Western blot assay. Furthermore, a pH-triggered release of siRNA from the GPD/siRNA complex was studied to provide a mechanistic insight toward unloading of siRNA from the vector. Current strategy is a way forward for designing effective therapeutic vectors for gene-based antitumor therapy.

Optimized paired-sgRNA/Cas9 cloning and expression cassette triggers high-efficiency multiplex genome editing in kiwifruit.

PubMed

Wang, Zupeng; Wang, Shuaibin; Li, Dawei; Zhang, Qiong; Li, Li; Zhong, Caihong; Liu, Yifei; Huang, Hongwen

2018-01-13

Kiwifruit is an important fruit crop; however, technologies for its functional genomic and molecular improvement are limited. The clustered regulatory interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) system has been successfully applied to genetic improvement in many crops, but its editing capability is variable depending on the different combinations of the synthetic guide RNA (sgRNA) and Cas9 protein expression devices. Optimizing conditions for its use within a particular species is therefore needed to achieve highly efficient genome editing. In this study, we developed a new cloning strategy for generating paired-sgRNA/Cas9 vectors containing four sgRNAs targeting the kiwifruit phytoene desaturase gene (AcPDS). Comparing to the previous method of paired-sgRNA cloning, our strategy only requires the synthesis of two gRNA-containing primers which largely reduces the cost. We further compared efficiencies of paired-sgRNA/Cas9 vectors containing different sgRNA expression devices, including both the polycistronic tRNA-sgRNA cassette (PTG) and the traditional CRISPR expression cassette. We found the mutagenesis frequency of the PTG/Cas9 system was 10-fold higher than that of the CRISPR/Cas9 system, coinciding with the relative expressions of sgRNAs in two different expression cassettes. In particular, we identified large chromosomal fragment deletions induced by the paired-sgRNAs of the PTG/Cas9 system. Finally, as expected, we found both systems can successfully induce the albino phenotype of kiwifruit plantlets regenerated from the G418-resistance callus lines. We conclude that the PTG/Cas9 system is a more powerful system than the traditional CRISPR/Cas9 system for kiwifruit genome editing, which provides valuable clues for optimizing CRISPR/Cas9 editing system in other plants. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons

Quantifying circular RNA expression from RNA-seq data using model-based framework.

PubMed

Li, Musheng; Xie, Xueying; Zhou, Jing; Sheng, Mengying; Yin, Xiaofeng; Ko, Eun-A; Zhou, Tong; Gu, Wanjun

2017-07-15

Circular RNAs (circRNAs) are a class of non-coding RNAs that are widely expressed in various cell lines and tissues of many organisms. Although the exact function of many circRNAs is largely unknown, the cell type-and tissue-specific circRNA expression has implicated their crucial functions in many biological processes. Hence, the quantification of circRNA expression from high-throughput RNA-seq data is becoming important to ascertain. Although many model-based methods have been developed to quantify linear RNA expression from RNA-seq data, these methods are not applicable to circRNA quantification. Here, we proposed a novel strategy that transforms circular transcripts to pseudo-linear transcripts and estimates the expression values of both circular and linear transcripts using an existing model-based algorithm, Sailfish. The new strategy can accurately estimate transcript expression of both linear and circular transcripts from RNA-seq data. Several factors, such as gene length, amount of expression and the ratio of circular to linear transcripts, had impacts on quantification performance of circular transcripts. In comparison to count-based tools, the new computational framework had superior performance in estimating the amount of circRNA expression from both simulated and real ribosomal RNA-depleted (rRNA-depleted) RNA-seq datasets. On the other hand, the consideration of circular transcripts in expression quantification from rRNA-depleted RNA-seq data showed substantial increased accuracy of linear transcript expression. Our proposed strategy was implemented in a program named Sailfish-cir. Sailfish-cir is freely available at https://github.com/zerodel/Sailfish-cir . tongz@medicine.nevada.edu or wanjun.gu@gmail.com. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

[Construction and selection of effective mouse Smad6 recombinant lenti-virus interference vectors].

PubMed

Yu, Jing; Qi, Mengchun; Deng, Jiupeng; Liu, Gang; Chen, Huaiqing

2010-10-01

This experiment was designed to construct mouse Smad6 recombinant RNA interference vectors and determine their interference effects on bone marrow mesenchymal stem cells (BMSCs). Three recombinant Smad6 RNA interference vectors were constructed by molecular clone techniques with a lenti-virus vector expressing green fluorescent protein (GFP), and the correctness of recombinant vectors was verified by DNA sequencing. Mouse BMSCs were used for transfection experiments and BMP-2 was in use for osteogenic induction of MSCs. The transfection efficiency of recombinant vectors was examined by Laser confocal scanning microscope and the interference effect of recombinant vectors on Smad6 gene expression was determined by real-time RT-PCR and Western blot, respectively. Three Smad6 recombinant RNA interference vectors were successfully constructed and their correctness was proved by DNA sequencing. After transfection, GFPs were effectively expressed in MSCs and all of three recombinant vectors gained high transfection efficiency (> 95%). Both real-time PCR and Western blot examination indicated that among three recombinant vectors, No. 2 Svector had the best interference effect and the interference effect was nearly 91% at protein level. In conclusion, Mouse recombinant Smad6 RNA interference (RNAi) vector was successfully constructed and it provided an effective tool for further studies on BMP signal pathways.

High-level recombinant protein expression in transgenic plants by using a double-inducible viral vector

PubMed Central

Werner, Stefan; Breus, Oksana; Symonenko, Yuri; Marillonnet, Sylvestre; Gleba, Yuri

2011-01-01

We describe here a unique ethanol-inducible process for expression of recombinant proteins in transgenic plants. The process is based on inducible release of viral RNA replicons from stably integrated DNA proreplicons. A simple treatment with ethanol releases the replicon leading to RNA amplification and high-level protein production. To achieve tight control of replicon activation and spread in the uninduced state, the viral vector has been deconstructed, and its two components, the replicon and the cell-to-cell movement protein, have each been placed separately under the control of an inducible promoter. Transgenic Nicotiana benthamiana plants incorporating this double-inducible system demonstrate negligible background expression, high (over 0.5 × 104-fold) induction multiples, and high absolute levels of protein expression upon induction (up to 4.3 mg/g fresh biomass). The process can be easily scaled up, supports expression of practically important recombinant proteins, and thus can be directly used for industrial manufacturing. PMID:21825158

Nephron segment-specific gene expression using AAV vectors.

PubMed

Asico, Laureano D; Cuevas, Santiago; Ma, Xiaobo; Jose, Pedro A; Armando, Ines; Konkalmatt, Prasad R

2018-02-26

AAV9 vector provides efficient gene transfer in all segments of the renal nephron, with minimum expression in non-renal cells, when administered retrogradely via the ureter. It is important to restrict the transgene expression to the desired cell type within the kidney, so that the physiological endpoints represent the function of the transgene expressed in that specific cell type within kidney. We hypothesized that segment-specific gene expression within the kidney can be accomplished using the highly efficient AAV9 vectors carrying the promoters of genes that are expressed exclusively in the desired segment of the nephron in combination with administration by retrograde infusion into the kidney via the ureter. We constructed AAV vectors carrying eGFP under the control of: kidney-specific cadherin (KSPC) gene promoter for expression in the entire nephron; Na + /glucose co-transporter (SGLT2) gene promoter for expression in the S1 and S2 segments of the proximal tubule; sodium, potassium, 2 chloride co-transporter (NKCC2) gene promoter for expression in the thick ascending limb of Henle's loop (TALH); E-cadherin (ECAD) gene promoter for expression in the collecting duct (CD); and cytomegalovirus (CMV) early promoter that provides expression in most of the mammalian cells, as control. We tested the specificity of the promoter constructs in vitro for cell type-specific expression in mouse kidney cells in primary culture, followed by retrograde infusion of the AAV vectors via the ureter in the mouse. Our data show that AAV9 vector, in combination with the segment-specific promoters administered by retrograde infusion via the ureter, provides renal nephron segment-specific gene expression. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Intraperitoneal AAV9-shRNA inhibits target expression in neonatal skeletal and cardiac muscles.

PubMed

Mayra, Azat; Tomimitsu, Hiroyuki; Kubodera, Takayuki; Kobayashi, Masaki; Piao, Wenying; Sunaga, Fumiko; Hirai, Yukihiko; Shimada, Takashi; Mizusawa, Hidehiro; Yokota, Takanori

2011-02-11

Systemic injections of AAV vectors generally transduce to the liver more effectively than to cardiac and skeletal muscles. The short hairpin RNA (shRNA)-expressing AAV9 (shRNA-AAV9) can also reduce target gene expression in the liver, but not enough in cardiac or skeletal muscles. Higher doses of shRNA-AAV9 required for inhibiting target genes in cardiac and skeletal muscles often results in shRNA-related toxicity including microRNA oversaturation that can induce fetal liver failure. In this study, we injected high-dose shRNA-AAV9 to neonates and efficiently silenced genes in cardiac and skeletal muscles without inducing liver toxicity. This is because AAV is most likely diluted or degraded in the liver than in cardiac or skeletal muscle during cell division after birth. We report that this systemically injected shRNA-AAV method does not induce any major side effects, such as liver dysfunction, and the dose of shRNA-AAV is sufficient for gene silencing in skeletal and cardiac muscle tissues. This novel method may be useful for generating gene knockdown in skeletal and cardiac mouse tissues, thus providing mouse models useful for analyzing diseases caused by loss-of-function of target genes. Copyright © 2011 Elsevier Inc. All rights reserved.

Rev-erb beta regulates the Srebp-1c promoter and mRNA expression in skeletal muscle cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ramakrishnan, Sathiya N.; Lau, Patrick; Crowther, Lisa M.

2009-10-30

The nuclear hormone receptor, Rev-erb beta operates as a transcriptional silencer. We previously demonstrated that exogenous expression of Rev-erb{beta}{Delta}E in skeletal muscle cells increased Srebp-1c mRNA expression. We validated these in vitro observations by injection of an expression vector driving Rev-erb{beta}{Delta}E expression into mouse tibialis muscle that resulted in increased Srebp-1c mRNA expression. Paradoxically, Rev-erb{beta} siRNA expression in skeletal muscle cells repressed Srebp-1c expression, and indicated that Rev-erb{beta} expression was necessary for Srebp-1c expression. ChIP analysis demonstrated that Rev-erb{beta} was recruited to the Srebp-1c promoter. Moreover, Rev-erb{beta} trans-activated the Srebp-1c promoter, in contrast, Rev-erb{beta} efficiently repressed the Rev-erb{alpha} promoter, amore » previously characterized target gene. Finally, treatment with the Rev-erb agonist (hemin) (i) increased the trans-activation of the Srebp-1c promoter by Rev-erb{beta}; and (ii) increased Rev-erb{beta} and Srebp-1c mRNA expression. These data suggest that Rev-erb{beta} has the potential to activate gene expression, and is a positive regulator of Srebp-1c, a regulator of lipogenesis.« less

A universal reference sample derived from clone vector for improved detection of differential gene expression

PubMed Central

Khan, Rishi L; Gonye, Gregory E; Gao, Guang; Schwaber, James S

2006-01-01

Background Using microarrays by co-hybridizing two samples labeled with different dyes enables differential gene expression measurements and comparisons across slides while controlling for within-slide variability. Typically one dye produces weaker signal intensities than the other often causing signals to be undetectable. In addition, undetectable spots represent a large problem for two-color microarray designs and most arrays contain at least 40% undetectable spots even when labeled with reference samples such as Stratagene's Universal Reference RNAs™. Results We introduce a novel universal reference sample that produces strong signal for all spots on the array, increasing the average fraction of detectable spots to 97%. Maximizing detectable spots on the reference image channel also decreases the variability of microarray data allowing for reliable detection of smaller differential gene expression changes. The reference sample is derived from sequence contained in the parental EST clone vector pT7T3D-Pac and is called vector RNA (vRNA). We show that vRNA can also be used for quality control of microarray printing and PCR product quality, detection of hybridization anomalies, and simplification of spot finding and segmentation tasks. This reference sample can be made inexpensively in large quantities as a renewable resource that is consistent across experiments. Conclusion Results of this study show that vRNA provides a useful universal reference that yields high signal for almost all spots on a microarray, reduces variation and allows for comparisons between experiments and laboratories. Further, it can be used for quality control of microarray printing and PCR product quality, detection of hybridization anomalies, and simplification of spot finding and segmentation tasks. This type of reference allows for detection of small changes in differential expression while reference designs in general allow for large-scale multivariate experimental designs. vRNA in

Expression of versican 3'-untranslated region modulates endogenous microRNA functions.

PubMed

Lee, Daniel Y; Jeyapalan, Zina; Fang, Ling; Yang, Jennifer; Zhang, Yaou; Yee, Albert Y; Li, Minhui; Du, William W; Shatseva, Tatiana; Yang, Burton B

2010-10-25

Mature microRNAs (miRNAs) are single-stranded RNAs that regulate post-transcriptional gene expression. In our previous study, we have shown that versican 3'UTR, a fragment of non-coding transcript, has the ability to antagonize miR-199a-3p function thereby regulating expression of the matrix proteins versican and fibronectin, and thus resulting in enhanced cell-cell adhesion and organ adhesion. However, the impact of this non-coding fragment on tumorigenesis is yet to be determined. Using computational prediction confirmed with in vitro and in vivo experiments, we report that the expression of versican 3'UTR not only antagonizes miR-199a-3p but can also lower its steady state expression. We found that expression of versican 3'UTR in a mouse breast carcinoma cell line, 4T1, decreased miR-199a-3p levels. The decrease in miRNA activity consequently translated into differences in tumor growth. Computational analysis indicated that both miR-199a-3p and miR-144 targeted a cell cycle regulator, Rb1. In addition, miR-144 and miR-136, which have also been shown to interact with versican 3'UTR, was found to target PTEN. Expression of Rb1 and PTEN were up-regulated synergistically in vitro and in vivo, suggesting that the 3'UTR binds and modulates miRNA activities, freeing Rb1 and PTEN mRNAs for translation. In tumor formation assays, cells transfected with the 3'UTR formed smaller tumors compared with cells transfected with a control vector. Our results demonstrated that a 3'UTR fragment can be used to modulate miRNA functions. Our study also suggests that miRNAs in the cancer cells are more susceptible to degradation, due to its interaction with a non-coding 3'UTR. This non-coding component of mRNA may be used retrospectively to modulate miRNA activities.

A tetracycline inducible expression vector for Corynebacterium glutamicum allowing tightly regulable gene expression.

PubMed

Lausberg, Frank; Chattopadhyay, Ava Rebecca; Heyer, Antonia; Eggeling, Lothar; Freudl, Roland

2012-09-01

Here we report on the construction of a tetracycline inducible expression vector that allows a tightly regulable gene expression in Corynebacterium glutamicum which is used in industry for production of small molecules such as amino acids. Using the green fluorescent protein (GFP) as a reporter protein we show that this vector, named pCLTON1, is characterized by tight repression under non-induced conditions as compared to a conventional IPTG inducible expression vector, and that it allows gradual GFP synthesis upon gradual increase of anhydrotetracycline addition. Copyright © 2012 Elsevier Inc. All rights reserved.

Long-Term Behavioral Recovery in Parkinsonian Rats by an HSV Vector Expressing Tyrosine Hydroxylase

PubMed Central

Naegele, Janice R.; O’Malley, Karen L.; Geller, Alfred I.

2006-01-01

One therapeutic approach to treating Parkinson’s disease is to convert endogenous striatal cells into levo-3,4-dihydroxyphenylalanine (l-dopa)–producing cells. A defective herpes simplex virus type 1 vector expressing human tyrosine hydroxylase was delivered into the partially denervated striatum of 6-hydroxydopamine–lesioned rats, used as a model of Parkinson’s disease. Efficient behavioral and biochemical recovery was maintained for 1 year after gene transfer. Biochemical recovery included increases in both striatal tyrosine hydroxylase enzyme activity and in extracellular dopamine concentrations. Persistence of human tyrosine hydroxylase was revealed by expression of RNA and immunoreactivity. PMID:7669103

Regulation of adeno-associated virus gene expression in 293 cells: control of mRNA abundance and translation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trempe, J.P.; Carter, B.J.

1988-01-01

The authors studied the effects of the adeno-associated virus (AAV) rep gene on the control of gene expression from the AAV p/sub 40/ promoter in 293 cells in the absence of an adenovirus coinfection. AAV vectors containing the chloramphenicol acetyltransferase (cat) gene were used to measure the levels of cat expression and steady-state mRNA from p/sub 40/. When the rep gene was present in cis or in trans, cat expression from p/sub 40/ was decreased 3- to 10-fold, but there was a 2- to 10-fold increase in the level of p/sub 40/ mRNA. Conversely, cat expression increased and the p/submore » 40/ mRNA level decreased in the absence of the rep gene. Both wild-type and carboxyl-terminal truncated Rep proteins were capable of eliciting both effects. These data suggest two roles for the pleiotropic AAV rep gene: as a translational inhibitor and as a positive regulator of p/sub 40/ mRNA levels. They also provide additional evidence for a cis-acting negative regulatory region which decreases RNA from the AAV p/sub 5/ promoter in a fashion independent of rep.« less

Identifying miRNA-mediated signaling subpathways by integrating paired miRNA/mRNA expression data with pathway topology.

PubMed

Vrahatis, Aristidis G; Dimitrakopoulos, Georgios N; Tsakalidis, Athanasios K; Bezerianos, Anastasios

2015-01-01

In the road for network medicine the newly emerged systems-level subpathway-based analysis methods offer new disease genes, drug targets and network-based biomarkers. In parallel, paired miRNA/mRNA expression data enable simultaneously monitoring of the micronome effect upon the signaling pathways. Towards this orientation, we present a methodological pipeline for the identification of differentially expressed subpathways along with their miRNA regulators by using KEGG signaling pathway maps, miRNA-target interactions and expression profiles from paired miRNA/mRNA experiments. Our pipeline offered new biological insights on a real application of paired miRNA/mRNA expression profiles with respect to the dynamic changes from colostrum to mature milk whey; several literature supported genes and miRNAs were recontextualized through miRNA-mediated differentially expressed subpathways.

MicroRNA-mediated non-viral direct conversion of embryonic fibroblasts to cardiomyocytes: comparison of commercial and synthetic non-viral vectors.

PubMed

Kim, Hyosuk; Kim, Dongkyu; Ku, Sook Hee; Kim, Kwangmeyung; Kim, Sun Hwa; Kwon, Ick Chan

Technological advances opened up new ways of directing cell fate conversion from one cell lineage to another. The direct cell conversion technique has recently attracted much attention in regenerative medicine to treat devastated organs and tissues, particularly having limited regenerative capacity such as the heart and brain. Unfortunately, its clinical application is severely limited due to a safety concern and immunogenicity of viral vectors, as human gene therapy did in the beginning stages. In this study, we examined the possibility of adopting non-viral vectors to direct cell conversion from mouse embryonic fibroblasts to induced cardiomyocytes (iCM) by transient transfection of four types of chemically synthesized micro-RNA mimics (miRNA-1, 133, 208, and 499). Herein, we tested several commercial and synthetic non-viral gene delivery carriers, which could be divided into three different categories: polymers [branched PEI (bPEI), bioreducible PEI (PEI-SS), deoxycholic acid-conjugated PEI (DA-PEI), jetPEI™, SuperFect™], lipids (Lipofectamine 2000™), and peptides (PepMute™). According to the analyses of physicochemical properties, cellular uptake, and cytotoxicity of the carrier/miRNA complexes, DA-PEI exhibited excellent miRNA delivery efficiency to mouse embryonic fibroblasts. One week after a single treatment of DA-PEI/miRNA without other adjuvants, the cells started to express cardiomyocyte-specific markers, such as α-actinin and α-MHC, indicating the formation of cardiomyocyte-like cells. Although the overall frequency of non-viral vector induced cardiomyogenic transdifferentiation was quite low (ca. 0.2%), this study can provide compelling support to develop clinically applicable transdifferentiation techniques.

Inhibition of myostatin gene expression in skeletal muscle of fish by in vivo electrically mediated dsRNA and shRNAi delivery.

PubMed

Terova, Genciana; Rimoldi, Simona; Bernardini, Giovanni; Saroglia, Marco

2013-06-01

Myostatin (MSTN), previously referred to as growth differentiation factor 8 (GDF8), is a negative regulator of skeletal muscle growth. In accordance with this role, natural mutations that inactivate the gene disrupting the function of the protein are associated with excessive muscle growth and double-muscling phenotype in several mammalian species. Recent studies using transgenic MSTN deficient zebrafish and medaka support the idea that this gene inhibits skeletal muscle growth even in fish. If the atrophic actions of mammalian MSTN are indeed conserved in fish, strategies capable of inhibiting the expression of this gene could be applied to enhance growth performance in livestock production. Gene silencing by RNA interference has emerged as a promising new method of inhibiting the expression of targeted genes and inducing knockdown of associated proteins both in vitro and in vivo. Accordingly, we investigated here whether double-stranded RNA (dsRNA) or different plasmids expressing short-hairpin interfering RNAs (shRNAs) against myostatin and transduced by in vivo electroporation would increase skeletal muscle mass in reared European sea bass. After 7 weeks of intramuscular injections on a weekly basis followed by in vivo electrically mediated dsRNA delivery, no increase in the condition factor (K) of fish was observed as compared to the controls. Analogously, mean body weight and K of sea bass injected with three shRNAs were not higher than those of the control fish. On the other hand, MSTN transcript quantification via real-time RT-PCR revealed a significant inhibition of gene expression in the muscle of the dsRNA-injected fish and in the muscle of fish injected with one of the three tested shRNA-expressing vector constructs. In conclusion, in vivo electric-mediated delivery of dsRNA- or shRNA-expressing vectors against MSTN inhibits MSTN gene expression in adult sea bass muscle, but this is associated with an inconsistent double-muscle phenotype.

TMV-Gate vectors: Gateway compatible tobacco mosaic virus based expression vectors for functional analysis of proteins

PubMed Central

Kagale, Sateesh; Uzuhashi, Shihomi; Wigness, Merek; Bender, Tricia; Yang, Wen; Borhan, M. Hossein; Rozwadowski, Kevin

2012-01-01

Plant viral expression vectors are advantageous for high-throughput functional characterization studies of genes due to their capability for rapid, high-level transient expression of proteins. We have constructed a series of tobacco mosaic virus (TMV) based vectors that are compatible with Gateway technology to enable rapid assembly of expression constructs and exploitation of ORFeome collections. In addition to the potential of producing recombinant protein at grams per kilogram FW of leaf tissue, these vectors facilitate either N- or C-terminal fusions to a broad series of epitope tag(s) and fluorescent proteins. We demonstrate the utility of these vectors in affinity purification, immunodetection and subcellular localisation studies. We also apply the vectors to characterize protein-protein interactions and demonstrate their utility in screening plant pathogen effectors. Given its broad utility in defining protein properties, this vector series will serve as a useful resource to expedite gene characterization efforts. PMID:23166857

Adeno-associated virus type 8 vector–mediated expression of siRNA targeting vascular endothelial growth factor efficiently inhibits neovascularization in a murine choroidal neovascularization model

PubMed Central

Igarashi, Tsutomu; Miyake, Noriko; Fujimoto, Chiaki; Yaguchi, Chiemi; Iijima, Osamu; Shimada, Takashi; Takahashi, Hiroshi

2014-01-01

Purpose To assess the feasibility of a gene therapeutic approach to treating choroidal neovascularization (CNV), we generated an adeno-associated virus type 8 vector (AAV2/8) encoding an siRNA targeting vascular endothelial growth factor (VEGF), and determined the AAV2/8 vector’s ability to inhibit angiogenesis. Methods We initially transfected 3T3 cells expressing VEGF with the AAV2/8 plasmid vector psiRNA-VEGF using the H1 promoter and found that VEGF expression was significantly diminished in the transfectants. We next injected 1 μl (3 × 1014 vg/ml) of AAV2/8 vector encoding siRNA targeting VEGF (AAV2/8/SmVEGF-2; n = 12) or control vector encoding green fluorescent protein (GFP) (AAV2/8/GFP; n = 14) into the subretinal space in C57BL/6 mice. One week later, CNV was induced by using a diode laser to make four separate choroidal burns around the optic nerve in each eye. After an additional 2 weeks, the eyes were removed for flat mount analysis of the CNV surface area. Results Subretinal delivery of AAV2/8/SmVEGF-2 significantly diminished CNV at the laser lesions, compared to AAV8/GFP (1597.3±2077.2 versus 5039.5±4055.9 µm2; p<0.05). Using an enzyme-linked immunosorbent assay, we found that VEGF levels were reduced by approximately half in the AAV2/8/SmVEGF-2 treated eyes. Conclusions These results suggest that siRNA-VEGF can be expressed across the retina and that long-term suppression of CNV is possible through the use of stable AAV2/8-mediated siRNA-VEGF expression. In vivo gene therapy may thus be a feasible approach to the clinical management of CNV in conditions such as age-related macular degeneration. PMID:24744609

Design and construction of functional AAV vectors.

PubMed

Gray, John T; Zolotukhin, Serge

2011-01-01

Using the basic principles of molecular biology and laboratory techniques presented in this chapter, researchers should be able to create a wide variety of AAV vectors for both clinical and basic research applications. Basic vector design concepts are covered for both protein coding gene expression and small non-coding RNA gene expression cassettes. AAV plasmid vector backbones (available via AddGene) are described, along with critical sequence details for a variety of modular expression components that can be inserted as needed for specific applications. Protocols are provided for assembling the various DNA components into AAV vector plasmids in Escherichia coli, as well as for transferring these vector sequences into baculovirus genomes for large-scale production of AAV in the insect cell production system.

[Expression of SLP-2 mRNA in endometrial cancer and its significance].

PubMed

Feng, Wang-qin; Cui, Zhu-mei; Feng, Feng-zhi; Qi, Xiu-juan; Ding, Fang; Li, Wen-dong; Liu, Zhi-hua

2005-08-01

To characterize the differential expression of SLP-2 in endometrial cancer, and to study the effect of human SLP-2 gene on human endometrial cancer cell line. The expression of SLP-2 gene in 32 cases of endometrial cancer and 28 cases of normal endometrial tissues was examined by semi-quantitative RT-PCR. Eukaryotic expression vectors of sense and antisense SLP-2 were constructed and transfected into HEC-1B cell line using lipofectamine 2000 respectively. The morphological changes of the cell were observed by phase contrast microscopy. The cell growth was detected by methyl thiazolyl tetrazolium (MTT) assay, and the cell cycles were analyzed by flow cytometry. The expression of SLP-2 mRNA in endometrial cancer tissues was higher than that in normal endometrial tissues (1.6 +/- 0.7 vs 0.7 +/- 0.3, P < 0.05). Sense and antisense human SLP-2 constructs were transfected into HEC-1B cell line respectively. After being transfected with sense SLP-2, the expression of SLP-2 mRNA in HEC-1B cell line was increased by about 2.4 times that of the control group, the cell growth was accelerated, and the number of cells in G(1) phase was decreased by 12.5%, S phase was increased by 8.0%. After being transfected with antisense SLP-2, the expression of SLP-2 mRNA was declined 50%. The transfected cells showed slower growth, and the number of cells in G(1) phase was significantly increased by 10.5%, and S phase was declined by 9.8%. SLP-2 mRNA shows up-regulation in endometrial cancer tissues, and it may have some relationship with carcinogenesis of endometrial cancer.

Circular RNA Expression: Its Potential Regulation and Function.

PubMed

Salzman, Julia

2016-05-01

In 2012, a new feature of eukaryotic gene expression emerged: ubiquitous expression of circular RNA (circRNA) from genes traditionally thought to express messenger or linear noncoding (nc)RNA only. CircRNAs are covalently closed, circular RNA molecules that typically comprise exonic sequences and are spliced at canonical splice sites. This feature of gene expression was first recognized in humans and mouse, but it quickly emerged that it was common across essentially all eukaryotes studied by molecular biologists. CircRNA abundance, and even which alternatively spliced circRNA isoforms are expressed, varies by cell type and can exceed the abundance of the traditional linear mRNA or ncRNA transcript. CircRNAs are enriched in the brain and increase in abundance during fetal development. Together, these features raise fundamental questions regarding the regulation of circRNA in cis and in trans, and its function. Copyright © 2016. Published by Elsevier Ltd.

Construction of two vectors for gene expression in Trichoderma reesei.

PubMed

Lv, Dandan; Wang, Wei; Wei, Dongzhi

2012-01-01

We report the construction of two filamentous fungi Trichoderma reesei expression vectors, pWEF31 and pWEF32. Both vectors possess the hygromycin phosphotransferase B gene expression cassette and the strong promoter and terminator of the cellobiohydrolase 1 gene (cbh1) from T. reesei. The two newly constructed vectors can be efficiently transformed into T. reesei with Agrobacterium-mediated transformation. The difference between pWEF31 and pWEF32 is that pWEF32 has two longer homologous arms. As a result, pWEF32 easily undergoes homologous recombination. On the other hand, pWEF31 undergoes random recombination. The applicability of both vectors was tested by first generating the expression vectors pWEF31-red and pWEF32-red and then detecting the expression of the DsRed2 gene in T. reesei Rut C30. Additionally, we measured the exo-1,4-β-glucanase activity of the recombinant cells. Our work provides an effective transformation system for homologous and heterologous gene expression and gene knockout in T. reesei. It also provides a method for recombination at a specific chromosomal location. Finally, both vectors will be useful for the large-scale gene expression industry. Copyright © 2011 Elsevier Inc. All rights reserved.

Embedding siRNA sequences targeting Apolipoprotein B100 in shRNA and miRNA scaffolds results in differential processing and in vivo efficacy

PubMed Central

Maczuga, Piotr; Lubelski, Jacek; van Logtenstein, Richard; Borel, Florie; Blits, Bas; Fakkert, Erwin; Costessi, Adalberto; Butler, Derek; van Deventer, Sander; Petry, Harald; Koornneef, Annemart; Konstantinova, Pavlina

2013-01-01

Overexpression of short hairpin RNA (shRNA) often causes cytotoxicity and using microRNA (miRNA) scaffolds can circumvent this problem. In this study, identically predicted small interfering RNA (siRNA) sequences targeting apolipoprotein B100 (siApoB) were embedded in shRNA (shApoB) or miRNA (miApoB) scaffolds and a direct comparison of the processing and long-term in vivo efficacy was performed. Next generation sequencing of small RNAs originating from shApoB- or miApoB-transfected cells revealed substantial differences in processing, resulting in different siApoB length, 5′ and 3′ cleavage sites and abundance of the guide or passenger strands. Murine liver transduction with adeno-associated virus (AAV) vectors expressing shApoB or miApoB resulted in high levels of siApoB expression associated with strong decrease of plasma ApoB protein and cholesterol. Expression of miApoB from the liver-specific LP1 promoter was restricted to the liver, while the H1 promoter-expressed shApoB was ectopically present. Delivery of 1 × 1011 genome copies AAV-shApoB or AAV-miApoB led to a gradual loss of ApoB and plasma cholesterol inhibition, which was circumvented by delivering a 20-fold lower vector dose. In conclusion, incorporating identical siRNA sequences in shRNA or miRNA scaffolds results in differential processing patterns and in vivo efficacy that may have serious consequences for future RNAi-based therapeutics. PMID:23089734

Expression of Versican 3′-Untranslated Region Modulates Endogenous MicroRNA Functions

PubMed Central

Lee, Daniel Y.; Jeyapalan, Zina; Fang, Ling; Yang, Jennifer; Zhang, Yaou; Yee, Albert Y.; Li, Minhui; Du, William W.; Shatseva, Tatiana; Yang, Burton B.

2010-01-01

Background Mature microRNAs (miRNAs) are single-stranded RNAs that regulate post-transcriptional gene expression. In our previous study, we have shown that versican 3′UTR, a fragment of non-coding transcript, has the ability to antagonize miR-199a-3p function thereby regulating expression of the matrix proteins versican and fibronectin, and thus resulting in enhanced cell-cell adhesion and organ adhesion. However, the impact of this non-coding fragment on tumorigenesis is yet to be determined. Methods and Findings Using computational prediction confirmed with in vitro and in vivo experiments, we report that the expression of versican 3′UTR not only antagonizes miR-199a-3p but can also lower its steady state expression. We found that expression of versican 3′UTR in a mouse breast carcinoma cell line, 4T1, decreased miR-199a-3p levels. The decrease in miRNA activity consequently translated into differences in tumor growth. Computational analysis indicated that both miR-199a-3p and miR-144 targeted a cell cycle regulator, Rb1. In addition, miR-144 and miR-136, which have also been shown to interact with versican 3′UTR, was found to target PTEN. Expression of Rb1 and PTEN were up-regulated synergistically in vitro and in vivo, suggesting that the 3′UTR binds and modulates miRNA activities, freeing Rb1 and PTEN mRNAs for translation. In tumor formation assays, cells transfected with the 3′UTR formed smaller tumors compared with cells transfected with a control vector. Conclusion Our results demonstrated that a 3′UTR fragment can be used to modulate miRNA functions. Our study also suggests that miRNAs in the cancer cells are more susceptible to degradation, due to its interaction with a non-coding 3′UTR. This non-coding component of mRNA may be used retrospectively to modulate miRNA activities. PMID:21049042

[Expression and identification of eukaryotic expression vectors of Brucella melitensis lipoprotein OMP19].

PubMed

He, Zuoping; Luo, Peifang; Hu, Feihuan; Weng, Yunceng; Wang, Wenjing; Li, Chengyao

2016-04-01

To construct eukaryotic expression vectors carrying Brucella melitensis outer membrane protein 19 (OMP19), express them in transfected Huh7.5.1 and JEG-3 cells, and analyze their role in cell apoptosis. Brucella melitensis lipidated OMP19 (L-OMP19) gene and unlipidated OMP19 (U-OMP19) gene were amplified by PCR and inserted into the vector pZeroBack/blunt. The correct L-OMP19 and U-OMP19 genes verified by XbaI and BamHI double digestion and sequencing were cloned into the lentivirus expression vector pHAGE-CMV-MCS-IZsGreen to construct vectors pHAGE-L-OMP19 and pHAGE-U-OMP19, which were separately transfected into 293FT cells, Huh7.5.1 and JEG-3 cells. L-OMP19 and U-OMP19 in the cells were detected by Western blotting and immunofluorescence technique. Flow cytometry combined with annexin V-PE/7-AAD staining was used to detect the cell apoptosis. The lentiviral vectors pHAGE-L-OMP19 and pHAGE-U-OMP19 were constructed correctly and the recombinant lipoproteins L-OMP19 and U-OMP19 expressed in the above cells were well recognized by the specific antibodies against L-OMP19 in Western blotting and immunofluorescence technique. L-OMP19 and U-OMP19 induced JEG-3 cell death, but did not induce the apoptosis of Huh7.5.1 cells. The eukaryotic expression vectors of L-OMP19 and U-OMP19 have been constructed successfully. Recombinant lipoproteins L-OMP19 and U-OMP19 expressed in cells have a good antigenicity, which could be used as experimental materials for the research on the relationship between host cells and lipoproteins in Brucella infection.

[Construction and expression of recombinant lentiviral vectors of AKT2,PDK1 and BAD].

PubMed

Zhu, Jing; Chen, Bo-Jiang; Huang, Na; Li, Wei-Min

2014-03-01

To construct human protein kinase B (ATK2), phosphoinositide-dependent kinase 1 (PDK1) and bcl-2-associated death protein (BAD) lentiviral expression vector, and to determine their expressions in 293T cells. Total RNA was extracted from lung cancer tissues. The full-length coding regions of human ATK2, BAD and PDK1 cDNA were amplified via RT-PCR using specific primers, subcloned into PGEM-Teasy and then sequenced for confirmation. The full-length coding sequence was cut out with a specific restriction enzyme digest and subclone into pCDF1-MCS2-EF1-copGFP. The plasmids were transfected into 293T cells using the calcium phosphate method. The over expression of AKT2, BAD and PDK1 were detected by Western blot. AKT2, PDK1 and BAD were subcloned into pCDF1-MCS2-EF1-copGFP, with an efficiency of transfection of 100%, 95%, and 90% respectively. The virus titers were 6.7 x 10(6) PFU/mL in the supernatant. After infection, the proteins of AKT2, PDK1 and BAD were detected by Western blot. The lentivial vector pCDF1-MCS2-EF1-copGFP containing AKT2, BAD and PDK1 were successfully constructed and expressed in 293T cells.

Narcolepsy patients' blood-based miRNA expression profiling: miRNA expression differences with Pandemrix vaccination.

PubMed

Mosakhani, N; Sarhadi, V; Panula, P; Partinen, M; Knuutila, S

2017-11-01

Narcolepsy is a neurological sleep disorder characterized by excessive daytime sleepiness and nighttime sleep disturbance. Among children and adolescents vaccinated with Pandemrix vaccine in Finland and Sweden, the number of narcolepsy cases increased. Our aim was to identify miRNAs involved in narcolepsy and their association with Pandemrix vaccination. We performed global miRNA proofing by miRNA microarrays followed by RT-PCR verification on 20 narcolepsy patients (Pandemrix-associated and Pandemrix-non-associated) and 17 controls (vaccinated and non-vaccinated). Between all narcolepsy patients and controls, 11 miRNAs were differentially expressed; 17 miRNAs showed significantly differential expression between Pandemrix-non-associated narcolepsy patients and non-vaccinated healthy controls. MiR-188-5p and miR-4499 were over-expressed in narcolepsy patients vs healthy controls. Two miRNAs, miR-1470 and miR-4455, were under-expressed in Pandemrix-associated narcolepsy patients vs Pandemrix-non-associated narcolepsy patients. We identified miRNA expression patterns in narcolepsy patients that linked them to mRNA targets known to be involved in brain-related pathways or brain disorders. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

A universal expression/silencing vector in plants.

PubMed

Peretz, Yuval; Mozes-Koch, Rita; Akad, Fuad; Tanne, Edna; Czosnek, Henryk; Sela, Ilan

2007-12-01

A universal vector (IL-60 and auxiliary constructs), expressing or silencing genes in every plant tested to date, is described. Plants that have been successfully manipulated by the IL-60 system include hard-to-manipulate species such as wheat (Triticum duram), pepper (Capsicum annuum), grapevine (Vitis vinifera), citrus, and olive (Olea europaea). Expression or silencing develops within a few days in tomato (Solanum lycopersicum), wheat, and most herbaceous plants and in up to 3 weeks in woody trees. Expression, as tested in tomato, is durable and persists throughout the life span of the plant. The vector is, in fact, a disarmed form of Tomato yellow leaf curl virus, which is applied as a double-stranded DNA and replicates as such. However, the disarmed virus does not support rolling-circle replication, and therefore viral progeny single-stranded DNA is not produced. IL-60 does not integrate into the plant's genome, and the construct, including the expressed gene, is not heritable. IL-60 is not transmitted by the Tomato yellow leaf curl virus's natural insect vector. In addition, artificial satellites were constructed that require a helper virus for replication, movement, and expression. With IL-60 as the disarmed helper "virus," transactivation occurs, resulting in an inducible expressing/silencing system. The system's potential is demonstrated by IL-60-derived suppression of a viral-silencing suppressor of Grapevine virus A, resulting in Grapevine virus A-resistant/tolerant plants.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most

Cell-type specific features of circular RNA expression.

