RNA interference of tubulin genes has lethal effects in Mythimna separate.

PubMed

Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji

2018-05-23

RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.

Ethical Perspectives on RNA Interference Therapeutics

PubMed Central

Ebbesen, Mette; Jensen, Thomas G.; Andersen, Svend; Pedersen, Finn Skou

2008-01-01

RNA interference is a mechanism for controlling normal gene expression which has recently begun to be employed as a potential therapeutic agent for a wide range of disorders, including cancer, infectious diseases and metabolic disorders. Clinical trials with RNA interference have begun. However, challenges such as off-target effects, toxicity and safe delivery methods have to be overcome before RNA interference can be considered as a conventional drug. So, if RNA interference is to be used therapeutically, we should perform a risk-benefit analysis. It is ethically relevant to perform a risk-benefit analysis since ethical obligations about not inflicting harm and promoting good are generally accepted. But the ethical issues in RNA interference therapeutics not only include a risk-benefit analysis, but also considerations about respecting the autonomy of the patient and considerations about justice with regard to the inclusion criteria for participation in clinical trials and health care allocation. RNA interference is considered a new and promising therapeutic approach, but the ethical issues of this method have not been greatly discussed, so this article analyses these issues using the bioethical theory of principles of the American bioethicists, Tom L. Beauchamp and James F. Childress. PMID:18612370

Gene silencing efficiency and INF-β induction effects of splicing miRNA 155-based artificial miRNA with pre-miRNA stem-loop structures.

PubMed

Sin, Onsam; Mabiala, Prudence; Liu, Ye; Sun, Ying; Hu, Tao; Liu, Qingzhen; Guo, Deyin

2012-02-01

Artificial microRNA (miRNA) expression vectors have been developed and used for RNA interference. The secondary structure of artificial miRNA is important for RNA interference efficacy. We designed two groups of six artificial splicing miRNA 155-based miRNAs (SM155-based miRNAs) with the same target in the coding region or 3' UTR of a target gene and studied their RNA silencing efficiency and interferon β (IFN-β) induction effects. SM155-based miRNA with a mismatch at the +1 position and a bulge at the +11, +12 positions in a miRNA precursor stem-loop structure showed the highest gene silencing efficiency and lowest IFN-β induction effect (increased IFN-β mRNA level by 10% in both target cases), regardless of the specificity of the target sequence, suggesting that pSM155-based miRNA with this design could be a valuable miRNA expression vector.

RNA interference-mediated NOTCH3 knockdown induces phenotype switching of vascular smooth muscle cells in vitro

PubMed Central

Liu, Nan; Li, Ying; Chen, Hui; Wei, Wei; An, Yulin; Zhu, Guangming

2015-01-01

Notch3 plays an important role in differentiation, migration and signal transduction of vascular smooth muscle cells (VSMCs). In this study, we used RNA interference (RNAi) technique to investigate the effect of knocking down the expression of the NOTCH3 gene in VSMCs on the phenotype determination under pathologic status. Real-time PCR and Western Blot experiments verified the expression levels of Notch3 mRNA and protein were reduced more than 40% and 50% in the NOTCH3 siRNA group. When the expression of Notch3 was decreased, the proliferation, apoptosis and immigration of VSMCs were enhanced compared to control groups (P < 0.01). NOTCH3 siRNA VSMCs observed using confocal microscopy showed abnormal nuclear configuration, a disorganized actin filament system, polygonal cell shapes, and decreasing cell sizes. Additionally, knocking down the expression of NOTCH3 may evoke the CASR and FAK expression. In Conclusion, interfering with the expression of NOTCH3 causes VSMCs to exhibit an intermediate phenotype. CaSR and FAK may be involved in the Notch3 signaling pathway. PMID:26550181

RNA interference-mediated NOTCH3 knockdown induces phenotype switching of vascular smooth muscle cells in vitro.

PubMed

Liu, Nan; Li, Ying; Chen, Hui; Wei, Wei; An, Yulin; Zhu, Guangming

2015-01-01

Notch3 plays an important role in differentiation, migration and signal transduction of vascular smooth muscle cells (VSMCs). In this study, we used RNA interference (RNAi) technique to investigate the effect of knocking down the expression of the NOTCH3 gene in VSMCs on the phenotype determination under pathologic status. Real-time PCR and Western Blot experiments verified the expression levels of Notch3 mRNA and protein were reduced more than 40% and 50% in the NOTCH3 siRNA group. When the expression of Notch3 was decreased, the proliferation, apoptosis and immigration of VSMCs were enhanced compared to control groups (P < 0.01). NOTCH3 siRNA VSMCs observed using confocal microscopy showed abnormal nuclear configuration, a disorganized actin filament system, polygonal cell shapes, and decreasing cell sizes. Additionally, knocking down the expression of NOTCH3 may evoke the CASR and FAK expression. In Conclusion, interfering with the expression of NOTCH3 causes VSMCs to exhibit an intermediate phenotype. CaSR and FAK may be involved in the Notch3 signaling pathway.

[Expression of Jagged1 mRNA in human epithelial ovarian carcinoma tissues and effect of RNA interference of Jagged1 on growth of xenograft in nude mice].

PubMed

Liu, G Y; Gao, Z H; Li, L; Song, T T; Sheng, X G

2016-06-25

To investigate the expression of Jagged1 in human epithelial ovarian carcinoma tissues and the effect of Jagged1 on growth of xenograft in nude mice. (1) Forty-eight cases of ovarian cancer and 30 cases of patients with benign epithelial ovarian tumor in the Henan Province Xinxiang Central Hospital during Feb. 2011 to Mar. 2014 were enrolled in this study. The mRNA expression of Jagged1, Notch1 and the downstream target genes Hes1, Hey1 were analyzed by using realtime PCR method. (2) The ovarian cancer xenograft models in nude mice were constructed by injecting SKOV3 cells in axillary subcutaneouswere. The nude mice were randomly divided into Jagged1 interference group, blank plasmid group and control group. Each group had 10 mice. They were transfected with pcDNA3.1(+)-siRNA-Jagged1, blank plasmid pDC3.1 and phosphate buffer, respectively. The tumor volumes and tumor masses were measured 14 days after transfection and the inhibition rate was calculated. The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues after transfection in each group was detected by using realtime PCR technique and the relative protein expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues was detected by utilizing western blot method. (1) The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in ovarian cancer tissues were higher than benign ovarian tumor tissues, the differences were statistically significant (P<0.01). (2) The tumor volume was (491± 68) mm(3) and tumor mass was (2.6±0.4) g in Jagged1 interference group, which were significantly lower than that in the blank plasmid group [(842±88) mm(3) and (4.4±0.8) g, respectively] and that in the control group [(851±90) mm(3) and (4.5±0.9) g, respectively; P<0.05], the tumor inhibition rate was 42.2% in Jagged1 interference group, which was significantly higher than that in the blank plasmid group and that in the control group (2.2% and 0, respectively), the differences were statistically significant (P<0.05). The relative mRNA and protein expression of Jagged1, Hes1 and Hey1 in xenograft tissues of nude micein Jagged1 interference group were lower than that in the other two groups, the differences were statistically significant (P<0.05). There were no differences of relative mRNA and protein expression of Notch1 in xenograft tissues of nude mice among the three groups (P>0.05). Jagged1 is highly expressed in epithelial ovarian carcinoma. Jagged1 gene interference in xenograft tumor can inhibit ovarian cancer cell growth and improve tumor suppressor rate, which probably play roles by inhibiting Notch1 signaling pathway.

Hypoxia-inducible factor 1–mediated human GATA1 induction promotes erythroid differentiation under hypoxic conditions

PubMed Central

Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu

2012-01-01

Abstract Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type–specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34+ haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl2 induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. PMID:22050843

Expression and RNA interference of salivary polygalacturonase genes in the tarnished plant bug, Lygus lineolaris.

PubMed

Walker, William B; Allen, Margaret L

2010-01-01

Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris.

Knockdown of RNA interference pathway genes impacts the fitness of western corn rootworm.

PubMed

Davis-Vogel, Courtney; Ortiz, Angel; Procyk, Lisa; Robeson, Jonathan; Kassa, Adane; Wang, Yiwei; Huang, Emily; Walker, Carl; Sethi, Amit; Nelson, Mark E; Sashital, Dipali G

2018-05-18

Western corn rootworm (Diabrotica virgifera virgifera) is a serious agricultural pest known for its high adaptability to various management strategies, giving rise to a continual need for new control options. Transgenic maize expressing insecticidal RNAs represents a novel mode of action for rootworm management that is dependent on the RNA interference (RNAi) pathways of the insect for efficacy. Preliminary evidence suggests that western corn rootworm could develop broad resistance to all insecticidal RNAs through changes in RNAi pathway genes; however, the likelihood of field-evolved resistance occurring through this mechanism remains unclear. In the current study, eight key genes involved in facilitating interference in the microRNA and small interfering RNA pathways were targeted for knockdown in order to evaluate impact on fitness of western corn rootworm. These genes include drosha, dicer-1, dicer-2, pasha, loquacious, r2d2, argonaute 1, and argonaute 2. Depletion of targeted transcripts in rootworm larvae led to changes in microRNA expression, decreased ability to pupate, reduced adult beetle emergence, and diminished reproductive capacity. The observed effects do not support evolution of resistance through changes in expression of these eight genes due to reduced insect fitness.

Trojan Horse Strategy for Non-invasive Interference of Clock Gene in the Oyster Crassostrea gigas.

PubMed

Payton, Laura; Perrigault, Mickael; Bourdineaud, Jean-Paul; Marcel, Anjara; Massabuau, Jean-Charles; Tran, Damien

2017-08-01

RNA interference is a powerful method to inhibit specific gene expression. Recently, silencing target genes by feeding has been successfully carried out in nematodes, insects, and small aquatic organisms. A non-invasive feeding-based RNA interference is reported here for the first time in a mollusk bivalve, the pacific oyster Crassostrea gigas. In this Trojan horse strategy, the unicellular alga Heterocapsa triquetra is the food supply used as a vector to feed oysters with Escherichia coli strain HT115 engineered to express the double-stranded RNA targeting gene. To test the efficacy of the method, the Clock gene, a central gene of the circadian clock, was targeted for knockout. Results demonstrated specific and systemic efficiency of the Trojan horse strategy in reducing Clock mRNA abundance. Consequences of Clock disruption were observed in Clock-related genes (Bmal, Tim1, Per, Cry1, Cry2, Rev.-erb, and Ror) and triploid oysters were more sensitive than diploid to the interference. This non-invasive approach shows an involvement of the circadian clock in oyster bioaccumulation of toxins produced by the harmful alga Alexandrium minutum.

Chemical modification: the key to clinical application of RNA interference?

PubMed Central

Corey, David R.

2007-01-01

RNA interference provides a potent and specific method for controlling gene expression in human cells. To translate this potential into a broad new family of therapeutics, it is necessary to optimize the efficacy of the RNA-based drugs. As discussed in this Review, it might be possible to achieve this optimization using chemical modifications that improve their in vivo stability, cellular delivery, biodistribution, pharmacokinetics, potency, and specificity. PMID:18060019

A simple and robust vector-based shRNA expression system used for RNA interference.

PubMed

Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

2013-01-01

RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

RNA Interference Based Approach to Down Regulate Osmoregulators of Whitefly (Bemisia tabaci): Potential Technology for the Control of Whitefly

USDA-ARS?s Scientific Manuscript database

Over the past decade RNA interference (RNAi) technology has emerged as a successful tool not only for functional genomics, but in planta expression of short interfering RNAs (siRNAs) could offer potential for insect pest management. Insects feeding exclusively on plant sap depend on osmotic pressure...

Expression and RNA Interference of Salivary Polygalacturonase Genes in the Tarnished Plant Bug, Lygus lineolaris

PubMed Central

Walker, William B.; Allen, Margaret L.

2010-01-01

Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris. PMID:21062205

Specificity Protein (Sp) Transcription Factors and Metformin Regulate Expression of the Long Non-coding RNA HULC

EPA Science Inventory

There is evidence that specificity protein 1 (Sp1) transcription factor (TF) regulates expression of long non-coding RNAs (lncRNAs) in hepatocellular carcinoma (HCC) cells. RNA interference (RNAi) studies showed that among several lncRNAs expressed in HepG2, SNU-449 and SK-Hep-1...

[Wnt/β-catenin pathway involved in the regulation of rat mesangial cell proliferation by adipose-derived mesenchymal stem cells].

PubMed

Li, Zhi; Zhang, Mengying; Li, Xueqin; Lu, Jinming; Xu, Liang

2016-11-01

Objective To investigate the effect of adipose-derived mesenchymal stem cells (ADSCs) on glomerular mesangial cell proliferation via Wnt/β-catenin pathway. Methods The rat glomerular mesangial cells (HBZY-1) were incubated in conditioned ADSC medium. Cell cycle was analyzed with flow cytometry; the proliferation rate of HBZY-1 and the expression levels of relative genes and proteins of Wnt signaling pathway were measured using RNA interference, quantitative real-time PCR and Western blotting, respectively. Results HBZY-1 proliferation was significantly inhibited under the action of conditioned ADSC medium, whereas dickkopf WNT signaling pathway inhibitor 1 (DKK1) mRNA level was up-regulated. Fibronectin and TGF-β1 mRNA expression as well as β-catenin and Bcl-2 protein levels of HBZY-1 were significantly down-regulated. DKK1 gene expression level in ADSCs was significantly higher than that of HBZY-1. After RNA interference, DKK1 expression level in ADSCs was markedly inhibited, yet the β-catenin protein level was notably elevated. The β-catenin and Bcl-2 protein levels of HBZY-1 were also significantly raised in HBZY-1 after cultured with conditioned medium containing ADSCs treated with RNA interference. Conclusion Wnt/β-catenin may be a potential signaling pathway involved in the regulative effect of ADSCs on glomerular mesangial cell proliferation.

SiLEncing SLE: the power and promise of small noncoding RNAs.

PubMed

Rigby, Robert J; Vinuesa, Carola G

2008-09-01

In this study, we outline the evidence suggesting that defects in the RNA silencing machinery can lead to the prototypic systemic autoimmune disease, systemic lupus erythematosus, and describe the potential for RNA interference to provide novel therapeutic agents. Over the last year, a class of small noncoding RNAs--microRNAs--have been shown to play key roles in immune regulation including T-cell selection in the thymus, B cell affinity maturation and selection in germinal centres, and development of regulatory T cells, suggesting that the microRNA machinery may be crucial in the maintenance of immunological tolerance. Two RNA silencing mechanisms have been shown to be involved in lupus pathogenesis: failed Roquin-mediated repression of inducible costimulatory receptors messenger RNA through miR-101 in roquin(san/san) mice and decreased expression of pro-apoptotic molecule and phosphatase and tensin homologue on chromosome 10 in mice transgenic for the miR-17-92 cluster, leading to lymphoproliferation and other lupus manisfestations. MicroRNA array experiments performed on peripheral blood mononuclear cells have revealed different expression profiles in systemic lupus erythematosus patients. RNA interference has also been used ex vivo to silence dysregulated T-cell molecules in cells from systemic lupus erythematosus patients. Dysregulation of the RNA silencing machinery has been implicated in systemic lupus erythematosus pathogenesis. Although microRNA profiling may prove to be a useful diagnostic and prognostic tool for a notoriously heterogeneous disease, manipulation of RNA interference emerges as a powerful and potentially specific means to correct dysregulated gene expression in systemic lupus erythematosus patients.

The protective effect of Hif3a RNA interference and HIF-prolyl hydroxylase inhibition on cardiomyocytes under anoxia-reoxygenation.

PubMed

Drevytska, T; Gonchar, E; Okhai, I; Lynnyk, O; Mankovska, I; Klionsky, D; Dosenko, V

2018-06-01

The aim of this study was to investigate the molecular mechanisms underlying the protective effects of hypoxia-inducible factor (HIF) signaling pathway activation in cardiomyocytes under anoxia-reoxygenation (A/R) injury. In this study, rat neonatal cardiomyocytes were pretreated with anti-Hif3A/Hif-3α siRNA or HIF-prolyl hydroxylase inhibitor prior to A/R injury. Our results showed that both HIF3A silencing and HIF-prolyl hydroxylase inhibition effectively increased the cell viability during A/R, led to changes in mRNA expression of HIF1-target genes, and reduced the loss of mitochondrial membrane potential (Δψ m ). Furthermore, application of anti-Hif3a siRNA led to an increase in mRNA expression of Epo, Igf1, Slc2a1/Glut-1, and Slc2a4/Glut-4. Similar results were observed with HIF-prolyl hydroxylase inhibition, which additionally upregulated the mRNA expression of Epor, Tert, and Pdk1. Hif3a RNA-interference and application of HIF-prolyl hydroxylase inhibitor during A/R modelling led to an increase of Δψ m on 11.5 and 11.9 mV respectively, compared to the control groups. Thus, Hif3a RNA interference and HIF-prolyl hydroxylase inhibition protect cardiomyocytes against A/R injury via the HIF signaling pathway. Copyright © 2018 Elsevier Inc. All rights reserved.

Immune modulation through RNA interference-mediated silencing of CD40 in dendritic cells.

PubMed

Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Samiee, Shahram; Ataee, Zahra; Tabei, Seyyed Ziyaoddin; Moazzeni, Seyed Mohammad

2009-01-01

RNA interference (RNAi) is an exciting mechanism for knocking down any target gene in transcriptional level. It is now clear that small interfering RNA (siRNA), a 19-21nt long dsRNA, can trigger a degradation process (RNAi) that specifically silences the expression of a cognate mRNA. Our findings in this study showed that down regulation of CD40 gene expression in dendritic cells (DCs) by RNAi culminated to immune modulation. Effective delivery of siRNA into DCs would be a reasonable method for the blocking of CD40 gene expression at the cell surface without any effect on other genes and cell cytotoxicity. The effects of siRNA against CD40 mRNA on the function and phenotype of DCs were investigated. The DCs were separated from the mice spleen and then cultured in vitro. By the means of Lipofectamine2000, siRNA was delivered to the cells and the efficacy of transfection was estimated by flow cytometry. By Annexine V and Propidium Iodide staining, we could evaluate the transfected cells viability. Also, the mRNA expression and protein synthesis were assessed by real-time PCR and flow cytometry, respectively. Knocking down the CD40 gene in the DCs caused an increase in IL-4 production, decrease in IL-12 production and allostimulation activity. All together, these effects would stimulate Th2 cytokines production from allogenic T-cells in vitro.

Vector-based RNA interference against vascular endothelial growth factor-A significantly limits vascularization and growth of prostate cancer in vivo.

PubMed

Wannenes, Francesca; Ciafré, Silvia Anna; Niola, Francesco; Frajese, Gaetano; Farace, Maria Giulia

2005-12-01

RNA interference technology is emerging as a very potent tool to obtain a cellular knockdown of a desired gene. In this work we used vector-based RNA interference to inhibit vascular endothelial growth factor (VEGF) expression in prostate cancer in vitro and in vivo. We demonstrated that transduction with a plasmid carrying a small interfering RNA targeting all isoforms of VEGF, dramatically impairs the expression of this growth factor in the human prostate cancer cell line PC3. As a consequence, PC3 cells loose their ability to induce one of the fundamental steps of angiogenesis, namely the formation of a tube-like network in vitro. Most importantly, our "therapeutic" vector is able to impair tumor growth rate and vascularization in vivo. We show that a single injection of naked plasmid in developing neoplastic mass significantly decreases microvessel density in an androgen-refractory prostate xenograft and is able to sustain a long-term slowing down of tumor growth. In conclusion, our results confirm the basic role of VEGF in the angiogenic development of prostate carcinoma, and suggest that the use of our vector-based RNA interference approach to inhibit angiogenesis could be an effective tool in view of future gene therapy applications for prostate cancer.

Knockdown of Midgut Genes by dsRNA-Transgenic Plant-Mediated RNA Interference in the Hemipteran Insect Nilaparvata lugens

PubMed Central

Zha, Wenjun; Peng, Xinxin; Chen, Rongzhi; Du, Bo; Zhu, Lili; He, Guangcun

2011-01-01

Background RNA interference (RNAi) is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA) directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. Methodology/Principal Findings The Hemipteran insect brown planthopper (Nilaparvata lugens Stål) is a typical phloem sap feeder specific to rice (Oryza sativa L.). To analyze the potential of exploiting RNAi-mediated effects in this insect, we identified genes (Nlsid-1 and Nlaub) encoding proteins that might be involved in the RNAi pathway in N. lugens. Both genes are expressed ubiquitously in nymphs and adult insects. Three genes (the hexose transporter gene NlHT1, the carboxypeptidase gene Nlcar and the trypsin-like serine protease gene Nltry) that are highly expressed in the N. lugens midgut were isolated and used to develop dsRNA constructs for transforming rice. RNA blot analysis showed that the dsRNAs were transcribed and some of them were processed to siRNAs in the transgenic lines. When nymphs were fed on rice plants expressing dsRNA, levels of transcripts of the targeted genes in the midgut were reduced; however, lethal phenotypic effects after dsRNA feeding were not observed. Conclusions Our study shows that genes for the RNAi pathway (Nlsid-1 and Nlaub) are present in N. lugens. When insects were fed on rice plant materials expressing dsRNAs, RNA interference was triggered and the target genes transcript levels were suppressed. The gene knockdown technique described here may prove to be a valuable tool for further investigations in N. lugens. The results demonstrate the potential of dsRNA-mediated RNAi for field-level control of planthoppers, but appropriate target genes must be selected when designing the dsRNA-transgenic plants. PMID:21655219

Advance of RNA interference technique in Hemipteran insects.

PubMed

Li, Jie; Wang, Xiaoping; Wang, Manqun; Ma, Weihua; Hua, Hongxia

2012-07-24

RNA interference (RNAi) suppressed the expression of the target genes by post transcriptional regulation and the double-stranded RNA (dsRNA) mediated gene silencing has been a conserved mechanism in many eukaryotes, which prompted RNAi to become a valuable tool for unveiling the gene function in many model insects. Recent research attested that RNAi technique can be also effective in downregulation target genes in Hemipteran insects. In this review, we collected the researches of utilizing RNAi technique in gene functional analysis in Hemipteran insects, highlighted the methods of dsRNA/siRNA uptake by insects and discussed the knock-down efficiency of these techniques. Although the RNA interference technique has drawbacks and obscure points, our primary goal of this review is try to exploit it for further discovering gene functions and pest control tactic in the Hemipteran insects. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.

Role of caspase-9 in the effector caspases and genome expressions, and growth of bovine skeletal myoblasts.

PubMed

Van Ba, Hoa; Hwang, Inho

2014-02-01

Caspase-9 has been reported as the key regulator of apoptosis, however, its role in skeletal myoblast development and molecular involvements during cell growth still remains unknown. The current study aimed to present the key role of caspase-9 in the expressions of apoptotic caspases and genome, and cell viability during myoblast growth using RNA interference mediated silencing. Three small interference RNA sequences (siRNAs) targeting caspase-9 gene was designed and ligated into pSilencer plasmid vector to construct shRNA expression constructs. Cells were transfected with the constructs for 48 h. Results indicated that all three siRNAs could silence the caspase-9 mRNA expression significantly. Particularly, the mRNA expression level of caspase-9 in the cells transfected by shRNA1, shRNA2 and shRNA3 constructs were reduced by 37.85%, 68.20% and 58.14%, respectively. Suppression of caspase-9 led to the significant increases in the mRNA and protein expressions of effector caspase-3, whereas the reduction in mRNA and protein expressions of caspase-7. The microarray results showed that the suppression of caspase-9 resulted in significant upregulations of cell proliferation-, adhesion-, growth-, development- and division-regulating genes, whereas the reduction in the expressions of cell death program- and stress response-regulating genes. Furthermore, cell viability was significantly increased following the transfection. These data suggest that caspase-9 could play an important role in the control of cell growth, and knockdown of caspase-9 may have genuine potential in the treatment of skeletal muscle atrophy. © 2013 The Authors Development, Growth & Differentiation © 2013 Japanese Society of Developmental Biologists.

[Impact of Pax-8 gene interference on mitochondrial function and cardiomyocyte apoptosis].

PubMed

Dai, Xiao-chun; Zhou, Xi; Huang, Xiao-yan; Wang, Liang-guo; Lin, Su; Yang, De-ye

2013-01-01

To observe the effects of paired box gene 8 (Pax-8) silencing by RNA interference on mitochondrial function and cardiomyocytes apoptosis. The cultured H9C2 (2-1) myocytes were divided into 3 groups: short interference RNA targeting Pax-8 (Pax-8 siRNA) group, non-specific siRNA group as the negative control (NC siRNA), and blank control group (BC siRNA). Fluorescence spectrophotometry was used to detect the activity of caspase-3. RT-PCR was performed to detect mRNA expression of Bcl2 and Bax. The protein expression of Bcl2, Bax and cytoplasm of Cytochrome was examined by Western blot. Changes of ΔΨm were detected by flow cytometry.ΔΨm with JC-1 monomer/polymer ratio was calculated for measuring mitochondrial depolarization proportion. Compared to NC siRNA and BC siRNA group (0.075 ± 0.021, 0.072 ± 0.019), the activity of caspase-3 in Pax-8 siRNA group (0.167 ± 0.012) was significantly increased (P < 0.05); Bcl2 mRNA and protein expression in Pax-8 siRNA group (0.61 ± 0.06, 0.94 ± 0.11) were significantly downregulated compared with NC siRNA group (0.90 ± 0.070, 1.39 ± 0.15) and BC siRNA group (0.94 ± 0.087, 1.49 ± 0.20) (P < 0.05); Bax mRNA and protein expression in Pax-8 siRNA group (1.05 ± 0.10, 1.25 ± 0.12) were markedly upregulated compared with NC siRNA group (0.72 ± 0.03, 0.99 ± 0.12) and BC siRNA group (0.64 ± 0.03, 0.92 ± 0.06), P < 0.05; cytosolic cytochrome expression in Pax-8 siRNA group (0.75 ± 0.14) was significantly upregulated compared with NC siRNA group (0.51 ± 0.06) and BC siRNA group (0.48 ± 0.07) (P < 0.05); JC-1 monomer/polymer ratio in Pax-8 siRNA group (0.163 ± 0.011) was significantly increased compared with NC siRNA group (0.092 ± 0.015) and BC siRNA group (0.072 ± 0.025) (P < 0.05) indicating mitochondrial membrane potential was significantly reduced in Pax-8 siRNA group. Above parameters were similar between NC siRNA group and BC siRNA group (P > 0.05). Inhibiting Pax-8 results in enhanced cardiomyocytes apoptosis through the mitochondrial pathway.

The effect of Pokemon on bladder cancer epithelial-mesenchymal transition.

PubMed

Guo, Changcheng; Zhu, Kai; Sun, Wei; Yang, Bin; Gu, Wenyu; Luo, Jun; Peng, Bo; Zheng, Junhua

2014-01-24

This study aimed at detecting Pokemon expression in bladder cancer cell and investigating the relationship between Pokemon and epithelial-mesenchymal transition. Furthermore, we investigated the functions of Pokemon in the carcinogenesis and development of bladder cancer. This study was also designed to observe the inhibitory effects of siRNA expression vector on Pokemon in bladder cancer cell. The siRNA expression vectors which were constructed to express a short hairpin RNA against Pokemon were transfected to the bladder cancer cells T24 with a liposome. Levels of Pokemon, E-cadherin and β-catenin mRNA and protein were examined by real-time quantitative-fluorescent PCR and Western blot analysis, respectively. The effects of Pokemon silencing on epithelial-mesenchymal transition of T24 cells were evaluated with wound-healing assay. Pokemon was strongly inhibited by siRNA treatment, especially siRNA3 treatment group, as it was reflected by Western blot and real-time PCR. The gene and protein of E-cadherin expression level showed increased markedly after Pokemon was inhibited by RNA interference. While there were no differences in the levels of gene and protein of β-catenin among five groups. The bladder cancer cell after Pokemon siRNA interference showed a significantly reduced wound-closing efficiency at 6, 12 and 24h. Our findings suggest Pokemon may inhibit the expression of E-cadherin. The low expression of E-cadherin lead to increasing the phenotype and apical-base polarity of epithelial cells. These changes of cells may result in the recurrence and progression of bladder cancer at last. Copyright © 2013 Elsevier Inc. All rights reserved.

The cytomegalovirus promoter-driven short hairpin RNA constructs mediate effective RNA interference in zebrafish in vivo.

PubMed

Su, Jianguo; Zhu, Zuoyan; Wang, Yaping; Xiong, Feng; Zou, Jun

2008-01-01

The ability to utilize the RNA interference (RNAi) machinery for silencing target-gene expression has created a lot of excitement in the research community. In the present study, we used a cytomegalovirus (CMV) promoter-driven DNA template approach to induce short hairpin RNA (shRNA) triggered RNAi to block exogenous Enhanced Green Fluorescent Protein (EGFP) and endogenous No Tail (NTL) gene expressions. We constructed three plasmids, pCMV-EGFP-CMV-shGFP-SV40, pCMV-EGFP-CMV-shNTL-SV40, and pCMV-EGFP-CMV-shScrambled-SV40, each containing a CMV promoter driving an EGFP reporter cDNA and DNA coding for one shRNA under the control of another CMV promoter. The three shRNA-generating plasmids and pCMV-EGFP control plasmid were introduced into zebrafish embryos by microinjection. Samples were collected at 48 h after injection. Results were evaluated by phenotype observation and real-time fluorescent quantitative reverse-transcription polymerase chain reaction (Q-PCR). The shGFP-generating plasmid significantly inhibited the EGFP expression viewed under fluorescent microscope and reduced by 70.05 +/- 1.26% of exogenous EGFP gene mRNA levels compared with controls by Q-PCR. The shRNA targeting endogenous NTL gene resulted in obvious NTL phenotype of 30 +/- 4% and decreased the level of their corresponding mRNAs up to 54.52 +/- 2.05% compared with nontargeting control shRNA. These data proved the feasibility of the CMV promoter-driven shRNA expression technique to be used to inhibit exogenous and endogenous gene expressions in zebrafish in vivo.

RNA Interference Therapies for an HIV-1 Functional Cure.

PubMed

Scarborough, Robert J; Gatignol, Anne

2017-12-27

HIV-1 drug therapies can prevent disease progression but cannot eliminate HIV-1 viruses from an infected individual. While there is hope that elimination of HIV-1 can be achieved, several approaches to reach a functional cure (control of HIV-1 replication in the absence of drug therapy) are also under investigation. One of these approaches is the transplant of HIV-1 resistant cells expressing anti-HIV-1 RNAs, proteins or peptides. Small RNAs that use RNA interference pathways to target HIV-1 replication have emerged as competitive candidates for cell transplant therapy and have been included in all gene combinations that have so far entered clinical trials. Here, we review RNA interference pathways in mammalian cells and the design of therapeutic small RNAs that use these pathways to target pathogenic RNA sequences. Studies that have been performed to identify anti-HIV-1 RNA interference therapeutics are also reviewed and perspectives on their use in combination gene therapy to functionally cure HIV-1 infection are provided.

Argonaute Proteins and Mechanisms of RNA Interference in Eukaryotes and Prokaryotes.

PubMed

Olina, A V; Kulbachinskiy, A V; Aravin, A A; Esyunina, D M

2018-05-01

Noncoding RNAs play essential roles in genetic regulation in all organisms. In eukaryotic cells, many small noncoding RNAs act in complex with Argonaute proteins and regulate gene expression by recognizing complementary RNA targets. The complexes of Argonaute proteins with small RNAs also play a key role in silencing of mobile genetic elements and, in some cases, viruses. These processes are collectively called RNA interference. RNA interference is a powerful tool for specific gene silencing in both basic research and therapeutic applications. Argonaute proteins are also found in prokaryotic organisms. Recent studies have shown that prokaryotic Argonautes can also cleave their target nucleic acids, in particular DNA. This activity of prokaryotic Argonautes might potentially be used to edit eukaryotic genomes. However, the molecular mechanisms of small nucleic acid biogenesis and the functions of Argonaute proteins, in particular in bacteria and archaea, remain largely unknown. Here we briefly review available data on the RNA interference processes and Argonaute proteins in eukaryotes and prokaryotes.

Non-target Effects of Green Fluorescent Protein (GFP)-derived Double-Stranded RNA (dsRNA-GFP) Used in Honey Bee RNA Interference (RNAi) Assays

PubMed Central

Nunes, Francis M. F.; Aleixo, Aline C.; Barchuk, Angel R.; Bomtorin, Ana D.; Grozinger, Christina M.; Simões, Zilá L. P.

2013-01-01

RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control. PMID:26466797

Non-Target Effects of Green Fluorescent Protein (GFP)-Derived Double-Stranded RNA (dsRNA-GFP) Used in Honey Bee RNA Interference (RNAi) Assays.

PubMed

Nunes, Francis M F; Aleixo, Aline C; Barchuk, Angel R; Bomtorin, Ana D; Grozinger, Christina M; Simões, Zilá L P

2013-01-04

RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control.

Global effects of the CSR-1 RNA interference pathway on the transcriptional landscape.

PubMed

Cecere, Germano; Hoersch, Sebastian; O'Keeffe, Sean; Sachidanandam, Ravi; Grishok, Alla

2014-04-01

Argonaute proteins and their small RNA cofactors short interfering RNAs are known to inhibit gene expression at the transcriptional and post-transcriptional levels. In Caenorhabditis elegans, the Argonaute CSR-1 binds thousands of endogenous siRNAs (endo-siRNAs) that are antisense to germline transcripts. However, its role in gene expression regulation remains controversial. Here we used genome-wide profiling of nascent RNA transcripts and found that the CSR-1 RNA interference pathway promoted sense-oriented RNA polymerase II transcription. Moreover, a loss of CSR-1 function resulted in global increase in antisense transcription and ectopic transcription of silent chromatin domains, which led to reduced chromatin incorporation of centromere-specific histone H3. On the basis of these findings, we propose that the CSR-1 pathway helps maintain the directionality of active transcription, thereby propagating the distinction between transcriptionally active and silent genomic regions.

RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding.

PubMed

Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung

2014-01-01

RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties.

RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding

PubMed Central

Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung

2014-01-01

RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties. PMID:25332689

Ribonucleic acid interference knockdown of interleukin 6 attenuates cold-induced hypertension.

PubMed

Crosswhite, Patrick; Sun, Zhongjie

2010-06-01

The purpose of this study was to determine the role of the proinflammatory cytokine interleukin (IL) 6 in cold-induced hypertension. Four groups of male Sprague-Dawley rats were used (6 rats per group). After blood pressure was stabilized, 3 groups received intravenous delivery of adenoassociated virus carrying IL-6 small hairpin RNA (shRNA), adenoassociated virus carrying scrambled shRNA, and PBS, respectively, before exposure to a cold environment (5 degrees C). The last group received PBS and was kept at room temperature (25 degrees C, warm) as a control. Adenoassociated virus delivery of IL-6 shRNA significantly attenuated cold-induced elevation of systolic blood pressure and kept it at the control level for < or =7 weeks (length of the study). Chronic exposure to cold upregulated IL-6 expression in aorta, heart, and kidneys and increased macrophage and T-cell infiltration in kidneys, suggesting that cold exposure increases inflammation. IL-6 shRNA delivery abolished the cold-induced upregulation of IL-6, indicating effective silence of IL-6. Interestingly, RNA interference knockdown of IL-6 prevented cold-induced inflammation, as evidenced by a complete inhibition of tumor necrosis factor-alpha expression and leukocyte infiltration by IL-6 shRNA. RNA interference knockdown of IL-6 significantly decreased the cold-induced increase in vascular superoxide production. It is noted that IL-6 shRNA abolished the cold-induced increase in collagen deposition in the heart, suggesting that inflammation is involved in cold-induced cardiac remodeling. Cold exposure caused glomerular collapses, which could be prevented by knockdown of IL-6, suggesting an important role of inflammation in cold-induced renal damage. In conclusion, cold exposure increased IL-6 expression and inflammation, which play critical roles in the pathogenesis of cold-induced hypertension and cardiac and renal damage.

RNA interference: from biology to drugs and therapeutics.

PubMed

Appasani, Krishnarao

2004-07-01

RNA interference (RNAi) is a newly discovered and popular technology platform among researchers not only in the fields of RNA biology and molecular cell biology. It has created excitement in clinical sciences such as oncology, neurology, endocrinology, infectious diseases and drug discovery. There is an urgent need to educate and connect academic and industry researchers for the purpose of knowledge transfer. Thus, GeneExpression Systems of Waltham organized its Second International Conference in Waltham City (May 2-4, 2004, MA, USA) on the theme of 'RNA interference: From Biology to Drugs & Therapeutics.' About 200 participants and 32 speakers attended this two and half-day event which was arranged in six scientific and three technology sessions and ended with a panel discussion. This report covers a few representative talks from academia, biotech and the drug industry.

PAMP-induced defense responses in potato require both salicylic acid and jasmonic acid.

PubMed

Halim, Vincentius A; Altmann, Simone; Ellinger, Dorothea; Eschen-Lippold, Lennart; Miersch, Otto; Scheel, Dierk; Rosahl, Sabine

2009-01-01

To elucidate the molecular mechanisms underlying pathogen-associated molecular pattern (PAMP)-induced defense responses in potato (Solanum tuberosum), the role of the signaling compounds salicylic acid (SA) and jasmonic acid (JA) was analyzed. Pep-13, a PAMP from Phytophthora, induces the accumulation of SA, JA and hydrogen peroxide, as well as the activation of defense genes and hypersensitive-like cell death. We have previously shown that SA is required for Pep-13-induced defense responses. To assess the importance of JA, RNA interference constructs targeted at the JA biosynthetic genes, allene oxide cyclase and 12-oxophytodienoic acid reductase, were expressed in transgenic potato plants. In addition, expression of the F-box protein COI1 was reduced by RNA interference. Plants expressing the RNA interference constructs failed to accumulate the respective transcripts in response to wounding or Pep-13 treatment, neither did they contain significant amounts of JA after elicitation. In response to infiltration of Pep-13, the transgenic plants exhibited a highly reduced accumulation of reactive oxygen species as well as reduced hypersensitive cell death. The ability of the JA-deficient plants to accumulate SA suggests that SA accumulation is independent or upstream of JA accumulation. These data show that PAMP responses in potato require both SA and JA and that, in contrast to Arabidopsis, these compounds act in the same signal transduction pathway. Despite their inability to fully respond to PAMP treatment, the transgenic RNA interference plants are not altered in their basal defense against Phytophthora infestans.

Next-generation libraries for robust RNA interference-based genome-wide screens

PubMed Central

Kampmann, Martin; Horlbeck, Max A.; Chen, Yuwen; Tsai, Jordan C.; Bassik, Michael C.; Gilbert, Luke A.; Villalta, Jacqueline E.; Kwon, S. Chul; Chang, Hyeshik; Kim, V. Narry; Weissman, Jonathan S.

2015-01-01

Genetic screening based on loss-of-function phenotypes is a powerful discovery tool in biology. Although the recent development of clustered regularly interspaced short palindromic repeats (CRISPR)-based screening approaches in mammalian cell culture has enormous potential, RNA interference (RNAi)-based screening remains the method of choice in several biological contexts. We previously demonstrated that ultracomplex pooled short-hairpin RNA (shRNA) libraries can largely overcome the problem of RNAi off-target effects in genome-wide screens. Here, we systematically optimize several aspects of our shRNA library, including the promoter and microRNA context for shRNA expression, selection of guide strands, and features relevant for postscreen sample preparation for deep sequencing. We present next-generation high-complexity libraries targeting human and mouse protein-coding genes, which we grouped into 12 sublibraries based on biological function. A pilot screen suggests that our next-generation RNAi library performs comparably to current CRISPR interference (CRISPRi)-based approaches and can yield complementary results with high sensitivity and high specificity. PMID:26080438

Potential applications of RNA interference-based therapeutics in the treatment of cardiovascular disease.

PubMed

Hassan, Ali

2006-06-01

RNA interference (RNAi) in eukaryotes is a recently identified phenomenon in which small double stranded RNA molecules called short interfering RNA (siRNA) interact with messenger RNA (mRNA) containing homologous sequences in a sequence-specific manner. Ultimately, this interaction results in degradation of the target mRNA. Because of the high sequence specificity of the RNAi process, and the apparently ubiquitous expression of the endogenous protein components necessary for RNAi, there appears to be little limitation to the genes that can be targeted for silencing by RNAi. Thus, RNAi has enormous potential, both as a research tool and as a mode of therapy. Several recent patents have described advances in RNAi technology that are likely to lead to new treatments for cardiovascular disease. These patents have described methods for increased delivery of siRNA to cardiovascular target tissues, chemical modifications of siRNA that improve their pharmacokinetic characteristics, and expression vectors capable of expressing RNAi effectors in situ. Though RNAi has only recently been demonstrated to occur in mammalian tissues, work has advanced rapidly in the development of RNAi-based therapeutics. Recently, therapeutic silencing of apoliporotein B, the ligand for the low density lipoprotein receptor, has been demonstrated in adult mice by systemic administration of chemically modified siRNA. This demonstrates the potential for RNAi-based therapeutics, and suggests that the future for RNAi in the treatment of cardiovascular disease is bright.

The effects of RNA interference mediated VEGF gene silencing on biological behavior of renal cell carcinoma and transplanted renal tumor in nude mice.

PubMed

Wang, Qi; Wang, Shuai; Sun, Si-Qiao; Cheng, Zhi-Hua; Zhang, Yang; Chen, Guang; Gu, Meng; Yao, Hai-Jun; Wang, Zhong; Zhou, Juan; Peng, Yu-Bing; Xu, Ming-Xi; Zhang, Ke; Sun, Xi-Wei

2016-01-01

This study was to explore the effects of RNA interference mediated vascular endothelial growth factor (VEGF) gene silencing on biological behavior of renal cell carcinoma (RCC), transplanted renal tumor and angiogenesis in nude mice. The specific siRNA sequence targeting VEGF were designed and synthesized to construct hVEGF-siRNA plasmid which was transfected into RCC 786-O cells. Reverse transcriptase-polymerase chain reaction (RT-PCR) was used for the detection of VEGF gene expression and western blot was adopted for the examination of VEGF protein expression. The 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used to detect cell growth as well as cell migration and invasion. The transplanted renal tumor models in nude mice were established, and the growth condition of nude mice, and VEGF protein expression in transplanted tumor slices and the microvessel density (MVD) were detected. The expression level of VEGF mRNA in VEGF-siRNA group was significant lower than that in the control group and negative group, suggesting that establishment of plasmid specifically inhibited the expression of VEGF gene The expression level of VEGF protein in VEGF-siRNA group was significant lower than that in the control group and negative group. VEGF gene silencing has the significant inhibition effects on proliferation, migration and invasion of RCC 786-O cells. The tumor weight, VEGF protein positive rate and MVD in VEGF-siRNA group were significant lower than those in negative group and blank group. The VEGF gene silencing could inhibit the cell proliferation, migration and invasion of RCC 786-O cells; inhibition of VEGF protein expression could prevent transplanted RCC growth and tumor angiogenesis.

Efficient delivery of RNA interference oligonucleotides to polarized airway epithelia in vitro

PubMed Central

Ramachandran, Shyam; Krishnamurthy, Sateesh; Jacobi, Ashley M.; Wohlford-Lenane, Christine; Behlke, Mark A.; Davidson, Beverly L.

2013-01-01

Polarized and pseudostratified primary airway epithelia present barriers that significantly reduce their transfection efficiency and the efficacy of RNA interference oligonucleotides. This creates an impediment in studies of the airway epithelium, diminishing the utility of loss-of-function as a research tool. Here we outline methods to introduce RNAi oligonucleotides into primary human and porcine airway epithelia grown at an air-liquid interface and difficult-to-transfect transformed epithelial cell lines grown on plastic. At the time of plating, we reverse transfect small-interfering RNA (siRNA), Dicer-substrate siRNA, or microRNA oligonucleotides into cells by use of lipid or peptide transfection reagents. Using this approach we achieve significant knockdown in vitro of hypoxanthine-guanine phosphoribosyltransferase, IL-8, and CFTR expression at the mRNA and protein levels in 1–3 days. We also attain significant reduction of secreted IL-8 in polarized primary pig airway epithelia 3 days posttransfection and inhibition of CFTR-mediated Cl− conductance in polarized air-liquid interface cultures of human airway epithelia 2 wk posttransfection. These results highlight an efficient means to deliver RNA interference reagents to airway epithelial cells and achieve significant knockdown of target gene expression and function. The ability to reliably conduct loss-of-function assays in polarized primary airway epithelia offers benefits to research in studies of epithelial cell homeostasis, candidate gene function, gene-based therapeutics, microRNA biology, and targeting the replication of respiratory viruses. PMID:23624792

RNA targeting with CRISPR-Cas13.

PubMed

Abudayyeh, Omar O; Gootenberg, Jonathan S; Essletzbichler, Patrick; Han, Shuo; Joung, Julia; Belanto, Joseph J; Verdine, Vanessa; Cox, David B T; Kellner, Max J; Regev, Aviv; Lander, Eric S; Voytas, Daniel F; Ting, Alice Y; Zhang, Feng

2017-10-12

RNA has important and diverse roles in biology, but molecular tools to manipulate and measure it are limited. For example, RNA interference can efficiently knockdown RNAs, but it is prone to off-target effects, and visualizing RNAs typically relies on the introduction of exogenous tags. Here we demonstrate that the class 2 type VI RNA-guided RNA-targeting CRISPR-Cas effector Cas13a (previously known as C2c2) can be engineered for mammalian cell RNA knockdown and binding. After initial screening of 15 orthologues, we identified Cas13a from Leptotrichia wadei (LwaCas13a) as the most effective in an interference assay in Escherichia coli. LwaCas13a can be heterologously expressed in mammalian and plant cells for targeted knockdown of either reporter or endogenous transcripts with comparable levels of knockdown as RNA interference and improved specificity. Catalytically inactive LwaCas13a maintains targeted RNA binding activity, which we leveraged for programmable tracking of transcripts in live cells. Our results establish CRISPR-Cas13a as a flexible platform for studying RNA in mammalian cells and therapeutic development.

An in vivo and in silico approach to study cis-antisense: a short cut to higher order response

NASA Astrophysics Data System (ADS)

Courtney, Colleen; Varanasi, Usha; Chatterjee, Anushree

2014-03-01

Antisense interactions are present in all domains of life. Typically sense, antisense RNA pairs originate from overlapping genes with convergent face to face promoters, and are speculated to be involved in gene regulation. Recent studies indicate the role of transcriptional interference (TI) in regulating expression of genes in convergent orientation. Modeling antisense, TI gene regulation mechanisms allows us to understand how organisms control gene expression. We present a modeling and experimental framework to understand convergent transcription that combines the effects of transcriptional interference and cis-antisense regulation. Our model shows that combining transcriptional interference and antisense RNA interaction adds multiple-levels of regulation which affords a highly tunable biological output, ranging from first order response to complex higher-order response. To study this system we created a library of experimental constructs with engineered TI and antisense interaction by using face-to-face inducible promoters separated by carefully tailored overlapping DNA sequences to control expression of a set of fluorescent reporter proteins. Studying this gene expression mechanism allows for an understanding of higher order behavior of gene expression networks.

Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

PubMed Central

2010-01-01

Background Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEXGM-CSF, we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. Methods To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Results Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. Conclusions This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials. PMID:20836854

RNAi-mediated mortality of the whitefly through transgenic expression of double-stranded RNA homologous to acetylcholinesterase and ecdysone receptor in tobacco plants

USDA-ARS?s Scientific Manuscript database

The whitefly Bemisia tabaci (Genn.) is a pest and vector of plant viruses affecting plants worldwide. Using RNA interference (RNAi) to downregulate whitefly genes by expressing their homologous double stranded RNAs in plants has great potential for management of whiteflies to reduce plant virus dise...

Enhanced Whitefly Resistance in Transgenic Tobacco Plants Expressing Double Stranded RNA of v-ATPase A Gene

PubMed Central

Thakur, Nidhi; Upadhyay, Santosh Kumar; Verma, Praveen C.; Chandrashekar, Krishnappa; Tuli, Rakesh; Singh, Pradhyumna K.

2014-01-01

Background Expression of double strand RNA (dsRNA) designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi), thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci) upon oral feeding. The v-ATPase subunit A (v-ATPaseA) coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. Methodology/Principal Findings Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. Conclusions/Significance Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops. PMID:24595215

TLR4-NOX4-AP-1 signaling mediates lipopolysaccharide-induced CXCR6 expression in human aortic smooth muscle cells.

PubMed

Patel, Devang N; Bailey, Steven R; Gresham, John K; Schuchman, David B; Shelhamer, James H; Goldstein, Barry J; Foxwell, Brian M; Stemerman, Michael B; Maranchie, Jodi K; Valente, Anthony J; Mummidi, Srinivas; Chandrasekar, Bysani

2006-09-08

CXCL16 is a transmembrane non-ELR CXC chemokine that signals via CXCR6 to induce aortic smooth muscle cell (ASMC) proliferation. While bacterial lipopolysaccharide (LPS) has been shown to stimulate CXCL16 expression in SMC, its effects on CXCR6 are not known. Here, we demonstrate that LPS upregulates CXCR6 mRNA, protein, and surface expression in human ASMC. Inhibition of TLR4 with neutralizing antibodies or specific siRNA interference blocked LPS-mediated CXCR6 expression. LPS stimulated both AP-1 (c-Fos, c-Jun) and NF-kappaB (p50 and p65) activation, but only inhibition of AP-1 attenuated LPS-induced CXCR6 expression. Using dominant negative expression vectors and siRNA interference, we demonstrate that LPS induces AP-1 activation via MyD88, TRAF6, ERK1/2, and JNK signaling pathways. Furthermore, the flavoprotein inhibitor diphenyleniodonium chloride significantly attenuated LPS-mediated AP-1-dependent CXCR6 expression, as did inhibition of NOX4 NADPH oxidase by siRNA. Finally, CXCR6 knockdown inhibited CXCL16-induced ASMC proliferation. These results demonstrate that LPS-TLR4-NOX4-AP-1 signaling can induce CXCR6 expression in ASMC, and suggest that the CXCL16-CXCR6 axis may be an important proinflammatory pathway in the pathogenesis of atherosclerosis.

TLR4-NOX4-AP-1 signaling mediates lipopolysaccharide-induced CXCR6 expression in human aortic smooth muscle cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patel, Devang N.; Bailey, Steven R.; Gresham, John K.

2006-09-08

CXCL16 is a transmembrane non-ELR CXC chemokine that signals via CXCR6 to induce aortic smooth muscle cell (ASMC) proliferation. While bacterial lipopolysaccharide (LPS) has been shown to stimulate CXCL16 expression in SMC, its effects on CXCR6 are not known. Here, we demonstrate that LPS upregulates CXCR6 mRNA, protein, and surface expression in human ASMC. Inhibition of TLR4 with neutralizing antibodies or specific siRNA interference blocked LPS-mediated CXCR6 expression. LPS stimulated both AP-1 (c-Fos, c-Jun) and NF-{kappa}B (p50 and p65) activation, but only inhibition of AP-1 attenuated LPS-induced CXCR6 expression. Using dominant negative expression vectors and siRNA interference, we demonstrate thatmore » LPS induces AP-1 activation via MyD88, TRAF6, ERK1/2, and JNK signaling pathways. Furthermore, the flavoprotein inhibitor diphenyleniodonium chloride significantly attenuated LPS-mediated AP-1-dependent CXCR6 expression, as did inhibition of NOX4 NADPH oxidase by siRNA. Finally, CXCR6 knockdown inhibited CXCL16-induced ASMC proliferation. These results demonstrate that LPS-TLR4-NOX4-AP-1 signaling can induce CXCR6 expression in ASMC, and suggest that the CXCL16-CXCR6 axis may be an important proinflammatory pathway in the pathogenesis of atherosclerosis.« less

Tumor-specific RNA interference targeting Pokemon suppresses tumor growth and induces apoptosis in prostate cancer.

PubMed

Li, Yining; Xu, Shuxiong; Wang, Xiangwei; Shi, Hua; Sun, Zhaolin; Yang, Zhao

2013-02-01

To explore the exact mechanism of Pokemon in prostate cancer. Pokemon is a member of the POK family of transcriptional repressors. Its main function is suppression of the p14ARF (alternate reading frame) tumor suppressor gene. Although Pokemon expression has been found to be increased in various types of lymphoma, the exact mechanism of the gene in prostate cancer is not clear. In the present study, prostate cancer cells were transfected with the specific short hairpin ribonucleic acid (RNA) expression vector targeting Pokemon. The expression of Pokemon messenger RNA and its protein was detected by semiquantitative reverse transcriptase-polymerase chain reaction and Western blotting, respectively. The cell growth and cell apoptosis were also examined using the methyl thiazolyl tetrazolium assay and flow cytometry. The results demonstrated that specific RNA interference (RNAi) could decrease the expression levels of Pokemon gene messenger RNA and protein in prostate cancer cells. In addition, that specific RNAi significantly inhibited the cell proliferation and increased the apoptotic rate. In vivo experiments showed that specific RNAi inhibited the tumorigenicity of prostate cancer cells and significantly suppressed tumor growth. Therefore, an RNAi-targeted Pokemon gene strategy could be a potential approach to prostate cancer therapy. Copyright © 2013 Elsevier Inc. All rights reserved.

Enhanced susceptibility of cancer cells to oncolytic rhabdo-virotherapy by expression of Nodamura virus protein B2 as a suppressor of RNA interference.

PubMed

Bastin, Donald; Aitken, Amelia S; Pelin, Adrian; Pikor, Larissa A; Crupi, Mathieu J F; Huh, Michael S; Bourgeois-Daigneault, Marie-Claude; Bell, John C; Ilkow, Carolina S

2018-06-19

Antiviral responses are barriers that must be overcome for efficacy of oncolytic virotherapy. In mammalian cells, antiviral responses involve the interferon pathway, a protein-signaling cascade that alerts the immune system and limits virus propagation. Tumour-specific defects in interferon signaling enhance viral infection and responses to oncolytic virotherapy, but many human cancers are still refractory to oncolytic viruses. Given that invertebrates, fungi and plants rely on RNA interference pathways for antiviral protection, we investigated the potential involvement of this alternative antiviral mechanism in cancer cells. Here, we detected viral genome-derived small RNAs, indicative of RNAi-mediated antiviral responses, in human cancer cells. As viruses may encode suppressors of the RNA interference pathways, we engineered an oncolytic vesicular stomatitis virus variant to encode the Nodamura virus protein B2, a known inhibitor of RNAi-mediated immune responses. B2-expressing oncolytic virus showed enhanced viral replication and cytotoxicity, impaired viral genome cleavage and altered microRNA processing in cancer cells. Our data establish the improved therapeutic potential of our novel virus which targets the RNAi-mediated antiviral defense of cancer cells.

An Active Immune Defense with a Minimal CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) RNA and without the Cas6 Protein*

PubMed Central

Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J.; Backofen, Rolf; Marchfelder, Anita

2015-01-01

The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3′ handle are still active in triggering an interference reaction. The complete 3′ handle could be removed without loss of activity. However, manipulations of the 5′ handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. PMID:25512373

ß-catenin, a transcription factor activated by canonical Wnt signaling, is expressed in sensory neurons of calves latently infected with bovine herpesvirus 1

USDA-ARS?s Scientific Manuscript database

Like many a-herpesvirinae subfamily members, bovine herpes virus 1 (BoHV-1) expresses an abundant transcript in latently infected sensory neurons: the latency-related (LR) RNA. LR-RNA encodes a protein (ORF2) that inhibits apoptosis, interacts with Notch family members, interferes with Notch mediate...

HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs

PubMed Central

Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

2015-01-01

Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses. PMID:25668122

HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs.

PubMed

Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

2015-01-01

Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses.

Knockdown of Zinc Transporter ZIP5 by RNA Interference Inhibits Esophageal Cancer Growth In Vivo.

PubMed

Li, Qian; Jin, Jing; Liu, Jianghui; Wang, Liqun; He, Yutong

2016-01-01

We recently found that SLC39A5 (ZIP5), a zinc transporter, is overexpressed in esophageal cancer. Downregulation of ZIP5 inhibited the proliferation, migration, and invasion of the esophageal cancer cell line KYSE170 in vitro. In this study, we found that downregulation of SLC39A5 (ZIP5) by interference resulted in a significant reduction in esophageal cancer tumor volume and weight in vivo. COX2 (cyclooxygenase 2) expression was decreased and E-cadherin expression was increased in the KYSE170K xenografts, which was caused by the downregulation of ZIP5. However, we did not find that the downregulation of ZIP5 caused a change in the relative expressions of cyclin D1, VEGF (vascular endothelial growth factor), MMP9 (matrix metalloprotein 9), and Bcl-2 (B-cell lymphoma/leukmia-2) mRNA or an alteration in the average level of zinc in the peripheral blood and xenografts in vivo. Collectively, these findings indicate that knocking down ZIP5 by small interfering RNA (siRNA) might be a novel treatment strategy for esophageal cancer with ZIP5 overexpression.

[Expression of cation-chloride cotransporters KCC2 and NKCC1 in brainstem of para- chlorophenylalanine-induced acute insomnia rats].

PubMed

Lin, Fang-ju; Yang, Xiao-su; Yang, De; Zou, Yan-qun

2013-05-21

To explore the possible roles of KCC2 and NKCC1 in the pathological mechanism of acute insomnia in rats. A total of 18 Sprague-Dawley rats were randomly selected into model, interference and normal control groups.The expressions of KCC2 and NKCC1 in brainstem were detected by reverse transcription-polymerase chain reaction (RT-PCR) and Western blot.The concentration of intracellular Cl(-) ([Cl(-)]i) in brainstem was detected by fluorescence probe MQAE with laser confocal microscopy. (1) Comparing with the control group, both KCC2 mRNA and protein expression were down-regulated in the model and interference groups (mRNA:0.196 ± 0.021 vs 0.939 ± 0.109, P < 0.05; 0.485 ± 0.026 vs 0.939 ± 0.109, P < 0.05; protein expression:0.363 ± 0.058 vs 0.967 ± 0.155, P < 0.05; 0.663 ± 0.106 vs 0.967 ± 0.155, P < 0.05).However they became up-regulated in the interference group versus the model group (mRNA: 0.485 ± 0.026 vs 0.196 ± 0.021, P < 0.05; protein expression:0.663 ± 0.106 vs 0.363 ± 0.058, P < 0.05). (2) Comparing with the control group, both NKCC1 mRNA and protein expression in the model group were slightly up-regulated.But statistical difference was insignificant (mRNA: 0.344 ± 0.026 vs 0.320 ± 0.019, P > 0.05; protein expression:0.244 ± 0.010 vs 0.230 ± 0.021, P > 0.05).There was down-regulation in the interference group versus the model and control groups (mRNA: 0.066 ± 0.031 vs 0.320 ± 0.019, P < 0.05; 0.066 ± 0.031 vs 0.344 ± 0.026, P < 0.05; protein expression:0.131 ± 0.012 vs 0.230 ± 0.021, P < 0.05; 0.131 ± 0.012 vs 0.244 ± 0.010, P < 0.05). (3) Comparing with the control group, [Cl(-)]i became up-regulated in the model group (0.0315 ± 0.0039 vs 0.0164 ± 0.0019, P < 0.05).It was down-regulated in the interference group versus the model group (0.0182 ± 0.0013 vs 0.0315 ± 0.0039, P < 0.05), but higher than control group without statistical difference (0.0182 ± 0.0013 vs 0.0164 ± 0.0019, P > 0.05). The down-regulation of KCC2 and rise of [Cl(-)]i in brainstem may participate in the pathological mechanism of acute insomnia in rats. And the mechanism of sedative-hypnotic diazepam may be operate through an up-regulation of KCC2, a down-regulation of NKCC1 and decreased [Cl(-)]i.

The involvement of osteopontin and matrix metalloproteinase- 9 in the migration of endometrial epithelial cells in patients with endometriosis.

PubMed

Yang, Mei; Jiang, Chunfan; Chen, Hua; Nian, Yan; Bai, Zhimiao; Ha, Chunfang

2015-08-20

Endometriosis, which shares certain characteristics with cancers, may cause abnormal expression of proteins involved in cell migration. Endometrial epithelial cells (EECs) are believed to play an important role in endometriotic migration. The aim of this study was to investigate the relationship between the expression of osteopontin (OPN) and matrix metalloproteinase-9 (MMP-9) in endometriotic migration. We performed primary culture of EECs and investigated the expression of OPN and MMP-9 in EECs regulated by 17beta-estradiol (E2). OPN-specific siRNA interference was used to down-regulate OPN and to explore the corresponding change in MMP-9 expression. Real-time RT-PCR, western blot analysis and flow cytometry were used to determine the expression levels of OPN and MMP-9. Gelatin zymography was performed to observe the enzymatic activity of MMP-9 in conditioned media. Transwell and wound scratch assays were performed to investigate the migration ability of EECs. The expression levels of OPN and MMP-9 in normal EECs (NEECs) were inferior to those in EECs from patients with endometriosis (EEECs). The expression levels of OPN and MMP-9 from stage III/IV EEECs and secretory-phase EECs were higher than those of stage I/II EEECs or proliferative-phase EECs. The expression levels of OPN and MMP-9 in EEECs were increased by E2 treatment and remarkably decreased by siRNA interference. Active MMP-9 expression increased with E2 treatment and decreased with siRNA treatment in EEECs compared with the same treatments in NEECs. The migratory abilities of EEECs were enhanced after cells were treated with E2; in contrast, these abilities were reduced by siRNA interference. In NEECs, active MMP-9 and cellular migration abilities were only minimally influenced by E2 and siRNA treatment. The present study suggests that the up-regulation of MMP-9 via activation of OPN induced by estrogen may correlate with the migration of endometrial epithelial cells in patients with endometriosis.

Regulatory functions of trehalose-6-phosphate synthase in the chitin biosynthesis pathway in Tribolium castaneum (Coleoptera: Tenebrionidae) revealed by RNA interference.

PubMed

Chen, Q W; Jin, S; Zhang, L; Shen, Q D; Wei, P; Wei, Z M; Wang, S G; Tang, B

2018-06-01

RNA interference (RNAi) is a very effective technique for studying gene function and may be an efficient method for controlling pests. Trehalose-6-phosphate synthase (TPS), which plays a key role in the synthesis of trehalose and insect development, was cloned in Tribolium castaneum (Herbst) (TcTPS) and the putative functions were studied using RNAi via the injection of double-stranded RNA (dsRNA) corresponding to conserved TPS and trehalose-6-phosphate phosphatase domains. Expression analyses show that TcTPS is expressed higher in the fat body, while quantitative real-time polymerase chain reaction results show that the expression of four trehalase isoforms was significantly suppressed by dsTPS injection. Additionally, the expression of six chitin synthesis-related genes, such as hexokinase 2 and glutamine-fructose-6-phosphate aminotransferase, was suppressed at 48 and 72 h post-dsTPS-1 and dsTPS-2 RNA injection, which were two dsTPS fragments that had been designed for two different locations in TcTPS open reading frame, and that trehalose content and trehalase 1 activity decreased significantly at 72 h post-dsRNA injection. Furthermore, T. castaneum injected with dsTPS-1 and dsTPS-2 RNA displayed significantly lower levels of chitin and could not complete the molting process from larvae to pupae, revealing abnormal molting phenotypes. These results demonstrate that silencing TPS gene leads to molting deformities and high mortality rates via regulation of gene expression in the chitin biosynthetic pathway, and may be a promising approach for pest control in the future.

Lentivirus mediated RNA interference of EMMPRIN (CD147) gene inhibits the proliferation, matrigel invasion and tumor formation of breast cancer cells.

PubMed

Yang, Jing; Wang, Rong; Li, Hongjiang; Lv, Qing; Meng, Wentong; Yang, Xiaoqin

2016-07-08

Overexpression of extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), a glycoprotein enriched on the plasma membrane of tumor cells, promotes proliferation, invasion, metastasis, and survival of malignant tumor cells. In this study, we sought to examine the expression of EMMPRIN in breast tumors, and to identify the potential roles of EMMPRIN on breast cancer cells. EMMPRIN expression in breast cancer tissues was assessed by immunohistochemistry. We used a lentivirus vector-based RNA interference (RNAi) approach expressing short hairpin RNA (shRNA) to knockdown EMMPRIN gene in breast cancer cell lines MDA-MB-231 and MCF-7. In vitro, Cell proliferative, invasive potential were determined by Cell Counting Kit (CCK-8), cell cycle analysis and matrigel invasion assay, respectively. In vivo, tumorigenicity was monitored by inoculating tumor cells into breast fat pad of female nude mice. EMMPRIN was over-expressed in breast tumors and breast cancer cell lines. Down-regulation of EMMPRIN by lentivirus vector-based RNAi led to decreased cell proliferative, decreased matrigel invasion in vitro, and attenuated tumor formation in vivo. High expression of EMMPRIN plays a crucial role in breast cancer cell proliferation, matrigel invasion and tumor formation.

Strand antagonism in RNAi: an explanation of differences in potency between intracellularly expressed siRNA and shRNA

PubMed Central

Jin, Xin; Sun, Tingting; Zhao, Chuanke; Zheng, Yongxiang; Zhang, Yufan; Cai, Weijing; He, Qiuchen; Taira, Kaz; Zhang, Lihe; Zhou, Demin

2012-01-01

Strategies to regulate gene function frequently use small interfering RNAs (siRNAs) that can be made from their shRNA precursors via Dicer. However, when the duplex components of these siRNA effectors are expressed from their respective coding genes, the RNA interference (RNAi) activity is much reduced. Here, we explored the mechanisms of action of shRNA and siRNA and found the expressed siRNA, in contrast to short hairpin RNA (shRNA), exhibits strong strand antagonism, with the sense RNA negatively and unexpectedly regulating RNAi. Therefore, we altered the relative levels of strands of siRNA duplexes during their expression, increasing the level of the antisense component, reducing the level of the sense component, or both and, in this way we were able to enhance the potency of the siRNA. Such vector-delivered siRNA attacked its target effectively. These findings provide new insight into RNAi and, in particular, they demonstrate that strand antagonism is responsible for making siRNA far less potent than shRNA. PMID:22039150

RNA interference of carboxyesterases causes nymph mortality in the Asian citrus psyllid, Diaphorina citri.

PubMed

Kishk, Abdelaziz; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Gowda, Siddarame; Killiny, Nabil

2017-03-01

Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is an important pest of citrus. In addition, D. citri is the vector of Huanglongbing, a destructive disease in citrus, also known as citrus greening disease caused by Candidatus Liberibacter asiaticus. Huanglongbing causes huge losses for citrus industries. Insecticide application for D. citri is the major strategy to prevent disease spread. The heavy use of insecticides causes development of insecticide resistance. We used RNA interference (RNAi) to silence genes implicated in pesticide resistance in order to increase the susceptibility. The activity of dsRNA to reduce the expression of carboxyesterases including esterases FE4 (EstFE4) and acetylcholinesterases (AChe) in D. citri was investigated. The dsRNA was applied topically to the fourth and fifth instars of nymphs. We targeted several EstFE4 and AChe genes using dsRNA against a consensus sequence for each of them. Five concentrations (25, 50, 75, 100, 125 ng/μl) from both dsRNAs were used. The treatments with the dsRNA caused concentration dependent nymph mortality. The highest gene expression levels of both AChe and EstFE4 were found in the fourth and fifth nymphal instars. Gene expression analysis showed that AChe genes were downregulated in emerged adults from dsRNA-AChe-treated nymphs compared to controls. However, EstFE4 genes were not affected. In the same manner, treatment with dsRNA-EstFE4 reduced expression level of EstFE4 genes in emerged adults from treated nymphs, but did not affect the expression of AChe genes. In the era of environmentally friendly control strategies, RNAi is a new promising venue to reduce pesticide applications. © 2017 Wiley Periodicals, Inc.

Virus-Derived Gene Expression and RNA Interference Vector for Grapevine

PubMed Central

Kurth, Elizabeth G.; Peremyslov, Valera V.; Prokhnevsky, Alexey I.; Kasschau, Kristin D.; Miller, Marilyn; Carrington, James C.

2012-01-01

The improvement of the agricultural and wine-making qualities of the grapevine (Vitis vinifera) is hampered by adherence to traditional varieties, the recalcitrance of this plant to genetic modifications, and public resistance to genetically modified organism (GMO) technologies. To address these challenges, we developed an RNA virus-based vector for the introduction of desired traits into grapevine without heritable modifications to the genome. This vector expresses recombinant proteins in the phloem tissue that is involved in sugar transport throughout the plant, from leaves to roots to berries. Furthermore, the vector provides a powerful RNA interference (RNAi) capability of regulating the expression of endogenous genes via virus-induced gene-silencing (VIGS) technology. Additional advantages of this vector include superb genetic capacity and stability, as well as the swiftness of technology implementation. The most significant applications of the viral vector include functional genomics of the grapevine and disease control via RNAi-enabled vaccination against pathogens or invertebrate pests. PMID:22438553

Silencing the hsp25 Gene Eliminates Migration Capability of the Highly Metastatic Murine 4T1 Breast Adenocarcinoma Cell

PubMed Central

Bausero, Maria A.; Bharti, Ajit; Page, Diana T.; Perez, Kristen D.; Eng, Jason W.-L.; Ordonez, Susana L.; Jantschitsch, Christian; Kindas-Muegge, Ingela; Ciocca, Daniel; Asea, Alexzander

2006-01-01

The 25-kDa heat shock protein (Hsp25) is associated with various malignancies and is expressed at high levels in biopsies as well as circulating in the serum of breast cancer patients. In this study, we used RNA interference technology to silence the hsp25 gene in 4T1 breast adenocarcinoma cells, known as a poorly immunogenic, highly metastatic cell line. We demonstrate that transfection of 4T1 cells with short interference RNA-Hsp25 dramatically inhibits proliferation as compared with control transfected cells. In addition, we show that 4T1 cells transfected with short interference RNA-Hsp25 abrogates tumor migration potential by a mechanism that is in part due to the repression of matrix metalloproteinase 9 expression and a concomitant upregulation of its antagonist, tissue inhibitor metalloproteinase 1. Taken together, these findings provide a model system for the study of metastatic potential of tumors and are suggestive of an earlier unrecognized role for Hsp25 in tumor migration. PMID:16340246

Silencing the hsp25 gene eliminates migration capability of the highly metastatic murine 4T1 breast adenocarcinoma cell.

PubMed

Bausero, Maria A; Bharti, Ajit; Page, Diana T; Perez, Kristen D; Eng, Jason W-L; Ordonez, Susana L; Asea, Edwina E; Jantschitsch, Christian; Kindas-Muegge, Ingela; Ciocca, Daniel; Asea, Alexzander

2006-01-01

The 25-kDa heat shock protein (Hsp25) is associated with various malignancies and is expressed at high levels in biopsies as well as circulating in the serum of breast cancer patients. In this study, we used RNA interference technology to silence the hsp25 gene in 4T1 breast adenocarcinoma cells, known as a poorly immunogenic, highly metastatic cell line. We demonstrate that transfection of 4T1 cells with short interference RNA-Hsp25 dramatically inhibits proliferation as compared with control transfected cells. In addition, we show that 4T1 cells transfected with short interference RNA-Hsp25 abrogates tumor migration potential by a mechanism that is in part due to the repression of matrix metalloproteinase 9 expression and a concomitant upregulation of its antagonist, tissue inhibitor metalloproteinase 1. Taken together, these findings provide a model system for the study of metastatic potential of tumors and are suggestive of an earlier unrecognized role for Hsp25 in tumor migration. Copyright 2006 S. Karger AG, Basel.

Construction of siRNA/miRNA expression vectors based on a one-step PCR process

PubMed Central

Xu, Jun; Zeng, Jie Qiong; Wan, Gang; Hu, Gui Bin; Yan, Hong; Ma, Li Xin

2009-01-01

Background RNA interference (RNAi) has become a powerful means for silencing target gene expression in mammalian cells and is envisioned to be useful in therapeutic approaches to human disease. In recent years, high-throughput, genome-wide screening of siRNA/miRNA libraries has emerged as a desirable approach. Current methods for constructing siRNA/miRNA expression vectors require the synthesis of long oligonucleotides, which is costly and suffers from mutation problems. Results Here we report an ingenious method to solve traditional problems associated with construction of siRNA/miRNA expression vectors. We synthesized shorter primers (< 50 nucleotides) to generate a linear expression structure by PCR. The PCR products were directly transformed into chemically competent E. coli and converted to functional vectors in vivo via homologous recombination. The positive clones could be easily screened under UV light. Using this method we successfully constructed over 500 functional siRNA/miRNA expression vectors. Sequencing of the vectors confirmed a high accuracy rate. Conclusion This novel, convenient, low-cost and highly efficient approach may be useful for high-throughput assays of RNAi libraries. PMID:19490634

Symbiont-mediated RNA interference in insects

PubMed Central

Whitten, Miranda M. A.; Facey, Paul D.; Del Sol, Ricardo; Fernández-Martínez, Lorena T.; Evans, Meirwyn C.; Mitchell, Jacob J.; Bodger, Owen G.

2016-01-01

RNA interference (RNAi) methods for insects are often limited by problems with double-stranded (ds) RNA delivery, which restricts reverse genetics studies and the development of RNAi-based biocides. We therefore delegated to insect symbiotic bacteria the task of: (i) constitutive dsRNA synthesis and (ii) trauma-free delivery. RNaseIII-deficient, dsRNA-expressing bacterial strains were created from the symbionts of two very diverse pest species: a long-lived blood-sucking bug, Rhodnius prolixus, and a short-lived globally invasive polyphagous agricultural pest, western flower thrips (Frankliniella occidentalis). When ingested, the manipulated bacteria colonized the insects, successfully competed with the wild-type microflora, and sustainably mediated systemic knockdown phenotypes that were horizontally transmissible. This represents a significant advance in the ability to deliver RNAi, potentially to a large range of non-model insects. PMID:26911963

An active immune defense with a minimal CRISPR (clustered regularly interspaced short palindromic repeats) RNA and without the Cas6 protein.

PubMed

Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J; Backofen, Rolf; Marchfelder, Anita

2015-02-13

The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3' handle are still active in triggering an interference reaction. The complete 3' handle could be removed without loss of activity. However, manipulations of the 5' handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Suppression of the Epidermal Growth Factor-like Domain 7 and Inhibition of Migration and Epithelial-Mesenchymal Transition in Human Pancreatic Cancer PANC-1 Cells.

PubMed

Wang, Yun-Liang; Dong, Feng-Lin; Yang, Jian; Li, Zhi; Zhi, Qiao-Ming; Zhao, Xin; Yang, Yong; Li, De-Chun; Shen, Xiao-Chun; Zhou, Jin

2015-01-01

Epidermal growth factor-like domain multiple 7 (EGFL7), a secreted protein specifically expressed by endothelial cells during embryogenesis, recently was identified as a critical gene in tumor metastasis. Epithelial-mesenchymal transition (EMT) was found to be closely related with tumor progression. Accordingly, it is important to investigate the migration and EMT change after knock-down of EGFL7 gene expression in human pancreatic cancer cells. EGFL7 expression was firstly testified in 4 pancreatic cancer cell lines by real-time polymerase chain reaction (Real-time PCR) and western blot, and the highest expression of EGFL7 was found in PANC-1 cell line. Then, PANC-1 cells transfected with small interference RNA (siRNA) of EGFL7 using plasmid vector were named si-PANC-1, while transfected with negative control plasmid vector were called NC-PANC-1. Transwell assay was used to analyze the migration of PANC-1 cells. Real-time PCR and western blotting were used to detect the expression change of EGFL7 gene, EMT markers like E-Cadherin, N-Cadherin, Vimentin, Fibronectin and transcription factors like snail, slug in PANC-1, NC- PANC-1, and si-PANC-1 cells, respectively. After successful plasmid transfection, EGFL7 gene were dramatically knock-down by RNA interference in si-PANC-1 group. Meanwhile, migration ability decreased significantly, compared with PANC-1 and NC-PANC-1 group. Meanwhile, the expression of epithelial phenotype marker E-Cadherin increased and that of mesenchymal phenotype markers N-Cadherin, Vimentin, Fibronectin dramatically decreased in si-PANC-1 group, indicating a reversion of EMT. Also, transcription factors snail and slug decreased significantly after RNA interference. Current study suggested that highly-expressed EGFL7 promotes migration of PANC-1 cells and acts through transcription factors snail and slug to induce EMT, and further study is needed to confirm this issue.

The role of mAKAPβ in the process of cardiomyocyte hypertrophy induced by angiotensin II

PubMed Central

GUO, HUIXIN; LIU, BAOXIN; HOU, LEI; THE, ERLINDA; LI, GANG; WANG, DONGZHI; JIE, QIQIANG; CHE, WENLIANG; WEI, YIDONG

2015-01-01

Angiotensin II (AngII) is the central product of the renin-angiotensin system (RAS) and this octapeptide contributes to the pathophysiology of cardiac hypertrophy and remodeling. mAKAPβ is an A-kinase anchoring protein (AKAP) that has the function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. In this study, we aimed to investigate the role of mAKAPβ in AngII-induced cardiomyocyte hypertrophy and the possible mechanisms involved. Cultured cardiomyocytes from neonatal rats were treated with AngII. Subsequently, the morphology of the cardiomyocytes was observed and the expression of mAKAPβ and cardiomyocyte hypertrophic markers was measured. mAKAPβ-shRNA was constructed for RNA interference; the expression of mAKAPβ and hypertrophic markers, the cell surface area and the [3H]Leucine incorporation rate in the AngII-treated rat cardiomyocytes were detected following RNA interference. Simultaneously, changes in the expression levels of phosphorylated extracellular signal-regulated kinase (p-ERK)2 in the cardiomyocytes were assessed. The cell size of the AngII-treated cardiaomyocytes was significantly larger than that of the untreated cardiomyocytes. The expression of hypertrophic markers and p-ERK2, the cell surface area and the [3H]Leucine incorporation rate were all significantly increased in the AngII-treated cells. However, the expression of mAKAPβ remained unaltered in this process. RNA interference simultaneously inhibited the protein expression of mAKAPβ and p-ERK2, and the hypertrophy of the cardiomyocytes induced by AngII was attenuated. These results demonstrate that AngII induces hypertrophy in cardiomyocytes, and mAKAPβ is possibly involved in this process. The effects of mAKAPβ on AngII-induced cardiomyocyte hypertrophy may be associated with p-ERK2 expression. PMID:25739102

RNA interference targeting cytosolic NADP(+)-dependent isocitrate dehydrogenase exerts anti-obesity effect in vitro and in vivo.

PubMed

Nam, Woo Suk; Park, Kwon Moo; Park, Jeen-Woo

2012-08-01

A metabolic abnormality in lipid biosynthesis is frequently associated with obesity and hyperlipidemia. Nicotinamide adenine dinucleotide phosphate-oxidase (NADPH) is an essential reducing equivalent for numerous enzymes required in fat and cholesterol biosynthesis. Cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) has been proposed as a key enzyme for supplying cytosolic NADPH. We report here that knockdown of IDPc expression by Ribonucleic acid (RNA) interference (RNAi) inhibited adipocyte differentiation and lipogenesis in 3T3-L1 preadipocytes and mice. Attenuated IDPc expression by IDPc small interfering RNA (siRNA) resulted in a reduction of differentiation and triglyceride level and adipogenic protein expression as well as suppression of glucose uptake in cultured adipocytes. In addition, the attenuation of Nox activity and Reactive oxygen species (ROS) generation accompanied with knockdown of IDPc was associated with inhibition of adipogenesis and lipogenesis. The loss of body weight and the reduction of triglyceride level were also observed in diet-induced obese mice transduced with IDPc short-hairpin (shRNA). Taken together, the inhibiting effect of RNAi targeting IDPc on adipogenesis and lipid biosynthesis is considered to be of therapeutic value in the treatment and prevention of obesity and obesity-associated metabolic syndrome. © 2012 Elsevier B.V. All rights reserved.

AMPK regulates energy metabolism through the SIRT1 signaling pathway to improve myocardial hypertrophy.

PubMed

Dong, H-W; Zhang, L-F; Bao, S-L

2018-05-01

We investigated the correlations of adenosine monophosphate-activated protein kinase (AMPK), Silence information regulator 1 (SIRT1) and energy metabolism with myocardial hypertrophy. Myocardial hypertrophy experimental model was established via transverse aortic constriction (TAC)-induced myocardial hypertrophy and phenylephrine (PE)-induced hypertrophic myocardial cell culture. After activation of AMPK, the messenger ribonucleic acid (mRNA) expressions in myocardial tissue- and myocardial cell hypertrophy-related genes, atrial natriuretic peptide (ANP) and β-myosin heavy chain (β-MHC), were detected. The production rate of 14C-labeled 14CO2 from palmitic acid was quantitatively determined to detect the fatty acid and glucose oxidation of hypertrophic myocardial tissues or cells, and the glucose uptake of myocardial cells was studied using [14C] glucose. Reverse transcription-polymerase chain reaction (RT-PCR) and Western blotting were performed to detect the changes in SIRT1 mRNA and protein expressions in hypertrophic myocardial tissues. Moreover, SIRT1 small interfering ribonucleic acid (siRNA) was used to interfere in SIRT1 expression to further investigate the role of SIRT1 in the effect of AMPK activation on myocardial hypertrophy. AMPK activation could significantly reduce the mRNA expressions of ANP and β-MHC in vitro and in vivo. AMPK could increase the ejection fraction (EF) and decrease the protein synthesis rate in myocardial cells in mice with myocardial hypertrophy. Besides, AMPK activation could increase the fatty acid oxidation, improve the glucose uptake and reduce the glucose oxidation. After AMPK activation, both SIRT1 mRNA and protein expressions in hypertrophic myocardial tissues and myocardial cells were increased. After SIRT1 siRNA was further used to interfere in SIRT1 expression in myocardial cells, it was found that mRNA expressions and protein synthesis rates of ANP and β-MHC were increased. The activation of AMPK can inhibit the myocardial hypertrophy, which may be realized through regulating the myocardial energy metabolism via SIRT1 signaling pathway.

