Drevytska, T; Gonchar, E; Okhai, I; Lynnyk, O; Mankovska, I; Klionsky, D; Dosenko, V
2018-06-01
The aim of this study was to investigate the molecular mechanisms underlying the protective effects of hypoxia-inducible factor (HIF) signaling pathway activation in cardiomyocytes under anoxia-reoxygenation (A/R) injury. In this study, rat neonatal cardiomyocytes were pretreated with anti-Hif3A/Hif-3α siRNA or HIF-prolyl hydroxylase inhibitor prior to A/R injury. Our results showed that both HIF3A silencing and HIF-prolyl hydroxylase inhibition effectively increased the cell viability during A/R, led to changes in mRNA expression of HIF1-target genes, and reduced the loss of mitochondrial membrane potential (Δψ m ). Furthermore, application of anti-Hif3a siRNA led to an increase in mRNA expression of Epo, Igf1, Slc2a1/Glut-1, and Slc2a4/Glut-4. Similar results were observed with HIF-prolyl hydroxylase inhibition, which additionally upregulated the mRNA expression of Epor, Tert, and Pdk1. Hif3a RNA-interference and application of HIF-prolyl hydroxylase inhibitor during A/R modelling led to an increase of Δψ m on 11.5 and 11.9 mV respectively, compared to the control groups. Thus, Hif3a RNA interference and HIF-prolyl hydroxylase inhibition protect cardiomyocytes against A/R injury via the HIF signaling pathway. Copyright © 2018 Elsevier Inc. All rights reserved.
RNA interference inhibits yellow fever virus replication in vitro and in vivo.
Pacca, Carolina C; Severino, Adriana A; Mondini, Adriano; Rahal, Paula; D'avila, Solange G P; Cordeiro, José Antonio; Nogueira, Mara Correa Lelles; Bronzoni, Roberta V M; Nogueira, Maurício L
2009-04-01
RNA interference (RNAi) is a process that is induced by double stranded RNA and involves the degradation of specific sequences of mRNA in the cytoplasm of the eukaryotic cells. It has been used as an antiviral tool against many viruses, including flaviviruses. The genus Flavivirus contains the most important arboviruses in the world, i.e., dengue (DENV) and yellow fever (YFV). In our study, we investigated the in vitro and in vivo effect of RNAi against YFV. Using stable cell lines that expressed RNAi against YFV, the cell lines were able to inhibit as much as 97% of the viral replication. Two constructions (one against NS1 and the other against E region of YFV genome) were able to protect the adult Balb/c mice against YFV challenge. The histopathologic analysis demonstrated an important protection of the central nervous system by RNAi after 10 days of viral challenge. Our data suggests that RNAi is a potential viable therapeutic weapon against yellow fever.
Silva, Amanda Perse da; Lopes, Juliana Freitas; Paula, Vanessa Salete de
2014-01-01
The aim of this study was to evaluate the use of RNA interference to inhibit herpes simplex virus type-1 replication in vitro. For herpes simplex virus type-1 gene silencing, three different small interfering RNAs (siRNAs) targeting the herpes simplex virus type-1 UL39 gene (sequence si-UL 39-1, si-UL 39-2, and si-UL 39-3) were used, which encode the large subunit of ribonucleotide reductase, an essential enzyme for DNA synthesis. Herpes simplex virus type-1 was isolated from saliva samples and mucocutaneous lesions from infected patients. All mucocutaneous lesions' samples were positive for herpes simplex virus type-1 by real-time PCR and by virus isolation; all herpes simplex virus type-1 from saliva samples were positive by real-time PCR and 50% were positive by virus isolation. The levels of herpes simplex virus type-1 DNA remaining after siRNA treatment were assessed by real-time PCR, whose results demonstrated that the effect of siRNAs on gene expression depends on siRNA concentration. The three siRNA sequences used were able to inhibit viral replication, assessed by real-time PCR and plaque assays and among them, the sequence si-UL 39-1 was the most effective. This sequence inhibited 99% of herpes simplex virus type-1 replication. The results demonstrate that silencing herpes simplex virus type-1 UL39 expression by siRNAs effectively inhibits herpes simplex virus type-1 replication, suggesting that siRNA based antiviral strategy may be a potential therapeutic alternative. Copyright © 2014. Published by Elsevier Editora Ltda.
Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing
Salton, Maayan; Kasprzak, Wojciech K.; Voss, Ty; Shapiro, Bruce A.; Poulikakos, Poulikos I.; Misteli, Tom
2015-01-01
Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signaling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumors. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumor formation and slows growth of vemurafenib-resistant tumors. Our results identify an intronic mutation as a molecular basis for RNA splicing-mediated RAF inhibitor resistance and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma. PMID:25971842
Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing.
Salton, Maayan; Kasprzak, Wojciech K; Voss, Ty; Shapiro, Bruce A; Poulikakos, Poulikos I; Misteli, Tom
2015-05-14
Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signalling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumours. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small-molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumour formation and slows growth of vemurafenib-resistant tumours. Our results identify an intronic mutation as the molecular basis for a RNA splicing-mediated RAF inhibitor resistance mechanism and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma.
Silence of the transcripts: RNA interference in medicine.
Barik, Sailen
2005-10-01
Silencing of gene expression by ribonucleic acid (RNA), known as RNA interference (RNAi), is now recognized as a major means of gene regulation in biology. In this mechanism, small noncoding double-stranded RNA molecules knock down gene expression through a variety of mechanisms that include messenger RNA (mRNA) degradation, inhibition of mRNA translation, or chromatin remodeling. The posttranscriptional mechanism of RNAi has been embraced by researchers as a powerful tool for generating deficient phenotypes without mutating the gene. In parallel, exciting recent results have promised its application in disease therapy. This review aims to summarize the current knowledge in this area and provide a roadmap that may eventually launch RNAi from the research bench to the medicine chest.
Knockdown of Zinc Transporter ZIP5 by RNA Interference Inhibits Esophageal Cancer Growth In Vivo.
Li, Qian; Jin, Jing; Liu, Jianghui; Wang, Liqun; He, Yutong
2016-01-01
We recently found that SLC39A5 (ZIP5), a zinc transporter, is overexpressed in esophageal cancer. Downregulation of ZIP5 inhibited the proliferation, migration, and invasion of the esophageal cancer cell line KYSE170 in vitro. In this study, we found that downregulation of SLC39A5 (ZIP5) by interference resulted in a significant reduction in esophageal cancer tumor volume and weight in vivo. COX2 (cyclooxygenase 2) expression was decreased and E-cadherin expression was increased in the KYSE170K xenografts, which was caused by the downregulation of ZIP5. However, we did not find that the downregulation of ZIP5 caused a change in the relative expressions of cyclin D1, VEGF (vascular endothelial growth factor), MMP9 (matrix metalloprotein 9), and Bcl-2 (B-cell lymphoma/leukmia-2) mRNA or an alteration in the average level of zinc in the peripheral blood and xenografts in vivo. Collectively, these findings indicate that knocking down ZIP5 by small interfering RNA (siRNA) might be a novel treatment strategy for esophageal cancer with ZIP5 overexpression.
Li, Bai-Ling; Zhang, Guan-Xin; Hou, Xiao-Lei; Tan, Meng-Wei; Yuan, Yang; Liu, Xiao-Hong; Gong, De-Jun; Huang, Sheng-Dong
2009-03-01
To study the inhibition of angiogenin (ANG) expression in human lung squamous cancer cell strain-A549 through adeno-associated virus (AAV)-mediated RNA-interference, and therefore to observe its effect on the growth of cancer cells and tumor formation. Recombinant AAV expressing H1-promoter-induced small-interference- RNA (siRNA) targeting ANG (AAV-shANG) was constructed, and then transfected into A549 cells. A549 cells and cells transfected with AAV-Null were used as the control groups. The effects of the reduced expression of ANG by RNAi from AAV-shANG on the growth, formation, reproduction, apoptosis, and microvessel-density of the carcinoma were observed. In vitro experiment showed that AAV-shANG was constructed successfully, There was an significant decrease in the expression of ANG protein 72 h after transfection, compared with the normal A459 cells and AAV-Null cells (P < 0.01). Cell cycle analysis showed that the proliferation index (PI) of normal A549 cells, AAV-Null cells and AAVshANG cells were 0.32 +/- 0.29, 0.35 +/- 0.38 and 0.31 +/- 0.43, respectively. There was no statistic difference in the PIs among the 3 groups (P > 0.05). In vivo experiment using thymus-defect mice showed that, there was an remarkable reduction in the mass and volume of tumors in AAV-shANG transfected group, compared to the control groups. Microvessel-density was 9.4 +/- 1.5, 9.8 +/- 2.1 and 5.7 +/- 1.9, respectively in the 3 groups, a statistic difference among the AAV-shANG-transfected group, the normal A549 group and the AAV-Null transfected group. The percentages of apoptotic cells in each group were (7.7 +/- 3.1)%, (8.5 +/- 5.4)%, (17.1 +/- 8.6)%, respectively, the experimental group being higher than those of the control groups. Positive rates of PCNA were (84.8 +/- 9.7)%, (85.8 +/- 9.8)%, and (70.4 +/- 10.1)%, respectively, the AAV-shANG transfected cancer cells showing a lower PCNA index than the control groups. AAV-mediated expression of siRNA could reduce the expression
Ethical Perspectives on RNA Interference Therapeutics
Ebbesen, Mette; Jensen, Thomas G.; Andersen, Svend; Pedersen, Finn Skou
2008-01-01
RNA interference is a mechanism for controlling normal gene expression which has recently begun to be employed as a potential therapeutic agent for a wide range of disorders, including cancer, infectious diseases and metabolic disorders. Clinical trials with RNA interference have begun. However, challenges such as off-target effects, toxicity and safe delivery methods have to be overcome before RNA interference can be considered as a conventional drug. So, if RNA interference is to be used therapeutically, we should perform a risk-benefit analysis. It is ethically relevant to perform a risk-benefit analysis since ethical obligations about not inflicting harm and promoting good are generally accepted. But the ethical issues in RNA interference therapeutics not only include a risk-benefit analysis, but also considerations about respecting the autonomy of the patient and considerations about justice with regard to the inclusion criteria for participation in clinical trials and health care allocation. RNA interference is considered a new and promising therapeutic approach, but the ethical issues of this method have not been greatly discussed, so this article analyses these issues using the bioethical theory of principles of the American bioethicists, Tom L. Beauchamp and James F. Childress. PMID:18612370
The rde-1 gene, RNA interference, and transposon silencing in C. elegans.
Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C
1999-10-15
Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.
A Herpesvirus Protein Selectively Inhibits Cellular mRNA Nuclear Export.
Gong, Danyang; Kim, Yong Hoon; Xiao, Yuchen; Du, Yushen; Xie, Yafang; Lee, Kevin K; Feng, Jun; Farhat, Nisar; Zhao, Dawei; Shu, Sara; Dai, Xinghong; Chanda, Sumit K; Rana, Tariq M; Krogan, Nevan J; Sun, Ren; Wu, Ting-Ting
2016-11-09
Nuclear mRNA export is highly regulated to ensure accurate cellular gene expression. Viral inhibition of cellular mRNA export can enhance viral access to the cellular translation machinery and prevent anti-viral protein production but is generally thought to be nonselective. We report that ORF10 of Kaposi's sarcoma-associated herpesvirus (KSHV), a nuclear DNA virus, inhibits mRNA export in a transcript-selective manner to control cellular gene expression. Nuclear export inhibition by ORF10 requires an interaction with an RNA export factor, Rae1. Genome-wide analysis reveals a subset of cellular mRNAs whose nuclear export is blocked by ORF10 with the 3' UTRs of ORF10-targeted transcripts conferring sensitivity to export inhibition. The ORF10-Rae1 interaction is important for the virus to express viral genes and produce infectious virions. These results suggest that a nuclear DNA virus can selectively interfere with RNA export to restrict host gene expression for optimal replication. Published by Elsevier Inc.
2011-01-01
Background Sensitivity of cancer cells to recombinant arginine deiminase (rADI) depends on expression of argininosuccinate synthetase (AS), a rate-limiting enzyme in synthesis of arginine from citrulline. To understand the efficiency of RNA interfering of AS in sensitizing the resistant cancer cells to rADI, the down regulation of AS transiently and permanently were performed in vitro, respectively. Methods We studied the use of down-regulation of this enzyme by RNA interference in three human cancer cell lines (A375, HeLa, and MCF-7) as a way to restore sensitivity to rADI in resistant cells. The expression of AS at levels of mRNA and protein was determined to understand the effect of RNA interference. Cell viability, cell cycle, and possible mechanism of the restore sensitivity of AS RNA interference in rADI treated cancer cells were evaluated. Results AS DNA was present in all cancer cell lines studied, however, the expression of this enzyme at the mRNA and protein level was different. In two rADI-resistant cell lines, one with endogenous AS expression (MCF-7 cells) and one with induced AS expression (HeLa cells), AS small interference RNA (siRNA) inhibited 37-46% of the expression of AS in MCF-7 cells. ASsiRNA did not affect cell viability in MCF-7 which may be due to the certain amount of residual AS protein. In contrast, ASsiRNA down-regulated almost all AS expression in HeLa cells and caused cell death after rADI treatment. Permanently down-regulated AS expression by short hairpin RNA (shRNA) made MCF-7 cells become sensitive to rADI via the inhibition of 4E-BP1-regulated mTOR signaling pathway. Conclusions Our results demonstrate that rADI-resistance can be altered via AS RNA interference. Although transient enzyme down-regulation (siRNA) did not affect cell viability in MCF-7 cells, permanent down-regulation (shRNA) overcame the problem of rADI-resistance due to the more efficiency in AS silencing. PMID:21453546
Lan, Xi; Wang, Yong; Cao, Shu; Zou, Dongling; Li, Fang; Li, Shaolin
2012-12-01
To study the effects of CD133 suppression by lentivirus-mediated RNA interference (RNAi) on the proliferation and chemosensitivity of CD133(+) cancer stem cells (CSCs) sorted from HepG2 cell line. CD133(+) and CD133- cells were sorted from HepG2 cell line by flow cytometry, and the expression of CD133 before and after cell sorting were detected. The stem cell property of sorted CD133(+) cells were validated by sphere-forming assay in vitro and xenograft experiments in vivo. Lentivirus-mediated short hairpin RNA (shRNA) targeting CD133 were transfected into CD133(+) cells, and CD133 mRNA and protein expressions of the transfected cells were detected by RT-PCR and Western blotting, respectively. Before and after the transfection, the proliferative ability of CD133(+) cells was evaluated by colony formation assay, and the cell growth inhibition rate and apoptosis following cisplatin exposure were detected using CCK-8 assay and flow cytometry. The sorted CD133(+) cells showed a high purity of (88.74∓3.19)%, as compared with the purity of (3.36∓1.80)% before cell sorting. CD133(+) cells showed a high tumor sphere formation ability and tumorigenesis capacity compared with CD133- cells. CD133 shRNA transfection significantly inhibited CD133 mRNA and protein expressions in CD133(+) cells (P<0.01), resulting also in a significantly lowered cell proliferative ability (P<0.01) and an increased growth inhibition rate (P<0.01) and obviously increased cell apoptosis (P<0.05) after cisplatin exposure. Lentivirus-mediated RNAi for CD133 suppression inhibits the proliferation of CD133(+) liver cancer stem cells and increases their chemosensitivity to cisplatin.
Bu, Xiancong; Zhang, Xiangyan; Xu, Jinhong; Yang, Heping; Zhou, Xiangdong; Wang, Haijing; Gong, Liang
2018-06-01
Epigenetic modifications serve important roles in non-small cell lung cancer (NSCLC) tumorigenesis; however, the role of DNA methyltransferase 1 (DNMT1) in lung cancer progression remains unclear. In the present study, the expression of DNMT1 in the human NSCLC cell lines 95D (high invasive ability) and 95C (low invasive ability) was analyzed by western blotting. The results demonstrated that the expression of DNMT1 in 95D cells was significantly higher, compared with in 95C cells and small airway epithelial cells. To further define the role of DNMT1 in tumor migration and invasion in NSCLC cells, RNA interference was used to silence DNMT1 expression. Depletion of DNMT1 significantly inhibited 95D cell invasion and migration. In addition, treatment with DNMT1 small interfering RNA resulted in compact cell morphology and significantly increased epithelial marker E-cadherin expression whilst also decreasing the expression of certain mesenchymal markers, including vimentin and fibronectin. Suppression of DNMT1 increased cytoplasmic β-catenin levels while downregulating nuclear β-catenin and Snail, an important regulator of EMT. The results from the present study suggest that the inhibition of DNMT1 reverses the epithelial-mesenchymal transition partly via the inhibition of the Wnt/β-catenin signaling pathway, and therefore inhibits cell migration and invasion. These results indicate that targeting DNMT1 may inhibit tumor metastasis and that DNMT1 is a promising target for the novel treatment of lung cancer.
Modeling RNA interference in mammalian cells
2011-01-01
Background RNA interference (RNAi) is a regulatory cellular process that controls post-transcriptional gene silencing. During RNAi double-stranded RNA (dsRNA) induces sequence-specific degradation of homologous mRNA via the generation of smaller dsRNA oligomers of length between 21-23nt (siRNAs). siRNAs are then loaded onto the RNA-Induced Silencing multiprotein Complex (RISC), which uses the siRNA antisense strand to specifically recognize mRNA species which exhibit a complementary sequence. Once the siRNA loaded-RISC binds the target mRNA, the mRNA is cleaved and degraded, and the siRNA loaded-RISC can degrade additional mRNA molecules. Despite the widespread use of siRNAs for gene silencing, and the importance of dosage for its efficiency and to avoid off target effects, none of the numerous mathematical models proposed in literature was validated to quantitatively capture the effects of RNAi on the target mRNA degradation for different concentrations of siRNAs. Here, we address this pressing open problem performing in vitro experiments of RNAi in mammalian cells and testing and comparing different mathematical models fitting experimental data to in-silico generated data. We performed in vitro experiments in human and hamster cell lines constitutively expressing respectively EGFP protein or tTA protein, measuring both mRNA levels, by quantitative Real-Time PCR, and protein levels, by FACS analysis, for a large range of concentrations of siRNA oligomers. Results We tested and validated four different mathematical models of RNA interference by quantitatively fitting models' parameters to best capture the in vitro experimental data. We show that a simple Hill kinetic model is the most efficient way to model RNA interference. Our experimental and modeling findings clearly show that the RNAi-mediated degradation of mRNA is subject to saturation effects. Conclusions Our model has a simple mathematical form, amenable to analytical investigations and a small set of
RNA therapeutics: Beyond RNA interference and antisense oligonucleotides
Kole, Ryszard; Krainer, Adrian R.; Altman, Sidney
2016-01-01
Here we discuss three RNA therapeutic technologies exploiting various oligonucleotides that bind RNA by base-pairing in a sequence-specific manner yet have different mechanisms of action and effects. RNA interference and antisense oligonucleotides downregulate gene expression by enzyme-dependent degradation of targeted mRNA. Steric blocking oligonucleotides block access of cellular machinery to pre-mRNA and mRNA without degrading the RNA. Through this mechanism, blocking oligonucleotides can redirect alternative splicing, repair defective RNA, restore protein production or also downregulate gene expression. Moreover, they can be extensively chemically modified, resulting in more drug-like properties. The ability of RNA blocking oligonucleotides to restore gene function makes them suited for treatment of genetic disorders. Positive results from clinical trials for the treatment of Duchenne muscular dystrophy show that this technology is close to realizing its clinical potential. PMID:22262036
Generation of siRNA Nanosheets for Efficient RNA Interference
NASA Astrophysics Data System (ADS)
Kim, Hyejin; Lee, Jae Sung; Lee, Jong Bum
2016-04-01
After the discovery of small interference RNA (siRNA), nanostructured siRNA delivery systems have been introduced to achieve an efficient regulation of the target gene expression. Here we report a new siRNA-generating two dimensional nanostructure in a formation of nanosized sheet. Inspired by tunable mechanical and functional properties of the previously reported RNA membrane, siRNA nanosized sheets (siRNA-NS) with multiple Dicer cleavage sites were prepared. The siRNA-NS has two dimensional structure, providing a large surface area for Dicer to cleave the siRNA-NS for the generation of functional siRNAs. Furthermore, downregulation of the cellular target gene expression was achieved by delivery of siRNA-NS without chemical modification of RNA strands or conjugation to other substances.
Suppression of RNA Interference by Adenovirus Virus-Associated RNA†
Andersson, M. Gunnar; Haasnoot, P. C. Joost; Xu, Ning; Berenjian, Saideh; Berkhout, Ben; Akusjärvi, Göran
2005-01-01
We show that human adenovirus inhibits RNA interference (RNAi) at late times of infection by suppressing the activity of two key enzyme systems involved, Dicer and RNA-induced silencing complex (RISC). To define the mechanisms by which adenovirus blocks RNAi, we used a panel of mutant adenoviruses defective in virus-associated (VA) RNA expression. The results show that the virus-associated RNAs, VA RNAI and VA RNAII, function as suppressors of RNAi by interfering with the activity of Dicer. The VA RNAs bind Dicer and function as competitive substrates squelching Dicer. Further, we show that VA RNAI and VA RNAII are processed by Dicer, both in vitro and during a lytic infection, and that the resulting short interfering RNAs (siRNAs) are incorporated into active RISC. Dicer cleaves the terminal stem of both VA RNAI and VA RNAII. However, whereas both strands of the VA RNAI-specific siRNA are incorporated into RISC, the 3′ strand of the VA RNAII-specific siRNA is selectively incorporated during a lytic infection. In summary, our work shows that adenovirus suppresses RNAi during a lytic infection and gives insight into the mechanisms of RNAi suppression by VA RNA. PMID:16014917
Su, Jianguo; Zhu, Zuoyan; Wang, Yaping; Xiong, Feng; Zou, Jun
2008-01-01
The ability to utilize the RNA interference (RNAi) machinery for silencing target-gene expression has created a lot of excitement in the research community. In the present study, we used a cytomegalovirus (CMV) promoter-driven DNA template approach to induce short hairpin RNA (shRNA) triggered RNAi to block exogenous Enhanced Green Fluorescent Protein (EGFP) and endogenous No Tail (NTL) gene expressions. We constructed three plasmids, pCMV-EGFP-CMV-shGFP-SV40, pCMV-EGFP-CMV-shNTL-SV40, and pCMV-EGFP-CMV-shScrambled-SV40, each containing a CMV promoter driving an EGFP reporter cDNA and DNA coding for one shRNA under the control of another CMV promoter. The three shRNA-generating plasmids and pCMV-EGFP control plasmid were introduced into zebrafish embryos by microinjection. Samples were collected at 48 h after injection. Results were evaluated by phenotype observation and real-time fluorescent quantitative reverse-transcription polymerase chain reaction (Q-PCR). The shGFP-generating plasmid significantly inhibited the EGFP expression viewed under fluorescent microscope and reduced by 70.05 +/- 1.26% of exogenous EGFP gene mRNA levels compared with controls by Q-PCR. The shRNA targeting endogenous NTL gene resulted in obvious NTL phenotype of 30 +/- 4% and decreased the level of their corresponding mRNAs up to 54.52 +/- 2.05% compared with nontargeting control shRNA. These data proved the feasibility of the CMV promoter-driven shRNA expression technique to be used to inhibit exogenous and endogenous gene expressions in zebrafish in vivo.
Efficient delivery of RNA interference oligonucleotides to polarized airway epithelia in vitro
Ramachandran, Shyam; Krishnamurthy, Sateesh; Jacobi, Ashley M.; Wohlford-Lenane, Christine; Behlke, Mark A.; Davidson, Beverly L.
2013-01-01
Polarized and pseudostratified primary airway epithelia present barriers that significantly reduce their transfection efficiency and the efficacy of RNA interference oligonucleotides. This creates an impediment in studies of the airway epithelium, diminishing the utility of loss-of-function as a research tool. Here we outline methods to introduce RNAi oligonucleotides into primary human and porcine airway epithelia grown at an air-liquid interface and difficult-to-transfect transformed epithelial cell lines grown on plastic. At the time of plating, we reverse transfect small-interfering RNA (siRNA), Dicer-substrate siRNA, or microRNA oligonucleotides into cells by use of lipid or peptide transfection reagents. Using this approach we achieve significant knockdown in vitro of hypoxanthine-guanine phosphoribosyltransferase, IL-8, and CFTR expression at the mRNA and protein levels in 1–3 days. We also attain significant reduction of secreted IL-8 in polarized primary pig airway epithelia 3 days posttransfection and inhibition of CFTR-mediated Cl− conductance in polarized air-liquid interface cultures of human airway epithelia 2 wk posttransfection. These results highlight an efficient means to deliver RNA interference reagents to airway epithelial cells and achieve significant knockdown of target gene expression and function. The ability to reliably conduct loss-of-function assays in polarized primary airway epithelia offers benefits to research in studies of epithelial cell homeostasis, candidate gene function, gene-based therapeutics, microRNA biology, and targeting the replication of respiratory viruses. PMID:23624792
Induction of RNA interference in dendritic cells.
Li, Mu; Qian, Hua; Ichim, Thomas E; Ge, Wei-Wen; Popov, Igor A; Rycerz, Katarzyna; Neu, John; White, David; Zhong, Robert; Min, Wei-Ping
2004-01-01
Dendritic cells (DC) reside at the center of the immunological universe, possessing the ability both to stimulate and inhibit various types of responses. Tolerogenic/regulatory DC with therapeutic properties can be generated through various means of manipulations in vitro and in vivo. Here we describe several attractive strategies for manipulation of DC using the novel technique of RNA interference (RNAi). Additionally, we overview some of our data regarding yet undescribed characteristics of RNAi in DC such as specific transfection strategies, persistence of gene silencing, and multi-gene silencing. The advantages of using RNAi for DC genetic manipulation gives rise to the promise of generating tailor-made DC that can be used effectively to treat a variety of immunologically mediated diseases.
Interference of hepatitis C virus RNA replication by short interfering RNAs
NASA Astrophysics Data System (ADS)
Kapadia, Sharookh B.; Brideau-Andersen, Amy; Chisari, Francis V.
2003-02-01
Hepatitis C virus (HCV) infection is a major cause of chronic liver disease, which can lead to the development of liver cirrhosis and hepatocellular carcinoma. Current therapy of patients with chronic HCV infection includes treatment with IFN in combination with ribavirin. Because most treated patients do not resolve the infection, alternative treatment is essential. RNA interference (RNAi) is a recently discovered antiviral mechanism present in plants and animals that induces double-stranded RNA degradation. Using a selectable subgenomic HCV replicon cell culture system, we have shown that RNAi can specifically inhibit HCV RNA replication and protein expression in Huh-7 cells that stably replicate the HCV genome, and that this antiviral effect is independent of IFN. These results suggest that RNAi may represent a new approach for the treatment of persistent HCV infection.
Targeting CCl4 -induced liver fibrosis by RNA interference-mediated inhibition of cyclin E1 in mice.
Bangen, Jörg-Martin; Hammerich, Linda; Sonntag, Roland; Baues, Maike; Haas, Ute; Lambertz, Daniela; Longerich, Thomas; Lammers, Twan; Tacke, Frank; Trautwein, Christian; Liedtke, Christian
2017-10-01
Initiation and progression of liver fibrosis requires proliferation and activation of resting hepatic stellate cells (HSCs). Cyclin E1 (CcnE1) is the regulatory subunit of the cyclin-dependent kinase 2 (Cdk2) and controls cell cycle re-entry. We have recently shown that genetic inactivation of CcnE1 prevents activation, proliferation, and survival of HSCs and protects from liver fibrogenesis. The aim of the present study was to translate these findings into preclinical applications using an RNA interference (RNAi)-based approach. CcnE1-siRNA (small interfering RNA) efficiently inhibited CcnE1 gene expression in murine and human HSC cell lines and in primary HSCs, resulting in diminished proliferation and increased cell death. In C57BL/6 wild-type (WT) mice, delivery of stabilized siRNA using a liposome-based carrier targeted approximately 95% of HSCs, 70% of hepatocytes, and 40% of CD45 + cells after single injection. Acute CCl 4 -mediated liver injury in WT mice induced endogenous CcnE1 expression and proliferation of surviving hepatocytes and nonparenchymal cells, including CD45 + leukocytes. Pretreatment with CcnE1-siRNA reverted CcnE1 induction to baseline levels of healthy mice, which was associated with reduced liver injury, diminished proliferation of hepatocytes and leukocytes, and attenuated overall inflammatory response. For induction of liver fibrosis, WT mice were challenged with CCl 4 for 4-6 weeks. Co-treatment with CcnE1-siRNA once a week was sufficient to continuously block CcnE1 expression and cell-cycle activity of hepatocytes and nonparenchymal cells, resulting in significantly ameliorated liver fibrosis and inflammation. Importantly, CcnE1-siRNA also prevented progression of liver fibrosis if applied after onset of chronic liver injury. Therapeutic targeting of CcnE1 in vivo using RNAi is feasible and has high antifibrotic activity. (Hepatology 2017;66:1242-1257). © 2017 by the American Association for the Study of Liver Diseases.
Short hairpin RNA interference therapy for ischemic heart disease.
Huang, Mei; Chan, Denise A; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C; Chen, Xiaoyuan; Giaccia, Amato J; Wu, Joseph C
2008-09-30
During hypoxia, upregulation of hypoxia inducible factor-1 alpha transcriptional factor can activate several downstream angiogenic genes. However, hypoxia inducible factor-1 alpha is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. PHD2 was cloned from mouse embryonic stem cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter followed by a separate hypoxia response element-incorporated promoter driving a firefly luciferase reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared with the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of hypoxia inducible factor-1 alpha protein and several downstream angiogenic genes by >30% (P<0.01). Afterward, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending artery in mice. Animals were randomized into shPHD2 experimental group (n=25) versus shScramble control group (n=20). Bioluminescence imaging detected plasmid-mediated transgene expression for 4 to 5 weeks. Echocardiography showed the shPHD2 group had improved fractional shortening compared with the shScramble group at Week 4 (33.7%+/-1.9% versus 28.4%+/-2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot analysis of explanted hearts also confirmed that animals treated with shPHD2 had significantly higher levels of hypoxia inducible factor-1 alpha protein. This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by
RNA interference: learning gene knock-down from cell physiology
Mocellin, Simone; Provenzano, Maurizio
2004-01-01
Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080
Pham, John W; Sontheimer, Erik J
2005-11-25
Complexes in the Drosophila RNA-induced silencing complex (RISC) assembly pathway can be resolved using native gel electrophoresis, revealing an initiator called R1, an intermediate called R2, and an effector called R3 (now referred to as holo-RISC). Here we show that R1 forms when the Dicer-2/R2D2 heterodimer binds short interfering RNA (siRNA) duplexes. The heterodimer alone can initiate RISC assembly, indicating that other factors are dispensable for initiation. During assembly, R2 requires Argonaute 2 to convert into holo-RISC. This requirement is reminiscent of the RISC-loading complex, which also requires Argonaute 2 for assembly into RISC. We have compared R2 to the RISC-loading complex and show that the two complexes are similar in their sensitivities to ATP and to chemical modifications on siRNA duplexes, indicating that they are likely to be identical. We have examined the requirements for RISC formation and show that the siRNA 5'-termini are repeatedly monitored during RISC assembly, first by the Dcr-2/R2D2 heterodimer and again after R2 formation, before siRNA unwinding. The 2'-position of the 5'-terminal nucleotide also affects RISC assembly, because an siRNA strand bearing a 2'-deoxyribose at this position can inhibit the cognate strand from entering holo-RISC; in contrast, the 2'-deoxyribose-modified strand has enhanced activity in the RNA interference pathway.
Advance of RNA interference technique in Hemipteran insects.
Li, Jie; Wang, Xiaoping; Wang, Manqun; Ma, Weihua; Hua, Hongxia
2012-07-24
RNA interference (RNAi) suppressed the expression of the target genes by post transcriptional regulation and the double-stranded RNA (dsRNA) mediated gene silencing has been a conserved mechanism in many eukaryotes, which prompted RNAi to become a valuable tool for unveiling the gene function in many model insects. Recent research attested that RNAi technique can be also effective in downregulation target genes in Hemipteran insects. In this review, we collected the researches of utilizing RNAi technique in gene functional analysis in Hemipteran insects, highlighted the methods of dsRNA/siRNA uptake by insects and discussed the knock-down efficiency of these techniques. Although the RNA interference technique has drawbacks and obscure points, our primary goal of this review is try to exploit it for further discovering gene functions and pest control tactic in the Hemipteran insects. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.
RNA Interference in Infectious Tropical Diseases
Hong, Young S.
2008-01-01
Introduction of double-stranded RNA (dsRNA) into some cells or organisms results in degradation of its homologous mRNA, a process called RNA interference (RNAi). The dsRNAs are processed into short interfering RNAs (siRNAs) that subsequently bind to the RNA-induced silencing complex (RISC), causing degradation of target mRNAs. Because of this sequence-specific ability to silence target genes, RNAi has been extensively used to study gene functions and has the potential to control disease pathogens or vectors. With this promise of RNAi to control pathogens and vectors, this paper reviews the current status of RNAi in protozoans, animal parasitic helminths and disease-transmitting vectors, such as insects. Many pathogens and vectors cause severe parasitic diseases in tropical regions and it is difficult to control once the host has been invaded. Intracellularly, RNAi can be highly effective in impeding parasitic development and proliferation within the host. To fully realize its potential as a means to control tropical diseases, appropriate delivery methods for RNAi should be developed, and possible off-target effects should be minimized for specific gene suppression. RNAi can also be utilized to reduce vector competence to interfere with disease transmission, as genes critical for pathogenesis of tropical diseases are knockdowned via RNAi. PMID:18344671
Fajardo, Teodoro; Sung, Po-Yu; Roy, Polly
2015-01-01
Bluetongue virus (BTV) causes hemorrhagic disease in economically important livestock. The BTV genome is organized into ten discrete double-stranded RNA molecules (S1-S10) which have been suggested to follow a sequential packaging pathway from smallest to largest segment during virus capsid assembly. To substantiate and extend these studies, we have investigated the RNA sorting and packaging mechanisms with a new experimental approach using inhibitory oligonucleotides. Putative packaging signals present in the 3’untranslated regions of BTV segments were targeted by a number of nuclease resistant oligoribonucleotides (ORNs) and their effects on virus replication in cell culture were assessed. ORNs complementary to the 3’ UTR of BTV RNAs significantly inhibited virus replication without affecting protein synthesis. Same ORNs were found to inhibit complex formation when added to a novel RNA-RNA interaction assay which measured the formation of supramolecular complexes between and among different RNA segments. ORNs targeting the 3’UTR of BTV segment 10, the smallest RNA segment, were shown to be the most potent and deletions or substitution mutations of the targeted sequences diminished the RNA complexes and abolished the recovery of viable viruses using reverse genetics. Cell-free capsid assembly/RNA packaging assay also confirmed that the inhibitory ORNs could interfere with RNA packaging and further substitution mutations within the putative RNA packaging sequence have identified the recognition sequence concerned. Exchange of 3’UTR between segments have further demonstrated that RNA recognition was segment specific, most likely acting as part of the secondary structure of the entire genomic segment. Our data confirm that genome packaging in this segmented dsRNA virus occurs via the formation of supramolecular complexes formed by the interaction of specific sequences located in the 3’ UTRs. Additionally, the inhibition of packaging in-trans with inhibitory
Fajardo, Teodoro; Sung, Po-Yu; Roy, Polly
2015-12-01
Bluetongue virus (BTV) causes hemorrhagic disease in economically important livestock. The BTV genome is organized into ten discrete double-stranded RNA molecules (S1-S10) which have been suggested to follow a sequential packaging pathway from smallest to largest segment during virus capsid assembly. To substantiate and extend these studies, we have investigated the RNA sorting and packaging mechanisms with a new experimental approach using inhibitory oligonucleotides. Putative packaging signals present in the 3'untranslated regions of BTV segments were targeted by a number of nuclease resistant oligoribonucleotides (ORNs) and their effects on virus replication in cell culture were assessed. ORNs complementary to the 3' UTR of BTV RNAs significantly inhibited virus replication without affecting protein synthesis. Same ORNs were found to inhibit complex formation when added to a novel RNA-RNA interaction assay which measured the formation of supramolecular complexes between and among different RNA segments. ORNs targeting the 3'UTR of BTV segment 10, the smallest RNA segment, were shown to be the most potent and deletions or substitution mutations of the targeted sequences diminished the RNA complexes and abolished the recovery of viable viruses using reverse genetics. Cell-free capsid assembly/RNA packaging assay also confirmed that the inhibitory ORNs could interfere with RNA packaging and further substitution mutations within the putative RNA packaging sequence have identified the recognition sequence concerned. Exchange of 3'UTR between segments have further demonstrated that RNA recognition was segment specific, most likely acting as part of the secondary structure of the entire genomic segment. Our data confirm that genome packaging in this segmented dsRNA virus occurs via the formation of supramolecular complexes formed by the interaction of specific sequences located in the 3' UTRs. Additionally, the inhibition of packaging in-trans with inhibitory ORNs
RNA virus interference via CRISPR/Cas13a system in plants.
Aman, Rashid; Ali, Zahir; Butt, Haroon; Mahas, Ahmed; Aljedaani, Fatimah; Khan, Muhammad Zuhaib; Ding, Shouwei; Mahfouz, Magdy
2018-01-04
CRISPR/Cas systems confer immunity against invading nucleic acids and phages in bacteria and archaea. CRISPR/Cas13a (known previously as C2c2) is a class 2 type VI-A ribonuclease capable of targeting and cleaving single-stranded RNA (ssRNA) molecules of the phage genome. Here, we employ CRISPR/Cas13a to engineer interference with an RNA virus, Turnip Mosaic Virus (TuMV), in plants. CRISPR/Cas13a produces interference against green fluorescent protein (GFP)-expressing TuMV in transient assays and stable overexpression lines of Nicotiana benthamiana. CRISPR RNA (crRNAs) targeting the HC-Pro and GFP sequences exhibit better interference than those targeting other regions such as coat protein (CP) sequence. Cas13a can also process pre-crRNAs into functional crRNAs. Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses and for other RNA manipulations in plants.
Wannenes, Francesca; Ciafré, Silvia Anna; Niola, Francesco; Frajese, Gaetano; Farace, Maria Giulia
2005-12-01
RNA interference technology is emerging as a very potent tool to obtain a cellular knockdown of a desired gene. In this work we used vector-based RNA interference to inhibit vascular endothelial growth factor (VEGF) expression in prostate cancer in vitro and in vivo. We demonstrated that transduction with a plasmid carrying a small interfering RNA targeting all isoforms of VEGF, dramatically impairs the expression of this growth factor in the human prostate cancer cell line PC3. As a consequence, PC3 cells loose their ability to induce one of the fundamental steps of angiogenesis, namely the formation of a tube-like network in vitro. Most importantly, our "therapeutic" vector is able to impair tumor growth rate and vascularization in vivo. We show that a single injection of naked plasmid in developing neoplastic mass significantly decreases microvessel density in an androgen-refractory prostate xenograft and is able to sustain a long-term slowing down of tumor growth. In conclusion, our results confirm the basic role of VEGF in the angiogenic development of prostate carcinoma, and suggest that the use of our vector-based RNA interference approach to inhibit angiogenesis could be an effective tool in view of future gene therapy applications for prostate cancer.
RNA interference targets arbovirus replication in Culicoides cells.
Schnettler, Esther; Ratinier, Maxime; Watson, Mick; Shaw, Andrew E; McFarlane, Melanie; Varela, Mariana; Elliott, Richard M; Palmarini, Massimo; Kohl, Alain
2013-03-01
Arboviruses are transmitted to vertebrate hosts by biting arthropod vectors such as mosquitoes, ticks, and midges. These viruses replicate in both arthropods and vertebrates and are thus exposed to different antiviral responses in these organisms. RNA interference (RNAi) is a sequence-specific RNA degradation mechanism that has been shown to play a major role in the antiviral response against arboviruses in mosquitoes. Culicoides midges are important vectors of arboviruses, known to transmit pathogens of humans and livestock such as bluetongue virus (BTV) (Reoviridae), Oropouche virus (Bunyaviridae), and likely the recently discovered Schmallenberg virus (Bunyaviridae). In this study, we investigated whether Culicoides cells possess an antiviral RNAi response and whether this is effective against arboviruses, including those with double-stranded RNA (dsRNA) genomes, such as BTV. Using reporter gene-based assays, we established the presence of a functional RNAi response in Culicoides sonorensis-derived KC cells which is effective in inhibiting BTV infection. Sequencing of small RNAs from KC and Aedes aegypti-derived Aag2 cells infected with BTV or the unrelated Schmallenberg virus resulted in the production of virus-derived small interfering RNAs (viRNAs) of 21 nucleotides, similar to the viRNAs produced during arbovirus infections of mosquitoes. In addition, viRNA profiles strongly suggest that the BTV dsRNA genome is accessible to a Dicer-type nuclease. Thus, we show for the first time that midge cells target arbovirus replication by mounting an antiviral RNAi response mainly resembling that of other insect vectors of arboviruses.
Molecular imaging of RNA interference therapy targeting PHD2 for treatment of myocardial ischemia.
Huang, Mei; Wu, Joseph C
2011-01-01
Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments.
Molecular Imaging of RNA Interference Therapy Targeting PHD2 for Treatment of Myocardial Ischemia
Huang, Mei; Wu, Joseph C.
2011-01-01
Summary Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments. PMID:21194030
RNA Interference Therapies for an HIV-1 Functional Cure.
Scarborough, Robert J; Gatignol, Anne
2017-12-27
HIV-1 drug therapies can prevent disease progression but cannot eliminate HIV-1 viruses from an infected individual. While there is hope that elimination of HIV-1 can be achieved, several approaches to reach a functional cure (control of HIV-1 replication in the absence of drug therapy) are also under investigation. One of these approaches is the transplant of HIV-1 resistant cells expressing anti-HIV-1 RNAs, proteins or peptides. Small RNAs that use RNA interference pathways to target HIV-1 replication have emerged as competitive candidates for cell transplant therapy and have been included in all gene combinations that have so far entered clinical trials. Here, we review RNA interference pathways in mammalian cells and the design of therapeutic small RNAs that use these pathways to target pathogenic RNA sequences. Studies that have been performed to identify anti-HIV-1 RNA interference therapeutics are also reviewed and perspectives on their use in combination gene therapy to functionally cure HIV-1 infection are provided.
Short hairpin RNA interference therapy for ischemic heart disease
Huang, Mei; Chan, Denise; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Chen, Xiaoyuan; Giaccia, Amato; Wu, Joseph C.
2013-01-01
Background During hypoxia, upregulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. Methods and Results PHD2 was cloned from mouse embryonic stem (ES) cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared to the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of HIF-1α protein and several downstream angiogenic genes by >30% (P<0.01). Afterwards, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending (LAD) artery in mice. Animals were randomized into shPHD2 group (n=20) versus shScramble sequence as control (n=20). Bioluminescence imaging detected transgene expression for 4–5 weeks. Echocardiographic study showed the shPHD2 group had improved fractional shortening compared with the shScramble group at week 4 (33.7%±1.9% vs. 28.4%±2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot anlaysis of explanted hearts also confirm that animals treated with shPHD2 had significantly higher levels of HIF-1α protein. Conclusions This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by shRNA led to
RNA interference of pax2 inhibits growth of transplanted human endometrial cancer cells in nude mice
Zhang, Li-Ping; Shi, Xiao-Yan; Zhao, Chang-Yin; Liu, Yong-Zhen; Cheng, Ping
2011-01-01
The development of human endometrial carcinoma (HEC) is a complex pathologic process involves several oncogenes and tumor suppressor genes. The full-length paired-box gene 2 (pax2), a recently discovered Oncogene, promotes cell proliferation and growth and inhibits apoptosis of HEC cells. Here, we examined the effect of pax2 small interfering RNA (siRNA) on the growth of transplanted HEC cells in nude mice. The expression of Pax2 in 21 cases of normal endometrium and 38 cases of HEC was examined by immohistochemistry (IHC). HEC models were developed by subcutaneously transferring HEC cells into nude mice, followed by treatment with empty lentivirus vector, lentivirus vector-based pax2 siRNA, and phosphate buffered saline, respectively. Four weeks later, tumor size was measured, tumor inhibition rate was calculated, and histological analyses were conducted after staining with hematoxylin and eosin. The expression of Pax2 and Bcl-2 was detected by Western blot; proliferating cell nuclear antigen (PCNA) was detected by IHC. Significant differences were observed in the positive rate of Pax2 between normal endometrium and HEC (14.2% vs. 60.5%, P < 0.01). The expression index of Pax2 in well differentiated tumors was 1.88 ± 1.68, much lower than that in tumors of moderate (3.07 ± 1.96, P < 0.05) or poor differentiation (5.45 ± 2.76, P < 0.01). Tumor necrosis increased, nuclear basophilia stain decreased, tumor growth was inhibited, and PCNA, Pax2, and Bcl-2 expression was reduced in HEC models treated with pax2 siRNA. These results indicate that Pax2 expression is related to HEC tumor biology with the increased expression of Pax2 correlated to malignancy. pax2 siRNA down-regulates Pax2 expression and inhibits tumorigenesis of HEC in nude mice, possibly due to cell apoptosis and the inhibition of tumor proliferation induced by down-regulation of Bcl-2. PMID:21627862
Vig, Komal; Lewis, Nuruddeen; Moore, Eddie G; Pillai, Shreekumar; Dennis, Vida A; Singh, Shree R
2009-11-01
RNA interference (RNAi) is a post-transcriptional, gene silencing mechanism which uses small interfering RNA molecules (siRNA) for gene silencing. Respiratory Syncytial Virus (RSV) is an important respiratory pathogen of medical significance that causes high mortality in infants. The fusion (F) protein of RSV is a good target for therapeutic purposes as it is primarily responsible for penetration of the virus into host cells and subsequent syncytium formation during infection. In the present study, four siRNAs were designed and used individually as well as a mixture, to silence the RSV F gene. The relationship between siRNA design, target RNA structure, and their thermodynamics was also investigated. Silencing of F gene was observed using indirect immunofluorescence, western blot, reverse transcription PCR, and progeny viral titers. Our results show F gene silencing by all the four siRNAs individually and collectively. RT-PCR analysis revealed a decrease in mRNA level which corresponded to decreased F protein expression. siRNAs also inhibited RSV progeny as shown by viral titer estimation on infected HEp-2 cells. The present study demonstrates the silencing of the F gene using siRNA. Thermodynamic characteristics of the target RSV mRNA and siRNA seem to play an important role in siRNA gene silencing efficiency.
RNA interference mediated pten knock-down inhibit the formation of polycystic ovary.
Ouyang, Jie-Xiu; Luo, Tao; Sun, Hui-Yun; Huang, Jian; Tang, Dan-Feng; Wu, Lei; Zheng, Yue-Hui; Zheng, Li-Ping
2013-08-01
Pten (phosphatase and tensin homolog deleted on chromosome 10), a kind of tumor suppressor gene, plays important roles in female reproductive system. But its expression and roles in the formation of polycystic ovaries are yet to be known. In this study, we constructed a rat model of PCOS using norethindrone and HCG injections and found the expressions of pten mRNA and PTEN protein increased significantly in the polycystic ovary tissue by immunohistochemistry, RT-PCR, and western blot. Furthermore, the results showed that in vivo ovaries could be effectively transfected by lentiviral vectors through the ovarian microinjection method and indicated that pten shRNA may inhibit the formation of polycystic ovaries by pten down-regulation. Our study provides new information regarding the role of PTEN in female reproductive disorders, such as polycystic ovary syndrome.
Kenesi, Erzsébet; Lózsa, Rita
2017-01-01
Abstract In most eukaryotes, RNA silencing is an adaptive immune system regulating key biological processes including antiviral defense. To evade this response, viruses of plants, worms and insects have evolved viral suppressors of RNA silencing proteins (VSRs). Various VSRs, such as P1 from Sweet potato mild mottle virus (SPMMV), inhibit the activity of RNA-induced silencing complexes (RISCs) including an ARGONAUTE (AGO) protein loaded with a small RNA. However, the specific mechanisms explaining this class of inhibition are unknown. Here, we show that SPMMV P1 interacts with AGO1 and AGO2 from Arabidopsis thaliana, but solely interferes with AGO1 function. Moreover, a mutational analysis of a newly identified zinc finger domain in P1 revealed that this domain could represent an effector domain as it is required for P1 suppressor activity but not for AGO1 binding. Finally, a comparative analysis of the target RNA binding capacity of AGO1 in the presence of wild-type or suppressor-defective P1 forms revealed that P1 blocks target RNA binding to AGO1. Our results describe the negative regulation of RISC, the small RNA containing molecular machine. PMID:28499009
Global effects of the CSR-1 RNA interference pathway on the transcriptional landscape.