PubMed

Salzman, Julia; Chen, Raymond E; Olsen, Mari N; Wang, Peter L; Brown, Patrick O

2013-01-01

Thousands of loci in the human and mouse genomes give rise to circular RNA transcripts; at many of these loci, the predominant RNA isoform is a circle. Using an improved computational approach for circular RNA identification, we found widespread circular RNA expression in Drosophila melanogaster and estimate that in humans, circular RNA may account for 1% as many molecules as poly(A) RNA. Analysis of data from the ENCODE consortium revealed that the repertoire of genes expressing circular RNA, the ratio of circular to linear transcripts for each gene, and even the pattern of splice isoforms of circular RNAs from each gene were cell-type specific. These results suggest that biogenesis of circular RNA is an integral, conserved, and regulated feature of the gene expression program.

Polyamidoamine Dendrimer Conjugates with Cyclodextrins as Novel Carriers for DNA, shRNA and siRNA

PubMed Central

Arima, Hidetoshi; Motoyama, Keiichi; Higashi, Taishi

2012-01-01

Gene, short hairpin RNA (shRNA) and small interfering RNA (siRNA) delivery can be particularly used for the treatment of diseases by the entry of genetic materials mammalian cells either to express new proteins or to suppress the expression of proteins, respectively. Polyamidoamine (PAMAM) StarburstTM dendrimers are used as non-viral vectors (carriers) for gene, shRNA and siRNA delivery. Recently, multifunctional PAMAM dendrimers can be used for the wide range of biomedical applications including intracellular delivery of genes and nucleic acid drugs. In this context, this review paper provides the recent findings on PAMAM dendrimer conjugates with cyclodextrins (CyDs) for gene, shRNA and siRNA delivery. PMID:24300184

Circular RNA expression profiles and features in human tissues: a study using RNA-seq data.

PubMed

Xu, Tianyi; Wu, Jing; Han, Ping; Zhao, Zhongming; Song, Xiaofeng

2017-10-03

Circular RNA (circRNA) is one type of noncoding RNA that forms a covalently closed continuous loop. Similar to long noncoding RNA (lncRNA), circRNA can act as microRNA (miRNA) 'sponges' to regulate gene expression, and its abnormal expression is related to diseases such as atherosclerosis, nervous system disorders and cancer. So far, there have been no systematic studies on circRNA abundance and expression profiles in human adult and fetal tissues. We explored circRNA expression profiles using RNA-seq data for six adult and fetal normal tissues (colon, heart, kidney, liver, lung, and stomach) and four gland normal tissues (adrenal gland, mammary gland, pancreas, and thyroid gland). A total of 8120, 25,933 and 14,433 circRNAs were detected by at least two supporting junction reads in adult, fetal and gland tissues, respectively. Among them, 3092, 14,241 and 6879 circRNAs were novel when compared to the published results. In each adult tissue type, we found at least 1000 circRNAs, among which 36.97-50.04% were tissue-specific. We reported 33 circRNAs that were ubiquitously expressed in all the adult tissues we examined. To further explore the potential "housekeeping" function of these circRNAs, we constructed a circRNA-miRNA-mRNA regulatory network containing 17 circRNAs, 22 miRNAs and 90 mRNAs. Furthermore, we found that both the abundance and the relative expression level of circRNAs were higher in fetal tissue than adult tissue. The number of circRNAs in gland tissues, especially in mammary gland (9665 circRNA candidates), was higher than that of other adult tissues (1160-3777). We systematically investigated circRNA expression in a variety of human adult and fetal tissues. Our observation of different expression level of circRNAs in adult and fetal tissues suggested that circRNAs might play their role in a tissue-specific and development-specific fashion. Analysis of circRNA-miRNA-mRNA network provided potential targets of circRNAs. High expression level of circ

Increased complexity of circRNA expression during species evolution.

PubMed

Dong, Rui; Ma, Xu-Kai; Chen, Ling-Ling; Yang, Li

2017-08-03

Circular RNAs (circRNAs) are broadly identified from precursor mRNA (pre-mRNA) back-splicing across various species. Recent studies have suggested a cell-/tissue- specific manner of circRNA expression. However, the distinct expression pattern of circRNAs among species and its underlying mechanism still remain to be explored. Here, we systematically compared circRNA expression from human and mouse, and found that only a small portion of human circRNAs could be determined in parallel mouse samples. The conserved circRNA expression between human and mouse is correlated with the existence of orientation-opposite complementary sequences in introns that flank back-spliced exons in both species, but not the circRNA sequences themselves. Quantification of RNA pairing capacity of orientation-opposite complementary sequences across circRNA-flanking introns by Complementary Sequence Index (CSI) identifies that among all types of complementary sequences, SINEs, especially Alu elements in human, contribute the most for circRNA formation and that their diverse distribution across species leads to the increased complexity of circRNA expression during species evolution. Together, our integrated and comparative reference catalog of circRNAs in different species reveals a species-specific pattern of circRNA expression and suggests a previously under-appreciated impact of fast-evolved SINEs on the regulation of (circRNA) gene expression.

Vectors expressing chimeric Japanese encephalitis dengue 2 viruses.

PubMed

Wei, Y; Wang, S; Wang, X

2014-01-01

Vectors based on self-replicating RNAs (replicons) of flaviviruses are becoming powerful tool for expression of heterologous genes in mammalian cells and development of novel antiviral and anticancer vaccines. We constructed two vectors expressing chimeric viruses consisting of attenuated SA14-14-2 strain of Japanese encephalitis virus (JEV) in which the PrM/M-E genes were replaced fully or partially with those of dengue 2 virus (DENV-2). These vectors, named pJED2 and pJED2-1770 were transfected to BHK-21 cells and produced chimeric viruses JED2V and JED2-1770V, respectively. The chimeric viruses could be passaged in C6/36 but not BHK-21 cells. The chimeric viruses produced in C6/36 cells CPE 4-5 days after infection and RT-PCR, sequencing, immunofluorescence assay (IFA) and Western blot analysis confirmed the chimeric nature of produced viruses. The immunogenicity of chimeric viruses in mice was proved by detecting DENV-2 E protein-specific serum IgG antibodies with neutralization titer of 10. Successful preparation of infectious clones of chimeric JEV-DENV-2 viruses showed that JEV-based expression vectors are fully functional.

Regulated Expression of Adenoviral Vectors-Based Gene Therapies

PubMed Central

Curtin, James F.; Candolfi, Marianela; Puntel, Mariana; Xiong, Weidong; Muhammad, A. K. M.; Kroeger, Kurt; Mondkar, Sonali; Liu, Chunyan; Bondale, Niyati; Lowenstein, Pedro R.; Castro, Maria G.

2008-01-01

Summary Regulatable promoter systems allow gene expression to be tightly controlled in vivo. This is highly desirable for the development of safe, efficacious adenoviral vectors that can be used to treat human diseases in the clinic. Ideally, regulatable cassettes should have minimal gene expression in the “OFF” state, and expression should quickly reach therapeutic levels in the “ON” state. In addition, the components of regulatable cassettes should be non-toxic at physiological concentrations and should not be immunogenic, especially when treating chronic illness that requires long-lasting gene expression. In this chapter, we will describe in detail protocols to develop and validate first generation (Ad) and high-capacity adenoviral (HC-Ad) vectors that express therapeutic genes under the control of the TetON regulatable system. Our laboratory has successfully used these protocols to regulate the expression of marker genes, immune stimulatory genes, and toxins for cancer gene therapeutics, i.e., glioma that is a deadly form of brain cancer. We have shown that this third generation TetON regulatable system, incorporating a doxycycline (DOX)-sensitive rtTA2S-M2 inducer and tTSKid silencer, is non-toxic, relatively non-immunogenic, and can tightly regulate reporter transgene expression downstream of a TRE promoter from adenoviral vectors in vitro and also in vivo. PMID:18470649

Reduction of voltage gated sodium channel protein in DRG by vector mediated miRNA reduces pain in rats with painful diabetic neuropathy.

PubMed

Chattopadhyay, Munmun; Zhou, Zhigang; Hao, Shuanglin; Mata, Marina; Fink, David J

2012-03-22

Painful neuropathy is a common complication of diabetes. Previous studies have identified significant increases in the amount of voltage gated sodium channel isoforms Na(V)1.7 and Na(V)1.3 protein in the dorsal root ganglia (DRG) of rats with streptozotocin (STZ)-induced diabetes. We found that gene transfer-mediated release of the inhibitory neurotransmitters enkephalin or gamma amino butyric acid (GABA) from DRG neurons in diabetic animals reduced pain-related behaviors coincident with a reduction in Na(V)1.7 protein levels in DRG in vivo. To further evaluate the role of Na(V)α subunit levels in DRG in the pathogenesis of pain in diabetic neuropathy, we constructed a non-replicating herpes simplex virus (HSV)-based vector expressing a microRNA (miRNA) against Na(V)α subunits. Subcutaneous inoculation of the miRNA-expressing HSV vector into the feet of diabetic rats to transduce DRG resulted in a reduction in Na(V)α subunit levels in DRG neurons, coincident with a reduction in cold allodynia, thermal hyperalgesia and mechanical hyperalgesia. These data support the role of increased Na(V)α protein in DRG in the pathogenesis of pain in diabetic neuropathy, and provide a proof-of-principle demonstration for the development of a novel therapy that could be used to treat intractable pain in patients with diabetic neuropathy.

Genome-Wide Analysis of Long Noncoding RNA (lncRNA) Expression in Hepatoblastoma Tissues

PubMed Central

Xue, Ping; Cui, Ximao; Li, Kai; Zheng, Shan; He, Xianghuo; Dong, Kuiran

2014-01-01

Long noncoding RNAs (lncRNAs) have crucial roles in cancer biology. We performed a genome-wide analysis of lncRNA expression in hepatoblastoma tissues to identify novel targets for further study of hepatoblastoma. Hepatoblastoma and normal liver tissue samples were obtained from hepatoblastoma patients. The genome-wide analysis of lncRNA expression in these tissues was performed using a 4×180 K lncRNA microarray and Sureprint G3 Human lncRNA Chips. Quantitative RT-PCR (qRT-PCR) was performed to confirm these results. The differential expressions of lncRNAs and mRNAs were identified through fold-change filtering. Gene Ontology (GO) and pathway analyses were performed using the standard enrichment computation method. Associations between lncRNAs and adjacent protein-coding genes were determined through complex transcriptional loci analysis. We found that 2736 lncRNAs were differentially expressed in hepatoblastoma tissues. Among these, 1757 lncRNAs were upregulated more than two-fold relative to normal tissues and 979 lncRNAs were downregulated. Moreover, in hepatoblastoma there were 420 matched lncRNA-mRNA pairs for 120 differentially expressed lncRNAs, and 167 differentially expressed mRNAs. The co-expression network analysis predicted 252 network nodes and 420 connections between 120 lncRNAs and 132 coding genes. Within this co-expression network, 369 pairs were positive, and 51 pairs were negative. Lastly, qRT-PCR data verified six upregulated and downregulated lncRNAs in hepatoblastoma, plus endothelial cell-specific molecule 1 (ESM1) mRNA. Our results demonstrated that expression of these aberrant lncRNAs could respond to hepatoblastoma development. Further study of these lncRNAs could provide useful insight into hepatoblastoma biology. PMID:24465615

Geminivirus vectors for high-level expression of foreign proteins in plant cells.

PubMed

Mor, Tsafrir S; Moon, Yong-Sun; Palmer, Kenneth E; Mason, Hugh S

2003-02-20

Bean yellow dwarf virus (BeYDV) is a monopartite geminivirus that can infect dicotyledonous plants. We have developed a high-level expression system that utilizes elements of the replication machinery of this single-stranded DNA virus. The replication initiator protein (Rep) mediates release and replication of a replicon from a DNA construct ("LSL vector") that contains an expression cassette for a gene of interest flanked by cis-acting elements of the virus. We used tobacco NT1 cells and biolistic delivery of plasmid DNA for evaluation of replication and expression of reporter genes contained within an LSL vector. By codelivery of a GUS reporter-LSL vector and a Rep-supplying vector, we obtained up to 40-fold increase in expression levels compared to delivery of the reporter-LSL vectors alone. High-copy replication of the LSL vector was correlated with enhanced expression of GUS. Rep expression using a whole BeYDV clone, a cauliflower mosaic virus 35S promoter driving either genomic rep or an intron-deleted rep gene, or 35S-rep contained in the LSL vector all achieved efficient replication and enhancement of GUS expression. We anticipate that this system can be adapted for use in transgenic plants or plant cell cultures with appropriately regulated expression of Rep, with the potential to greatly increase yield of recombinant proteins. Copyright 2003 Wiley Periodicals, Inc. Biotechnol Bioeng 81: 430-437, 2003.

Inhibition effect of small interfering RNA of connective tissue growth factor on the expression of extracellular matrix molecules in cultured human renal proximal tubular cells.

PubMed

Liu, Yuyuan; Li, Weiwei; Liu, Hong; Peng, Youming; Yang, Qiu; Xiao, Li; Liu, Yinghong; Liu, Fuyou

2014-03-01

In this study, we investigated the effect of small interfering RNA (siRNA) of connective tissue growth factor (CTGF) by pRetro-Super (PRS) retrovirus vector on the expression of CTGF and related extracellular matrix molecules in human renal proximal tubular cells (HKCs) induced by high glucose, to provide help for renal tubulointerstitial fibrosis therapy. HKCs were exposed to d-glucose to observe their dose and time effect, while the mannitol as osmotic control. Retrovirus producing CTGF siRNA were constructed from the inverted oligonucleotides and transferred into packaging cell line PT67 with lipofectamine, and the virus supernatant was used to infect HKC. The expression of CTGF, fibronectin (FN) and collagen-type I (col1) were measured by semi-quantitative RT-PCR and Western blot. In response to high glucose, CTGF expression in HKCs was increased in a dose- and time-dependent manner, whereas the increase did not occur in the osmotic control. Introduction of PRS-CTGF-siRNA resulted in the significant reduction of CTGF, FN, col1 mRNA (p < 0.01, respectively) and CTGF, col1 protein (p < 0.05, respectively) expression, while PRS void vector group did not have these effects (p > 0.05). CTGF siRNA therapy can effectively reduce the levels of CTGF, FN and col1 induced by high glucose in cultured HKCs, which suggested that it may be a potential therapeutic strategy to prevent the renal interstitial fibrosis in the future.

Changes in mRNA expression precede changes in microRNA expression in lesional psoriatic skin during treatment with adalimumab.

PubMed

Raaby, L; Langkilde, A; Kjellerup, R B; Vinter, H; Khatib, S H; Hjuler, K F; Johansen, C; Iversen, L

2015-08-01

Tumour necrosis factor (TNF)-α inhibition is an effective treatment for moderate to severe plaque-type psoriasis. A change in the cytokine expression profile occurs in the skin after 4 days of treatment, preceding any clinical or histological improvements. MicroRNAs (miRNAs) are important post-transcriptional regulators of gene expression, but miRNA expression has never been studied in psoriatic skin during treatment. To investigate changes in miRNA expression in psoriatic skin during adalimumab treatment and to compare results with changes in miRNA expression in a mouse model of Aldara-induced psoriasis-like skin inflammation. Punch biopsies were obtained from nonlesional and lesional psoriatic skin during adalimumab treatment. In the mouse model of Aldara-induced skin inflammation, biopsies were obtained from TNF-α knockout (KO), IL-17A KO and wild-type mice. miRNA expression levels were analysed with microarray, reverse transcriptase quantitative polymerase chain reaction and in situ hybridization. In psoriatic skin, no changes in miRNA expression were seen 4 days after treatment initiation. After 14 days of treatment, the expression of several miRNAs was normalized towards the level seen in nonlesional skin before treatment. miR-23b expression increased after 14 days of treatment and remained high for 84 days, despite unaltered levels at baseline. In the mouse model of Aldara-induced skin inflammation, the level of miR-146a increased, whereas no regulation was seen for miR-203, miR-214-3p, miR-125a, miR-23b or let-7d-5p. This study demonstrates that the changes seen in the cytokine expression levels after 4 days of treatment with adalimumab are not facilitated by early changes in miRNA expression. © 2015 British Association of Dermatologists.

The tunable pReX expression vector enables optimizing the T7-based production of membrane and secretory proteins in E. coli.

PubMed

Kuipers, Grietje; Karyolaimos, Alexandros; Zhang, Zhe; Ismail, Nurzian; Trinco, Gianluca; Vikström, David; Slotboom, Dirk Jan; de Gier, Jan-Willem

2017-12-16

To optimize the production of membrane and secretory proteins in Escherichia coli, it is critical to harmonize the expression rates of the genes encoding these proteins with the capacity of their biogenesis machineries. Therefore, we engineered the Lemo21(DE3) strain, which is derived from the T7 RNA polymerase-based BL21(DE3) protein production strain. In Lemo21(DE3), the T7 RNA polymerase activity can be modulated by the controlled co-production of its natural inhibitor T7 lysozyme. This setup enables to precisely tune target gene expression rates in Lemo21(DE3). The t7lys gene is expressed from the pLemo plasmid using the titratable rhamnose promoter. A disadvantage of the Lemo21(DE3) setup is that the system is based on two plasmids, a T7 expression vector and pLemo. The aim of this study was to simplify the Lemo21(DE3) setup by incorporating the key elements of pLemo in a standard T7-based expression vector. By incorporating the gene encoding the T7 lysozyme under control of the rhamnose promoter in a standard T7-based expression vector, pReX was created (ReX stands for Regulated gene eXpression). For two model membrane proteins and a model secretory protein we show that the optimized production yields obtained with the pReX expression vector in BL21(DE3) are similar to the ones obtained with Lemo21(DE3) using a standard T7 expression vector. For another secretory protein, a c-type cytochrome, we show that pReX, in contrast to Lemo21(DE3), enables the use of a helper plasmid that is required for the maturation and hence the production of this heme c protein. Here, we created pReX, a T7-based expression vector that contains the gene encoding the T7 lysozyme under control of the rhamnose promoter. pReX enables regulated T7-based target gene expression using only one plasmid. We show that with pReX the production of membrane and secretory proteins can be readily optimized. Importantly, pReX facilitates the use of helper plasmids. Furthermore, the use of pReX is

Cell-Type Specific Features of Circular RNA Expression

PubMed Central

Salzman, Julia; Chen, Raymond E.; Olsen, Mari N.; Wang, Peter L.; Brown, Patrick O.

2013-01-01

Thousands of loci in the human and mouse genomes give rise to circular RNA transcripts; at many of these loci, the predominant RNA isoform is a circle. Using an improved computational approach for circular RNA identification, we found widespread circular RNA expression in Drosophila melanogaster and estimate that in humans, circular RNA may account for 1% as many molecules as poly(A) RNA. Analysis of data from the ENCODE consortium revealed that the repertoire of genes expressing circular RNA, the ratio of circular to linear transcripts for each gene, and even the pattern of splice isoforms of circular RNAs from each gene were cell-type specific. These results suggest that biogenesis of circular RNA is an integral, conserved, and regulated feature of the gene expression program. PMID:24039610

Unmasking Upstream Gene Expression Regulators with miRNA-corrected mRNA Data

PubMed Central

Bollmann, Stephanie; Bu, Dengpan; Wang, Jiaqi; Bionaz, Massimo

2015-01-01

Expressed micro-RNA (miRNA) affects messenger RNA (mRNA) abundance, hindering the accuracy of upstream regulator analysis. Our objective was to provide an algorithm to correct such bias. Large mRNA and miRNA analyses were performed on RNA extracted from bovine liver and mammary tissue. Using four levels of target scores from TargetScan (all miRNA:mRNA target gene pairs or only the top 25%, 50%, or 75%). Using four levels of target scores from TargetScan (all miRNA:mRNA target gene pairs or only the top 25%, 50%, or 75%) and four levels of the magnitude of miRNA effect (ME) on mRNA expression (30%, 50%, 75%, and 83% mRNA reduction), we generated 17 different datasets (including the original dataset). For each dataset, we performed upstream regulator analysis using two bioinformatics tools. We detected an increased effect on the upstream regulator analysis with larger miRNA:mRNA pair bins and higher ME. The miRNA correction allowed identification of several upstream regulators not present in the analysis of the original dataset. Thus, the proposed algorithm improved the prediction of upstream regulators. PMID:27279737

microRNA Expression Profiling: Technologies, Insights, and Prospects.

PubMed

Roden, Christine; Mastriano, Stephen; Wang, Nayi; Lu, Jun

2015-01-01

Since the early days of microRNA (miRNA) research, miRNA expression profiling technologies have provided important tools toward both better understanding of the biological functions of miRNAs and using miRNA expression as potential diagnostics. Multiple technologies, such as microarrays, next-generation sequencing, bead-based detection system, single-molecule measurements, and quantitative RT-PCR, have enabled accurate quantification of miRNAs and the subsequent derivation of key insights into diverse biological processes. As a class of ~22 nt long small noncoding RNAs, miRNAs present unique challenges in expression profiling that require careful experimental design and data analyses. We will particularly discuss how normalization and the presence of miRNA isoforms can impact data interpretation. We will present one example in which the consideration in data normalization has provided insights that helped to establish the global miRNA expression as a tumor suppressor. Finally, we discuss two future prospects of using miRNA profiling technologies to understand single cell variability and derive new rules for the functions of miRNA isoforms.

Improved Innate and Adaptive Immunostimulation by Genetically Modified HIV-1 Protein Expressing NYVAC Vectors

PubMed Central

Quakkelaar, Esther D.; Redeker, Anke; Haddad, Elias K.; Harari, Alexandre; McCaughey, Stella Mayo; Duhen, Thomas; Filali-Mouhim, Abdelali; Goulet, Jean-Philippe; Loof, Nikki M.; Ossendorp, Ferry; Perdiguero, Beatriz; Heinen, Paul; Gomez, Carmen E.; Kibler, Karen V.; Koelle, David M.; Sékaly, Rafick P.; Sallusto, Federica; Lanzavecchia, Antonio; Pantaleo, Giuseppe; Esteban, Mariano; Tartaglia, Jim; Jacobs, Bertram L.; Melief, Cornelis J. M.

2011-01-01

Attenuated poxviruses are safe and capable of expressing foreign antigens. Poxviruses are applied in veterinary vaccination and explored as candidate vaccines for humans. However, poxviruses express multiple genes encoding proteins that interfere with components of the innate and adaptive immune response. This manuscript describes two strategies aimed to improve the immunogenicity of the highly attenuated, host-range restricted poxvirus NYVAC: deletion of the viral gene encoding type-I interferon-binding protein and development of attenuated replication-competent NYVAC. We evaluated these newly generated NYVAC mutants, encoding HIV-1 env, gag, pol and nef, for their ability to stimulate HIV-specific CD8 T-cell responses in vitro from blood mononuclear cells of HIV-infected subjects. The new vectors were evaluated and compared to the parental NYVAC vector in dendritic cells (DCs), RNA expression arrays, HIV gag expression and cross-presentation assays in vitro. Deletion of type-I interferon-binding protein enhanced expression of interferon and interferon-induced genes in DCs, and increased maturation of infected DCs. Restoration of replication competence induced activation of pathways involving antigen processing and presentation. Also, replication-competent NYVAC showed increased Gag expression in infected cells, permitting enhanced cross-presentation to HIV-specific CD8 T cells and proliferation of HIV-specific memory CD8 T-cells in vitro. The recombinant NYVAC combining both modifications induced interferon-induced genes and genes involved in antigen processing and presentation, as well as increased Gag expression. This combined replication-competent NYVAC is a promising candidate for the next generation of HIV vaccines. PMID:21347234

Targeted Knock-Down of miR21 Primary Transcripts Using snoMEN Vectors Induces Apoptosis in Human Cancer Cell Lines.

PubMed

Ono, Motoharu; Yamada, Kayo; Avolio, Fabio; Afzal, Vackar; Bensaddek, Dalila; Lamond, Angus I

2015-01-01

We have previously reported an antisense technology, 'snoMEN vectors', for targeted knock-down of protein coding mRNAs using human snoRNAs manipulated to contain short regions of sequence complementarity with the mRNA target. Here we characterise the use of snoMEN vectors to target the knock-down of micro RNA primary transcripts. We document the specific knock-down of miR21 in HeLa cells using plasmid vectors expressing miR21-targeted snoMEN RNAs and show this induces apoptosis. Knock-down is dependent on the presence of complementary sequences in the snoMEN vector and the induction of apoptosis can be suppressed by over-expression of miR21. Furthermore, we have also developed lentiviral vectors for delivery of snoMEN RNAs and show this increases the efficiency of vector transduction in many human cell lines that are difficult to transfect with plasmid vectors. Transduction of lentiviral vectors expressing snoMEN targeted to pri-miR21 induces apoptosis in human lung adenocarcinoma cells, which express high levels of miR21, but not in human primary cells. We show that snoMEN-mediated suppression of miRNA expression is prevented by siRNA knock-down of Ago2, but not by knock-down of Ago1 or Upf1. snoMEN RNAs colocalise with Ago2 in cell nuclei and nucleoli and can be co-immunoprecipitated from nuclear extracts by antibodies specific for Ago2.

Profiling Pre-MicroRNA and Mature MicroRNA Expressions Using a Single Microarray and Avoiding Separate Sample Preparation

PubMed Central

Gan, Lin; Denecke, Bernd

2013-01-01

Mature microRNA is a crucial component in the gene expression regulation network. At the same time, microRNA gene expression and procession is regulated in a precise and collaborated way. Pre-microRNAs mediate products during the microRNA transcription process, they can provide hints of microRNA gene expression regulation or can serve as alternative biomarkers. To date, little effort has been devoted to pre-microRNA expression profiling. In this study, three human and three mouse microRNA profile data sets, based on the Affymetrix miRNA 2.0 array, have been re-analyzed for both mature and pre-microRNA signals as a primary test of parallel mature/pre-microRNA expression profiling on a single platform. The results not only demonstrated a glimpse of pre-microRNA expression in human and mouse, but also the relationship of microRNA expressions between pre- and mature forms. The study also showed a possible application of currently available microRNA microarrays in profiling pre-microRNA expression in a time and cost effective manner. PMID:27605179

Transduction of hematopoietic stem cells to stimulate RNA interference against feline infectious peritonitis.

PubMed

Anis, Eman A; Dhar, Madhu; Legendre, Alfred M; Wilkes, Rebecca P

2017-06-01

Objectives The goals of the study were: (1) to develop and evaluate non-replicating lentivirus vectors coding for feline coronavirus (FCoV)-specific micro (mi)RNA as a potential antiviral therapy for feline infectious peritonitis (FIP); (2) to assess the feasibility of transducing hematopoietic stem cells (HSCs) with ex vivo introduction of the miRNA-expressing lentivirus vector; and (3) to assess the ability of the expressed miRNA to inhibit FCoV replication in HSCs in vitro. Methods HSCs were obtained from feline bone marrow and replicated in vitro. Three lentiviruses were constructed, each expressing a different anti-FCoV miRNA. HSCs were stably transduced with the miRNA-expressing lentivirus vector that produced the most effective viral inhibition in a feline cell line. The effectiveness of the transduction and the expression of anti-FCoV miRNA were tested by infecting the HSCs with two different strains of FCoV. The inhibition of coronavirus replication was determined by relative quantification of the inhibition of intracellular viral genomic RNA synthesis using real-time, reverse-transcription PCR. The assessment of virus replication inhibition was determined via titration of extracellular virus using the TCID 50 assay. Results Inhibition of FCoV was most significant in feline cells expressing miRNA-L2 that targeted the viral leader sequence, 48 h postinfection. miRNA-L2 expression in stably transduced HSCs resulted in 90% and 92% reductions in FIPV WSU 79-1146 genomic RNA synthesis and extracellular virus production, respectively, as well as 74% and 80% reduction in FECV WSU 79-1683 genomic RNA synthesis and extracellular virus production, respectively, as compared with an infected negative control sample producing non-targeting miRNA. Conclusions and relevance These preliminary results show that genetic modification of HSCs for constitutive production of anti-coronavirus miRNA will reduce FCoV replication.

A landscape of circular RNA expression in the human heart.

PubMed

Tan, Wilson L W; Lim, Benson T S; Anene-Nzelu, Chukwuemeka G O; Ackers-Johnson, Matthew; Dashi, Albert; See, Kelvin; Tiang, Zenia; Lee, Dominic Paul; Chua, Wee Woon; Luu, Tuan D A; Li, Peter Y Q; Richards, Arthur Mark; Foo, Roger S Y

2017-03-01

Circular RNA (circRNA) is a newly validated class of single-stranded RNA, ubiquitously expressed in mammalian tissues and possessing key functions including acting as microRNA sponges and as transcriptional regulators by binding to RNA-binding proteins. While independent studies confirm the expression of circRNA in various tissue types, genome-wide circRNA expression in the heart has yet to be described in detail. We performed deep RNA-sequencing on ribosomal-depleted RNA isolated from 12 human hearts, 25 mouse hearts and across a 28-day differentiation time-course of human embryonic stem cell-derived cardiomyocytes. Using purpose-designed bioinformatics tools, we uncovered a total of 15 318 and 3017 cardiac circRNA within human and mouse, respectively. Their abundance generally correlates with the abundance of their cognate linear RNA, but selected circRNAs exist at disproportionately higher abundance. Top highly expressed circRNA corresponded to key cardiac genes including Titin (TTN), RYR2, and DMD. The most abundant cardiac-expressed circRNA is a cytoplasmic localized single-exon circSLC8A1-1. The longest human transcript TTN alone generates up to 415 different exonic circRNA isoforms, the majority (83%) of which originates from the I-band domain. Finally, we confirmed the expression of selected cardiac circRNA by RT-PCR, Sanger sequencing and single molecule RNA-fluorescence in situ hybridization. Our data provide a detailed circRNA expression landscape in hearts. There is a high-abundance of specific cardiac-expressed circRNA. These findings open up a new avenue for future investigation into this emerging class of RNA. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2016. For Permissions, please email: journals.permissions@oup.com.

An Integrated Analysis of MicroRNA and mRNA Expression Profiles to Identify RNA Expression Signatures in Lambskin Hair Follicles in Hu Sheep

PubMed Central

Lv, Xiaoyang; Sun, Wei; Yin, Jinfeng; Ni, Rong; Su, Rui; Wang, Qingzeng; Gao, Wen; Bao, Jianjun; Yu, Jiarui; Wang, Lihong; Chen, Ling

2016-01-01

Wave patterns in lambskin hair follicles are an important factor determining the quality of sheep’s wool. Hair follicles in lambskin from Hu sheep, a breed unique to China, have 3 types of waves, designated as large, medium, and small. The quality of wool from small wave follicles is excellent, while the quality of large waves is considered poor. Because no molecular and biological studies on hair follicles of these sheep have been conducted to date, the molecular mechanisms underlying the formation of different wave patterns is currently unknown. The aim of this article was to screen the candidate microRNAs (miRNA) and genes for the development of hair follicles in Hu sheep. Two-day-old Hu lambs were selected from full-sib individuals that showed large, medium, and small waves. Integrated analysis of microRNA and mRNA expression profiles employed high-throughout sequencing technology. Approximately 13, 24, and 18 differentially expressed miRNAs were found between small and large waves, small and medium waves, and medium and large waves, respectively. A total of 54, 190, and 81 differentially expressed genes were found between small and large waves, small and medium waves, and medium and large waves, respectively, by RNA sequencing (RNA-seq) analysis. Differentially expressed genes were classified using gene ontology and pathway analyses. They were found to be mainly involved in cell differentiation, proliferation, apoptosis, growth, immune response, and ion transport, and were associated with MAPK and the Notch signaling pathway. Reverse transcription-polymerase chain reaction (RT-PCR) analyses of differentially-expressed miRNA and genes were consistent with sequencing results. Integrated analysis of miRNA and mRNA expression indicated that, compared to small waves, large waves included 4 downregulated miRNAs that had regulatory effects on 8 upregulated genes and 3 upregulated miRNAs, which in turn influenced 13 downregulated genes. Compared to small waves

New support vector machine-based method for microRNA target prediction.

PubMed

Li, L; Gao, Q; Mao, X; Cao, Y

2014-06-09

MicroRNA (miRNA) plays important roles in cell differentiation, proliferation, growth, mobility, and apoptosis. An accurate list of precise target genes is necessary in order to fully understand the importance of miRNAs in animal development and disease. Several computational methods have been proposed for miRNA target-gene identification. However, these methods still have limitations with respect to their sensitivity and accuracy. Thus, we developed a new miRNA target-prediction method based on the support vector machine (SVM) model. The model supplies information of two binding sites (primary and secondary) for a radial basis function kernel as a similarity measure for SVM features. The information is categorized based on structural, thermodynamic, and sequence conservation. Using high-confidence datasets selected from public miRNA target databases, we obtained a human miRNA target SVM classifier model with high performance and provided an efficient tool for human miRNA target gene identification. Experiments have shown that our method is a reliable tool for miRNA target-gene prediction, and a successful application of an SVM classifier. Compared with other methods, the method proposed here improves the sensitivity and accuracy of miRNA prediction. Its performance can be further improved by providing more training examples.

Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

PubMed

Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

2014-11-01

Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates

Integrated Analysis of Long Noncoding RNA and mRNA Expression Profile in Advanced Laryngeal Squamous Cell Carcinoma.

PubMed

Feng, Ling; Wang, Ru; Lian, Meng; Ma, Hongzhi; He, Ning; Liu, Honggang; Wang, Haizhou; Fang, Jugao

2016-01-01

Long non-coding RNA (lncRNA) plays an important role in tumorigenesis. However, the expression pattern and function of lncRNAs in laryngeal squamous cell carcinoma (LSCC) are still unclear. To investigate the aberrantly expressed lncRNAs and mRNAs in advanced LSCC, we screened lncRNA and mRNA expression profiles in 9 pairs of primary Stage IVA LSCC tissues and adjacent non-neoplastic tissues by lncRNA and mRNA integrated microarrays. Gene Ontology and pathway analysis were performed to find out the significant function and pathway of the differentially expressed mRNAs, gene-gene functional interaction network and ceRNA network were constructed to select core mRNAs, and lncRNA-mRNA expression correlation network was built to identify the interactions between lncRNA and mRNA. qRT-PCR was performed to further validate the expressions of selected lncRNAs and mRNAs in advanced LSCC. We found 1459 differentially expressed lncRNAs and 2381 differentially expressed mRNAs, including 846 up-regulated lncRNAs and 613 down-regulated lncRNAs, 1542 up-regulated mRNAs and 839 down-regulated mRNAs. The mRNAs ITGB1, HIF1A, and DDIT4 were selected as core mRNAs, which are mainly involved in biological processes, such as matrix organization, cell cycle, adhesion, and metabolic pathway. LncRNA-mRNA expression correlation network showed LncRNA NR_027340, MIR31HG were positively correlated with ITGB1, HIF1A respectively. LncRNA SOX2-OT was negatively correlated with DDIT4. qRT-PCR further validated the expression of these lncRNAs and mRNAs. The work provides convincing evidence that the identified lncRNAs and mRNAs are potential biomarkers in advanced LSCC for further future studies.

The centrality of RNA for engineering gene expression

PubMed Central

Chappell, James; Takahashi, Melissa K; Meyer, Sarai; Loughrey, David; Watters, Kyle E; Lucks, Julius

2013-01-01

Synthetic biology holds promise as both a framework for rationally engineering biological systems and a way to revolutionize how we fundamentally understand them. Essential to realizing this promise is the development of strategies and tools to reliably and predictably control and characterize sophisticated patterns of gene expression. Here we review the role that RNA can play towards this goal and make a case for why this versatile, designable, and increasingly characterizable molecule is one of the most powerful substrates for engineering gene expression at our disposal. We discuss current natural and synthetic RNA regulators of gene expression acting at key points of control – transcription, mRNA degradation, and translation. We also consider RNA structural probing and computational RNA structure predication tools as a way to study RNA structure and ultimately function. Finally, we discuss how next-generation sequencing methods are being applied to the study of RNA and to the characterization of RNA's many properties throughout the cell. PMID:24124015

[Construction and functional identification of eukaryotic expression vector carrying Sprague-Dawley rat MSX-2 gene].

PubMed

Yang, Xian-Xian; Zhang, Mei; Yan, Zhao-Wen; Zhang, Ru-Hong; Mu, Xiong-Zheng

2008-01-01

To construct a high effective eukaryotic expressing plasmid PcDNA 3.1-MSX-2 encoding Sprague-Dawley rat MSX-2 gene for the further study of MSX-2 gene function. The full length SD rat MSX-2 gene was amplified by PCR, and the full length DNA was inserted in the PMD1 8-T vector. It was isolated by restriction enzyme digest with BamHI and Xhol, then ligated into the cloning site of the PcDNA3.1 expression plasmid. The positive recombinant was identified by PCR analysis, restriction endonudease analysis and sequence analysis. Expression of RNA and protein was detected by RT-PCR and Western blot analysis in PcDNA3.1-MSX-2 transfected HEK293 cells. Sequence analysis and restriction endonudease analysis of PcDNA3.1-MSX-2 demonstrated that the position and size of MSX-2 cDNA insertion were consistent with the design. RT-PCR and Western blot analysis showed specific expression of mRNA and protein of MSX-2 in the transfected HEK293 cells. The high effective eukaryotic expression plasmid PcDNA3.1-MSX-2 encoding Sprague-Dawley Rat MSX-2 gene which is related to craniofacial development can be successfully reconstructed. It may serve as the basis for the further study of MSX-2 gene function.

Retrovirus-based vectors for transient and permanent cell modification.

PubMed

Schott, Juliane W; Hoffmann, Dirk; Schambach, Axel

2015-10-01

Retroviral vectors are commonly employed for long-term transgene expression via integrating vector technology. However, three alternative retrovirus-based platforms are currently available that allow transient cell modification. Gene expression can be mediated from either episomal DNA or RNA templates, or selected proteins can be directly transferred through retroviral nanoparticles. The different technologies are functionally graded with respect to safety, expression magnitude and expression duration. Improvement of the initial technologies, including modification of vector designs, targeted increase in expression strength and duration as well as improved safety characteristics, has allowed maturation of retroviral systems into efficient and promising tools that meet the technological demands of a wide variety of potential application areas. Copyright © 2015 Elsevier Ltd. All rights reserved.

Circular RNA expression in basal cell carcinoma.

PubMed

Sand, Michael; Bechara, Falk G; Sand, Daniel; Gambichler, Thilo; Hahn, Stephan A; Bromba, Michael; Stockfleth, Eggert; Hessam, Schapoor

2016-05-01

Circular RNAs (circRNAs), are nonprotein coding RNAs consisting of a circular loop with multiple miRNA, binding sites called miRNA response elements (MREs), functioning as miRNA sponges. This study was performed to identify differentially expressed circRNAs and their MREs in basal cell carcinoma (BCC). Microarray circRNA expression profiles were acquired from BCC and control followed by qRT-PCR validation. Bioinformatical target prediction revealed multiple MREs. Sequence analysis was performed concerning MRE interaction potential with the BCC miRNome. We identified 23 upregulated and 48 downregulated circRNAs with 354 miRNA response elements capable of sequestering miRNA target sequences of the BCC miRNome. The present study describes a variety of circRNAs that are potentially involved in the molecular pathogenesis of BCC.