[Mechanism of protective effects of tumor necrosis factor receptor associated protein 1 on hypoxic cardiomyocytes of rats].

PubMed

Xiang, F; Zhang, D X; Ma, S Y; Huang, Y S

2016-12-20

Objective: To investigate the mechanism of protective effects of tumor necrosis factor receptor associated protein 1 (TRAP1) on hypoxic cardiomyocytes of rats. Methods: Primary cultured cardiomyocytes were obtained from neonatal Sprague-Dawley rats (aged 1 to 3 days) and then used in the following experiments. (1) Cells were divided into group TRAP1 and control group according to the random number table (the same grouping method below), and then the total protein of cells was extracted. Total protein of cells in group TRAP1 was added with mouse anti-rat TRAP1 monoclonal antibody, while that in control group was added with the same type of IgG from mouse. Co-immunoprecipitation and protein mass spectrography analysis were used to determine the possible proteins interacted with TRAP1. (2) Cells were divided into normoxia blank control group (NBC), normoxia+ TRAP1 interference control group (NTIC), normoxia+ TRAP1 interference group (NTI), normoxia+ TRAP1 over-expression control group (NTOC), and normoxia+ TRAP1 over-expression group (NTO), with 1 well in each group. Cells in group NBC were routinely cultured, while cells in the latter four groups were respectively added with TRAP1 RNA interference empty virus vector, TRAP1 RNA interference adenovirus vector, TRAP1 over-expression empty virus vector, and TRAP1 over-expression adenovirus vector. Another batch of cells were divided into group NBC, hypoxic blank control group (HBC), hypoxic+ TRAP1 interference control group (HTIC), hypoxic+ TRAP1 interference group (HTI), hypoxic+ TRAP1 over-expression control group (HTOC), and hypoxic+ TRAP1 over-expression group (HTO), with 1 well in each group. Cells in hypoxic groups were under hypoxic condition for 6 hours after being treated as those in the corresponding normoxia groups, respectively. The mRNA expression of cytochrome c oxidase subunit Ⅱ (COXⅡ) of cells in each group was detected by real time fluorescent quantitive reverse transcription polymerase chain reaction. Experiments were repeated for three times. (3) Cells were divided into group NBC, group HBC, group HTOC, group HTO, hypoxic+ TRAP1 over-expression+ COXⅡinterference control group (HTOCIC), and hypoxic+ TRAP1 over-expression+ COXⅡinterference group (HTOCI), with 3 wells in each group. Cells in the previous 4 groups were treated as those in experiment (2). Cells in group HTOCIC and HTOCI were respectively transfected with COXⅡ RNA interference empty virus vector and COXⅡ RNA interference adenovirus vector, and then both added with TRAP1 over-expression adenovirus vector. The proliferation activity of cells was determined by cell counting kit 8 and microplate reader, and the ratio of death cells was measured by propidium lodide and Hoechst 33342 staining. Another batch of cells were divided into group NBC, group HBC, group HTIC, group HTI, hypoxic+ TRAP1 interference+ COXⅡover-expression control group (HTICOC), and hypoxic+ TRAP1 interference+ COXⅡ over-expression group (HTICO), with 3 wells in each group. Cells in the previous 4 groups were treated as those in experiment (2). Cells in group HTICOC and HTICO were both transfected with TRAP1 RNA interference adenovirus vector, and then respectively added with COXⅡ over-expression empty virus vector and COXⅡ over-expression adenovirus vector. The proliferation activity of cells and the ratio of death cells were detected as before. Experiments were repeated for three times. Data were processed with one-way analysis of variance and LSD test. Results: (1) The expression of TRAP1 was found in cells of group TRAP1, while that was not found in cells of control group. The possible proteins interacted with TRAP1 were keratin, COXⅡ, and an unknown protein with predicted molecular weight 13×10 3 . (2) Compared with that in group NBC, the mRNA expression of COXⅡof cells had no significant change in group NTIC and group NTOC (with P values above 0.05), but significantly decreased in group NTI ( P <0.01), and significantly increased in group NTO ( P <0.01). Compared with that in group NBC, the mRNA expression of COXⅡof cells in group HBC was significantly decreased ( P <0.01). Compared with that in group HBC, the mRNA expression of COXⅡof cells had no significant change in group HTIC and group HTOC (with P values above 0.05), but significantly decreased in group HTI ( P <0.01), and significantly increased in group HTO ( P <0.01). (3) The proliferation activity of cells in group NBC, group HBC, group HTOC, group HTO, group HTOCIC, and group HTOCI was respectively 0.498±0.022, 0.303±0.018, 0.313±0.032, 0.456±0.031, 0.448±0.034, and 0.335±0.026, and the ratios of death cells in above groups were respectively (4.7±1.5)%, (24.7±3.1)%, (26.0±2.7)%, (13.3±2.5)%, (12.7±2.1)%, and (21.0±1.7)%. Compared with those in group NBC, the proliferation activity of cells in HBC was decreased, while the ratio of death cells was increased (with P values below 0.01). Compared with those in group HBC, the proliferation activity of cells and the ratio of death cells in group HTOC had no significant change (with P values above 0.05), while the proliferation activity of cells was increased and the ratio of death cells was decreased in group HTO (with P values below 0.01). Compared with those in group HTO, the proliferation activity of cells and the ratio of death cells in group HTOCIC had no significant change (with P values above 0.05), while the proliferation activity of cells was decreased and the ratio of death cells was increased in group HTOCI (with P values below 0.01). (4) The proliferation activity of cells in group NBC, group HBC, group HTIC, group HTI, group HTICOC, and group HTICO was respectively 0.444±0.025, 0.275±0.016, 0.283±0.021, 0.150±0.009, 0.135±0.011, and 0.237±0.017, and the ratios of death cells in above groups were respectively (3.7±0.6)%, (21.0±2.7)%, (20.3±3.1)%, (31.7±2.5)%, (33.3±3.2)%, and (19.3±1.5)%. Compared with those in group HBC, the proliferation activity of cells and the ratio of death cells in group HTIC had no significant change (with P values above 0.05). Compared with those in group HBC and group HTIC, the proliferation activity of cells was decreased and the ratio of death cells was significantly increased in group HTI (with P values below 0.01). Compared with those in group HTI, the proliferation activity of cells and the ratio of death cells in group HTICOC had no significant change (with P values above 0.05), while the proliferation activity of cells was increased and the ratio of death cells was significantly decreased in group HTICO (with P values below 0.01). Conclusions: TRAP1 can up-regulate the expression of COXⅡ mRNA, and COXⅡ is one of the downstream effector molecules that TRAP1 mediates its protective effects on hypoxic cardiomyocytes.

Dual role for argonautes in microRNA processing and posttranscriptional regulation of microRNA expression.

PubMed

Diederichs, Sven; Haber, Daniel A

2007-12-14

MicroRNAs are small endogenous noncoding RNAs involved in posttranscriptional gene regulation. During microRNA biogenesis, Drosha and Dicer process the primary transcript (pri-miRNA) through a precursor hairpin (pre-miRNA) to the mature miRNA. The miRNA is incorporated into the RNA-Induced Silencing Complex (RISC) with Argonaute proteins, the effector molecules in RNA interference (RNAi). Here, we show that all Argonautes elevate mature miRNA expression posttranscriptionally, independent of RNase activity. Also, we identify a role for the RISC slicer Argonaute2 (Ago2) in cleaving the pre-miRNA to an additional processing intermediate, termed Ago2-cleaved precursor miRNA or ac-pre-miRNA. This endogenous, on-pathway intermediate results from cleavage of the pre-miRNA hairpin 12 nucleotides from its 3'-end. By analogy to siRNA processing, Ago2 cleavage may facilitate removal of the nicked passenger strand from RISC after maturation. The multiple roles of Argonautes in the RNAi effector phase and miRNA biogenesis and maturation suggest coordinate regulation of microRNA expression and function.

[The role of miRNA in endometrial cancer in the context of miRNA 205].

PubMed

Wilczyński, Miłosz; Danielska, Justyna; Dzieniecka, Monika; Malinowski, Andrzej

2015-11-01

MiRNAs are small, non-coding molecules of ribonucleic acids of approximately 22 bp length, which serve as regulators of gene expression and protein translation due to interference with messenger RNA (mRNA). MiRNAs, which take part in the regulation of cell cycle and apoptosis, may be associated with carcinogenesis. Aberrant expression of miRNAs in endometrial cancer might contribute to the endometrial cancer initiation or progression, as well as metastasis formation, and may influence cancer invasiveness. Specific-miRNAs expressed in endometrial cancer tissues may serve as diagnostic markers of the disease, prognostic biomarkers, or play an important part in oncological therapy We aimed to describe the role of miRNAs in endometrial cancer with special consideration of miRNA 205.

Expression of CAR in SW480 and HepG2 cells during G1 is associated with cell proliferation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Osabe, Makoto; Sugatani, Junko; Global COE Program, School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka

Constitutive androstane receptor (CAR) is a transcription factor to regulate the expression of several genes related to drug-metabolism. Here, we demonstrate that CAR protein accumulates during G1 in human SW480 and HepG2 cells. After the G1/S phase transition, CAR protein levels decreased, and CAR was hardly detected in cells by the late M phase. CAR expression in both cell lines was suppressed by RNA interference-mediated suppression of CDK4. Depletion of CAR by RNA interference in both cells and by hepatocyte growth factor treatment in HepG2 cells resulted in decreased MDM2 expression that led to p21 upregulation and repression of HepG2more » cell growth. Thus, our results demonstrate that CAR expression is an early G1 event regulated by CDK4 that contributes to MDM2 expression; these findings suggest that CAR may influence the expression of genes involved in not only the metabolism of endogenous and exogenous substances but also in the cell proliferation.« less

RNA viruses and microRNAs: challenging discoveries for the 21st century

PubMed Central

Swaminathan, Gokul; Martin-Garcia, Julio

2013-01-01

RNA viruses represent the predominant cause of many clinically relevant viral diseases in humans. Among several evolutionary advantages acquired by RNA viruses, the ability to usurp host cellular machinery and evade antiviral immune responses is imperative. During the past decade, RNA interference mechanisms, especially microRNA (miRNA)-mediated regulation of cellular protein expression, have revolutionized our understanding of host-viral interactions. Although it is well established that several DNA viruses express miRNAs that play crucial roles in their pathogenesis, expression of miRNAs by RNA viruses remains controversial. However, modulation of the miRNA machinery by RNA viruses may confer multiple benefits for enhanced viral replication and survival in host cells. In this review, we discuss the current literature on RNA viruses that may encode miRNAs and the varied advantages of engineering RNA viruses to express miRNAs as potential vectors for gene therapy. In addition, we review how different families of RNA viruses can alter miRNA machinery for productive replication, evasion of antiviral immune responses, and prolonged survival. We underscore the need to further explore the complex interactions of RNA viruses with host miRNAs to augment our understanding of host-virus interplay. PMID:24046280

Reduction of CD147 surface expression on primary T cells leads to enhanced cell proliferation.

PubMed

Biegler, Brian; Kasinrerk, Watchara

2012-12-01

CD147 is a ubiquitously expressed membrane glycoprotein that has numerous functional associations in health and disease. However, the molecular mechanisms by which CD147 participates in these processes are unclear. Establishing physiologically relevant silencing of CD147 in primary T cells could provide clues essential for elucidating some aspects of CD147 biology. To date, achieving the knockdown of CD147 in primary T cells has remained elusive. Utilizing RNA interference and the Nucleofector transfection system, we were able to reduce the expression of CD147 in primary T cells. Comparison of basic functions, such as proliferation and CD25 expression, were then made between control populations and populations with reduced expression. Up-regulation of CD147 was found upon T-cell activation, indicating a role in T-cell responses. To better understand the possible importance of this up-regulation, we knocked down the expression of CD147 using RNA interference. When compared to control populations the CD147 knockdown populations exhibited increased proliferation. This alteration of cell proliferation, however, was not linked to a change in CD25 expression. We achieved reduction of CD147 surface expression in primary T cells by siRNA-mediated gene silencing. Our results point to CD147 having a possible negative regulatory role in T cell-mediated immune responses.

The effect of myostatin silencing by lentiviral-mediated RNA interference on goat fetal fibroblasts.

PubMed

Lu, Jian; Wei, Caihong; Zhang, Xiaoning; Xu, Lingyang; Zhang, Shifang; Liu, Jiasen; Cao, Jiaxue; Zhao, Fuping; Zhang, Li; Li, Bichun; Du, Lixin

2013-06-01

Myostatin is a transforming growth factor-β family member that acts as a negative regulator of skeletal muscle mass. To identify possible myostatin inhibitors that may promote muscle growth, we used RNA interference mediated by a lentiviral vector to knockdown myostatin in goat fetal fibroblast cells. We also investigated the expression changes in relevant myogenic regulatory factors (MRFs) and adipogenic regulatory factors in the absence of myostatin in goat fetal fibroblasts. Quantitative RT-PCR revealed that myostatin transcripts were significantly reduced by 75 % (P < 0.01). Western blot showed that myostatin protein expression was reduced by 95 % (P < 0.01). We also found that the mRNA expression of activin receptor IIB (ACVR2B) significantly increased by 350 % (P < 0.01), and p21 increased 172 % (P < 0.01). Furthermore, myostatin inhibition decreased Myf5 and increased MEF2C mRNA expression in goat fetal fibroblasts, suggesting that myostatin regulates MRFs differently in fibroblasts compared to muscle. In addition, the expression of adipocyte marker genes peroxisome proliferator-activated receptor (PPAR) γ and leptin, but not CCAAT/enhance-binding protein (C/EBP) α and C/EBPβ, were upregulated at the transcript level after myostatin silencing. These results suggest that we have generated a novel way to block myostatin in vitro, which could be used to improve livestock meat production and gene therapy of musculoskeletal diseases. This also suggests that myostatin plays a negative role in regulating the expression of adipogenesis related genes in goat fetal fibroblasts.

Harnessing RNA interference to develop neonatal therapies: from Nobel Prize winning discovery to proof of concept clinical trials.

PubMed

DeVincenzo, John P

2009-10-01

A revolution in the understanding of RNA biological processing and control is leading to revolutionary new concepts in human therapeutics. It has become increasingly clear that the so called "non-coding RNA" exerts specific and profound functional control on regulation of protein production and indeed controls the expression of all genes. Harnessing this naturally-occurring RNA-mediated regulation of protein production has immense human therapeutic potential. These processes are collectively known as RNA interference (RNAi). RNAi is a recently discovered, naturally-occurring intracellular process that regulates gene expression through the silencing of specific mRNAs. Methods of harnessing this natural pathway are being developed that allow the catalytic degradation of targeted mRNAs using specifically designed complementary small inhibitory RNAs (siRNA). siRNAs are being chemically modified to acquire drug-like properties. Numerous recent high profile publications have provided proofs of concept that RNA interference may be useful therapeutically. Much of the design of these siRNAs can be accomplished bioinformatically, thus potentially expediting drug discovery and opening new avenues of therapy for many uncommon, orphan, or emerging diseases. This makes this approach very attractive for developing therapies targeting orphan diseases including neonatal diseases. Theoretically, any disease that can be ameliorated through knockdown of any endogenous or exogenous protein is a potential therapeutic target for RNAi-based therapeutics. Lung diseases are particularly attractive targets for RNAi therapeutics since the affected cells' location increases their accessibility to topical administration of siRNA, for example by aerosol. Respiratory viral infections and chronic lung disease are examples of such diseases. RNAi therapeutics have been shown to be active against RSV, parainfluenza and human metapneumoviruses in vitro and in vivo resulting in profound antiviral effects. The first proof of concept test of efficacy of an RNAi-based therapeutic in man has been initiated. A discussion of the science behind RNA interference is followed by a presentation of the potential practical issues in applying this technology to neonatal respiratory viral diseases. RNAi may offer new strategies for the treatment of a variety of orphan diseases including neonatal diseases, RSV infections, and other respiratory viruses.

[Expression analysis of a transformer gene in Daphnia pulex after RNAi].

PubMed

Guo, C Y; Chen, P; Zhang, M M; Ning, J J; Wang, С L; Wang, D L; Zhao, Y L

2016-01-01

In order to explore the importance of the transformer (tra) gene in reproductive mode switching in Daphnia pulex, we studied the effect of silencing of this gene using RNA interference (RNAi). We obtained Dptra dsRNA by constructing and using a dsRNA expression vector and transcription method in vitro. D. pulex individuals in different reproductive modes were treated by soaking in a solution of Dptra dsRNA. We then assayed the expression of the endogenous Dptra mRNA after RNAi treatment using RT-PCR and obtained the suppression ratio. Expression of the tra gene in the RNAi groups was down-regulated compared with the controls after 16 h (p < 0.05). We also analyzed the effect of RNAi on the expression of the TRA protein using Western blot, which showed that the expression level of the TRA protein was reduced after RNAi treatment. Our experimental results showed that soaking of D. pulex adults in tra-specific dsRNA transcribed in vitro can specifically reduce the level of tra mRNA and also reduce the expression of the TRA protein, demonstrating effective in vivo silencing of the tra gene.

A-to-I editing of coding and non-coding RNAs by ADARs

PubMed Central

Nishikura, Kazuko

2016-01-01

Adenosine deaminases acting on RNA (ADARs) convert adenosine to inosine in double-stranded RNA. This A-to-I editing occurs not only in protein-coding regions of mRNAs, but also frequently in non-coding regions that contain inverted Alu repeats. Editing of coding sequences can result in the expression of functionally altered proteins that are not encoded in the genome, whereas the significance of Alu editing remains largely unknown. Certain microRNA (miRNA) precursors are also edited, leading to reduced expression or altered function of mature miRNAs. Conversely, recent studies indicate that ADAR1 forms a complex with Dicer to promote miRNA processing, revealing a new function of ADAR1 in the regulation of RNA interference. PMID:26648264

RNAi-dependent and -independent antiviral phenotypes of chromosomally integrated shRNA clones: role of VASP in respiratory syncytial virus growth.

PubMed

Musiyenko, Alla; Bitko, Vira; Barik, Sailen

2007-07-01

Stable RNA interference (RNAi) is commonly achieved by recombinant expression of short hairpin RNA (shRNA). To generate virus-resistant cell lines, we cloned a shRNA cassette against the phosphoprotein gene of respiratory syncytial virus (RSV) into a polIII-driven plasmid vector. Analysis of individual stable transfectants showed a spectrum of RSV resistance correlating with the levels of shRNA expressed from different chromosomal locations. Interestingly, resistance in a minority of clones was due to mono-allelic disruption of the cellular gene for vasodilator-stimulated phosphoprotein (VASP). Thus, pure clones of chromosomally integrated DNA-directed RNAi can exhibit gene disruption phenotypes resembling but unrelated to RNAi.

Defining the molecular profile of planarian pluripotent stem cells using a combinatorial RNA-seq, RNA interference and irradiation approach

PubMed Central

2012-01-01

Background Planarian stem cells, or neoblasts, drive the almost unlimited regeneration capacities of freshwater planarians. Neoblasts are traditionally described by their morphological features and by the fact that they are the only proliferative cell type in asexual planarians. Therefore, they can be specifically eliminated by irradiation. Irradiation, however, is likely to induce transcriptome-wide changes in gene expression that are not associated with neoblast ablation. This has affected the accurate description of their specific transcriptomic profile. Results We introduce the use of Smed-histone-2B RNA interference (RNAi) for genetic ablation of neoblast cells in Schmidtea mediterranea as an alternative to irradiation. We characterize the rapid, neoblast-specific phenotype induced by Smed-histone-2B RNAi, resulting in neoblast ablation. We compare and triangulate RNA-seq data after using both irradiation and Smed-histone-2B RNAi over a time course as means of neoblast ablation. Our analyses show that Smed-histone-2B RNAi eliminates neoblast gene expression with high specificity and discrimination from gene expression in other cellular compartments. We compile a high confidence list of genes downregulated by both irradiation and Smed-histone-2B RNAi and validate their expression in neoblast cells. Lastly, we analyze the overall expression profile of neoblast cells. Conclusions Our list of neoblast genes parallels their morphological features and is highly enriched for nuclear components, chromatin remodeling factors, RNA splicing factors, RNA granule components and the machinery of cell division. Our data reveal that the regulation of planarian stem cells relies on posttranscriptional regulatory mechanisms and suggest that planarians are an ideal model for this understudied aspect of stem cell biology. PMID:22439894

Oral Delivery of Double-Stranded RNA in Larvae of the Yellow Fever Mosquito, Aedes aegypti: Implications for Pest Mosquito Control

PubMed Central

Singh, Aditi D.; Wong, Sylvia; Ryan, Calen P.; Whyard, Steven

2013-01-01

RNA interference has already proven itself to be a highly versatile molecular biology tool for understanding gene function in a limited number of insect species, but its widespread use in other species will be dependent on the development of easier methods of double-stranded RNA (dsRNA) delivery. This study demonstrates that RNA interference can be induced in the mosquito Aedes aegypti L. (Diptera: Culicidae) simply by soaking larvae in a solution of dsRNA for two hours. The mRNA transcripts for β-tubulin, chitin synthase-1 and -2, and heat shock protein 83 were reduced between 30 and 50% three days post-dsRNA treatment. The dsRNA was mixed with a visible dye to identify those individuals that fed on the dsRNA, and based on an absence of RNA interference in those individuals that contained no dye within their guts, the primary route of entry of dsRNA is likely through the gut epithelium. RNA interference was systemic in the insects, inducing measurable knock down of gene expression in tissues beyond the gut. Silencing of the β-tubulin and chitin synthase-1 genes resulted in reduced growth and/or mortality of the larvae, demonstrating the utility of dsRNA as a potential mosquito larvicide. Silencing of chitin synthase-2 did not induce mortality in the larvae, and silencing of heat shock protein 83 only induced mortality in the insects if they were subsequently subjected to a heat stress. Drosophila melanogaster Meigen (Diptera: Drosophilidae) larvae were also soaked in dsRNA designed to specifically target either their own β-tubulin gene, or that of A. aegypti, and significant mortality was only seen in larvae treated with dsRNA targeting their own gene, which suggests that dsRNA pesticides could be designed to be species-limited. PMID:24224468

Effects of RNA interference-mediated silencing of toll-like receptor 4 gene on proliferation and apoptosis of human breast cancer MCF-7 and MDA-MB-231 cells: An in vitro study.

PubMed

Gao, Xiao-Ling; Yang, Jiao-Jiao; Wang, Shu-Juan; Chen, Yan; Wang, Bei; Cheng, Er-Jing; Gong, Jian-Nan; Dong, Yan-Ting; Liu, Dai; Wang, Xiang-Li; Huang, Ya-Qiong; An, Dong-Dong

2018-06-22

Breast cancer is known as the most prevalent cancer in women worldwide, and has an undeniable negative impact on public health, both physically, and mentally. This study aims to investigate the effects of toll-like receptor 4 (TLR4) gene silencing on proliferation and apoptosis of human breast cancer cells to explore for a new theoretical basis for its treatment. TLR4 small interference RNA (siRNA) fragment recombinant plasmids were constructed, including TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3. Human breast cancer MCF-7 and MDA-MB-231 cells were assigned into blank, negative control (NC), TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3 groups. MCF-7 and MDA-MB-231 cell growth was detected by MTT assay. Apoptosis and cell cycle were determined by flow cytometry. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) and Western blot analysis were conducted to determine the expression of TLR4, CDK4, cyclin D1, Livin, Bcl-2, p53, c-FLIP, and caspase-3. In comparison with the NC and blank groups, the TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3 groups showed decreased the expression of TLR4, inhibited proliferation of MCF-7 and MDA-MB-231 cells and promoted MCF-7 and MDA-MB-231 cell apoptosis, and the cells were blocked in G1 phase. In comparison with the NC and blank groups, in the TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3 groups, siRNA-TLR4 significantly increased expression of p53 and caspase-3 in MCF-7 and MDA-MB-231 cells, while it decreased the expressions of CDK4, cyclinD1, Livin, Bal-2, and c-FLIP. The study demonstrates that TLR4 gene silencing inhibits proliferation and induces apoptosis of MCF-7 and MDA-MB-231 cells. © 2018 Wiley Periodicals, Inc.

Isl-1 down-regulates DRG cell proliferation during chicken embryo development.

PubMed

Chen, Dawei; Wang, Guoxin; Luo, Haoshu; Liu, Jiali; Cui, Sheng

2010-01-01

Protein Isl-1 RNA interference and over expression in early chicken embryo dorsal root ganglia (DRG) were used to investigate the function of Isl-1 in DRG cell proliferation. Isl-1 targeted shRNA expression vector and Isl-1 over-expression vector were transfected into chicken embryo DRG by in ovo electroporation. Then, the DRG proliferation rate was detected by BrdU immunohistochemistry. The rate of DRG cell proliferation increased after Isl-1 knock-down and decreased after Isl-1 over-expression. In this study, we found that Isl-1 negatively modulates DRG cell proliferation.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

The HIV Nef protein modulates cellular and exosomal miRNA profiles in human monocytic cells.

PubMed

Aqil, Madeeha; Naqvi, Afsar Raza; Mallik, Saurav; Bandyopadhyay, Sanghamitra; Maulik, Ujjwal; Jameel, Shahid

2014-01-01

The HIV Nef protein is a multifunctional virulence factor that perturbs intracellular membranes and signalling and is secreted into exosomes. While Nef-containing exosomes have a distinct proteomic profile, no comprehensive analysis of their miRNA cargo has been carried out. Since Nef functions as a viral suppressor of RNA interference and disturbs the distribution of RNA-induced silencing complex proteins between cells and exosomes, we hypothesized that it might also affect the export of miRNAs into exosomes. Exosomes were purified from human monocytic U937 cells that stably expressed HIV-1 Nef. The RNA from cells and exosomes was profiled for 667 miRNAs using a Taqman Low Density Array. Selected miRNAs and their mRNA targets were validated by quantitative RT-PCR. Bioinformatics analyses were used to identify targets and predict pathways. Nef expression affected a significant fraction of miRNAs in U937 cells. Our analysis showed 47 miRNAs to be selectively secreted into Nef exosomes and 2 miRNAs to be selectively retained in Nef-expressing cells. The exosomal miRNAs were predicted to target several cellular genes in inflammatory cytokine and other pathways important for HIV pathogenesis, and an overwhelming majority had targets within the HIV genome. This is the first study to report miRnome analysis of HIV Nef expressing monocytes and exosomes. Our results demonstrate that Nef causes large-scale dysregulation of cellular miRNAs, including their secretion through exosomes. We suggest this to be a novel viral strategy to affect pathogenesis and to limit the effects of RNA interference on viral replication and persistence.

A Herpesvirus Protein Selectively Inhibits Cellular mRNA Nuclear Export.

PubMed

Gong, Danyang; Kim, Yong Hoon; Xiao, Yuchen; Du, Yushen; Xie, Yafang; Lee, Kevin K; Feng, Jun; Farhat, Nisar; Zhao, Dawei; Shu, Sara; Dai, Xinghong; Chanda, Sumit K; Rana, Tariq M; Krogan, Nevan J; Sun, Ren; Wu, Ting-Ting

2016-11-09

Nuclear mRNA export is highly regulated to ensure accurate cellular gene expression. Viral inhibition of cellular mRNA export can enhance viral access to the cellular translation machinery and prevent anti-viral protein production but is generally thought to be nonselective. We report that ORF10 of Kaposi's sarcoma-associated herpesvirus (KSHV), a nuclear DNA virus, inhibits mRNA export in a transcript-selective manner to control cellular gene expression. Nuclear export inhibition by ORF10 requires an interaction with an RNA export factor, Rae1. Genome-wide analysis reveals a subset of cellular mRNAs whose nuclear export is blocked by ORF10 with the 3' UTRs of ORF10-targeted transcripts conferring sensitivity to export inhibition. The ORF10-Rae1 interaction is important for the virus to express viral genes and produce infectious virions. These results suggest that a nuclear DNA virus can selectively interfere with RNA export to restrict host gene expression for optimal replication. Published by Elsevier Inc.

Genetically Modifying the Insect Gut Microbiota to Control Chagas Disease Vectors through Systemic RNAi

PubMed Central

Taracena, Mabel L.; Oliveira, Pedro L.; Almendares, Olivia; Umaña, Claudia; Lowenberger, Carl; Dotson, Ellen M.; Paiva-Silva, Gabriela O.; Pennington, Pamela M.

2015-01-01

Technologies based on RNA interference may be used for insect control. Sustainable strategies are needed to control vectors of Chagas disease such as Rhodnius prolixus. The insect microbiota can be modified to deliver molecules to the gut. Here, Escherichia coli HT115(DE3) expressing dsRNA for the Rhodnius heme-binding protein (RHBP) and for catalase (CAT) were fed to nymphs and adult triatomine stages. RHBP is an egg protein and CAT is an antioxidant enzyme expressed in all tissues by all developmental stages. The RNA interference effect was systemic and temporal. Concentrations of E. coli HT115(DE3) above 3.35 × 107 CFU/mL produced a significant RHBP and CAT gene knockdown in nymphs and adults. RHBP expression in the fat body was reduced by 99% three days after feeding, returning to normal levels 10 days after feeding. CAT expression was reduced by 99% and 96% in the ovary and the posterior midgut, respectively, five days after ingestion. Mortality rates increased by 24-30% in first instars fed RHBP and CAT bacteria. Molting rates were reduced by 100% in first instars and 80% in third instars fed bacteria producing RHBP or CAT dsRNA. Oviposition was reduced by 43% (RHBP) and 84% (CAT). Embryogenesis was arrested in 16% (RHBP) and 20% (CAT) of laid eggs. Feeding females 105 CFU/mL of the natural symbiont, Rhodococcus rhodnii, transformed to express RHBP-specific hairpin RNA reduced RHBP expression by 89% and reduced oviposition. Modifying the insect microbiota to induce systemic RNAi in R. prolixus may result in a paratransgenic strategy for sustainable vector control. PMID:25675102

RNA sensor LGP2 inhibits TRAF ubiquitin ligase to negatively regulate innate immune signaling.

PubMed

Parisien, Jean-Patrick; Lenoir, Jessica J; Mandhana, Roli; Rodriguez, Kenny R; Qian, Kenin; Bruns, Annie M; Horvath, Curt M

2018-06-01

The production of type I interferon (IFN) is essential for cellular barrier functions and innate and adaptive antiviral immunity. In response to virus infections, RNA receptors RIG-I and MDA5 stimulate a mitochondria-localized signaling apparatus that uses TRAF family ubiquitin ligase proteins to activate master transcription regulators IRF3 and NFκB, driving IFN and antiviral target gene expression. Data indicate that a third RNA receptor, LGP2, acts as a negative regulator of antiviral signaling by interfering with TRAF family proteins. Disruption of LGP2 expression in cells results in earlier and overactive transcriptional responses to virus or dsRNA LGP2 associates with the C-terminus of TRAF2, TRAF3, TRAF5, and TRAF6 and interferes with TRAF ubiquitin ligase activity. TRAF interference is independent of LGP2 ATP hydrolysis, RNA binding, or its C-terminal domain, and LGP2 can regulate TRAF-mediated signaling pathways in trans , including IL-1β, TNFα, and cGAMP These findings provide a unique mechanism for LGP2 negative regulation through TRAF suppression and extend the potential impact of LGP2 negative regulation beyond the IFN antiviral response. © 2018 The Authors.

A Small GTP-Binding Host Protein Is Required for Entry of Powdery Mildew Fungus into Epidermal Cells of Barley1

PubMed Central

Schultheiss, Holger; Dechert, Cornelia; Kogel, Karl-Heinz; Hückelhoven, Ralph

2002-01-01

Small GTP-binding proteins such as those from the RAC family are cytosolic signal transduction proteins that often are involved in processing of extracellular stimuli. Plant RAC proteins are implicated in regulation of plant cell architecture, secondary wall formation, meristem signaling, and defense against pathogens. We isolated a RacB homolog from barley (Hordeum vulgare) to study its role in resistance to the barley powdery mildew fungus (Blumeria graminis f.sp. hordei). RacB was constitutively expressed in the barley epidermis and its expression level was not strongly influenced by inoculation with B. graminis. However, after biolistic bombardment of barley leaf segments with RacB-double-stranded RNA, sequence-specific RNA interference with RacB function inhibited fungal haustorium establishment in a cell-autonomous and genotype-specific manner. Mutants compromised in function of the Mlo wild-type gene and the Ror1 gene (genotype mlo5 ror1) that are moderately susceptible to B. graminis showed no alteration in powdery mildew resistance upon RacB-specific RNA interference. Thus, the phenotype, induced by RacB-specific RNA interference, was apparently dependent on the same processes as mlo5-mediated broad resistance, which is suppressed by ror1. We conclude that an RAC small GTP-binding protein is required for successful fungal haustorium establishment and that this function may be linked to MLO-associated functions. PMID:11950993

Ingestion of genetically modified yeast symbiont reduces fitness of an insect pest via RNA interference

PubMed Central

Murphy, Katherine A.; Tabuloc, Christine A.; Cervantes, Kevin R.; Chiu, Joanna C.

2016-01-01

RNA interference has had major advances as a developing tool for pest management. In laboratory experiments, double-stranded RNA (dsRNA) is often administered to the insect by genetic modification of the crop, or synthesized in vitro and topically applied to the crop. Here, we engineered genetically modified yeast that express dsRNA targeting y-Tubulin in Drosophila suzukii. Our design takes advantage of the symbiotic interactions between Drosophila, yeast, and fruit crops. Yeast is naturally found growing on the surface of fruit crops, constitutes a major component of the Drosophila microbiome, and is highly attractive to Drosophila. Thus, this naturally attractive yeast biopesticide can deliver dsRNA to an insect pest without the need for genetic crop modification. We demonstrate that this biopesticide decreases larval survivorship, and reduces locomotor activity and reproductive fitness in adults, which are indicative of general health decline. To our knowledge, this is the first study to show that yeast can be used to deliver dsRNA to an insect pest. PMID:26931800

siRNA targeting decoy receptor 3 enhances the sensitivity of gastric carcinoma cells to 5-fluorouracil.

PubMed

Xu, Xiao-Tao; Tao, Ze-Zhang; Song, Qi-Bin; Yao, Yi; Ruan, Peng

2012-09-01

In order to investigate the effects of RNA interference of decoy receptor 3 (DcR3) on the sensitivity of gastric cancer cells to 5-fluorouracil (5-FU) and the relevant mechanisms, siRNA against DcR3 was transfected into the gastric cancer cell line AGS. AGS cells were treated with different doses of 5-FU or for different time periods. The sensitivity of AGS cells to 5-FU was determined. The cell survival rate was detected by MTT assay. The apoptotic rate was determined by DAPI staining, and the expression of related proteins were detected by western blot analysis. The results showed that the cell survival rate was significanlty decreased in the knockdown group compared to the control group at different doses of 5-FU (P<0.01). After different time periods of treatment with 5-FU, the cell survival rate in the knockdown group was significantly decreased compared to the control group, respectively (P<0.01). The apoptotic rate of AGS cells in the knockdown group was increased along with the increasing dose of siRNA. The siRNA against DcR3 enhanced the expression of Fas, FasL, caspase-3 and caspase-8. In conclusion, knockdown of DcR3 by RNA interference enhances apoptosis and inhibits the growth of gastric cancer cells. Downregulation of DcR3 enhances the sensitivity of gastric cancer cells to 5-FU and increased the expression of Fas, FasL and caspase-3/8.

Interference in plant defense and development by non-structural protein NSs of Groundnut bud necrosis virus.

PubMed

Goswami, Suneha; Sahana, Nandita; Pandey, Vanita; Doblas, Paula; Jain, R K; Palukaitis, Peter; Canto, Tomas; Praveen, Shelly

2012-01-01

Groundnut bud necrosis virus (GBNV) infects a large number of leguminous and solanaceous plants. To elucidate the biological function of the non-structural protein encoded by the S RNA of GBNV (NSs), we studied its role in RNA silencing suppression and in viral pathogenesis. Our results demonstrated that GBNV NSs functions as a suppressor of RNA silencing using the agroinfiltration patch assay. An in silico analysis suggested the presence of pro-apoptotic protein Reaper-like sequences in the GBNV NSs, which were known to be present in animal infecting bunyaviruses. Utilizing NSs mutants, we demonstrated that a Leu-rich domain was required for RNA silencing suppression activity, but not the non-overlapping Trp/GH3 motif of the Reaper-like sequence. To investigate the role of NSs in symptom development we generated transgenic tomato expressing the GBNV NSs and showed that the expression of NSs in tomato mimics symptoms induced by infection with GBNV, such as leaf senescence and necrosis. As leaf senescence is controlled by miR319 regulation of the transcription factor TCP1, we assessed the accumulation of both RNAs in transgenic NSs-expressing and GBNV-infected tomato plants. In both types of plants the levels of miR319 decreased, while the levels of TCP1 transcripts increased. We propose that GBNV-NSs affects miRNA biogenesis through its RNA silencing suppressor activity and interferes with TCP1-regulated leaf developmental pathways. Copyright © 2011 Elsevier B.V. All rights reserved.

siRNA-mediated silencing of MDR1 reverses the resistance to oxaliplatin in SW480/OxR colon cancer cells.

PubMed

Montazami, N; Kheir Andish, M; Majidi, J; Yousefi, M; Yousefi, B; Mohamadnejad, L; Shanebandi, D; Estiar, M A; Khaze, V; Mansoori, B; Baghbani, E; Baradaran, B

2015-05-28

One of the most challenging aspects of colon cancer therapy is rapid acquisition of multidrug resistant phenotype. The multidrug resistance gene 1 (MDR1) product, p—glycoprotein (P—gp), pump out a variety of anticancer agents from the cell, giving rise to a general drug resistance against chemotherapeutic agents. The aim of this study was to investigate the effect of a specific MDR1 small interference RNA (siRNA) on sensitivity of oxaliplatin—resistant SW480 human colon cancer cell line (SW480/OxR) to the chemotherapeutic drug oxaliplatin. SW480 cells were made resistant by continuous incubation with stepwise serially increased concentrations of oxaliplatin over a 6—months period. Resistance cell were subsequently transfected with specific MDR1 siRNA. Relative MDR1 mRNA expression was measured by Quantitative real—time PCR. Western blot analysis was performed to determine the protein levels of P—gp. The cytotoxic effects of oxaliplatin and MDR1 siRNA, alone and in combination were assessed using MTT and the number of apoptotic cells was determined with the TUNEL assay. MDR1 siRNA effectively reduced MDR1 expression in both mRNA and protein levels. MDR1 down—regulation synergistically increased the cytotoxic effects of oxaliplatin and spontaneous apoptosis SW480/OxR. Our data demonstrates that RNA interference could down regulate MDR1 gene expression and reduce the P—gp level, and partially reverse the drug resistance in SW480/OxR cells in vitro. Therefore, the results could suggest that MDR1 silencing may be a potent adjuvant in human colon chemotherapy.

[Study on the inhibition effect of siRNA on herpes simplex virus type 2 ICP4 gene].

PubMed

Liu, Ji-feng; Guan, Cui-ping; Tang, Xu; Xu, Ai-e

2010-06-01

To explore the inhibition effect of RNA interference on the ICP4 expression and DNA replication of herpes simplex virus type 2 (HSV2). Four pairs of siRNA targeted to HSV2 ICP4 gene and negative control siRNA were synthetized by chemical method, named as siRNA-1, siRNA-2, siRNA-3, siRNA-4 and siRNA-N respecticely. HSV2 HG52 was used to attack Vero cell after transfection overnight. Vero cell and supernatant were collected at 1d, 2d, 3d, 4d and 5d after virus attacking. Flurogenic quantitative reverse transcription polymerase chain reaction (FQ-RT-PCR)was used to detect the expression of HSV2 ICP4 mRNA, flurogenic quantitative polymerase chain reaction(FG-PCR) was used to detect the expression of HSV2 DNA and Western-Blot was used to detect the expression of HSV2 ICP4 protein. All the four pairs of siRNA could significantly inhibit the expression of HSV2 ICP4 mRNA and protein, especially siRNA-2. The above siRNAs could significantly decrease HSV2 DNA copy number,too. siRNAs targeted to HSV2 ICP4 gene could significantly inhibit expression of HSV2 ICP4 mRNA and protein, and decrease HSV2 DNA copy number, suggesting that siRNA can inhibit HSV2 DNA replication through silencing ICP4 gene.

Downregulation of mouse CCR3 by lentiviral shRNA inhibits proliferation and induces apoptosis of mouse eosinophils.

PubMed

Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui

2017-02-01

RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.

Decreased low back pain intensity and differential gene expression following Calmare®: results from a double-blinded randomized sham-controlled study.

PubMed

Starkweather, Angela R; Coyne, Patrick; Lyon, Debra E; Elswick, R K; An, Kyungeh; Sturgill, Jamie

2015-02-01

In this double-blinded, randomized controlled trial we evaluated the effects of Calmare®, a non-invasive neurocutaneous electrical pain intervention, on lower back pain intensity as measured by the "worst" pain score and on pain interference using the Brief Pain Inventory-Short Form, on measures of pain sensitivity assessed by quantitative sensory testing, and on mRNA expression of pain sensitivity genes. Thirty participants were randomized to receive up to 10 sessions of Calmare® treatment (n = 15) or a sham treatment (n = 15) using the same device at a non-therapeutic threshold. At 3 weeks after conclusion of treatment, compared with the sham group, the Calmare® group reported a significant decrease in the "worst" pain and interference scores. There were also significant differences in pain sensitivity and differential mRNA expression of 17 pain genes, suggesting that Calmare® can be effective in reducing pain intensity and interference in individuals with persistent low back pain by altering the mechanisms of enhanced pain sensitivity. Further study of long-term pain outcomes, particularly functional status, analgesic use and health care utilization, is warranted. © 2015 Wiley Periodicals, Inc.

Intergenic Transcriptional Interference Is Blocked by RNA Polymerase III Transcription Factor TFIIIB in Saccharomyces cerevisiae

PubMed Central

Korde, Asawari; Rosselot, Jessica M.; Donze, David

2014-01-01

The major function of eukaryotic RNA polymerase III is to transcribe transfer RNA, 5S ribosomal RNA, and other small non-protein-coding RNA molecules. Assembly of the RNA polymerase III complex on chromosomal DNA requires the sequential binding of transcription factor complexes TFIIIC and TFIIIB. Recent evidence has suggested that in addition to producing RNA transcripts, chromatin-assembled RNA polymerase III complexes may mediate additional nuclear functions that include chromatin boundary, nucleosome phasing, and general genome organization activities. This study provides evidence of another such “extratranscriptional” activity of assembled RNA polymerase III complexes, which is the ability to block progression of intergenic RNA polymerase II transcription. We demonstrate that the RNA polymerase III complex bound to the tRNA gene upstream of the Saccharomyces cerevisiae ATG31 gene protects the ATG31 promoter against readthrough transcriptional interference from the upstream noncoding intergenic SUT467 transcription unit. This protection is predominately mediated by binding of the TFIIIB complex. When TFIIIB binding to this tRNA gene is weakened, an extended SUT467–ATG31 readthrough transcript is produced, resulting in compromised ATG31 translation. Since the ATG31 gene product is required for autophagy, strains expressing the readthrough transcript exhibit defective autophagy induction and reduced fitness under autophagy-inducing nitrogen starvation conditions. Given the recent discovery of widespread pervasive transcription in all forms of life, protection of neighboring genes from intergenic transcriptional interference may be a key extratranscriptional function of assembled RNA polymerase III complexes and possibly other DNA binding proteins. PMID:24336746

RNA interference-based nanosystems for inflammatory bowel disease therapy

PubMed Central

Guo, Jian; Jiang, Xiaojing; Gui, Shuangying

2016-01-01

Inflammatory bowel disease (IBD), which includes ulcerative colitis and Crohn’s disease, is a chronic, recrudescent disease that invades the gastrointestinal tract, and it requires surgery or lifelong medicinal therapy. The conventional medicinal therapies for IBD, such as anti-inflammatories, glucocorticoids, and immunosuppressants, are limited because of their systemic adverse effects and toxicity during long-term treatment. RNA interference (RNAi) precisely regulates susceptibility genes to decrease the expression of proinflammatory cytokines related to IBD, which effectively alleviates IBD progression and promotes intestinal mucosa recovery. RNAi molecules generally include short interfering RNA (siRNA) and microRNA (miRNA). However, naked RNA tends to degrade in vivo as a consequence of endogenous ribonucleases and pH variations. Furthermore, RNAi treatment may cause unintended off-target effects and immunostimulation. Therefore, nanovectors of siRNA and miRNA were introduced to circumvent these obstacles. Herein, we introduce non-viral nanosystems of RNAi molecules and discuss these systems in detail. Additionally, the delivery barriers and challenges associated with RNAi molecules will be discussed from the perspectives of developing efficient delivery systems and potential clinical use. PMID:27789943

[Recombinant adeno-associated virus mediated RNA interference of angiogenin expression inhibits cell growth of human lung adenocarcinoma].

PubMed

Li, Bai-Ling; Zhang, Guan-Xin; Hou, Xiao-Lei; Tan, Meng-Wei; Yuan, Yang; Liu, Xiao-Hong; Gong, De-Jun; Huang, Sheng-Dong

2009-03-01

To study the inhibition of angiogenin (ANG) expression in human lung squamous cancer cell strain-A549 through adeno-associated virus (AAV)-mediated RNA-interference, and therefore to observe its effect on the growth of cancer cells and tumor formation. Recombinant AAV expressing H1-promoter-induced small-interference- RNA (siRNA) targeting ANG (AAV-shANG) was constructed, and then transfected into A549 cells. A549 cells and cells transfected with AAV-Null were used as the control groups. The effects of the reduced expression of ANG by RNAi from AAV-shANG on the growth, formation, reproduction, apoptosis, and microvessel-density of the carcinoma were observed. In vitro experiment showed that AAV-shANG was constructed successfully, There was an significant decrease in the expression of ANG protein 72 h after transfection, compared with the normal A459 cells and AAV-Null cells (P < 0.01). Cell cycle analysis showed that the proliferation index (PI) of normal A549 cells, AAV-Null cells and AAVshANG cells were 0.32 +/- 0.29, 0.35 +/- 0.38 and 0.31 +/- 0.43, respectively. There was no statistic difference in the PIs among the 3 groups (P > 0.05). In vivo experiment using thymus-defect mice showed that, there was an remarkable reduction in the mass and volume of tumors in AAV-shANG transfected group, compared to the control groups. Microvessel-density was 9.4 +/- 1.5, 9.8 +/- 2.1 and 5.7 +/- 1.9, respectively in the 3 groups, a statistic difference among the AAV-shANG-transfected group, the normal A549 group and the AAV-Null transfected group. The percentages of apoptotic cells in each group were (7.7 +/- 3.1)%, (8.5 +/- 5.4)%, (17.1 +/- 8.6)%, respectively, the experimental group being higher than those of the control groups. Positive rates of PCNA were (84.8 +/- 9.7)%, (85.8 +/- 9.8)%, and (70.4 +/- 10.1)%, respectively, the AAV-shANG transfected cancer cells showing a lower PCNA index than the control groups. AAV-mediated expression of siRNA could reduce the expression of ANG in cancer cells, significantly enough to inhibit cell proliferation, promote cell apoptosis and inhibit tumor growth.

Interference of hepatitis C virus RNA replication by short interfering RNAs

NASA Astrophysics Data System (ADS)

Kapadia, Sharookh B.; Brideau-Andersen, Amy; Chisari, Francis V.

2003-02-01

Hepatitis C virus (HCV) infection is a major cause of chronic liver disease, which can lead to the development of liver cirrhosis and hepatocellular carcinoma. Current therapy of patients with chronic HCV infection includes treatment with IFN in combination with ribavirin. Because most treated patients do not resolve the infection, alternative treatment is essential. RNA interference (RNAi) is a recently discovered antiviral mechanism present in plants and animals that induces double-stranded RNA degradation. Using a selectable subgenomic HCV replicon cell culture system, we have shown that RNAi can specifically inhibit HCV RNA replication and protein expression in Huh-7 cells that stably replicate the HCV genome, and that this antiviral effect is independent of IFN. These results suggest that RNAi may represent a new approach for the treatment of persistent HCV infection.

RNAi therapeutics and applications of microRNAs in cancer treatment.

PubMed

Uchino, Keita; Ochiya, Takahiro; Takeshita, Fumitaka

2013-06-01

RNA interference-based therapies are proving to be powerful tools for combating various diseases, including cancer. Scientists are researching the development of safe and efficient systems for the delivery of small RNA molecules, which are extremely fragile in serum, to target organs and cells in the human body. A dozen pre-clinical and clinical trials have been under way over the past few years involving biodegradable nanoparticles, lipids, chemical modification and conjugation. On the other hand, microRNAs, which control the balance of cellular biological processes, have been studied as attractive therapeutic targets in cancer treatment. In this review, we provide an overview of RNA interference-based therapeutics in clinical trials and discuss the latest technology for the systemic delivery of nucleic acid drugs. Furthermore, we focus on dysregulated microRNAs in human cancer, which have progressed in pre-clinical trials as therapeutic targets, and describe a wide range of strategies to control the expression levels of endogenous microRNAs. Further development of RNA interference technologies and progression of clinical trials will contribute to the achievement of practical applications of nucleic acid drugs.

A Significant Increase of RNAi Efficiency in Human Cells by the CMV Enhancer with a tRNAlys Promoter

PubMed Central

Weiwei, Ma; Zhenhua, Xie; Feng, Liu; Hang, Ning; Yuyang, Jiang

2009-01-01

RNA interference (RNAi) is the process of mRNA degradation induced by double-stranded RNA in a sequence-specific manner. Different types of promoters, such as U6, H1, tRNA, and CMV, have been used to control the inhibitory effect of RNAi expression vectors. In the present study, we constructed two shRNA expression vectors, respectively, controlled by tRNAlys and CMV enhancer-tRNAlys promoters. Compared to the vectors with tRNAlys or U6 promoter, the vector with a CMV enhancer-tRNAlys promoter silenced pokemon more efficiently on both the mRNA and the protein levels. Meanwhile, the silencing of pokemon inhibited the proliferation of MCF7 cells, but the induction of apoptosis of MCF7 cells was not observed. We conclude that the CMV enhancer-tRNAlys promoter may be a powerful tool in driving intracellular expression of shRNA which can efficiently silence targeted gene. PMID:19859553

Small Interfering RNA-Mediated Suppression of Fas Modulate Apoptosis and Proliferation in Rat Intervertebral Disc Cells.

PubMed

Park, Jong-Beom; Park, Chanjoo

2017-10-01

In vitro cell culture model. To investigate the effect of small interfering RNA (siRNA) on Fas expression, apoptosis, and proliferation in serum-deprived rat disc cells. Synthetic siRNA can trigger an RNA interference (RNAi) response in mammalian cells and precipitate the inhibition of specific gene expression. However, the potential utility of siRNA technology in downregulation of specific genes associated with disc cell apoptosis remains unclear. Rat disc cells were isolated and cultured in the presence of either 10% fetal bovine serum (FBS) (normal control) or 0% FBS (serum deprivation to induce apoptosis) for 48 hours. Fas expression, apoptosis, and proliferation were determined. Additionally, siRNA oligonucleotides against Fas (Fas siRNA) were transfected into rat disc cells to suppress Fas expression. Changes in Fas expression were assessed by reverse transcription-polymerase chain reaction and semiquantitatively analyzed using densitometry. The effect of Fas siRNA on apoptosis and proliferation of rat disc cells were also determined. Negative siRNA and transfection agent alone (Mock) were used as controls. Serum deprivation increased apoptosis by 40.3% ( p <0.001), decreased proliferation by 45.3% ( p <0.001), and upregulated Fas expression. Additionally, Fas siRNA suppressed Fas expression in serum-deprived cultures, with 68.5% reduction at the mRNA level compared to the control cultures ( p <0.001). Finally, Fas siRNA-mediated suppression of Fas expression significantly inhibited apoptosis by 9.3% and increased proliferation by 21% in serum-deprived cultures ( p <0.05 for both). The observed dual positive effect of Fas siRNA might be a powerful therapeutic approach for disc degeneration by suppression of harmful gene expression.

Modeling RNA interference in mammalian cells

PubMed Central

2011-01-01

Background RNA interference (RNAi) is a regulatory cellular process that controls post-transcriptional gene silencing. During RNAi double-stranded RNA (dsRNA) induces sequence-specific degradation of homologous mRNA via the generation of smaller dsRNA oligomers of length between 21-23nt (siRNAs). siRNAs are then loaded onto the RNA-Induced Silencing multiprotein Complex (RISC), which uses the siRNA antisense strand to specifically recognize mRNA species which exhibit a complementary sequence. Once the siRNA loaded-RISC binds the target mRNA, the mRNA is cleaved and degraded, and the siRNA loaded-RISC can degrade additional mRNA molecules. Despite the widespread use of siRNAs for gene silencing, and the importance of dosage for its efficiency and to avoid off target effects, none of the numerous mathematical models proposed in literature was validated to quantitatively capture the effects of RNAi on the target mRNA degradation for different concentrations of siRNAs. Here, we address this pressing open problem performing in vitro experiments of RNAi in mammalian cells and testing and comparing different mathematical models fitting experimental data to in-silico generated data. We performed in vitro experiments in human and hamster cell lines constitutively expressing respectively EGFP protein or tTA protein, measuring both mRNA levels, by quantitative Real-Time PCR, and protein levels, by FACS analysis, for a large range of concentrations of siRNA oligomers. Results We tested and validated four different mathematical models of RNA interference by quantitatively fitting models' parameters to best capture the in vitro experimental data. We show that a simple Hill kinetic model is the most efficient way to model RNA interference. Our experimental and modeling findings clearly show that the RNAi-mediated degradation of mRNA is subject to saturation effects. Conclusions Our model has a simple mathematical form, amenable to analytical investigations and a small set of parameters with an intuitive physical meaning, that makes it a unique and reliable mathematical tool. The findings here presented will be a useful instrument for better understanding RNAi biology and as modelling tool in Systems and Synthetic Biology. PMID:21272352

Neuron-derived orphan receptor 1 transduces survival signals in neuronal cells in response to hypoxia-induced apoptotic insults.

PubMed

Chio, Chung-Ching; Wei, Li; Chen, Tyng Guey; Lin, Chien-Min; Shieh, Ja-Ping; Yeh, Poh-Shiow; Chen, Ruei-Ming

2016-06-01

OBJECT Hypoxia can induce cell death or trigger adaptive mechanisms to guarantee cell survival. Neuron-derived orphan receptor 1 (NOR-1) works as an early-response protein in response to a variety of environmental stresses. In this study, the authors evaluated the roles of NOR-1 in hypoxia-induced neuronal insults. METHODS Neuro-2a cells were exposed to oxygen/glucose deprivation (OGD). Cell viability, cell morphology, cas-pase-3 activity, DNA fragmentation, and cell apoptosis were assayed to determine the mechanisms of OGD-induced neuronal insults. RNA and protein analyses were carried out to evaluate the effects of OGD on expressions of NOR-1, cAMP response element-binding (CREB), and cellular inhibitor of apoptosis protein 2 (cIAP2) genes. Translations of these gene expressions were knocked down using RNA interference. Mice subjected to traumatic brain injury (TBI) and NOR-1 was immunodetected. RESULTS Exposure of neuro-2a cells to OGD decreased cell viability in a time-dependent manner. Additionally, OGD led to cell shrinkage, DNA fragmentation, and cell apoptosis. In parallel, treatment of neuro-2a cells with OGD time dependently increased cellular NOR-1 mRNA and protein expressions. Interestingly, administration of TBI also augmented NOR-1 levels in the impacted regions of mice. As to the mechanism, exposure to OGD increased nuclear levels of the transcription factor CREB protein. Downregulating CREB expression using RNA interference simultaneously inhibited OGD-induced NOR-1 mRNA expression. Also, levels of cIAP2 mRNA and protein in neuro-2a cells were augmented by OGD. After reducing cIAP2 translation, OGD-induced cell death was reduced. Sequentially, application of NOR-1 small interfering RNA to neuro-2a cells significantly inhibited OGD-induced cIAP2 mRNA expression and concurrently alleviated hypoxia-induced alterations in cell viability, caspase-3 activation, DNA damage, and cell apoptosis. CONCLUSIONS This study shows that NOR-1 can transduce survival signals in neuronal cells responsible for hypoxiainduced apoptotic insults through activation of a CREB/cIAP2-dependent mechanism.

Functional analysis of two polygalacturonase genes in Apolygus lucorum associated with eliciting plant injury using RNA interference.

PubMed

Zhang, Wanna; Liu, Bing; Lu, Yanhui; Liang, Gemei

2017-04-01

Salivary enzymes of many piercing-sucking insects lead to host plant injury. The salivary enzymes, polygalacturonase (PGs), act in insect feeding. PG family genes have been cloned from the mirid bug Apolygus lucorum, a pest of cotton and other host crops in China. We investigated the function of two PG genes that are highly expressed in A. lucorum nymphs (PG3-4) and adults (PG3-5), using siRNA injection-based RNA interference (RNAi). Accumulation of mRNA encoding both genes and their cognate proteins was significantly reduced (>60%) in experimental compared control green fluorescent protein (GFP) siRNA-treated mirids at 48 h post injection. Injury levels of cotton buds were also significantly reduced after injecting saliva isolated from PG3-4 and PG3-5 siRNA-treated A. lucorum. These results demonstrate that these two PG act in A. lucorum elicitation of plant injury. © 2017 Wiley Periodicals, Inc.

Roles of Heparan Sulfate Sulfation in Dentinogenesis*

PubMed Central

Hayano, Satoru; Kurosaka, Hiroshi; Yanagita, Takeshi; Kalus, Ina; Milz, Fabian; Ishihara, Yoshihito; Islam, Md. Nurul; Kawanabe, Noriaki; Saito, Masahiro; Kamioka, Hiroshi; Adachi, Taiji; Dierks, Thomas; Yamashiro, Takashi

2012-01-01

Cell surface heparan sulfate (HS) is an essential regulator of cell signaling and development. HS traps signaling molecules, like Wnt in the glycosaminoglycan side chains of HS proteoglycans (HSPGs), and regulates their functions. Endosulfatases Sulf1 and Sulf2 are secreted at the cell surface to selectively remove 6-O-sulfate groups from HSPGs, thereby modifying the affinity of cell surface HSPGs for its ligands. This study provides molecular evidence for the functional roles of HSPG sulfation and desulfation in dentinogenesis. We show that odontogenic cells are highly sulfated on the cell surface and become desulfated during their differentiation to odontoblasts, which produce tooth dentin. Sulf1/Sulf2 double null mutant mice exhibit a thin dentin matrix and short roots combined with reduced expression of dentin sialophosphoprotein (Dspp) mRNA, encoding a dentin-specific extracellular matrix precursor protein, whereas single Sulf mutants do not show such defective phenotypes. In odontoblast cell lines, Dspp mRNA expression is potentiated by the activation of the Wnt canonical signaling pathway. In addition, pharmacological interference with HS sulfation promotes Dspp mRNA expression through activation of Wnt signaling. On the contrary, the silencing of Sulf suppresses the Wnt signaling pathway and subsequently Dspp mRNA expression. We also show that Wnt10a protein binds to cell surface HSPGs in odontoblasts, and interference with HS sulfation decreases the binding affinity of Wnt10a for HSPGs, which facilitates the binding of Wnt10a to its receptor and potentiates the Wnt signaling pathway, thereby up-regulating Dspp mRNA expression. These results demonstrate that Sulf-mediated desulfation of cellular HSPGs is an important modification that is critical for the activation of the Wnt signaling in odontoblasts and for production of the dentin matrix. PMID:22351753

Defining the molecular profile of planarian pluripotent stem cells using a combinatorial RNAseq, RNA interference and irradiation approach.

PubMed

Solana, Jordi; Kao, Damian; Mihaylova, Yuliana; Jaber-Hijazi, Farah; Malla, Sunir; Wilson, Ray; Aboobaker, Aziz

2012-01-01

Planarian stem cells, or neoblasts, drive the almost unlimited regeneration capacities of freshwater planarians. Neoblasts are traditionally described by their morphological features and by the fact that they are the only proliferative cell type in asexual planarians. Therefore, they can be specifically eliminated by irradiation. Irradiation, however, is likely to induce transcriptome-wide changes in gene expression that are not associated with neoblast ablation. This has affected the accurate description of their specific transcriptomic profile. We introduce the use of Smed-histone-2B RNA interference (RNAi) for genetic ablation of neoblast cells in Schmidtea mediterranea as an alternative to irradiation. We characterize the rapid, neoblast-specific phenotype induced by Smed-histone-2B RNAi, resulting in neoblast ablation. We compare and triangulate RNA-seq data after using both irradiation and Smed-histone-2B RNAi over a time course as means of neoblast ablation. Our analyses show that Smed-histone-2B RNAi eliminates neoblast gene expression with high specificity and discrimination from gene expression in other cellular compartments. We compile a high confidence list of genes downregulated by both irradiation and Smed-histone-2B RNAi and validate their expression in neoblast cells. Lastly, we analyze the overall expression profile of neoblast cells. Our list of neoblast genes parallels their morphological features and is highly enriched for nuclear components, chromatin remodeling factors, RNA splicing factors, RNA granule components and the machinery of cell division. Our data reveal that the regulation of planarian stem cells relies on posttranscriptional regulatory mechanisms and suggest that planarians are an ideal model for this understudied aspect of stem cell biology.

Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome

NASA Astrophysics Data System (ADS)

Lu, Rui; Folimonov, Alexey; Shintaku, Michael; Li, Wan-Xiang; Falk, Bryce W.; Dawson, William O.; Ding, Shou-Wei

2004-11-01

Viral infection in both plant and invertebrate hosts requires a virus-encoded function to block the RNA silencing antiviral defense. Here, we report the identification and characterization of three distinct suppressors of RNA silencing encoded by the 20-kb plus-strand RNA genome of citrus tristeza virus (CTV). When introduced by genetic crosses into plants carrying a silencing transgene, both p20 and p23, but not coat protein (CP), restored expression of the transgene. Although none of the CTV proteins prevented DNA methylation of the transgene, export of the silencing signal (capable of mediating intercellular silencing spread) was detected only from the F1 plants expressing p23 and not from the CP- or p20-expressing F1 plants, demonstrating suppression of intercellular silencing by CP and p20 but not by p23. Thus, intracellular and intercellular silencing are each targeted by a CTV protein, whereas the third, p20, inhibits silencing at both levels. Notably, CP suppresses intercellular silencing without interfering with intracellular silencing. The novel property of CP suggests a mechanism distinct to p20 and all of the other viral suppressors known to interfere with intercellular silencing and that this class of viral suppressors may not be consistently identified by Agrobacterium coinfiltration because it also induces RNA silencing against the infiltrated suppressor transgene. Our analyses reveal a sophisticated viral counter-defense strategy that targets the silencing antiviral pathway at multiple steps and may be essential for protecting CTV with such a large RNA genome from antiviral silencing in the perennial tree host. RNA interference | citrus tristeza virus | virus synergy | antiviral immunity

Decreased expression of RNA interference machinery, Dicer and Drosha, is associated with poor outcome in ovarian cancer patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Merritt, William M.; Lin, Yvonne G.; Han, Liz Y.

2008-05-06

The clinical and functional significance of RNA interference (RNAi) machinery, Dicer and Drosha, in ovarian cancer is not known and was examined. Dicer and Drosha expression was measured in ovarian cancer cell lines (n=8) and invasive epithelial ovarian cancer specimens (n=111) and correlated with clinical outcome. Validation was performed with previously published cohorts of ovarian, breast, and lung cancer patients. Anti-Galectin-3 siRNA and shRNA transfections were used for in vitro functional studies. Dicer and Drosha mRNA and protein levels were decreased in 37% to 63% of ovarian cancer cell lines and in 60% and 51% of human ovarian cancer specimens,more » respectively. Low Dicer was significantly associated with advanced tumor stage (p=0.007), and low Drosha with suboptimal surgical cytoreduction (p=0.02). Tumors with both high Dicer and Drosha were associated with increased median patient survival (>11 years vs. 2.66 years for other groups; p<0.001). In multivariate analysis, high Dicer (HR=0.48; p=0.02), high-grade histology (HR=2.46; p=0.03), and poor chemoresponse (HR=3.95; p<0.001) were identified as independent predictors of disease-specific survival. Findings of poor clinical outcome with low Dicer expression were validated in separate cohorts of cancer patients. Galectin-3 silencing with siRNA transfection was superior to shRNA in cell lines with low Dicer (78-95% vs. 4-8% compared to non-targeting sequences), and similar in cell lines with high Dicer. Our findings demonstrate the clinical and functional impact of RNAi machinery alterations in ovarian carcinoma and support the use of siRNA constructs that do not require endogenous Dicer and Drosha for therapeutic applications.« less

Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli.

PubMed

Bernheim, Aude G; Libis, Vincent K; Lindner, Ariel B; Wintermute, Edwin H

2016-03-20

RNA-mediated knockdowns are widely used to control gene expression. This versatile family of techniques makes use of short RNA (sRNA) that can be synthesized with any sequence and designed to complement any gene targeted for silencing. Because sRNA constructs can be introduced to many cell types directly or using a variety of vectors, gene expression can be repressed in living cells without laborious genetic modification. The most common RNA knockdown technology, RNA interference (RNAi), makes use of the endogenous RNA-induced silencing complex (RISC) to mediate sequence recognition and cleavage of the target mRNA. Applications of this technique are therefore limited to RISC-expressing organisms, primarily eukaryotes. Recently, a new generation of RNA biotechnologists have developed alternative mechanisms for controlling gene expression through RNA, and so made possible RNA-mediated gene knockdowns in bacteria. Here we describe a method for silencing gene expression in E. coli that functionally resembles RNAi. In this system a synthetic phagemid is designed to express sRNA, which may designed to target any sequence. The expression construct is delivered to a population of E. coli cells with non-lytic M13 phage, after which it is able to stably replicate as a plasmid. Antisense recognition and silencing of the target mRNA is mediated by the Hfq protein, endogenous to E. coli. This protocol includes methods for designing the antisense sRNA, constructing the phagemid vector, packaging the phagemid into M13 bacteriophage, preparing a live cell population for infection, and performing the infection itself. The fluorescent protein mKate2 and the antibiotic resistance gene chloramphenicol acetyltransferase (CAT) are targeted to generate representative data and to quantify knockdown effectiveness.

Photomodulating Gene Expression by Using Caged siRNAs with Single-Aptamer Modification.

PubMed

Zhang, Liangliang; Chen, Changmai; Fan, Xinli; Tang, Xinjing

2018-06-18

Caged siRNAs incorporating terminal modification were rationally designed for photochemical regulation of gene silencing induced by RNA interference (RNAi). Through the conjugation of a single oligonucleotide aptamer at the 5' terminus of the antisense RNA strand, enhancement of the blocking effect for RNA-induced silencing complex (RISC) formation/processing was expected, due both/either to the aptamers themselves and/or to their interaction with large binding proteins. Two oligonucleotide aptamers (AS1411 and MUC-1) were chosen for aptamer-siRNA conjugation through a photolabile linker. This caging strategy was successfully used to photoregulate gene expression both of firefly luciferase and of green fluorescent protein (GFP) in cells. Further patterning experiments revealed that spatial regulation of GFP expression was successfully achieved by using the aptamer-modified caged siRNA and light activation. We expect that further optimized caged siRNAs featuring aptamer conjugation will be promising for practical applications to spatiotemporal photoregulation of gene expression in the future. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

RNA Interference for improving the Outcome of Islet Transplantation

PubMed Central

Li, Feng; Mahato, Ram I

2010-01-01

Islet transplantation has the potential to cure type 1 diabetes. Despite recent therapeutic success, it is still not common because a large number of transpanted islets get damaged by multiple challenges including instant blood mediated inflammatory reaction, hypoxia/reperfusion injury, inflammatory cytokines, and immune rejection. RNA interference (RNAi) is an novel strategy to selectively degrade target mRNA. The use of RNAi technologies to downregulate the expression of harmful genes has the potential to improve the outcome of islet transplantation. The aim of this review is to gain a thorough understanding of biological obstacles to islet transplantation and discuss how to overcome these barriers using different RNAi technologies. This eventually will help improve islet survival and function post transplantaion. Chemically synthesized small interferring RNA (siRNA), vector based short haripin RNA (shRNA), and their critical design elements (such as sequences, promoters, backbone) are discussed. The application of combinatorial RNAi in islet transplantation is also discussed. Last but not the least, several delivery strategies for enhanced gene silencing are discussed, including chemical modification of siRNA, complex formation, bioconjugation, and viral vectors. PMID:21156190

[Effect of silencing Bmi-1 expression in reversing cisplatin resistance in lung cancer cells and its mechanism].

PubMed

Mao, Nan; He, Guansheng; Rao, Jinjun; Lv, Lin

2014-06-01

To investigate the effect of silencing Bmi-1 expression in reversing cisplatin resistance in human lung cancer cells and explore the possible mechanisms. Cisplatin-resistant A549/DDP cells with small interference RNA (siRNA)-mediated Bmi-1 expression silencing were examined for cisplatin sensitivity using MTT assay and alterations in cell cycle distribution and apoptosis with flow cytometry, and the changes in cell senescence was assessed using β-galactosidase staining. The protein expressions of Bmi-1, P14(ARF), P16(INK4a), P53, P21, Rb and ubi-H2AK119 in the cells were determined with Western blotting. A549/DDP cells showed significantly higher Bmi-1 expression than A549 cells. After siRNA-mediated Bmi-1 silencing, A549/DDP cells showed significantly enhanced cisplatin sensitivity with an increased IC50 from 40.3±4.1 µmol/L to 18.3±2.8 µmol/L (P<0.01) and increased cell percentage in G0/G1 phase from (48.9±2.3)% to (78.7±7.6)% (P<0.01). Silencing Bmi-1 did not cause significant changes in the cell apoptosis rate but induced obvious senescence phenotype in A549/DDP cells with down-regulated expression of ubi-H2AK119 and up-regulated expressions of P14(ARF), P16(INK4a), P53, P21 and Rb. Silencing Bmi-1 by RNA interference can induce cell senescence and resensitize A549/DDP cells to cisplatin possibly by regulating INK4a/ARF/Rb senescence pathway.

Aberrant expression of the tight junction molecules claudin-1 and zonula occludens-1 mediates cell growth and invasion in oral squamous cell carcinoma.

PubMed

Babkair, Hamzah; Yamazaki, Manabu; Uddin, Md Shihab; Maruyama, Satoshi; Abé, Tatsuya; Essa, Ahmed; Sumita, Yoshimasa; Ahsan, Md Shahidul; Swelam, Wael; Cheng, Jun; Saku, Takashi

2016-11-01

We reported that altered cell contact mediated by E-cadherin is an initial event in the pathogenesis of oral epithelial malignancies. To assess other effects of cell adhesion, we examined the expression levels of tight junction (TJ) molecules in oral carcinoma in situ (CIS) and squamous cell carcinoma (SCC). To identify changes in the expression of TJ molecules, we conducted an analysis of the immunohistochemical profiles of claudin-1 (CLDN-1) and zonula occludens-1 (ZO-1) in surgical specimens acquired from patients with oral SCC containing foci of epithelial dysplasia or from patients with CIS. We used immunofluorescence, Western blotting, reverse-transcription polymerase chain reaction, and RNA interference to evaluate the functions of CLDN-1 and ZO-1 in cultured oral SCC cells. TJ molecules were not detected in normal oral epithelial tissues but were expressed in SCC/CIS cells. ZO-1 was localized within the nucleus of proliferating cells. When CLDN-1 expression was inhibited by transfecting cells with specific small interference RNAs, SCC cells dissociated, and their ability to proliferate and invade Matrigel was inhibited. In contrast, although RNA interference-mediated inhibition of ZO-1 expression did not affect cell morphology, it inhibited cell proliferation and invasiveness. Our findings indicated that the detection of TJ molecules in the oral epithelia may serve as a marker for the malignant phenotype of cells in which CLDN-1 regulates proliferation and invasion. Copyright © 2016 Elsevier Inc. All rights reserved.

Suppression of polygalacturonase gene expression in the phytopathogenic fungus Ophiostoma novo-ulmi by RNA interference.

PubMed

Carneiro, Joyce S; de la Bastide, Paul Y; Chabot, Meghan; Lerch, Lindsey; Hintz, William E

2010-05-01

The fungal pathogen, Ophiostomo novo-ulmi, has been responsible for the rapid decline of American elm (Ulmus americana) across North America and remains a serious threat to surviving elm populations. The production of pectinolytic polygalacturonase enzymes has been implicated as a virulence factor for many fungal pathogens, including O. novo-ulmi. Previous work has shown that the targeted disruption of the endopolygalacturonase gene locus epg1 of O. novo-ulmi reduced, but did not eliminate pectinase activity. In the present study, we evaluated the use of RNA interference (RNAi) as a method of suppressing expression of the epg1 locus in O. novo-ulmi and compared its efficiency to the gene disruption method. While there was a reduction in epg1-specific mRNA transcripts and in the amount of polygalacturonase enzyme secreted for both methods of gene regulation, neither method completely suppressed the expression of pectinase activity. There was, however, a significantly greater reduction in both transcript levels and secreted enzyme observed for some of the RNAi transformants. As the first demonstration of RNAi in O. novo-ulmi, this method of gene regulation shows promise in future studies of gene expression and pathogenicity. Copyright 2010 Elsevier Inc. All rights reserved.

A Cellular High-Throughput Screening Approach for Therapeutic trans-Cleaving Ribozymes and RNAi against Arbitrary mRNA Disease Targets

PubMed Central

Yau, Edwin H.; Butler, Mark C.; Sullivan, Jack M.

2016-01-01

Major bottlenecks in development of therapeutic post transcriptional gene silencing (PTGS) agents (e.g. ribozymes, RNA interference, antisense) include the challenge of mapping rare accessible regions of the mRNA target that are open for annealing and cleavage, testing and optimization of agents in human cells to identify lead agents, testing for cellular toxicity, and preclinical evaluation in appropriate animal models of disease. Methods for rapid and reliable cellular testing of PTGS agents are needed to identify potent lead candidates for optimization. Our goal was to develop a means of rapid assessment of many RNA agents to identify a lead candidate for a given mRNA associated with a disease state. We developed a rapid human cell-based screening platform to test efficacy of hammerhead ribozyme (hhRz) or RNA interference (RNAi) constructs, using a model retinal degeneration target, human rod opsin (RHO) mRNA. The focus is on RNA Drug Discovery for diverse retinal degeneration targets. To validate the approach, candidate hhRzs were tested against NUH↓ cleavage sites (N=G,C,A,U; H=C,A,U) within the target mRNA of secreted alkaline phosphatase (SEAP), a model gene expression reporter, based upon in silico predictions of mRNA accessibility. HhRzs were embedded in a larger stable adenoviral VAI RNA scaffold for high cellular expression, cytoplasmic trafficking, and stability. Most hhRz expression plasmids exerted statistically significant knockdown of extracellular SEAP enzyme activity when readily assayed by a fluorescence enzyme assay intended for high throughput screening (HTS). Kinetics of PTGS knockdown of cellular targets is measureable in live cells with the SEAP reporter. The validated SEAP HTS platform was transposed to identify lead PTGS agents against a model hereditary retinal degeneration target, RHO mRNA. Two approaches were used to physically fuse the model retinal gene target mRNA to the SEAP reporter mRNA. The most expedient way to evaluate a large set of potential VAI-hhRz expression plasmids against diverse NUH↓ cleavage sites uses cultured human HEK293S cells stably expressing a dicistronic Target-IRES-SEAP target fusion mRNA. Broad utility of this rational RNA drug discovery approach is feasible for any ophthalmological disease-relevant mRNA targets and any disease mRNA targets in general. The approach will permit rank ordering of PTGS agents based on potency to identify a lead therapeutic compound for further optimization. PMID:27233447

In cell mutational interference mapping experiment (in cell MIME) identifies the 5' polyadenylation signal as a dual regulator of HIV-1 genomic RNA production and packaging.

PubMed

Smyth, Redmond P; Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe; von Kleist, Max; Marquet, Roland

2018-05-18

Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5' region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5' PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production.

In cell mutational interference mapping experiment (in cell MIME) identifies the 5′ polyadenylation signal as a dual regulator of HIV-1 genomic RNA production and packaging

PubMed Central

Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe

2018-01-01

Abstract Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5′ region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5′ PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production. PMID:29514260

Stable SET knockdown in breast cell carcinoma inhibits cell migration and invasion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Jie; Key Laboratory of Modern Toxicology of Shenzhen, Shenzhen Center for Disease Control and Prevention, Shenzhen; Yang, Xi-fei

2014-10-10

Highlights: • We employed RNA interference to knockdown SET expression in breast cancer cells. • Knockdown of SET expression inhibits cell proliferation, migration and invasion. • Knockdown of SET expression increases the activity and expression of PP2A. • Knockdown of SET expression decreases the expression of MMP-9. - Abstract: Breast cancer is the most malignant tumor for women, however, the mechanisms underlying this devastating disease remain unclear. SET is an endogenous inhibitor of protein phosphatase 2A (PP2A) and involved in many physiological and pathological processes. SET could promote the occurrence of tumor through inhibiting PP2A. In this study, we exploremore » the role of SET in the migration and invasion of breast cancer cells MDA-MB-231 and ZR-75-30. The stable suppression of SET expression through lentivirus-mediated RNA interference (RNAi) was shown to inhibit the growth, migration and invasion of breast cancer cells. Knockdown of SET increases the activity and expression of PP2Ac and decrease the expression of matrix metalloproteinase 9 (MMP-9). These data demonstrate that SET may be involved in the pathogenic processes of breast cancer, indicating that SET can serve as a potential therapeutic target for the treatment of breast cancer.« less

[Knock-down of ZEB1 inhibits the proliferation, invasion and migration of gastric cancer cells].

PubMed

Chen, Dengyu; Chu, Yifan; Zheng, Qingwei; Xu, Zhiben; Zhou, Ping; Li, Sheng

2017-08-01

Objective To down-regulate the expression of zinc-finger E-box binding homeobox 1 (ZEB1) gene by shRNA, and investigate its effect on invasion, migration and proliferation, as well as the related gene expressions of lncRNA HOTAIR and E-cadherin in human gastric cancer BGC823 cells. Methods RNA interfering (RNAi) was used to knock down ZEB1 in gastric cancer BGC823 cells. The recombinant plasmid shZEB1 was constructed and transfected into the gastric cancer BGC823 cells by Lipofectamine TM 2000, and the stably transfected cells were isolated by G418 selection and limited dilution. The expression of ZEB1 mRNA and protein was detected by real-time quantitative PCR and Western blot analysis. Cell proliferation was determined by MTT assay, and the invasion and migration abilities of BGC823 cells were monitored by Transwell TM invasion assay and wound healing assay, respectively. The expressions of lncRNA HOTAIR and E-cadherin mRNA were detected by real-time quantitative PCR. Results After ZEB1 expression was successfully down-regulated in BGC823 cells by siRNA, the proliferation, invasion and migration rates in shZEB1 transfection group were significantly lower than those in control group; meanwhile, the expression of lncRNA HOTAIR was reduced and E-cadherin expression was enhanced. Conclusion Knock-down of ZEB1 expression by RNA interference can decease lncRNA HOTAIR expression and restrain cell proliferation, invasion and migration in gastric cancer BGC823 cells.

Targeting a KH-domain protein with RNA decoys.

PubMed

Makeyev, Aleksandr V; Eastmond, Dawn L; Liebhaber, Stephen A

2002-09-01

RNA-binding proteins are involved in the regulation of many aspects of eukaryotic gene expression. Targeted interference with RNA-protein interactions could offer novel approaches to modulation of expression profiles, alteration of developmental pathways, and reversal of certain disease processes. Here we investigate a decoy strategy for the study of the alphaCP subgroup of KH-domain RNA-binding proteins. These poly(C)-binding proteins have been implicated in a wide spectrum of posttranscriptional controls. Three categories of RNA decoys to alphaCPs were studied: poly(C) homopolymers, native mRNA-binding sites, and a high-affinity structure selected from a combinatorial library. Native chemistry was found to be essential for alphaCP decoy action. Because alphaCP proteins are found in both the nucleus and cytoplasm, decoy cassettes were incorporated within both nuclear (U1 snRNA) and cytoplasmic (VA1 RNA) RNA frameworks. Several sequences demonstrated optimal decoy properties when assayed for protein-binding and decoy bioactivity in vitro. A subset of these transcripts was shown to mediate targeted inhibition of alphaCP-dependent translation when expressed in either the nucleus or cytoplasm of transfected cells. Significantly, these studies establish the feasibility of developing RNA decoys that can selectively target biologic functions of abundant and widely expressed RNA binding proteins.

Targeting a KH-domain protein with RNA decoys.