Cecere, Germano; Hoersch, Sebastian; O'Keeffe, Sean; Sachidanandam, Ravi; Grishok, Alla
2014-04-01
Argonaute proteins and their small RNA cofactors short interfering RNAs are known to inhibit gene expression at the transcriptional and post-transcriptional levels. In Caenorhabditis elegans, the Argonaute CSR-1 binds thousands of endogenous siRNAs (endo-siRNAs) that are antisense to germline transcripts. However, its role in gene expression regulation remains controversial. Here we used genome-wide profiling of nascent RNA transcripts and found that the CSR-1 RNA interference pathway promoted sense-oriented RNA polymerase II transcription. Moreover, a loss of CSR-1 function resulted in global increase in antisense transcription and ectopic transcription of silent chromatin domains, which led to reduced chromatin incorporation of centromere-specific histone H3. On the basis of these findings, we propose that the CSR-1 pathway helps maintain the directionality of active transcription, thereby propagating the distinction between transcriptionally active and silent genomic regions.
Multimodality Imaging of RNA Interference
Nayak, Tapas R.; Krasteva, Lazura K.; Cai, Weibo
2013-01-01
The discovery of small interfering RNAs (siRNAs) and their potential to knock down virtually any gene of interest has ushered in a new era of RNA interference (RNAi). Clinical use of RNAi faces severe limitations due to inefficiency delivery of siRNA or short hairpin RNA (shRNA). Many molecular imaging techniques have been adopted in RNAi-related research for evaluation of siRNA/shRNA delivery, biodistribution, pharmacokinetics, and the therapeutic effect. In this review article, we summarize the current status of in vivo imaging of RNAi. The molecular imaging techniques that have been employed include bioluminescence/fluorescence imaging, magnetic resonance imaging/spectroscopy, positron emission tomography, single-photon emission computed tomography, and various combinations of these techniques. Further development of non-invasive imaging strategies for RNAi, not only focusing on the delivery of siRNA/shRNA but also the therapeutic efficacy, is critical for future clinical translation. Rigorous validation will be needed to confirm that biodistribution of the carrier is correlated with that of siRNA/shRNA, since imaging only detects the label (e.g. radioisotopes) but not the gene or carrier themselves. It is also essential to develop multimodality imaging approaches for realizing the full potential of therapeutic RNAi, as no single imaging modality may be sufficient to simultaneously monitor both the gene delivery and silencing effect of RNAi. PMID:23745567
The promises and pitfalls of RNA-interference-based therapeutics
Castanotto, Daniela; Rossi, John J.
2009-01-01
The discovery that gene expression can be controlled by the Watson–Crick base-pairing of small RNAs with messenger RNAs containing complementary sequence — a process known as RNA interference — has markedly advanced our understanding of eukaryotic gene regulation and function. The ability of short RNA sequences to modulate gene expression has provided a powerful tool with which to study gene function and is set to revolutionize the treatment of disease. Remarkably, despite being just one decade from its discovery, the phenomenon is already being used therapeutically in human clinical trials, and biotechnology companies that focus on RNA-interference-based therapeutics are already publicly traded. PMID:19158789
Bosher, J M; Dufourcq, P; Sookhareea, S; Labouesse, M
1999-01-01
In nematodes, flies, trypanosomes, and planarians, introduction of double-stranded RNA results in sequence-specific inactivation of gene function, a process termed RNA interference (RNAi). We demonstrate that RNAi against the Caenorhabditis elegans gene lir-1, which is part of the lir-1/lin-26 operon, induced phenotypes very different from a newly isolated lir-1 null mutation. Specifically, lir-1(RNAi) induced embryonic lethality reminiscent of moderately strong lin-26 alleles, whereas the lir-1 null mutant was viable. We show that the lir-1(RNAi) phenotypes resulted from a severe loss of lin-26 gene expression. In addition, we found that RNAi directed against lir-1 or lin-26 introns induced similar phenotypes, so we conclude that lir-1(RNAi) targets the lir-1/lin-26 pre-mRNA. This provides direct evidence that RNA interference can prevent gene expression by targeting nuclear transcripts. Our results highlight that caution may be necessary when interpreting RNA interference without the benefit of mutant alleles. PMID:10545456
Rp-phosphorothioate modifications in RNase P RNA that interfere with tRNA binding.
Hardt, W D; Warnecke, J M; Erdmann, V A; Hartmann, R K
1995-01-01
We have used Rp-phosphorothioate modifications and a binding interference assay to analyse the role of phosphate oxygens in tRNA recognition by Escherichia coli ribonuclease P (RNase P) RNA. Total (100%) Rp-phosphorothioate modification at A, C or G positions of RNase P RNA strongly impaired tRNA binding and pre-tRNA processing, while effects were less pronounced at U positions. Partially modified E. coli RNase P RNAs were separated into tRNA binding and non-binding fractions by gel retardation. Rp-phosphorothioate modifications that interfered with tRNA binding were found 5' of nucleotides A67, G68, U69, C70, C71, G72, A130, A132, A248, A249, G300, A317, A330, A352, C353 and C354. Manganese rescue at positions U69, C70, A130 and A132 identified, for the first time, sites of direct metal ion coordination in RNase P RNA. Most sites of interference are at strongly conserved nucleotides and nine reside within a long-range base-pairing interaction present in all known RNase P RNAs. In contrast to RNase P RNA, 100% Rp-phosphorothioate substitutions in tRNA showed only moderate effects on binding to RNase P RNAs from E. coli, Bacillus subtilis and Chromatium vinosum, suggesting that pro-Rp phosphate oxygens of mature tRNA contribute relatively little to the formation of the tRNA-RNase P RNA complex. Images PMID:7540978
RNA interference: from biology to drugs and therapeutics.
Appasani, Krishnarao
2004-07-01
RNA interference (RNAi) is a newly discovered and popular technology platform among researchers not only in the fields of RNA biology and molecular cell biology. It has created excitement in clinical sciences such as oncology, neurology, endocrinology, infectious diseases and drug discovery. There is an urgent need to educate and connect academic and industry researchers for the purpose of knowledge transfer. Thus, GeneExpression Systems of Waltham organized its Second International Conference in Waltham City (May 2-4, 2004, MA, USA) on the theme of 'RNA interference: From Biology to Drugs & Therapeutics.' About 200 participants and 32 speakers attended this two and half-day event which was arranged in six scientific and three technology sessions and ended with a panel discussion. This report covers a few representative talks from academia, biotech and the drug industry.
Liu, G Y; Gao, Z H; Li, L; Song, T T; Sheng, X G
2016-06-25
To investigate the expression of Jagged1 in human epithelial ovarian carcinoma tissues and the effect of Jagged1 on growth of xenograft in nude mice. (1) Forty-eight cases of ovarian cancer and 30 cases of patients with benign epithelial ovarian tumor in the Henan Province Xinxiang Central Hospital during Feb. 2011 to Mar. 2014 were enrolled in this study. The mRNA expression of Jagged1, Notch1 and the downstream target genes Hes1, Hey1 were analyzed by using realtime PCR method. (2) The ovarian cancer xenograft models in nude mice were constructed by injecting SKOV3 cells in axillary subcutaneouswere. The nude mice were randomly divided into Jagged1 interference group, blank plasmid group and control group. Each group had 10 mice. They were transfected with pcDNA3.1(+)-siRNA-Jagged1, blank plasmid pDC3.1 and phosphate buffer, respectively. The tumor volumes and tumor masses were measured 14 days after transfection and the inhibition rate was calculated. The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues after transfection in each group was detected by using realtime PCR technique and the relative protein expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues was detected by utilizing western blot method. (1) The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in ovarian cancer tissues were higher than benign ovarian tumor tissues, the differences were statistically significant (P<0.01). (2) The tumor volume was (491± 68) mm(3) and tumor mass was (2.6±0.4) g in Jagged1 interference group, which were significantly lower than that in the blank plasmid group [(842±88) mm(3) and (4.4±0.8) g, respectively] and that in the control group [(851±90) mm(3) and (4.5±0.9) g, respectively; P<0.05], the tumor inhibition rate was 42.2% in Jagged1 interference group, which was significantly higher than that in the blank plasmid group and that in the control group (2.2% and 0, respectively), the differences were
Kenesi, Erzsébet; Carbonell, Alberto; Lózsa, Rita; Vértessy, Beáta; Lakatos, Lóránt
2017-07-27
In most eukaryotes, RNA silencing is an adaptive immune system regulating key biological processes including antiviral defense. To evade this response, viruses of plants, worms and insects have evolved viral suppressors of RNA silencing proteins (VSRs). Various VSRs, such as P1 from Sweet potato mild mottle virus (SPMMV), inhibit the activity of RNA-induced silencing complexes (RISCs) including an ARGONAUTE (AGO) protein loaded with a small RNA. However, the specific mechanisms explaining this class of inhibition are unknown. Here, we show that SPMMV P1 interacts with AGO1 and AGO2 from Arabidopsis thaliana, but solely interferes with AGO1 function. Moreover, a mutational analysis of a newly identified zinc finger domain in P1 revealed that this domain could represent an effector domain as it is required for P1 suppressor activity but not for AGO1 binding. Finally, a comparative analysis of the target RNA binding capacity of AGO1 in the presence of wild-type or suppressor-defective P1 forms revealed that P1 blocks target RNA binding to AGO1. Our results describe the negative regulation of RISC, the small RNA containing molecular machine. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Prokaryotic Argonautes - variations on the RNA interference theme.
van der Oost, John; Swarts, Daan C; Jore, Matthijs M
2014-04-15
The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes.
Prokaryotic Argonautes - variations on the RNA interference theme
van der Oost, John; Swarts, Daan C.; Jore, Matthijs M.
2014-01-01
The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes. PMID:28357239
Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui
2017-02-01
RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.
Symbiont-mediated RNA interference in insects
Whitten, Miranda M. A.; Facey, Paul D.; Del Sol, Ricardo; Fernández-Martínez, Lorena T.; Evans, Meirwyn C.; Mitchell, Jacob J.; Bodger, Owen G.
2016-01-01
RNA interference (RNAi) methods for insects are often limited by problems with double-stranded (ds) RNA delivery, which restricts reverse genetics studies and the development of RNAi-based biocides. We therefore delegated to insect symbiotic bacteria the task of: (i) constitutive dsRNA synthesis and (ii) trauma-free delivery. RNaseIII-deficient, dsRNA-expressing bacterial strains were created from the symbionts of two very diverse pest species: a long-lived blood-sucking bug, Rhodnius prolixus, and a short-lived globally invasive polyphagous agricultural pest, western flower thrips (Frankliniella occidentalis). When ingested, the manipulated bacteria colonized the insects, successfully competed with the wild-type microflora, and sustainably mediated systemic knockdown phenotypes that were horizontally transmissible. This represents a significant advance in the ability to deliver RNAi, potentially to a large range of non-model insects. PMID:26911963
Ingestion of bacterially expressed double-stranded RNA inhibits gene expression in planarians.
Newmark, Phillip A; Reddien, Peter W; Cebrià, Francesc; Sánchez Alvarado, Alejandro
2003-09-30
Freshwater planarian flatworms are capable of regenerating complete organisms from tiny fragments of their bodies; the basis for this regenerative prowess is an experimentally accessible stem cell population that is present in the adult planarian. The study of these organisms, classic experimental models for investigating metazoan regeneration, has been revitalized by the application of modern molecular biological approaches. The identification of thousands of unique planarian ESTs, coupled with large-scale whole-mount in situ hybridization screens, and the ability to inhibit planarian gene expression through double-stranded RNA-mediated genetic interference, provide a wealth of tools for studying the molecular mechanisms that regulate tissue regeneration and stem cell biology in these organisms. Here we show that, as in Caenorhabditis elegans, ingestion of bacterially expressed double-stranded RNA can inhibit gene expression in planarians. This inhibition persists throughout the process of regeneration, allowing phenotypes with disrupted regenerative patterning to be identified. These results pave the way for large-scale screens for genes involved in regenerative processes.
RNA interference-mediated intrinsic antiviral immunity in invertebrates.
Nayak, Arabinda; Tassetto, Michel; Kunitomi, Mark; Andino, Raul
2013-01-01
In invertebrates such as insects and nematodes, RNA interference (RNAi) provides RNA-based protection against viruses. This form of immunity restricts viral replication and dissemination from infected cells and viruses, in turn, have evolved evasion mechanisms or RNAi suppressors to counteract host defenses. Recent advances indicate that, in addition to RNAi, other related small RNA pathways contribute to antiviral functions in invertebrates. This has led to a deeper understanding of fundamental aspects of small RNA-based antiviral immunity in invertebrates and its contribution to viral spread and pathogenesis.
Amicoumacin A inhibits translation by stabilizing mRNA interaction with the ribosome
Polikanov, Yury S.; Osterman, Ilya A.; Szal, Teresa; Tashlitsky, Vadim N.; Serebryakova, Marina V.; Kusochek, Pavel; Bulkley, David; Malanicheva, Irina A.; Efimenko, Tatyana A.; Efremenkova, Olga V.; Konevega, Andrey L.; Shaw, Karen J.; Bogdanov, Alexey A.; Rodnina, Marina V.; Dontsova, Olga A.; Mankin, Alexander S.; Steitz, Thomas A.; Sergiev, Petr V.
2014-01-01
SUMMARY We demonstrate that the antibiotic amicoumacin A (AMI) whose cellular target was unknown, is a potent inhibitor of protein synthesis. Resistance mutations in helix 24 of the 16S rRNA mapped the AMI binding site to the small ribosomal subunit. The crystal structure of bacterial ribosome in complex with AMI solved at 2.4 Å resolution revealed that the antibiotic makes contacts with universally conserved nucleotides of 16S rRNA in the E site and the mRNA backbone. Simultaneous interactions of AMI with 16S rRNA and mRNA and the in vivo experimental evidence suggest that it may inhibit the progression of the ribosome along mRNA. Consistent with this proposal, binding of AMI interferes with translocation in vitro. The inhibitory action of AMI can be partly compensated by mutations in the translation elongation factor G. PMID:25306919
Zhou, Wen-Qin; Wang, Peng; Shao, Qiu-Ping; Wang, Jian
2016-08-01
Acute respiratory distress syndrome (ARDS) is a common clinical disorder characterized by pulmonary edema leading to acute lung damage and arterial hypoxemia. Pulmonary fibrosis is a progressive, fibrotic lung disorder, whose pathogenesis in ARDS remains speculative. LincRNA-p21 was a novel regulator of cell proliferation, apoptosis and DNA damage response. This study aims to investigate the effects and mechanism of lincRNA-p21 on pulmonary fibrosis in ARDS. Purified 10 mg/kg LPS was dropped into airways of C57BL/6 mice. Expression levels of lincRNA-p21 and Thy-1 were measured by real-time PCR or western blotting. Proliferation of lung fibroblasts was analyzed by BrdU incorporation assay. Lung and BAL collagen contents were estimated using colorimetric Sircol assay. LincRNA-p21 expression was time-dependently increased and Thy-1 expression was time-dependently reduced in a mouse model of ARDS and in LPS-treated lung fibroblasts. Meanwhile, lung fibroblast proliferation was also time-dependently elevated in LPS-treated lung fibroblasts. In addition, lung fibroblast proliferation could be promoted by lincRNA-p21 overexpression and LPS treatment, however, the elevated lung fibroblast proliferation was further abrogated by Thy-1 overexpression or lincRNA-p21 interference. And Thy-1 interference could elevate cell viability of lung fibroblasts and rescue the reduction of lung fibroblast proliferation induced by lincRNA-p21 interference. Moreover, lincRNA-p21 overexpression dramatically inhibited acetylation of H3 and H4 at the Thy-1 promoter and Thy-1 expression levels in HLF1 cells. Finally, lincRNA-p21 interference rescued LPS-induced increase of lung and BAL collagen contents. LincRNA-p21 could lead to pulmonary fibrosis in ARDS by inhibition of the expression of Thy-1.
[Study on the inhibition effect of siRNA on herpes simplex virus type 2 ICP4 gene].
Liu, Ji-feng; Guan, Cui-ping; Tang, Xu; Xu, Ai-e
2010-06-01
To explore the inhibition effect of RNA interference on the ICP4 expression and DNA replication of herpes simplex virus type 2 (HSV2). Four pairs of siRNA targeted to HSV2 ICP4 gene and negative control siRNA were synthetized by chemical method, named as siRNA-1, siRNA-2, siRNA-3, siRNA-4 and siRNA-N respecticely. HSV2 HG52 was used to attack Vero cell after transfection overnight. Vero cell and supernatant were collected at 1d, 2d, 3d, 4d and 5d after virus attacking. Flurogenic quantitative reverse transcription polymerase chain reaction (FQ-RT-PCR)was used to detect the expression of HSV2 ICP4 mRNA, flurogenic quantitative polymerase chain reaction(FG-PCR) was used to detect the expression of HSV2 DNA and Western-Blot was used to detect the expression of HSV2 ICP4 protein. All the four pairs of siRNA could significantly inhibit the expression of HSV2 ICP4 mRNA and protein, especially siRNA-2. The above siRNAs could significantly decrease HSV2 DNA copy number,too. siRNAs targeted to HSV2 ICP4 gene could significantly inhibit expression of HSV2 ICP4 mRNA and protein, and decrease HSV2 DNA copy number, suggesting that siRNA can inhibit HSV2 DNA replication through silencing ICP4 gene.
PEGylated poly(ethylene imine) copolymer-delivered siRNA inhibits HIV replication in vitro.
Weber, Nick D; Merkel, Olivia M; Kissel, Thomas; Muñoz-Fernández, María Ángeles
2012-01-10
RNA interference is increasingly being utilized for the specific targeting and down-regulation of disease-causing genes, including targeting viral infections such as HIV. T lymphocytes, the primary target for HIV, are very difficult to treat with gene therapy applications such as RNA interference because of issues with drug delivery. To circumvent these problems, we investigated poly(ethylene imine) (PEI) as a method of improving transfection efficiency of siRNA to T lymphocytes. Additionally, polyethylene glycol (PEG) moieties were engrafted to the PEI polymers with the goals of improving stability and reducing cytotoxicity. Initial studies on PEG-PEI/siRNA polyplex formation, size and their interaction with cell membranes demonstrated their feasibility as drug delivery agents. Assays with lymphocytes revealed low cytotoxicity profiles of the polyplexes at pharmacologically relevant concentrations with PEGylated copolymers obtaining the best results. Successful transfection of a T cell line or primary T cells with siRNA was observed via flow cytometry and confocal microscopy. Finally, the biological effect of copolymer-delivered siRNA was measured. Of particular significance, siRNA targeted to the HIV gene nef and delivered by one of the PEG-PEI copolymers in repetitive treatments every 2-3 days was observed to inhibit HIV replication to the same extent as azidothymidine over the course of 15 days. Copyright © 2011 Elsevier B.V. All rights reserved.
Argonaute Proteins and Mechanisms of RNA Interference in Eukaryotes and Prokaryotes.
Olina, A V; Kulbachinskiy, A V; Aravin, A A; Esyunina, D M
2018-05-01
Noncoding RNAs play essential roles in genetic regulation in all organisms. In eukaryotic cells, many small noncoding RNAs act in complex with Argonaute proteins and regulate gene expression by recognizing complementary RNA targets. The complexes of Argonaute proteins with small RNAs also play a key role in silencing of mobile genetic elements and, in some cases, viruses. These processes are collectively called RNA interference. RNA interference is a powerful tool for specific gene silencing in both basic research and therapeutic applications. Argonaute proteins are also found in prokaryotic organisms. Recent studies have shown that prokaryotic Argonautes can also cleave their target nucleic acids, in particular DNA. This activity of prokaryotic Argonautes might potentially be used to edit eukaryotic genomes. However, the molecular mechanisms of small nucleic acid biogenesis and the functions of Argonaute proteins, in particular in bacteria and archaea, remain largely unknown. Here we briefly review available data on the RNA interference processes and Argonaute proteins in eukaryotes and prokaryotes.
Nam, Woo Suk; Park, Kwon Moo; Park, Jeen-Woo
2012-08-01
A metabolic abnormality in lipid biosynthesis is frequently associated with obesity and hyperlipidemia. Nicotinamide adenine dinucleotide phosphate-oxidase (NADPH) is an essential reducing equivalent for numerous enzymes required in fat and cholesterol biosynthesis. Cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) has been proposed as a key enzyme for supplying cytosolic NADPH. We report here that knockdown of IDPc expression by Ribonucleic acid (RNA) interference (RNAi) inhibited adipocyte differentiation and lipogenesis in 3T3-L1 preadipocytes and mice. Attenuated IDPc expression by IDPc small interfering RNA (siRNA) resulted in a reduction of differentiation and triglyceride level and adipogenic protein expression as well as suppression of glucose uptake in cultured adipocytes. In addition, the attenuation of Nox activity and Reactive oxygen species (ROS) generation accompanied with knockdown of IDPc was associated with inhibition of adipogenesis and lipogenesis. The loss of body weight and the reduction of triglyceride level were also observed in diet-induced obese mice transduced with IDPc short-hairpin (shRNA). Taken together, the inhibiting effect of RNAi targeting IDPc on adipogenesis and lipid biosynthesis is considered to be of therapeutic value in the treatment and prevention of obesity and obesity-associated metabolic syndrome. © 2012 Elsevier B.V. All rights reserved.
Photoinduced RNA interference.
Matsushita-Ishiodori, Yuka; Ohtsuki, Takashi
2012-07-17
Because RNA interference (RNAi) can be applied to any gene, this technique has been widely used for studying gene functions. In addition, many researchers are attempting to use RNAi technology in RNAi-based therapies. However, several challenging and controversial issues have arisen during the widespread application of RNAi including target gene specificity, target cell specificity, and spatiotemporal control of gene silencing. To address these issues, several groups have utilized photochemistry to control the RNA release, both spatially and temporally. In this Account, we focus on recent studies using photocleavable protecting groups, photosensitizers, Hand gold nanoparticles for photoinduced RNAi. In 2005 the first report of photoinduced RNAi used a caged short interfering RNA (siRNA), an siRNA carrying a photocleavable protecting group. Caging groups block the bioactivities of target molecules, but allow for complete recovery of these functions via photoactivation. However, some RNAi activity can occur in these caged siRNAs, so it will be necessary to decrease this "leakage" and raise the RNAi activity restored after irradiation. This technique also uses UV light around 350 nm, which is cytotoxic, but in the near future we expect that it will be possible to use visible and near-infrared light We also examine the application of photochemical internalization (PCI) to RNAi technology, which involves a combination of photosensitizers and light. Instead of inducing RNAi using light, the strategy behind this method was to enhance RNAi using RNA carriers. Many wellknown RNA carriers deliver siRNAs into cells by endocytosis. The siRNAs are trapped in endocytic vesicles and have to be released into the cytoplasm in order to express their activity. To achieve the endosomal escape of siRNAs, PCI technology employed photosensitizers to generate light-dependent reactive oxygen species (ROS) that disrupted the endocytic vesicles. In most studies, RNAi-mediated knockdown of
Li, Yining; Xu, Shuxiong; Wang, Xiangwei; Shi, Hua; Sun, Zhaolin; Yang, Zhao
2013-02-01
To explore the exact mechanism of Pokemon in prostate cancer. Pokemon is a member of the POK family of transcriptional repressors. Its main function is suppression of the p14ARF (alternate reading frame) tumor suppressor gene. Although Pokemon expression has been found to be increased in various types of lymphoma, the exact mechanism of the gene in prostate cancer is not clear. In the present study, prostate cancer cells were transfected with the specific short hairpin ribonucleic acid (RNA) expression vector targeting Pokemon. The expression of Pokemon messenger RNA and its protein was detected by semiquantitative reverse transcriptase-polymerase chain reaction and Western blotting, respectively. The cell growth and cell apoptosis were also examined using the methyl thiazolyl tetrazolium assay and flow cytometry. The results demonstrated that specific RNA interference (RNAi) could decrease the expression levels of Pokemon gene messenger RNA and protein in prostate cancer cells. In addition, that specific RNAi significantly inhibited the cell proliferation and increased the apoptotic rate. In vivo experiments showed that specific RNAi inhibited the tumorigenicity of prostate cancer cells and significantly suppressed tumor growth. Therefore, an RNAi-targeted Pokemon gene strategy could be a potential approach to prostate cancer therapy. Copyright © 2013 Elsevier Inc. All rights reserved.
Bringing RNA Interference (RNAi) into the High School Classroom
ERIC Educational Resources Information Center
Sengupta, Sibani
2013-01-01
RNA interference (abbreviated RNAi) is a relatively new discovery in the field of mechanisms that serve to regulate gene expression (a.k.a. protein synthesis). Gene expression can be regulated at the transcriptional level (mRNA production, processing, or stability) and at the translational level (protein synthesis). RNAi acts in a gene-specific…
Respiratory viral diseases: access to RNA interference therapy
Bitko, Vira; Barik, Sailen
2008-01-01
This review summarizes recent experimental achievements in the area of the development of new RNA interference (RNAi) therapeutics for the treatment of viral respiratory diseases. Delivery of siRNA to their intended target tissue remains the biggest problem for most therapeutic applications of these compounds. Appropriate formulations and chemical modifications for improved stability will boost the probability of utilization of RNAi drugs in the clinical applications. PMID:19081824
Scavenger receptor mediates systemic RNA interference in ticks.
Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Galay, Remil Linggatong; Tanaka, Tetsuya; Fujisaki, Kozo
2011-01-01
RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks.
Scavenger Receptor Mediates Systemic RNA Interference in Ticks
Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Linggatong Galay, Remil; Tanaka, Tetsuya; Fujisaki, Kozo
2011-01-01
RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks. PMID:22145043
Domain motions of Argonaute, the catalytic engine of RNA interference
Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y
2007-01-01
Background The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. Results The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes – an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Conclusion Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference. PMID:18053142
Domain motions of Argonaute, the catalytic engine of RNA interference.
Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y
2007-11-30
The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes - an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference.
Geurts, Hilde M; van den Bergh, Sanne F W M; Ruzzano, Laura
2014-08-01
There is a substantial amount of data providing evidence for, but also against the hypothesis that individuals with autism spectrum disorders (ASD) encounter inhibitory control deficits. ASD is often associated with interference control deficits rather than prepotent response inhibition. Moreover, the developmental trajectory for these inhibitory control processes is hypothesized to differ in ASD as compared to typical development. In efforts to gain a more comprehensive perspective of inhibition in ASD, separate quantitative analysis for prepotent response inhibition studies and interference control studies were conducted. Together, these two meta-analyses included 41 studies with a combined sample size of 1,091 people with ASD (M age 14.8 years), and 1,306 typically developing (TD) controls (M age 13.8 years).The meta-analyses indicated that individuals with ASD show increased difficulties in prepotent response inhibition (effect size 0.55) and in interference control (effect size 0.31). In addition, age was a relevant moderator for prepotent response inhibition but not for interference control. Exploratory analyses revealed that when IQ was taken into account, heterogeneity considerably decreased among interference control studies but not among prepotent response inhibition. In contrast to the general belief, both prepotent response inhibition and interference control problems were observed in individuals with ASD. However, a large variation between studies was also found. Therefore, there remain factors beyond inhibition type, age, or IQ that significantly influence inhibitory control performance among individuals with ASD. © 2014 International Society for Autism Research, Wiley Periodicals, Inc.
Wei, Jie; Jones, Jeffrey; Kang, Jing; Card, Ananda; Krimm, Michael; Hancock, Paula; Pei, Yi; Ason, Brandon; Payson, Elmer; Dubinina, Natalya; Cancilla, Mark; Stroh, Mark; Burchard, Julja; Sachs, Alan B; Hochman, Jerome H; Flanagan, W Michael; Kuklin, Nelly A
2011-06-01
Deeper knowledge of pharmacokinetic and pharmacodynamic (PK/PD) concepts for RNA therapeutics is important to streamline the drug development process and for rigorous selection of best performing drug candidates. Here we characterized the PK/PD relationship for small interfering RNAs (siRNAs) targeting luciferase by examining siRNA concentration in plasma and liver, the temporal RNA-induced silencing complex binding profiles, mRNA reduction, and protein inhibition measured by noninvasive bioluminescent imaging. A dose-dependent and time-related decrease in bioluminescence was detected over 25 days after a single treatment of a lipid nanoparticle-formulated siRNA targeting luciferase messenger RNA. A direct relationship was observed between the degree of in vivo mRNA and protein reduction and the Argonaute2 (Ago2)-bound siRNA fraction but not with the total amount of siRNA found in the liver, suggesting that the Ago2-siRNA complex is the key determinant of target inhibition. These observations were confirmed for an additional siRNA that targets endogenously expressed Sjögren syndrome antigen B (Ssb) mRNA, indicating that our observations are not limited to a transgenic mouse system. Our data provide detailed information of the temporal regulation of siRNA liver delivery, Ago2 loading, mRNA reduction, and protein inhibition that are essential for the rapid and cost-effective clinical development of siRNAs therapeutics.
Maciąg-Dorszyńska, Monika; Węgrzyn, Grzegorz; Guzow-Krzemińska, Beata
2014-04-01
Usnic acid, a compound produced by various lichen species, has been demonstrated previously to inhibit growth of different bacteria and fungi; however, mechanism of its antimicrobial activity remained unknown. In this report, we demonstrate that usnic acid causes rapid and strong inhibition of RNA and DNA synthesis in Gram-positive bacteria, represented by Bacillus subtilis and Staphylococcus aureus, while it does not inhibit production of macromolecules (DNA, RNA, and proteins) in Escherichia coli, which is resistant to even high doses of this compound. However, we also observed slight inhibition of RNA synthesis in a Gram-negative bacterium, Vibrio harveyi. Inhibition of protein synthesis in B. subtilis and S. aureus was delayed, which suggest indirect action (possibly through impairment of transcription) of usnic acid on translation. Interestingly, DNA synthesis was halted rapidly in B. subtilis and S. aureus, suggesting interference of usnic acid with elongation of DNA replication. We propose that inhibition of RNA synthesis may be a general mechanism of antibacterial action of usnic acid, with additional direct mechanisms, such as impairment of DNA replication in B. subtilis and S. aureus. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
CRISPR interference: RNA-directed adaptive immunity in bacteria and archaea
Marraffini, Luciano A.; Sontheimer, Erik J.
2010-01-01
Sequence-directed genetic interference pathways control gene expression and preserve genome integrity in all kingdoms of life. The importance of such pathways is highlighted by the extensive study of RNA interference (RNAi) and related processes in eukaryotes. In many bacteria and most archaea, clustered, regularly interspaced short palindromic repeats (CRISPRs) are involved in a more recently discovered interference pathway that protects cells from bacteriophages and conjugative plasmids. CRISPR sequences provide an adaptive, heritable record of past infections and express CRISPR RNAs — small RNAs that target invasive nucleic acids. Here, we review the mechanisms of CRISPR interference and its roles in microbial physiology and evolution. We also discuss potential applications of this novel interference pathway. PMID:20125085
Cardiovascular RNA interference therapy: the broadening tool and target spectrum.
Poller, Wolfgang; Tank, Juliane; Skurk, Carsten; Gast, Martina
2013-08-16
Understanding of the roles of noncoding RNAs (ncRNAs) within complex organisms has fundamentally changed. It is increasingly possible to use ncRNAs as diagnostic and therapeutic tools in medicine. Regarding disease pathogenesis, it has become evident that confinement to the analysis of protein-coding regions of the human genome is insufficient because ncRNA variants have been associated with important human diseases. Thus, inclusion of noncoding genomic elements in pathogenetic studies and their consideration as therapeutic targets is warranted. We consider aspects of the evolutionary and discovery history of ncRNAs, as far as they are relevant for the identification and selection of ncRNAs with likely therapeutic potential. Novel therapeutic strategies are based on ncRNAs, and we discuss here RNA interference as a highly versatile tool for gene silencing. RNA interference-mediating RNAs are small, but only parts of a far larger spectrum encompassing ncRNAs up to many kilobasepairs in size. We discuss therapeutic options in cardiovascular medicine offered by ncRNAs and key issues to be solved before clinical translation. Convergence of multiple technical advances is highlighted as a prerequisite for the translational progress achieved in recent years. Regarding safety, we review properties of RNA therapeutics, which may immunologically distinguish them from their endogenous counterparts, all of which underwent sophisticated evolutionary adaptation to specific biological contexts. Although our understanding of the noncoding human genome is only fragmentary to date, it is already feasible to develop RNA interference against a rapidly broadening spectrum of therapeutic targets and to translate this to the clinical setting under certain restrictions.
Role of RNA interference (RNAi) in the Moss Physcomitrella patens.
Arif, Muhammad Asif; Frank, Wolfgang; Khraiwesh, Basel
2013-01-14
RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species.
Next-generation libraries for robust RNA interference-based genome-wide screens
Kampmann, Martin; Horlbeck, Max A.; Chen, Yuwen; Tsai, Jordan C.; Bassik, Michael C.; Gilbert, Luke A.; Villalta, Jacqueline E.; Kwon, S. Chul; Chang, Hyeshik; Kim, V. Narry; Weissman, Jonathan S.
2015-01-01
Genetic screening based on loss-of-function phenotypes is a powerful discovery tool in biology. Although the recent development of clustered regularly interspaced short palindromic repeats (CRISPR)-based screening approaches in mammalian cell culture has enormous potential, RNA interference (RNAi)-based screening remains the method of choice in several biological contexts. We previously demonstrated that ultracomplex pooled short-hairpin RNA (shRNA) libraries can largely overcome the problem of RNAi off-target effects in genome-wide screens. Here, we systematically optimize several aspects of our shRNA library, including the promoter and microRNA context for shRNA expression, selection of guide strands, and features relevant for postscreen sample preparation for deep sequencing. We present next-generation high-complexity libraries targeting human and mouse protein-coding genes, which we grouped into 12 sublibraries based on biological function. A pilot screen suggests that our next-generation RNAi library performs comparably to current CRISPR interference (CRISPRi)-based approaches and can yield complementary results with high sensitivity and high specificity. PMID:26080438
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi) has gained popularity in several fields of research, silencing targeted genes by degradation of RNA. The objective of this study was to develop RNAi for use as a molecular tool in the control of the invasive pest Lymantria dispar (Lepidoptera: Erebidae), gypsy moth, which ha...
The Relations Among Inhibition and Interference Control Functions: A Latent-Variable Analysis
ERIC Educational Resources Information Center
Friedman, Naomi P.; Miyake, Akira
2004-01-01
This study used data from 220 adults to examine the relations among 3 inhibition-related functions. Confirmatory factor analysis suggested that Prepotent Response Inhibition and Resistance to Distractor Interference were closely related, but both were unrelated to Resistance to Proactive Interference. Structural equation modeling, which combined…
Sequence-specific inhibition of Dicer measured with a force-based microarray for RNA ligands.
Limmer, Katja; Aschenbrenner, Daniela; Gaub, Hermann E
2013-04-01
Malfunction of protein translation causes many severe diseases, and suitable correction strategies may become the basis of effective therapies. One major regulatory element of protein translation is the nuclease Dicer that cuts double-stranded RNA independently of the sequence into pieces of 19-22 base pairs starting the RNA interference pathway and activating miRNAs. Inhibiting Dicer is not desirable owing to its multifunctional influence on the cell's gene regulation. Blocking specific RNA sequences by small-molecule binding, however, is a promising approach to affect the cell's condition in a controlled manner. A label-free assay for the screening of site-specific interference of small molecules with Dicer activity is thus needed. We used the Molecular Force Assay (MFA), recently developed in our lab, to measure the activity of Dicer. As a model system, we used an RNA sequence that forms an aptamer-binding site for paromomycin, a 615-dalton aminoglycoside. We show that Dicer activity is modulated as a function of concentration and incubation time: the addition of paromomycin leads to a decrease of Dicer activity according to the amount of ligand. The measured dissociation constant of paromomycin to its aptamer was found to agree well with literature values. The parallel format of the MFA allows a large-scale search and analysis for ligands for any RNA sequence.
RNA Interference: Biology, Mechanism, and Applications
Agrawal, Neema; Dasaradhi, P. V. N.; Mohmmed, Asif; Malhotra, Pawan; Bhatnagar, Raj K.; Mukherjee, Sunil K.
2003-01-01
Double-stranded RNA-mediated interference (RNAi) is a simple and rapid method of silencing gene expression in a range of organisms. The silencing of a gene is a consequence of degradation of RNA into short RNAs that activate ribonucleases to target homologous mRNA. The resulting phenotypes either are identical to those of genetic null mutants or resemble an allelic series of mutants. Specific gene silencing has been shown to be related to two ancient processes, cosuppression in plants and quelling in fungi, and has also been associated with regulatory processes such as transposon silencing, antiviral defense mechanisms, gene regulation, and chromosomal modification. Extensive genetic and biochemical analysis revealed a two-step mechanism of RNAi-induced gene silencing. The first step involves degradation of dsRNA into small interfering RNAs (siRNAs), 21 to 25 nucleotides long, by an RNase III-like activity. In the second step, the siRNAs join an RNase complex, RISC (RNA-induced silencing complex), which acts on the cognate mRNA and degrades it. Several key components such as Dicer, RNA-dependent RNA polymerase, helicases, and dsRNA endonucleases have been identified in different organisms for their roles in RNAi. Some of these components also control the development of many organisms by processing many noncoding RNAs, called micro-RNAs. The biogenesis and function of micro-RNAs resemble RNAi activities to a large extent. Recent studies indicate that in the context of RNAi, the genome also undergoes alterations in the form of DNA methylation, heterochromatin formation, and programmed DNA elimination. As a result of these changes, the silencing effect of gene functions is exercised as tightly as possible. Because of its exquisite specificity and efficiency, RNAi is being considered as an important tool not only for functional genomics, but also for gene-specific therapeutic activities that target the mRNAs of disease-related genes. PMID:14665679
Response Inhibition and Interference Control in Obsessive–Compulsive Spectrum Disorders
van Velzen, Laura S.; Vriend, Chris; de Wit, Stella J.; van den Heuvel, Odile A.
2014-01-01
Over the past 20 years, motor response inhibition and interference control have received considerable scientific effort and attention, due to their important role in behavior and the development of neuropsychiatric disorders. Results of neuroimaging studies indicate that motor response inhibition and interference control are dependent on cortical–striatal–thalamic–cortical (CSTC) circuits. Structural and functional abnormalities within the CSTC circuits have been reported for many neuropsychiatric disorders, including obsessive–compulsive disorder (OCD) and related disorders, such as attention-deficit hyperactivity disorder, Tourette’s syndrome, and trichotillomania. These disorders also share impairments in motor response inhibition and interference control, which may underlie some of their behavioral and cognitive symptoms. Results of task-related neuroimaging studies on inhibitory functions in these disorders show that impaired task performance is related to altered recruitment of the CSTC circuits. Previous research has shown that inhibitory performance is dependent upon dopamine, noradrenaline, and serotonin signaling, neurotransmitters that have been implicated in the pathophysiology of these disorders. In this narrative review, we discuss the common and disorder-specific pathophysiological mechanisms of inhibition-related dysfunction in OCD and related disorders. PMID:24966828
Ogram, Sushma A; Boone, Christopher D; McKenna, Robert; Flanegan, James B
2014-09-01
The mechanism of amiloride inhibition of Coxsackievirus B3 (CVB3) and poliovirus type 1 (PV1) RNA replication was investigated using membrane-associated RNA replication complexes. Amiloride was shown to inhibit viral RNA replication and VPgpUpU synthesis. However, the drug had no effect on polymerase elongation activity during either (-) strand or (+) strand synthesis. These findings indicated that amiloride inhibited the initiation of RNA synthesis by inhibiting VPg uridylylation. In addition, in silico binding studies showed that amiloride docks in the VPg binding site on the back of the viral RNA polymerase, 3D(pol). Since VPg binding at this site on PV1 3D(pol) was previously shown to be required for VPg uridylylation, our results suggest that amiloride inhibits VPg binding to 3D(pol). In summary, our findings are consistent with a model in which amiloride inhibits VPgpUpU synthesis and viral RNA replication by competing with VPg for binding to 3D(pol). Copyright © 2014 Elsevier Inc. All rights reserved.
Exploring Fusarium head blight disease control by RNA interference
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi) technology provides a novel tool to study gene function and plant protection strategies. Fusarium graminearum is the causal agent of Fusarium head blight (FHB), which reduces crop yield and quality by producing trichothecene mycotoxins including 3-acetyl deoxynivalenol (3-ADO...
[RNA interference: biogenesis molecular mechanisms and its applications in cervical cancer].
Peralta-Zaragoza, Oscar; Bermúdez-Morales, Víctor Hugo; Madrid-Marina, Vicente
2010-01-01
RNAi (RNA interference) is a natural process by which eukaryotic cells silence gene expression through small interference RNAs (siRNA) which are complementary to messenger RNA (mRNA). In this process, the siRNA that are 21-25 nucleotides long and are known as microRNA (miRNA), either associate with the RNA-induced silencing complex (RISC), which targets and cleaves the complementary mRNAs by the endonucleolytic pathway, or repress the translation. It is also possible to silence exogenous gene expression during viral infections by using DNA templates to transcribe siRNA with properties that are identical to those of bioactive microRNA. Persistent human papillomavirus (HPV) infection is the main etiological agent during cervical cancer development and the HPV E6 and E7 oncogenes, which induce cellular transformation and immortalization, represent strategic targets to be silenced with siRNA. In several in vitro and in vivo studies, it has been demonstrated that the introduction of siRNA directed against the E6 and E7 oncogenes in human tumoral cervical cells transformed by HPV, leads to the efficient silencing of HPV E6 and E7 oncogene expression, which induces the accumulation of the products of the p53 and pRb tumor suppressor genes and activates the mechanism of programmed cell death by apoptosis; thus, the progression of the tumoral growth process may be prevented. The goal of this review is to analyze the microRNA biogenesis process in the silencing of gene expression and to discuss the different protocols for the use of siRNA as a potential gene therapy strategy for the treatment of cervical cancer.
The structural basis for RNA specificity and Ca2+ inhibition of an RNA-dependent RNA polymerase.
Salgado, Paula S; Makeyev, Eugene V; Butcher, Sarah J; Bamford, Dennis H; Stuart, David I; Grimes, Jonathan M
2004-02-01
The RNA-dependent RNA polymerase of bacteriophage phi6 transcribes mRNA from the three segments of the dsRNA viral genome. We have cocrystallized RNA oligonucleotides with the polymerase, revealing the mode of binding of RNA templates. This binding is somewhat different from that previously seen for DNA oligomers, leading to additional RNA-protein hydrogen bonds, consistent with a preference for RNA. Activation of the RNA/polymerase complex by the addition of substrate and Mg2+ initiates a single round of reaction within the crystal to form a dead-end complex that partially collapses within the enzyme active site. By replacing Mg2+ with Ca2+, we have been able to capture the inhibited complex which shows distortion that explains the structural basis for the inhibition of such polymerases by Ca2+.
Silencing VDAC1 Expression by siRNA Inhibits Cancer Cell Proliferation and Tumor Growth In Vivo
Arif, Tasleem; Vasilkovsky, Lilia; Refaely, Yael; Konson, Alexander; Shoshan-Barmatz, Varda
2014-01-01
Alterations in cellular metabolism and bioenergetics are vital for cancer cell growth and motility. Here, the role of the mitochondrial protein voltage-dependent anion channel (VDAC1), a master gatekeeper regulating the flux of metabolites and ions between mitochondria and the cytoplasm, in regulating the growth of several cancer cell lines was investigated by silencing VDAC1 expression using small interfering RNA (siRNA). A single siRNA specific to the human VDAC1 sequence at nanomolar concentrations led to some 90% decrease in VDAC1 levels in the lung A549 and H358, prostate PC-3, colon HCT116, glioblastoma U87, liver HepG2, and pancreas Panc-1 cancer cell lines. VDAC1 silencing persisted 144 hours post-transfection and resulted in profound inhibition of cell growth in cancer but not in noncancerous cells, with up to 90% inhibition being observed over 5 days that was prolonged by a second transfection. Cells expressing low VDAC1 levels showed decreased mitochondrial membrane potential and adenoside triphosphate (ATP) levels, suggesting limited metabolite exchange between mitochondria and cytosol. Moreover, cells silenced for VDAC1 expression showed decreased migration, even in the presence of the wound healing accelerator basic fibroblast growth factor (bFGF). VDAC1-siRNA inhibited cancer cell growth in a Matrigel-based assay in host nude mice. Finally, in a xenograft lung cancer mouse model, chemically modified VDAC1-siRNA not only inhibited tumor growth but also resulted in tumor regression. This study thus shows that VDAC1 silencing by means of RNA interference (RNAi) dramatically inhibits cancer cell growth and tumor development by disabling the abnormal metabolic behavior of cancer cells, potentially paving the way for a more effective pipeline of anticancer drugs. PMID:24781191
Kai, Yoshiro; Tomoda, Koichi; Yoneyama, Hiroyuki; Yoshikawa, Masanori; Kimura, Hiroshi
2015-12-09
Chondroitin sulfate proteoglycans are an important mediators in inflammation and leukocyte trafficking. However, their roles in pulmonary emphysema have not been explored. In a murine model of elastase-induced pulmonary emphysema, we found increased carbohydrate sulfotransferase 3 (CHST3), a specific enzyme that synthesizes chondroitin 6-sulfate proteoglycan (C6SPG). To elucidate the role of C6SPG, we investigated the effect of small interfering RNA (siRNA) targeting CHST3 that inhibits C6SPG-synthesis on the pathogenesis of pulmonary emphysema. Mice were intraperitoneally injected with CHST3 siRNA or negative control siRNA on day0 and 7 after intratracheal instillation of elastase. Histology, respiratory function, glycosaminoglycans (GAGs) content, bronchoalveolar lavage (BAL), elastin staining and gene expressions of tumor necrosis factor (TNF)-α and matrix metalloproteinase (MMP)-9 mRNA were evaluated on day7 and/or day21. CHST3 mRNA increased at day 7 and decreased thereafter in lung. CHST3 siRNA successfully inhibited the expression of CHST3 mRNA throughout the study and this was associated with significant reduction of GAGs and C6SPG. Airway destruction and respiratory function were improved by the treatment with CHST3 siRNA. CHST3 siRNA reduced the number of macrophages both in BAL and lung parenchyma and also suppressed the increased expressions of TNF-α and MMP-9 mRNA. Futhermore, CHST3 siRNA improved the reduction of the elastin in the alveolar walls. CHST3 siRNA diminishes accumulation of excessive macrophages and the mediators, leading to accelerate the functional recovery from airway damage by repair of the elastin network associated with pulmonary emphysema.
Effects of RNA interference therapy against herpes simplex virus type 1 encephalitis.
da Silva, Alexandre S; Raposo, Jéssica V; Pereira, Tiago C; Pinto, Marcelo A; de Paula, Vanessa S
2016-01-01
Herpetic encephalitis (HSE) is caused mainly by herpes simplex virus type 1 (HSV-1) with an annual incidence of 1-4 cases/million inhabitants. Currently, HSE treatment faces difficulties such as the use of antivirals with elevated toxicity, metabolic side effects and HSV-1 resistance. An alternative to antivirals is the use of small interfering RNA (siRNA) as a viral replication inhibitor. In this work, siRNA targeting the UL-39 region was evaluated for HSE treatment in vivo. BALB/c mice were inoculated with HSV-1 and treated with siRNA. The treatment was evaluated through kinetics of HSV-1 replication inhibition, number of siRNA doses administered and treatment with siRNA plus acyclovir. All groups were evaluated for signs of HSE, mortality and HSV-1 replication inhibition. The treated group of the kinetic experiment demonstrated a reduction of HSE signs and an HSV-1 replication inhibition of 43.6-99.9% in the brain and 53-98% in trigeminal ganglia (TG). Animals treated with one or two doses of siRNA had a prolonged survival time, reduced clinical signs of HSE and HSV-1 replication inhibition of 67.7% in brains and 85.7% in TG of animals treated with two doses of siRNA. Also, animals treated with siRNA plus acyclovir demonstrated reduced signs of HSE and mortality, as well as HSV-1 replication inhibition in the brain (83.2%) and TG (74.5%). These findings demonstrated that siRNA was capable of reducing HSE clinical signs, prolonging survival time and inhibiting HSV-1 replication in mice. Thus, siRNA can be a potential alternative to the standard HSE treatment especially to reduce clinical signs and extend survival time in vivo.