RNAi-mediated mortality of the whitefly through transgenic expression of double-stranded RNA homologous to acetylcholinesterase and ecdysone receptor in tobacco plants

USDA-ARS?s Scientific Manuscript database

The whitefly Bemisia tabaci (Genn.) is a pest and vector of plant viruses affecting plants worldwide. Using RNA interference (RNAi) to downregulate whitefly genes by expressing their homologous double stranded RNAs in plants has great potential for management of whiteflies to reduce plant virus dise...

Alphavirus vector-based replicon particles expressing multivalent cross-protective Lassa virus glycoproteins

PubMed Central

Wang, Min; Jokinen, Jenny; Tretyakova, Irina; Pushko, Peter; Lukashevich, Igor S.

2018-01-01

Lassa virus (LASV) is the most prevalent rodent-borne arenavirus circulated in West Africa. With population at risk from Senegal to Nigeria, LASV causes Lassa fever and is responsible for thousands of deaths annually. High genetic diversity of LASV is one of the challenges for vaccine R&D. We developed multivalent virus-like particle vectors (VLPVs) derived from the human Venezuelan equine encephalitis TC-83 IND vaccine (VEEV) as the next generation of alphavirus-based bicistronic RNA replicon particles. The genes encoding VEEV structural proteins were replaced with LASV glycoproteins (GPC) from distantly related clades I and IV with individual 26S promoters. Bicistronic RNA replicons encoding wild-type LASV GPC (GPCwt) and C-terminally deleted, non-cleavable modified glycoprotein (ΔGPfib), were encapsidated into VLPV particles using VEEV capsid and glycoproteins provided in trans. In transduced cells, VLPVs induced simultaneous expression of LASV GPCwt and ΔGPfib from 26S alphavirus promoters. LASV ΔGPfib was predominantly expressed as trimers, accumulated in the endoplasmic reticulum, induced ER stress and apoptosis promoting antigen cross-priming. VLPV vaccines were immunogenic and protective in mice and upregulated CD11c+/CD8+ dendritic cells playing the major role in cross-presentation. Notably, VLPV vaccination resulted in induction of cross-reactive multifunctional T cell responses after stimulation of immune splenocytes with peptide cocktails derived from LASV from clades I-IV. Multivalent RNA replicon-based LASV vaccines can be applicable for first responders, international travelers visiting endemic areas, military and lab personnel. PMID:29287681

[Construction and expression of a eukaryotic expression vector containing human CR2-Fc fusion protein].

PubMed

Li, Xinxin; Wu, Zhihao; Zhang, Chuanfu; Jia, Leili; Song, Hongbin; Xu, Yuanyong

2014-01-01

To construct a eukaryotic expression vector containing human complement receptor 2 (CR2)-Fc and express the CR2-Fc fusion protein in Chinese hamster ovary (CHO) cells. The extracellular domain of human CR2 and IgG1 Fc were respectively amplified, ligated and inserted into the eukaryotic expression vector PCI-neo. After verified by restriction enzyme digestion and sequencing, the recombinant plasmid was transfected into CHO K1 cells. The ones with stable expression of the fusion protein were obtained by means of G418 selection. The expression of the CR2-Fc fusion protein was detected and confirmed by SDS-PAGE and Western blotting. Restriction enzyme digestion and sequencing demonstrated that the recombinant plasmid was valid. SDS-PAGE showed that relative molecular mass (Mr;) of the purified product was consistent with the expected value. Western blotting further proved the single band at the same position. We constructed the eukaryotic expression vector of CR2-Fc/PCI-neo successfully. The obtained fusion protein was active and can be used for the further study of the role in HIV control.

AAVPG: A vigilant vector where transgene expression is induced by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajgelman, Marcio C.; Medrano, Ruan F.V.; Carvalho, Anna Carolina P.V.

2013-12-15

Using p53 to drive transgene expression from viral vectors may provide on demand expression in response to physiologic stress, such as hypoxia or DNA damage. Here we introduce AAVPG, an adeno-associated viral (AAV) vector where a p53-responsive promoter, termed PG, is used to control transgene expression. In vitro assays show that expression from the AAVPG-luc vector was induced specifically in the presence of functional p53 (1038±202 fold increase, p<0.001). The AAVPG-luc vector was an effective biosensor of p53 activation in response to hypoxia (4.48±0.6 fold increase in the presence of 250 µM CoCl{sub 2}, p<0.001) and biomechanical stress (2.53±0.4 foldmore » increase with stretching, p<0.05). In vivo, the vigilant nature of the AAVPG-luc vector was revealed after treatment of tumor-bearing mice with doxorubicin (pre-treatment, 3.4×10{sup 5}±0.43×10{sup 5} photons/s; post-treatment, 6.6×10{sup 5}±2.1×10{sup 5} photons/s, p<0.05). These results indicate that the AAVPG vector is an interesting option for detecting p53 activity both in vitro and in vivo. - Highlights: • AAV vector where transgene expression is controlled by the tumor suppressor p53. • The new vector, AAVPG, shown to function as a biosensor of p53 activity, in vitro and in vivo. • The p53 activity monitored by the AAVPG vector is relevant to cancer and other diseases. • AAVPG reporter gene expression was activated upon DNA damage, hypoxia and mechanical stress.« less

Generation of stable human cell lines with Tetracycline-inducible (Tet-on) shRNA or cDNA expression.

PubMed

Gomez-Martinez, Marta; Schmitz, Debora; Hergovich, Alexander

2013-03-05

A major approach in the field of mammalian cell biology is the manipulation of the expression of genes of interest in selected cell lines, with the aim to reveal one or several of the gene's function(s) using transient/stable overexpression or knockdown of the gene of interest. Unfortunately, for various cell biological investigations this approach is unsuitable when manipulations of gene expression result in cell growth/proliferation defects or unwanted cell differentiation. Therefore, researchers have adapted the Tetracycline repressor protein (TetR), taken from the E. coli tetracycline resistance operon(1), to generate very efficient and tight regulatory systems to express cDNAs in mammalian cells(2,3). In short, TetR has been modified to either (1) block initiation of transcription by binding to the Tet-operator (TO) in the promoter region upon addition of tetracycline (termed Tet-off system) or (2) bind to the TO in the absence of tetracycline (termed Tet-on system) (Figure 1). Given the inconvenience that the Tet-off system requires the continuous presence of tetracycline (which has a half-life of about 24 hr in tissue cell culture medium) the Tet-on system has been more extensively optimized, resulting in the development of very tight and efficient vector systems for cDNA expression as used here. Shortly after establishment of RNA interference (RNAi) for gene knockdown in mammalian cells(4), vectors expressing short-hairpin RNAs (shRNAs) were described that function very similar to siRNAs(5-11). However, these shRNA-mediated knockdown approaches have the same limitation as conventional knockout strategies, since stable depletion is not feasible when gene targets are essential for cellular survival. To overcome this limitation, van de Wetering et al.(12) modified the shRNA expression vector pSUPER(5) by inserting a TO in the promoter region, which enabled them to generate stable cell lines with tetracycline-inducible depletion of their target genes of

Inhibition of CRISPR/Cas9-Mediated Genome Engineering by a Type I Interferon-Induced Reduction in Guide RNA Expression.

PubMed

Machitani, Mitsuhiro; Sakurai, Fuminori; Wakabayashi, Keisaku; Nakatani, Kosuke; Takayama, Kazuo; Tachibana, Masashi; Mizuguchi, Hiroyuki

2017-01-01

Clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9-mediated genome engineering technology is a powerful tool for generation of cells and animals with engineered mutations in their genomes. In order to introduce the CRISPR/Cas9 system into target cells, nonviral and viral vectors are often used; however, such vectors trigger innate immune responses associated with production of type I interferons (IFNs). We have recently demonstrated that type I IFNs inhibit short-hairpin RNA-mediated gene silencing, which led us to hypothesize that type I IFNs may also inhibit CRISPR/Cas9-mediated genome mutagenesis. Here we investigated this hypothesis. A single-strand annealing assay using a reporter plasmid demonstrated that CRISPR/Cas9-mediated cleavage efficiencies of the target double-stranded DNA were significantly reduced by IFNα. A mismatch recognition nuclease-dependent genotyping assay also demonstrated that IFNα reduced insertion or deletion (indel) mutation levels by approximately half. Treatment with IFNα did not alter Cas9 protein expression levels, whereas the copy numbers of guide RNA (gRNA) were significantly reduced by IFNα stimulation. These results indicate that type I IFNs significantly reduce gRNA expression levels following introduction of the CRISPR/Cas9 system in the cells, leading to a reduction in the efficiencies of CRISPR/Cas9-mediated genome mutagenesis. Our findings provide important clues for the achievement of efficient genome engineering using the CRISPR/Cas9 system.

Cardiac gene transfer of short hairpin RNA directed against phospholamban effectively knocks down gene expression but causes cellular toxicity in canines.

PubMed

Bish, Lawrence T; Sleeper, Meg M; Reynolds, Caryn; Gazzara, Jeffrey; Withnall, Elanor; Singletary, Gretchen E; Buchlis, George; Hui, Daniel; High, Katherine A; Gao, Guangping; Wilson, James M; Sweeney, H Lee

2011-08-01

Derangements in calcium cycling have been described in failing hearts, and preclinical studies have suggested that therapies aimed at correcting this defect can lead to improvements in cardiac function and survival. One strategy to improve calcium cycling would be to inhibit phospholamban (PLB), the negative regulator of SERCA2a that is upregulated in failing hearts. The goal of this study was to evaluate the safety and efficacy of using adeno-associated virus (AAV)-mediated cardiac gene transfer of short hairpin RNA (shRNA) to knock down expression of PLB. Six dogs were treated with self-complementary AAV serotype 6 (scAAV6) expressing shRNA against PLB. Three control dogs were treated with empty AAV6 capsid, and two control dogs were treated with scAAV6 expressing dominant negative PLB. Vector was delivered via a percutaneously inserted cardiac injection catheter. PLB mRNA and protein expression were analyzed in three of six shRNA dogs between days 16 and 26. The other three shRNA dogs and five control dogs were monitored long-term to assess cardiac safety. PLB mRNA was reduced 16-fold, and PLB protein was reduced 5-fold, with treatment. Serum troponin elevation and depressed cardiac function were observed in the shRNA group only at 4 weeks. An enzyme-linked immunospot assay failed to detect any T cells reactive to AAV6 capsid in peripheral blood mononuclear cells, heart, or spleen. Microarray analysis revealed alterations in cardiac expression of several microRNAs with shRNA treatment. AAV6-mediated cardiac gene transfer of shRNA effectively knocks down PLB expression but is associated with severe cardiac toxicity. Toxicity may result from dysregulation of endogenous microRNA pathways.

Cardiac Gene Transfer of Short Hairpin RNA Directed Against Phospholamban Effectively Knocks Down Gene Expression but Causes Cellular Toxicity in Canines

PubMed Central

Sleeper, Meg M.; Reynolds, Caryn; Gazzara, Jeffrey; Withnall, Elanor; Singletary, Gretchen E.; Buchlis, George; Hui, Daniel; High, Katherine A.; Gao, Guangping; Wilson, James M.; Sweeney, H. Lee

2011-01-01

Abstract Derangements in calcium cycling have been described in failing hearts, and preclinical studies have suggested that therapies aimed at correcting this defect can lead to improvements in cardiac function and survival. One strategy to improve calcium cycling would be to inhibit phospholamban (PLB), the negative regulator of SERCA2a that is upregulated in failing hearts. The goal of this study was to evaluate the safety and efficacy of using adeno-associated virus (AAV)-mediated cardiac gene transfer of short hairpin RNA (shRNA) to knock down expression of PLB. Six dogs were treated with self-complementary AAV serotype 6 (scAAV6) expressing shRNA against PLB. Three control dogs were treated with empty AAV6 capsid, and two control dogs were treated with scAAV6 expressing dominant negative PLB. Vector was delivered via a percutaneously inserted cardiac injection catheter. PLB mRNA and protein expression were analyzed in three of six shRNA dogs between days 16 and 26. The other three shRNA dogs and five control dogs were monitored long-term to assess cardiac safety. PLB mRNA was reduced 16-fold, and PLB protein was reduced 5-fold, with treatment. Serum troponin elevation and depressed cardiac function were observed in the shRNA group only at 4 weeks. An enzyme-linked immunospot assay failed to detect any T cells reactive to AAV6 capsid in peripheral blood mononuclear cells, heart, or spleen. Microarray analysis revealed alterations in cardiac expression of several microRNAs with shRNA treatment. AAV6-mediated cardiac gene transfer of shRNA effectively knocks down PLB expression but is associated with severe cardiac toxicity. Toxicity may result from dysregulation of endogenous microRNA pathways. PMID:21542669

Posttranscriptional regulation of retroviral gene expression: primary RNA transcripts play three roles as pre-mRNA, mRNA, and genomic RNA

PubMed Central

LeBlanc, Jason; Weil, Jason; Beemon, Karen

2013-01-01

After reverse transcription of the retroviral RNA genome and integration of the DNA provirus into the host genome, host machinery is used for viral gene expression along with viral proteins and RNA regulatory elements. Here, we discuss co-transcriptional and posttranscriptional regulation of retroviral gene expression, comparing simple and complex retroviruses. Cellular RNA polymerase II synthesizes full-length viral primary RNA transcripts that are capped and polyadenylated. All retroviruses generate a singly spliced env mRNA from this primary transcript, which encodes the viral glycoproteins. In addition, complex viral RNAs are alternatively spliced to generate accessory proteins, such as Rev, which is involved in posttranscriptional regulation of HIV-1 RNA. Importantly, the splicing of all retroviruses is incomplete; they must maintain and export a fraction of their primary RNA transcripts. This unspliced RNA functions both as the major mRNA for Gag and Pol proteins and as the packaged genomic RNA. Different retroviruses export their unspliced viral RNA from the nucleus to the cytoplasm by either Tap-dependent or Rev/CRM1-dependent routes. Translation of the unspliced mRNA involves frame-shifting or termination codon suppression so that the Gag proteins, which make up the capsid, are expressed more abundantly than the Pol proteins, which are the viral enzymes. After the viral polyproteins assemble into viral particles and bud from the cell membrane, a viral encoded protease cleaves them. Some retroviruses have evolved mechanisms to protect their unspliced RNA from decay by nonsense-mediated RNA decay and to prevent genome editing by the cellular APOBEC deaminases. PMID:23754689

Modulating ectopic gene expression levels by using retroviral vectors equipped with synthetic promoters.

PubMed

Ferreira, Joshua P; Peacock, Ryan W S; Lawhorn, Ingrid E B; Wang, Clifford L

2011-12-01

The human cytomegalovirus and elongation factor 1α promoters are constitutive promoters commonly employed by mammalian expression vectors. These promoters generally produce high levels of expression in many types of cells and tissues. To generate a library of synthetic promoters capable of generating a range of low, intermediate, and high expression levels, the TATA and CAAT box elements of these promoters were mutated. Other promoter variants were also generated by random mutagenesis. Evaluation using plasmid vectors integrated at a single site in the genome revealed that these various synthetic promoters were capable of expression levels spanning a 40-fold range. Retroviral vectors were equipped with the synthetic promoters and evaluated for their ability to reproduce the graded expression demonstrated by plasmid integration. A vector with a self-inactivating long terminal repeat could neither reproduce the full range of expression levels nor produce stable expression. Using a second vector design, the different synthetic promoters enabled stable expression over a broad range of expression levels in different cell lines. The online version of this article (doi:10.1007/s11693-011-9089-0) contains supplementary material, which is available to authorized users.

[MicroRNA in neurodegenerative disorders].

PubMed

Sobue, Gen

2013-01-01

MicroRNAs (miRNAs) bind to the 3'-untranslated region of mRNA, and thereby suppress the gene expression. Recent studies suggest that miRNAs modify the pathogenesis of cancer and neurodegeneration. Our study demonstrated that the expression levels of miR-196a is increased in a mouse model of spinal and bulbar muscular atrophy (SBMA), a neurodegenerative disease caused by the expansion of polyglutamine in androgen receptor (AR). In cultured neuronal cells, miR-196a decayed the mutant AR mRNA via silencing CUG triplet repeat RNA binding protein 2, a potent miR-196a targeting mRNA, which contributed to stabilize the mutant AR mRNA. Adeno-associated virus vector-mediated delivery of this miRNA attenuates the expression of the mutant AR, resulting in the mitigation of motor neuron degeneration in the SBMA mice. Introduction of miRNA appears to be a novel therapeutic strategy for devastating neurodegenerative diseases.

Reduction of adenovirus E1A mRNA by RNAi results in enhanced recombinant protein expression in transiently transfected HEK293 cells.

PubMed

Hacker, David L; Bertschinger, Martin; Baldi, Lucia; Wurm, Florian M

2004-10-27

Human embryonic kidney 293 (HEK293) cells, a widely used host for large-scale transient expression of recombinant proteins, are transformed with the adenovirus E1A and E1B genes. Because the E1A proteins function as transcriptional activators or repressors, they may have a positive or negative effect on transient transgene expression in this cell line. Suspension cultures of HEK293 EBNA (HEK293E) cells were co-transfected with a reporter plasmid expressing the GFP gene and a plasmid expressing a short hairpin RNA (shRNA) targeting the E1A mRNAs for degradation by RNA interference (RNAi). The presence of the shRNA in HEK293E cells reduced the steady state level of E1A mRNA up to 75% and increased transient GFP expression from either the elongation factor-1alpha (EF-1alpha) promoter or the human cytomegalovirus (HCMV) immediate early promoter up to twofold. E1A mRNA depletion also resulted in a twofold increase in transient expression of a recombinant IgG in both small- and large-scale suspension cultures when the IgG light and heavy chain genes were controlled by the EF-1alpha promoter. Finally, transient IgG expression was enhanced 2.5-fold when the anti-E1A shRNA was expressed from the same vector as the IgG light chain gene. These results demonstrated that E1A has a negative effect on transient gene expression in HEK293E cells, and they established that RNAi can be used to enhance recombinant protein expression in mammalian cells.

Vectors for co-expression of an unrestricted number of proteins

PubMed Central

Scheich, Christoph; Kümmel, Daniel; Soumailakakis, Dimitri; Heinemann, Udo; Büssow, Konrad

2007-01-01

A vector system is presented that allows generation of E. coli co-expression clones by a standardized, robust cloning procedure. The number of co-expressed proteins is not limited. Five ‘pQLink’ vectors for expression of His-tag and GST-tag fusion proteins as well as untagged proteins and for cloning by restriction enzymes or Gateway cloning were generated. The vectors allow proteins to be expressed individually; to achieve co-expression, two pQLink plasmids are combined by ligation-independent cloning. pQLink co-expression plasmids can accept an unrestricted number of genes. As an example, the co-expression of a heterotetrameric human transport protein particle (TRAPP) complex from a single plasmid, its isolation and analysis of its stoichiometry are shown. pQLink clones can be used directly for pull-down experiments if the proteins are expressed with different tags. We demonstrate pull-down experiments of human valosin-containing protein (VCP) with fragments of the autocrine motility factor receptor (AMFR). The cloning method avoids PCR or gel isolation of restriction fragments, and a single resistance marker and origin of replication are used, allowing over-expression of rare tRNAs from a second plasmid. It is expected that applications are not restricted to bacteria, but could include co-expression in other hosts such as Bacluovirus/insect cells. PMID:17311810

HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs

PubMed Central

Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

2015-01-01

Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses. PMID:25668122

HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs.

PubMed

Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

2015-01-01

Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses.

Heterologous viral expression systems in fosmid vectors increase the functional analysis potential of metagenomic libraries.

PubMed

Terrón-González, L; Medina, C; Limón-Mortés, M C; Santero, E

2013-01-01

The extraordinary potential of metagenomic functional analyses to identify activities of interest present in uncultured microorganisms has been limited by reduced gene expression in surrogate hosts. We have developed vectors and specialized E. coli strains as improved metagenomic DNA heterologous expression systems, taking advantage of viral components that prevent transcription termination at metagenomic terminators. One of the systems uses the phage T7 RNA-polymerase to drive metagenomic gene expression, while the other approach uses the lambda phage transcription anti-termination protein N to limit transcription termination. A metagenomic library was constructed and functionally screened to identify genes conferring carbenicillin resistance to E. coli. The use of these enhanced expression systems resulted in a 6-fold increase in the frequency of carbenicillin resistant clones. Subcloning and sequence analysis showed that, besides β-lactamases, efflux pumps are not only able contribute to carbenicillin resistance but may in fact be sufficient by themselves to convey carbenicillin resistance.

Polyester: simulating RNA-seq datasets with differential transcript expression.

PubMed

Frazee, Alyssa C; Jaffe, Andrew E; Langmead, Ben; Leek, Jeffrey T

2015-09-01

Statistical methods development for differential expression analysis of RNA sequencing (RNA-seq) requires software tools to assess accuracy and error rate control. Since true differential expression status is often unknown in experimental datasets, artificially constructed datasets must be utilized, either by generating costly spike-in experiments or by simulating RNA-seq data. Polyester is an R package designed to simulate RNA-seq data, beginning with an experimental design and ending with collections of RNA-seq reads. Its main advantage is the ability to simulate reads indicating isoform-level differential expression across biological replicates for a variety of experimental designs. Data generated by Polyester is a reasonable approximation to real RNA-seq data and standard differential expression workflows can recover differential expression set in the simulation by the user. Polyester is freely available from Bioconductor (http://bioconductor.org/). jtleek@gmail.com Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

The Development of a Viral Mediated CRISPR/Cas9 System with Doxycycline Dependent gRNA Expression for Inducible In vitro and In vivo Genome Editing

PubMed Central

de Solis, Christopher A.; Ho, Anthony; Holehonnur, Roopashri; Ploski, Jonathan E.

2016-01-01

The RNA-guided Cas9 nuclease, from the type II prokaryotic Clustered Regularly Interspersed Short Palindromic Repeats (CRISPR) adaptive immune system, has been adapted and utilized by scientists to edit the genomes of eukaryotic cells. Here, we report the development of a viral mediated CRISPR/Cas9 system that can be rendered inducible utilizing doxycycline (Dox) and can be delivered to cells in vitro and in vivo utilizing adeno-associated virus (AAV). Specifically, we developed an inducible gRNA (gRNAi) AAV vector that is designed to express the gRNA from a H1/TO promoter. This AAV vector is also designed to express the Tet repressor (TetR) to regulate the expression of the gRNAi in a Dox dependent manner. We show that H1/TO promoters of varying length and a U6/TO promoter can edit DNA with similar efficiency in vitro, in a Dox dependent manner. We also demonstrate that our inducible gRNAi vector can be used to edit the genomes of neurons in vivo within the mouse brain in a Dox dependent manner. Genome editing can be induced in vivo with this system by supplying animals Dox containing food for as little as 1 day. This system might be cross compatible with many existing S. pyogenes Cas9 systems (i.e., Cas9 mouse, CRISPRi, etc.), and therefore it likely can be used to render these systems inducible as well. PMID:27587996

Gene Therapy for Neuropathic Pain by Silencing of TNF-α Expression with Lentiviral Vectors Targeting the Dorsal Root Ganglion in Mice

PubMed Central

Ogawa, Nobuhiro; Kawai, Hiromichi; Terashima, Tomoya; Kojima, Hideto; Oka, Kazuhiro; Chan, Lawrence; Maegawa, Hiroshi

2014-01-01

Neuropathic pain can be a debilitating condition. Many types of drugs that have been used to treat neuropathic pain have only limited efficacy. Recent studies indicate that pro-inflammatory mediators including tumor necrosis factor α (TNF-α) are involved in the pathogenesis of neuropathic pain. In the present study, we engineered a gene therapy strategy to relieve neuropathic pain by silencing TNF-α expression in the dorsal root ganglion (DRG) using lentiviral vectors expressing TNF short hairpin RNA1-4 (LV-TNF-shRNA1-4) in mice. First, based on its efficacy in silencing TNF-α in vitro, we selected shRNA3 to construct LV-TNF-shRNA3 for in vivo study. We used L5 spinal nerve transection (SNT) mice as a neuropathic pain model. These animals were found to display up-regulated mRNA expression of activating transcription factor 3 (ATF3) and neuropeptide Y (NPY), injury markers, and interleukin (IL)-6, an inflammatory cytokine in the ipsilateral L5 DRG. Injection of LV-TNF-shRNA3 onto the proximal transected site suppressed significantly the mRNA levels of ATF3, NPY and IL-6, reduced mechanical allodynia and neuronal cell death of DRG neurons. These results suggest that lentiviral-mediated silencing of TNF-α in DRG relieves neuropathic pain and reduces neuronal cell death, and may constitute a novel therapeutic option for neuropathic pain. PMID:24642694

Effects of Light and Temperature on Daily Activity and Clock Gene Expression in Two Mosquito Disease Vectors.

PubMed

Rivas, Gustavo B S; Teles-de-Freitas, Rayane; Pavan, Márcio G; Lima, José B P; Peixoto, Alexandre A; Bruno, Rafaela Vieira

2018-06-01

Most organisms feature an endogenous circadian clock capable of synchronization with their environment. The most well-known synchronizing agents are light and temperature. The circadian clock of mosquitoes, vectors of many pathogens, drives important behaviors related to vectoral capacity, including oviposition, host seeking, and hematophagy. Main clock gene expression, as well as locomotor activity patterns, has been identified in Aedes aegypti and Culex quinquefasciatus under artificial light-dark cycles. Given that these mosquito species thrive in tropical areas, it is reasonable to speculate that temperature plays an important role in the circadian clock. Here, we provide data supporting a different hierarchy of light and temperature as zeitgebers of two mosquito species. We recorded their locomotor activity and quantified mRNA expression of the main clock genes in several combinations of light and temperature cycles. We observed that A. aegypti is more sensitive to temperature, while C. quinquefasciatus is more responsive to light. These variations in clock gene expression and locomotor activity may have affected the mosquito species' metabolism, energy expenditure, fitness cost, and pathogen transmission efficiency. Our findings are relevant to chronobiology studies and also have epidemiological implications.

Expression of calmodulin mRNA in rat olfactory neuroepithelium.

PubMed

Biffo, S; Goren, T; Khew-Goodall, Y S; Miara, J; Margolis, F L

1991-04-01

A calmodulin (CaM) cDNA was isolated by differential hybridization screening of a lambda gt10 library prepared from rat olfactory mucosa. This cDNA fragment, containing most of the open reading frame of the rat CaMI gene, was subcloned and used to characterize steady-state expression of CaM mRNA in rat olfactory neuroepithelium and bulb. Within the bulb mitral cells are the primary neuronal population expressing CaM mRNA. The major CaM mRNA expressed in the olfactory mucosa is 1.7 kb with smaller contributions from mRNAs of 4.0 and 1.4 kb. CaM mRNA was primarily associated with the olfactory neurons and, despite the cellular complexity of the tissue and the known involvement of CaM in diverse cellular processes, was only minimally evident in sustentacular cells, gland cells or respiratory epithelium. Following bulbectomy CaM mRNA declines in the olfactory neuroepithelium as does olfactory marker protein (OMP) mRNA. In contrast to the latter, CaM mRNA makes a partial recovery by one month after surgery. These results, coupled with those from in situ hybridization, indicate that CaM mRNA is expressed in both mature and immature olfactory neurons. The program regulating CaM gene expression in olfactory neurons is distinct from those controlling expression of B50/GAP43 in immature, or OMP in mature, neurons respectively.

Transient foreign gene expression in chloroplasts of cultured tobacco cells after biolistic delivery of chloroplast vectors.

PubMed Central

Daniell, H; Vivekananda, J; Nielsen, B L; Ye, G N; Tewari, K K; Sanford, J C

1990-01-01

Expression of chloramphenicol acetyltransferase (cat) by suitable vectors in chloroplasts of cultured tobacco cells, delivered by high-velocity microprojectiles, is reported here. Several chloroplast expression vectors containing bacterial cat genes, placed under the control of either psbA promoter region from pea (pHD series) or rbcL promoter region from maize (pAC series) have been used in this study. In addition, chloroplast expression vectors containing replicon fragments from pea, tobacco, or maize chloroplast DNA have also been tested for efficiency and duration of cat expression in chloroplasts of tobacco cells. Cultured NT1 tobacco cells collected on filter papers were bombarded with tungsten particles coated with pUC118 (negative control), 35S-CAT (nuclear expression vector), pHD312 (repliconless chloroplast expression vector), and pHD407, pACp18, and pACp19 (chloroplast expression vectors with replicon). Sonic extracts of cells bombarded with pUC118 showed no detectable cat activity in the autoradiograms. Nuclear expression of cat reached two-thirds of the maximal 48 hr after bombardment and the maximal at 72 hr. Cells bombarded with chloroplast expression vectors showed a low level of expression until 48 hr of incubation. A dramatic increase in the expression of cat was observed 24 hr after the addition of fresh medium to cultured cells in samples bombarded with pHD407; the repliconless vector pHD312 showed about 50% of this maximal activity. The expression of nuclear cat and the repliconless chloroplast vector decreased after 72 hr, but a high level of chloroplast cat expression was maintained in cells bombarded with pHD407. Organelle-specific expression of cat in appropriate compartments was checked by introducing various plasmid constructions into tobacco protoplasts by electroporation. Although the nuclear expression vector 35S-CAT showed expression of cat, no activity was observed with any chloroplast vectors. Images PMID:2404285

Transient foreign gene expression in chloroplasts of cultured tobacco cells after biolistic delivery of chloroplast vectors.

PubMed

Daniell, H; Vivekananda, J; Nielsen, B L; Ye, G N; Tewari, K K; Sanford, J C

1990-01-01

Expression of chloramphenicol acetyltransferase (cat) by suitable vectors in chloroplasts of cultured tobacco cells, delivered by high-velocity microprojectiles, is reported here. Several chloroplast expression vectors containing bacterial cat genes, placed under the control of either psbA promoter region from pea (pHD series) or rbcL promoter region from maize (pAC series) have been used in this study. In addition, chloroplast expression vectors containing replicon fragments from pea, tobacco, or maize chloroplast DNA have also been tested for efficiency and duration of cat expression in chloroplasts of tobacco cells. Cultured NT1 tobacco cells collected on filter papers were bombarded with tungsten particles coated with pUC118 (negative control), 35S-CAT (nuclear expression vector), pHD312 (repliconless chloroplast expression vector), and pHD407, pACp18, and pACp19 (chloroplast expression vectors with replicon). Sonic extracts of cells bombarded with pUC118 showed no detectable cat activity in the autoradiograms. Nuclear expression of cat reached two-thirds of the maximal 48 hr after bombardment and the maximal at 72 hr. Cells bombarded with chloroplast expression vectors showed a low level of expression until 48 hr of incubation. A dramatic increase in the expression of cat was observed 24 hr after the addition of fresh medium to cultured cells in samples bombarded with pHD407; the repliconless vector pHD312 showed about 50% of this maximal activity. The expression of nuclear cat and the repliconless chloroplast vector decreased after 72 hr, but a high level of chloroplast cat expression was maintained in cells bombarded with pHD407. Organelle-specific expression of cat in appropriate compartments was checked by introducing various plasmid constructions into tobacco protoplasts by electroporation. Although the nuclear expression vector 35S-CAT showed expression of cat, no activity was observed with any chloroplast vectors.

MicroRNA, mRNA, and protein expression link development and aging in human and macaque brain

PubMed Central

Somel, Mehmet; Guo, Song; Fu, Ning; Yan, Zheng; Hu, Hai Yang; Xu, Ying; Yuan, Yuan; Ning, Zhibin; Hu, Yuhui; Menzel, Corinna; Hu, Hao; Lachmann, Michael; Zeng, Rong; Chen, Wei; Khaitovich, Philipp

2010-01-01

Changes in gene expression levels determine differentiation of tissues involved in development and are associated with functional decline in aging. Although development is tightly regulated, the transition between development and aging, as well as regulation of post-developmental changes, are not well understood. Here, we measured messenger RNA (mRNA), microRNA (miRNA), and protein expression in the prefrontal cortex of humans and rhesus macaques over the species' life spans. We find that few gene expression changes are unique to aging. Instead, the vast majority of miRNA and gene expression changes that occur in aging represent reversals or extensions of developmental patterns. Surprisingly, many gene expression changes previously attributed to aging, such as down-regulation of neural genes, initiate in early childhood. Our results indicate that miRNA and transcription factors regulate not only developmental but also post-developmental expression changes, with a number of regulatory processes continuing throughout the entire life span. Differential evolutionary conservation of the corresponding genomic regions implies that these regulatory processes, although beneficial in development, might be detrimental in aging. These results suggest a direct link between developmental regulation and expression changes taking place in aging. PMID:20647238

[Inhibiting target gene expression and controlling growth of Epstein-Barr virus transformed cells by antisense RNA transcripts].

PubMed

Chen, Jian-jing; Raab-Traub, Nancy; Yao, Qing-yun; Zhang, Feng; Huang, Mei-ling; Kuang, Zhu-ji; Zhang, Xiao-shi; Ye, Yan-li; Gu, Li

2002-01-01

The latent membrane protein gene (LMP) of Epstein-Barr virus (EBV) was thought to play an important role in the carcinogenesis of nasopharyngeal carcinoma (NPC). In this study, the authors investigated the effects of antisense RNA (AsRNA) on LMP for down regulating at the target gene over expression in EBV transformed lymphoid cells, and set up an antisense system to inhibit LMP expression. Constructing the single strand antisense transcription system in vitro, the authors have got large amount of AsRNA. Designing and setting up an antisense tracing system in situ (ATSIS), the authors could observe the living particles of AsRNA/sense RNA duplex dimer. With time lapse phase-contrast microscopy, the agglutination phenotype on living cells was easily detected by MTT test, the inhibition rate on EBV transformed cells was calculated. LMP 1.9 fragment ligated into pGEM vector in reverse orientation have been constructed and produced a plentiful amount of AsLMPmRNA which could incorporated into both B95-8 and C1936 cell lines by endophagocytosis and formed the duplex dimer of As/Sense RNA. This particles have been visualized in situ when labelling 35S isotope by ATSIS. When AsLMPmRNA acted as agents for specific inhibition to LMP over expression, the transform phenotype of cell agglutination have been suppressed and MTT particle formatin was apparently reduced both two EBV tansformed cell lines. AsLMPmRNA targets at sense strand have a high effectiveness of down-regulation on EBV-LMP overexpression. This down regulating function of LMP and growth inhibition on transformed cell is demonstrated by the antisenes tracing system in situ (ATSIS). The results provide a clue to overcome the latent EBV infection in human bodies all living long time and to prevent it inducing NPC in high incidence area by antisense strategies.

Three gene expression vector sets for concurrently expressing multiple genes in Saccharomyces cerevisiae.

PubMed

Ishii, Jun; Kondo, Takashi; Makino, Harumi; Ogura, Akira; Matsuda, Fumio; Kondo, Akihiko

2014-05-01

Yeast has the potential to be used in bulk-scale fermentative production of fuels and chemicals due to its tolerance for low pH and robustness for autolysis. However, expression of multiple external genes in one host yeast strain is considerably labor-intensive due to the lack of polycistronic transcription. To promote the metabolic engineering of yeast, we generated systematic and convenient genetic engineering tools to express multiple genes in Saccharomyces cerevisiae. We constructed a series of multi-copy and integration vector sets for concurrently expressing two or three genes in S. cerevisiae by embedding three classical promoters. The comparative expression capabilities of the constructed vectors were monitored with green fluorescent protein, and the concurrent expression of genes was monitored with three different fluorescent proteins. Our multiple gene expression tool will be helpful to the advanced construction of genetically engineered yeast strains in a variety of research fields other than metabolic engineering. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Development of a duplex real-time RT-qPCR assay to monitor genome replication, gene expression and gene insert stability during in vivo replication of a prototype live attenuated canine distemper virus vector encoding SIV gag.

PubMed

Coleman, John W; Wright, Kevin J; Wallace, Olivia L; Sharma, Palka; Arendt, Heather; Martinez, Jennifer; DeStefano, Joanne; Zamb, Timothy P; Zhang, Xinsheng; Parks, Christopher L

2015-03-01

Advancement of new vaccines based on live viral vectors requires sensitive assays to analyze in vivo replication, gene expression and genetic stability. In this study, attenuated canine distemper virus (CDV) was used as a vaccine delivery vector and duplex 2-step quantitative real-time RT-PCR (RT-qPCR) assays specific for genomic RNA (gRNA) or mRNA have been developed that concurrently quantify coding sequences for the CDV nucleocapsid protein (N) and a foreign vaccine antigen (SIV Gag). These amplicons, which had detection limits of about 10 copies per PCR reaction, were used to show that abdominal cavity lymphoid tissues were a primary site of CDV vector replication in infected ferrets, and importantly, CDV gRNA or mRNA was undetectable in brain tissue. In addition, the gRNA duplex assay was adapted for monitoring foreign gene insert genetic stability during in vivo replication by analyzing the ratio of CDV N and SIV gag genomic RNA copies over the course of vector infection. This measurement was found to be a sensitive probe for assessing the in vivo genetic stability of the foreign gene insert. Copyright © 2014 Elsevier B.V. All rights reserved.

pHg/pSILBAγ vector system for efficient gene silencing in homobasidiomycetes: optimization of ihpRNA – triggering in the mycorrhizal fungus Laccaria bicolor

PubMed Central

Kemppainen, Minna J.; Pardo, Alejandro G.

2010-01-01

Summary pSILBAγ silencing vector was constructed for efficient RNA silencing triggering in the model mycorrhizal fungus Laccaria bicolor. This cloning vector carries the Agaricus bisporus gpdII promoter, two multiple cloning sites separated by a L. bicolor nitrate reductase intron and the Aspergillus nidulans trpC terminator. pSILBAγ allows an easy oriented two‐step PCR cloning of hairpin sequences to be expressed in basidiomycetes. With one further cloning step into pHg, a pCAMBIA1300‐based binary vector carrying a hygromycin resistance cassette, the pHg/pSILBAγ plasmid is used for Agrobacterium‐mediated transformation. The pHg/pSILBAγ system results in predominantly single integrations of RNA silencing triggering T‐DNAs in the fungal genome and the integration sites of the transgenes can be resolved by plasmid rescue. pSILBAγ construct and two other pSILBA plasmid variants (pSILBA and pSILBAα) were evaluated for their capacity to silence Laccaria nitrate reductase gene. While all pSILBA variants tested resulted in up to 65–76% of transformants with reduced growth on nitrate, pSILBAγ produced the highest number (65%) of strongly affected fungal strains. The strongly silenced phenotype was shown to correlate with T‐DNA integration in transcriptionally active genomic sites. pHg/pSILBAγ was shown to produce T‐DNAs with minimum CpG methylation in transgene promoter regions which assures the maximum silencing trigger production in Laccaria. Methylation of the target endogene was only slight in RNA silencing triggered with constructs carrying an intronic spacer hairpin sequence. The silencing capacity of the pHg/pSILBAγ was further tested with Laccaria inositol‐1,4,5‐triphosphate 5‐phosphatase gene. Besides its use in silencing triggering, the herein described plasmid system can also be used for transgene expression in Laccaria. pHg/pSILBAγ silencing system is optimized for L. bicolor but it should be highly useful also for other

mESAdb: microRNA Expression and Sequence Analysis Database

PubMed Central

Kaya, Koray D.; Karakülah, Gökhan; Yakıcıer, Cengiz M.; Acar, Aybar C.; Konu, Özlen

2011-01-01

microRNA expression and sequence analysis database (http://konulab.fen.bilkent.edu.tr/mirna/) (mESAdb) is a regularly updated database for the multivariate analysis of sequences and expression of microRNAs from multiple taxa. mESAdb is modular and has a user interface implemented in PHP and JavaScript and coupled with statistical analysis and visualization packages written for the R language. The database primarily comprises mature microRNA sequences and their target data, along with selected human, mouse and zebrafish expression data sets. mESAdb analysis modules allow (i) mining of microRNA expression data sets for subsets of microRNAs selected manually or by motif; (ii) pair-wise multivariate analysis of expression data sets within and between taxa; and (iii) association of microRNA subsets with annotation databases, HUGE Navigator, KEGG and GO. The use of existing and customized R packages facilitates future addition of data sets and analysis tools. Furthermore, the ability to upload and analyze user-specified data sets makes mESAdb an interactive and expandable analysis tool for microRNA sequence and expression data. PMID:21177657

mESAdb: microRNA expression and sequence analysis database.