PubMed Central

Makeyev, Aleksandr V; Eastmond, Dawn L; Liebhaber, Stephen A

2002-01-01

RNA-binding proteins are involved in the regulation of many aspects of eukaryotic gene expression. Targeted interference with RNA-protein interactions could offer novel approaches to modulation of expression profiles, alteration of developmental pathways, and reversal of certain disease processes. Here we investigate a decoy strategy for the study of the alphaCP subgroup of KH-domain RNA-binding proteins. These poly(C)-binding proteins have been implicated in a wide spectrum of posttranscriptional controls. Three categories of RNA decoys to alphaCPs were studied: poly(C) homopolymers, native mRNA-binding sites, and a high-affinity structure selected from a combinatorial library. Native chemistry was found to be essential for alphaCP decoy action. Because alphaCP proteins are found in both the nucleus and cytoplasm, decoy cassettes were incorporated within both nuclear (U1 snRNA) and cytoplasmic (VA1 RNA) RNA frameworks. Several sequences demonstrated optimal decoy properties when assayed for protein-binding and decoy bioactivity in vitro. A subset of these transcripts was shown to mediate targeted inhibition of alphaCP-dependent translation when expressed in either the nucleus or cytoplasm of transfected cells. Significantly, these studies establish the feasibility of developing RNA decoys that can selectively target biologic functions of abundant and widely expressed RNA binding proteins. PMID:12358435

Selective inhibition of FLICE-like inhibitory protein expression with small interfering RNA oligonucleotides is sufficient to sensitize tumor cells for TRAIL-induced apoptosis.

PubMed Central

Siegmund, Daniela; Hadwiger, Philipp; Pfizenmaier, Klaus; Vornlocher, Hans-Peter; Wajant, Harald

2002-01-01

BACKGROUND: Most tumors express death receptors and their activation represents a potential selective approach in cancer treatment. The most promising candidate for tumor selective death receptor-activation is tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)/Apo2L, which activates the death receptors TRAIL-R1 and TRAIL-R2, and induces apoptosis preferentially in tumor cells but not in normal tissues. However, many cancer cells are not or only moderately sensitive towards TRAIL and require cotreatment with irradiation or chemotherapy to yield a therapeutically reasonable apoptotic response. Because chemotherapy can have a broad range of unwanted side effects, more specific means for sensitizing tumor cells for TRAIL are desirable. The expression of the cellular FLICE-like inhibitory protein (cFLIP) is regarded as a major cause of TRAIL resistance. We therefore analyzed the usefulness of targeting FLIP to sensitize tumor cells for TRAIL-induced apoptosis. MATERIALS AND METHODS: To selectively interfere with expression of cFLIP short double-stranded RNA oligonucleotides (small interfering RNAs [siRNAs]) were introduced in the human cell lines SV80 and KB by electroporation. Effects of siRNA on FLIP expression were analyzed by Western blotting and RNase protection assay and correlated with TRAIL sensitivity upon stimulation with recombinant soluble TRAIL and TRAIL-R1- and TRAIL-R2-specific agonistic antibodies. RESULTS: FLIP expression can be inhibited by RNA interference using siRNAs, evident from reduced levels of FLIP-mRNA and FLIP protein. Inhibition of cFLIP expression sensitizes cells for apoptosis induction by TRAIL and other death ligands. In accordance with the presumed function of FLIP as an inhibitor of death receptor-induced caspase-8 activation, down-regulation of FLIP by siRNAs enhanced TRAIL-induced caspase-8 activation. CONCLUSION: Inhibition of FLIP expression was sufficient to sensitize tumor cells for TRAIL-induced apoptosis. The combination of TRAIL and FLIP-targeting siRNA could therefore be a useful strategy to attack cancer cells, which are resistant to TRAIL alone. PMID:12520089

Specific inhibition of gene expression by small double-stranded RNAs in invertebrate and vertebrate systems

PubMed Central

Caplen, Natasha J.; Parrish, Susan; Imani, Farhad; Fire, Andrew; Morgan, Richard A.

2001-01-01

Short interfering RNAs (siRNAs) are double-stranded RNAs of ≈21–25 nucleotides that have been shown to function as key intermediaries in triggering sequence-specific RNA degradation during posttranscriptional gene silencing in plants and RNA interference in invertebrates. siRNAs have a characteristic structure, with 5′-phosphate/3′-hydroxyl ends and a 2-base 3′ overhang on each strand of the duplex. In this study, we present data that synthetic siRNAs can induce gene-specific inhibition of expression in Caenorhabditis elegans and in cell lines from humans and mice. In each case, the interference by siRNAs was superior to the inhibition of gene expression mediated by single-stranded antisense oligonucleotides. The siRNAs seem to avoid the well documented nonspecific effects triggered by longer double-stranded RNAs in mammalian cells. These observations may open a path toward the use of siRNAs as a reverse genetic and therapeutic tool in mammalian cells. PMID:11481446

An RNA isolation system for plant tissues rich in secondary metabolites

PubMed Central

2011-01-01

Background Secondary metabolites are reported to interfere with the isolation of RNA particularly with the recipes that use guanidinium-based salt. Such interference was observed in isolation of RNA with medicinal plants rheum (Rheum australe) and arnebia (Arnebia euchroma). A rapid and less cumbersome system for isolation of RNA was essential to facilitate any study related to gene expression. Findings An RNA isolation system free of guanidinium salt was developed that successfully isolated RNA from rheum and arnebia. The method took about 45 min and was successfully evaluated on twenty one tissues with varied secondary metabolites. The A260/280 ratio ranged between 1.8 - 2.0 with distinct 28 S and 18 S rRNA bands visible on a formaldehyde-agarose gel. Conclusions The present manuscript describes a rapid protocol for isolation of RNA, which works well with all the tissues examined so far. The remarkable feature was the success in isolation of RNA with those tissues, wherein the most commonly used methods failed. Isolated RNA was amenable to downstream applications such as reverse transcription-polymerase chain reaction (RT-PCR), differential display (DD), suppression subtractive hybridization (SSH) library construction, and northern hybridization. PMID:21443767

RNA interference for performance enhancement and detection in doping control.

PubMed

Kohler, Maxie; Schänzer, Wilhelm; Thevis, Mario

2011-10-01

RNA interference represents a comparably new route of regulating and manipulating specific gene expression. Promising results were obtained in experimental therapies aim at the treatment of different kinds of diseases including cancer, diabetes mellitus or Dychenne muscular dystrophy. While studies on down-regulation efficiency are often performed by analyzing the regulated protein, the direct detection of small, interfering RNA molecules and antisense oligonucleotides is of great interest for the investigation of the metabolism and degradation and also for the detection of a putative misuse of these molecules in sports. Myostatin down-regulation was shown to result in increased performance and muscle growth and the regulation of several other proteins could be relevant for performance enhancement. This mini-review summarizes current approaches for the mass spectrometric analysis of siRNA and antisense oligonucleotides from biological matrices and the available data on biodistribution, metabolism, and half-life of relevant substances are discussed. Copyright © 2011 John Wiley & Sons, Ltd.

DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells

PubMed Central

Spike, Caroline A.; Bader, Jason; Reinke, Valerie; Strome, Susan

2008-01-01

P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs). PMID:18234720

DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells.

PubMed

Spike, Caroline A; Bader, Jason; Reinke, Valerie; Strome, Susan

2008-03-01

P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs).

RNA interference mediated in human primary cells via recombinant baculoviral vectors.

PubMed

Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T

2005-04-01

The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.

RNA interference: learning gene knock-down from cell physiology

PubMed Central

Mocellin, Simone; Provenzano, Maurizio

2004-01-01

Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080

Scavenger receptor WC1 contributes to the γδ T cell response to Leptospira.

PubMed

Wang, Fei; Herzig, Carolyn T A; Chen, Chuang; Hsu, Haoting; Baldwin, Cynthia L; Telfer, Janice C

2011-03-01

WC1 molecules are exclusively expressed on the surface of γδ T cells. They belong to the scavenger receptor cysteine-rich (SRCR) superfamily and are encoded by a multi-gene family. WC1 molecules have been grouped on the basis of antibody reactivity. The expression of WC1 molecules from these serologically defined groups is correlated with differences in γδ T cell responses. The expression of receptors within the WC1.1 group correlates with the capacity of γδ T cells to respond to Leptospira antigen. In this study, we used RNA interference to directly investigate the role of WC1 expression in the response to Leptospira borgpetersenii. We found that when three out of thirteen WC1 gene products were downregulated by RNA interference, γδ T cell proliferation and IFN-γ production in response to Leptospira antigen was significantly reduced. Our data demonstrate that specific receptors in the WC1 family directly participate in Leptospira recognition and/or activation of γδ T cells. Copyright © 2010 Elsevier Ltd. All rights reserved.

[Lentivirus-mediated RNA interference of CD133 inhibits the proliferation of CD133(+) liver cancer stem cells and increases their cisplatin chemosensitivity].

PubMed

Lan, Xi; Wang, Yong; Cao, Shu; Zou, Dongling; Li, Fang; Li, Shaolin

2012-12-01

To study the effects of CD133 suppression by lentivirus-mediated RNA interference (RNAi) on the proliferation and chemosensitivity of CD133(+) cancer stem cells (CSCs) sorted from HepG2 cell line. CD133(+) and CD133- cells were sorted from HepG2 cell line by flow cytometry, and the expression of CD133 before and after cell sorting were detected. The stem cell property of sorted CD133(+) cells were validated by sphere-forming assay in vitro and xenograft experiments in vivo. Lentivirus-mediated short hairpin RNA (shRNA) targeting CD133 were transfected into CD133(+) cells, and CD133 mRNA and protein expressions of the transfected cells were detected by RT-PCR and Western blotting, respectively. Before and after the transfection, the proliferative ability of CD133(+) cells was evaluated by colony formation assay, and the cell growth inhibition rate and apoptosis following cisplatin exposure were detected using CCK-8 assay and flow cytometry. The sorted CD133(+) cells showed a high purity of (88.74∓3.19)%, as compared with the purity of (3.36∓1.80)% before cell sorting. CD133(+) cells showed a high tumor sphere formation ability and tumorigenesis capacity compared with CD133- cells. CD133 shRNA transfection significantly inhibited CD133 mRNA and protein expressions in CD133(+) cells (P<0.01), resulting also in a significantly lowered cell proliferative ability (P<0.01) and an increased growth inhibition rate (P<0.01) and obviously increased cell apoptosis (P<0.05) after cisplatin exposure. Lentivirus-mediated RNAi for CD133 suppression inhibits the proliferation of CD133(+) liver cancer stem cells and increases their chemosensitivity to cisplatin.

Variation in vasopressin receptor Avpr1a) expression creates diversity in behaviors related to monogamy in prairie voles

PubMed Central

Barrett, Catherine E.; Keebaugh, Alaine C.; Ahern, Todd H.; Bass, Caroline E.; Terwilliger, Ernest F.; Young, Larry J.

2013-01-01

Polymorphisms in noncoding regions of the vasopressin 1a receptor gene (Avpr1a) are associated with a variety of socioemotional characteristics in humans, chimpanzees, and voles, and may impact behavior through site-specific variation in gene expression. The socially monogamous prairie vole offers a unique opportunity to study such neurobiological control of individual differences in complex behavior. Vasopressin 1a receptor (V1aR) signaling is necessary for the formation of the pair bond in males, and prairie voles exhibit greater V1aR binding in the reward-processing ventral pallidum than do asocial voles of the same genus. Diversity in social behavior within prairie voles has been correlated to natural variation in neuropeptide receptor expression in specific brain regions. Here we use RNA interference to examine the causal relationship between intraspecific variation in V1aR and behavioral outcomes, by approximating the degree of naturalistic variation in V1aR expression. Juvenile male prairie voles were injected with viral vectors expressing shRNA sequences targeting Avpr1a mRNA into the ventral pallidum. Down-regulation of pallidal V1aR density resulted in a significant impairment in the preference for a mated female partner and a reduction in anxiety-like behavior in adulthood. No effect on alloparenting was detected. These data demonstrate that within-species naturalistic-like variation in V1aR expression has a profound effect on individual differences in social attachment and emotionality. RNA interference may prove a useful technique to unite the fields of behavioral ecology and neurogenetics to perform ethologically relevant studies of the control of individual variation and offer insight into the evolutionary mechanisms leading to behavioral diversity. PMID:23370363

Inhibition of CD147 expression by RNA interference reduces proliferation, invasion and increases chemosensitivity in cancer stem cell-like HT-29 cells.

PubMed

Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui

2015-10-01

The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.

shRNA-Induced Gene Knockdown In Vivo to Investigate Neutrophil Function.

PubMed

Basit, Abdul; Tang, Wenwen; Wu, Dianqing

2016-01-01

To silence genes in neutrophils efficiently, we exploited the RNA interference and developed an shRNA-based gene knockdown technique. This method involves transfection of mouse bone marrow-derived hematopoietic stem cells with retroviral vector carrying shRNA directed at a specific gene. Transfected stem cells are then transplanted into irradiated wild-type mice. After engraftment of stem cells, the transplanted mice have two sets of circulating neutrophils. One set has a gene of interest knocked down while the other set has full complement of expressed genes. This efficient technique provides a unique way to directly compare the response of neutrophils with a knocked-down gene to that of neutrophils with the full complement of expressed genes in the same environment.

The over expression of long non-coding RNA ANRIL promotes epithelial-mesenchymal transition by activating the ATM-E2F1 signaling pathway in pancreatic cancer: An in vivo and in vitro study.

PubMed

Chen, Shi; Zhang, Jia-Qiang; Chen, Jiang-Zhi; Chen, Hui-Xing; Qiu, Fu-Nan; Yan, Mao-Lin; Chen, Yan-Ling; Peng, Cheng-Hong; Tian, Yi-Feng; Wang, Yao-Dong

2017-09-01

This study aims to investigate the roles of lncRNA ANRIL in epithelial-mesenchymal transition (EMT) by regulating the ATM-E2F1 signaling pathway in pancreatic cancer (PC). PC rat models were established and ANRIL overexpression and interference plasmids were transfected. The expression of ANRIL, EMT markers (E-cadherin, N-cadherin and Vimentin) and ATM-E2F1 signaling pathway-related proteins (ATM, E2F1, INK4A, INK4B and ARF) were detected. Small molecule drugs were applied to activate and inhibit the ATM-E2F1 signaling pathway. Transwell assay and the scratch test were adopted to detect cell invasion and migration abilities. ANRIL expression in the PC cells was higher than in normal pancreatic duct epithelial cells. In the PC rat models and PC cells, ANRIL interference promoted the expressions of INK4B, INK4A, ARF and E-cadherin, while reduced N-cadherin and Vimentin expression. Over-expressed ANRIL decreased the expression of INK4B, INK4A, ARF and E-cadherin, but raised N-cadherin and Vimentin expressions. By inhibiting the ATM-E2F1 signaling pathway in PC cells, E-cadherin expression increased but N-cadherin and Vimentin expressions decreased. After ANRIL was silenced or the ATM-E2F1 signaling pathway inhibited, PC cell migration and invasion abilities were decreased. In conclusion, over-expression of lncRNA ANRIL can promote EMT of PC cells by activating the ATM-E2F1 signaling pathway. Copyright © 2017 Elsevier B.V. All rights reserved.

Evaluation and control of miRNA-like off-target repression for RNA interference.

PubMed

Seok, Heeyoung; Lee, Haejeong; Jang, Eun-Sook; Chi, Sung Wook

2018-03-01

RNA interference (RNAi) has been widely adopted to repress specific gene expression and is easily achieved by designing small interfering RNAs (siRNAs) with perfect sequence complementarity to the intended target mRNAs. Although siRNAs direct Argonaute (Ago), a core component of the RNA-induced silencing complex (RISC), to recognize and silence target mRNAs, they also inevitably function as microRNAs (miRNAs) and suppress hundreds of off-targets. Such miRNA-like off-target repression is potentially detrimental, resulting in unwanted toxicity and phenotypes. Despite early recognition of the severity of miRNA-like off-target repression, this effect has often been overlooked because of difficulties in recognizing and avoiding off-targets. However, recent advances in genome-wide methods and knowledge of Ago-miRNA target interactions have set the stage for properly evaluating and controlling miRNA-like off-target repression. Here, we describe the intrinsic problems of miRNA-like off-target effects caused by canonical and noncanonical interactions. We particularly focus on various genome-wide approaches and chemical modifications for the evaluation and prevention of off-target repression to facilitate the use of RNAi with secured specificity.

Bacterial delivery of RNAi effectors: transkingdom RNAi.

PubMed

Lage, Hermann; Krühn, Andrea

2010-08-18

RNA interference (RNAi) represents a high effective mechanism for specific inhibition of mRNA expression. Besides its potential as a powerful laboratory tool, the RNAi pathway appears to be promising for therapeutic utilization. For development of RNA interference (RNAi)-based therapies, delivery of RNAi-mediating agents to target cells is one of the major obstacles. A novel strategy to overcome this hurdle is transkingdom RNAi (tkRNAi). This technology uses non-pathogenic bacteria, e.g. Escherichia coli, to produce and deliver therapeutic short hairpin RNA (shRNA) into target cells to induce RNAi. A first-generation tkRNAi-mediating vector, TRIP, contains the bacteriophage T7 promoter for expression regulation of a therapeutic shRNA of interest. Furthermore, TRIP has the Inv locus from Yersinia pseudotuberculosis that encodes invasin, which permits natural noninvasive bacteria to enter beta1-integrin-positive mammalian cells and the HlyA gene from Listeria monocytogenes, which produces listeriolysin O. This enzyme allows the therapeutic shRNA to escape from entry vesicles within the cytoplasm of the target cell. TRIP constructs are introduced into a competent non-pathogenic Escherichia coli strain, which encodes T7 RNA polymerase necessary for the T7 promoter-driven synthesis of shRNAs. A well-characterized cancer-associated target molecule for different RNAi strategies is ABCB1 (MDR1/P-glycoprotein, MDR1/P-gp). This ABC-transporter acts as a drug extrusion pump and mediates the "classical" ABCB1-mediated multidrug resistance (MDR) phenotype of human cancer cells which is characterized by a specific cross resistance pattern. Different ABCB1-expressing MDR cancer cells were treated with anti-ABCB1 shRNA expression vector bearing E. coli. This procedure resulted in activation of the RNAi pathways within the cancer cells and a considerable down regulation of the ABCB1 encoding mRNA as well as the corresponding drug extrusion pump. Accordingly, drug accumulation was enhanced in the pristine drug-resistant cancer cells and the MDR phenotype was reversed. By means of this model the data provide the proof-of-concept that tkRNAi is suitable for modulation of cancer-associated factors, e.g. ABCB1, in human cancer cells.

Attenuation of alpha2A-adrenergic receptor expression in neonatal rat brain by RNA interference or antisense oligonucleotide reduced anxiety in adulthood.

PubMed

Shishkina, G T; Kalinina, T S; Dygalo, N N

2004-01-01

Brain alpha2-adrenergic receptors (alpha2-ARs) have been implicated in the regulation of anxiety, which is associated with stress. Environmental treatments during neonatal development could modulate the level of brain alpha2-AR expression and alter anxiety in adults, suggesting possible involvement of these receptors in early-life programming of anxiety state. The present study was undertaken to determine whether the reduction of the expression of A subtype of these receptors most abundant in the neonatal brain affects anxiety-related behavior in adulthood. We attenuated the expression of alpha2A-ARs during neonatal life by two different sequence specific approaches, antisense technology and RNA interference. Treatment of rats with the antisense oligodeoxynucleotide or short interfering RNA (siRNA) against alpha2A-ARs on the days 2-4 of their life, produced a marked acute decrease in the levels of both alpha2A-AR mRNA and [3H]RX821002 binding sites in the brainstem into which drugs were injected. The decrease of alpha2A-AR expression in the neonatal brainstem influenced the development of this receptor system in the brain regions as evidenced by the increased number of [3H]RX821002 binding sites in the hypothalamus of adult animals with both neonatal alpha2A-AR knockdown treatments; also in the frontal cortex of antisense-treated, and in the hippocampus of siRNA-treated adult rats. These adult animals also demonstrated a decreased anxiety in the elevated plus-maze as evidenced by an increased number of the open arm entries, greater proportion of time spent in the open arms, and more than a two-fold increase in the number of exploratory head dips. The results provide the first evidence that the reduction in the brain expression of a gene encoding for alpha2A-AR during neonatal life led to the long-term neurochemical and behavioral alterations. The data suggests that alterations in the expression of the receptor-specific gene during critical periods of brain development may be involved in early-life programming of anxiety-related behavior.

New Type of BACE1 siRNA Delivery to Cells

PubMed Central

Jabłkowski, Maciej; Szemraj, Maciej; Oszajca, Katarzyna; Janiszewska, Grażyna; Bartkowiak, Jacek; Szemraj, Janusz

2014-01-01

Background Small interfering RNA (siRNA) gene therapy is a new molecular approach in the search for an efficient therapy for Alzheimer disease (AD), based on the principle of RNA interference. Reducing BACE activity can have great therapeutic potential for the treatment of AD. In this study, receptor-mediated delivery was used to deliver opioid peptide-conjugated BACE 1 to INR-32 human neuroblastoma cells. Material/Methods An INR-32 human neuroblastoma cell line was stably transfected to express the APP cDNA coding fragment containing the predicted sites for cleavage by α, β, or γ-secretase. This was then treated with BACE 1 siRNA to silence BACE gene expression. BACE gene transcription and translation was determined using BACE-1 siRNA cross-linked with opioid peptide, together with RT-PCR, Western blot analysis, and ELISA. Results Receptor-mediated delivery was used to introduce BACE1 siRNA to the APP – INR 32 human neuroblastoma cells. Decreased BACE mRNA and protein expression were observed after the cells were transfected with BACE1 siRNA. Conclusions Delivery of BACE1 siRNA appears to specifically reduce the cleavage of APP by inhibiting BACE1 activity. PMID:25491230

Specific knockdown of Oct4 and beta2-microglobulin expression by RNA interference in human embryonic stem cells and embryonic carcinoma cells.

PubMed

Matin, Maryam M; Walsh, James R; Gokhale, Paul J; Draper, Jonathan S; Bahrami, Ahmad R; Morton, Ian; Moore, Harry D; Andrews, Peter W

2004-01-01

We have used RNA interference (RNAi) to downregulate beta2-microglobulin and Oct4 in human embryonal carcinoma (hEC) cells and embryonic stem (hES) cells, demonstrating that RNAi is an effective tool for regulating specific gene activity in these human stem cells. The knockdown of Oct4 but not beta2-microglobulin expression in both EC and ES cells resulted in their differentiation, as indicated by a marked change in morphology, growth rate, and surface antigen phenotype, with respect to SSEA1, SSEA3, and TRA-1-60 expression. Expression of hCG and Gcm1 was also induced following knockdown of Oct4 expression, in both 2102Ep hEC cells and in H7 and H14 hES cells, consistent with the conclusion that, as in the mouse, Oct4 is required to maintain the undifferentiated stem cell state, and that differentiation to trophectoderm occurs in its absence. NTERA2 hEC cells also differentiated, but not to trophectoderm, suggesting their equivalence to a later stage of embryogenesis than other hEC and hES cells.

RNA interference by feeding in vitro synthesized double-stranded RNA to planarians: methodology and dynamics

PubMed Central

Rouhana, Labib; Weiss, Jennifer A.; Forsthoefel, David J.; Lee, Hayoung; King, Ryan S.; Inoue, Takeshi; Shibata, Norito; Agata, Kiyokazu; Newmark, Phillip A.

2013-01-01

Background The ability to assess gene function is essential for understanding biological processes. Currently, RNA interference (RNAi) is the only technique available to assess gene function in planarians, in which it has been induced via injection of double-stranded RNA (dsRNA), soaking, or ingestion of bacteria expressing dsRNA. Results We describe a simple and robust RNAi protocol, involving in vitro synthesis of dsRNA that is fed to the planarians. Advantages of this protocol include the ability to produce dsRNA from any vector without subcloning, resolution of ambiguities in quantity and quality of input dsRNA, as well as time, and ease of application. We have evaluated the logistics of inducing RNAi in planarians using this methodology in careful detail, from the ingestion and processing of dsRNA in the intestine, to timing and efficacy of knockdown in neoblasts, germline, and soma. We also present systematic comparisons of effects of amount, frequency, and mode of dsRNA delivery. Conclusions This method gives robust and reproducible results and is amenable to high-throughput studies. Overall, this RNAi methodology provides a significant advance by combining the strengths of current protocols available for dsRNA delivery in planarians and has the potential to benefit RNAi methods in other systems. PMID:23441014

Secondary RNA structure and its role in RNA interference to silence the respiratory syncytial virus fusion protein gene.

PubMed

Vig, Komal; Lewis, Nuruddeen; Moore, Eddie G; Pillai, Shreekumar; Dennis, Vida A; Singh, Shree R

2009-11-01

RNA interference (RNAi) is a post-transcriptional, gene silencing mechanism which uses small interfering RNA molecules (siRNA) for gene silencing. Respiratory Syncytial Virus (RSV) is an important respiratory pathogen of medical significance that causes high mortality in infants. The fusion (F) protein of RSV is a good target for therapeutic purposes as it is primarily responsible for penetration of the virus into host cells and subsequent syncytium formation during infection. In the present study, four siRNAs were designed and used individually as well as a mixture, to silence the RSV F gene. The relationship between siRNA design, target RNA structure, and their thermodynamics was also investigated. Silencing of F gene was observed using indirect immunofluorescence, western blot, reverse transcription PCR, and progeny viral titers. Our results show F gene silencing by all the four siRNAs individually and collectively. RT-PCR analysis revealed a decrease in mRNA level which corresponded to decreased F protein expression. siRNAs also inhibited RSV progeny as shown by viral titer estimation on infected HEp-2 cells. The present study demonstrates the silencing of the F gene using siRNA. Thermodynamic characteristics of the target RSV mRNA and siRNA seem to play an important role in siRNA gene silencing efficiency.

Translation Repression in Human Cells by MicroRNA-Induced Gene Silencing Requires RCK/p54

PubMed Central

Chu, Chia-ying

2006-01-01

RNA interference is triggered by double-stranded RNA that is processed into small interfering RNAs (siRNAs) by Dicer enzyme. Endogenously, RNA interference triggers are created from small noncoding RNAs called microRNAs (miRNAs). RNA-induced silencing complexes (RISC) in human cells can be programmed by exogenously introduced siRNA or endogenously expressed miRNA. siRNA-programmed RISC (siRISC) silences expression by cleaving a perfectly complementary target mRNA, whereas miRNA-induced silencing complexes (miRISC) inhibits translation by binding imperfectly matched sequences in the 3′ UTR of target mRNA. Both RISCs contain Argonaute2 (Ago2), which catalyzes target mRNA cleavage by siRISC and localizes to cytoplasmic mRNA processing bodies (P-bodies). Here, we show that RCK/p54, a DEAD box helicase, interacts with argonaute proteins, Ago1 and Ago2, in affinity-purified active siRISC or miRISC from human cells; directly interacts with Ago1 and Ago2 in vivo, facilitates formation of P-bodies, and is a general repressor of translation. Disrupting P-bodies by depleting Lsm1 did not affect RCK/p54 interactions with argonaute proteins and its function in miRNA-mediated translation repression. Depletion of RCK/p54 disrupted P-bodies and dispersed Ago2 throughout the cytoplasm but did not significantly affect siRNA-mediated RNA functions of RISC. Depleting RCK/p54 released general, miRNA-induced, and let-7-mediated translational repression. Therefore, we propose that translation repression is mediated by miRISC via RCK/p54 and its specificity is dictated by the miRNA sequence binding multiple copies of miRISC to complementary 3′ UTR sites in the target mRNA. These studies also suggest that translation suppression by miRISC does not require P-body structures, and location of miRISC to P-bodies is the consequence of translation repression. PMID:16756390

A quantitative framework for the forward design of synthetic miRNA circuits.

PubMed

Bloom, Ryan J; Winkler, Sally M; Smolke, Christina D

2014-11-01

Synthetic genetic circuits incorporating regulatory components based on RNA interference (RNAi) have been used in a variety of systems. A comprehensive understanding of the parameters that determine the relationship between microRNA (miRNA) and target expression levels is lacking. We describe a quantitative framework supporting the forward engineering of gene circuits that incorporate RNAi-based regulatory components in mammalian cells. We developed a model that captures the quantitative relationship between miRNA and target gene expression levels as a function of parameters, including mRNA half-life and miRNA target-site number. We extended the model to synthetic circuits that incorporate protein-responsive miRNA switches and designed an optimized miRNA-based protein concentration detector circuit that noninvasively measures small changes in the nuclear concentration of β-catenin owing to induction of the Wnt signaling pathway. Our results highlight the importance of methods for guiding the quantitative design of genetic circuits to achieve robust, reliable and predictable behaviors in mammalian cells.

Genome-wide RNA interference screen identifies previously undescribed regulators of polyglutamine aggregation

PubMed Central

Nollen, Ellen A. A.; Garcia, Susana M.; van Haaften, Gijs; Kim, Soojin; Chavez, Alejandro; Morimoto, Richard I.; Plasterk, Ronald H. A.

2004-01-01

Protein misfolding and the formation of aggregates are increasingly recognized components of the pathology of human genetic disease and hallmarks of many neurodegenerative disorders. As exemplified by polyglutamine diseases, the propensity for protein misfolding is associated with the length of polyglutamine expansions and age-dependent changes in protein-folding homeostasis, suggesting a critical role for a protein homeostatic buffer. To identify the complement of protein factors that protects cells against the formation of protein aggregates, we tested transgenic Caenorhabditis elegans strains expressing polyglutamine expansion yellow fluorescent protein fusion proteins at the threshold length associated with the age-dependent appearance of protein aggregation. We used genome-wide RNA interference to identify genes that, when suppressed, resulted in the premature appearance of protein aggregates. Our screen identified 186 genes corresponding to five principal classes of polyglutamine regulators: genes involved in RNA metabolism, protein synthesis, protein folding, and protein degradation; and those involved in protein trafficking. We propose that each of these classes represents a molecular machine collectively comprising the protein homeostatic buffer that responds to the expression of damaged proteins to prevent their misfolding and aggregation. PMID:15084750

Chemical Approaches to Control Gene Expression

PubMed Central

Gottesfeld, Joel M.; Turner, James M.; Dervan, Peter B.

2000-01-01

A current goal in molecular medicine is the development of new strategies to interfere with gene expression in living cells in the hope that novel therapies for human disease will result from these efforts. This review focuses on small-molecule or chemical approaches to manipulate gene expression by modulating either transcription of messenger RNA-coding genes or protein translation. The molecules under study include natural products, designed ligands, and compounds identified through functional screens of combinatorial libraries. The cellular targets for these molecules include DNA, messenger RNA, and the protein components of the transcription, RNA processing, and translational machinery. Studies with model systems have shown promise in the inhibition of both cellular and viral gene transcription and mRNA utilization. Moreover, strategies for both repression and activation of gene transcription have been described. These studies offer promise for treatment of diseases of pathogenic (viral, bacterial, etc.) and cellular origin (cancer, genetic diseases, etc.). PMID:11097426

Proteomics for understanding miRNA biology

PubMed Central

Huang, Tai-Chung; Pinto, Sneha M.; Pandey, Akhilesh

2013-01-01

MicroRNAs (miRNAs) are small noncoding RNAs that play important roles in posttranscriptional regulation of gene expression. Mature miRNAs associate with the RNA interference silencing complex to repress mRNA translation and/or degrade mRNA transcripts. Mass spectrometry-based proteomics has enabled identification of several core components of the canonical miRNA processing pathway and their posttranslational modifications which are pivotal in miRNA regulatory mechanisms. The use of quantitative proteomic strategies has also emerged as a key technique for experimental identification of miRNA targets by allowing direct determination of proteins whose levels are altered because of translational suppression. This review focuses on the role of proteomics and labeling strategies to understand miRNA biology. PMID:23125164

Microbiota Small RNAs in Inflammatory Bowel Disease.

PubMed

Filip, Anca T; Balacescu, Ovidiu; Marian, Catalin; Anghel, Andrei

2016-12-01

MiRNAs are a class of potential gene regulators of critical importance in Inflammatory Bowel Disease (IBD). This review aims to present the connection between gut microbiota, probiotics administration and microRNA (miRNA) expression in IBD. It also brings into question cross-kingdom RNAi (RNA interference). Not only that gut host cells garden the intestinal microbiome via miRNA, but also strong evidence supports the idea that different species of bacteria have an impact on the intestinal immune response by modulating miRNA expression. Cross-kingdom RNAi refers to RNA silencing signals that travel between two unrelated, interacting organisms. RNAs communication between prokaryotes and eukaryotes (bacteria and nematodes) via RNAs transfer has been proved. Some authors also support the idea that non-coding RNAs are being transferred by bacterial pathogens to the host cells as part of the intracellular infection process. Further studies are required in order to clarify whether the mechanism by which bacteria modulate miRNA expression concerns RNAs transfer. These findings may lead to a different approach to IBD therapy in the future.

In silico molecular docking analysis of the human Argonaute 2 PAZ domain reveals insights into RNA interference.

PubMed

Kandeel, Mahmoud; Kitade, Yukio

2013-07-01

RNA interference (RNAi) is a critical cellular pathway activated by double stranded RNA and regulates the gene expression of target mRNA. During RNAi, the 3' end of siRNA binds with the PAZ domain, followed by release and rebinding in a cyclic manner, which deemed essential for proper gene silencing. Recently, we provided the forces underlying the recognition of small interfering RNA by PAZ in a computational study based on the structure of Drosophila Argonaute 2 (Ago2) PAZ domain. We have now reanalyzed these data within the view of the new available structures from human Argonauts. While the parameters of weak binding are correlated with higher (RNAi) in the Drosophila model, a different profile is predicted with the human Ago2 PAZ domain. On the basis of the human Ago2 PAZ models, the indicators of stronger binding as the total binding energy and the free energy were associated with better RNAi efficacy. This discrepancy might be attributable to differences in the binding site topology and the difference in the conformation of the bound nucleotides.

Mitochondrial uncoupling proteins regulate angiotensin-converting enzyme expression: crosstalk between cellular and endocrine metabolic regulators suggested by RNA interference and genetic studies.

PubMed

Dhamrait, Sukhbir S; Maubaret, Cecilia; Pedersen-Bjergaard, Ulrik; Brull, David J; Gohlke, Peter; Payne, John R; World, Michael; Thorsteinsson, Birger; Humphries, Steve E; Montgomery, Hugh E

2016-07-01

Uncoupling proteins (UCPs) regulate mitochondrial function, and thus cellular metabolism. Angiotensin-converting enzyme (ACE) is the central component of endocrine and local tissue renin-angiotensin systems (RAS), which also regulate diverse aspects of whole-body metabolism and mitochondrial function (partly through altering mitochondrial UCP expression). We show that ACE expression also appears to be regulated by mitochondrial UCPs. In genetic analysis of two unrelated populations (healthy young UK men and Scandinavian diabetic patients) serum ACE (sACE) activity was significantly higher amongst UCP3-55C (rather than T) and UCP2 I (rather than D) allele carriers. RNA interference against UCP2 in human umbilical vein endothelial cells reduced UCP2 mRNA sixfold (P < 0·01) whilst increasing ACE expression within a physiological range (<1·8-fold at 48 h; P < 0·01). Our findings suggest novel hypotheses. Firstly, cellular feedback regulation may occur between UCPs and ACE. Secondly, cellular UCP regulation of sACE suggests a novel means of crosstalk between (and mutual regulation of) cellular and endocrine metabolism. This might partly explain the reduced risk of developing diabetes and metabolic syndrome with RAS antagonists and offer insight into the origins of cardiovascular disease in which UCPs and ACE both play a role. © 2016 The Authors. BioEssays published by WILEY Periodicals, Inc.

Mitochondrial uncoupling proteins regulate angiotensin‐converting enzyme expression: crosstalk between cellular and endocrine metabolic regulators suggested by RNA interference and genetic studies

PubMed Central

Maubaret, Cecilia; Pedersen‐Bjergaard, Ulrik; Brull, David J.; Gohlke, Peter; Payne, John R.; World, Michael; Thorsteinsson, Birger; Humphries, Steve E.; Montgomery, Hugh E.

2015-01-01

Uncoupling proteins (UCPs) regulate mitochondrial function, and thus cellular metabolism. Angiotensin‐converting enzyme (ACE) is the central component of endocrine and local tissue renin–angiotensin systems (RAS), which also regulate diverse aspects of whole‐body metabolism and mitochondrial function (partly through altering mitochondrial UCP expression). We show that ACE expression also appears to be regulated by mitochondrial UCPs. In genetic analysis of two unrelated populations (healthy young UK men and Scandinavian diabetic patients) serum ACE (sACE) activity was significantly higher amongst UCP3‐55C (rather than T) and UCP2 I (rather than D) allele carriers. RNA interference against UCP2 in human umbilical vein endothelial cells reduced UCP2 mRNA sixfold (P < 0·01) whilst increasing ACE expression within a physiological range (<1·8‐fold at 48 h; P < 0·01). Our findings suggest novel hypotheses. Firstly, cellular feedback regulation may occur between UCPs and ACE. Secondly, cellular UCP regulation of sACE suggests a novel means of crosstalk between (and mutual regulation of) cellular and endocrine metabolism. This might partly explain the reduced risk of developing diabetes and metabolic syndrome with RAS antagonists and offer insight into the origins of cardiovascular disease in which UCPs and ACE both play a role. PMID:27347560

Mitochondrial uncoupling proteins regulate angiotensin-converting enzyme expression: crosstalk between cellular and endocrine metabolic regulators suggested by RNA interference and genetic studies.

PubMed

Dhamrait, Sukhbir S; Maubaret, Cecilia; Pedersen-Bjergaard, Ulrik; Brull, David J; Gohlke, Peter; Payne, John R; World, Michael; Thorsteinsson, Birger; Humphries, Steve E; Montgomery, Hugh E

2016-01-01

Uncoupling proteins (UCPs) regulate mitochondrial function, and thus cellular metabolism. Angiotensin-converting enzyme (ACE) is the central component of endocrine and local tissue renin-angiotensin systems (RAS), which also regulate diverse aspects of whole-body metabolism and mitochondrial function (partly through altering mitochondrial UCP expression). We show that ACE expression also appears to be regulated by mitochondrial UCPs. In genetic analysis of two unrelated populations ( healthy young UK men and Scandinavian diabetic patients ) serum ACE (sACE) activity was significantly higher amongst UCP3-55C (rather than T) and UCP2 I (rather than D) allele carriers. RNA interference against UCP2 in human umbilical vein endothelial cells reduced UCP2 mRNA sixfold ( P  < 0·01) whilst increasing ACE expression within a physiological range (<1·8-fold at 48 h; P  < 0·01). Our findings suggest novel hypotheses. Firstly, cellular feedback regulation may occur between UCPs and ACE. Secondly, cellular UCP regulation of sACE suggests a novel means of crosstalk between (and mutual regulation of) cellular and endocrine metabolism. This might partly explain the reduced risk of developing diabetes and metabolic syndrome with RAS antagonists and offer insight into the origins of cardiovascular disease in which UCPs and ACE both play a role.

Accumulation of dsRNA in endosomes contributes to inefficient RNA interference in the fall armyworm, Spodoptera frugiperda.

PubMed

Yoon, June-Sun; Gurusamy, Dhandapani; Palli, Subba Reddy

2017-11-01

RNA interference (RNAi) efficiency varies among insects studied. The barriers for successful RNAi include the presence of double-stranded ribonucleases (dsRNase) in the lumen and hemolymph that could potentially digest double-stranded RNA (dsRNA) and the variability in the transport of dsRNA into and within the cells. We recently showed that the dsRNAs are transported into lepidopteran cells, but they are not processed into small interference RNAs (siRNAs) because they are trapped in acidic bodies. In the current study, we focused on the identification of acidic bodies in which dsRNAs accumulate in Sf9 cells. Time-lapse imaging studies showed that dsRNAs enter Sf9 cells and accumulate in acidic bodies within 20 min after their addition to the medium. CypHer-5E-labeled dsRNA also accumulated in the midgut and fat body dissected from Spodoptera frugiperda larvae with similar patterns observed in Sf9 cells. Pharmacological inhibitor assays showed that the dsRNAs use clathrin mediated endocytosis pathway for transport into the cells. We investigated the potential dsRNA accumulation sites employing LysoTracker and double labeling experiments using the constructs to express a fusion of green fluorescence protein with early or late endosomal marker proteins and CypHer-5E-labeled dsRNA. Interestingly, CypHer-5E-labeled dsRNA accumulated predominantly in early and late endosomes. These data suggest that entrapment of internalized dsRNA in endosomes is one of the major factors contributing to inefficient RNAi response in lepidopteran insects. Copyright © 2017 Elsevier Ltd. All rights reserved.

Constitutive Expression of Short Hairpin RNA in Vivo Triggers Buildup of Mature Hairpin Molecules

PubMed Central

Ahn, M.; Witting, S.R.; Ruiz, R.; Saxena, R.

2011-01-01

Abstract RNA interference (RNAi) has become the cornerstone technology for studying gene function in mammalian cells. In addition, it is a promising therapeutic treatment for multiple human diseases. Virus-mediated constitutive expression of short hairpin RNA (shRNA) has the potential to provide a permanent source of silencing molecules to tissues, and it is being devised as a strategy for the treatment of liver conditions such as hepatitis B and hepatitis C virus infection. Unintended interaction between silencing molecules and cellular components, leading to toxic effects, has been described in vitro. Despite the enormous interest in using the RNAi technology for in vivo applications, little is known about the safety of constitutively expressing shRNA for multiple weeks. Here we report the effects of in vivo shRNA expression, using helper-dependent adenoviral vectors. We show that gene-specific knockdown is maintained for at least 6 weeks after injection of 1 × 1011 viral particles. Nonetheless, accumulation of mature shRNA molecules was observed up to weeks 3 and 4, and then declined gradually, suggesting the buildup of mature shRNA molecules induced cell death with concomitant loss of viral DNA and shRNA expression. No evidence of well-characterized innate immunity activation (such as interferon production) or saturation of the exportin-5 pathway was observed. Overall, our data suggest constitutive expression of shRNA results in accumulation of mature shRNA molecules, inducing cellular toxicity at late time points, despite the presence of gene silencing. PMID:21780944

EMMPRIN (basigin/CD147) is involved in the morphogenesis of tooth germ in mouse molars.

PubMed

Xie, Ming; Jiao, Ting; Chen, Yuqin; Xu, Chun; Li, Jing; Jiang, Xinquan; Zhang, Fuqiang

2010-05-01

The pattern of gene expression for extracellular matrix metalloproteinase inducer (EMMPRIN) was revealed in the tooth germ of mouse mandibular molars using quantitative real-time PCR. In situ hybridization and immunohistochemical study demonstrated the characteristic distribution of EMMPRIN in the different stages of tooth germ development. To investigate the functional role played by EMMPRIN in tooth germ development, EMMPRIN siRNA interference approach was carried out in cultured mouse mandibles at embryonic day 11.0 (E11.0). The results showed that EMMPRIN siRNA-treated explants exhibited a marked growth inhibition of tooth germ compared to the control and scrambled siRNA-treated explants. Meanwhile, a significant increase in MT1-MMP mRNA expression and a reduction in MMP-2, MMP-3, MMP-9, MMP-13 and MT2-MMP mRNA expression were observed in the mouse mandibles following EMMPRIN abrogation. The current results indicate that EMMPRIN could thus be involved in the early stage of tooth germ development and morphogenesis, possibly by regulating the expression of MMP genes.

Reduction of adenovirus E1A mRNA by RNAi results in enhanced recombinant protein expression in transiently transfected HEK293 cells.

PubMed

Hacker, David L; Bertschinger, Martin; Baldi, Lucia; Wurm, Florian M

2004-10-27

Human embryonic kidney 293 (HEK293) cells, a widely used host for large-scale transient expression of recombinant proteins, are transformed with the adenovirus E1A and E1B genes. Because the E1A proteins function as transcriptional activators or repressors, they may have a positive or negative effect on transient transgene expression in this cell line. Suspension cultures of HEK293 EBNA (HEK293E) cells were co-transfected with a reporter plasmid expressing the GFP gene and a plasmid expressing a short hairpin RNA (shRNA) targeting the E1A mRNAs for degradation by RNA interference (RNAi). The presence of the shRNA in HEK293E cells reduced the steady state level of E1A mRNA up to 75% and increased transient GFP expression from either the elongation factor-1alpha (EF-1alpha) promoter or the human cytomegalovirus (HCMV) immediate early promoter up to twofold. E1A mRNA depletion also resulted in a twofold increase in transient expression of a recombinant IgG in both small- and large-scale suspension cultures when the IgG light and heavy chain genes were controlled by the EF-1alpha promoter. Finally, transient IgG expression was enhanced 2.5-fold when the anti-E1A shRNA was expressed from the same vector as the IgG light chain gene. These results demonstrated that E1A has a negative effect on transient gene expression in HEK293E cells, and they established that RNAi can be used to enhance recombinant protein expression in mammalian cells.

Role of RNA interference in plant improvement

NASA Astrophysics Data System (ADS)

Jagtap, Umesh Balkrishna; Gurav, Ranjit Gajanan; Bapat, Vishwas Anant

2011-06-01

Research to alter crops for their better performance involving modern technology is underway in numerous plants, and achievements in transgenic plants are impacting crop improvements in unparalleled ways. Striking progress has been made using genetic engineering technology over the past two decades in manipulating genes from diverse and exotic sources, and inserting them into crop plants for inducing desirable characteristics. RNA interference (RNAi) has recently been identified as a natural mechanism for regulation of gene expression in all higher organisms from plants to humans and promises greater accuracy and precision to plant improvement. The expression of any gene can be down-regulated in a highly explicit manner exclusive of affecting the expression of any other gene by using RNAi technologies. Additional research in this field has been focused on a number of other areas including microRNAs, hairpin RNA, and promoter methylation. Manipulating new RNAi pathways, which generate small RNA molecules to amend gene expression in crops, can produce new quality traits and having better potentiality of protection against abiotic and biotic stresses. Nutritional improvement, change in morphology, or enhanced secondary metabolite synthesis are some of the other advantages of RNAi technology. In addition to its roles in regulating gene expression, RNAi is also used as a natural defense mechanism against molecular parasites such as jumping genes and viral genetic elements that affect genome stability. Even though much advancement has been made on the field of RNAi over the preceding few years, the full prospective of RNAi for crop improvement remains to be fully realized. The intricacy of RNAi pathway, the molecular machineries, and how it relates to plant development are still to be explained.

Down-regulation of a chitin synthase a gene by RNA interference enhances pathogenicity of Beauveria bassiana ANU1 against Spodoptera exigua (HÜBNER).

PubMed

Lee, Jung-Bok; Kim, Hyun Soo; Park, Youngjin

2017-02-01

Chitin synthase (CHS) is an important enzymatic component, which is required for chitin formation in the cuticles and cuticular linings of other tissues in insects. CHSs have been divided into two classes, classes A and B, based on their amino acid sequence similarities and functions. Class A CHS (CHS-A) is specifically expressed in the epidermis and related ectodermal cells such as tracheal cells, while class B CHS (CHS-B) is expressed in gut epithelial cells that produce peritrophic matrices. In this study, we cloned the CHS-A gene from the beet armyworm, Spodoptera exigua (SeCHS-A). The SeCHS-A contains an open reading frame of 4,698 nucleotides, encoding a protein of 1,565 amino acids with a predicted molecular mass of approximately 177.8 kDa. The SeCHS-A mRNA was expressed in all developmental stages and specifically in the epidermis and tracheae tissue by quantitative real-time-PCR analysis. Expression of SeCHS-A gene was suppressed by feeding double-stranded RNA (dsCHS-A, 400 ng/larva) in the third instar larvae of S. exigua. Suppression of the SeCHS-A gene expression significantly increased 35% of mortality on pupation of S. exigua. Also, the third instar larvae fed with dsCHS-A significantly increased susceptibility to entomopathogenic fungi, Beauveria bassiana ANU1 at 3 days after treatment. These results suggest that the SeCHS-A gene plays an important role in development of S. exigua and RNA interference may apply to effective pest control with B. bassiana. © 2017 Wiley Periodicals, Inc.

Evidence for the involvement of NOD2 in regulating colonic epithelial cell growth and survival.

PubMed

Cruickshank, Sheena-M; Wakenshaw, Louise; Cardone, John; Howdle, Peter-D; Murray, Peter-J; Carding, Simon-R

2008-10-14

To investigate the function of NOD2 in colonic epithelial cells (CEC). A combination of in vivo and in vitro analyses of epithelial cell turnover in the presence and absence of a functional NOD2 protein and, in response to enteric Salmonella typhimurium infection, were used. shRNA interference was also used to investigate the consequences of knocking down NOD2 gene expression on the growth and survival of colorectal carcinoma cell lines. In the colonic mucosa the highest levels of NOD2 expression were in proliferating crypt epithelial cells. Muramyl dipeptide (MDP), that is recognized by NOD2, promoted CEC growth in vitro. By contrast, the growth of NOD2-deficient CECs was impaired. In vivo CEC proliferation was also reduced and apoptosis increased in Nod2(-/-) mice, which were also evident following enteric Salmonella infection. Furthermore, neutralization of NOD2 mRNA expression in human colonic carcinoma cells by shRNA interference resulted in decreased survival due to increased levels of apoptosis. These findings are consistent with the involvement of NOD2 protein in promoting CEC growth and survival. Defects in proliferation by CECs in cases of CD may contribute to the underlying pathology of disrupted intestinal homeostasis and excessive inflammation.

Evidence for the involvement of NOD2 in regulating colonic epithelial cell growth and survival

PubMed Central

Cruickshank, Sheena M; Wakenshaw, Louise; Cardone, John; Howdle, Peter D; Murray, Peter J; Carding, Simon R

2008-01-01

AIM: To investigate the function of NOD2 in colonic epithelial cells (CEC). METHODS: A combination of in vivo and in vitro analyses of epithelial cell turnover in the presence and absence of a functional NOD2 protein and, in response to enteric Salmonella typhimurium infection, were used. shRNA interference was also used to investigate the consequences of knocking down NOD2 gene expression on the growth and survival of colorectal carcinoma cell lines. RESULTS: In the colonic mucosa the highest levels of NOD2 expression were in proliferating crypt epithelial cells. Muramyl dipeptide (MDP), that is recognized by NOD2, promoted CEC growth in vitro. By contrast, the growth of NOD2-deficient CECs was impaired. In vivo CEC proliferation was also reduced and apoptosis increased in Nod2-/- mice, which were also evident following enteric Salmonella infection. Furthermore, neutralization of NOD2 mRNA expression in human colonic carcinoma cells by shRNA interference resulted in decreased survival due to increased levels of apoptosis. CONCLUSION: These findings are consistent with the involvement of NOD2 protein in promoting CEC growth and survival. Defects in proliferation by CECs in cases of CD may contribute to the underlying pathology of disrupted intestinal homeostasis and excessive inflammation. PMID:18855982

[Inhibitory effect of RNA interference targeting GFI-1 on the proliferation of atypical chronic myelogenous leukemia NT1 cells].

PubMed

Yang, X; Liu, H; Lin, Z H; Qian, J; Xu, X R

2016-08-01

To investigate the inhibitory effects of RNA interference targeting GFI-1 on growth and proliferation of atypical chronic myelogenous leukemia (aCML) NT1 cells. NT1 cells were transfected with PBS and liposome complex (vehicle group), scrambled siRNA and liposome complex (negative control, NC group), and GFI-1 siRNA and liposome complex (GFI-1 siRNA group), respectively. Real-time quantitative RT-PCR (qRT-PCR) and Western blot were performed to examine the expression levels of GFI-1 mRNA and protein, respectively. The proliferation abilities of NT1 cells of the three groups were evaluated by MTT assay. The cell cycle in cells of the three groups was analyzed by flow cytometry. Moreover, nude mouse xenograft model was used to detect the tumor formation ability in the three group cells. Quantitative real-time PCR data showed that the expression level of GFI-1 mRNA in GFI-1 siRNA group was significantly lower than those of NC group and vehicle group [(0.367±0.017) vs. (0.918±0.006) and (1.010±0.005), respectively, (P<0.05)]. Western blot results showed that the GFI-1 protein expression level in the GFI-1 siRNA group was also significantly reduced, compared with those of the NC group and vehicle group (P<0.05 for both). From MTT assay data, the absorbance value of NT1 cells in the GFI-1 siRNA group (0.667±0.059) was significantly lower than those of the NC group (1.096±0.049) and vehicle group (1.193±0.064, P=0.023). Flow cytometry data showed that sub-G1 and G0/G1 phase proportions of the GFI-1 siRNA group were significantly higher than those of the NC and vehicle groups [sub-G1: (8.2±2.5)% vs. (1.9±1.3)% and (2.0±3.6)%, respectively, (P<0.05); G0/G1: (66.7±3.8)% vs. (53.3±4.5)% and (48.6±3.2)%, respectively, (P<0.05)]. Furthermore, the tumor weight in the GFI-1 siRNA group [(0.37±0.02) g] was significantly lower than those in the NC group [(0.83±0.06) g] and vehicle group [(0.92±0.04) g] (P<0.05). RNA interference targeting GFI-1 inhibits the growth and proliferation of NT1 cells, which may provide a new therapeutic target for atypical chronic myelogenous leukemia.

Antisense transcriptional interference mediates condition-specific gene repression in budding yeast.

PubMed

Nevers, Alicia; Doyen, Antonia; Malabat, Christophe; Néron, Bertrand; Kergrohen, Thomas; Jacquier, Alain; Badis, Gwenael

2018-05-18

Pervasive transcription generates many unstable non-coding transcripts in budding yeast. The transcription of such noncoding RNAs, in particular antisense RNAs (asRNAs), has been shown in a few examples to repress the expression of the associated mRNAs. Yet, such mechanism is not known to commonly contribute to the regulation of a given class of genes. Using a mutant context that stabilized pervasive transcripts, we observed that the least expressed mRNAs during the exponential phase were associated with high levels of asRNAs. These asRNAs also overlapped their corresponding gene promoters with a much higher frequency than average. Interrupting antisense transcription of a subset of genes corresponding to quiescence-enriched mRNAs restored their expression. The underlying mechanism acts in cis and involves several chromatin modifiers. Our results convey that transcription interference represses up to 30% of the 590 least expressed genes, which includes 163 genes with quiescence-enriched mRNAs. We also found that pervasive transcripts constitute a higher fraction of the transcriptome in quiescence relative to the exponential phase, consistent with gene expression itself playing an important role to suppress pervasive transcription. Accordingly, the HIS1 asRNA, normally only present in quiescence, is expressed in exponential phase upon HIS1 mRNA transcription interruption.

Endocannabinoids as endometrial inflammatory markers in lactating Holstein cows.

PubMed

Bonsale, R; Seyed Sharifi, R; Dirandeh, E; Hedayat, N; Mojtahedin, A; Ghorbanalinia, M; Abolghasemi, A

2018-06-01

The objective of this study was to consider endocannabinoid system as inflammatory markers in bovine endometrium to better understand the role of this system in regulating many of the functions that are related to inflammatory condition. At day 26 post-partum, fourteen cows were divided into two groups depending on the inflammatory condition: 1- subclinical endometritis (n = 7, with purulent or mucopurulent uterine discharge detectable in the vagina) and 2- healthy (n = 7, No (muco)) purulent discharge. Blood samples were collected at 26 and 30 days relative to calving to determine plasma tumour necrosis factor (TNF) and lipopolysaccharide-binding protein (LBP) concentrations; moreover, uterine biopsy was carried out on day 26 post-partum to measure mRNA abundance of TNF, interleukin-1B (IL1B), interleukin-6 (IL-6), C-X-C motif chemokine ligand 8 (CXCL8), endocannabinoid receptor (CNR2), N-acyl phosphatidylethanolamine phospholipase D (NAPEPLD), fatty acid amide hydrolase (FAAH), N-acylethanolamine acid amidase (NAAA) and monoglyceride lipase (MGLL) by real-time PCR. Results showed mean plasma concentrations of TNF and LBP were lower in healthy cows compared to subclinical endometritis cows (p < .05). Relative mRNA expression for NAAA and FAAH was decreased (p < .05), and relative mRNA expression for CNR2 and NAPEPLD increased in cows with subclinical endometritis compared to healthy cows. In conclusion, relative mRNA expression of TNF, IL1B and CXCL8 and plasma concentration of LBP increased during inflammatory condition along with decreased endocannabinoids hydrolyzing enzyme (NAAA and FAAH), increased enzymes that synthesize endocannabinoids (NAPEPLD) and relative gene expression of the endocannabinoid receptor; together, these contribute to increased endocannabinoids levels during inflammation. Overall, we provide evidence that endocannabinoid system is altered in endometrium tissue during inflammation through increased mRNA expression of CNR2 and synthesis enzyme and decreased mRNA expression of hydrolyzing enzymes interfere with pro-cytokine production and signalling, which may interfere with the onset and progression of inflammation. © 2018 Blackwell Verlag GmbH.

RNA interference-mediated knockdown of the hydroxyacid-oxoacid transhydrogenase gene decreases thiamethoxam resistance in adults of the whitefly Bemisia tabaci

PubMed Central

Yang, Xin; Xie, Wen; Li, Ru-mei; Zhou, Xiao-mao; Wang, Shao-li; Wu, Qing-jun; Yang, Ni-na; Xia, Ji-xing; Yang, Ze-zong; Guo, Li-tao; Liu, Ya-ting; Zhang, You-jun

2017-01-01

Bemisia tabaci has developed a high level of resistance to thiamethoxam, a second generation neonicotinoid insecticide that has been widely used to control this pest. In this study, we investigated whether hydroxyacid-oxoacid transhydrogenase (HOT) is involved in resistance to the neonicotinoid insecticide thiamethoxam in the whitefly. We cloned the full-length gene that encodes HOT in B. tabaci. Its cDNA contains a 1428-bp open reading frame encoding 475 amino acid residues. Then we evaluated the mRNA expression level of HOT in different developmental stages, and found HOT expression was significantly greater in thiamethoxam resistance adults than in thiamethoxam susceptible adults. Subsequently, seven field populations of B. tabaci adults were sampled, the expression of mRNA level of HOT significant positive correlated with thiamethoxam resistance level. At last, we used a modified gene silencing system to knock-down HOT expression in B. tabaci adults. The results showed that the HOT mRNA levels decreased by 57% and thiamethoxam resistance decreased significantly after 2 days of feeding on a diet containing HOT dsRNA. The results indicated that down-regulation of HOT expression decreases thiamethoxam resistance in B. tabaci adults. PMID:28117358

Transgenic Cotton Plants Expressing the HaHR3 Gene Conferred Enhanced Resistance to Helicoverpa armigera and Improved Cotton Yield

PubMed Central

Han, Qiang; Wang, Zhenzhen; He, Yunxin; Xiong, Yehui; Lv, Shun; Li, Shupeng; Zhang, Zhigang; Qiu, Dewen; Zeng, Hongmei

2017-01-01

RNA interference (RNAi) has been developed as an efficient technology. RNAi insect-resistant transgenic plants expressing double-stranded RNA (dsRNA) that is ingested into insects to silence target genes can affect the viability of these pests or even lead to their death. HaHR3, a molt-regulating transcription factor gene, was previously selected as a target expressed in bacteria and tobacco plants to control Helicoverpa armigera by RNAi technology. In this work, we selected the dsRNA-HaHR3 fragment to silence HaHR3 in cotton bollworm for plant mediated-RNAi research. A total of 19 transgenic cotton lines expressing HaHR3 were successfully cultivated, and seven generated lines were used to perform feeding bioassays. Transgenic cotton plants expressing dsHaHR3 were shown to induce high larval mortality and deformities of pupation and adult eclosion when used to feed the newly hatched larvae, and 3rd and 5th instar larvae of H. armigera. Moreover, HaHR3 transgenic cotton also demonstrated an improved cotton yield when compared with controls. PMID:28867769

Silencing the myotrophin gene by RNA interference leads to the regression of cardiac hypertrophy.

PubMed

Gupta, Sudhiranjan; Maitra, Ratan; Young, Dave; Gupta, Anasuya; Sen, Subha

2009-08-01

Myotrophin-induced activation of NF-kappaB has been shown to be associated with cardiac hypertrophy (CH) that progresses to heart failure (HF). In the present study, we examined the cause-and-effect relationship between myotrophin and NF-kappaB activation using small hairpin RNA (shRNA) against myotrophin both in vitro (using neonatal rat myocytes) and in vivo [using myotrophin transgenic (Myo-Tg) mice, which overexpress myotrophin in the heart, develop CH, and gradually progress to HF]. Among several lentiviral vectors expressing myotrophin shRNAs, L-sh-109 showed the best silencing effect at both the mRNA (155.3 +/- 5.9 vs. 32.5 +/- 5.5, P < 0.001) and protein levels associated with a significant reduction of atrial natriuretic factor (ANF) and NF-kappaB. In vivo, when L-sh-109 was delivered directly into the hearts of 10-wk-old Myo-Tg mice, we observed a significant regression of cardiac mass (8.0 vs. 5.7 mg/g, P < 0.001) and myotrophin gene expression (54.5% over untreated Myo-Tg mice, P < 0.001) associated with a reduction in ANF and NF-kappaB signaling components. Our data suggest that using RNA interference to silence the myotrophin gene prevents NF-kappaB activation, associated with an attenuation of CH. This strategy could be an excellent therapeutic means for the treatment of CH and HF.

[Herpes simplex virus-mediated RNA interference targeting vesicular glutamate transporter 3 attenuates tactile allodynia in mice].

PubMed

Liu, Jie-Qiong; Li, Chen-Hong; Luo, Qiong; Yin, Ping-Ping; Lei, Tao; Luo, Fang

2016-11-20

To construct a replication-deficient herpes simplex virus (HSV-1) for delivering a short hairpin RNA (shRNA) targeting vesicular glutamate transporter 3 (VGLUT3) and observe its effect in alleviating allodynia in mice. The recombinant HSV-1 vector carrying the shRNA targeting Vglut3 (HSV-1-shvglut3) was constructed and inoculated in the sciatic nerve in a mouse model of mechanical allodynia to test its analgesia effect. Mechanical allodynia and heat hypersensitivity of the mice were tested by von Frey filaments and Hargreaves' test, respectively. VGLUT3 expression in the dorsal root ganglion (DRG) was evaluated by immunohistochemistry and Western blotting. Following inoculation in the sciatic nerve, the HSV vector HSV-1-shvglut3 was retrogradely transported to the DRG. Mechanical withdraw thresholds of the mouse models receiving HSV-1-shvglut3 inoculation were reversed to nearly the baseline level, and VGLUT3 expression in the DRG was down-regulated 2 weeks after vector inoculation. The analgesic effect lasted for over 2 weeks in these mice without obvious systematic side effects or changes in heat hypersensitivity threshold. Vglut3 in the DRG is a promising therapeutic target for alleviating mechanical allodynia, and HSV-1 vector-mediated RNA interference is safe and efficient for inducing long-lasting analgesia after peripheral inoculation of the vector.

Expression profile of circular RNAs in human gastric cancer tissues

PubMed Central

Huang, You-Sheng; Jie, Na; Zou, Ke-Jian; Weng, Yang

2017-01-01

Circular RNAs (circRNAs) represent a newly identified class of non-coding RNA molecules, which interfere with gene transcription by adsorbing microRNAs (miRNAs). CircRNAs serve important roles in disease development and have the potential to serve as a novel class of biomarkers for clinical diagnosis. However, the role of circRNAs in the occurrence and development of gastric cancer (GC) remains unclear. In the present study, the expression profiles of circRNAs were compared between GC and adjacent normal tissues using a circRNA microarray, following which quantitative polymerase chain reaction (qPCR) was used to confirm the results of the circRNA microarray. Compared with the adjacent, normal mucosal tissues, 16 circRNAs were upregulated and 84 circRNAs were downregulated in GC. A total of 10 circRNAs were selected for validation in three pairs of GC and adjacent noncancerous tissues. The qPCR results were consistent with the findings of the microarray-based expression analysis. Of the circRNAs studied, only circRNA-0026 (hsa_circ_0000026) exhibited significantly different expression in GC (2.8-fold, P=0.001). Furthermore, online Database for Annotation, Visualization and Integrated Discovery annotation was used to predict circRNA-targeted miRNA-gene interactions. The analysis revealed that circRNA-0026 may regulate RNA transcription, RNA metabolism, gene expression, gene silencing and other biological functions in GC. In conclusion, differential expression of circRNAs may be associated with GC tumorigenesis, and circRNA-0026 is a promising biomarker for GC diagnosis and targeted therapy. PMID:28737829

Enhancement of antiproliferative activity of interferons by RNA interference-mediated silencing of SOCS gene expression in tumor cells.

PubMed

Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu

2008-08-01

The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.

Increased Dickkopf-1 expression accelerates bone cell apoptosis in femoral head osteonecrosis.

PubMed

Ko, Jih-Yang; Wang, Feng-Sheng; Wang, Ching-Jen; Wong, To; Chou, Wen-Yi; Tseng, Shin-Ling

2010-03-01

Intensive bone cell apoptosis contributes to osteonecrosis of femoral head (ONFH). Dickkopf-1 (DKK1) reportedly mediates various types of skeletal disorders. This study investigated whether DKK1 was linked to the occurrence of ONFH. Thirty-nine patients with various stages of ONFH were recruited. Bone specimens were harvested from 34 ONFH patients underwent hip arthroplasty, and from 10 femoral neck fracture patients. Bad, Bcl2 TNFalpha, DKK1, Wnt3a, LRP5, and Axin1 expressions were analyzed by quantitative RT-PCR and ELISA. Apoptotic cells were assayed using terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate-biotin nick end-labelling (TUNEL). Primary bone-marrow mesenchymal cells were treated with DKK1 RNA interference and recombinant DKK1 protein. ONFH patients with the histories of being administrated corticosteroids and excessive alcohol consumption had significantly higher Bad and DKK1 mRNA expressions in bone tissue and DKK1 abundances in serum than femoral neck fracture patients. Bone cells adjacent to osteonecrotic bone displayed strong DKK1 immunoreactivity and TUNEL staining. Increased DKK1 expression in bone tissue and serum correlated with Bad expression and TUNEL staining. Serum DKK1 abundance correlated with the severity of ONFH. The DKK1 RNA interference and recombinant DKK1 protein regulated Bad expression and apoptosis of primary bone-marrow mesenchymal cells. Knock down of DKK1 reduced dexamethasone-induced apoptosis of mesenchymal cells. Taken together, promoted DKK1 expression was associated with bone cell apoptosis in the occurrence of ONFH patients with the histories of corticosteroid and alcohol intake and progression of ONFH. DKK1 expression in injured tissue provides new insight into ONFH pathogenesis.

Interferon-α Silencing by Small Interference RNA Increases Adenovirus Transduction and Transgene Expression in Huh7 Cells.

PubMed

Sobrevilla-Navarro, Ana Alondra; Sandoval-Rodríguez, Ana; García-Bañuelos, Jesús Javier; Armendariz-Borunda, Juan; Salazar-Montes, Adriana María

2018-04-01

Adenoviruses are the most common vectors used in clinical trials of gene therapy. In 2017, 21.2% of clinical trials used rAds as vectors. Systemic administration of rAds results in high tropism in the liver. Interferon types α and β are the major antiviral cytokines which orchestrate the host's immune response against rAd, limiting therapeutic gene expression and preventing subsequent vector administration. siRNA is small double-strand RNAs that temporally inhibit the expression of a specific gene. The aim is to evaluate the effect of IFN-α blocking by a specific siRNA on Ad-GFP transduction and on transgene expression in Huh7 cells in culture. Huh7 cells were cultured in DMEM and transfected with 70 nM of siRNA-IFN-α. Six hours later, the cells were exposed to 1 × 10 9  vp/ml of rAd-GFP for 24 h. Expression of IFN-α, TNF-α and the PKR gene was determined by RT-qPCR. Percentage of transduction was analyzed by flow cytometry and by qPCR. GFP expression was determined by western blot. 70 nM of siRNA-IFN-α inhibited 96% of IFN-α and 65% of TNF-α gene expression compared to an irrelevant siRNA. Percentage of transduction and transgene expression increased in these cells compared to an irrelevant siRNA. Inhibition of IFN-α expression by siRNA-IFN-α enabled a higher level of transduction and transgene expression GFP, highlighting the role of IFN-α in the elimination of adenovirus in transduced cells and thus suggesting that its inhibition could be an important strategy for gene therapy in clinical trials using adenovirus as a vector directed to liver diseases.

Efficient generation of transgenic reporter strains and analysis of expression patterns in Caenorhabditis elegans using Library MosSCI

PubMed Central

Kaymak, Ebru; Farley, Brian M.; Hay, Samantha A.; Li, Chihua; Ho, Samantha; Hartman, Daniel J.; Ryder, Sean P.

2016-01-01

Background In C. elegans, germline development and early embryogenesis rely on post-transcriptional regulation of maternally transcribed mRNAs. In many cases, the 3′UTR is sufficient to govern the expression patterns of these transcripts. Several RNA-binding proteins are required to regulate maternal mRNAs through the 3′UTR. Despite intensive efforts to map RNA-binding protein-mRNA interactions in vivo, the biological impact of most binding events remains unknown. Reporter studies using single copy integrated transgenes are essential to evaluate the functional consequences of interactions between RNA-binding proteins and their associated mRNAs. Results In this report, we present an efficient method of generating reporter strains with improved throughput by using a library variant of MosSCI transgenesis. Furthermore, using RNA interference, we identify the suite of RBPs that control the expression pattern of five different maternal mRNAs. Conclusions The results provide a generalizable and efficient strategy to assess the functional relevance of protein-RNA interactions in vivo, and reveal new regulatory connections between key RNA-binding proteins and their maternal mRNA targets. PMID:27294288

Silencing the HaHR3 Gene by Transgenic Plant-mediated RNAi to Disrupt Helicoverpa armigera Development

PubMed Central

Xiong, Yehui; Zeng, Hongmei; Zhang, Yuliang; Xu, Dawei; Qiu, Dewen

2013-01-01

RNA interference (RNAi) caused by exogenous double-stranded RNA (dsRNA) has developed into a powerful technique in functional genomics, and to date it is widely used to down-regulate crucial physiology-related genes to control pest insects. A molt-regulating transcription factor gene, HaHR3, of cotton bollworm (Helicoverpa armigera) was selected as the target gene. Four different fragments covering the coding sequence (CDS) of HaHR3 were cloned into vector L4440 to express dsRNAs in Escherichia coli. The most effective silencing fragment was then cloned into a plant over-expression vector to express a hairpin RNA (hpRNA) in transgenic tobacco (Nicotiana tabacum). When H. armigera larvae were fed the E. coli or transgenic plants, the HaHR3 mRNA and protein levels dramatically decreased, resulting developmental deformity and larval lethality. The results demonstrate that both recombinant bacteria and transgenic plants could induce HaHR3 silence to disrupt H. armigera development, transgenic plant-mediated RNAi is emerging as a powerful approach for controlling insect pests. PMID:23630449

Molecular interactions and immune responses between Maize fine streak virus and the leafhopper vector Graminella nigrifrons through differential expression and RNA interference.

PubMed

Chen, Y; Redinbaugh, M G; Michel, A P

2015-06-01

Graminella nigrifrons is the only known vector for Maize fine streak virus (MFSV). In this study, we used real-time quantitative PCR to compare the expression profiles of transcripts that putatively function in the insect immune response: four peptidoglycan recognition proteins (PGRP-SB1, -SD, -LC and LB), Toll, spaetzle, defensin, Dicer-2 (Dcr-2), Argonaut-2 (Ago-2) and Arsenic resistance protein 2 (Ars-2). Except for PGRP-LB and defensin, transcripts involved in humoral pathways were significantly suppressed in G. nigrifrons fed on MFSV-infected maize. The abundance of three RNA interference (RNAi) pathway transcripts (Dcr-2, Ago-2, Ars-2) was significantly lower in nontransmitting relative to transmitting G. nigrifrons. Injection with double-stranded RNA (dsRNA) encoding segments of the PGRP-LC and Dcr-2 transcripts effectively reduced transcript levels by 90 and 75% over 14 and 22 days, respectively. MFSV acquisition and transmission were not significantly affected by injection of either dsRNA. Knock-down of PGRP-LC resulted in significant mortality (greater than 90%) at 27 days postinjection, and resulted in more abnormal moults relative to those injected with Dcr-2 or control dsRNA. The use of RNAi to silence G. nigrifrons transcripts will facilitate the study of gene function and pathogen transmission, and may provide approaches for developing novel targets of RNAi-based pest control. © 2015 The Royal Entomological Society.

Species specific inhibition of viral replication using dicer substrate siRNAs (DsiRNAs) targeting the viral nucleoprotein of the fish pathogenic rhabdovirus viral hemorrhagic septicemia virus (VHSV).

PubMed

Bohle, Harry; Lorenzen, Niels; Schyth, Brian Dall

2011-06-01

Gene knock down by the use of small interfering RNAs (siRNAs) is widely used as a method for reducing the expression of specific genes in eukaryotic cells via the RNA interference pathway. But, the effectivity of siRNA induced gene knock down in cells from fish has in several studies been questioned and the specificity seems to be a general problem in cells originating from both lower and higher vertebrates. Here we show that we are able to reduce the level of viral gene expression and replication specifically in fish cells in vitro. We do so by using 27/25-mer DsiRNAs acting as substrates for dicer for the generation of siRNAs targeting the nucleoprotein N gene of viral hemorrhagic septicemia virus (VHSV). This rhabdovirus infects salmonid fish and is responsible for large yearly losses in aquaculture production. Specificity of the DsiRNA is assured in two ways: first, by using the conventional method of testing a control DsiRNA which should not target the gene of interest. Second, by assuring that replication of a heterologous virus of the same genus as the target virus was not inhibited by the DsiRNA. Target controls are, as we have previously highlighted, essential for verification of the specificity of siRNA-induced interference with virus multiplication, but they are still not in general use. Copyright © 2011 Elsevier B.V. All rights reserved.

A member of the polymerase beta nucleotidyltransferase superfamily is required for RNA interference in C. elegans.

PubMed

Chen, Chun-Chieh G; Simard, Martin J; Tabara, Hiroaki; Brownell, Daniel R; McCollough, Jennifer A; Mello, Craig C

2005-02-22

RNA interference (RNAi) is an ancient, highly conserved mechanism in which small RNA molecules (siRNAs) guide the sequence-specific silencing of gene expression . Several silencing machinery protein components have been identified, including helicases, RNase-related proteins, double- and single-stranded RNA binding proteins, and RNA-dependent RNA polymerase-related proteins . Work on these factors has led to the revelation that RNAi mechanisms intersect with cellular pathways required for development and fertility . Despite rapid progress in understanding key steps in the RNAi pathway, it is clear that many factors required for both RNAi and related developmental mechanisms have not yet been identified. Here, we report the characterization of the C. elegans gene rde-3. Genetic analysis of presumptive null alleles indicates that rde-3 is required for siRNA accumulation and for efficient RNAi in all tissues, and it is essential for fertility and viability at high temperatures. RDE-3 contains conserved domains found in the polymerase beta nucleotidyltransferase superfamily, which includes conventional poly(A) polymerases, 2'-5' oligoadenylate synthetase (OAS), and yeast Trf4p . These findings implicate a new enzymatic modality in RNAi and suggest possible models for the role of RDE-3 in the RNAi mechanism.

Suppression of RNA Interference by Adenovirus Virus-Associated RNA†

PubMed Central

Andersson, M. Gunnar; Haasnoot, P. C. Joost; Xu, Ning; Berenjian, Saideh; Berkhout, Ben; Akusjärvi, Göran

2005-01-01

We show that human adenovirus inhibits RNA interference (RNAi) at late times of infection by suppressing the activity of two key enzyme systems involved, Dicer and RNA-induced silencing complex (RISC). To define the mechanisms by which adenovirus blocks RNAi, we used a panel of mutant adenoviruses defective in virus-associated (VA) RNA expression. The results show that the virus-associated RNAs, VA RNAI and VA RNAII, function as suppressors of RNAi by interfering with the activity of Dicer. The VA RNAs bind Dicer and function as competitive substrates squelching Dicer. Further, we show that VA RNAI and VA RNAII are processed by Dicer, both in vitro and during a lytic infection, and that the resulting short interfering RNAs (siRNAs) are incorporated into active RISC. Dicer cleaves the terminal stem of both VA RNAI and VA RNAII. However, whereas both strands of the VA RNAI-specific siRNA are incorporated into RISC, the 3′ strand of the VA RNAII-specific siRNA is selectively incorporated during a lytic infection. In summary, our work shows that adenovirus suppresses RNAi during a lytic infection and gives insight into the mechanisms of RNAi suppression by VA RNA. PMID:16014917

Identification of a novel cytochrome P450 gene, CYP321E1 from the diamondback moth, Plutella xylostella (L.) and RNA interference to evaluate its role in chlorantraniliprole resistance.

PubMed

Hu, Z; Lin, Q; Chen, H; Li, Z; Yin, F; Feng, X

2014-12-01

Insect cytochrome P450 monooxygenases (P450s) play an important role in catalysis of many reactions leading to insecticides resistance. Our previous studies on transcriptome analysis of chlorantraniliprole-resistant development in the diamondback moth, Plutella xylostella revealed that up-regulation of cytochrome P450s are one of the main factors leading to the development of chlorantraniliprole resistance. Here, we report for the first time a novel cytochrome P450 gene CYP321E1, which belongs to the cytochrome P450 gene family CYP321. Real-time quantitative PCR (RT-qPCR) analyses indicated that CYP321E1 was expressed at all developmental stages of P. xylostella but was highest in the fourth-instar larvae; furthermore, the relatively high expression was observed in the midgut of the fourth-instar larvae, followed by fat bodies and epidermis. The expression of CYP321E1 in P. xylostella was differentially affected by three representative insecticides, including alphamethrin, abamectin and chlorantraniliprole. Among them, the exposure to chlorantraniliprole resulted in the largest transcript level of this cytochrome P450 gene. The findings suggested potential involvement of CYP321E1 in chlorantraniliprole resistance of P. xylostella. To assess the functional link of CYP321E1 to chlorantraniliprole resistance, RNA interference (RNAi)-mediated gene silencing by double stranded RNA (dsRNA) injecting was used. Results revealed that injection delivery of dsRNA can greatly reduce gene expression after 24 h. As a consequence of RNAi, a significant increment in mortality of larvae injected CYP321E1 dsRNA was observed after 24 h of exposure to chlorantraniliprole. These results strongly support our notion that this novel cytochrome P450 gene plays an important role in chlorantraniliprole detoxification in the diamondback moth and is partly responsible for its resistance.

Targeting CCl4 -induced liver fibrosis by RNA interference-mediated inhibition of cyclin E1 in mice.

PubMed

Bangen, Jörg-Martin; Hammerich, Linda; Sonntag, Roland; Baues, Maike; Haas, Ute; Lambertz, Daniela; Longerich, Thomas; Lammers, Twan; Tacke, Frank; Trautwein, Christian; Liedtke, Christian

2017-10-01

Initiation and progression of liver fibrosis requires proliferation and activation of resting hepatic stellate cells (HSCs). Cyclin E1 (CcnE1) is the regulatory subunit of the cyclin-dependent kinase 2 (Cdk2) and controls cell cycle re-entry. We have recently shown that genetic inactivation of CcnE1 prevents activation, proliferation, and survival of HSCs and protects from liver fibrogenesis. The aim of the present study was to translate these findings into preclinical applications using an RNA interference (RNAi)-based approach. CcnE1-siRNA (small interfering RNA) efficiently inhibited CcnE1 gene expression in murine and human HSC cell lines and in primary HSCs, resulting in diminished proliferation and increased cell death. In C57BL/6 wild-type (WT) mice, delivery of stabilized siRNA using a liposome-based carrier targeted approximately 95% of HSCs, 70% of hepatocytes, and 40% of CD45 + cells after single injection. Acute CCl 4 -mediated liver injury in WT mice induced endogenous CcnE1 expression and proliferation of surviving hepatocytes and nonparenchymal cells, including CD45 + leukocytes. Pretreatment with CcnE1-siRNA reverted CcnE1 induction to baseline levels of healthy mice, which was associated with reduced liver injury, diminished proliferation of hepatocytes and leukocytes, and attenuated overall inflammatory response. For induction of liver fibrosis, WT mice were challenged with CCl 4 for 4-6 weeks. Co-treatment with CcnE1-siRNA once a week was sufficient to continuously block CcnE1 expression and cell-cycle activity of hepatocytes and nonparenchymal cells, resulting in significantly ameliorated liver fibrosis and inflammation. Importantly, CcnE1-siRNA also prevented progression of liver fibrosis if applied after onset of chronic liver injury. Therapeutic targeting of CcnE1 in vivo using RNAi is feasible and has high antifibrotic activity. (Hepatology 2017;66:1242-1257). © 2017 by the American Association for the Study of Liver Diseases.

Improving Small Interfering RNA Delivery In Vivo Through Lipid Conjugation.

PubMed

Osborn, Maire F; Khvorova, Anastasia

2018-05-10

RNA interference (RNAi)-based therapeutics are approaching clinical approval for genetically defined diseases. Current clinical success is a result of significant innovations in the development of chemical architectures that support sustained, multi-month efficacy in vivo following a single administration. Conjugate-mediated delivery has established itself as the most promising platform for safe and targeted small interfering RNA (siRNA) delivery. Lipophilic conjugates represent a major class of modifications that improve siRNA pharmacokinetics and enable efficacy in a broad range of tissues. Here, we review current literature and define key features and limitations of this approach for in vivo modulation of gene expression.