2006-12-01
Defence Research and Recherche et developpement Development Canada pour la defense Canada DEFENCE I I! / DEFENSE Generation of Constructs for DNA... research into specific antiviral strategies. One such strategy is RNA interference. RNA interference involves the targeted silencing of a gene using...of an effective vaccine or therapeutic for VEE, a highly infectious virus, underscores the need for research in this area. In addition, the potential
RNA interference-based nanosystems for inflammatory bowel disease therapy
Guo, Jian; Jiang, Xiaojing; Gui, Shuangying
2016-01-01
Inflammatory bowel disease (IBD), which includes ulcerative colitis and Crohn’s disease, is a chronic, recrudescent disease that invades the gastrointestinal tract, and it requires surgery or lifelong medicinal therapy. The conventional medicinal therapies for IBD, such as anti-inflammatories, glucocorticoids, and immunosuppressants, are limited because of their systemic adverse effects and toxicity during long-term treatment. RNA interference (RNAi) precisely regulates susceptibility genes to decrease the expression of proinflammatory cytokines related to IBD, which effectively alleviates IBD progression and promotes intestinal mucosa recovery. RNAi molecules generally include short interfering RNA (siRNA) and microRNA (miRNA). However, naked RNA tends to degrade in vivo as a consequence of endogenous ribonucleases and pH variations. Furthermore, RNAi treatment may cause unintended off-target effects and immunostimulation. Therefore, nanovectors of siRNA and miRNA were introduced to circumvent these obstacles. Herein, we introduce non-viral nanosystems of RNAi molecules and discuss these systems in detail. Additionally, the delivery barriers and challenges associated with RNAi molecules will be discussed from the perspectives of developing efficient delivery systems and potential clinical use. PMID:27789943
Shao, Zeshu; Roelofs, Ardi; Martin, Randi C; Meyer, Antje S
2015-11-01
In 2 studies, we examined whether explicit distractors are necessary and sufficient to evoke selective inhibition in 3 naming tasks: the semantic blocking, picture-word interference, and color-word Stroop task. Delta plots were used to quantify the size of the interference effects as a function of reaction time (RT). Selective inhibition was operationalized as the decrease in the size of the interference effect as a function of naming RT. For all naming tasks, mean naming RTs were significantly longer in the interference condition than in the control condition. The slopes of the interference effects for the longest naming RTs correlated with the magnitude of the mean interference effect in both the semantic blocking task and the picture-word interference task, suggesting that selective inhibition was involved to reduce the interference from strong semantic competitors either invoked by a single explicit competitor or strong implicit competitors in picture naming. However, there was no correlation between the slopes and the mean interference effect in the Stroop task, suggesting less importance of selective inhibition in this task despite explicit distractors. Whereas the results of the semantic blocking task suggest that an explicit distractor is not necessary for triggering inhibition, the results of the Stroop task suggest that such a distractor is not sufficient for evoking inhibition either. (c) 2015 APA, all rights reserved).
Chemical modification: the key to clinical application of RNA interference?
Corey, David R.
2007-01-01
RNA interference provides a potent and specific method for controlling gene expression in human cells. To translate this potential into a broad new family of therapeutics, it is necessary to optimize the efficacy of the RNA-based drugs. As discussed in this Review, it might be possible to achieve this optimization using chemical modifications that improve their in vivo stability, cellular delivery, biodistribution, pharmacokinetics, potency, and specificity. PMID:18060019
Evaluation and control of miRNA-like off-target repression for RNA interference.
Seok, Heeyoung; Lee, Haejeong; Jang, Eun-Sook; Chi, Sung Wook
2018-03-01
RNA interference (RNAi) has been widely adopted to repress specific gene expression and is easily achieved by designing small interfering RNAs (siRNAs) with perfect sequence complementarity to the intended target mRNAs. Although siRNAs direct Argonaute (Ago), a core component of the RNA-induced silencing complex (RISC), to recognize and silence target mRNAs, they also inevitably function as microRNAs (miRNAs) and suppress hundreds of off-targets. Such miRNA-like off-target repression is potentially detrimental, resulting in unwanted toxicity and phenotypes. Despite early recognition of the severity of miRNA-like off-target repression, this effect has often been overlooked because of difficulties in recognizing and avoiding off-targets. However, recent advances in genome-wide methods and knowledge of Ago-miRNA target interactions have set the stage for properly evaluating and controlling miRNA-like off-target repression. Here, we describe the intrinsic problems of miRNA-like off-target effects caused by canonical and noncanonical interactions. We particularly focus on various genome-wide approaches and chemical modifications for the evaluation and prevention of off-target repression to facilitate the use of RNAi with secured specificity.
[RNA interference library research progress and its application in cancer research].
Zhao, Ning; Cai, Li
2013-02-01
RNA interference is a homologous mRNA special degradation phenomenon which is caused by the double-stranded RNA. RNAi library is a pooled library that is artificially constructed using RNAi technology. As RNAi library has made a major breakthrough in the field of genetic research, it has been widely used in the field of medical research, especially in the field of cancer research. This review discussed the research progress of RNAi library and its applications in cancer research.
Yoon, June-Sun; Gurusamy, Dhandapani; Palli, Subba Reddy
2017-11-01
RNA interference (RNAi) efficiency varies among insects studied. The barriers for successful RNAi include the presence of double-stranded ribonucleases (dsRNase) in the lumen and hemolymph that could potentially digest double-stranded RNA (dsRNA) and the variability in the transport of dsRNA into and within the cells. We recently showed that the dsRNAs are transported into lepidopteran cells, but they are not processed into small interference RNAs (siRNAs) because they are trapped in acidic bodies. In the current study, we focused on the identification of acidic bodies in which dsRNAs accumulate in Sf9 cells. Time-lapse imaging studies showed that dsRNAs enter Sf9 cells and accumulate in acidic bodies within 20 min after their addition to the medium. CypHer-5E-labeled dsRNA also accumulated in the midgut and fat body dissected from Spodoptera frugiperda larvae with similar patterns observed in Sf9 cells. Pharmacological inhibitor assays showed that the dsRNAs use clathrin mediated endocytosis pathway for transport into the cells. We investigated the potential dsRNA accumulation sites employing LysoTracker and double labeling experiments using the constructs to express a fusion of green fluorescence protein with early or late endosomal marker proteins and CypHer-5E-labeled dsRNA. Interestingly, CypHer-5E-labeled dsRNA accumulated predominantly in early and late endosomes. These data suggest that entrapment of internalized dsRNA in endosomes is one of the major factors contributing to inefficient RNAi response in lepidopteran insects. Copyright © 2017 Elsevier Ltd. All rights reserved.
Bejerman, Nicolás; Mann, Krin S; Dietzgen, Ralf G
2016-09-15
Plants employ RNA silencing as an innate defense mechanism against viruses. As a counter-defense, plant viruses have evolved to express RNA silencing suppressor proteins (RSS), which target one or more steps of the silencing pathway. In this study, we show that the phosphoprotein (P) encoded by the negative-sense RNA virus alfalfa dwarf virus (ADV), a species of the genus Cytorhabdovirus, family Rhabdoviridae, is a suppressor of RNA silencing. ADV P has a relatively weak local RSS activity, and does not prevent siRNA accumulation. On the other hand, ADV P strongly suppresses systemic RNA silencing, but does not interfere with the short-distance spread of silencing, which is consistent with its lack of inhibition of siRNA accumulation. The mechanism of suppression appears to involve ADV P binding to RNA-induced silencing complex proteins AGO1 and AGO4 as shown in protein-protein interaction assays when ectopically expressed. In planta, we demonstrate that ADV P likely functions by inhibiting miRNA-guided AGO1 cleavage and prevents transitive amplification by repressing the production of secondary siRNAs. As recently described for lettuce necrotic yellows cytorhabdovirus P, but in contrast to other viral RSS known to disrupt AGO activity, ADV P sequence does not contain any recognizable GW/WG or F-box motifs, which suggests that cytorhabdovirus P proteins may use alternative motifs to bind to AGO proteins. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.
RNA Interference of Gonadotropin-Inhibitory Hormone Gene Induces Arousal in Songbirds
Ubuka, Takayoshi; Mukai, Motoko; Wolfe, Jordan; Beverly, Ryan; Clegg, Sarah; Wang, Ariel; Hsia, Serena; Li, Molly; Krause, Jesse S.; Mizuno, Takanobu; Fukuda, Yujiro; Tsutsui, Kazuyoshi; Bentley, George E.; Wingfield, John C.
2012-01-01
Gonadotropin-inhibitory hormone (GnIH) was originally identified in quail as a hypothalamic neuropeptide inhibitor of pituitary gonadotropin synthesis and release. However, GnIH neuronal fibers do not only terminate in the median eminence to control anterior pituitary function but also extend widely in the brain, suggesting it has multiple roles in the regulation of behavior. To identify the role of GnIH neurons in the regulation of behavior, we investigated the effect of RNA interference (RNAi) of the GnIH gene on the behavior of white-crowned sparrows, a highly social songbird species. Administration of small interfering RNA against GnIH precursor mRNA into the third ventricle of male and female birds reduced resting time, spontaneous production of complex vocalizations, and stimulated brief agonistic vocalizations. GnIH RNAi further enhanced song production of short duration in male birds when they were challenged by playbacks of novel male songs. These behaviors resembled those of breeding birds during territorial defense. The overall results suggest that GnIH gene silencing induces arousal. In addition, the activities of male and female birds were negatively correlated with GnIH mRNA expression in the paraventricular nucleus. Density of GnIH neuronal fibers in the ventral tegmental area was decreased by GnIH RNAi treatment in female birds, and the number of gonadotropin-releasing hormone neurons that received close appositions of GnIH neuronal fiber terminals was negatively correlated with the activity of male birds. In summary, GnIH may decrease arousal level resulting in the inhibition of specific motivated behavior such as in reproductive contexts. PMID:22279571
Anis, Eman A; Dhar, Madhu; Legendre, Alfred M; Wilkes, Rebecca P
2017-06-01
Objectives The goals of the study were: (1) to develop and evaluate non-replicating lentivirus vectors coding for feline coronavirus (FCoV)-specific micro (mi)RNA as a potential antiviral therapy for feline infectious peritonitis (FIP); (2) to assess the feasibility of transducing hematopoietic stem cells (HSCs) with ex vivo introduction of the miRNA-expressing lentivirus vector; and (3) to assess the ability of the expressed miRNA to inhibit FCoV replication in HSCs in vitro. Methods HSCs were obtained from feline bone marrow and replicated in vitro. Three lentiviruses were constructed, each expressing a different anti-FCoV miRNA. HSCs were stably transduced with the miRNA-expressing lentivirus vector that produced the most effective viral inhibition in a feline cell line. The effectiveness of the transduction and the expression of anti-FCoV miRNA were tested by infecting the HSCs with two different strains of FCoV. The inhibition of coronavirus replication was determined by relative quantification of the inhibition of intracellular viral genomic RNA synthesis using real-time, reverse-transcription PCR. The assessment of virus replication inhibition was determined via titration of extracellular virus using the TCID 50 assay. Results Inhibition of FCoV was most significant in feline cells expressing miRNA-L2 that targeted the viral leader sequence, 48 h postinfection. miRNA-L2 expression in stably transduced HSCs resulted in 90% and 92% reductions in FIPV WSU 79-1146 genomic RNA synthesis and extracellular virus production, respectively, as well as 74% and 80% reduction in FECV WSU 79-1683 genomic RNA synthesis and extracellular virus production, respectively, as compared with an infected negative control sample producing non-targeting miRNA. Conclusions and relevance These preliminary results show that genetic modification of HSCs for constitutive production of anti-coronavirus miRNA will reduce FCoV replication.
RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems.
Dietrich, Isabelle; Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Brennan, Benjamin; Elliott, Richard M; Diallo, Mawlouth; Sall, Amadou A; Failloux, Anna-Bella; Schnettler, Esther; Kohl, Alain; Becker, Stefanie C
2017-01-01
The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus , Bunyaviridae ) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect Drosophila
RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems
Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Elliott, Richard M.; Diallo, Mawlouth; Sall, Amadou A.; Failloux, Anna-Bella; Schnettler, Esther
2017-01-01
ABSTRACT The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus, Bunyaviridae) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect
Sánchez-Luque, Francisco J.; Stich, Michael; Manrubia, Susanna; Briones, Carlos; Berzal-Herranz, Alfredo
2014-01-01
The human immunodeficiency virus type-1 (HIV-1) genome contains multiple, highly conserved structural RNA domains that play key roles in essential viral processes. Interference with the function of these RNA domains either by disrupting their structures or by blocking their interaction with viral or cellular factors may seriously compromise HIV-1 viability. RNA aptamers are amongst the most promising synthetic molecules able to interact with structural domains of viral genomes. However, aptamer shortening up to their minimal active domain is usually necessary for scaling up production, what requires very time-consuming, trial-and-error approaches. Here we report on the in vitro selection of 64 nt-long specific aptamers against the complete 5′-untranslated region of HIV-1 genome, which inhibit more than 75% of HIV-1 production in a human cell line. The analysis of the selected sequences and structures allowed for the identification of a highly conserved 16 nt-long stem-loop motif containing a common 8 nt-long apical loop. Based on this result, an in silico designed 16 nt-long RNA aptamer, termed RNApt16, was synthesized, with sequence 5′-CCCCGGCAAGGAGGGG-3′. The HIV-1 inhibition efficiency of such an aptamer was close to 85%, thus constituting the shortest RNA molecule so far described that efficiently interferes with HIV-1 replication. PMID:25175101
Steric restrictions of RISC in RNA interference identified with size-expanded RNA nucleobases.
Hernández, Armando R; Peterson, Larryn W; Kool, Eric T
2012-08-17
Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC), the key protein complex of RNA interference (RNAi), is of great importance to the development of siRNAs with improved biological and potentially therapeutic function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to -5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3'-end increased activity over that of wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation.
Molecular mechanisms influencing efficiency of RNA interference in insects.
Cooper, Anastasia M W; Silver, Kristopher; Jianzhen, Zhang; Park, Yoonseong; Zhu, Kun Yan
2018-06-21
RNA interference (RNAi) is an endogenous, sequence-specific gene silencing mechanism elicited by small RNA molecules. RNAi is a powerful reverse genetic tool, and is currently being utilized for managing insects and viruses. Widespread implementation of RNAi-based pest management strategies is currently hindered by inefficient and highly variable results when different insect species, strains, developmental stages, tissues, and genes are targeted. Mechanistic studies have shown that double-stranded ribonucleases (dsRNases), endosomal entrapment, deficient function of the core machinery, and inadequate immune stimulation contribute to limited RNAi efficiency. However, a comprehensive understanding of the molecular mechanisms limiting RNAi efficiency remains elusive. The recent advances in dsRNA stability in physiological tissues, dsRNA internalization into cells, the composition and function of the core RNAi machinery, as well as small-interfering RNA/double-stranded RNA amplification and spreading mechanisms are reviewed to establish a global understanding of the obstacles impeding wider understanding of RNAi mechanisms in insects. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
RNA Interference for improving the Outcome of Islet Transplantation
Li, Feng; Mahato, Ram I
2010-01-01
Islet transplantation has the potential to cure type 1 diabetes. Despite recent therapeutic success, it is still not common because a large number of transpanted islets get damaged by multiple challenges including instant blood mediated inflammatory reaction, hypoxia/reperfusion injury, inflammatory cytokines, and immune rejection. RNA interference (RNAi) is an novel strategy to selectively degrade target mRNA. The use of RNAi technologies to downregulate the expression of harmful genes has the potential to improve the outcome of islet transplantation. The aim of this review is to gain a thorough understanding of biological obstacles to islet transplantation and discuss how to overcome these barriers using different RNAi technologies. This eventually will help improve islet survival and function post transplantaion. Chemically synthesized small interferring RNA (siRNA), vector based short haripin RNA (shRNA), and their critical design elements (such as sequences, promoters, backbone) are discussed. The application of combinatorial RNAi in islet transplantation is also discussed. Last but not the least, several delivery strategies for enhanced gene silencing are discussed, including chemical modification of siRNA, complex formation, bioconjugation, and viral vectors. PMID:21156190
Wang, Qi; Wang, Shuai; Sun, Si-Qiao; Cheng, Zhi-Hua; Zhang, Yang; Chen, Guang; Gu, Meng; Yao, Hai-Jun; Wang, Zhong; Zhou, Juan; Peng, Yu-Bing; Xu, Ming-Xi; Zhang, Ke; Sun, Xi-Wei
2016-01-01
This study was to explore the effects of RNA interference mediated vascular endothelial growth factor (VEGF) gene silencing on biological behavior of renal cell carcinoma (RCC), transplanted renal tumor and angiogenesis in nude mice. The specific siRNA sequence targeting VEGF were designed and synthesized to construct hVEGF-siRNA plasmid which was transfected into RCC 786-O cells. Reverse transcriptase-polymerase chain reaction (RT-PCR) was used for the detection of VEGF gene expression and western blot was adopted for the examination of VEGF protein expression. The 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used to detect cell growth as well as cell migration and invasion. The transplanted renal tumor models in nude mice were established, and the growth condition of nude mice, and VEGF protein expression in transplanted tumor slices and the microvessel density (MVD) were detected. The expression level of VEGF mRNA in VEGF-siRNA group was significant lower than that in the control group and negative group, suggesting that establishment of plasmid specifically inhibited the expression of VEGF gene The expression level of VEGF protein in VEGF-siRNA group was significant lower than that in the control group and negative group. VEGF gene silencing has the significant inhibition effects on proliferation, migration and invasion of RCC 786-O cells. The tumor weight, VEGF protein positive rate and MVD in VEGF-siRNA group were significant lower than those in negative group and blank group. The VEGF gene silencing could inhibit the cell proliferation, migration and invasion of RCC 786-O cells; inhibition of VEGF protein expression could prevent transplanted RCC growth and tumor angiogenesis.
The inhibition of proactive interference among adults with Internet gaming disorder.
Ko, Chih-Hung; Wang, Peng-Wei; Liu, Tai-Ling; Yen, Cheng-Fang; Chen, Cheng-Sheng; Yen, Ju-Yu
2015-06-01
Cognitive control plays a pivotal role in the mechanism of addictive behavior. The aim of the study was to evaluate the deficit in inhibition of proactive interference of Internet gaming disorder (IGD) using a directed forgetting task among young adults. A total of 64 participants with IGD and 69 controls were recruited on a university campus. They completed the directed forgetting task for online gaming words and neutral words. The results demonstrated that the IGD group had a poorer performance on the directed forgetting task, and this represented a deficit in inhibition of proactive interference. They also had a higher tendency to remember online gaming words rather than neutral words in comparison with the control group. This demonstrated memory bias toward online gaming words. These results suggested that more attention should be paid to deficits in inhibition of proactive interference and memory bias toward gaming content when treating subjects with IGD. Furthermore, it is essential and practical to prevent exposure to online gaming-related cues when endeavoring to control online gaming behavior. © 2014 Wiley Publishing Asia Pty Ltd.
Stopping while Going! Response Inhibition Does Not Suffer Dual-Task Interference
ERIC Educational Resources Information Center
Yamaguchi, Motonori; Logan, Gordon D.; Bissett, Patrick G.
2012-01-01
Although dual-task interference is ubiquitous in a variety of task domains, stop-signal studies suggest that response inhibition is not subject to such interference. Nevertheless, no study has directly examined stop-signal performance in a dual-task setting. In two experiments, stop-signal performance was examined in a psychological refractory…
Using RNA interference to knock down the adhesion protein TES.
Griffith, Elen
2007-01-01
RNA interference (RNAi) is a specific and efficient method to knock down protein levels using small interfering RNAs (siRNAs), which target mRNA degradation. RNAi can be used in mammalian cell culture systems to target any protein of interest, and several studies have used this method to knock down adhesion proteins. We used siRNAs to knock down the levels of TES, a focal adhesion protein, in HeLa cells. We demonstrated knockdown of both TES mRNA and TES protein. Although total knockdown of TES was not achieved, the observed reduction in TES protein was sufficient to result in a cellular phenotype of reduced actin stress fibers.
Induction and suppression of antiviral RNA interference by influenza A virus in mammalian cells.
Li, Yang; Basavappa, Megha; Lu, Jinfeng; Dong, Shuwei; Cronkite, D Alexander; Prior, John T; Reinecker, Hans-Christian; Hertzog, Paul; Han, Yanhong; Li, Wan-Xiang; Cheloufi, Sihem; Karginov, Fedor V; Ding, Shou-Wei; Jeffrey, Kate L
2016-12-05
Influenza A virus (IAV) causes annual epidemics and occasional pandemics, and is one of the best-characterized human RNA viral pathogens 1 . However, a physiologically relevant role for the RNA interference (RNAi) suppressor activity of the IAV non-structural protein 1 (NS1), reported over a decade ago 2 , remains unknown 3 . Plant and insect viruses have evolved diverse virulence proteins to suppress RNAi as their hosts produce virus-derived small interfering RNAs (siRNAs) that direct specific antiviral defence 4-7 by an RNAi mechanism dependent on the slicing activity of Argonaute proteins (AGOs) 8,9 . Recent studies have documented induction and suppression of antiviral RNAi in mouse embryonic stem cells and suckling mice 10,11 . However, it is still under debate whether infection by IAV or any other RNA virus that infects humans induces and/or suppresses antiviral RNAi in mature mammalian somatic cells 12-21 . Here, we demonstrate that mature human somatic cells produce abundant virus-derived siRNAs co-immunoprecipitated with AGOs in response to IAV infection. We show that the biogenesis of viral siRNAs from IAV double-stranded RNA (dsRNA) precursors in infected cells is mediated by wild-type human Dicer and potently suppressed by both NS1 of IAV as well as virion protein 35 (VP35) of Ebola and Marburg filoviruses. We further demonstrate that the slicing catalytic activity of AGO2 inhibits IAV and other RNA viruses in mature mammalian cells, in an interferon-independent fashion. Altogether, our work shows that IAV infection induces and suppresses antiviral RNAi in differentiated mammalian somatic cells.
Lu, Xiaoli; Yang, Xi; Huang, Xiaoyan; Huang, Chen; Sun, Huan Huan; Jin, Lihua; Xu, Weifeng; Mao, Haiyan; Guo, Junming; Zhou, Jianqing; Lian, Jiangfang
2013-01-01
Long QT syndrome (LQTS) is a monogenic proarrhythmic disorder that predisposes affected individuals to sudden death from tachyarrhythmia. As an inherited disease, LQTS cannot be completely cured by conventional treatment modalities. Individualized gene therapy is a promising therapeutic approach. The purpose of this study was to investigate the role of small interference RNA (siRNA) on expression of E637K-hERG (human ether-a-go-go-related gene) mutant and whether it can be used to rescue the mutant's dominant-negative suppressive effects on hERG protein channel function. Western blot was performed to select the most sensitive siRNAs to target E637K-hERG mutant knockdown. Confocal laser scanning microscope was performed to monitor cellular localization of wild-type (WT)-hERG and E637K-hERG with or without siRNA. Patch-clamp technique was used to assess the effect of siRNA on the electrophysiologic characteristics of the rapidly activating delayed rectifier K(+) current I(Kr) of the hERG protein channel. siRNA led to a significant decrease in the level of E637K-hERG protein but did not affect the level of WT-hERG protein. WT-hERG localization in cells coexpressing E637K-hERG mutant was restored to the membrane by siRNA. The siRNA-mediated inhibition of E637K-hERG mutant restored the maximum current and tail current amplitudes. Furthermore, siRNA treatment rescued the kinetic properties of WT/E637K-hERG protein channel to a level comparable to that of WT-hERG protein channel. Our findings illustrated that siRNA can effectively inhibit E637K-hERG protein expression and rescue the dominant-negative effect of this mutation by restoring the kinetic properties of hERG protein channel. It has potential clinical implications with regard to the possibility of using siRNA in the treatment of LQTS. Copyright © 2013 Heart Rhythm Society. All rights reserved.
Inhibition, interference, and conflict in task switching.
Costa, Russell E; Friedrich, Frances J
2012-12-01
The role of inhibition in the task-switching process has received increased empirical and theoretical attention in the literature on cognitive control. Many accounts have suggested that inhibition occurs when a conflict must be resolved-for example, when a target stimulus contains features of more than one task. In the two experiments reported here, we used variants of backward inhibition, or N - 2 repetition, designs to examine (1) whether inhibition occurs in the absence of conflict at the stimulus or response level, (2) when in the task-switching process such inhibition may occur, and (3) the potential consequences of inhibition. In Experiment 1, we demonstrate that neither stimulus- nor response-level conflict is necessary for inhibition to occur, while the results of Experiment 2 suggest that inhibition may be associated with a reduction of proactive interference (PI) from a previously performed task. Evidence of inhibition and the reduction of PI both occurred at the task-set level. However, inhibition of specific stimulus values can also occur, but this is clearly separable from task-set inhibition. Both experiments also provided evidence that task-set inhibition can be applied at the time of the new task cue, as opposed to at the onset of the target or at the response stage of the trial. Taken together, the results from these experiments provide insight into when and where in the task-switching process inhibition may occur, as well as into the potential functional benefits that inhibition of task sets may provide.
Steric Restrictions of RISC in RNA Interference Identified with Size-Expanded RNA Nucleobases
Hernández, Armando R.; Peterson, Larryn W.; Kool, Eric T.
2012-01-01
Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC) – the key protein complex of RNA interference (RNAi) – is of great importance to the development of siRNAs with improved biological, and potentially therapeutic, function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases, and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to −5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region, but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3′-end increased activity over wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation. PMID:22646660
Abasic pivot substitution harnesses target specificity of RNA interference
Lee, Hye-Sook; Seok, Heeyoung; Lee, Dong Ha; Ham, Juyoung; Lee, Wooje; Youm, Emilia Moonkyung; Yoo, Jin Seon; Lee, Yong-Seung; Jang, Eun-Sook; Chi, Sung Wook
2015-01-01
Gene silencing via RNA interference inadvertently represses hundreds of off-target transcripts. Because small interfering RNAs (siRNAs) can function as microRNAs, avoiding miRNA-like off-target repression is a major challenge. Functional miRNA–target interactions are known to pre-require transitional nucleation, base pairs from position 2 to the pivot (position 6). Here, by substituting nucleotide in pivot with abasic spacers, which prevent base pairing and alleviate steric hindrance, we eliminate miRNA-like off-target repression while preserving on-target activity at ∼80–100%. Specifically, miR-124 containing dSpacer pivot substitution (6pi) loses seed-mediated transcriptome-wide target interactions, repression activity and biological function, whereas other conventional modifications are ineffective. Application of 6pi allows PCSK9 siRNA to efficiently lower plasma cholesterol concentration in vivo, and abolish potentially deleterious off-target phenotypes. The smallest spacer, C3, also shows the same improvement in target specificity. Abasic pivot substitution serves as a general means to harness the specificity of siRNA experiments and therapeutic applications. PMID:26679372
Li, Fang; Zhang, Junping; Guo, Jiqiang; Jia, Yuan; Han, Yaping; Wang, Zhuanhua
2018-06-12
Breast cancer is one of the most common malignancies. It is necessary to identify new markers for predicting tumor progression and therapeutic molecular targets. It has been reported that CD147 is one of the most commonly expressed proteins in primary tumors and in metastatic cells. In this study, we investigated the role of CD147 in human breast cancer metastasis and invasion, and examined its underlying molecular mechanisms. Immunohistochemistry results revealed high expression of CD147 in human breast tumor tissues, which was positively correlated with the malignancy of breast cancer. MCF-7 cells were transfected with CD147 siRNA eukaryotic expression vector, which resulted in significant knockdown of CD147. We found that CD147 siRNA dramatically inhibited cell proliferation, metastasis, and invasion. Furthermore, our results demonstrated that CD147 siRNA inhibited the synthesis of matrix metalloproteinase 9 (MMP-9) but had no significant effect on matrix metalloproteinase 2 (MMP-2). In addition, CD147 siRNA significantly inhibited the production of vascular endothelial growth factor (VEGF). Taken together, these data indicate that CD147 promotes breast cancer cell proliferation, metastasis, and invasion by modulating MMP-9 and VEGF expression. Thus, CD147 may be used as an important indicator for the judgment of malignant behavior of breast cancer, and may be a potential novel target for breast cancer therapy.
Rouhana, Labib; Weiss, Jennifer A.; Forsthoefel, David J.; Lee, Hayoung; King, Ryan S.; Inoue, Takeshi; Shibata, Norito; Agata, Kiyokazu; Newmark, Phillip A.
2013-01-01
Background The ability to assess gene function is essential for understanding biological processes. Currently, RNA interference (RNAi) is the only technique available to assess gene function in planarians, in which it has been induced via injection of double-stranded RNA (dsRNA), soaking, or ingestion of bacteria expressing dsRNA. Results We describe a simple and robust RNAi protocol, involving in vitro synthesis of dsRNA that is fed to the planarians. Advantages of this protocol include the ability to produce dsRNA from any vector without subcloning, resolution of ambiguities in quantity and quality of input dsRNA, as well as time, and ease of application. We have evaluated the logistics of inducing RNAi in planarians using this methodology in careful detail, from the ingestion and processing of dsRNA in the intestine, to timing and efficacy of knockdown in neoblasts, germline, and soma. We also present systematic comparisons of effects of amount, frequency, and mode of dsRNA delivery. Conclusions This method gives robust and reproducible results and is amenable to high-throughput studies. Overall, this RNAi methodology provides a significant advance by combining the strengths of current protocols available for dsRNA delivery in planarians and has the potential to benefit RNAi methods in other systems. PMID:23441014
Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J.
2012-01-01
The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies. PMID:22411954
Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J
2012-05-01
The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies.
Whitten, Miranda; Dyson, Paul
2017-03-01
Insight into animal biology and development provided by classical genetic analysis of the model organism Drosophila melanogaster was an incentive to develop advanced genetic tools for this insect. But genetic systems for the over one million other known insect species are largely undeveloped. With increasing information about insect genomes resulting from next generation sequencing, RNA interference is now the method of choice for reverse genetics, although it is constrained by the means of delivery of interfering RNA. A recent advance to ensure sustained delivery with minimal experimental intervention or trauma to the insect is to exploit commensal bacteria for symbiont-mediated RNA interference. This technology not only offers an efficient means for RNA interference in insects in laboratory conditions, but also has potential for use in the control of human disease vectors, agricultural pests and pathogens of beneficial insects. © 2017 WILEY Periodicals, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sriwilaijaroen, N.; Boonma, S.; Attasart, P.
Acetylation and deacetylation of histones play important roles in transcription regulation, cell cycle progression and development events. The steady state status of histone acetylation is controlled by a dynamic equilibrium between competing histone acetylase and deacetylase (HDAC). We have used long PfHDAC-1 double-stranded (ds)RNA to interfere with its cognate mRNA expression and determined the effect on malaria parasite growth and development. Chloroquine- and pyrimethamine-resistant Plasmodium falciparum K1 strain was exposed to 1-25 {mu}g of dsRNA/ml of culture for 48 h and growth was determined by [{sup 3}H]-hypoxanthine incorporation and microscopic examination. Parasite culture treated with 10 {mu}g/ml pfHDAC-1 dsRNA exhibitedmore » 47% growth inhibition when compared with either untreated control or culture treated with an unrelated dsRNA. PfHDAC-1 dsRNA specifically blocked maturation of trophozoite to schizont stages and decreased PfHDAC-1 transcript 44% in treated trophozoites. These results indicate the potential of HDAC-1 as a target for development of novel antimalarials.« less
Wei, Min; Zhang, Yan-Ling; Chen, Lan; Cai, Cui-Xia; Wang, Han-Duo
2016-02-20
To explore the effects of silencing HERC4 on the proliferation, apoptosis, and migration of cervical cancer cell line Hela and the possible molecular mechanisms. Three HERC4-specific small interfering RNAs (siRNAs) were transfected into Hela cells, and HERC4 expression in the cells was examined with Western blotting. CCK-8 assay, annexin V-FITC/PI assay, and wound healing assay were used to assess the effect of HERC4 silencing on the proliferation, apoptosis and migration ability of Hela cells. The expression levels of cyclin D1 and Bcl-2 in the cells were detected using Western blotting. Transfection of siRNA-3 resulted in significantly decreased HERC4 protein expression (P<0.01). HERC4 silencing by siRNA-3 markedly suppressed the proliferation and migration of Hela cells, increased the apoptosis rate (P<0.01) and reduced the expression levels of cyclin D1 and Bcl-2 (P<0.01). Silencing of HERC4 efficiently inhibits the proliferation, migration, and invasion of Hela cells in vitro, and the underlying mechanisms may involve the down-regulation of cyclin D1 and Bcl-2.
Zha, Wenjun; Peng, Xinxin; Chen, Rongzhi; Du, Bo; Zhu, Lili; He, Guangcun
2011-01-01
Background RNA interference (RNAi) is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA) directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. Methodology/Principal Findings The Hemipteran insect brown planthopper (Nilaparvata lugens Stål) is a typical phloem sap feeder specific to rice (Oryza sativa L.). To analyze the potential of exploiting RNAi-mediated effects in this insect, we identified genes (Nlsid-1 and Nlaub) encoding proteins that might be involved in the RNAi pathway in N. lugens. Both genes are expressed ubiquitously in nymphs and adult insects. Three genes (the hexose transporter gene NlHT1, the carboxypeptidase gene Nlcar and the trypsin-like serine protease gene Nltry) that are highly expressed in the N. lugens midgut were isolated and used to develop dsRNA constructs for transforming rice. RNA blot analysis showed that the dsRNAs were transcribed and some of them were processed to siRNAs in the transgenic lines. When nymphs were fed on rice plants expressing dsRNA, levels of transcripts of the targeted genes in the midgut were reduced; however, lethal phenotypic effects after dsRNA feeding were not observed. Conclusions Our study shows that genes for the RNAi pathway (Nlsid-1 and Nlaub) are present in N. lugens. When insects were fed on rice plant materials expressing dsRNAs, RNA interference was triggered and the target genes transcript levels were suppressed. The gene knockdown technique described here may prove to be a valuable tool for further investigations in N. lugens. The results demonstrate the potential of dsRNA-mediated RNAi for field-level control of planthoppers, but appropriate target genes must be selected when designing the dsRNA-transgenic plants. PMID:21655219
Small RNA binding is a common strategy to suppress RNA silencing by several viral suppressors
Lakatos, Lóránt; Csorba, Tibor; Pantaleo, Vitantonio; Chapman, Elisabeth J; Carrington, James C; Liu, Yu-Ping; Dolja, Valerian V; Calvino, Lourdes Fernández; López-Moya, Juan José; Burgyán, József
2006-01-01
RNA silencing is an evolutionarily conserved system that functions as an antiviral mechanism in higher plants and insects. To counteract RNA silencing, viruses express silencing suppressors that interfere with both siRNA- and microRNA-guided silencing pathways. We used comparative in vitro and in vivo approaches to analyse the molecular mechanism of suppression by three well-studied silencing suppressors. We found that silencing suppressors p19, p21 and HC-Pro each inhibit the intermediate step of RNA silencing via binding to siRNAs, although the molecular features required for duplex siRNA binding differ among the three proteins. None of the suppressors affected the activity of preassembled RISC complexes. In contrast, each suppressor uniformly inhibited the siRNA-initiated RISC assembly pathway by preventing RNA silencing initiator complex formation. PMID:16724105
A simple and robust vector-based shRNA expression system used for RNA interference.
Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi
2013-01-01
RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.
Effects of nicotine on response inhibition and interference control.
Ettinger, Ulrich; Faiola, Eliana; Kasparbauer, Anna-Maria; Petrovsky, Nadine; Chan, Raymond C K; Liepelt, Roman; Kumari, Veena
2017-04-01
Nicotine is a cholinergic agonist with known pro-cognitive effects in the domains of alerting and orienting attention. However, its effects on attentional top-down functions such as response inhibition and interference control are less well characterised. Here, we investigated the effects of 7 mg transdermal nicotine on performance on a battery of response inhibition and interference control tasks. A sample of N = 44 healthy adult non-smokers performed antisaccade, stop signal, Stroop, go/no-go, flanker, shape matching and Simon tasks, as well as the attentional network test (ANT) and a continuous performance task (CPT). Nicotine was administered in a within-subjects, double-blind, placebo-controlled design, with order of drug administration counterbalanced. Relative to placebo, nicotine led to significantly shorter reaction times on a prosaccade task and on CPT hits but did not significantly improve inhibitory or interference control performance on any task. Instead, nicotine had a negative influence in increasing the interference effect on the Simon task. Nicotine did not alter inter-individual associations between reaction times on congruent trials and error rates on incongruent trials on any task. Finally, there were effects involving order of drug administration, suggesting practice effects but also beneficial nicotine effects when the compound was administered first. Overall, our findings support previous studies showing positive effects of nicotine on basic attentional functions but do not provide direct evidence for an improvement of top-down cognitive control through acute administration of nicotine at this dose in healthy non-smokers.
Miguez, Gonzalo; Soares, Julia S.; Miller, Ralph R.
2015-01-01
Two lick-suppression experiments with rats assessed interference with behavior indicative of conditioned inhibition by a latent inhibition treatment as a function of test context. We asked what effect the test context has, given identical latent inhibition treatment in Phase 1 and identical conditioned inhibition training in Phase 2. In Experiment 1, an AAA vs. AAB context-shift design determined that latent inhibition treatment in Phase 1 attenuated behavior indicative of conditioned inhibition training administered in Phase 2 regardless of the test context, which could reflect a failure to either acquire or express conditioned inhibition. In Experiment 2, an ABA vs. ABB design found that test performance in Contexts A and B reflected the treatments that had been administered in those contexts (i.e., conditioned inhibition was observed in Context B but not A), which could reflect either context specificity of latent inhibition or context specificity of conditioned inhibition. In either case, latent inhibition of conditioned inhibition training in at least some situations was seen to reflect an expression deficit rather than an acquisition deficit. These data, in conjunction with prior reports, suggest that latent inhibition is relatively specific to the context in which it was administered, whereas conditioned inhibition is specific to its training context only when it is the second learned relationship concerning the target cue. These experiments are part of a larger effort to delineate control by the test context of two-phase associative interference as a function of the nature of target training and the nature of interference training. PMID:25875792
Miguez, Gonzalo; Soares, Julia S; Miller, Ralph R
2015-09-01
In two lick suppression experiments with rats, we assessed interference with behavior indicative of conditioned inhibition by a latent inhibition treatment as a function of test context. We asked what effect the test context has, given identical latent inhibition treatments in Phase 1 and identical conditioned inhibition trainings in Phase 2. In Experiment 1, an AAA versus AAB context-shift design determined that the latent inhibition treatment in Phase 1 attenuated behavior indicative of the conditioned inhibition training administered in Phase 2, regardless of the test context, which could reflect a failure to either acquire or express conditioned inhibition. In Experiment 2, an ABA versus ABB design showed that test performance in Contexts A and B reflected the treatments that had been administered in those contexts (i.e., conditioned inhibition was observed in Context B but not A), which could reflect either the context specificity of either latent inhibition or conditioned inhibition. In either case, latent inhibition of conditioned inhibition training in at least some situations was seen to reflect an expression deficit rather than an acquisition deficit. These data, in conjunction with prior reports, suggest that latent inhibition is relatively specific to the context in which it was administered, whereas conditioned inhibition is specific to its training context only when it is the second-learned relationship concerning the target cue. These experiments are part of a larger effort to delineate control by the test context of two-phase associative interference, as a function of the nature of target training and the nature of interference training.
Ewing's Sarcoma: Development of RNA Interference-Based Therapy for Advanced Disease
Simmons, Olivia; Maples, Phillip B.; Senzer, Neil; Nemunaitis, John
2012-01-01
Ewing's sarcoma tumors are associated with chromosomal translocation between the EWS gene and the ETS transcription factor gene. These unique target sequences provide opportunity for RNA interference(i)-based therapy. A summary of RNAi mechanism and therapeutically designed products including siRNA, shRNA and bi-shRNA are described. Comparison is made between each of these approaches. Systemic RNAi-based therapy, however, requires protected delivery to the Ewing's sarcoma tumor site for activity. Delivery systems which have been most effective in preclinical and clinical testing are reviewed, followed by preclinical assessment of various silencing strategies with demonstration of effectiveness to EWS/FLI-1 target sequences. It is concluded that RNAi-based therapeutics may have testable and achievable activity in management of Ewing's sarcoma. PMID:22523703
RNA interference: ready to silence cancer?
Mocellin, Simone; Costa, Rodolfo; Nitti, Donato
2006-01-01
RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.
Chimeric peptide-mediated siRNA transduction to inhibit HIV-1 infection.
Bivalkar-Mehla, Shalmali; Mehla, Rajeev; Chauhan, Ashok
2017-04-01
Persistent human immunodeficiency virus 1 (HIV-1) infection provokes immune activation and depletes CD4 + lymphocytes, leading to acquired immunodeficiency syndrome. Uninterrupted administration of combination antiretroviral therapy (cART) in HIV-infected patients suppresses viral replication to below the detectable level and partially restores the immune system. However, cART-unresponsive residual HIV-1 infection and elusive transcriptionally silent but reactivatable viral reservoirs maintain a permanent viral DNA blue print. The virus rebounds within a few weeks after interruption of suppressive therapy. Adjunct gene therapy to control viral replication by ribonucleic acid interference (RNAi) is a post-transcriptional gene silencing strategy that could suppress residual HIV-1 burden and overcome viral resistance. Small interfering ribonucleic acids (siRNAs) are efficient transcriptional inhibitors, but need delivery systems to reach inside target cells. We investigated the potential of chimeric peptide (FP-PTD) to deliver specific siRNAs to HIV-1-susceptible and permissive cells. Chimeric FP-PTD peptide was designed with an RNA binding domain (PTD) to bind siRNA and a cell fusion peptide domain (FP) to enter cells. FP-PTD-siRNA complex entered and inhibited HIV-1 replication in susceptible cells, and could be a candidate for in vivo testing.
RNA interference for functional genomics and improvement of cotton (Gossypium species)
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium ssp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function ...
Noël, Xavier; Van der Linden, Martial; Brevers, Damien; Campanella, Salvatore; Verbanck, Paul; Hanak, Catherine; Kornreich, Charles; Verbruggen, Frederick
2013-03-01
Impulsivity is a hallmark of addictive behaviors. Addicts' weakened inhibition of irrelevant prepotent responses is commonly thought to explain this association. However, inhibition is not a unitary mechanism. This study investigated the efficiency of overcoming competition due to irrelevant responses (i.e., inhibition of a prepotent response) and overcoming competition in memory (i.e., resistance to proactive interference) in sober and recently detoxified alcohol-dependent individuals. Three cognitive tasks assessing the inhibition of a prepotent response (Hayling task, anti-saccade task and Stroop task) and two tasks tapping into the capacity to resist proactive interference (cued recall, Brown-Peterson variant) were administered to 30 non-amnesic recently detoxified alcohol-dependent individuals and 30 matched healthy participants without alcohol dependency. In addition, possible confounds such as verbal updating in working memory was assessed. Alcohol-dependent subjects performed worse than healthy participants on the three cognitive tasks assessing the inhibition of irrelevant prepotent responses but group performance was similar in the tasks assessing overcoming proactive interference in memory, updating of working memory and abstract reasoning. These findings suggest that alcohol-dependence is mainly associated with impaired capacity to intentionally suppress irrelevant prepotent response information. Control of proactive interference from memory is preserved. Theoretical and clinical implications are discussed. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Shi, Ji-Feng; Mu, Li-Li; Chen, Xu; Guo, Wen-Chao; Li, Guo-Qing
2016-01-01
Dietary introduction of bacterially expressed double-stranded RNA (dsRNA) has great potential for management of Leptinotarsa decemlineata . Identification of the most attractive candidate genes for RNA interference (RNAi) is the first step. In the present paper, three complete chitin synthase cDNA sequences ( LdChSAa , LdChSAb and LdChSB ) were cloned. LdChSAa and LdChSAb , two splicing variants of LdChSA gene, were highly expressed in ectodermally-derived epidermal cells forming epidermis, trachea, foregut and hindgut, whereas LdChSB was mainly transcribed in midgut cells. Feeding bacterially expressed ds ChSA (derived from a common fragment of LdChSAa and LdChSAb ), ds ChSAa , ds ChSAb and ds ChSB in the second- and fourth-instar larvae specifically knocked down their target mRNAs. RNAi of LdChSAa + LdChSAb and LdChSAa lowered chitin contents in whole body and integument samples, and thinned tracheal taenidia. The resulting larvae failed to ecdyse, pupate, or emerge as adults. Comparably, knockdown of LdChSAb mainly affected pupal-adult molting. The LdChSAb RNAi pupae did not completely shed the old larval exuviae, which caused failure of adult emergence. In contrast, silencing of LdChSB significantly reduced foliage consumption, decreased chitin content in midgut sample, damaged midgut peritrophic matrix, and retarded larval growth. As a result, the development of the LdChSB RNAi hypomorphs was arrested. Our data reveal that these LdChS s are among the effective candidate genes for an RNAi-based control strategy against L. decemlineata .
Cotranslational Coat Protein-Mediated Inhibition of Potyviral RNA Translation
Besong-Ndika, Jane; Ivanov, Konstantin I.; Hafrèn, Anders; Michon, Thierry
2015-01-01
ABSTRACT Potato virus A (PVA) is a single-stranded positive-sense RNA virus and a member of the family Potyviridae. The PVA coat protein (CP) has an intrinsic capacity to self-assemble into filamentous virus-like particles, but the mechanism responsible for the initiation of viral RNA encapsidation in vivo remains unclear. Apart from virion assembly, PVA CP is also involved in the inhibition of viral RNA translation. In this study, we show that CP inhibits PVA RNA translation in a dose-dependent manner, through a mechanism involving the CP-encoding region. Analysis of this region, however, failed to identify any RNA secondary structure(s) preferentially recognized by CP, suggesting that the inhibition depends on CP-CP rather than CP-RNA interactions. In agreement with this possibility, insertion of an in-frame stop codon upstream of the CP sequence led to a marked decrease in the inhibition of viral RNA translation. Based on these results, we propose a model in which the cotranslational interactions between excess CP accumulating in trans and CP translated from viral RNA in cis are required to initiate the translational repression. This model suggests a mechanism for how viral RNA can be sequestered from translation and specifically selected for encapsidation at the late stages of viral infection. IMPORTANCE The main functions of the CP during potyvirus infection are to protect viral RNA from degradation and to transport it locally, systemically, and from host to host. Although virion assembly is a key step in the potyviral infectious cycle, little is known about how it is initiated and how viral RNA is selected for encapsidation. The results presented here suggest that CP-CP rather than CP-RNA interactions are predominantly involved in the sequestration of viral RNA away from translation. We propose that the cotranslational nature of these interactions may represent a mechanism for the selection of viral RNA for encapsidation. A better understanding of the
Shih, Yao-Ming; Sun, Cheng-Pu; Chou, Hui-Hsien; Wu, Tzu-Hui; Chen, Chun-Chi; Wu, Ping-Yi; Enya Chen, Yu-Chen; Bissig, Karl-Dimiter; Tao, Mi-Hua
2015-01-01
Selection of escape mutants with mutations within the target sequence could abolish the antiviral RNA interference activity. Here, we investigated the impact of a pre-existing shRNA-resistant HBV variant on the efficacy of shRNA therapy. We previously identified a highly potent shRNA, S1, which, when delivered by an adeno-associated viral vector, effectively inhibits HBV replication in HBV transgenic mice. We applied the “PICKY” software to systemically screen the HBV genome, then used hydrodynamic transfection and HBV transgenic mice to identify additional six highly potent shRNAs. Human liver chimeric mice were infected with a mixture of wild-type and T472C HBV, a S1-resistant HBV variant, and then treated with a single or combined shRNAs. The presence of T472C mutant compromised the therapeutic efficacy of S1 and resulted in replacement of serum wild-type HBV by T472C HBV. In contrast, combinatorial therapy using S1 and P28, one of six potent shRNAs, markedly reduced titers for both wild-type and T472C HBV. Interestingly, treatment with P28 alone led to the emergence of escape mutants with mutations in the P28 target region. Our results demonstrate that combinatorial RNAi therapy can minimize the escape of resistant viral mutants in chronic HBV patients. PMID:26482836
Knockdown of RNA interference pathway genes impacts the fitness of western corn rootworm.
Davis-Vogel, Courtney; Ortiz, Angel; Procyk, Lisa; Robeson, Jonathan; Kassa, Adane; Wang, Yiwei; Huang, Emily; Walker, Carl; Sethi, Amit; Nelson, Mark E; Sashital, Dipali G
2018-05-18
Western corn rootworm (Diabrotica virgifera virgifera) is a serious agricultural pest known for its high adaptability to various management strategies, giving rise to a continual need for new control options. Transgenic maize expressing insecticidal RNAs represents a novel mode of action for rootworm management that is dependent on the RNA interference (RNAi) pathways of the insect for efficacy. Preliminary evidence suggests that western corn rootworm could develop broad resistance to all insecticidal RNAs through changes in RNAi pathway genes; however, the likelihood of field-evolved resistance occurring through this mechanism remains unclear. In the current study, eight key genes involved in facilitating interference in the microRNA and small interfering RNA pathways were targeted for knockdown in order to evaluate impact on fitness of western corn rootworm. These genes include drosha, dicer-1, dicer-2, pasha, loquacious, r2d2, argonaute 1, and argonaute 2. Depletion of targeted transcripts in rootworm larvae led to changes in microRNA expression, decreased ability to pupate, reduced adult beetle emergence, and diminished reproductive capacity. The observed effects do not support evolution of resistance through changes in expression of these eight genes due to reduced insect fitness.
Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi
2016-01-01
Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870
ERIC Educational Resources Information Center
Shao, Zeshu; Roelofs, Ardi; Martin, Randi C.; Meyer, Antje S.
2015-01-01
In 2 studies, we examined whether explicit distractors are necessary and sufficient to evoke selective inhibition in 3 naming tasks: the semantic blocking, picture-word interference, and color-word Stroop task. Delta plots were used to quantify the size of the interference effects as a function of reaction time (RT). Selective inhibition was…
Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.
Parrish, S; Fire, A
2001-10-01
RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed.
Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.
Parrish, S; Fire, A
2001-01-01
RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed. PMID:11680844
Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference
Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu
2015-01-01
RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells. PMID:25731667
Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference.
Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu
2015-03-03
RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Lei; Zhang, Qing; Yang, Yu
Highlights: • RNA recognition motif domains of RBM5 are essential for cell proliferation inhibition. • RNA recognition motif domains of RBM5 are essential for apoptosis induction. • RNA recognition motif domains of RBM5 are essential for RNA binding. • RNA recognition motif domains of RBM5 are essential for caspase-2 alternative splicing. - Abstract: RBM5 is a known putative tumor suppressor gene that has been shown to function in cell growth inhibition by modulating apoptosis. RBM5 also plays a critical role in alternative splicing as an RNA binding protein. However, it is still unclear which domains of RBM5 are required formore » RNA binding and related functional activities. We hypothesized the two putative RNA recognition motif (RRM) domains of RBM5 spanning from amino acids 98–178 and 231–315 are essential for RBM5-mediated cell growth inhibition, apoptosis regulation, and RNA binding. To investigate this hypothesis, we evaluated the activities of the wide-type and mutant RBM5 gene transfer in low-RBM5 expressing A549 cells. We found that, unlike wild-type RBM5 (RBM5-wt), a RBM5 mutant lacking the two RRM domains (RBM5-ΔRRM), is unable to bind RNA, has compromised caspase-2 alternative splicing activity, lacks cell proliferation inhibition and apoptosis induction function in A549 cells. These data provide direct evidence that the two RRM domains of RBM5 are required for RNA binding and the RNA binding activity of RBM5 contributes to its function on apoptosis induction and cell growth inhibition.« less
Thomsen, Dana; Lee, Chow H.
2014-01-01
Studies on Coding Region Determinant-Binding Protein (CRD-BP) and its orthologs have confirmed their functional role in mRNA stability and localization. CRD-BP is present in extremely low levels in normal adult tissues, but it is over-expressed in many types of aggressive human cancers and in neonatal tissues. Although the exact role of CRD-BP in tumour progression is unclear, cumulative evidence suggests that its ability to physically associate with target mRNAs is an important criterion for its oncogenic role. CRD-BP has high affinity for the 3′UTR of the oncogenic CD44 mRNA and depletion of CRD-BP in cells led to destabilization of CD44 mRNA, decreased CD44 expression, reduced adhesion and disruption of invadopodia formation. Here, we further characterize the CRD-BP-CD44 RNA interaction and assess specific antisense oligonucleotides and small molecule antibiotics for their ability to inhibit the CRD-BP-CD44 RNA interaction. CRD-BP has a high affinity for binding to CD44 RNA nts 2862–3055 with a Kd of 645 nM. Out of ten antisense oligonucleotides spanning nts 2862–3055, only three antisense oligonucleotides (DD4, DD7 and DD10) were effective in competing with CRD-BP for binding to 32P-labeled CD44 RNA. The potency of DD4, DD7 and DD10 in inhibiting the CRD-BP-CD44 RNA interaction in vitro correlated with their ability to specifically reduce the steady-state level of CD44 mRNA in cells. The aminoglycoside antibiotics neomycin, paramomycin, kanamycin and streptomycin effectively inhibited the CRD-BP-CD44 RNA interaction in vitro. Assessing the potential inhibitory effect of aminoglycoside antibiotics including neomycin on the CRD-BP-CD44 mRNA interaction in cells proved difficult, likely due to their propensity to non-specifically bind nucleic acids. Our results have important implications for future studies in finding small molecules and nucleic acid-based inhibitors that interfere with protein-RNA interactions. PMID:24622399
King, Dustin T; Barnes, Mark; Thomsen, Dana; Lee, Chow H
2014-01-01
Studies on Coding Region Determinant-Binding Protein (CRD-BP) and its orthologs have confirmed their functional role in mRNA stability and localization. CRD-BP is present in extremely low levels in normal adult tissues, but it is over-expressed in many types of aggressive human cancers and in neonatal tissues. Although the exact role of CRD-BP in tumour progression is unclear, cumulative evidence suggests that its ability to physically associate with target mRNAs is an important criterion for its oncogenic role. CRD-BP has high affinity for the 3'UTR of the oncogenic CD44 mRNA and depletion of CRD-BP in cells led to destabilization of CD44 mRNA, decreased CD44 expression, reduced adhesion and disruption of invadopodia formation. Here, we further characterize the CRD-BP-CD44 RNA interaction and assess specific antisense oligonucleotides and small molecule antibiotics for their ability to inhibit the CRD-BP-CD44 RNA interaction. CRD-BP has a high affinity for binding to CD44 RNA nts 2862-3055 with a Kd of 645 nM. Out of ten antisense oligonucleotides spanning nts 2862-3055, only three antisense oligonucleotides (DD4, DD7 and DD10) were effective in competing with CRD-BP for binding to 32P-labeled CD44 RNA. The potency of DD4, DD7 and DD10 in inhibiting the CRD-BP-CD44 RNA interaction in vitro correlated with their ability to specifically reduce the steady-state level of CD44 mRNA in cells. The aminoglycoside antibiotics neomycin, paramomycin, kanamycin and streptomycin effectively inhibited the CRD-BP-CD44 RNA interaction in vitro. Assessing the potential inhibitory effect of aminoglycoside antibiotics including neomycin on the CRD-BP-CD44 mRNA interaction in cells proved difficult, likely due to their propensity to non-specifically bind nucleic acids. Our results have important implications for future studies in finding small molecules and nucleic acid-based inhibitors that interfere with protein-RNA interactions.
Göertz, G P; Fros, J J; Miesen, P; Vogels, C B F; van der Bent, M L; Geertsema, C; Koenraadt, C J M; van Rij, R P; van Oers, M M; Pijlman, G P
2016-11-15
Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5'-3' exoribonuclease XRN1/Pacman on conserved RNA structures in the 3' untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo Two reproducible small-RNA hot spots within the 3' UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3' SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. Understanding the flavivirus transmission
Göertz, G. P.; Fros, J. J.; Miesen, P.; Vogels, C. B. F.; van der Bent, M. L.; Geertsema, C.; Koenraadt, C. J. M.; van Oers, M. M.
2016-01-01
ABSTRACT Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5′-3′ exoribonuclease XRN1/Pacman on conserved RNA structures in the 3′ untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo. Two reproducible small-RNA hot spots within the 3′ UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3′ SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. IMPORTANCE Understanding
Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin
2018-01-01
RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccas e 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like ( Sil1 ), scavenger receptor class C ( Src ), and scavenger receptor class B ( Srb3 and Srb4 ) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean.
Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin
2018-01-01
RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccase 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like (Sil1), scavenger receptor class C (Src), and scavenger receptor class B (Srb3 and Srb4) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean. PMID:29773992
Hung, Yuwen; Gaillard, Schuyler L; Yarmak, Pavel; Arsalidou, Marie
2018-06-19
Inhibitory control is the stopping of a mental process with or without intention, conceptualized as mental suppression of competing information because of limited cognitive capacity. Inhibitory control dysfunction is a core characteristic of many major psychiatric disorders. Inhibition is generally thought to involve the prefrontal cortex; however, a single inhibitory mechanism is insufficient for interpreting the heterogeneous nature of human cognition. It remains unclear whether different dimensions of inhibitory processes-specifically cognitive inhibition, response inhibition, and emotional interference-rely on dissociated neural systems. We conducted systematic meta-analyses of fMRI studies in the BrainMap database supplemented by PubMed using whole-brain activation likelihood estimation. A total of 66 study experiments including 1,447 participants and 987 foci revealed that while the left anterior insula was concordant in all inhibitory dimensions, cognitive inhibition reliably activated specific dorsal frontal inhibitory system, engaging dorsal anterior cingulate, dorsolateral prefrontal cortex, and parietal areas, whereas emotional interference reliably implicated a ventral inhibitory system, involving the ventral surface of the inferior frontal gyrus and the amygdala. Response inhibition showed concordant clusters in the fronto-striatal system, including the dorsal anterior cingulate region and extended supplementary motor areas, the dorsal and ventral lateral prefrontal cortex, basal ganglia, midbrain regions, and parietal regions. We provide an empirically derived dimensional model of inhibition characterizing neural systems underlying different aspects of inhibitory mechanisms. This study offers a fundamental framework to advance current understanding of inhibition and provides new insights for future clinical research into disorders with different types of inhibition-related dysfunctions. © 2018 Wiley Periodicals, Inc.
RNA Interference in Moths: Mechanisms, Applications, and Progress
Xu, Jin; Wang, Xia-Fei; Chen, Peng; Liu, Fang-Tao; Zheng, Shuai-Chao; Ye, Hui; Mo, Ming-He
2016-01-01
The vast majority of lepidopterans, about 90%, are moths. Some moths, particularly their caterpillars, are major agricultural and forestry pests in many parts of the world. However, some other members of moths, such as the silkworm Bombyx mori, are famous for their economic value. Fire et al. in 1998 initially found that exogenous double-stranded RNA (dsRNA) can silence the homolog endogenous mRNA in organisms, which is called RNA interference (RNAi). Soon after, the RNAi technique proved to be very promising not only in gene function determination but also in pest control. However, later studies demonstrate that performing RNAi in moths is not as straightforward as shown in other insect taxa. Nevertheless, since 2007, especially after 2010, an increasing number of reports have been published that describe successful RNAi experiments in different moth species either on gene function analysis or on pest management exploration. So far, more than 100 peer-reviewed papers have reported successful RNAi experiments in moths, covering 10 families and 25 species. By using classic and novel dsRNA delivery methods, these studies effectively silence the expression of various target genes and determine their function in larval development, reproduction, immunology, resistance against chemicals, and other biological processes. In addition, a number of laboratory and field trials have demonstrated that RNAi is also a potential strategy for moth pest management. In this review, therefore, we summarize and discuss the mechanisms and applications of the RNAi technique in moths by focusing on recent progresses. PMID:27775569
Terova, Genciana; Rimoldi, Simona; Bernardini, Giovanni; Saroglia, Marco
2013-06-01
Myostatin (MSTN), previously referred to as growth differentiation factor 8 (GDF8), is a negative regulator of skeletal muscle growth. In accordance with this role, natural mutations that inactivate the gene disrupting the function of the protein are associated with excessive muscle growth and double-muscling phenotype in several mammalian species. Recent studies using transgenic MSTN deficient zebrafish and medaka support the idea that this gene inhibits skeletal muscle growth even in fish. If the atrophic actions of mammalian MSTN are indeed conserved in fish, strategies capable of inhibiting the expression of this gene could be applied to enhance growth performance in livestock production. Gene silencing by RNA interference has emerged as a promising new method of inhibiting the expression of targeted genes and inducing knockdown of associated proteins both in vitro and in vivo. Accordingly, we investigated here whether double-stranded RNA (dsRNA) or different plasmids expressing short-hairpin interfering RNAs (shRNAs) against myostatin and transduced by in vivo electroporation would increase skeletal muscle mass in reared European sea bass. After 7 weeks of intramuscular injections on a weekly basis followed by in vivo electrically mediated dsRNA delivery, no increase in the condition factor (K) of fish was observed as compared to the controls. Analogously, mean body weight and K of sea bass injected with three shRNAs were not higher than those of the control fish. On the other hand, MSTN transcript quantification via real-time RT-PCR revealed a significant inhibition of gene expression in the muscle of the dsRNA-injected fish and in the muscle of fish injected with one of the three tested shRNA-expressing vector constructs. In conclusion, in vivo electric-mediated delivery of dsRNA- or shRNA-expressing vectors against MSTN inhibits MSTN gene expression in adult sea bass muscle, but this is associated with an inconsistent double-muscle phenotype.
Korde, Asawari; Rosselot, Jessica M.; Donze, David
2014-01-01
The major function of eukaryotic RNA polymerase III is to transcribe transfer RNA, 5S ribosomal RNA, and other small non-protein-coding RNA molecules. Assembly of the RNA polymerase III complex on chromosomal DNA requires the sequential binding of transcription factor complexes TFIIIC and TFIIIB. Recent evidence has suggested that in addition to producing RNA transcripts, chromatin-assembled RNA polymerase III complexes may mediate additional nuclear functions that include chromatin boundary, nucleosome phasing, and general genome organization activities. This study provides evidence of another such “extratranscriptional” activity of assembled RNA polymerase III complexes, which is the ability to block progression of intergenic RNA polymerase II transcription. We demonstrate that the RNA polymerase III complex bound to the tRNA gene upstream of the Saccharomyces cerevisiae ATG31 gene protects the ATG31 promoter against readthrough transcriptional interference from the upstream noncoding intergenic SUT467 transcription unit. This protection is predominately mediated by binding of the TFIIIB complex. When TFIIIB binding to this tRNA gene is weakened, an extended SUT467–ATG31 readthrough transcript is produced, resulting in compromised ATG31 translation. Since the ATG31 gene product is required for autophagy, strains expressing the readthrough transcript exhibit defective autophagy induction and reduced fitness under autophagy-inducing nitrogen starvation conditions. Given the recent discovery of widespread pervasive transcription in all forms of life, protection of neighboring genes from intergenic transcriptional interference may be a key extratranscriptional function of assembled RNA polymerase III complexes and possibly other DNA binding proteins. PMID:24336746
The effect of myostatin silencing by lentiviral-mediated RNA interference on goat fetal fibroblasts.
Lu, Jian; Wei, Caihong; Zhang, Xiaoning; Xu, Lingyang; Zhang, Shifang; Liu, Jiasen; Cao, Jiaxue; Zhao, Fuping; Zhang, Li; Li, Bichun; Du, Lixin
2013-06-01
Myostatin is a transforming growth factor-β family member that acts as a negative regulator of skeletal muscle mass. To identify possible myostatin inhibitors that may promote muscle growth, we used RNA interference mediated by a lentiviral vector to knockdown myostatin in goat fetal fibroblast cells. We also investigated the expression changes in relevant myogenic regulatory factors (MRFs) and adipogenic regulatory factors in the absence of myostatin in goat fetal fibroblasts. Quantitative RT-PCR revealed that myostatin transcripts were significantly reduced by 75 % (P < 0.01). Western blot showed that myostatin protein expression was reduced by 95 % (P < 0.01). We also found that the mRNA expression of activin receptor IIB (ACVR2B) significantly increased by 350 % (P < 0.01), and p21 increased 172 % (P < 0.01). Furthermore, myostatin inhibition decreased Myf5 and increased MEF2C mRNA expression in goat fetal fibroblasts, suggesting that myostatin regulates MRFs differently in fibroblasts compared to muscle. In addition, the expression of adipocyte marker genes peroxisome proliferator-activated receptor (PPAR) γ and leptin, but not CCAAT/enhance-binding protein (C/EBP) α and C/EBPβ, were upregulated at the transcript level after myostatin silencing. These results suggest that we have generated a novel way to block myostatin in vitro, which could be used to improve livestock meat production and gene therapy of musculoskeletal diseases. This also suggests that myostatin plays a negative role in regulating the expression of adipogenesis related genes in goat fetal fibroblasts.
RNA interference in the clinic: challenges and future directions
Pecot, Chad V.; Calin, George A.; Coleman, Robert L.; Lopez-Berestein, Gabriel; Sood, Anil K.
2011-01-01
Inherent difficulties with blocking many desirable targets using conventional approaches have prompted many to consider using RNA interference (RNAi) as a therapeutic approach. Although exploitation of RNAi has immense potential as a cancer therapeutic, many physiological obstacles stand in the way of successful and efficient delivery. This Review explores current challenges to the development of synthetic RNAi-based therapies and considers new approaches to circumvent biological barriers, to avoid intolerable side effects and to achieve controlled and sustained release. PMID:21160526
Efficacy of a Novel Class of RNA Interference Therapeutic Agents
Matsumoto, Takahiro; D'Alessandro-Gabazza, Corina N.; Gil-Bernabe, Paloma; Boveda-Ruiz, Daniel; Naito, Masahiro; Kobayashi, Tetsu; Toda, Masaaki; Mizutani, Takayuki; Taguchi, Osamu; Morser, John; Eguchi, Yutaka; Kuroda, Masahiko; Ochiya, Takahiro; Hayashi, Hirotake; Gabazza, Esteban C.; Ohgi, Tadaaki
2012-01-01
RNA interference (RNAi) is being widely used in functional gene research and is an important tool for drug discovery. However, canonical double-stranded short interfering RNAs are unstable and induce undesirable adverse effects, and thus there is no currently RNAi-based therapy in the clinic. We have developed a novel class of RNAi agents, and evaluated their effectiveness in vitro and in mouse models of acute lung injury (ALI) and pulmonary fibrosis. The novel class of RNAi agents (nkRNA®, PnkRNA™) were synthesized on solid phase as single-stranded RNAs that, following synthesis, self-anneal into a unique helical structure containing a central stem and two loops. They are resistant to degradation and suppress their target genes. nkRNA and PnkRNA directed against TGF-β1mRNA ameliorate outcomes and induce no off-target effects in three animal models of lung disease. The results of this study support the pathological relevance of TGF-β1 in lung diseases, and suggest the potential usefulness of these novel RNAi agents for therapeutic application. PMID:22916145
Yang, Jing; Wang, Rong; Li, Hongjiang; Lv, Qing; Meng, Wentong; Yang, Xiaoqin
2016-07-08
Overexpression of extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), a glycoprotein enriched on the plasma membrane of tumor cells, promotes proliferation, invasion, metastasis, and survival of malignant tumor cells. In this study, we sought to examine the expression of EMMPRIN in breast tumors, and to identify the potential roles of EMMPRIN on breast cancer cells. EMMPRIN expression in breast cancer tissues was assessed by immunohistochemistry. We used a lentivirus vector-based RNA interference (RNAi) approach expressing short hairpin RNA (shRNA) to knockdown EMMPRIN gene in breast cancer cell lines MDA-MB-231 and MCF-7. In vitro, Cell proliferative, invasive potential were determined by Cell Counting Kit (CCK-8), cell cycle analysis and matrigel invasion assay, respectively. In vivo, tumorigenicity was monitored by inoculating tumor cells into breast fat pad of female nude mice. EMMPRIN was over-expressed in breast tumors and breast cancer cell lines. Down-regulation of EMMPRIN by lentivirus vector-based RNAi led to decreased cell proliferative, decreased matrigel invasion in vitro, and attenuated tumor formation in vivo. High expression of EMMPRIN plays a crucial role in breast cancer cell proliferation, matrigel invasion and tumor formation.
RNA Interference in Insect Vectors for Plant Viruses.
Kanakala, Surapathrudu; Ghanim, Murad
2016-12-12
Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists.
RNA Interference in Insect Vectors for Plant Viruses
Kanakala, Surapathrudu; Ghanim, Murad
2016-01-01
Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists. PMID:27973446
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hu, Duanmin; Su, Cunjin; Jiang, Min
There is still no suitable drug for pancreatic cancer treatment, which is one of the most aggressive human tumors. Maternally expressed gene 3 (MEG3), a LncRNA, has been suggested as a tumor suppressor in a range of human tumors. Studies found fenofibrate exerted anti-tumor roles in various human cancer cell lines. However, its role in pancreatic cancer remains unknown. The present study aimed to explore the impacts of fenofibrate on pancreatic cancer cell lines, and to investigate MEG3 role in its anti-tumor mechanisms. We used MTT assay to determine cells proliferation, genome-wide LncRNA microarray analysis to identify differently expressed LncRNAs,more » siRNA or pCDNA-MEG3 transfection to interfere or upregulate MEG3 expression, western blot to detect protein levels, real-time PCR to determine MEG3 level. Fenofibrate significantly inhibited proliferation of pancreatic cancer cells, increased MEG3 expression and p53 levels. Moreover, knockdown of MEG3 attenuated cytotoxicity induced by fenofibrate. Furthermore, overexpression of MEG3 induced cells death and increased p53 expression. Our results indicated fenofibrate inhibited pancreatic cancer cells proliferation via activation of p53 mediated by upregulation of MEG3. - Highlights: • We found that fenofibrate suppressed proliferation of pancreatic cancer cells. • We found fenofibrate increased LncRNA-MEG3 expression and p53 level in PANC-1 cells. • Inhibition of MEG3 expression attenuated anti-tumor effects of fenofibrate.« less
Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui
2015-10-01
The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.
Chen, Chen; Mei, Heng; Shi, Wei; Deng, Jun; Zhang, Bo; Guo, Tao; Wang, Huafang; Hu, Yu
2013-01-01
Injured endothelium is an important target for drug and/or gene therapy because brain microvascular endothelial cells (BMECs) play critical roles in various pathophysiological conditions. RNA-mediated gene silencing presents a new therapeutic approach for treating such diseases, but major challenge is to ensure minimal toxicity and target delivery of siRNA to injured BMECs. Injured BMECs overexpress tissue factor (TF), which the fusion protein EGFP-EGF1 could be targeted to. In this study, TNF alpha (TNF-α) was chosen as a stimulus for primary BMECs to produce injured endothelium in vitro. The EGFP-EGF1-PLGA nanoparticles (ENPs) with loaded TF-siRNA were used as a new carrier for targeted delivery to the injured BMECs. The nanoparticles then produced intracellular RNA interference against TF. We compared ENP-based transfections with NP-mediated transfections, and our studies show that the ENP-based transfections result in a more efficient downregulation of TF. Our findings also show that the TF siRNA-loaded ENPs had minimal toxicity, with almost 96% of the cells viable 24 h after transfection while Lipofectamine-based transfections resulted in only 75% of the cells. Therefore, ENP-based transfection could be used for efficient siRNA transfection to injured BMECs and for efficient RNA interference (RNAi). This transfection could serve as a potential treatment for diseases, such as stroke, atherosclerosis and cancer. PMID:23593330
Deng, Yan; Wang, Chi Chiu; Choy, Kwong Wai; Du, Quan; Chen, Jiao; Wang, Qin; Li, Lu; Chung, Tony Kwok Hung; Tang, Tao
2014-04-01
During recent decades there have been remarkable advances in biology, in which one of the most important discoveries is RNA interference (RNAi). RNAi is a specific post-transcriptional regulatory pathway that can result in silencing gene functions. Efforts have been done to translate this new discovery into clinical applications for disease treatment. However, technical difficulties restrict the development of RNAi, including stability, off-target effects, immunostimulation and delivery problems. Researchers have attempted to surmount these barriers and improve the bioavailability and safety of RNAi-based therapeutics by optimizing the chemistry and structure of these molecules. This paper aimed to describe the principles of RNA interference, review the therapeutic potential in various diseases and discuss the new strategies for in vivo delivery of RNAi to overcome the challenges. Copyright © 2013 Elsevier B.V. All rights reserved.
Ahn, Jeonghyun; Ko, Ara; Jun, Eun Jung; Won, Minah; Kim, Yoo Kyum; Ju, Eun-Seon
2012-01-01
Antiviral therapeutics are currently unavailable for treatment of coxsackievirus B3, which can cause life-threatening myocarditis. A modified small interfering RNA (siRNA) containing 5′-triphosphate, 3p-siRNA, was shown to induce RNA interference and interferon activation. We aimed to develop a potent antiviral treatment using CVB3-specific 3p-siRNA and to understand its underlying mechanisms. Virus-specific 3p-siRNA was superior to both conventional virus-specific siRNA with an empty hydroxyl group at the 5′ end (OH-siRNA) and nonspecific 3p-siRNA in decreasing viral replication and subsequent cytotoxicity. A single administration of 3p-siRNA dramatically attenuated virus-associated pathological symptoms in mice with no signs of toxicity, and their body weights eventually reached the normal range. Myocardial inflammation and fibrosis were rare, and virus production was greatly reduced. A nonspecific 3p-siRNA showed relatively less protective effect under identical conditions, and a virus-specific OH-siRNA showed no protective effects. We confirmed that virus-specific 3p-siRNA simultaneously activated target-specific gene silencing and type I interferon signaling. We provide a clear proof of concept that coxsackievirus B3-specific 3p-siRNA has 2 distinct modes of action, which significantly enhance antiviral activities with minimal organ damage. This is the first direct demonstration of improved antiviral effects with an immunostimulatory virus-specific siRNA in coxsackievirus myocarditis, and this method could be applied to many virus-related diseases. PMID:22508300
RNA interference of tubulin genes has lethal effects in Mythimna separate.
Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji
2018-05-23
RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.
RNA interference for performance enhancement and detection in doping control.
Kohler, Maxie; Schänzer, Wilhelm; Thevis, Mario
2011-10-01
RNA interference represents a comparably new route of regulating and manipulating specific gene expression. Promising results were obtained in experimental therapies aim at the treatment of different kinds of diseases including cancer, diabetes mellitus or Dychenne muscular dystrophy. While studies on down-regulation efficiency are often performed by analyzing the regulated protein, the direct detection of small, interfering RNA molecules and antisense oligonucleotides is of great interest for the investigation of the metabolism and degradation and also for the detection of a putative misuse of these molecules in sports. Myostatin down-regulation was shown to result in increased performance and muscle growth and the regulation of several other proteins could be relevant for performance enhancement. This mini-review summarizes current approaches for the mass spectrometric analysis of siRNA and antisense oligonucleotides from biological matrices and the available data on biodistribution, metabolism, and half-life of relevant substances are discussed. Copyright © 2011 John Wiley & Sons, Ltd.
Special Issue: Gene Therapy with Emphasis on RNA Interference
Lundstrom, Kenneth
2015-01-01
Gene therapy was originally thought to cover replacement of malfunctioning genes in treatment of various diseases. Today, the field has been expanded to application of viral and non-viral vectors for delivery of recombinant proteins for the compensation of missing or insufficient proteins, anti-cancer genes and proteins for destruction of tumor cells, immunostimulatory genes and proteins for stimulation of the host defense system against viral agents and tumors. Recently, the importance of RNA interference and its application in gene therapy has become an attractive alternative for drug development. PMID:26447255
Siegmund, Daniela; Hadwiger, Philipp; Pfizenmaier, Klaus; Vornlocher, Hans-Peter; Wajant, Harald
2002-01-01
BACKGROUND: Most tumors express death receptors and their activation represents a potential selective approach in cancer treatment. The most promising candidate for tumor selective death receptor-activation is tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)/Apo2L, which activates the death receptors TRAIL-R1 and TRAIL-R2, and induces apoptosis preferentially in tumor cells but not in normal tissues. However, many cancer cells are not or only moderately sensitive towards TRAIL and require cotreatment with irradiation or chemotherapy to yield a therapeutically reasonable apoptotic response. Because chemotherapy can have a broad range of unwanted side effects, more specific means for sensitizing tumor cells for TRAIL are desirable. The expression of the cellular FLICE-like inhibitory protein (cFLIP) is regarded as a major cause of TRAIL resistance. We therefore analyzed the usefulness of targeting FLIP to sensitize tumor cells for TRAIL-induced apoptosis. MATERIALS AND METHODS: To selectively interfere with expression of cFLIP short double-stranded RNA oligonucleotides (small interfering RNAs [siRNAs]) were introduced in the human cell lines SV80 and KB by electroporation. Effects of siRNA on FLIP expression were analyzed by Western blotting and RNase protection assay and correlated with TRAIL sensitivity upon stimulation with recombinant soluble TRAIL and TRAIL-R1- and TRAIL-R2-specific agonistic antibodies. RESULTS: FLIP expression can be inhibited by RNA interference using siRNAs, evident from reduced levels of FLIP-mRNA and FLIP protein. Inhibition of cFLIP expression sensitizes cells for apoptosis induction by TRAIL and other death ligands. In accordance with the presumed function of FLIP as an inhibitor of death receptor-induced caspase-8 activation, down-regulation of FLIP by siRNAs enhanced TRAIL-induced caspase-8 activation. CONCLUSION: Inhibition of FLIP expression was sufficient to sensitize tumor cells for TRAIL-induced apoptosis. The
Current Progress of siRNA/shRNA Therapeutics in Clinical Trials
Burnett, John C.; Rossi, John J.; Tiemann, Katrin
2012-01-01
Through a mechanism known as RNA interference (RNAi), small interfering RNA (siRNA) molecules can target complementary mRNA strands for degradation, thus specifically inhibiting gene expression. The ability of siRNAs to inhibit gene expression offers a mechanism that can be exploited for novel therapeutics. Indeed, over the past decade, at least 21 siRNA therapeutics have been developed for more than a dozen diseases, including various cancers, viruses, and genetic disorders. Like other biological drugs, RNAi-based therapeutics often require a delivery vehicle to transport them to the targeted cells. Thus, the clinical advancement of numerous siRNA drugs has relied on the development of siRNA carriers including biodegradable nanoparticles, lipids, bacteria, and attenuated viruses. Most therapies permit systemic delivery of the siRNA drug, while others use ex vivo delivery by autologous cell therapy. For some of the drugs, advancements in bioengineering and nanotechnology have led to improved control of delivery and release of the siRNA. Likewise, progress in molecular biology has allowed for improved design of the siRNA molecules. Here, we provide an overview of siRNA therapeutics in clinical trials, including their clinical progress, the challenges they have encountered, and the future they hold in the treatment of human diseases. PMID:21744502
RNA interference as a key to knockdown overexpressed cyclooxygenase-2 gene in tumour cells
Strillacci, A; Griffoni, C; Spisni, E; Manara, M C; Tomasi, V
2006-01-01
Silencing those genes that are overexpressed in cancer and contribute to the survival and progression of tumour cells is the aim of several researches. Cyclooxygenase-2 (COX-2) is one of the most intensively studied genes since it is overexpressed in most tumours, mainly in colon cancer. The use of specific COX-2 inhibitors to treat colon cancer has generated great enthusiasm. Yet, the side effects of some inhibitors emerging during long-term treatment have caused much concern. Genes silencing by RNA interference (RNAi) has led to new directions in the field of experimental oncology. In this study, we detected sequences directed against COX-2 mRNA, that potently downregulate COX-2 gene expression and inhibit phorbol 12-myristate 13-acetate-induced angiogenesis in vitro in a specific, nontoxic manner. Moreover, we found that the insertion of a specific cassette carrying anti-COX-2 short hairpin RNA sequence into a viral vector (pSUPER.retro) greatly increased silencing potency in a colon cancer cell line (HT29) without activating any interferon response. Phenotypically, COX-2 deficient HT29 cells showed a significant impairment of their in vitro malignant behaviour. Thus, the retroviral approach enhancing COX-2 knockdown, mediated by RNAi, proved to be an useful tool to better understand the role of COX-2 in colon cancer. Furthermore, the higher infection efficiency we observed in tumour cells, if compared to normal endothelial cells, may disclose the possibility to specifically treat tumour cells without impairing endothelial COX-2 activity. PMID:16622456
Lysosomal putative RNA transporter SIDT2 mediates direct uptake of RNA by lysosomes.
Aizawa, Shu; Fujiwara, Yuuki; Contu, Viorica Raluca; Hase, Katsunori; Takahashi, Masayuki; Kikuchi, Hisae; Kabuta, Chihana; Wada, Keiji; Kabuta, Tomohiro
2016-01-01
Lysosomes are thought to be the major intracellular compartment for the degradation of macromolecules. We recently identified a novel type of autophagy, RNautophagy, where RNA is directly taken up by lysosomes in an ATP-dependent manner and degraded. However, the mechanism of RNA translocation across the lysosomal membrane and the physiological role of RNautophagy remain unclear. In the present study, we performed gain- and loss-of-function studies with isolated lysosomes, and found that SIDT2 (SID1 transmembrane family, member 2), an ortholog of the Caenorhabditis elegans putative RNA transporter SID-1 (systemic RNA interference deficient-1), mediates RNA translocation during RNautophagy. We also observed that SIDT2 is a transmembrane protein, which predominantly localizes to lysosomes. Strikingly, knockdown of Sidt2 inhibited up to ˜50% of total RNA degradation at the cellular level, independently of macroautophagy. Moreover, we showed that this impairment is mainly due to inhibition of lysosomal RNA degradation, strongly suggesting that RNautophagy plays a significant role in constitutive cellular RNA degradation. Our results provide a novel insight into the mechanisms of RNA metabolism, intracellular RNA transport, and atypical types of autophagy.
Lysosomal putative RNA transporter SIDT2 mediates direct uptake of RNA by lysosomes
Aizawa, Shu; Fujiwara, Yuuki; Contu, Viorica Raluca; Hase, Katsunori; Takahashi, Masayuki; Kikuchi, Hisae; Kabuta, Chihana; Wada, Keiji; Kabuta, Tomohiro
2016-01-01
ABSTRACT Lysosomes are thought to be the major intracellular compartment for the degradation of macromolecules. We recently identified a novel type of autophagy, RNautophagy, where RNA is directly taken up by lysosomes in an ATP-dependent manner and degraded. However, the mechanism of RNA translocation across the lysosomal membrane and the physiological role of RNautophagy remain unclear. In the present study, we performed gain- and loss-of-function studies with isolated lysosomes, and found that SIDT2 (SID1 transmembrane family, member 2), an ortholog of the Caenorhabditis elegans putative RNA transporter SID-1 (systemic RNA interference deficient-1), mediates RNA translocation during RNautophagy. We also observed that SIDT2 is a transmembrane protein, which predominantly localizes to lysosomes. Strikingly, knockdown of Sidt2 inhibited up to ˜50% of total RNA degradation at the cellular level, independently of macroautophagy. Moreover, we showed that this impairment is mainly due to inhibition of lysosomal RNA degradation, strongly suggesting that RNautophagy plays a significant role in constitutive cellular RNA degradation. Our results provide a novel insight into the mechanisms of RNA metabolism, intracellular RNA transport, and atypical types of autophagy. PMID:27046251
Systematic RNA interference reveals that oncogenic KRAS-driven cancers require TBK1
Barbie, David A.; Tamayo, Pablo; Boehm, Jesse S.; Kim, So Young; Moody, Susan E.; Dunn, Ian F.; Schinzel, Anna C.; Sandy, Peter; Meylan, Etienne; Scholl, Claudia; Fröhling, Stefan; Chan, Edmond M.; Sos, Martin L.; Michel, Kathrin; Mermel, Craig; Silver, Serena J.; Weir, Barbara A.; Reiling, Jan H.; Sheng, Qing; Gupta, Piyush B.; Wadlow, Raymond C.; Le, Hanh; Hoersch, Sebastian; Wittner, Ben S.; Ramaswamy, Sridhar; Livingston, David M.; Sabatini, David M.; Meyerson, Matthew; Thomas, Roman K.; Lander, Eric S.; Mesirov, Jill P.; Root, David E.; Gilliland, D. Gary; Jacks, Tyler; Hahn, William C.
2009-01-01
The proto-oncogene KRAS is mutated in a wide array of human cancers, most of which are aggressive and respond poorly to standard therapies. Although the identification of specific oncogenes has led to the development of clinically effective, molecularly targeted therapies in some cases, KRAS has remained refractory to this approach. A complementary strategy for targeting KRAS is to identify gene products that, when inhibited, result in cell death only in the presence of an oncogenic allele1,2. Here we have used systematic RNA interference (RNAi) to detect synthetic lethal partners of oncogenic KRAS and found that the non-canonical IκB kinase, TBK1, was selectively essential in cells that harbor mutant KRAS. Suppression of TBK1 induced apoptosis specifically in human cancer cell lines that depend on oncogenic KRAS expression. In these cells, TBK1 activated NF-κB anti-apoptotic signals involving cREL and BCL-XL that were essential for survival, providing mechanistic insights into this synthetic lethal interaction. These observations identify TBK1 and NF-κB signaling as essential in KRAS mutant tumors and establish a general approach for the rational identification of co-dependent pathways in cancer. PMID:19847166
Yang, X; Liu, H; Lin, Z H; Qian, J; Xu, X R
2016-08-01
To investigate the inhibitory effects of RNA interference targeting GFI-1 on growth and proliferation of atypical chronic myelogenous leukemia (aCML) NT1 cells. NT1 cells were transfected with PBS and liposome complex (vehicle group), scrambled siRNA and liposome complex (negative control, NC group), and GFI-1 siRNA and liposome complex (GFI-1 siRNA group), respectively. Real-time quantitative RT-PCR (qRT-PCR) and Western blot were performed to examine the expression levels of GFI-1 mRNA and protein, respectively. The proliferation abilities of NT1 cells of the three groups were evaluated by MTT assay. The cell cycle in cells of the three groups was analyzed by flow cytometry. Moreover, nude mouse xenograft model was used to detect the tumor formation ability in the three group cells. Quantitative real-time PCR data showed that the expression level of GFI-1 mRNA in GFI-1 siRNA group was significantly lower than those of NC group and vehicle group [(0.367±0.017) vs. (0.918±0.006) and (1.010±0.005), respectively, (P<0.05)]. Western blot results showed that the GFI-1 protein expression level in the GFI-1 siRNA group was also significantly reduced, compared with those of the NC group and vehicle group (P<0.05 for both). From MTT assay data, the absorbance value of NT1 cells in the GFI-1 siRNA group (0.667±0.059) was significantly lower than those of the NC group (1.096±0.049) and vehicle group (1.193±0.064, P=0.023). Flow cytometry data showed that sub-G1 and G0/G1 phase proportions of the GFI-1 siRNA group were significantly higher than those of the NC and vehicle groups [sub-G1: (8.2±2.5)% vs. (1.9±1.3)% and (2.0±3.6)%, respectively, (P<0.05); G0/G1: (66.7±3.8)% vs. (53.3±4.5)% and (48.6±3.2)%, respectively, (P<0.05)]. Furthermore, the tumor weight in the GFI-1 siRNA group [(0.37±0.02) g] was significantly lower than those in the NC group [(0.83±0.06) g] and vehicle group [(0.92±0.04) g] (P<0.05). RNA interference targeting GFI-1 inhibits the growth
Fabozzi, Giulia; Nabel, Christopher S; Dolan, Michael A; Sullivan, Nancy J
2011-03-01
Cellular RNA interference (RNAi) provides a natural response against viral infection, but some viruses have evolved mechanisms to antagonize this form of antiviral immunity. To determine whether Ebolavirus (EBOV) counters RNAi by encoding suppressors of RNA silencing (SRSs), we screened all EBOV proteins using an RNAi assay initiated by exogenously delivered small interfering RNAs (siRNAs) against either an EBOV or a reporter gene. In addition to viral protein 35 (VP35), we found that VP30 and VP40 independently act as SRSs. Here, we present the molecular mechanisms of VP30 and VP35. VP30 interacts with Dicer independently of siRNA and with one Dicer partner, TRBP, only in the presence of siRNA. VP35 directly interacts with Dicer partners TRBP and PACT in an siRNA-independent fashion and in the absence of effects on interferon (IFN). Taken together, our findings elucidate a new mechanism of RNAi suppression that extends beyond the role of SRSs in double-stranded RNA (dsRNA) binding and IFN antagonism. The presence of three suppressors highlights the relevance of host RNAi-dependent antiviral immunity in EBOV infection and illustrates the importance of RNAi in shaping the evolution of RNA viruses.
Kertzman, Semion; Avital, Avi; Weizman, Abraham; Segal, Michael
2014-10-01
Intrusive cognitions that enter consciousness involuntarily are prominent symptoms of posttraumatic stress disorder (PTSD). The present study aimed to identify neuropsychological mechanisms involved. Fifty PTSD outpatients and 50 healthy controls were tested using Finger Tapping, Simple and Choice Reaction Times and Stroop Tasks, to measure motor, psychomotor speed, response selection, and interference inhibition ability respectively. PTSD patients performed poorly in all tests, presumably owing to their generalized slowness of information processing and motor reaction. Psychomotor speed was a predictor of slowness and high error rate during the Stroop. Impaired inhibition, as measured by the interference index of the Stroop task, explained 9.7% of the predicated variance in frequency of re-experiencing PTSD symptoms and 23.5% of the predicated variance in augmentation of the interference response time. Impaired interference control may be related to internal (re-experiencing) and external (sensory) stimuli that leads to cognitive deficits in PTSD patients. Copyright © 2014 Elsevier Inc. All rights reserved.
Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum
Tomoyasu, Yoshinori
2014-01-01
The red flour beetle, Tribolium castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully annotated genome sequence, transposon-based transgenesis, and effective RNA interference (RNAi). Among these advantages, RNAi-based gene knockdown techniques are at the core of Tribolium research. T. castaneum show a robust systemic RNAi response, making it possible to perform RNAi at any life stage by simply injecting double-stranded RNA (dsRNA) into the beetle’s body cavity. In this report, we provide an overview of our larval RNAi technique in T. castaneum. The protocol includes (i) isolation of the proper stage of T. castaneum larvae for injection, (ii) preparation for the injection setting, and (iii) dsRNA injection. Larval RNAi is a simple, but powerful technique that provides us with quick access to loss-of-function phenotypes, including multiple gene knockdown phenotypes as well as a series of hypomorphic phenotypes. Since virtually all T. castaneum tissues are susceptible to extracellular dsRNA, the larval RNAi technique allows researchers to study a wide variety of tissues in diverse contexts, including the genetic basis of organismal responses to the outside environment. In addition, the simplicity of this technique stimulates more student involvement in research, making T. castaneum an ideal genetic system for use in a classroom setting. PMID:25350485
Vadillo, Miguel A; Orgaz, Cristina; Luque, David; Cobos, Pedro L; López, Francisco J; Matute, Helena
2013-05-01
Current associative theories of contingency learning assume that inhibitory learning plays a part in the interference between outcomes. However, it is unclear whether this inhibitory learning results in the inhibition of the outcome representation or whether it simply counteracts previous excitatory learning so that the outcome representation is neither activated nor inhibited. Additionally, these models tend to conceptualize inhibition as a relatively transient and cue-dependent state. However, research on retrieval-induced forgetting suggests that the inhibition of representations is a real process that can be relatively independent of the retrieval cue used to access the inhibited information. Consistent with this alternative view, we found that interference between outcomes reduces the retrievability of the target outcome even when the outcome is associated with a novel (non-inhibitory) cue. This result has important theoretical implications for associative models of interference and shows that the empirical facts and theories developed in studies of retrieval-induced forgetting might be relevant in contingency learning and vice versa. © 2012 The British Psychological Society.
Dysregulation of RNA Interference in Breast Cancer
2007-07-01
of miRNA complementary elements in 3-UTR of target mRNAs, the concentration in the seed (6–8 bp) of continuous Watson - Crick base pairing in the 5...treated the transfected cells with the anticancer drug topotecan (TPT) that is known to inhibit DNA topoisomerase I and cause DNA damage (Tanizawa et...as DNA damage caused by TPT, can increase the inhibitory effect mediated by R el at iv e C el l G ro w th R el at iv e C el l G ro w th Negative
Osteoclast-derived microRNA-containing exosomes selectively inhibit osteoblast activity
Sun, Weijia; Zhao, Chenyang; Li, Yuheng; Wang, Liang; Nie, Guangjun; Peng, Jiang; Wang, Aiyuan; Zhang, Pengfei; Tian, Weiming; Li, Qi; Song, Jinping; Wang, Cheng; Xu, Xiaolong; Tian, Yanhua; Zhao, Dingsheng; Xu, Zi; Zhong, Guohui; Han, Bingxing; Ling, Shukuan; Chang, Yan-Zhong; Li, Yingxian
2016-01-01
MicroRNAs have an important role in bone homeostasis. However, the detailed mechanism of microRNA-mediated intercellular communication between bone cells remains elusive. Here, we report that osteoclasts secrete microRNA-enriched exosomes, by which miR-214 is transferred into osteoblasts to inhibit their function. In a coculture system, inhibition of exosome formation and secretion prevented miR-214 transportation. Exosomes specifically recognized osteoblasts through the interaction between ephrinA2 and EphA2. In osteoclast-specific miR-214 transgenic mice, exosomes were secreted into the serum, and miR-214 and ephrinA2 levels were elevated. Therefore, these exosomes have an inhibitory role in osteoblast activity. miR-214 and ephrinA2 levels in serum exosomes from osteoporotic patients and mice were upregulated substantially. These exosomes may significantly inhibit osteoblast activity. Inhibition of exosome secretion via Rab27a small interfering RNA prevented ovariectomized-induced osteoblast dysfunction in vivo. Taken together, these findings suggest that exosome-mediated transfer of microRNA plays an important role in the regulation of osteoblast activity. Circulating miR-214 in exosomes not only represents a biomarker for bone loss but could selectively regulate osteoblast function. PMID:27462462
Role of RNA interference in plant improvement
NASA Astrophysics Data System (ADS)
Jagtap, Umesh Balkrishna; Gurav, Ranjit Gajanan; Bapat, Vishwas Anant
2011-06-01
Research to alter crops for their better performance involving modern technology is underway in numerous plants, and achievements in transgenic plants are impacting crop improvements in unparalleled ways. Striking progress has been made using genetic engineering technology over the past two decades in manipulating genes from diverse and exotic sources, and inserting them into crop plants for inducing desirable characteristics. RNA interference (RNAi) has recently been identified as a natural mechanism for regulation of gene expression in all higher organisms from plants to humans and promises greater accuracy and precision to plant improvement. The expression of any gene can be down-regulated in a highly explicit manner exclusive of affecting the expression of any other gene by using RNAi technologies. Additional research in this field has been focused on a number of other areas including microRNAs, hairpin RNA, and promoter methylation. Manipulating new RNAi pathways, which generate small RNA molecules to amend gene expression in crops, can produce new quality traits and having better potentiality of protection against abiotic and biotic stresses. Nutritional improvement, change in morphology, or enhanced secondary metabolite synthesis are some of the other advantages of RNAi technology. In addition to its roles in regulating gene expression, RNAi is also used as a natural defense mechanism against molecular parasites such as jumping genes and viral genetic elements that affect genome stability. Even though much advancement has been made on the field of RNAi over the preceding few years, the full prospective of RNAi for crop improvement remains to be fully realized. The intricacy of RNAi pathway, the molecular machineries, and how it relates to plant development are still to be explained.
McLinden, James H; Bhattarai, Nirjal; Stapleton, Jack T; Chang, Qing; Kaufman, Thomas M; Cassel, Suzanne L; Sutterwala, Fayyaz S; Haim, Hillel; Houtman, Jon C; Xiang, Jinhua
2017-11-27
The Flavivirus genus within the Flaviviridae family is comprised of many important human pathogens including yellow fever virus (YFV), dengue virus (DENV), and Zika virus (ZKV), all of which are global public health concerns. Although the related flaviviruses hepatitis C virus and human pegivirus (formerly named GBV-C) interfere with T-cell receptor (TCR) signaling by novel RNA and protein-based mechanisms, the effect of other flaviviruses on TCR signaling is unknown. Here, we studied the effect of YFV, DENV, and ZKV on TCR signaling. Both YFV and ZKV replicated in human T cells in vitro; however, only YFV inhibited TCR signaling. This effect was mediated at least in part by the YFV envelope (env) protein coding RNA. Deletion mutagenesis studies demonstrated that expression of a short, YFV env RNA motif (vsRNA) was required and sufficient to inhibit TCR signaling. Expression of this vsRNA and YFV infection of T cells reduced the expression of a Src-kinase regulatory phosphatase (PTPRE), while ZKV infection did not. YFV infection in mice resulted in impaired TCR signaling and PTPRE expression, with associated reduction in murine response to experimental ovalbumin vaccination. Together, these data suggest that viruses within the flavivirus genus inhibit TCR signaling in a species-dependent manner. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
Current progress of siRNA/shRNA therapeutics in clinical trials.
Burnett, John C; Rossi, John J; Tiemann, Katrin
2011-09-01
Through a mechanism known as RNA interference (RNAi), small interfering RNA (siRNA) molecules can target complementary mRNA strands for degradation, thus specifically inhibiting gene expression. The ability of siRNAs to inhibit gene expression offers a mechanism that can be exploited for novel therapeutics. Indeed, over the past decade, at least 21 siRNA therapeutics have been developed for more than a dozen diseases, including various cancers, viruses, and genetic disorders. Like other biological drugs, RNAi-based therapeutics often require a delivery vehicle to transport them to the targeted cells. Thus, the clinical advancement of numerous siRNA drugs has relied on the development of siRNA carriers, including biodegradable nanoparticles, lipids, bacteria, and attenuated viruses. Most therapies permit systemic delivery of the siRNA drug, while others use ex vivo delivery by autologous cell therapy. Advancements in bioengineering and nanotechnology have led to improved control of delivery and release of some siRNA therapeutics. Likewise, progress in molecular biology has allowed for improved design of the siRNA molecules. Here, we provide an overview of siRNA therapeutics in clinical trials, including their clinical progress, the challenges they have encountered, and the future they hold in the treatment of human diseases. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia; ...