PubMed

Kaya, Koray D; Karakülah, Gökhan; Yakicier, Cengiz M; Acar, Aybar C; Konu, Ozlen

2011-01-01

microRNA expression and sequence analysis database (http://konulab.fen.bilkent.edu.tr/mirna/) (mESAdb) is a regularly updated database for the multivariate analysis of sequences and expression of microRNAs from multiple taxa. mESAdb is modular and has a user interface implemented in PHP and JavaScript and coupled with statistical analysis and visualization packages written for the R language. The database primarily comprises mature microRNA sequences and their target data, along with selected human, mouse and zebrafish expression data sets. mESAdb analysis modules allow (i) mining of microRNA expression data sets for subsets of microRNAs selected manually or by motif; (ii) pair-wise multivariate analysis of expression data sets within and between taxa; and (iii) association of microRNA subsets with annotation databases, HUGE Navigator, KEGG and GO. The use of existing and customized R packages facilitates future addition of data sets and analysis tools. Furthermore, the ability to upload and analyze user-specified data sets makes mESAdb an interactive and expandable analysis tool for microRNA sequence and expression data.

A microRNA-mRNA expression network during oral siphon regeneration in Ciona

PubMed Central

Spina, Elijah J.; Guzman, Elmer; Zhou, Hongjun; Kosik, Kenneth S.

2017-01-01

Here we present a parallel study of mRNA and microRNA expression during oral siphon (OS) regeneration in Ciona robusta, and the derived network of their interactions. In the process of identifying 248 mRNAs and 15 microRNAs as differentially expressed, we also identified 57 novel microRNAs, several of which are among the most highly differentially expressed. Analysis of functional categories identified enriched transcripts related to stress responses and apoptosis at the wound healing stage, signaling pathways including Wnt and TGFβ during early regrowth, and negative regulation of extracellular proteases in late stage regeneration. Consistent with the expression results, we found that inhibition of TGFβ signaling blocked OS regeneration. A correlation network was subsequently inferred for all predicted microRNA-mRNA target pairs expressed during regeneration. Network-based clustering associated transcripts into 22 non-overlapping groups, the functional analysis of which showed enrichment of stress response, signaling pathway and extracellular protease categories that could be related to specific microRNAs. Predicted targets of the miR-9 cluster suggest a role in regulating differentiation and the proliferative state of neural progenitors through regulation of the cytoskeleton and cell cycle. PMID:28432214

Reporter gene expression in fish following cutaneous infection with pantropic retroviral vectors.

PubMed

Paul, T A; Burns, J C; Shike, H; Getchell, R; Bowser, P R; Whitlock, K E; Casey, J W

2001-06-01

A central issue in gene delivery systems is choosing promoters that will direct defined and sustainable levels of gene expression. Pantropic retroviral vectors provide a means to insert genes into either somatic or germline cells. In this study, we focused on somatic cell infection by evaluating the activity of 3 promoters inserted by vectors into fish cell lines and fish skin using pantropic retroviruses. In bluegill and zebrafish cell lines, the highest levels of luciferase expression were observed from the 5' murine leukemia virus long terminal repeat of the retroviral vector. The Rous sarcoma virus long terminal repeat and cytomegalovirus early promoter, as internal promoters, generated lower levels of luciferase. Luciferase reporter vectors infected zebrafish skin, as measured by the presence of viral DNA, and expressed luciferase. We infected developing walleye dermal sarcomas with retroviral vectors to provide an environment with enhanced cell proliferation, a condition necessary for integration of the provirus into the host genome. We demonstrated a 4-fold to 7-fold increase in luciferase gene expression in tumor tissue over infections in normal walleye skin.

Construction of two Lactococcus lactis expression vectors combining the Gateway and the NIsin Controlled Expression systems.

PubMed

Douillard, François P; Mahony, Jennifer; Campanacci, Valérie; Cambillau, Christian; van Sinderen, Douwe

2011-09-01

Over the last 10 years, the NIsin Controlled Expression (NICE) system has been extensively used in the food-grade bacterium Lactococcus lactis subsp. cremoris to produce homologous and heterologous proteins for academic and biotechnological purposes. Although various L. lactis molecular tools have been developed, no expression vectors harboring the popular Gateway recombination system are currently available for this widely used cloning host. In this study, we constructed two expression vectors that combine the NICE and the Gateway recombination systems and we tested their applicability by recombining and over-expressing genes encoding structural proteins of lactococcal phages Tuc2009 and TP901-1. Over-expressed phage proteins were analyzed by immunoblotting and purified by His-tag affinity chromatography with protein productions yielding 2.8-3.7 mg/l of culture. This therefore is the first description of L. lactis NICE expression vectors which integrate the Gateway cloning technology and which are suitable for the production of sufficient amounts of proteins to facilitate subsequent structural and functional analyses. Copyright © 2011 Elsevier Inc. All rights reserved.

The developmental transcriptome of the mosquito Aedes aegypti, an invasive species and major arbovirus vector.

PubMed

Akbari, Omar S; Antoshechkin, Igor; Amrhein, Henry; Williams, Brian; Diloreto, Race; Sandler, Jeremy; Hay, Bruce A

2013-09-04

Mosquitoes are vectors of a number of important human and animal diseases. The development of novel vector control strategies requires a thorough understanding of mosquito biology. To facilitate this, we used RNA-seq to identify novel genes and provide the first high-resolution view of the transcriptome throughout development and in response to blood feeding in a mosquito vector of human disease, Aedes aegypti, the primary vector for Dengue and yellow fever. We characterized mRNA expression at 34 distinct time points throughout Aedes development, including adult somatic and germline tissues, by using polyA+ RNA-seq. We identify a total of 14,238 novel new transcribed regions corresponding to 12,597 new loci, as well as many novel transcript isoforms of previously annotated genes. Altogether these results increase the annotated fraction of the transcribed genome into long polyA+ RNAs by more than twofold. We also identified a number of patterns of shared gene expression, as well as genes and/or exons expressed sex-specifically or sex-differentially. Expression profiles of small RNAs in ovaries, early embryos, testes, and adult male and female somatic tissues also were determined, resulting in the identification of 38 new Aedes-specific miRNAs, and ~291,000 small RNA new transcribed regions, many of which are likely to be endogenous small-interfering RNAs and Piwi-interacting RNAs. Genes of potential interest for transgene-based vector control strategies also are highlighted. Our data have been incorporated into a user-friendly genome browser located at www.Aedes.caltech.edu, with relevant links to Vectorbase (www.vectorbase.org).

Gene expression distribution deconvolution in single-cell RNA sequencing.

PubMed

Wang, Jingshu; Huang, Mo; Torre, Eduardo; Dueck, Hannah; Shaffer, Sydney; Murray, John; Raj, Arjun; Li, Mingyao; Zhang, Nancy R

2018-06-26

Single-cell RNA sequencing (scRNA-seq) enables the quantification of each gene's expression distribution across cells, thus allowing the assessment of the dispersion, nonzero fraction, and other aspects of its distribution beyond the mean. These statistical characterizations of the gene expression distribution are critical for understanding expression variation and for selecting marker genes for population heterogeneity. However, scRNA-seq data are noisy, with each cell typically sequenced at low coverage, thus making it difficult to infer properties of the gene expression distribution from raw counts. Based on a reexamination of nine public datasets, we propose a simple technical noise model for scRNA-seq data with unique molecular identifiers (UMI). We develop deconvolution of single-cell expression distribution (DESCEND), a method that deconvolves the true cross-cell gene expression distribution from observed scRNA-seq counts, leading to improved estimates of properties of the distribution such as dispersion and nonzero fraction. DESCEND can adjust for cell-level covariates such as cell size, cell cycle, and batch effects. DESCEND's noise model and estimation accuracy are further evaluated through comparisons to RNA FISH data, through data splitting and simulations and through its effectiveness in removing known batch effects. We demonstrate how DESCEND can clarify and improve downstream analyses such as finding differentially expressed genes, identifying cell types, and selecting differentiation markers. Copyright © 2018 the Author(s). Published by PNAS.

T-lymphocyte cytokine mRNA expression in cystic echinococcosis.

PubMed

Fauser, S; Kern, P

1997-04-01

In the present study we investigated cytokine mRNA expression by peripheral blood mononuclear cells (PBMC) from patients with cystic echinococcosis (CE) after stimulation with different antigens. By using reverse transcriptase polymerase chain reaction (RT-PCR) we could demonstrate that restimulation with crude Echinococcus granulosus antigen (Eg-Ag) induced or enhanced Th2 cytokine mRNA expression, especially IL-5 (by using antigen from sheep cyst fluid) in 23 out of 26 investigated CE patients and IL-10 (by using antigen from camel cyst fluid) in 10 out of 10 investigated CE patients. In contrast, IL-5 mRNA expression was absent in PBMC of healthy controls after Eg-Ag stimulation. To determine the specificity of this reaction we stimulated PBMC from 11 CE patients with crude Echinococcus multilocularis antigen (Em-Ag) and PBMC from 8 CE patients with Toxocara canis antigen (Tc-Ag). We found that the PBMC of patients showed a similar mRNA cytokine pattern on stimulation with Em-Ag when compared with Eg-Ag stimulation. The cytokine mRNA pattern on stimulation with Tc-Ag, however, resembled the cytokine mRNA pattern of unstimulated PBMC. Furthermore, the stimulation of PBMC with crude Mycobacterium tuberculosis antigen (H37Ra) and purified protein derivative (PPD) of M. tuberculosis revealed distinct IL-5 mRNA expression in all investigated CE patients, whereas in healthy controls IL-5 mRNA expression was very weak or totally absent. Thus, our results indicate an induction of Th2 cytokine mRNA expression in CE patients, which is frequently observed in parasite infections. Interestingly, this response persists after stimulation with tuberculosis antigens, which normally induce Th1 response.

PmiRExAt: plant miRNA expression atlas database and web applications

PubMed Central

Gurjar, Anoop Kishor Singh; Panwar, Abhijeet Singh; Gupta, Rajinder; Mantri, Shrikant S.

2016-01-01

High-throughput small RNA (sRNA) sequencing technology enables an entirely new perspective for plant microRNA (miRNA) research and has immense potential to unravel regulatory networks. Novel insights gained through data mining in publically available rich resource of sRNA data will help in designing biotechnology-based approaches for crop improvement to enhance plant yield and nutritional value. Bioinformatics resources enabling meta-analysis of miRNA expression across multiple plant species are still evolving. Here, we report PmiRExAt, a new online database resource that caters plant miRNA expression atlas. The web-based repository comprises of miRNA expression profile and query tool for 1859 wheat, 2330 rice and 283 maize miRNA. The database interface offers open and easy access to miRNA expression profile and helps in identifying tissue preferential, differential and constitutively expressing miRNAs. A feature enabling expression study of conserved miRNA across multiple species is also implemented. Custom expression analysis feature enables expression analysis of novel miRNA in total 117 datasets. New sRNA dataset can also be uploaded for analysing miRNA expression profiles for 73 plant species. PmiRExAt application program interface, a simple object access protocol web service allows other programmers to remotely invoke the methods written for doing programmatic search operations on PmiRExAt database. Database URL: http://pmirexat.nabi.res.in. PMID:27081157

Analysis of microRNA expression and function.

PubMed

Van Wynsberghe, Priscilla M; Chan, Shih-Peng; Slack, Frank J; Pasquinelli, Amy E

2011-01-01

Originally discovered in C. elegans, microRNAs (miRNAs) are small RNAs that regulate fundamental cellular processes in diverse organisms. MiRNAs are encoded within the genome and are initially transcribed as primary transcripts that can be several kilobases in length. Primary transcripts are successively cleaved by two RNase III enzymes, Drosha in the nucleus and Dicer in the cytoplasm, to produce ∼70 nucleotide (nt) long precursor miRNAs and 22 nt long mature miRNAs, respectively. Mature miRNAs regulate gene expression post-transcriptionally by imperfectly binding target mRNAs in association with the multiprotein RNA induced silencing complex (RISC). The conserved sequence, expression pattern, and function of some miRNAs across distinct species as well as the importance of specific miRNAs in many biological pathways have led to an explosion in the study of miRNA biogenesis, miRNA target identification, and miRNA target regulation. Many advances in our understanding of miRNA biology have come from studies in the powerful model organism C. elegans. This chapter reviews the current methods used in C. elegans to study miRNA biogenesis, small RNA populations, miRNA-protein complexes, and miRNA target regulation. Copyright © 2011 Elsevier Inc. All rights reserved.

microRNA-342, microRNA-191 and microRNA-510 are differentially expressed in T regulatory cells of type 1 diabetic patients.

PubMed

Hezova, Renata; Slaby, Ondrej; Faltejskova, Petra; Mikulkova, Zuzana; Buresova, Ivana; Raja, K R Muthu; Hodek, Jan; Ovesna, Jaroslava; Michalek, Jaroslav

2010-01-01

Regulatory T cells (Tregs) are critical regulators of autoimmune diseases, including type 1 diabetes mellitus. It is hypothesised that Tregs' function can be influenced by changes in the expression of specific microRNAs (miRNAs). Thus, we performed miRNAs profiling in a population of Tregs separated from peripheral blood of five type 1 diabetic patients and six healthy donors. For more detailed molecular characterisation of Tregs, we additionally compared miRNAs expression profiles of Tregs and conventional T cells. Tregs were isolated according to CD3+, CD4+, CD25(hi)+ and CD127- by flow cytometry, and miRNA expression profiling was performed using TaqMan Array Human MicroRNA Panel-1 (384-well low density array). In Tregs of diabetic patients we found significantly increased expression of miRNA-510 (p=0.05) and decreased expression of both miRNA-342 (p<0.0001) and miRNA-191 (p=0.0079). When comparing Tregs and T cells, we revealed that Tregs had significant higher expression of miRNA-146a and lower expression of eight specific miRNAs (20b, 31, 99a, 100, 125b, 151, 335, and 365). To our knowledge, this is the first study demonstrating changes in miRNA expression profiles occurring in Tregs of T1D patients and a miRNAs signature of adult Tregs.

Use of a bacterial expression vector to map the varicella-zoster virus major glycoprotein gene, gC.

PubMed Central

Ellis, R W; Keller, P M; Lowe, R S; Zivin, R A

1985-01-01

The genome of varicella-zoster virus (VZV) encodes at least three major glycoprotein genes. Among viral gene products, the gC gene products are the most abundant glycoproteins and induce a substantial humoral immune response (Keller et al., J. Virol. 52:293-297, 1984). We utilized two independent approaches to map the gC gene. Small fragments of randomly digested VZV DNA were inserted into a bacterial expression vector. Bacterial colonies transformed by this vector library were screened serologically for antigen expression with monoclonal antibodies to gC. Hybridization of the plasmid DNA from a gC antigen-positive clone revealed homology to the 3' end of the VZV Us segment. In addition, mRNA from VZV-infected cells was hybrid selected by a set of VZV DNA recombinant plasmids and translated in vitro, and polypeptide products were immunoprecipitated by convalescent zoster serum or by monoclonal antibodies to gC. This analysis revealed that the mRNA encoding a 70,000-dalton polypeptide precipitable by anti-gC antibodies mapped to the HindIII C fragment, which circumscribes the entire Us region. We conclude that the VZV gC glycoprotein gene maps to the 3' end of the Us region and is expressed as a 70,000-dalton primary translational product. These results are consistent with the recently reported DNA sequence of Us (A.J. Davison, EMBO J. 2:2203-2209, 1983). Furthermore, glycosylation appears not to be required for a predominant portion of the antigenicity of gC glycoproteins. We also report the tentative map assignments for eight other VZV primary translational products. Images PMID:2981365

Rule-Based Design of Plant Expression Vectors Using GenoCAD.

PubMed

Coll, Anna; Wilson, Mandy L; Gruden, Kristina; Peccoud, Jean

2015-01-01

Plant synthetic biology requires software tools to assist on the design of complex multi-genic expression plasmids. Here a vector design strategy to express genes in plants is formalized and implemented as a grammar in GenoCAD, a Computer-Aided Design software for synthetic biology. It includes a library of plant biological parts organized in structural categories and a set of rules describing how to assemble these parts into large constructs. Rules developed here are organized and divided into three main subsections according to the aim of the final construct: protein localization studies, promoter analysis and protein-protein interaction experiments. The GenoCAD plant grammar guides the user through the design while allowing users to customize vectors according to their needs. Therefore the plant grammar implemented in GenoCAD will help plant biologists take advantage of methods from synthetic biology to design expression vectors supporting their research projects.

Targeted expression of suicide gene by tissue-specific promoter and microRNA regulation for cancer gene therapy.

PubMed

Danda, Ravikanth; Krishnan, Gopinath; Ganapathy, Kalaivani; Krishnan, Uma Maheswari; Vikas, Khetan; Elchuri, Sailaja; Chatterjee, Nivedita; Krishnakumar, Subramanian

2013-01-01

In order to realise the full potential of cancer suicide gene therapy that allows the precise expression of suicide gene in cancer cells, we used a tissue specific Epithelial cell adhesion molecule (EpCAM) promoter (EGP-2) that directs transgene Herpes simplex virus-thymidine kinase (HSV-TK) expression preferentially in EpCAM over expressing cancer cells. EpCAM levels are considerably higher in retinoblastoma (RB), a childhood eye cancer with limited expression in normal cells. Use of miRNA regulation, adjacent to the use of the tissue-specific promoter, would provide the second layer of control to the transgene expression only in the tumor cells while sparing the normal cells. To test this hypothesis we cloned let-7b miRNA targets in the 3'UTR region of HSV-TK suicide gene driven by EpCAM promoter because let-7 family miRNAs, including let-7b, were found to be down regulated in the RB tumors and cell lines. We used EpCAM over expressing and let-7 down regulated RB cell lines Y79, WERI-Rb1 (EpCAM (+ve)/let-7b(down-regulated)), EpCAM down regulated, let-7 over expressing normal retinal Müller glial cell line MIO-M1(EpCAM (-ve)/let-7b(up-regulated)), and EpCAM up regulated, let-7b up-regulated normal thyroid cell line N-Thy-Ori-3.1(EpCAM (+ve)/let-7b(up-regulated)) in the study. The cell proliferation was measured by MTT assay, apoptosis was measured by probing cleaved Caspase3, EpCAM and TK expression were quantified by Western blot. Our results showed that the EGP2-promoter HSV-TK (EGP2-TK) construct with 2 or 4 copies of let-7b miRNA targets expressed TK gene only in Y79, WERI-Rb-1, while the TK gene did not express in MIO-M1. In summary, we have developed a tissue-specific, miRNA-regulated dual control vector, which selectively expresses the suicide gene in EpCAM over expressing cells.

A microRNA-mRNA expression network during oral siphon regeneration in Ciona.

PubMed

Spina, Elijah J; Guzman, Elmer; Zhou, Hongjun; Kosik, Kenneth S; Smith, William C

2017-05-15

Here we present a parallel study of mRNA and microRNA expression during oral siphon (OS) regeneration in Ciona robusta , and the derived network of their interactions. In the process of identifying 248 mRNAs and 15 microRNAs as differentially expressed, we also identified 57 novel microRNAs, several of which are among the most highly differentially expressed. Analysis of functional categories identified enriched transcripts related to stress responses and apoptosis at the wound healing stage, signaling pathways including Wnt and TGFβ during early regrowth, and negative regulation of extracellular proteases in late stage regeneration. Consistent with the expression results, we found that inhibition of TGFβ signaling blocked OS regeneration. A correlation network was subsequently inferred for all predicted microRNA-mRNA target pairs expressed during regeneration. Network-based clustering associated transcripts into 22 non-overlapping groups, the functional analysis of which showed enrichment of stress response, signaling pathway and extracellular protease categories that could be related to specific microRNAs. Predicted targets of the miR-9 cluster suggest a role in regulating differentiation and the proliferative state of neural progenitors through regulation of the cytoskeleton and cell cycle. © 2017. Published by The Company of Biologists Ltd.

Development of Defective and Persistent Sendai Virus Vector

PubMed Central

Nishimura, Ken; Sano, Masayuki; Ohtaka, Manami; Furuta, Birei; Umemura, Yoko; Nakajima, Yoshiro; Ikehara, Yuzuru; Kobayashi, Toshihiro; Segawa, Hiroaki; Takayasu, Satoko; Sato, Hideyuki; Motomura, Kaori; Uchida, Eriko; Kanayasu-Toyoda, Toshie; Asashima, Makoto; Nakauchi, Hiromitsu; Yamaguchi, Teruhide; Nakanishi, Mahito

2011-01-01

The ectopic expression of transcription factors can reprogram differentiated tissue cells into induced pluripotent stem cells. However, this is a slow and inefficient process, depending on the simultaneous delivery of multiple genes encoding essential reprogramming factors and on their sustained expression in target cells. Moreover, once cell reprogramming is accomplished, these exogenous reprogramming factors should be replaced with their endogenous counterparts for establishing autoregulated pluripotency. Complete and designed removal of the exogenous genes from the reprogrammed cells would be an ideal option for satisfying this latter requisite as well as for minimizing the risk of malignant cell transformation. However, no single gene delivery/expression system has ever been equipped with these contradictory characteristics. Here we report the development of a novel replication-defective and persistent Sendai virus (SeVdp) vector based on a noncytopathic variant virus, which fulfills all of these requirements for cell reprogramming. The SeVdp vector could accommodate up to four exogenous genes, deliver them efficiently into various mammalian cells (including primary tissue cells and human hematopoietic stem cells) and express them stably in the cytoplasm at a prefixed balance. Furthermore, interfering with viral transcription/replication using siRNA could erase the genomic RNA of SeVdp vector from the target cells quickly and thoroughly. A SeVdp vector installed with Oct4/Sox2/Klf4/c-Myc could reprogram mouse primary fibroblasts quite efficiently; ∼1% of the cells were reprogrammed to Nanog-positive induced pluripotent stem cells without chromosomal gene integration. Thus, this SeVdp vector has potential as a tool for advanced cell reprogramming and for stem cell research. PMID:21138846

Complex interplay among DNA modification, noncoding RNA expression and protein-coding RNA expression in Salvia miltiorrhiza chloroplast genome.

PubMed

Chen, Haimei; Zhang, Jianhui; Yuan, George; Liu, Chang

2014-01-01

Salvia miltiorrhiza is one of the most widely used medicinal plants. As a first step to develop a chloroplast-based genetic engineering method for the over-production of active components from S. miltiorrhiza, we have analyzed the genome, transcriptome, and base modifications of the S. miltiorrhiza chloroplast. Total genomic DNA and RNA were extracted from fresh leaves and then subjected to strand-specific RNA-Seq and Single-Molecule Real-Time (SMRT) sequencing analyses. Mapping the RNA-Seq reads to the genome assembly allowed us to determine the relative expression levels of 80 protein-coding genes. In addition, we identified 19 polycistronic transcription units and 136 putative antisense and intergenic noncoding RNA (ncRNA) genes. Comparison of the abundance of protein-coding transcripts (cRNA) with and without overlapping antisense ncRNAs (asRNA) suggest that the presence of asRNA is associated with increased cRNA abundance (p<0.05). Using the SMRT Portal software (v1.3.2), 2687 potential DNA modification sites and two potential DNA modification motifs were predicted. The two motifs include a TATA box-like motif (CPGDMM1, "TATANNNATNA"), and an unknown motif (CPGDMM2 "WNYANTGAW"). Specifically, 35 of the 97 CPGDMM1 motifs (36.1%) and 91 of the 369 CPGDMM2 motifs (24.7%) were found to be significantly modified (p<0.01). Analysis of genes downstream of the CPGDMM1 motif revealed the significantly increased abundance of ncRNA genes that are less than 400 bp away from the significantly modified CPGDMM1motif (p<0.01). Taking together, the present study revealed a complex interplay among DNA modifications, ncRNA and cRNA expression in chloroplast genome.

Dual role for argonautes in microRNA processing and posttranscriptional regulation of microRNA expression.

PubMed

Diederichs, Sven; Haber, Daniel A

2007-12-14

MicroRNAs are small endogenous noncoding RNAs involved in posttranscriptional gene regulation. During microRNA biogenesis, Drosha and Dicer process the primary transcript (pri-miRNA) through a precursor hairpin (pre-miRNA) to the mature miRNA. The miRNA is incorporated into the RNA-Induced Silencing Complex (RISC) with Argonaute proteins, the effector molecules in RNA interference (RNAi). Here, we show that all Argonautes elevate mature miRNA expression posttranscriptionally, independent of RNase activity. Also, we identify a role for the RISC slicer Argonaute2 (Ago2) in cleaving the pre-miRNA to an additional processing intermediate, termed Ago2-cleaved precursor miRNA or ac-pre-miRNA. This endogenous, on-pathway intermediate results from cleavage of the pre-miRNA hairpin 12 nucleotides from its 3'-end. By analogy to siRNA processing, Ago2 cleavage may facilitate removal of the nicked passenger strand from RISC after maturation. The multiple roles of Argonautes in the RNAi effector phase and miRNA biogenesis and maturation suggest coordinate regulation of microRNA expression and function.

Overview of long non-coding RNA and mRNA expression in response to methamphetamine treatment in vitro.

PubMed

Xiong, Kun; Long, Lingling; Zhang, Xudong; Qu, Hongke; Deng, Haixiao; Ding, Yanjun; Cai, Jifeng; Wang, Shuchao; Wang, Mi; Liao, Lvshuang; Huang, Jufang; Yi, Chun-Xia; Yan, Jie

2017-10-01

Long non-coding RNAs (lncRNAs) display multiple functions including regulation of neuronal injury. However, their impact in methamphetamine (METH)-induced neurotoxicity has rarely been reported. Here, using microarray analysis, we investigated the expression profiling of lncRNAs and mRNAs in primary cultured prefrontal cortical neurons after METH treatment. We observed a difference in lncRNA and mRNA expression between the experimental and sham control groups. Using bioinformatics, we analyzed the highest enriched gene ontology (GO) terms of biological process, cellular component, and molecular function, and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway and pathway network analysis. Furthermore, an lncRNA-mRNA co-expression sub-network for aberrantly expressed terms revealed possible interactions of lncRNA NR_110713 and NR_027943 with their related genes. Afterwards, three lncRNAs (NR_110713, NR_027943, GAS5) and two mRNAs (Ddit3, Casp12) were targeted to validate the microarray data by qRT-PCR. This presented an overview of lncRNA and mRNA expression profiling and indicated that lncRNA might participate in METH-induced neuronal apoptosis by regulating the coding genes of neurons. Copyright © 2017 Elsevier Ltd. All rights reserved.

Lentiviral vectors encoding shRNAs efficiently transduce and knockdown LINGO-1 but induce an interferon response and cytotoxicity in CNS neurons

PubMed Central

Hutson, Thomas H.; Foster, Edmund; Dawes, John M.; Hindges, Robert; Yáñez-Muñoz, Rafael J.; Moon, Lawrence D.F.

2017-01-01

Background Knocking down neuronal LINGO-1 using short hairpin RNAs (shRNAs) might enhance axon regeneration in the CNS. Integration-deficient lentiviral vectors have great potential as a therapeutic delivery system for CNS injuries. However, recent studies have revealed that shRNAs can induce an interferon response resulting in off-target effects and cytotoxicity. Methods CNS neurons were transduced with integration-deficient lentiviral vectors in vitro. The transcriptional effect of shRNA expression was analysed using qRT-PCR and northern blots were used to assess shRNA production. Results Integration-deficient lentiviral vectors efficiently transduced CNS neurons and knocked down LINGO-1 mRNA in vitro. However, an increase in cell death was observed when lentiviral vectors encoding an shRNA were applied or when high vector concentrations were used. We demonstrate that high doses of vector or the use of vectors encoding shRNAs can induce an up-regulation of interferon stimulated genes (OAS1 and PKR) and a down-regulation of off- target genes (including p75NTR and NgR1). Furthermore, the northern blot demonstrated that these negative consequences occur even when lentiviral vectors express low levels of shRNAs. Together, these results may explain why neurite outgrowth was not enhanced on an inhibitory substrate after transduction with lentiviral vectors encoding an shRNA targeting LINGO-1. Conclusions These findings highlight the importance of including appropriate controls to verify silencing specificity and the requirement to check for an interferon response when conducting RNA interference experiments. However, the potential benefits that RNA interference and viral vectors offer to gene-based therapies to CNS injuries cannot be overlooked and demand further investigation. PMID:22499506

Correlation analyses revealed global microRNA-mRNA expression associations in human peripheral blood mononuclear cells.

PubMed

Wang, Lan; Zhu, Jiang; Deng, Fei-Yan; Wu, Long-Fei; Mo, Xing-Bo; Zhu, Xiao-Wei; Xia, Wei; Xie, Fang-Fei; He, Pei; Bing, Peng-Fei; Qiu, Ying-Hua; Lin, Xiang; Lu, Xin; Zhang, Lei; Yi, Neng-Jun; Zhang, Yong-Hong; Lei, Shu-Feng

2018-02-01

MicroRNAs (miRNAs) can regulate gene expression through binding to complementary sites in the 3'-untranslated regions of target mRNAs, which will lead to existence of correlation in expression between miRNA and mRNA. However, the miRNA-mRNA correlation patterns are complex and remain largely unclear yet. To establish the global correlation patterns in human peripheral blood mononuclear cells (PBMCs), multiple miRNA-mRNA correlation analyses and expression quantitative trait locus (eQTL) analysis were conducted in this study. We predicted and achieved 861 miRNA-mRNA pairs (65 miRNAs, 412 mRNAs) using multiple bioinformatics programs, and found global negative miRNA-mRNA correlations in PBMC from all 46 study subjects. Among the 861 pairs of correlations, 19.5% were significant (P < 0.05) and ~70% were negative. The correlation network was complex and highlighted key miRNAs/genes in PBMC. Some miRNAs, such as hsa-miR-29a, hsa-miR-148a, regulate a cluster of target genes. Some genes, e.g., TNRC6A, are regulated by multiple miRNAs. The identified genes tend to be enriched in molecular functions of DNA and RNA binding, and biological processes such as protein transport, regulation of translation and chromatin modification. The results provided a global view of the miRNA-mRNA expression correlation profile in human PBMCs, which would facilitate in-depth investigation of biological functions of key miRNAs/mRNAs and better understanding of the pathogenesis underlying PBMC-related diseases.

Silencing of p53 RNA through transarterial delivery ameliorates renal tubular injury and downregulates GSK-3β expression after ischemia-reperfusion injury.

PubMed

Fujino, Takayuki; Muhib, Sharifi; Sato, Nobuyuki; Hasebe, Naoyuki

2013-12-01

p53, a pivotal protein in the apoptotic pathway, has been identified as a mediator of transcriptional responses to ischemia-reperfusion (IR) injury. The characteristics and functional significance of the p53 response in vivo are largely unknown in IR-induced kidney injury. Therapeutic opportunities of delivering small interfering RNA (siRNA) via venous injection have gained recognition; however, systemic adverse effects of siRNA therapy should be considered. To prevent IR-induced kidney injury, we tested the efficacy of transarterial administration of siRNA targeting p53 (p53 siRNA). Female C57BL/6 mice underwent unilateral renal artery ischemia for 30 min, followed by reperfusion. siRNA experiments utilized short hairpin (sh) RNA plasmid-based approaches. Transfection of shRNA was performed using cationic polymer transfection reagent. Injection of synthetic p53 shRNA into the left renal artery just after ischemia improved tubular injury, apoptosis, and the swelling of mitochondria in cells of the thick ascending limb of Henle (mTALH) at the outer medullary regions. Staining of upregulated p53 was colocalized with the inducible expression of glycogen synthase kinase-3β (GSK-3β) at mTALH after IR injury. p53 shRNA inhibited GSK-3β expression and restored β-catenin expression at mTALH. For IR-induced kidney injury, transarterial delivery of p53 siRNA is an effective pharmacological intervention. Targeting siRNA to p53 leads to an attenuation of apoptosis and mitochondrial damage through the downregulation of GSK-3β expression and upregulation of β-catenin. Local delivery of vectors such as p53 siRNA through a transaortic catheter is clinically useful in reducing the adverse effect of siRNA-related therapy.

[Anti-HBV effects of genetically engineered replication-defective HBV with combined expression of antisense RNA and dominant negative mutants of core protein and construction of first-generation packaging cell line for HBV vector].

PubMed

Sun, Dian Xing; Hu, Da Rong; Wu, Guang Hui; Hu, Xue Ling; Li, Juan; Fan, Gong Ren

2002-08-01

To explore the possibility of using HBV as a gene delivery vector, and to test the anti-HBV effects by intracellular combined expression of antisense RNA and dominant negative mutants of core protein. Full length of mutant HBV genome, which expresses core-partial P fusion protein and/or antisense RNA, was transfected into HepG2.2.15 cell lines. Positive clones were selected and mixed in respective groups with hygromycin in the culture medium. HBsAg and HBeAg, which exist in the culture medium, were tested by ELISA method. Intracellular HBc related HBV DNA was examined by dot blot hybridization. The existence of recombinant HBV virion in the culture medium was examined by PCR. Free of packaging signal, HBV genome, which express the HBV structural proteins including core, pol and preS/S proteins, was inserted into pCI-neo vector. HepG2 cell lines were employed to transfect with the construct. G418 selection was done at the concentration of 400mug/ml in the culture medium. The G418-resistant clones with the best expression of HBsAg and HBcAg were theoretically considered as packaging cell lines and propagated under the same conditions. It was transfected with plasmid pMEP-CPAS and then selected with G418 and hygromycin in the culture medium. The existence of recombinant HBV virion in the culture medium was examined by PCR. The mean inhibitory rates of HBsAg were 2.74% 3.83%, 40.08 2.05% (t=35.5, P<0.01), 66.54% 4.45% (t=42.3, P<0.01), and 73.68% 5.07% (t=51.9, P<0.01) in group 2.2.15-pMEP4, 2.2.15-CP, 2.2.15-SAS, and 2.2.15-CPAS, respectively. The mean inhibitory rates of HBeAg were 4.46% 4.25%, 52.86% 1.32% (t=36.2, P<0.01), 26.36% 1.69% (t=22.3, P<0.01), and 59.28% 2.10% (t=39.0, P<0.01), respectively. The inhibitory rates of HBc related HBV DNA were 0, 82.0%, 59.9%, and 96.6%, respectively. Recombinant HB virion was detectable in the culture medium of all the three treatment groups. G418-resistant HBV packaging cell line, which harbored an HBV mutant whose

Optimized Lentiviral Vector Design Improves Titer and Transgene Expression of Vectors Containing the Chicken β-Globin Locus HS4 Insulator Element

PubMed Central

Hanawa, Hideki; Yamamoto, Motoko; Zhao, Huifen; Shimada, Takashi; Persons, Derek A

2009-01-01

Hematopoietic cell gene therapy using retroviral vectors has achieved success in clinical trials. However, safety issues regarding vector insertional mutagenesis have emerged. In two different trials, vector insertion resulted in the transcriptional activation of proto-oncogenes. One strategy for potentially diminishing vector insertional mutagenesis is through the use of self-inactivating lentiviral vectors containing the 1.2-kb insulator element derived from the chicken β-globin locus. However, use of this element can dramatically decrease both vector titer and transgene expression, thereby compromising its practical use. Here, we studied lentiviral vectors containing either the full-length 1.2-kb insulator or the smaller 0.25-kb core element in both orientations in the partially deleted long-terminal repeat. We show that use of the 0.25-kb core insulator rescued vector titer by alleviating a postentry block to reverse transcription associated with the 1.2-kb element. In addition, in an orientation-dependent manner, the 0.25-kb core element significantly increased transgene expression from an internal promoter due to improved transcriptional termination. This element also demonstrated barrier activity, reducing variability of expression due to position effects. As it is known that the 0.25-kb core insulator has enhancer-blocking activity, this particular insulated lentiviral vector design may be useful for clinical application. PMID:19223867

The Landscape of Circular RNA Expression Profiles in Papillary Thyroid Carcinoma Based on RNA Sequencing.

PubMed

Lan, Xiabin; Xu, Jiajie; Chen, Chao; Zheng, Chuanming; Wang, Jiafeng; Cao, Jun; Zhu, Xuhang; Ge, Minghua

2018-05-25

Papillary thyroid carcinoma (PTC) is the most common type of thyroid cancer. However, the molecular mechanisms responsible for its tumorigenesis and progression remain largely unknown. Circular RNA (circRNA) is a novel type of noncoding RNA that can serve as an ideal biomarker due to its stability. Recent evidence suggests that circRNAs play important roles in tumorigenesis. This study aims to investigate circRNA expression profiles and their potential biological functions in PTC. High-throughput RNA sequencing was used to assess circRNA expression profiles in PTC, and quantitative real-time polymerase chain reaction (qRT-PCR) was used to validate dysregulated circRNAs. Receiver operating characteristic (ROC) curves were generated to evaluate the diagnostic value of circRNAs for PTC. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were employed to determine the biological functions of differentially expressed circRNAs. Bioinformatic analyses were applied to predict interactions between circRNAs and microRNAs (miRNAs), and a circRNA-miRNA-mRNA network was constructed using Cytoscape software. We identified a number of differentially expressed circRNAs in PTC tissues compared with paired normal thyroid tissues, with chr5: 160757890-160763776-, chr12: 40696591-40697936+, chr7: 22330794-22357656-, and chr21: 16386665-16415895- being upregulated, and chr7: 91924203-91957214+, chr2: 179514891-179516047-, chr9: 16435553-16437522-, and chr22: 36006931-36007153- being downregulated. These findings were confirmed by qRT-PCR, and ROC curves indicated that they can serve as potential biomarkers for PTC. GO and KEGG pathway analyses showed that some of these circRNAs are related to cancers. Additionally, bioinformatic analyses revealed a potential competing-endogenous-RNA-regulating network among circRNAs, miRNAs, and mRNAs. Our study results depict the landscape of circRNA expression profiles in PTC and also provide potential

[Construction, identification and expression of three kinds of shuttle plasmids of adenovirus expression vector of hepatitis C virus structure gene].