Mesoporous silica nanorods toward efficient loading and intracellular delivery of siRNA

NASA Astrophysics Data System (ADS)

Chen, Lijue; She, Xiaodong; Wang, Tao; Shigdar, Sarah; Duan, Wei; Kong, Lingxue

2018-02-01

The technology of RNA interference (RNAi) that uses small interfering RNA (siRNA) to silence the gene expression with complementary messenger RNA (mRNA) sequence has great potential for the treatment of cancer in which certain genes were usually found overexpressed. However, the carry and delivery of siRNA to the target site in the human body can be challenging for this technology to be used clinically to silence the cancer-related gene expression. In this work, rod shaped mesoporous silica nanoparticles (MSNs) were developed as siRNA delivery system for specific intracellular delivery. The rod MSNs with an aspect ratio of 1.5 had a high surface area of 934.28 m2/g and achieved a siRNA loading of more than 80 mg/g. With the epidermal growth factor (EGF) grafted on the surface of the MSNs, siRNA can be delivered to the epidermal growth factor receptor (EGFR) overexpressed colorectal cancer cells with high intracellular concentration compared to MSNs without EGF and lead to survivin gene knocking down to less than 30%.

CRISPR/Cas9 mediates efficient conditional mutagenesis in Drosophila.

PubMed

Xue, Zhaoyu; Wu, Menghua; Wen, Kejia; Ren, Menda; Long, Li; Zhang, Xuedi; Gao, Guanjun

2014-09-05

Existing transgenic RNA interference (RNAi) methods greatly facilitate functional genome studies via controlled silencing of targeted mRNA in Drosophila. Although the RNAi approach is extremely powerful, concerns still linger about its low efficiency. Here, we developed a CRISPR/Cas9-mediated conditional mutagenesis system by combining tissue-specific expression of Cas9 driven by the Gal4/upstream activating site system with various ubiquitously expressed guide RNA transgenes to effectively inactivate gene expression in a temporally and spatially controlled manner. Furthermore, by including multiple guide RNAs in a transgenic vector to target a single gene, we achieved a high degree of gene mutagenesis in specific tissues. The CRISPR/Cas9-mediated conditional mutagenesis system provides a simple and effective tool for gene function analysis, and complements the existing RNAi approach. Copyright © 2014 Xue et al.

Molecular imaging of RNA interference therapy targeting PHD2 for treatment of myocardial ischemia.

PubMed

Huang, Mei; Wu, Joseph C

2011-01-01

Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments.

Molecular Imaging of RNA Interference Therapy Targeting PHD2 for Treatment of Myocardial Ischemia

PubMed Central

Huang, Mei; Wu, Joseph C.

2011-01-01

Summary Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments. PMID:21194030

RNA interference inhibits yellow fever virus replication in vitro and in vivo.

PubMed

Pacca, Carolina C; Severino, Adriana A; Mondini, Adriano; Rahal, Paula; D'avila, Solange G P; Cordeiro, José Antonio; Nogueira, Mara Correa Lelles; Bronzoni, Roberta V M; Nogueira, Maurício L

2009-04-01

RNA interference (RNAi) is a process that is induced by double stranded RNA and involves the degradation of specific sequences of mRNA in the cytoplasm of the eukaryotic cells. It has been used as an antiviral tool against many viruses, including flaviviruses. The genus Flavivirus contains the most important arboviruses in the world, i.e., dengue (DENV) and yellow fever (YFV). In our study, we investigated the in vitro and in vivo effect of RNAi against YFV. Using stable cell lines that expressed RNAi against YFV, the cell lines were able to inhibit as much as 97% of the viral replication. Two constructions (one against NS1 and the other against E region of YFV genome) were able to protect the adult Balb/c mice against YFV challenge. The histopathologic analysis demonstrated an important protection of the central nervous system by RNAi after 10 days of viral challenge. Our data suggests that RNAi is a potential viable therapeutic weapon against yellow fever.

Multifunctional Envelope-Type siRNA Delivery Nanoparticle Platform for Prostate Cancer Therapy.

PubMed

Xu, Xiaoding; Wu, Jun; Liu, Yanlan; Saw, Phei Er; Tao, Wei; Yu, Mikyung; Zope, Harshal; Si, Michelle; Victorious, Amanda; Rasmussen, Jonathan; Ayyash, Dana; Farokhzad, Omid C; Shi, Jinjun

2017-03-28

With the capability of specific silencing of target gene expression, RNA interference (RNAi) technology is emerging as a promising therapeutic modality for the treatment of cancer and other diseases. One key challenge for the clinical applications of RNAi is the safe and effective delivery of RNAi agents such as small interfering RNA (siRNA) to a particular nonliver diseased tissue (e.g., tumor) and cell type with sufficient cytosolic transport. In this work, we proposed a multifunctional envelope-type nanoparticle (NP) platform for prostate cancer (PCa)-specific in vivo siRNA delivery. A library of oligoarginine-functionalized and sharp pH-responsive polymers was synthesized and used for self-assembly with siRNA into NPs with the features of long blood circulation and pH-triggered oligoarginine-mediated endosomal membrane penetration. By further modification with ACUPA, a small molecular ligand specifically recognizing prostate-specific membrane antigen (PSMA) receptor, this envelope-type nanoplatform with multifunctional properties can efficiently target PSMA-expressing PCa cells and silence target gene expression. Systemic delivery of the siRNA NPs can efficiently silence the expression of prohibitin 1 (PHB1), which is upregulated in PCa and other cancers, and significantly inhibit PCa tumor growth. These results suggest that this multifunctional envelope-type nanoplatform could become an effective tool for PCa-specific therapy.

Expression of geminiviral AC2 RNA silencing suppressor changes sugar and jasmonate responsive gene expression in transgenic tobacco plants

PubMed Central

2012-01-01

Background RNA-silencing is a conserved gene regulation and surveillance machinery, which in plants, is also used as major defence mechanism against viruses. Various virus-specific dsRNA structures are recognized by the silencing machinery leading to degradation of the viral RNAs or, as in case of begomoviruses, to methylation of their DNA genomes. Viruses produce specific RNA silencing suppressor (RSS) proteins to prevent these host defence mechanisms, and as these interfere with the silencing machinery they also disturb the endogenous silencing reactions. In this paper, we describe how expression of AC2 RSS, derived from African cassava mosaic geminivirus changes transcription profile in tobacco (Nicotiana tabacum) leaves and in flowers. Results Expression of AC2 RSS in transgenic tobacco plants induced clear phenotypic changes both in leaves and in flowers. Transcriptomes of these plants were strongly altered, with total of 1118 and 251 differentially expressed genes in leaves and flowers, respectively. The three most up-regulated transcript groups were related to stress, cell wall modifications and signalling, whereas the three most down-regulated groups were related to translation, photosynthesis and transcription. It appears that many of the gene expression alterations appeared to be related to enhanced biosynthesis of jasmonate and ethylene, and consequent enhancement of the genes and pathways that are regulated by these hormones, or to the retrograde signalling caused by the reduced photosynthetic activity and sugar metabolism. Comparison of these results to a previous transcriptional profiling of HC-Pro RSS-expressing plants revealed that some of same genes were induced by both RSSs, but their expression levels were typically higher in AC2 than in HC-Pro RSS expressing plants. All in all, a large number of transcript alterations were found to be specific to each of the RSS expressing transgenic plants. Conclusions AC2 RSS in transgenic tobacco plants interferes with the silencing machinery. It causes stress and defence reactions for instance via induction of the jasmonate and ethylene biosynthesis, and by consequent gene expression alteration regulated by these hormones. The changed sugar metabolism may cause significant down-regulation of genes encoding ribosomal proteins, thus reducing the general translation level. PMID:23130567

Cytokine stimulation of MUC4 expression in human female reproductive tissue carcinoma cell lines and endometrial cancer.

PubMed

Chapela, Patricia J; Broaddus, Russell R; Hawkins, Shannon M; Lessey, Bruce A; Carson, Daniel D

2015-11-01

MUC4, a transmembrane glycoprotein, interferes with cell adhesion, and promotes EGFR signaling in cancer. Studies in rat models have demonstrated steroid hormonal regulation of endometrial MUC4 expression. In this study, qRT-PCR screening of mouse tissues determined that Muc4 mRNA also was robustly expressed in mouse uteri. Previous studies from our labs have demonstrated MUC4 mRNA was expressed at levels <1% of MUC1 mRNA in human endometrium and endometriotic tissue. Multiple human endometrial adenocarcinoma cell lines were assayed for MUC4 mRNA expression revealing extremely low basal expression in the Ishikawa, RL-95-2, AN3CA, and KLE lines. Moderate to high expression was observed in HEC50 and HEC-1A cells. MUC4 mRNA expression was not affected by progesterone and/or estrogen treatment, but was greatly stimulated at both mRNA and protein levels by proinflammatory cytokines (IFN-γ and TNF-α), particularly when used in combination. In endometrial tissue, MUC4 mRNA levels did not change significantly between normal or cancerous samples; although, a subset of patients with grade 1 and 2 tumors displayed substantially higher expression. Likewise, immunostaining of human endometrial adenocarcinoma tissues revealed little to no staining in many patients (low MUC4), but strong staining in some patients (high MUC4) independent of cancer grade. In cases where staining was observed, it was heterogeneous with some cells displaying robust MUC4 expression and others displaying little or no staining. Collectively, these observations demonstrate that while MUC4 is highly expressed in the mouse uterus, it is not a major mucin in normal human endometrium. Rather, MUC4 is a potential marker of endometrial adenocarcinoma in a subset of patients. © 2015 Wiley Periodicals, Inc.

Ingestion of bacterially expressed double-stranded RNA inhibits gene expression in planarians.

PubMed

Newmark, Phillip A; Reddien, Peter W; Cebrià, Francesc; Sánchez Alvarado, Alejandro

2003-09-30

Freshwater planarian flatworms are capable of regenerating complete organisms from tiny fragments of their bodies; the basis for this regenerative prowess is an experimentally accessible stem cell population that is present in the adult planarian. The study of these organisms, classic experimental models for investigating metazoan regeneration, has been revitalized by the application of modern molecular biological approaches. The identification of thousands of unique planarian ESTs, coupled with large-scale whole-mount in situ hybridization screens, and the ability to inhibit planarian gene expression through double-stranded RNA-mediated genetic interference, provide a wealth of tools for studying the molecular mechanisms that regulate tissue regeneration and stem cell biology in these organisms. Here we show that, as in Caenorhabditis elegans, ingestion of bacterially expressed double-stranded RNA can inhibit gene expression in planarians. This inhibition persists throughout the process of regeneration, allowing phenotypes with disrupted regenerative patterning to be identified. These results pave the way for large-scale screens for genes involved in regenerative processes.

Urokinase receptor expression involves tyrosine phosphorylation of phosphoglycerate kinase.

PubMed

Shetty, Praveenkumar; Velusamy, Thirunavukkarasu; Bhandary, Yashodhar P; Liu, Ming C; Shetty, Sreerama

2010-02-01

The interaction of urokinase-type plasminogen activator (uPA) with its receptor, uPAR, plays a central role in several pathophysiological processes, including cancer. uPA induces its own cell surface receptor expression through stabilization of uPAR mRNA. The mechanism involves binding of a 51 nt uPAR mRNA coding sequence with phosphoglycerate kinase (PGK) to down regulate cell surface uPAR expression. Tyrosine phosphorylation of PGK mediated by uPA treatment enhances uPAR mRNA stabilization. In contrast, inhibition of tyrosine phosphorylation augments PGK binding to uPAR mRNA and attenuates uPA-induced uPAR expression. Mapping the specific peptide region of PGK indicated that its first quarter (amino acids 1-100) interacts with uPAR mRNA. To determine if uPAR expression by uPA is regulated through activation of tyrosine residues of PGK, we mutated the specific tyrosine residue and tested mutant PGK for its ability to interfere with uPAR expression. Inhibition of tyrosine phosphorylation by mutating Y76 residue abolished uPAR expression induced by uPA treatment. These findings collectively demonstrate that Y76 residue present in the first quarter of the PGK molecule is involved in lung epithelial cell surface uPAR expression. This region can effectively mimic the function of a whole PGK molecule in inhibiting tumor cell growth.

The Wnt5A/Protein Kinase C Pathway Mediates Motility in Melanoma Cells via the Inhibition of Metastasis Suppressors and Initiation of an Epithelial to Mesenchymal Transition*S

PubMed Central

Dissanayake, Samudra K.; Wade, Michael; Johnson, Carrie E.; O’Connell, Michael P.; Leotlela, Poloko D.; French, Amanda D.; Shah, Kavita V.; Hewitt, Kyle J.; Rosenthal, Devin T.; Indig, Fred E.; Jiang, Yuan; Nickoloff, Brian J.; Taub, Dennis D.; Trent, Jeffrey M.; Moon, Randall T.; Bittner, Michael; Weeraratna, Ashani T.

2008-01-01

We have shown that Wnt5A increases the motility of melanoma cells. To explore cellular pathways involving Wnt5A, we compared gain-of-function (WNT5A stable transfectants) versus loss-of-function (siRNA knockdown) of WNT5A by microarray analysis. Increasing WNT5A suppressed the expression of several genes, which were re-expressed after small interference RNA-mediated knockdown of WNT5A. Genes affected by WNT5A include KISS-1, a metastasis suppressor, and CD44, involved in tumor cell homing during metastasis. This could be validated at the protein level using both small interference RNA and recombinant Wnt5A (rWnt5A). Among the genes up-regulated by WNT5A was the gene vimentin, associated with an epithelial to mesenchymal transition (EMT), which involves decreases in E-cadherin, due to up-regulation of the transcriptional repressor, Snail. rWnt5A treatment increases Snail and vimentin expression, and decreases E-cadherin, even in the presence of dominant-negativeTCF4, suggesting that this activation is independent of Wnt/β-catenin signaling. Because Wnt5A can signal via protein kinase C (PKC), the role of PKC in Wnt5A-mediated motility and EMT was also assessed using PKC inhibition and activation studies. Treating cells expressing low levels of Wnt5A with phorbol ester increased Snail expression inhibiting PKC in cells expressing high levels of Wnt5A decreased Snail. Furthermore, inhibition of PKC before Wnt5A treatment blocked Snail expression, implying that Wnt5A can potentiate melanoma metastasis via the induction of EMT in a PKC-dependent manner. PMID:17426020

Transduction of hematopoietic stem cells to stimulate RNA interference against feline infectious peritonitis.

PubMed

Anis, Eman A; Dhar, Madhu; Legendre, Alfred M; Wilkes, Rebecca P

2017-06-01

Objectives The goals of the study were: (1) to develop and evaluate non-replicating lentivirus vectors coding for feline coronavirus (FCoV)-specific micro (mi)RNA as a potential antiviral therapy for feline infectious peritonitis (FIP); (2) to assess the feasibility of transducing hematopoietic stem cells (HSCs) with ex vivo introduction of the miRNA-expressing lentivirus vector; and (3) to assess the ability of the expressed miRNA to inhibit FCoV replication in HSCs in vitro. Methods HSCs were obtained from feline bone marrow and replicated in vitro. Three lentiviruses were constructed, each expressing a different anti-FCoV miRNA. HSCs were stably transduced with the miRNA-expressing lentivirus vector that produced the most effective viral inhibition in a feline cell line. The effectiveness of the transduction and the expression of anti-FCoV miRNA were tested by infecting the HSCs with two different strains of FCoV. The inhibition of coronavirus replication was determined by relative quantification of the inhibition of intracellular viral genomic RNA synthesis using real-time, reverse-transcription PCR. The assessment of virus replication inhibition was determined via titration of extracellular virus using the TCID 50 assay. Results Inhibition of FCoV was most significant in feline cells expressing miRNA-L2 that targeted the viral leader sequence, 48 h postinfection. miRNA-L2 expression in stably transduced HSCs resulted in 90% and 92% reductions in FIPV WSU 79-1146 genomic RNA synthesis and extracellular virus production, respectively, as well as 74% and 80% reduction in FECV WSU 79-1683 genomic RNA synthesis and extracellular virus production, respectively, as compared with an infected negative control sample producing non-targeting miRNA. Conclusions and relevance These preliminary results show that genetic modification of HSCs for constitutive production of anti-coronavirus miRNA will reduce FCoV replication.

Expression of the proto-oncogene Pokemon in colorectal cancer--inhibitory effects of an siRNA.

PubMed

Zhao, Gan-Ting; Yang, Li-Juan; Li, Xi-Xia; Cui, Hui-Lin; Guo, Rui

2013-01-01

This study aimed to investigate expression of the proto-oncogene POK erythroid myeloid ontogenic factor (Pokemon) in colorectal cancer (CRC), and assess inhibitory effects of a small interference RNA (siRNA) expression vector in SW480 and SW620 cells. Semi-quantitative reverse transcription-polymerase chain reaction (PCR) and immunohistochemistry were performed to determine mRNA and protein expression levels of Pokemon in CRC tissues. Indirect immunofluorescence staining was applied to investigate the location of Pokemon in SW480 and SW620 cells. The siRNA expression vectors that were constructed to express a short hairpin RNA against Pokemon were transfected to the SW480 and SW620 cells with a liposome. Expression levels of Pokemon mRNA and protein were examined by real-time quantitative-fluorescent PCR and western blot analysis. The effects of Pokemon silencing on proliferation of SW480 and SW620 cells were evaluated with reference to growth curves with MTT assays. The mRNA expression level of Pokemon in tumor tissues (0.845 ± 0.344) was significantly higher than that in adjacent tumor specimens (0.321 ± 0.197). The positive expression ratio of Pokemon protein in CRC (87.0%) was significantly higher than that in the adjacent tissues (19.6%). Strong fluorescence staining of Pokemon protein was observed in the cytoplasm of the SW480 and SW620 cells. The inhibition ratios of Pokemon mRNA and protein in the SW480 cells were 83.1% and 73.5% at 48 and 72 h, respectively, compared with those of the negative control cells with the siRNA. In the SW620 cells, the inhibition ratios of Pokemon mRNA and protein were 76.3% and 68.7% at 48 and 72 h, respectively. MTT showed that Pokemon gene silencing inhibited the proliferation of SW480 and SW620 cells. Overexpression of Pokemon in CRC may have a function in carcinogenesis and progression. siRNA expression vectors could effectively inhibit mRNA and protein expression of Pokemon in SW480 and SW620 cells, thereby reducing malignant cell proliferation.

Immunity to Rice black streaked dwarf virus, a plant reovirus, can be achieved in rice plants by RNA silencing against the gene for the viroplasm component protein.

PubMed

Shimizu, Takumi; Nakazono-Nagaoka, Eiko; Akita, Fusamichi; Uehara-Ichiki, Tamaki; Omura, Toshihiro; Sasaya, Takahide

2011-09-01

The nonstructural protein P9-1 of Rice black streaked dwarf virus has been confirmed to accumulate in viroplasms, the putative sites of viral replication, in infected plants and insects. We transformed rice plants by introducing an RNA interference construct against the P9-1-encoding gene. The resultant transgenic plants accumulated short interfering RNAs specific to the construct. All progenies produced by self-fertilization of these transgenic plants with induced RNA interference against the gene for P9-1 were resistant to infection by the virus. Our results demonstrated that interfering with the expression of a viroplasm component protein of plant reoviruses, which plays an important role in viral proliferation, might be a practical and effective way to control plant reovirus infection in crop plants. Copyright © 2011 Elsevier B.V. All rights reserved.

[Expression of Chemokine receptor CXCR6 and its significance in breast cancer cell lines].

PubMed

Cheng, Hao; Chen, Nian-yong

2014-05-01

To detect the expression of Chemokine receptor CXCR6 in invasive breast cancer cell lines and normal mammary epithelial cell line, and assess the relationship between CXCR6 expression and malignant behavior of breast cancer cells. Expression level of CXCR6 in different invasive breast cancer cell lines (SK-BR-3, MCF-7, MDA-MB-231) and normal mammary epithelial cell line (MCF-10A)was detected by real time reverse transcription-polymerase chain reaction (real time-PCR) and Western blot. Lentivirus was employed to interfere CXCR6 expression in MDA-MB-231. MTT assay and transwell chamber were used to study proliferative and invasive ability of those cells respectively. Vascular enothelial growth factor (VEGF) expression was detected to study the role of CXCR6 in angiogenesis. At both mRNA level and protein level, normal mammary epithelial cell line MCF-10A showed the weakest CXCR6 expression. The breast cancer cell lines expressed CXCR6 in different levels, the expression level of CXCR6 in highly invasive cell line MDA-MB-231 was significantly higher than that in two low-invasive cell lines SK-BR-3 and MCF-7 (P < 0.05). Silencing CXCR6 gene by Lentivirus-mediated RNA interference in MDA-MB-231 inhibited its proliferation ability, invasion ability and angiogenesis ability in vitro (P < 0.05). Different invasive breast cancer cell lines express CXCR6 at different levels, positively correlated with its invasive ability.

RNA Interference of the Muscle Actin Gene in Bed Bugs: Exploring Injection Versus Topical Application for dsRNA Delivery.

PubMed

Basnet, Sanjay; Kamble, Shripat T

2018-05-01

Bed bugs are one the most troublesome household pests that feed primarily on human blood. RNA interference (RNAi) is currently being pursued as a potential tool for insect population management and has shown efficacy against some phytophagous insects. We evaluated the different techniques to deliver dsRNA specific to bed bug muscle actin (dsactin) into bed bugs. Initially, stability of dsRNA in human blood was studied to evaluate the feasibility of feeding method. Adult bed bugs were injected with dsRNA between last thoracic segment and first abdominal segment on the ventral side, with a dose of 0.2 µg dsactin per insect. In addition to injection, dsactin was mixed in acetone and treated topically in the abdomens of fifth stage nymphs. We found the quick degradation of dsRNA in blood. Injection of dsactin caused significant depletion of actin transcripts and substantial reduction in oviposition and lethality in female adults. Topically treated dsRNA in fifth stage nymphs had no effect on actin mRNA expression and survival. Our results demonstrated that injection is a reliable method of dsRNA delivery into bed bugs while topical treatment was not successful. This research provides an understanding on effective delivery methods of dsRNA into bed bugs for functional genomics research and feasibility of the RNAi based molecules for pest management purposes.

IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells.

PubMed

Fiume, Giuseppe; Scialdone, Annarita; Rizzo, Francesca; De Filippo, Maria Rosaria; Laudanna, Carmelo; Albano, Francesco; Golino, Gaetanina; Vecchio, Eleonora; Pontoriero, Marilena; Mimmi, Selena; Ceglia, Simona; Pisano, Antonio; Iaccino, Enrico; Palmieri, Camillo; Paduano, Sergio; Viglietto, Giuseppe; Weisz, Alessandro; Scala, Giuseppe; Quinto, Ileana

2016-11-07

The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03%) of 63,128 mapped transcripts were differentially expressed in IBTK -shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7%) and 698 downregulated (54.3%) RNAs. In K562 cells, 1959 (3.1%) of 63128 mapped RNAs were differentially expressed in IBTK -shRNA-transduced cells, including 1053 upregulated (53.7%) and 906 downregulated (46.3%). Only 137 transcripts (0.22%) were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3'- and 5'-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein.

IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells

PubMed Central

Fiume, Giuseppe; Scialdone, Annarita; Rizzo, Francesca; De Filippo, Maria Rosaria; Laudanna, Carmelo; Albano, Francesco; Golino, Gaetanina; Vecchio, Eleonora; Pontoriero, Marilena; Mimmi, Selena; Ceglia, Simona; Pisano, Antonio; Iaccino, Enrico; Palmieri, Camillo; Paduano, Sergio; Viglietto, Giuseppe; Weisz, Alessandro; Scala, Giuseppe; Quinto, Ileana

2016-01-01

The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03%) of 63,128 mapped transcripts were differentially expressed in IBTK-shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7%) and 698 downregulated (54.3%) RNAs. In K562 cells, 1959 (3.1%) of 63128 mapped RNAs were differentially expressed in IBTK-shRNA-transduced cells, including 1053 upregulated (53.7%) and 906 downregulated (46.3%). Only 137 transcripts (0.22%) were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3′- and 5′-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein. PMID:27827994

HIV-1 RNAs are Not Part of the Argonaute 2 Associated RNA Interference Pathway in Macrophages.

PubMed

Vongrad, Valentina; Imig, Jochen; Mohammadi, Pejman; Kishore, Shivendra; Jaskiewicz, Lukasz; Hall, Jonathan; Günthard, Huldrych F; Beerenwinkel, Niko; Metzner, Karin J

2015-01-01

MiRNAs and other small noncoding RNAs (sncRNAs) are key players in post-transcriptional gene regulation. HIV-1 derived small noncoding RNAs (sncRNAs) have been described in HIV-1 infected cells, but their biological functions still remain to be elucidated. Here, we approached the question whether viral sncRNAs may play a role in the RNA interference (RNAi) pathway or whether viral mRNAs are targeted by cellular miRNAs in human monocyte derived macrophages (MDM). The incorporation of viral sncRNAs and/or their target RNAs into RNA-induced silencing complex was investigated using photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) as well as high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation (HITS-CLIP), which capture Argonaute2-bound miRNAs and their target RNAs. HIV-1 infected monocyte-derived macrophages (MDM) were chosen as target cells, as they have previously been shown to express HIV-1 sncRNAs. In addition, we applied small RNA deep sequencing to study differential cellular miRNA expression in HIV-1 infected versus non-infected MDMs. PAR-CLIP and HITS-CLIP data demonstrated the absence of HIV-1 RNAs in Ago2-RISC, although the presence of a multitude of HIV-1 sncRNAs in HIV-1 infected MDMs was confirmed by small RNA sequencing. Small RNA sequencing revealed that 1.4% of all sncRNAs were of HIV-1 origin. However, neither HIV-1 derived sncRNAs nor putative HIV-1 target sequences incorporated into Ago2-RISC were identified suggesting that HIV-1 sncRNAs are not involved in the canonical RNAi pathway nor is HIV-1 targeted by this pathway in HIV-1 infected macrophages.

Illuminating the gateway of gene silencing: perspective of RNA interference technology in clinical therapeutics.

PubMed

Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok

2012-07-01

A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.

Novel AgoshRNA molecules for silencing of the CCR5 co-receptor for HIV-1 infection

PubMed Central

Herrera-Carrillo, Elena

2017-01-01

Allogeneic transplantation of blood stem cells from a CCR5-Δ32 homozygous donor to an HIV-infected individual, the “Berlin patient”, led to a cure. Since then there has been a search for approaches that mimic this intervention in a gene therapy setting. RNA interference (RNAi) has evolved as a powerful tool to regulate gene expression in a sequence-specific manner and can be used to inactivate the CCR5 mRNA. Short hairpin RNA (shRNA) molecules can impair CCR5 expression, but these molecules may cause unintended side effects and they will not be processed in cells that lack Dicer, such as monocytes. Dicer-independent RNAi pathways have opened opportunities for new AgoshRNA designs that rely exclusively on Ago2 for maturation. Furthermore, AgoshRNA processing yields a single active guide RNA, thus reducing off-target effects. In this study, we tested different AgoshRNA designs against CCR5. We selected AgoshRNAs that potently downregulated CCR5 expression on human T cells and peripheral blood mononuclear cells (PBMC) and that had no apparent adverse effect on T cell development as assessed in a competitive cell growth assay. CCR5 knockdown significantly protected T cells from CCR5 tropic HIV-1 infection. PMID:28542329

From The Cover: Genome-wide RNA interference screen identifies previously undescribed regulators of polyglutamine aggregation

NASA Astrophysics Data System (ADS)

Nollen, Ellen A. A.; Garcia, Susana M.; van Haaften, Gijs; Kim, Soojin; Chavez, Alejandro; Morimoto, Richard I.; Plasterk, Ronald H. A.

2004-04-01

Protein misfolding and the formation of aggregates are increasingly recognized components of the pathology of human genetic disease and hallmarks of many neurodegenerative disorders. As exemplified by polyglutamine diseases, the propensity for protein misfolding is associated with the length of polyglutamine expansions and age-dependent changes in protein-folding homeostasis, suggesting a critical role for a protein homeostatic buffer. To identify the complement of protein factors that protects cells against the formation of protein aggregates, we tested transgenic Caenorhabditis elegans strains expressing polyglutamine expansion yellow fluorescent protein fusion proteins at the threshold length associated with the age-dependent appearance of protein aggregation. We used genome-wide RNA interference to identify genes that, when suppressed, resulted in the premature appearance of protein aggregates. Our screen identified 186 genes corresponding to five principal classes of polyglutamine regulators: genes involved in RNA metabolism, protein synthesis, protein folding, and protein degradation; and those involved in protein trafficking. We propose that each of these classes represents a molecular machine collectively comprising the protein homeostatic buffer that responds to the expression of damaged proteins to prevent their misfolding and aggregation. protein misfolding | neurodegenerative diseases

RNA interference-mediated silencing of genes involved in the immune responses of the soybean pod borer Leguminivora glycinivorella (Lepidoptera: Olethreutidae).

PubMed

Ran, Ruixue; Li, Tianyu; Liu, Xinxin; Ni, Hejia; Li, Wenbin; Meng, Fanli

2018-01-01

RNA interference (RNAi) technology may be useful for developing new crop protection strategies against the soybean pod borer (SPB; Leguminivora glycinivorella ), which is a critical soybean pest in northeastern Asia. Immune-related genes have been recently identified as potential RNAi targets for controlling insects. However, little is known about these genes or mechanisms underlying their expression in the SPB. In this study, we completed a transcriptome-wide analysis of SPB immune-related genes. We identified 41 genes associated with SPB microbial recognition proteins, immune-related effectors or signalling molecules in immune response pathways (e.g., Toll and immune deficiency pathways). Eleven of these genes were selected for a double-stranded RNA artificial feeding assay. The down-regulated expression levels of LgToll-5-1a and LgPGRP-LB2a resulted in relatively high larval mortality rates and abnormal development. Our data represent a comprehensive genetic resource for immune-related SPB genes, and may contribute to the elucidation of the mechanism regulating innate immunity in Lepidoptera species. Furthermore, two immune-related SPB genes were identified as potential RNAi targets, which may be used in the development of RNAi-mediated SPB control methods.

RNA interference-mediated silencing of genes involved in the immune responses of the soybean pod borer Leguminivora glycinivorella (Lepidoptera: Olethreutidae)

PubMed Central

Ran, Ruixue; Li, Tianyu; Liu, Xinxin; Ni, Hejia; Li, Wenbin

2018-01-01

RNA interference (RNAi) technology may be useful for developing new crop protection strategies against the soybean pod borer (SPB; Leguminivora glycinivorella), which is a critical soybean pest in northeastern Asia. Immune-related genes have been recently identified as potential RNAi targets for controlling insects. However, little is known about these genes or mechanisms underlying their expression in the SPB. In this study, we completed a transcriptome-wide analysis of SPB immune-related genes. We identified 41 genes associated with SPB microbial recognition proteins, immune-related effectors or signalling molecules in immune response pathways (e.g., Toll and immune deficiency pathways). Eleven of these genes were selected for a double-stranded RNA artificial feeding assay. The down-regulated expression levels of LgToll-5-1a and LgPGRP-LB2a resulted in relatively high larval mortality rates and abnormal development. Our data represent a comprehensive genetic resource for immune-related SPB genes, and may contribute to the elucidation of the mechanism regulating innate immunity in Lepidoptera species. Furthermore, two immune-related SPB genes were identified as potential RNAi targets, which may be used in the development of RNAi-mediated SPB control methods. PMID:29910977

A 3’UTR polymorphism marks differential KLRG1 mRNA levels through disruption of a miR-584-5p binding site and associates with pemphigus foliaceus susceptibility

PubMed Central

Cipolla, Gabriel A.; Park, Jong K.; de Oliveira, Liana A.; Lobo-Alves, Sara Cristina; de Almeida, Rodrigo C.; Farias, Ticiana D. J.; Lemos, Débora de S.; Malheiros, Danielle; Lavker, Robert M.; Petzl-Erler, Maria Luiza

2016-01-01

Genetic variations mapping to 3’ untranslated regions (3’UTRs) may overlap with microRNA (miRNA) binding sites, therefore potentially interfering with translation inhibition or messenger RNA (mRNA) degradation. The aim of this study was to investigate whether single nucleotide polymorphisms (SNPs) located within the 3’UTRs of six candidate genes and predicted to interfere with miRNA ligation could account for disease-relevant differential mRNA levels. Focusing on pemphigus foliaceus (PF) – an autoimmune blistering skin condition with unique endemic patterns – we investigated if nine 3’UTR SNPs from the CD1D, CTLA4, KLRD1, KLRG1, NKG7, and TNFSF13B genes differentially expressed in PF were disease-associated. The heterozygous genotype of the KLRG1 rs1805672 polymorphism was associated with increased predisposition to PF (A/G vs. A/A: P=0.038; OR=1.60), and a trend for augmented susceptibility was observed for carriers of the G allele (P=0.094; OR=1.44). In silico analyses suggested that rs1805672 G allele could disrupt binding of miR-584-5p, and indicated rs1805672 as an expression Quantitative Trait Locus (eQTL), with an effect on KLRG1 gene expression. Dual-luciferase assay showed that miR-584-5p mediated approximately 50% downregulation of the reporter gene’s activity through the 3’UTR of KLRG1 harboring rs1805672 A allele (vs. miRNA-negative condition, P=0.006). This silencing relationship was lost after site-directed mutation to G allele (vs. miRNA-negative condition, P=0.391; vs. rs1805672 A allele, P=0.005). Collectively, these results suggest that a disease-associated SNP located within the 3’UTR of KLRG1 directly interferes with miR-584-5p binding, allowing for KLRG1 mRNA differential accumulation, which in turn may contribute to pathogenesis of autoimmune diseases, such as pemphigus. PMID:27424220

A 3'UTR polymorphism marks differential KLRG1 mRNA levels through disruption of a miR-584-5p binding site and associates with pemphigus foliaceus susceptibility.

PubMed

Cipolla, Gabriel A; Park, Jong Kook; de Oliveira, Liana A; Lobo-Alves, Sara Cristina; de Almeida, Rodrigo C; Farias, Ticiana D J; Lemos, Débora de S; Malheiros, Danielle; Lavker, Robert M; Petzl-Erler, Maria Luiza

2016-10-01

Genetic variations mapping to 3' untranslated regions (3'UTRs) may overlap with microRNA (miRNA) binding sites, therefore potentially interfering with translation inhibition or messenger RNA (mRNA) degradation. The aim of this study was to investigate whether single nucleotide polymorphisms (SNPs) located within the 3'UTRs of six candidate genes and predicted to interfere with miRNA ligation could account for disease-relevant differential mRNA levels. Focusing on pemphigus foliaceus (PF) - an autoimmune blistering skin condition with unique endemic patterns - we investigated whether nine 3'UTR SNPs from the CD1D, CTLA4, KLRD1, KLRG1, NKG7, and TNFSF13B genes differentially expressed in PF were disease-associated. The heterozygous genotype of the KLRG1 rs1805672 polymorphism was associated with increased predisposition to PF (A/G vs. A/A: P=0.038; OR=1.60), and a trend for augmented susceptibility was observed for carriers of the G allele (P=0.094; OR=1.44). In silico analyses suggested that rs1805672 G allele could disrupt binding of miR-584-5p, and indicated rs1805672 as an expression Quantitative Trait Locus (eQTL), with an effect on KLRG1 gene expression. Dual-luciferase assay showed that miR-584-5p mediated approximately 50% downregulation of the reporter gene's activity through the 3'UTR of KLRG1 harboring rs1805672 A allele (vs. miRNA-negative condition, P=0.006). This silencing relationship was lost after site-directed mutation to G allele (vs. miRNA-negative condition, P=0.391; vs. rs1805672 A allele, P=0.005). Collectively, these results suggest that a disease-associated SNP located within the 3'UTR of KLRG1 directly interferes with miR-584-5p binding, allowing for KLRG1 mRNA differential accumulation, which in turn may contribute to pathogenesis of autoimmune diseases, such as pemphigus. Copyright © 2016 Elsevier B.V. All rights reserved.

Influenza A Virus Infection of Human Respiratory Cells Induces Primary MicroRNA Expression*

PubMed Central

Buggele, William A.; Johnson, Karen E.; Horvath, Curt M.

2012-01-01

The cellular response to virus infection is initiated by recognition of the invading pathogen and subsequent changes in gene expression mediated by both transcriptional and translational mechanisms. In addition to well established means of regulating antiviral gene expression, it has been demonstrated that RNA interference (RNAi) can play an important role in antiviral responses. Virus-derived small interfering RNA (siRNA) is a primary antiviral response exploited by plants and invertebrate animals, and host-encoded microRNA (miRNA) species have been clearly implicated in the regulation of innate and adaptive immune responses in mammals and other vertebrates. Examination of miRNA abundance in human lung cell lines revealed endogenous miRNAs, including miR-7, miR-132, miR-146a, miR-187, miR-200c, and miR-1275, to specifically accumulate in response to infection with two influenza A virus strains, A/Udorn/72 and A/WSN/33. Known antiviral response pathways, including Toll-like receptor, RIG-I-like receptor, and direct interferon or cytokine stimulation did not alter the abundance of the tested miRNAs to the extent of influenza A virus infection, which initiates primary miRNA transcription via a secondary response pathway. Gene expression profiling identified 26 cellular mRNAs targeted by these miRNAs, including IRAK1, MAPK3, and other components of innate immune signaling systems. PMID:22822053

Knockdown of OY-TES-1 by RNAi causes cell cycle arrest and migration decrease in bone marrow-derived mesenchymal stem cells.

PubMed

Cen, Yan-Hui; Guo, Wen-Wen; Luo, Bin; Lin, Yong-Da; Zhang, Qing-Mei; Zhou, Su-Fang; Luo, Guo-Rong; Xiao, Shao-Wen; Xie, Xiao-Xun

2012-10-01

OY-TES-1 is a member of the CTA (cancer-testis antigen) group expressed in a variety of cancer and restrictedly expressed in adult normal tissues, except for testis. To determine whether MSCs (mesenchymal stem cells) express OY-TES-1 and its possible roles on MSCs, OY-TES-1 expression in MSCs isolated from human bone marrow was tested with RT (reverse transcription)-PCR, immunocytochemistry and Western blot. Using RNAi (RNA interference) technology, OY-TES-1 expression was knocked down followed by analysing cell viability, cell cycle, apoptosis and migration ability. MSCs expressed OY-TES-1 at both mRNA and protein levels. The down-regulation of OY-TES-1 expression in these MSCs caused cell growth inhibition, cell cycle arrest, apoptosis induction and migration ability attenuation. Through these primary results it was suggested that OY-TES-1 may influence the biological behaviour of MSCs.

Saliva of TBP digests double stranded RNAs

USDA-ARS?s Scientific Manuscript database

The tarnished plant bug (TPB), Lygus lineolaris, is a generalist pest of many crops including cotton, strawberries, and alfalfa. While studying gene expression and gene knockdown through RNA interference, my lab was frustrated by an observation. We were unable to replicate knock down effects observe...

Inhibition of DNA methyltransferase 1 by RNA interference reverses epithelial-mesenchymal transition in highly metastatic 95D lung cancer cells by inhibiting the Wnt signaling pathway.

PubMed

Bu, Xiancong; Zhang, Xiangyan; Xu, Jinhong; Yang, Heping; Zhou, Xiangdong; Wang, Haijing; Gong, Liang

2018-06-01

Epigenetic modifications serve important roles in non-small cell lung cancer (NSCLC) tumorigenesis; however, the role of DNA methyltransferase 1 (DNMT1) in lung cancer progression remains unclear. In the present study, the expression of DNMT1 in the human NSCLC cell lines 95D (high invasive ability) and 95C (low invasive ability) was analyzed by western blotting. The results demonstrated that the expression of DNMT1 in 95D cells was significantly higher, compared with in 95C cells and small airway epithelial cells. To further define the role of DNMT1 in tumor migration and invasion in NSCLC cells, RNA interference was used to silence DNMT1 expression. Depletion of DNMT1 significantly inhibited 95D cell invasion and migration. In addition, treatment with DNMT1 small interfering RNA resulted in compact cell morphology and significantly increased epithelial marker E-cadherin expression whilst also decreasing the expression of certain mesenchymal markers, including vimentin and fibronectin. Suppression of DNMT1 increased cytoplasmic β-catenin levels while downregulating nuclear β-catenin and Snail, an important regulator of EMT. The results from the present study suggest that the inhibition of DNMT1 reverses the epithelial-mesenchymal transition partly via the inhibition of the Wnt/β-catenin signaling pathway, and therefore inhibits cell migration and invasion. These results indicate that targeting DNMT1 may inhibit tumor metastasis and that DNMT1 is a promising target for the novel treatment of lung cancer.

AAV delivery of tumor necrosis factor-α short hairpin RNA attenuates cold-induced pulmonary hypertension and pulmonary arterial remodeling.

PubMed

Crosswhite, Patrick; Chen, Kai; Sun, Zhongjie

2014-11-01

Cold temperatures are associated with increased mortality and morbidity of cardiovascular and pulmonary disease. Cold exposure causes lung inflammation, pulmonary hypertension (PH), and right ventricle hypertrophy, but there is no effective therapy because of unknown mechanism. Here, we investigated whether RNA interference silencing of tumor necrosis factor (TNF)-α decreases cold-induced macrophage infiltration, PH, and pulmonary arterial (PA) remodeling. We found for the first time that continuous cold exposure (5.0°C) increased TNF-α expression and macrophage infiltration in the lungs and PAs right before elevation of right ventricle systolic pressure. The in vivo RNA interference silencing of TNF-α was achieved by intravenous delivery of recombinant AAV-2 carrying TNF-α short hairpin small-interfering RNA 24 hours before cold exposure. Cold exposure for 8 weeks significantly increased right ventricle pressure compared with the warm controls (40.19±4.9 versus 22.9±1.1 mm Hg), indicating that cold exposure caused PH. Cold exposure increased TNF-α, interleukin-6, and phosphodiesterase-1C protein expression in the lungs and PAs and increased lung macrophage infiltration. Notably, TNF-α short hairpin small-interfering RNA prevented the cold-induced increases in TNF-α, interleukin-6, and phosphodiesterase-1C protein expression, abolished lung macrophage infiltration, and attenuated PH (26.28±1.6 mm Hg), PA remodeling, and right ventricle hypertrophy. PA smooth muscle cells isolated from cold-exposed animals showed increased intracellular superoxide levels and cell proliferation along with decreased intracellular cGMP. These cold-induced changes were prevented by TNF-α short hairpin small-interfering RNA. In conclusions, upregulation of TNF-α played a critical role in the pathogenesis of cold-induced PH by promoting pulmonary macrophage infiltration and inflammation. AAV delivery of TNF-α short hairpin small-interfering RNA may be an effective therapeutic approach for cold-induced PH and PA remodeling. © 2014 American Heart Association, Inc.

Skin tumor formation in human papillomavirus 8 transgenic mice is associated with a deregulation of oncogenic miRNAs and their tumor suppressive targets.

PubMed

Hufbauer, Martin; Lazić, Daliborka; Reinartz, Markus; Akgül, Baki; Pfister, Herbert; Weissenborn, Sönke Jan

2011-10-01

Dysregulation of microRNA (miRNA) expression is regularly found in various types of cancer and contributes to tumorigenic processes. However, little is known about miRNA expression in non-melanoma skin cancer in which a pathogenic role of beta human papillomaviruses (HPV) is discussed. A carcinogenic potential of beta HPV8 could be demonstrated in a transgenic mouse model, expressing all early genes of HPV8 (HPV8-CER). A single UVA/B-dose induced oncogene expression and led to papilloma growth within three weeks. Expression of miRNAs and their targets during HPV8-mediated tumor formation in mice. Skin of untreated or UV-irradiated wild-type and HPV8-CER mice was analyzed for miRNA expression and localization by qPCR and in situ hybridization. MiRNA target protein expression was analyzed by immunohistochemical staining. Early steps in skin tumor formation in HPV8-CER mice were associated with an upregulation of the oncogenic miRNA-17-5p, -21 and -106a and a downregulation of the tumor-suppressive miRNA-155 and -206, which could be demonstrated by qPCR and in situ hybridization. The respective targets of miRNA-21 and -106a, the tumor suppressors PTEN, PDCD4 and Rb with their pivotal role in cell cycle regulation, apoptosis and proliferation were found to be downregulated. This is the first report demonstrating that a cutaneous HPV type deregulates the expression of miRNAs. These deregulations are closely related to the UV-induced upregulation of HPV8 oncogene levels, which suggest a direct or indirect HPV8-specific effect on miRNA expression. These data presume that HPV8 interferes with the miRNA mediated gene regulation to induce tumorigenesis. Copyright © 2011 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

Vector design for liver specific expression of multiple interfering RNAs that target hepatitis B virus transcripts

PubMed Central

Snyder, Lindsey L.; Esser, Jonathan M.; Pachuk, Catherine J.; Steel, Laura F.

2008-01-01

RNA interference (RNAi) is a process that can target intracellular RNAs for degradation in a highly sequence specific manner, making it a powerful tool that is being pursued in both research and therapeutic applications. Hepatitis B virus (HBV) is a serious public health problem in need of better treatment options, and aspects of its life cycle make it an excellent target for RNAi-based therapeutics. We have designed a vector that expresses interfering RNAs that target HBV transcripts, including both viral RNA replicative intermediates and mRNAs encoding viral proteins. Our vector design incorporates many features of endogenous microRNA (miRNA) gene organization that are proving useful for the development of reagents for RNAi. In particular, our vector contains an RNA pol II driven gene cassette that leads to tissue specific expression and efficient processing of multiple interfering RNAs from a single transcript, without the co-expression of any protein product. This vector shows potent silencing of HBV targets in cell culture models of HBV infection. The vector design will be applicable to silencing of additional cellular or disease-related genes. PMID:18499277

Persistent interferon transgene expression by RNA interference-mediated silencing of interferon receptors.

PubMed

Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu

2010-09-01

The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.

Double-Stranded RNA-Binding Protein Regulates Vascular Endothelial Growth Factor mRNA Stability, Translation, and Breast Cancer Angiogenesis▿

PubMed Central

Vumbaca, Frank; Phoenix, Kathryn N.; Rodriguez-Pinto, Daniel; Han, David K.; Claffey, Kevin P.

2008-01-01

Vascular endothelial growth factor (VEGF) is a key angiogenic factor expressed under restricted nutrient and oxygen conditions in most solid tumors. The expression of VEGF under hypoxic conditions requires transcription through activated hypoxia-inducible factor 1 (HIF-1), increased mRNA stability, and facilitated translation. This study identified double-stranded RNA-binding protein 76/NF90 (DRBP76/NF90), a specific isoform of the DRBP family, as a VEGF mRNA-binding protein which plays a key role in VEGF mRNA stability and protein synthesis under hypoxia. The DRBP76/NF90 protein binds to a human VEGF 3′ untranslated mRNA stability element. RNA interference targeting the DRBP76/NF90 isoform limited hypoxia-inducible VEGF mRNA and protein expression with no change in HIF-1-dependent transcriptional activity. Stable repression of DRBP76/NF90 in MDA-MB-435 breast cancer cells demonstrated reduced polysome-associated VEGF mRNA levels under hypoxic conditions and reduced mRNA stability. Transient overexpression of the DRBP76/NF90 protein increased both VEGF mRNA and protein levels synthesized under normoxic and hypoxic conditions. Cells with stable repression of the DRBP76/NF90 isoform showed reduced tumorigenic and angiogenic potential in an orthotopic breast tumor model. These data demonstrate that the DRBP76/NF90 isoform facilitates VEGF expression by promoting VEGF mRNA loading onto polysomes and translation under hypoxic conditions, thus promoting breast cancer growth and angiogenesis in vivo. PMID:18039850

The brain-specific double-stranded RNA-binding protein Staufen2 is required for dendritic spine morphogenesis.

PubMed

Goetze, Bernhard; Tuebing, Fabian; Xie, Yunli; Dorostkar, Mario M; Thomas, Sabine; Pehl, Ulrich; Boehm, Stefan; Macchi, Paolo; Kiebler, Michael A

2006-01-16

Mammalian Staufen2 (Stau2) is a member of the double-stranded RNA-binding protein family. Its expression is largely restricted to the brain. It is thought to play a role in the delivery of RNA to dendrites of polarized neurons. To investigate the function of Stau2 in mature neurons, we interfered with Stau2 expression by RNA interference (RNAi). Mature neurons lacking Stau2 displayed a significant reduction in the number of dendritic spines and an increase in filopodia-like structures. The number of PSD95-positive synapses and miniature excitatory postsynaptic currents were markedly reduced in Stau2 down-regulated neurons. Akin effects were caused by overexpression of dominant-negative Stau2. The observed phenotype could be rescued by overexpression of two RNAi cleavage-resistant Stau2 isoforms. In situ hybridization revealed reduced expression levels of beta-actin mRNA and fewer dendritic beta-actin mRNPs in Stau2 down-regulated neurons. Thus, our data suggest an important role for Stau2 in the formation and maintenance of dendritic spines of hippocampal neurons.

The brain-specific double-stranded RNA-binding protein Staufen2 is required for dendritic spine morphogenesis

PubMed Central

Goetze, Bernhard; Tuebing, Fabian; Xie, Yunli; Dorostkar, Mario M.; Thomas, Sabine; Pehl, Ulrich; Boehm, Stefan; Macchi, Paolo; Kiebler, Michael A.

2006-01-01

Mammalian Staufen2 (Stau2) is a member of the double-stranded RNA-binding protein family. Its expression is largely restricted to the brain. It is thought to play a role in the delivery of RNA to dendrites of polarized neurons. To investigate the function of Stau2 in mature neurons, we interfered with Stau2 expression by RNA interference (RNAi). Mature neurons lacking Stau2 displayed a significant reduction in the number of dendritic spines and an increase in filopodia-like structures. The number of PSD95-positive synapses and miniature excitatory postsynaptic currents were markedly reduced in Stau2 down-regulated neurons. Akin effects were caused by overexpression of dominant-negative Stau2. The observed phenotype could be rescued by overexpression of two RNAi cleavage-resistant Stau2 isoforms. In situ hybridization revealed reduced expression levels of β-actin mRNA and fewer dendritic β-actin mRNPs in Stau2 down-regulated neurons. Thus, our data suggest an important role for Stau2 in the formation and maintenance of dendritic spines of hippocampal neurons. PMID:16418534

RNAi Functions in Adaptive Reprogramming of the Genome | Center for Cancer Research

Cancer.gov

The regulation of transcribing DNA into RNA, including the production, processing, and degradation of RNA transcripts, affects the expression and the regulation of the genome in ways that are just beginning to be unraveled. A surprising discovery in recent years is that the vast majority of the genome is transcribed to yield an abundance of RNA transcripts. Many transcripts are regulated by the exosome, a multi-protein complex that degrades RNAs, and may also be targeted, under certain conditions, by the RNA interference (RNAi) pathway. These RNA degrading activities can recruit factors to silence certain regions of the genome by condensing the DNA into tightly-packed heterochromatin. For some chromosomal regions, such as centromeres and telomeres, which lie at the center and ends of chromosomes, respectively, silencing must be stably enforced through each cell generation. For other regions, silencing mechanisms must be easily reversible to activate gene expression in response to changing environmental or developmental conditions. Thus, the regulation of gene silencing is key to maintaining the integrity of the genome and proper cellular expression patterns, which, when disrupted can underlie many diseases, including cancer.

Proteomics for understanding miRNA biology.

PubMed

Huang, Tai-Chung; Pinto, Sneha M; Pandey, Akhilesh

2013-02-01

MicroRNAs (miRNAs) are small noncoding RNAs that play important roles in posttranscriptional regulation of gene expression. Mature miRNAs associate with the RNA interference silencing complex to repress mRNA translation and/or degrade mRNA transcripts. Mass spectrometry-based proteomics has enabled identification of several core components of the canonical miRNA processing pathway and their posttranslational modifications which are pivotal in miRNA regulatory mechanisms. The use of quantitative proteomic strategies has also emerged as a key technique for experimental identification of miRNA targets by allowing direct determination of proteins whose levels are altered because of translational suppression. This review focuses on the role of proteomics and labeling strategies to understand miRNA biology. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Discovery of Prostate Cancer Tumor Suppressors and Mediators of MDV3100 Resistance Through in Vivo RNA Interference Screen

DTIC Science & Technology

2015-11-01

concept of increase of NSE and decrease of PSMA with NED. Right, the quadrants of a hypothetical FACS-plot after Enzalutamide treatment from which...antigen ( PSMA ) expression. Thus, we also decided to sort for cells that have decreased PSMA expression with prolonged Enzalutamide treatment. Using the...cells, till there was almost plateauing of the GFP signals, Figure 6. PSMA expression FACS%based+screen+strategy+ AR#independent# AR

Human Papilloma Virus-Dependent HMGA1 Expression Is a Relevant Step in Cervical Carcinogenesis1

PubMed Central

Mellone, Massimiliano; Rinaldi, Christian; Massimi, Isabella; Petroni, Marialaura; Veschi, Veronica; Talora, Claudio; Truffa, Silvia; Stabile, Helena; Frati, Luigi; Screpanti, Isabella; Gulino, Alberto; Giannini, Giuseppe

2008-01-01

HMGA1 is a member of a small family of architectural transcription factors involved in the coordinate assembly of multiprotein complexes referred to as enhanceosomes. In addition to their role in cell proliferation, differentiation, and development, high-mobility group proteins of the A type (HMGA) family members behave as transforming protoncogenes either in vitro or in animal models. Recent reports indicated that HMGA1 might counteract p53 pathway and provided an interesting hint on the mechanisms determining HMGA's transforming potential. HMGA1 expression is deregulated in a very large array of human tumors, including cervical cancer, but very limited information is available on the molecular mechanisms leading to HMGA1 deregulation in cancer cells. Here, we report that HMGA1 expression is sustained by human papilloma virus (HPV) E6/E7 proteins in cervical cancer, as demonstrated by either E6/E7 overexpression or by repression through RNA interference. Knocking down HMGA1 expression by means of RNA interference, we also showed that it is involved in cell proliferation and contributes to p53 inactivation in this type of neoplasia. Finally, we show that HMGA1 is necessary for the full expression of HPV18 E6 and E7 oncoproteins thus establishing a positive autoregulatory loop between HPV E6/E7 and HMGA1 expression. PMID:18670638

Convergent transcription in the butyrolactone regulon in Streptomyces coelicolor confers a bistable genetic switch for antibiotic biosynthesis.

PubMed

Chatterjee, Anushree; Drews, Laurie; Mehra, Sarika; Takano, Eriko; Kaznessis, Yiannis N; Hu, Wei-Shou

2011-01-01

cis-encoded antisense RNAs (cis asRNA) have been reported to participate in gene expression regulation in both eukaryotic and prokaryotic organisms. Its presence in Streptomyces coelicolor has also been reported recently; however, its role has yet to be fully investigated. Using mathematical modeling we explore the role of cis asRNA produced as a result of convergent transcription in scbA-scbR genetic switch. scbA and scbR gene pair, encoding repressor-amplifier proteins respectively, mediates the synthesis of a signaling molecule, the γ-butyrolactone SCB1 and controls the onset of antibiotic production. Our model considers that transcriptional interference caused by convergent transcription of two opposing RNA polymerases results in fatal collision and transcriptional termination, which suppresses transcription efficiency. Additionally, convergent transcription causes sense and antisense interactions between complementary sequences from opposing strands, rendering the full length transcript inaccessible for translation. We evaluated the role of transcriptional interference and the antisense effect conferred by convergent transcription on the behavior of scbA-scbR system. Stability analysis showed that while transcriptional interference affects the system, it is asRNA that confers scbA-scbR system the characteristics of a bistable switch in response to the signaling molecule SCB1. With its critical role of regulating the onset of antibiotic synthesis the bistable behavior offers this two gene system the needed robustness to be a genetic switch. The convergent two gene system with potential of transcriptional interference is a frequent feature in various genomes. The possibility of asRNA regulation in other such gene-pairs is yet to be examined.

Reduced STMN1 expression induced by RNA interference inhibits the bioactivity of pancreatic cancer cell line Panc-1.

PubMed

Li, J; Hu, G H; Kong, F J; Wu, K M; He, B; Song, K; Sun, W J

2014-01-01

Increased expression of STMN1 has been observed in many tumor forms, but its expression and potential biological role in pancreatic cancer is still unknown. In this study, we demonstrated that STMN1 was expressed to a large extent in pancreatic cancer tissues and cell lines as compared to normal pancreatic tissues. Suppression of STMN1 expression via transfection with STMN1-specific siRNA could not only significantly inhibit the proliferation, migration and invasion ability of Panc-1 cells, but also enhance the apoptosis of Panc-1 cells. In addition, downregulation of STMN1 obviously enhanced the acetylation level of α-tubulin. All these results indicated that STMN1 plays an important role in pancreatic cancer development, and might serve as a potential therapeutic target for pancreatic cancer.

Small RNA binding is a common strategy to suppress RNA silencing by several viral suppressors

PubMed Central

Lakatos, Lóránt; Csorba, Tibor; Pantaleo, Vitantonio; Chapman, Elisabeth J; Carrington, James C; Liu, Yu-Ping; Dolja, Valerian V; Calvino, Lourdes Fernández; López-Moya, Juan José; Burgyán, József

2006-01-01

RNA silencing is an evolutionarily conserved system that functions as an antiviral mechanism in higher plants and insects. To counteract RNA silencing, viruses express silencing suppressors that interfere with both siRNA- and microRNA-guided silencing pathways. We used comparative in vitro and in vivo approaches to analyse the molecular mechanism of suppression by three well-studied silencing suppressors. We found that silencing suppressors p19, p21 and HC-Pro each inhibit the intermediate step of RNA silencing via binding to siRNAs, although the molecular features required for duplex siRNA binding differ among the three proteins. None of the suppressors affected the activity of preassembled RISC complexes. In contrast, each suppressor uniformly inhibited the siRNA-initiated RISC assembly pathway by preventing RNA silencing initiator complex formation. PMID:16724105

RNA interference inhibits herpes simplex virus type 1 isolated from saliva samples and mucocutaneous lesions.

PubMed

Silva, Amanda Perse da; Lopes, Juliana Freitas; Paula, Vanessa Salete de

2014-01-01

The aim of this study was to evaluate the use of RNA interference to inhibit herpes simplex virus type-1 replication in vitro. For herpes simplex virus type-1 gene silencing, three different small interfering RNAs (siRNAs) targeting the herpes simplex virus type-1 UL39 gene (sequence si-UL 39-1, si-UL 39-2, and si-UL 39-3) were used, which encode the large subunit of ribonucleotide reductase, an essential enzyme for DNA synthesis. Herpes simplex virus type-1 was isolated from saliva samples and mucocutaneous lesions from infected patients. All mucocutaneous lesions' samples were positive for herpes simplex virus type-1 by real-time PCR and by virus isolation; all herpes simplex virus type-1 from saliva samples were positive by real-time PCR and 50% were positive by virus isolation. The levels of herpes simplex virus type-1 DNA remaining after siRNA treatment were assessed by real-time PCR, whose results demonstrated that the effect of siRNAs on gene expression depends on siRNA concentration. The three siRNA sequences used were able to inhibit viral replication, assessed by real-time PCR and plaque assays and among them, the sequence si-UL 39-1 was the most effective. This sequence inhibited 99% of herpes simplex virus type-1 replication. The results demonstrate that silencing herpes simplex virus type-1 UL39 expression by siRNAs effectively inhibits herpes simplex virus type-1 replication, suggesting that siRNA based antiviral strategy may be a potential therapeutic alternative. Copyright © 2014. Published by Elsevier Editora Ltda.

RNAi control of aflatoxins in peanut plants, a multifactorial system

USDA-ARS?s Scientific Manuscript database

RNA-interference (RNAi)-mediated control of aflatoxin contamination in peanut plants is a multifactorial and hyper variable system. The use of RNAi biotechnology to silence single genes in plants has inherently high-variability among transgenic events. Also the level of expression of small interfe...

Lithium promotes the production of reactive oxygen species via GSK-3β/TSC2/TOR signaling in the gill of zebrafish (Danio rerio).

PubMed

Liu, Dongwu; Gao, Lili; Zhang, Zhuangzhuang; Tao, Shiyi; Pang, Qiuxiang; Li, Ao; Deng, Hongkuan; Yu, Hairui

2018-03-01

In this study, the mechanism that lithium (Li) promotes the production of reactive oxygen species (ROS) via the glycogen synthase kinase-3β (GSK-3β)/tuberous sclerosis complex 2 (TSC2)/target of rapamycin (TOR) signaling was investigated in the gill of zebrafish (Danio rerio). After the zebrafish were treated by 25 and 50 mg/L Li + , the mRNA expression of GSK-3β and TSC2 was inhibited, but the expression of TOR was induced in the gill of zebrafish. The levels of hydrogen peroxide (H 2 O 2 ), superoxide anion (O 2 ·- ), and hydroxy radical (·OH) as well as the activity of superoxide dismutase (SOD) were increased, while the activities of catalase (CAT), glutathione peroxidase (GSH-PX), and peroxidase (POD) were decreased by 25 and 50 mg/L Li + treatments. In the ZF4 cells, the mRNA expression of GSK-3β and TSC2 was inhibited, but TOR expression was induced by 1, 5, and 10 mmol/L Li + treatments. To further confirm that lithium promoted ROS production via GSK-3β inhibition, GSK-3β RNA was interfered. It was found that the interference of GSK-3β RNA induced the TSC2/TOR signaling. The levels of H 2 O 2 , O 2 ·- , and ·OH were increased, but the activities of CAT, GSH-PX, and POD were decreased by GSK-3β RNA interference. In addition, lithium decreased the mitochondrial membrane potential (MMP) with Rhodamine-123 assay, but increased the levels of ROS by 2',7'-dichlorofluorescein diacetate (DCFH-DA) assay. The present results indicated that lithium promoted the ROS production through the GSK-3β/TSC2/TOR signaling in the gill of zebrafish. Copyright © 2017 Elsevier Ltd. All rights reserved.

Efficiency and Safety of β-CD-(D3)7 as siRNA Carrier for Decreasing Matrix Metalloproteinase-9 Expression and Improving Wound Healing in Diabetic Rats.

PubMed

Li, Na; Luo, Heng-Cong; Ren, Meng; Zhang, Li-Ming; Wang, Wei; Pan, Cheng-Lin; Yang, Li-Qun; Lao, Guo-Juan; Deng, Jun-Jie; Mai, Kai-Jin; Sun, Kan; Yang, Chuan; Yan, Li

2017-05-24

Overexpression of matrix metalloproteinase-9 (MMP-9) is critical for diabetic chronic wounds involved in the refractory wound healing process. We aimed to develop a strategy through RNAi to decrease MMP-9 expression and improve diabetic wound healing. We had explored β-CD-(D 3 ) 7 as a gene carrier to take siRNA and effectively interfere with MMP-9 expression. It has been proven that β-CD-(D 3 ) 7 could be used as an effective siRNA delivery system. In this study, we want to know about the efficiency and safety of β-CD-(D 3 ) 7 /MMP-9 siRNA for improving wound healing in diabetic rats. β-CD-(D3)7/MMP-9 siRNA treated animals show lower levels of MMP-9 expression, which induce faster wound-close rates. Histological evaluation indicates that β-CD-(D3)7/MMP-9 siRNA significantly increases the content of collagen around the injured tissues. The number of neutrophilic ganulocytes was significantly decreased through treatment of β-CD-(D3)7/MMP-9 siRNA. In vivo fluorescence imaging assessment shows that β-CD-(D3)7/MMP-9 siRNA could not cause organ damage and organ accumulation. The results suggest that β-CD-(D 3 ) 7 /MMP-9 siRNA might be developed as a novel topical agent for the diabetic wounds treatment.

The HTLV-1 Tax Oncoprotein Represses Ku80 Gene Expression

PubMed Central

Ducu, Razvan I.; Dayaram, Tajhal; Marriott, Susan J.

2011-01-01

The HTLV-I oncoprotein Tax interferes with DNA double strand break repair. Since non-homologous end joining (NHEJ) is a major pathway used to repair DNA double strand breaks we examined the effect of Tax on this pathway, with particular interest in the expression and function of Ku80, a critical component of the NHEJ pathway. Tax expression decreased Ku80 mRNA and protein levels, and repressed transcription from the Ku80 promoter. Conversely, Ku80 mRNA increased following siRNA knockdown of Tax in HTLV-I infected cells. Tax expression was associated with an elevated number of micronuclei and nucleoplasmic bridges, hallmarks of improper DNA double strand break repair. Our studies identified Tax as a transcriptional repressor of Ku80 that correlates with decreased DNA repair function. The reduction of Ku80 transcription by Tax may deplete the cell of an essential DNA break binding protein, resulting in reduced repair of DNA double strand breaks and accumulation genomic mutations. PMID:21571351

Lentiviral vectors encoding shRNAs efficiently transduce and knockdown LINGO-1 but induce an interferon response and cytotoxicity in CNS neurons

PubMed Central

Hutson, Thomas H.; Foster, Edmund; Dawes, John M.; Hindges, Robert; Yáñez-Muñoz, Rafael J.; Moon, Lawrence D.F.

2017-01-01

Background Knocking down neuronal LINGO-1 using short hairpin RNAs (shRNAs) might enhance axon regeneration in the CNS. Integration-deficient lentiviral vectors have great potential as a therapeutic delivery system for CNS injuries. However, recent studies have revealed that shRNAs can induce an interferon response resulting in off-target effects and cytotoxicity. Methods CNS neurons were transduced with integration-deficient lentiviral vectors in vitro. The transcriptional effect of shRNA expression was analysed using qRT-PCR and northern blots were used to assess shRNA production. Results Integration-deficient lentiviral vectors efficiently transduced CNS neurons and knocked down LINGO-1 mRNA in vitro. However, an increase in cell death was observed when lentiviral vectors encoding an shRNA were applied or when high vector concentrations were used. We demonstrate that high doses of vector or the use of vectors encoding shRNAs can induce an up-regulation of interferon stimulated genes (OAS1 and PKR) and a down-regulation of off- target genes (including p75NTR and NgR1). Furthermore, the northern blot demonstrated that these negative consequences occur even when lentiviral vectors express low levels of shRNAs. Together, these results may explain why neurite outgrowth was not enhanced on an inhibitory substrate after transduction with lentiviral vectors encoding an shRNA targeting LINGO-1. Conclusions These findings highlight the importance of including appropriate controls to verify silencing specificity and the requirement to check for an interferon response when conducting RNA interference experiments. However, the potential benefits that RNA interference and viral vectors offer to gene-based therapies to CNS injuries cannot be overlooked and demand further investigation. PMID:22499506

Manipulation of Cell Physiology Enables Gene Silencing in Well-differentiated Airway Epithelia

PubMed Central

Krishnamurthy, Sateesh; Behlke, Mark A; Ramachandran, Shyam; Salem, Aliasger K; McCray Jr, Paul B; Davidson, Beverly L

2012-01-01

The application of RNA interference-based gene silencing to the airway surface epithelium holds great promise to manipulate host and pathogen gene expression for therapeutic purposes. However, well-differentiated airway epithelia display significant barriers to double-stranded small-interfering RNA (siRNA) delivery despite testing varied classes of nonviral reagents. In well-differentiated primary pig airway epithelia (PAE) or human airway epithelia (HAE) grown at the air–liquid interface (ALI), the delivery of a Dicer-substrate small-interfering RNA (DsiRNA) duplex against hypoxanthine–guanine phosphoribosyltransferase (HPRT) with several nonviral reagents showed minimal uptake and no knockdown of the target. In contrast, poorly differentiated cells (2–5-day post-seeding) exhibited significant oligonucleotide internalization and target knockdown. This finding suggested that during differentiation, the barrier properties of the epithelium are modified to an extent that impedes oligonucleotide uptake. We used two methods to overcome this inefficiency. First, we tested the impact of epidermal growth factor (EGF), a known enhancer of macropinocytosis. Treatment of the cells with EGF improved oligonucleotide uptake resulting in significant but modest levels of target knockdown. Secondly, we used the connectivity map (Cmap) database to correlate gene expression changes during small molecule treatments on various cells types with genes that change upon mucociliary differentiation. Several different drug classes were identified from this correlative assessment. Well-differentiated epithelia treated with DsiRNAs and LY294002, a PI3K inhibitor, significantly improved gene silencing and concomitantly reduced target protein levels. These novel findings reveal that well-differentiated airway epithelia, normally resistant to siRNA delivery, can be pretreated with small molecules to improve uptake of synthetic oligonucleotide and RNA interference (RNAi) responses. PMID:23344182

Small Molecule Modulators of Pre-mRNA Splicing in Cancer Therapy.

PubMed

Salton, Maayan; Misteli, Tom

2016-01-01

Pre-mRNA splicing is a fundamental process in mammalian gene expression and alternative RNA splicing plays a considerable role in generating protein diversity. RNA splicing events are also key to the pathology of numerous diseases, particularly cancers. Some tumors are molecularly addicted to specific RNA splicing isoforms making interference with pre-mRNA processing a viable therapeutic strategy. Several RNA splicing modulators have recently been characterized, some showing promise in preclinical studies. While the targets of most splicing modulators are constitutive RNA processing components, possibly leading to undesirable side effects, selectivity for individual splicing events has been observed. Given the high prevalence of splicing defects in cancer, small molecule modulators of RNA processing represent a potentially promising novel therapeutic strategy in cancer treatment. Here, we review their reported effects, mechanisms, and limitations. Published by Elsevier Ltd.

mRNA expression of corticotropin-releasing factor and urocortin 1 after restraint and foot shock together with alprazolam administration.

PubMed

Cespedes, Isabel C; de Oliveira, Amanda R; da Silva, Joelcimar M; da Silva, André V; Sita, Luciane V; Bittencourt, Jackson C

2010-12-01

Corticotropin-releasing factor (CRF) is expressed in the paraventricular nucleus of the hypothalamus (PVN), and act centrally to provoke stress-like autonomic and behavioral responses. Urocortins 1-3 are additional ligands to the CRF receptors 1 and 2. Ucn 1 neurons are primarily concentrated in the Edinger-Westphal (EW) nucleus and also have been associated with stress responses. It is also known that UCN 1 respond in different ways depending on the stressor presented. Benzodiazepines can act via the CRF peptidergic system and chronic administration of alprazolam does not interfere with CRF mRNA expression in the PVN, but significantly increase Ucn 1 mRNA expression in the EW. The aim of our study was to investigate the relationship between different stressor stimuli, foot shock (FS) and restraint (R), and the mRNA expression of CRF and Ucn 1 in the PVN and EW using alprazolam (A). We employed fos activation and in situ hybridization. Restraint group presented increased fos-ir and CRF mRNA expression in the PVN compared to FS group. The stress responses of R group were prevented by A. In the EW, fos-ir was higher in the FS group than in the R group, whereas Ucn 1 mRNA expression was higher in the R group than in the FS group. Alprazolam significantly increased fos-ir and Ucn 1 mRNA expression in both groups. Our results show that PVN and EW respond in different ways to the same stressors. Furthermore, EW of stressed animals replies in a complementary way comparing to PVN with the use of Alprazolam. Copyright © 2010 Elsevier Inc. All rights reserved.

The long non-coding RNA ROCR contributes to SOX9 expression and chondrogenic differentiation of human mesenchymal stem cells

PubMed Central

Hyatt, Sam; Cheung, Kat; Skelton, Andrew J.; Xu, Yaobo; Clark, Ian M.

2017-01-01

Long non-coding RNAs (lncRNAs) are expressed in a highly tissue-specific manner and function in various aspects of cell biology, often as key regulators of gene expression. In this study, we established a role for lncRNAs in chondrocyte differentiation. Using RNA sequencing we identified a human articular chondrocyte repertoire of lncRNAs from normal hip cartilage donated by neck of femur fracture patients. Of particular interest are lncRNAs upstream of the master chondrocyte transcription factor SOX9 locus. SOX9 is an HMG-box transcription factor that plays an essential role in chondrocyte development by directing the expression of chondrocyte-specific genes. Two of these lncRNAs are upregulated during chondrogenic differentiation of mesenchymal stem cells (MSCs). Depletion of one of these lncRNAs, LOC102723505, which we termed ROCR (regulator of chondrogenesis RNA), by RNA interference disrupted MSC chondrogenesis, concomitant with reduced cartilage-specific gene expression and incomplete matrix component production, indicating an important role in chondrocyte biology. Specifically, SOX9 induction was significantly ablated in the absence of ROCR, and overexpression of SOX9 rescued the differentiation of MSCs into chondrocytes. Our work sheds further light on chondrocyte-specific SOX9 expression and highlights a novel method of chondrocyte gene regulation involving a lncRNA. PMID:29084806

Systemic delivery of siRNA with cationic lipid assisted PEG-PLA nanoparticles for cancer therapy.

PubMed

Yang, Xian-Zhu; Dou, Shuang; Sun, Tian-Meng; Mao, Cheng-Qiong; Wang, Hong-Xia; Wang, Jun

2011-12-10

Delivery of small interfering RNA (siRNA) has been one of the major hurdles for the application of RNA interference in therapeutics. Here, we describe a cationic lipid assisted polymeric nanoparticle system with stealthy property for efficient siRNA encapsulation and delivery, which was fabricated with poly(ethylene glycol)-b-poly(d,l-lactide), siRNA and a cationic lipid, using a double emulsion-solvent evaporation technique. By incorporation of the cationic lipid, the encapsulation efficiency of siRNA into the nanoparticles could be above 90% and the siRNA loading weight ratio was up to 4.47%, while the diameter of the nanoparticles was around 170 to 200nm. The siRNA retained its integrity within the nanoparticles, which were effectively internalized by cancer cells and escaped from the endosome, resulting in significant gene knockdown. This effect was demonstrated by significant down-regulation of luciferase expression in HepG2-luciferase cells which stably express luciferase, and suppression of polo-like kinase 1 (Plk1) expression in HepG2 cells, following delivery of specific siRNAs by the nanoparticles. Furthermore, the nanoparticles carrying siRNA targeting the Plk1 gene were found to induce remarkable apoptosis in both HepG2 and MDA-MB-435s cancer cells. Systemic delivery of specific siRNA by nanoparticles significantly inhibited luciferase expression in an orthotopic murine liver cancer model and suppressed tumor growth in a MDA-MB-435s murine xenograft model, suggesting its therapeutic promise in disease treatment. Copyright © 2011 Elsevier B.V. All rights reserved.

RNA interference targeting carbohydrate sulfotransferase 3 diminishes macrophage accumulation, inhibits MMP-9 expression and promotes lung recovery in murine pulmonary emphysema.

PubMed

Kai, Yoshiro; Tomoda, Koichi; Yoneyama, Hiroyuki; Yoshikawa, Masanori; Kimura, Hiroshi

2015-12-09

Chondroitin sulfate proteoglycans are an important mediators in inflammation and leukocyte trafficking. However, their roles in pulmonary emphysema have not been explored. In a murine model of elastase-induced pulmonary emphysema, we found increased carbohydrate sulfotransferase 3 (CHST3), a specific enzyme that synthesizes chondroitin 6-sulfate proteoglycan (C6SPG). To elucidate the role of C6SPG, we investigated the effect of small interfering RNA (siRNA) targeting CHST3 that inhibits C6SPG-synthesis on the pathogenesis of pulmonary emphysema. Mice were intraperitoneally injected with CHST3 siRNA or negative control siRNA on day0 and 7 after intratracheal instillation of elastase. Histology, respiratory function, glycosaminoglycans (GAGs) content, bronchoalveolar lavage (BAL), elastin staining and gene expressions of tumor necrosis factor (TNF)-α and matrix metalloproteinase (MMP)-9 mRNA were evaluated on day7 and/or day21. CHST3 mRNA increased at day 7 and decreased thereafter in lung. CHST3 siRNA successfully inhibited the expression of CHST3 mRNA throughout the study and this was associated with significant reduction of GAGs and C6SPG. Airway destruction and respiratory function were improved by the treatment with CHST3 siRNA. CHST3 siRNA reduced the number of macrophages both in BAL and lung parenchyma and also suppressed the increased expressions of TNF-α and MMP-9 mRNA. Futhermore, CHST3 siRNA improved the reduction of the elastin in the alveolar walls. CHST3 siRNA diminishes accumulation of excessive macrophages and the mediators, leading to accelerate the functional recovery from airway damage by repair of the elastin network associated with pulmonary emphysema.

Evaluation of the reversal of multidrug resistance by MDR1 ribonucleic acid interference in a human colon cancer model using a Renilla luciferase reporter gene and coelenterazine.

PubMed

Jeon, Yong Hyun; Bae, Seon-ae; Lee, Yong Jin; Lee, You La; Lee, Sang-Woo; Yoon, Ghil-Suk; Ahn, Byeong-Cheol; Ha, Jeoung-Hee; Lee, Jaetae

2010-12-01

The reversal effect of multidrug resistance (MDR1) gene expression by adenoviral vector-mediated MDR1 ribonucleic acid interference was assessed in a human colon cancer animal model using bioluminescent imaging with Renilla luciferase (Rluc) gene and coelenterazine, a substrate for Rluc or MDR1 gene expression. A fluorescent microscopic examination demonstrated an increased green fluorescent protein signal in Ad-shMDR1- (recombinant adenovirus that coexpressed MDR1 small hairpin ribonucleic acid [shRNA] and green fluorescent protein) infected HCT-15/Rluc cells in a virus dose-dependent manner. Concurrently, with an increasing administered virus dose (0, 15, 30, 60, and 120 multiplicity of infection), Rluc activity was significantly increased in Ad-shMDR1-infected HCT-15/Rluc cells in a virus dose-dependent manner. In vivo bioluminescent imaging showed about 7.5-fold higher signal intensity in Ad-shMDR1-infected tumors than in control tumors (p < .05). Immunohistologic analysis demonstrated marked reduction of P-glycoprotein expression in infected tumor but not in control tumor. In conclusion, the reversal of MDR1 gene expression by MDR1 shRNA was successfully evaluated by bioluminescence imaging with Rluc activity using an in vivo animal model with a multidrug resistance cancer xenograft.

Development of a baculovirus vector carrying a small hairpin RNA for suppression of sf-caspase-1 expression and improvement of recombinant protein production.

PubMed

Zhang, Xiaoyue; Xu, Keyan; Ou, Yanmei; Xu, Xiaodong; Chen, Hongying

2018-05-02

The Baculovirus expression vector system (BEVS) is a transient expression platform for recombinant protein production in insect cells. Baculovirus infection of insect cells will shutoff host translation and induce apoptosis and lead to the termination of protein expression. Previous reports have demonstrated the enhancement of protein yield in BEVS using stable insect cell lines expressing interference RNA to suppress the expression of caspase-1. In this study, short-hairpin RNA (shRNA) expression cassettes targeting Spodoptera frugiperda caspase-1 (Sf-caspase-1) were constructed and inserted into an Autographa californica multiple nucleopolyhedrovirus (AcMNPV) vector. Using the recombinant baculovirus vectors, we detected the suppression of Sf-caspase-1 expression and cell apoptosis. Green fluorescent protein (GFP), Discosoma sp. Red (DsRed) and firefly luciferase were then expressed as reporter proteins. The results showed that suppression of apoptosis enhanced the accumulation of exogenous proteins at 2 and 3 days post infection. After 4 days post infection, the activity of the reporter proteins remained higher in BEVS using the baculovirus carrying shRNA in comparison with the control without shRNA, but the accumulated protein levels showed no obvious difference between them, suggesting that apoptosis suppression resulted in improved protein folding rather than translation efficiency at the very late stage of baculovirus infection. The baculovirus vector developed in this study would be a useful tool for the production of active proteins suitable for structural and functional studies or pharmaceutical applications in Sf9 cells, and it also has the potential to be adapted for the improvement of protein expression in different insect cell lines that can be infected by AcMNPV.

Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

NASA Astrophysics Data System (ADS)

Travella, Silvia; Keller, Beat

Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

Inhibition of memory consolidation after active avoidance conditioning by antisense intervention with ependymin gene expression.

PubMed

Schmidt, R; Brysch, W; Rother, S; Schlingensiepen, K H

1995-10-01

A rapid increase in ependymin mRNA expression demonstrated by semiquantitative in situ hybridization after avoidance conditioning on goldfish suggested a molecular demand for newly synthesized ependymin translation product. To inhibit de novo synthesis of ependymin molecules without interference with preexisting ones, 18 mer anti-ependymin mRNA-phosphorothioate oligodeoxynucleotides (S-ODNs) were injected into the perimeningeal brain fluid before active avoidance training. S-ODN-injected animals learned the avoidance response; however, they were amnesic in the test. When injected into overtrained animals, S-ODNs did not interfere with retrieval or performance of the avoidance response. Fish treated with randomized S-ODN sequences served as further controls. Incorporation of S-ODNs was analyzed by injection of fluorescein isothiocyanate (FITC)-conjugated oligodeoxynucleotide probes. Microscopic observation revealed strong FITC-S-ODN fluorescence in reticular-shaped fibroblasts, the only known site of ependymin synthesis. Results demonstrate that selective inhibition of ependymin gene expression in vivo can specifically prevent memory formation. We conclude that in particular the newly synthesized ependymin molecules are involved in memory consolidation, possibly because they have not yet undergone irreversible molecular changes, which have been reported of this glycoprotein in a low-calcium microenvironment.

The RNA helicase DDX39B and its paralog DDX39A regulate androgen receptor splice variant AR-V7 generation.