2016-10-13
The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia
The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less
Prefrontal inhibition of threat processing reduces working memory interference
Clarke, Robert; Johnstone, Tom
2013-01-01
Bottom-up processes can interrupt ongoing cognitive processing in order to adaptively respond to emotional stimuli of high potential significance, such as those that threaten wellbeing. However it is vital that this interference can be modulated in certain contexts to focus on current tasks. Deficits in the ability to maintain the appropriate balance between cognitive and emotional demands can severely impact on day-to-day activities. This fMRI study examined this interaction between threat processing and cognition; 18 adult participants performed a visuospatial working memory (WM) task with two load conditions, in the presence and absence of anxiety induction by threat of electric shock. Threat of shock interfered with performance in the low cognitive load condition; however interference was eradicated under high load, consistent with engagement of emotion regulation mechanisms. Under low load the amygdala showed significant activation to threat of shock that was modulated by high cognitive load. A directed top-down control contrast identified two regions associated with top-down control; ventrolateral PFC and dorsal ACC. Dynamic causal modeling provided further evidence that under high cognitive load, top-down inhibition is exerted on the amygdala and its outputs to prefrontal regions. Additionally, we hypothesized that individual differences in a separate, non-emotional top-down control task would predict the recruitment of dorsal ACC and ventrolateral PFC during top-down control of threat. Consistent with this, performance on a separate dichotic listening task predicted dorsal ACC and ventrolateral PFC activation during high WM load under threat of shock, though activation in these regions did not directly correlate with WM performance. Together, the findings suggest that under high cognitive load and threat, top-down control is exerted by dACC and vlPFC to inhibit threat processing, thus enabling WM performance without threat-related interference. PMID
Impaired inhibition of proactive interference in abstinent individuals with alcoholism.
Noël, Xavier; Billieux, Joël; Van der Linden, Martial; Dan, Bernard; Hanak, Catherine; de Bournonville, Stéphanie; Baurain, Céline; Verbanck, Paul
2009-01-01
Cognitive impairment has been associated with higher risk of alcoholism and relapse. Recent theoretical refinements have separated inhibition of dominant response and inhibition of proactive interference. We assessed the latter using a directed-forgetting procedure in 38 recently detoxified individuals with alcoholism and in 26 controls. On this task, memory performance of letter trigrams was compared when presented alone, followed by a second trigram to be recalled, then a second trigram to be forgotten (directed-forgetting condition). Individuals with alcoholism recalled more letters to be forgotten and performed worse than controls in the directed-forgetting condition, which significantly correlated with the duration of alcoholism.
Using RNA Interference to Reveal Genetic Vulnerabilities in Human Cancer Cells
2005-07-01
pl of RNase/DNase free water and performed PCR amplification in 50pl reaction volumes using Invitrogen’s Platinum® Pfx DNA Polymerase . To obtain a...destroyed1’ 2. This pathway, known as RNA interference (RNAi), has been exploited in organisms ranging from plants to fungi to animals for...experimentally alter its targeting capability. Indeed such strategies have previously succeeded in both plants and animals23. My initial studies
Todorov, I N; Shen, R A; Zheliabovskaia, S M; Galkin, A P
1976-10-01
A drastic inhibition of protein biosynthesis in rat liver in vivo by cycloheximide (CHI) (0.3 mg/100 g of body weight) first caused an increase of RNA synthesis (after 1 hour), which was then followed by its decrease. Partial gradual restoration of the protein synthesis level was shown to be accompanied by a repeated increase of RNA synthesis (12 hs) and its normalisation after 24 hs. The first maximum of RNA synthesis increase in the isolated nuclei system was AU-type RNA synthesis (sensitive to alpha-amanitine), the second one was due to GC-type RNA synthesis (resistant to this toxin). Purified chromatine template activity in the system with E. coli RNA polymerase (by 14%) an hour after CHI treatment, but 3 hrs later was decreased and subsequently restored (12 hrs after CHI injection). The changes of RNA biosynthesis induced by prolonged protein synthesis inhibition suggest the existence of continuous RNA synthesis control in nuclei. This control is realized by translation system using the feed back principle.
How Golden Is Silence? Teaching Undergraduates the Power and Limits of RNA Interference
ERIC Educational Resources Information Center
Kuldell, Natalie H.
2006-01-01
It is hard and getting harder to strike a satisfying balance in teaching. Time dedicated to student-generated models or ideas is often sacrificed in an effort to "get through the syllabus." I describe a series of RNA interference (RNAi) experiments for undergraduate students that simultaneously explores fundamental concepts in gene regulation,…
Lei, Ming; Jiao, Hanwei; Liu, Tao; Du, Li; Cheng, Ying; Zhang, Donglin; Hao, Yongchang; Man, Churiga; Wang, Fengyang
2011-10-01
Innate immunity plays a key role in protecting a host against invading microorganism, including Gram-negative bacteria. Cluster of differentiation antigen 14 (CD14) is an important innate immunity molecule, existing as a soluble (sCD14) and membrane-associated (mCD14) protein. Endotoxin [lipopolysaccharide (LPS)] is recognized as a key molecule in the pathogenesis of sepsis and septic shock caused by Gram negative bacteria. Emerging evidences indicate that upstream inhibition of bacterial LPS/Toll-like receptor 4(TLR4)/CD14-mediated inflammation pathway is an effective therapeutic approach for attenuating damaging immune activation. RNA interference (RNAi) provides a promising approach to down-regulate gene expression specifically. To explore the possibility of using RNAi against mCD14 as a strategy for inhibiting the secretion of cytokines and the nitric oxide (NO) production from LPS-activated RAW264.7 cells, four different short interfering RNA (siRNA) molecules corresponding to the sequence of mCD14 gene were designed and synthesized. We then tested the inhibition effects of these siRNA molecules on mCD14 expression by real-time quantitative RT-PCR and Western blot. After effective siRNA molecule (mCD14-siRNA-224), which is capable of reducing messenger RNA (mRNA) accumulation and protein expression of mCD14 specifically, was identified, RAW264.7 cells pretreated with mCD14-siRNA-224 were stimulated with LPS, and the secretion of tumor necrosis factor alpha (TNF-α), macrophage inflammatory protein-2 (MIP-2) and interleukin-6 (IL-6) and the NO production were evaluated. The results indicated that mCD14-siRNA-224 effectively inhibited TNF-α, MIP-2, and IL-6 release and NO production from LPS-stimulated RAW 264.7 cells by down-regulating mRNA accumulation and protein expression of mCD14 specifically. These findings provide useful information for the development of RNAi-based prophylaxis and therapy for endotoxin-related diseases.
Wang, Hong; Sun, Ruowen; Chi, Zuofei; Li, Shuang; Hao, Liangchun
2017-09-01
Y-box binding protein-1 (YB-1), a member of Y-box protein family binding DNA and RNA, has been proposed as a novel marker in multiple malignant tumors and found to be associated with tumor malignancy. Neuroblastoma is an embryonal tumor arising from neuroblast cells of the autonomic nervous system, which is the most common cancer diagnosed in infants. It has been reported that YB-1 is highly expressing in various human tumors including nasopharynx, thyroid, lung, breast, colon, ovary, and prostate cancers. This study aimed to investigate the functional role of YB-1 in neuroblastoma by silencing YB-1 using RNA interference (shRNA) in neuroblastoma SH-SY5Y cells. We found that silencing of YB-1 decreased the proliferation, migration, and invasion of SH-SY5Y cells. At molecular level, inhibition of YB-1 decreased the expression level of PCNA as well as MMP-2 in neuroblastoma SH-SY5Y cells. Also, we discovered that YB-1 silencing sensitized SH-SY5Y cells to cisplatin and promoted the apoptosis induced by cisplatin due to down-regulation of multidrug resistance (MDR) 1 protein via NF-κB signaling pathway. Therefore, we consider that targeting YB-1 is promising for neuroblastoma treatment and for overcoming its cisplatin resistance in the development of new neuroblastoma therapeutic strategies.
Crook, Nathan C; Schmitz, Alexander C; Alper, Hal S
2014-05-16
Reduction of endogenous gene expression is a fundamental operation of metabolic engineering, yet current methods for gene knockdown (i.e., genome editing) remain laborious and slow, especially in yeast. In contrast, RNA interference allows facile and tunable gene knockdown via a simple plasmid transformation step, enabling metabolic engineers to rapidly prototype knockdown strategies in multiple strains before expending significant cost to undertake genome editing. Although RNAi is naturally present in a myriad of eukaryotes, it has only been recently implemented in Saccharomyces cerevisiae as a heterologous pathway and so has not yet been optimized as a metabolic engineering tool. In this study, we elucidate a set of design principles for the construction of hairpin RNA expression cassettes in yeast and implement RNA interference to quickly identify routes for improvement of itaconic acid production in this organism. The approach developed here enables rapid prototyping of knockdown strategies and thus accelerates and reduces the cost of the design-build-test cycle in yeast.
On future's doorstep: RNA interference and the pharmacopeia of tomorrow.
Gewirtz, Alan M
2007-12-01
Small molecules and antibodies have revolutionized the treatment of malignant diseases and appear promising for the treatment of many others. Nonetheless, there are many candidate therapeutic targets that are not amenable to attack by the current generation of targeted therapies, and in a small but growing number of patients, resistance to initially successful treatments evolves. This Review Series on the medicinal promise of posttranscriptional gene silencing with small interfering RNA and other molecules capable of inducing RNA interference (RNAi) is motivated by the hypothesis that effectors of RNAi can be developed into effective drugs for treating malignancies as well as many other types of disease. As this Review Series points out, there is still much to do, but many in the field now hope that the time has finally arrived when "antisense" therapies will finally come of age and fulfill their promise as the magic bullets of the 21st century.
Negative Priming Effect after Inhibition of Weight/Number Interference in a Piaget-Like Task
ERIC Educational Resources Information Center
Schirlin, Olivier; Houde, Olivier
2007-01-01
Piagetian tasks have more to do with the child's ability to inhibit interference than they do with the ability to grasp their underlying logic. Here we used a chronometric paradigm with 11-year-olds, who succeed in Piaget's conservation-of-weight task, to test the role of cognitive inhibition in a priming version of this classical task. The…
Boric acid reversibly inhibits the second step of pre-mRNA splicing.
Shomron, Noam; Ast, Gil
2003-09-25
Several approaches have been used to identify the factors involved in mRNA splicing. None of them, however, comprises a straightforward reversible method for inhibiting the second step of splicing using an external reagent other than a chelator. This investigation demonstrates that the addition of boric acid to an in vitro pre-mRNA splicing reaction causes a dose-dependent reversible inhibition effect on the second step of splicing. The mechanism of action does not involve chelation of several metal ions; hindrance of 3' splice-site; or binding to hSlu7. This study presents a novel method for specific reversible inhibition of the second step of pre-mRNA splicing.
Nunes, Francis M. F.; Aleixo, Aline C.; Barchuk, Angel R.; Bomtorin, Ana D.; Grozinger, Christina M.; Simões, Zilá L. P.
2013-01-01
RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control. PMID:26466797
Nunes, Francis M F; Aleixo, Aline C; Barchuk, Angel R; Bomtorin, Ana D; Grozinger, Christina M; Simões, Zilá L P
2013-01-04
RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control.
Basnet, Sanjay; Kamble, Shripat T
2018-05-01
Bed bugs are one the most troublesome household pests that feed primarily on human blood. RNA interference (RNAi) is currently being pursued as a potential tool for insect population management and has shown efficacy against some phytophagous insects. We evaluated the different techniques to deliver dsRNA specific to bed bug muscle actin (dsactin) into bed bugs. Initially, stability of dsRNA in human blood was studied to evaluate the feasibility of feeding method. Adult bed bugs were injected with dsRNA between last thoracic segment and first abdominal segment on the ventral side, with a dose of 0.2 µg dsactin per insect. In addition to injection, dsactin was mixed in acetone and treated topically in the abdomens of fifth stage nymphs. We found the quick degradation of dsRNA in blood. Injection of dsactin caused significant depletion of actin transcripts and substantial reduction in oviposition and lethality in female adults. Topically treated dsRNA in fifth stage nymphs had no effect on actin mRNA expression and survival. Our results demonstrated that injection is a reliable method of dsRNA delivery into bed bugs while topical treatment was not successful. This research provides an understanding on effective delivery methods of dsRNA into bed bugs for functional genomics research and feasibility of the RNAi based molecules for pest management purposes.
Hao, Junli; Jin, Wensong; Li, Xinghui; Wang, Saifeng; Zhang, Xiaojun; Fan, Hongxia; Li, Changfei; Chen, Lizhao; Gao, Bin; Liu, Guangze; Meng, Songdong
2013-01-01
Alpha interferon (IFN-α)-based therapy can effectively treat chronic hepatitis B virus (HBV) infection, which causes life-threatening complications. Responses to IFN-α therapy vary greatly in chronic hepatitis B (CHB) patients, but underlying mechanisms are almost unknown. In this study, we found that IFN-α treatment induced a marked decrease of microRNA-122 (miR-122) expression in hepatocytes. We next showed that IFN-α-induced miR-122 downregulation was only partly due to transcriptional suppression. One IFN-stimulated gene (ISG), NT5C3, which was identified as a miR-122 target, efficiently inhibited miR-122 by binding and sequestering miR-122 with its mRNA 3'-untranslated region (3'-UTR), indicating that this ISG is involved in IFN-α-mediated miR-122 suppression. Notably, the inhibitory effect of IFN-α on miR-122 was completely abolished by blocking IFN-α-induced upregulation of NT5C3 mRNA expression by RNA interference (RNAi). Meanwhile, we observed that miR-122 dramatically inhibited HBV expression and replication. Finally, we showed that IFN-α-mediated HBV-inhibitory effects could be enhanced significantly by blocking IFN-α-induced downregulation of miR-122. We therefore concluded that IFN-α-induced inhibition of miR-122 may negatively affect the anti-HBV function of IFN-α. These data provide valuable insights for a better understanding of the antiviral mechanism of IFN-α and raise further potential interest in enhancing its anti-HBV efficacy.
Hao, Junli; Jin, Wensong; Li, Xinghui; Wang, Saifeng; Zhang, Xiaojun; Fan, Hongxia; Li, Changfei; Chen, Lizhao; Gao, Bin
2013-01-01
Alpha interferon (IFN-α)-based therapy can effectively treat chronic hepatitis B virus (HBV) infection, which causes life-threatening complications. Responses to IFN-α therapy vary greatly in chronic hepatitis B (CHB) patients, but underlying mechanisms are almost unknown. In this study, we found that IFN-α treatment induced a marked decrease of microRNA-122 (miR-122) expression in hepatocytes. We next showed that IFN-α-induced miR-122 downregulation was only partly due to transcriptional suppression. One IFN-stimulated gene (ISG), NT5C3, which was identified as a miR-122 target, efficiently inhibited miR-122 by binding and sequestering miR-122 with its mRNA 3′-untranslated region (3′-UTR), indicating that this ISG is involved in IFN-α-mediated miR-122 suppression. Notably, the inhibitory effect of IFN-α on miR-122 was completely abolished by blocking IFN-α-induced upregulation of NT5C3 mRNA expression by RNA interference (RNAi). Meanwhile, we observed that miR-122 dramatically inhibited HBV expression and replication. Finally, we showed that IFN-α-mediated HBV-inhibitory effects could be enhanced significantly by blocking IFN-α-induced downregulation of miR-122. We therefore concluded that IFN-α-induced inhibition of miR-122 may negatively affect the anti-HBV function of IFN-α. These data provide valuable insights for a better understanding of the antiviral mechanism of IFN-α and raise further potential interest in enhancing its anti-HBV efficacy. PMID:23055569
Therapeutic synergy between microRNA and siRNA in ovarian cancer treatment.
Nishimura, Masato; Jung, Eun-Jung; Shah, Maitri Y; Lu, Chunhua; Spizzo, Riccardo; Shimizu, Masayoshi; Han, Hee Dong; Ivan, Cristina; Rossi, Simona; Zhang, Xinna; Nicoloso, Milena S; Wu, Sherry Y; Almeida, Maria Ines; Bottsford-Miller, Justin; Pecot, Chad V; Zand, Behrouz; Matsuo, Koji; Shahzad, Mian M; Jennings, Nicholas B; Rodriguez-Aguayo, Cristian; Lopez-Berestein, Gabriel; Sood, Anil K; Calin, George A
2013-11-01
Development of improved RNA interference-based strategies is of utmost clinical importance. Although siRNA-mediated silencing of EphA2, an ovarian cancer oncogene, results in reduction of tumor growth, we present evidence that additional inhibition of EphA2 by a microRNA (miRNA) further "boosts" its antitumor effects. We identified miR-520d-3p as a tumor suppressor upstream of EphA2, whose expression correlated with favorable outcomes in two independent patient cohorts comprising 647 patients. Restoration of miR-520d-3p prominently decreased EphA2 protein levels, and suppressed tumor growth and migration/invasion both in vitro and in vivo. Dual inhibition of EphA2 in vivo using 1,2-dioleoyl-sn-glycero-3-phosphatidylcholine (DOPC) nanoliposomes loaded with miR-520d-3p and EphA2 siRNA showed synergistic antitumor efficiency and greater therapeutic efficacy than either monotherapy alone. This synergy is at least in part due to miR-520d-3p targeting EphB2, another Eph receptor. Our data emphasize the feasibility of combined miRNA-siRNA therapy, and will have broad implications for innovative gene silencing therapies for cancer and other diseases. This study addresses a new concept of RNA inhibition therapy by combining miRNA and siRNA in nanoliposomal particles to target oncogenic pathways altered in ovarian cancer. Combined targeting of the Eph pathway using EphA2-targeting siRNA and the tumor suppressor miR-520d-3p exhibits remarkable therapeutic synergy and enhanced tumor suppression in vitro and in vivo compared with either monotherapy alone. ©2013 AACR.
Fan, Jie; Liu, Wanting; Lei, Hui; Cai, Lin; Zhong, Mingtian; Dong, Jiaojiao; Zhou, Cheng; Zhu, Xiongzhao
2016-05-01
Obsessive-compulsive disorder (OCD) is characterized by unwanted, intrusive thoughts (obsessions) and/or repetitive, ritualistic behaviors (compulsions). Findings related to the two components of inhibition, namely interference control and behavioral inhibition, among OCD patients have been inconsistent. It might be that this inconsistency is due to the heterogeneity among OCD cases representing multiple subtypes of OCD, such as autogenous obsessions and reactive obsessions types (AOs vs. ROs). AOs and ROs are distinguished by the category of their most disturbing obsessions. The purpose of this study was to systematically examine whether inhibition functions differ between AO and RO patients. We assessed interference control and behavioral inhibition with the emotional Stroop task (EST) and stop-signal task (SST), respectively, in 42 AOs, 55 ROs and 62 healthy controls (HCs) and event-related potentials (ERPs) were recorded in a random subset of these subjects (25 AOs, 25 ROs, and 31HCs). Results showed that in the EST, AOs exhibited longer reaction times (RTs) for color-naming positive-, negative-, and neutral-valence word stimulus than both ROs and HCs, and demonstrated larger P2 and less negative N450 amplitudes than HCs and larger P3 amplitudes than ROs and HCs. In the SST, both AOs and ROs showed lengthened stop signal reaction time (SSRT) and reduced Stop-P3 amplitudes in successful inhibition (SI) trials compared to the HC group. These present findings suggest that behavioral inhibition impairment may reflect a common pathology in both the autogenous- and reactive-type OCD patients, whereas interference inhibition impairment appears to be specific to patients with autogenous obsessions. These findings strengthened the insight into the clinical heterogeneity and pathophysiology of OCD. Copyright © 2016 Elsevier B.V. All rights reserved.
Virus-Derived Gene Expression and RNA Interference Vector for Grapevine
Kurth, Elizabeth G.; Peremyslov, Valera V.; Prokhnevsky, Alexey I.; Kasschau, Kristin D.; Miller, Marilyn; Carrington, James C.
2012-01-01
The improvement of the agricultural and wine-making qualities of the grapevine (Vitis vinifera) is hampered by adherence to traditional varieties, the recalcitrance of this plant to genetic modifications, and public resistance to genetically modified organism (GMO) technologies. To address these challenges, we developed an RNA virus-based vector for the introduction of desired traits into grapevine without heritable modifications to the genome. This vector expresses recombinant proteins in the phloem tissue that is involved in sugar transport throughout the plant, from leaves to roots to berries. Furthermore, the vector provides a powerful RNA interference (RNAi) capability of regulating the expression of endogenous genes via virus-induced gene-silencing (VIGS) technology. Additional advantages of this vector include superb genetic capacity and stability, as well as the swiftness of technology implementation. The most significant applications of the viral vector include functional genomics of the grapevine and disease control via RNAi-enabled vaccination against pathogens or invertebrate pests. PMID:22438553
Elhassan, Mohamed O.; Christie, Jennifer; Duxbury, Mark S.
2012-01-01
Locally initiated RNA interference (RNAi) has the potential for spatial propagation, inducing posttranscriptional gene silencing in distant cells. In Caenorhabditis elegans, systemic RNAi requires a phylogenetically conserved transmembrane channel, SID-1. Here, we show that a human SID-1 orthologue, SIDT1, facilitates rapid, contact-dependent, bidirectional small RNA transfer between human cells, resulting in target-specific non-cell-autonomous RNAi. Intercellular small RNA transfer can be both homotypic and heterotypic. We show SIDT1-mediated intercellular transfer of microRNA-21 to be a driver of resistance to the nucleoside analog gemcitabine in human adenocarcinoma cells. Documentation of a SIDT1-dependent small RNA transfer mechanism and the associated phenotypic effects on chemoresistance in human cancer cells raises the possibility that conserved systemic RNAi pathways contribute to the acquisition of drug resistance. Mediators of non-cell-autonomous RNAi may be tractable targets for novel therapies aimed at improving the efficacy of current cytotoxic agents. PMID:22174421
Zhang, Liang; Das, Priyabrata; Schmolke, Mirco; Manicassamy, Balaji; Wang, Yaming; Deng, Xiaoyi; Cai, Ling; Tu, Benjamin P.; Forst, Christian V.; Roth, Michael G.; Levy, David E.; García-Sastre, Adolfo; de Brabander, Jef; Phillips, Margaret A.
2012-01-01
The NS1 protein of influenza virus is a major virulence factor essential for virus replication, as it redirects the host cell to promote viral protein expression. NS1 inhibits cellular messenger ribonucleic acid (mRNA) processing and export, down-regulating host gene expression and enhancing viral gene expression. We report in this paper the identification of a nontoxic quinoline carboxylic acid that reverts the inhibition of mRNA nuclear export by NS1, in the absence or presence of the virus. This quinoline carboxylic acid directly inhibited dihydroorotate dehydrogenase (DHODH), a host enzyme required for de novo pyrimidine biosynthesis, and partially reduced pyrimidine levels. This effect induced NXF1 expression, which promoted mRNA nuclear export in the presence of NS1. The release of NS1-mediated mRNA export block by DHODH inhibition also occurred in the presence of vesicular stomatitis virus M (matrix) protein, another viral inhibitor of mRNA export. This reversal of mRNA export block allowed expression of antiviral factors. Thus, pyrimidines play a necessary role in the inhibition of mRNA nuclear export by virulence factors. PMID:22312003
ERIC Educational Resources Information Center
Buluwela, Laki; Kamalati, Tahereh; Photiou, Andy; Heathcote, Dean A.; Jones, Michael D.; Ali, Simak
2010-01-01
RNA mediated gene interference (RNAi) is now a key tool in eukaryotic cell and molecular biology research. This article describes a five session laboratory practical, spread over a seven day period, to introduce and illustrate the technique. During the exercise, students working in small groups purify PCR products that encode "in vitro"…
Trojan Horse Strategy for Non-invasive Interference of Clock Gene in the Oyster Crassostrea gigas.
Payton, Laura; Perrigault, Mickael; Bourdineaud, Jean-Paul; Marcel, Anjara; Massabuau, Jean-Charles; Tran, Damien
2017-08-01
RNA interference is a powerful method to inhibit specific gene expression. Recently, silencing target genes by feeding has been successfully carried out in nematodes, insects, and small aquatic organisms. A non-invasive feeding-based RNA interference is reported here for the first time in a mollusk bivalve, the pacific oyster Crassostrea gigas. In this Trojan horse strategy, the unicellular alga Heterocapsa triquetra is the food supply used as a vector to feed oysters with Escherichia coli strain HT115 engineered to express the double-stranded RNA targeting gene. To test the efficacy of the method, the Clock gene, a central gene of the circadian clock, was targeted for knockout. Results demonstrated specific and systemic efficiency of the Trojan horse strategy in reducing Clock mRNA abundance. Consequences of Clock disruption were observed in Clock-related genes (Bmal, Tim1, Per, Cry1, Cry2, Rev.-erb, and Ror) and triploid oysters were more sensitive than diploid to the interference. This non-invasive approach shows an involvement of the circadian clock in oyster bioaccumulation of toxins produced by the harmful alga Alexandrium minutum.
Hassan, Ali
2006-06-01
RNA interference (RNAi) in eukaryotes is a recently identified phenomenon in which small double stranded RNA molecules called short interfering RNA (siRNA) interact with messenger RNA (mRNA) containing homologous sequences in a sequence-specific manner. Ultimately, this interaction results in degradation of the target mRNA. Because of the high sequence specificity of the RNAi process, and the apparently ubiquitous expression of the endogenous protein components necessary for RNAi, there appears to be little limitation to the genes that can be targeted for silencing by RNAi. Thus, RNAi has enormous potential, both as a research tool and as a mode of therapy. Several recent patents have described advances in RNAi technology that are likely to lead to new treatments for cardiovascular disease. These patents have described methods for increased delivery of siRNA to cardiovascular target tissues, chemical modifications of siRNA that improve their pharmacokinetic characteristics, and expression vectors capable of expressing RNAi effectors in situ. Though RNAi has only recently been demonstrated to occur in mammalian tissues, work has advanced rapidly in the development of RNAi-based therapeutics. Recently, therapeutic silencing of apoliporotein B, the ligand for the low density lipoprotein receptor, has been demonstrated in adult mice by systemic administration of chemically modified siRNA. This demonstrates the potential for RNAi-based therapeutics, and suggests that the future for RNAi in the treatment of cardiovascular disease is bright.
Immune modulation through RNA interference-mediated silencing of CD40 in dendritic cells.
Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Samiee, Shahram; Ataee, Zahra; Tabei, Seyyed Ziyaoddin; Moazzeni, Seyed Mohammad
2009-01-01
RNA interference (RNAi) is an exciting mechanism for knocking down any target gene in transcriptional level. It is now clear that small interfering RNA (siRNA), a 19-21nt long dsRNA, can trigger a degradation process (RNAi) that specifically silences the expression of a cognate mRNA. Our findings in this study showed that down regulation of CD40 gene expression in dendritic cells (DCs) by RNAi culminated to immune modulation. Effective delivery of siRNA into DCs would be a reasonable method for the blocking of CD40 gene expression at the cell surface without any effect on other genes and cell cytotoxicity. The effects of siRNA against CD40 mRNA on the function and phenotype of DCs were investigated. The DCs were separated from the mice spleen and then cultured in vitro. By the means of Lipofectamine2000, siRNA was delivered to the cells and the efficacy of transfection was estimated by flow cytometry. By Annexine V and Propidium Iodide staining, we could evaluate the transfected cells viability. Also, the mRNA expression and protein synthesis were assessed by real-time PCR and flow cytometry, respectively. Knocking down the CD40 gene in the DCs caused an increase in IL-4 production, decrease in IL-12 production and allostimulation activity. All together, these effects would stimulate Th2 cytokines production from allogenic T-cells in vitro.
Chen, Weizao; Liu, Mingqiu; Jiao, Ye; Yan, Weiyao; Wei, Xuefeng; Chen, Jiulian; Fei, Liang; Liu, Yang; Zuo, Xiaoping; Yang, Fugui; Lu, Yonggan; Zheng, Zhaoxin
2006-04-01
Foot-and-mouth disease virus (FMDV) infection is responsible for the heavy economic losses in stockbreeding each year. Because of the limited effectiveness of existing vaccines and antiviral drugs, the development of new strategies is needed. RNA interference (RNAi) is an effective means of suppressing virus replication in vitro. Here we demonstrate that treatment with recombinant, replication-defective human adenovirus type 5 (Ad5) expressing short-hairpin RNAs (shRNAs) directed against either structural protein 1D (Ad5-NT21) or polymerase 3D (Ad5-POL) of FMDV totally protects swine IBRS-2 cells from homologous FMDV infection, whereas only Ad5-POL inhibits heterologous FMDV replication. Moreover, delivery of these shRNAs significantly reduces the susceptibility of guinea pigs and swine to FMDV infection. Three of five guinea pigs inoculated with 10(6) PFU of Ad5-POL and challenged 24 h later with 50 50% infectious doses (ID50) of homologous virus were protected from the major clinical manifestation of disease: the appearance of vesicles on the feet. Two of three swine inoculated with an Ad5-NT21-Ad5-POL mixture containing 2 x 10(9) PFU each and challenged 24 h later with 100 ID50 of homologous virus were protected from the major clinical disease, but treatment with a higher dose of adenovirus mixture cannot promote protection of animals. The inhibition was rapid and specific because treatment with a control adenovirus construct (Ad5-LacZ) expressing Escherichia coli galactosidase-specific shRNA showed no marked antiviral activity. Our data highlight the in vivo potential of RNAi technology in the case of FMD.
Simultaneous inhibition of multiple oncogenic miRNAs by a multi-potent microRNA sponge.
Jung, Jaeyun; Yeom, Chanjoo; Choi, Yeon-Sook; Kim, Sinae; Lee, EunJi; Park, Min Ji; Kang, Sang Wook; Kim, Sung Bae; Chang, Suhwan
2015-08-21
The roles of oncogenic miRNAs are widely recognized in many cancers. Inhibition of single miRNA using antagomiR can efficiently knock-down a specific miRNA. However, the effect is transient and often results in subtle phenotype, as there are other miRNAs contribute to tumorigenesis. Here we report a multi-potent miRNA sponge inhibiting multiple miRNAs simultaneously. As a model system, we targeted miR-21, miR-155 and miR-221/222, known as oncogenic miRNAs in multiple tumors including breast and pancreatic cancers. To achieve efficient knockdown, we generated perfect and bulged-matched miRNA binding sites (MBS) and introduced multiple copies of MBS, ranging from one to five, in the multi-potent miRNA sponge. Luciferase reporter assay showed the multi-potent miRNA sponge efficiently inhibited 4 miRNAs in breast and pancreatic cancer cells. Furthermore, a stable and inducible version of the multi-potent miRNA sponge cell line showed the miRNA sponge efficiently reduces the level of 4 target miRNAs and increase target protein level of these oncogenic miRNAs. Finally, we showed the miRNA sponge sensitize cells to cancer drug and attenuate cell migratory activity. Altogether, our study demonstrates the multi-potent miRNA sponge is a useful tool to examine the functional impact of simultaneous inhibition of multiple miRNAs and proposes a therapeutic potential.
Li, J; Hu, G H; Kong, F J; Wu, K M; He, B; Song, K; Sun, W J
2014-01-01
Increased expression of STMN1 has been observed in many tumor forms, but its expression and potential biological role in pancreatic cancer is still unknown. In this study, we demonstrated that STMN1 was expressed to a large extent in pancreatic cancer tissues and cell lines as compared to normal pancreatic tissues. Suppression of STMN1 expression via transfection with STMN1-specific siRNA could not only significantly inhibit the proliferation, migration and invasion ability of Panc-1 cells, but also enhance the apoptosis of Panc-1 cells. In addition, downregulation of STMN1 obviously enhanced the acetylation level of α-tubulin. All these results indicated that STMN1 plays an important role in pancreatic cancer development, and might serve as a potential therapeutic target for pancreatic cancer.
Modulating drug resistance by targeting BCRP/ABCG2 using retrovirus-mediated RNA interference.
Xie, Ni; Mou, Lisha; Yuan, Jianhui; Liu, Wenlan; Deng, Tingting; Li, Zigang; Jing, Yi; Jin, Yi; Hu, Zhangli
2014-01-01
The BCRP/ABCG2 transporter, which mediates drug resistance in many types of cells, depends on energy provided by ATP hydrolysis. Here, a retrovirus encoding a shRNA targeting the ATP-binding domain of this protein was used to screen for highly efficient agents that could reverse drug resistance and improve cell sensitivity to drugs, thus laying the foundation for further studies and applications. To target the ATP-binding domain of BCRP/ABCG2, pLenti6/BCRPsi shRNA recombinant retroviruses, with 20 bp target sequences starting from the 270th, 745th and 939th bps of the 6th exon, were constructed and packaged. The pLenti6/BCRPsi retroviruses (V-BCRPi) that conferred significant knockdown effects were screened using a drug-sensitivity experiment and flow cytometry. The human choriocarcinoma cell line JAR, which highly expresses endogenous BCRP/ABCG2, was injected under the dorsal skin of a hairless mouse to initiate a JAR cytoma. After injecting V-BCRPi-infected JAR tumor cells into the dorsal skin of hairless mice, BCRP/ABCG2 expression in the tumor tissue was determined using immunohistochemistry, fluorescent quantitative RT-PCR and Western blot analyses. After intraperitoneal injection of BCRP/ABCG2-tolerant 5-FU, the tumor volume, weight change, and apoptosis rate of the tumor tissue were determined using in situ hybridization. V-BCRPi increased the sensitivity of the tumor histiocytes to 5-FU and improved the cell apoptosis-promoting effects of 5-FU in the tumor. The goal of the in vivo and in vitro studies was to screen for an RNA interference recombinant retrovirus capable of stably targeting the ATP-binding domain of BCRP/ABCG2 (V-BCRPi) to inhibit its function. A new method to improve the chemo-sensitivity of breast cancer and other tumor cells was discovered, and this method could be used for gene therapy and functional studies of malignant tumors.
RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding.
Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung
2014-01-01
RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties.
RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding
Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung
2014-01-01
RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties. PMID:25332689
Modulation of RNA function by aminoglycoside antibiotics.
Schroeder, R; Waldsich, C; Wank, H
2000-01-04
One of the most important families of antibiotics are the aminoglycosides, including drugs such as neomycin B, paromomycin, gentamicin and streptomycin. With the discovery of the catalytic potential of RNA, these antibiotics became very popular due to their RNA-binding capacity. They serve for the analysis of RNA function as well as for the study of RNA as a potential therapeutic target. Improvements in RNA structure determination recently provided first insights into the decoding site of the ribosome at high resolution and how aminoglycosides might induce misreading of the genetic code. In addition to inhibiting prokaryotic translation, aminoglycosides inhibit several catalytic RNAs such as self-splicing group I introns, RNase P and small ribozymes in vitro. Furthermore, these antibiotics interfere with human immunodeficiency virus (HIV) replication by disrupting essential RNA-protein contacts. Most exciting is the potential of many RNA-binding antibiotics to stimulate RNA activities, conceiving small-molecule partners for the hypothesis of an ancient RNA world. SELEX (systematic evolution of ligands by exponential enrichment) has been used in this evolutionary game leading to small synthetic RNAs, whose NMR structures gave valuable information on how aminoglycosides interact with RNA, which could possibly be used in applied science.
RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans.
Tops, Bastiaan B J; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C; Plasterk, Ronald H A; Ketting, René F
2005-01-01
In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of approximately 250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step.
RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans
Tops, Bastiaan B. J.; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C.; Plasterk, Ronald H. A.; Ketting, René F.
2005-01-01
In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of ∼250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step. PMID:15653635
Ghosh, Saikat Kumar B; Hunter, Wayne B; Park, Alexis L; Gundersen-Rindal, Dawn E
2018-05-04
Phloem and plant sap feeding insects invade the integrity of crops and fruits to retrieve nutrients, in the process damaging food crops. Hemipteran insects account for a number of economically substantial pests of plants that cause damage to crops by feeding on phloem sap. The brown marmorated stink bug (BMSB), Halyomorpha halys (Heteroptera: Pentatomidae) and the Asian citrus psyllid (ACP), Diaphorina citri Kuwayama (Hemiptera: Liviidae) are hemipteran insect pests introduced in North America, where they are an invasive agricultural pest of high-value specialty, row, and staple crops and citrus fruits, as well as a nuisance pest when they aggregate indoors. Insecticide resistance in many species has led to the development of alternate methods of pest management strategies. Double-stranded RNA (dsRNA)-mediated RNA interference (RNAi) is a gene silencing mechanism for functional genomic studies that has potential applications as a tool for the management of insect pests. Exogenously synthesized dsRNA or small interfering RNA (siRNA) can trigger highly efficient gene silencing through the degradation of endogenous RNA, which is homologous to that presented. Effective and environmental use of RNAi as molecular biopesticides for biocontrol of hemipteran insects requires the in vivo delivery of dsRNAs through feeding. Here we demonstrate methods for delivery of dsRNA to insects: loading of dsRNA into green beans by immersion, and absorbing of gene-specific dsRNA with oral delivery through ingestion. We have also outlined non-transgenic plant delivery approaches using foliar sprays, root drench, trunk injections as well as clay granules, all of which may be essential for sustained release of dsRNA. Efficient delivery by orally ingested dsRNA was confirmed as an effective dosage to induce a significant decrease in expression of targeted genes, such as juvenile hormone acid O-methyltransferase (JHAMT) and vitellogenin (Vg). These innovative methods represent strategies for
O'Grady, Michael; Raha, Debasish; Hanson, Bonnie J; Bunting, Michaeline; Hanson, George T
2005-01-01
Background The transcription factor activator protein-1 (AP-1) has been implicated in a large variety of biological processes including oncogenic transformation. The tyrosine kinases of the epidermal growth factor receptor (EGFR) constitute the beginning of one signal transduction cascade leading to AP-1 activation and are known to control cell proliferation and differentiation. Drug discovery efforts targeting this receptor and other pathway components have centred on monoclonal antibodies and small molecule inhibitors. Resistance to such inhibitors has already been observed, guiding the prediction of their use in combination therapies with other targeted agents such as RNA interference (RNAi). This study examines the use of RNAi and kinase inhibitors for qualification of components involved in the EGFR/AP-1 pathway of ME180 cells, and their inhibitory effects when evaluated individually or in tandem against multiple components of this important disease-related pathway. Methods AP-1 activation was assessed using an ME180 cell line stably transfected with a beta-lactamase reporter gene under the control of AP-1 response element following epidermal growth factor (EGF) stimulation. Immunocytochemistry allowed for further quantification of small molecule inhibition on a cellular protein level. RNAi and RT-qPCR experiments were performed to assess the amount of knockdown on an mRNA level, and immunocytochemistry was used to reveal cellular protein levels for the targeted pathway components. Results Increased potency of kinase inhibitors was shown by combining RNAi directed towards EGFR and small molecule inhibitors acting at proximal or distal points in the pathway. After cellular stimulation with EGF and analysis at the level of AP-1 activation using a β-lactamase reporter gene, a 10–12 fold shift or 2.5–3 fold shift toward greater potency in the IC50 was observed for EGFR and MEK-1 inhibitors, respectively, in the presence of RNAi targeting EGFR. Conclusion EGFR
Guan, Ruo-Bing; Li, Hai-Chao; Miao, Xue-Xia
2018-06-01
When using RNA interference (RNAi) to study gene functions in Lepidoptera insects, we discovered that some genes could not be suppressed; instead, their expression levels could be up-regulated by double-stranded RNA (dsRNA). To predict which genes could be easily silenced, we treated the Asian corn borer (Ostrinia furnacalis) with dsGFP (green fluorescent protein) and dsMLP (muscle lim protein). A transcriptome sequence analysis was conducted using the cDNAs 6 h after treatment with dsRNA. The results indicated that 160 genes were up-regulated and 44 genes were down-regulated by the two dsRNAs. Then, 50 co-up-regulated, 25 co-down-regulated and 43 unaffected genes were selected to determine their RNAi responses. All the 25 down-regulated genes were knocked down by their corresponding dsRNA. However, several of the up-regulated and unaffected genes were up-regulated when treated with their corresponding dsRNAs instead of being knocked down. The genes up-regulated by the dsGFP treatment may be involved in insect immune responses or the RNAi pathway. When the immune-related genes were excluded, only seven genes were induced by dsGFP, including ago-2 and dicer-2. These results not only provide a reference for efficient RNAi target predications, but also provide some potential RNAi pathway-related genes for further study. © 2017 Institute of Zoology, Chinese Academy of Sciences.
The inside cover picture shows how siRNAs modified with North bicyclo[3.1.0]hexane 2'-deoxy-pseudosugars are able to activate the RNA interference machinery. The paper confirms that the North conformation is critical for RNAi activity.
Li, Rui; Pan, Yuqin; He, Bangshun; Xu, Yeqiong; Gao, Tianyi; Song, Guoqi; Sun, Huiling; Deng, Qiwen; Wang, Shukui
2013-12-01
We investigated the effect of CD147 silencing on HT29 cell proliferation and invasion. We constructed a novel short hairpin RNA (shRNA) expression vector pYr-mir30-shRNA. The plasmid was transferred to HT29 cells. The expression of CD147, MCT1 (lactate transporters monocarboxylate transporter 1) and MCT4 (lactate transporters monocarboxylate transporter 4) were monitored by quantitative PCR and western blotting, respectively. The MMP-2 (matrix metalloproteinase-2) and MMP-9 (matrix metalloproteinase-9) activities were determined by gelatin zymography assay, while the intracellular lactate concentration was determined by the lactic acid assay kit. WST-8 assay was used to determine the HT29 cell proliferation and the chemosensitivity. Invasion assay was used to determine the invasion of HT29 cells. In addition, we established a colorectal cancer model, and detected CD147 expression in vivo. The results showed that the expression of CD147 and MCT1 was significantly reduced at both mRNA and protein levels, and also the activity of MMP-2 and MMP-9 was reduced. The proliferation and invasion were decreased, but chemosensitivity to cisplatin was increased. In vivo, the CD147 expression was also significantly decreased, and reduced the tumor growth after CD147 gene silencing. The results demonstrated that silencing of CD147 expression inhibited the proliferation and invasion, suggesting CD147 silencing might be an adjuvant gene therapy strategy to chemotherapy.
Liu, Zongxiang; Wu, Cui; Xie, Nina; Wang, Penglai
2017-10-01
This study aimed to investigate how long non-coding RNA (lncRNA) maternally expressed gene 3 (MEG3) inhibits the growth and metastasis of oral squamous cell carcinoma (OSCC) by regulating WNT/β-catenin signaling pathway in order to explore the antitumor effect of MEG3 and to provide a potential molecular target for the treatment of OSCC. The RT-qPCR technique was used to quantitatively analyze the expression of MEG3 in cancer and adjacent tissues collected from the patients after surgery. Using the Lipofectamine method, the MEG3 overexpression vector and the siRNA interference vector were constructed and transfected into SCC15 and Cal27 cells, respectively, followed by cell proliferation, apoptosis and metastasis analyses. The semi-quantitative analysis of the expression of the β-catenin protein in transfected cells was performed by the western blot analysis, and the activity of the WNT/β-catenin signaling pathway was analyzed using the TOP/FOP flash reporters. In addition, the cells were treated with decitabine to investigate the correlation between the MEG3 expression and the DNA methylation. Results showed that the expression level of MEG3 was significantly decreased in OSCC (p<0.05) and overexpression of MEG3 inhibited the proliferation and metastasis of cancer cells and promoted apoptosis. Importantly, MEG3 played a role as a tumor suppressor by inhibiting the WNT/β-catenin signaling pathway. In addition, the expression of the MEG3 was significantly affected by the degree of DNA methylation. It was concluded that the lncRNA MEG3 can inhibit the growth and metastasis of OSCC by negatively regulating the WNT/β-catenin signaling pathway.
Zhang, Rui; Wang, Yan; Song, Bo; Han, Zhi Qiang; Xu, Yu Ming
2012-01-01
To establish HSV2 VP16 targeting shRNA-expressing cell lines and investigate the antiviral effect of shRNA targeting HSV2 VP16. The cell lines Vero-shRNAs and negative-control Vero-shCON were established. Their inhibition effects on VP16 mRNA expression were tested by real-time fluorescent quantitative polymerase chain reaction (PCR) and their antiviral effects were evaluated by yield reduction assay. The influence of passage numbers on the inhibition ability of cell lines was researched. Vero-shRNA24 targeting the upper stream, Vero-shRNA642 targeting the lower stream and Vero-shCON were established. Vero-shRNA24, Vero-shRNA642 and Vero-shRNA24 + 642 could reduce the VP16 mRNA significantly. Vero-shRNA24 was the most efficient. The HSV2 titers in Vero and Vero-shCON were the highest at 72 h after infection, and started decreasing thereafter. The viral titers of the Vero-shRNA groups reached a peak after 84 h and the highest titers were lower than in the Vero group. The inhibiting effect on VP16 mRNA expression and viral replication of Vero-shRNA24 cell lines of passages 10 and 20 were not significantly different from the primary cell line. Although of no statistical significance, the passage 50 cell line showed decreased inhibiting ability. Recombinant cell lines expressing shRNA targeting HSV2 VP16 were established. They can stably inhibit HSV2 VP16 mRNA expression and viral replication within passage 50. Copyright © 2012 S. Karger AG, Basel.
Soifer, Harris S; Zaragoza, Adriana; Peyvan, Maany; Behlke, Mark A; Rossi, John J
2005-01-01
Long interspersed nuclear elements (LINE-1 or L1) comprise 17% of the human genome, although only 80-100 L1s are considered retrotransposition-competent (RC-L1). Despite their small number, RC-L1s are still potential hazards to genome integrity through insertional mutagenesis, unequal recombination and chromosome rearrangements. In this study, we provide several lines of evidence that the LINE-1 retrotransposon is susceptible to RNA interference (RNAi). First, double-stranded RNA (dsRNA) generated in vitro from an L1 template is converted into functional short interfering RNA (siRNA) by DICER, the RNase III enzyme that initiates RNAi in human cells. Second, pooled siRNA from in vitro cleavage of L1 dsRNA, as well as synthetic L1 siRNA, targeting the 5'-UTR leads to sequence-specific mRNA degradation of an L1 fusion transcript. Finally, both synthetic and pooled siRNA suppressed retrotransposition from a highly active RC-L1 clone in cell culture assay. Our report is the first to demonstrate that a human transposable element is subjected to RNAi.
Schnettler, Esther; Hemmes, Hans; Huismann, Rik; Goldbach, Rob; Prins, Marcel; Kormelink, Richard
2010-11-01
The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs proteins analyzed exhibited affinity to small double-stranded RNA molecules, i.e., small interfering RNAs (siRNAs) and micro-RNA (miRNA)/miRNA* duplexes. Interestingly, the NSs proteins from tomato spotted wilt virus (TSWV), impatiens necrotic spot virus (INSV), and groundnut ringspot virus (GRSV) also showed affinity to long double-stranded RNA (dsRNA), whereas tomato yellow ring virus (TYRV) NSs did not. The TSWV NSs protein was shown to be capable of inhibiting Dicer-mediated cleavage of long dsRNA in vitro. In addition, it suppressed the accumulation of green fluorescent protein (GFP)-specific siRNAs during coinfiltration with an inverted-repeat-GFP RNA construct in Nicotiana benthamiana. In vivo interference of TSWV NSs in the miRNA pathway was shown by suppression of an enhanced GFP (eGFP) miRNA sensor construct. The ability to stabilize miRNA/miRNA* by different tospovirus NSs proteins in vivo was demonstrated by increased accumulation and detection of both miRNA171c and miRNA171c* in tospovirus-infected N. benthamiana. All together, these data suggest that tospoviruses interfere in the RNA silencing pathway by sequestering siRNA and miRNA/miRNA* molecules before they are uploaded into their respective RNA-induced silencing complexes. The observed affinity to long dsRNA for only a subset of the tospoviruses studied is discussed in light of evolutional divergence and their ancestral relation to the animal-infecting members of the Bunyaviridae.
RNA interference mediated in human primary cells via recombinant baculoviral vectors.
Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T
2005-04-01
The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.
RNA interference can be used to disrupt gene function in tardigrades.
Tenlen, Jennifer R; McCaskill, Shaina; Goldstein, Bob
2013-05-01
How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We showed that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments.