PubMed

Cao, Yi-zhan; Hao, Chun-qiu; Feng, Zhi-hua; Zhou, Yong-xing; Li, Jin-ge; Jia, Zhan-sheng; Wang, Ping-zhong

2003-02-01

To construct three recombinant shuttle plasmids of adenovirus expression vector which can express hepatitis C virus(HCV) different structure genes(C, C+E1, C+E1+E2) in order to pack adenovirus expression vectors which can express HCV different structure gene effectively. The different HCV structure genes derived from the plasmid pBRTM/HCV1-3011 by using polymerase chain reaction (PCR) were inserted into the backward position of cytomegalovirus(CMV) immediate early promotor element of shuttle plasmid(pAd.CMV-Link.1) of adenovirus expression vector respectively, then the three recombinant plasmids (pAd.HCV-C, pAd.HCV-CE1, pAd.HCV-S) were obtained. The recombinant plasmids were identified by endonuclease, PCR and sequencing. HCV structure genes were expressed transiently with Lipofectamine 2000 coated in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. Insert DNAs of the three recombinant plasmids' were confirmed to be HCV different structure genes by endonuclease, PCR and sequencing. The three recombinant plasmids can express HCV structure gene (C, C+E1, C+E1+E2) transiently in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. The three recombinant shuttle plasmids of adenovirus expression vector can express HCV structure gene(C, C+E1, C+E1+E2) transiently. This should be useful to pack adenovirus expression vector which can express HCV structure genes.

Biological mechanism analysis of acute renal allograft rejection: integrated of mRNA and microRNA expression profiles.

PubMed

Huang, Shi-Ming; Zhao, Xia; Zhao, Xue-Mei; Wang, Xiao-Ying; Li, Shan-Shan; Zhu, Yu-Hui

2014-01-01

Renal transplantation is the preferred method for most patients with end-stage renal disease, however, acute renal allograft rejection is still a major risk factor for recipients leading to renal injury. To improve the early diagnosis and treatment of acute rejection, study on the molecular mechanism of it is urgent. MicroRNA (miRNA) expression profile and mRNA expression profile of acute renal allograft rejection and well-functioning allograft downloaded from ArrayExpress database were applied to identify differentially expressed (DE) miRNAs and DE mRNAs. DE miRNAs targets were predicted by combining five algorithm. By overlapping the DE mRNAs and DE miRNAs targets, common genes were obtained. Differentially co-expressed genes (DCGs) were identified by differential co-expression profile (DCp) and differential co-expression enrichment (DCe) methods in Differentially Co-expressed Genes and Links (DCGL) package. Then, co-expression network of DCGs and the cluster analysis were performed. Functional enrichment analysis for DCGs was undergone. A total of 1270 miRNA targets were predicted and 698 DE mRNAs were obtained. While overlapping miRNA targets and DE mRNAs, 59 common genes were gained. We obtained 103 DCGs and 5 transcription factors (TFs) based on regulatory impact factors (RIF), then built the regulation network of miRNA targets and DE mRNAs. By clustering the co-expression network, 5 modules were obtained. Thereinto, module 1 had the highest degree and module 2 showed the most number of DCGs and common genes. TF CEBPB and several common genes, such as RXRA, BASP1 and AKAP10, were mapped on the co-expression network. C1R showed the highest degree in the network. These genes might be associated with human acute renal allograft rejection. We conducted biological analysis on integration of DE mRNA and DE miRNA in acute renal allograft rejection, displayed gene expression patterns and screened out genes and TFs that may be related to acute renal allograft

Biological mechanism analysis of acute renal allograft rejection: integrated of mRNA and microRNA expression profiles

PubMed Central

Huang, Shi-Ming; Zhao, Xia; Zhao, Xue-Mei; Wang, Xiao-Ying; Li, Shan-Shan; Zhu, Yu-Hui

2014-01-01

Objectives: Renal transplantation is the preferred method for most patients with end-stage renal disease, however, acute renal allograft rejection is still a major risk factor for recipients leading to renal injury. To improve the early diagnosis and treatment of acute rejection, study on the molecular mechanism of it is urgent. Methods: MicroRNA (miRNA) expression profile and mRNA expression profile of acute renal allograft rejection and well-functioning allograft downloaded from ArrayExpress database were applied to identify differentially expressed (DE) miRNAs and DE mRNAs. DE miRNAs targets were predicted by combining five algorithm. By overlapping the DE mRNAs and DE miRNAs targets, common genes were obtained. Differentially co-expressed genes (DCGs) were identified by differential co-expression profile (DCp) and differential co-expression enrichment (DCe) methods in Differentially Co-expressed Genes and Links (DCGL) package. Then, co-expression network of DCGs and the cluster analysis were performed. Functional enrichment analysis for DCGs was undergone. Results: A total of 1270 miRNA targets were predicted and 698 DE mRNAs were obtained. While overlapping miRNA targets and DE mRNAs, 59 common genes were gained. We obtained 103 DCGs and 5 transcription factors (TFs) based on regulatory impact factors (RIF), then built the regulation network of miRNA targets and DE mRNAs. By clustering the co-expression network, 5 modules were obtained. Thereinto, module 1 had the highest degree and module 2 showed the most number of DCGs and common genes. TF CEBPB and several common genes, such as RXRA, BASP1 and AKAP10, were mapped on the co-expression network. C1R showed the highest degree in the network. These genes might be associated with human acute renal allograft rejection. Conclusions: We conducted biological analysis on integration of DE mRNA and DE miRNA in acute renal allograft rejection, displayed gene expression patterns and screened out genes and TFs that may

Sleeping Beauty-baculovirus hybrid vectors for long-term gene expression in the eye.

PubMed

Turunen, Tytteli Anni Kaarina; Laakkonen, Johanna Päivikki; Alasaarela, Laura; Airenne, Kari Juhani; Ylä-Herttuala, Seppo

2014-01-01

A baculovirus vector is capable of efficiently transducing many nondiving and diving cell types. However, the potential of baculovirus is restricted for many gene delivery applications as a result of the transient gene expression that it mediates. The plasmid-based Sleeping Beauty (SB) transposon system integrates transgenes into target cell genome efficiently with a genomic integration pattern that is generally considered safer than the integration of many other integrating vectors; yet efficient delivery of therapeutic genes into cells of target tissues in vivo is a major challenge for nonviral gene therapy. In the present study, SB was introduced into baculovirus to obtain novel hybrid vectors that would combine the best features of the two vector systems (i.e. effective gene delivery and efficient integration into the genome), thus circumventing the major limitations of these vectors. We constructed and optimized SB-baculovirus hybrid vectors that bear either SB100x transposase or SB transposon in the forward or reverse orientations with respect to the viral backbone The functionality of the novel hybrid vectors was investigated in cell cultures and in a proof-of-concept study in the mouse eye. The hybrid vectors showed high and sustained transgene expression that remained stable and demonstrated no signs of decline during the 2 months follow-up in vitro. These results were verified in the mouse eye where persistent transgene expression was detected two months after intravitreal injection. Our results confirm that (i) SB-baculovirus hybrid vectors mediate long-term gene expression in vitro and in vivo, and (ii) the hybrid vectors are potential new tools for the treatment of ocular diseases. Copyright © 2014 John Wiley & Sons, Ltd.

Complex Interplay among DNA Modification, Noncoding RNA Expression and Protein-Coding RNA Expression in Salvia miltiorrhiza Chloroplast Genome

PubMed Central

Chen, Haimei; Zhang, Jianhui; Yuan, George; Liu, Chang

2014-01-01

Salvia miltiorrhiza is one of the most widely used medicinal plants. As a first step to develop a chloroplast-based genetic engineering method for the over-production of active components from S. miltiorrhiza, we have analyzed the genome, transcriptome, and base modifications of the S. miltiorrhiza chloroplast. Total genomic DNA and RNA were extracted from fresh leaves and then subjected to strand-specific RNA-Seq and Single-Molecule Real-Time (SMRT) sequencing analyses. Mapping the RNA-Seq reads to the genome assembly allowed us to determine the relative expression levels of 80 protein-coding genes. In addition, we identified 19 polycistronic transcription units and 136 putative antisense and intergenic noncoding RNA (ncRNA) genes. Comparison of the abundance of protein-coding transcripts (cRNA) with and without overlapping antisense ncRNAs (asRNA) suggest that the presence of asRNA is associated with increased cRNA abundance (p<0.05). Using the SMRT Portal software (v1.3.2), 2687 potential DNA modification sites and two potential DNA modification motifs were predicted. The two motifs include a TATA box–like motif (CPGDMM1, “TATANNNATNA”), and an unknown motif (CPGDMM2 “WNYANTGAW”). Specifically, 35 of the 97 CPGDMM1 motifs (36.1%) and 91 of the 369 CPGDMM2 motifs (24.7%) were found to be significantly modified (p<0.01). Analysis of genes downstream of the CPGDMM1 motif revealed the significantly increased abundance of ncRNA genes that are less than 400 bp away from the significantly modified CPGDMM1motif (p<0.01). Taking together, the present study revealed a complex interplay among DNA modifications, ncRNA and cRNA expression in chloroplast genome. PMID:24914614

A multisite gateway-based toolkit for targeted gene expression and hairpin RNA silencing in tomato fruits.

PubMed

Estornell, Leandro Hueso; Orzáez, Diego; López-Peña, Lucas; Pineda, Benito; Antón, María Teresa; Moreno, Vicente; Granell, Antonio

2009-04-01

A collection of fruit promoters, reporter genes and protein tags has been constructed in a triple-gateway format, a recombination-based cloning system that facilitates the tandem assembly of three DNA fragments into plant expression vectors. The new pENFRUIT collection includes, among others, the classical tomato-ripening promoters E8 and 2A11 and a set of six new tomato promoters. The new promoter activities were characterized in both transient assays and stable transgenic plants. The range of expression of the new promoters comprises strong (PNH, PLI), medium (PLE, PFF, PHD) and weak (PSN) promoters driving gene expression preferentially in the fruit, and covering a wide range of tissues and developmental stages. Together, a total of 78 possible combinations for the expression of a gene of interest in the fruit, plus a set of five reporters for new promoter analysis, was made available in the current collection. Moreover, the pENFRUIT promoter collection is adaptable to hairpin RNA strategies aimed at tissue/organ-specific gene silencing with only an additional cloning step. The pENFRUIT toolkit broadens the spectrum of promoter activities available for fruit biotechnology and fundamental research, and bypasses technical difficulties of current ligase-dependent cloning techniques in the construction of fruit expression cassettes. The pENFRUIT vector collection is available for the research community in a plasmid repository, facilitating its accessibility.

Capsule-Like Safe Genetic Vectors - Cell-Penetrating Core-Shell Particles Selectively Release Functional Small RNA and Entrap its Encoding DNA.

PubMed

Yu, Han; Pan, Houwen Matthew; Evalin, Fnu; Trau, Dieter Wilhelm; Patzel, Volker

2018-06-05

The breakthrough of genetic therapy is set back by the lack of suitable genetic vector systems. We present the development of permeability-tunable, capsule-like, polymeric, micron-sized, core-shell particles for delivery of recombinant nucleic acids into target cells. These particles were demonstrated to effectively release rod-shaped small hairpin RNA and to selectively retain the RNA-encoding DNA template which was designed to form a bulky tripartite structure. Thus, they can serve as delivery vectors preloaded with cargo RNA or alternatively as RNA producing micro-bioreactors. The internalization of particles by human tissue culture cells inversely correlated with particle size and with the cell to particle ratio, though at a higher than stoichiometric excess of particles over cells, cell viability was impaired. Among primary human peripheral blood mononuclear cells, up to 50% of the monocytes displayed positive uptake of particles. Finally, these particles efficiently delivered siRNA into HEK293T cells triggering functional knockdown of the target gene lamin A/C. Particle-mediated knockdown was superior to that observed after conventional siRNA delivery via lipofection. Core-shell particles protect encapsulated nucleic acids from degradation and target cell genomes from direct contact with recombinant DNA, thus representing a promising delivery vector system that can be explored for genetic therapy and vaccination.

RNA-Seq for Bacterial Gene Expression.

PubMed

Poulsen, Line Dahl; Vinther, Jeppe

2018-06-01

RNA sequencing (RNA-seq) has become the preferred method for global quantification of bacterial gene expression. With the continued improvements in sequencing technology and data analysis tools, the most labor-intensive and expensive part of an RNA-seq experiment is the preparation of sequencing libraries, which is also essential for the quality of the data obtained. Here, we present a straightforward and inexpensive basic protocol for preparation of strand-specific RNA-seq libraries from bacterial RNA as well as a computational pipeline for the data analysis of sequencing reads. The protocol is based on the Illumina platform and allows easy multiplexing of samples and the removal of sequencing reads that are PCR duplicates. © 2018 by John Wiley & Sons, Inc. © 2018 John Wiley & Sons, Inc.

Short Hairpin RNA Gene Silencing of Prolyl Hydroxylase-2 with a Minicircle Vector Improves Neovascularization of Hindlimb Ischemia

PubMed Central

Lijkwan, Maarten A.; Hellingman, Alwine A.; Bos, Ernst J.; van der Bogt, Koen E.A.; Huang, Mei; Kooreman, Nigel G.; de Vries, Margreet R.; Peters, Hendrika A.B.; Robbins, Robert C.; Quax, Paul H.A.

2014-01-01

Abstract In this study, we target the hypoxia inducible factor-1 alpha (HIF-1-alpha) pathway by short hairpin RNA interference therapy targeting prolyl hydroxylase-2 (shPHD2). We use the minicircle (MC) vector technology as an alternative for conventional nonviral plasmid (PL) vectors in order to improve neovascularization after unilateral hindlimb ischemia in a murine model. Gene expression and transfection efficiency of MC and PL, both in vitro and in vivo, were assessed using bioluminescence imaging (BLI) and firefly luciferase (Luc) reporter gene. C57Bl6 mice underwent unilateral electrocoagulation of the femoral artery and gastrocnemic muscle injection with MC-shPHD2, PL-shPHD2, or phosphate-buffered saline (PBS) as control. Blood flow recovery was monitored using laser Doppler perfusion imaging, and collaterals were visualized by immunohistochemistry and angiography. MC-Luc showed a 4.6-fold higher in vitro BLI signal compared with PL-Luc. BLI signals in vivo were 4.3×105±3.3×105 (MC-Luc) versus 0.4×105±0.3×105 (PL-Luc) at day 28 (p=0.016). Compared with PL-shPHD2 or PBS, MC-shPHD2 significantly improved blood flow recovery, up to 50% from day 3 until day 14 after ischemia induction. MC-shPHD2 significantly increased collateral density and capillary density, as monitored by alpha-smooth muscle actin expression and CD31+ expression, respectively. Angiography data confirmed the histological findings. Significant downregulation of PHD2 mRNA levels by MC-shPHD2 was confirmed by quantitative polymerase chain reaction. Finally, Western blot analysis confirmed significantly higher levels of HIF-1-alpha protein by MC-shPHD2, compared with PL-shPHD2 and PBS. This study provides initial evidence of a new potential therapeutic approach for peripheral artery disease. The combination of HIF-1-alpha pathway targeting by shPHD2 with the robust nonviral MC plasmid improved postischemic neovascularization, making this approach a promising potential treatment option for

Development of an adenoviral vector with robust expression driven by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajgelman, Marcio C.; Biotechnology Program, Biomedical Sciences Institute, University of Sao Paulo; Millennium Institute-Gene Therapy Network, Ministry of Science and Technology

2008-02-05

Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTx{beta}, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit {beta}-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG servedmore » as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.« less

[Construction and expression of the eukaryotic expression vector carrying HSV-1 gC glycoprotein gene].

PubMed

Dang, Yin-li; Yan, Yan; Zhang, Xiao-xiao; Li, Pu-yuan; Yu, Lan; Zhang, Lei; Zhang, Fang-lin; Xu, Zhi-kai; Wu, Xing-an

2011-05-01

To stably express herpes simplex virus type 1 (HSV-1) glycoprotein C (gC) in Chinese hamster ovary cells (CHO-K1). The eukaryotic expression vector pCI-mCMV-gC-1-IRES-DHFR-L22R was constructed and transfected into CHO-K1 cells by Lipofectamine 2000. The transfected cells were selected by G418 and methotrexate (MTX). The expression of HSV-1 gC was analyzed by Slot blot. HSV-1 gC proteins were purified with His-Ni Sepharose and then detected by Western blot. The eukaryotic expression vector pCI-mCMV-gC-1-IRES-DHFR-L22R was constructed successfully. CHO-K1 cells stably expressing HSV-1 gC proteins were established and confirmed by Western blot. The HSV-1 gC proteins have been expressed successfully and have good bioactivity. The results make it possible for further study and clinical use of HSV-1 gC.

miRNA and mRNA Expression Profiles Reveal Insight into Chitosan-Mediated Regulation of Plant Growth.

PubMed

Zhang, Xiaoqian; Li, Kecheng; Xing, Ronge; Liu, Song; Chen, Xiaolin; Yang, Haoyue; Li, Pengcheng

2018-04-18

Chitosan has been numerously studied as a plant growth regulator and stress tolerance inducer. To investigate the roles of chitosan as bioregulator on plant and unravel its possible metabolic responses mechanisms, we simultaneously investigated mRNAs and microRNAs (miRNAs) expression profiles of wheat seedlings in response to chitosan heptamer. We found 400 chitosan-responsive differentially expressed genes, including 268 up-regulated and 132 down-regulated mRNAs, many of which were related to photosynthesis, primary carbon and nitrogen metabolism, defense responses, and transcription factors. Moreover, miRNAs also participate in chitosan-mediated regulation on plant growth. We identified 87 known and 21 novel miRNAs, among which 56 miRNAs were induced or repressed by chitosan heptamer, such as miRNA156, miRNA159a, miRNA164, miRNA171a, miRNA319, and miRNA1127. The integrative analysis of miRNA and mRNA expression profiles in this case provides fundamental information for further investigation of regulation mechanisms of chitosan on plant growth and will facilitate its application in agriculture.

Improvement of In Vivo Expression of Genes Delivered by Self-Amplifying RNA Using Vaccinia Virus Immune Evasion Proteins.

PubMed

Beissert, Tim; Koste, Lars; Perkovic, Mario; Walzer, Kerstin C; Erbar, Stephanie; Selmi, Abderraouf; Diken, Mustafa; Kreiter, Sebastian; Türeci, Özlem; Sahin, Ugur

2017-12-01

Among nucleic acid-based delivery platforms, self-amplifying RNA (saRNA) vectors are of increasing interest for applications such as transient expression of recombinant proteins and vaccination. saRNA is safe and, due to its capability to amplify intracellularly, high protein levels can be produced from even minute amounts of transfected templates. However, it is an obstacle to full exploitation of this platform that saRNA induces a strong innate host immune response. In transfected cells, pattern recognition receptors sense double-stranded RNA intermediates and via activation of protein kinase R (PKR) and interferon signaling initiate host defense measures including a translational shutdown. To reduce pattern recognition receptor stimulation and unleash suppressed saRNA translation, this study co-delivered non-replicating mRNA encoding vaccinia virus immune evasion proteins E3, K3, and B18. It was shown that E3 is far superior to K3 or B18 as a highly potent blocker of PKR activation and of interferon (IFN)-β upregulation. B18, in contrast, is superior in controlling OAS1, a key IFN-inducible gene involved in viral RNA degradation. By combining all three vaccinia proteins, the study achieved significant suppression of PKR and IFN pathway activation in vitro and enhanced expression of saRNA-encoded genes of interest both in vitro and in vivo. This approach promises to overcome key hurdles of saRNA gene delivery. Its application may improve the bioavailability of the encoded protein, and reduce the effective dose and correspondingly the cost of goods of manufacture in the various fields where saRNA utilization is envisioned.

Improvement of In Vivo Expression of Genes Delivered by Self-Amplifying RNA Using Vaccinia Virus Immune Evasion Proteins

PubMed Central

Beissert, Tim; Koste, Lars; Perkovic, Mario; Walzer, Kerstin C.; Erbar, Stephanie; Selmi, Abderraouf; Diken, Mustafa; Kreiter, Sebastian; Türeci, Özlem; Sahin, Ugur

2017-01-01

Among nucleic acid–based delivery platforms, self-amplifying RNA (saRNA) vectors are of increasing interest for applications such as transient expression of recombinant proteins and vaccination. saRNA is safe and, due to its capability to amplify intracellularly, high protein levels can be produced from even minute amounts of transfected templates. However, it is an obstacle to full exploitation of this platform that saRNA induces a strong innate host immune response. In transfected cells, pattern recognition receptors sense double-stranded RNA intermediates and via activation of protein kinase R (PKR) and interferon signaling initiate host defense measures including a translational shutdown. To reduce pattern recognition receptor stimulation and unleash suppressed saRNA translation, this study co-delivered non-replicating mRNA encoding vaccinia virus immune evasion proteins E3, K3, and B18. It was shown that E3 is far superior to K3 or B18 as a highly potent blocker of PKR activation and of interferon (IFN)-β upregulation. B18, in contrast, is superior in controlling OAS1, a key IFN-inducible gene involved in viral RNA degradation. By combining all three vaccinia proteins, the study achieved significant suppression of PKR and IFN pathway activation in vitro and enhanced expression of saRNA-encoded genes of interest both in vitro and in vivo. This approach promises to overcome key hurdles of saRNA gene delivery. Its application may improve the bioavailability of the encoded protein, and reduce the effective dose and correspondingly the cost of goods of manufacture in the various fields where saRNA utilization is envisioned. PMID:28877647

mRNA secondary structure engineering of Thermobifida fusca endoglucanase (Cel6A) for enhanced expression in Escherichia coli.

PubMed

Ali, Imran; Asghar, Rehana; Ahmed, Sajjad; Sajjad, Muhammad; Tariq, Muhammad; Waheed Akhtar, M

2015-03-01

The sequence and structure of mRNA plays an important role in solubility and expression of the translated protein. To divulge the role of mRNA secondary structure and its thermodynamics in the expression level of the recombinant endoglucanase in Escherichia coli, 5'-end of the mRNA was thermodynamically optimized. Molecular engineering was done by introducing two silent synonymous mutations at positions +5 (UCU with UCC) and +7 (UUC with UUU) of the 5'-end of mRNA to relieve hybridization with ribosomal binding site. Two variants of glycoside hydrolase family six endoglucanase, wild type (cel6A.wt) and mutant (cel6A.mut) from Thermobifida fusca were expressed and characterized in E. coli using T7 promoter-based expression vector; pET22b(+). Enhanced expression level of engineered construct (Cel6A.mut) with ∆G = -2.7 kcal mol(-1)was observed. It showed up to ~45 % higher expression as compared to the wild type construct (Cel6A.wt) having ∆G = -7.8 kcal mol(-1) and ~25 % expression to the total cell proteins. Heterologous protein was purified by heating the recombinant E. coli BL21 (DE3) CodonPlus at 60 °C. The optimum pH for enzyme activity was six and optimum temperature was 60 °C. Maximum activity was observed 4.5 Umg(-1) on CMC. Hydrolytic activity was also observed on insoluble substrates, i.e. RAC (2.8 Umg(-1)), alkali treated bagass (1.7 Umg(-1)), filter paper (1.2 Umg(-1)) and BMCC (0.3 Umg(-1)). Metal ions affect endoglucanase activity in different ways. Only Fe(2+) exhibited 20.8 % stimulatory effects on enzyme activity. Enzyme activity was profoundly inhibited by Hg2(+) (91.8 %).

Ribosomal DNA Integrating rAAV-rDNA Vectors Allow for Stable Transgene Expression

PubMed Central

Lisowski, Leszek; Lau, Ashley; Wang, Zhongya; Zhang, Yue; Zhang, Feijie; Grompe, Markus; Kay, Mark A

2012-01-01

Although recombinant adeno-associated virus (rAAV) vectors are proving to be efficacious in clinical trials, the episomal character of the delivered transgene restricts their effectiveness to use in quiescent tissues, and may not provide lifelong expression. In contrast, integrating vectors enhance the risk of insertional mutagenesis. In an attempt to overcome both of these limitations, we created new rAAV-rDNA vectors, with an expression cassette flanked by ribosomal DNA (rDNA) sequences capable of homologous recombination into genomic rDNA. We show that after in vivo delivery the rAAV-rDNA vectors integrated into the genomic rDNA locus 8–13 times more frequently than control vectors, providing an estimate that 23–39% of the integrations were specific to the rDNA locus. Moreover, a rAAV-rDNA vector containing a human factor IX (hFIX) expression cassette resulted in sustained therapeutic levels of serum hFIX even after repeated manipulations to induce liver regeneration. Because of the relative safety of integration in the rDNA locus, these vectors expand the usage of rAAV for therapeutics requiring long-term gene transfer into dividing cells. PMID:22990671

Improving the Transduction of Bone Marrow–Derived Cells with an Integrase-Defective Lentiviral Vector

PubMed Central

Pay, S. Louise; Qi, Xiaoping; Willard, Jeffrey F.; Godoy, Juliana; Sankhavaram, Kavya; Horton, Ranier; Mitter, Sayak K.; Quigley, Judith L.; Chang, Lung-Ji; Grant, Maria B.; Boulton, Michael E.

2018-01-01

In lentiviral vector (LV) applications where transient transgene expression is sufficient, integrase-defective lentiviral vectors (IDLVs) are beneficial for reducing the potential for off-target effects associated with insertional mutagenesis. It was previously demonstrated that human RPE65 mRNA expression from an integrating lentiviral vector (ILV) induces endogenous Rpe65 and Cralbp mRNA expression in murine bone marrow–derived cells (BMDCs), initiating programming of the cells to retinal pigment epithelium (RPE)-like cells. These cells regenerate RPE in retinal degeneration models when injected systemically. As transient expression of RPE65 is sufficient to activate endogenous RPE-associated genes for programming BMDCs, use of an ILV is an unnecessary risk. In this study, an IDLV expressing RPE65 (IDLV3-RPE65) was generated. Transduction with IDLV3-RPE65 is less efficient than the integrating vector (ILV3-RPE65). Therefore, IDLV3-RPE65 transduction was enhanced with a combination of preloading 20 × -concentrated viral supernatant on RetroNectin at a multiplicity of infection of 50 and transduction of BMDCs by low-speed centrifugation. RPE65 mRNA levels increased from ∼12-fold to ∼25-fold (p < 0.05) after modification of the IDLV3-RPE65 transduction protocol, achieving expression similar to the ∼27-fold (p < 0.05) increase observed with ILV3-RPE65. Additionally, the study shows that the same preparation of RetroNectin can be used to coat up to three wells with no reduction in transduction. Critically, IDLV3-RPE65 transduction initiates endogenous Rpe65 mRNA expression in murine BMDCs and Cralbp/CRALBP mRNA in both murine and human BMDCs, similar to expression observed in ILV3-RPE65-transduced cells. Systemic administration of ILV3-RPE65 or IDLV3-RPE65 programmed BMDCs in a mouse model of retinal degeneration is sufficient to retain visual function and reduce retinal degeneration compared to mice receiving no treatment or naïve BMDC. It is

Downregulation of CD147 expression by RNA interference inhibits HT29 cell proliferation, invasion and tumorigenicity in vitro and in vivo.

PubMed

Li, Rui; Pan, Yuqin; He, Bangshun; Xu, Yeqiong; Gao, Tianyi; Song, Guoqi; Sun, Huiling; Deng, Qiwen; Wang, Shukui

2013-12-01

We investigated the effect of CD147 silencing on HT29 cell proliferation and invasion. We constructed a novel short hairpin RNA (shRNA) expression vector pYr-mir30-shRNA. The plasmid was transferred to HT29 cells. The expression of CD147, MCT1 (lactate transporters monocarboxylate transporter 1) and MCT4 (lactate transporters monocarboxylate transporter 4) were monitored by quantitative PCR and western blotting, respectively. The MMP-2 (matrix metalloproteinase-2) and MMP-9 (matrix metalloproteinase-9) activities were determined by gelatin zymography assay, while the intracellular lactate concentration was determined by the lactic acid assay kit. WST-8 assay was used to determine the HT29 cell proliferation and the chemosensitivity. Invasion assay was used to determine the invasion of HT29 cells. In addition, we established a colorectal cancer model, and detected CD147 expression in vivo. The results showed that the expression of CD147 and MCT1 was significantly reduced at both mRNA and protein levels, and also the activity of MMP-2 and MMP-9 was reduced. The proliferation and invasion were decreased, but chemosensitivity to cisplatin was increased. In vivo, the CD147 expression was also significantly decreased, and reduced the tumor growth after CD147 gene silencing. The results demonstrated that silencing of CD147 expression inhibited the proliferation and invasion, suggesting CD147 silencing might be an adjuvant gene therapy strategy to chemotherapy.

Expression of chicken parvovirus VP2 in chicken embryo fibroblasts requires codon optimization for production of naked DNA and vectored meleagrid herpesvirus type 1 vaccines.

PubMed

Spatz, Stephen J; Volkening, Jeremy D; Mullis, Robert; Li, Fenglan; Mercado, John; Zsak, Laszlo

2013-10-01

Meleagrid herpesvirus type 1 (MeHV-1) is an ideal vector for the expression of antigens from pathogenic avian organisms in order to generate vaccines. Chicken parvovirus (ChPV) is a widespread infectious virus that causes serious disease in chickens. It is one of the etiological agents largely suspected in causing Runting Stunting Syndrome (RSS) in chickens. Initial attempts to express the wild-type gene encoding the capsid protein VP2 of ChPV by insertion into the thymidine kinase gene of MeHV-1 were unsuccessful. However, transient expression of a codon-optimized synthetic VP2 gene cloned into the bicistronic vector pIRES2-Ds-Red2, could be demonstrated by immunocytochemical staining of transfected chicken embryo fibroblasts (CEFs). Red fluorescence could also be detected in these transfected cells since the red fluorescent protein gene is downstream from the internal ribosome entry site (IRES). Strikingly, fluorescence could not be demonstrated in cells transiently transfected with the bicistronic vector containing the wild-type or non-codon-optimized VP2 gene. Immunocytochemical staining of these cells also failed to demonstrate expression of wild-type VP2, indicating that the lack of expression was at the RNA level and the VP2 protein was not toxic to CEFs. Chickens vaccinated with a DNA vaccine consisting of the bicistronic vector containing the codon-optimized VP2 elicited a humoral immune response as measured by a VP2-specific ELISA. This VP2 codon-optimized bicistronic cassette was rescued into the MeHV-1 genome generating a vectored vaccine against ChPV disease.

Evaluation of the miRNA-146a and miRNA-155 Expression Levels in Patients with Oral Lichen Planus.

PubMed

Ahmadi-Motamayel, Fatemeh; Bayat, Zeynab; Hajilooi, Mehrdad; Shahryar-Hesami, Soroosh; Mahdavinezhad, Ali; Samie, Lida; Solgi, Ghasem

2017-12-01

Oral Lichen Planus (OLP) is a chronic autoimmune disease that could be considered as a potential premalignant status. To evaluate the miRNA-146a and miRNA-155 expression levels in patients with oral Lichen planus lesions compared to healthy subjects with normal oral mucosa. Forty patients with oral lichen planus and 18 healthy age and gender-matched controls were recruited in this case-control study. Oral lichen planus was diagnosed clinically and pathologically. The expression levels of two miRNAs in peripheral blood samples were determined using commercial TaqMan MicroRNA Assays. Relative quantification of gene expression was calculated by the 2-ΔΔct method. The expression levels of miRNA-146a and miRNA-155 in patients with oral Lichen planus were significantly higher than those of healthy controls. Also, a direct but insignificant correlation was found between miRNA-155 and miRNA-146a expression levels among the patient group. Our findings indicate that miRNA-146a and miRNA-155 could be potential biomarkers for the immunopathogenesis of oral lichen planus.

A high-throughput microRNA expression profiling system.

PubMed

Guo, Yanwen; Mastriano, Stephen; Lu, Jun

2014-01-01

As small noncoding RNAs, microRNAs (miRNAs) regulate diverse biological functions, including physiological and pathological processes. The expression and deregulation of miRNA levels contain rich information with diagnostic and prognostic relevance and can reflect pharmacological responses. The increasing interest in miRNA-related research demands global miRNA expression profiling on large numbers of samples. We describe here a robust protocol that supports high-throughput sample labeling and detection on hundreds of samples simultaneously. This method employs 96-well-based miRNA capturing from total RNA samples and on-site biochemical reactions, coupled with bead-based detection in 96-well format for hundreds of miRNAs per sample. With low-cost, high-throughput, high detection specificity, and flexibility to profile both small and large numbers of samples, this protocol can be adapted in a wide range of laboratory settings.

Cigarette Smoking Decreases Global MicroRNA Expression in Human Alveolar Macrophages

PubMed Central

Graff, Joel W.; Powers, Linda S.; Dickson, Anne M.; Kim, Jongkwang; Reisetter, Anna C.; Hassan, Ihab H.; Kremens, Karol; Gross, Thomas J.

2012-01-01

Human alveolar macrophages are critical components of the innate immune system. Cigarette smoking-induced changes in alveolar macrophage gene expression are linked to reduced resistance to pulmonary infections and to the development of emphysema/COPD. We hypothesized that microRNAs (miRNAs) could control, in part, the unique messenger RNA (mRNA) expression profiles found in alveolar macrophages of cigarette smokers. Activation of macrophages with different stimuli in vitro leads to a diverse range of M1 (inflammatory) and M2 (anti-inflammatory) polarized phenotypes that are thought to mimic activated macrophages in distinct tissue environments. Microarray mRNA data indicated that smoking promoted an “inverse” M1 mRNA expression program, defined by decreased expression of M1-induced transcripts and increased expression of M1-repressed transcripts with few changes in M2-regulated transcripts. RT-PCR arrays identified altered expression of many miRNAs in alveolar macrophages of smokers and a decrease in global miRNA abundance. Stratification of human subjects suggested that the magnitude of the global decrease in miRNA abundance was associated with smoking history. We found that many of the miRNAs with reduced expression in alveolar macrophages of smokers were predicted to target mRNAs upregulated in alveolar macrophages of smokers. For example, miR-452 is predicted to target the transcript encoding MMP12, an important effector of smoking-related diseases. Experimental antagonism of miR-452 in differentiated monocytic cells resulted in increased expression of MMP12. The comprehensive mRNA and miRNA expression profiles described here provide insight into gene expression regulation that may underlie the adverse effects cigarette smoking has on alveolar macrophages. PMID:22952876

Vero/BC-F: an efficient packaging cell line stably expressing F protein to generate single round-infectious human parainfluenza virus type 2 vector.

PubMed

Ohtsuka, J; Fukumura, M; Tsurudome, M; Hara, K; Nishio, M; Kawano, M; Nosaka, T

2014-08-01

A stable packaging cell line (Vero/BC-F) constitutively expressing fusion (F) protein of the human parainfluenza virus type 2 (hPIV2) was established for production of the F-defective and single round-infectious hPIV2 vector in a strategy for recombinant vaccine development. The F gene expression has not evoked cytostatic or cytotoxic effects on the Vero/BC-F cells and the F protein was physiologically active to induce syncytial formation with giant polykaryocytes when transfected with a plasmid expressing hPIV2 hemagglutinin-neuraminidase (HN). Transduction of the F-defective replicon RNA into the Vero/BC-F cells led to the release of the infectious particles that packaged the replicon RNA (named as hPIV2ΔF) without detectable mutations, limiting the infectivity to a single round. The maximal titer of the hPIV2ΔF was 6.0 × 10(8) median tissue culture infections dose per ml. The influenza A virus M2 gene was inserted into hPIV2ΔF, and the M2 protein was found to be highly expressed in a human lung cancer cell line after transduction. Furthermore, in vivo airway infection experiments revealed that the hPIV2ΔF was capable of delivering transgenes to hamster tracheal cells. Thus, non-transmissible or single round-infectious hPIV2 vector will be potentially applicable to human gene therapy or recombinant vaccine development.

Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression.

PubMed

Trinh, Alice T; Ball, Bret G; Weber, Erin; Gallaher, Timothy K; Gluzman-Poltorak, Zoya; Anderson, French; Basile, Lena A

2009-12-30

Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements

Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression

PubMed Central

2009-01-01

Background Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. Methods A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Results Vectors that contained the ADA LCR were preferentially expressed in T

An integrated mRNA and microRNA expression signature for glioblastoma multiforme prognosis.

PubMed

Xiong, Jie; Bing, Zhitong; Su, Yanlin; Deng, Defeng; Peng, Xiaoning

2014-01-01

Although patients with Glioblastoma multiforme (GBM) have grave prognosis, significant variability in patient outcome is observed. The objective of this study is to identify a molecular signature for GBM prognosis. We subjected 355 mRNA and microRNA expression profiles to elastic net-regulated Cox regression for identification of an integrated RNA signature for GBM prognosis. A prognostic index (PI) was generated for patient stratification. Survival comparison was conducted by Kaplan-Meier method and a general multivariate Cox regression procedure was applied to evaluate the independence of the PI. The abilities and efficiencies of signatures to predict GBM patient outcome was assessed and compared by the area under the curve (AUC) of the receiver-operator characteristic (ROC). An integrated RNA prognostic signature consisted by 4 protective mRNAs, 12 risky mRNAs, and 1 risky microRNA was identified. Decreased survival was associated with being in the high-risk group (hazard ratio = 2.864, P<0.0001). The prognostic value of the integrated signature was validated in five independent GBM expression datasets (n = 201, hazard ratio = 2.453, P<0.0001). The PI outperformed the known clinical factors, mRNA-only, and miRNA-only prognostic signatures for GBM prognosis (area under the ROC curve for the integrated RNA, mRNA-only, and miRNA-only signatures were 0.828, 0.742, and 0.757 at 3 years of overall survival, respectively, P<0.0001 by permutation test). We describe the first, to our knowledge, robust transcriptome-based integrated RNA signature that improves the current GBM prognosis based on clinical variables, mRNA-only, and miRNA-only signatures.

An Integrated mRNA and microRNA Expression Signature for Glioblastoma Multiforme Prognosis

PubMed Central

Xiong, Jie; Bing, Zhitong; Su, Yanlin; Deng, Defeng; Peng, Xiaoning

2014-01-01

Although patients with Glioblastoma multiforme (GBM) have grave prognosis, significant variability in patient outcome is observed. The objective of this study is to identify a molecular signature for GBM prognosis. We subjected 355 mRNA and microRNA expression profiles to elastic net-regulated Cox regression for identification of an integrated RNA signature for GBM prognosis. A prognostic index (PI) was generated for patient stratification. Survival comparison was conducted by Kaplan-Meier method and a general multivariate Cox regression procedure was applied to evaluate the independence of the PI. The abilities and efficiencies of signatures to predict GBM patient outcome was assessed and compared by the area under the curve (AUC) of the receiver-operator characteristic (ROC). An integrated RNA prognostic signature consisted by 4 protective mRNAs, 12 risky mRNAs, and 1 risky microRNA was identified. Decreased survival was associated with being in the high-risk group (hazard ratio = 2.864, P<0.0001). The prognostic value of the integrated signature was validated in five independent GBM expression datasets (n = 201, hazard ratio = 2.453, P<0.0001). The PI outperformed the known clinical factors, mRNA-only, and miRNA-only prognostic signatures for GBM prognosis (area under the ROC curve for the integrated RNA, mRNA-only, and miRNA-only signatures were 0.828, 0.742, and 0.757 at 3 years of overall survival, respectively, P<0.0001 by permutation test). We describe the first, to our knowledge, robust transcriptome-based integrated RNA signature that improves the current GBM prognosis based on clinical variables, mRNA-only, and miRNA-only signatures. PMID:24871302

Transformation and model choice for RNA-seq co-expression analysis.