PubMed

Nakata, Daisuke; Nakao, Shoichi; Nakayama, Kazuhide; Araki, Shinsuke; Nakayama, Yusuke; Aparicio, Samuel; Hara, Takahito; Nakanishi, Atsushi

2017-01-29

Mounting evidence suggests that constitutively active androgen receptor (AR) splice variants, typified by AR-V7, are associated with poor prognosis and resistance to androgen deprivation therapy in prostate cancer patients. However, mechanisms governing the generation of AR splice variants are not fully understood. In this study, we aimed to investigate the dynamics of AR splice variant generation using the JDCaP prostate cancer model that expresses AR splice variants under androgen depletion. Microarray analysis of JDCaP xenografts before and after expression of AR splice variants suggested that dysregulation of RNA processing pathways is likely involved in AR splice variant generation. To explore factors contributing to generation of AR-V7 mRNA, we conducted a focused RNA interference screen in AR-V7-positive JDCaP-hr cells using an shRNA library targeting spliceosome-related genes. This screen identified DDX39B as a regulator of AR-V7 mRNA expression. Simultaneous knockdown of DDX39B and its paralog DDX39A drastically and selectively downregulated AR-V7 mRNA expression in multiple AR-V7-positive prostate cancer cell lines. DDX39B was upregulated in relapsed JDCaP xenografts expressing AR splice variants, suggesting its role in expression of AR splice variants. Taken together, our findings offer insight into the mechanisms of AR splice variant generation and identify DDX39 as a potential drug target for the treatment of AR splice variant-positive prostate cancer. Copyright © 2016 Elsevier Inc. All rights reserved.

Comparative Distribution and Retention of Arsenic in Arsenic (+3 Oxidation State) Methyltransferase Knockout and Wild Type Mice

EPA Science Inventory

The mouse arsenic (+3 oxidation state) methyltransferase (As3mt) gene encodes a ~ 43 kDa protein that catalyzes conversion of inorganic arsenic into methylated products. Heterologous expression of AS3MT or its silencing by RNA interference controls arsenic methylation phenotypes...

Search for Limiting Factors in the RNAi Pathway in Silkmoth Tissues and the Bm5 Cell Line: The RNA-Binding Proteins R2D2 and Translin

PubMed Central

Swevers, Luc; Liu, Jisheng; Huvenne, Hanneke; Smagghe, Guy

2011-01-01

RNA interference (RNAi), an RNA-dependent gene silencing process that is initiated by double-stranded RNA (dsRNA) molecules, has been applied with variable success in lepidopteran insects, in contrast to the high efficiency achieved in the coleopteran Tribolium castaneum. To gain insight into the factors that determine the efficiency of RNAi, a survey was carried out to check the expression of factors that constitute the machinery of the small interfering RNA (siRNA) and microRNA (miRNA) pathways in different tissues and stages of the silkmoth, Bombyx mori. It was found that the dsRNA-binding protein R2D2, an essential component in the siRNA pathway in Drosophila, was expressed at minimal levels in silkmoth tissues. The silkmoth-derived Bm5 cell line was also deficient in expression of mRNA encoding full-length BmTranslin, an RNA-binding factor that has been shown to stimulate the efficiency of RNAi. However, despite the lack of expression of the RNA-binding proteins, silencing of a luciferase reporter gene was observed by co-transfection of luc dsRNA using a lipophilic reagent. In contrast, gene silencing was not detected when the cells were soaked in culture medium supplemented with dsRNA. The introduction of an expression construct for Tribolium R2D2 (TcR2D2) did not influence the potency of luc dsRNA to silence the luciferase reporter. Immunostaining experiments further showed that both TcR2D2 and BmTranslin accumulated at defined locations within the cytoplasm of transfected cells. Our results offer a first evaluation of the expression of the RNAi machinery in silkmoth tissues and Bm5 cells and provide evidence for a functional RNAi response to intracellular dsRNA in the absence of R2D2 and Translin. The failure of TcR2D2 to stimulate the intracellular RNAi pathway in Bombyx cells is discussed. PMID:21637842

Inhibition of myostatin gene expression in skeletal muscle of fish by in vivo electrically mediated dsRNA and shRNAi delivery.

PubMed

Terova, Genciana; Rimoldi, Simona; Bernardini, Giovanni; Saroglia, Marco

2013-06-01

Myostatin (MSTN), previously referred to as growth differentiation factor 8 (GDF8), is a negative regulator of skeletal muscle growth. In accordance with this role, natural mutations that inactivate the gene disrupting the function of the protein are associated with excessive muscle growth and double-muscling phenotype in several mammalian species. Recent studies using transgenic MSTN deficient zebrafish and medaka support the idea that this gene inhibits skeletal muscle growth even in fish. If the atrophic actions of mammalian MSTN are indeed conserved in fish, strategies capable of inhibiting the expression of this gene could be applied to enhance growth performance in livestock production. Gene silencing by RNA interference has emerged as a promising new method of inhibiting the expression of targeted genes and inducing knockdown of associated proteins both in vitro and in vivo. Accordingly, we investigated here whether double-stranded RNA (dsRNA) or different plasmids expressing short-hairpin interfering RNAs (shRNAs) against myostatin and transduced by in vivo electroporation would increase skeletal muscle mass in reared European sea bass. After 7 weeks of intramuscular injections on a weekly basis followed by in vivo electrically mediated dsRNA delivery, no increase in the condition factor (K) of fish was observed as compared to the controls. Analogously, mean body weight and K of sea bass injected with three shRNAs were not higher than those of the control fish. On the other hand, MSTN transcript quantification via real-time RT-PCR revealed a significant inhibition of gene expression in the muscle of the dsRNA-injected fish and in the muscle of fish injected with one of the three tested shRNA-expressing vector constructs. In conclusion, in vivo electric-mediated delivery of dsRNA- or shRNA-expressing vectors against MSTN inhibits MSTN gene expression in adult sea bass muscle, but this is associated with an inconsistent double-muscle phenotype.

LncRNA uc.48+ siRNA improved diabetic sympathetic neuropathy in type 2 diabetic rats mediated by P2X7 receptor in SCG.

PubMed

Wu, Bing; Zhang, Chunping; Zou, Lifang; Ma, Yucheng; Huang, Kangyu; Lv, Qiulan; Zhang, Xi; Wang, Shouyu; Xue, Yun; Yi, Zhihua; Jia, Tianyu; Zhao, Shanhong; Liu, Shuangmei; Xu, Hong; Li, Guilin; Liang, Shangdong

2016-05-01

Diabetic autonomic neuropathy includes the sympathetic ganglionic dysfunction. P2X7 receptor in superior cervical ganglia (SCG) participated in the pathological changes of cardiac dysfunction. Abnormal expression of long noncoding RNAs (lncRNAs) was reported to be involved in nervous system diseases. Our preliminary results obtained from rat lncRNA array profiling revealed that the expression of the uc.48+ was significantly increased in the rat SCG in response to diabetic sympathetic pathology. In this study, we found that lncRNAuc.48+ and P2X7 receptor in the SCG were increased in type 2 diabetic rats and were associated with the cardiac dysfunction. The uc.48+ small interference RNA (siRNA) improved the cardiac autonomic dysfunction and decreased the up-regulation P2X7 and the ratio of phosphorylated extracellular regulated protein kinases1/2 (p-ERK1/2) to ERK1/2 in SCG of type 2 diabetic rats. In conclusion, lncRNA uc.48+ siRNA improved diabetic sympathetic neuropathy in type 2 diabetic rats through regulating the expression of P2X7 and ERK signaling in SCG. Copyright © 2016 Elsevier B.V. All rights reserved.

Current Progress of siRNA/shRNA Therapeutics in Clinical Trials

PubMed Central

Burnett, John C.; Rossi, John J.; Tiemann, Katrin

2012-01-01

Through a mechanism known as RNA interference (RNAi), small interfering RNA (siRNA) molecules can target complementary mRNA strands for degradation, thus specifically inhibiting gene expression. The ability of siRNAs to inhibit gene expression offers a mechanism that can be exploited for novel therapeutics. Indeed, over the past decade, at least 21 siRNA therapeutics have been developed for more than a dozen diseases, including various cancers, viruses, and genetic disorders. Like other biological drugs, RNAi-based therapeutics often require a delivery vehicle to transport them to the targeted cells. Thus, the clinical advancement of numerous siRNA drugs has relied on the development of siRNA carriers including biodegradable nanoparticles, lipids, bacteria, and attenuated viruses. Most therapies permit systemic delivery of the siRNA drug, while others use ex vivo delivery by autologous cell therapy. For some of the drugs, advancements in bioengineering and nanotechnology have led to improved control of delivery and release of the siRNA. Likewise, progress in molecular biology has allowed for improved design of the siRNA molecules. Here, we provide an overview of siRNA therapeutics in clinical trials, including their clinical progress, the challenges they have encountered, and the future they hold in the treatment of human diseases. PMID:21744502

Current progress of siRNA/shRNA therapeutics in clinical trials.

PubMed

Burnett, John C; Rossi, John J; Tiemann, Katrin

2011-09-01

Through a mechanism known as RNA interference (RNAi), small interfering RNA (siRNA) molecules can target complementary mRNA strands for degradation, thus specifically inhibiting gene expression. The ability of siRNAs to inhibit gene expression offers a mechanism that can be exploited for novel therapeutics. Indeed, over the past decade, at least 21 siRNA therapeutics have been developed for more than a dozen diseases, including various cancers, viruses, and genetic disorders. Like other biological drugs, RNAi-based therapeutics often require a delivery vehicle to transport them to the targeted cells. Thus, the clinical advancement of numerous siRNA drugs has relied on the development of siRNA carriers, including biodegradable nanoparticles, lipids, bacteria, and attenuated viruses. Most therapies permit systemic delivery of the siRNA drug, while others use ex vivo delivery by autologous cell therapy. Advancements in bioengineering and nanotechnology have led to improved control of delivery and release of some siRNA therapeutics. Likewise, progress in molecular biology has allowed for improved design of the siRNA molecules. Here, we provide an overview of siRNA therapeutics in clinical trials, including their clinical progress, the challenges they have encountered, and the future they hold in the treatment of human diseases. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Final report: FASEB Summer Research Conference on ''Post-transcriptional control of gene expression: Effectors of mRNA decay'' [agenda and attendees list

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maquat, Lynne

2002-12-01

The goal of this meeting was to provide an interactive forum for scientists working on prokaryotic and eukaryotic mRNA decay. A special seminar presented by a leader in the field of mRNA decay in S. cerevisiae focused on what is known and what needs to be determined, not only for yeast but for other organisms. The large attendance (110 participants) reflects the awareness that mRNA decay is a key player in gene regulation in a way that is affected by the many steps that precede mRNA formation. Sessions were held on the following topics: mRNA transport and mRNP; multicomponent eukaryoticmore » nucleases; nonsense-mediated mRNA decay and nonsense-associated altered splicing; Cis-acting sequences/Trans-acting factors of mRNA decay; translational accuracy; multicomponent bacterial nucleases; interplay between mRNA polyadenylation, translation and decay in prokaryotes and prokaryotic organelles; and RNA interference and other RNA mediators of gene expression. In addition to the talks and two poster sessions, there were three round tables: (1) Does translation occur in the nucleus? (2) Differences and similarities in the mechanisms of mRNA decay in different eukaryotes, and (3) RNA surveillance in bacteria?« less

The double-stranded RNA binding protein RDE-4 can act cell autonomously during feeding RNAi in C. elegans

PubMed Central

Raman, Pravrutha; Zaghab, Soriayah M.; Traver, Edward C.

2017-01-01

Abstract Long double-stranded RNA (dsRNA) can silence genes of matching sequence upon ingestion in many invertebrates and is therefore being developed as a pesticide. Such feeding RNA interference (RNAi) is best understood in the worm Caenorhabditis elegans, where the dsRNA-binding protein RDE-4 initiates silencing by recruiting an endonuclease to process long dsRNA into short dsRNA. These short dsRNAs are thought to move between cells because muscle-specific rescue of rde-4 using repetitive transgenes enables silencing in other tissues. Here, we extend this observation using additional promoters, report an inhibitory effect of repetitive transgenes, and discover conditions for cell-autonomous silencing in animals with tissue-specific rescue of rde-4. While expression of rde-4(+) in intestine, hypodermis, or neurons using a repetitive transgene can enable silencing also in unrescued tissues, silencing can be inhibited wihin tissues that express a repetitive transgene. Single-copy transgenes that express rde-4(+) in body-wall muscles or hypodermis, however, enable silencing selectively in the rescued tissue but not in other tissues. These results suggest that silencing by the movement of short dsRNA between cells is not an obligatory feature of feeding RNAi in C. elegans. We speculate that similar control of dsRNA movement could modulate tissue-specific silencing by feeding RNAi in other invertebrates. PMID:28541563

Microprocessor mediates transcriptional termination in long noncoding microRNA genes

PubMed Central

Dhir, Ashish; Dhir, Somdutta; Proudfoot, Nick J.; Jopling, Catherine L.

2015-01-01

MicroRNA (miRNA) play a major role in the post-transcriptional regulation of gene expression. Mammalian miRNA biogenesis begins with co-transcriptional cleavage of RNA polymerase II (Pol II) transcripts by the Microprocessor complex. While most miRNA are located within introns of protein coding genes, a substantial minority of miRNA originate from long non coding (lnc) RNA where transcript processing is largely uncharacterized. We show, by detailed characterization of liver-specific lnc-pri-miR-122 and genome-wide analysis in human cell lines, that most lnc-pri-miRNA do not use the canonical cleavage and polyadenylation (CPA) pathway, but instead use Microprocessor cleavage to terminate transcription. This Microprocessor inactivation leads to extensive transcriptional readthrough of lnc-pri-miRNA and transcriptional interference with downstream genes. Consequently we define a novel RNase III-mediated, polyadenylation-independent mechanism of Pol II transcription termination in mammalian cells. PMID:25730776

miRNA-embedded shRNAs for Lineage-specific BCL11A Knockdown and Hemoglobin F Induction

PubMed Central

Guda, Swaroopa; Brendel, Christian; Renella, Raffaele; Du, Peng; Bauer, Daniel E; Canver, Matthew C; Grenier, Jennifer K; Grimson, Andrew W; Kamran, Sophia C; Thornton, James; de Boer, Helen; Root, David E; Milsom, Michael D; Orkin, Stuart H; Gregory, Richard I; Williams, David A

2015-01-01

RNA interference (RNAi) technology using short hairpin RNAs (shRNAs) expressed via RNA polymerase (pol) III promoters has been widely exploited to modulate gene expression in a variety of mammalian cell types. For certain applications, such as lineage-specific knockdown, embedding targeting sequences into pol II-driven microRNA (miRNA) architecture is required. Here, using the potential therapeutic target BCL11A, we demonstrate that pol III-driven shRNAs lead to significantly increased knockdown but also increased cytotoxcity in comparison to pol II-driven miRNA adapted shRNAs (shRNAmiR) in multiple hematopoietic cell lines. We show that the two expression systems yield mature guide strand sequences that differ by a 4 bp shift. This results in alternate seed sequences and consequently influences the efficacy of target gene knockdown. Incorporating a corresponding 4 bp shift into the guide strand of shRNAmiRs resulted in improved knockdown efficiency of BCL11A. This was associated with a significant de-repression of the hemoglobin target of BCL11A, human γ-globin or the murine homolog Hbb-y. Our results suggest the requirement for optimization of shRNA sequences upon incorporation into a miRNA backbone. These findings have important implications in future design of shRNAmiRs for RNAi-based therapy in hemoglobinopathies and other diseases requiring lineage-specific expression of gene silencing sequences. PMID:26080908

Conditional sterility in plants

DOEpatents

Meagher, Richard B.; McKinney, Elizabeth; Kim, Tehryung

2010-02-23

The present disclosure provides methods, recombinant DNA molecules, recombinant host cells containing the DNA molecules, and transgenic plant cells, plant tissue and plants which contain and express at least one antisense or interference RNA specific for a thiamine biosynthetic coding sequence or a thiamine binding protein or a thiamine-degrading protein, wherein the RNA or thiamine binding protein is expressed under the regulatory control of a transcription regulatory sequence which directs expression in male and/or female reproductive tissue. These transgenic plants are conditionally sterile; i.e., they are fertile only in the presence of exogenous thiamine. Such plants are especially appropriate for use in the seed industry or in the environment, for example, for use in revegetation of contaminated soils or phytoremediation, especially when those transgenic plants also contain and express one or more chimeric genes which confer resistance to contaminants.

Fenofibrate inhibited pancreatic cancer cells proliferation via activation of p53 mediated by upregulation of LncRNA MEG3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Duanmin; Su, Cunjin; Jiang, Min

There is still no suitable drug for pancreatic cancer treatment, which is one of the most aggressive human tumors. Maternally expressed gene 3 (MEG3), a LncRNA, has been suggested as a tumor suppressor in a range of human tumors. Studies found fenofibrate exerted anti-tumor roles in various human cancer cell lines. However, its role in pancreatic cancer remains unknown. The present study aimed to explore the impacts of fenofibrate on pancreatic cancer cell lines, and to investigate MEG3 role in its anti-tumor mechanisms. We used MTT assay to determine cells proliferation, genome-wide LncRNA microarray analysis to identify differently expressed LncRNAs,more » siRNA or pCDNA-MEG3 transfection to interfere or upregulate MEG3 expression, western blot to detect protein levels, real-time PCR to determine MEG3 level. Fenofibrate significantly inhibited proliferation of pancreatic cancer cells, increased MEG3 expression and p53 levels. Moreover, knockdown of MEG3 attenuated cytotoxicity induced by fenofibrate. Furthermore, overexpression of MEG3 induced cells death and increased p53 expression. Our results indicated fenofibrate inhibited pancreatic cancer cells proliferation via activation of p53 mediated by upregulation of MEG3. - Highlights: • We found that fenofibrate suppressed proliferation of pancreatic cancer cells. • We found fenofibrate increased LncRNA-MEG3 expression and p53 level in PANC-1 cells. • Inhibition of MEG3 expression attenuated anti-tumor effects of fenofibrate.« less

Downregulation of CD147 expression by RNA interference inhibits HT29 cell proliferation, invasion and tumorigenicity in vitro and in vivo.

PubMed

Li, Rui; Pan, Yuqin; He, Bangshun; Xu, Yeqiong; Gao, Tianyi; Song, Guoqi; Sun, Huiling; Deng, Qiwen; Wang, Shukui

2013-12-01

We investigated the effect of CD147 silencing on HT29 cell proliferation and invasion. We constructed a novel short hairpin RNA (shRNA) expression vector pYr-mir30-shRNA. The plasmid was transferred to HT29 cells. The expression of CD147, MCT1 (lactate transporters monocarboxylate transporter 1) and MCT4 (lactate transporters monocarboxylate transporter 4) were monitored by quantitative PCR and western blotting, respectively. The MMP-2 (matrix metalloproteinase-2) and MMP-9 (matrix metalloproteinase-9) activities were determined by gelatin zymography assay, while the intracellular lactate concentration was determined by the lactic acid assay kit. WST-8 assay was used to determine the HT29 cell proliferation and the chemosensitivity. Invasion assay was used to determine the invasion of HT29 cells. In addition, we established a colorectal cancer model, and detected CD147 expression in vivo. The results showed that the expression of CD147 and MCT1 was significantly reduced at both mRNA and protein levels, and also the activity of MMP-2 and MMP-9 was reduced. The proliferation and invasion were decreased, but chemosensitivity to cisplatin was increased. In vivo, the CD147 expression was also significantly decreased, and reduced the tumor growth after CD147 gene silencing. The results demonstrated that silencing of CD147 expression inhibited the proliferation and invasion, suggesting CD147 silencing might be an adjuvant gene therapy strategy to chemotherapy.

Isolation and identification of gene-specific microRNAs.

PubMed

Lin, Shi-Lung; Chang, Donald C; Ying, Shao-Yao

2006-01-01

Prediction of microRNA (miRNA) candidates using computer programming has identified hundreds and hundreds of genomic hairpin sequences, of which, the functions remain to be determined. Because direct transfection of hairpin-like miRNA precursors (pre)-miRNAs in mammalian cells is not always sufficient to trigger effective RNA-induced gene-silencing complex (RISC) assembly, a key step for RNA interference (RNAi)-related gene silencing, we developed an intronic miRNA-expressing system to overcome this problem, and successfully increased the efficiency and effectiveness of miRNA-associated RNAi induction in vitro and in vivo. By insertion of a hairpin-like pre-miRNA structure into the intron region of a gene, this intronic miRNA biogenesis system has been found to depend on a coupled interaction of nascent precursor messenger RNA transcription and intron excision within a specific nuclear region proximal to genomic perichromatin fibrils. The intronic miRNA was transcribed by RNA type II polymerases, coexpressed with a primary gene transcript, and excised out of its encoding gene transcript by intracellular RNA splicing and processing mechanisms. Currently, some ribonuclease III endonucleases have been found to be involved in the processing of spliced introns and probably facilitating the intronic miRNA maturation. Using this miRNA-expressing system, we have shown for the first time that the intron-derived miRNAs were able to induce strong RNAi effects in not only human and mouse cells but also zebrafish, chicken embryos, and adult mice. Based on the strand complementarity between the designed miRNA and its target gene sequence, we have also developed a miRNA isolation protocol to purify and identify the mature miRNAs generated by the intronic miRNA-expressing system. Several intronic miRNA identities and structures are currently confirmed to be active in vitro and in vivo. According to this proof- of-principle method, we now have the knowledge to design pre-miRNA inserts that are more efficient and effective for the intronic miRNA-expressing system.

TRIM25 blockade by RNA interference inhibited migration and invasion of gastric cancer cells through TGF-β signaling.

PubMed

Zhu, Zhenya; Wang, Yong; Zhang, Chunhui; Yu, Shiyong; Zhu, Qi; Hou, Kun; Yan, Bo

2016-01-12

Tripartite Motif Containing 25 (TRIM25), a member of TRIM proteins, has been found abnormally expressed in cancers of female reproductive system. Here, TRIM25 was conspicuously expressed in human gastric cancer (GC) tissues in which its higher expression generally correlated with the poor prognosis of patients. Small interfering RNA (siRNA)-mediated knockdown of TRIM25 expression in MGC-803 and AGS cells had no effects on cell proliferation, whereas reduced cell migration and invasion. Gene set enrichment analysis on The Cancer Genome Atlas stomach adenocarcinoma (STAD) dataset revealed that several signaling pathways, including the migration, E-cadherin and transforming growth factor-β (TGF-β) pathways, were enriched in TRIM25 higher expression patients. Moreover, ectopic expression of TRIM25 in a GC cell line with lower expression of TRIM25 significantly promoted the migration and invasion. Further experiments with TGF-β inhibitor suggested that TRIM25 may exert its function through TGF-β pathway. In summary, our results indicate that TRIM25 acts as an oncogene in GC and thus presents a novel target for the detection and treatment of GC.

TRIM25 blockade by RNA interference inhibited migration and invasion of gastric cancer cells through TGF-β signaling

PubMed Central

Zhu, Zhenya; Wang, Yong; Zhang, Chunhui; Yu, Shiyong; Zhu, Qi; Hou, Kun; Yan, Bo

2016-01-01

Tripartite Motif Containing 25 (TRIM25), a member of TRIM proteins, has been found abnormally expressed in cancers of female reproductive system. Here, TRIM25 was conspicuously expressed in human gastric cancer (GC) tissues in which its higher expression generally correlated with the poor prognosis of patients. Small interfering RNA (siRNA)-mediated knockdown of TRIM25 expression in MGC-803 and AGS cells had no effects on cell proliferation, whereas reduced cell migration and invasion. Gene set enrichment analysis on The Cancer Genome Atlas stomach adenocarcinoma (STAD) dataset revealed that several signaling pathways, including the migration, E-cadherin and transforming growth factor-β (TGF-β) pathways, were enriched in TRIM25 higher expression patients. Moreover, ectopic expression of TRIM25 in a GC cell line with lower expression of TRIM25 significantly promoted the migration and invasion. Further experiments with TGF-β inhibitor suggested that TRIM25 may exert its function through TGF-β pathway. In summary, our results indicate that TRIM25 acts as an oncogene in GC and thus presents a novel target for the detection and treatment of GC. PMID:26754079

The Expression of BTS-2 Enhances Cell Growth and Invasiveness in Renal Cell Carcinoma.

PubMed

Pham, Quoc Thang; Oue, Naohide; Yamamoto, Yuji; Shigematsu, Yoshinori; Sekino, Yohei; Sakamoto, Naoya; Sentani, Kazuhiro; Uraoka, Naohiro; Tiwari, Mamata; Yasui, Wataru

2017-06-01

Renal cell carcinoma (RCC) is one of the most common types of cancer in developed countries. Bone marrow stromal cell antigen 2 (BST2) gene, which encodes BST2 transmembrane glycoprotein, is overexpressed in several cancer types. In the present study, we analyzed the expression and function of BST2 in RCC. BST2 expression was analyzed by immunohistochemistry in 123 RCC cases. RNA interference was used to inhibit BST2 expression in a RCC cell line. Immunohistochemical analysis showed that 32% of the 123 RCC cases were positive for BST2. BST2 expression was positively associated with tumour stage. Furthermore, BST2 expression was an independent predictor of survival in patients with RCC. BST2 siRNA-transfected Caki-1 cells displayed significantly reduced cell growth and invasive activity relative to negative control siRNA-transfected cells. These results suggest that BST2 plays an important role in the progression of RCC. Because BST2 is expressed on the cell membrane, BST2 is a good therapeutic target for RCC. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Silencing of sodium/hydrogen exchanger in the heart by direct injection of naked siRNA.

PubMed

Morgan, Patricio E; Correa, María V; Ennis, Irene L; Ennis, Irene E; Diez, Ariel A; Pérez, Néstor G; Cingolani, Horacio E

2011-08-01

Cardiac Na(+)/H(+) exchanger (NHE1) hyperactivity is a central factor in cardiac remodeling following hypertension, myocardial infarction, ischemia-reperfusion injury, and heart failure. Treatment of these pathologies by inhibiting NHE1 is challenging because specific drugs that have been beneficial in experimental models were associated with undesired side effects in clinical practice. In the present work, small interference RNA (siRNA) produced in vitro to specifically silence NHE1 (siRNA(NHE1)) was injected once in vivo into the apex of the left ventricular wall of mouse myocardium. After 48 h, left ventricular NHE1 protein expression was reduced in siRNA(NHE1)-injected mice compared with scrambled siRNA by 33.2 ± 3.4% (n = 5; P < 0.05). Similarly, NHE1 mRNA levels were reduced by 20 ± 2.0% (n = 4). At 72 h, siRNA(NHE1) spreading was evident from the decrease in NHE1 expression in three portions of the myocardium (apex, medium, base). NHE1 function was assessed based on maximal velocity of intracellular pH (pH(i)) recovery (dpH(i)/dt) after an ammonium prepulse-induced acidic load. Maximal dpH(i)/dt was reduced to 14% in siRNA(NHE1)-isolated left ventricular papillary muscles compared with scrambled siRNA. In conclusion, only one injection of naked siRNA(NHE1) successfully reduced NHE1 expression and activity in the left ventricle. As has been previously suggested, extensive NHE1 expression reduction may indicate myocardial spread of siRNA molecules from the injection site through gap junctions, providing a valid technique not only for further research into NHE1 function, but also for consideration as a potential therapeutic strategy.

SOX11 identified by target gene evaluation of miRNAs differentially expressed in focal and non-focal brain tissue of therapy-resistant epilepsy patients.

PubMed

Haenisch, Sierk; Zhao, Yi; Chhibber, Aparna; Kaiboriboon, Kitti; Do, Lynn V; Vogelgesang, Silke; Barbaro, Nicholas M; Alldredge, Brian K; Lowenstein, Daniel H; Cascorbi, Ingolf; Kroetz, Deanna L

2015-05-01

MicroRNAs (miRNAs) are small non-coding RNAs that post-transcriptionally control the expression of their target genes via RNA interference. There is increasing evidence that expression of miRNAs is dysregulated in neuronal disorders, including epilepsy, a chronic neurological disorder characterized by spontaneous recurrent seizures. Mesial temporal lobe epilepsy (MTLE) is a common type of focal epilepsy in which disease-induced abnormalities of hippocampal neurogenesis in the subgranular zone as well as gliosis and neuronal cell loss in the cornu ammonis area are reported. We hypothesized that in MTLE altered miRNA-mediated regulation of target genes could be involved in hippocampal cell remodeling. A miRNA screen was performed in hippocampal focal and non-focal brain tissue samples obtained from the temporal neocortex (both n=8) of MTLE patients. Out of 215 detected miRNAs, two were differentially expressed (hsa-miR-34c-5p: mean increase of 5.7 fold (p=0.014), hsa-miR-212-3p: mean decrease of 76.9% (p=0.0014)). After in-silico target gene analysis and filtering, reporter gene assays confirmed RNA interference for hsa-miR-34c-5p with 3'-UTR sequences of GABRA3, GRM7 and GABBR2 and for hsa-miR-212-3p with 3'-UTR sequences of SOX11, MECP2, ADCY1 and ABCG2. Reporter gene assays with mutated 3'-UTR sequences of the transcription factor SOX11 identified two different binding sites for hsa-miR-212-3p and its primary transcript partner hsa-miR-132-3p. Additionally, there was an inverse time-dependent expression of Sox11 and miR-212-3p as well as miR-132-3p in rat neonatal cortical neurons. Transfection of neurons with anti-miRs for miR-212-3p and miR-132-3p suggest that both miRNAs work synergistically to control Sox11 expression. Taken together, these results suggest that differential miRNA expression in neurons could contribute to an altered function of the transcription factor SOX11 and other genes in the setting of epilepsy, resulting not only in impaired neural differentiation, but also in imbalanced neuronal excitability and accelerated drug export. Copyright © 2015 Elsevier Inc. All rights reserved.

Specific Silencing of L392V PSEN1 Mutant Allele by RNA Interference

PubMed Central

Sierant, Malgorzata; Paduszynska, Alina; Kazmierczak-Baranska, Julia; Nacmias, Benedetta; Sorbi, Sandro; Bagnoli, Silvia; Sochacka, Elzbieta; Nawrot, Barbara

2011-01-01

RNA interference (RNAi) technology provides a powerful molecular tool to reduce an expression of selected genes in eukaryotic cells. Short interfering RNAs (siRNAs) are the effector molecules that trigger RNAi. Here, we describe siRNAs that discriminate between the wild type and mutant (1174 C→G) alleles of human Presenilin1 gene (PSEN1). This mutation, resulting in L392V PSEN1 variant, contributes to early onset familial Alzheimer's disease. Using the dual fluorescence assay, flow cytometry and fluorescent microscopy we identified positions 8th–11th, within the central part of the antisense strand, as the most sensitive to mismatches. 2-Thiouridine chemical modification introduced at the 3′-end of the antisense strand improved the allele discrimination, but wobble base pairing adjacent to the mutation site abolished the siRNA activity. Our data indicate that siRNAs can be designed to discriminate between the wild type and mutant alleles of genes that differ by just a single nucleotide. PMID:21559198

RNA interference and retinoblastoma-related genes are required for repression of endogenous siRNA targets in Caenorhabditis elegans.

PubMed

Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A

2008-12-23

In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans.

RNA interference and retinoblastoma-related genes are required for repression of endogenous siRNA targets in Caenorhabditis elegans

PubMed Central

Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A.

2008-01-01

In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans. PMID:19073934

Predicting gene regulatory networks of soybean nodulation from RNA-Seq transcriptome data.

PubMed

Zhu, Mingzhu; Dahmen, Jeremy L; Stacey, Gary; Cheng, Jianlin

2013-09-22

High-throughput RNA sequencing (RNA-Seq) is a revolutionary technique to study the transcriptome of a cell under various conditions at a systems level. Despite the wide application of RNA-Seq techniques to generate experimental data in the last few years, few computational methods are available to analyze this huge amount of transcription data. The computational methods for constructing gene regulatory networks from RNA-Seq expression data of hundreds or even thousands of genes are particularly lacking and urgently needed. We developed an automated bioinformatics method to predict gene regulatory networks from the quantitative expression values of differentially expressed genes based on RNA-Seq transcriptome data of a cell in different stages and conditions, integrating transcriptional, genomic and gene function data. We applied the method to the RNA-Seq transcriptome data generated for soybean root hair cells in three different development stages of nodulation after rhizobium infection. The method predicted a soybean nodulation-related gene regulatory network consisting of 10 regulatory modules common for all three stages, and 24, 49 and 70 modules separately for the first, second and third stage, each containing both a group of co-expressed genes and several transcription factors collaboratively controlling their expression under different conditions. 8 of 10 common regulatory modules were validated by at least two kinds of validations, such as independent DNA binding motif analysis, gene function enrichment test, and previous experimental data in the literature. We developed a computational method to reliably reconstruct gene regulatory networks from RNA-Seq transcriptome data. The method can generate valuable hypotheses for interpreting biological data and designing biological experiments such as ChIP-Seq, RNA interference, and yeast two hybrid experiments.

Upregulation of EMMPRIN (OX47) in Rat Dorsal Root Ganglion Contributes to the Development of Mechanical Allodynia after Nerve Injury.

PubMed

Wang, Qun; Sun, Yanyuan; Ren, Yingna; Gao, Yandong; Tian, Li; Liu, Yang; Pu, Yanan; Gou, Xingchun; Chen, Yanke; Lu, Yan

2015-01-01

Matrix metalloproteinases (MMPs) are widely implicated in inflammation and tissue remodeling associated with various neurodegenerative diseases and play an important role in nociception and allodynia. Extracellular Matrix Metalloproteinase Inducer (EMMPRIN) plays a key regulatory role for MMP activities. However, the role of EMMPRIN in the development of neuropathic pain is not clear. Western blotting, real-time quantitative RT-PCR (qRT-PCR), and immunofluorescence were performed to determine the changes of messenger RNA and protein of EMMPRIN/OX47 and their cellular localization in the rat dorsal root ganglion (DRG) after nerve injury. Paw withdrawal threshold test was examined to evaluate the pain behavior in spinal nerve ligation (SNL) model. The lentivirus containing OX47 shRNA was injected into the DRG one day before SNL. The expression level of both mRNA and protein of OX47 was markedly upregulated in ipsilateral DRG after SNL. OX47 was mainly expressed in the extracellular matrix of DRG. Administration of shRNA targeted against OX47 in vivo remarkably attenuated mechanical allodynia induced by SNL. In conclusion, peripheral nerve injury induced upregulation of OX47 in the extracellular matrix of DRG. RNA interference against OX47 significantly suppressed the expression of OX47 mRNA and the development of mechanical allodynia. The altered expression of OX47 may contribute to the development of neuropathic pain after nerve injury.

Gene silencing in primary and metastatic tumors by small interfering RNA delivery in mice: quantitative analysis using melanoma cells expressing firefly and sea pansy luciferases.

PubMed

Takahashi, Yuki; Nishikawa, Makiya; Kobayashi, Naoki; Takakura, Yoshinobu

2005-07-20

Silencing of oncogenes or other genes contributing to tumor malignancy or progression by RNA interference (RNAi) offers a promising approach to treating tumor patients. To achieve RNAi-based tumor therapy, a small interfering RNA (siRNA) or siRNA-expressing vector needs to be delivered to tumor cells, but little information about its in vivo delivery has been reported. In this study, we examined whether the expression of the target gene in tumor cells can be suppressed by the delivery of RNAi effectors to primary and metastatic tumor cells. To quantitatively evaluate the RNAi effects in tumor cells, mouse melanoma B16-BL6 cells were stably transfected with both firefly (a model target gene) and sea pansy (an internal standard gene) luciferase genes to obtain B16-BL6/dual Luc cells. The target gene expression in subcutaneous primary tumors of B16-BL6/dual Luc cells was significantly suppressed by direct injection of the RNAi effectors followed by electroporation. The expression in metastatic hepatic tumors was also significantly reduced by an intravenous injection of either RNAi effector by the hydrodynamics-based procedure. These results indicate that the both RNAi effectors have a potential to silence target gene in tumor cells in vivo when successfully delivered to tumor cells.

RNA interference targeting CD147 inhibits metastasis and invasion of human breast cancer MCF-7 cells by downregulating MMP-9/VEGF expression.

PubMed

Li, Fang; Zhang, Junping; Guo, Jiqiang; Jia, Yuan; Han, Yaping; Wang, Zhuanhua

2018-06-12

Breast cancer is one of the most common malignancies. It is necessary to identify new markers for predicting tumor progression and therapeutic molecular targets. It has been reported that CD147 is one of the most commonly expressed proteins in primary tumors and in metastatic cells. In this study, we investigated the role of CD147 in human breast cancer metastasis and invasion, and examined its underlying molecular mechanisms. Immunohistochemistry results revealed high expression of CD147 in human breast tumor tissues, which was positively correlated with the malignancy of breast cancer. MCF-7 cells were transfected with CD147 siRNA eukaryotic expression vector, which resulted in significant knockdown of CD147. We found that CD147 siRNA dramatically inhibited cell proliferation, metastasis, and invasion. Furthermore, our results demonstrated that CD147 siRNA inhibited the synthesis of matrix metalloproteinase 9 (MMP-9) but had no significant effect on matrix metalloproteinase 2 (MMP-2). In addition, CD147 siRNA significantly inhibited the production of vascular endothelial growth factor (VEGF). Taken together, these data indicate that CD147 promotes breast cancer cell proliferation, metastasis, and invasion by modulating MMP-9 and VEGF expression. Thus, CD147 may be used as an important indicator for the judgment of malignant behavior of breast cancer, and may be a potential novel target for breast cancer therapy.

Achieving large dynamic range control of gene expression with a compact RNA transcription–translation regulator

PubMed Central

2017-01-01

Abstract RNA transcriptional regulators are emerging as versatile components for genetic network construction. However, these regulators suffer from incomplete repression in their OFF state, making their dynamic range less than that of their protein counterparts. This incomplete repression causes expression leak, which impedes the construction of larger synthetic regulatory networks as leak propagation can interfere with desired network function. To address this, we demonstrate how naturally derived antisense RNA-mediated transcriptional regulators can be configured to regulate both transcription and translation in a single compact RNA mechanism that functions in Escherichia coli. Using in vivo gene expression assays, we show that a combination of transcriptional termination and ribosome binding site sequestration increases repression from 85% to 98%, or activation from 10-fold to over 900-fold, in response to cognate antisense RNAs. We also show that orthogonal repressive versions of this mechanism can be created through engineering minimal antisense RNAs. Finally, to demonstrate the utility of this mechanism, we use it to reduce network leak in an RNA-only cascade. We anticipate these regulators will find broad use as synthetic biology moves beyond parts engineering to the design and construction of more sophisticated regulatory networks. PMID:28387839

The long non-coding RNA HOTTIP enhances pancreatic cancer cell proliferation, survival and migration.

PubMed

Cheng, Yating; Jutooru, Indira; Chadalapaka, Gayathri; Corton, J Christopher; Safe, Stephen

2015-05-10

HOTTIP is a long non-coding RNA (lncRNA) transcribed from the 5' tip of the HOXA locus and is associated with the polycomb repressor complex 2 (PRC2) and WD repeat containing protein 5 (WDR5)/mixed lineage leukemia 1 (MLL1) chromatin modifying complexes. HOTTIP is expressed in pancreatic cancer cell lines and knockdown of HOTTIP by RNA interference (siHOTTIP) in Panc1 pancreatic cancer cells decreased proliferation, induced apoptosis and decreased migration. In Panc1 cells transfected with siHOTTIP, there was a decrease in expression of 757 genes and increased expression of 514 genes, and a limited gene analysis indicated that HOTTIP regulation of genes is complex. For example, Aurora kinase A, an important regulator of cell growth, is coregulated by MLL and not WDR5 and, in contrast to previous studies in liver cancer cells, HOTTIP does not regulate HOXA13 but plays a role in regulation of several other HOX genes including HOXA10, HOXB2, HOXA11, HOXA9 and HOXA1. Although HOTTIP and the HOX-associated lncRNA HOTAIR have similar pro-oncogenic functions, they regulate strikingly different sets of genes in Panc1 cells and in pancreatic tumors.

Combined antitumor gene therapy with herpes simplex virus-thymidine kinase and short hairpin RNA specific for mammalian target of rapamycin.

PubMed

Woo, Ha-Na; Lee, Won Il; Kim, Ji Hyun; Ahn, Jeonghyun; Han, Jeong Hee; Lim, Sue Yeon; Lee, Won Woo; Lee, Heuiran

2015-12-01

A proof-of-concept study is presented using dual gene therapy that employed a small hairpin RNA (shRNA) specific for mammalian target of rapamycin (mTOR) and a herpes simplex virus-thymidine kinase (HSV-TK) gene to inhibit the growth of tumors. Recombinant adeno-associated virus (rAAV) vectors containing a mutant TK gene (sc39TK) were transduced into HeLa cells, and the prodrug ganciclovir (GCV) was administered to establish a suicide gene-therapy strategy. Additionally, rAAV vectors expressing an mTOR-targeted shRNA were employed to suppress mTOR-dependent tumor growth. GCV selectively induced death in tumor cells expressing TK, and the mTOR-targeted shRNA altered the cell cycle to impair tumor growth. Combining the TK-GCV system with mTOR inhibition suppressed tumor growth to a greater extent than that achieved with either treatment alone. Furthermore, HSV-TK expression and mTOR inhibition did not mutually interfere with each other. In conclusion, gene therapy that combines the TK-GCV system and mTOR inhibition shows promise as a novel strategy for cancer therapy.

Zika Virus Alters the Expression Profile of microRNA-Related Genes in Liver, Lung, and Kidney Cell Lineages.

PubMed

Ferreira, Rafaella Nascimento; Holanda, Gustavo Moraes; Pinto Silva, Eliana Vieira; Casseb, Samir Mansour Moraes; Melo, Karla Fabiane Lopes; Carvalho, Carlos Alberto Marques; Lima, Juliana Abreu; Vasconcelos, Pedro Fernando Costa; Cruz, Ana Cecília Ribeiro

2018-06-07

Zika virus (ZIKV) is an arbovirus belonging to the genus Flavivirus (Flaviviridae). ZIKV infection is associated with alterations in various organs, including the liver, lungs, and kidneys. Studies on the influence of posttranscriptional control on viral infections have demonstrated that microRNAs (miRNAs) interfere with different stages of the replicative cycle of several viruses and may influence the disease outcome. To shed light on ZIKV-induced regulation of host miRNA-processing machinery in the above organs, we analyzed the expression of genes encoding key proteins of the miRNA pathway in different ZIKV-infected continuous primate cell lineages (HepG2, A549, and MA104) by reverse-transcription quantitative polymerase chain reaction (RT-qPCR). Expression of the genes encoding the miRNA-related proteins DGCR8, Ago1, and Ago3 in HepG2 cells and Drosha, Dicer, Ago2, and Ago3 in A549 and MA104 cells was significantly altered in the presence of ZIKV. Our results suggest that ZIKV modulates miRNA levels during infection in liver, lung, and kidney cells, which may be an additional mechanism of host cell subversion in these organs.

Targeted knockout of TNF-α by injection of lentivirus-mediated siRNA into the subacromial bursa for the treatment of subacromial bursitis in rats.

PubMed

Wang, Yi; Li, Quan; Wei, Xianzhao; Xu, Jie; Chen, Qi; Song, Shuang; Lu, Zhe; Wang, Zimin

2015-09-01

Subacromial bursitis (SAB) is the major source of pain in rotator cuff disease. Although multiple investigations have provided support for the role of inflammatory cytokines in SAB, few have focussed on the use these cytokines in the treatment of SAB. The aim of the present study was to observe the therapeutic efficacy of lentivirus‑mediated RNA interference (RNAi) on carrageenan‑induced SAB by injecting lentivirus‑tumor necrosis factor (TNF)‑α‑RNAi expressing TNF‑α small interfering (si)RNA. Using screened siRNA segments, an siRNA was designed. A lentivirus vector expressing siRNA was established and packed as lentivirus particles. A lentivirus that expressed the negative sequence was used as a lentivirus‑negative control (NC). The carrageenan‑induced SAB model was established in 32 male Sprague‑Dawley rats. The modeled rats were randomly assigned to four groups: Lentivirus‑RNAi treatment group, lentivirus‑NC group, SAB group and phosphate‑buffered saline (PBS) blank control group. The lentivirus was injected (1x10(7) transducing units) into the subacromial bursa of the rats in the lentivirus‑RNAi group and lentivirus‑NC group, whereas 100 µl PBS was injected at the same site in the SAB group and the PBS blank control group. At 5 weeks following injection, the animals were sacrificed and venous blood was obtained. The effect of TNF‑α interference and the expression of inflammatory cytokines were determined by reverse transcription‑quantitative polymerase chain reaction, western blotting, hematoxylin and eosin staining, Van Gieson's staining and immunofluorescence. The expression of TNF‑α was decreased in the lentivirus‑TNF‑α‑RNAi group compared with that in the SAB group. Morphological observations revealed that the number of inflammatory cells were reduced and damage to tendon fibers was attenuated in this group, suggesting that the downregulation of the protein expression levels of TNF‑α‑associated nuclear factor‑κB, matrix metalloproteinase (MMP)1, MMP9, cyclooxygenase (COX)‑1 and COX‑2 may exert a therapeutic effect on inflammation of the SAB caused by rheumatoid arthritis. It was also found that the expression of stromal cell‑derived growth factor‑1 was downregulated in the lentivirus‑TNF‑α‑RNAi group. Therefore, the present study demonstrated that lentivirus‑mediated TNF‑α RNAi effectively inhibited the inflammatory response in SAB, and that injection of a lentivirus vector into the affected region is an effective way of achieving RNAi in vivo.

RNA interference mediated pten knock-down inhibit the formation of polycystic ovary.

PubMed

Ouyang, Jie-Xiu; Luo, Tao; Sun, Hui-Yun; Huang, Jian; Tang, Dan-Feng; Wu, Lei; Zheng, Yue-Hui; Zheng, Li-Ping

2013-08-01

Pten (phosphatase and tensin homolog deleted on chromosome 10), a kind of tumor suppressor gene, plays important roles in female reproductive system. But its expression and roles in the formation of polycystic ovaries are yet to be known. In this study, we constructed a rat model of PCOS using norethindrone and HCG injections and found the expressions of pten mRNA and PTEN protein increased significantly in the polycystic ovary tissue by immunohistochemistry, RT-PCR, and western blot. Furthermore, the results showed that in vivo ovaries could be effectively transfected by lentiviral vectors through the ovarian microinjection method and indicated that pten shRNA may inhibit the formation of polycystic ovaries by pten down-regulation. Our study provides new information regarding the role of PTEN in female reproductive disorders, such as polycystic ovary syndrome.

Scavenger receptor mediates systemic RNA interference in ticks.

PubMed

Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Galay, Remil Linggatong; Tanaka, Tetsuya; Fujisaki, Kozo

2011-01-01

RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks.

Scavenger Receptor Mediates Systemic RNA Interference in Ticks

PubMed Central

Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Linggatong Galay, Remil; Tanaka, Tetsuya; Fujisaki, Kozo

2011-01-01

RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks. PMID:22145043

The dose can make the poison: lessons learned from adverse in vivo toxicities caused by RNAi overexpression.

PubMed

Grimm, Dirk

2011-10-26

For the past five years, evidence has accumulated that vector-mediated robust RNA interference (RNAi) expression can trigger severe side effects in small and large animals, from cytotoxicity and accelerated tumorigenesis to organ failure and death. The recurring notions in these studies that a critical parameter is the strength of RNAi expression and that Exportin-5 and the Argonaute proteins are rate-limiting mammalian RNAi, strongly imply dose-dependent saturation of the endogenous miRNA pathway as one of the underlying mechanisms. This minireview summarizes the relevant work and data leading to this intriguing model and highlights potential avenues by which to alleviate RNAi-induced toxicities in future clinical applications.

Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange

PubMed Central

Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.

2014-01-01

RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198

RNA interference of chitin synthase genes inhibits chitin biosynthesis and affects larval performance in Leptinotarsa decemlineata (Say).

PubMed

Shi, Ji-Feng; Mu, Li-Li; Chen, Xu; Guo, Wen-Chao; Li, Guo-Qing

2016-01-01

Dietary introduction of bacterially expressed double-stranded RNA (dsRNA) has great potential for management of Leptinotarsa decemlineata . Identification of the most attractive candidate genes for RNA interference (RNAi) is the first step. In the present paper, three complete chitin synthase cDNA sequences ( LdChSAa , LdChSAb and LdChSB ) were cloned. LdChSAa and LdChSAb , two splicing variants of LdChSA gene, were highly expressed in ectodermally-derived epidermal cells forming epidermis, trachea, foregut and hindgut, whereas LdChSB was mainly transcribed in midgut cells. Feeding bacterially expressed ds ChSA (derived from a common fragment of LdChSAa and LdChSAb ), ds ChSAa , ds ChSAb and ds ChSB in the second- and fourth-instar larvae specifically knocked down their target mRNAs. RNAi of LdChSAa + LdChSAb and LdChSAa lowered chitin contents in whole body and integument samples, and thinned tracheal taenidia. The resulting larvae failed to ecdyse, pupate, or emerge as adults. Comparably, knockdown of LdChSAb mainly affected pupal-adult molting. The LdChSAb RNAi pupae did not completely shed the old larval exuviae, which caused failure of adult emergence. In contrast, silencing of LdChSB significantly reduced foliage consumption, decreased chitin content in midgut sample, damaged midgut peritrophic matrix, and retarded larval growth. As a result, the development of the LdChSB RNAi hypomorphs was arrested. Our data reveal that these LdChS s are among the effective candidate genes for an RNAi-based control strategy against L. decemlineata .

IFN-β antiproliferative effect and miRNA regulation in Human Papilloma Virus E6- and E7-transformed keratinocytes.

PubMed

Chiantore, Maria Vincenza; Mangino, Giorgio; Iuliano, Marco; Zangrillo, Maria Simona; De Lillis, Ilaria; Vaccari, Gabriele; Accardi, Rosita; Tommasino, Massimo; Fiorucci, Gianna; Romeo, Giovanna

2017-01-01

Human Papilloma Viruses (HPVs) are the causative agents of cervical cancer although other types of cancers are associated with HPV infection. Type I Interferons can interfere with HPV E6- and/or E7-dependent transformation and can affect microRNA (miRNA) expression. Cancer cells show a specific pattern of miRNA expression and HPVs are able to modulate miRNAs expressed in infected cells. Keratinocytes transduced with E6 and E7 from mucosal HPV-16 or cutaneous HPV-38 (K16 and K38) were studied to analyze the involvement of HPV oncoproteins in the anti-proliferative activity of IFN-β. In view of our previous data showing senescence induction by the cytokine in K38 cells, we observe that IFN-β treatment leads to p53-indipendent apoptosis in K16 cells whereas induces senescence in K16 cells if E6 is silenced and p53 expression is restored. The levels of selected miRNAs, deregulated in K16 and K38 cells, can be modulated by IFN-β when E6 and E7 proteins of HPV-16, but not HPV-38, are expressed. Copyright © 2015 Elsevier Ltd. All rights reserved.

Delivery of dsRNA through topical feeding for RNA interference in the citrus sap piercing-sucking hemipteran, Diaphorina citri.

PubMed

Killiny, Nabil; Kishk, Abdelaziz

2017-06-01

RNA interference (RNAi) is a powerful means to study functional genomics in insects. The delivery of dsRNA is a challenging step in the development of RNAi assay. Here, we describe a new delivery method to increase the effectiveness of RNAi in the Asian citrus psyllid Diaphorina citri. Bromophenol blue droplets were topically applied to fifth instar nymphs and adults on the ventral side of the thorax between the three pairs of legs. In addition to video recordings that showed sucking of the bromophenol blue by the stylets, dissected guts turned blue indicating that the uptake was through feeding. Thus, we called the method topical feeding. We targeted the abnormal wing disc gene (awd), also called nucleoside diphosphate kinase (NDPK), as a reporter gene to prove the uptake of dsRNA via this method of delivery. Our results showed that dsRNA-awd caused reduction of awd expression and nymph mortality. Survival and lifespan of adults emerged from treated nymphs and treated adults were affected. Silencing awd caused wing malformation in the adults emerged from treated nymphs. Topical feeding as a delivery of dsRNA is highly efficient for both nymphs and adults. The described method could be used to increase the efficiency of RNAi in D. citri and other sap piercing-sucking hemipterans. © 2017 Wiley Periodicals, Inc.

Hypoxia-inducible bidirectional shRNA expression vector delivery using PEI/chitosan-TBA copolymers for colorectal Cancer gene therapy.

PubMed

Javan, Bita; Atyabi, Fatemeh; Shahbazi, Majid

2018-06-01

This investigation was conducted to construct a hypoxia/colorectal dual-specific bidirectional short hairpin RNA (shRNA) expression vector and to transfect it into the colon cancer cell line HT-29 with PEI/chitosan-TBA nanoparticles for the simultaneous knock down of β-catenin and Bcl-2 under hypoxia. To construct a pRNA-bipHRE-CEA vector, the carcinoma embryonic antigen (CEA) promoter designed in two directions and the vascular endothelial growth factor (VEGF) enhancer were inserted between two promoters for hypoxic cancer specific gene expression. To confirm the therapeutic effect of the dual-specific vector, β-catenin and Bcl-2 shRNAs were inserted downstream of each promoter. The physicochemical properties, the cytotoxicity, and the transfection efficiency of these PEI/chitosan-TBA nanoparticles were investigated. In addition, the antitumor effects of the designed vector on the expression of β-catenin and Bcl-2, cell cycle distribution, and apoptosis were investigated in vitro. The silencing effect of the hypoxia-response shRNA expression vector was relatively low (18%-25%) under normoxia, whereas it was significantly increased to approximately 50%-60% in the HT-29 cell line. Moreover, the cancer cells showed significant G0/G1 arrest and increased apoptosis due to gene silencing under hypoxia. Furthermore, MTS assay, fluorescence microscopy images, and flow cytometry analyses confirmed that the PEI/chitosan-TBA blend system provided effective transfection with low cytotoxicity. This novel hypoxia-responsive shRNA expression vector may be useful for RNA interference (RNAi)-based cancer gene therapy in hypoxic colorectal tumors. Moreover, the PEI/chitosan-TBA copolymer might be a promising gene carrier for use in gene transfer in vivo. Copyright © 2018. Published by Elsevier Inc.

Adenovirus-mediated interference of FABP4 regulates mRNA expression of ADIPOQ, LEP and LEPR in bovine adipocytes.

PubMed

Wei, S; Zan, L S; Wang, H B; Cheng, G; Du, M; Jiang, Z; Hausman, G J; McFarland, D C; Dodson, M V

2013-02-27

Fatty acid binding protein 4 (FABP4) is an important adipocyte gene, with roles in fatty acid transport and fat deposition in animals as well as human metabolic syndrome. However, little is known about the functional regulation of FABP4 at the cellular level in bovine. We designed and selected an effective shRNA (small hairpin RNA) against bovine FABP4, constructed a corresponding adenovirus (AD-FABP4), and then detected its influence on mRNA expression of four differentiation-related genes (PPAR(y), CEBPA, CEBPB, and SREBF1) and three lipid metabolism-related genes (ADIPOQ, LEP and LEPR) of adipocytes. The FABP4 mRNA content, derived from bovine adipocytes, decreased by 41% (P < 0.01) after 24 h and 66% (P < 0.01) after 72 h of AD-FABP4 infection. However, lower mRNA content of FABP4 did not significantly alter levels of differentiation-related gene expression at 24 h following AD-FABP4 treatment of bovine-derived preadipocytes (P = 0.54, 0.78, 0.89, and 0.94, respectively). Meanwhile, knocking down (partially silencing) FABP4 significantly decreased ADIPOQ (P < 0.05) and LEP (P < 0.01) gene expression after 24 h of AD-FABP4 treatment, decreased ADIPOQ (P < 0.01) and LEP (P < 0.01) gene expression, but increased LEPR mRNA expression (P < 0.01) after a 72-h treatment of bovine preadipocytes. We conclude that FABP4 plays a role in fat deposition and metabolic syndrome by regulating lipid metabolism-related genes (such as ADIPOQ, LEP and LEPR), without affecting the ability of preadipocytes to differentiate into adipocytes.

Targeted nanobubbles in low-frequency ultrasound-mediated gene transfection and growth inhibition of hepatocellular carcinoma cells.

PubMed

Wu, Bolin; Qiao, Qiang; Han, Xue; Jing, Hui; Zhang, Hao; Liang, Hongjian; Cheng, Wen

2016-09-01

The use of SonoVue combined with ultrasound exposure increases the transfection efficiency of short interfering RNA (siRNA). The objective of this study was to prepare targeted nanobubbles (TNB) conjugated with NET-1 siRNA and an antibody GPC3 to direct nanobubbles to hepatocellular carcinoma cells. SMMC-7721 human hepatocellular carcinoma cells were treated with six different groups. The transfection efficiency and cellular apoptosis were measured by flow cytometry. The protein and messenger RNA (mRNA) expression were measured by Western blot and quantitative real-time PCR, respectively. The migration and invasion potential of the cells were determined by Transwell analysis. The results show that US-guided siRNA-TNB transfection effectively enhanced gene silencing. In summary, siRNA-TNB may be an effective delivery vector to mediate highly effective RNA interference in tumor treatment.

Small interfering ribonucleic acid induces liquid-to-ripple phase transformation in a phospholipid membrane

DOE Office of Scientific and Technical Information (OSTI.GOV)

Choubey, Amit; Nomura, Ken-ichi; Kalia, Rajiv K.

Small interfering ribonucleic acid (siRNA) molecules play a pivotal role in silencing gene expression via the RNA interference mechanism. A key limitation to the widespread implementation of siRNA therapeutics is the difficulty of delivering siRNA-based drugs to cells. Here, we examine changes in the structure and dynamics of a dipalmitoylphosphatidylcholine bilayer in the presence of a siRNA molecule and mechanical barriers to siRNA transfection in the bilayer. Our all-atom molecular dynamics simulation shows that siRNA induces a liquid crystalline-to-ripple phase transformation in the bilayer. The ripple phase consists of a major region of non-interdigitated and a minor region of interdigitatedmore » lipid molecules with an intervening kink. In the ripple phase, hydrocarbon chains of lipid molecules have large compressive stresses, which present a considerable barrier to siRNA transfection.« less

Silencing of Y-box binding protein-1 by RNA interference inhibits proliferation, invasion, and metastasis, and enhances sensitivity to cisplatin through NF-κB signaling pathway in human neuroblastoma SH-SY5Y cells.

PubMed

Wang, Hong; Sun, Ruowen; Chi, Zuofei; Li, Shuang; Hao, Liangchun

2017-09-01

Y-box binding protein-1 (YB-1), a member of Y-box protein family binding DNA and RNA, has been proposed as a novel marker in multiple malignant tumors and found to be associated with tumor malignancy. Neuroblastoma is an embryonal tumor arising from neuroblast cells of the autonomic nervous system, which is the most common cancer diagnosed in infants. It has been reported that YB-1 is highly expressing in various human tumors including nasopharynx, thyroid, lung, breast, colon, ovary, and prostate cancers. This study aimed to investigate the functional role of YB-1 in neuroblastoma by silencing YB-1 using RNA interference (shRNA) in neuroblastoma SH-SY5Y cells. We found that silencing of YB-1 decreased the proliferation, migration, and invasion of SH-SY5Y cells. At molecular level, inhibition of YB-1 decreased the expression level of PCNA as well as MMP-2 in neuroblastoma SH-SY5Y cells. Also, we discovered that YB-1 silencing sensitized SH-SY5Y cells to cisplatin and promoted the apoptosis induced by cisplatin due to down-regulation of multidrug resistance (MDR) 1 protein via NF-κB signaling pathway. Therefore, we consider that targeting YB-1 is promising for neuroblastoma treatment and for overcoming its cisplatin resistance in the development of new neuroblastoma therapeutic strategies.

Cellular La protein shields nonsegmented negative-strand RNA viral leader RNA from RIG-I and enhances virus growth by diverse mechanisms.

PubMed

Bitko, Vira; Musiyenko, Alla; Bayfield, Mark A; Maraia, Richard J; Barik, Sailen

2008-08-01

The La antigen (SS-B) associates with a wide variety of cellular and viral RNAs to affect gene expression in multiple systems. We show that La is the major cellular protein found to be associated with the abundant 44-nucleotide viral leader RNA (leRNA) early after infection with respiratory syncytial virus (RSV), a nonsegmented negative-strand RNA virus. Consistent with this, La redistributes from the nucleus to the cytoplasm in RSV-infected cells. Upon RNA interference knockdown of La, leRNA is redirected to associate with the RNA-binding protein RIG-I, a known activator of interferon (IFN) gene expression, and this is accompanied by the early induction of IFN mRNA. These results suggest that La shields leRNA from RIG-I, abrogating the early viral activation of type I IFN. We mapped the leRNA binding function to RNA recognition motif 1 of La and showed that while wild-type La greatly enhanced RSV growth, a La mutant defective in RSV leRNA binding also did not support RSV growth. Comparative studies of RSV and Sendai virus and the use of IFN-negative Vero cells indicated that La supports the growth of nonsegmented negative-strand RNA viruses by both IFN suppression and a potentially novel IFN-independent mechanism.

Reduced expression of selective immune-related genes in silver catfish (Rhamdia quelen) monocytes exposed to atrazine.

PubMed

Kirsten, Karina Schreiner; Canova, Raíssa; Soveral, Lucas de Figueiredo; Friedrich, Maria Tereza; Frandoloso, Rafael; Kreutz, Luiz Carlos

2017-05-01

The effect of atrazine (ATZ) and its metabolites on aquatic vertebrate species has been a matter of concern to researchers and environmentalist. In this study we exposed head kidney monocytes to sublethal concentrations of atrazine (1 and 10 μg/ml -1 ), corresponding to 1% and 10% of the LC 50-96h , to evaluate the expression of immune-related genes central to immune stimulation. The mRNA levels of TNF-α, Mieloperoxidase and Mx genes were significantly reduced following 24 h exposure to both concentrations of ATZ. The mRNA levels of iRAK4 were reduced only at the higher ATZ concentration and the mRNA levels of IL-1β were not affected. The results reported here support our previous findings on the immunosuppressive effect of ATZ indicating its potential to interfere with the expression of immune-related genes, and strengthen the need to regulate ATZ usage aiming to preserve animal and human health. Copyright © 2017 Elsevier Ltd. All rights reserved.

Nogo-B regulates migration and contraction of airway smooth muscle cells by decreasing ARPC 2/3 and increasing MYL-9 expression.

PubMed

Xu, Wujian; Hong, Weijun; Shao, Yan; Ning, Yunye; Cai, Zailong; Li, Qiang

2011-01-21

Abnormal proliferation, apoptosis, migration and contraction of airway smooth muscle (ASM) cells in airway remodeling in asthma are basically excessive repair responses to a network of inflammatory mediators such as PDGF, but the mechanisms of such responses remain unclear. Nogo-B, a member of the reticulum family 4(RTN4), is known to play a key role in arteriogenesis and tissue repair. Further studies are needed to elucidate the role of Nogo-B in airway smooth muscle abnormalities. A mouse model of chronic asthma was established by repeated OVA inhalation and subjected to Nogo-B expression analysis using immunohistochemistry and Western Blotting. Then, primary human bronchial smooth muscle cells (HBSMCs) were cultured in vitro and a siRNA interference was performed to knockdown the expression of Nogo-B in the cells. The effects of Nogo-B inhibition on PDGF-induced HBSMCs proliferation, migration and contraction were evaluated. Finally, a proteomic analysis was conducted to unveil the underlying mechanisms responsible for the function of Nogo-B. Total Nogo-B expression was approximately 3.08-fold lower in chronic asthmatic mice compared to naïve mice, which was obvious in the smooth muscle layer of the airways. Interference of Nogo-B expression by siRNA resulted nearly 96% reduction in mRNA in cultured HBSMCs. In addition, knockdown of Nogo-B using specific siRNA significantly decreased PDGF-induced migration of HBSMCs by 2.3-fold, and increased the cellular contraction by 16% compared to negative controls, but had limited effects on PDGF-induced proliferation. Furthermore, using proteomic analysis, we demonstrate that the expression of actin related protein 2/3 complex subunit 5 (ARPC 2/3) decreased and, myosin regulatory light chain 9 isoform a (MYL-9) increased after Nogo-B knockdown. These data define a novel role for Nogo-B in airway remodeling in chronic asthma. Endogenous Nogo-B, which may exert its effects through ARPC 2/3 and MYL-9, is necessary for the migration and contraction of airway smooth muscle cells.

Targeted Silencing of MART-1 Gene Expression by RNA Interference Enhances the Migration Ability of Uveal Melanoma Cells

PubMed Central

Zhang, Yidan; Jia, Renbing; Wang, Jing; Xu, Xiaofang; Yao, Yuting; Ge, Shengfan; Fan, Xianqun

2013-01-01

Uveal melanoma (UM) is the most common primary intraocular malignancy and the leading potentially fatal primary intraocular disease in adults. Melanoma antigen recognized by T-cells (MART-1) has been studied extensively as a clinically important diagnostic marker for melanoma, however, its biological function remains unclear. In the present study, the UM cell line SP6.5, which showed a high level of MART-1 expression, was subjected to small interfering RNA-mediated silencing of MART-1. Silencing of MART-1 expression increased the migration ability of SP6.5 cells and down-regulated the expression of the metastasis suppressor NM23. Our results suggest that MART-1 is a candidate target for the development of therapeutic strategies for UM and in particular for the suppression of metastasis associated with this malignancy. PMID:23877836

RNA interference of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO1 and ACO2) genes expression prolongs the shelf life of Eksotika (Carica papaya L.) papaya fruit.

PubMed

Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom; Yeong, Wee Chien; Pillai, Vilasini

2014-06-19

The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6). Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.

The double-stranded RNA binding protein RDE-4 can act cell autonomously during feeding RNAi in C. elegans.

PubMed

Raman, Pravrutha; Zaghab, Soriayah M; Traver, Edward C; Jose, Antony M

2017-08-21

Long double-stranded RNA (dsRNA) can silence genes of matching sequence upon ingestion in many invertebrates and is therefore being developed as a pesticide. Such feeding RNA interference (RNAi) is best understood in the worm Caenorhabditis elegans, where the dsRNA-binding protein RDE-4 initiates silencing by recruiting an endonuclease to process long dsRNA into short dsRNA. These short dsRNAs are thought to move between cells because muscle-specific rescue of rde-4 using repetitive transgenes enables silencing in other tissues. Here, we extend this observation using additional promoters, report an inhibitory effect of repetitive transgenes, and discover conditions for cell-autonomous silencing in animals with tissue-specific rescue of rde-4. While expression of rde-4(+) in intestine, hypodermis, or neurons using a repetitive transgene can enable silencing also in unrescued tissues, silencing can be inhibited wihin tissues that express a repetitive transgene. Single-copy transgenes that express rde-4(+) in body-wall muscles or hypodermis, however, enable silencing selectively in the rescued tissue but not in other tissues. These results suggest that silencing by the movement of short dsRNA between cells is not an obligatory feature of feeding RNAi in C. elegans. We speculate that similar control of dsRNA movement could modulate tissue-specific silencing by feeding RNAi in other invertebrates. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

RNA interference targeting E637K mutation rescues hERG channel currents and restores its kinetic properties.

PubMed

Lu, Xiaoli; Yang, Xi; Huang, Xiaoyan; Huang, Chen; Sun, Huan Huan; Jin, Lihua; Xu, Weifeng; Mao, Haiyan; Guo, Junming; Zhou, Jianqing; Lian, Jiangfang

2013-01-01

Long QT syndrome (LQTS) is a monogenic proarrhythmic disorder that predisposes affected individuals to sudden death from tachyarrhythmia. As an inherited disease, LQTS cannot be completely cured by conventional treatment modalities. Individualized gene therapy is a promising therapeutic approach. The purpose of this study was to investigate the role of small interference RNA (siRNA) on expression of E637K-hERG (human ether-a-go-go-related gene) mutant and whether it can be used to rescue the mutant's dominant-negative suppressive effects on hERG protein channel function. Western blot was performed to select the most sensitive siRNAs to target E637K-hERG mutant knockdown. Confocal laser scanning microscope was performed to monitor cellular localization of wild-type (WT)-hERG and E637K-hERG with or without siRNA. Patch-clamp technique was used to assess the effect of siRNA on the electrophysiologic characteristics of the rapidly activating delayed rectifier K(+) current I(Kr) of the hERG protein channel. siRNA led to a significant decrease in the level of E637K-hERG protein but did not affect the level of WT-hERG protein. WT-hERG localization in cells coexpressing E637K-hERG mutant was restored to the membrane by siRNA. The siRNA-mediated inhibition of E637K-hERG mutant restored the maximum current and tail current amplitudes. Furthermore, siRNA treatment rescued the kinetic properties of WT/E637K-hERG protein channel to a level comparable to that of WT-hERG protein channel. Our findings illustrated that siRNA can effectively inhibit E637K-hERG protein expression and rescue the dominant-negative effect of this mutation by restoring the kinetic properties of hERG protein channel. It has potential clinical implications with regard to the possibility of using siRNA in the treatment of LQTS. Copyright © 2013 Heart Rhythm Society. All rights reserved.

Establishment of conditional vectors for hairpin siRNA knockdowns

PubMed Central

Matsukura, Shiro; Jones, Peter A.; Takai, Daiya

2003-01-01

Small interference RNA (siRNA) is an emerging methodology in reverse genetics. Here we report the development of a new tetracycline-inducible vector-based siRNA system, which uses a tetracycline-responsive derivative of the U6 promoter and the tetracycline repressor for conditional in vivo transcription of short hairpin RNA. This method prevents potential lethality immediately after transfection of a vector when the targeted gene is indispensable, or the phenotype of the knockdown is lethal or results in a growth abnormality. We show that the controlled knockdown of DNA methyltransferase 1 (DNMT1) in human cancer resulted in growth arrest. Removal of the inducer, doxycycline, from treated cells led to re-expression of the targeted gene. Thus the method allows for a highly controlled approach to gene knockdown. PMID:12888529

RNA therapeutics targeting osteoclast-mediated excessive bone resorption

PubMed Central

Wang, Yuwei; Grainger, David W

2011-01-01

RNA interference (RNAi) is a sequence-specific post-transcriptional gene silencing technique developed with dramatically increasing utility for both scientific and therapeutic purposes. Short interfering RNA (siRNA) is currently exploited to regulate protein expression relevant to many therapeutic applications, and commonly used as a tool for elucidating disease-associated genes. Osteoporosis and their associated osteoporotic fragility fractures in both men and women are rapidly becoming a global healthcare crisis as average life expectancy increases worldwide. New therapeutics are needed for this increasing patient population. This review describes the diversity of molecular targets suitable for RNAi-based gene knock-down in osteoclasts to control osteoclast-mediated excessive bone resorption. We identify strategies for developing targeted siRNA delivery and efficient gene silencing, and describe opportunities and challenges of introducing siRNA as a therapeutic approach to hard and connective tissue disorders. PMID:21945356

Tomato Spotted Wilt Virus NSs Protein Supports Infection and Systemic Movement of a Potyvirus and Is a Symptom Determinant

PubMed Central

Gabriel Peralta, Sergio M.; Harte-Maxwell, Patricia A.

2018-01-01

Plant viruses are inducers and targets of antiviral RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressor proteins that interfere with antiviral RNA silencing. The NSs protein is an RNA silencing suppressor in orthotospoviruses, such as the tomato spotted wilt virus (TSWV). The mechanism of RNA silencing suppression by NSs and its role in virus infection and movement are poorly understood. Here, we cloned and tagged TSWV NSs and expressed it from a GFP-tagged turnip mosaic virus (TuMV-GFP) carrying either a wild-type or suppressor-deficient (AS9) helper component proteinase (HC-Pro). When expressed in cis, NSs restored pathogenicity and promoted systemic infection of suppressor-deficient TuMV-AS9-GFP in Nicotiana benthamiana and Arabidopsis thaliana. Inactivating mutations were introduced in NSs RNA-binding domain one. A genetic analysis with active and suppressor-deficient NSs, in combination with wild-type and mutant plants lacking essential components of the RNA silencing machinery, showed that the NSs insert is stable when expressed from a potyvirus. NSs can functionally replace potyviral HC-Pro, condition virus susceptibility, and promote systemic infection and symptom development by suppressing antiviral RNA silencing through a mechanism that partially overlaps that of potyviral HC-Pro. The results presented provide new insight into the mechanism of silencing suppression by NSs and its effect on virus infection. PMID:29538326

Tomato Spotted Wilt Virus NSs Protein Supports Infection and Systemic Movement of a Potyvirus and Is a Symptom Determinant.

PubMed

Garcia-Ruiz, Hernan; Gabriel Peralta, Sergio M; Harte-Maxwell, Patricia A

2018-03-14

Plant viruses are inducers and targets of antiviral RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressor proteins that interfere with antiviral RNA silencing. The NSs protein is an RNA silencing suppressor in orthotospoviruses, such as the tomato spotted wilt virus (TSWV). The mechanism of RNA silencing suppression by NSs and its role in virus infection and movement are poorly understood. Here, we cloned and tagged TSWV NSs and expressed it from a GFP-tagged turnip mosaic virus (TuMV-GFP) carrying either a wild-type or suppressor-deficient (AS9) helper component proteinase (HC-Pro). When expressed in cis, NSs restored pathogenicity and promoted systemic infection of suppressor-deficient TuMV-AS9-GFP in Nicotiana benthamiana and Arabidopsis thaliana . Inactivating mutations were introduced in NSs RNA-binding domain one. A genetic analysis with active and suppressor-deficient NSs, in combination with wild-type and mutant plants lacking essential components of the RNA silencing machinery, showed that the NSs insert is stable when expressed from a potyvirus. NSs can functionally replace potyviral HC-Pro, condition virus susceptibility, and promote systemic infection and symptom development by suppressing antiviral RNA silencing through a mechanism that partially overlaps that of potyviral HC-Pro. The results presented provide new insight into the mechanism of silencing suppression by NSs and its effect on virus infection.

Differentially expressed microRNAs in lung adenocarcinoma invert effects of copy number aberrations of prognostic genes

PubMed Central

Tokar, Tomas; Pastrello, Chiara; Ramnarine, Varune R.; Zhu, Chang-Qi; Craddock, Kenneth J.; Pikor, Larrisa A.; Vucic, Emily A.; Vary, Simon; Shepherd, Frances A.; Tsao, Ming-Sound; Lam, Wan L.; Jurisica, Igor

2018-01-01

In many cancers, significantly down- or upregulated genes are found within chromosomal regions with DNA copy number alteration opposite to the expression changes. Generally, this paradox has been overlooked as noise, but can potentially be a consequence of interference of epigenetic regulatory mechanisms, including microRNA-mediated control of mRNA levels. To explore potential associations between microRNAs and paradoxes in non-small-cell lung cancer (NSCLC) we curated and analyzed lung adenocarcinoma (LUAD) data, comprising gene expressions, copy number aberrations (CNAs) and microRNA expressions. We integrated data from 1,062 tumor samples and 241 normal lung samples, including newly-generated array comparative genomic hybridization (aCGH) data from 63 LUAD samples. We identified 85 “paradoxical” genes whose differential expression consistently contrasted with aberrations of their copy numbers. Paradoxical status of 70 out of 85 genes was validated on sample-wise basis using The Cancer Genome Atlas (TCGA) LUAD data. Of these, 41 genes are prognostic and form a clinically relevant signature, which we validated on three independent datasets. By meta-analysis of results from 9 LUAD microRNA expression studies we identified 24 consistently-deregulated microRNAs. Using TCGA-LUAD data we showed that deregulation of 19 of these microRNAs explains differential expression of the paradoxical genes. Our results show that deregulation of paradoxical genes is crucial in LUAD and their expression pattern is maintained epigenetically, defying gene copy number status. PMID:29507679

RNA interference of two glutathione S-transferase genes, Diaphorina citri DcGSTe2 and DcGSTd1, increases the susceptibility of Asian citrus psyllid (Hemiptera: Liviidae) to the pesticides fenpropathrin and thiamethoxam.

PubMed

Yu, Xiudao; Killiny, Nabil

2018-03-01

The Asian citrus psyllid, Diaphorina citri Kuwayama, is an important agricultural pest of citrus globally. Foliar application of chemical insecticides is the most widely used option for reducing D. citri populations. Knockdown of glutathione S-transferase (GST) in several insect species leads to increased susceptibility to insecticides; however, information about the detoxifying role of GST genes in D. citri is unavailable. Via a sequence homology search, we isolated and characterized three DcGST genes (DcGSTd1, DcGSTe1 and DcGSTe2) from D. citri. Phylogenetic analysis grouped DcGSTd1 into the delta class of GST genes, whereas DcGSTe1 and DcGSTe2 were clustered in the epsilon clade. Gene expression analysis revealed that chlorpyrifos treatment increased the mRNA levels of DcGSTe1 and fenpropathrin enhanced the expression level of DcGSTd1, while DcGSTe2 was significantly up-regulated after exposure to thiamethoxam at a dose of 30% lethal concentration (LC30). RNA interference (RNAi) of DcGSTe2 and DcGSTd1 followed by an insecticide bioassay increased the mortalities of thiamethoxam-treated psyllids by 23.0% and fenpropathrin-treated psyllids by 15.0%. In contrast, knockdown of DcGSTe1 did not significantly increase the susceptibility of D. citri to any of these three insecticides. Further, feeding with double-stranded RNA (dsDcGSTe2-d1) interfusion co-silenced DcGSTe2 and DcGSTd1 expression in D. citri, and led to an increase of susceptibility to both fenpropathrin and thiamethoxam. The findings suggest that DcGSTe2 and DcGSTd1 play unique roles in detoxification of the pesticides thiamethoxam and fenpropathrin. In addition, co-silencing by creating a well-designed dsRNA interfusion against multiple genes was a good RNAi strategy in D. citri. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Interference with endogenous EZH2 reverses the chemotherapy drug resistance in cervical cancer cells partly by up-regulating Dicer expression.

PubMed

Cai, Liqiong; Wang, Zehua; Liu, Denghua

2016-05-01

Cervical cancer is one of the most common female malignancies in the world, and chemotherapeutic drug resistance is a major obstacle to cancer therapy. Enhancer of zeste homolog 2 (EZH2) is an enzymatic subunit of polycomb repressive complex 2 (PRC2) and catalyzes the repressive histone H3 lysine 27 trimethylation (H3K27me3). However, the role of EZH2 on the chemotherapy drug resistance in cervical cancers remains unclear. In the present study, the cervical carcinoma specimens and paired normal tissue specimens were obtained and the expression of EZH2 was detected by western blotting. The results showed that high levels of EZH2 were detected in cervical carcinoma tissues, compared with paired control tissues (**p < 0.01). Next, three pairs of shRNA specific to EZH2 were designed and used to interfere with endogenous EZH2 expression. Cell viability was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays following treatment with various concentrations of cisplatin in HeLa and HeLa/DDP cells. The MTT assay results showed that knockdown of EZH2 in HeLa/DDP cells caused a 2.29- or 1.83-fold decrease in the cisplatin IC50 values (for shRNA1-EZH2, 34.88 vs. 15.21 μg/mL; p < 0.01; for shRNA3-EZH2, 34.88 vs. 19.09 μg/mL; p < 0.01). The EZH2 activity was also suppressed by 3-deazaneplanocin A (DZNep), EZH2 inhibitor, and the results demonstrated that, meanwhile, DZNep potently inhibited cell viability of HeLa/DDP cells, partly by suppression the levels of EZH2 and H3K27me3, but not H3K27me2, which was detected by western blotting analysis. Moreover, cell migration assay results showed that knockdown of EZH2 decreased cell metastasis of cervical cancer cells. Furthermore, cell cycle was detected by fluorescence-activated cell sorting (FACS) assay and the results demonstrated that interference with EZH2 expression increased the percentage of cells at G0/G1 phase and the HeLa/DDP cells were blocked at G0/G1 phase. Interestingly, western blotting results revealed that higher expression of EZH2 was related with lower level of Dicer in HeLa/DDP cells. Finally, in vivo tumorigenicity experiments results demonstrated that interference with endogenous EZH2 by shRNA specific to EZH2 or inhibition EZH2 by DZNep could significantly increase antitumor effects in nude mice. Thus, inhibiting the levels of endogenous EZH2 effectively reversed the cisplatin resistance and increased the cisplatin sensitivity in cisplatin-resistant HeLa/DDP cells. EZH2 might be a potential target for treating chemotherapeutic drug-resistant cervical cancers.

Renewing the Assault on mRNA

PubMed Central

McCAIN, JACK

2004-01-01

Mammalian cells dislike double-stranded RNA. They interpret it as a sign of an intruder, and they can unleash a recently discovered defensive mechanism to deal with the problem – they chop the invader into little pieces and use the remnants, called small interfering RNA, to identify and destroy the invader and its progeny. This process, known as RNA interference, may lend itself to new treatments for a wide range of diseases. RNA interference, however, resembles two therapies studied during the 1990s, antisense and ribozymes, in that the gene-silencing target is messenger RNA (mRNA). Is RNA interference really the Next Big Thing – or just a variation on an older but still intriguing theme? PMID:23372488

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis

PubMed Central

Santangeloyz, K.S.; Bertoneyz, A.L.

2011-01-01

summary Objective To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Methods Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RTPCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2−ΔΔCT) method. Results Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P= 0.0045) or >90% (P= 0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Conclusions Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. PMID:21945742

A yeast model for the mechanism of the Epstein-Barr virus immune evasion identifies a new therapeutic target to interfere with the virus stealthiness.