Korrapati, Anil Babu; Swaminathan, Gokul; Singh, Aarti; Khanna, Navin; Swaminathan, Sathyamangalam
2012-01-01
Background Dengue is a mosquito-borne viral disease caused by four closely related serotypes of Dengue viruses (DENVs). This disease whose symptoms range from mild fever to potentially fatal haemorrhagic fever and hypovolemic shock, threatens nearly half the global population. There is neither a preventive vaccine nor an effective antiviral therapy against dengue disease. The difference between severe and mild disease appears to be dependent on the viral load. Early diagnosis may enable timely therapeutic intervention to blunt disease severity by reducing the viral load. Harnessing the therapeutic potential of RNA interference (RNAi) to attenuate DENV replication may offer one approach to dengue therapy. Methodology/Principal Findings We screened the non-translated regions (NTRs) of the RNA genomes of representative members of the four DENV serotypes for putative siRNA targets mapping to known transcription/translation regulatory elements. We identified a target site in the 5′ NTR that maps to the 5′ upstream AUG region, a highly conserved cis-acting element essential for viral replication. We used a replication-defective human adenovirus type 5 (AdV5) vector to deliver a short-hairpin RNA (shRNA) targeting this site into cells. We show that this shRNA matures to the cognate siRNA and is able to inhibit effectively antigen secretion, viral RNA replication and infectious virus production by all four DENV serotypes. Conclusion/Significance The data demonstrate the feasibility of using AdV5-mediated delivery of shRNAs targeting conserved sites in the viral genome to achieve inhibition of all four DENV serotypes. This paves the way towards exploration of RNAi as a possible therapeutic strategy to curtail DENV infection. PMID:22848770
Hasiów-Jaroszewska, Beata; Minicka, Julia; Zarzyńska-Nowak, Aleksandra; Budzyńska, Daria; Elena, Santiago F
2018-05-02
Tomato black ring virus (TBRV) is the only member of the Nepovirus genus that is known to form defective RNA particles (D RNAs) during replication. Here, de novo generation of D RNAs was observed during prolonged passages of TBRV isolates originated from Solanum lycopersicum and Lactuca sativa in Chenopodium quinoa plants. D RNAs of about 500 nt derived by a single deletion in the RNA1 molecule and contained a portion of the 5' untranslated region and viral replicase, and almost the entire 3' non-coding region. Short regions of sequence complementarity were found at the 5' and 3' junction borders, which can facilitate formation of the D RNAs. Moreover, in this study we analyzed the effects of D RNAs on TBRV replication and symptoms development of infected plants. C. quinoa, S. lycopersicum, Nicotiana tabacum, and L. sativa were infected with the original TBRV isolates (TBRV-D RNA) and those containing additional D RNA particles (TBRV + D RNA). The viral accumulation in particular hosts was measured up to 28 days post inoculation by RT-qPCR. Statistical analyses revealed that D RNAs interfere with TBRV replication and thus should be referred to as defective interfering particles. The magnitude of the interference effect depends on the interplay between TBRV isolate and host species. Copyright © 2018 Elsevier B.V. All rights reserved.
Malina, Jaroslav; Hannon, Michael J.; Brabec, Viktor
2016-01-01
The interaction between the HIV-1 transactivator protein Tat and TAR (transactivation responsive region) RNA, plays a critical role in HIV-1 transcription. Iron(II) supramolecular helicates were evaluated for their in vitro activity to inhibit Tat–TAR RNA interaction using UV melting studies, electrophoretic mobility shift assay, and RNase A footprinting. The results demonstrate that iron(II) supramolecular helicates inhibit Tat-TAR interaction at nanomolar concentrations by binding to TAR RNA. These studies provide a new insight into the biological potential of metallosupramolecular helicates. PMID:27405089
Malina, Jaroslav; Hannon, Michael J; Brabec, Viktor
2016-07-12
The interaction between the HIV-1 transactivator protein Tat and TAR (transactivation responsive region) RNA, plays a critical role in HIV-1 transcription. Iron(II) supramolecular helicates were evaluated for their in vitro activity to inhibit Tat-TAR RNA interaction using UV melting studies, electrophoretic mobility shift assay, and RNase A footprinting. The results demonstrate that iron(II) supramolecular helicates inhibit Tat-TAR interaction at nanomolar concentrations by binding to TAR RNA. These studies provide a new insight into the biological potential of metallosupramolecular helicates.
Perceptual Load-Dependent Neural Correlates of Distractor Interference Inhibition
Xu, Jiansong; Monterosso, John; Kober, Hedy; Balodis, Iris M.; Potenza, Marc N.
2011-01-01
Background The load theory of selective attention hypothesizes that distractor interference is suppressed after perceptual processing (i.e., in the later stage of central processing) at low perceptual load of the central task, but in the early stage of perceptual processing at high perceptual load. Consistently, studies on the neural correlates of attention have found a smaller distractor-related activation in the sensory cortex at high relative to low perceptual load. However, it is not clear whether the distractor-related activation in brain regions linked to later stages of central processing (e.g., in the frontostriatal circuits) is also smaller at high rather than low perceptual load, as might be predicted based on the load theory. Methodology/Principal Findings We studied 24 healthy participants using functional magnetic resonance imaging (fMRI) during a visual target identification task with two perceptual loads (low vs. high). Participants showed distractor-related increases in activation in the midbrain, striatum, occipital and medial and lateral prefrontal cortices at low load, but distractor-related decreases in activation in the midbrain ventral tegmental area and substantia nigra (VTA/SN), striatum, thalamus, and extensive sensory cortices at high load. Conclusions Multiple levels of central processing involving midbrain and frontostriatal circuits participate in suppressing distractor interference at either low or high perceptual load. For suppressing distractor interference, the processing of sensory inputs in both early and late stages of central processing are enhanced at low load but inhibited at high load. PMID:21267080
Perceptual load-dependent neural correlates of distractor interference inhibition.
Xu, Jiansong; Monterosso, John; Kober, Hedy; Balodis, Iris M; Potenza, Marc N
2011-01-18
The load theory of selective attention hypothesizes that distractor interference is suppressed after perceptual processing (i.e., in the later stage of central processing) at low perceptual load of the central task, but in the early stage of perceptual processing at high perceptual load. Consistently, studies on the neural correlates of attention have found a smaller distractor-related activation in the sensory cortex at high relative to low perceptual load. However, it is not clear whether the distractor-related activation in brain regions linked to later stages of central processing (e.g., in the frontostriatal circuits) is also smaller at high rather than low perceptual load, as might be predicted based on the load theory. We studied 24 healthy participants using functional magnetic resonance imaging (fMRI) during a visual target identification task with two perceptual loads (low vs. high). Participants showed distractor-related increases in activation in the midbrain, striatum, occipital and medial and lateral prefrontal cortices at low load, but distractor-related decreases in activation in the midbrain ventral tegmental area and substantia nigra (VTA/SN), striatum, thalamus, and extensive sensory cortices at high load. Multiple levels of central processing involving midbrain and frontostriatal circuits participate in suppressing distractor interference at either low or high perceptual load. For suppressing distractor interference, the processing of sensory inputs in both early and late stages of central processing are enhanced at low load but inhibited at high load.
Robinson, John I; Beverley, Stephen M
2018-04-27
Leishmania is a widespread trypanosomatid protozoan parasite causing significant morbidity and mortality in humans. The endobiont dsRNA virus Leishmania RNA virus 1 (LRV1) chronically infects some strains, where it increases parasite numbers and virulence in murine leishmaniasis models, and correlates with increased treatment failure in human disease. Previously, we reported that 2'-C-methyladenosine (2CMA) potently inhibited LRV1 in Leishmania guyanensis ( Lgy ) and Leishmania braziliensis , leading to viral eradication at concentrations above 10 μm Here we probed the cellular mechanisms of 2CMA inhibition, involving metabolism, accumulation, and inhibition of the viral RNA-dependent RNA polymerase (RDRP). Activation to 2CMA triphosphate (2CMA-TP) was required, as 2CMA showed no inhibition of RDRP activity from virions purified on cesium chloride gradients. In contrast, 2CMA-TP showed IC 50 values ranging from 150 to 910 μm, depending on the CsCl density of the virion (empty, ssRNA-, and dsRNA-containing). Lgy parasites incubated in vitro with 10 μm 2CMA accumulated 2CMA-TP to 410 μm, greater than the most sensitive RDRP IC 50 measured. Quantitative modeling showed good agreement between the degree of LRV1 RDRP inhibition and LRV1 levels. These results establish that 2CMA activity is due to its conversion to 2CMA-TP, which accumulates to levels that inhibit RDRP and cause LRV1 loss. This attests to the impact of the Leishmania purine uptake and metabolism pathways, which allow even a weak RDRP inhibitor to effectively eradicate LRV1 at micromolar concentrations. Future RDRP inhibitors with increased potency may have potential therapeutic applications for ameliorating the increased Leishmania pathogenicity conferred by LRV1. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Sosic, Alice; Saccone, Irene; Carraro, Caterina; Kenderdine, Thomas; Gamba, Elia; Caliendo, Giuseppe; Corvino, Angela; Di Vaio, Paola; Fiorino, Ferdinando; Magli, Elisa; Perissutti, Elisa; Santagada, Vincenzo; Severino, Beatrice; Spada, Valentina; Fabris, Dan; Frecentese, Francesco; Gatto, Barbara
2018-06-12
The HIV-1 nucleocapsid (NC) protein represents an excellent molecular target for the development of anti-retrovirals by virtue of its well-characterized chaperone activities, which play pivotal roles in essential steps of the viral life cycle. Our ongoing search for candidates able to impair NC binding/annealing activities led to the identification of peptidyl-anthraquinones as a promising class of nucleic acid ligands. Seeking to elucidate the inhibition determinants and increase the potency of this class of compounds, we have now explored the effects of chirality in the linker connecting the planar nucleus to the basic side chains. We show here that the non-natural linker configuration imparted unexpected TAR RNA targeting properties to the 2,6-peptidyl-anthraquinones and significantly enhanced their potency. Even if the new compounds were able to interact directly with the NC protein, they manifested a consistently higher affinity for the TAR RNA substrate and their TAR-binding properties mirrored their ability to interfere with NC-TAR interactions. Based on these findings, we propose that the viral Tat protein, sharing the same RNA substrate but acting in distinct phases of the viral life cycle, constitutes an additional druggable target for this class of peptidyl-anthraquinones. The inhibition of Tat-TAR interaction for the test compounds correlated again with their TAR-binding properties, while simultaneously failing to demonstrate any direct Tat-binding capabilities. These considerations highlighted the importance of TAR RNA in the elucidation of their inhibition mechanism, rather than direct protein inhibition. We have therefore identified anti-TAR compounds with dual in vitro inhibitory activity on different viral proteins, demonstrating that it is possible to develop multitarget compounds capable of interfering with processes mediated by the interactions of this essential RNA domain of HIV-1 genome with NC and Tat proteins.
Miguez, Gonzalo; McConnell, Bridget; Polack, Cody W; Miller, Ralph R
2018-01-08
This report is part of a larger project examining associative interference as a function of the nature of the interfering and target associations. Lick suppression experiments with rats assessed the effects of context shifts on proactive outcome interference by latent inhibition (LI) and Pavlovian conditioned inhibition (CI) treatments on subsequently trained Pavlovian conditioned excitation treatment. LI and CI were trained in Context A during Phase 1, and then excitation treatment was administered in Context B during Phase 2, followed by tests for conditioned excitation in Contexts A, B, or C. Experiment 1 preliminarily established our LI and CI treatments and resulted in equally retarded acquisition of behavioral control when the target cue was subsequently trained as a conditioned excitor and tested in Context A. However, only CI treatment caused the target to pass a summation test for inhibition. Centrally, Experiment 2 consisted of LI and CI treatments in Context A followed by excitatory training in Context B. Testing found low excitatory control by both LI and CI cues in Context A relative to strong excitatory control in Context B, but CI treatment transferred to Context C more strongly than LI treatment. Experiment 3 determined that LI treatment failed to transfer to Context C even when the number of LI trials was greatly increased. Thus, first-learned LI appears to be relatively context specific, whereas first-learned CI generalizes to a neutral context. These observations add to existing evidence that LI and CI treatments result in different types of learning that diverge sharply in transfer to a novel test context.
DeVincenzo, John P
2009-10-01
A revolution in the understanding of RNA biological processing and control is leading to revolutionary new concepts in human therapeutics. It has become increasingly clear that the so called "non-coding RNA" exerts specific and profound functional control on regulation of protein production and indeed controls the expression of all genes. Harnessing this naturally-occurring RNA-mediated regulation of protein production has immense human therapeutic potential. These processes are collectively known as RNA interference (RNAi). RNAi is a recently discovered, naturally-occurring intracellular process that regulates gene expression through the silencing of specific mRNAs. Methods of harnessing this natural pathway are being developed that allow the catalytic degradation of targeted mRNAs using specifically designed complementary small inhibitory RNAs (siRNA). siRNAs are being chemically modified to acquire drug-like properties. Numerous recent high profile publications have provided proofs of concept that RNA interference may be useful therapeutically. Much of the design of these siRNAs can be accomplished bioinformatically, thus potentially expediting drug discovery and opening new avenues of therapy for many uncommon, orphan, or emerging diseases. This makes this approach very attractive for developing therapies targeting orphan diseases including neonatal diseases. Theoretically, any disease that can be ameliorated through knockdown of any endogenous or exogenous protein is a potential therapeutic target for RNAi-based therapeutics. Lung diseases are particularly attractive targets for RNAi therapeutics since the affected cells' location increases their accessibility to topical administration of siRNA, for example by aerosol. Respiratory viral infections and chronic lung disease are examples of such diseases. RNAi therapeutics have been shown to be active against RSV, parainfluenza and human metapneumoviruses in vitro and in vivo resulting in profound antiviral
Inhibition of mRNA export in vertebrate cells by nuclear export signal conjugates
Pasquinelli, Amy E.; Powers, Maureen A.; Lund, Elsebet; Forbes, Douglass; Dahlberg, James E.
1997-01-01
Leucine-rich nuclear export signals (NESs) are recognized by the NES receptor exportin 1 and are central to the export of multiple shuttling proteins and RNAs. The export of messenger RNA in vertebrates was, however, thought to occur by a different pathway, because inhibition by injection of a synthetic Rev NES conjugate could not be demonstrated. Here we find that peptide conjugates composed of the NES of either protein kinase A inhibitor protein (PKI) or the HIV-1 Rev protein, when coupled to human serum albumin, are potent inhibitors of mRNA and small nuclear RNA export. These results provide direct evidence that mRNA export in vertebrates depends on interactions between an NES and its cognate NES receptors. PKI NES conjugates are significantly more efficient at inhibiting RNA export than are REV NES conjugates, indicating that different NESs may have different abilities to promote protein and RNA export. Surprisingly, an expected control conjugate containing the mutant Rev NES sequence M10 strongly inhibited the export of intronless dihydrofolate reductase mRNA. Nuclear injection of NES peptide conjugates led to mislocalization to the nucleus of 10–20% of the cytoplasmic Ran GTPase-binding protein (RanBP1) indicating that RanBP1 shuttles between the nucleus and the cytoplasm via an NES pathway. These results demonstrate that in vertebrates the export of mRNA, like that of small nuclear RNA, 5S rRNA, and transport factors such as RanBP1, employs NES-mediated molecular machinery. PMID:9405623
Schuster, Susan; Tholen, Lotte E; Overheul, Gijs J; van Kuppeveld, Frank J M; van Rij, Ronald P
2017-01-01
Antiviral immunity in insects and plants is mediated by the RNA interference (RNAi) pathway in which viral long double-stranded RNA (dsRNA) is processed into small interfering RNAs (siRNAs) by Dicer enzymes. Although this pathway is evolutionarily conserved, its involvement in antiviral defense in mammals is the subject of debate. In vertebrates, recognition of viral RNA induces a sophisticated type I interferon (IFN)-based immune response, and it has been proposed that this response masks or inhibits antiviral RNAi. To test this hypothesis, we analyzed viral small RNA production in differentiated cells deficient in the cytoplasmic RNA sensors RIG-I and MDA5. We did not detect 22-nucleotide (nt) viral siRNAs upon infection with three different positive-sense RNA viruses. Our data suggest that the depletion of cytoplasmic RIG-I-like sensors is not sufficient to uncover viral siRNAs in differentiated cells. IMPORTANCE The contribution of the RNA interference (RNAi) pathway in antiviral immunity in vertebrates has been widely debated. It has been proposed that RNAi possesses antiviral activity in mammalian systems but that its antiviral effect is masked by the potent antiviral interferon response in differentiated mammalian cells. In this study, we show that inactivation of the interferon response is not sufficient to uncover antiviral activity of RNAi in human epithelial cells infected with three wild-type positive-sense RNA viruses.
A Polyamide Inhibits Replication of Vesicular Stomatitis Virus by Targeting RNA in the Nucleocapsid
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gumpper, Ryan H.; Li, Weike; Castañeda, Carlos H.
Polyamides have been shown to bind double-stranded DNA by complementing the curvature of the minor groove and forming various hydrogen bonds with DNA. Several polyamide molecules have been found to have potent antiviral activities against papillomavirus, a double-stranded DNA virus. By analogy, we reason that polyamides may also interact with the structured RNA bound in the nucleocapsid of a negative-strand RNA virus. Vesicular stomatitis virus (VSV) was selected as a prototype virus to test this possibility since its genomic RNA encapsidated in the nucleocapsid forms a structure resembling one strand of an A-form RNA duplex. One polyamide molecule, UMSL1011, wasmore » found to inhibit infection of VSV. To confirm that the polyamide targeted the nucleocapsid, a nucleocapsid-like particle (NLP) was incubated with UMSL1011. The encapsidated RNA in the polyamide-treated NLP was protected from thermo-release and digestion by RNase A. UMSL1011 also inhibits viral RNA synthesis in the intracellular activity assay for the viral RNA-dependent RNA polymerase. The crystal structure revealed that UMSL1011 binds the structured RNA in the nucleocapsid. The conclusion of our studies is that the RNA in the nucleocapsid is a viable antiviral target of polyamides. Since the RNA structure in the nucleocapsid is similar in all negative-strand RNA viruses, polyamides may be optimized to target the specific RNA genome of a negative-strand RNA virus, such as respiratory syncytial virus and Ebola virus. IMPORTANCENegative-strand RNA viruses (NSVs) include several life-threatening pathogens, such as rabies virus, respiratory syncytial virus, and Ebola virus. There are no effective antiviral drugs against these viruses. Polyamides offer an exceptional opportunity because they may be optimized to target each NSV. Our studies on vesicular stomatitis virus, an NSV, demonstrated that a polyamide molecule could specifically target the viral RNA in the nucleocapsid and inhibit viral growth
A Polyamide Inhibits Replication of Vesicular Stomatitis Virus by Targeting RNA in the Nucleocapsid.
Gumpper, Ryan H; Li, Weike; Castañeda, Carlos H; Scuderi, M José; Bashkin, James K; Luo, Ming
2018-04-15
Polyamides have been shown to bind double-stranded DNA by complementing the curvature of the minor groove and forming various hydrogen bonds with DNA. Several polyamide molecules have been found to have potent antiviral activities against papillomavirus, a double-stranded DNA virus. By analogy, we reason that polyamides may also interact with the structured RNA bound in the nucleocapsid of a negative-strand RNA virus. Vesicular stomatitis virus (VSV) was selected as a prototype virus to test this possibility since its genomic RNA encapsidated in the nucleocapsid forms a structure resembling one strand of an A-form RNA duplex. One polyamide molecule, UMSL1011, was found to inhibit infection of VSV. To confirm that the polyamide targeted the nucleocapsid, a nucleocapsid-like particle (NLP) was incubated with UMSL1011. The encapsidated RNA in the polyamide-treated NLP was protected from thermo-release and digestion by RNase A. UMSL1011 also inhibits viral RNA synthesis in the intracellular activity assay for the viral RNA-dependent RNA polymerase. The crystal structure revealed that UMSL1011 binds the structured RNA in the nucleocapsid. The conclusion of our studies is that the RNA in the nucleocapsid is a viable antiviral target of polyamides. Since the RNA structure in the nucleocapsid is similar in all negative-strand RNA viruses, polyamides may be optimized to target the specific RNA genome of a negative-strand RNA virus, such as respiratory syncytial virus and Ebola virus. IMPORTANCE Negative-strand RNA viruses (NSVs) include several life-threatening pathogens, such as rabies virus, respiratory syncytial virus, and Ebola virus. There are no effective antiviral drugs against these viruses. Polyamides offer an exceptional opportunity because they may be optimized to target each NSV. Our studies on vesicular stomatitis virus, an NSV, demonstrated that a polyamide molecule could specifically target the viral RNA in the nucleocapsid and inhibit viral growth. The
Li, Longhu; Zhao, Dong; Jin, Zhe; Zhang, Jian; Paul, Christian; Wang, Yigang
2015-01-01
Treatment with short hairpin RNA (shRNA) interference therapy targeting phosphodiesterase 5a after myocardial infarction (MI) has been shown to mitigate post-MI heart failure. We investigated the mechanisms that underpin the beneficial effects of PDE5a inhibition through shRNA on post-MI heart failure. An adenoviral vector with an shRNA sequence inserted was adopted for the inhibition of phosphodiesterase 5a (Ad-shPDE5a) in vivo and in vitro. Myocardial infarction (MI) was induced in male C57BL/6J mice by left coronary artery ligation, and immediately after that, the Ad-shPDE5a was injected intramyocardially around the MI region and border areas. Four weeks post-MI, the Ad-shPDE5a-treated mice showed significant mitigation of the left ventricular (LV) dilatation and dysfunction compared to control mice. Infarction size and fibrosis were also significantly reduced in Ad-shPDE5a-treated mice. Additionally, Ad-shPDE5a treatment decreased the MI-induced inflammatory cytokines interleukin (IL)-1β, IL-6, tumor necrosis factor-α, and transforming growth factor-β1, which was confirmed in vitro in Ad-shPDE5a transfected myofibroblasts cultured under oxygen glucose deprivation. Finally, Ad-shPDE5a treatment was found to activate the myocardial Akt signaling pathway in both in vivo and in vitro experiments. These findings indicate that PDE5a inhibition by Ad-shPDE5a via the Akt signal pathway could be of significant value in the design of future therapeutics for post-MI heart failure.
Murphy, Katherine A.; Tabuloc, Christine A.; Cervantes, Kevin R.; Chiu, Joanna C.
2016-01-01
RNA interference has had major advances as a developing tool for pest management. In laboratory experiments, double-stranded RNA (dsRNA) is often administered to the insect by genetic modification of the crop, or synthesized in vitro and topically applied to the crop. Here, we engineered genetically modified yeast that express dsRNA targeting y-Tubulin in Drosophila suzukii. Our design takes advantage of the symbiotic interactions between Drosophila, yeast, and fruit crops. Yeast is naturally found growing on the surface of fruit crops, constitutes a major component of the Drosophila microbiome, and is highly attractive to Drosophila. Thus, this naturally attractive yeast biopesticide can deliver dsRNA to an insect pest without the need for genetic crop modification. We demonstrate that this biopesticide decreases larval survivorship, and reduces locomotor activity and reproductive fitness in adults, which are indicative of general health decline. To our knowledge, this is the first study to show that yeast can be used to deliver dsRNA to an insect pest. PMID:26931800
USDA-ARS?s Scientific Manuscript database
Gene silencing through RNA interference (RNAi) has revolutionized the study of gene function, particularly in non-model insects. However, in Lepidoptera (moths and butterflies) RNAi has many times proven to be difficult to achieve. Most of the negative results have been anecdotal and the positive ex...
RNA interference: new mechanistic and biochemical insights with application in oral cancer therapy.
Buduru, Smaranda; Zimta, Alina-Andreea; Ciocan, Cristina; Braicu, Cornelia; Dudea, Diana; Irimie, Alexandra Iulia; Berindan-Neagoe, Ioana
2018-01-01
Over the last few decades, the incidence of oral cancer has gradually increased, due to the negative influence of environmental factors and also abnormalities within the genome. The main issues in oral cancer treatment consist in surpassing resistance and recurrence. However, continuous discovery of altered signaling pathways in these tumors provides valuable information for the identification of novel gene candidates targeted in personalized therapy. RNA interference (RNAi) is a natural mechanism that involves small interfering RNA (siRNA); this can be exploited in biomedical research by using natural or synthetic constructs for activation of the mechanism. Synthetic siRNA transcripts were developed as a versatile class of molecular tools that have a diverse range of programmable roles, being involved in the regulation of several biological processes, thereby providing the perspective of an alternative option to classical treatment. In this review, we summarize the latest information related to the application of siRNA in oral malignancy together with molecular aspects of the technology and also the perspective upon the delivery system. Also, the emergence of newer technologies such as clustered regularly interspaced short palindromic repeats/Cas9 or transcription activator-like effector nucleases in comparison with the RNAi approach is discussed in this paper.
RNA interference technology in crop protection against arthropod pests, pathogens and nematodes.
Zotti, Moises; Dos Santos, Ericmar Avila; Cagliari, Deise; Christiaens, Olivier; Taning, Clauvis Nji Tizi; Smagghe, Guy
2018-06-01
Scientists have made significant progress in understanding and unraveling several aspects of double-stranded RNA (dsRNA)-mediated gene silencing during the last two decades. Now that the RNA interference (RNAi) mechanism is well understood, it is time to consider how to apply the acquired knowledge to agriculture and crop protection. Some RNAi-based products are already available for farmers and more are expected to reach the market soon. Tailor-made dsRNA as an active ingredient for biopesticide formulations is considered a raw material that can be used for diverse purposes, from pest control and bee protection against viruses to pesticide resistance management. The RNAi mechanism works at the messenger RNA (mRNA) level, exploiting a sequence-dependent mode of action, which makes it unique in potency and selectivity compared with conventional agrochemicals. Furthermore, the use of RNAi in crop protection can be achieved by employing plant-incorporated protectants through plant transformation, but also by non-transformative strategies such as the use of formulations of sprayable RNAs as direct control agents, resistance factor repressors or developmental disruptors. In this review, RNAi is presented in an agricultural context (discussing products that have been launched on the market or will soon be available), and we go beyond the classical presentation of successful examples of RNAi in pest-insect control and comprehensively explore its potential for the control of plant pathogens, nematodes and mites, and to fight against diseases and parasites in beneficial insects. Moreover, we also discuss its use as a repressor for the management of pesticide-resistant weeds and insects. Finally, this review reports on the advances in non-transformative dsRNA delivery and the production costs of dsRNA, and discusses environmental considerations. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
RNA interference can be used to disrupt gene function in tardigrades
Tenlen, Jennifer R.; McCaskill, Shaina; Goldstein, Bob
2012-01-01
How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We show that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions, and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments. PMID:23187800
RNA sensor LGP2 inhibits TRAF ubiquitin ligase to negatively regulate innate immune signaling.
Parisien, Jean-Patrick; Lenoir, Jessica J; Mandhana, Roli; Rodriguez, Kenny R; Qian, Kenin; Bruns, Annie M; Horvath, Curt M
2018-06-01
The production of type I interferon (IFN) is essential for cellular barrier functions and innate and adaptive antiviral immunity. In response to virus infections, RNA receptors RIG-I and MDA5 stimulate a mitochondria-localized signaling apparatus that uses TRAF family ubiquitin ligase proteins to activate master transcription regulators IRF3 and NFκB, driving IFN and antiviral target gene expression. Data indicate that a third RNA receptor, LGP2, acts as a negative regulator of antiviral signaling by interfering with TRAF family proteins. Disruption of LGP2 expression in cells results in earlier and overactive transcriptional responses to virus or dsRNA LGP2 associates with the C-terminus of TRAF2, TRAF3, TRAF5, and TRAF6 and interferes with TRAF ubiquitin ligase activity. TRAF interference is independent of LGP2 ATP hydrolysis, RNA binding, or its C-terminal domain, and LGP2 can regulate TRAF-mediated signaling pathways in trans , including IL-1β, TNFα, and cGAMP These findings provide a unique mechanism for LGP2 negative regulation through TRAF suppression and extend the potential impact of LGP2 negative regulation beyond the IFN antiviral response. © 2018 The Authors.
Bellissimo, Teresa; Masciarelli, Silvia; Poser, Elena; Genovese, Ilaria; Del Rio, Alberto; Colotti, Gianni; Fazi, Francesco
2017-01-01
The development of small-molecule-based target therapy design for human disease and cancer is object of growing attention. Recently, specific microRNA (miRNA) mimicking compounds able to bind the miRNA-binding domain of Argonaute 2 protein (AGO2) to inhibit miRNA loading and its functional activity were described. Computer-aided molecular design techniques and RNA immunoprecipitation represent suitable approaches to identify and experimentally determine if a compound is able to impair the loading of miRNAs on AGO2 protein. Here, we describe these two methodologies that we recently used to select a specific compound able to interfere with the AGO2 functional activity and able to improve the retinoic acid-dependent myeloid differentiation of leukemic cells.
Killiny, Nabil; Kishk, Abdelaziz
2017-06-01
RNA interference (RNAi) is a powerful means to study functional genomics in insects. The delivery of dsRNA is a challenging step in the development of RNAi assay. Here, we describe a new delivery method to increase the effectiveness of RNAi in the Asian citrus psyllid Diaphorina citri. Bromophenol blue droplets were topically applied to fifth instar nymphs and adults on the ventral side of the thorax between the three pairs of legs. In addition to video recordings that showed sucking of the bromophenol blue by the stylets, dissected guts turned blue indicating that the uptake was through feeding. Thus, we called the method topical feeding. We targeted the abnormal wing disc gene (awd), also called nucleoside diphosphate kinase (NDPK), as a reporter gene to prove the uptake of dsRNA via this method of delivery. Our results showed that dsRNA-awd caused reduction of awd expression and nymph mortality. Survival and lifespan of adults emerged from treated nymphs and treated adults were affected. Silencing awd caused wing malformation in the adults emerged from treated nymphs. Topical feeding as a delivery of dsRNA is highly efficient for both nymphs and adults. The described method could be used to increase the efficiency of RNAi in D. citri and other sap piercing-sucking hemipterans. © 2017 Wiley Periodicals, Inc.
RNA interference tools for the western flower thrips, Frankliniella occidentalis.
Badillo-Vargas, Ismael E; Rotenberg, Dorith; Schneweis, Brandi A; Whitfield, Anna E
2015-05-01
The insect order Thysanoptera is exclusively comprised of small insects commonly known as thrips. The western flower thrips, Frankliniella occidentalis, is an economically important pest amongst thysanopterans due to extensive feeding damage and tospovirus transmission to hundreds of plant species worldwide. Geographically-distinct populations of F. occidentalis have developed resistance against many types of traditional chemical insecticides, and as such, management of thrips and tospoviruses are a persistent challenge in agriculture. Molecular methods for defining the role(s) of specific genes in thrips-tospovirus interactions and for assessing their potential as gene targets in thrips management strategies is currently lacking. The goal of this work was to develop an RNA interference (RNAi) tool that enables functional genomic assays and to evaluate RNAi for its potential as a biologically-based approach for controlling F. occidentalis. Using a microinjection system, we delivered double-stranded RNA (dsRNA) directly to the hemocoel of female thrips to target the vacuolar ATP synthase subunit B (V-ATPase-B) gene of F. occidentalis. Gene expression analysis using real-time quantitative reverse transcriptase-PCR (qRT-PCR) revealed significant reductions of V-ATPase-B transcripts at 2 and 3 days post-injection (dpi) with dsRNA of V-ATPase-B compared to injection with dsRNA of GFP. Furthermore, the effect of knockdown of the V-ATPase-B gene in females at these two time points was mirrored by the decreased abundance of V-ATPase-B protein as determined by quantitative analysis of Western blots. Reduction in V-ATPase-B expression in thrips resulted in increased female mortality and reduced fertility, i.e., number of viable offspring produced. Survivorship decreased significantly by six dpi compared to the dsRNA-GFP control group, which continued decreasing significantly until the end of the bioassay. Surviving female thrips injected with dsRNA-V-ATPase-B produced
Sobrevilla-Navarro, Ana Alondra; Sandoval-Rodríguez, Ana; García-Bañuelos, Jesús Javier; Armendariz-Borunda, Juan; Salazar-Montes, Adriana María
2018-04-01
Adenoviruses are the most common vectors used in clinical trials of gene therapy. In 2017, 21.2% of clinical trials used rAds as vectors. Systemic administration of rAds results in high tropism in the liver. Interferon types α and β are the major antiviral cytokines which orchestrate the host's immune response against rAd, limiting therapeutic gene expression and preventing subsequent vector administration. siRNA is small double-strand RNAs that temporally inhibit the expression of a specific gene. The aim is to evaluate the effect of IFN-α blocking by a specific siRNA on Ad-GFP transduction and on transgene expression in Huh7 cells in culture. Huh7 cells were cultured in DMEM and transfected with 70 nM of siRNA-IFN-α. Six hours later, the cells were exposed to 1 × 10 9 vp/ml of rAd-GFP for 24 h. Expression of IFN-α, TNF-α and the PKR gene was determined by RT-qPCR. Percentage of transduction was analyzed by flow cytometry and by qPCR. GFP expression was determined by western blot. 70 nM of siRNA-IFN-α inhibited 96% of IFN-α and 65% of TNF-α gene expression compared to an irrelevant siRNA. Percentage of transduction and transgene expression increased in these cells compared to an irrelevant siRNA. Inhibition of IFN-α expression by siRNA-IFN-α enabled a higher level of transduction and transgene expression GFP, highlighting the role of IFN-α in the elimination of adenovirus in transduced cells and thus suggesting that its inhibition could be an important strategy for gene therapy in clinical trials using adenovirus as a vector directed to liver diseases.
Geisbert, Thomas W; Hensley, Lisa E; Kagan, Elliott; Yu, Erik Zhaoying; Geisbert, Joan B; Daddario-DiCaprio, Kathleen; Fritz, Elizabeth A; Jahrling, Peter B; McClintock, Kevin; Phelps, Janet R; Lee, Amy C H; Judge, Adam; Jeffs, Lloyd B; MacLachlan, Ian
2006-06-15
Ebola virus (EBOV) infection causes a frequently fatal hemorrhagic fever (HF) that is refractory to treatment with currently available antiviral therapeutics. RNA interference represents a powerful, naturally occurring biological strategy for the inhibition of gene expression and has demonstrated utility in the inhibition of viral replication. Here, we describe the development of a potential therapy for EBOV infection that is based on small interfering RNAs (siRNAs). Four siRNAs targeting the polymerase (L) gene of the Zaire species of EBOV (ZEBOV) were either complexed with polyethylenimine (PEI) or formulated in stable nucleic acid-lipid particles (SNALPs). Guinea pigs were treated with these siRNAs either before or after lethal ZEBOV challenge. Treatment of guinea pigs with a pool of the L gene-specific siRNAs delivered by PEI polyplexes reduced plasma viremia levels and partially protected the animals from death when administered shortly before the ZEBOV challenge. Evaluation of the same pool of siRNAs delivered using SNALPs proved that this system was more efficacious, as it completely protected guinea pigs against viremia and death when administered shortly after the ZEBOV challenge. Additional experiments showed that 1 of the 4 siRNAs alone could completely protect guinea pigs from a lethal ZEBOV challenge. Further development of this technology has the potential to yield effective treatments for EBOV HF as well as for diseases caused by other agents that are considered to be biological threats.
Poliovirus RNA synthesis in vitro: structural elements and antibody inhibition
DOE Office of Scientific and Technical Information (OSTI.GOV)
Semler, B.L.; Hanecak, R.; Dorner, L.F.
1983-01-01
The poliovirus RNA polymerase complex has been analyzed by immunoautoradiography using antibody probes derived from purified replicase (P3) region viral polypeptides. Antibody preparations made against the polio RNA polymerase, P3-4b, detected a previously unreported cellular protein that copurifies with the RNA polymerase. An IgG fraction purified from rabbit antiserum to polypeptide P3-2, a precursor fo the RNA polymerase, specifically inhibits poliovirus RNA synthesis in vitro. The authors have also immunoprecipitated a 60,000-dalton protein (P3-4a) with antiserum to protein P3-4b and have determined the precise genomic map position of this protein by automated Edman degradation. Protein P3-4a originates by cleavage ofmore » the RNA polymerase precursor at a glutamine-glucine amino acid pair not previously reported to be a viral cleavage site.« less
Sophoraflavenone G Restricts Dengue and Zika Virus Infection via RNA Polymerase Interference.
Sze, Alexandre; Olagnier, David; Hadj, Samar Bel; Han, Xiaoying; Tian, Xiao Hong; Xu, Hong-Tao; Yang, Long; Shi, Qingwen; Wang, Penghua; Wainberg, Mark A; Wu, Jian Hui; Lin, Rongtuan
2017-10-03
Flaviviruses including Zika, Dengue and Hepatitis C virus cause debilitating diseases in humans, and the former are emerging as global health concerns with no antiviral treatments. We investigated Sophora Flavecens , used in Chinese medicine, as a source for antiviral compounds. We isolated Sophoraflavenone G and found that it inhibited Hepatitis C replication, but not Sendai or Vesicular Stomatitis Virus. Pre- and post-infection treatments demonstrated anti-flaviviral activity against Dengue and Zika virus, via viral RNA polymerase inhibition. These data suggest that Sophoraflavenone G represents a promising candidate regarding anti-Flaviviridae research.
Sophoraflavenone G Restricts Dengue and Zika Virus Infection via RNA Polymerase Interference
Sze, Alexandre; Olagnier, David; Bel Hadj, Samar; Han, Xiaoying; Hong Tian, Xiao; Xu, Hong-Tao; Yang, Long; Shi, Qingwen; Wang, Penghua; Wainberg, Mark A.; Hui Wu, Jian
2017-01-01
Flaviviruses including Zika, Dengue and Hepatitis C virus cause debilitating diseases in humans, and the former are emerging as global health concerns with no antiviral treatments. We investigated Sophora Flavecens, used in Chinese medicine, as a source for antiviral compounds. We isolated Sophoraflavenone G and found that it inhibited Hepatitis C replication, but not Sendai or Vesicular Stomatitis Virus. Pre- and post-infection treatments demonstrated anti-flaviviral activity against Dengue and Zika virus, via viral RNA polymerase inhibition. These data suggest that Sophoraflavenone G represents a promising candidate regarding anti-Flaviviridae research. PMID:28972551
Chen, Y-N
2017-03-01
Melanoma is a highly aggressive tumour, and treatment efficacy depends on the stage of the tumour. Early stage cutaneous melanoma is efficiently treated by surgical excision. In contrast, late-stage melanoma requires chemotherapy with dacarbazine (DTIC). Unfortunately, advanced melanoma can often be resistant to DTIC. The mechanisms of anti-melanoma effects of DTIC are still poorly understood, which hinders development of more potent therapies. In this study, we examined the effects of DTIC on growth inhibition of FEMX-1 melanoma cell line, expression of apoptosis-related proteins, and expression of micro (mi)RNA-200 (miRNA-200a, miRNA-200b, miRNA-200c, and miRNA-141). DTIC was used at 50 (low dose) or 100 (high dose) mg/ml. Cell growth inhibition was documented by MTT assay. Cell apoptosis was quantified by propidium iodide staining and caspase 3-8 activity assay. Expression of apoptosis-related proteins Bim, Bak, BAX, and Bad were documented by Western blot analysis, while expression of miRNA-200 by PCR. DTIC dose-dependently inhibited growth of FEMX-1 melanoma cell line, induced cell apoptosis, modulated the levels of apoptosis-related proteins, and up-regulated expression of miRNA-200 family members. DTIC inhibits the growth of melanoma cells by up-regulating expression of miRNA-200.
RNA Interference: A Novel Source of Resistance to Combat Plant Parasitic Nematodes.
Banerjee, Sagar; Banerjee, Anamika; Gill, Sarvajeet S; Gupta, Om P; Dahuja, Anil; Jain, Pradeep K; Sirohi, Anil
2017-01-01
Plant parasitic nematodes cause severe damage and yield loss in major crops all over the world. Available control strategies include use of insecticides/nematicides but these have proved detrimental to the environment, while other strategies like crop rotation and resistant cultivars have serious limitations. This scenario provides an opportunity for the utilization of technological advances like RNA interference (RNAi) to engineer resistance against these devastating parasites. First demonstrated in the model free living nematode, Caenorhabtidis elegans ; the phenomenon of RNAi has been successfully used to suppress essential genes of plant parasitic nematodes involved in parasitism, nematode development and mRNA metabolism. Synthetic neurotransmitants mixed with dsRNA solutions are used for in vitro RNAi in plant parasitic nematodes with significant success. However, host delivered in planta RNAi has proved to be a pioneering phenomenon to deliver dsRNAs to feeding nematodes and silence the target genes to achieve resistance. Highly enriched genomic databases are exploited to limit off target effects and ensure sequence specific silencing. Technological advances like gene stacking and use of nematode inducible and tissue specific promoters can further enhance the utility of RNAi based transgenics against plant parasitic nematodes.
Amorim, Rebeca Padrão; Araújo, Michelle Gasparetti Leão; Valero, Jorge; Lopes-Cendes, Iscia; Pascoal, Vinicius Davila Bitencourt; Malva, João Oliveira; da Silva Fernandes, Maria José
2017-12-01
Cell signaling mediated by P2X7 receptors (P2X7R) has been suggested to be involved in epileptogenesis, via modulation of intracellular calcium levels, excitotoxicity, activation of inflammatory cascades, and cell death, among other mechanisms. These processes have been described to be involved in pilocarpine-induced status epilepticus (SE) and contribute to hyperexcitability, resulting in spontaneous and recurrent seizures. Here, we aimed to investigate the role of P2X7R in epileptogenesis in vivo using RNA interference (RNAi) to inhibit the expression of this receptor. Small interfering RNA (siRNA) targeting P2X7R mRNA was injected into the lateral ventricles (icv) 6 h after SE. Four groups were studied: Saline-Vehicle, Saline-siRNA, Pilo-Vehicle, and Pilo-siRNA. P2X7R was quantified by western blotting and neuronal death assessed by Fluoro-Jade B histochemistry. The hippocampal volume (edema) was determined 48 h following RNAi. Behavioral parameters as latency to the appearance of spontaneous seizures and the number of seizures were determined until 60 days after the SE onset. The Saline-siRNA and Pilo-siRNA groups showed a 43 and 37% reduction, respectively, in P2X7R protein levels compared to respective vehicle groups. Neuroprotection was observed in CA1 and CA3 of the Pilo-siRNA group compared to Pilo-Vehicle. P2X7R silencing in pilocarpine group reversed the increase in the edema detected in the hilus, suprapyramidal dentate gyrus, CA1, and CA3; reduced mortality rate following SE; increased the time to onset of spontaneous seizure; and reduced the number of seizures, when compared to the Pilo-Vehicle group. Therefore, our data highlights the potential of P2X7R as a therapeutic target for the adjunct treatment of epilepsy.
Dissociating interference-control processes between memory and response.
Bissett, Patrick G; Nee, Derek Evan; Jonides, John
2009-09-01
The ability to mitigate interference is of central importance to cognition. Previous research has provided conflicting accounts about whether operations that resolve interference are singular in character or form a family of functions. Here, the authors examined the relationship between interference-resolution processes acting on working memory representations versus responses. The authors combined multiple forms of interference into a single paradigm by merging a directed-forgetting task, which induces proactive interference, with a stop-signal task, which taps response inhibition processes. The results demonstrated that proactive interference and response inhibition produced distinct behavioral signatures that did not interact. By contrast, combining two different measures of response inhibition by merging a go/no-go task variant and a stop signal produced overadditive behavioral interference, demonstrating that different forms of response inhibition tap the same processes. However, not all forms of response conflict interacted, suggesting that inhibition-related functions acting on response selection are dissociable from those acting on response inhibition. These results suggest that inhibition-related functions for memory and responses are dissociable. (c) 2009 APA, all rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie
2009-11-20
RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR)more » shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.« less
Stoppani, Elena; Bassi, Ivan; Dotti, Silvia; Lizier, Michela; Ferrari, Maura; Lucchini, Franco
2015-08-01
Influenza A virus is the principal agent responsible of the respiratory tract's infections in humans. Every year, highly pathogenic and infectious strains with new antigenic assets appear, making ineffective vaccines so far developed. The discovery of RNA interference (RNAi) opened the way to the progress of new promising drugs against Influenza A virus and also to the introduction of disease resistance traits in genetically modified animals. In this paper, we show that Madin-Darby Canine Kidney (MDCK) cell line expressing short hairpin RNAs (shRNAs) cassette, designed on a specific conserved region of the nucleoprotein (NP) viral genome, can strongly inhibit the viral replication of four viral strains sharing the target sequence, reducing the viral mRNA respectively to 2.5×10(-4), 7.5×10(-5), 1.7×10(-3), 1.9×10(-4) compared to the control, as assessed by real-time PCR. Moreover, we demonstrate that during the challenge with a viral strain bearing a single mismatch on the target sequence, although a weaker inhibition is observed, viral mRNA is still lowered down to 1.2×10(-3) folds in the shRNA-expressing clone compared to the control, indicating a broad potential use of this approach. In addition, we developed a highly predictive and fast screening test of siRNA sequences based on dual-luciferase assay, useful for the in vitro prediction of the potential effect of viral inhibition. In conclusion, these findings reveal new siRNA sequences able to inhibit Influenza A virus replication and provide a basis for the development of siRNAs as prophylaxis and therapy for influenza infection both in humans and animals. Copyright © 2015 Elsevier B.V. All rights reserved.
Engineered Hydrogels for Local and Sustained Delivery of RNA-Interference Therapies.
Wang, Leo L; Burdick, Jason A
2017-01-01
It has been nearly two decades since RNA-interference (RNAi) was first reported. While there are no approved clinical uses, several phase II and III clinical trials suggest the great promise of RNAi therapeutics. One challenge for RNAi therapies is the controlled localization and sustained presentation to target tissues, to both overcome systemic toxicity concerns and to enhance in vivo efficacy. One approach that is emerging to address these limitations is the entrapment of RNAi molecules within hydrogels for local and sustained release. In these systems, nucleic acids are either delivered as siRNA conjugates or within nanoparticles. A plethora of hydrogels has been implemented using these approaches, including both traditional hydrogels that have already been developed for other applications and new hydrogels developed specifically for RNAi delivery. These hydrogels have been applied to various applications in vivo, including cancer, bone regeneration, inflammation and cardiac repair. This review will examine the design and implementation of such hydrogel RNAi systems and will cover the most recent applications of these systems. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carbonell, Alberto; Martinez de Alba, Angel-Emilio; Flores, Ricardo
2008-02-05
Infection by viroids, non-protein-coding circular RNAs, occurs with the accumulation of 21-24 nt viroid-derived small RNAs (vd-sRNAs) with characteristic properties of small interfering RNAs (siRNAs) associated to RNA silencing. The vd-sRNAs most likely derive from dicer-like (DCL) enzymes acting on viroid-specific dsRNA, the key elicitor of RNA silencing, or on the highly structured genomic RNA. Previously, viral dsRNAs delivered mechanically or agroinoculated have been shown to interfere with virus infection in a sequence-specific manner. Here, we report similar results with members of the two families of nuclear- and chloroplast-replicating viroids. Moreover, homologous vd-sRNAs co-delivered mechanically also interfered with one ofmore » the viroids examined. The interference was sequence-specific, temperature-dependent and, in some cases, also dependent on the dose of the co-inoculated dsRNA or vd-sRNAs. The sequence-specific nature of these effects suggests the involvement of the RNA induced silencing complex (RISC), which provides sequence specificity to RNA silencing machinery. Therefore, viroid titer in natural infections might be regulated by the concerted action of DCL and RISC. Viroids could have evolved their secondary structure as a compromise between resistance to DCL and RISC, which act preferentially against RNAs with compact and relaxed secondary structures, respectively. In addition, compartmentation, association with proteins or active replication might also help viroids to elude their host RNA silencing machinery.« less
Xia, He; Jun, Ji; Wen-Ping, Ling; Yi-Feng, Pan; Xiao-Ling, Chen
2013-10-01
The purpose of this study was to elucidate the transfection of chitosan nanoparticle carrying small interfering RNA against platelet-derived growth factor B (PDGF-B) to inhibit the expression of PDGF-B mRNA and proliferation of smooth muscle cells. A rabbit iliac artery injury model was constructed. A small interfering RNA (siRNA) against PDGF-B mRNA expression vector was constructed and packaged by chitosan nanoparticle to transfect into the vascular smooth muscle cells (vSMCs) of balloon catheter-injured rabbit iliac artery wall, using a therapeutic ultrasound for the gene delivery. The experiment was divided into two groups: experimental group, denudation and nano-PDGF-B siRNA treated, and only single denudation as control. Effects of the siRNA on the expressions of proliferating cell nuclear antigen (PCNA) and PDGF-B mRNA by vSMCs and the proliferation of vSMCs were observed with the methods of routine pathological, immunohistochemical staining, in situ hybridization and morphometry. The nano siRNA against PDGF-B was successfully transfected. The nano siRNA significantly inhibited the expressions of PCNA and PDGF-B mRNA in intimal vSMCs. The local intimal thickness and area were also reduced remarkably. In conclusion, transfection of chitosan nanoparticle carrying siRNA against PDGF-B mRNA could inhibit proliferation of vSMCs in the rabbit iliac artery injury model. © The Author(s) 2013 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.