PubMed

Rau, Andrea; Maugis-Rabusseau, Cathy

2018-05-01

Although a large number of clustering algorithms have been proposed to identify groups of co-expressed genes from microarray data, the question of if and how such methods may be applied to RNA sequencing (RNA-seq) data remains unaddressed. In this work, we investigate the use of data transformations in conjunction with Gaussian mixture models for RNA-seq co-expression analyses, as well as a penalized model selection criterion to select both an appropriate transformation and number of clusters present in the data. This approach has the advantage of accounting for per-cluster correlation structures among samples, which can be strong in RNA-seq data. In addition, it provides a rigorous statistical framework for parameter estimation, an objective assessment of data transformations and number of clusters and the possibility of performing diagnostic checks on the quality and homogeneity of the identified clusters. We analyze four varied RNA-seq data sets to illustrate the use of transformations and model selection in conjunction with Gaussian mixture models. Finally, we propose a Bioconductor package coseq (co-expression of RNA-seq data) to facilitate implementation and visualization of the recommended RNA-seq co-expression analyses.

Neutrophils Express Distinct RNA Receptors in a Non-canonical Way*

PubMed Central

Berger, Michael; Hsieh, Chin-Yuan; Bakele, Martina; Marcos, Veronica; Rieber, Nikolaus; Kormann, Michael; Mays, Lauren; Hofer, Laura; Neth, Olaf; Vitkov, Ljubomir; Krautgartner, Wolf Dietrich; von Schweinitz, Dietrich; Kappler, Roland; Hector, Andreas; Weber, Alexander; Hartl, Dominik

2012-01-01

RNAs are capable of modulating immune responses by binding to specific receptors. Neutrophils represent the major fraction of circulating immune cells, but receptors and mechanisms by which neutrophils sense RNA are poorly defined. Here, we analyzed the mRNA and protein expression patterns and the subcellular localization of the RNA receptors RIG-I, MDA-5, TLR3, TLR7, and TLR8 in primary neutrophils and immortalized neutrophil-like differentiated HL-60 cells. Our results demonstrate that both neutrophils and differentiated HL-60 cells express RIG-I, MDA-5, and TLR8 at the mRNA and protein levels, whereas TLR3 and TLR7 are not expressed at the protein level. Subcellular fractionation, flow cytometry, confocal laser scanning microscopy, and immuno-transmission electron microscopy provided evidence that, besides the cytoplasm, RIG-I and MDA-5 are stored in secretory vesicles of neutrophils and showed that RIG-I and its ligand, 3p-RNA, co-localize at the cell surface without triggering neutrophil activation. In summary, this study demonstrates that neutrophils express a distinct pattern of RNA recognition receptors in a non-canonical way, which could have essential implications for future RNA-based therapeutics. PMID:22532562

Identification of a Polyomavirus microRNA Highly Expressed in Tumors

PubMed Central

Chen, Chun Jung; Cox, Jennifer E.; Azarm, Kristopher; Wylie, Karen N.; Woolard, Kevin D.; Pesavento, Patricia A.; Sullivan, Christopher S.

2014-01-01

Polyomaviruses (PyVs) are associated with tumors including Merkel cell carcinoma (MCC). Several PyVs encode microRNAs (miRNAs) but to date no abundant PyV miRNAs have been reported in tumors. To better understand the function of the Merkel cell PyV (MCPyV) miRNA, we examined phylogenetically-related viruses for miRNA expression. We show that two primate PyVs and the more distantly-related raccoon PyV (RacPyV) encode miRNAs that share genomic position and partial sequence identity with MCPyV miRNAs. Unlike MCPyV miRNA in MCC, RacPyV miRNA is highly abundant in raccoon tumors. RacPyV miRNA negatively regulates reporters of early viral (T antigen) transcripts, yet robust viral miRNA expression is tolerated in tumors. We also identify raccoon miRNAs expressed in RacPyV-associated neuroglial brain tumors, including several likely oncogenic miRNAs (oncomiRs). This work describes the first PyV miRNA abundantly expressed in tumors and is consistent with a possible role for both host and viral miRNAs in RacPyV-associated tumors. PMID:25514573

Validation of a recombinant human bactericidal/permeability-increasing protein (hBPI) expression vector using murine mammary gland tumor cells and the early development of hBPI transgenic goat embryos.

PubMed

Gui, Tao; Liu, Xing; Tao, Jia; Chen, Jianwen; Li, Yunsheng; Zhang, Meiling; Wu, Ronghua; Zhang, Yuanliang; Peng, Kaisong; Liu, Ya; Zhang, Xiaorong; Zhang, Yunhai

2013-12-01

Human bactericidal/permeability-increasing protein (hBPI) is the only antibacterial peptide which acts against both gram-negative bacteria and neutralizes endotoxins in human polymorphonuclear neutrophils; therefore, hBPI is of great value in clinical applications. In the study, we constructed a hBPI expression vector (pBC1-Loxp-Neo-Loxp-hBPI) containing the full-length hBPI coding sequence which could be specifically expressed in the mammary gland. To validate the function of the vector, in vitro cultured C127 (mouse mammary Carcinoma Cells) were transfected with the vector, and the transgenic cell clones were selected to express hBPI by hormone induction. The mRNA and protein expression of hBPI showed that the constructed vector was effective and suitable for future application in producing mammary gland bioreactor. Then, female and male goat fibroblasts were transfected with the vector, and two male and two female transgenic clonal cell lines were obtained. Using the transgenic cell lines as nuclear donors for somatic cell nuclear transfer, the reconstructed goat embryos produced from all four clones could develop to blastocysts in vitro. In conclusion, we constructed and validated an efficient mammary gland-specific hBPI expression vector, pBC1-Loxp-Neo-Loxp-hBPI, and transgenic hBPI goat embryos were successfully produced, laying foundations for future production of recombinant hBPI in goat mammary gland. Copyright © 2013 Elsevier B.V. All rights reserved.

Correlation analysis of the mRNA and miRNA expression profiles in the nascent synthetic allotetraploid Raphanobrassica

PubMed Central

Ye, Bingyuan; Wang, Ruihua; Wang, Jianbo

2016-01-01

Raphanobrassica is an allopolyploid species derived from inter-generic hybridization that combines the R genome from R. sativus and the C genome from B. oleracea var. alboglabra. In the present study, we used a high-throughput sequencing method to identify the mRNA and miRNA profiles in Raphanobrassica and its parents. A total of 33,561 mRNAs and 283 miRNAs were detected, 9,209 mRNAs and 134 miRNAs were differentially expressed respectively, 7,633 mRNAs and 39 miRNAs showed ELD expression, 5,219 mRNAs and 57 miRNAs were non-additively expressed in Raphanobrassica. Remarkably, differentially expressed genes (DEGs) were up-regulated and maternal bias was detected in Raphanobrassica. In addition, a miRNA-mRNA interaction network was constructed based on reverse regulated miRNA-mRNAs, which included 75 miRNAs and 178 mRNAs, 31 miRNAs were non-additively expressed target by 13 miRNAs. The related target genes were significantly enriched in the GO term ‘metabolic processes’. Non-additive related target genes regulation is involved in a range of biological pathways, like providing a driving force for variation and adaption in this allopolyploid. The integrative analysis of mRNA and miRNA profiling provides more information to elucidate gene expression mechanism and may supply a comprehensive and corresponding method to study genetic and transcription variation of allopolyploid. PMID:27874043

Circular RNA and gene expression profiles in gastric cancer based on microarray chip technology.

PubMed

Sui, Weiguo; Shi, Zhoufang; Xue, Wen; Ou, Minglin; Zhu, Ying; Chen, Jiejing; Lin, Hua; Liu, Fuhua; Dai, Yong

2017-03-01

The aim of the present study was to screen gastric cancer (GC) tissue and adjacent tissue for differences in mRNA and circular (circRNA) expression, to analyze the differences in circRNA and mRNA expression, and to investigate the circRNA expression in gastric carcinoma and its mechanism. circRNA and mRNA differential expression profiles generated using Agilent microarray technology were analyzed in the GC tissues and adjacent tissues. qRT-PCR was used to verify the differential expression of circRNAs and mRNAs according to the interactions between circRNAs and miRNAs as well as the possible existence of miRNA and mRNA interactions. We found that: i) the circRNA expression profile revealed 1,285 significant differences in circRNA expression, with circRNA expression downregulated in 594 samples and upregulated in 691 samples via interactions with miRNAs. The qRT-PCR validation experiments showed that hsa_circRNA_400071, hsa_circRNA_000543 and hsa_circRNA_001959 expression was consistent with the microarray analysis results. ii) 29,112 genes were found in the GC tissues and adjacent tissues, including 5,460 differentially expressed genes. Among them, 2,390 differentially expressed genes were upregulated and 3,070 genes were downregulated. Gene Ontology (GO) analysis of the differentially expressed genes revealed these genes involved in biological process classification, cellular component classification and molecular function classification. Pathway analysis of the differentially expressed genes identified 83 significantly enriched genes, including 28 upregulated genes and 55 downregulated genes. iii) 69 differentially expressed circRNAs were found that might adsorb specific miRNAs to regulate the expression of their target gene mRNAs. The conclusions are: i) differentially expressed circRNAs had corresponding miRNA binding sites. These circRNAs regulated the expression of target genes through interactions with miRNAs and might become new molecular biomarkers for GC

Ribozyme-mediated cleavage of c-fos mRNA reduces gene expression of DNA synthesis enzymes and metallothionein.

PubMed Central

Scanlon, K J; Jiao, L; Funato, T; Wang, W; Tone, T; Rossi, J J; Kashani-Sabet, M

1991-01-01

The c-fos gene product Fos has been implicated in many cellular processes, including signal transduction, DNA synthesis, and resistance to antineoplastic agents. A fos ribozyme (catalytic RNA) was designed to evaluate the effects of suppressing Fos protein synthesis on expression of enzymes involved in DNA synthesis, DNA repair, and drug resistance. DNA encoding the fos ribozyme (fosRb) was cloned into the pMAMneo expression plasmid, and the resultant vector was transfected into A2780DDP cells resistant to the chemotherapeutic agent cisplatin. The parental drug-sensitive A2780S cells were transfected with the pMMV vector containing the c-fos gene. Morphological alterations were accompanied by significant changes in pharmacological sensitivity in both c-fos- and fosRb-transfected cells. pMAMneo fosRb transfectants revealed decreased c-fos gene expression, concomitant with reduced thymidylate (dTMP) synthase, DNA polymerase beta, topoisomerase I, and metallothionein IIA mRNAs. In contrast, c-myc expression was elevated after fos ribozyme action. Insertion of a mutant ribozyme, mainly capable of antisense activity, into A2780DDP cells resulted in smaller reductions in c-fos gene expression and in cisplatin resistance than the active ribozyme. These studies establish a role for c-fos in drug resistance and in mediating DNA synthesis and repair processes by modulating expression of genes such as dTMP synthase, DNA polymerase beta, and topoisomerase I. These studies also suggest the utility of ribozymes in the analysis of cellular gene expression. Images PMID:1660142

MicroRNA-155 promotes the pathogenesis of experimental colitis by repressing SHIP-1 expression

PubMed Central

Lu, Zhan-Jun; Wu, Jian-Jiong; Jiang, Wei-Liang; Xiao, Jun-Hua; Tao, Kai-Zhong; Ma, Lei; Zheng, Ping; Wan, Rong; Wang, Xing-Peng

2017-01-01

AIM To explore the mechanism by which microRNA-155 (miR-155) regulates the pathogenesis of experimental colitis. METHODS A luciferase assay was performed to confirm the binding of miR-155 to the SHIP-1 3’-UTR. MiR-155 mimics, negative controls and SHIP-1 expression/knockdown vectors were established and then utilized in gain- and loss-of-function studies performed in raw264.7 cells and primary bone marrow-derived macrophages (BMDMs). Thereafter, dextran sulfate sodium (DSS)-induced colitis mouse model with or without antagomiR-155 treatment was established, and the levels of miR-155 and SHIP-1, as well as the pro-inflammatory capabilities, were measured by western blot, quantitative polymerase chain reaction, and immunohistochemistry. RESULTS MiR-155 directly bound to the 3’-UTR of SHIP-1 mRNA and induced a significant decrease in SHIP-1 expression in both raw264.7 cells and primary BMDMs. MiR-155 markedly promoted cell proliferation and pro-inflammatory secretions including IL-6, TNF-α, IL-1β, and IFN-γ, whereas these effects could be reversed by the restoration of SHIP-1 expression. In vivo studies showed that antagomiR-155 administration could alleviate DSS-induced intestinal inflammation in Balb/c mice. Moreover, significantly increased SHIP-1 expression, as well as decreased Akt activation and inflammatory response, were observed in the antagomiR-155-treated mice. CONCLUSION MiR-155 promotes experimental colitis by repressing SHIP-1 expression. Thus, the inhibition of miR-155 might be a promising strategy for therapy. PMID:28246471

Logic programming to infer complex RNA expression patterns from RNA-seq data.

PubMed

Weirick, Tyler; Militello, Giuseppe; Ponomareva, Yuliya; John, David; Döring, Claudia; Dimmeler, Stefanie; Uchida, Shizuka

2018-03-01

To meet the increasing demand in the field, numerous long noncoding RNA (lncRNA) databases are available. Given many lncRNAs are specifically expressed in certain cell types and/or time-dependent manners, most lncRNA databases fall short of providing such profiles. We developed a strategy using logic programming to handle the complex organization of organs, their tissues and cell types as well as gender and developmental time points. To showcase this strategy, we introduce 'RenalDB' (http://renaldb.uni-frankfurt.de), a database providing expression profiles of RNAs in major organs focusing on kidney tissues and cells. RenalDB uses logic programming to describe complex anatomy, sample metadata and logical relationships defining expression, enrichment or specificity. We validated the content of RenalDB with biological experiments and functionally characterized two long intergenic noncoding RNAs: LOC440173 is important for cell growth or cell survival, whereas PAXIP1-AS1 is a regulator of cell death. We anticipate RenalDB will be used as a first step toward functional studies of lncRNAs in the kidney.

Biodegradable Nanoparticles of mPEG-PLGA-PLL Triblock Copolymers as Novel Non-Viral Vectors for Improving siRNA Delivery and Gene Silencing

PubMed Central

Du, Jing; Sun, Ying; Shi, Qiu-Sheng; Liu, Pei-Feng; Zhu, Ming-Jie; Wang, Chun-Hui; Du, Lian-Fang; Duan, You-Rong

2012-01-01

Degradation of mRNA by RNA interference is one of the most powerful and specific mechanisms for gene silencing. However, insufficient cellular uptake and poor stability have limited its usefulness. Here, we report efficient delivery of siRNA via the use of biodegradable nanoparticles (NPs) made from monomethoxypoly(ethylene glycol)-poly(lactic-co-glycolic acid)-poly-l-lysine (mPEG-PLGA-PLL) triblock copolymers. Various physicochemical properties of mPEG-PLGA-PLL NPs, including morphology, size, surface charge, siRNA encapsulation efficiency, and in vitro release profile of siRNA from NPs, were characterized by scanning electron microscope, particle size and zeta potential analyzer, and high performance liquid chromatography. The levels of siRNA uptake and targeted gene inhibition were detected in human lung cancer SPC-A1-GFP cells stably expressing green fluorescent protein. Examination of the cultured SPC-A1-GFP cells with fluorescent microscope and flow cytometry showed NPs loading Cy3-labeled siRNA had much higher intracellular siRNA delivery efficiencies than siRNA alone and Lipofectamine-siRNA complexes. The gene silencing efficiency of mPEG-PLGA-PLL NPs was higher than that of commercially available transfecting agent Lipofectamine while showing no cytotoxicity. Thus, the current study demonstrates that biodegradable NPs of mPEG-PLGA-PLL triblock copolymers can be potentially applied as novel non-viral vectors for improving siRNA delivery and gene silencing. PMID:22312268

Tissue-specific expression of silkmoth chorion genes in vivo using Bombyx mori nuclear polyhedrosis virus as a transducing vector.

PubMed Central

Iatrou, K; Meidinger, R G

1990-01-01

A pair of silkmoth chorion chromosomal genes, HcA.12-HcB.12, was inserted into a baculovirus transfer vector, pBmp2, derived from the nuclear polyhedrosis virus of Bombyx mori. This vector, which permits the insertion of foreign genetic material in the vicinity of a mutationally inactivated polyhedrin gene, was used to acquire the corresponding recombinant virus. Injection of mutant silkmoth pupae that lack all Hc chorion genes with the recombinant virus resulted in the infection of all internal organs including follicular tissue. Analysis of RNA from infected tissues has demonstrated that the two chorion genes present in the viral genome are correctly transcribed under the control of their own promoter in follicular cells, the tissue in which chorion genes are normally expressed. The chorion primary transcripts are also correctly processed in the infected follicular cells and yield mature mRNAs indistinguishable from authentic chorion mRNAs present in wild-type follicles. These results demonstrate that recombinant nuclear polyhedrosis viruses can be used as transducing vectors for introducing genetic material of host origin into the cells of the organism and that the transduced genes are transiently expressed in a tissue-specific manner under the control of their resident regulatory sequences. Thus we show the in vivo expression of cloned genes under cellular promoter control in an insect other than Drosophila melanogaster. The approach should be applicable to all insect systems that are subject to nuclear polyhedrosis virus infection. Images PMID:2187186

Improved Production Efficiency of Virus-Like Particles by the Baculovirus Expression Vector System.

PubMed

López-Vidal, Javier; Gómez-Sebastián, Silvia; Bárcena, Juan; Nuñez, Maria del Carmen; Martínez-Alonso, Diego; Dudognon, Benoit; Guijarro, Eva; Escribano, José M

2015-01-01

Vaccines based on virus-like particles (VLPs) have proven effective in humans and animals. In this regard, the baculovirus expression vector system (BEVS) is one of the technologies of choice to generate such highly immunogenic vaccines. The extended use of these vaccines for human and animal populations is constrained because of high production costs, therefore a significant improvement in productivity is crucial to ensure their commercial viability. Here we describe the use of the previously described baculovirus expression cassette, called TB, to model the production of two VLP-forming vaccine antigens in insect cells. Capsid proteins from porcine circovirus type 2 (PCV2 Cap) and from the calicivirus that causes rabbit hemorrhagic disease (RHDV VP60) were expressed in insect cells using baculoviruses genetically engineered with the TB expression cassette. Productivity was compared to that obtained using standard counterpart vectors expressing the same proteins under the control of the polyhedrin promoter. Our results demonstrate that the use of the TB expression cassette increased the production yields of these vaccine antigens by around 300% with respect to the standard vectors. The recombinant proteins produced by TB-modified vectors were fully functional, forming VLPs identical in size and shape to those generated by the standard baculoviruses, as determined by electron microscopy analysis. The use of the TB expression cassette implies a simple modification of the baculovirus vectors that significantly improves the cost efficiency of VLP-based vaccine production, thereby facilitating the commercial viability and broad application of these vaccines for human and animal health.

Improved Production Efficiency of Virus-Like Particles by the Baculovirus Expression Vector System

PubMed Central

Bárcena, Juan; Nuñez, Maria del Carmen; Martínez-Alonso, Diego; Dudognon, Benoit; Guijarro, Eva; Escribano, José M.

2015-01-01

Vaccines based on virus-like particles (VLPs) have proven effective in humans and animals. In this regard, the baculovirus expression vector system (BEVS) is one of the technologies of choice to generate such highly immunogenic vaccines. The extended use of these vaccines for human and animal populations is constrained because of high production costs, therefore a significant improvement in productivity is crucial to ensure their commercial viability. Here we describe the use of the previously described baculovirus expression cassette, called TB, to model the production of two VLP-forming vaccine antigens in insect cells. Capsid proteins from porcine circovirus type 2 (PCV2 Cap) and from the calicivirus that causes rabbit hemorrhagic disease (RHDV VP60) were expressed in insect cells using baculoviruses genetically engineered with the TB expression cassette. Productivity was compared to that obtained using standard counterpart vectors expressing the same proteins under the control of the polyhedrin promoter. Our results demonstrate that the use of the TB expression cassette increased the production yields of these vaccine antigens by around 300% with respect to the standard vectors. The recombinant proteins produced by TB-modified vectors were fully functional, forming VLPs identical in size and shape to those generated by the standard baculoviruses, as determined by electron microscopy analysis. The use of the TB expression cassette implies a simple modification of the baculovirus vectors that significantly improves the cost efficiency of VLP-based vaccine production, thereby facilitating the commercial viability and broad application of these vaccines for human and animal health. PMID:26458221

Production of SV40-derived vectors.

PubMed

Strayer, David S; Mitchell, Christine; Maier, Dawn A; Nichols, Carmen N

2010-06-01

Recombinant simian virus 40 (rSV40)-derived vectors are particularly useful for gene delivery to bone marrow progenitor cells and their differentiated derivatives, certain types of epithelial cells (e.g., hepatocytes), and central nervous system neurons and microglia. They integrate rapidly into cellular DNA to provide long-term gene expression in vitro and in vivo in both resting and dividing cells. Here we describe a protocol for production and purification of these vectors. These procedures require only packaging cells (e.g., COS-7) and circular vector genome DNA. Amplification involves repeated infection of packaging cells with vector produced by transfection. Cotransfection is not required in any step. Viruses are purified by centrifugation using discontinuous sucrose or cesium chloride (CsCl) gradients and resulting vectors are replication-incompetent and contain no detectable wild-type SV40 revertants. These approaches are simple, give reproducible results, and may be used to generate vectors that are deleted only for large T antigen (Tag), or for all SV40-coding sequences capable of carrying up to 5 kb of foreign DNA. These vectors are best applied to long-term expression of proteins normally encoded by mammalian cells or by viruses that infect mammalian cells, or of untranslated RNAs (e.g., RNA interference). The preparative approaches described facilitate application of these vectors and allow almost any laboratory to exploit their strengths for diverse gene delivery applications.

MicroRNA Expression Profiles in Cultured Human Fibroblasts in Space

NASA Technical Reports Server (NTRS)

Wu, Honglu; Lu, Tao; Jeevarajan, John; Rohde, Larry; Zhang, Ye

2014-01-01

Microgravity, or an altered gravity environment from the static 1g, has been shown to influence global gene expression patterns and protein levels in living organisms. However, it is unclear how these changes in gene and protein expressions are related to each other or are related to other factors regulating such changes. A different class of RNA, the small non-coding microRNA (miRNA), can have a broad effect on gene expression networks by mainly inhibiting the translation process. Previously, we investigated changes in the expression of miRNA and related genes under simulated microgravity conditions on the ground using the NASA invented bioreactor. In comparison to static 1 g, simulated microgravity altered a number of miRNAs in human lymphoblastoid cells. Pathway analysis with the altered miRNAs and RNA expressions revealed differential involvement of cell communication and catalytic activity, as well as immune response signaling and NGF activation of NF-kB pathways under simulated microgravity condition. The network analysis also identified several projected networks with c- Rel, ETS1 and Ubiquitin C as key factors. In a flight experiment on the International Space Station (ISS), we will investigate the effects of actual spaceflight on miRNA expressions in nondividing human fibroblast cells in mostly G1 phase of the cell cycle. A fibroblast is a type of cell that synthesizes the extracellular matrix and collagen, the structural framework for tissues, and plays a critical role in wound healing and other functions. In addition to miRNA expressions, we will investigate the effects of spaceflight on the cellular response to DNA damages from bleomycin treatment.

Expression of MicroRNA-146a and MicroRNA-155 in Placental Villi in Early- and Late-Onset Preeclampsia.

PubMed

Nizyaeva, N V; Kulikova, G V; Nagovitsyna, M N; Kan, N E; Prozorovskaya, K N; Shchegolev, A I; Sukhikh, G T

2017-07-01

We studied the expression of microRNA-146a and microRNA-155 in placental villi from 18 women (26-39 weeks of gestation) of reproductive age with early- or late-onset preeclampsia. The reference group consisted of women with physiological pregnancy and full-term gestation and with preterm birth after caesarian section on gestation week 26-31. MicroRNA-146a and microRNA-155 were detected by in situ hybridization with digoxigenin on paraffin sections. It was found that the expression of microRNA-146a in both syncytiotrophoblast of the intermediate villi and syncytial knots was lower at late-onset preeclampsia than at physiologic pregnancy of full-term period (p=0.037 and p=0.001 respectively). The expression of microRNA-155 in syncytiotrophoblast of intermediate placental villi in early-onset preeclampsia was higher than in group with preterm delivery (p=0.003). However, in syncytiotrophoblast of intermediate villi and in syncytial knots, the expression of microRNA-155 was lower at late-onset preeclampsia in comparison with full-term physiological pregnancy (p=0.005). In addition, the expression of microRNA-146a and microRNA-155 did not increase in the later terms in preeclampsia, while in the reference groups demonstrating gradual increase in the expression of these markers with increasing gestational age. Expression microRNA-146a and microRNA-155 little differed in early- and late-onset preeclampsia. These findings suggest that different variants of preeclampsia are probably characterized by common pathogenetic pathways. Damaged trophoblast cannot maintain of microRNAs synthesis at the required level, which determines the formation of a vicious circle in preeclampsia and further progression of the disease.

A novel system for the production of high levels of functional human therapeutic proteins in stable cells with a Semliki Forest virus noncytopathic vector.

PubMed

Casales, Erkuden; Aranda, Alejandro; Quetglas, Jose I; Ruiz-Guillen, Marta; Rodriguez-Madoz, Juan R; Prieto, Jesus; Smerdou, Cristian

2010-05-31

Semliki Forest virus (SFV) vectors lead to high protein expression in mammalian cells, but expression is transient due to vector cytopathic effects, inhibition of host cell proteins and RNA-based expression. We have used a noncytopathic SFV mutant (ncSFV) RNA vector to generate stable cell lines expressing two human therapeutic proteins: insulin-like growth factor I (IGF-I) and cardiotrophin-1 (CT-1). Therapeutic genes were fused at the carboxy-terminal end of Puromycin N-acetyl-transferase gene by using as a linker the sequence coding for foot-and-mouth disease virus (FMDV) 2A autoprotease. These cassettes were cloned into the ncSFV vector. Recombinant ncSFV vectors allowed rapid and efficient selection of stable BHK cell lines with puromycin. These cells expressed IGF-I and CT-1 in supernatants at levels reaching 1.4 and 8.6 microg/10(6)cells/24 hours, respectively. Two cell lines generated with each vector were passaged ten times during 30 days, showing constant levels of protein expression. Recombinant proteins expressed at different passages were functional by in vitro signaling assays. Stability at RNA level was unexpectedly high, showing a very low mutation rate in the CT-1 sequence, which did not increase at high passages. CT-1 was efficiently purified from supernatants of ncSFV cell lines, obtaining a yield of approximately 2mg/L/24 hours. These results indicate that the ncSFV vector has a great potential for the production of recombinant proteins in mammalian cells. 2010 Elsevier B.V. All rights reserved.

Preprotachykinin A mRNA expression in the rat brain during development.

PubMed

Brené, S; Lindefors, N; Friedman, W J; Persson, H

1990-12-15

Expression of preprotachykinin A (PPT-A) mRNA was analyzed by northern blots using mRNA prepared from rat brain at 12 different developmental stages ranging from embryonic day 15 (E15) to adult. A single PPT-A mRNA of 1.3 kb was detected throughout development. PPT-A mRNA was detected as early as E15 and an approximately 3-fold increase occurred at birth. This amount remained until 3 weeks of age when the level increased, reaching a peak at 5 weeks of age. Adult amounts were approximately 3-fold higher than the levels at birth. The distribution of PPT-A mRNA-expressing cells in rat brain was studied by in situ hybridization on sections from embryonic day 20, postnatal days 4 and 7 as well as adult. Cells expressing PPT-A mRNA were detected in the forebrain at all 4 ages analyzed. However, the hybridization pattern and the labeling intensity varied in different brain regions during development. In cingulate cortex, intense labeling was seen in numerous cells at embryonic day 20 and postnatal days 4 and 7, whereas in the adult cingulate cortex only a few scattered labeled cells were observed. In frontoparietal cortex labeled cells were found from postnatal day 4 to adult, with the highest density of labeled cells at P7. Developmental differences in both the distribution of PPT-A mRNA-expressing cells and the level of PPT-A mRNA expression were also found in caudate-putamen, lateral hypothalamus and amygdala. Thus, our results show several changes in PPT-A mRNA expression during ontogeny, indicating a region and time-specific regulation of PPT-A mRNA expression during brain maturation.

Inflammation-Mediated Regulation of MicroRNA Expression in Transplanted Pancreatic Islets

PubMed Central

Bravo-Egana, Valia; Rosero, Samuel; Klein, Dagmar; Jiang, Zhijie; Vargas, Nancy; Tsinoremas, Nicholas; Doni, Marco; Podetta, Michele; Ricordi, Camillo; Molano, R. Damaris; Pileggi, Antonello; Pastori, Ricardo L.

2012-01-01

Nonspecific inflammation in the transplant microenvironment results in β-cell dysfunction and death influencing negatively graft outcome. MicroRNA (miRNA) expression and gene target regulation in transplanted islets are not yet well characterized. We evaluated the impact of inflammation on miRNA expression in transplanted rat islets. Islets exposed in vitro to proinflammatory cytokines and explanted syngeneic islet grafts were evaluated by miRNA arrays. A subset of 26 islet miRNAs was affected by inflammation both in vivo and in vitro. Induction of miRNAs was dependent on NF-κB, a pathway linked with cytokine-mediated islet cell death. RT-PCR confirmed expression of 8 miRNAs. The association between these miRNAs and mRNA target-predicting algorithms in genome-wide RNA studies of β-cell inflammation identified 238 potential miRNA gene targets. Several genes were ontologically associated with regulation of insulin signaling and secretion, diabetes, and islet physiology. One of the most activated miRNAs was miR-21. Overexpression of miR-21 in insulin-secreting MIN6 cells downregulated endogenous expression of the tumor suppressor Pdcd4 and of Pclo, a Ca2+ sensor protein involved in insulin secretion. Bioinformatics identified both as potential targets. The integrated analysis of miRNA and mRNA expression profiles revealed potential targets that may identify molecular targets for therapeutic interventions. PMID:22655170

Optimal consistency in microRNA expression analysis using reference-gene-based normalization.

PubMed

Wang, Xi; Gardiner, Erin J; Cairns, Murray J

2015-05-01

Normalization of high-throughput molecular expression profiles secures differential expression analysis between samples of different phenotypes or biological conditions, and facilitates comparison between experimental batches. While the same general principles apply to microRNA (miRNA) normalization, there is mounting evidence that global shifts in their expression patterns occur in specific circumstances, which pose a challenge for normalizing miRNA expression data. As an alternative to global normalization, which has the propensity to flatten large trends, normalization against constitutively expressed reference genes presents an advantage through their relative independence. Here we investigated the performance of reference-gene-based (RGB) normalization for differential miRNA expression analysis of microarray expression data, and compared the results with other normalization methods, including: quantile, variance stabilization, robust spline, simple scaling, rank invariant, and Loess regression. The comparative analyses were executed using miRNA expression in tissue samples derived from subjects with schizophrenia and non-psychiatric controls. We proposed a consistency criterion for evaluating methods by examining the overlapping of differentially expressed miRNAs detected using different partitions of the whole data. Based on this criterion, we found that RGB normalization generally outperformed global normalization methods. Thus we recommend the application of RGB normalization for miRNA expression data sets, and believe that this will yield a more consistent and useful readout of differentially expressed miRNAs, particularly in biological conditions characterized by large shifts in miRNA expression.

Design of a Retrovirus-Derived Vector for Expression and Transduction of Exogenous Genes in Mammalian Cells

PubMed Central

Perkins, Archibald S.; Kirschmeier, Paul T.; Gattoni-Celli, Sebastiano; Weinstein, I. Bernard

1983-01-01

We have developed a transfection vector for animal cells that contains long terminal repeat (LTR) sequences to promote expression. Plasmid p101/101, a derivative of plasmid pBR322 containing the complete Moloney murine sarcoma virus genome, was cut with restriction enzymes and religated so that both the 5′ and 3′ LTRs were retained and all but about 700 base pairs of the intervening viral sequences were removed. To test this vector, the Escherichia coli gene gpt was cloned into a unique PstI site, between the two LTRs, with guanine and cytosine tailing, a method that can be generalized for insertion of any DNA segment into this vector. When DNA from recombinant plasmids in which the gpt gene was inserted in the same transcriptional polarity as the LTR sequences was transfected onto murine or rat fibroblast cultures, we obtained a high yield of Gpt+ colonies. However, plasmid constructs with the gpt gene in the opposite polarity were virtually devoid of activity. With gpt in the proper orientation, restriction enzyme cuts within the LTRs or between the 5′ LTR and the gpt gene reduced transfection by more than 98%, whereas a cut between the gpt gene and the 3′ LTR gave an 80% reduction in activity. Thus, both 5′ and 3′ LTR sequences are essential for optimal gpt expression, although the 5′ LTR appears to play a more important role. When the LTR-gpt plasmid was transfected onto murine leukemia virus-infected mouse fibroblasts, we obtained evidence that RNA copies became pseudotyped into viral particles which could transfer the Gpt+ phenotype into rodent cells with extremely high efficiency. This vector should prove useful for high-efficiency transduction of a variety of genes in mammalian cells. Images PMID:6308426

Stability of Lentiviral Vector-Mediated Transgene Expression in the Brain in the Presence of Systemic Antivector Immune Responses

PubMed Central

ABORDO-ADESIDA, EVELYN; FOLLENZI, ANTONIA; BARCIA, CARLOS; SCIASCIA, SANDRA; CASTRO, MARIA G.; NALDINI, LUIGI; LOWENSTEIN, PEDRO R.

2009-01-01

Lentiviral vectors are promising tools for gene therapy in the CNS. It is therefore important to characterize their interactions with the immune system in the CNS. This work characterizes transgene expression and brain inflammation in the presence or absence of immune responses generated after systemic immunization with lentiviral vectors. We characterized transduction with SIN-LV vectors in the CNS. A dose—response curve using SIN-LV-GFP demonstrated detectable transgene expression in the striatum at a dose of 102, and maximum expression at 106, transducing units of lentiviral vector, with minimal increase in inflammatory markers between the lowest and highest dose of vector injected. Our studies demonstrate that injection of a lentiviral vector into the CNS did not cause a measurable inflammatory response. Systemic immunization after CNS injection, with the lentiviral vector expressing the same transgene as a vector injected into the CNS, caused a decrease in transgene expression in the CNS, concomitantly with an infiltration of inflammatory cells into the CNS parenchyma at the injection site. However, peripheral immunization with a lentiviral vector carrying a different transgene did not diminish transgene expression, or cause CNS inflammation. Systemic immunization preceding injection of lentiviral vectors into the CNS determined that preexisting antilentiviral immunity, regardless of the transgene, did not affect transgene expression. Furthermore, we showed that the transgene, but not the virion or vector components, is responsible for providing antigenic epitopes to the activated immune system, on systemic immunization with lentivirus. Low immunogenicity and prolonged transgene expression in the presence of preexisting lentiviral immunity are encouraging data for the future use of lentiviral vectors in CNS gene therapy. In summary, the lentiviral vectors tested induced undetectable activation of innate immune responses, and stimulation of adaptive immune

The 3D protein of duck hepatitis A virus type 1 binds to a viral genomic 3' UTR and shows RNA-dependent RNA polymerase activity.

PubMed

Zhang, Yu; Cao, Qianda; Wang, Mingshu; Jia, Renyong; Chen, Shun; Zhu, Dekang; Liu, Mafeng; Sun, Kunfeng; Yang, Qiao; Wu, Ying; Zhao, Xinxin; Chen, Xiaoyue; Cheng, Anchun

2017-12-01

To explore the RNA-dependent RNA polymerase (RdRP) function of the 3D protein of duck hepatitis A virus type 1 (DHAV-1), the gene was cloned into the pET-32a(+) vector for prokaryotic expression. The 3' untranslated region (3' UTR) of DHAV-1 together with a T7 promoter was cloned into the pMD19-T vector for in vitro transcription of 3' UTR RNA, which was further used as a template in RNA-dependent RNA polymerization. In this study, three methods were applied to analyze the RdRP function of the 3D protein: (1) ammonium molybdate spectrophotometry to detect pyrophosphate produced during polymerization; (2) quantitative reverse transcription PCR (RT-qPCR) to investigate the changes in RNA quantity during polymerization; and (3) electrophoresis mobility shift assay to examine the interaction between the 3D protein and 3' UTR. The results showed the 3D protein was successfully expressed in bacteria culture supernatant in a soluble form, which could be purified by affinity chromatography. In 3D enzymatic activity assays, pyrophosphate and RNA were produced, the amounts of which increased based on approximative kinetics, and binding of the 3D protein to the 3' UTR was observed. These results indicate that prokaryotically expressed soluble DHAV-13D protein can bind to a viral genomic 3' UTR and exhibit RdRP activity.

Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

PubMed Central

Huang, Weizhe; He, Ziying

2013-01-01

RNA interference (RNAi) was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA) are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc.) of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system. PMID:24288498

Integrated Analysis of Dysregulated ncRNA and mRNA Expression Profiles in Humans Exposed to Carbon Nanotubes

PubMed Central

Shvedova, Anna A.; Yanamala, Naveena; Kisin, Elena R.; Khailullin, Timur O.; Birch, M. Eileen; Fatkhutdinova, Liliya M.

2016-01-01

Background As the application of carbon nanotubes (CNT) in consumer products continues to rise, studies have expanded to determine the associated risks of exposure on human and environmental health. In particular, several lines of evidence indicate that exposure to multi-walled carbon nanotubes (MWCNT) could pose a carcinogenic risk similar to asbestos fibers. However, to date the potential markers of MWCNT exposure are not yet explored in humans. Methods In the present study, global mRNA and ncRNA expression profiles in the blood of exposed workers, having direct contact with MWCNT aerosol for at least 6 months (n = 8), were compared with expression profiles of non-exposed (n = 7) workers (e.g., professional and/or technical staff) from the same manufacturing facility. Results Significant changes in the ncRNA and mRNA expression profiles were observed between exposed and non-exposed worker groups. An integrative analysis of ncRNA-mRNA correlations was performed to identify target genes, functional relationships, and regulatory networks in MWCNT-exposed workers. The coordinated changes in ncRNA and mRNA expression profiles revealed a set of miRNAs and their target genes with roles in cell cycle regulation/progression/control, apoptosis and proliferation. Further, the identified pathways and signaling networks also revealed MWCNT potential to trigger pulmonary and cardiovascular effects as well as carcinogenic outcomes in humans, similar to those previously described in rodents exposed to MWCNTs. Conclusion This study is the first to investigate aberrant changes in mRNA and ncRNA expression profiles in the blood of humans exposed to MWCNT. The significant changes in several miRNAs and mRNAs expression as well as their regulatory networks are important for getting molecular insights into the MWCNT-induced toxicity and pathogenesis in humans. Further large-scale prospective studies are necessary to validate the potential applicability of such changes in mRNAs and mi

Construction of novel shuttle expression vectors for gene expression in Bacillus subtilis and Bacillus pumilus.