PubMed

Lista, María José; Martins, Rodrigo Prado; Angrand, Gaelle; Quillévéré, Alicia; Daskalogianni, Chrysoula; Voisset, Cécile; Teulade-Fichou, Marie-Paule; Fåhraeus, Robin; Blondel, Marc

2017-08-31

The oncogenic Epstein-Barr virus (EBV) evades the immune system but has an Achilles heel: its genome maintenance protein EBNA1. Indeed, EBNA1 is essential for viral genome replication and maintenance but also highly antigenic. Hence, EBV evolved a system in which the glycine-alanine repeat (GAr) of EBNA1 limits the translation of its own mRNA at a minimal level to ensure its essential function thereby, at the same time, minimizing immune recognition. Defining intervention points where to interfere with EBNA1 immune evasion is an important step to trigger an immune response against EBV-carrying cancers. Thanks to a yeast-based assay that recapitulates all the aspects of EBNA1 self-limitation of expression, a recent study by Lista et al. [Nature Communications (2017) 7, 435-444] has uncovered the role of the host cell nucleolin (NCL) in this process via a direct interaction of this protein with G-quadruplexes (G4) formed in GAr-encoding sequence of EBNA1 mRNA. In addition, the G4 ligand PhenDC3 prevents NCL binding on EBNA1 mRNA and reverses GAr-mediated repression of translation and antigen presentation. This shows that the NCL-EBNA1 mRNA interaction is a relevant therapeutic target to unveil EBV-carrying cancers to the immune system and that the yeast model can be successfully used for uncovering drugs and host factors that interfere with EBV stealthiness.

Three newly identified galectin homologues from triangle sail mussel (Hyriopsis cumingii) function as potential pattern-recognition receptors.

PubMed

Zhao, Ling-Ling; Hui, Kaimin; Wang, Yu-Qing; Wang, Yue; Ren, Qian; Li, Xin-Cang

2018-05-01

Galactoside-binding lectins, also known as galectins, play crucial roles in innate immune response in invertebrates. In this study, three cDNA sequences from Hyriopsis cumingii were identified and collectively called HcGalec genes. Each of the three deduced HcGalec proteins contained a galactose-binding lectin domain or a GLECT domain. All the three HcGalec genes are mainly present in the hepatopancreas and gills, and their expression is induced at 24 h after bacterial challenge. Three recombinant HcGalec proteins can bind and agglutinate (Ca 2+ -dependent) various microorganisms, including Gram-positive and Gram-negative bacteria. These proteins can attach to mannan and peptidoglycan. Meanwhile, the expression of the three HcGalec genes in the gills were significantly down-regulated after dsRNA interference (HcGalec1-RNAi, HcGalec2-RNAi, and HcGalec3-RNAi) and Vibrio parahaemolyticus injection. The expression levels of some antimicrobial peptides, including lysozyme 1 and lysozyme 2, were also markedly decreased after dsRNA interference. Overall, these results suggested that these three HcGalec proteins may function as potential receptors participating in the innate immune responses of H. cumingii against bacterial infection. Copyright © 2018 Elsevier Ltd. All rights reserved.

[The effect of 5-HD on expression of PKC-alpha in rats of chronic hypoxic pulmonary hypertension].

PubMed

Shu, Ying; Li, Qiu; Li, Yun-lei; Zhang, Li-ping; Chen, Cheng-shui

2011-08-01

To investigate the effect of mito chondrial K(ATP) channels (mitoK(ATP)) inhibitor 5-hydroxydecanoate(5-HD) on chronic hypoxic pulmonary artery hypertension (CHPAH) rats and its underlying mechanisms. Forty-eight male SD rats were equally divided into 4 groups randomly (n=12): normal group, hypoxia group, hypoxia + 5-HD group, hypoxia + Diazoxide group. Except the first group, the other three groups were put into hypoxic [O2 (10.0% +/- 0.3%] and nonrmobaric chamber for four weeks to establish chronic hypoxic model and received different interference. When the interference completed, right heart catheter was used to detect the mean pulmonary arterial pressure (mPAP) of each rat and PKC-alpha mRNA expression in pulmonary arteries was detected by reverse transcription-polymerase chain reaction (RT-PCR) and protein expression by Western blot. (mPAP was much higher in hypoxia group than that in normal group (P < 0.01) while in hypoxia + 5-HD group and hypoxia + diazoxide were decreased significantly compared to hypoxia group (P < 0.01). (2) The protein and mRNA levels of PKC-alpha in the hypoxic group were higher than those in normal group (P < 0.05). 5-HD plays a protective role on CHPAH. The mechanism of its effect may be attributed to inhibiting MitoK(ATP).

The clock gene cycle plays an important role in the circadian clock of the cricket Gryllus bimaculatus.

PubMed

Uryu, Outa; Karpova, Svetlana G; Tomioka, Kenji

2013-07-01

To dissect the molecular oscillatory mechanism of the circadian clock in the cricket Gryllus bimaculatus, we have cloned a cDNA of the clock gene cycle (Gb'cyc) and analyzed its structure and function. Gb'cyc contains four functional domains, i.e. bHLH, PAS-A, PAS-B and BCTR domains, and is expressed rhythmically in light dark cycles, peaking at mid night. The RNA interference (RNAi) of Clock (Gb'Clk) and period (Gb'per) reduced the Gb'cyc mRNA levels and abolished the rhythmic expression, suggesting that the rhythmic expression of Gb'cyc is regulated by a mechanism including Gb'Clk and Gb'per. These features are more similar to those of mammalian orthologue of cyc (Bmal1) than those of Drosophila cyc. A single treatment with double-stranded RNA (dsRNA) of Gb'cyc effectively knocked down the Gb'cyc mRNA level and abolished its rhythmic expression. The cyc RNAi failed to disrupt the locomotor rhythm, but lengthened its free-running period in constant darkness (DD). It is thus likely that Gb'cyc is involved in the circadian clock machinery of the cricket. The cyc RNAi crickets showed a rhythmic expression of Gb'per and timeless (Gb'tim) in the optic lobe in DD, explaining the persistence of the locomotor rhythm. Surprisingly, cyc RNAi revealed a rhythmic expression of Gb'Clk in DD which is otherwise rather constitutively expressed in the optic lobe. These facts suggest that the cricket might have a unique clock oscillatory mechanism in which both Gb'cyc and Gb'Clk are rhythmically controlled and that under abundant expression of Gb'cyc the rhythmic expression of Gb'Clk may be concealed. Copyright © 2013 Elsevier Ltd. All rights reserved.

Quantitative Evaluation of Myostatin Gene in Stably Transfected Caprine Fibroblast Cells by Anti-Myostatin shRNA.

PubMed

Jain, Sudhir Kumar; Jain, Hemlata; Kumar, Dharmendra; Bedekar, Megha Kadam; Pandey, Akhilesh Kumar; Sarkhel, Bikash Chandra

2015-09-01

Skeletal muscle is the major component of lean tissue that is used for consumption, and myostatin is a negative regulator of skeletal muscle growth. Downregulation of this gene therefore offers a strategy for developing superior animals with enhanced muscle growth. Knockdown of myostatin was achieved by RNA interference technology. The anti-myostatin shRNA were designed and stably transfected in caprine fibroblast cells. The reduced expression of target gene was achieved and measured in clonal fibroblast cells by real-time PCR. Two single-cell clones induced significant decrease of myostatin gene expression by 73.96 and 72.66 %, respectively (P < 0.05). To ensure the appropriate growth of transfected cell, seven media were tested. The best suited media was used for transfected fibroblast cell proliferation. The findings suggest that shRNA provides a novel potential tool for gene knockdown and these stably transfected cells can be used as the donor cells for animal cloning.

Global effects of the CSR-1 RNA interference pathway on transcriptional landscape

PubMed Central

Cecere, Germano; Hoersch, Sebastian; O’Keeffe, Sean; Sachidanandam, Ravi; Grishok, Alla

2014-01-01

Argonaute proteins and their small RNA co-factors short interfering RNAs (siRNAs) are known to inhibit gene expression at the transcriptional and post-transcriptional levels. In Caenorhabditis elegans, the Argonaute CSR-1 binds thousands of endogenous siRNAs (endo-siRNAs) antisense to germline transcripts and associates with chromatin in a siRNA-dependent manner. However, its role in gene expression regulation remains controversial. Here, we used a genome-wide profiling of nascent RNA transcripts to demonstrate that the CSR-1 RNAi pathway promotes sense-oriented Pol II transcription. Moreover, a loss of CSR-1 function resulted in global increase in antisense transcription and ectopic transcription of silent chromatin domains, which led to reduced chromatin incorporation of centromere-specific histone H3. Based on these findings, we propose that the CSR-1 pathway has a role in maintaining the directionality of active transcription thereby propagating the distinction between transcriptionally active and silent genomic regions. PMID:24681887

Mitochondrial Effects of PGC-1alpha Silencing in MPP+ Treated Human SH-SY5Y Neuroblastoma Cells

PubMed Central

Ye, Qinyong; Chen, Chun; Si, Erwang; Cai, Yousheng; Wang, Juhua; Huang, Wanling; Li, Dongzhu; Wang, Yingqing; Chen, Xiaochun

2017-01-01

The dopaminergic neuron degeneration and loss that occurs in Parkinson’s disease (PD) has been tightly linked to mitochondrial dysfunction. Although the aged-related cause of the mitochondrial defect observed in PD patients remains unclear, nuclear genes are of potential importance to mitochondrial function. Human peroxisome proliferator-activated receptor γ coactivator-1alpha (PGC-1α) is a multi-functional transcription factor that tightly regulates mitochondrial biogenesis and oxidative capacity. The goal of the present study was to explore the potential pathogenic effects of interference by the PGC-1α gene on N-methyl-4-phenylpyridinium ion (MPP+)-induced SH-SY5Y cells. We utilized RNA interference (RNAi) technology to probe the pathogenic consequences of inhibiting PGC-1α in the SH-SY5Y cell line. Remarkably, a reduction in PGC-1α resulted in the reduction of mitochondrial membrane potential, intracellular ATP content and intracellular H2O2 generation, leading to the translocation of cytochrome c (cyt c) to the cytoplasm in the MPP+-induced PD cell model. The expression of related proteins in the signaling pathway (e.g., estrogen-related receptor α (ERRα), nuclear respiratory factor 1 (NRF-1), NRF-2 and Peroxisome proliferator-activated receptor γ (PPARγ)) also decreased. Our finding indicates that small interfering RNA (siRNA) interference targeting the PGC-1α gene could inhibit the function of mitochondria in several capacities and that the PGC-1α gene may modulate mitochondrial function by regulating the expression of ERRα, NRF-1, NRF-2 and PPARγ. Thus, PGC-1α can be considered a potential therapeutic target for PD. PMID:28611589

Establishment of Functional Genomics Pipeline in Mouse Epiblast-Like Tissue by Combining Transcriptomic Analysis and Gene Knockdown/Knockin/Knockout, Using RNA Interference and CRISPR/Cas9.

PubMed

Takata, Nozomu; Sakakura, Eriko; Kasukawa, Takeya; Sakuma, Tetsushi; Yamamoto, Takashi; Sasai, Yoshiki

2016-06-01

The epiblast (foremost embryonic ectoderm) generates all three germ layers and therefore has crucial roles in the formation of all mammalian body cells. However, regulation of epiblast gene expression is poorly understood because of the difficulty of manipulating epiblast tissues in vivo. In the present study, using the self-organizing properties of mouse embryonic stem cell (ESC), we generated and characterized epiblast-like tissue in three-dimensional culture. We identified significant genome-wide gene expression changes in this epiblast-like tissue by transcriptomic analysis. In addition, we identified the particular significance of the Erk/Mapk and integrin-linked kinase pathways, and genes related to ectoderm/epithelial formation, using the bioinformatics resources IPA and DAVID. Here, we focused on Fgf5, which ranked in the top 10 among the discovered genes. To develop a functional analysis of Fgf5, we created an efficient method combining CRISPR/Cas9-mediated genome engineering and RNA interference (RNAi). Notably, we show one-step generation of various Fgf5 reporter lines including heterozygous and homozygous knockins (the GET method). For time- and dose-dependent depletion of fgf5 over the course of development, we generated an ESC line harboring Tol2 transposon-mediated integration of an inducible short hairpin RNA interference system (pdiRNAi). Our findings raised the possibility that Fgf/Erk signaling and apicobasal epithelial integrity are important factors in epiblast development. In addition, our methods provide a framework for a broad array of applications in the areas of mammalian genetics and molecular biology to understand development and to improve future therapeutics.

Mammalian genome-wide loss-of-function screens using arrayed small interfering RNA expression libraries.

PubMed

Zheng, Lianxing; Ding, Sheng

2004-04-01

Extract: RNA interference (RNAi), first discovered in Caenorhabdtitis elegans and now widely found and applied in a variety of organisms such as Drosophila, zebrafish and mammalian systems, has emerged to revolutionize the field of functional genomics by inducing specific and effective post-transcriptional gene silencing for loss-of-function studies. Mechanistic investigations of RNAi suggest that long double-stranded RNAs (dsRNAs) are first cleaved by the RNase III-like enzyme, Dicer, to 21-23 base pair (bp) small interfering RNAs (siRNAs). These siRNAs are resolved by ATP-dependent RNA helicase, and the resulting single-stranded RNAs are then incorporated into the RNA-induced silencing complex (RISC). The antisense strand of the siRNA duplex guides the RISC to the homologous mRNA, where the RISC-associated endoribonuclease cleaves the target mRNA, resulting in silencing of the target gene. The approach of using long dsRNA (up to 1-2 kb) in C. elegans and Drosophila to induce gene silencing cannot be similarly used in mammalian cells, where introduction of long dsRNA activates the dsRNA-dependent protein kinase PKR. PKR phosphorylates and inactivates the translation initiation factor eIF2, resulting in a non-specific gene-silencing effect. Development and implementation of the use of 21 to 23bp siRNAs, which can be prepared by chemical synthesis, in vitro transcription, or expressed in cells using siRNA expression systems, allows specific and effective gene silencing in mammalian cells to occur without activation of PKR.

Gene silencing in non-model insects: Overcoming hurdles using symbiotic bacteria for trauma-free sustainable delivery of RNA interference: Sustained RNA interference in insects mediated by symbiotic bacteria: Applications as a genetic tool and as a biocide.

PubMed

Whitten, Miranda; Dyson, Paul

2017-03-01

Insight into animal biology and development provided by classical genetic analysis of the model organism Drosophila melanogaster was an incentive to develop advanced genetic tools for this insect. But genetic systems for the over one million other known insect species are largely undeveloped. With increasing information about insect genomes resulting from next generation sequencing, RNA interference is now the method of choice for reverse genetics, although it is constrained by the means of delivery of interfering RNA. A recent advance to ensure sustained delivery with minimal experimental intervention or trauma to the insect is to exploit commensal bacteria for symbiont-mediated RNA interference. This technology not only offers an efficient means for RNA interference in insects in laboratory conditions, but also has potential for use in the control of human disease vectors, agricultural pests and pathogens of beneficial insects. © 2017 WILEY Periodicals, Inc.

Cyclophilin B is a functional regulator of hepatitis C virus RNA polymerase.

PubMed

Watashi, Koichi; Ishii, Naoto; Hijikata, Makoto; Inoue, Daisuke; Murata, Takayuki; Miyanari, Yusuke; Shimotohno, Kunitada

2005-07-01

Viruses depend on host-derived factors for their efficient genome replication. Here, we demonstrate that a cellular peptidyl-prolyl cis-trans isomerase (PPIase), cyclophilin B (CyPB), is critical for the efficient replication of the hepatitis C virus (HCV) genome. CyPB interacted with the HCV RNA polymerase NS5B to directly stimulate its RNA binding activity. Both the RNA interference (RNAi)-mediated reduction of endogenous CyPB expression and the induced loss of NS5B binding to CyPB decreased the levels of HCV replication. Thus, CyPB functions as a stimulatory regulator of NS5B in HCV replication machinery. This regulation mechanism for viral replication identifies CyPB as a target for antiviral therapeutic strategies.

A long noncoding RNA UCA1 promotes proliferation and predicts poor prognosis in glioma.

PubMed

Zhao, W; Sun, C; Cui, Z

2017-06-01

Acting as a proto-oncogene, long noncoding RNAs (lncRNAs) urothelial carcinoembryonic antigen 1 (UCA1) plays a key role in the occurrence and development of several human tumors. However, the expression and biological functions of UCA1 in glioma are less known. This study discussed the expression of UCA1 in glioma and its effect on the proliferation and cell cycle of glioma cells. LncRNA UCA1 expressions in 64 glioma samples (Grade I-II in 22 cases and Grade III-IV in 42 cases, according to WHO criteria) and 10 normal brain samples were detected using real-time fluorescence quantitative PCR. On this basis, the correlations of UCA1 to clinicopathological characteristics and prognosis of glioma were assessed. Then, using qPCR, the lncRNA UCA1 expressions in glioma cell lines and astrocytes were detected. UCA1-overexpressing glioma cell lines U87 and U251 were further detected after siRNA transfection of these two cell lines, and the impact on cell proliferation and cell cycle was assessed with CCK-8 (cell counting kit-8) assay and flow cytometry method (FCM), respectively. The expression of cyclin D1, a cell cycle-related protein, was detected using Western Blot. LncRNA UCA1 expression in the glioma samples was obviously higher as compared with the normal brain samples (P < 0.001), and the expression was correlated significantly with grading of the tumors (P < 0.05). However, lncRNA UCA1 expression was not correlated with age, gender, tumor size and KPS score (P > 0.05). After interference of UCA1 expression by siRNA transfection, the proliferation of both U251 and SHG-44 cells was inhibited (P < 0.05), with more cells arrested in G0/G1 (P < 0.05). Moreover, cyclin D1 expression was also downregulated considerably. LncRNA UCA1 can promote the proliferation and cell cycle progression of glioma cells by upregulating cyclin D1 transcription. So UCA1 may serve as an independent prognostic indicator and a novel therapeutic target for glioma.

Influence of silencing soluble epoxide hydrolase with RNA interference on cardiomyocytes apoptosis induced by doxorubicin.

PubMed

Du, Guangsheng; Lv, Jiagao; He, Li; Ma, Yexin

2011-06-01

In order to investigate the influence of silencing soluble epoxide hydrolase (sEH) with double-stranded small interfering RNA (siRNA) on cardiomyocytes apoptosis induced by doxorubicin (DOX), two plasmids containing siRNA sequences specific to sEH were constructed and transfected into the primary cultured cardiomyocytes by using FuGENE HD transfection agents. The mRNA and protein expression levels of sEH were detected by semiquantitative RT-PCR and Western blotting respectively, and the plasmids that silenced sEH most significantly were selected, and renamed EH-R. The plasmids carrying a nonspecific siRNA coding sequence (PCN) served as the negative control. Cardiomyocytes were divided into four groups: control group, DOX group, PCN+DOX group, and EH-R+DOX group. Apoptosis of cardiomyocytes was induced by DOX at a concentration of 1 μmol/L. Apoptosis rate of cardiomyocytes was determined by flow cytometery. The protein expression levels of Bcl-2 and Bax were detected by Western blotting. The results showed that the expression of sEH was down-regulated by EH-R plasmid. The expression levels of sEH mRNA and protein in the EH-R+DOX group were significantly decreased as compared with other groups (P<0.01). As compared with the control group, the apoptosis rate of cardiomyocytes in three DOX-treated groups was obviously increased, the expression levels of Bax increased, and those of Bcl-2 decreased (P<0.01). However, the expression levels of Bax were decreased, those of Bcl-2 increased and the apoptosis rate of cardiomyocytes obviously decreased in EH-R+DOX group when compared with those in the DOX group and the PCN+DOX group (P<0.01 for each). It was concluded that the recombinant plasmids could be successfully constructed, and transfected into the primary cultured cardiomyocytes. They could ameliorate the DOX-induced cardiomyocytes apoptosis by selectively inhibiting the expression of sEH with RNAi and increasing the expression of Bcl-2.

Generating Two-Dimensional Repertoire of siRNA Linc-ROR and siRNA mRNA ARF6 from the lincRNA-RoR/miR-145/ARF6 expression Pathway that involved in the progression of Triple Negative Breast Cancer

NASA Astrophysics Data System (ADS)

Aditya Parikesit, Arli; Nurdiansyah, Rizki

2018-01-01

The research for finding the cure for breast cancer is currently entering the interesting phase of the transcriptomics based method. With the application of Next Generation Sequencing (NGS), molecular information on breast cancer could be gathered. Thus, both in silico and wet lab research has determined that the role of lincRNA-RoR/miR-145/ARF6 expression Pathway could not be ignored as one of the cardinal starting points for Triple-Negative Breast Cancer (TNBC). As the most hazardous type of breast cancer, TNBC should be treated with the most advanced approach that available in the scientific community. Bioinformatics approach has found the possible siRNA-based drug candidates for TNBC. It was found that siRNA that interfere with lincRNA-ROR and mRNA ARF6 could be a feasible opportunity as the drug candidate for TNBC. However, this claim should be validated with more thorough thermodynamics and kinetics computational approach as the comprehensive way to comprehend their molecular repertoire. In this respect, the claim was validated using various tools such as the RNAfold server to determine the 2D structure, Barriers server to comprehend the RNA folding kinetics, RNAeval server to validate the siRNA-target interaction. It was found that the thermodynamics and kinetics repertoire of the siRNA are indeed rational and feasible. In this end, our computation approach has proven that our designed siRNA could interact with lincRNA-RoR/miR-145/ARF6 expression Pathway.

Anagrelide represses GATA-1 and FOG-1 expression without interfering with thrombopoietin receptor signal transduction.

PubMed

Ahluwalia, M; Donovan, H; Singh, N; Butcher, L; Erusalimsky, J D

2010-10-01

 Anagrelide is a selective inhibitor of megakaryocytopoiesis used to treat thrombocytosis in patients with chronic myeloproliferative disorders. The effectiveness of anagrelide in lowering platelet counts is firmly established, but its primary mechanism of action remains elusive.  Here, we have evaluated whether anagrelide interferes with the major signal transduction cascades stimulated by thrombopoietin in the hematopoietic cell line UT-7/mpl and in cultured CD34(+) -derived human hematopoietic cells. In addition, we have used quantitative mRNA expression analysis to assess whether the drug affects the levels of known transcription factors that control megakaryocytopoiesis.  In UT-7/mpl cells, anagrelide (1μm) did not interfere with MPL-mediated signaling as monitored by its lack of effect on JAK2 phosphorylation. Similarly, the drug did not affect the phosphorylation of STAT3, ERK1/2 or AKT in either UT-7/mpl cells or primary hematopoietic cells. In contrast, during thrombopoietin-induced megakaryocytic differentiation of normal hematopoietic cultures, anagrelide (0.3μm) reduced the rise in the mRNA levels of the transcription factors GATA-1 and FOG-1 as well as those of the downstream genes encoding FLI-1, NF-E2, glycoprotein IIb and MPL. However, the drug showed no effect on GATA-2 or RUNX-1 mRNA expression. Furthermore, anagrelide did not diminish the rise in GATA-1 and FOG-1 expression during erythropoietin-stimulated erythroid differentiation. Cilostamide, an exclusive and equipotent phosphodiesterase III (PDEIII) inhibitor, did not alter the expression of these genes.  Anagrelide suppresses megakaryocytopoiesis by reducing the expression levels of GATA-1 and FOG-1 via a PDEIII-independent mechanism that is differentiation context-specific and does not involve inhibition of MPL-mediated early signal transduction events. © 2010 International Society on Thrombosis and Haemostasis.

Genome-wide identification and characterization of microRNAs differenytially expressed in fibers in a cotton phytochrome A1 RNAi line

USDA-ARS?s Scientific Manuscript database

Silencing phytochrome A1 gene (PHYA1) by RNA interference in Upland cotton (Gossypium hirsutum L. cv. Coker 312) had generated PHYA1 RNAi lines with simultaneously improved fiber quality (longer, stronger and finer fiber) and other key agronomic traits. Comparative analyses of altered molecular proc...

Effects of endocrine disrupters on the expression of growth hormone and prolactin mRNA in the rainbow trout pituitary.

USDA-ARS?s Scientific Manuscript database

It is now widely accepted that chemical pollutants in the environment can interfere with the endocrine system of animals, thus affecting development and reproduction. Some of these endocrine disrupters (EDs) can have estrogenic or antiestrogenic effects. Most studies to date have focused on the ef...

Knockdown of p53 suppresses Nanog expression in embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa; Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192; Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia

2014-01-10

Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21more » and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.« less

Assessment of RNAi-induced silencing in banana (Musa spp.).

PubMed

Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

2014-09-18

In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target sequences (26-nt and 19-nt). RNAi-induced silencing was achieved in banana, both at transient and stable level, resulting in significant reduction of gene expression and enzyme activity. The success of silencing was dependent on the targeted region of the target gene. The successful generation of transgenic ECS for second transformation with (an)other construct(s) can be of value for functional genomics research in banana.

In vitro therapeutic effect of PDT combined with VEGF-A gene therapy

NASA Astrophysics Data System (ADS)

Lecaros, Rumwald Leo G.; Huang, Leaf; Hsu, Yih-Chih

2014-02-01

Vascular endothelial growth factor A (VEGF-A), commonly known as VEGF, is one of the primary factors that affect tumor angiogenesis. It was found to be expressed in cancer cell lines including oral squamous cell carcinoma. Photodynamic therapy (PDT) is a novel therapeutic modality to treat cancer by using a photosensitizer which is activated by a light source to produce reactive oxygen species and mediates oxygen-independent hypoxic conditions to tumor. Another emerging treatment to cure cancer is the use of interference RNA (e.g. siRNA) to silence a specific mRNA sequence. VEGF-A was found to be expressed in oral squamous cell carcinoma and overexpressed after 24 hour post-PDT by Western blot analysis. Cell viability was found to decrease at 25 nM of transfected VEGF-A siRNA. In vitro combined therapy of PDT and VEGF-A siRNA showed better response as compared with PDT and gene therapy alone. The results suggest that PDT combined with targeted gene therapy has a potential mean to achieve better therapeutic outcome.

The modularity and dynamicity of miRNA-mRNA interactions in high-grade serous ovarian carcinomas and the prognostic implication.

PubMed

Zhang, Wensheng; Edwards, Andrea; Fan, Wei; Flemington, Erik K; Zhang, Kun

2016-08-01

Ovarian carcinoma is the fifth-leading cause of cancer death among women in the United States. Major reasons for this persistent mortality include the poor understanding of the underlying biology and a lack of reliable biomarkers. Previous studies have shown that aberrantly expressed MicroRNAs (miRNAs) are involved in carcinogenesis and tumor progression by post-transcriptionally regulating gene expression. However, the interference of miRNAs in tumorigenesis is quite complicated and far from being fully understood. In this work, by an integrative analysis of mRNA expression, miRNA expression and clinical data published by The Cancer Genome Atlas (TCGA), we studied the modularity and dynamicity of miRNA-mRNA interactions and the prognostic implications in high-grade serous ovarian carcinomas. With the top transcriptional correlations (Bonferroni-adjusted p-value<0.01) as inputs, we identified five miRNA-mRNA module pairs (MPs), each of which included one positive-connection (correlation) module and one negative-connection (correlation) module. The number of miRNAs or mRNAs in each module varied from 3 to 7 or from 2 to 873. Among the four major negative-connection modules, three fit well with the widely accepted miRNA-mediated post-transcriptional regulation theory. These modules were enriched with the genes relevant to cell cycle and immune response. Moreover, we proposed two novel algorithms to reveal the group or sample specific dynamic regulations between these two RNA classes. The obtained miRNA-mRNA dynamic network contains 3350 interactions captured across different cancer progression stages or tumor grades. We found that those dynamic interactions tended to concentrate on a few miRNAs (e.g. miRNA-936), and were more likely present on the miRNA-mRNA pairs outside the discovered modules. In addition, we also pinpointed a robust prognostic signature consisting of 56 modular protein-coding genes, whose co-expression patterns were predictive for the survival time of ovarian cancer patients in multiple independent cohorts. Copyright © 2016 Elsevier Ltd. All rights reserved.

[Erythromycin restores oxidative stress-induced corticosteroid responsiveness of human THP-1 cells by up-regulating the expression of histone deacetylase 2].

PubMed

Zhang, Yang; He, Zhiyi; Sun, Xuejiao; Li, Zhanhua; Zhao, Lin; Mao, Congzheng; Huang, Dongmei; Zhang, Jianquan; Zhong, Xiaoning

2014-04-01

To investigate the effect of erythromycin (EM) on corticosteroid insensitivity of human THP-1 cells induced by cigarette smoke extract (CSE) and its mechanism. THP-1 cells were treated with EM followed by CSE stimulation. Histone deacetylase-2 (HDAC2) short interference RNA (HDAC2-siRNA) was transfected into the cells using Lipofectamine(TM); 2000. Interleukin-8 (IL-8) level in supernatants was measured by ELISA and HDAC2 expression was determined by real-time quantitative PCR (qRT-PCR) and Western blotting. The inhibition ratio of IL-8 in the EM group was significantly higher than that in the CSE group, but lower than that in the control group (P<0.05). The half-maximal inhibitory concentration of dexamethasone (IC50;-Dex) in the EM group was lower than that in the CSE group, but higher than that in the control group (P<0.05). The expression of HDAC2 protein in the EM group was higher than that in the CSE group, but lower than that in the control group (P<0.05). Besides, HDAC2 mRNA and HDAC2 protein expressions were lower in the HDAC2-siRNA group than in the scrambled oligonucleotide (SC) group. EM could reverse HDAC2 mRNA and HDAC2 protein reduction induced by HDAC2-siRNA (P<0.05). Corticosteroid sensitivity of THP-1 cells could be reduced by CSE. EM could reverse the corticosteroid insensitivity by up-regulating the expression of HDAC2 protein.

An efficient protocol for the production of tRNA-free recombinant Selenocysteine Synthase (SELA) from Escherichia coli and its biophysical characterization.

PubMed

Manzine, Livia Regina; Cassago, Alexandre; da Silva, Marco Túlio Alves; Thiemann, Otavio Henrique

2013-03-01

Selenocysteine Synthase (SELA, E.C. 2.9.1.1) from Escherichia coli is a homodecamer pyridoxal-5'-phosphate containing enzyme responsible for the conversion of seryl-tRNA(sec) into selenocysteyl-tRNA(sec) in the biosynthesis of the 21th amino acid, selenocysteine (Sec or U). This paper describes the cloning of the E. coli selA gene into a modified pET29a(+) vector and its expression in E. coli strain WL81460, a crucial modification allowing SELA expression without bound endogenous tRNA(sec). This expression strategy enabled the purification and additional biochemical and biophysical characterization of the SELA decamer. The homogeneous SELA protein was obtained using three chromatographic steps. Size Exclusion Chromatography and Native Gel Electrophoresis showed that SELA maintains a decameric state with molecular mass of approximately 500 kDa with an isoelectric point of 6,03. A predominance of α-helix structures was detected by circular dichroism with thermal stability up to 45 °C. The oligomeric assemblage of SELA was investigated by glutaraldehyde crosslinking experiments indicate that SELA homodecameric structure is the result of a stepwise addition of intermediate oligomeric states and not a direct monomer to homodecamer transition. Our results have contributed to the establishment of a robust expression model for the enzyme free of bound RNA and are of general interest to be taken into consideration in all cases of heterologous/homologous expressions of RNA-binding proteins avoiding the carryover of endogenous RNAs, which may interfere with further biochemical characterizations. Copyright © 2012 Elsevier Inc. All rights reserved.

Pathogenic effects of Rift Valley fever virus NSs gene are alleviated in cultured cells by expressed antiviral short hairpin RNAs.

PubMed

Scott, Tristan; Paweska, Janusz T; Arbuthnot, Patrick; Weinberg, Marc S

2012-01-01

Rift Valley fever virus (RVFV), a member of the Bunyaviridae family, may cause severe hepatitis, encephalitis and haemorrhagic fever in humans. There are currently no available licensed vaccines or therapies to treat the viral infection in humans. RNA interference (RNAi)-based viral gene silencing offers a promising approach to inhibiting replication of this highly pathogenic virus. The small (S) segment of the RVFV tripartite genome carries the genetic determinates for pathogenicity during infection. This segment encodes the non-structural S (NSs) and essential nucleocapsid (N) genes. To advance RNAi-based inhibition of RVFV replication, we designed several Pol III short hairpin RNA (shRNA) expression cassettes against the NSs and N genes, including a multimerized plasmid vector that included four shRNA expression cassettes. Effective target silencing was demonstrated using full- and partial-length target reporter assays, and confirmed by western blot analysis of exogenous N and NSs expression. Small RNA northern blots showed detectable RNAi guide strand formation from single and multimerized shRNA constructs. Using a cell culture model of RVFV replication, shRNAs targeting the N gene decreased intracellular nucleocapsid protein concentration and viral replication. The shRNAs directed against the NSs gene reduced NSs protein concentrations and alleviated NSs-mediated cytotoxicity, which may be caused by host transcription suppression. These data are the first demonstration that RNAi activators have a potential therapeutic benefit for countering RVFV infection.

Yellow Fever Virus, but Not Zika Virus or Dengue Virus, Inhibits T-Cell Receptor-Mediated T-Cell Function by an RNA-Based Mechanism.

PubMed

McLinden, James H; Bhattarai, Nirjal; Stapleton, Jack T; Chang, Qing; Kaufman, Thomas M; Cassel, Suzanne L; Sutterwala, Fayyaz S; Haim, Hillel; Houtman, Jon C; Xiang, Jinhua

2017-11-27

The Flavivirus genus within the Flaviviridae family is comprised of many important human pathogens including yellow fever virus (YFV), dengue virus (DENV), and Zika virus (ZKV), all of which are global public health concerns. Although the related flaviviruses hepatitis C virus and human pegivirus (formerly named GBV-C) interfere with T-cell receptor (TCR) signaling by novel RNA and protein-based mechanisms, the effect of other flaviviruses on TCR signaling is unknown. Here, we studied the effect of YFV, DENV, and ZKV on TCR signaling. Both YFV and ZKV replicated in human T cells in vitro; however, only YFV inhibited TCR signaling. This effect was mediated at least in part by the YFV envelope (env) protein coding RNA. Deletion mutagenesis studies demonstrated that expression of a short, YFV env RNA motif (vsRNA) was required and sufficient to inhibit TCR signaling. Expression of this vsRNA and YFV infection of T cells reduced the expression of a Src-kinase regulatory phosphatase (PTPRE), while ZKV infection did not. YFV infection in mice resulted in impaired TCR signaling and PTPRE expression, with associated reduction in murine response to experimental ovalbumin vaccination. Together, these data suggest that viruses within the flavivirus genus inhibit TCR signaling in a species-dependent manner. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Self-Delivering RNAi Targeting PD-1 Improves Tumor-Specific T Cell Functionality for Adoptive Cell Therapy of Malignant Melanoma.

PubMed

Ligtenberg, Maarten A; Pico de Coaña, Yago; Shmushkovich, Taisia; Yoshimoto, Yuya; Truxova, Iva; Yang, Yuan; Betancur-Boissel, Monica; Eliseev, Alexey V; Wolfson, Alexey D; Kiessling, Rolf

2018-06-06

Adoptive cell therapy (ACT) is becoming a prominent alternative therapeutic treatment for cancer patients relapsing on traditional therapies. In parallel, antibodies targeting immune checkpoint molecules, such as cytotoxic-T-lymphocyte-associated antigen 4 (CTLA-4) and cell death protein 1 pathway (PD-1), are rapidly being approved for multiple cancer types, including as first line therapy for PD-L1-expressing non-small-cell lung cancer. The combination of ACT and checkpoint blockade could substantially boost the efficacy of ACT. In this study, we generated a novel self-delivering small interfering RNA (siRNA) (sdRNA) that knocked down PD-1 expression on healthy donor T cells as well as patient-derived tumor-infiltrating lymphocytes (TIL). We have developed an alternative chemical modification of RNA backbone for improved stability and increased efficacy. Our results show that T cells treated with sdRNA specific for PD-1 had increased interferon γ (IFN-γ) secreting capacity and that this modality of gene expression interference could be utilized in our rapid expansion protocol for production of TIL for therapy. TIL expanded in the presence of PD-1-specific sdRNA performed with increased functionality against autologous tumor as compared to control TIL. This method of introducing RNAi into T cells to modify the expression of proteins could easily be adopted into any ACT protocol and will lead to the exploration of new combination therapies. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Down-regulation of CD19 expression inhibits proliferation, adhesion, migration and invasion and promotes apoptosis and the efficacy of chemotherapeutic agents and imatinib in SUP-B15 cells.

PubMed

Wu, Junqing; Liang, Bin; Qian, Yan; Tang, Liyuan; Xing, Chongyun; Zhuang, Qiang; Shen, Zhijian; Jiang, Songfu; Yu, Kang; Feng, Jianhua

2018-05-29

The survival rate of childhood acute lymphoblastic leukemia (ALL) has increased while that of Philadelphia-positive (Ph+) ALL remains low. CD19 is a B-cell specific molecule related to the survival and proliferation of normal B cells. However, there is little information available on the effects of CD19 on the biological behavior of Ph+ ALL cells. In this study, we explored a lentiviral vector-mediated short hairpin RNA (shRNA) expression vector to stably reduce CD19 expression in Ph+ ALL cell line SUP-B15 cells and investigated the effects of CD19 downregulation on cell proliferation, apoptosis, drug sensitivity, cell adhesion, cell migration and cell invasion in vitro. CD19 mRNA and protein expression levels were inhibited significantly by CD19 shRNA. Down-regulation of CD19 could inhibit cell proliferation, adhesion, migration and invasion, and increase cell apoptosis and the efficacy of chemotherapeutic agents and imatinib in SUP-B15 cells. Moreover, we found that down-regulation of CD19 expression inhibits cell proliferation and induces apoptosis in SUP-B15 cells in a p53-dependent manner. Taken together, our results suggest that lentiviral vector-mediated RNA interference of CD19 gene may be a promising strategy in the treatment of Ph+ ALL. This article is protected by copyright. All rights reserved.

XRN2 is required for the degradation of target RNAs by RNase H1-dependent antisense oligonucleotides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hori, Shin-Ichiro; Yamamoto, Tsuyoshi; Obika, Satoshi, E-mail: obika@phs.osaka-u.ac.jp

Antisense oligonucleotides (ASOs) can suppress the expression of a target gene by cleaving pre-mRNA and/or mature mRNA via RNase H1. Following the initial endonucleolytic cleavage by RNase H1, the target RNAs are degraded by a mechanism that is poorly understood. To better understand this degradation pathway, we depleted the expression of two major 5′ to 3′ exoribonucleases (XRNs), named XRN1 and XRN2, and analyzed the levels of 3′ fragments of the target RNAs in vitro. We found that the 3′ fragments of target pre-mRNA generated by ASO were almost completely degraded from their 5′ ends by nuclear XRN2 after RNase H1-mediatedmore » cleavage, whereas the 3′ fragments of mature mRNA were partially degraded by XRN2. In contrast to ASO, small interference RNA (siRNA) could reduce the expression level of only mature mRNA, and the 3′ fragment was degraded by cytoplasmic XRN1. Our findings indicate that the RNAs targeted by RNase H1-dependent ASO are rapidly degraded in the nucleus, contrary to the cytoplasmic degradation pathway mediated by siRNA. - Highlights: • We compared the degradation mechanism of the transcript targeted by ASO and siRNA. • We focused on two 5′ to 3′ exoribonucleases, cytoplasmic XRN1, and nuclear XRN2. • The 3′ fragment of target pre-mRNA generated by ASO was degraded by XRN2. • The 3′ fragment of target mRNA generated by ASO was partially degraded by XRN2. • XRN1 depletion promoted accumulation of the 3′ fragment of mRNA generated by siRNA.« less

MafA is a Key Molecule in Glucose and Energy Balance in the Central Nervous System and Peripheral Organs

PubMed Central

Tsuchiya, Mariko; Tsuchiya, Ken; Yasuda, Kazuki; Fujita, Mikiko; Takinishi, Akira; Furukawa, Maiko; Nitta, Kosaku; Maeda, Atsushi

2011-01-01

MafA is a strong transactivator of insulin in pancreatic β cells. Elucidating the profile of MafA action in organs other than the pancreas is essential. We established an mRNA interference technique that modifies the level of target mRNAs in mice in vivo. After rapidly injecting MafA-siRNA, the resulting changes in the gene profile were analyzed using a microarray system. Significant suppression of the MafA mRNA levels was observed in the pancreas, liver, adipose tissue, and brain of siRNA-injected mice. As we reported previously, the down-regulation of insulin mRNA and adipocytokines was observed in the pancreas, and MafA siRNA caused alterations in the expressions of genes related to lipid metabolism and cell growth in the liver, and the attenuation of cell differentiation in cultured adipocytes. In addition to the effects on these organs, MafA expression was immunohistochemically detected in the brain in our preliminary data, and the expression level in siRNA-treated mice was significantly suppressed. The expressions of the affected genes were distinct, including growth hormone, vasopressin, hypocretin, and pro-melanin-concentrating hormone, were almost completely down-regulated (to ~1/100). These results suggested that MafA is likely involved in the regulation of hormonal systems related to glucose metabolism, and MafA is likely positioned near the beginning of the cascade or may influence the expressions of the above-mentioned genes in coordination with other factors in brain tissue. Taken together, the findings in this study suggested that MafA functions as a transcription factor with distinct activities in each organ and is cross-linked in several organs. PMID:23675216

New basic approach to treat non-small cell lung cancer based on RNA-interference.

PubMed

Makowiecki, Christina; Nolte, Andrea; Sutaj, Besmire; Keller, Timea; Avci-Adali, Meltem; Stoll, Heidi; Schlensak, Christian; Wendel, Hans Peter; Walker, Tobias

2014-03-01

To date the therapy for non-small cell lung cancer (NSCLC) is associated with severe side effects, frustrating outcomes, and does not consider different tumor characteristics. The RNA-interference (RNAi) pathway represents a potential new approach to treat NSCLC. With small interfering ribonucleic acids (siRNAs), it is possible to reduce the expression of proliferation-dependent proteins in tumor cells, leading to their apoptosis. We propose that siRNAs could be adapted to the tumor type and may cause fewer side effects than current therapy. Four NSCLC cell lines were cultured under standard conditions and transfected with three different concentrations of siRNAs targeted against the hypoxia-inducible factors 1α and 2α (HIF1α and HIF2α) and signal transducer and activator of transcription 3 (STAT3). The expression was observed by quantitative real-time polymerase chain reaction and western blots. For the analysis of cell growth three days after transfection, the cell number was detected using a CASY cell counter system. The results of the silencing of the analyzed factors differ in each cell line. Cell growth was significantly reduced in all cell lines after transfection with HIF1α- and STAT3-siRNA. The silencing of HIF2α resulted in a significant effect on cell growth in squamous, and large-cell lung cancer. This study shows that the knockdown and viability to siRNA transfection differ in each tumor type according to the used siRNA. This implies that the tumor types differ among themselves and should be treated differently. Therefore, the authors suggest a possible approach to a more personalized treatment of NSCLC.

Single-target RNA interference for the blockade of multiple interacting proinflammatory and profibrotic pathways in cardiac fibroblasts.

PubMed

Tank, Juliane; Lindner, Diana; Wang, Xiaomin; Stroux, Andrea; Gilke, Leona; Gast, Martina; Zietsch, Christin; Skurk, Carsten; Scheibenbogen, Carmen; Klingel, Karin; Lassner, Dirk; Kühl, Uwe; Schultheiss, Heinz-Peter; Westermann, Dirk; Poller, Wolfgang

2014-01-01

Therapeutic targets of broad relevance are likely located in pathogenic pathways common to disorders of various etiologies. Screening for targets of this type revealed CCN genes to be consistently upregulated in multiple cardiomyopathies. We developed RNA interference (RNAi) to silence CCN2 and found this single-target approach to block multiple proinflammatory and profibrotic pathways in activated primary cardiac fibroblasts (PCFBs). The RNAi-strategy was developed in murine PCFBs and then investigated in "individual" human PCFBs grown from human endomyocardial biopsies (EMBs). Screening of short hairpin RNA (shRNA) sequences for high silencing efficacy and specificity yielded RNAi adenovectors silencing CCN2 in murine or human PCFBs, respectively. Comparison of RNAi with CCN2-modulating microRNA (miR) vectors expressing miR-30c or miR-133b showed higher efficacy of RNAi. In murine PCFBs, CCN2 silencing resulted in strongly reduced expression of stretch-induced chemokines (Ccl2, Ccl7, Ccl8), matrix metalloproteinases (MMP2, MMP9), extracellular matrix (Col3a1), and a cell-to-cell contact protein (Cx43), suggesting multiple signal pathways to be linked to CCN2. Immune cell chemotaxis towards CCN2-depleted PCFBs was significantly reduced. We demonstrate here that this RNAi strategy is technically applicable to "individual" human PCFBs, too, but that these display individually strikingly different responses to CCN2 depletion. Either genomically encoded factors or stable epigenetic modification may explain different responses between individual PCFBs. The new RNAi approach addresses a key regulator protein induced in cardiomyopathies. Investigation of this and other molecular therapies in individual human PCBFs may help to dissect differential pathogenic processes between otherwise similar disease entities and individuals. Copyright © 2013 Elsevier Ltd. All rights reserved.

Nanolayered siRNA delivery platforms for local silencing of CTGF reduce cutaneous scar contraction in third-degree burns

PubMed Central

Castleberry, Steven A.; Golberg, Alexander; Sharkh, Malak Abu; Khan, Saiqa; Almquist, Benjamin D.; Austen, William G.; Yarmush, Martin L.; Hammond, Paula T.

2017-01-01

Wound healing is an incredibly complex biological process that often results in thickened collagen-enriched healed tissue called scar. Cutaneous scars lack many functional structures of the skin such as hair follicles, sweat glands, and papillae. The absence of these structures contributes to a number of the long-term morbidities of wound healing, including loss of function for tissues, increased risk of re-injury, and aesthetic complications. Scar formation is a pervasive factor in our daily lives; however, in the case of serious traumatic injury, scars can create long-lasting complications due to contraction and poor tissue remodeling. Within this report we target the expression of connective tissue growth factor (CTGF), a key mediator of TGFβ pro-fibrotic response in cutaneous wound healing, with controlled local delivery of RNA interference. Through this work we describe both a thorough in vitro analysis of nanolayer coated sutures for the controlled delivery of siRNA and its application to improve scar outcomes in a third-degree burn induced scar model in rats. We demonstrate that the knockdown of CTGF significantly altered the local expression of αSMA, TIMP1, and Col1a1, which are known to play roles in scar formation. The knockdown of CTGF within the healing burn wounds resulted in improved tissue remodeling, reduced scar contraction, and the regeneration of papillary structures within the healing tissue. This work adds support to a number of previous reports that indicate CTGF as a potential therapeutic target for fibrosis. Additionally, we believe that the controlled local delivery of siRNA from ultrathin polymer coatings described within this work is a promising approach in RNA interference that could be applied in developing improved cancer therapies, regenerative medicine, and fundamental scientific research. PMID:27108403

Delivery of RNAi reagents in murine models of obesity and diabetes.

PubMed

Wilcox, Denise M; Yang, Ruojing; Morgan, Sherry J; Nguyen, Phong T; Voorbach, Martin J; Jung, Paul M; Haasch, Deanna L; Lin, Emily; Bush, Eugene N; Opgenorth, Terry J; Jacobson, Peer B; Collins, Christine A; Rondinone, Cristina M; Surowy, Terry; Landschulz, Katherine T

2006-11-29

RNA interference (RNAi) is an exciting new tool to effect acute in vivo knockdown of genes for pharmacological target validation. Testing the application of this technology to metabolic disease targets, three RNAi delivery methods were compared in two frequently utilized preclinical models of obesity and diabetes, the diet-induced obese (DIO) and B6.V-Lep/J (ob/ob) mouse. Intraperitoneal (i.p.) and high pressure hydrodynamic intravenous (i.v.) administration of naked siRNA, and low pressure i.v. administration of shRNA-expressing adenovirus were assessed for both safety and gene knockdown efficacy using constructs targeting cJun N-terminal kinase 1 (JNK1). Hydrodynamic delivery of siRNA lowered liver JNK1 protein levels 40% in DIO mice, but was accompanied by iatrogenic liver damage. The ob/ob model proved even more intolerant of this technique, with hydrodynamic delivery resulting in severe liver damage and death of most animals. While well-tolerated, i.p. injections of siRNA in DIO mice did not result in any knockdown or phenotypic changes in the mice. On the other hand, i.v. injected adenovirus expressing shRNA potently reduced expression of JNK1 in vivo by 95% without liver toxicity. In conclusion, i.p. and hydrodynamic injections of siRNA were ineffective and/or inappropriate for in vivo gene targeting in DIO and ob/ob mice, while adenovirus-mediated delivery of shRNA provided a relatively benign and effective method for exploring liver target silencing.

Non-coding RNAs in crop genetic modification: considerations and predictable environmental risk assessments (ERA).

PubMed

Ramesh, S V

2013-09-01

Of late non-coding RNAs (ncRNAs)-mediated gene silencing is an influential tool deliberately deployed to negatively regulate the expression of targeted genes. In addition to the widely employed small interfering RNA (siRNA)-mediated gene silencing approach, other variants like artificial miRNA (amiRNA), miRNA mimics, and artificial transacting siRNAs (tasiRNAs) are being explored and successfully deployed in developing non-coding RNA-based genetically modified plants. The ncRNA-based gene manipulations are typified with mobile nature of silencing signals, interference from viral genome-derived suppressor proteins, and an obligation for meticulous computational analysis to prevaricate any inadvertent effects. In a broad sense, risk assessment inquiries for genetically modified plants based on the expression of ncRNAs are competently addressed by the environmental risk assessment (ERA) models, currently in vogue, designed for the first generation transgenic plants which are based on the expression of heterologous proteins. Nevertheless, transgenic plants functioning on the foundation of ncRNAs warrant due attention with respect to their unique attributes like off-target or non-target gene silencing effects, small RNAs (sRNAs) persistence, food and feed safety assessments, problems in detection and tracking of sRNAs in food, impact of ncRNAs in plant protection measures, effect of mutations etc. The role of recent developments in sequencing techniques like next generation sequencing (NGS) and the ERA paradigm of the different countries in vogue are also discussed in the context of ncRNA-based gene manipulations.

Viruses within the Flaviviridae Decrease CD4 Expression and Inhibit HIV Replication in Human CD4+ Cells1

PubMed Central

Xiang, Jinhua; McLinden, James H.; Rydze, Robert A.; Chang, Qing; Kaufman, Thomas M.; Klinzman, Donna; Stapleton, Jack T.

2013-01-01

Viral infections alter host cell homeostasis and this may lead to immune evasion and/or interfere with the replication of other microbes in coinfected hosts. Two flaviviruses are associated with a reduction in HIV replication or improved survival in HIV-infected people (dengue virus (DV) and GB virus type C (GBV-C)). GBV-C infection and expression of the GBV-C nonstructural protein 5A (NS5A) and the DV NS5 protein in CD4+ T cells inhibit HIV replication in vitro. To determine whether the inhibitory effect on HIV replication is conserved among other flaviviruses and to characterize mechanism(s) of HIV inhibition, the NS5 proteins of GBV-C, DV, hepatitis C virus, West Nile virus, and yellow fever virus (YFV; vaccine strain 17D) were expressed in CD4+ T cells. All NS5 proteins inhibited HIV replication. This correlated with decreased steady-state CD4 mRNA levels and reduced cell surface CD4 protein expression. Infection of CD4+ T cells and macrophages with YFV (17D vaccine strain) also inhibited HIV replication and decreased CD4 gene expression. In contrast, mumps virus was not inhibited by the expression of flavivirus NS5 protein or by YFV infection, and mumps infection did not alter CD4 mRNA or protein levels. In summary, CD4 gene expression is decreased by all human flavivirus NS5 proteins studied. CD4 regulation by flaviviruses may interfere with innate and adaptive immunity and contribute to in vitro HIV replication inhibition. Characterization of the mechanisms by which flaviviruses regulate CD4 expression may lead to novel therapeutic strategies for HIV and immunological diseases. PMID:19923460

Upregulation of human DNA binding protein A (dbpA) in gastric cancer cells.

PubMed

Wang, Guo-rong; Zheng, Yan; Che, Xiang-ming; Wang, Xin-yang; Zhao, Jia-hui; Wu, Kai-jie; Zeng, Jin; Pan, Chen-en; He, Da-lin

2009-10-01

To determine the effect of human DNA binding protein (dbpA) on the biology of gastric cancer cells. DbpA expression was analyzed by Western blot analysis and immunofluorescence staining in gastric cancer tissues and cell lines. A dbpA-specific small interference (si) RNA was designed and synthesized. Suppressive effect of siRNA on dbpA expression was assessed by real-time RT-PCR. Transwell migration and colony formation assays were used to assess the inhibitory effects of dbpA siRNA on cell invasion and tumorigenesis in vitro. Drug-sensitivity was evaluated using a conventional 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay. The expression of dbpA was upregulated in gastric cancer tissues and cell lines as compared to adjacent normal tissues or gastric epithelial cells. siRNA treatment successfully silenced dbpA expression. Silencing of dbpA increased expression of E-cadherin, decreased expression of adenomatous polyposis coli (APC), beta-catenin and cyclin D1, but had no effect on expression of NF-kappaB. Silencing of dbpA also suppressed cell invasion and colony formation of SGC7901 cells, and enhanced their chemosensitivity to 5-fluorouracil. DbpA plays an important role in the pathogenesis and development of gastric cancer, and the process involves E-cadherin, APC, beta-catenin and cyclin D1. Silencing of dbpA might be a novel therapeutic strategy for increasing chemosensitivity to 5-fluorouracil in gastric cancer.

Analysis of C. elegans VIG-1 expression.

PubMed

Shin, Kyoung-Hwa; Choi, Boram; Park, Yang-Seo; Cho, Nam Jeong

2008-12-31

Double-stranded RNA (dsRNA) induces gene silencing in a sequence-specific manner by a process known as RNA interference (RNAi). The RNA-induced silencing complex (RISC) is a multi-subunit ribonucleoprotein complex that plays a key role in RNAi. VIG (Vasa intronic gene) has been identified as a component of Drosophila RISC; however, the role VIG plays in regulating RNAi is poorly understood. Here, we examined the spatial and temporal expression patterns of VIG-1, the C. elegans ortholog of Drosophila VIG, using a vig-1::gfp fusion construct. This construct contains the 908-bp region immediately upstream of vig-1 gene translation initiation site. Analysis by confocal microscopy demonstrated GFP-VIG-1 expression in a number of tissues including the pharynx, body wall muscle, hypodermis, intestine, reproductive system, and nervous system at the larval and adult stages. Furthermore, western blot analysis showed that VIG-1 is present in each developmental stage examined. To investigate regulatory sequences for vig-1 gene expression, we generated constructs containing deletions in the upstream region. It was determined that the GFP expression pattern of a deletion construct (delta-908 to -597) was generally similar to that of the non-deletion construct. In contrast, removal of a larger segment (delta-908 to -191) resulted in the loss of GFP expression in most cell types. Collectively, these results indicate that the 406-bp upstream region (-596 to -191) contains essential regulatory sequences required for VIG-1 expression.

TTLL12 Inhibits the Activation of Cellular Antiviral Signaling through Interaction with VISA/MAVS.

PubMed

Ju, Lin-Gao; Zhu, Yuan; Lei, Pin-Ji; Yan, Dong; Zhu, Kun; Wang, Xiang; Li, Qing-Lan; Li, Xue-Jing; Chen, Jian-Wen; Li, Lian-Yun; Wu, Min

2017-02-01

Upon virus infection, host cells use retinoic-acid-inducible geneI I (RIG-I)-like receptors to recognize viral RNA and activate type I IFN expression. To investigate the role of protein methylation in the antiviral signaling pathway, we screened all the SET domain-containing proteins and identified TTLL12 as a negative regulator of RIG-I signaling. TTLL12 contains SET and TTL domains, which are predicted to have lysine methyltransferase and tubulin tyrosine ligase activities, respectively. Exogenous expression of TTLL12 represses IFN-β expression induced by Sendai virus. TTLL12 deficiency by RNA interference and CRISPR-gRNA techniques increases the induced IFN-β expression and inhibits virus replication in the cell. The global gene expression profiling indicated that TTLL12 specifically inhibits the expression of the downstream genes of innate immunity pathways. Cell fractionation and fluorescent staining indicated that TTLL12 is localized in the cytosol. The mutagenesis study suggested that TTLL12's ability to repress the RIG-I pathway is probably not dependent on protein modifications. Instead, TTLL12 directly interacts with virus-induced signaling adaptor (VISA), TBK1, and IKKε, and inhibits the interactions of VISA with other signaling molecules. Taken together, our findings demonstrate TTLL12 as a negative regulator of RNA-virus-induced type I IFN expression by inhibiting the interaction of VISA with other proteins. Copyright © 2017 by The American Association of Immunologists, Inc.

Tim-3 facilitates osteosarcoma proliferation and metastasis through the NF-κB pathway and epithelial-mesenchymal transition.

PubMed

Feng, Z M; Guo, S M

2016-09-02

The aim of this study was to investigate the expression of T-cell immunoglobulin mucin domain molecule-3 (Tim-3) in osteosarcoma tissues, and analyze its effect on cell proliferation and metastasis in an osteosarcoma cell line. Tim-3 mRNA and protein expression in osteosarcoma tissue was detected by reverse transcriptase-polymerase chain reaction and immunohistochemistry, respectively. Additionally, the cell viability, apoptosis rate, and invasive ability of the osteosarcoma cell line MG-63 were tested using the methyl thiazolyl tetrazolium assay, Annexin V-propidium iodide flow cytometry, and a Transwell assay, respectively, following Tim-3 interference using small interfering RNA (siRNA). We also analyzed the expression of Snail, E-cadherin, vimentin, and nuclear factor (NF)-kB in the cells by western blot. We observed that Tim-3 mRNA and protein was significantly overexpressed in osteosarcoma tissues, compared to the adjacent normal tissue (P < 0.01). Moreover, MG-63 cells transfected with the Tim-3 siRNA presented lower cell viability, a greater number of apoptotic cells, and decreased invasive ability (P < 0.01), compared to control cells. Additionally, we observed a decrease in Snail and vimentin expression, an increase in the E-cadherin level, and an increase in NF-kB p65 phosphorylation (P < 0.01) in Tim-3 siRNA-transfected MG-63 cells. Based on these results, we concluded that Tim-3 is highly expressed in osteosarcoma tissue. Moreover, we speculated that interfering in Tim-3 expression could significantly suppress osteosarcoma cell (MG-63) proliferation and metastasis via the NF-kB/Snail signaling pathway and epithelial-mesenchymal transition.

Novel small interfering RNA-containing solution protecting donor organs in heart transplantation.

PubMed

Zheng, Xiufen; Lian, Dameng; Wong, Arthur; Bygrave, Michael; Ichim, Thomas E; Khoshniat, Mahdieh; Zhang, Xusheng; Sun, Hongtao; De Zordo, Tobias; Lacefield, James C; Garcia, Bertha; Jevnikar, Anthony M; Min, Wei-Ping

2009-09-22

Ischemia/reperfusion injury is a major factor in graft quality and subsequent function in the transplantation setting. We hypothesize that the process of RNA interference may be used to "engineer" a graft to suppress expression of genes associated with inflammation, apoptosis, and complement, which are believed to cause ischemia/reperfusion injury. Such manipulation of pathological gene expression may be performed by treatment of the graft ex vivo with small interfering RNA (siRNA) as part of the preservation procedure. Heart grafts from BALB/c mice were preserved in UW solution (control) or UW solution containing siRNAs targeting tumor necrosis factor-alpha, C3, and Fas genes (siRNA solution) at 4 degrees C for 48 hours and subsequently transplanted into syngeneic recipients. Tumor necrosis factor-alpha, C3, and Fas genes were elevated by ischemia/reperfusion injury after 48 hours of preservation in UW solution. Preservation in siRNA solution knocked down gene expression at the level of messenger RNA and protein in the grafts after transplantation. All grafts preserved in siRNA solution showed strong contraction, whereas grafts preserved in control solution demonstrated no detectable contraction by high-frequency ultrasound scanning. siRNA solution-treated organs exhibited improved histology and diminished neutrophil and lymphocyte infiltration compared with control solution-treated organs. Furthermore, the treated heart grafts retained strong beating up to the end of the observation period (>100 days), whereas all control grafts lost function within 8 days. Incorporation of siRNA into organ storage solution is a feasible and effective method of attenuating ischemia/reperfusion injury, protecting cardiac function, and prolonging graft survival.

Discovery of Prostate Cancer Tumor Suppressors and Mediators of MDV3100 Resistance through in Vivo RNA Interference Screen

DTIC Science & Technology

2014-05-01

NE phenotype. Figure 5: Rational of the FACS-based screen. Left, the concept of increase of NSE and decrease of PSMA with NED. Right, the...of AR dependency is associated with increase in Prostate specific membrane antigen ( PSMA ) expression. Thus, we also decided to sort for cells that...have decreased PSMA expression with prolonged Enzalutamide treatment. Using the above markers and FACS we attempted to sort out 4 populations of

Heat shock protein 90{beta}: A novel mediator of vitamin D action

DOE Office of Scientific and Technical Information (OSTI.GOV)

Angelo, Giana; Mineral Bioavailability Laboratory, 711 Washington Street, Boston, MA 02111; Lamon-Fava, Stefania

2008-03-14

We investigated the role of Heat shock protein 90 (Hsp90) in vitamin D action in Caco-2 cells using geldanamycin (GA) to block Hsp90 function and RNA interference to reduce Hsp90{beta} expression. When cells were exposed to GA, vitamin D-mediated gene expression and transcriptional activity were inhibited by 69% and 54%, respectively. Gel shift analysis indicated that GA reduced vitamin D-mediated DNA binding activity of the vitamin D receptor (VDR). We tested the specific role of Hsp90{beta} by knocking down its expression with stably expressed short hairpin RNA. Vitamin D-induced gene expression and transcriptional activity were reduced by 90% and 80%,more » respectively, in Hsp90{beta}-deficient cells. Nuclear protein for VDR and RXR{alpha}, its heterodimer partner, were not reduced in Hsp90{beta}-deficient cells. These findings indicate that Hsp90{beta} is needed for optimal vitamin D responsiveness in the enterocyte and demonstrate a specific role for Hsp90{beta} in VDR signaling.« less

Rice yellow stunt rhabdovirus protein 6 suppresses systemic RNA silencing by blocking RDR6-mediated secondary siRNA synthesis.

PubMed

Guo, Hongyan; Song, Xiaoguang; Xie, Chuanmiao; Huo, Yan; Zhang, Fujie; Chen, Xiaoying; Geng, Yunfeng; Fang, Rongxiang

2013-08-01

The P6 protein of Rice yellow stunt rhabdovirus (RYSV) is a virion structural protein that can be phosphorylated in vitro. However its exact function remains elusive. We found that P6 enhanced the virulence of Potato virus X (PVX) in Nicotiana benthamiana and N. tabacum plants, suggesting that it might function as a suppressor of RNA silencing. We examined the mechanism of P6-mediated silencing suppression by transiently expressing P6 in both N. benthamiana leaves and rice protoplasts. Our results showed that P6 could repress the production of secondary siRNAs and inhibit systemic green fluorescent protein RNA silencing but did not interfere with local RNA silencing in N. benthamiana plants or in rice protoplasts. Intriguingly, P6 and RDR6 had overlapping subcellular localization and P6 bound both rice and Arabidopsis RDR6 in vivo. Furthermore, transgenic rice plants expressing P6 showed enhanced susceptibility to infection by Rice stripe virus. Hence, we propose that P6 is part of the RYSV's counter-defense machinery against the plant RNA silencing system and plays a role mainly in affecting RDR6-mediated secondary siRNA synthesis. Our work provides a new perspective on how a plant-infecting nucleorhabdovirus may counteract host RNA silencing-mediated antiviral defense.

The long non-coding RNA HOTTIP enhances pancreatic cancer cell proliferation, survival and migration

PubMed Central

Cheng, Yating; Jutooru, Indira; Chadalapaka, Gayathri; Corton, J. Christopher; Safe, Stephen

2015-01-01

HOTTIP is a long non-coding RNA (lncRNA) transcribed from the 5′ tip of the HOXA locus and is associated with the polycomb repressor complex 2 (PRC2) and WD repeat containing protein 5 (WDR5)/mixed lineage leukemia 1 (MLL1) chromatin modifying complexes. HOTTIP is expressed in pancreatic cancer cell lines and knockdown of HOTTIP by RNA interference (siHOTTIP) in Panc1 pancreatic cancer cells decreased proliferation, induced apoptosis and decreased migration. In Panc1 cells transfected with siHOTTIP, there was a decrease in expression of 757 genes and increased expression of 514 genes, and a limited gene analysis indicated that HOTTIP regulation of genes is complex. For example, Aurora kinase A, an important regulator of cell growth, is coregulated by MLL and not WDR5 and, in contrast to previous studies in liver cancer cells, HOTTIP does not regulate HOXA13 but plays a role in regulation of several other HOX genes including HOXA10, HOXB2, HOXA11, HOXA9 and HOXA1. Although HOTTIP and the HOX-associated lncRNA HOTAIR have similar pro-oncogenic functions, they regulate strikingly different sets of genes in Panc1 cells and in pancreatic tumors. PMID:25912306

T cells are influenced by a long non-coding RNA in the autoimmune associated PTPN2 locus.

PubMed

Houtman, Miranda; Shchetynsky, Klementy; Chemin, Karine; Hensvold, Aase Haj; Ramsköld, Daniel; Tandre, Karolina; Eloranta, Maija-Leena; Rönnblom, Lars; Uebe, Steffen; Catrina, Anca Irinel; Malmström, Vivianne; Padyukov, Leonid

2018-06-01

Non-coding SNPs in the protein tyrosine phosphatase non-receptor type 2 (PTPN2) locus have been linked with several autoimmune diseases, including rheumatoid arthritis, type I diabetes, and inflammatory bowel disease. However, the functional consequences of these SNPs are poorly characterized. Herein, we show in blood cells that SNPs in the PTPN2 locus are highly correlated with DNA methylation levels at four CpG sites downstream of PTPN2 and expression levels of the long non-coding RNA (lncRNA) LINC01882 downstream of these CpG sites. We observed that LINC01882 is mainly expressed in T cells and that anti-CD3/CD28 activated naïve CD4 + T cells downregulate the expression of LINC01882. RNA sequencing analysis of LINC01882 knockdown in Jurkat T cells, using a combination of antisense oligonucleotides and RNA interference, revealed the upregulation of the transcription factor ZEB1 and kinase MAP2K4, both involved in IL-2 regulation. Overall, our data suggests the involvement of LINC01882 in T cell activation and hints towards an auxiliary role of these non-coding SNPs in autoimmunity associated with the PTPN2 locus. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

RNAi knockdown of oxytocin receptor in the nucleus accumbens inhibits social attachment and parental care in monogamous female prairie voles

PubMed Central

Keebaugh, Alaine C.; Barrett, Catherine E.; LaPrairie, Jamie L.; Jenkins, Jasmine J.; Young, Larry J.

2015-01-01

Oxytocin modulates many aspects of social cognition and behaviors, including maternal nurturing, social recognition and bonding. Natural variation in oxytocin receptor (OXTR) density in the nucleus accumbens (NAcc) is associated with variation in alloparental behavior, and artificially enhancing OXTR expression in the NAcc enhances alloparental behavior and pair bonding in socially monogamous prairie voles. Furthermore, infusion of an OXTR antagonist into the nucleus accumbens (NAcc) inhibits alloparental behavior and partner preference formation. However, antagonists can promiscuously interact with other neuropeptide receptors. To directly examine the role of OXTR signaling in social bonding, we used RNA interference to selectively knockdown, but not eliminate, OXTR in the NAcc of female prairie voles and examined the impact on social behaviors. Using an adeno-associated viral vector expressing a short hairpin RNA (shRNA) targeting Oxtr mRNA, we reduced accumbal OXTR density in female prairie voles from juvenile age through adulthood. Females receiving the shRNA vector displayed a significant reduction in alloparental behavior and disrupted partner preference formation. These are the first direct demonstrations that OXTR plays a critical role in alloparental behavior and adult social attachment, and suggest that natural variation in OXTR expression in this region alone can create variation in social behavior. PMID:25874849

Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver.

PubMed

Piras, Bryan A; O'Connor, Daniel M; French, Brent A

2013-01-01

AAV9 is a powerful gene delivery vehicle capable of providing long-term gene expression in a variety of cell types, particularly cardiomyocytes. The use of AAV-delivery for RNA interference is an intense area of research, but a comprehensive analysis of knockdown in cardiac and liver tissues after systemic delivery of AAV9 has yet to be reported. We sought to address this question by using AAV9 to deliver a short-hairpin RNA targeting the enhanced green fluorescent protein (GFP) in transgenic mice that constitutively overexpress GFP in all tissues. The expression cassette was initially tested in vitro and we demonstrated a 61% reduction in mRNA and a 90% reduction in GFP protein in dual-transfected 293 cells. Next, the expression cassette was packaged as single-stranded genomes in AAV9 capsids to test cardiac GFP knockdown with several doses ranging from 1.8×10(10) to 1.8×10(11) viral genomes per mouse and a dose-dependent response was obtained. We then analyzed GFP expression in both heart and liver after delivery of 4.4×10(11) viral genomes per mouse. We found that while cardiac knockdown was highly efficient, with a 77% reduction in GFP mRNA and a 71% reduction in protein versus control-treated mice, there was no change in liver expression. This was despite a 4.5-fold greater number of viral genomes in the liver than in the heart. This study demonstrates that single-stranded AAV9 vectors expressing shRNA can be used to achieve highly efficient cardiac-selective knockdown of GFP expression that is sustained for at least 7 weeks after the systemic injection of 8 day old mice, with no change in liver expression and no evidence of liver damage despite high viral genome presence in the liver.

Prediction of effective RNA interference targets and pathway-related genes in lepidopteran insects by RNA sequencing analysis.

PubMed

Guan, Ruo-Bing; Li, Hai-Chao; Miao, Xue-Xia

2018-06-01

When using RNA interference (RNAi) to study gene functions in Lepidoptera insects, we discovered that some genes could not be suppressed; instead, their expression levels could be up-regulated by double-stranded RNA (dsRNA). To predict which genes could be easily silenced, we treated the Asian corn borer (Ostrinia furnacalis) with dsGFP (green fluorescent protein) and dsMLP (muscle lim protein). A transcriptome sequence analysis was conducted using the cDNAs 6 h after treatment with dsRNA. The results indicated that 160 genes were up-regulated and 44 genes were down-regulated by the two dsRNAs. Then, 50 co-up-regulated, 25 co-down-regulated and 43 unaffected genes were selected to determine their RNAi responses. All the 25 down-regulated genes were knocked down by their corresponding dsRNA. However, several of the up-regulated and unaffected genes were up-regulated when treated with their corresponding dsRNAs instead of being knocked down. The genes up-regulated by the dsGFP treatment may be involved in insect immune responses or the RNAi pathway. When the immune-related genes were excluded, only seven genes were induced by dsGFP, including ago-2 and dicer-2. These results not only provide a reference for efficient RNAi target predications, but also provide some potential RNAi pathway-related genes for further study. © 2017 Institute of Zoology, Chinese Academy of Sciences.

MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts

PubMed Central

Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng

2014-01-01

Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645

Establishment of lysozyme gene RNA interference systemand its involvement in salinity tolerance in sea cucumber (Apostichopus japonicus).

PubMed

Tian, Yi; Jiang, Yanan; Shang, Yanpeng; Zhang, Yu-Peng; Geng, Chen-Fan; Wang, Li-Qiang; Chang, Ya-Qing

2017-06-01

The lysozyme gene was silenced using RNA interference (RNAi) to analyze the function of lysozyme in sea cucumber under salt stress. The interfering efficiency of four lysozyme RNAi oligos ranged from 0.55 to 0.70. From the four oligos, p-miR-L245 was used for further interfering experiments because it had the best silencing efficiency. Peristomial film injection of p-miR-L245 (10 μg) was used for further interfering experiments. The lowest gene expression, determined by RT-PCR assay, in muscle, coelomic fluid, and parapodium occurred 48 h after p-miR-L245 injection, while that of body wall and tube foot was 96 h and 24 h, respectively. Lysozyme activity in muscle and body wall was significantly lower than the controls. The lowest lysozyme activity in muscle, body wall and parapodium, was found at 48, 72, and 48 h, respectively, which was consistent with the transcription expression of lysozyme. The lowest point of lysozyme activity was at 96 h in coelomic fluid and tube foot, which was laid behind lysozyme expression in transcription level. The expression profile of the lysozyme transcription level and lysozyme activity in the body wall and tube foot increased at 12 h after p-miR-L245 injection before the interference effect appeared. NKA gene expression was expressed at a high level in the positive control (PC) and negative control (NC) groups at 12, 24, and 48 h, while NKA was expressed at low levels in the lysozyme RNAi injection group at 12 and 24 h. The level of NKA gene expression recovered to the level of the PC and NC group at 48, 72, and 96 h after the lysozyme RNAi injection. NKCC1 gene expression was high in the PC and NC groups at 96 h, while the NKCC1 was expressed at a low level 96 h after lysozyme RNAi injection. The results suggest that lysozyme decay involves NKA and NKCC1 gene expression under salinity 18 psμ. The K + and Cl - concentration after lysozyme RNAi injection was lower than in the PC and NC group. Copyright © 2017 Elsevier Ltd. All rights reserved.

Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.

PubMed

Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H

2016-06-17

In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.

Biomimetic RNA-silencing nanocomplexes: overcoming multidrug resistance in cancer cells.

PubMed

Wang, Zhongliang; Wang, Zhe; Liu, Dingbin; Yan, Xuefeng; Wang, Fu; Niu, Gang; Yang, Min; Chen, Xiaoyuan

2014-02-10

RNA interference (RNAi) is an RNA-dependent gene silencing approach controlled by an RNA-induced silencing complex (RISC). Herein, we present a synthetic RISC-mimic nanocomplex, which can actively cleave its target RNA in a sequence-specific manner. With high enzymatic stability and efficient self-delivery to target cells, the designed nanocomplex can selectively and potently induce gene silencing without cytokine activation. These nanocomplexes, which target multidrug resistance, are not only able to bypass the P-glycoprotein (Pgp) transporter, due to their nano-size effect, but also effectively suppress Pgp expression, thus resulting in successful restoration of drug sensitivity of OVCAR8/ADR cells to Pgp-transportable cytotoxic agents. This nanocomplex approach has the potential for both functional genomics and cancer therapy. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Inhibition of West Nile Virus replication by retrovirus-delivered small interfering RNA in human neuroblastoma cells.

PubMed

Yang, Yongbo; Wu, Chengxiang; Wu, Jianguo; Nerurkar, Vivek R; Yanagihara, Richard; Lu, Yuanan

2008-05-01

West Nile virus (WNV) has been responsible for the largest outbreaks of arboviral encephalitis in U.S. history. No specific drug is currently available for the effective treatment of WNV infection. To exploit RNA interference as a potential therapeutic approach, a Moloney murine leukemia virus-based retrovirus vector was used to effectively deliver WNV-specific small interfering RNA (siRNA) into human neuroblastoma HTB-11 cells. Viral plaque assays demonstrated that transduced cells were significantly refractory to WNV replication, as compared to untransduced control cells (P < 0.05), which correlated with the reduced expression of target viral genes and respective viral proteins. Therefore, retrovirus-mediated delivery of siRNA for gene silencing can be used to study the specific functions of viral genes associated with replication and may have potential therapeutic applications.

RNAi-mediated knockdown of the voltage gated sodium ion channel TcNav causes mortality in Tribolium castaneum.

PubMed

Abd El Halim, Hesham M; Alshukri, Baida M H; Ahmad, Munawar S; Nakasu, Erich Y T; Awwad, Mohammed H; Salama, Elham M; Gatehouse, Angharad M R; Edwards, Martin G

2016-07-14

The voltage-gated sodium ion channel (VGSC) belongs to the largest superfamily of ion channels. Since VGSCs play key roles in physiological processes they are major targets for effective insecticides. RNA interference (RNAi) is widely used to analyse gene function, but recently, it has shown potential to contribute to novel strategies for selectively controlling agricultural insect pests. The current study evaluates the delivery of dsRNA targeted to the sodium ion channel paralytic A (TcNav) gene in Tribolium castaneum as a viable means of controlling this insect pest. Delivery of TcNav dsRNA caused severe developmental arrest with larval mortalities up to 73% post injection of dsRNA. Injected larvae showed significant (p < 0.05) knockdown in gene expression between 30-60%. Expression was also significantly (p < 0.05) reduced in pupae following injection causing 30% and 42% knockdown for early and late pupal stages, respectively. Oral delivery of dsRNA caused dose-dependant mortalities of between 19 and 51.34%; this was accompanied by significant (p < 0.05) knockdown in gene expression following 3 days of continuous feeding. The majority of larvae injected with, or fed, dsRNA died during the final larval stage prior to pupation. This work provides evidence of a viable RNAi-based strategy for insect control.

Differentially Expressed Genes Associated with Low-Dose Gamma Radiation

NASA Astrophysics Data System (ADS)

Hegyesi, Hargita; Sándor, Nikolett; Schilling, Boglárka; Kis, Enikő; Lumniczky, Katalin; Sáfrány, Géza

We have studied low dose radiation induced gene expression alterations in a primary human fibroblast cell line using Agilent's whole human genome microarray. Cells were irradiated with 60Co γ-rays (0; 0.1; 0.5 Gy) and 2 hours later total cellular RNA was isolated. We observed differential regulation of approximately 300-500 genes represented on the microarray. Of these, 126 were differentially expressed at both doses, among them significant elevation of GDF-15 and KITLG was confirmed by qRT-PCR. Based on the transcriptional studies we selected GDF-15 to assess its role in radiation response, since GDF-15 is one of the p53 gene targets and is believed to participate in mediating p53 activities. First we confirmed gamma-radiation induced dose-dependent changes in GDF-15 expression by qRT-PCR. Next we determined the effect of GDF-15 silencing on radiosensitivity. Four GDF-15 targeting shRNA expressing lentiviral vectors were transfected into immortalized human fibroblast cells. We obtained efficient GDF-15 silencing in one of the four constructs. RNA interference inhibited GDF-15 gene expression and enhanced the radiosensitivity of the cells. Our studies proved that GDF-15 plays an essential role in radiation response and may serve as a promising target in radiation therapy.

Cellular Response to Ionizing Radiation: A MicroRNA Story

PubMed Central

Halimi, Mohammad; Asghari, S. Mohsen; Sariri, Reyhaneh; Moslemi, Dariush; Parsian, Hadi

2012-01-01

MicroRNAs (miRNAs) represent a class of small non-coding RNA molecules that regulate gene expression at the post-transcriptional level. They play a crucial role in diverse cellular pathways. Ionizing radiation (IR) is one of the most important treatment protocols for patients that suffer from cancer and affects directly or indirectly cellular integration. Recently it has been discovered that microRNA-mediated gene regulation interferes with radio-related pathways in ionizing radiation. Here, we review the recent discoveries about miRNAs in cellular response to IR. Thoroughly understanding the mechanism of miRNAs in radiation response, it will be possible to design new strategies for improving radiotherapy efficiency and ultimately cancer treatment. PMID:24551775

SUMOylation of TARBP2 regulates miRNA/siRNA efficiency

PubMed Central

Chen, Cheng; Zhu, Changhong; Huang, Jian; Zhao, Xian; Deng, Rong; Zhang, Hailong; Dou, Jinzhuo; Chen, Qin; Xu, Ming; Yuan, Haihua; Wang, Yanli; Yu, Jianxiu

2015-01-01

Small RNA-induced gene silencing is essential for post-transcriptional regulation of gene expression; however, it remains unclear how miRNA/siRNA efficiency is regulated. Here we show that TARBP2 is SUMOylated at K52, which can be enhanced by its phosphorylation. This modification can stabilize TARBP2 via repressing its K48-linked ubiquitination. We find that TARBP2 SUMOylation does not influence the overall production of mature miRNAs, but it regulates miRNA/siRNA efficiency. SUMOylated TARBP2 recruits Ago2 to constitute the RNA-induced silencing complex (RISC)-loading complex (RLC), and simultaneously promotes more pre-miRNAs to load into the RLC. Consequently, Ago2 is stabilized and miRNAs/siRNAs bound by TARBP2/Dicer is effectively transferred to Ago2. Thus, these processes lead to the formation of the effective RISC for RNA interference (RNAi). Collectively, our data suggest that SUMOylation of TARBP2 is required for regulating miRNA/siRNA efficiency, which is a general mechanism of miRNA/siRNA regulation. PMID:26582366

Expressing genes do not forget their LINEs: transposable elements and gene expression

PubMed Central

Kines, Kristine J.; Belancio, Victoria P.

2012-01-01

1. ABSTRACT Historically the accumulated mass of mammalian transposable elements (TEs), particularly those located within gene boundaries, was viewed as a genetic burden potentially detrimental to the genomic landscape. This notion has been strengthened by the discovery that transposable sequences can alter the architecture of the transcriptome, not only through insertion, but also long after the integration process is completed. Insertions previously considered harmless are now known to impact the expression of host genes via modification of the transcript quality or quantity, transcriptional interference, or by the control of pathways that affect the mRNA life-cycle. Conversely, several examples of the evolutionary advantageous impact of TEs on the host gene structure that diversified the cellular transcriptome are reported. TE-induced changes in gene expression can be tissue-or disease-specific, raising the possibility that the impact of TE sequences may vary during development, among normal cell types, and between normal and disease-affected tissues. The understanding of the rules and abundance of TE-interference with gene expression is in its infancy, and its contribution to human disease and/or evolution remains largely unexplored. PMID:22201807

Isolation and identification of gene-specific microRNAs.