Neutrophil-derived alpha defensins control inflammation by inhibiting macrophage mRNA translation
Tomlinson, Gareth H.; Miles, Katherine; Smith, Richard W. P.; Rossi, Adriano G.; Hiemstra, Pieter S.; van ’t Wout, Emily F. A.; Dean, Jonathan L. E.; Gray, Nicola K.; Lu, Wuyuan; Gray, Mohini
2016-01-01
Neutrophils are the first and most numerous cells to arrive at the site of an inflammatory insult and are among the first to die. We previously reported that alpha defensins, released from apoptotic human neutrophils, augmented the antimicrobial capacity of macrophages while also inhibiting the biosynthesis of proinflammatory cytokines. In vivo, alpha defensin administration protected mice from inflammation, induced by thioglychollate-induced peritonitis or following infection with Salmonella enterica serovar Typhimurium. We have now dissected the antiinflammatory mechanism of action of the most abundant neutrophil alpha defensin, Human Neutrophil Peptide 1 (HNP1). Herein we show that HNP1 enters macrophages and inhibits protein translation without inducing the unfolded-protein response or affecting mRNA stability. In a cell-free in vitro translation system, HNP1 powerfully inhibited both cap-dependent and cap-independent mRNA translation while maintaining mRNA polysomal association. This is, to our knowledge, the first demonstration of a peptide released from one cell type (neutrophils) directly regulating mRNA translation in another (macrophages). By preventing protein translation, HNP1 functions as a “molecular brake” on macrophage-driven inflammation, ensuring both pathogen clearance and the resolution of inflammation with minimal bystander tissue damage. PMID:27044108
Perivascular Delivery of Notch 1 siRNA Inhibits Injury-Induced Arterial Remodeling
Redmond, Eileen M.; Liu, Weimin; Hamm, Katie; Hatch, Ekaterina; Cahill, Paul A.; Morrow, David
2014-01-01
Objectives To determine the efficacy of perivascular delivery of Notch 1 siRNA in preventing injury-induced arterial remodeling. Methods and Results Carotid artery ligation was performed to induce arterial remodeling. After 14 days, morphometric analysis confirmed increased vSMC growth and subsequent media thickening and neointimal formation. Laser capture microdissection, quantitative qRT-PCR and immunoblot analysis of medial tissue revealed a significant increase in Notch1 receptor and notch target gene, Hrt 1 and 2 expression in the injured vessels. Perivascular delivery of Notch 1 siRNA by pluronic gel inhibited the injury-induced increase in Notch 1 receptor and target gene expression when compared to scrambled siRNA controls while concomitantly reducing media thickening and neointimal formation to pre-injury, sham-operated levels. Selective Notch 1 knockdown also reversed the injury-induced inhibition of pro-apoptotic Bax expression while decreasing injury-induced anti-apoptotic Bcl-XL expression to sham-operated control levels. In parallel experiments, proliferative cyclin levels, as measured by PCNA expression, were reversed to sham-operated control levels following selective Notch 1 knockdown. Conclusion These results suggest that injury-induced arterial remodeling can be successfully inhibited by localized perivascular delivery of Notch 1 siRNA. PMID:24416200
RNA interference technology to control pest sea lampreys--a proof-of-concept.
Heath, George; Childs, Darcy; Docker, Margaret F; McCauley, David W; Whyard, Steven
2014-01-01
The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0-fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species.
RNA Interference Technology to Control Pest Sea Lampreys - A Proof-of-Concept
Heath, George; Childs, Darcy; Docker, Margaret F.; McCauley, David W.; Whyard, Steven
2014-01-01
The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0–fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species. PMID:24505485
Prakash, Thazha P.; Johnston, Joseph F.; Graham, Mark J.; Condon, Thomas P.; Manoharan, Muthiah
2004-01-01
Synthesis and antisense activity of oligonucleotides modified with 2′-O-[2-[(N,N-dimethylamino)oxy] ethyl] (2′-O-DMAOE) are described. The 2′-O-DMAOE-modified oligonucleotides showed superior metabolic stability in mice. The phosphorothioate oligonucleotide ‘gapmers’, with 2′-O-DMAOE- modified nucleoside residues at the ends and 2′-deoxy nucleosides residues in the central region, showed dose-dependent inhibition of mRNA expression in cell culture for two targets. ‘Gapmer’ oligonucleotides have one or two 2′-O-modified regions and a 2′-deoxyoligonucleotide phosphorothioate region that allows RNase H digestion of target mRNA. To determine the in vivo potency and efficacy, BalbC mice were treated with 2′-O-DMAOE gapmers and a dose-dependent reduction in the targeted C-raf mRNA expression was observed. Oligonucleotides with 2′-O-DMAOE modifications throughout the sequences reduced the intercellular adhesion molecule-1 (ICAM-1) protein expression very efficiently in HUVEC cells with an IC50 of 1.8 nM. The inhibition of ICAM-1 protein expression by these uniformly modified 2′-O-DMAOE oligonucleotides may be due to selective interference with the formation of the translational initiation complex. These results demonstrate that 2′-O-DMAOE- modified oligonucleotides are useful for antisense-based therapeutics when either RNase H-dependent or RNase H-independent target reduction mechanisms are employed. PMID:14762210
Gao, Xiao-Ling; Yang, Jiao-Jiao; Wang, Shu-Juan; Chen, Yan; Wang, Bei; Cheng, Er-Jing; Gong, Jian-Nan; Dong, Yan-Ting; Liu, Dai; Wang, Xiang-Li; Huang, Ya-Qiong; An, Dong-Dong
2018-06-22
Breast cancer is known as the most prevalent cancer in women worldwide, and has an undeniable negative impact on public health, both physically, and mentally. This study aims to investigate the effects of toll-like receptor 4 (TLR4) gene silencing on proliferation and apoptosis of human breast cancer cells to explore for a new theoretical basis for its treatment. TLR4 small interference RNA (siRNA) fragment recombinant plasmids were constructed, including TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3. Human breast cancer MCF-7 and MDA-MB-231 cells were assigned into blank, negative control (NC), TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3 groups. MCF-7 and MDA-MB-231 cell growth was detected by MTT assay. Apoptosis and cell cycle were determined by flow cytometry. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) and Western blot analysis were conducted to determine the expression of TLR4, CDK4, cyclin D1, Livin, Bcl-2, p53, c-FLIP, and caspase-3. In comparison with the NC and blank groups, the TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3 groups showed decreased the expression of TLR4, inhibited proliferation of MCF-7 and MDA-MB-231 cells and promoted MCF-7 and MDA-MB-231 cell apoptosis, and the cells were blocked in G1 phase. In comparison with the NC and blank groups, in the TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3 groups, siRNA-TLR4 significantly increased expression of p53 and caspase-3 in MCF-7 and MDA-MB-231 cells, while it decreased the expressions of CDK4, cyclinD1, Livin, Bal-2, and c-FLIP. The study demonstrates that TLR4 gene silencing inhibits proliferation and induces apoptosis of MCF-7 and MDA-MB-231 cells. © 2018 Wiley Periodicals, Inc.
MicroRNA-133 inhibits behavioral aggregation by controlling dopamine synthesis in locusts.
Yang, Meiling; Wei, Yuanyuan; Jiang, Feng; Wang, Yanli; Guo, Xiaojiao; He, Jing; Kang, Le
2014-02-01
Phenotypic plasticity is ubiquitous and primarily controlled by interactions between environmental and genetic factors. The migratory locust, a worldwide pest, exhibits pronounced phenotypic plasticity, which is a population density-dependent transition that occurs between the gregarious and solitary phases. Genes involved in dopamine synthesis have been shown to regulate the phase transition of locusts. However, the function of microRNAs in this process remains unknown. In this study, we report the participation of miR-133 in dopamine production and the behavioral transition by negatively regulating two critical genes, henna and pale, in the dopamine pathway. miR-133 participated in the post-transcriptional regulation of henna and pale by binding to their coding region and 3' untranslated region, respectively. miR-133 displayed cellular co-localization with henna/pale in the protocerebrum, and its expression in the protocerebrum was negatively correlated with henna and pale expression. Moreover, miR-133 agomir delivery suppressed henna and pale expression, which consequently decreased dopamine production, thus resulting in the behavioral shift of the locusts from the gregarious phase to the solitary phase. Increasing the dopamine content could rescue the solitary phenotype, which was induced by miR-133 agomir delivery. Conversely, miR-133 inhibition increased the expression of henna and pale, resulting in the gregarious-like behavior of solitary locusts; this gregarious phenotype could be rescued by RNA interference of henna and pale. This study shows the novel function and modulation pattern of a miRNA in phenotypic plasticity and provides insight into the underlying molecular mechanisms of the phase transition of locusts.
PHOSPHOLIPASE Cβ CONNECTS G PROTEIN SIGNALING WITH RNA INTERFERENCE
Scarlata, Suzanne; Garwain, Osama; Williams, Leo; Burguera, Imanol Gonzalez; Rosati, Barbara; Sahu, Shriya; Guo, Yuanjian; Philip, Finly; Golebiewska, Urszula
2015-01-01
Phosphoinositide-specific-phospholipase Cβ (PLCβ) is the main effector of Gαq stimulation which is coupled to receptors that bind acetylcholine, bradykinin, dopamine, angiotensin II as well as other hormones and neurotransmitters. Using a yeast two-hybrid and other approaches, we have recently found that the same region of PLCβ that binds Gαq also interacts with Component 3 Promoter of RNA induced silencing complex (RISC) (C3PO), which is required for efficient activity of the RNA-induced silencing complex. In purified form, C3PO competes with Gαq for PLCβ binding and at high concentration can quench PLCβ activation. Additionally, we have found that the binding of PLCβ to C3PO inhibits its nuclease activity leading to reversal of RNA-induced silencing of specific genes. In cells, we found that PLCβ distributes between the plasma membrane where it localizes with Gαq, and in the cytosol where it localizes with C3PO. When cells are actively processing small interfering RNAs the interaction between PLCβ and C3PO gets stronger and leads to changes in the cellular distribution of PLCβ. The magnitude of attenuation is specific for different silencing RNAs. Our studies imply a direct link between calcium responses mediated through Gαq and post-transcriptional gene regulation through PLCβ. PMID:26746047
Phospholipase Cβ connects G protein signaling with RNA interference.
Scarlata, Suzanne; Garwain, Osama; Williams, Leo; Burguera, Imanol Gonzalez; Rosati, Barbara; Sahu, Shriya; Guo, Yuanjian; Philip, Finly; Golebiewska, Urszula
2016-05-01
Phosphoinositide-specific-phospholipase Cβ (PLCβ) is the main effector of Gαq stimulation which is coupled to receptors that bind acetylcholine, bradykinin, dopamine, angiotensin II as well as other hormones and neurotransmitters. Using a yeast two-hybrid and other approaches, we have recently found that the same region of PLCβ that binds Gαq also interacts with Component 3 Promoter of RNA induced silencing complex (C3PO), which is required for efficient activity of the RNA-induced silencing complex. In purified form, C3PO competes with Gαq for PLCβ binding and at high concentrations can quench PLCβ activation. Additionally, we have found that the binding of PLCβ to C3PO inhibits its nuclease activity leading to reversal of RNA-induced silencing of specific genes. In cells, we found that PLCβ distributes between the plasma membrane where it localizes with Gαq, and in the cytosol where it localizes with C3PO. When cells are actively processing small interfering RNAs the interaction between PLCβ and C3PO gets stronger and leads to changes in the cellular distribution of PLCβ. The magnitude of attenuation is specific for different silencing RNAs. Our studies imply a direct link between calcium responses mediated through Gαq and post-transcriptional gene regulation through PLCβ. Copyright © 2015 Elsevier Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi) is one of the most powerful and extraordinarily-specific means by which to silence genes. The ability of RNAi to silence genes makes it possible to ascertain function from genomic data, thereby making it an excellent choice for target-site screening. To test the efficacy of...
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.
Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige
2007-07-26
Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most
Yang, Wenbin; Zhao, Xiaoqing; Liang, Ran; Chen, Da
2017-09-01
To investigate the effects of small RNA interference targeting mammalian target of rapamycin (mTOR) expression on paraquat-induced pulmonary fibrosis in rats. Human embryonic kidney cells HEK-293 were cultured in vitro. The mTOR small interfering RNA (mTOR-siRNA) expression plasmid transfection lentivirus was constructed, and non-specific sequence plasmid with no homology to mTOR gene was set as the control. Seventy-two healthy male Sprague-Dawley (SD) rats were randomly divided into normal saline (NS) control group, paraquat model group, mTOR unrelated sequence group, and mTOR-siRNA group, with 18 rats in each group. Paraquat poisoning animal model was reproduced by intraperitoneally injecting 20% paraquat solution 15 mg/kg, while the NS control group was intraperitoneally injected the same volumes of NS. Rats in the mTOR unrelated sequence group and mTOR-siRNA group were injected 1×10 9 TU/mL lentivirus solution 50 μL into the airway, respectively, while in the NS control group and paraquat model group were injected the same volumes of NS. At 7, 14 and 28 days after treatment, 6 rats in each group were sacrificed respectively for lung tissue, the pathological changes and fibrosis of lung tissues were observed under light microscope. The levels of hydroxyproline (HYP) in lung tissues were determined by alkaline hydrolysis. The mRNA and protein expressions of mTOR in lung tissues were determined by reverse transcription-polymerase chain reaction (RT-PCR) and Western Blot. Under light microscope, there was no obvious pathological changes in the lung tissues in the NS control group, while in the paraquat model group and mTOR unrelated sequence group, lung tissue in rats were damaged, there were a lot of inflammatory cell infiltration, a large number of matrix collagen and fibrous tissues hyperplasia, and gradually increased with time, and it was consistent with paraquat-induced lung tissue fibrosis process. The pathological and fibrotic changes in lung tissue of mTOR-siRNA
Zhang, Qun; Shu, Fu-Li; Jiang, Yu-Feng; Huang, Xin-En
2015-01-01
In this study, influence caused by expression plasmids of connective tissue growth factor (CTGF) and tissue inhibitor of metalloproteinase-1 (TIMP-1) short hairpin RNA (shRNA) on mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII in hepatic tissue with hepatic fibrosis, a precancerous condition, in rats is analyzed. To screen and construct shRNA expression plasimid which effectively interferes RNA targets of CTGF and TIMP-1 in rats. 50 cleaning Wistar male rats are allocated randomly at 5 different groups after precancerous fibrosis models and then injection of shRNA expression plasimids. Plasmid psiRNA-GFP-Com (CTGF and TIMP-1 included), psiRNA-GFP-CTGF, psiRNA-GFP-TIMP-1 and psiRNA- DUO-GFPzeo of blank plasmid are injected at group A, B, C and D, respectively, and as model control group that none plasimid is injected at group E. In 2 weeks after last injection, to hepatic tissue at different groups, protein expression of CTGF, TIMP-1, procol-α1and PC III is tested by immunohistochemical method and,mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII is measured by real-time PCR. One-way ANOVA is used to comparison between-groups. Compared with model group, there is no obvious difference of mRNA expression among CTGF,TIMP-1,procol-α1,PC III and of protein expression among CTGF, TIMP-1, procol-α1, PC III in hepatic tissue at group injected with blank plasmid. Expression quantity of mRNA of CTGF, TIMP-1, procol-α1 and PCIII at group A, B and C decreases, protein expression of CTGF, TIMP-1, procol-α1, PC III in hepatic tissue is lower, where the inhibition of combination RNA interference group (group A) on procol-α1 mRNA transcription and procol-α1 protein expression is superior to that of single interference group (group B and C) (P<0.01 or P<0.05). RNA interference on CTGF and/or TIMP-1 is obviously a inhibiting factor for mRNA and protein expression of CTGF, TIMP-1, procol-α1 and PCIII. Combination RNA interference on genes of CTGF and TIMP-1 is superior
Evans, James C; Malhotra, Meenakshi; Sweeney, Katrina; Darcy, Raphael; Nelson, Colleen C; Hollier, Brett G; O'Driscoll, Caitriona M
2017-10-30
The main barrier to the development of an effective RNA interference (RNAi) therapy is the lack of a suitable delivery vector. Modified cyclodextrins have emerged in recent years for the delivery of siRNA. In the present study, a folate-targeted amphiphilic cyclodextrin was formulated using DSPE-PEG 5000 -folate to target prostate cancer cells. The fusogenic peptide GALA was included in the formulation to aid in the endosomal release of siRNA. Targeted nanoparticles were less than 200nm in size with a neutral surface charge. The complexes were able to bind siRNA and protect it from serum nucleases. Incubation with excess free folate resulted in a significant decrease in the uptake of targeted nanoparticles in LNCaP and PC3 cells, both of which have been reported to have differing pathways of folate uptake. There was a significant reduction in the therapeutic targets, ZEB1 and NRP1 at mRNA and protein level following treatment with targeted complexes. In preliminary functional assays using 3D spheroids, treatment of PC3 tumours with targeted complexes with ZEB1 and NRP1 siRNA resulted in more compact colonies relative to the untargeted controls and inhibited infiltration into the Matrigel™ layer. Copyright © 2017 Elsevier B.V. All rights reserved.
Emerging strategies for RNA interference (RNAi) applications in insects.
Nandety, Raja Sekhar; Kuo, Yen-Wen; Nouri, Shahideh; Falk, Bryce W
2015-01-01
RNA interference (RNAi) in insects is a gene regulatory process that also plays a vital role in the maintenance and in the regulation of host defenses against invading viruses. Small RNAs determine the specificity of the RNAi through precise recognition of their targets. These small RNAs in insects comprise small interfering RNAs (siRNAs), micro RNAs (miRNAs) and Piwi interacting RNAs (piRNAs) of various lengths. In this review, we have explored different forms of the RNAi inducers that are presently in use, and their applications for an effective and efficient fundamental and practical RNAi research with insects. Further, we reviewed trends in next generation sequencing (NGS) technologies and their importance for insect RNAi, including the identification of novel insect targets as well as insect viruses. Here we also describe a rapidly emerging trend of using plant viruses to deliver the RNAi inducer molecules into insects for an efficient RNAi response.
Aedes aegypti uses RNA interference in defense against Sindbis virus infection.
Campbell, Corey L; Keene, Kimberly M; Brackney, Douglas E; Olson, Ken E; Blair, Carol D; Wilusz, Jeffrey; Foy, Brian D
2008-03-17
RNA interference (RNAi) is an important anti-viral defense mechanism. The Aedes aegypti genome encodes RNAi component orthologs, however, most populations of this mosquito are readily infected by, and subsequently transmit flaviviruses and alphaviruses. The goal of this study was to use Ae. aegypti as a model system to determine how the mosquito's anti-viral RNAi pathway interacts with recombinant Sindbis virus (SINV; family Togaviridae, genus Alphavirus). SINV (TR339-eGFP) (+) strand RNA, infectious virus titers and infection rates transiently increased in mosquitoes following dsRNA injection to cognate Ago2, Dcr2, or TSN mRNAs. Detection of SINV RNA-derived small RNAs at 2 and 7 days post-infection in non-silenced mosquitoes provided important confirmation of RNAi pathway activity. Two different recombinant SINV viruses (MRE16-eGFP and TR339-eGFP) with significant differences in infection kinetics were used to delineate vector/virus interactions in the midgut. We show virus-dependent effects on RNAi component transcript and protein levels during infection. Monitoring midgut Ago2, Dcr2, and TSN transcript levels during infection revealed that only TSN transcripts were significantly increased in midguts over blood-fed controls. Ago2 protein levels were depleted immediately following a non-infectious bloodmeal and varied during SINV infection in a virus-dependent manner. We show that silencing RNAi components in Ae. aegypti results in transient increases in SINV replication. Furthermore, Ae. aegypti RNAi is active during SINV infection as indicated by production of virus-specific siRNAs. Lastly, the RNAi response varies in a virus-dependent manner. These data define important features of RNAi anti-viral defense in Ae. aegypti.
Inhibition of PAI-1 Antiproteolytic Activity Against tPA by RNA Aptamers
Damare, Jared; Brandal, Stephanie
2014-01-01
Plasminogen activator inhibitor-1 (PAI-1; SERPINE1) inhibits the plasminogen activators: tissue-type plasminogen activator (tPA) and urokinase-type plasminogen activator (uPA). Elevated levels of PAI-1 have been correlated with an increased risk for cardiovascular disease. Pharmacologically suppressing PAI-1 might prevent, or successfully treat PAI-1 related vascular diseases. This can potentially be accomplished by using small RNA molecules (aptamers). This study's goal is to develop RNA aptamers to a region of PAI-1 that will prevent the ability of PAI-1 to interact with the plasminogen activators. The aptamers were generated through a systematic evolution of ligands via exponential enrichment approach that ensures the creation of RNA molecules that bind to our target protein, PAI-1. In vitro assays were used to determine the effect of these aptamers on PAI-1's inhibitory activity. Three aptamers that bind to PAI-1 with affinities in the nanomolar range were isolated. The aptamer clones R10-4 and R10-2 inhibited PAI-1's antiproteolytic activity against tPA and disrupted PAI-1's ability to form a stable covalent complex with tPA. Increasing aptamer concentrations correlated positively with an increase in cleaved PAI-1. To the best of our knowledge, this is the first report of RNA molecules that inhibit the antiproteolytic activity of PAI-1. PMID:24922319
Triptolide inhibits COX-2 expression by regulating mRNA stability in TNF-{alpha}-treated A549 cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sun, Lixin; Zhang, Shuang; Jiang, Zhenzhou
2011-12-09
Highlights: Black-Right-Pointing-Pointer Triptolide inhibited COX-2 expression and the half-life of COX-2 mRNA is decreased. Black-Right-Pointing-Pointer The HuR protein shuttling from nucleus to cytoplasm is inhibited by triptolide. Black-Right-Pointing-Pointer Triptolide inhibited 3 Prime -UTR fluorescence reporter gene activity. Black-Right-Pointing-Pointer COX-2 mRNA binding to HuR is decreased by triptolide in pull-down experiments. -- Abstract: Cyclooxygenase-2 (COX-2) over-expression is frequently associated with human non-small-cell lung cancer (NSCLC) and involved in tumor proliferation, invasion, angiogenesis and resistance to apoptosis. In the present study, the effects of triptolide on COX-2 expression in A549 cells were investigated and triptolide was found to inhibit TNF-{alpha}-induced COX-2 expression.more » In our further studies, it was found that triptolide decreased the half-life of COX-2 mRNA dramatically and that it inhibited 3 Prime -untranslated region (3 Prime -UTR) fluorescence reporter gene activity. Meanwhile, triptolide inhibited the HuR shuttling from nucleus to cytoplasm. After triptolide treatment, decreased COX-2 mRNA in pull-down experiments with anti-HuR antibodies was observed, indicating that the decreased cytoplasmic HuR is responsible for the decreased COX-2 mRNA. Taken together, our results provided evidence for the first time that triptolide inhibited COX-2 expression by COX-2 mRNA stability modulation and post-transcriptional regulation. These results provide a novel mechanism of action for triptolide which may be important in the treatment of lung cancer.« less
Zhong, Di; Zhao, Siren; He, Guangxu; Li, Jinku; Lang, Yanbin; Ye, Wei; Li, Yongli; Jiang, Chuanlu; Li, Xianfeng
2015-06-01
Leucine-rich α2 glycoprotein 1 (LRG1) has been shown to be aberrantly expressed in multiple human malignancies. However, the biological functions of LRG1 in human glioblastoma remain unknown. Here, we report for the first time the role of LRG1 in glioblastoma development based on the preliminary in vitro and in vivo data. We first confirmed the expression of LRG1 in human glioblastoma cell lines. Next, to investigate the role of LRG1 in the tumorigenesis and development of glioblastoma, a short hairpin RNA (shRNA) construct targeting LRG1 mRNA was transfected into U251 glioblastoma cells to generate a cell line with stably silenced LRG1 expression. The results showed that silencing of LRG1 significantly inhibited cell proliferation, induced cell cycle arrest at G0/G1 phase, and enhanced apoptosis in U251 cells in vitro. Consistently, LRG1 silencing resulted in the downregulation of key cell cycle factors including cyclin D1, B, and E and apoptotic gene Bcl-2 while elevated the levels of pro-apoptotic Bax and cleaved caspase-3, as determined by Western blot analysis. We further demonstrate that the silencing of LRG1 expression effectively reduced the tumorigenicity of U251 cells, delayed tumor formation, and promoted apoptosis in a xenograft tumor model in vivo. In conclusion, silencing the expression of LRG1 suppresses the growth of glioblastoma U251 cells in vitro and in vivo, suggesting that LRG1 may play a critical role in glioblastoma development, and it may have potential clinical implications in glioblastoma therapy.
Conditioned Fear Inhibits c-fos mRNA Expression in the Central Extended Amygdala
Day, Heidi E.W.; Kryskow, Elisa M.; Nyhuis, Tara J.; Herlihy, Lauren; Campeau, Serge
2008-01-01
We have shown previously that unconditioned stressors inhibit neurons of the lateral/capsular division of the central nucleus of the amygdala (CEAl/c) and oval division of the bed nucleus of the stria terminalis (BSTov), which form part of the central extended amygdala. The current study investigated whether conditioned fear inhibits c-fos mRNA expression in these regions. Male rats were trained either to associate a visual stimulus (light) with footshock or were exposed to the light alone. After training, animals were replaced in the apparatus, and 2 hours later injected remotely, via a catheter, with amphetamine (2 mg/kg i.p.), to induce c-fos mRNA and allow inhibition of expression to be measured. The rats were then presented with 15 visual stimuli over a 30 minute period. As expected, fear conditioned animals that were not injected with amphetamine, had extremely low levels of c-fos mRNA in the central extended amygdala. In contrast, animals that were trained with the light alone (no fear conditioning) and were injected with amphetamine had high levels of c-fos mRNA in the CEAl/c and BSTov. Animals that underwent fear-conditioning, and were re-exposed to the conditioned stimulus after amphetamine injection had significantly reduced levels of c-fos mRNA in both the BSTov and CEAl/c, compared to the non-conditioned animals. These data suggest that conditioned fear can inhibit neurons of the central extended amygdala. Because these neurons are GABAergic, and project to the medial CEA (an amygdaloid output region), this may be a novel mechanism whereby conditioned fear potentiates amygdaloid output. PMID:18634767
A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.
Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi
2018-02-12
Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.
Meliopoulos, Victoria A.; Andersen, Lauren E.; Birrer, Katherine F.; Simpson, Kaylene J.; Lowenthal, John W.; Bean, Andrew G. D.; Stambas, John; Stewart, Cameron R.; Tompkins, S. Mark; van Beusechem, Victor W.; Fraser, Iain; Mhlanga, Musa; Barichievy, Samantha; Smith, Queta; Leake, Devin; Karpilow, Jon; Buck, Amy; Jona, Ghil; Tripp, Ralph A.
2012-01-01
Influenza virus encodes only 11 viral proteins but replicates in a broad range of avian and mammalian species by exploiting host cell functions. Genome-wide RNA interference (RNAi) has proven to be a powerful tool for identifying the host molecules that participate in each step of virus replication. Meta-analysis of findings from genome-wide RNAi screens has shown influenza virus to be dependent on functional nodes in host cell pathways, requiring a wide variety of molecules and cellular proteins for replication. Because rapid evolution of the influenza A viruses persistently complicates the effectiveness of vaccines and therapeutics, a further understanding of the complex host cell pathways coopted by influenza virus for replication may provide new targets and strategies for antiviral therapy. RNAi genome screening technologies together with bioinformatics can provide the ability to rapidly identify specific host factors involved in resistance and susceptibility to influenza virus, allowing for novel disease intervention strategies.—Meliopoulos, V. A., Andersen, L. E., Birrer, K. F., Simpson, K. J., Lowenthal, J. W., Bean, A. G. D., Stambas, J., Stewart, C. R., Tompkins, S. M., van Beusechem, V. W., Fraser, I., Mhlanga, M., Barichievy, S., Smith, Q., Leake, D., Karpilow, J., Buck, A., Jona, G., Tripp, R. A. Host gene targets for novel influenza therapies elucidated by high-throughput RNA interference screens. PMID:22247330
Amiloride Derivatives Inhibit Coxsackievirus B3 RNA Replication▿
Harrison, David N.; Gazina, Elena V.; Purcell, Damian F.; Anderson, David A.; Petrou, Steven
2008-01-01
Amiloride derivatives are known blockers of the cellular Na+/H+ exchanger and the epithelial Na+ channel. More recent studies demonstrate that they also inhibit ion channels formed by a number of viral proteins. We previously reported that 5-(N-ethyl-N-isopropyl)amiloride (EIPA) modestly inhibits intracellular replication and, to a larger extent, release of human rhinovirus 2 (HRV2) (E. V. Gazina, D. N. Harrison, M. Jefferies, H. Tan, D. Williams, D. A. Anderson and S. Petrou, Antiviral Res. 67:98-106, 2005). Here, we demonstrate that amiloride and EIPA strongly inhibit coxsackievirus B3 (CVB3) RNA replication and do not inhibit CVB3 release, in contrast to our previous findings on HRV2. Passaging of plasmid-derived CVB3 in the presence of amiloride generated mutant viruses with amino acid substitutions in position 299 or 372 of the CVB3 polymerase. Introduction of either of these mutations into the CVB3 plasmid produced resistance to amiloride and EIPA, suggesting that they act as inhibitors of CVB3 polymerase, a novel mechanism of antiviral activity for these compounds. PMID:18032495
Inhibition by Siomycin and Thiostrepton of Both Aminoacyl-tRNA and Factor G Binding to Ribosomes
Ll, Juan Modole; Cabrer, Bartolomé; Parmeggiani, Andrea; Azquez, David V
1971-01-01
Siomycin, a peptide antibiotic that interacts with the 50S ribosomal subunit and inhibits binding of factor G, is shown also to inhibit binding of aminoacyl-tRNA; however, it does not impair binding of fMet-tRNA and completion of the initiation complex. Moreover, unlike other inhibitors of aminoacyl-tRNA binding (tetracycline, sparsomycin, and streptogramin A), siomycin completely abolishes the GTPase activity associated with the binding of aminoacyl-tRNA catalyzed by factor Tu. A single-site interaction of siomycin appears to be responsible for its effect on both the binding of the aminoacyl-tRNA-Tu-GTP complex and that of factor G. PMID:4331558
Crowther, Carol; Mowa, Mohube B; Ely, Abdullah; Arbuthnot, Patrick B
2014-01-01
HBV is hyperendemic to southern Africa and parts of Asia, but licensed antivirals have little effect on limiting life-threatening complications of the infection. Although RNA interference (RNAi)-based gene silencing has shown therapeutic potential, difficulties with delivery of anti-HBV RNAi effectors remain an obstacle to their clinical use. To address concerns about the transient nature of transgene expression and toxicity resulting from immunostimulation by recombinant adenovirus vectors (Ads), utility of RNAi-activating anti-HBV helper-dependent (HD) Ads were assessed in this study. Following intravenous administration of 5×10(9) unmodified or pegylated HD Ad infectious particles to HBV transgenic mice, HBV viral loads and serum HBV surface antigen levels were monitored for 12 weeks. Immunostimulation of HD Ads was assessed by measuring inflammatory cytokines, hepatic function and immune response to the co-delivered LacZ reporter gene. Unmodified and pegylated HD Ads transduced 80-90% of hepatocytes and expressed short hairpin RNAs (shRNAs) were processed to generate intended HBV-targeting guides. Markers of HBV replication were decreased by approximately 95% and silencing was sustained for 8 weeks. Unmodified HD Ads induced release of proinflammatory cytokines and there was evidence of an adaptive immune response to β-galactosidase. However the HD Ad-induced innate immune response was minimal in preparations that were enriched with infectious particles. HD Ads have potential utility for delivery of therapeutic HBV-silencing sequences and alterations of these vectors to attenuate their immune responses may further improve their efficacy.
Zhang, Wanna; Liu, Bing; Lu, Yanhui; Liang, Gemei
2017-04-01
Salivary enzymes of many piercing-sucking insects lead to host plant injury. The salivary enzymes, polygalacturonase (PGs), act in insect feeding. PG family genes have been cloned from the mirid bug Apolygus lucorum, a pest of cotton and other host crops in China. We investigated the function of two PG genes that are highly expressed in A. lucorum nymphs (PG3-4) and adults (PG3-5), using siRNA injection-based RNA interference (RNAi). Accumulation of mRNA encoding both genes and their cognate proteins was significantly reduced (>60%) in experimental compared control green fluorescent protein (GFP) siRNA-treated mirids at 48 h post injection. Injury levels of cotton buds were also significantly reduced after injecting saliva isolated from PG3-4 and PG3-5 siRNA-treated A. lucorum. These results demonstrate that these two PG act in A. lucorum elicitation of plant injury. © 2017 Wiley Periodicals, Inc.
Chen, Chun-Chieh G; Simard, Martin J; Tabara, Hiroaki; Brownell, Daniel R; McCollough, Jennifer A; Mello, Craig C
2005-02-22
RNA interference (RNAi) is an ancient, highly conserved mechanism in which small RNA molecules (siRNAs) guide the sequence-specific silencing of gene expression . Several silencing machinery protein components have been identified, including helicases, RNase-related proteins, double- and single-stranded RNA binding proteins, and RNA-dependent RNA polymerase-related proteins . Work on these factors has led to the revelation that RNAi mechanisms intersect with cellular pathways required for development and fertility . Despite rapid progress in understanding key steps in the RNAi pathway, it is clear that many factors required for both RNAi and related developmental mechanisms have not yet been identified. Here, we report the characterization of the C. elegans gene rde-3. Genetic analysis of presumptive null alleles indicates that rde-3 is required for siRNA accumulation and for efficient RNAi in all tissues, and it is essential for fertility and viability at high temperatures. RDE-3 contains conserved domains found in the polymerase beta nucleotidyltransferase superfamily, which includes conventional poly(A) polymerases, 2'-5' oligoadenylate synthetase (OAS), and yeast Trf4p . These findings implicate a new enzymatic modality in RNAi and suggest possible models for the role of RDE-3 in the RNAi mechanism.
Allen, Michael Todd; Miller, Daniel P
2016-01-01
Anxiety vulnerable individuals exhibit enhanced acquisition of conditioned eyeblinks as well as enhanced proactive interference from conditioned stimulus (CS) or unconditioned stimulus (US) alone pre-exposures (Holloway et al., 2012). US alone pre-exposures disrupt subsequent conditioned response (CR) acquisition to CS-US paired trials as compared to context pre-exposure controls. While Holloway et al. (2012) reported enhanced acquisition in high trait anxiety individuals in the context condition, anxiety vulnerability effects were not reported for the US alone pre-exposure group. It appears from the published data that there were no differences between high and low anxiety individuals in the US alone condition. In the work reported here, we sought to extend the findings of enhanced proactive interference with US alone pre-exposures to determine if the enhanced conditioning was disrupted by proactive interference procedures. We also were interested in the spontaneous eyeblinks during the pre-exposure phase of training. We categorized individuals as anxiety vulnerability or non-vulnerable individuals based scores on the Adult Measure of Behavioral Inhibition (AMBI). Sixty-six participants received 60 trials consisting of 30 US alone or context alone pre-exposures followed by 30 CS-US trials. US alone pre-exposures not only disrupted CR acquisition overall, but behaviorally inhibited (BI) individuals exhibited enhanced proactive interference as compared to non-inhibited (NI) individuals. In addition, US alone pre-exposures disrupted the enhanced acquisition observed in BI individuals as compared to NI individuals following context alone pre-exposures. Differences were also found in rates of spontaneous eyeblinks between BI and NI individuals during context pre-exposure. Our findings will be discussed in the light of the neural substrates of eyeblink conditioning as well as possible factors such as hypervigilance in the amygdala and hippocampal systems, and possible
Allen, Michael Todd; Miller, Daniel P.
2016-01-01
Anxiety vulnerable individuals exhibit enhanced acquisition of conditioned eyeblinks as well as enhanced proactive interference from conditioned stimulus (CS) or unconditioned stimulus (US) alone pre-exposures (Holloway et al., 2012). US alone pre-exposures disrupt subsequent conditioned response (CR) acquisition to CS-US paired trials as compared to context pre-exposure controls. While Holloway et al. (2012) reported enhanced acquisition in high trait anxiety individuals in the context condition, anxiety vulnerability effects were not reported for the US alone pre-exposure group. It appears from the published data that there were no differences between high and low anxiety individuals in the US alone condition. In the work reported here, we sought to extend the findings of enhanced proactive interference with US alone pre-exposures to determine if the enhanced conditioning was disrupted by proactive interference procedures. We also were interested in the spontaneous eyeblinks during the pre-exposure phase of training. We categorized individuals as anxiety vulnerability or non-vulnerable individuals based scores on the Adult Measure of Behavioral Inhibition (AMBI). Sixty-six participants received 60 trials consisting of 30 US alone or context alone pre-exposures followed by 30 CS-US trials. US alone pre-exposures not only disrupted CR acquisition overall, but behaviorally inhibited (BI) individuals exhibited enhanced proactive interference as compared to non-inhibited (NI) individuals. In addition, US alone pre-exposures disrupted the enhanced acquisition observed in BI individuals as compared to NI individuals following context alone pre-exposures. Differences were also found in rates of spontaneous eyeblinks between BI and NI individuals during context pre-exposure. Our findings will be discussed in the light of the neural substrates of eyeblink conditioning as well as possible factors such as hypervigilance in the amygdala and hippocampal systems, and possible
Hu, Hui; Lu, Hong; He, Zhanping; Han, Xiangjun; Chen, Jing; Tu, Rong
2012-01-01
To investigate the effects of mRNA interference on aquaporin-4 expression in swollen tissue of rats with ischemic cerebral edema, and diagnose the significance of diffusion-weighted MRI, we injected 5 μL shRNA- aquaporin-4 (control group) or siRNA- aquaporin-4 solution (1:800) (RNA interference group) into the rat right basal ganglia immediately before occlusion of the middle cerebral artery. At 0.25 hours after occlusion of the middle cerebral artery, diffusion-weighted MRI displayed a high signal; within 2 hours, the relative apparent diffusion coefficient decreased markedly, aquaporin-4 expression increased rapidly, and intracellular edema was obviously aggravated; at 4 and 6 hours, the relative apparent diffusion coefficient slowly returned to control levels, aquaporin-4 expression slightly increased, and angioedema was observed. In the RNA interference group, during 0.25–6 hours after injection of siRNA- aquaporin-4 solution, the relative apparent diffusion coefficient slightly fluctuated and aquaporin-4 expression was upregulated; during 0.5–4 hours, the relative apparent diffusion coefficient was significantly higher, while aquaporin-4 expression was significantly lower when compared with the control group, and intracellular edema was markedly reduced; at 0.25 and 6 hours, the relative apparent diffusion coefficient and aquaporin-4 expression were similar when compared with the control group; obvious angioedema remained at 6 hours. Pearson's correlation test results showed that aquaporin-4 expression was negatively correlated with the apparent diffusion coefficient (r = −0.806, P < 0.01). These findings suggest that upregulated aquaporin-4 expression is likely to be the main molecular mechanism of intracellular edema and may be the molecular basis for decreased relative apparent diffusion coefficient. Aquaporin-4 gene interference can effectively inhibit the upregulation of aquaporin-4 expression during the stage of intracellular edema with time
Inhibition of Human Papillomavirus Type 16 Infection Using an RNA Aptamer.
Valencia-Reséndiz, Diana Gabriela; Palomino-Vizcaino, Giovanni; Tapia-Vieyra, Juana Virginia; Benítez-Hess, María Luisa; Leija-Montoya, Ana Gabriela; Alvarez-Salas, Luis Marat
2018-04-01
Human papillomavirus type 16 (HPV16) DNA has been found in ∼50% of cervical tumors worldwide. HPV infection starts with the binding of the virus capsid to heparan sulfate (HS) receptors exposed on the surface of epithelial basal layer keratinocytes. Previously, our group isolated a high-affinity RNA aptamer (Sc5c3) specific for HPV16 L1 virus-like particles (VLPs). In this study, we report the inhibition of HPV16 infection by Sc5c3 in a pseudovirus (PsVs) model. 293TT cells were infected by HPV16 PsVs containing the yellow fluorescent protein (YFP) as reporter gene. Incubation of HPV16 PsVs with Sc5c3 before infection resulted in a dose-dependent decrease in YFP fluorescence, suggesting infection inhibition. Aptamer degradation by RNase A restored PsVs infectivity, supporting the previous observation that Sc5c3 aptamer can inhibit infection. VLP mutants with removed HS binding sites were used in binding assays to elucidate the Sc5c3 blocking mechanism; however, no binding difference was observed between wild-type and mutant VLPs, suggesting that pseudoinfection inhibition relies on mechanisms additional to electrostatic HS binding site interaction. A DNA/RNA Sc5c3 version also inhibited HPV PsVs infection, suggesting that a modified, nuclease-resistant Sc5c3 may be used to inhibit HPV16 infection in vivo.
FcepsilonRI-alpha siRNA inhibits the antigen-induced activation of mast cells.
Safaralizadeh, Reza; Soheili, Zahra-Soheila; Deezagi, Abdolkhaleg; Pourpak, Zahra; Samiei, Shahram; Moin, Mostafa
2009-12-01
FcepsilonRI, The high affinity receptor for IgE plays a critical role in triggering the allergic reactions. It is responsible for inducing mast cell degranulation and deliberation of allergy mediators when it is aggregated by allergen and IgE complexes. FcepsilonRI on the mast cells consists of three subunits; alpha chain directly binds IgE, beta chain and dimmer of gamma chains together mediate intracellular signaling. Cross-linking of IgE-bound FcepsilonRI on the surface of mast cells and basophils by the multivalent antigen induces release of chemical mediators. The present in vitro study was designed to investigate the effect of synthetic FcepsilonRI-alpha siRNA on the antigen-induced activation of MC/9 cells. MC/9 cells which are murine mast cells were transfected by FcepsilonRI-alpha siRNA and negative control siRNA. After 6 h, anti-DNP (Dinitrophenyl) IgE was used for the cells sensitization. Then the cells were challenged with Dinitrophenyl-Human Serum Albumin (DNP-HSA) for mast cell degranulation induction before collection of supernatants. The amount of mRNA and protein expression was measured by Real Time PCR and western blot analysis, respectively. Determination of the expression rate of FcepsilonRI-alpha on cell surface was achieved by flow cytometry. ELISA and spectrophotometry methods were used subsequently for measuring the effects of FcepsilonRI-alpha siRNA on antigen-induced histamine and beta-hexosaminidase release. FcepsilonRI-alpha siRNA treated cells showed significant decrease in FcepsilonRI-alpha mRNA and protein expression in comparison to control cells. FcepsilonRI-mediated mast cell release of beta-hexosaminidase and histamine were also inhibited. In this study it was shown that FcepsilonRI-alpha siRNA could suppress FcepsilonRI-alpha expression and inhibited degranulation and histamine release in antigen-stimulated MC/9 cells. In conclusion, knock-down of FcepsilonRI-alpha by siRNA could be a promising method for inhibition of the mast
MicroRNA-133 Inhibits Behavioral Aggregation by Controlling Dopamine Synthesis in Locusts
Wang, Yanli; Guo, Xiaojiao; He, Jing; Kang, Le
2014-01-01
Phenotypic plasticity is ubiquitous and primarily controlled by interactions between environmental and genetic factors. The migratory locust, a worldwide pest, exhibits pronounced phenotypic plasticity, which is a population density-dependent transition that occurs between the gregarious and solitary phases. Genes involved in dopamine synthesis have been shown to regulate the phase transition of locusts. However, the function of microRNAs in this process remains unknown. In this study, we report the participation of miR-133 in dopamine production and the behavioral transition by negatively regulating two critical genes, henna and pale, in the dopamine pathway. miR-133 participated in the post-transcriptional regulation of henna and pale by binding to their coding region and 3′ untranslated region, respectively. miR-133 displayed cellular co-localization with henna/pale in the protocerebrum, and its expression in the protocerebrum was negatively correlated with henna and pale expression. Moreover, miR-133 agomir delivery suppressed henna and pale expression, which consequently decreased dopamine production, thus resulting in the behavioral shift of the locusts from the gregarious phase to the solitary phase. Increasing the dopamine content could rescue the solitary phenotype, which was induced by miR-133 agomir delivery. Conversely, miR-133 inhibition increased the expression of henna and pale, resulting in the gregarious-like behavior of solitary locusts; this gregarious phenotype could be rescued by RNA interference of henna and pale. This study shows the novel function and modulation pattern of a miRNA in phenotypic plasticity and provides insight into the underlying molecular mechanisms of the phase transition of locusts. PMID:24586212
[Efficacy of siRNA on feline leukemia virus replication in vitro].
Lehmann, Melanie; Weber, Karin; Rauch, Gisep; Hofmann-Lehmann, Regina; Hosie, Margaret J; Meli, Marina L; Hartmann, Katrin
2015-01-01
Feline leukemia virus (FeLV) can lead to severe clinical signs in cats. Until now, there is no effective therapy for FeLV-infected cats. RNA interference-based antiviral therapy is a new concept. Specific small interfering RNA (siRNA) are designed complementary to the mRNA of a target region, and thus inhibit replication. Several studies have proven efficacy of siRNAs in inhibiting virus replication. The aim of this study was to evaluate the inhibitory potential of siRNAs against FeLV replication in vitro. siRNAs against the FeLV env gene and the host cell surface receptor (feTHTR1) which is used by FeLV-A for entry as well as siRNA that were not complementary to the FeLV or cat genome, were tested. Crandell feline kidney cells (CrFK cells) were transfected with FeLV-A/Glasgow-1. On day 13, infected cells were transfected with siRNAs. As control, cells were mock-transfected or treated with azidothymidine (AZT) (5 μg/ml). Culture supernatants were analyzed for FeLV RNA using quantitative real-time RT-PCR and for FeLV p27 by ELISA every 24 hours for five days. All siRNAs significantly reduced viral RNA and p27 production, starting after 48 hours. The fact that non-complementary siRNAs also inhibited virus replication may lead to the conclusion that unspecific mechanisms rather than specific binding lead to inhibition.