PubMed

Shao, Huanhuan; Cao, Qinghua; Zhao, Hongyan; Tan, Xuemei; Feng, Hong

2015-01-01

A native plasmid (pSU01) was detected by genome sequencing of Bacillus subtilis strain S1-4. Two pSU01-based shuttle expression vectors pSU02-AP and pSU03-AP were constructed enabling stable replication in B. subtilis WB600. These vectors contained the reporter gene aprE, encoding an alkaline protease from Bacillus pumilus BA06. The expression vector pSU03-AP only possessed the minimal replication elements (rep, SSO, DSO) and exhibited more stability on structure, suggesting that the rest of the genes in pSU01 (ORF1, ORF2, mob, hsp) were unessential for the structural stability of plasmid in B. subtilis. In addition, recombinant production of the alkaline protease was achieved more efficiently with pSU03-AP whose copy number was estimated to be more than 100 per chromosome. Furthermore, pSU03-AP could also be used to transform and replicate in B. pumilus BA06 under selective pressure. In conclusion, pSU03-AP is expected to be a useful tool for gene expression in Bacillus subtilis and B. pumilus.

Determination of absolute expression profiles using multiplexed miRNA analysis

PubMed Central

Song, Jee Hoon; Cheng, Yulan; Saeui, Christopher T.; Cheung, Douglas G.; Croce, Carlo M.; Yarema, Kevin J.; Meltzer, Stephen J.; Liu, Kelvin J.; Wang, Tza-Huei

2017-01-01

Accurate measurement of miRNA expression is critical to understanding their role in gene expression as well as their application as disease biomarkers. Correct identification of changes in miRNA expression rests on reliable normalization to account for biological and technological variance between samples. Ligo-miR is a multiplex assay designed to rapidly measure absolute miRNA copy numbers, thus reducing dependence on biological controls. It uses a simple 2-step ligation process to generate length coded products that can be quantified using a variety of DNA sizing methods. We demonstrate Ligo-miR’s ability to quantify miRNA expression down to 20 copies per cell sensitivity, accurately discriminate between closely related miRNA, and reliably measure differential changes as small as 1.2-fold. Then, benchmarking studies were performed to show the high correlation between Ligo-miR, microarray, and TaqMan qRT-PCR. Finally, Ligo-miR was used to determine copy number profiles in a number of breast, esophageal, and pancreatic cell lines and to demonstrate the utility of copy number analysis for providing layered insight into expression profile changes. PMID:28704432

A pepper mottle virus-based vector enables systemic expression of endoglucanase D in non-transgenic plants.

PubMed

Song, Eun Gyeong; Ryu, Ki Hyun

2017-12-01

Plant-virus-based expression vectors have been used as an alternative to the creation of transgenic plants. Using a virus-based vector, we investigated the feasibility of producing the endoglucanase D (EngD) from Clostridium cellulovorans in Nicotiana benthamiana. This protein has endoglucanase, xylanase, and exoglucanase activities and may be of value for cellulose digestion in the generation of biofuels from plant biomass. The EngD gene was cloned between the nuclear inclusion b (NIb)- and coat protein (CP)-encoding sequences of pSP6PepMoV-Vb1. In vitro transcripts derived from the clone (pSP6PepMoV-Vb1/EngD) were infectious in N. benthamiana but caused milder symptoms than wild-type PepMoV-Vb1. RT-PCR amplification of total RNA from non-inoculated upper leaves infected with PepMoV-Vb1/EngD produced the target band for the CP, partial NIb and EngD-CP regions of PepMoV-V1/EngD, in addition to nonspecific bands. Western blot analysis showed the CP target bands of PepMoV-Vb1/EngD as well as non-target bands. EngD enzymatic activity in infected plants was detected using a glucose assay. The plant leaves showed increased senescence compared with healthy and PepMoV-Vb1-infected plants. Our study suggests the feasibility of using a viral vector for systemic infection of plants for expression of heterologous engD for the purpose of digesting a cellulose substrate in plant cells for biomass production.

Genetic engineering of human embryonic stem cells with lentiviral vectors.

PubMed

Xiong, Chen; Tang, Dong-Qi; Xie, Chang-Qing; Zhang, Li; Xu, Ke-Feng; Thompson, Winston E; Chou, Wayne; Gibbons, Gary H; Chang, Lung-Ji; Yang, Li-Jun; Chen, Yuqing E

2005-08-01

Human embryonic stem (hES) cells present a valuable source of cells with a vast therapeutic potential. However, the low efficiency of directed differentiation of hES cells remains a major obstacle in their uses for regenerative medicine. While differentiation may be controlled by the genetic manipulation, effective and efficient gene transfer into hES cells has been an elusive goal. Here, we show stable and efficient genetic manipulations of hES cells using lentiviral vectors. This method resulted in the establishment of stable gene expression without loss of pluripotency in hES cells. In addition, lentiviral vectors were effective in conveying the expression of an U6 promoter-driven small interfering RNA (siRNA), which was effective in silencing its specific target. Taken together, our results suggest that lentiviral gene delivery holds great promise for hES cell research and application.

Induction of humoral responses to BHV-1 glycoprotein D expressed by HSV-1 amplicon vectors

PubMed Central

Blanc, Andrea Maria; Berois, Mabel Beatriz; Tomé, Lorena Magalí; Epstein, Alberto L.

2012-01-01

Herpes simplex virus type-1 (HSV-1) amplicon vectors are versatile and useful tools for transferring genes into cells that are capable of stimulating a specific immune response to their expressed antigens. In this work, two HSV-1-derived amplicon vectors were generated. One of these expressed the full-length glycoprotein D (gD) of bovine herpesvirus 1 while the second expressed the truncated form of gD (gDtr) which lacked the trans-membrane region. After evaluating gD expression in the infected cells, the ability of both vectors to induce a specific gD immune response was tested in BALB/c mice that were intramuscularly immunized. Specific serum antibody responses were detected in mice inoculated with both vectors, and the response against truncated gD was higher than the response against full-length gD. These results reinforce previous findings that HSV-1 amplicon vectors can potentially deliver antigens to animals and highlight the prospective use of these vectors for treating infectious bovine rhinotracheitis disease. PMID:22437537

Inhibition of prohormone convertase 1 (PC1) expression in cholecystokinin (CCK) expressing At-T20 cells decreased cellular content and secretion of CCK and caused a shift in molecular forms of CCK secreted.

PubMed

Beinfeld, Margery C; Vishnuvardhan, Daesety; Blum, Alissa; Reynolds, Nicole; Fannous, Sanya; Kitagawa, Kouki; Marchand, James E

2006-04-01

Two different RNAi methods were used to inhibit the expression of prohormone convertase 1 (PC1) in At-T20 cells. Transient transfection of double stranded RNA and stable expression of a vector expressing hairpin-loop RNA targeting PC1 reduced cholecystokinin (CCK) secretion from At-T20 cells. PC1 mRNA and protein were also decreased in the vector transfected cells. This treatment caused a shift in the forms of cholecystokinin (CCK) secreted, decreasing CCK 22 and increasing CCK 8. Stable expression of RNAi effectively decreased PC1 expression. The observed decrease in CCK seen with these RNAi treatments further supports a role for PC1 in CCK processing in these cells.

Quantitative evaluation of first, second, and third generation hairpin systems reveals the limit of mammalian vector-based RNAi

PubMed Central

Watanabe, Colin; Cuellar, Trinna L.; Haley, Benjamin

2016-01-01

ABSTRACT Incorporating miRNA-like features into vector-based hairpin scaffolds has been shown to augment small RNA processing and RNAi efficiency. Therefore, defining an optimal, native hairpin context may obviate a need for hairpin-specific targeting design schemes, which confound the movement of functional siRNAs into shRNA/artificial miRNA backbones, or large-scale screens to identify efficacious sequences. Thus, we used quantitative cell-based assays to compare separate third generation artificial miRNA systems, miR-E (based on miR-30a) and miR-3G (based on miR-16-2 and first described in this study) to widely-adopted, first and second generation formats in both Pol-II and Pol-III expression vector contexts. Despite their unique structures and strandedness, and in contrast to first and second-generation RNAi triggers, the third generation formats operated with remarkable similarity to one another, and strong silencing was observed with a significant fraction of the evaluated target sequences within either promoter context. By pairing an established siRNA design algorithm with the third generation vectors we could readily identify targeting sequences that matched or exceeded the potency of those discovered through large-scale sensor-based assays. We find that third generation hairpin systems enable the maximal level of siRNA function, likely through enhanced processing and accumulation of precisely-defined guide RNAs. Therefore, we predict future gains in RNAi potency will come from improved hairpin expression and identification of optimal siRNA-intrinsic silencing properties rather than further modification of these scaffolds. Consequently, third generation systems should be the primary format for vector-based RNAi studies; miR-3G is advantageous due to its small expression cassette and simplified, cost-efficient cloning scheme. PMID:26786363

Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver.

PubMed

Piras, Bryan A; O'Connor, Daniel M; French, Brent A

2013-01-01

AAV9 is a powerful gene delivery vehicle capable of providing long-term gene expression in a variety of cell types, particularly cardiomyocytes. The use of AAV-delivery for RNA interference is an intense area of research, but a comprehensive analysis of knockdown in cardiac and liver tissues after systemic delivery of AAV9 has yet to be reported. We sought to address this question by using AAV9 to deliver a short-hairpin RNA targeting the enhanced green fluorescent protein (GFP) in transgenic mice that constitutively overexpress GFP in all tissues. The expression cassette was initially tested in vitro and we demonstrated a 61% reduction in mRNA and a 90% reduction in GFP protein in dual-transfected 293 cells. Next, the expression cassette was packaged as single-stranded genomes in AAV9 capsids to test cardiac GFP knockdown with several doses ranging from 1.8×10(10) to 1.8×10(11) viral genomes per mouse and a dose-dependent response was obtained. We then analyzed GFP expression in both heart and liver after delivery of 4.4×10(11) viral genomes per mouse. We found that while cardiac knockdown was highly efficient, with a 77% reduction in GFP mRNA and a 71% reduction in protein versus control-treated mice, there was no change in liver expression. This was despite a 4.5-fold greater number of viral genomes in the liver than in the heart. This study demonstrates that single-stranded AAV9 vectors expressing shRNA can be used to achieve highly efficient cardiac-selective knockdown of GFP expression that is sustained for at least 7 weeks after the systemic injection of 8 day old mice, with no change in liver expression and no evidence of liver damage despite high viral genome presence in the liver.

In silico methods for co-transcriptional RNA secondary structure prediction and for investigating alternative RNA structure expression.

PubMed

Meyer, Irmtraud M

2017-05-01

RNA transcripts are the primary products of active genes in any living organism, including many viruses. Their cellular destiny not only depends on primary sequence signals, but can also be determined by RNA structure. Recent experimental evidence shows that many transcripts can be assigned more than a single functional RNA structure throughout their cellular life and that structure formation happens co-transcriptionally, i.e. as the transcript is synthesised in the cell. Moreover, functional RNA structures are not limited to non-coding transcripts, but can also feature in coding transcripts. The picture that now emerges is that RNA structures constitute an additional layer of information that can be encoded in any RNA transcript (and on top of other layers of information such as protein-context) in order to exert a wide range of functional roles. Moreover, different encoded RNA structures can be expressed at different stages of a transcript's life in order to alter the transcript's behaviour depending on its actual cellular context. Similar to the concept of alternative splicing for protein-coding genes, where a single transcript can yield different proteins depending on cellular context, it is thus appropriate to propose the notion of alternative RNA structure expression for any given transcript. This review introduces several computational strategies that my group developed to detect different aspects of RNA structure expression in vivo. Two aspects are of particular interest to us: (1) RNA secondary structure features that emerge during co-transcriptional folding and (2) functional RNA structure features that are expressed at different times of a transcript's life and potentially mutually exclusive. Copyright © 2017. Published by Elsevier Inc.

Using rabies virus vaccine strain SRV9 as viral vector to express exogenous gene.

PubMed

Wang, Hualei; Jin, Hongli; Feng, Na; Zheng, Xuexing; Li, Ling; Qi, Yinglin; Liang, Meng; Zhao, Yongkun; Wang, Tiecheng; Gao, Yuwei; Tu, Changchun; Jin, Ningyi; Yang, Songtao; Xia, Xianzhu

2015-04-01

Rabies virus (RABV) can cause a fatal neurological disease in human and animals, and vaccines were generally applied for the immunoprophylaxis of rabies. Here, a recombinant viral vector carrying the exogenous gene expression component between phosphoprotein (P) and matrix protein (M) genes of RABV was constructed based on the vaccine strain SRV9 used in China. To develop a reverse genetic system, the full-length cDNA plasmids of SRV9 were constructed using the eukaryotic expression vector pCI or pcDNA3.1(+). However, recovery efficiency based on the pcDNA3.1 vector was significantly higher than that of the pCI vector. The exogenous gene expression component PE-PS-BsiWI-PmeI or PS-BsiWI-PmeI-PE was introduced in different locations between the P and M genes of SRV9. When the enhanced green fluorescent protein (eGFP) was used as a reporter gene, both locations could rescue recombinant RABV (rRABV) expressing eGFP with high efficiency. Characterization of rRABV expressing eGFP in vitro revealed that its growth was similar to that of the parental virus. Animal experiments showed that rRABV expressing eGFP could replicate and express eGFP in the brains of suckling mice. Furthermore, rRABV of SRV9 was nonpathogenic for 3-week-old mice and could be cleared from the central nervous system at 5 days post-inoculation. Our results showed that the recombinant SRV9 virus could be used as a useful viral vector for exogenous gene expression.

[Lentivirus-mediated shRNA silencing of LAMP2A inhibits the proliferation of multiple myeloma cells].

PubMed

Li, Lixuan; Li, Jia

2015-05-01

To study the effects of lentivirus-mediated short hairpin RNA (shRNA) silencing of lysosome-associated membrane protein type 2A (LAMP2A) expression on the proliferation of multiple myeloma cells. The constructed shRNA lentiviral vector was applied to infect human multiple myeloma cell line MM.1S, and stable expression cell line was obtained by puromycin screening. Western blotting was used to verify the inhibitory effect on LAMP2A protein expression. MTT assay was conducted to detect the effect of knocked-down LAMP2A on MM.1S cell proliferation, and the anti-tumor potency of suberoylanilide hydroxamic acid (SAHA) against the obtained MM.1S LAMP2A(shRNA) stable cell line. Lactate assay was performed to observe the impact of low LAMP2A expression on cell glycolysis. The stable cell line with low LAMP2A expression were obtained with the constructed human LAMP2A-shRNA lentiviral vector. Down-regulation of LAMP2A expression significantly inhibited MM.1S cell proliferation and enhanced the anti-tumor activity of SAHA. Interestingly, decreased LAMP2A expression also inhibited MM.1S cell lactic acid secretion. Down-regulation of LAMP2A expression could inhibit cell proliferation in multiple myeloma cells.

RNA interference targeting CD147 inhibits metastasis and invasion of human breast cancer MCF-7 cells by downregulating MMP-9/VEGF expression.

PubMed

Li, Fang; Zhang, Junping; Guo, Jiqiang; Jia, Yuan; Han, Yaping; Wang, Zhuanhua

2018-06-12

Breast cancer is one of the most common malignancies. It is necessary to identify new markers for predicting tumor progression and therapeutic molecular targets. It has been reported that CD147 is one of the most commonly expressed proteins in primary tumors and in metastatic cells. In this study, we investigated the role of CD147 in human breast cancer metastasis and invasion, and examined its underlying molecular mechanisms. Immunohistochemistry results revealed high expression of CD147 in human breast tumor tissues, which was positively correlated with the malignancy of breast cancer. MCF-7 cells were transfected with CD147 siRNA eukaryotic expression vector, which resulted in significant knockdown of CD147. We found that CD147 siRNA dramatically inhibited cell proliferation, metastasis, and invasion. Furthermore, our results demonstrated that CD147 siRNA inhibited the synthesis of matrix metalloproteinase 9 (MMP-9) but had no significant effect on matrix metalloproteinase 2 (MMP-2). In addition, CD147 siRNA significantly inhibited the production of vascular endothelial growth factor (VEGF). Taken together, these data indicate that CD147 promotes breast cancer cell proliferation, metastasis, and invasion by modulating MMP-9 and VEGF expression. Thus, CD147 may be used as an important indicator for the judgment of malignant behavior of breast cancer, and may be a potential novel target for breast cancer therapy.

Feeder-free reprogramming of human fibroblasts with messenger RNA.

PubMed

Warren, Luigi; Wang, Jiwu

2013-11-13

This unit describes a feeder-free protocol for deriving induced pluripotent stem cells (iPSCs) from human fibroblasts by transfection of synthetic mRNA. The reprogramming of somatic cells requires transient expression of a set of transcription factors that collectively activate an endogenous gene regulatory network specifying the pluripotent phenotype. The necessary ectopic factor expression was first effected using retroviruses; however, as viral integration into the genome is problematic for cell therapy applications, the use of footprint-free vectors such as mRNA is increasingly preferred. Strong points of the mRNA approach include high efficiency, rapid kinetics, and obviation of a clean-up phase to purge the vector. Still, the method is relatively laborious and has, up to now, involved the use of feeder cells, which brings drawbacks including poor applicability to clinically oriented iPSC derivation. Using the methods described here, mRNA reprogramming can be performed without feeders at much-reduced labor and material costs relative to established protocols. Copyright © 2013 John Wiley & Sons, Inc.

Stabilization of Clostridium perfringens collagenase mRNA by VR-RNA-dependent cleavage in 5' leader sequence.

PubMed

Obana, Nozomu; Shirahama, Yu; Abe, Kimihiro; Nakamura, Kouji

2010-09-01

The small RNA (sRNA), VR-RNA that is directly regulated by the VirR/VirS two-component system, regulates many genes including toxin genes such as collagenase (colA) and phospholipase C (plc) in Clostridium perfringens. Although the VR-RNA 3' region is sufficient to regulate the colA and plc genes, the molecular mechanism of toxin gene regulation by VR-RNA remains unclear. Here, we found that colA mRNA is cleaved at position -79 and -78 from the A of the first codon (ATG) in the presence of VR-RNA. The processed transcripts were stable compared with longer intact transcripts. On the other hand, colA mRNA was labile in a VR-RNA-deficient strain, and processed transcripts were undetectable. The stability and processing of colA mRNA were restored by transformation of the 3' region of VR-RNA-expression vector. The 3' region of VR-RNA and colA mRNA had significant complementation and interacted in vitro. These results show that VR-RNA base pairs with colA mRNA and induces cleavage in the 5' untranslated region (UTR) of colA mRNA, which leads to the stabilization of colA mRNA and the activation of colA expression. © 2010 Blackwell Publishing Ltd.

MicroRNA expression in melanocytic nevi: the usefulness of formalin-fixed, paraffin-embedded material for miRNA microarray profiling.

PubMed

Glud, Martin; Klausen, Mikkel; Gniadecki, Robert; Rossing, Maria; Hastrup, Nina; Nielsen, Finn C; Drzewiecki, Krzysztof T

2009-05-01

MicroRNAs (miRNAs) are small, noncoding RNA molecules that regulate cellular differentiation, proliferation, and apoptosis. MiRNAs are expressed in a developmentally regulated and tissue-specific manner. Aberrant expression may contribute to pathological processes such as cancer, and miRNA may therefore serve as biomarkers that may be useful in a clinical environment for diagnosis of various diseases. Most miRNA profiling studies have used fresh tissue samples. However, in some types of cancer, including malignant melanoma, fresh material is difficult to obtain from primary tumors, and most surgical specimens are formalin fixed and paraffin embedded (FFPE). To explore whether FFPE material would be suitable for miRNA profiling in melanocytic lesions, we compared miRNA expression patterns in FFPE versus fresh frozen samples, obtained from 15 human melanocytic nevi. Out of microarray data, we identified 84 miRNAs that were expressed in both types of samples and represented an miRNA profile of melanocytic nevi. Our results showed a high correlation in miRNA expression (Spearman r-value of 0.80) between paired FFPE and fresh frozen material. The data were further validated by quantitative RT-PCR. In conclusion, FFPE specimens of melanocytic lesions are suitable as a source for miRNA microarray profiling.

RNA Deep Sequencing Reveals Differential MicroRNA Expression during Development of Sea Urchin and Sea Star

PubMed Central

Kadri, Sabah; Hinman, Veronica F.; Benos, Panayiotis V.

2011-01-01

microRNAs (miRNAs) are small (20–23 nt), non-coding single stranded RNA molecules that act as post-transcriptional regulators of mRNA gene expression. They have been implicated in regulation of developmental processes in diverse organisms. The echinoderms, Strongylocentrotus purpuratus (sea urchin) and Patiria miniata (sea star) are excellent model organisms for studying development with well-characterized transcriptional networks. However, to date, nothing is known about the role of miRNAs during development in these organisms, except that the genes that are involved in the miRNA biogenesis pathway are expressed during their developmental stages. In this paper, we used Illumina Genome Analyzer (Illumina, Inc.) to sequence small RNA libraries in mixed stage population of embryos from one to three days after fertilization of sea urchin and sea star (total of 22,670,000 reads). Analysis of these data revealed the miRNA populations in these two species. We found that 47 and 38 known miRNAs are expressed in sea urchin and sea star, respectively, during early development (32 in common). We also found 13 potentially novel miRNAs in the sea urchin embryonic library. miRNA expression is generally conserved between the two species during development, but 7 miRNAs are highly expressed in only one species. We expect that our two datasets will be a valuable resource for everyone working in the field of developmental biology and the regulatory networks that affect it. The computational pipeline to analyze Illumina reads is available at http://www.benoslab.pitt.edu/services.html. PMID:22216218

Adenovirus small interfering RNA targeting ezrin induces apoptosis and inhibits metastasis of human osteosarcoma MG-63 cells.

PubMed

Tao, Zhi-Wei; Zou, Ping-An

2018-06-13

Osteosarcoma is a disease prone to recurrence and metastasis, and adenovirus expression vector is frequently studied as a therapeutic target of osteosarcoma in recent year. This study attempts to explore the effect of adenovirus-mediated small interfering RNA (siRNA) targeting ezrin on the proliferation, migration, invasion and apoptosis of human osteosarcoma MG-63 cells. Human osteosarcoma MG-63 cell line was selected for construction of recombinant adenovirus vector. The mRNA and protein levels of ezrin, Bcl2-associated X protein (Bax), B cell lymphoma-2 (Bcl-2), p21, p53, Caspase-3, matrix metalloproteinase 2 (MMP-2) and MMP-9, Cyclin D1, and cyclin-dependent kinase 4a (CDK4a) were determined. Through ELISA, the levels of Caspase-3, MMP-2 and MMP-9 were examined. Finally, human osteosarcoma MG-63 cell viability, growth, invasion, migration, and apoptosis were detected. Initially, adenovirus expression vector of ezrin was constructed by ezrin 2 siRNA sequence. Adenovirus-mediated siRNA targeting ezrin reduced expression of ezrin in MG-63 cells. The results revealed that adenovirus-mediated siRNA targeting ezrin elevated expression levels of Bax, P21, P53, and Caspase-3, Cyclin D1, and CDK4a and reduced expression levels of Bcl-2, MMP-2, and MMP-9. Furthermore, adenovirus-mediated siRNA targeting ezrin inhibited human osteosarcoma MG-63 cell viability, growth, invasion, and migration, and promoted apoptosis. Our study demonstrates that adenovirus-mediated siRNA targeting ezrin can induce apoptosis and inhibit the proliferation, migration and invasion of human osteosarcoma MG-63 cells. ©2018 The Author(s).

Identification and consequences of miRNA-target interactions--beyond repression of gene expression.

PubMed

Hausser, Jean; Zavolan, Mihaela

2014-09-01

Comparative genomics analyses and high-throughput experimental studies indicate that a microRNA (miRNA) binds to hundreds of sites across the transcriptome. Although the knockout of components of the miRNA biogenesis pathway has profound phenotypic consequences, most predicted miRNA targets undergo small changes at the mRNA and protein levels when the expression of the miRNA is perturbed. Alternatively, miRNAs can establish thresholds in and increase the coherence of the expression of their target genes, as well as reduce the cell-to-cell variability in target gene expression. Here, we review the recent progress in identifying miRNA targets and the emerging paradigms of how miRNAs shape the dynamics of target gene expression.

Exploiting translational coupling for the selection of cells producing toxic recombinant proteins from expression vectors.

PubMed

Tagliavia, Marcello; Cuttitta, Angela

2016-01-01

High rates of plasmid instability are associated with the use of some expression vectors in Escherichia coli, resulting in the loss of recombinant protein expression. This is due to sequence alterations in vector promoter elements caused by the background expression of the cloned gene, which leads to the selection of fast-growing, plasmid-containing cells that do not express the target protein. This phenomenon, which is worsened when expressing toxic proteins, results in preparations containing very little or no recombinant protein, or even in clone loss; however, no methods to prevent loss of recombinant protein expression are currently available. We have exploited the phenomenon of translational coupling, a mechanism of prokaryotic gene expression regulation, in order to select cells containing plasmids still able to express recombinant proteins. Here we designed an expression vector in which the cloned gene and selection marker are co-expressed. Our approach allowed for the selection of the recombinant protein-expressing cells and proved effective even for clones encoding toxic proteins.

Single-Cell RNA-Sequencing: Assessment of Differential Expression Analysis Methods.

PubMed

Dal Molin, Alessandra; Baruzzo, Giacomo; Di Camillo, Barbara

2017-01-01

The sequencing of the transcriptomes of single-cells, or single-cell RNA-sequencing, has now become the dominant technology for the identification of novel cell types and for the study of stochastic gene expression. In recent years, various tools for analyzing single-cell RNA-sequencing data have been proposed, many of them with the purpose of performing differentially expression analysis. In this work, we compare four different tools for single-cell RNA-sequencing differential expression, together with two popular methods originally developed for the analysis of bulk RNA-sequencing data, but largely applied to single-cell data. We discuss results obtained on two real and one synthetic dataset, along with considerations about the perspectives of single-cell differential expression analysis. In particular, we explore the methods performance in four different scenarios, mimicking different unimodal or bimodal distributions of the data, as characteristic of single-cell transcriptomics. We observed marked differences between the selected methods in terms of precision and recall, the number of detected differentially expressed genes and the overall performance. Globally, the results obtained in our study suggest that is difficult to identify a best performing tool and that efforts are needed to improve the methodologies for single-cell RNA-sequencing data analysis and gain better accuracy of results.

Extent, Causes, and Consequences of Small RNA Expression Variation in Human Adipose Tissue

PubMed Central

Knights, Andrew J.; Abreu-Goodger, Cei; van de Bunt, Martijn; Guerra-Assunção, José Afonso; Bartonicek, Nenad; van Dongen, Stijn; Mägi, Reedik; Nisbet, James; Barrett, Amy; Rantalainen, Mattias; Nica, Alexandra C.; Quail, Michael A.; Small, Kerrin S.; Glass, Daniel; Enright, Anton J.; Winn, John; Deloukas, Panos; Dermitzakis, Emmanouil T.; McCarthy, Mark I.; Spector, Timothy D.; Durbin, Richard; Lindgren, Cecilia M.

2012-01-01

Small RNAs are functional molecules that modulate mRNA transcripts and have been implicated in the aetiology of several common diseases. However, little is known about the extent of their variability within the human population. Here, we characterise the extent, causes, and effects of naturally occurring variation in expression and sequence of small RNAs from adipose tissue in relation to genotype, gene expression, and metabolic traits in the MuTHER reference cohort. We profiled the expression of 15 to 30 base pair RNA molecules in subcutaneous adipose tissue from 131 individuals using high-throughput sequencing, and quantified levels of 591 microRNAs and small nucleolar RNAs. We identified three genetic variants and three RNA editing events. Highly expressed small RNAs are more conserved within mammals than average, as are those with highly variable expression. We identified 14 genetic loci significantly associated with nearby small RNA expression levels, seven of which also regulate an mRNA transcript level in the same region. In addition, these loci are enriched for variants significant in genome-wide association studies for body mass index. Contrary to expectation, we found no evidence for negative correlation between expression level of a microRNA and its target mRNAs. Trunk fat mass, body mass index, and fasting insulin were associated with more than twenty small RNA expression levels each, while fasting glucose had no significant associations. This study highlights the similar genetic complexity and shared genetic control of small RNA and mRNA transcripts, and gives a quantitative picture of small RNA expression variation in the human population. PMID:22589741

Effects of hypothermia and cerebral ischemia on cold-inducible RNA-binding protein mRNA expression in rat brain.

PubMed

Liu, Aijun; Zhang, Zhiwen; Li, Anmin; Xue, Jinghui

2010-08-06

CIRP (cold-inducible RNA-binding protein) mRNA is highly expressed in hypothermic conditions in mammalian cells, and the relationship between CIRP and neuroprotection for cerebral ischemia under hypothermia has been focused upon. At present, however, the expression characteristics of CIRP under hypothermia and cerebral ischemia in vivo are not clearly elucidated. In this study, CIRP mRNA expression in various regions of rat brain was examined by reverse transcriptase polymerase chain reaction (RT-PCR). CIRP expression levels were found to be similar in the hippocampus and cortex. Real-time quantitative PCR analysis revealed increasing CIRP mRNA expression in the cortex during the 24-h observation period following treatment with hypothermia or cerebral ischemia, with a greater increase in the hypothermia group. When cerebral ischemia was induced following hypothermia, CIRP mRNA expression in the cortex again showed a significant increasing tendency, but ischemia delayed the appearance of this increase. To reveal the relationship between CIRP and energy metabolism in the rat brain, lactate and pyruvate concentrations in the cortex of the rats treated with hypothermia, ischemia and ischemia after hypothermia were determined by spectrophotometric assay, and levels of phosphofructokinas-1 (PFK-1), the major regulatory enzyme of the glycolytic pathway, in the rat cortex in the three groups was also analyzed by Western blot. Using linear correlation, lactate and pyruvate concentrations, and PFK-1 levels, were each analyzed in the three groups in association with CIRP mRNA expression levels. The analysis did not reveal any correlation between the three metabolic parameters and CIRP mRNA expression induced by hypothermia, suggesting that while playing a role in neuroprotection under hypothermia, CIRP does not affect cerebral energy metabolism. Copyright 2010. Published by Elsevier B.V.

Development of a domain-specific genetic language to design Chlamydomonas reinhardtii expression vectors.

PubMed

Wilson, Mandy L; Okumoto, Sakiko; Adam, Laura; Peccoud, Jean

2014-01-15

Expression vectors used in different biotechnology applications are designed with domain-specific rules. For instance, promoters, origins of replication or homologous recombination sites are host-specific. Similarly, chromosomal integration or viral delivery of an expression cassette imposes specific structural constraints. As de novo gene synthesis and synthetic biology methods permeate many biotechnology specialties, the design of application-specific expression vectors becomes the new norm. In this context, it is desirable to formalize vector design strategies applicable in different domains. Using the design of constructs to express genes in the chloroplast of Chlamydomonas reinhardtii as an example, we show that a vector design strategy can be formalized as a domain-specific language. We have developed a graphical editor of context-free grammars usable by biologists without prior exposure to language theory. This environment makes it possible for biologists to iteratively improve their design strategies throughout the course of a project. It is also possible to ensure that vectors designed with early iterations of the language are consistent with the latest iteration of the language. The context-free grammar editor is part of the GenoCAD application. A public instance of GenoCAD is available at http://www.genocad.org. GenoCAD source code is available from SourceForge and licensed under the Apache v2.0 open source license.

Small RNA Deep Sequencing and the Effects of microRNA408 on Root Gravitropic Bending in Arabidopsis

NASA Astrophysics Data System (ADS)

Li, Huasheng; Lu, Jinying; Sun, Qiao; Chen, Yu; He, Dacheng; Liu, Min

2015-11-01

MicroRNA (miRNA) is a non-coding small RNA composed of 20 to 24 nucleotides that influences plant root development. This study analyzed the miRNA expression in Arabidopsis root tip cells using Illumina sequencing and real-time PCR before (sample 0) and 15 min after (sample 15) a 3-D clinostat rotational treatment was administered. After stimulation was performed, the expression levels of seven miRNA genes, including Arabidopsis miR160, miR161, miR394, miR402, miR403, miR408, and miR823, were significantly upregulated. Illumina sequencing results also revealed two novel miRNAsthat have not been previously reported, The target genes of these miRNAs included pentatricopeptide repeat-containing protein and diadenosine tetraphosphate hydrolase. An overexpression vector of Arabidopsis miR408 was constructed and transferred to Arabidopsis plant. The roots of plants over expressing miR408 exhibited a slower reorientation upon gravistimulation in comparison with those of wild-type. This result indicate that miR408 could play a role in root gravitropic response.

In vivo Assembly in Escherichia coli of Transformation Vectors for Plastid Genome Engineering.

PubMed

Wu, Yuyong; You, Lili; Li, Shengchun; Ma, Meiqi; Wu, Mengting; Ma, Lixin; Bock, Ralph; Chang, Ling; Zhang, Jiang

2017-01-01

Plastid transformation for the expression of recombinant proteins and entire metabolic pathways has become a promising tool for plant biotechnology. However, large-scale application of this technology has been hindered by some technical bottlenecks, including lack of routine transformation protocols for agronomically important crop plants like rice or maize. Currently, there are no standard or commercial plastid transformation vectors available for the scientific community. Construction of a plastid transformation vector usually requires tedious and time-consuming cloning steps. In this study, we describe the adoption of an in vivo Escherichia coli cloning (iVEC) technology to quickly assemble a plastid transformation vector. The method enables simple and seamless build-up of a complete plastid transformation vector from five DNA fragments in a single step. The vector assembled for demonstration purposes contains an enhanced green fluorescent protein (GFP) expression cassette, in which the gfp transgene is driven by the tobacco plastid ribosomal RNA operon promoter fused to the 5' untranslated region (UTR) from gene10 of bacteriophage T7 and the transcript-stabilizing 3'UTR from the E. coli ribosomal RNA operon rrnB . Successful transformation of the tobacco plastid genome was verified by Southern blot analysis and seed assays. High-level expression of the GFP reporter in the transplastomic plants was visualized by confocal microscopy and Coomassie staining, and GFP accumulation was ~9% of the total soluble protein. The iVEC method represents a simple and efficient approach for construction of plastid transformation vector, and offers great potential for the assembly of increasingly complex vectors for synthetic biology applications in plastids.

DDM1 represses noncoding RNA expression and RNA-directed DNA methylation in heterochromatin.

PubMed

Tan, Feng; Lu, Yue; Jiang, Wei; Zhao, Yu; Wu, Tian; Zhang, Ruoyu; Zhou, Dao-Xiu

2018-05-24

Cytosine methylation of DNA, which occurs at CG, CHG, and CHH (H=A, C, or T) sequences in plants, is a hallmark for epigenetic repression of repetitive sequences. The chromatin remodeling factor DECREASE IN DNA METHYLATION1 (DDM1) is essential for DNA methylation, especially at CG and CHG sequences. However, its potential role in RNA-directed DNA methylation (RdDM) and in chromatin function is not completely understood in rice (Oryza sativa). In this work, we used high-throughput approaches to study the function of rice DDM1 (OsDDM1) in RdDM and the expression of non-coding RNA (ncRNA). We show that loss of function of OsDDM1 results in ectopic CHH methylation of transposable elements and repeats. The ectopic CHH methylation was dependent on rice DOMAINS REARRANGED METHYLTRANSFERASE2 (OsDRM2), a DNA methyltransferase involved in RdDM. Mutations in OsDDM1 lead to decreases of histone H3K9me2 and increases in the levels of heterochromatic small RNA (sRNA) and long noncoding RNA (lncRNA). In particular, OsDDM1 was found to be essential to repress transcription of the two repetitive sequences, Centromeric Retrotransposons of Rice1 (CRR1) and the dominant centromeric CentO repeats. These results suggest that OsDDM1 antagonizes RdDM at heterochromatin and represses tissue-specific expression of ncRNA from repetitive sequences in the rice genome. {copyright, serif} 2018 American Society of Plant Biologists. All rights reserved.

Alpharetroviral Self-inactivating Vectors: Long-term Transgene Expression in Murine Hematopoietic Cells and Low Genotoxicity

PubMed Central

Suerth, Julia D; Maetzig, Tobias; Brugman, Martijn H; Heinz, Niels; Appelt, Jens-Uwe; Kaufmann, Kerstin B; Schmidt, Manfred; Grez, Manuel; Modlich, Ute; Baum, Christopher; Schambach, Axel

2012-01-01

Comparative integrome analyses have highlighted alpharetroviral vectors with a relatively neutral, and thus favorable, integration spectrum. However, previous studies used alpharetroviral vectors harboring viral coding sequences and intact long-terminal repeats (LTRs). We recently developed self-inactivating (SIN) alpharetroviral vectors with an advanced split-packaging design. In a murine bone marrow (BM) transplantation model we now compared alpharetroviral, gammaretroviral, and lentiviral SIN vectors and showed that all vectors transduced hematopoietic stem cells (HSCs), leading to comparable, sustained multilineage transgene expression in primary and secondary transplanted mice. Alpharetroviral integrations were decreased near transcription start sites, CpG islands, and potential cancer genes compared with gammaretroviral, and decreased in genes compared with lentiviral integrations. Analyzing the transcriptome and intragenic integrations in engrafting cells, we observed stronger correlations between in-gene integration targeting and transcriptional activity for gammaretroviral and lentiviral vectors than for alpharetroviral vectors. Importantly, the relatively “extragenic” alpharetroviral integration pattern still supported long-term transgene expression upon serial transplantation. Furthermore, sensitive genotoxicity studies revealed a decreased immortalization incidence compared with gammaretroviral and lentiviral SIN vectors. We conclude that alpharetroviral SIN vectors have a favorable integration pattern which lowers the risk of insertional mutagenesis while supporting long-term transgene expression in the progeny of transplanted HSCs. PMID:22334016

A self-initiating eukaryotic transient gene expression system based on contransfection of bacteriophage T7 RNA polymerase and DNA vectors containing a T7 autogene.

PubMed Central

Chen, X; Li, Y; Xiong, K; Wagner, T E

1994-01-01

A novel cytoplasmic gene expression system has been developed. This system differs from other expression systems in that it relies on the co-delivery of plasmid DNA and T7 RNA polymerase (RNAP) during transfection. The plasmid contains a T7 RNAP gene driven by the T7 promoter (T7 autogene) and a functional/reporter gene driven by another T7 promoter (T7T7/T7-gene construct). Once this DNA-enzyme complex is introduced into eukaryotic cells, the transcription of the T7 RNAP and the functional/reporter genes is initiated by the co-delivered T7 RNAP. The T7 RNAP, which is responsible for the initiation and maintenance of expression of both T7 and functional/reporter genes, is replenished by translation of newly synthesized T7 mRNA. This T7 system was designed in such a manner that the expression of the functional/reporter genes can occur in the cytoplasm and does not require any nuclear involvement. When transfected by either a pT7T7/T7Luc or a pT7T7/T7hGH plasmids with the cointroduced T7 RNAP, mouse L cells were found to express high levels of luciferase immediately after transfection, apparently due to the cytoplasmic gene expression; the expression of human growth hormone (hGH) could be sustained for at least 6 days. Both T7 and hGH mRNA were expressed by the cells transfected with pT7T7/T7hGH. These results suggest that this cytoplasmic expression system may be used for certain targets of somatic gene therapy. Images PMID:8029020

Expression Profiling Identifies Circular RNA Signature in Hepatoblastoma.