PubMed

Lin, Shi-Lung; Chang, Donald C; Ying, Shao-Yao

2013-01-01

Computer programming has identified hundreds of genomic hairpin sequences, many with functions remain to be determined. Because direct transfection of hairpin-like miRNA precursors (pre)-miRNAs in mammalian cells is not always sufficient to trigger effective RNA-induced gene silencing complex (RISC) assembly, a key step for RNA interference (RNAi)-related gene silencing, we developed an intronic miRNA-expressing system to overcome this problem by inserting a hairpin-like pre-miRNA structure into the intron region of a gene and successfully increased the efficiency and effectiveness of miRNA-associated RNAi induction in vitro and in vivo. This intronic miRNA biogenesis has been found to depend on a coupled interaction of nascent precursor messenger RNA transcription and intron excision within a specific nuclear region proximal to genomic perichromatin fibrils. The intronic miRNA was transcribed by RNA type II polymerases, coexpressed with a primary gene transcript, and excised out of its encoding gene transcript by intracellular RNA splicing and processing mechanisms. Currently, some ribonuclease III endonucleases have been found to be involved in the processing of spliced introns and probably facilitating the intronic miRNA maturation. Using this miRNA generation system, we have shown for the first time that the intron-derived miRNAs were able to induce strong RNAi effects in not only human and mouse cells but also zebrafishes, chicken embryos, and adult mice. We have also developed an miRNA isolation protocol, based on the complementarity between the designed miRNA and its target gene sequence, to purify and identify the mature miRNAs generated by the intronic miRNA-expressing system. Several intronic miRNA identities and structures are currently confirmed to be active in vitro and in vivo. According to this proven-of-principle method, we now have full knowledge to design pre-miRNA inserts that are more efficient and effective for the intronic miRNA-expressing systems.

Competition between virus-derived and endogenous small RNAs regulates gene expression in Caenorhabditis elegans.

PubMed

Sarkies, Peter; Ashe, Alyson; Le Pen, Jérémie; McKie, Mikel A; Miska, Eric A

2013-08-01

Positive-strand RNA viruses encompass more than one-third of known virus genera and include many medically and agriculturally relevant human, animal, and plant pathogens. The nematode Caenorhabditis elegans and its natural pathogen, the positive-strand RNA virus Orsay, have recently emerged as a new animal model to understand the mechanisms and evolution of innate immune responses. In particular, the RNA interference (RNAi) pathway is required for C. elegans resistance to viral infection. Here we report the first genome-wide analyses of gene expression upon viral infection in C. elegans. Using the laboratory strain N2, we identify a novel C. elegans innate immune response specific to viral infection. A subset of these changes is driven by the RNAi response to the virus, which redirects the Argonaute protein RDE-1 from its endogenous small RNA cofactors, leading to loss of repression of endogenous RDE-1 targets. Additionally, we show that a C. elegans wild isolate, JU1580, has a distinct gene expression signature in response to viral infection. This is associated with a reduction in microRNA (miRNA) levels and an up-regulation of their target genes. Intriguingly, alterations in miRNA levels upon JU1580 infection are associated with a transformation of the antiviral transcriptional response into an antibacterial-like response. Together our data support a model whereby antiviral RNAi competes with endogenous small RNA pathways, causing widespread transcriptional changes. This provides an elegant mechanism for C. elegans to orchestrate its antiviral response, which may have significance for the relationship between small RNA pathways and immune regulation in other organisms.

Competition between virus-derived and endogenous small RNAs regulates gene expression in Caenorhabditis elegans

PubMed Central

Sarkies, Peter; Ashe, Alyson; Le Pen, Jérémie; McKie, Mikel A.; Miska, Eric A.

2013-01-01

Positive-strand RNA viruses encompass more than one-third of known virus genera and include many medically and agriculturally relevant human, animal, and plant pathogens. The nematode Caenorhabditis elegans and its natural pathogen, the positive-strand RNA virus Orsay, have recently emerged as a new animal model to understand the mechanisms and evolution of innate immune responses. In particular, the RNA interference (RNAi) pathway is required for C. elegans resistance to viral infection. Here we report the first genome-wide analyses of gene expression upon viral infection in C. elegans. Using the laboratory strain N2, we identify a novel C. elegans innate immune response specific to viral infection. A subset of these changes is driven by the RNAi response to the virus, which redirects the Argonaute protein RDE-1 from its endogenous small RNA cofactors, leading to loss of repression of endogenous RDE-1 targets. Additionally, we show that a C. elegans wild isolate, JU1580, has a distinct gene expression signature in response to viral infection. This is associated with a reduction in microRNA (miRNA) levels and an up-regulation of their target genes. Intriguingly, alterations in miRNA levels upon JU1580 infection are associated with a transformation of the antiviral transcriptional response into an antibacterial-like response. Together our data support a model whereby antiviral RNAi competes with endogenous small RNA pathways, causing widespread transcriptional changes. This provides an elegant mechanism for C. elegans to orchestrate its antiviral response, which may have significance for the relationship between small RNA pathways and immune regulation in other organisms. PMID:23811144

Loss of DLK expression in WI-38 human diploid fibroblasts induces a senescent-like proliferation arrest

DOE Office of Scientific and Technical Information (OSTI.GOV)

Daviau, Alex; Couture, Jean-Philippe; Blouin, Richard, E-mail: Richard.Blouin@USherbrooke.ca

Highlights: {yields} Role of DLK in cell proliferation. {yields} Modulation of DLK expression during cell cycle progression. {yields} DLK knockdown induces proliferation arrest and senescence. {yields} DLK-depleted cells display loss of cyclin D1 and up-regulation of p21. {yields} DLK participates in cell proliferation by modulating cell cycle regulator expression. -- Abstract: DLK, a serine/threonine kinase that functions as an upstream activator of the mitogen-activated protein kinase (MAPK) pathways, has been shown to play a role in development, cell differentiation, apoptosis and neuronal response to injury. Interestingly, recent studies have shown that DLK may also be required for cell proliferation, althoughmore » little is known about its specific functions. To start addressing this issue, we studied how DLK expression is modulated during cell cycle progression and what effect DLK depletion has on cell proliferation in WI-38 fibroblasts. Our results indicate that DLK protein levels are low in serum-starved cells, but that serum addition markedly stimulated it. Moreover, RNA interference experiments demonstrate that DLK is required for ERK activity, expression of the cell cycle regulator cyclin D1 and proliferation of WI-38 cells. DLK-depleted cells also show a senescent phenotype as revealed by senescence-associated galactosidase activity and up-regulation of the senescence pathway proteins p53 and p21. Consistent with a role for p53 in this response, inhibition of p53 expression by RNA interference significantly alleviated senescence induced by DLK knockdown. Together, these findings indicate that DLK participates in cell proliferation and/or survival, at least in part, by modulating the expression of cell cycle regulatory proteins.« less

Molecular interactions and immune responses between maize fine streak virus and the leafhopper vector G. nigrifrons through differential expression and RNA interference

USDA-ARS?s Scientific Manuscript database

Maize fine streak virus (MFSV) is an emerging virus of maize that is transmitted by an insect vector, the leafhopper called Graminella nigrifrons. Virus transmission by the leafhopper requires that the virus enter into and multiply in insect cells, tissues and organs before being transmitted to a ne...

Discovery, adaptation and transcriptional activity of two tick promoters: Construction of a dual luciferase reporter system for optimization of RNA interference in Rhipicephalus (Boophilus) microplus cell lines

USDA-ARS?s Scientific Manuscript database

Dual luciferase reporter systems are valuable tools for functional genomic studies, but have not previously been developed for use in tick cell culture. We evaluated expression of available luciferase constructs in tick cell cultures derived from Rhipicephalus (Boophilus) microplus, an important vec...

Evidence for a Role of Connexin 43 in Trigeminal Pain Using RNA Interference In Vivo

PubMed Central

Ohara, Peter T.; Vit, Jean-Philippe; Bhargava, Aditi; Jasmin, Luc

2008-01-01

The importance of glial cells in the generation and maintenance of neuropathic pain is becoming widely accepted. We examined the role of glial-specific gap junctions in nociception in the rat trigeminal ganglion in nerve-injured and -uninjured states. The connexin 43 (Cx43) gap-junction subunit was found to be confined to the satellite glial cells (SGCs) that tightly envelop primary sensory neurons in the trigeminal ganglion and we therefore used Cx43 RNA interference (RNAi) to alter gap-junction function in SGCs. Using behavioral evaluation, together with immunocytochemical and Western blot monitoring, we show that Cx43 increased in the trigeminal ganglion in rats with a chronic constriction injury (CCI) of the infraorbital nerve. Reducing Cx43 expression using RNAi in CCI rats reduced painlike behavior, whereas in non-CCI rats, reducing Cx43 expression increased painlike behavior. The degree of painlike behavior in CCI rats and intact, Cx43-silenced rats was similar. Our results support previous suggestions that increases in glial gap junctions after nerve injury increases nociceptive behavior but paradoxically the reduction of gap junctions in normal ganglia also increases nociceptive behavior, possibly a reflection of the multiple functions performed by glia. PMID:18715894

NIK and Cot cooperate to trigger NF-kappaB p65 phosphorylation.

PubMed

Wittwer, Tobias; Schmitz, M Lienhard

2008-06-27

The serine/threonine kinase Cot triggers NF-kappaB-dependent transactivation and activation of various MAPKinases. Here we identify Cot as a novel p65 interacting protein kinase. Cot expression induces p65 phosphorylation at serines 536 and 468 in dependence from its kinase function. Accordingly, shRNA-mediated knockdown of Cot expression interferes with TNF-induced NF-kappaB-dependent gene expression. Also the C-terminally truncated, oncogenic form of Cot is able to trigger p65 phosphorylation. In vitro kinase assays and dominant negative mutants revealed that NIK functions downstream of Cot to mediate p65 phosphorylation.

Common ground: small RNA programming and chromatin modifications.

PubMed

Lejeune, Erwan; Allshire, Robin C

2011-06-01

Epigenetic mechanisms regulate genome structure and expression profiles in eukaryotes. RNA interference (RNAi) and other small RNA-based chromatin-modifying activities can act to reset the epigenetic landscape at defined chromatin domains. Centromeric heterochromatin assembly is a RNAi-dependent process in the fission yeast Schizosaccharomyces pombe, and provides a paradigm for detailed examination of such epigenetic processes. Here we review recent progress in understanding the mechanisms that underpin RNAi-mediated heterochromatin formation in S. pombe. We discuss recent analyses of the events that trigger RNAi and manipulations which uncouple RNAi and chromatin modification. Finally we provide an overview of similar molecular machineries across species where related small RNA pathways appear to drive the epigenetic reprogramming in germ cells and/or during early development in metazoans. Copyright © 2011 Elsevier Ltd. All rights reserved.

Design of siRNA Therapeutics from the Molecular Scale

PubMed Central

Angart, Phillip; Vocelle, Daniel; Chan, Christina; Walton, S. Patrick

2013-01-01

While protein-based therapeutics is well-established in the market, development of nucleic acid therapeutics has lagged. Short interfering RNAs (siRNAs) represent an exciting new direction for the pharmaceutical industry. These small, chemically synthesized RNAs can knock down the expression of target genes through the use of a native eukaryotic pathway called RNA interference (RNAi). Though siRNAs are routinely used in research studies of eukaryotic biological processes, transitioning the technology to the clinic has proven challenging. Early efforts to design an siRNA therapeutic have demonstrated the difficulties in generating a highly-active siRNA with good specificity and a delivery vehicle that can protect the siRNA as it is transported to a specific tissue. In this review article, we discuss design considerations for siRNA therapeutics, identifying criteria for choosing therapeutic targets, producing highly-active siRNA sequences, and designing an optimized delivery vehicle. Taken together, these design considerations provide logical guidelines for generating novel siRNA therapeutics. PMID:23976875

Antiviral effect of PmRab7 knock-down on inhibition of Laem-Singh virus replication in black tiger shrimp.

PubMed

Ongvarrasopone, Chalermporn; Chomchay, Ekapol; Panyim, Sakol

2010-10-01

PmRab7 is a Penaeus monodon small GTPase protein possibly involved in replication of several shrimp viruses. In this study RNA interference (RNAi) using double-stranded RNA (dsRNA) targeting PmRab7 gene (dsRNA-PmRab7) was employed to silence the expression of PmRab7 to investigate the inhibitory effect on Laem-Singh virus (LSNV) replication. Injection of dsRNA-PmRab7 24h before challenge with the virus resulted in a drastic decrease of PmRab7 mRNA and complete inhibition of LSNV replication at 3 days post-challenge. In a therapeutic mode, shrimp injected with dsRNA-PmRab7 1 day but not at 3 or 5 days post-LSNV challenge resulted in inhibition of LSNV replication. These results pave the way to use dsRNA-PmRab7 to prevent or cure LSNV infection in shrimp. Copyright © 2010 Elsevier B.V. All rights reserved.

Exaptive origins of regulated mRNA decay in eukaryotes.

PubMed

Hamid, Fursham M; Makeyev, Eugene V

2016-09-01

Eukaryotic gene expression is extensively controlled at the level of mRNA stability and the mechanisms underlying this regulation are markedly different from their archaeal and bacterial counterparts. We propose that two such mechanisms, nonsense-mediated decay (NMD) and motif-specific transcript destabilization by CCCH-type zinc finger RNA-binding proteins, originated as a part of cellular defense against RNA pathogens. These branches of the mRNA turnover pathway might have been used by primeval eukaryotes alongside RNA interference to distinguish their own messages from those of RNA viruses and retrotransposable elements. We further hypothesize that the subsequent advent of "professional" innate and adaptive immunity systems allowed NMD and the motif-triggered mechanisms to be efficiently repurposed for regulation of endogenous cellular transcripts. This scenario explains the rapid emergence of archetypical mRNA destabilization pathways in eukaryotes and argues that other aspects of post-transcriptional gene regulation in this lineage might have been derived through a similar exaptation route. © 2016 The Authors BioEssays Published by WILEY Periodicals, Inc.

Pest control. Full crop protection from an insect pest by expression of long double-stranded RNAs in plastids.

PubMed

Zhang, Jiang; Khan, Sher Afzal; Hasse, Claudia; Ruf, Stephanie; Heckel, David G; Bock, Ralph

2015-02-27

Double-stranded RNAs (dsRNAs) targeted against essential genes can trigger a lethal RNA interference (RNAi) response in insect pests. The application of this concept in plant protection is hampered by the presence of an endogenous plant RNAi pathway that processes dsRNAs into short interfering RNAs. We found that long dsRNAs can be stably produced in chloroplasts, a cellular compartment that appears to lack an RNAi machinery. When expressed from the chloroplast genome, dsRNAs accumulated to as much as 0.4% of the total cellular RNA. Transplastomic potato plants producing dsRNAs targeted against the β-actin gene of the Colorado potato beetle, a notorious agricultural pest, were protected from herbivory and were lethal to its larvae. Thus, chloroplast expression of long dsRNAs can provide crop protection without chemical pesticides. Copyright © 2015, American Association for the Advancement of Science.

RNA interference-mediated silencing of mutant superoxide dismutase rescues cyclosporin A-induced death in cultured neuroblastoma cells

PubMed Central

Maxwell, Michele M.; Pasinelli, Piera; Kazantsev, Aleksey G.; Brown, Robert H.

2004-01-01

Amyotrophic lateral sclerosis (ALS) is a progressive and fatal neurodegenerative disorder resulting from selective death of motor neurons in the brain and spinal cord. In ≈25% of familial ALS cases, the disease is caused by dominantly acting point mutations in the gene encoding cytosolic Cu,Zn superoxide dismutase (SOD1). In cell culture and in rodent models of ALS, mutant SOD1 proteins exhibit dose-dependent toxicity; thus, agents that reduce mutant protein expression would be powerful therapeutic tools. A wealth of recent evidence has demonstrated that the mechanism of RNA-mediated interference (RNAi) can be exploited to achieve potent and specific gene silencing in vitro and in vivo. We have evaluated the utility of RNAi for selective silencing of mutant SOD1 expression in cultured cells and have identified small interfering RNAs capable of specifically inhibiting expression of ALS-linked mutant, but not wild-type, SOD1. We have investigated the functional effects of RNAi-mediated silencing of mutant SOD1 in cultured murine neuroblastoma cells. In this model, stable expression of mutant, but not wild-type, human SOD1 sensitizes cells to cytotoxic stimuli. We find that silencing of mutant SOD1 protects these cells against cyclosporin A-induced cell death. These results demonstrate a positive physiological effect caused by RNAi-mediated silencing of a dominant disease allele. The present study further supports the therapeutic potential of RNAi-based methods for the treatment of inherited human diseases, including ALS. PMID:14981234

Heat shock protein 83 plays pleiotropic roles in embryogenesis, longevity, and fecundity of the pea aphid Acyrthosiphon pisum.

PubMed

Will, Torsten; Schmidtberg, Henrike; Skaljac, Marisa; Vilcinskas, Andreas

2017-01-01

Heat shock protein 83 (HSP83) is homologous to the chaperone HSP90. It has pleiotropic functions in Drosophila melanogaster, including the control of longevity and fecundity, and facilitates morphological evolution by buffering cryptic deleterious mutations in wild populations. In the pea aphid Acyrthosiphon pisum, HSP83 expression is moderately induced by bacterial infection but upregulated more strongly in response to heat stress and fungal infection. Stress-inducible heat shock proteins are of considerable evolutionary and ecological importance because they are known to buffer environmental variation and to influence fitness under non-optimal conditions. To investigate the functions of HSP83 in viviparous aphids, we used RNA interference to attenuate its expression and studied the impact on complex parameters. The RNA interference (RNAi)-mediated depletion of HSP83 expression in A. pisum reduced both longevity and fecundity, suggesting this chaperone has an evolutionarily conserved function in insects. Surprisingly, HSP83 depletion reduced the number of viviparous offspring while simultaneously increasing the number of premature nymphs developing in the ovaries, suggesting an unexpected role in aphid embryogenesis and eclosion. The present study indicates that reduced HSP83 expression in A. pisum reveals both functional similarities and differences compared with its reported roles in holometabolous insects. Its impact on aphid lifespan, fecundity, and embryogenesis suggests a function that determines their fitness. This could be achieved by targeting different client proteins, recruiting distinct co-chaperones or transposon activation.

Specification of skeletal muscle differentiation by repressor element-1 silencing transcription factor (REST)-regulated Kv7.4 potassium channels

PubMed Central

Iannotti, Fabio Arturo; Barrese, Vincenzo; Formisano, Luigi; Miceli, Francesco; Taglialatela, Maurizio

2013-01-01

Changes in the expression of potassium (K+) channels is a pivotal event during skeletal muscle differentiation. In mouse C2C12 cells, similarly to human skeletal muscle cells, myotube formation increased the expression of Kv7.1, Kv7.3, and Kv7.4, the last showing the highest degree of regulation. In C2C12 cells, Kv7.4 silencing by RNA interference reduced the expression levels of differentiation markers (myogenin, myosin heavy chain, troponinT-1, and Pax3) and impaired myotube formation and multinucleation. In Kv7.4-silenced cells, the differentiation-promoting effect of the Kv7 activator N-(2-amino-4-(4-fluorobenzylamino)-phenyl)-carbamic acid ethyl ester (retigabine) was abrogated. Expression levels for the repressor element-1 silencing transcription factor (REST) declined during myotube formation. Transcript levels for Kv7.4, as well as for myogenin, troponinT-1, and Pax3, were reduced by REST overexpression and enhanced upon REST suppression by RNA interference. Four regions containing potential REST-binding sites in the 5′ untranslated region and in the first intron of the Kv7.4 gene were identified by bioinformatic analysis. Chromatin immunoprecipitation assays showed that REST binds to these regions, exhibiting a higher efficiency in myoblasts than in myotubes. These data suggest that Kv7.4 plays a permissive role in skeletal muscle differentiation and highlight REST as a crucial transcriptional regulator for this K+ channel subunit. PMID:23242999

LncRNA NONRATT021972 siRNA rescued decreased heart rate variability in diabetic rats in superior cervical ganglia.

PubMed

Xu, Hong; Liu, Changle; Rao, Shenqiang; He, Luling; Zhang, Tengling; Sun, Shanshan; Wu, Bing; Zou, Lifang; Wang, Shouyu; Xue, Yun; Jia, Tianyu; Zhao, Shanhong; Li, Guilin; Liu, Shuangmei; Li, Guodong; Liang, Shangdong

2016-12-01

Diabetic cardiac autonomic neuropathy (DCAN) is a serious and common complication in diabetes mellitus (DM). Long noncoding RNAs (lncRNAs), an important class of regulatory molecules in diverse biological processes, have attracted considerable interest in DCAN. Our previous study has indicated a lncRNA, NONRATT021972 (NONCODE ID), was enhanced in sympathetic neuronal-like PC12 cells in the setting of high glucose (HG) and high FFAs (HF); its silence was found to significantly alleviate HGHF-induced tumor necrosis factor-α (TNF-α) release in PC12 cells. Here we further explore the effects of NONRATT021972 small interference RNA (siRNA) on heart rate variability (HRV) mediated by superior cervical ganglia (SCG) in diabetic rats and the possible mechanism underlying. We found an increment of NONRATT021972 in SCG of DM rats. Treatment of NONRATT021972 siRNA in DM rats decreased the elevated expression of TNF-α, blocked serine phosphorylation of insulin receptor substrate (IRS) 1 and increased the down-regulated expression of IRS1 in SCG. Meanwhile, NONRATT021972 siRNA rescued decreased HRV in DM rats. Therefore, inhibition of NONRATT021972 may serve as a novel therapeutic strategy for preventing the development of DCAN. Copyright © 2016 Elsevier B.V. All rights reserved.

MicroRNA-mediated gene regulation: potential applications for plant genetic engineering.

PubMed

Zhou, Man; Luo, Hong

2013-09-01

Food security is one of the most important issues challenging the world today. Any strategies to solve this problem must include increasing crop yields and quality. MicroRNA-based genetic modification technology (miRNA-based GM tech) can be one of the most promising solutions that contribute to agricultural productivity directly by developing superior crop cultivars with enhanced biotic and abiotic stress tolerance and increased biomass yields. Indirectly, the technology may increase usage of marginal soils and decrease pesticide use, among other benefits. This review highlights the most recent progress of transgenic studies utilizing various miRNAs and their targets for plant trait modifications, and analyzes the potential of miRNA-mediated gene regulation for use in crop improvement. Strategies for manipulating miRNAs and their targets in transgenic plants including constitutive, stress-induced, or tissue-specific expression of miRNAs or their targets, RNA interference, expressing miRNA-resistant target genes, artificial target mimic and artificial miRNAs were discussed. We also discussed potential risks of utilizing miRNA-based GM tech. In general, miRNAs and their targets not only provide an invaluable source of novel transgenes, but also inspire the development of several new GM strategies, allowing advances in breeding novel crop cultivars with agronomically useful characteristics.

Betulinic Acid Targets YY1 and ErbB2 through Cannabinoid Receptor-Dependent Disruption of MicroRNA-27a:ZBTB10 in Breast Cancer

PubMed Central

Liu, Xinyi; Jutooru, Indira; Lei, Ping; Kim, KyoungHyun; Lee, Syng-ook; Brents, Lisa K.; Prather, Paul L.; Safe, Stephen

2016-01-01

Treatment of ErbB2-overexpressing BT474 and MDA-MB-453 breast cancer cells with 1 to 10 μmol/L betulinic acid inhibited cell growth, induced apoptosis, downregulated specificity protein (Sp) transcription factors Sp1, Sp3, and Sp4, and decreased expression of ErbB2. Individual or combined knockdown of Sp1, Sp3, Sp4 by RNA interference also decreased expression of ErbB2 and this response was because of repression of YY1, an Sp-regulated gene. Betulinic acid–dependent repression of Sp1, Sp3, Sp4, and Sp-regulated genes was due, in part, to induction of the Sp repressor ZBTB10 and downregulation of microRNA-27a (miR-27a), which constitutively inhibits ZBTB10 expression, and we show for the first time that the effects of betulinic acid on the miR-27a:ZBTB10-Sp transcription factor axis were cannabinoid 1 (CB1) and CB2 receptor–dependent, thus identifying a new cellular target for this anticancer agent. PMID:22553354

Transovarial silencing of the subolesin gene in three-host ixodid tick species after injection of replete females with subolesin dsRNA.

PubMed

Kocan, Katherine M; Manzano-Roman, Raúl; de la Fuente, José

2007-05-01

RNA interference (RNAi) has become the most powerful experimental tool for the study of gene function in ticks. Subolesin, initially called 4D8, was found to be protective against tick infestations when used as a vaccine and was shown to be highly conserved among ixodid tick species at the nucleotide and protein levels. RNAi caused systemic silencing of subolesin and demonstrated that this protein is involved in regulation of tick feeding, reproduction, and development. Recently, these results were extended to the one-host tick Rhipicephalus (Boophilus) microplus in which injection of dsRNA into replete females resulted in transovarial silencing of subolesin expression in eggs and larvae. Herein, we report transovarial silencing of subolesin by RNAi in the three-host ticks, Amblyomma americanum, Dermacentor variabilis, and Ixodes scapularis. Silencing of subolesin expression by RNAi in these tick species also affected subolesin expression in eggs and larvae. Transovarial RNAi appears to be a common mechanism in ixodid ticks and provides a simple method for the rapid characterization of tick genes involved in oviposition, embryogenesis, and larval development.

A nanobiosensor for dynamic single cell analysis during microvascular self-organization.

PubMed

Wang, S; Sun, J; Zhang, D D; Wong, P K

2016-10-14

The formation of microvascular networks plays essential roles in regenerative medicine and tissue engineering. Nevertheless, the self-organization mechanisms underlying the dynamic morphogenic process are poorly understood due to a paucity of effective tools for mapping the spatiotemporal dynamics of single cell behaviors. By establishing a single cell nanobiosensor along with live cell imaging, we perform dynamic single cell analysis of the morphology, displacement, and gene expression during microvascular self-organization. Dynamic single cell analysis reveals that endothelial cells self-organize into subpopulations with specialized phenotypes to form microvascular networks and identifies the involvement of Notch1-Dll4 signaling in regulating the cell subpopulations. The cell phenotype correlates with the initial Dll4 mRNA expression level and each subpopulation displays a unique dynamic Dll4 mRNA expression profile. Pharmacological perturbations and RNA interference of Notch1-Dll4 signaling modulate the cell subpopulations and modify the morphology of the microvascular network. Taken together, a nanobiosensor enables a dynamic single cell analysis approach underscoring the importance of Notch1-Dll4 signaling in microvascular self-organization.

Vasorin is a potential serum biomarker and drug target of hepatocarcinoma screened by subtractive-EMSA-SELEX to clinic patient serum.

PubMed

Li, Shaohua; Li, Hui; Yang, Xiqin; Wang, Wei; Huang, Aixue; Li, Jie; Qin, Xingliang; Li, Fei; Lu, Guanyi; Ding, Hongmei; Su, Xueting; Hou, Lvbin; Xia, Wei; Shi, Ming; Zhang, Hongwen; Zhao, Qiang; Dong, Jie; Ge, Xingfeng; Sun, Leqiao; Bai, Chenjun; Wang, Chaonan; Shen, Xuelian; Fang, Tao; Wang, Fusheng; Zhang, Heqiu; Shao, Ningsheng

2015-04-30

We report a new biomarker of hepatocarcinoma, vasorin (VASN), screened by a subtractive EMSA-SELEX strategy from AFP negative serum of hepatocellular carcinoma (HCC) patients with extrahepatic metastases. VASN was verified to be highly expressed in sera of 100 cases of HCC patients compared with 97 cases of normal persons and 129 cases of hepatitis patients. Further validation by Q-PCR,IFA and Western blot showed higher expression of VASN at mRNA and protein levels in HCC cell lines and HCC tissues than in normal controls. RNA interference and forced overexpression assays verified that VASN promotes cell proliferation and migration and inhibits apoptosis. Down-regulation of microRNA miR145 and miR146a is an important mechanism leading to high expression of VASN. As a membrane protein and/or as free protein, VASN may be an effective target for biological treatment of liver cancer and is a potential biomarker for HCC diagnosis. Small molecular nucleotides targeting VASN are promising biological therapies to HCC.

Vasorin is a potential serum biomarker and drug target of hepatocarcinoma screened by subtractive-EMSA-SELEX to clinic patient serum

PubMed Central

Wang, Wei; Huang, Aixue; Li, Jie; Qin, Xingliang; Li, Fei; Lu, Guanyi; Ding, Hongmei; Su, Xueting; Hou, Lvbin; Xia, Wei; Shi, Ming; Zhang, Hongwen; Zhao, Qiang; Dong, Jie; Ge, Xingfeng; Sun, Leqiao; Bai, Chenjun; Wang, Chaonan; Shen, Xuelian; Fang, Tao; Wang, Fusheng; Zhang, Heqiu; Shao, Ningsheng

2015-01-01

We report a new biomarker of hepatocarcinoma, vasorin (VASN), screened by a subtractive EMSA-SELEX strategy from AFP negative serum of hepatocellular carcinoma (HCC) patients with extrahepatic metastases. VASN was verified to be highly expressed in sera of 100 cases of HCC patients compared with 97 cases of normal persons and 129 cases of hepatitis patients. Further validation by Q-PCR, IFA and Western blot showed higher expression of VASN at mRNA and protein levels in HCC cell lines and HCC tissues than in normal controls. RNA interference and forced overexpression assays verified that VASN promotes cell proliferation and migration and inhibits apoptosis. Down-regulation of microRNA miR145 and miR146a is an important mechanism leading to high expression of VASN. Conclusion: As a membrane protein and/or as free protein, VASN may be an effective target for biological treatment of liver cancer and is a potential biomarker for HCC diagnosis. Small molecular nucleotides targeting VASN are promising biological therapies to HCC. PMID:25826090

MAPK Usage in Periodontal Disease Progression

PubMed Central

Li, Qiyan; Valerio, Michael S.; Kirkwood, Keith L.

2012-01-01

In periodontal disease, host recognition of bacterial constituents, including lipopolysaccharide (LPS), induces p38 MAPK activation and subsequent inflammatory cytokine expression, favoring osteoclastogenesis and increased net bone resorption in the local periodontal environment. In this paper, we discuss evidence that the p38/MAPK-activated protein kinase-2 (MK2) signaling axis is needed for periodontal disease progression: an orally administered p38α inhibitor reduced the progression of experimental periodontal bone loss by reducing inflammation and cytokine expression. Subsequently, the significance of p38 signaling was confirmed with RNA interference to attenuate MK2-reduced cytokine expression and LPS-induced alveolar bone loss. MAPK phosphatase-1 (MKP-1), a negative regulator of MAPK activation, was also critical for periodontal disease progression. In MPK-1-deficient mice, p38-sustained activation increased osteoclast formation and bone loss, whereas MKP-1 overexpression dampened p38 signaling and subsequent cytokine expression. Finally, overexpression of the p38/MK2 target RNA-binding tristetraprolin (TTP) decreased mRNA stability of key inflammatory cytokines at the posttranscriptional level, thereby protecting against periodontal inflammation. Collectively, these studies highlight the importance of p38 MAPK signaling in immune cytokine production and periodontal disease progression. PMID:22315682

[RNA interference of HERC4 inhibits proliferation, apoptosis and migration of cervical cancer Hela cells].

PubMed

Wei, Min; Zhang, Yan-Ling; Chen, Lan; Cai, Cui-Xia; Wang, Han-Duo

2016-02-20

To explore the effects of silencing HERC4 on the proliferation, apoptosis, and migration of cervical cancer cell line Hela and the possible molecular mechanisms. Three HERC4-specific small interfering RNAs (siRNAs) were transfected into Hela cells, and HERC4 expression in the cells was examined with Western blotting. CCK-8 assay, annexin V-FITC/PI assay, and wound healing assay were used to assess the effect of HERC4 silencing on the proliferation, apoptosis and migration ability of Hela cells. The expression levels of cyclin D1 and Bcl-2 in the cells were detected using Western blotting. Transfection of siRNA-3 resulted in significantly decreased HERC4 protein expression (P<0.01). HERC4 silencing by siRNA-3 markedly suppressed the proliferation and migration of Hela cells, increased the apoptosis rate (P<0.01) and reduced the expression levels of cyclin D1 and Bcl-2 (P<0.01). Silencing of HERC4 efficiently inhibits the proliferation, migration, and invasion of Hela cells in vitro, and the underlying mechanisms may involve the down-regulation of cyclin D1 and Bcl-2.

Selective gene silencing by viral delivery of short hairpin RNA

PubMed Central

2010-01-01

RNA interference (RNAi) technology has not only become a powerful tool for functional genomics, but also allows rapid drug target discovery and in vitro validation of these targets in cell culture. Furthermore, RNAi represents a promising novel therapeutic option for treating human diseases, in particular cancer. Selective gene silencing by RNAi can be achieved essentially by two nucleic acid based methods: i) cytoplasmic delivery of short double-stranded (ds) interfering RNA oligonucleotides (siRNA), where the gene silencing effect is only transient in nature, and possibly not suitable for all applications; or ii) nuclear delivery of gene expression cassettes that express short hairpin RNA (shRNA), which are processed like endogenous interfering RNA and lead to stable gene down-regulation. Both processes involve the use of nucleic acid based drugs, which are highly charged and do not cross cell membranes by free diffusion. Therefore, in vivo delivery of RNAi therapeutics must use technology that enables the RNAi therapeutic to traverse biological membrane barriers in vivo. Viruses and the vectors derived from them carry out precisely this task and have become a major delivery system for shRNA. Here, we summarize and compare different currently used viral delivery systems, give examples of in vivo applications, and indicate trends for new developments, such as replicating viruses for shRNA delivery to cancer cells. PMID:20858246

The brain-specific double-stranded RNA-binding protein Staufen2: nucleolar accumulation and isoform-specific exportin-5-dependent export.

PubMed

Macchi, Paolo; Brownawell, Amy M; Grunewald, Barbara; DesGroseillers, Luc; Macara, Ian G; Kiebler, Michael A

2004-07-23

The mammalian double-stranded RNA-binding proteins Staufen (Stau1 and Stau2) are involved in RNA localization in polarized neurons. In contrast to the more ubiquitously expressed Stau1, Stau2 is mainly expressed in the nervous system. In Drosophila, the third double-stranded RNA-binding domain (RBD3) of Staufen is essential for RNA interaction. When conserved amino acids within the RBD3 of Stau2 were mutated to render Stau2 defective for RNA binding, the mutant Stau2 proteins accumulate predominantly in the nucleolus. This is in contrast to wild type Stau2 that mostly localizes in the cytosol. The nuclear import is dependent on a nuclear localization signal in close proximity to the RBD3. The nuclear export of Stau2 is not dependent on CRM1 but rather on Exportin-5. We show that Exportin-5 interacts with the RBD3 of wild type Stau2 in an RNA-dependent manner in vitro but not with mutant Stau2. When Exportin-5 is down-regulated by RNA interference, only the largest isoform of Stau2 (Stau2(62)) preferentially accumulates in the nucleolus. It is tempting to speculate that Stau2(62) binds RNA in the nucleus and assembles into ribonucleoparticles, which are then exported via the Exportin-5 pathway to their final destination.

15-deoxy-Delta12,14-prostaglandin J2 inhibits INF-gamma-induced JAK/STAT1 signalling pathway activation and IP-10/CXCL10 expression in mesangial cells.

PubMed

Panzer, Ulf; Zahner, Gunther; Wienberg, Ulrike; Steinmetz, Oliver M; Peters, Anett; Turner, Jan-Eric; Paust, Hans-Joachim; Wolf, Gunter; Stahl, Rolf A K; Schneider, André

2008-12-01

Activators of the peroxisome proliferator-activated receptor gamma (PPARgamma), originally found to be implicated in lipid metabolism and glucose homeostasis, have been shown to modulate inflammatory responses through interference with cytokine and chemokine production. Given the central role of mesangial cell-derived chemokines in glomerular leukocyte recruitment in human and experimental glomerulonephritis, we studied the influence of natural and synthetic PPARgamma activators on INF-gamma-induced expression of the T cell-attracting chemokines IP-10/CXCL10, Mig/CXCL9 and I-TAC/CXCL11 in mouse mesangial cells. INF-gamma-treated mesangial cells were cultured in the presence or absence of either the naturally occurring PPARgamma ligand 15-deoxy-Delta(12,14)-prostaglandin J(2) (15d-PGJ(2)) or synthetic PPARgamma activators of the glitazone group. Chemokine mRNA and protein expression and activation of the JAK/STAT signalling pathway were analysed. The 15d-PGJ(2), but not synthetic PPARgamma ligands, dose-dependently inhibited INF-gamma-induced chemokine gene (mRNA and protein) expression. Combined results from EMSA and western blot analysis revealed the inhibitory ability of 15d-PGJ(2), but not of synthetic PPARgamma ligands, on IFN-gamma-induced tyrosine phosphorylation of JAK1, JAK2, STAT1 and nuclear STAT1 translocation and DNA binding. Our results demonstrate that 15d-PGJ(2) inhibits INF-gamma-induced chemokine expression in mesangial cells by targeting the JAK/STAT signalling pathway. This effect is independent of an interference with PPARgamma.

MUC4 modulates human glioblastoma cell proliferation and invasion by upregulating EGFR expression.

PubMed

Li, Weihua; Wu, Chunming; Yao, Yiqun; Dong, Bin; Wei, Zhenqing; Lv, Xiupeng; Zhang, Jian; Xu, Yinghui

2014-04-30

Glioblastoma (GBM), the most common primary brain tumor, is the leading cause of deaths related to tumors in the central nervous system. The prognosis of GBM patients is currently poor, and the mechanisms underlying GBM genesis remain unclear. The expression of MUC4, a high-molecular-weight and highly glycosylated protein, has been studied in many cancers. However, information on MUC4 expression in GBM is limited. In this study, we found that MUC4 was overexpressed in GBM cell lines and tissues. The proliferation and invasive potential of GBM cells were significantly increased by the ectopic expression of MUC4. By contrast, RNA interference targeting MUC4 in GBM cells significantly decreased the proliferation and invasive potential of GBM cells. We also found that the expression of epidermal growth factor receptor (EGFR) was modulated by MUC4. EGFR inhibition by siRNA reversed the MUC4-induced proliferation and invasion. These results indicated that MUC4 expression in GBM was important in GBM cell proliferation and invasion, which may be partly associated with EGFR overexpression. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Functional Nanostructures for Effective Delivery of Small Interfering RNA Therapeutics

PubMed Central

Hong, Cheol Am; Nam, Yoon Sung

2014-01-01

Small interfering RNA (siRNA) has proved to be a powerful tool for target-specific gene silencing via RNA interference (RNAi). Its ability to control targeted gene expression gives new hope to gene therapy as a treatment for cancers and genetic diseases. However, siRNA shows poor pharmacological properties, such as low serum stability, off-targeting, and innate immune responses, which present a significant challenge for clinical applications. In addition, siRNA cannot cross the cell membrane for RNAi activity because of its anionic property and stiff structure. Therefore, the development of a safe, stable, and efficient system for the delivery of siRNA therapeutics into the cytoplasm of targeted cells is crucial. Several nanoparticle platforms for siRNA delivery have been developed to overcome the major hurdles facing the therapeutic uses of siRNA. This review covers a broad spectrum of non-viral siRNA delivery systems developed for enhanced cellular uptake and targeted gene silencing in vitro and in vivo and discusses their characteristics and opportunities for clinical applications of therapeutic siRNA. PMID:25285170

Double-stranded RNA Oral Delivery Methods to Induce RNA Interference in Phloem and Plant-sap-feeding Hemipteran Insects.

PubMed

Ghosh, Saikat Kumar B; Hunter, Wayne B; Park, Alexis L; Gundersen-Rindal, Dawn E

2018-05-04

Phloem and plant sap feeding insects invade the integrity of crops and fruits to retrieve nutrients, in the process damaging food crops. Hemipteran insects account for a number of economically substantial pests of plants that cause damage to crops by feeding on phloem sap. The brown marmorated stink bug (BMSB), Halyomorpha halys (Heteroptera: Pentatomidae) and the Asian citrus psyllid (ACP), Diaphorina citri Kuwayama (Hemiptera: Liviidae) are hemipteran insect pests introduced in North America, where they are an invasive agricultural pest of high-value specialty, row, and staple crops and citrus fruits, as well as a nuisance pest when they aggregate indoors. Insecticide resistance in many species has led to the development of alternate methods of pest management strategies. Double-stranded RNA (dsRNA)-mediated RNA interference (RNAi) is a gene silencing mechanism for functional genomic studies that has potential applications as a tool for the management of insect pests. Exogenously synthesized dsRNA or small interfering RNA (siRNA) can trigger highly efficient gene silencing through the degradation of endogenous RNA, which is homologous to that presented. Effective and environmental use of RNAi as molecular biopesticides for biocontrol of hemipteran insects requires the in vivo delivery of dsRNAs through feeding. Here we demonstrate methods for delivery of dsRNA to insects: loading of dsRNA into green beans by immersion, and absorbing of gene-specific dsRNA with oral delivery through ingestion. We have also outlined non-transgenic plant delivery approaches using foliar sprays, root drench, trunk injections as well as clay granules, all of which may be essential for sustained release of dsRNA. Efficient delivery by orally ingested dsRNA was confirmed as an effective dosage to induce a significant decrease in expression of targeted genes, such as juvenile hormone acid O-methyltransferase (JHAMT) and vitellogenin (Vg). These innovative methods represent strategies for delivery of dsRNA to use in crop protection and overcome environmental challenges for pest management.

Y-autosome translocation interferes with meiotic sex inactivation and expression of autosomal genes: a case study in the pig.

PubMed

Barasc, H; Mary, N; Letron, R; Calgaro, A; Dudez, A M; Bonnet, N; Lahbib-Mansais, Y; Yerle, M; Ducos, A; Pinton, A

2012-01-01

Y-autosome translocations are rare in humans and pigs. In both species, these rearrangements can be responsible for meiotic arrest and subsequent infertility. Chromosome pairing abnormalities on the SSCX, SSCY and SSC1 chromatin domains were identified by analyzing pachytene spermatocytes from a boar carrying a (Y;1) translocation by immunolocalization of specific meiotic protein combined with FISH. Disturbance of the meiotic sex chromosome inactivation (MSCI) was observed by Cot-RNA-FISH and analysis of ZFY gene expression by sequential RNA- and DNA-FISH on spermatocytes. We hypothesized that the meiotic arrest observed in this boar might be due to the silencing of critical autosomal genes and/or the reactivation of some sex chromosome genes. Copyright © 2011 S. Karger AG, Basel.

RNAi or overexpression: Alternative therapies for Spinocerebellar Ataxia Type 1

PubMed Central

Keiser, Megan S.; Geoghegan, James C.; Boudreau, Ryan L.; Lennox, Kim A.; Davidson, Beverly L.

2014-01-01

Spinocerebellar Ataxia Type 1 (SCA1) is an autosomal dominant late onset neurodegenerative disease caused by an expanded polyglutamine tract in ataxin-1. Here, we compared the protective effects of overexpressing ataxin-1-like using recombinant AAVs, or reducing expression of mutant ataxin-1 using virally delivered RNA interference (RNAi), in a transgenic mouse model of SCA1. For the latter, we used an artificial microRNA (miR) design that optimizes potency, efficacy and safety to suppress ataxin-1 expression (miS1). Delivery of either ataxin-1-like or miS1 viral vectors to SCA1 mice cerebella resulted in widespread cerebellar Purkinje cell transduction and improved behavioral and histological phenotypes. Our data indicate the utility of either approach as a possible therapy for SCA1 patients. PMID:23583610

The antiapoptotic gene survivin is highly expressed in human chondrosarcoma and promotes drug resistance in chondrosarcoma cells in vitro

PubMed Central

2011-01-01

Background Chondrosarcoma is virtually resistant to chemotherapy and radiation therapy. Survivin, the smallest member of the inhibitor of apoptosis protein family, is a critical factor for tumor progression and resistance to conventional therapeutic approaches in a wide range of malignancies. However, the role of survivin in chondrosarcoma has not been well studied. We examined the importance of survivin gene expression in chondrosarcoma and analysed its influences on proliferation, apoptosis and resistance to chemotherapy in vitro. Methods Resected chondrosarcoma specimens from which paraffin-embedded tissues could be extracted were available from 12 patients. In vitro experiments were performed in human chondrosarcoma cell lines SW1353 and Hs819.T. Immunohistochemistry, immunoblot, quantitative PCR, RNA interference, gene-overexpression and analyses of cell proliferation and apoptosis were performed. Results Expression of survivin protein was detected in all chondrosarcoma specimens analyzed, while undetectable in adult human cartilage. RNA interference targeting survivin resulted in a G2/M-arrest of the cell cycle and led to increased rates of apoptosis in chondrosarcoma cells in vitro. Overexpression of survivin resulted in pronounced resistance to doxorubicin treatment. Conclusions These findings indicate that survivin plays a role in the pathogenesis and pronounced chemoresistance of high grade chondrosarcoma. Survivin antagonizing therapeutic strategies may lead to new treatment options in unresectable and metastasized chondrosarcoma. PMID:21457573

Dissection of K+ currents in Caenorhabditis elegans muscle cells by genetics and RNA interference

PubMed Central

Santi, C. M.; Yuan, A.; Fawcett, G.; Wang, Z.-W.; Butler, A.; Nonet, M. L.; Wei, A.; Rojas, P.; Salkoff, L.

2003-01-01

GFP-promoter experiments have previously shown that at least nine genes encoding potassium channel subunits are expressed in Caenorhabditis elegans muscle. By using genetic, RNA interference, and physiological techniques we revealed the molecular identity of the major components of the outward K+ currents in body wall muscle cells in culture. We found that under physiological conditions, outward current is dominated by the products of only two genes, Shaker (Kv1) and Shal (Kv4), both expressing voltage-dependent potassium channels. Other channels may be held in reserve to respond to particular circumstances. Because GFP-promoter experiments indicated that slo-2 expression is prominent, we created a deletion mutant to identify the SLO-2 current in vivo. In both whole-cell and single-channel modes, in vivo SLO-2 channels were active only when intracellular Ca2+ and Cl- were raised above normal physiological conditions, as occurs during hypoxia. Under such conditions, SLO-2 is the largest outward current, contributing up to 87% of the total current. Other channels are present in muscle, but our results suggest that they are unlikely to contribute a large outward component under physiological conditions. However, they, too, may contribute currents conditional on other factors. Hence, the picture that emerges is of a complex membrane with a small number of household conductances functioning under normal circumstances, but with additional conductances that are activated during unusual circumstances. PMID:14612577

Generation of Constructs for DNA-Directed RNA Interference of Venezuelan Equine Encephalitis Virus Genes

DTIC Science & Technology

2006-12-01

Defence Research and Recherche et developpement Development Canada pour la defense Canada DEFENCE I I! / DEFENSE Generation of Constructs for DNA... research into specific antiviral strategies. One such strategy is RNA interference. RNA interference involves the targeted silencing of a gene using...of an effective vaccine or therapeutic for VEE, a highly infectious virus, underscores the need for research in this area. In addition, the potential

The pINDUCER lentiviral toolkit for inducible RNA interference in vitro and in vivo

PubMed Central

Meerbrey, Kristen L.; Hu, Guang; Kessler, Jessica D.; Roarty, Kevin; Fang, Justin E.; Herschkowitz, Jason I.; Burrows, Anna E.; Ciccia, Alberto; Sun, Tingting; Schmitt, Earlene M.; Bernardi, Ronald J.; Fu, Xiaoyong; Bland, Christopher S.; Cooper, Thomas A.; Schiff, Rachel; Rosen, Jeffrey M.; Westbrook, Thomas F.; Elledge, Stephen J.

2011-01-01

The discovery of RNAi has revolutionized loss-of-function genetic studies in mammalian systems. However, significant challenges still remain to fully exploit RNAi for mammalian genetics. For instance, genetic screens and in vivo studies could be broadly improved by methods that allow inducible and uniform gene expression control. To achieve this, we built the lentiviral pINDUCER series of expression vehicles for inducible RNAi in vivo. Using a multicistronic design, pINDUCER vehicles enable tracking of viral transduction and shRNA or cDNA induction in a broad spectrum of mammalian cell types in vivo. They achieve this uniform temporal, dose-dependent, and reversible control of gene expression across heterogenous cell populations via fluorescence-based quantification of reverse tet-transactivator expression. This feature allows isolation of cell populations that exhibit a potent, inducible target knockdown in vitro and in vivo that can be used in human xenotransplantation models to examine cancer drug targets. PMID:21307310

FOXC1 Regulates Expression of Prostaglandin Receptors Leading to an Attenuated Response to Latanoprost.

PubMed

Doucette, Lance P; Footz, Tim; Walter, Michael A

2018-05-01

This study examines the effect of FOXC1 on the prostaglandin pathway in order to explore FOXC1's role in the prostaglandin-resistant glaucoma phenotype commonly seen in Axenfeld-Rieger syndrome. Binding and transcriptional activity of FOXC1 to the gene coding for the EP3 prostaglandin receptor (PTGER3) were evaluated through ChIP-qPCR and luciferase-based assays. Immortalized trabecular meshwork cells (TM1) and HeLa cells had FOXC1 mRNA reduced via siRNA interference. qPCR and Western blot experiments were conducted to examine the changes in prostaglandin receptor expression brought about by lowered FOXC1. TM1 cells were then treated with 10 μM latanoprost acid and/or an siRNA for FOXC1. The expression of fibronectin and matrix metalloproteinase 9 were evaluated via qPCR in each treatment condition. ChIP-qPCR and luciferase experiments confirmed that FOXC1 binds to and activates transcription of the EP3 gene prostaglandin receptor. qPCR and Western experiments in HeLa and TM1 cells showed that FOXC1 siRNA knockdown results in significantly lowered EP3 levels (protein and RNA). In addition, RNA levels of the other prostaglandin receptor genes EP1 (PTGER1), EP2 (PTGER2), EP4 (PTGER4), and FP (PTGFR) were altered when FOXC1 was knocked down in TM1 and HeLa cells. Analysis of fibronectin expression in TM1 cells after treatment with 10 μM latanoprost acid showed a statistically significant increase in expression; this increase was abrogated by cotreatment with a siRNA for FOXC1. We show the abrogation of latanoprost signalling when FOXC1 is knocked down via siRNA in a trabecular meshwork cell line. We propose that the lower levels of active FOXC1 in Axenfeld-Rieger syndrome patients with glaucoma account for the lack of response to prostaglandin-based medications.

RNA Interference in Moths: Mechanisms, Applications, and Progress

PubMed Central

Xu, Jin; Wang, Xia-Fei; Chen, Peng; Liu, Fang-Tao; Zheng, Shuai-Chao; Ye, Hui; Mo, Ming-He

2016-01-01

The vast majority of lepidopterans, about 90%, are moths. Some moths, particularly their caterpillars, are major agricultural and forestry pests in many parts of the world. However, some other members of moths, such as the silkworm Bombyx mori, are famous for their economic value. Fire et al. in 1998 initially found that exogenous double-stranded RNA (dsRNA) can silence the homolog endogenous mRNA in organisms, which is called RNA interference (RNAi). Soon after, the RNAi technique proved to be very promising not only in gene function determination but also in pest control. However, later studies demonstrate that performing RNAi in moths is not as straightforward as shown in other insect taxa. Nevertheless, since 2007, especially after 2010, an increasing number of reports have been published that describe successful RNAi experiments in different moth species either on gene function analysis or on pest management exploration. So far, more than 100 peer-reviewed papers have reported successful RNAi experiments in moths, covering 10 families and 25 species. By using classic and novel dsRNA delivery methods, these studies effectively silence the expression of various target genes and determine their function in larval development, reproduction, immunology, resistance against chemicals, and other biological processes. In addition, a number of laboratory and field trials have demonstrated that RNAi is also a potential strategy for moth pest management. In this review, therefore, we summarize and discuss the mechanisms and applications of the RNAi technique in moths by focusing on recent progresses. PMID:27775569

Double strand RNA-mediated RNA interference through feeding in larval gypsy moth, Lymantria dispar (Lepidoptera: Erebidae)

USDA-ARS?s Scientific Manuscript database

RNA interference (RNAi) has gained popularity in several fields of research, silencing targeted genes by degradation of RNA. The objective of this study was to develop RNAi for use as a molecular tool in the control of the invasive pest Lymantria dispar (Lepidoptera: Erebidae), gypsy moth, which ha...

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis.

PubMed

Santangelo, K S; Bertone, A L

2011-12-01

To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RT-PCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2(-ΔΔCT)) method. Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P=0.0045) or >90% (P=0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. Copyright © 2011 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

Silencing VDAC1 Expression by siRNA Inhibits Cancer Cell Proliferation and Tumor Growth In Vivo

PubMed Central

Arif, Tasleem; Vasilkovsky, Lilia; Refaely, Yael; Konson, Alexander; Shoshan-Barmatz, Varda

2014-01-01

Alterations in cellular metabolism and bioenergetics are vital for cancer cell growth and motility. Here, the role of the mitochondrial protein voltage-dependent anion channel (VDAC1), a master gatekeeper regulating the flux of metabolites and ions between mitochondria and the cytoplasm, in regulating the growth of several cancer cell lines was investigated by silencing VDAC1 expression using small interfering RNA (siRNA). A single siRNA specific to the human VDAC1 sequence at nanomolar concentrations led to some 90% decrease in VDAC1 levels in the lung A549 and H358, prostate PC-3, colon HCT116, glioblastoma U87, liver HepG2, and pancreas Panc-1 cancer cell lines. VDAC1 silencing persisted 144 hours post-transfection and resulted in profound inhibition of cell growth in cancer but not in noncancerous cells, with up to 90% inhibition being observed over 5 days that was prolonged by a second transfection. Cells expressing low VDAC1 levels showed decreased mitochondrial membrane potential and adenoside triphosphate (ATP) levels, suggesting limited metabolite exchange between mitochondria and cytosol. Moreover, cells silenced for VDAC1 expression showed decreased migration, even in the presence of the wound healing accelerator basic fibroblast growth factor (bFGF). VDAC1-siRNA inhibited cancer cell growth in a Matrigel-based assay in host nude mice. Finally, in a xenograft lung cancer mouse model, chemically modified VDAC1-siRNA not only inhibited tumor growth but also resulted in tumor regression. This study thus shows that VDAC1 silencing by means of RNA interference (RNAi) dramatically inhibits cancer cell growth and tumor development by disabling the abnormal metabolic behavior of cancer cells, potentially paving the way for a more effective pipeline of anticancer drugs. PMID:24781191

Molecular cloning and characterization of a SID-1-like gene in Plutella xylostella.

PubMed

Wang, Huidong; Gong, Liang; Qi, Jiangwei; Hu, Meiying; Zhong, Guohua; Gong, Liang

2014-11-01

RNA interference (RNAi) signal can spread from the point where the double-stranded RNA (dsRNA) was initially applied to other cells or tissues. SID-related genes in Caenorhabditis elegans help in the spreading of this signal. However, the mechanisms of systemic RNAi are still not unveiled in insects. In this study, we cloned a full-length cDNA of sid-1-like gene, Pxylsid-1, from Plutella xylostella that contains 1,047 bp opening reading frame encoding a putative protein of 348 amino acids. This transcript is very much similar to the sil-1 in Bombyx mori (68.8%). The higher expression levels of Pxylsid-1 were found at the adult and fourth-instar stages compared to the second-instar stage with 21.48- and 10.36-fold increase, respectively. Its expression levels in different tissues were confirmed with the highest expression in the hemolymph, which showed 21.09-fold increase than the midgut; however it was lower in other tissues. The result of RNAi by feeding bacterially expressed dsRNA targeting Pxylace-1, which showed that the mRNA level of Pxylace-1 decreased by 34.52 and 64.04% after 36- and 72-h treatment, respectively. However, the mRNA level of Pxylsid-1 was not significantly induced when the Pxylace-1 was downregulated. Furthermore, we found that downregulation of Pxylsid-1 did not affect the RNAi effect of Pxylace-1. Hence, the Pxylsid-1 may not be involved in absorption of dsRNA from the midgut fluid. A further study is needed to uncover the function of Pxylsid-1. © 2014 Wiley Periodicals, Inc.

Knockdown of PLC-gamma-2 and calmodulin 1 genes sensitizes human cervical adenocarcinoma cells to doxorubicin and paclitaxel.

PubMed

Stanislaus, Anthony; Bakhtiar, Athirah; Salleh, Diyana; Tiash, Snigdha; Fatemian, Tahereh; Hossain, Sharif; Akaike, Toshihiro; Chowdhury, Ezharul Hoque

2012-06-18

RNA interference (RNAi) is a powerful approach in functional genomics to selectively silence messenger mRNA (mRNA) expression and can be employed to rapidly develop potential novel drugs against a complex disease like cancer. However, naked siRNA being anionic is unable to cross the anionic cell membrane through passive diffusion and therefore, delivery of siRNA remains a major hurdle to overcome before the potential of siRNA technology can fully be exploited in cancer. pH-sensitive carbonate apatite has recently been developed as an efficient tool to deliver siRNA into the mammalian cells by virtue of its high affinity interaction with the siRNA and the desirable size distribution of the resulting siRNA-apatite complex for effective cellular endocytosis. Moreover, internalized siRNA was found to escape from the endosomes in a time-dependent manner and efficiently silence gene expression. Here we show that carbonate apatite-mediated delivery of siRNA against PLC-gamma-2 (PLCG2) and calmodulin 1 (CALM1) genes has led to the sensitization of a human cervical cancer cell line to doxorubicin- and paclitaxel depending on the dosage of the individual drug whereas no such enhancement in cell death was observed with cisplatin irrespective of the dosage following intracellular delivery of the siRNAs. Thus, PLCG2 and CALM1 genes are two potential targets for gene knockdown in doxorubicin and paclitaxel-based chemotherapy of cervical cancer.

RNA interference of cytochrome P450 CYP6F subfamily genes affects susceptibility to different insecticides in Locusta migratoria.

PubMed

Guo, Yanqiong; Wu, Haihua; Zhang, Xueyao; Ma, Enbo; Guo, Yaping; Zhu, Kun Yan; Zhang, Jianzhen

2016-11-01

Many insect cytochrome P450s (CYPs) play critical roles in detoxification of insecticides. The CYP6 family is unique to the class Insecta, and its biochemical function has essentially been associated with the metabolism of xenobiotics. In this study, we sequenced and characterised the full-length cDNAs of five CYP genes from Locusta migratoria, a highly destructive agricultural pest worldwide. The five genes were predominantly expressed in brain, guts, fat bodies or Malpighian tubules. CYP6FE1, CYP6FF1 and CYP6FG1 were expressed at higher levels in fourth-instar nymphs than in other developmental stages. CYPFD2 is specifically expressed in adults, whereas CYP6FD1, CYP6FD2 and CYP6FE1 showed significantly lower expression in eggs than in other developmental stages. Deltamethrin suppressed CYP6FD1 expression in third-instar nymphs and upregulated the expression level of CYP6FD2, CYP6FF1 and CYP6FG1 at the dose of LD 10 . Efficient RNA interference-mediated gene silencing was established for four of the five CYP genes. Silencing of CYP6FF1 increased the nymphal mortality from 23 to 50% in response to deltamethrin. Silencing of CYP6FD2 and CYP6FE1 increased the nymphal mortality from 32 to 72 and 66%, respectively, to carbaryl. Three of the four CYP6F subfamily genes in L. migratoria were associated with the detoxification of deltamethrin or carbaryl. The role of CYPs in insecticide detoxification appears to be both gene and insecticide specific. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Insights on ornithine decarboxylase silencing as a potential strategy for targeting retinoblastoma.

PubMed

Muthukumaran, Sivashanmugam; Bhuvanasundar, Renganathan; Umashankar, Vetrivel; Sulochana, K N

2018-02-01

Ornithine Decarboxylase (ODC) is a key enzyme involved in polyamine synthesis and is reported to be up regulated in several cancers. However, the effect of ODC gene silencing in retinoblastoma is to be understood for utilization in therapeutic applications. Hence, in this study, a novel siRNA (small interference RNA) targeting ODC was designed and validated in Human Y79 retinoblastoma cells for its effects on intracellular polyamine levels, Matrix Metalloproteinase 2 & 9 activity and Cell cycle. The designed siRNA showed efficient silencing of ODC mRNA expression and protein levels in Y79 cells. It also showed significant reduction of intracellular polyamine levels and altered levels of oncogenic LIN28b expression. By this study, a regulatory loop is proposed, wherein, ODC silencing in Y79 cells to result in decreased polyamine levels, thereby, leading to altered protein levels of Lin28b, MMP-2 and MMP-9, which falls in line with earlier studies in neuroblastoma. Thus, by this study, we propose ODC silencing as a prospective strategy for targeting retinoblastoma. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fan, Qi; Wang, Xuedi; Zhang, Hanguang

Highlights: Black-Right-Pointing-Pointer Cat S is highly expressed in HCC cells with high metastatic potential. Black-Right-Pointing-Pointer Knockdown of Cat S inhibits growth and invasion of HCC cells. Black-Right-Pointing-Pointer Knockdown of Cat S inhibits HCC-associated angiogenesis. Black-Right-Pointing-Pointer Cat S might be a potential target for HCC therapy. -- Abstract: Cathepsin S (Cat S) plays an important role in tumor invasion and metastasis by its ability to degrade extracellular matrix (ECM). Our previous study suggested there could be a potential association between Cat S and hepatocellular carcinoma (HCC) metastasis. The present study was designed to determine the role of Cat S in HCCmore » cell growth, invasion and angiogenesis, using RNA interference technology. Small interfering RNA (siRNA) sequences for the Cat S gene were synthesized and transfected into human HCC cell line MHCC97-H. The Cat S gene targeted siRNA-mediated knockdown of Cat S expression, leading to potent suppression of MHCC97-H cell proliferation, invasion and angiogenesis. These data suggest that Cat S might be a potential target for HCC therapy.« less

Ribosome-targeting antibiotics as inhibitors of oncogenic microRNAs biogenesis: Old scaffolds for new perspectives in RNA targeting.

PubMed

Tran, Thi Phuong Anh; Vo, Duc Duy; Di Giorgio, Audrey; Duca, Maria

2015-09-01

MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression at the post-transcriptional level. It is now well established that the overexpression of some miRNAs (oncogenic miRNAs) is responsible for initiation and progression of human cancers and the discovery of new molecules able to interfere with their production and/or function represents one of the most important challenges of current medicinal chemistry of RNA ligands. In this work, we studied the ability of 18 different antibiotics, known as prokaryotic ribosomal RNA, to bind to oncogenic miRNA precursors (stem-loop structured pre-miRNAs) in order to inhibit miRNAs production. In vitro inhibition, binding constants, thermodynamic parameters and binding sites were investigated and highlighted that aminoglycosides and tetracyclines represent interesting pre-miRNA ligands with the ability to inhibit Dicer processing. Copyright © 2015 Elsevier Ltd. All rights reserved.

Microprocessor mediates transcriptional termination of long noncoding RNA transcripts hosting microRNAs.

PubMed

Dhir, Ashish; Dhir, Somdutta; Proudfoot, Nick J; Jopling, Catherine L

2015-04-01

MicroRNAs (miRNAs) play a major part in the post-transcriptional regulation of gene expression. Mammalian miRNA biogenesis begins with cotranscriptional cleavage of RNA polymerase II (Pol II) transcripts by the Microprocessor complex. Although most miRNAs are located within introns of protein-coding transcripts, a substantial minority of miRNAs originate from long noncoding (lnc) RNAs, for which transcript processing is largely uncharacterized. We show, by detailed characterization of liver-specific lnc-pri-miR-122 and genome-wide analysis in human cell lines, that most lncRNA transcripts containing miRNAs (lnc-pri-miRNAs) do not use the canonical cleavage-and-polyadenylation pathway but instead use Microprocessor cleavage to terminate transcription. Microprocessor inactivation leads to extensive transcriptional readthrough of lnc-pri-miRNA and transcriptional interference with downstream genes. Consequently we define a new RNase III-mediated, polyadenylation-independent mechanism of Pol II transcription termination in mammalian cells.

Analysis of Antisense Expression by Whole Genome Tiling Microarrays and siRNAs Suggests Mis-Annotation of Arabidopsis Orphan Protein-Coding Genes

PubMed Central

Richardson, Casey R.; Luo, Qing-Jun; Gontcharova, Viktoria; Jiang, Ying-Wen; Samanta, Manoj; Youn, Eunseog; Rock, Christopher D.

2010-01-01

Background MicroRNAs (miRNAs) and trans-acting small-interfering RNAs (tasi-RNAs) are small (20–22 nt long) RNAs (smRNAs) generated from hairpin secondary structures or antisense transcripts, respectively, that regulate gene expression by Watson-Crick pairing to a target mRNA and altering expression by mechanisms related to RNA interference. The high sequence homology of plant miRNAs to their targets has been the mainstay of miRNA prediction algorithms, which are limited in their predictive power for other kingdoms because miRNA complementarity is less conserved yet transitive processes (production of antisense smRNAs) are active in eukaryotes. We hypothesize that antisense transcription and associated smRNAs are biomarkers which can be computationally modeled for gene discovery. Principal Findings We explored rice (Oryza sativa) sense and antisense gene expression in publicly available whole genome tiling array transcriptome data and sequenced smRNA libraries (as well as C. elegans) and found evidence of transitivity of MIRNA genes similar to that found in Arabidopsis. Statistical analysis of antisense transcript abundances, presence of antisense ESTs, and association with smRNAs suggests several hundred Arabidopsis ‘orphan’ hypothetical genes are non-coding RNAs. Consistent with this hypothesis, we found novel Arabidopsis homologues of some MIRNA genes on the antisense strand of previously annotated protein-coding genes. A Support Vector Machine (SVM) was applied using thermodynamic energy of binding plus novel expression features of sense/antisense transcription topology and siRNA abundances to build a prediction model of miRNA targets. The SVM when trained on targets could predict the “ancient” (deeply conserved) class of validated Arabidopsis MIRNA genes with an accuracy of 84%, and 76% for “new” rapidly-evolving MIRNA genes. Conclusions Antisense and smRNA expression features and computational methods may identify novel MIRNA genes and other non-coding RNAs in plants and potentially other kingdoms, which can provide insight into antisense transcription, miRNA evolution, and post-transcriptional gene regulation. PMID:20520764

Long non-coding RNA MEG3 inhibits the proliferation and metastasis of oral squamous cell carcinoma by regulating the WNT/β-catenin signaling pathway.

PubMed

Liu, Zongxiang; Wu, Cui; Xie, Nina; Wang, Penglai

2017-10-01

This study aimed to investigate how long non-coding RNA (lncRNA) maternally expressed gene 3 (MEG3) inhibits the growth and metastasis of oral squamous cell carcinoma (OSCC) by regulating WNT/β-catenin signaling pathway in order to explore the antitumor effect of MEG3 and to provide a potential molecular target for the treatment of OSCC. The RT-qPCR technique was used to quantitatively analyze the expression of MEG3 in cancer and adjacent tissues collected from the patients after surgery. Using the Lipofectamine method, the MEG3 overexpression vector and the siRNA interference vector were constructed and transfected into SCC15 and Cal27 cells, respectively, followed by cell proliferation, apoptosis and metastasis analyses. The semi-quantitative analysis of the expression of the β-catenin protein in transfected cells was performed by the western blot analysis, and the activity of the WNT/β-catenin signaling pathway was analyzed using the TOP/FOP flash reporters. In addition, the cells were treated with decitabine to investigate the correlation between the MEG3 expression and the DNA methylation. Results showed that the expression level of MEG3 was significantly decreased in OSCC (p<0.05) and overexpression of MEG3 inhibited the proliferation and metastasis of cancer cells and promoted apoptosis. Importantly, MEG3 played a role as a tumor suppressor by inhibiting the WNT/β-catenin signaling pathway. In addition, the expression of the MEG3 was significantly affected by the degree of DNA methylation. It was concluded that the lncRNA MEG3 can inhibit the growth and metastasis of OSCC by negatively regulating the WNT/β-catenin signaling pathway.

Exaptive origins of regulated mRNA decay in eukaryotes

PubMed Central

Hamid, Fursham M.

2016-01-01

Eukaryotic gene expression is extensively controlled at the level of mRNA stability and the mechanisms underlying this regulation are markedly different from their archaeal and bacterial counterparts. We propose that two such mechanisms, nonsense‐mediated decay (NMD) and motif‐specific transcript destabilization by CCCH‐type zinc finger RNA‐binding proteins, originated as a part of cellular defense against RNA pathogens. These branches of the mRNA turnover pathway might have been used by primeval eukaryotes alongside RNA interference to distinguish their own messages from those of RNA viruses and retrotransposable elements. We further hypothesize that the subsequent advent of “professional” innate and adaptive immunity systems allowed NMD and the motif‐triggered mechanisms to be efficiently repurposed for regulation of endogenous cellular transcripts. This scenario explains the rapid emergence of archetypical mRNA destabilization pathways in eukaryotes and argues that other aspects of post‐transcriptional gene regulation in this lineage might have been derived through a similar exaptation route. PMID:27438915

RNA interference of pax2 inhibits growth of transplanted human endometrial cancer cells in nude mice

PubMed Central

Zhang, Li-Ping; Shi, Xiao-Yan; Zhao, Chang-Yin; Liu, Yong-Zhen; Cheng, Ping

2011-01-01

The development of human endometrial carcinoma (HEC) is a complex pathologic process involves several oncogenes and tumor suppressor genes. The full-length paired-box gene 2 (pax2), a recently discovered Oncogene, promotes cell proliferation and growth and inhibits apoptosis of HEC cells. Here, we examined the effect of pax2 small interfering RNA (siRNA) on the growth of transplanted HEC cells in nude mice. The expression of Pax2 in 21 cases of normal endometrium and 38 cases of HEC was examined by immohistochemistry (IHC). HEC models were developed by subcutaneously transferring HEC cells into nude mice, followed by treatment with empty lentivirus vector, lentivirus vector-based pax2 siRNA, and phosphate buffered saline, respectively. Four weeks later, tumor size was measured, tumor inhibition rate was calculated, and histological analyses were conducted after staining with hematoxylin and eosin. The expression of Pax2 and Bcl-2 was detected by Western blot; proliferating cell nuclear antigen (PCNA) was detected by IHC. Significant differences were observed in the positive rate of Pax2 between normal endometrium and HEC (14.2% vs. 60.5%, P < 0.01). The expression index of Pax2 in well differentiated tumors was 1.88 ± 1.68, much lower than that in tumors of moderate (3.07 ± 1.96, P < 0.05) or poor differentiation (5.45 ± 2.76, P < 0.01). Tumor necrosis increased, nuclear basophilia stain decreased, tumor growth was inhibited, and PCNA, Pax2, and Bcl-2 expression was reduced in HEC models treated with pax2 siRNA. These results indicate that Pax2 expression is related to HEC tumor biology with the increased expression of Pax2 correlated to malignancy. pax2 siRNA down-regulates Pax2 expression and inhibits tumorigenesis of HEC in nude mice, possibly due to cell apoptosis and the inhibition of tumor proliferation induced by down-regulation of Bcl-2. PMID:21627862

Functionalized Dendrimer-Based Delivery of Angiotensin Type 1 Receptor siRNA for Preserving Cardiac Function Following Infarction

PubMed Central

Liu, Jie; Gu, Catherine; Cabigas, E. Bernadette; Pendergrass, Karl D.; Brown, Milton E.; Luo, Ying; Davis, Michael E.

2013-01-01

Cardiovascular disease (CVD) is the leading cause of death throughout the world and much pathology is associated with upregulation of inflammatory genes. Gene silencing using RNA interference is a powerful tool in regulating gene expression, but its application in CVDs has been prevented by the lack of efficient delivery systems. We report here the development of tadpole dendrimeric materials for siRNA delivery in a rat ischemia-reperfusion (IR) model. Angiotensin II (Ang II) type 1 receptor (AT1R), the major receptor that mediates most adverse effects of Ang II, was chosen to be the silencing targeting. Among the three tadpole dendrimers synthesized, the oligo-arginine conjugated dendrimer loaded with siRNA demonstrated effective down-regulation in AT1R expression in cardiomyocytes in vitro. When the dendrimeric material was applied in vivo, the siRNA delivery prevented the increase in AT1R levels and significantly improved cardiac function recovery compared to saline injection or empty dendrimer treated groups after IR injury. These experiments demonstrate a potential treatment for dysfunction caused by IR injury and may represent an alternative to AT1R blockade. PMID:23433774

Acute Knockdown of Kv4.1 Regulates Repetitive Firing Rates and Clock Gene Expression in the Suprachiasmatic Nucleus and Daily Rhythms in Locomotor Behavior

PubMed Central

Hermanstyne, Tracey O.; Mellor, Rebecca L.

2017-01-01

Abstract Rapidly activating and inactivating A-type K+ currents (IA) encoded by Kv4.2 and Kv4.3 pore-forming (α) subunits of the Kv4 subfamily are key regulators of neuronal excitability. Previous studies have suggested a role for Kv4.1 α-subunits in regulating the firing properties of mouse suprachiasmatic nucleus (SCN) neurons. To test this, we utilized an RNA-interference strategy to knockdown Kv4.1, acutely and selectively, in the SCN. Current-clamp recordings revealed that the in vivo knockdown of Kv4.1 significantly (p < 0.0001) increased mean ± SEM repetitive firing rates in SCN neurons during the day (6.4 ± 0.5 Hz) and at night (4.3 ± 0.6 Hz), compared with nontargeted shRNA-expressing SCN neurons (day: 3.1 ± 0.5 Hz; night: 1.6 ± 0.3 Hz). IA was also significantly (p < 0.05) reduced in Kv4.1-targeted shRNA-expressing SCN neurons (day: 80.3 ± 11.8 pA/pF; night: 55.3 ± 7.7 pA/pF), compared with nontargeted shRNA-expressing (day: 121.7 ± 10.2 pA/pF; night: 120.6 ± 16.5 pA/pF) SCN neurons. The magnitude of the effect of Kv4.1-targeted shRNA expression on firing rates and IA was larger at night. In addition, Kv4.1-targeted shRNA expression significantly (p < 0.001) increased mean ± SEM nighttime input resistance (Rin; 2256 ± 166 MΩ), compared to nontargeted shRNA-expressing SCN neurons (1143 ± 93 MΩ). Additional experiments revealed that acute knockdown of Kv4.1 significantly (p < 0.01) shortened, by ∼0.5 h, the circadian period of spontaneous electrical activity, clock gene expression and locomotor activity demonstrating a physiological role for Kv4.1-encoded IA channels in regulating circadian rhythms in neuronal excitability and behavior. PMID:28560311

Acute Knockdown of Kv4.1 Regulates Repetitive Firing Rates and Clock Gene Expression in the Suprachiasmatic Nucleus and Daily Rhythms in Locomotor Behavior.

PubMed

Hermanstyne, Tracey O; Granados-Fuentes, Daniel; Mellor, Rebecca L; Herzog, Erik D; Nerbonne, Jeanne M

2017-01-01

Rapidly activating and inactivating A-type K + currents (I A ) encoded by Kv4.2 and Kv4.3 pore-forming (α) subunits of the Kv4 subfamily are key regulators of neuronal excitability. Previous studies have suggested a role for Kv4.1 α-subunits in regulating the firing properties of mouse suprachiasmatic nucleus (SCN) neurons. To test this, we utilized an RNA-interference strategy to knockdown Kv4.1, acutely and selectively, in the SCN. Current-clamp recordings revealed that the in vivo knockdown of Kv4.1 significantly ( p < 0.0001) increased mean ± SEM repetitive firing rates in SCN neurons during the day (6.4 ± 0.5 Hz) and at night (4.3 ± 0.6 Hz), compared with nontargeted shRNA-expressing SCN neurons (day: 3.1 ± 0.5 Hz; night: 1.6 ± 0.3 Hz). I A was also significantly ( p < 0.05) reduced in Kv4.1-targeted shRNA-expressing SCN neurons (day: 80.3 ± 11.8 pA/pF; night: 55.3 ± 7.7 pA/pF), compared with nontargeted shRNA-expressing (day: 121.7 ± 10.2 pA/pF; night: 120.6 ± 16.5 pA/pF) SCN neurons. The magnitude of the effect of Kv4.1-targeted shRNA expression on firing rates and I A was larger at night. In addition, Kv4.1-targeted shRNA expression significantly ( p < 0.001) increased mean ± SEM nighttime input resistance (R in ; 2256 ± 166 MΩ), compared to nontargeted shRNA-expressing SCN neurons (1143 ± 93 MΩ). Additional experiments revealed that acute knockdown of Kv4.1 significantly ( p < 0.01) shortened, by ∼0.5 h, the circadian period of spontaneous electrical activity, clock gene expression and locomotor activity demonstrating a physiological role for Kv4.1-encoded I A channels in regulating circadian rhythms in neuronal excitability and behavior.

Cationic liquid crystalline nanoparticles for the delivery of synthetic RNAi-based therapeutics.

PubMed

Gentile, Emanuela; Oba, Taro; Lin, Jing; Shao, Ruping; Meng, Feng; Cao, Xiaobo; Lin, Heather Y; Mourad, Majidi; Pataer, Apar; Baladandayuthapani, Veerabhadran; Cai, Dong; Roth, Jack A; Ji, Lin

2017-07-18

RNA interference (RNAi)-based therapeutics have been used to silence the expression of targeted pathological genes. Small interfering RNA (siRNAs) and microRNA (miRNAs) inhibitor have performed this function. However, short half-life, poor cellular uptake, and nonspecific distribution of small RNAs call for the development of novel delivery systems to facilitate the use of RNAi. We developed a novel cationic liquid crystalline nanoparticle (CLCN) to efficiently deliver synthetic siRNAs and miRNAs. CLCNs were prepared by using high-speed homogenization and assembled with synthetic siRNA or miRNA molecules in nuclease-free water to create CLCN/siRNA or miRNA complexes. The homogeneous and stable CLCNs and CLCN-siRNA complexes were about 100 nm in diameter, with positively charged surfaces. CLCNs are nontoxic and are taken up by human cells though endocytosis. Significant inhibition of gene expression was detected in transiently transfected lung cancer H1299 cells treated with CLCNs/anti-GFP complexes 24 hours after transfection. Biodistribution analysis showed that the CLCNs and CLCNs-RNAi complexes were successfully delivered to various organs and into the subcutaneous human lung cancer H1299 tumor xenografts in mice 24 hours after systemic administration. These results suggest that CLCNs are a unique and advanced delivery system capable of protecting RNAi from degradation and of efficiently delivering RNAi in vitro and in vivo.

Cationic liquid crystalline nanoparticles for the delivery of synthetic RNAi-based therapeutics

PubMed Central

Gentile, Emanuela; Oba, Taro; Lin, Jing; Shao, Ruping; Meng, Feng; Cao, Xiaobo; Lin, Heather Y.; Mourad, Majidi; Pataer, Apar; Baladandayuthapani, Veerabhadran; Cai, Dong; Roth, Jack A.; Ji, Lin

2017-01-01

RNA interference (RNAi)-based therapeutics have been used to silence the expression of targeted pathological genes. Small interfering RNA (siRNAs) and microRNA (miRNAs) inhibitor have performed this function. However, short half-life, poor cellular uptake, and nonspecific distribution of small RNAs call for the development of novel delivery systems to facilitate the use of RNAi. We developed a novel cationic liquid crystalline nanoparticle (CLCN) to efficiently deliver synthetic siRNAs and miRNAs. CLCNs were prepared by using high-speed homogenization and assembled with synthetic siRNA or miRNA molecules in nuclease-free water to create CLCN/siRNA or miRNA complexes. The homogeneous and stable CLCNs and CLCN-siRNA complexes were about 100 nm in diameter, with positively charged surfaces. CLCNs are nontoxic and are taken up by human cells though endocytosis. Significant inhibition of gene expression was detected in transiently transfected lung cancer H1299 cells treated with CLCNs/anti-GFP complexes 24 hours after transfection. Biodistribution analysis showed that the CLCNs and CLCNs-RNAi complexes were successfully delivered to various organs and into the subcutaneous human lung cancer H1299 tumor xenografts in mice 24 hours after systemic administration. These results suggest that CLCNs are a unique and advanced delivery system capable of protecting RNAi from degradation and of efficiently delivering RNAi in vitro and in vivo. PMID:28637023

Biochemical analysis of NSs from different tospoviruses.

PubMed

Hedil, Marcio; de Ronde, Dryas; Kormelink, Richard

2017-10-15

Tospoviruses suppress antiviral RNA interference by coding for an RNA silencing suppressor (NSs) protein. Previously, using NSs-containing crude plant and insect cell extracts, the affinity of NSs for double-stranded (ds)RNA molecules was demonstrated by electrophoretic mobility shifts assays (EMSAs). While NSs from tomato spotted wilt virus (TSWV) and groundnut ringspot virus (GRSV) were able to bind small and long dsRNA molecules, the one from tomato yellow ring virus (TYRV), a distinct Asian tospovirus, only bound small dsRNA. Here, using bacterially expressed and purified NSs from GRSV and TYRV, it is shown that they are both able to bind to small and long dsRNA. Binding of siRNAs by NSs revealed two consecutive shifts, i.e. a first shift at low NSs concentrations followed by a second larger one at higher concentrations. When NSs of TSWV resistance inducing (RI) and resistance breaking (RB) isolates were analyzed using extracts from infected plants only a major siRNA shift was observed. In contrast, plant extracts containing the respective transiently expressed NSs proteins showed only the lower shift with NSs RI but no shift with NSs RB . The observed affinity for RNA duplexes, as well as the two-stepwise shift pattern, is discussed in light of NSs as a suppressor of silencing and its importance for tospovirus infection. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Design and cloning strategies for constructing shRNA expression vectors

PubMed Central

McIntyre, Glen J; Fanning, Gregory C

2006-01-01

Background Short hairpin RNA (shRNA) encoded within an expression vector has proven an effective means of harnessing the RNA interference (RNAi) pathway in mammalian cells. A survey of the literature revealed that shRNA vector construction can be hindered by high mutation rates and the ensuing sequencing is often problematic. Current options for constructing shRNA vectors include the use of annealed complementary oligonucleotides (74 % of surveyed studies), a PCR approach using hairpin containing primers (22 %) and primer extension of hairpin templates (4 %). Results We considered primer extension the most attractive method in terms of cost. However, in initial experiments we encountered a mutation frequency of 50 % compared to a reported 20 – 40 % for other strategies. By modifying the technique to be an isothermal reaction using the DNA polymerase Phi29, we reduced the error rate to 10 %, making primer extension the most efficient and cost-effective approach tested. We also found that inclusion of a restriction site in the loop could be exploited for confirming construct integrity by automated sequencing, while maintaining intended gene suppression. Conclusion In this study we detail simple improvements for constructing and sequencing shRNA that overcome current limitations. We also compare the advantages of our solutions against proposed alternatives. Our technical modifications will be of tangible benefit to researchers looking for a more efficient and reliable shRNA construction process. PMID:16396676

Treating hepatitis C: can you teach old dogs new tricks?