PubMed

Liu, Bai-Hui; Zhang, Bin-Bin; Liu, Xiang-Qi; Zheng, Shan; Dong, Kui-Ran; Dong, Rui

2018-01-01

Hepatoblastoma is the most common malignant pediatric liver cancer. circular RNAs (circRNAs) play important roles in fine-tuning gene expression and are often deregulated in cancers. However, the expression profile and clinical significance of circRNAs in hepatoblastoma is still unknown. Circular RNA microarray was conducted to identify hepatoblastoma-related circRNAs. GO analysis, pathway analysis, and miRNA response elements analysis was conducted to predict the potential roles of differentially expressed circRNAs in hepatoblastoma. MTT assays, Ki67 staining, and Transwell assays were conducted to clarify the role of circRNA in hepatoblastoma in vitro. Bioinformatics analysis and in vitro experiments were conducted to clarify the mechanism of circRNA-mediated gene regulation in hepatoblastoma cell. 869 differentially expressed circRNAs were identified between hepatoblastoma and adjacent normal liver samples, including 421 up-regulated circRNAs and 448 down-regulated circRNAs. The significant enriched GO term of hepatoblastoma-related circRNAs in biological process, cellular component, and molecular function were "chromosome organization", "cytoplasm", and "organic cyclic compound binding". Tight junction signaling pathway was ranked the Top 1 potentially affected by circRNA-mediated regulatory network. circ_0015756 was significantly up-regulated in human hepatoblastoma specimens and metastatic hepatoblastoma cell lines. circ_0015756 silencing decreased hepatoblastoma cell viability, proliferation, and invasion in vitro. circ_0015756 acted as miR-1250-3p sponge to regulate hepatoblastoma cell function. circRNAs are involved in the pathogenesis of hepatoblastoma. circ_0015756 is a promising target for the prognosis, diagnosis, and treatment of hepatoblastoma. © 2018 The Author(s). Published by S. Karger AG, Basel.

MicroRNA expression profiling of human breast cancer identifies new markers of tumor subtype.

PubMed

Blenkiron, Cherie; Goldstein, Leonard D; Thorne, Natalie P; Spiteri, Inmaculada; Chin, Suet-Feung; Dunning, Mark J; Barbosa-Morais, Nuno L; Teschendorff, Andrew E; Green, Andrew R; Ellis, Ian O; Tavaré, Simon; Caldas, Carlos; Miska, Eric A

2007-01-01

MicroRNAs (miRNAs), a class of short non-coding RNAs found in many plants and animals, often act post-transcriptionally to inhibit gene expression. Here we report the analysis of miRNA expression in 93 primary human breast tumors, using a bead-based flow cytometric miRNA expression profiling method. Of 309 human miRNAs assayed, we identify 133 miRNAs expressed in human breast and breast tumors. We used mRNA expression profiling to classify the breast tumors as luminal A, luminal B, basal-like, HER2+ and normal-like. A number of miRNAs are differentially expressed between these molecular tumor subtypes and individual miRNAs are associated with clinicopathological factors. Furthermore, we find that miRNAs could classify basal versus luminal tumor subtypes in an independent data set. In some cases, changes in miRNA expression correlate with genomic loss or gain; in others, changes in miRNA expression are likely due to changes in primary transcription and or miRNA biogenesis. Finally, the expression of DICER1 and AGO2 is correlated with tumor subtype and may explain some of the changes in miRNA expression observed. This study represents the first integrated analysis of miRNA expression, mRNA expression and genomic changes in human breast cancer and may serve as a basis for functional studies of the role of miRNAs in the etiology of breast cancer. Furthermore, we demonstrate that bead-based flow cytometric miRNA expression profiling might be a suitable platform to classify breast cancer into prognostic molecular subtypes.

Avian Paramyxovirus Type-3 as a Vaccine Vector: Identification of a Genome Location for High Level Expression of a Foreign Gene.

PubMed

Yoshida, Asuka; Samal, Siba K

2017-01-01

Avian paramyxovirus serotype 3 (APMV-3) causes infection in a wide variety of avian species, but it does not cause apparent diseases in chickens. On the contrary, APMV-1, also known as Newcastle disease virus (NDV), can cause severe disease in chickens. Currently, natural low virulence strains of NDV are used as live-attenuated vaccines throughout the world. NDV is also being evaluated as a vaccine vector against poultry pathogens. However, due to routine vaccination programs, chickens often possess pre-existing antibodies against NDV, which may cause the chickens to be less sensitive to recombinant NDV vaccines expressing antigens of other avian pathogens. Therefore, it may be possible for an APMV-3 vector vaccine to circumvent this issue. In this study, we determined the optimal insertion site in the genome of APMV-3 for high level expression of a foreign gene. We generated recombinant APMV-3 viruses expressing the green fluorescent protein (GFP) by inserting the GFP gene at five different intergenic regions in the genome. The levels of GFP transcription and translation were evaluated. Interestingly, the levels of GFP transcription and translation did not follow the 3'-to-5' attenuation mechanism of non-segmented, negative-sense RNA viruses. The insertion of GFP gene into the P-M gene junction resulted in higher level of expression of GFP than when the gene was inserted into the upstream N-P gene junction. Unlike NDV, insertion of GFP did not attenuate the growth efficiency of AMPV-3. Thus, APMV-3 could be a more useful vaccine vector for avian pathogens than NDV.

Monoclonal antibodies expression improvement in CHO cells by PiggyBac transposition regarding vectors ratios and design.

PubMed

Ahmadi, Samira; Davami, Fatemeh; Davoudi, Noushin; Nematpour, Fatemeh; Ahmadi, Maryam; Ebadat, Saeedeh; Azadmanesh, Kayhan; Barkhordari, Farzaneh; Mahboudi, Fereidoun

2017-01-01

Establishing stable Chinese Hamster Ovary (CHO) cells producing monoclonal antibodies (mAbs) usually pass through the random integration of vectors to the cell genome, which is sensitive to gene silencing. One approach to overcome this issue is to target a highly transcribed region in the genome. Transposons are useful devices to target active parts of genomes, and PiggyBac (PB) transposon can be considered as a good option. In the present study, three PB transposon donor vectors containing both heavy and light chains were constructed, one contained independent expression cassettes while the others utilized either an Internal Ribosome Entry Site (IRES) or 2A element to express mAb. Conventional cell pools were created by transferring donor vectors into the CHO cells, whereas transposon-based cells were generated by transfecting the cells with donor vectors with a companion of a transposase-encoding helper vector, with 1:2.5 helper/donor vectors ratio. To evaluate the influence of helper/donor vectors ratio on expression, the second transposon-based cell pools were generated with 1:5 helper/donor ratio. Expression levels in the transposon-based cells were two to five -folds more than those created by conventional method except for the IRES-mediated ones, in which the observed difference increased more than 100-fold. The results were dependent on both donor vector design and vectors ratios.

Monoclonal antibodies expression improvement in CHO cells by PiggyBac transposition regarding vectors ratios and design

PubMed Central

Ahmadi, Samira; Davami, Fatemeh; Davoudi, Noushin; Nematpour, Fatemeh; Ahmadi, Maryam; Ebadat, Saeedeh; Azadmanesh, Kayhan; Barkhordari, Farzaneh

2017-01-01

Establishing stable Chinese Hamster Ovary (CHO) cells producing monoclonal antibodies (mAbs) usually pass through the random integration of vectors to the cell genome, which is sensitive to gene silencing. One approach to overcome this issue is to target a highly transcribed region in the genome. Transposons are useful devices to target active parts of genomes, and PiggyBac (PB) transposon can be considered as a good option. In the present study, three PB transposon donor vectors containing both heavy and light chains were constructed, one contained independent expression cassettes while the others utilized either an Internal Ribosome Entry Site (IRES) or 2A element to express mAb. Conventional cell pools were created by transferring donor vectors into the CHO cells, whereas transposon-based cells were generated by transfecting the cells with donor vectors with a companion of a transposase-encoding helper vector, with 1:2.5 helper/donor vectors ratio. To evaluate the influence of helper/donor vectors ratio on expression, the second transposon-based cell pools were generated with 1:5 helper/donor ratio. Expression levels in the transposon-based cells were two to five -folds more than those created by conventional method except for the IRES-mediated ones, in which the observed difference increased more than 100-fold. The results were dependent on both donor vector design and vectors ratios. PMID:28662065

MicroRNA expression patterns in indeterminate inflammatory bowel disease.

PubMed

Lin, Jingmei; Cao, Qi; Zhang, Jianjun; Li, Yong; Shen, Bo; Zhao, Zijin; Chinnaiyan, Arul M; Bronner, Mary P

2013-01-01

A diagnosis of idiopathic inflammatory bowel disease requires synthesis of clinical, radiographic, endoscopic, surgical, and histologic data. While most cases of inflammatory bowel disease can be specifically classified as either ulcerative colitis or Crohns disease, 5-10% of patients have equivocal features placing them into the indeterminate colitis category. This study examines whether microRNA biomarkers assist in the classification of classically diagnosed indeterminate inflammatory bowel disease. Fresh frozen colonic mucosa from the distal-most part of the colectomy from 53 patients was used (16 indeterminate colitis, 14 Crohns disease, 12 ulcerative colitis, and 11 diverticular disease controls). Total RNA extraction and quantitative reverse-transcription-PCR was performed using five pairs of microRNA primers (miR-19b, miR-23b, miR-106a, miR-191, and miR-629). Analysis of variance was performed assessing differences among the groups. A significant difference in expressions of miR-19b, miR-106a, and miR-629 was detected between ulcerative colitis and Crohns disease groups (P<0.05). The average expression level of all five microRNAs was statistically different between indeterminate colitis and Crohns disease groups (P<0.05); no significant difference was present between indeterminate and ulcerative colitis groups. Among the 16 indeterminate colitis patients, 15 showed ulcerative colitis-like and one Crohns disease-like microRNA pattern. MicroRNA expression patterns in indeterminate colitis are far more similar to those of ulcerative colitis than Crohns disease. MicroRNA expression patterns of indeterminate colitis provide molecular evidence indicating that most cases are probably ulcerative colitis-similar to the data from long-term clinical follow-up studies. Validation of microRNA results by additional long-term outcome data is needed, but the data presented show promise for improved classification of indeterminate inflammatory bowel disease.

Conjunctival mucin mRNA expression in contact lens wear.

PubMed

Corrales, Rosa M; Galarreta, David; Herreras, Jose M; Saez, Victoria; Arranz, Isabel; González, Maria J; Mayo, Agustin; Calonge, Margarita; Chaves, Felipe J

2009-09-01

To investigate the influence of the water content in non-ionic hydrogel contact lenses (HCL) on the mRNA levels of human conjunctival mucin genes (MUCs). Sixteen healthy subjects with no history of contact lenses wear were selected and randomized into two equal groups. Group 1 subjects wore low water content (38%, Soflens 38) non-ionic HCLs. Group 2 wore high water content (66%, Soflens 66) non-ionic HCLs. Conjunctival impression cytology was applied to the superior bulbar conjunctiva of both eyes before, 6 months, and 1 year after HCL fitting, and 15 days after discontinuation of wearing. Total RNA was isolated, retrotranscribed, and amplified by conventional polymerase chain reaction (PCR) and by quantitative real time PCR to study the mRNA levels of MUCs and to analyze variations during the study period. Time- and HCL-dependent variations in mRNA expression were analyzed using Student's test. From the known MUCs, transcripts from MUC1, MUC2, MUC4, MUC5AC, MUC7, MUC13, MUC15, MUC16, and MUC17 genes were detected in all subjects before HCL fitting. Except for MUC2, the expression of some MUC genes significantly increased whereas others significantly decreased at either the 6- and 12-month period. Statistically significant differences between both HCL groups (p < 0.001) were found in the MUC4, MUC13, and MUC15 mRNA expression after 1 year of wear and after the 15 days without HCL wear. However, these differences were not clearly related to the water content of the lenses. Low and high water content non-ionic HCLs induced different changes in the mRNA levels of several MUCs, but the water content was not related to the changes. Recovery to basal levels of conjunctival MUC mRNA expression after wearing HCL lenses for a year takes longer than 15 days for some MUCs.

RNA replicons - a new approach for influenza virus immunoprophylaxis.

PubMed

Zimmer, Gert

2010-02-01

RNA replicons are derived from either positive- or negative-strand RNA viruses. They represent disabled virus vectors that are not only avirulent, but also unable to revert to virulence. Due to autonomous RNA replication, RNA replicons are able to drive high level, cytosolic expression of recombinant antigens stimulating both the humoral and the cellular branch of the immune system. This review provides an update on the available literature covering influenza virus vaccines based on RNA replicons. The pros and cons of these vaccine strategies will be discussed and future perspectives disclosed.

Global miRNA expression and correlation with mRNA levels in primary human bone cells

PubMed Central

Laxman, Navya; Rubin, Carl-Johan; Mallmin, Hans; Nilsson, Olle; Pastinen, Tomi; Grundberg, Elin; Kindmark, Andreas

2015-01-01

MicroRNAs (miRNAs) are important post-transcriptional regulators that have recently introduced an additional level of intricacy to our understanding of gene regulation. The aim of this study was to investigate miRNA–mRNA interactions that may be relevant for bone metabolism by assessing correlations and interindividual variability in miRNA levels as well as global correlations between miRNA and mRNA levels in a large cohort of primary human osteoblasts (HOBs) obtained during orthopedic surgery in otherwise healthy individuals. We identified differential expression (DE) of 24 miRNAs, and found 9 miRNAs exhibiting DE between males and females. We identified hsa-miR-29b, hsa-miR-30c2, and hsa-miR-125b and their target genes as important modulators of bone metabolism. Further, we used an integrated analysis of global miRNA–mRNA correlations, mRNA-expression profiling, DE, bioinformatics analysis, and functional studies to identify novel target genes for miRNAs with the potential to regulate osteoblast differentiation and extracellular matrix production. Functional studies by overexpression and knockdown of miRNAs showed that, the differentially expressed miRNAs hsa-miR-29b, hsa-miR-30c2, and hsa-miR-125b target genes highly relevant to bone metabolism, e.g., collagen, type I, α1 (COL1A1), osteonectin (SPARC), Runt-related transcription factor 2 (RUNX2), osteocalcin (BGLAP), and frizzled-related protein (FRZB). These miRNAs orchestrate the activities of key regulators of osteoblast differentiation and extracellular matrix proteins by their convergent action on target genes and pathways to control the skeletal gene expression. PMID:26078267

EMMA: An Extensible Mammalian Modular Assembly Toolkit for the Rapid Design and Production of Diverse Expression Vectors.

PubMed

Martella, Andrea; Matjusaitis, Mantas; Auxillos, Jamie; Pollard, Steven M; Cai, Yizhi

2017-07-21

Mammalian plasmid expression vectors are critical reagents underpinning many facets of research across biology, biomedical research, and the biotechnology industry. Traditional cloning methods often require laborious manual design and assembly of plasmids using tailored sequential cloning steps. This process can be protracted, complicated, expensive, and error-prone. New tools and strategies that facilitate the efficient design and production of bespoke vectors would help relieve a current bottleneck for researchers. To address this, we have developed an extensible mammalian modular assembly kit (EMMA). This enables rapid and efficient modular assembly of mammalian expression vectors in a one-tube, one-step golden-gate cloning reaction, using a standardized library of compatible genetic parts. The high modularity, flexibility, and extensibility of EMMA provide a simple method for the production of functionally diverse mammalian expression vectors. We demonstrate the value of this toolkit by constructing and validating a range of representative vectors, such as transient and stable expression vectors (transposon based vectors), targeting vectors, inducible systems, polycistronic expression cassettes, fusion proteins, and fluorescent reporters. The method also supports simple assembly combinatorial libraries and hierarchical assembly for production of larger multigenetic cargos. In summary, EMMA is compatible with automated production, and novel genetic parts can be easily incorporated, providing new opportunities for mammalian synthetic biology.

Biological significance of long non-coding RNA FTX expression in human colorectal cancer

PubMed Central

Guo, Xiao-Bo; Hua, Zhu; Li, Chen; Peng, Li-Pan; Wang, Jing-Shen; Wang, Bo; Zhi, Qiao-Ming

2015-01-01

The purpose of this study was to determine the expression of long non-coding RNA (lncRNA) FTX and analyze its prognostic and biological significance in colorectal cancer (CRC). A quantitative reverse transcription PCR was performed to detect the expression of long non-coding RNA FTX in 35 pairs of colorectal cancer and corresponding noncancerous tissues. The expression of long non-coding RNA FTX was detected in 187 colorectal cancer tissues and its correlations with clinicopathological factors of patients were examined. Univariate and multivariate analyses were performed to analyze the prognostic significance of Long Non-coding RNA FTX expression. The effects of long non-coding RNA FTX expression on malignant phenotypes of colorectal cancer cells and its possible biological significances were further determined. Long non-coding RNA FTX was significantly upregulated in colorectal cancer tissues, and low long non-coding RNA FTX expression was significantly correlated with differentiation grade, lymph vascular invasion, and clinical stage. Patients with high long non-coding RNA FTX showed poorer overall survival than those with low long non-coding RNA FTX. Multivariate analyses indicated that status of long non-coding RNA FTX was an independent prognostic factor for patients. Functional analyses showed that upregulation of long non-coding RNA FTX significantly promoted growth, migration, invasion, and increased colony formation in colorectal cancer cells. Therefore, long non-coding RNA FTX may be a potential biomarker for predicting the survival of colorectal cancer patients and might be a molecular target for treatment of human colorectal cancer. PMID:26629053

Biological significance of long non-coding RNA FTX expression in human colorectal cancer.

PubMed

Guo, Xiao-Bo; Hua, Zhu; Li, Chen; Peng, Li-Pan; Wang, Jing-Shen; Wang, Bo; Zhi, Qiao-Ming

2015-01-01

The purpose of this study was to determine the expression of long non-coding RNA (lncRNA) FTX and analyze its prognostic and biological significance in colorectal cancer (CRC). A quantitative reverse transcription PCR was performed to detect the expression of long non-coding RNA FTX in 35 pairs of colorectal cancer and corresponding noncancerous tissues. The expression of long non-coding RNA FTX was detected in 187 colorectal cancer tissues and its correlations with clinicopathological factors of patients were examined. Univariate and multivariate analyses were performed to analyze the prognostic significance of Long Non-coding RNA FTX expression. The effects of long non-coding RNA FTX expression on malignant phenotypes of colorectal cancer cells and its possible biological significances were further determined. Long non-coding RNA FTX was significantly upregulated in colorectal cancer tissues, and low long non-coding RNA FTX expression was significantly correlated with differentiation grade, lymph vascular invasion, and clinical stage. Patients with high long non-coding RNA FTX showed poorer overall survival than those with low long non-coding RNA FTX. Multivariate analyses indicated that status of long non-coding RNA FTX was an independent prognostic factor for patients. Functional analyses showed that upregulation of long non-coding RNA FTX significantly promoted growth, migration, invasion, and increased colony formation in colorectal cancer cells. Therefore, long non-coding RNA FTX may be a potential biomarker for predicting the survival of colorectal cancer patients and might be a molecular target for treatment of human colorectal cancer.

A genome-wide inducible phenotypic screen identifies antisense RNA constructs silencing Escherichia coli essential genes

PubMed Central

Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K.; Crummer, Heather; Tain, Justina; Xu, H. Howard

2013-01-01

Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250,000 library transformants for conditional growth-inhibitory recombinant clones from two shot-gun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer-sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes while 18 originated from non-essential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12 fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. PMID:22268863

Gene silencing in primary and metastatic tumors by small interfering RNA delivery in mice: quantitative analysis using melanoma cells expressing firefly and sea pansy luciferases.

PubMed

Takahashi, Yuki; Nishikawa, Makiya; Kobayashi, Naoki; Takakura, Yoshinobu

2005-07-20

Silencing of oncogenes or other genes contributing to tumor malignancy or progression by RNA interference (RNAi) offers a promising approach to treating tumor patients. To achieve RNAi-based tumor therapy, a small interfering RNA (siRNA) or siRNA-expressing vector needs to be delivered to tumor cells, but little information about its in vivo delivery has been reported. In this study, we examined whether the expression of the target gene in tumor cells can be suppressed by the delivery of RNAi effectors to primary and metastatic tumor cells. To quantitatively evaluate the RNAi effects in tumor cells, mouse melanoma B16-BL6 cells were stably transfected with both firefly (a model target gene) and sea pansy (an internal standard gene) luciferase genes to obtain B16-BL6/dual Luc cells. The target gene expression in subcutaneous primary tumors of B16-BL6/dual Luc cells was significantly suppressed by direct injection of the RNAi effectors followed by electroporation. The expression in metastatic hepatic tumors was also significantly reduced by an intravenous injection of either RNAi effector by the hydrodynamics-based procedure. These results indicate that the both RNAi effectors have a potential to silence target gene in tumor cells in vivo when successfully delivered to tumor cells.

Expression of beta 3-adrenoceptor mRNA in rat tissues.

PubMed

Evans, B A; Papaioannou, M; Bonazzi, V R; Summers, R J

1996-01-01

1. This study examines the expression of beta 3-adrenoceptor messenger RNA (beta 3-AR mRNA) in rat tissues to allow comparison with atypical beta-adrenoceptors determined by functional and radioligand binding techniques. 2. A reverse transcription/polymerase chain reaction protocol has been developed for determining the relative amounts of beta 3-AR mRNA in rat tissues. 3. Measurement of adipsin and uncoupling protein (UCP) mRNA was used to examine all tissues for the presence of white and brown adipose tissue which may contribute beta 3-AR mRNA. 4. The beta 3-AR mRNA is expressed at high levels in brown and white adipose tissue, stomach fundus, the longitudinal/circular smooth muscle of both colon and ileum, and colon submucosa. There was substantial expression of adipsin in colon submucosa and moderate expression in fundus, suggesting that in these regions at least some of the beta 3-AR signal may be contributed by fat. Pylorus and colon mucosa showed moderate levels of beta 3-AR mRNA with lower levels of adipsin. Ileum mucosa and submucosa showed low but readily detectable levels of beta 3-AR. 5. Expression of adipsin in rat skeletal muscles coupled to very low levels of beta 3-AR mRNA indicates that the observed beta 3-AR may be due to the presence of intrinsic fat. beta 3-AR mRNA was virtually undetectable in heart, lung and liver. These results raise the possibility that the atypical beta-AR demonstrated by functional and/or binding studies in muscle and in heart is not the beta 3-AR. 6. By use of two different sets of primers for amplification of beta 3-AR cDNA, no evidence was found for differential splicing of the mRNA in any of the tissues examined. 7. The detection of beta 3-AR mRNA in the gut mucosa and submucosa suggests that in addition to its established roles in lipolysis, thermogenesis and regulation of gut motility beta 3-AR may subserve other functions in the gastrointestinal tract. The absence of beta 3-AR mRNA in rat heart or its presence with

[Construction of recombinant lentiviral vector of Tie2-RNAi and its influence on malignant melanoma cells in vitro].

PubMed

Shan, Xiu-ying; Liu, Zhao-liang; Wang, Biao; Guo, Guo-xiang; Wang, Mei-shui; Zhuang, Fu-lian; Cai, Chuan-shu; Zhang, Ming-feng; Zhang, Yan-ding

2011-07-01

To construct lentivector carrying Tie2-Small interfering RNA (SiRNA), so as to study its influence on malignant melanoma cells. Recombinant plasmid pSilencer 1.0-U6-Tie2-siRNA and plasmid pNL-EGFP were digested with XbaI, ligated a target lentiviral transfer plasmid of pNL-EGFP-U6-Tie2-I or pNL-EGFP-U6-Tie2-II, and then the electrophoresis clones was sequenced. Plasmids of pNL-EGFP-U6-Tie2-I and pNL-EGFP-U6-Tie2-II were constructed and combined with pVSVG and pHelper, respectively, to constitute lentiviral vector system of three plasmids. The Lentiviral vector system was transfected into 293T cell to produce pNL-EGFP-U6-Tie2- I and pNL-EGFP-U6-Tie2-II lentivirus. Then the supernatant was collected to determine the titer. Malignant melanoma cells were infected by both lentiviruses and identified by Realtime RT-PCR to assess inhibitory efficiency. The recombinant lentiviral vectors of Tie2-RNAi were constructed successfully which were analyzed with restriction enzyme digestion and identified by sequencing. And the titer of lentiviral vector was 8.8 x 10(3)/ml, which was determined by 293T cell. The results of Realtime RT-PCR demonstrated that the lentiviral vectors of Tie2-RNAi could infect malignant melanoma cells and inhibit the expression of Tie2 genes in malignant melanoma cells (P<0.01). There was no significant difference in the expression level (P>0.05) between the two lentiviral vectors of Tie2-RNAi. Lentivector carrying Tie2-SiRNA can be constructed successfully and inhibit the expression of Tie2 gene in vitro significantly. The study will supply the theory basis for the further research on the inhibition of tumor growth in vivo.

Tissue- and Time-Specific Expression of Otherwise Identical tRNA Genes

PubMed Central

Adir, Idan; Dahan, Orna; Broday, Limor; Pilpel, Yitzhak; Rechavi, Oded

2016-01-01

Codon usage bias affects protein translation because tRNAs that recognize synonymous codons differ in their abundance. Although the current dogma states that tRNA expression is exclusively regulated by intrinsic control elements (A- and B-box sequences), we revealed, using a reporter that monitors the levels of individual tRNA genes in Caenorhabditis elegans, that eight tryptophan tRNA genes, 100% identical in sequence, are expressed in different tissues and change their expression dynamically. Furthermore, the expression levels of the sup-7 tRNA gene at day 6 were found to predict the animal’s lifespan. We discovered that the expression of tRNAs that reside within introns of protein-coding genes is affected by the host gene’s promoter. Pairing between specific Pol II genes and the tRNAs that are contained in their introns is most likely adaptive, since a genome-wide analysis revealed that the presence of specific intronic tRNAs within specific orthologous genes is conserved across Caenorhabditis species. PMID:27560950

Impact of STAT/SOCS mRNA Expression Levels after Major Injury

PubMed Central

Brumann, M.; Matz, M.; Kusmenkov, T.; Stegmaier, J.; Biberthaler, P.; Kanz, K.-G.; Mutschler, W.; Bogner, V.

2014-01-01

Background. Fulminant changes in cytokine receptor signalling might provoke severe pathological alterations after multiple trauma. The aim of this study was to evaluate the posttraumatic imbalance of the innate immune system with a special focus on the STAT/SOCS family. Methods. 20 polytraumatized patients were included. Blood samples were drawn 0 h–72 h after trauma; mRNA expression profiles of IL-10, STAT 3, SOCS 1, and SOCS 3 were quantified by qPCR. Results. IL-10 mRNA expression increased significantly in the early posttraumatic period. STAT 3 mRNA expressions showed a significant maximum at 6 h after trauma. SOCS 1 levels significantly decreased 6 h–72 h after trauma. SOCS 3 levels were significantly higher in nonsurvivors 6 h after trauma. Conclusion. We present a serial, sequential investigation in human neutrophil granulocytes of major trauma patients evaluating mRNA expression profiles of IL-10, STAT 3, SOCS 1, and SOCS 3. Posttraumatically, immune disorder was accompanied by a significant increase of IL-10 and STAT 3 mRNA expression, whereas SOCS 1 mRNA levels decreased after injury. We could demonstrate that death after trauma was associated with higher SOCS 3 mRNA levels already at 6 h after trauma. To support our results, further investigations have to evaluate protein levels of STAT/SOCS family in terms of posttraumatic immune imbalance. PMID:24648661

Characterization of constitutive and putative differentially expressed mRNAs by means of expressed sequence tags, differential display reverse transcriptase-PCR and randomly amplified polymorphic DNA-PCR from the sand fly vector Lutzomyia longipalpis.

PubMed

Ramalho-Ortigão, J M; Temporal, P; de Oliveira , S M; Barbosa, A F; Vilela, M L; Rangel, E F; Brazil, R P; Traub-Cseko, Y M

2001-01-01

Molecular studies of insect disease vectors are of paramount importance for understanding parasite-vector relationship. Advances in this area have led to important findings regarding changes in vectors' physiology upon blood feeding and parasite infection. Mechanisms for interfering with the vectorial capacity of insects responsible for the transmission of diseases such as malaria, Chagas disease and dengue fever are being devised with the ultimate goal of developing transgenic insects. A primary necessity for this goal is information on gene expression and control in the target insect. Our group is investigating molecular aspects of the interaction between Leishmania parasites and Lutzomyia sand flies. As an initial step in our studies we have used random sequencing of cDNA clones from two expression libraries made from head/thorax and abdomen of sugar fed L. longipalpis for the identification of expressed sequence tags (EST). We applied differential display reverse transcriptase-PCR and randomly amplified polymorphic DNA-PCR to characterize differentially expressed mRNA from sugar and blood fed insects, and, in one case, from a L. (V.) braziliensis-infected L. longipalpis. We identified 37 cDNAs that have shown homology to known sequences from GeneBank. Of these, 32 cDNAs code for constitutive proteins such as zinc finger protein, glutamine synthetase, G binding protein, ubiquitin conjugating enzyme. Three are putative differentially expressed cDNAs from blood fed and Leishmania-infected midgut, a chitinase, a V-ATPase and a MAP kinase. Finally, two sequences are homologous to Drosophila melanogaster gene products recently discovered through the Drosophila genome initiative.

Development of an Expression Vector to Overexpress or Downregulate Genes in Curvularia protuberata.

PubMed

Liu, Chengke; Cleckler, Blake; Morsy, Mustafa

2018-05-05

Curvularia protuberata , an endophytic fungus in the Ascomycota, provides plants with thermotolerance only when it carries a mycovirus known as Curvularia thermotolerance virus (CThTV), and forms a three-way symbiotic relationship among these organisms. Under heat stress, several genes are expressed differently between virus-free C. protuberata (VF) and C. protuberata carrying CThTV (AN). We developed an expression vector, pM2Z-fun, carrying a zeocin resistance gene driven by the ToxA promoter, to study gene functions in C. protuberata to better understand this three-way symbiosis. Using this new 3.7-kb vector, five genes that are differentially expressed in C. protuberata —including genes involved in the trehalose, melanin, and catalase biosynthesis pathways—were successfully overexpressed or downregulated in VF or AN C. protuberata strains, respectively. The VF overexpression lines showed higher metabolite and enzyme activity than in the control VF strain. Furthermore, downregulation of expression of the same genes in the AN strain resulted in lower metabolite and enzyme activity than in the control AN strain. The newly generated expression vector, pM2Z-fun, has been successfully used to express target genes in C. protuberata and will be useful in further functional expression studies in other Ascomycota fungi.

Circular RNA HIPK3 promotes gallbladder cancer cell growth by sponging microRNA-124.

PubMed

Kai, Ding; Yannian, Liao; Yitian, Chen; Dinghao, Gong; Xin, Zhao; Wu, Ji

2018-06-18

Recent studies have implied that circHIPK3, an abundant circular RNA (circRNA), participates in tumorigenesis and cancer progression. Its expression and potential functions in human gallbladder cancer were examined in this study. We show that circHIPK3 is upregulated in human gallbladder cancer cells. But its level is low in gallbladder epithelial cells. circHIPK3 silencing by targeted siRNA potently inhibited survival and proliferation of established and primary human gallbladder cancer cells, while inducing cell apoptosis. Conversely, ectopic over-expression of circHIPK3 can further promote cancer cell proliferation. In gallbladder cancer cells, circHIPK3 sponged the tumor-suppressive microRNA-124 (miR-124) to sequester and inhibit its activity, thereby leading to increased expression of miR-124 targets, including ROCK1 (rho-associated protein kinase 1) and CDK6 (rho-associated protein kinase). Ectopic over-expression of miR-124 b y a lentiviral vector mimicked and abolished actions by circHIPK3 siRNA in gallbladder cancer cells. At last, we show that circHIPK3 is upregulated in human gallbladder cancer tissues, which is correlated with miR-124 downregulation and ROCK1-CDK6 upregulation. Together, we conclude that circHIPK3 promotes gallbladder cancer cell growth possibly by sponging miR-124. The over-expressed circHIPK3 could be a novel therapeutic target and diagnosis marker of human gallbladder cancer. Copyright © 2018. Published by Elsevier Inc.

RNA Editing Modulates Human Hepatic Aryl Hydrocarbon Receptor Expression by Creating MicroRNA Recognition Sequence.

PubMed

Nakano, Masataka; Fukami, Tatsuki; Gotoh, Saki; Takamiya, Masataka; Aoki, Yasuhiro; Nakajima, Miki

2016-01-08

Adenosine to inosine (A-to-I) RNA editing is the most frequent type of post-transcriptional nucleotide conversion in humans, and it is catalyzed by adenosine deaminase acting on RNA (ADAR) enzymes. In this study we investigated the effect of RNA editing on human aryl hydrocarbon receptor (AhR) expression because the AhR transcript potentially forms double-stranded structures, which are targets of ADAR enzymes. In human hepatocellular carcinoma-derived Huh-7 cells, the ADAR1 knockdown reduced the RNA editing levels in the 3'-untranslated region (3'-UTR) of the AhR transcript and increased the AhR protein levels. The ADAR1 knockdown enhanced the ligand-mediated induction of CYP1A1, a gene downstream of AhR. We investigated the possibility that A-to-I RNA editing creates miRNA targeting sites in the AhR mRNA and found that the miR-378-dependent down-regulation of AhR was abolished by ADAR1 knockdown. These results indicated that the ADAR1-mediated down-regulation of AhR could be attributed to the creation of a miR-378 recognition site in the AhR 3'-UTR. The interindividual differences in the RNA editing levels within the AhR 3'-UTR in a panel of 32 human liver samples were relatively small, whereas the differences in ADAR1 expression were large (220-fold). In the human liver samples a significant inverse association was observed between the miR-378 and AhR protein levels, suggesting that the RNA-editing-dependent down-regulation of AhR by miR-378 contributes to the variability in the constitutive hepatic expression of AhR. In conclusion, this study uncovered for the first time that A-to-I RNA editing modulates the potency of xenobiotic metabolism in the human liver. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Transgene Expression and Host Cell Responses to Replication-Defective, Single-Cycle, and Replication-Competent Adenovirus Vectors.

PubMed

Crosby, Catherine M; Barry, Michael A

2017-02-18

Most adenovirus (Ad) vectors are E1 gene deleted replication defective (RD-Ad) vectors that deliver one transgene to the cell and all expression is based on that one gene. In contrast, E1-intact replication-competent Ad (RC-Ad) vectors replicate their DNA and their transgenes up to 10,000-fold, amplifying transgene expression markedly higher than RD-Ad vectors. While RC-Ad are more potent, they run the real risk of causing adenovirus infections in vector recipients and those that administer them. To gain the benefits of transgene amplification, but avoid the risk of Ad infections, we developed "single cycle" Ad (SC-Ad) vectors. SC-Ads amplify transgene expression and generated markedly stronger and more persistent immune responses than RD-Ad as expected. However, they also unexpectedly generated stronger immune responses than RC-Ad vectors. To explore the basis of this potency here, we compared gene expression and the cellular responses to infection to these vectors in vitro and in vivo. In vitro, in primary human lung epithelial cells, SC- and RC-Ad amplified their genomes more than 400-fold relative to RD-Ad with higher replication by SC-Ad. This replication translated into higher green fluorescent protein (GFP) expression for 48 h by SC- and RC-Ad than by RD-Ad. In vitro, in the absence of an immune system, RD-Ad expression became higher by 72 h coincident with cell death mediated by SC- and RC-Ad and release of transgene product from the dying cells. When the vectors were compared in human THP-1 Lucia- interferon-stimulated gene (ISG) cells, which are a human monocyte cell line that have been modified to quantify ISG activity, RC-Ad6 provoked significantly stronger ISG responses than RD- or SC-Ad. In mice, intravenous or intranasal injection produced up to 100-fold genome replication. Under these in vivo conditions in the presence of the immune system, luciferase expression by RC and SC-Ad was markedly higher than that by RD-Ad. In immunodeficient mice, SC

Alterations in Bronchial Airway miRNA Expression for Lung Cancer Detection.

PubMed

Pavel, Ana B; Campbell, Joshua D; Liu, Gang; Elashoff, David; Dubinett, Steven; Smith, Kate; Whitney, Duncan; Lenburg, Marc E; Spira, Avrum

2017-11-01

We have previously shown that gene expression alterations in normal-appearing bronchial epithelial cells can serve as a lung cancer detection biomarker in smokers. Given that miRNAs regulate airway gene expression responses to smoking, we evaluated whether miRNA expression is also altered in the bronchial epithelium of smokers with lung cancer. Using epithelial brushings from the mainstem bronchus of patients undergoing bronchoscopy for suspected lung cancer (as part of the AEGIS-1/2 clinical trials), we profiled miRNA expression via small-RNA sequencing from 347 current and former smokers for which gene expression data were also available. Patients were followed for one year postbronchoscopy until a final diagnosis of lung cancer ( n = 194) or benign disease ( n = 153) was made. Following removal of 6 low-quality samples, we used 138 patients (AEGIS-1) as a discovery set to identify four miRNAs (miR-146a-5p, miR-324-5p, miR-223-3p, and miR-223-5p) that were downregulated in the bronchial airway of lung cancer patients (ANOVA P < 0.002, FDR < 0.2). The expression of these miRNAs is significantly more negatively correlated with the expression of their mRNA targets than with the expression of other nontarget genes (K-S P < 0.05). Furthermore, these mRNA targets are enriched among genes whose expression is elevated in cancer patients (GSEA FDR < 0.001). Finally, we found that the addition of miR-146a-5p to an existing mRNA biomarker for lung cancer significantly improves its performance (AUC) in the 203 samples (AEGIS-1/2) serving an independent test set (DeLong P < 0.05). Our findings suggest that there are miRNAs whose expression is altered in the cytologically normal bronchial epithelium of smokers with lung cancer, and that they may regulate cancer-associated gene expression differences. Cancer Prev Res; 10(11); 651-9. ©2017 AACR . ©2017 American Association for Cancer Research.

In Situ Detection of MicroRNA Expression with RNAscope Probes.

PubMed

Yin, Viravuth P

2018-01-01

Elucidating the spatial resolution of gene transcripts provides important insight into potential gene function. MicroRNAs are short, singled-stranded noncoding RNAs that control gene expression through base-pair complementarity with target mRNAs in the 3' untranslated region (UTR) and inhibiting protein expression. However, given their small size of ~22- to 24-nt and low expression levels, standard in situ hybridization detection methods are not amendable for microRNA spatial resolution. Here, I describe a technique that employs RNAscope probe design and propriety amplification technology that provides simultaneous single molecule detection of individual microRNA and its target gene. This method allows for rapid and sensitive detection of noncoding RNA transcripts in frozen tissue sections.

[Expression profiles of miRNA-182 and Clock mRNA in the pineal gland of neonatal rats with hypoxic-ischemic brain damage].

PubMed

Han, Xing; Ding, Xin; Xu, Li-Xiao; Liu, Ming-Hua; Feng, Xing

2016-03-01