PubMed

Rice, Charles M; You, Shihyun

2005-12-01

Viruses depend on host-derived factors for their efficient genome replication. Here, we demonstrate that a cellular peptidyl-prolyl cis-trans isomerase (PPIase), cyclophilin B (CyPB), is critical for the efficient replication of the hepatitis C virus genome. CyPB interacted with the HCV RNA polymerase NS5B to directly stimulate its RNA binding activity. Both the RNA interference (RNAi)-mediated reduction of endogenous CyPB expression and the induced loss of NS5B binding to CyPB decreased the levels of HCV replication. Thus, CyPB functions as a stimulatory regulator of NS5B in HCV replication machinery. This regulation mechanism for viral replication identifies CyPB as a target for antiviral therapeutic strategies.

Electroporation transiently decreases GJB2 (connexin 26) expression in B16/BL6 melanoma cell line.

PubMed

Rangel, Marcelo Monte Mór; Chaible, Lucas Martins; Nagamine, Marcia Kazumi; Mennecier, Gregory; Cogliati, Bruno; de Oliveira, Krishna Duro; Fukumasu, Heidge; Sinhorini, Idércio Luiz; Mir, Lluis Maria; Dagli, Maria Lúcia Zaidan

2015-02-01

Connexins are proteins that form gap junctions. Perturbations in the cell membrane reportedly promote changes in the expression profile of connexins. Electroporation promotes destabilization by applying electrical pulses, and this procedure is used in electrochemotherapy and gene therapy, among others. This in vitro work aimed to study the interference of electroporation on the expression profile of GJB2 (Cx26 gene) and Connexin 26 in melanoma cell line B16/BL6. The techniques of immunocytochemistry, Western blot, and real-time PCR were used. After electroporation, cells showed a transient decrease in GJB2 mRNA. The immunostaining of Cx26 showed no noticeable change after electroporation at different time points. However, Western blot showed a significant reduction in Cx26 30 min after electroporation. Our results showed that electroporation interferes transiently in the expression of Connexin 26 in melanoma and are consistent with the idea that electroporation is a process of intense stress that promotes cell homeostatic imbalance and results in disruption of cell physiological processes such as transcription and translation.

Inhibition of Virulence Gene Expression in Staphylococcus aureus by Novel Depsipeptides from a Marine Photobacterium

PubMed Central

Mansson, Maria; Nielsen, Anita; Kjærulff, Louise; Gotfredsen, Charlotte H.; Wietz, Matthias; Ingmer, Hanne; Gram, Lone; Larsen, Thomas O.

2011-01-01

During a global research expedition, more than five hundred marine bacterial strains capable of inhibiting the growth of pathogenic bacteria were collected. The purpose of the present study was to determine if these marine bacteria are also a source of compounds that interfere with the agr quorum sensing system that controls virulence gene expression in Staphylococcus aureus. Using a gene reporter fusion bioassay, we recorded agr interference as enhanced expression of spa, encoding Protein A, concomitantly with reduced expression of hla, encoding α-hemolysin, and rnaIII encoding RNAIII, the effector molecule of agr. A marine Photobacterium produced compounds interfering with agr in S. aureus strain 8325-4, and bioassay-guided fractionation of crude extracts led to the isolation of two novel cyclodepsipeptides, designated solonamide A and B. Northern blot analysis confirmed the agr interfering activity of pure solonamides in both S. aureus strain 8325-4 and the highly virulent, community-acquired strain USA300 (CA-MRSA). To our knowledge, this is the first report of inhibitors of the agr system by a marine bacterium. PMID:22363239

Effects of AAV-mediated knockdown of nNOS and GPx-1 gene expression in rat hippocampus after traumatic brain injury.

PubMed

Boone, Deborah R; Leek, Jeanna M; Falduto, Michael T; Torres, Karen E O; Sell, Stacy L; Parsley, Margaret A; Cowart, Jeremy C; Uchida, Tatsuo; Micci, Maria-Adelaide; DeWitt, Douglas S; Prough, Donald S; Hellmich, Helen L

2017-01-01

Virally mediated RNA interference (RNAi) to knock down injury-induced genes could improve functional outcome after traumatic brain injury (TBI); however, little is known about the consequences of gene knockdown on downstream cell signaling pathways and how RNAi influences neurodegeneration and behavior. Here, we assessed the effects of adeno-associated virus (AAV) siRNA vectors that target two genes with opposing roles in TBI pathogenesis: the allegedly detrimental neuronal nitric oxide synthase (nNOS) and the potentially protective glutathione peroxidase 1 (GPx-1). In rat hippocampal progenitor cells, three siRNAs that target different regions of each gene (nNOS, GPx-1) effectively knocked down gene expression. However, in vivo, in our rat model of fluid percussion brain injury, the consequences of AAV-siRNA were variable. One nNOS siRNA vector significantly reduced the number of degenerating hippocampal neurons and showed a tendency to improve working memory. GPx-1 siRNA treatment did not alter TBI-induced neurodegeneration or working memory deficits. Nevertheless, microarray analysis of laser captured, virus-infected neurons showed that knockdown of nNOS or GPx-1 was specific and had broad effects on downstream genes. Since nNOS knockdown only modestly ameliorated TBI-induced working memory deficits, despite widespread genomic changes, manipulating expression levels of single genes may not be sufficient to alter functional outcome after TBI.

2′-O-[2-[(N,N-dimethylamino)oxy]ethyl]-modified oligonucleotides inhibit expression of mRNA in vitro and in vivo

PubMed Central

Prakash, Thazha P.; Johnston, Joseph F.; Graham, Mark J.; Condon, Thomas P.; Manoharan, Muthiah

2004-01-01

Synthesis and antisense activity of oligonucleotides modified with 2′-O-[2-[(N,N-dimethylamino)oxy] ethyl] (2′-O-DMAOE) are described. The 2′-O-DMAOE-modified oligonucleotides showed superior metabolic stability in mice. The phosphorothioate oligonucleotide ‘gapmers’, with 2′-O-DMAOE- modified nucleoside residues at the ends and 2′-deoxy nucleosides residues in the central region, showed dose-dependent inhibition of mRNA expression in cell culture for two targets. ‘Gapmer’ oligonucleotides have one or two 2′-O-modified regions and a 2′-deoxyoligonucleotide phosphorothioate region that allows RNase H digestion of target mRNA. To determine the in vivo potency and efficacy, BalbC mice were treated with 2′-O-DMAOE gapmers and a dose-dependent reduction in the targeted C-raf mRNA expression was observed. Oligonucleotides with 2′-O-DMAOE modifications throughout the sequences reduced the intercellular adhesion molecule-1 (ICAM-1) protein expression very efficiently in HUVEC cells with an IC50 of 1.8 nM. The inhibition of ICAM-1 protein expression by these uniformly modified 2′-O-DMAOE oligonucleotides may be due to selective interference with the formation of the translational initiation complex. These results demonstrate that 2′-O-DMAOE- modified oligonucleotides are useful for antisense-based therapeutics when either RNase H-dependent or RNase H-independent target reduction mechanisms are employed. PMID:14762210

Glutathione-responsive nano-transporter-mediated siRNA delivery: silencing the mRNA expression of Ras.

PubMed

Doss, C George Priya; Debottam, S; Debajyoti, C

2013-06-01

Gene therapy through antisense technology via intracellular delivery of a gene-silencing element is a promising approach to treat critical diseases like cancers. Ras acts as molecular switch, considered as one of the proto-oncogenes whose modification or mutation may promote tumor formation. The recent trends of nano-carrier-based drug delivery have gained superiority and proved to be 100 times more potent in drug delivery compared to standard therapies. The nano-based drug delivery has provided the basis of achieving successful target-specific drug delivery. Glutathione (GSH) is considered as one of the best and ubiquitous internal stimulus for swift destabilization of nano-transporters inside cells to accomplish proficient intracellular drug release. This concept has given a new hope to oncologists of modifying the existing drugs to be delivered to their desired destination. RNA interference is a primary tool in functional genomics to selectively silence messenger RNA (mRNA) expression, which can be exploited quickly to develop novel drugs against lethal disease target. Silencing of mRNA molecules using siRNA has also come of age to become one of the latest weapons developed in the concept of gene therapy. However, this strategy has severely failed to achieve target specificity especially to a tumor cell. In this context, we have proposed the incorporation of an antisense siRNA packed inside a GSH-responsive nano-transporter to be delivered specifically to a tumor cell against the sense mRNA of the Ras protein. It will limit the Ras-mediated activation of other proteins and transcription factors. Thus, it will knock down several differential gene expressions being regulated by Ras-activated pathways like enzyme-linked receptor kinase pathway. Henceforth, gene silencing technology through nano-drug delivery can be combined as a single weapon to terminate malignancy.

Combination of small RNAs for skeletal muscle regeneration.

PubMed

Kim, NaJung; Yoo, James J; Atala, Anthony; Lee, Sang Jin

2016-03-01

Selectively controlling the expression of the target genes through RNA interference (RNAi) has significant therapeutic potential for injuries or diseases of tissues. We used this strategy to accelerate and enhance skeletal muscle regeneration for the treatment of muscular atrophy. In this study, we used myostatin small interfering (si)RNA (siGDF-8), a major inhibitory factor in the development and postnatal regeneration of skeletal muscle and muscle-specific microRNAs (miR-1 and -206) to further accelerate muscle regeneration. This combination of 3 small RNAs significantly improved the gene expression of myogenic regulatory factors in vitro, suggesting myogenic activation. Moreover, cell proliferation and myotube formation improved without compromising each other, which indicates the myogenic potential of this combination of small RNAs. The recovery of chemically injured tibialis anterior muscles in rats was significantly accelerated, both functionally and structurally. This novel combination of siRNA and miRNAs has promising therapeutic potential to improve in situ skeletal muscle regeneration. © FASEB.

Characterization of small RNA populations in non-transgenic and aflatoxin-reducing-transformed peanut.

PubMed

Power, Imana L; Dang, Phat M; Sobolev, Victor S; Orner, Valerie A; Powell, Joseph L; Lamb, Marshall C; Arias, Renee S

2017-04-01

Aflatoxin contamination is a major constraint in food production worldwide. In peanut (Arachis hypogaea L.), these toxic and carcinogenic aflatoxins are mainly produced by Aspergillus flavus Link and A. parasiticus Speare. The use of RNA interference (RNAi) is a promising method to reduce or prevent the accumulation of aflatoxin in peanut seed. In this study, we performed high-throughput sequencing of small RNA populations in a control line and in two transformed peanut lines that expressed an inverted repeat targeting five genes involved in the aflatoxin-biosynthesis pathway and that showed up to 100% less aflatoxin B 1 than the controls. The objective was to determine the putative involvement of the small RNA populations in aflatoxin reduction. In total, 41 known microRNA (miRNA) families and many novel miRNAs were identified. Among those, 89 known and 10 novel miRNAs were differentially expressed in the transformed lines. We furthermore found two small interfering RNAs derived from the inverted repeat, and 39 sRNAs that mapped without mismatches to the genome of A. flavus and were present only in the transformed lines. This information will increase our understanding of the effectiveness of RNAi and enable the possible improvement of the RNAi technology for the control of aflatoxins. Copyright © 2017 Elsevier B.V. All rights reserved.

Brain Natriuretic Peptide Stimulates Lipid Metabolism through Its Receptor NPR1 and the Glycerolipid Metabolism Pathway in Chicken Adipocytes.

PubMed

Huang, H Y; Zhao, G P; Liu, R R; Li, Q H; Zheng, M Q; Li, S F; Liang, Z; Zhao, Z H; Wen, J

2015-11-03

Brain natriuretic peptide (BNP) is related to lipid metabolism in mammals, but its effect and the molecular mechanisms underlying it in chickens are incompletely understood. We found that the level of natriuretic peptide precursor B (NPPB, which encodes BNP) mRNA expression in high-abdominal-fat chicken groups was significantly higher than that of low-abdominal-fat groups. Partial correlations indicated that changes in the weight of abdominal fat were positively correlated with NPPB mRNA expression level. In vitro, compared with the control group, preadipocytes with NPPB interference showed reduced levels of proliferation, differentiation, and glycerin in media. Treatments of cells with BNP led to enhanced proliferation and differentiation of cells and glycerin concentration, and mRNA expression of its receptor natriuretic peptide receptor 1 (NPR1) was upregulated significantly. In cells exposed to BNP, 482 differentially expressed genes were identified compared with controls without BNP. Four genes known to be related to lipid metabolism (diacylglycerol kinase; lipase, endothelial; 1-acylglycerol-3-phosphate O-acyltransferase 1; and 1-acylglycerol-3-phosphate O-acyltransferase 2) were enriched in the glycerolipid metabolism pathway and expressed differentially. In conclusion, BNP stimulates the proliferation, differentiation, and lipolysis of preadipocytes through upregulation of the levels of expression of its receptor NPR1 and key genes enriched in the glycerolipid metabolic pathway.

Hydrophobization and bioconjugation for enhanced siRNA delivery and targeting

PubMed Central

De Paula, Daniel; Bentley, M. Vitória L.B.; Mahato, Ram I.

2007-01-01

RNA interference (RNAi) is an evolutionarily conserved process by which double-stranded small interfering RNA (siRNA) induces sequence-specific, post-transcriptional gene silencing. Unlike other mRNA targeting strategies, RNAi takes advantage of the physiological gene silencing machinery. The potential use of siRNA as therapeutic agents has attracted great attention as a novel approach for treating severe and chronic diseases. RNAi can be achieved by either delivery of chemically synthesized siRNAs or endogenous expression of small hairpin RNA, siRNA, and microRNA (miRNA). However, the relatively high dose of siRNA required for gene silencing limits its therapeutic applications. This review discusses several strategies to improve therapeutic efficacy as well as to abrogate off-target effects and immunostimulation caused by siRNAs. There is an in-depth discussion on various issues related to the (1) mechanisms of RNAi, (2) methods of siRNA production, (3) barriers to RNAi-based therapies, (4) biodistribution, (5) design of siRNA molecules, (6) chemical modification and bioconjugation, (7) complex formation with lipids and polymers, (8) encapsulation into lipid particles, and (9) target specificity for enhanced therapeutic effectiveness. PMID:17329355

The NS3 protein of Rice hoja blanca tenuivirus suppresses RNA silencing in plant and insect hosts by efficiently binding both siRNAs and miRNAs

PubMed Central

Hemmes, Hans; Lakatos, Lóránt; Goldbach, Rob; Burgyán, József; Prins, Marcel

2007-01-01

RNA silencing plays a key role in antiviral defense as well as in developmental processes in plants and insects. Negative strand RNA viruses such as the plant virus Rice hoja blanca tenuivirus (RHBV) replicate in plants and in their insect transmission vector. Like most plant-infecting viruses, RHBV encodes an RNA silencing suppressor, the NS3 protein, and here it is demonstrated that this protein is capable of suppressing RNA silencing in both plants and insect cells. Biochemical analyses showed that NS3 efficiently binds siRNA as well as miRNA molecules. Binding of NS3 is greatly influenced by the size of small RNA molecules, as 21 nucleotide (nt) siRNA molecules are bound > 100 times more efficiently than 26 nt species. Competition assays suggest that the activity of NS3 is based on binding to siRNAs prior to strand separation during the assembly of the RNA-induced silencing complex. In addition, NS3 has a high affinity for miRNA/miRNA* duplexes, indicating that its activity might also interfere with miRNA-regulated gene expression in both insects and plants. PMID:17513697

A novel gene from the takeout family involved in termite trail-following behavior.

PubMed

Schwinghammer, Margaret A; Zhou, Xuguo; Kambhampati, Srinivas; Bennett, Gary W; Scharf, Michael E

2011-03-15

This study investigated physiological and behavioral functions of a novel gene identified from the termite Reticulitermes flavipes. The gene, named deviate, encodes an apparent ligand binding protein from the takeout-homologous family. Initial studies were conducted to investigate deviate mRNA expression among termite castes and body regions, and changes in response to light-dark conditions, starvation, temperature, and juvenile hormone (JH). Deviate has ubiquitous caste and tissue expression, including antennal expression. Consistent with characteristics of other takeout family members, deviate expression is responsive to photophase conditions (p<0.1), and feeding, temperature, and JH (p<0.05). Using RNA-interference (RNAi) techniques, short-interfering RNAs (siRNAs) homologous to the deviate gene were synthesized and injected into worker termites, which were then subjected to bioassays designed to (1) induce caste differentiation or (2) measure various behavioral aspects of foraging and trail following. No impacts on JH-dependent caste differentiation were observable. However, trail following accuracy was significantly reduced in termites that received deviate siRNA injections, and this pattern generally mirrored deviate mRNA attenuation and recovery after RNAi. In a subsequent distance foraging bioassay, deviate-silenced termites exhibited equal feeding levels to controls, suggesting the deviate gene is not linked to general vigor or the ability/motivation of termites to move and forage. These findings are among the first linking the expression of a termite gene with eusocial behavior; they illustrate the connection between deviate expression and trailing behavior, which is a key evolutionary adaptation vital to subterranean social insects such as termites and ants. Copyright © 2010 Elsevier B.V. All rights reserved.

Permanent, lowered HLA class I expression using lentivirus vectors with shRNA constructs: Averting cytotoxicity by alloreactive T lymphocytes.

PubMed

Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C

2006-12-01

Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.

3' Untranslated regions mediate transcriptional interference between convergent genes both locally and ectopically in Saccharomyces cerevisiae.

PubMed

Wang, Luwen; Jiang, Ning; Wang, Lin; Fang, Ou; Leach, Lindsey J; Hu, Xiaohua; Luo, Zewei

2014-01-01

Paired sense and antisense (S/AS) genes located in cis represent a structural feature common to the genomes of both prokaryotes and eukaryotes, and produce partially complementary transcripts. We used published genome and transcriptome sequence data and found that over 20% of genes (645 pairs) in the budding yeast Saccharomyces cerevisiae genome are arranged in convergent pairs with overlapping 3'-UTRs. Using published microarray transcriptome data from the standard laboratory strain of S. cerevisiae, our analysis revealed that expression levels of convergent pairs are significantly negatively correlated across a broad range of environments. This implies an important role for convergent genes in the regulation of gene expression, which may compensate for the absence of RNA-dependent mechanisms such as micro RNAs in budding yeast. We selected four representative convergent gene pairs and used expression assays in wild type yeast and its genetically modified strains to explore the underlying patterns of gene expression. Results showed that convergent genes are reciprocally regulated in yeast populations and in single cells, whereby an increase in expression of one gene produces a decrease in the expression of the other, and vice-versa. Time course analysis of the cell cycle illustrated the functional significance of this relationship for the three pairs with relevant functional roles. Furthermore, a series of genetic modifications revealed that the 3'-UTR sequence plays an essential causal role in mediating transcriptional interference, which requires neither the sequence of the open reading frame nor the translation of fully functional proteins. More importantly, transcriptional interference persisted even when one of the convergent genes was expressed ectopically (in trans) and therefore does not depend on the cis arrangement of convergent genes; we conclude that the mechanism of transcriptional interference cannot be explained by the transcriptional collision model, which postulates a clash between simultaneous transcriptional processes occurring on opposite DNA strands.

3′ Untranslated Regions Mediate Transcriptional Interference between Convergent Genes Both Locally and Ectopically in Saccharomyces cerevisiae

PubMed Central

Wang, Luwen; Jiang, Ning; Wang, Lin; Fang, Ou; Leach, Lindsey J.; Hu, Xiaohua; Luo, Zewei

2014-01-01

Paired sense and antisense (S/AS) genes located in cis represent a structural feature common to the genomes of both prokaryotes and eukaryotes, and produce partially complementary transcripts. We used published genome and transcriptome sequence data and found that over 20% of genes (645 pairs) in the budding yeast Saccharomyces cerevisiae genome are arranged in convergent pairs with overlapping 3′-UTRs. Using published microarray transcriptome data from the standard laboratory strain of S. cerevisiae, our analysis revealed that expression levels of convergent pairs are significantly negatively correlated across a broad range of environments. This implies an important role for convergent genes in the regulation of gene expression, which may compensate for the absence of RNA-dependent mechanisms such as micro RNAs in budding yeast. We selected four representative convergent gene pairs and used expression assays in wild type yeast and its genetically modified strains to explore the underlying patterns of gene expression. Results showed that convergent genes are reciprocally regulated in yeast populations and in single cells, whereby an increase in expression of one gene produces a decrease in the expression of the other, and vice-versa. Time course analysis of the cell cycle illustrated the functional significance of this relationship for the three pairs with relevant functional roles. Furthermore, a series of genetic modifications revealed that the 3′-UTR sequence plays an essential causal role in mediating transcriptional interference, which requires neither the sequence of the open reading frame nor the translation of fully functional proteins. More importantly, transcriptional interference persisted even when one of the convergent genes was expressed ectopically (in trans) and therefore does not depend on the cis arrangement of convergent genes; we conclude that the mechanism of transcriptional interference cannot be explained by the transcriptional collision model, which postulates a clash between simultaneous transcriptional processes occurring on opposite DNA strands. PMID:24465217

Analysis of Nuclear RNA Interference (RNAi) in Human Cells by Subcellular Fractionation and Argonaute Loading

PubMed Central

Gagnon, Keith T.; Li, Liande; Janowski, Bethany A.; Corey, David R.

2014-01-01

RNA interference (RNAi) is well known for its ability to regulate gene expression in the cytoplasm of mammalian cells. In mammalian cell nuclei, however, the impact of RNAi has remained more controversial. A key technical hurdle has been a lack of optimized protocols for the isolation and analysis of cell nuclei. Here we describe a simplified protocol for nuclei isolation from cultured cells that incorporates a method for obtaining nucleoplasmic and chromatin fractions and removing cytoplasmic contamination. Cell fractions can then be used to detect the presence and activity of RNAi factors in the nucleus. We present a protocol for investigating an early step in RNAi, Argonaute protein loading with small RNAs, which is enabled by our improved extract preparations. These protocols facilitate characterization of nuclear RNAi and can be applied to the analysis of other nuclear proteins and pathways. From cellular fractionation to analysis of Argonaute loading results, this protocol takes 4–6 d to complete. PMID:25079428

A whole genome screening and RNA interference identify a juvenile hormone esterase-like gene of the diamondback moth, Plutella xylostella.

PubMed

Gu, Xiaojun; Kumar, Sunil; Kim, Eunjin; Kim, Yonggyun

2015-09-01

Juvenile hormone (JH) plays a crucial role in preventing precocious metamorphosis and stimulating reproduction. Thus, its hemolymph titer should be under a tight control. As a negative controller, juvenile hormone esterase (JHE) performs a rapid breakdown of residual JH in the hemolymph during last instar to induce a larval-to-pupal metamorphosis. A whole genome of the diamondback moth (DBM), Plutella xylostella, has been annotated and proposed 11 JHE candidates. Sequence analysis using conserved motifs commonly found in other JHEs proposed a putative JHE (Px004817). Px004817 (64.61 kDa, pI=5.28) exhibited a characteristic JHE expression pattern by showing high peak at the early last instar, at which JHE enzyme activity was also at a maximal level. RNA interference of Px004817 reduced JHE activity and interrupted pupal development with a significant increase of larval period. This study identifies Px004817 as a JHE-like gene of P. xylostella. Copyright © 2015 Elsevier Ltd. All rights reserved.

RNA-Seq and molecular docking reveal multi-level pesticide resistance in the bed bug

PubMed Central

2012-01-01

Background Bed bugs (Cimex lectularius) are hematophagous nocturnal parasites of humans that have attained high impact status due to their worldwide resurgence. The sudden and rampant resurgence of C. lectularius has been attributed to numerous factors including frequent international travel, narrower pest management practices, and insecticide resistance. Results We performed a next-generation RNA sequencing (RNA-Seq) experiment to find differentially expressed genes between pesticide-resistant (PR) and pesticide-susceptible (PS) strains of C. lectularius. A reference transcriptome database of 51,492 expressed sequence tags (ESTs) was created by combining the databases derived from de novo assembled mRNA-Seq tags (30,404 ESTs) and our previous 454 pyrosequenced database (21,088 ESTs). The two-way GLMseq analysis revealed ~15,000 highly significant differentially expressed ESTs between the PR and PS strains. Among the top 5,000 differentially expressed ESTs, 109 putative defense genes (cuticular proteins, cytochrome P450s, antioxidant genes, ABC transporters, glutathione S-transferases, carboxylesterases and acetyl cholinesterase) involved in penetration resistance and metabolic resistance were identified. Tissue and development-specific expression of P450 CYP3 clan members showed high mRNA levels in the cuticle, Malpighian tubules, and midgut; and in early instar nymphs, respectively. Lastly, molecular modeling and docking of a candidate cytochrome P450 (CYP397A1V2) revealed the flexibility of the deduced protein to metabolize a broad range of insecticide substrates including DDT, deltamethrin, permethrin, and imidacloprid. Conclusions We developed significant molecular resources for C. lectularius putatively involved in metabolic resistance as well as those participating in other modes of insecticide resistance. RNA-Seq profiles of PR strains combined with tissue-specific profiles and molecular docking revealed multi-level insecticide resistance in C. lectularius. Future research that is targeted towards RNA interference (RNAi) on the identified metabolic targets such as cytochrome P450s and cuticular proteins could lay the foundation for a better understanding of the genetic basis of insecticide resistance in C. lectularius. PMID:22226239

Effect of transient receptor potential vanilloid 6 gene silencing on the expression of calcium transport genes in chicken osteoblasts.

PubMed

Zhang, Jie; Deng, Yifeng; Ma, Huijie; Hou, Jiafa; Zhou, ZhenLei

2015-03-01

Ca2+ plays a major role in the regulation of signal transduction. Transient receptor potential vanilloid 6 is a Ca2+-selective channel that serves as an important rate-limiting step in the facilitation of Ca2+ entry into cells, but little is known about the regulation of transient receptor potential vanilloid 6 in chickens. In this study, we evaluated the effects of transient receptor potential vanilloid 6 gene interference on the expression of calbindin-D28K, Na+/Ca2+ exchangers, and plasma membrane Ca2+ ATPase 1b to investigate the mechanism underlying the regulation of transient receptor potential vanilloid 6. Three hairpin siRNA expression vectors targeting transient receptor potential vanilloid 6 (pSIREN- transient receptor potential vanilloid 6) and a negative control (pSIREN-control) were constructed and transfected into chicken osteoblasts. The mRNA and protein expression levels were evaluated by quantitative reverse transcription polymerase chain reaction and Western blot, respectively. The mRNA expression levels of transient receptor potential vanilloid 6 and calbindin-D28K were reduced by 45.7% (P<0.01) and 27.9% (P<0.01), respectively, 48 h after transfection with one of the three constructs (pSIREN- transient receptor potential vanilloid 6-3) compared with the level obtained in the untreated group. There was no significant difference in the mRNA expression levels of Na+/Ca2+ exchangers and plasma membrane Ca2+ ATPase 1b. The protein expression levels of transient receptor potential vanilloid 6 and calbindin-D28K were reduced by 40.2% (P<0.01) and 29.8% (P<0.01), respectively, 48 h after transfection with pSIREN-transient receptor potential vanilloid 6-3 compared with the level obtained in the untreated group. In conclusion, the vector-based transient receptor potential vanilloid 6-shRNA can efficiently suppress the mRNA and protein expression of transient receptor potential vanilloid 6 in chicken osteoblasts, and transient receptor potential vanilloid 6 regulates the expression of calbindin-D28K during Ca2+ transport. © 2015 Poultry Science Association Inc.

SiRNA Crosslinked Nanoparticles for the Treatment of Inflammation-induced Liver Injury.

PubMed

Tang, Yaqin; Zeng, Ziying; He, Xiao; Wang, Tingting; Ning, Xinghai; Feng, Xuli

2017-02-01

RNA interference mediated by small interfering RNA (siRNA) provides a powerful tool for gene regulation, and has a broad potential as a promising therapeutic strategy. However, therapeutics based on siRNA have had limited clinical success due to their undesirable pharmacokinetic properties. This study presents pH-sensitive nanoparticles-based siRNA delivery systems (PNSDS), which are positive-charge-free nanocarriers, composed of siRNA chemically crosslinked with multi-armed poly(ethylene glycol) carriers via acid-labile acetal linkers. The unique siRNA crosslinked structure of PNSDS allows it to have minimal cytotoxicity, high siRNA loading efficiency, and a stimulus-responsive property that enables the selective intracellular release of siRNA in response to pH conditions. This study demonstrates that PNSDS can deliver tumor necrosis factor alpha (TNF-α) siRNA into macrophages and induce the efficient down regulation of the targeted gene in complete cell culture media. Moreover, PNSDS with mannose targeting moieties can selectively accumulate in mice liver, induce specific inhibition of macrophage TNF-α expression in vivo, and consequently protect mice from inflammation-induced liver damages. Therefore, this novel siRNA delivering platform would greatly improve the therapeutic potential of RNAi based therapies.

A gene trap transposon eliminates haematopoietic expression of zebrafish Gfi1aa, but does not interfere with haematopoiesis.

PubMed

Thambyrajah, Roshana; Ucanok, Deniz; Jalali, Maryam; Hough, Yasmin; Wilkinson, Robert Neil; McMahon, Kathryn; Moore, Chris; Gering, Martin

2016-09-01

A transposon-mediated gene trap screen identified the zebrafish line qmc551 that expresses a GFP reporter in primitive erythrocytes and also in haemogenic endothelial cells, which give rise to haematopoietic stem and progenitor cells (HSPCs) that seed sites of larval and adult haematopoiesis. The transposon that mediates this GFP expression is located in intron 1 of the gfi1aa gene, one of three zebrafish paralogs that encode transcriptional repressors homologous to mammalian Gfi1 and Gfi1b proteins. In qmc551 transgenics, GFP expression is under the control of the endogenous gfi1aa promoter, recapitulates early gfi1aa expression and allows live observation of gfi1aa promoter activity. While the transposon integration interferes with the expression of gfi1aa mRNA in haematopoietic cells, homozygous qmc551 fish are viable and fertile, and display normal primitive and definitive haematopoiesis. Retained expression of Gfi1b in primitive erythrocytes and up-regulation of Gfi1ab at the onset of definitive haematopoiesis in homozygous qmc551 carriers, are sufficient to allow normal haematopoiesis. This finding contradicts previously published morpholino data that suggested an essential role for zebrafish Gfi1aa in primitive erythropoiesis. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

siRNA targeting mCD14 inhibits TNF-α, MIP-2, and IL-6 secretion and NO production from LPS-induced RAW264.7 cells.

PubMed

Lei, Ming; Jiao, Hanwei; Liu, Tao; Du, Li; Cheng, Ying; Zhang, Donglin; Hao, Yongchang; Man, Churiga; Wang, Fengyang

2011-10-01

Innate immunity plays a key role in protecting a host against invading microorganism, including Gram-negative bacteria. Cluster of differentiation antigen 14 (CD14) is an important innate immunity molecule, existing as a soluble (sCD14) and membrane-associated (mCD14) protein. Endotoxin [lipopolysaccharide (LPS)] is recognized as a key molecule in the pathogenesis of sepsis and septic shock caused by Gram negative bacteria. Emerging evidences indicate that upstream inhibition of bacterial LPS/Toll-like receptor 4(TLR4)/CD14-mediated inflammation pathway is an effective therapeutic approach for attenuating damaging immune activation. RNA interference (RNAi) provides a promising approach to down-regulate gene expression specifically. To explore the possibility of using RNAi against mCD14 as a strategy for inhibiting the secretion of cytokines and the nitric oxide (NO) production from LPS-activated RAW264.7 cells, four different short interfering RNA (siRNA) molecules corresponding to the sequence of mCD14 gene were designed and synthesized. We then tested the inhibition effects of these siRNA molecules on mCD14 expression by real-time quantitative RT-PCR and Western blot. After effective siRNA molecule (mCD14-siRNA-224), which is capable of reducing messenger RNA (mRNA) accumulation and protein expression of mCD14 specifically, was identified, RAW264.7 cells pretreated with mCD14-siRNA-224 were stimulated with LPS, and the secretion of tumor necrosis factor alpha (TNF-α), macrophage inflammatory protein-2 (MIP-2) and interleukin-6 (IL-6) and the NO production were evaluated. The results indicated that mCD14-siRNA-224 effectively inhibited TNF-α, MIP-2, and IL-6 release and NO production from LPS-stimulated RAW 264.7 cells by down-regulating mRNA accumulation and protein expression of mCD14 specifically. These findings provide useful information for the development of RNAi-based prophylaxis and therapy for endotoxin-related diseases.

Caspase-3 short hairpin RNAs: a potential therapeutic agent in neurodegeneration of aluminum-exposed animal model.

PubMed

Zhang, Qinli; Li, Na; Jiao, Xia; Qin, Xiujun; Kaur, Ramanjit; Lu, Xiaoting; Song, Jing; Wang, Linping; Wang, Junming; Niu, Qiao

2014-01-01

There is abundant evidence supporting the role of caspases in the development of neurodegenerative disease, including Alzheimer's disease (AD). Therefore, regulating the activity of caspases has been considered as a therapeutic target. However, all the efforts on AD therapy using pan-caspase inhibitors have failed because of uncontrolled adverse effects. Alternatively, the specific knockdown of caspase-3 gene through RNA interference (RNAi) could serve as a future potential therapeutic strategy. The aim of the present study is to down-regulate the expression of caspase-3 gene using lentiviral vector-mediated caspase-3 short hairpin RNA (LV-Caspase-3 shRNA). The effect of LV-Caspase-3 shRNA on apoptosis induced by aluminum (Al) was investigated in primary cultured cortical neurons and validated in C57BL/6J mice. The results indicated an increase in apoptosis and caspase-3 expression in primary cultured neurons and the cortex ofmice exposed to Al, which could be down-regulated by LV-Caspase-3 shRNA. Furthermore, LV-Caspase-3 shRNA reduced neural cell death and improved learning and memory in C57BL/6J mice treated with Al. Our results suggest that LV-caspase-3 shRNA is a potential therapeutic agent to prevent neurodegeneration and cognitive dysfunction in aluminum- exposed animal models. The findings provide a rational gene therapy strategy for AD.

RNA interference suppression of MUC1 reduces the growth rate and metastatic phenotype of human pancreatic cancer cells.

PubMed

Tsutsumida, Hideaki; Swanson, Benjamin J; Singh, Pankaj K; Caffrey, Thomas C; Kitajima, Shinichi; Goto, Masamichi; Yonezawa, Suguru; Hollingsworth, Michael A

2006-05-15

MUC1 is a highly glycosylated, type I transmembrane protein expressed by normal ductal epithelial cells of the pancreas, breast, lung, and gastrointestinal tract, and overexpressed in many cases of adenocarcinoma. We down-regulated MUC1 expression by RNA interference and investigated the effects on malignant and metastatic potential of a human pancreatic cancer cell line, S2-013. MUC1-suppressed clones, S2-013.MTII.C1 and S2-013.MTII.C2, were established by targeting a sequence 3,151 bp from the initiation codon and characterized in vitro for proliferation, invasion, and adhesion. We evaluated the effects of MUC1 suppression in vivo on tumor growth and metastatic properties following implantation into the cecum or pancreas of athymic mice. MUC1-suppressed clones showed significantly decreased proliferation in vitro and in vivo. Global gene expression was evaluated by oligonucleotide microarray analysis. Surprisingly, genes predicted to increase doubling times (cyclin B1 and cyclin D3) were overexpressed in MUC1-suppressed clones. There were alterations in expression of several genes that may affect the malignant properties of pancreatic cancer. Adhesion of MUC1-suppressed cells in vitro to type IV collagen and fibronectin was slightly increased, and adhesion was slightly decreased to type I collagen and laminin. Results of implantation to cecum and pancreas showed significant reduction of metastasis to lymph nodes, lung, or peritoneal sites compared with S2-013.gfp-neo control cells. These results support the hypothesis that MUC1 contributes significantly to growth and metastasis, and that down-regulation of MUC1 protein expression decreases the metastatic potential of pancreatic adenocarcinoma.

The asparagine residue in the FRNK box of potyviral helper-component protease is critical for its small RNA binding and subcellular localization.

PubMed

Sahana, Nandita; Kaur, Harpreet; Jain, R K; Palukaitis, Peter; Canto, Tomas; Praveen, Shelly

2014-05-01

The multifunctional potyviral helper-component protease (HcPro) contains variable regions with some functionally conserved domains, such as the FRNK box. Natural variants occur at the FRNK box, a conserved central domain, known for its role in RNA binding and RNAi suppression activities, although no dominant natural variants for the N(182) residue are known to occur. Here, a mutant at HcPro(N182L) was developed to investigate its role in natural populations. Using in vitro studies, we found an increase in the small RNA (sRNA) binding potential of HcPro(N182L) without affecting its protein-protein interaction properties, suggesting that the presence of N(182) is critical to maintain threshold levels of sRNAs, but does not interfere in the self-interaction of HcPro. Furthermore, we found that expression of HcPro(N182L) in Nicotiana benthamiana affected plant growth. Transient expression of HcPro(N182L) induced reporter gene expression in 16c GFP transgenic plants more than HcPro did, suggesting that replacement of asparagine in the FRNK box favours RNA silencing suppression. HcPro was found to be distributed in the nucleus and cytoplasm, whereas HcPro(N182L) was observed only in cytoplasmic inclusion bodies in N. benthamiana leaves, when fused to a GFP tag and expressed by agro-infiltration, suggesting mutation favours oligomerization of HcPro. These findings suggest that amino acid N(182) of the conserved FRNK box may regulate RNA silencing mechanisms, and is required for maintenance of the subcellular localization of the protein for its multi-functionality. Hence, the N(182) residue of the FRNK box seems to be indispensable for potyvirus infection during evolution.

Effect of North Bicyclo[3.1.0]hexane 2'-Deoxypseudosugars on RNA Interference: A Novel Class of siRNA Modification | Center for Cancer Research

Cancer.gov

The inside cover picture shows how siRNAs modified with North bicyclo[3.1.0]hexane 2'-deoxy-pseudosugars are able to activate the RNA interference machinery. The paper confirms that the North conformation is critical for RNAi activity.

Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing

PubMed Central

Salton, Maayan; Kasprzak, Wojciech K.; Voss, Ty; Shapiro, Bruce A.; Poulikakos, Poulikos I.; Misteli, Tom

2015-01-01

Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signaling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumors. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumor formation and slows growth of vemurafenib-resistant tumors. Our results identify an intronic mutation as a molecular basis for RNA splicing-mediated RAF inhibitor resistance and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma. PMID:25971842

Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing.

PubMed

Salton, Maayan; Kasprzak, Wojciech K; Voss, Ty; Shapiro, Bruce A; Poulikakos, Poulikos I; Misteli, Tom

2015-05-14

Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signalling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumours. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small-molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumour formation and slows growth of vemurafenib-resistant tumours. Our results identify an intronic mutation as the molecular basis for a RNA splicing-mediated RAF inhibitor resistance mechanism and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma.

AGO1, QDE-2, and RDE-1 are related proteins required for post-transcriptional gene silencing in plants, quelling in fungi, and RNA interference in animals

PubMed Central

Fagard, Mathilde; Boutet, Stéphanie; Morel, Jean-Benoit; Bellini, Catherine; Vaucheret, Hervé

2000-01-01

Introduction of transgene DNA may lead to specific degradation of RNAs that are homologous to the transgene transcribed sequence through phenomena named post-transcriptional gene silencing (PTGS) in plants, quelling in fungi, and RNA interference (RNAi) in animals. It was shown previously that PTGS, quelling, and RNAi require a set of related proteins (SGS2, QDE-1, and EGO-1, respectively). Here we report the isolation of Arabidopsis mutants impaired in PTGS which are affected at the Argonaute1 (AGO1) locus. AGO1 is similar to QDE-2 required for quelling and RDE-1 required for RNAi. Sequencing of ago1 mutants revealed one amino acid essential for PTGS that is also present in QDE-2 and RDE-1 in a highly conserved motif. Taken together, these results confirm the hypothesis that these processes derive from a common ancestral mechanism that controls expression of invading nucleic acid molecules at the post-transcriptional level. As opposed to rde-1 and qde-2 mutants, which are viable, ago1 mutants display several developmental abnormalities, including sterility. These results raise the possibility that PTGS, or at least some of its elements, could participate in the regulation of gene expression during development in plants. PMID:11016954

AGO1, QDE-2, and RDE-1 are related proteins required for post-transcriptional gene silencing in plants, quelling in fungi, and RNA interference in animals.

PubMed

Fagard, M; Boutet, S; Morel, J B; Bellini, C; Vaucheret, H

2000-10-10

Introduction of transgene DNA may lead to specific degradation of RNAs that are homologous to the transgene transcribed sequence through phenomena named post-transcriptional gene silencing (PTGS) in plants, quelling in fungi, and RNA interference (RNAi) in animals. It was shown previously that PTGS, quelling, and RNAi require a set of related proteins (SGS2, QDE-1, and EGO-1, respectively). Here we report the isolation of Arabidopsis mutants impaired in PTGS which are affected at the Argonaute1 (AGO1) locus. AGO1 is similar to QDE-2 required for quelling and RDE-1 required for RNAi. Sequencing of ago1 mutants revealed one amino acid essential for PTGS that is also present in QDE-2 and RDE-1 in a highly conserved motif. Taken together, these results confirm the hypothesis that these processes derive from a common ancestral mechanism that controls expression of invading nucleic acid molecules at the post-transcriptional level. As opposed to rde-1 and qde-2 mutants, which are viable, ago1 mutants display several developmental abnormalities, including sterility. These results raise the possibility that PTGS, or at least some of its elements, could participate in the regulation of gene expression during development in plants.

2,4,6-Tribromophenol Interferes with the Thyroid Hormone System by Regulating Thyroid Hormones and the Responsible Genes in Mice

PubMed Central

Lee, Dongoh; Ahn, Changhwan; Hong, Eui-Ju; An, Beum-Soo; Hyun, Sang-Hwan; Choi, Kyung-Chul; Jeung, Eui-Bae

2016-01-01

2,4,6-Tribromophenol (TBP) is a brominated flame retardant (BFR). Based on its affinity for transthyretin, TBP could compete with endogenous thyroid hormone. In this study, the effects of TBP on the thyroid hormone system were assessed in mice. Briefly, animals were exposed to 40 and 250 mg/kg TBP. Thyroid hormones were also administered with or without TBP. When mice were treated with TBP, deiodinase 1 (Dio1) and thyroid hormone receptor β isoform 2 (Thrβ2) decreased in the pituitary gland. The levels of deiodinase 2 (Dio2) and growth hormone (Gh) mRNA increased in response to 250 mg/kg of TBP, and the relative mRNA level of thyroid stimulating hormone β (Tshβ) increased in the pituitary gland. Dio1 and Thrβ1 expression in the liver were not altered, while Dio1 decreased in response to co-treatment with thyroid hormones. The thyroid gland activity decreased in response to TBP, as did the levels of free triiodothyronine and free thyroxine in serum. Taken together, these findings indicate that TBP can disrupt thyroid hormone homeostasis and the presence of TBP influenced thyroid actions as regulators of gene expression. These data suggest that TBP interferes with thyroid hormone systems PMID:27420076

2,4,6-Tribromophenol Interferes with the Thyroid Hormone System by Regulating Thyroid Hormones and the Responsible Genes in Mice.

PubMed

Lee, Dongoh; Ahn, Changhwan; Hong, Eui-Ju; An, Beum-Soo; Hyun, Sang-Hwan; Choi, Kyung-Chul; Jeung, Eui-Bae

2016-07-12

2,4,6-Tribromophenol (TBP) is a brominated flame retardant (BFR). Based on its affinity for transthyretin, TBP could compete with endogenous thyroid hormone. In this study, the effects of TBP on the thyroid hormone system were assessed in mice. Briefly, animals were exposed to 40 and 250 mg/kg TBP. Thyroid hormones were also administered with or without TBP. When mice were treated with TBP, deiodinase 1 (Dio1) and thyroid hormone receptor β isoform 2 (Thrβ2) decreased in the pituitary gland. The levels of deiodinase 2 (Dio2) and growth hormone (Gh) mRNA increased in response to 250 mg/kg of TBP, and the relative mRNA level of thyroid stimulating hormone β (Tshβ) increased in the pituitary gland. Dio1 and Thrβ1 expression in the liver were not altered, while Dio1 decreased in response to co-treatment with thyroid hormones. The thyroid gland activity decreased in response to TBP, as did the levels of free triiodothyronine and free thyroxine in serum. Taken together, these findings indicate that TBP can disrupt thyroid hormone homeostasis and the presence of TBP influenced thyroid actions as regulators of gene expression. These data suggest that TBP interferes with thyroid hormone systems.

lncRNA NONRATT021972 siRNA Decreases Diabetic Neuropathic Pain Mediated by the P2X3 Receptor in Dorsal Root Ganglia.

PubMed

Peng, Haiying; Zou, Lifang; Xie, Jinyan; Wu, Hong; Wu, Bing; Zhu, Gaochun; Lv, Qiulan; Zhang, Xi; Liu, Shuangmei; Li, Guilin; Xu, Hong; Gao, Yun; Xu, Changshui; Zhang, Chunping; Wang, Shouyu; Xue, Yun; Liang, Shangdong

2017-01-01

Long noncoding RNAs (lncRNAs) participate in physiological and pathophysiological processes. Type 2 diabetes mellitus (T2DM) accounts for more than 90 % of all cases of diabetes mellitus (DM). Diabetic neuropathic pain (DNP) is a common complication of T2DM. The aim of this study was to investigate the effects of lncRNA NONRATT021972 small interference RNA (siRNA) on DNP mediated by the P2X 3 receptor in dorsal root ganglia (DRG). These experiments showed that the expression levels of NONRATT021972 in DRG were increased in the T2DM rat model (intraperitoneal injection of STZ with 30 mg/kg). The concentration of NONRATT021972 in T2DM patient serum was higher compared to control healthy subjects. The mechanical withdrawal threshold (MWT) and thermal withdrawal latency (TWL) in T2DM rats were lower compared to control rats. MWT and TWL in T2DM rats treated with NONRATT021972 siRNA were higher compared with those in T2DM rats. The expression levels of the P2X 3 protein and messenger RNA (mRNA) of T2DM rat DRG were higher compared to the control, while those in T2DM rats treated with NONRATT021972 siRNA were significantly lower compared to T2DM rats. The level of tumor necrosis factor-α (TNF-α) in the serum of T2DM rats treated with NONRATT021972 siRNA was significantly decreased compared with T2DM rats. NONRATT021972 siRNA inhibited the phosphorylation and activation of ERK1/2 in T2DM DRG. Thus, NONRATT021972 siRNA treatment may suppress the upregulated expression and activation of the P2X 3 receptor and reduce the hyperalgesia potentiated by the pro-inflammatory cytokine TNF-α in T2DM rats.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Inoh, Yoshikazu; Furuno, Tadahide; Hirashima, Naohide

Highlights: Black-Right-Pointing-Pointer We use MEL-A-containing cationic liposomes for siRNA delivery. Black-Right-Pointing-Pointer MEL-A-containing cationic liposomes can efficiently and rapidly deliver siRNA into the cytoplasm. Black-Right-Pointing-Pointer Rapid delivery of siRNA is due to the membrane fusion between liposomes and plasma membrane. -- Abstract: The downregulation of gene expression by RNA interference holds great potential for genetic analysis and gene therapy. However, a more efficient delivery system for small interfering RNA (siRNA) into the target cells is required for wide fields such as cell biology, physiology, and clinical application. Non-viral vectors are stronger candidates than viral vectors because they are safer and easiermore » to prepare. We have previously used a new method for gene transfection by combining cationic liposomes with the biosurfactant mannosylerythritol lipid-A (MEL-A). The novel MEL-A-containing cationic liposomes rapidly delivered DNA (plasmids and oligonucleotides) into the cytosol and nucleus through membrane fusion between liposomes and the plasma membrane, and consequently, enhanced the gene transfection efficiency. In this study, we determined the efficiency of MEL-A-containing cationic liposomes for siRNA delivery. We observed that exogenous and endogenous protein expression was suppressed by approximately 60% at 24 h after brief (30 min) incubation of target cells with MEL-A-containing cationic liposome/siRNA complexes. Confocal microscopic analysis showed that suppression of protein expression was caused by rapid siRNA delivery into the cytosol. We found that the MEL-A-containing cationic liposomes directly delivered siRNA into the cytoplasm by the membrane fusion in addition to endocytotic pathway whereas Lipofectamine Trade-Mark-Sign RNAiMax delivered siRNA only by the endocytotic pathway. It seems that the ability to rapidly and directly deliver siRNA into the cytosol using MEL-A-containing cationic liposomes is able to reduce immune responses, cytotoxicity, and other side effects caused by viral vectors in clinical applications.« less

Gene Silencing by Gold Nanoshell-Mediated Delivery and Laser-Triggered Release of Antisense Oligonucleotide and siRNA

PubMed Central

Huschka, Ryan; Barhoumi, Aoune; Liu, Qing; Roth, Jack A.; Ji, Lin; Halas, Naomi J.

2013-01-01

The approach of RNA interference (RNAi)- using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein- is very useful in dissecting genetic function and holds significant promise as a molecular therapeutic. A major obstacle in achieving gene silencing with RNAi technology is the systemic delivery of therapeutic oligonucleotides. Here we demonstrate an engineered gold nanoshell (NS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer covalently attached to the NS surface (NS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotides, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. Controlled release of the captured therapeutic oligonucleotides in each case is accomplished by continuous wave NIR laser irradiation at 800 nm, near the resonance wavelength of the nanoshell. Fluorescently tagged oligonucleotides were used to monitor the time-dependent release process and light-triggered endosomal release. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and gene silencing mediated by the NS-PLL carrying GFP gene-specific single-stranded DNA antisense oligonucleotide (AON-GFP), or a double-stranded siRNA (siRNA-GFP), in vitro. Light-triggered delivery resulted in ∼ 47% and ∼49% downregulation of the targeted GFP expression by AON-GFP and siRNA-GFP, respectively. Cytotoxicity induced by both the NS-PLL delivery vector and by laser irradiation is minimal, as demonstrated by a XTT cell proliferation assay. PMID:22862291

Hepatitis B virus (HBV)-specific short hairpin RNA is capable of reducing the formation of HBV covalently closed circular (CCC) DNA but has no effect on established CCC DNA in vitro.

PubMed

Starkey, Jason L; Chiari, Estelle F; Isom, Harriet C

2009-01-01

Hepatitis B virus (HBV) covalently closed circular (CCC) DNA is the source of HBV transcripts and persistence in chronically infected patients. The novel aspect of this study was to determine the effect of RNA interference (RNAi) on HBV CCC DNA when administered prior to establishment of HBV replication or during chronic HBV infection. HBV replication was initiated in HepG2 cells by transduction with HBV baculovirus. Subculture of HBV-expressing HepG2 cells at 10 days post-transduction generates a system in which HBV replication is ongoing and HBV is expressed largely from CCC DNA, thus simulating chronic HBV infection. HepG2 cells were transduced with short hairpin RNA (shRNA)-expressing baculovirus prior to initiation of HBV replication or during chronic HBV replication, and the levels of HBV RNA, HBV surface antigens (HBsAg) and replicative intermediates (RI), extracellular (EC) and CCC DNA species were measured. HBsAg, HBV RNA and DNA levels were markedly reduced until day 8 whether cells were transduced with shRNA prior to or during a chronic infection; however, the CCC DNA species were only affected when shRNA was administered prior to initiation of infection. We conclude that RNAi may have a therapeutic value for controlling HBV replication at the level of RI and EC DNA and for reducing establishment of CCC DNA during HBV infection. Our data support previous findings demonstrating the stability of HBV CCC DNA following antiviral therapy. This study also reports the development of a novel HBV baculovirus subculture system that can be used to evaluate antiviral effects on chronic HBV replication.

Interferon-γ biphasically regulates angiotensinogen expression via a JAK-STAT pathway and suppressor of cytokine signaling 1 (SOCS1) in renal proximal tubular cells

PubMed Central

Satou, Ryousuke; Miyata, Kayoko; Gonzalez-Villalobos, Romer A.; Ingelfinger, Julie R.; Navar, L. Gabriel; Kobori, Hiroyuki

2012-01-01

Renal inflammation modulates angiotensinogen (AGT) production in renal proximal tubular cells (RPTCs) via inflammatory cytokines, including interleukin-6, tumor necrosis factor α, and interferon-γ (IFN-γ). Among these, the effects of IFN-γ on AGT regulation in RPTCs are incompletely delineated. This study aimed to elucidate mechanisms by which IFN-γ regulates AGT expression in RPTCs. RPTCs were incubated with or without IFN-γ up to 48 h. AGT expression, STAT1 and STAT3 activities, and SOCS1 expression were evaluated. RNA interference studies against STAT1, SOCS1, and STAT3 were performed to elucidate a signaling cascade. IFN-γ decreased AGT expression at 6 h (0.61±0.05, ratio to control) and 12 h (0.47±0.03). In contrast, longer exposure for 24 and 48 h increased AGT expression (1.76±0.18, EC50=3.4 ng/ml, and 1.45±0.08, respectively). IFN-γ treatment for 6 h strongly induced STAT1 phosphorylation and SOCS1 augmentation, and decreased STAT3 activity. However, STAT1 phosphorylation and SOCS1 augmentation waned at 24 h, while STAT3 activity increased. RNA interference studies revealed that activation of STAT1-SOCS1 axis decreased STAT3 activity. Thus, IFN-γ biphasically regulates AGT expression in RPTCs via STAT3 activity modulated by STAT1-SOCS1 axis, suggesting the STAT1-SOCS1 axis is important in IFN-γ-induced activation of the intrarenal renin-angiotensin system.—Satou, R., Miyata, K., Gonzalez-Villalobos, R. A., Ingelfinger, J. R., Navar, L. G., Kobori, H. Interferon-γ biphasically regulates angiotensinogen expression via a JAK-STAT pathway and suppressor of cytokine signaling 1 (SOCS1) in renal proximal tubular cells. PMID:22302831

Effects of birth trauma and estrogen on urethral elastic fibers and elastin expression.

PubMed

Lin, Guiting; Ning, Hongxiu; Wang, Guifang; Banie, Lia; Lue, Tom F; Lin, Ching-Shwun

2010-10-01

To investigate the effects of birth trauma and estrogen on urethral elastic fibers and elastin expression. Pregnant rats were subjected to sham operation (Delivery-only), DVDO (delivery, vaginal distension and ovariectomy), or DVDO + E₂ (estrogen). At 2, 4, 8, or 12 weeks, their urethras were harvested for elastic fiber staining and reverse transcription-polymerase chain reaction analysis. Urethral cells were treated with transforming growth factor- β1 (TGFβ1) and/or estrogen and analyzed for elastin mRNA expression. Urethral cells were also examined for the activities of Smad1- and Smad3/4-responsive elements in response to TGFβ1 and estrogen. At 8 weeks post-treatment, the urethras of DVDO rats had fewer and shorter elastic fibers when compared with Delivery-only rats, and those of DVDO + E₂ rats had fewer and shorter elastic fibers when compared with DVDO rats. Elastin mRNA was expressed at low levels in Delivery-only rats and at increasingly higher levels in DVDO rats at 2, 4, and 8 weeks but at sharply lower levels in DVDO + E₂ rats when compared with DVDO rats at 8 weeks. Urethral cells expressed increasingly higher levels of elastin mRNA in response to increasing concentrations of TGFβ1 up to 1 ng/mL. At this TGFβ1 concentration, urethral cells expressed significantly lower levels of elastin mRNA when treated with estrogen before or after TGFβ1 treatment. Both Smad1- and Smad3/4-responsive elements were activated by TGFβ1 and such activation was suppressed by estrogen. Birth trauma appears to activate urethral elastin expression via TGFβ1 signaling. Estrogen interferes with this signaling, resulting in improper assembly of elastic fibers. Copyright © 2010 Elsevier Inc. All rights reserved.

The nuclear hormone receptor E75A regulates vitellogenin gene (Al-Vg) expression in the mirid bug Apolygus lucorum.

PubMed

Tan, Y-A; Zhao, X-D; Sun, Y; Hao, D-J; Zhao, J; Jiang, Y-P; Bai, L-X; Xiao, L-B

2018-04-01

Apolygus lucorum is the predominant pest of Bacillus thuringiensis (Bt) cotton in China. 20-hydroxyecdysone (20E) plays a key role in the reproduction of this insect. To better understand the mechanism underlying 20E-regulated reproduction, the nuclear hormone receptor E75 isoform-A of Ap. lucorum (Al-E75A) was cloned and its expression analysed. A 2241-bp sequence of Al-E75A cDNA encoded an open reading frame of a polypeptide with a predicted molecular mass of 69.04 kDa. Al-E75A mRNA was detected in female adult stages of Ap. lucorum with peak expression in 7-day-old animals. Al-E75A was also expressed in several tissues, particularly in the fat body and ovary. A 3.2 kb Al-E75A mRNA was detected in all tissues by Northern blot. The fecundity and longevity were significantly decreased in female adults treated with Al-E75A small interfering RNA. The rates of egg incubation rates were considerably lower in the RNA interference-treated animals compared to the untreated controls. In order to investigate the molecular mechanism underlying the effects described above, vitellogenin (Al-Vg) was selected for further investigation. The expression pattern of Al-Vg was similar to that of Al-E75A and was up-regulated by 20E. After knockdown of Al-E75A, the expression profile of Al-Vg and the protein levels were down-regulated. These findings suggest that Al-E75A plays a crucial role in the regulation of Al-Vg expression in Ap. lucorum. © 2017 The Royal Entomological Society.

Gene therapy in animal models of autosomal dominant retinitis pigmentosa

PubMed Central

Rossmiller, Brian; Mao, Haoyu

2012-01-01

Gene therapy for dominantly inherited genetic disease is more difficult than gene-based therapy for recessive disorders, which can be treated with gene supplementation. Treatment of dominant disease may require gene supplementation partnered with suppression of the expression of the mutant gene either at the DNA level, by gene repair, or at the RNA level by RNA interference or transcriptional repression. In this review, we examine some of the gene delivery approaches used to treat animal models of autosomal dominant retinitis pigmentosa, focusing on those models associated with mutations in the gene for rhodopsin. We conclude that combinatorial approaches have the greatest promise for success. PMID:23077406

Inhibitory gene expression of the Cav3.1 T-type calcium channel to improve neuronal injury induced by lidocaine hydrochloride.

PubMed

Wen, Xianjie; Xu, Shiyuan; Zhang, Qingguo; Li, Xiaohong; Liang, Hua; Yang, Chenxiang; Wang, Hanbing; Liu, Hongzhen

2016-03-15

Cav3.1 is a low-voltage-activated (LVA) calcium channel that plays a key role in regulating intracellular calcium ion levels. In this study, we observed the effects of lidocaine hydrochloride on the pshRNA-CACNA1G-SH-SY5Y cells that silenced Cav3.1 mRNA by RNA interference, and investigated the roles of p38 MAPK in these effects. We constructed the pNC-puro-CACNA1G-SH-SY5Y cells and pshRNA-CACNA1G -SH-SY5Y cells by the RNA interference. All the cells were cultured with or without 10mM lidocaine hydrochloride for 24 h. The cell morphology, cell viability, Cav3.1 and p38 protein expression, cell apoptosis rate and intracellular calcium ion concentration were detected. We found that all cells treated with 10mM lidocaine hydrochloride for 24 h showed cellular rounding, axonal regression, and cellular floating. Compared with the cells in SH-SY5Y+Lido group and NC+Lido group, those in the RNAi+Lido group showed similar changes, but of smaller magnitude. Additionally, following lidocaine hydrochloride all cells displayed increased Cav3.1 and p38 MAPK protein, apoptosis rate, and intracellular calcium ion levels; however,these changes in the RNAi+Lido group were less pronounced than in the SH-SY5Y+Lido and NC+Lido groups. The cell viability decreased following lidocaine hydrochloride treatment, but viability of the cells in the RNAi+Lido group was higher than in the SH-SY5Y+Lido and NC+Lido groups. The results showed that Cav3.1 may be involved in neuronal injury induced by lidocaine hydrochloride and that p38 MAPK phosphorylation was reduced upon Cav3.1 gene silencing. Copyright © 2016 Elsevier B.V. All rights reserved.

Targeting Promoter-Associated Noncoding RNA In Vivo.

PubMed

Civenni, Gianluca

2017-01-01

There are many classes of noncoding RNAs (ncRNAs), with wide-ranging functionalities (e.g., RNA editing, mediation of mRNA splicing, ribosomal function). MicroRNAs (miRNAs) and long ncRNAs (lncRNAs) are implicated in a wide variety of cellular processes, including the regulation of gene expression. Incorrect expression or mutation of lncRNAs has been reported to be associated with several disease conditions, such a malignant transformation in humans. Importantly, pivotal players in tumorigenesis and cancer progression, such as c-Myc, may be regulated by lncRNA at promoter level. The function of lncRNA can be reduced with antisense oligonucleotides that sequester or degrade mature lncRNAs. In alternative, lncRNA transcription can be blocked by small interference RNA (RNAi), which had acquired, recently, broad interested in clinical applications. In vivo-jetPEI™ is a linear polyethylenimine mediating nucleic acid (DNA, shRNA, siRNA, oligonucelotides) delivery with high efficiency. Different in vivo delivery routes have been validated: intravenous (IV), intraperitoneal (IP), intratumoral, subcutaneous, topical, and intrathecal. High levels of nucleic acid delivery are achieved into a broad range of tissues, such as lung, salivary glands, heart, spleen, liver, and prostate upon systemic administration. In addition, in vivo-jetPEI™ is also an efficient carrier for local gene and siRNA delivery such as intratumoral or topical application on the skin. After systemic injection, siRNA can be detected and the levels can be validated in target tissues by qRT-PCR. Targeting promoter-associated lncRNAs with siRNAs (small interfering RNAs) in vivo is becoming an exciting breakthrough for the treatment of human disease.

A-to-I RNA editing promotes developmental stage–specific gene and lncRNA expression

PubMed Central

Goldstein, Boaz; Agranat-Tamir, Lily; Light, Dean; Ben-Naim Zgayer, Orna; Fishman, Alla; Lamm, Ayelet T.

2017-01-01

A-to-I RNA editing is a conserved widespread phenomenon in which adenosine (A) is converted to inosine (I) by adenosine deaminases (ADARs) in double-stranded RNA regions, mainly noncoding. Mutations in ADAR enzymes in Caenorhabditis elegans cause defects in normal development but are not lethal as in human and mouse. Previous studies in C. elegans indicated competition between RNA interference (RNAi) and RNA editing mechanisms, based on the observation that worms that lack both mechanisms do not exhibit defects, in contrast to the developmental defects observed when only RNA editing is absent. To study the effects of RNA editing on gene expression and function, we established a novel screen that enabled us to identify thousands of RNA editing sites in nonrepetitive regions in the genome. These include dozens of genes that are edited at their 3′ UTR region. We found that these genes are mainly germline and neuronal genes, and that they are down-regulated in the absence of ADAR enzymes. Moreover, we discovered that almost half of these genes are edited in a developmental-specific manner, indicating that RNA editing is a highly regulated process. We found that many pseudogenes and other lncRNAs are also extensively down-regulated in the absence of ADARs in the embryo but not in the fourth larval (L4) stage. This down-regulation is not observed upon additional knockout of RNAi. Furthermore, levels of siRNAs aligned to pseudogenes in ADAR mutants are enhanced. Taken together, our results suggest a role for RNA editing in normal growth and development by regulating silencing via RNAi. PMID:28031250

Alfalfa dwarf cytorhabdovirus P protein is a local and systemic RNA silencing supressor which inhibits programmed RISC activity and prevents transitive amplification of RNA silencing.

PubMed

Bejerman, Nicolás; Mann, Krin S; Dietzgen, Ralf G

2016-09-15

Plants employ RNA silencing as an innate defense mechanism against viruses. As a counter-defense, plant viruses have evolved to express RNA silencing suppressor proteins (RSS), which target one or more steps of the silencing pathway. In this study, we show that the phosphoprotein (P) encoded by the negative-sense RNA virus alfalfa dwarf virus (ADV), a species of the genus Cytorhabdovirus, family Rhabdoviridae, is a suppressor of RNA silencing. ADV P has a relatively weak local RSS activity, and does not prevent siRNA accumulation. On the other hand, ADV P strongly suppresses systemic RNA silencing, but does not interfere with the short-distance spread of silencing, which is consistent with its lack of inhibition of siRNA accumulation. The mechanism of suppression appears to involve ADV P binding to RNA-induced silencing complex proteins AGO1 and AGO4 as shown in protein-protein interaction assays when ectopically expressed. In planta, we demonstrate that ADV P likely functions by inhibiting miRNA-guided AGO1 cleavage and prevents transitive amplification by repressing the production of secondary siRNAs. As recently described for lettuce necrotic yellows cytorhabdovirus P, but in contrast to other viral RSS known to disrupt AGO activity, ADV P sequence does not contain any recognizable GW/WG or F-box motifs, which suggests that cytorhabdovirus P proteins may use alternative motifs to bind to AGO proteins. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

RNA interference tools for the western flower thrips, Frankliniella occidentalis.

PubMed

Badillo-Vargas, Ismael E; Rotenberg, Dorith; Schneweis, Brandi A; Whitfield, Anna E

2015-05-01

The insect order Thysanoptera is exclusively comprised of small insects commonly known as thrips. The western flower thrips, Frankliniella occidentalis, is an economically important pest amongst thysanopterans due to extensive feeding damage and tospovirus transmission to hundreds of plant species worldwide. Geographically-distinct populations of F. occidentalis have developed resistance against many types of traditional chemical insecticides, and as such, management of thrips and tospoviruses are a persistent challenge in agriculture. Molecular methods for defining the role(s) of specific genes in thrips-tospovirus interactions and for assessing their potential as gene targets in thrips management strategies is currently lacking. The goal of this work was to develop an RNA interference (RNAi) tool that enables functional genomic assays and to evaluate RNAi for its potential as a biologically-based approach for controlling F. occidentalis. Using a microinjection system, we delivered double-stranded RNA (dsRNA) directly to the hemocoel of female thrips to target the vacuolar ATP synthase subunit B (V-ATPase-B) gene of F. occidentalis. Gene expression analysis using real-time quantitative reverse transcriptase-PCR (qRT-PCR) revealed significant reductions of V-ATPase-B transcripts at 2 and 3 days post-injection (dpi) with dsRNA of V-ATPase-B compared to injection with dsRNA of GFP. Furthermore, the effect of knockdown of the V-ATPase-B gene in females at these two time points was mirrored by the decreased abundance of V-ATPase-B protein as determined by quantitative analysis of Western blots. Reduction in V-ATPase-B expression in thrips resulted in increased female mortality and reduced fertility, i.e., number of viable offspring produced. Survivorship decreased significantly by six dpi compared to the dsRNA-GFP control group, which continued decreasing significantly until the end of the bioassay. Surviving female thrips injected with dsRNA-V-ATPase-B produced significantly fewer offspring compared to those in the dsRNA-GFP control group. Our findings indicate that an RNAi-based strategy to study gene function in thrips is feasible, can result in quantifiable phenotypes, and provides a much-needed tool for investigating the molecular mechanisms of thrips-tospovirus interactions. To our knowledge, this represents the first report of RNAi for any member of the insect order Thysanoptera and demonstrates the potential for translational research in the area of thrips pest control. Copyright © 2015 Elsevier Ltd. All rights reserved.

Inhibition of hepatitis B virus replication with linear DNA sequences expressing antiviral micro-RNA shuttles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie

2009-11-20

RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR)more » shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.« less

Transcriptome analysis and identification of P450 genes relevant to imidacloprid detoxification in Bradysia odoriphaga.

PubMed

Chen, Chengyu; Wang, Cuicui; Liu, Ying; Shi, Xueyan; Gao, Xiwu

2018-02-07

Pesticide tolerance poses many challenges for pest control, particularly for destructive pests such as Bradysia odoriphaga. Imidacloprid has been used to control B. odoriphaga since 2013, however, imidacloprid resistance in B. odoriphaga has developed in recent years. Identifying actual and potential genes involved in detoxification metabolism of imidacloprid could offer solutions for controlling this insect. In this study, RNA-seq was used to explore differentially expressed genes in B. odoriphaga that respond to imidacloprid treatment. Differential expression data between imidacloprid treatment and the control revealed 281 transcripts (176 with annotations) showing upregulation and 394 transcripts (235 with annotations) showing downregulation. Among them, differential expression levels of seven P450 unigenes were associated with imidacloprid detoxification mechanism, with 4 unigenes that were upregulated and 3 unigenes that were downregulated. The qRT-PCR results of the seven differential expression P450 unigenes after imidacloprid treatment were consistent with RNA-Seq data. Furthermore, oral delivery mediated RNA interference of these four upregulated P450 unigenes followed by an insecticide bioassay significantly increased the mortality of imidacloprid-treated B. odoriphaga. This result indicated that the four upregulated P450s are involved in detoxification of imidacloprid. This study provides a genetic basis for further exploring P450 genes for imidacloprid detoxification in B. odoriphaga.

Human health and ecological risk assessments for SmartStax PRO (MON 89034 x TC1507 x MON 87411 x DAS-59122-7), a plant-incorporated protectant intended to control corn rootworm through ribonucleic acid (RNA) interference

EPA Science Inventory

The use of RNA interference (RNAi) gene silencing technology, particularly RNAi for pesticidal purposes to control macroorganism pests, is a relatively recent innovation. Post-transcriptional silencing of gene function is a very rapid process where double-stranded RNA (dsRNA) dir...

Role of RNA interference (RNAi) in the Moss Physcomitrella patens.

PubMed

Arif, Muhammad Asif; Frank, Wolfgang; Khraiwesh, Basel

2013-01-14

RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species.

Inherited polymorphisms in the RNA-mediated interference machinery affect microRNA expression and lung cancer survival.

PubMed

Rotunno, M; Zhao, Y; Bergen, A W; Koshiol, J; Burdette, L; Rubagotti, M; Linnoila, R I; Marincola, F M; Bertazzi, P A; Pesatori, A C; Caporaso, N E; McShane, L M; Wang, E; Landi, M T

2010-12-07

MicroRNAs (miRs) have an important role in lung carcinogenesis and progression. Single-nucleotide polymorphisms (SNPs) in genes involved in miR biogenesis may affect miR expression in lung tissue and be associated with lung carcinogenesis and progression. we analysed 12 SNPs in POLR2A, RNASEN and DICER1 genes in 1984 cases and 2073 controls from the Environment And Genetics in Lung cancer Etiology (EAGLE) study. We investigated miR expression profiles in 165 lung adenocarcinoma (AD) and 125 squamous cell carcinoma tissue samples from the same population. We used logistic and Cox regression models to examine the association of individual genotypes and haplotypes with lung cancer risk and with lung cancer-specific survival, respectively. SNPs-miR expression associations in cases were assessed using two-sample t-tests and global permutation tests. a haplotype in RNASEN (Drosha) was significantly associated with shorter lung cancer survival (hazard ratio=1.86, 95% CI=1.19-2.92, P=0.007). In AD cases, a SNP within the same haplotype was associated with reduced RNASEN mRNA expression (P=0.013) and with miR expression changes (global P=0.007) of miRs known to be associated with cancer (e.g., let-7 family, miR-21, miR-25, miR-126 and miR15a). inherited variation in the miR-processing machinery can affect miR expression levels and lung cancer-specific survival. 2010 Cancer Resaerch UK.

Biomolecular engineering of intracellular switches in eukaryotes

PubMed Central

Pastuszka, M.K.; Mackay, J.A.

2010-01-01

Tools to selectively and reversibly control gene expression are useful to study and model cellular functions. When optimized, these cellular switches can turn a protein's function “on” and “off” based on cues designated by the researcher. These cues include small molecules, drugs, hormones, and even temperature variations. Here we review three distinct areas in gene expression that are commonly targeted when designing cellular switches. Transcriptional switches target gene expression at the level of mRNA polymerization, with examples including the tetracycline gene induction system as well as nuclear receptors. Translational switches target the process of turning the mRNA signal into protein, with examples including riboswitches and RNA interference. Post-translational switches control how proteins interact with one another to attenuate or relay signals. Examples of post-translational modification include dimerization and intein splicing. In general, the delay times between switch and effect decreases from transcription to translation to post-translation; furthermore, the fastest switches may offer the most elegant opportunities to influence and study cell behavior. We discuss the pros and cons of these strategies, which directly influence their usefulness to study and implement drug targeting at the tissue and cellular level. PMID:21209849

Evaluation of RNAi and CRISPR technologies by large-scale gene expression profiling in the Connectivity Map.

PubMed

Smith, Ian; Greenside, Peyton G; Natoli, Ted; Lahr, David L; Wadden, David; Tirosh, Itay; Narayan, Rajiv; Root, David E; Golub, Todd R; Subramanian, Aravind; Doench, John G

2017-11-01

The application of RNA interference (RNAi) to mammalian cells has provided the means to perform phenotypic screens to determine the functions of genes. Although RNAi has revolutionized loss-of-function genetic experiments, it has been difficult to systematically assess the prevalence and consequences of off-target effects. The Connectivity Map (CMAP) represents an unprecedented resource to study the gene expression consequences of expressing short hairpin RNAs (shRNAs). Analysis of signatures for over 13,000 shRNAs applied in 9 cell lines revealed that microRNA (miRNA)-like off-target effects of RNAi are far stronger and more pervasive than generally appreciated. We show that mitigating off-target effects is feasible in these datasets via computational methodologies to produce a consensus gene signature (CGS). In addition, we compared RNAi technology to clustered regularly interspaced short palindromic repeat (CRISPR)-based knockout by analysis of 373 single guide RNAs (sgRNAs) in 6 cells lines and show that the on-target efficacies are comparable, but CRISPR technology is far less susceptible to systematic off-target effects. These results will help guide the proper use and analysis of loss-of-function reagents for the determination of gene function.

Down-regulation of Gab1 inhibits cell proliferation and migration in hilar cholangiocarcinoma.

PubMed

Sang, Haiquan; Li, Tingting; Li, Hangyu; Liu, Jingang

2013-01-01

Hilar cholangiocarcinoma is a highly aggressive malignancy originating from the hilar biliary duct epithelium. Due to few effective comprehensive treatments, the prognosis of hilar cholangiocarcinoma is poor. In this study, immunohistochemistry was first used to detect and analyze the expression of Gab1, VEGFR-2, and MMP-9 in hilar cholangiocarcinoma solid tumors and the relationships to the clinical pathological features. Furthermore, Gab1 and VEGFR-2 siRNA were used to interfere the hilar cholangiocarcinoma cell line ICBD-1 and then detect the PI3K/Akt signaling pathway, MMP-9 levels and malignant biological behaviors of tumor cells. The data showed that 1. Gab1, VEGFR-2, and MMP-9 were highly expressed and positively correlated with each other in hilar cholangiocarcinoma tissues, which were related to lymph node metastasis and differentiation. 2. After Gab1 or VEGFR-2 siRNA interference, PI3K/Akt pathway activity and MMP-9 levels were decreased in ICBD-1 cells. At the same time, cell proliferation decreased, cell cycle arrested in G1 phase, apoptosis increased and invasion decreased. These results suggest that the expression of Gab1, VEGFR-2, and MMP-9 are significantly related to the malignant biological behavior of hilar cholangiocarcinoma. Gab1 regulates growth, apoptosis and invasion through the VEGFR-2/Gab1/PI3K/Akt signaling pathway in hilar cholangiocarcinoma cells and influences the invasion of tumor cells via MMP-9.

Down-Regulation of Gab1 Inhibits Cell Proliferation and Migration in Hilar Cholangiocarcinoma

PubMed Central

Sang, Haiquan; Li, Tingting; Li, Hangyu; Liu, Jingang

2013-01-01

Hilar cholangiocarcinoma is a highly aggressive malignancy originating from the hilar biliary duct epithelium. Due to few effective comprehensive treatments, the prognosis of hilar cholangiocarcinoma is poor. In this study, immunohistochemistry was first used to detect and analyze the expression of Gab1, VEGFR-2, and MMP-9 in hilar cholangiocarcinoma solid tumors and the relationships to the clinical pathological features. Furthermore, Gab1 and VEGFR-2 siRNA were used to interfere the hilar cholangiocarcinoma cell line ICBD-1 and then detect the PI3K/Akt signaling pathway, MMP-9 levels and malignant biological behaviors of tumor cells. The data showed that 1. Gab1, VEGFR-2, and MMP-9 were highly expressed and positively correlated with each other in hilar cholangiocarcinoma tissues, which were related to lymph node metastasis and differentiation. 2. After Gab1 or VEGFR-2 siRNA interference, PI3K/Akt pathway activity and MMP-9 levels were decreased in ICBD-1 cells. At the same time, cell proliferation decreased, cell cycle arrested in G1 phase, apoptosis increased and invasion decreased. These results suggest that the expression of Gab1, VEGFR-2, and MMP-9 are significantly related to the malignant biological behavior of hilar cholangiocarcinoma. Gab1 regulates growth, apoptosis and invasion through the VEGFR-2/Gab1/PI3K/Akt signaling pathway in hilar cholangiocarcinoma cells and influences the invasion of tumor cells via MMP-9. PMID:24312291

Suppression of allene oxide synthase 3 in potato increases degree of arbuscular mycorrhizal fungal colonization.

PubMed

Morcillo, Rafael Jorge León; Navarrete, María Isabel Tamayo; Bote, Juan Antonio Ocampo; Monguio, Salomé Prat; García-Garrido, José Manuel

2016-01-15

Arbuscular mycorrhizal (AM) is a mutually beneficial interaction among higher plants and soil fungi of the phylum Glomeromycota. Numerous studies have pointed that jasmonic acid plays an important role in the development of the intraradical fungus. This compound belongs to a group of biologically active compounds known as oxylipins which are derived from the oxidative metabolism of polyunsaturated fatty acids. Studies of the regulatory role played by oxylipins in AM colonization have generally focused on jasmonates, while few studies exist on the 9-LOX pathway of oxylipins during AM formation. Here, the cDNA of Allene oxide synthase 3 (AOS3), a key enzyme in the 9-LOX pathway, was used in the RNA interference (RNAi) system to transform potato plants in order to suppress its expression. Results show increases in AOS3 gene expression and 9-LOX products in roots of wild type potato mycorrhizal plants. The suppression of AOS3 gene expression increases the percentage of root with mycorrhizal colonization at early stages of AM formation. AOS3 RNA interference lead to an induction of LOXA and 13-LOX genes, a reduction in AOS3 derived 9-LOX oxylipin compounds and an increase in jasmonic acid content, suggesting compensation between 9 and 13-LOX pathways. The results in a whole support the hypothesis of a regulatory role for the 9-LOX oxylipin pathway during mycorrhization. Copyright © 2015 Elsevier GmbH. All rights reserved.

Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.

PubMed

Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu

2014-02-04

TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.

Pre-microRNA and Mature microRNA in Human Mitochondria

PubMed Central

Barrey, Eric; Saint-Auret, Gaelle; Bonnamy, Blandine; Damas, Dominique; Boyer, Orane; Gidrol, Xavier

2011-01-01

Background Because of the central functions of the mitochondria in providing metabolic energy and initiating apoptosis on one hand and the role that microRNA (miRNA) play in gene expression, we hypothesized that some miRNA could be present in the mitochondria for post-transcriptomic regulation by RNA interference. We intend to identify miRNA localized in the mitochondria isolated from human skeletal primary muscular cells. Methodology/Principal Findings To investigate the potential origin of mitochondrial miRNA, we in-silico searched for microRNA candidates in the mtDNA. Twenty five human pre-miRNA and 33 miRNA aligments (E-value<0.1) were found in the reference mitochondrial sequence and some of the best candidates were chosen for a co-localization test. In situ hybridization of pre-mir-302a, pre-let-7b and mir-365, using specific labelled locked nucleic acids and confocal microscopy, demonstrated that these miRNA were localized in mitochondria of human myoblasts. Total RNA was extracted from enriched mitochondria isolated by an immunomagnetic method from a culture of human myotubes. The detection of 742 human miRNA (miRBase) were monitored by RT-qPCR at three increasing mtRNA inputs. Forty six miRNA were significantly expressed (2nd derivative method Cp>35) for the smallest RNA input concentration and 204 miRNA for the maximum RNA input concentration. In silico analysis predicted 80 putative miRNA target sites in the mitochondrial genome (E-value<0.05). Conclusions/Significance The present study experimentally demonstrated for the first time the presence of pre-miRNA and miRNA in the human mitochondria isolated from skeletal muscular cells. A set of miRNA were significantly detected in mitochondria fraction. The origin of these pre-miRNA and miRNA should be further investigate to determine if they are imported from the cytosol and/or if they are partially processed in the mitochondria. PMID:21637849