Gu, Jijin; Al-Bayati, Karam; Ho, Emmanuel A
2017-08-01
RNA interference (RNAi)-mediated gene silencing offers a novel treatment and prevention strategy for human immunodeficiency virus (HIV) infection. HIV was found to infect and replicate in human brain cells and can cause neuroinfections and neurological deterioration. We designed dual-antibody-modified chitosan/small interfering RNA (siRNA) nanoparticles to deliver siRNA across the blood-brain barrier (BBB) targeting HIV-infected brain astrocytes as a strategy for inhibiting HIV replication. We hypothesized that transferrin antibody and bradykinin B2 antibody could specifically bind to the transferrin receptor (TfR) and bradykinin B2 receptor (B2R), respectively, and deliver siRNA across the BBB into astrocytes as potential targeting ligands. In this study, chitosan nanoparticles (CS-NPs) were prepared by a complex coacervation method in the presence of siRNA, and antibody was chemically conjugated to the nanoparticles. The antibody-modified chitosan nanoparticles (Ab-CS-NPs) were spherical in shape, with an average particle size of 235.7 ± 10.2 nm and a zeta potential of 22.88 ± 1.78 mV. The therapeutic potential of the nanoparticles was evaluated based on their cellular uptake and gene silencing efficiency. Cellular accumulation and gene silencing efficiency of Ab-CS-NPs in astrocytes were significantly improved compared to non-modified CS-NPs and single-antibody-modified CS-NPs. These results suggest that the combination of anti-Tf antibody and anti-B2 antibody significantly increased the knockdown effect of siRNA-loaded nanoparticles. Thus, antibody-mediated dual-targeting nanoparticles are an efficient and promising delivery strategy for inhibiting HIV replication in astrocytes. Graphical abstract Graphic representation of dual-antibody-conjugated chitosan nanoparticles for the targeted delivery of siRNA across the blood-brain barrier (BBB) for inhibiting HIV replication in astrocytes. a Nanoparticle delivery to the BBB and penetration. b Tf
Global effects of the CSR-1 RNA interference pathway on transcriptional landscape
Cecere, Germano; Hoersch, Sebastian; O’Keeffe, Sean; Sachidanandam, Ravi; Grishok, Alla
2014-01-01
Argonaute proteins and their small RNA co-factors short interfering RNAs (siRNAs) are known to inhibit gene expression at the transcriptional and post-transcriptional levels. In Caenorhabditis elegans, the Argonaute CSR-1 binds thousands of endogenous siRNAs (endo-siRNAs) antisense to germline transcripts and associates with chromatin in a siRNA-dependent manner. However, its role in gene expression regulation remains controversial. Here, we used a genome-wide profiling of nascent RNA transcripts to demonstrate that the CSR-1 RNAi pathway promotes sense-oriented Pol II transcription. Moreover, a loss of CSR-1 function resulted in global increase in antisense transcription and ectopic transcription of silent chromatin domains, which led to reduced chromatin incorporation of centromere-specific histone H3. Based on these findings, we propose that the CSR-1 pathway has a role in maintaining the directionality of active transcription thereby propagating the distinction between transcriptionally active and silent genomic regions. PMID:24681887
Zhu, Bao-Song; Yu, Li-Yan; Zhao, Kui; Wu, Yong-You; Cheng, Xiao-Li; Wu, Yong; Zhong, Feng-Yun; Gong, Wei; Chen, Qiang; Xing, Chun-Gen
2013-01-01
AIM: To investigate the effects of small interfering RNA (siRNA)-mediated inhibition of Class I phosphoinositide 3-kinase (Class I PI3K) signal transduction on the proliferation, apoptosis, and autophagy of gastric cancer SGC7901 and MGC803 cells. METHODS: We constructed the recombinant replication adenovirus PI3K(I)-RNA interference (RNAi)-green fluorescent protein (GFP) and control adenovirus NC-RNAi-GFP, and infected it into human gastric cancer cells. MTT assay was used to determine the growth rate of the gastric cancer cells. Activation of autophagy was monitored with monodansylcadaverine (MDC) staining after adenovirus PI3K(I)-RNAi-GFP and control adenovirus NC-RNAi-GFP treatment. Immunofluorescence staining was used to detect the expression of microtubule-associated protein 1 light chain 3 (LC3). Mitochondrial membrane potential was measured using the fluorescent probe JC-1. The expression of autophagy was monitored with MDC, LC3 staining, and transmission electron microscopy. Western blotting was used to detect p53, Beclin-1, Bcl-2, and LC3 protein expression in the culture supernatant. RESULTS: The viability of gastric cancer cells was inhibited after siRNA targeting to the Class I PI3K blocked Class I PI3K signal pathway. MTT assays revealed that, after SGC7901 cancer cells were treated with adenovirus PI3K(I)-RNAi-GFP, the rate of inhibition reached 27.48% ± 2.71% at 24 h, 41.92% ± 2.02% at 48 h, and 50.85% ± 0.91% at 72 h. After MGC803 cancer cells were treated with adenovirus PI3K(I)-RNAi-GFP, the rate of inhibition reached 24.39% ± 0.93% at 24 h, 47.00% ± 0.87% at 48 h, and 70.30% ± 0.86% at 72 h (P < 0.05 compared to control group). It was determined that when 50 MOI, the transfection efficiency was 95% ± 2.4%. Adenovirus PI3K(I)-RNAi-GFP (50 MOI) induced mitochondrial dysfunction and activated cell apoptosis in SGC7901 cells, and the results described here prove that RNAi of Class I PI3K induced apoptosis in SGC7901 cells
Han, Yang; Wang, Lvyin; Cui, Jin; Song, Yu; Luo, Zhen; Chen, Junbo; Xiong, Ying; Zhang, Qi; Liu, Fang; Ho, Wenzhe; Liu, Yingle; Wu, Jianguo
2016-01-01
ABSTRACT Enterovirus 71 (EV71) possesses a single-stranded positive RNA genome that contains a single open reading frame (ORF) flanked by a 5′ untranslated region (5′UTR) and a polyadenylated 3′UTR. Here, we demonstrated that EV71 activates the production of silent mating type information regulation 2 homolog 1 (SIRT1), a histone deacetylase (HDAC). EV71 further stimulates SIRT1 sumoylation and deacetylase activity, and enhances SIRT1 translocation from the nucleus to the cytoplasm. More interestingly, activated SIRT1 subsequently binds with the EV71 3Dpol protein (a viral RNA-dependent RNA polymerase, RdRp) to repress the acetylation and RdRp activity of 3Dpol, resulting in the attenuation of viral genome replication. Moreover, SIRT1 interacts with the cloverleaf structure of the EV71 RNA 5′UTR to inhibit viral RNA transcription, and binds to the internal ribosome entry site (IRES) of the EV71 5′UTR to attenuate viral RNA translation. Thus, EV71 stimulates SIRT1 production and activity, which in turn represses EV71 genome replication by inhibiting viral polymerase, and attenuates EV71 RNA transcription and translation by interfering with viral RNA. These results uncover a new function of SIRT1 and reveal a new mechanism underlying the regulation of EV71 replication. PMID:27875274
Specific Silencing of L392V PSEN1 Mutant Allele by RNA Interference
Sierant, Malgorzata; Paduszynska, Alina; Kazmierczak-Baranska, Julia; Nacmias, Benedetta; Sorbi, Sandro; Bagnoli, Silvia; Sochacka, Elzbieta; Nawrot, Barbara
2011-01-01
RNA interference (RNAi) technology provides a powerful molecular tool to reduce an expression of selected genes in eukaryotic cells. Short interfering RNAs (siRNAs) are the effector molecules that trigger RNAi. Here, we describe siRNAs that discriminate between the wild type and mutant (1174 C→G) alleles of human Presenilin1 gene (PSEN1). This mutation, resulting in L392V PSEN1 variant, contributes to early onset familial Alzheimer's disease. Using the dual fluorescence assay, flow cytometry and fluorescent microscopy we identified positions 8th–11th, within the central part of the antisense strand, as the most sensitive to mismatches. 2-Thiouridine chemical modification introduced at the 3′-end of the antisense strand improved the allele discrimination, but wobble base pairing adjacent to the mutation site abolished the siRNA activity. Our data indicate that siRNAs can be designed to discriminate between the wild type and mutant alleles of genes that differ by just a single nucleotide. PMID:21559198
DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells
Spike, Caroline A.; Bader, Jason; Reinke, Valerie; Strome, Susan
2008-01-01
P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs). PMID:18234720
DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells.
Spike, Caroline A; Bader, Jason; Reinke, Valerie; Strome, Susan
2008-03-01
P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs).
Downregulation of telomerase activity in human promyelocytic cell line using RNA interference.
Miri-Moghaddam, E; Deezagi, A; Soheili, Z S
2009-12-01
Telomerase is a ribonucleoprotein complex. It consists of two main components, human telomerase reverse transcriptase (hTERT) and human telomerase RNA. High telomerase activity is present in most malignant cells, but it is barely detectable in majority of somatic cells. The direct correlation between telomerase reactivation and carcinogens has made hTERT a key target for anticancer therapeutic studies. In this study, for the first time, we evaluated the ability of the new generation of short interfering RNA (siRNA) to regulate telomerase activity in the human promyelocytic leukemia cell line (HL-60). Transient transfection cell line by hTERT siRNAs resulted in statistically significant suppression of hTERT messenger RNAs which were detected by quantitative real-time polymerase chain reaction, while the expressed hTERT protein levels were measured by flow cytometry. The results of telomeric repeat amplification protocol showed that telomerase activity was significantly reduced upon transfection of the HL-60 cell line with hTERT siRNAs. The results of this study showed that telomerase activity and cell proliferation were efficiently inhibited in the hTERT siRNA-treated leukemic cell line.
Ren, Suping; Espiritu, Christine; Kelly, Mollie; Lau, Vincent; Zheng, Lingjie; Hartman, George D.; Flores, Osvaldo A.; Klumpp, Klaus
2017-01-01
ABSTRACT The hepatitis B virus (HBV) core protein serves multiple essential functions in the viral life cycle, and antiviral agents that target the core protein are being developed. Capsid assembly modulators (CAMs) are compounds that target core and misdirect capsid assembly, resulting in the suppression of HBV replication and virion production. Besides HBV DNA, circulating HBV RNA has been detected in patient serum and can be associated with the treatment response. Here we studied the effect of HBV CAMs on the production of extracellular HBV RNA using infected HepaRG cells and primary human hepatocytes. Representative compounds from the sulfonamide carboxamide and heteroaryldihydropyrimidine series of CAMs were evaluated and compared to nucleos(t)ide analogs as inhibitors of the viral polymerase. The results showed that CAMs blocked extracellular HBV RNA with efficiencies similar to those with which they blocked pregenomic RNA (pgRNA) encapsidation, HBV DNA replication, and Dane particle production. Nucleos(t)ide analogs inhibited viral replication and virion production but not encapsidation or production of extracellular HBV RNA. Profiling of HBV RNA from both culture supernatants and patient serum showed that extracellular viral RNA consisted of pgRNA and spliced pgRNA variants with an internal deletion(s) but still retained the sequences at both the 5′ and 3′ ends. Similar variants were detected in the supernatants of infected cells with and without nucleos(t)ide analog treatment. Overall, our data demonstrate that HBV CAMs represent direct antiviral agents with a profile differentiated from that of nucleos(t)ide analogs, including the inhibition of extracellular pgRNA and spliced pgRNA. PMID:28559265
Han, Wei; Zhou, Jingshi; Li, Xiao; Wang, Jianfeng; Li, Junjie; Zhang, Zhuochao; Yang, Zhaoxu; Wang, Desheng; Tao, Kaishan; Dou, Kefeng
2013-11-01
Pig organs are commonly used in xenotransplantation, and α-1,3-galactose has been shown to be the main cause of hyperacute rejection. The development of transgenic pigs that lack α-1,3-galactosyltransferase (GGTA1) has overcome this problem to a certain extent, but transgenic pigs are difficult to maintain, making their usefulness in basic research limited. For this reason, we propose to establish a cell model to study hyperacute rejection. Immortalized primary porcine aortic endothelial cells were transfected with a short hairpin RNA targeted to GGTA1. Cell proliferation, apoptosis, complement C3 activation, and the binding of human immunoglobulins and components of the complement system, including IgM, IgG, C3, and C5b-9, were examined. After RNA interference, GGTA1 was found to be reduced at both the transcript and protein level as assessed by quantitative polymerase chain reaction and flow cytometry, respectively. When cultured in the presence of human serum, the proliferation rate of the transfected cells was higher than that of untransfected cells, and the apoptosis rate was lower. Additionally, activation of C3 and the binding of human immunoglobulins IgM and IgG and complement component C3 and C5b-9 to the transfected cells were lower than in the immortalized group but higher than in untransfected cells. RNA interference of GGTA1 in cultured porcine endothelial cells reduces the reaction of immunoglobulin and complement system with the cells. Therefore, this in vitro cell model could be useful for further study of xenotransplantation. Copyright © 2013 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fradkin, L.G.; Yoshinaga, S.K.; Berk, A.J.
1987-11-01
The inhibition of transcription by RNA polymerase III in poliovirus-infected cells was studied. Experiments utilizing two different cell lines showed that the initiation step of transcription by RNA polymerase III was impaired by infection of these cells with the virus. The observed inhibition of transcription was not due to shut-off of host cell protein synthesis by poliovirus. Among four distinct components required for accurate transcription in vitro from cloned DNA templates, activities of RNA polymerase III and transcription factor TFIIIA were not significantly affected by virus infection. The activity of transcription factor TFIIIC, the limiting component required for transcription ofmore » RNA polymerase III genes, was severely inhibited in infected cells, whereas that of transcription factor TFIIIB was inhibited to a lesser extent. The sequence-specific DNA-binding of TFIIIC to the adenovirus VA1 gene internal promoted, however, was not altered by infection of cells with the virus. The authors conclude that (i) at least two transcription factors, TFIIIB and TFIIIC, are inhibited by infection of cells with poliovirtus, (ii) inactivation of TFIIIC does not involve destruction of its DNA-binding domain, and (iii) sequence-specific DNA binding by TFIIIC may be necessary but is not sufficient for the formation of productive transcription complexes.« less
Tolonen, Anna-Maria; Magga, Johanna; Szabó, Zoltán; Viitala, Pirkko; Gao, Erhe; Moilanen, Anne-Mari; Ohukainen, Pauli; Vainio, Laura; Koch, Walter J; Kerkelä, Risto; Ruskoaho, Heikki; Serpi, Raisa
2014-01-01
The members of lethal-7 (Let-7) microRNA (miRNA) family are involved in regulation of cell differentiation and reprogramming of somatic cells into induced pluripotent stem cells. However, their function in the heart is not known. In this study, we examined the effect of inhibiting the function of Let-7c miRNA on the progression of postinfarction left ventricular (LV) remodeling in mice. Myocardial infarction was induced with permanent ligation of left anterior descending coronary artery with a 4-week follow-up period. Let-7c miRNA was inhibited with a specific antagomir administered intravenously. The inhibition of Let-7c miRNA downregulated the levels of mature Let-7c miRNA and its other closely related members of Let-7 family in the heart and resulted in increased expression of pluripotency-associated genes Oct4 and Sox2 in cardiac fibroblasts in vitro and in adult mouse heart in vivo. Importantly, Let-7c inhibitor prevented the deterioration of cardiac function postinfarction, as demonstrated by preserved LV ejection fraction and elevated cardiac output. Improvement in cardiac function by Let-7c inhibitor postinfarction was associated with decreased apoptosis, reduced fibrosis, and reduction in the number of discoidin domain receptor 2–positive fibroblasts, while the number of c-kit+ cardiac stem cells and Ki-67+ proliferating cells remained unaltered. In conclusion, inhibition of Let-7 miRNA may be beneficial for the prevention of postinfarction LV remodeling and progression of heart failure. PMID:25505600
Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome
NASA Astrophysics Data System (ADS)
Lu, Rui; Folimonov, Alexey; Shintaku, Michael; Li, Wan-Xiang; Falk, Bryce W.; Dawson, William O.; Ding, Shou-Wei
2004-11-01
Viral infection in both plant and invertebrate hosts requires a virus-encoded function to block the RNA silencing antiviral defense. Here, we report the identification and characterization of three distinct suppressors of RNA silencing encoded by the 20-kb plus-strand RNA genome of citrus tristeza virus (CTV). When introduced by genetic crosses into plants carrying a silencing transgene, both p20 and p23, but not coat protein (CP), restored expression of the transgene. Although none of the CTV proteins prevented DNA methylation of the transgene, export of the silencing signal (capable of mediating intercellular silencing spread) was detected only from the F1 plants expressing p23 and not from the CP- or p20-expressing F1 plants, demonstrating suppression of intercellular silencing by CP and p20 but not by p23. Thus, intracellular and intercellular silencing are each targeted by a CTV protein, whereas the third, p20, inhibits silencing at both levels. Notably, CP suppresses intercellular silencing without interfering with intracellular silencing. The novel property of CP suggests a mechanism distinct to p20 and all of the other viral suppressors known to interfere with intercellular silencing and that this class of viral suppressors may not be consistently identified by Agrobacterium coinfiltration because it also induces RNA silencing against the infiltrated suppressor transgene. Our analyses reveal a sophisticated viral counter-defense strategy that targets the silencing antiviral pathway at multiple steps and may be essential for protecting CTV with such a large RNA genome from antiviral silencing in the perennial tree host. RNA interference | citrus tristeza virus | virus synergy | antiviral immunity
USDA-ARS?s Scientific Manuscript database
Asian longhorned beetle (ALB), Anoplophora glabripennis, is a serious invasive forest pest in several countries including the United States, Canada, and Europe. RNA interference (RNAi)technology is being developed as a novel method for pest management. Here, we identified the ALB core RNAi genes in...
DICER-ARGONAUTE2 Complex in Continuous Fluorogenic Assays of RNA Interference Enzymes
Bernard, Mark A.; Wang, Leyu; Tachado, Souvenir D.
2015-01-01
Mechanistic studies of RNA processing in the RNA-Induced Silencing Complex (RISC) have been hindered by lack of methods for continuous monitoring of enzymatic activity. “Quencherless” fluorogenic substrates of RNAi enzymes enable continuous monitoring of enzymatic reactions for detailed kinetics studies. Recombinant RISC enzymes cleave the fluorogenic substrates targeting human thymidylate synthase (TYMS) and hypoxia-inducible factor 1-α subunit (HIF1A). Using fluorogenic dsRNA DICER substrates and fluorogenic siRNA, DICER+ARGONAUTE2 mixtures exhibit synergistic enzymatic activity relative to either enzyme alone, and addition of TRBP does not enhance the apparent activity. Titration of AGO2 and DICER in enzyme assays suggests that AGO2 and DICER form a functional high-affinity complex in equimolar ratio. DICER and DICER+AGO2 exhibit Michaelis-Menten kinetics with DICER substrates. However, AGO2 cannot process the fluorogenic siRNA without DICER enzyme, suggesting that AGO2 cannot self-load siRNA into its active site. The DICER+AGO2 combination processes the fluorogenic siRNA substrate (K m=74 nM) with substrate inhibition kinetics (K i=105 nM), demonstrating experimentally that siRNA binds two different sites that affect Dicing and AGO2-loading reactions in RISC. This result suggests that siRNA (product of DICER) bound in the active site of DICER may undergo direct transfer (as AGO2 substrate) to the active site of AGO2 in the DICER+AGO2 complex. Competitive substrate assays indicate that DICER+AGO2 cleavage of fluorogenic siRNA is specific, since unlabeled siRNA and DICER substrates serve as competing substrates that cause a concentration-dependent decrease in fluorescent rates. Competitive substrate assays of a series of DICER substrates in vitro were correlated with cell-based assays of HIF1A mRNA knockdown (log-log slope=0.29), suggesting that improved DICER substrate designs with 10-fold greater processing by the DICER+AGO2 complex can provide a strong
RNA interference-based therapeutics for inherited long QT syndrome.
Li, Guoliang; Ma, Shuting; Sun, Chaofeng
2015-08-01
Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved.
RNA interference-based therapeutics for inherited long QT syndrome
LI, GUOLIANG; MA, SHUTING; SUN, CHAOFENG
2015-01-01
Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved. PMID:26622327
2007-02-05
lines. Three regulatory mechanisms have been examined in our laboratory: antisense inhibition, ribozyme cleavage, and RNA interference (RNAi...cell lines. However, the latter two regulatory mechanisms, ribozyme -based inactivation and RNAi-mediated silencing, demonstrated significant activity...in these cell lines as is briefly described below. Microswitches responsive to the small molecule theophylline and targeting GFP based on a ribozyme
Kandeel, Mahmoud; Kitade, Yukio
2013-07-01
RNA interference (RNAi) is a critical cellular pathway activated by double stranded RNA and regulates the gene expression of target mRNA. During RNAi, the 3' end of siRNA binds with the PAZ domain, followed by release and rebinding in a cyclic manner, which deemed essential for proper gene silencing. Recently, we provided the forces underlying the recognition of small interfering RNA by PAZ in a computational study based on the structure of Drosophila Argonaute 2 (Ago2) PAZ domain. We have now reanalyzed these data within the view of the new available structures from human Argonauts. While the parameters of weak binding are correlated with higher (RNAi) in the Drosophila model, a different profile is predicted with the human Ago2 PAZ domain. On the basis of the human Ago2 PAZ models, the indicators of stronger binding as the total binding energy and the free energy were associated with better RNAi efficacy. This discrepancy might be attributable to differences in the binding site topology and the difference in the conformation of the bound nucleotides.
Liu, Nan; Li, Ying; Chen, Hui; Wei, Wei; An, Yulin; Zhu, Guangming
2015-01-01
Notch3 plays an important role in differentiation, migration and signal transduction of vascular smooth muscle cells (VSMCs). In this study, we used RNA interference (RNAi) technique to investigate the effect of knocking down the expression of the NOTCH3 gene in VSMCs on the phenotype determination under pathologic status. Real-time PCR and Western Blot experiments verified the expression levels of Notch3 mRNA and protein were reduced more than 40% and 50% in the NOTCH3 siRNA group. When the expression of Notch3 was decreased, the proliferation, apoptosis and immigration of VSMCs were enhanced compared to control groups (P < 0.01). NOTCH3 siRNA VSMCs observed using confocal microscopy showed abnormal nuclear configuration, a disorganized actin filament system, polygonal cell shapes, and decreasing cell sizes. Additionally, knocking down the expression of NOTCH3 may evoke the CASR and FAK expression. In Conclusion, interfering with the expression of NOTCH3 causes VSMCs to exhibit an intermediate phenotype. CaSR and FAK may be involved in the Notch3 signaling pathway. PMID:26550181
Liu, Nan; Li, Ying; Chen, Hui; Wei, Wei; An, Yulin; Zhu, Guangming
2015-01-01
Notch3 plays an important role in differentiation, migration and signal transduction of vascular smooth muscle cells (VSMCs). In this study, we used RNA interference (RNAi) technique to investigate the effect of knocking down the expression of the NOTCH3 gene in VSMCs on the phenotype determination under pathologic status. Real-time PCR and Western Blot experiments verified the expression levels of Notch3 mRNA and protein were reduced more than 40% and 50% in the NOTCH3 siRNA group. When the expression of Notch3 was decreased, the proliferation, apoptosis and immigration of VSMCs were enhanced compared to control groups (P < 0.01). NOTCH3 siRNA VSMCs observed using confocal microscopy showed abnormal nuclear configuration, a disorganized actin filament system, polygonal cell shapes, and decreasing cell sizes. Additionally, knocking down the expression of NOTCH3 may evoke the CASR and FAK expression. In Conclusion, interfering with the expression of NOTCH3 causes VSMCs to exhibit an intermediate phenotype. CaSR and FAK may be involved in the Notch3 signaling pathway.
RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?
Unniyampurath, Unnikrishnan; Pilankatta, Rajendra; Krishnan, Manoj N.
2016-01-01
The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi) based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term. PMID:26927085
RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?
Unniyampurath, Unnikrishnan; Pilankatta, Rajendra; Krishnan, Manoj N
2016-02-26
The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi) based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term.
Ribonucleic acid interference knockdown of interleukin 6 attenuates cold-induced hypertension.
Crosswhite, Patrick; Sun, Zhongjie
2010-06-01
The purpose of this study was to determine the role of the proinflammatory cytokine interleukin (IL) 6 in cold-induced hypertension. Four groups of male Sprague-Dawley rats were used (6 rats per group). After blood pressure was stabilized, 3 groups received intravenous delivery of adenoassociated virus carrying IL-6 small hairpin RNA (shRNA), adenoassociated virus carrying scrambled shRNA, and PBS, respectively, before exposure to a cold environment (5 degrees C). The last group received PBS and was kept at room temperature (25 degrees C, warm) as a control. Adenoassociated virus delivery of IL-6 shRNA significantly attenuated cold-induced elevation of systolic blood pressure and kept it at the control level for < or =7 weeks (length of the study). Chronic exposure to cold upregulated IL-6 expression in aorta, heart, and kidneys and increased macrophage and T-cell infiltration in kidneys, suggesting that cold exposure increases inflammation. IL-6 shRNA delivery abolished the cold-induced upregulation of IL-6, indicating effective silence of IL-6. Interestingly, RNA interference knockdown of IL-6 prevented cold-induced inflammation, as evidenced by a complete inhibition of tumor necrosis factor-alpha expression and leukocyte infiltration by IL-6 shRNA. RNA interference knockdown of IL-6 significantly decreased the cold-induced increase in vascular superoxide production. It is noted that IL-6 shRNA abolished the cold-induced increase in collagen deposition in the heart, suggesting that inflammation is involved in cold-induced cardiac remodeling. Cold exposure caused glomerular collapses, which could be prevented by knockdown of IL-6, suggesting an important role of inflammation in cold-induced renal damage. In conclusion, cold exposure increased IL-6 expression and inflammation, which play critical roles in the pathogenesis of cold-induced hypertension and cardiac and renal damage.
Long Non-Coding RNA CASC2 Improves Diabetic Nephropathy by Inhibiting JNK Pathway.
Yang, Huihui; Kan, Quan E; Su, Yong; Man, Hua
2018-06-11
It's known that long non-coding RNA CASC2 overexpression inhibit the JNK pathway in some disease models, while JNK pathway activation exacerbates diabetic nephropathy. Therefore we speculate that long non-coding RNA CASC2 can improve diabetic nephropathy by inhibiting JNK pathway. Thus, our study was carried out to investigate the involvement of CASC2 in diabetic nephropathy. We found that serum level of CASC2 was significantly lower in diabetic nephropathy patients than in normal people, and serum level of CASC2 showed no significant correlations with age, gender, alcohol consumption and smoking habits, but was correlated with course of disease. ROC curve analysis showed that serum level of CASC2 could be used to accurately predict diabetic nephropathy. Diabetes mellitus has many complications. This study also included a series of complications of diabetes, such as diabetic retinopathy, diabetic ketoacidosis, diabetic foot infections and diabetic cardiopathy, while serum level of CASC2 was specifically reduced in diabetic nephropathy. CASC2 expression level decreased, while JNK1 phosphorylation level increased in mouse podocyte cells treated with high glucose. CASC2 overexpression inhibited apoptosis of podocyte cells and reduced phosphorylation level of JNK1. We conclude that long non-coding RNA CASC2 may improve diabetic nephropathy by inhibiting JNK pathway. © Georg Thieme Verlag KG Stuttgart · New York.
Walker, William B; Allen, Margaret L
2010-01-01
Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris.
Walker, William B.; Allen, Margaret L.
2010-01-01
Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris. PMID:21062205
USDA-ARS?s Scientific Manuscript database
Over the past decade RNA interference (RNAi) technology has emerged as a successful tool not only for functional genomics, but in planta expression of short interfering RNAs (siRNAs) could offer potential for insect pest management. Insects feeding exclusively on plant sap depend on osmotic pressure...
CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.
Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A
2014-05-06
In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.
New target for inhibition of bacterial RNA polymerase: 'switch region'.
Srivastava, Aashish; Talaue, Meliza; Liu, Shuang; Degen, David; Ebright, Richard Y; Sineva, Elena; Chakraborty, Anirban; Druzhinin, Sergey Y; Chatterjee, Sujoy; Mukhopadhyay, Jayanta; Ebright, Yon W; Zozula, Alex; Shen, Juan; Sengupta, Sonali; Niedfeldt, Rui Rong; Xin, Cai; Kaneko, Takushi; Irschik, Herbert; Jansen, Rolf; Donadio, Stefano; Connell, Nancy; Ebright, Richard H
2011-10-01
A new drug target - the 'switch region' - has been identified within bacterial RNA polymerase (RNAP), the enzyme that mediates bacterial RNA synthesis. The new target serves as the binding site for compounds that inhibit bacterial RNA synthesis and kill bacteria. Since the new target is present in most bacterial species, compounds that bind to the new target are active against a broad spectrum of bacterial species. Since the new target is different from targets of other antibacterial agents, compounds that bind to the new target are not cross-resistant with other antibacterial agents. Four antibiotics that function through the new target have been identified: myxopyronin, corallopyronin, ripostatin, and lipiarmycin. This review summarizes the switch region, switch-region inhibitors, and implications for antibacterial drug discovery. Copyright © 2011 Elsevier Ltd. All rights reserved.
Kishk, Abdelaziz; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Gowda, Siddarame; Killiny, Nabil
2017-03-01
Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is an important pest of citrus. In addition, D. citri is the vector of Huanglongbing, a destructive disease in citrus, also known as citrus greening disease caused by Candidatus Liberibacter asiaticus. Huanglongbing causes huge losses for citrus industries. Insecticide application for D. citri is the major strategy to prevent disease spread. The heavy use of insecticides causes development of insecticide resistance. We used RNA interference (RNAi) to silence genes implicated in pesticide resistance in order to increase the susceptibility. The activity of dsRNA to reduce the expression of carboxyesterases including esterases FE4 (EstFE4) and acetylcholinesterases (AChe) in D. citri was investigated. The dsRNA was applied topically to the fourth and fifth instars of nymphs. We targeted several EstFE4 and AChe genes using dsRNA against a consensus sequence for each of them. Five concentrations (25, 50, 75, 100, 125 ng/μl) from both dsRNAs were used. The treatments with the dsRNA caused concentration dependent nymph mortality. The highest gene expression levels of both AChe and EstFE4 were found in the fourth and fifth nymphal instars. Gene expression analysis showed that AChe genes were downregulated in emerged adults from dsRNA-AChe-treated nymphs compared to controls. However, EstFE4 genes were not affected. In the same manner, treatment with dsRNA-EstFE4 reduced expression level of EstFE4 genes in emerged adults from treated nymphs, but did not affect the expression of AChe genes. In the era of environmentally friendly control strategies, RNAi is a new promising venue to reduce pesticide applications. © 2017 Wiley Periodicals, Inc.
Kaushik, Nidhi; Subramani, Chandru; Anang, Saumya; Muthumohan, Rajagopalan; Shalimar; Nayak, Baibaswata; Ranjith-Kumar, C T; Surjit, Milan
2017-11-01
Hepatitis E virus (HEV) causes an acute, self-limiting hepatitis in healthy individuals and leads to chronic disease in immunocompromised individuals. HEV infection in pregnant women results in a more severe outcome, with the mortality rate going up to 30%. Though the virus usually causes sporadic infection, epidemics have been reported in developing and resource-starved countries. No specific antiviral exists against HEV. A combination of interferon and ribavirin therapy has been used to control the disease with some success. Zinc is an essential micronutrient that plays crucial roles in multiple cellular processes. Zinc salts are known to be effective in reducing infections caused by few viruses. Here, we investigated the effect of zinc salts on HEV replication. In a human hepatoma cell (Huh7) culture model, zinc salts inhibited the replication of genotype 1 (g-1) and g-3 HEV replicons and g-1 HEV infectious genomic RNA in a dose-dependent manner. Analysis of a replication-defective mutant of g-1 HEV genomic RNA under similar conditions ruled out the possibility of zinc salts acting on replication-independent processes. An ORF4-Huh7 cell line-based infection model of g-1 HEV further confirmed the above observations. Zinc salts did not show any effect on the entry of g-1 HEV into the host cell. Furthermore, our data reveal that zinc salts directly inhibit the activity of viral RNA-dependent RNA polymerase (RdRp), leading to inhibition of viral replication. Taken together, these studies unravel the ability of zinc salts in inhibiting HEV replication, suggesting their possible therapeutic value in controlling HEV infection. IMPORTANCE Hepatitis E virus (HEV) is a public health concern in resource-starved countries due to frequent outbreaks. It is also emerging as a health concern in developed countries owing to its ability to cause acute and chronic infection in organ transplant and immunocompromised individuals. Although antivirals such as ribavirin have been used
Silencing the myotrophin gene by RNA interference leads to the regression of cardiac hypertrophy.
Gupta, Sudhiranjan; Maitra, Ratan; Young, Dave; Gupta, Anasuya; Sen, Subha
2009-08-01
Myotrophin-induced activation of NF-kappaB has been shown to be associated with cardiac hypertrophy (CH) that progresses to heart failure (HF). In the present study, we examined the cause-and-effect relationship between myotrophin and NF-kappaB activation using small hairpin RNA (shRNA) against myotrophin both in vitro (using neonatal rat myocytes) and in vivo [using myotrophin transgenic (Myo-Tg) mice, which overexpress myotrophin in the heart, develop CH, and gradually progress to HF]. Among several lentiviral vectors expressing myotrophin shRNAs, L-sh-109 showed the best silencing effect at both the mRNA (155.3 +/- 5.9 vs. 32.5 +/- 5.5, P < 0.001) and protein levels associated with a significant reduction of atrial natriuretic factor (ANF) and NF-kappaB. In vivo, when L-sh-109 was delivered directly into the hearts of 10-wk-old Myo-Tg mice, we observed a significant regression of cardiac mass (8.0 vs. 5.7 mg/g, P < 0.001) and myotrophin gene expression (54.5% over untreated Myo-Tg mice, P < 0.001) associated with a reduction in ANF and NF-kappaB signaling components. Our data suggest that using RNA interference to silence the myotrophin gene prevents NF-kappaB activation, associated with an attenuation of CH. This strategy could be an excellent therapeutic means for the treatment of CH and HF.
Nollen, Ellen A. A.; Garcia, Susana M.; van Haaften, Gijs; Kim, Soojin; Chavez, Alejandro; Morimoto, Richard I.; Plasterk, Ronald H. A.
2004-01-01
Protein misfolding and the formation of aggregates are increasingly recognized components of the pathology of human genetic disease and hallmarks of many neurodegenerative disorders. As exemplified by polyglutamine diseases, the propensity for protein misfolding is associated with the length of polyglutamine expansions and age-dependent changes in protein-folding homeostasis, suggesting a critical role for a protein homeostatic buffer. To identify the complement of protein factors that protects cells against the formation of protein aggregates, we tested transgenic Caenorhabditis elegans strains expressing polyglutamine expansion yellow fluorescent protein fusion proteins at the threshold length associated with the age-dependent appearance of protein aggregation. We used genome-wide RNA interference to identify genes that, when suppressed, resulted in the premature appearance of protein aggregates. Our screen identified 186 genes corresponding to five principal classes of polyglutamine regulators: genes involved in RNA metabolism, protein synthesis, protein folding, and protein degradation; and those involved in protein trafficking. We propose that each of these classes represents a molecular machine collectively comprising the protein homeostatic buffer that responds to the expression of damaged proteins to prevent their misfolding and aggregation. PMID:15084750
McCAIN, JACK
2004-01-01
Mammalian cells dislike double-stranded RNA. They interpret it as a sign of an intruder, and they can unleash a recently discovered defensive mechanism to deal with the problem – they chop the invader into little pieces and use the remnants, called small interfering RNA, to identify and destroy the invader and its progeny. This process, known as RNA interference, may lend itself to new treatments for a wide range of diseases. RNA interference, however, resembles two therapies studied during the 1990s, antisense and ribozymes, in that the gene-silencing target is messenger RNA (mRNA). Is RNA interference really the Next Big Thing – or just a variation on an older but still intriguing theme? PMID:23372488
Structural Basis for Specific Inhibition of tRNA Synthetase by an ATP Competitive Inhibitor.
Fang, Pengfei; Han, Hongyan; Wang, Jing; Chen, Kaige; Chen, Xin; Guo, Min
2015-06-18
Pharmaceutical inhibitors of aminoacyl-tRNA synthetases demand high species and family specificity. The antimalarial ATP-mimetic cladosporin selectively inhibits Plasmodium falciparum LysRS (PfLysRS). How the binding to a universal ATP site achieves the specificity is unknown. Here we report three crystal structures of cladosporin with human LysRS, PfLysRS, and a Pf-like human LysRS mutant. In all three structures, cladosporin occupies the class defining ATP-binding pocket, replacing the adenosine portion of ATP. Three residues holding the methyltetrahydropyran moiety of cladosporin are critical for the specificity of cladosporin against LysRS over other class II tRNA synthetase families. The species-exclusive inhibition of PfLysRS is linked to a structural divergence beyond the active site that mounts a lysine-specific stabilizing response to binding cladosporin. These analyses reveal that inherent divergence of tRNA synthetase structural assembly may allow for highly specific inhibition even through the otherwise universal substrate binding pocket and highlight the potential for structure-driven drug development. Copyright © 2015 Elsevier Ltd. All rights reserved.
Kapnoula, Efthymia C.; McMurray, Bob
2016-01-01
Language learning is generally described as a problem of acquiring new information (e.g., new words). However, equally important are changes in how the system processes known information. For example, a wealth of studies has suggested dramatic changes over development in how efficiently children recognize familiar words, but it is unknown what kind of experience-dependent mechanisms of plasticity give rise to such changes in real-time processing. We examined the plasticity of the language processing system by testing whether a fundamental aspect of spoken word recognition, lexical interference, can be altered by experience. Adult participants were trained on a set of familiar words over a series of 4 tasks. In the high-competition (HC) condition, tasks were designed to encourage coactivation of similar words (e.g., net and neck) and to require listeners to resolve this competition. Tasks were similar in the low-competition (LC) condition, but did not enhance this competition. Immediately after training, interlexical interference was tested using a visual world paradigm task. Participants in the HC group resolved interference to a fuller degree than those in the LC group, demonstrating that experience can shape the way competition between words is resolved. TRACE simulations showed that the observed late differences in the pattern of interference resolution can be attributed to differences in the strength of lexical inhibition. These findings inform cognitive models in many domains that involve competition/interference processes, and suggest an experience-dependent mechanism of plasticity that may underlie longer term changes in processing efficiency associated with both typical and atypical development. PMID:26709587
Zha, Lisha; He, Lichun; Xie, Weidong; Cheng, Jin; Li, Tong; Mohsen, Mona O; Lei, Fan; Storni, Federico; Bachmann, Martin; Chen, Hongquan; Zhang, Yaou
2017-01-01
Pleiotrophin (PTN) is a secreted cytokine that is expressed in various cancer cell lines and human tumor such as colon cancer, lung cancer, gastric cancer and melanoma. It plays significant roles in angiogenesis, metastasis, differentiation and cell growth. The expression of PTN in the adult is limited to the hippocampus in an activity-dependent manner, making it a very attractive target for cancer therapy. RNA interference (RNAi) offers great potential as a new powerful therapeutic strategy based on its highly specific and efficient silencing of a target gene. However, efficient delivery of small interfering RNA (siRNA) in vivo remains a significant hurdle for its successful therapeutic application. In this study, we first identified, on a cell-based experiment, applying a 1:1 mixture of two PTN specific siRNA engenders a higher silencing efficiency on both mRNA and protein level than using any of them discretely at the same dose. As a consequence, slower melanoma cells growth was also observed for using two specific siRNA combinatorially. To establish a robust way for siRNA delivery in vivo and further investigate how silence of PTN affects tumor growth, we tested three different methods to deliver siRNA in vivo: first non-targeted in-vivo delivery of siRNA via jetPEI; second lung targeted delivery of siRNA via microbubble coated jetPEI; third tumor cell targeted delivery of siRNA via transferrin-polyethylenimine (Tf-PEI). As a result, we found that all three in-vivo siRNAs delivery methods led to an evident inhibition of melanoma growth in non-immune deficiency C57BL/6 mice without a measureable change of ALT and AST activities. Both targeted delivery methods showed more significant curative effect than jetPEI. The lung targeted delivery by microbubble coated jetPEI revealed a comparable therapeutic effect with Tf-PEI, indicating its potential application for target delivery of siRNA in vivo.
Xie, Weidong; Cheng, Jin; Li, Tong; Mohsen, Mona O.; Lei, Fan; Storni, Federico; Bachmann, Martin; Chen, Hongquan; Zhang, Yaou
2017-01-01
Pleiotrophin (PTN) is a secreted cytokine that is expressed in various cancer cell lines and human tumor such as colon cancer, lung cancer, gastric cancer and melanoma. It plays significant roles in angiogenesis, metastasis, differentiation and cell growth. The expression of PTN in the adult is limited to the hippocampus in an activity-dependent manner, making it a very attractive target for cancer therapy. RNA interference (RNAi) offers great potential as a new powerful therapeutic strategy based on its highly specific and efficient silencing of a target gene. However, efficient delivery of small interfering RNA (siRNA) in vivo remains a significant hurdle for its successful therapeutic application. In this study, we first identified, on a cell-based experiment, applying a 1:1 mixture of two PTN specific siRNA engenders a higher silencing efficiency on both mRNA and protein level than using any of them discretely at the same dose. As a consequence, slower melanoma cells growth was also observed for using two specific siRNA combinatorially. To establish a robust way for siRNA delivery in vivo and further investigate how silence of PTN affects tumor growth, we tested three different methods to deliver siRNA in vivo: first non-targeted in-vivo delivery of siRNA via jetPEI; second lung targeted delivery of siRNA via microbubble coated jetPEI; third tumor cell targeted delivery of siRNA via transferrin-polyethylenimine (Tf-PEI). As a result, we found that all three in-vivo siRNAs delivery methods led to an evident inhibition of melanoma growth in non-immune deficiency C57BL/6 mice without a measureable change of ALT and AST activities. Both targeted delivery methods showed more significant curative effect than jetPEI. The lung targeted delivery by microbubble coated jetPEI revealed a comparable therapeutic effect with Tf-PEI, indicating its potential application for target delivery of siRNA in vivo. PMID:28562667
Tran, Thi Phuong Anh; Vo, Duc Duy; Di Giorgio, Audrey; Duca, Maria
2015-09-01
MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression at the post-transcriptional level. It is now well established that the overexpression of some miRNAs (oncogenic miRNAs) is responsible for initiation and progression of human cancers and the discovery of new molecules able to interfere with their production and/or function represents one of the most important challenges of current medicinal chemistry of RNA ligands. In this work, we studied the ability of 18 different antibiotics, known as prokaryotic ribosomal RNA, to bind to oncogenic miRNA precursors (stem-loop structured pre-miRNAs) in order to inhibit miRNAs production. In vitro inhibition, binding constants, thermodynamic parameters and binding sites were investigated and highlighted that aminoglycosides and tetracyclines represent interesting pre-miRNA ligands with the ability to inhibit Dicer processing. Copyright © 2015 Elsevier Ltd. All rights reserved.
Chen, Jian-jing; Raab-Traub, Nancy; Yao, Qing-yun; Zhang, Feng; Huang, Mei-ling; Kuang, Zhu-ji; Zhang, Xiao-shi; Ye, Yan-li; Gu, Li
2002-01-01
The latent membrane protein gene (LMP) of Epstein-Barr virus (EBV) was thought to play an important role in the carcinogenesis of nasopharyngeal carcinoma (NPC). In this study, the authors investigated the effects of antisense RNA (AsRNA) on LMP for down regulating at the target gene over expression in EBV transformed lymphoid cells, and set up an antisense system to inhibit LMP expression. Constructing the single strand antisense transcription system in vitro, the authors have got large amount of AsRNA. Designing and setting up an antisense tracing system in situ (ATSIS), the authors could observe the living particles of AsRNA/sense RNA duplex dimer. With time lapse phase-contrast microscopy, the agglutination phenotype on living cells was easily detected by MTT test, the inhibition rate on EBV transformed cells was calculated. LMP 1.9 fragment ligated into pGEM vector in reverse orientation have been constructed and produced a plentiful amount of AsLMPmRNA which could incorporated into both B95-8 and C1936 cell lines by endophagocytosis and formed the duplex dimer of As/Sense RNA. This particles have been visualized in situ when labelling 35S isotope by ATSIS. When AsLMPmRNA acted as agents for specific inhibition to LMP over expression, the transform phenotype of cell agglutination have been suppressed and MTT particle formatin was apparently reduced both two EBV tansformed cell lines. AsLMPmRNA targets at sense strand have a high effectiveness of down-regulation on EBV-LMP overexpression. This down regulating function of LMP and growth inhibition on transformed cell is demonstrated by the antisenes tracing system in situ (ATSIS). The results provide a clue to overcome the latent EBV infection in human bodies all living long time and to prevent it inducing NPC in high incidence area by antisense strategies.
Zhang, Xiaohua Douglas; Yang, Xiting Cindy; Chung, Namjin; Gates, Adam; Stec, Erica; Kunapuli, Priya; Holder, Dan J; Ferrer, Marc; Espeseth, Amy S
2006-04-01
RNA interference (RNAi) high-throughput screening (HTS) experiments carried out using large (>5000 short interfering [si]RNA) libraries generate a huge amount of data. In order to use these data to identify the most effective siRNAs tested, it is critical to adopt and develop appropriate statistical methods. To address the questions in hit selection of RNAi HTS, we proposed a quartile-based method which is robust to outliers, true hits and nonsymmetrical data. We compared it with the more traditional tests, mean +/- k standard deviation (SD) and median +/- 3 median of absolute deviation (MAD). The results suggested that the quartile-based method selected more hits than mean +/- k SD under the same preset error rate. The number of hits selected by median +/- k MAD was close to that by the quartile-based method. Further analysis suggested that the quartile-based method had the greatest power in detecting true hits, especially weak or moderate true hits. Our investigation also suggested that platewise analysis (determining effective siRNAs on a plate-by-plate basis) can adjust for systematic errors in different plates, while an experimentwise analysis, in which effective siRNAs are identified in an analysis of the entire experiment, cannot. However, experimentwise analysis may detect a cluster of true positive hits placed together in one or several plates, while platewise analysis may not. To display hit selection results, we designed a specific figure called a plate-well series plot. We thus suggest the following strategy for hit selection in RNAi HTS experiments. First, choose the quartile-based method, or median +/- k MAD, for identifying effective siRNAs. Second, perform the chosen method experimentwise on transformed/normalized data, such as percentage inhibition, to check the possibility of hit clusters. If a cluster of selected hits are observed, repeat the analysis based on untransformed data to determine whether the cluster is due to an artifact in the data
Fan, Changru; Liu, Jinju; Tian, Jianhai; Zhang, Yuliang; Yan, Maojun; Zhu, Chaoyu
2018-06-15
The aim of the study was to evaluate the effects of synuclein-γ (SNCG) silencing on gastric cancer SGC7901 cells and to elucidate the associated mechanisms. pGCSIL-lentiviral siRNA targeting of the SNCG gene was employed to inhibit SNCG expression. Several experiments such as quantitative real-time PCR, Western blotting, MTT, colony formation, migration assay, and flow cytometry were performed to investigate the biological behavior of infected SGC7901 cells. BALB/c nude mice were used as tumor xenograft models to assess the effects of SNCG silencing on tumor growth. Western blot analysis was carried out to determine the relative levels of AKT, p-AKT, ERK, and p-ERK expression. Our results showed that SNCG was overexpressed in SGC7901 cells as compared to normal gastric mucosal epithelial cells. SGC7901 cells transfected with SNCG siRNA demonstrated significantly decreased gastric cancer growth (p < 0.01), reduced cell migration, cell cycle arrest in the G0/G1 phase, promoted tumor cell apoptosis (p < 0.01), and inhibited tumorigenesis in xenograft animal models. Western blot analysis indicated that the protein levels of p-AKT and p-ERK were much lower in the SNCG siRNA group than in the control groups. The results of the present study suggest that SNCG siRNA plays a significant role in the proliferation, migration, and tumorigenesis of gastric cancer by downregulating the phosphorylation of AKT and ERK. RNA interference-mediated silencing of SNCG may provide an opportunity to develop a novel treatment strategy for gastric cancer. © 2018 S. Karger AG, Basel.
Conde, João; Edelman, Elazer R; Artzi, Natalie
2015-01-01
microRNAs (miRNAs) show high potential for cancer treatment, however one of the most significant bottlenecks in enabling miRNA effect is the need for an efficient vehicle capable of selective targeting to tumor cells without disrupting normal cells. Even more challenging is the ability to detect and silence multiple targets simultaneously with high sensitivity while precluding resistance to the therapeutic agents. Focusing on the pervasive role of miRNAs, herein we review the multiple nanomaterial-based systems that encapsulate DNA/RNA for miRNA sensing and inhibition in cancer therapy. Understanding the potential of miRNA detection and silencing while overcoming existing limitations will be critical to the optimization and clinical utilization of this technology. Copyright © 2014 Elsevier B.V. All rights reserved.
PsOr1, a potential target for RNA interference-based pest management.
Zhao, Y Y; Liu, F; Yang, G; You, M S
2011-02-01
Insect pests cause billions of dollars in agricultural losses, and attempts to kill them have resulted in growing threats from insecticide resistance, dietary pesticide pollution and environmental destruction. New approaches to control refractory insect pests are therefore needed. The host-plant preferences of insect pests rely on olfaction and are mediated via a seven transmembrane-domain odorant receptor (Or) family. The present study reports the cloning and characterization of PsOr1, the first candidate member of the Or gene family from Phyllotreta striolata, a devastating beetle pest that causes damage worldwide. PsOr1 is remarkably well conserved with respect to other insect orthologues, including DmOr83b from Drosophila melanogaster. These insect orthologues form an essential non-conventional Or sub-family and may play an important and generalized role in insect olfaction. We designed double-stranded (ds) RNA directly against the PsOr1 gene and exploited RNA interference (RNAi) to control P. striolata. The chemotactic behavioural measurements showed that adult beetles were unable to sense the attractant or repellent odour stimulus after microinjection of dsRNA against PsOr1. Reverse Transcription (RT)-PCR analysis showed specific down-regulation of mRNA transcript levels for this gene. Furthermore, host-plant preference experiments confirmed that silencing PsOr1 by RNAi treatment impaired the host-plant preferences of P. striolata for cruciferous vegetables. These results demonstrate that this insect control approach of using RNAi to target PsOr1 and its orthologues might be effective in blocking host-plant-seeking behaviours in diverse insect pests. The results also support the theory that this unique receptor type plays an essential general role in insect olfaction. © 2010 Fujian Agriculture and Forestry University. Insect Molecular Biology © 2010 The Royal Entomological Society.
MicroRNA-375 inhibits colorectal cancer growth by targeting PIK3CA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Yihui; Tang, Qingchao; Li, Mingqi
2014-02-07
Highlights: • miR-375 is downregulated in colorectal cancer cell lines and tissues. • miR-375 inhibits colorectal cancer cell growth by targeting PIK3CA. • miR-375 inhibits colorectal cancer cell growth in xenograft nude mice model. - Abstract: Colorectal cancer (CRC) is the second most common cause of death from cancer. MicroRNAs (miRNAs) represent a class of small non-coding RNAs that control gene expression by triggering RNA degradation or interfering with translation. Aberrant miRNA expression is involved in human disease including cancer. Herein, we showed that miR-375 was frequently down-regulated in human colorectal cancer cell lines and tissues when compared to normalmore » human colon tissues. PIK3CA was identified as a potential miR-375 target by bioinformatics. Overexpression of miR-375 in SW480 and HCT15 cells reduced PIK3CA protein expression. Subsequently, using reporter constructs, we showed that the PIK3CA untranslated region (3′-UTR) carries the directly binding site of miR-375. Additionally, miR-375 suppressed CRC cell proliferation and colony formation and led to cell cycle arrest. Furthermore, miR-375 overexpression resulted in inhibition of phosphatidylinositol 3-kinase (PI3K)/Akt signaling pathway. SiRNA-mediated silencing of PIK3CA blocked the inhibitory effect of miR-375 on CRC cell growth. Lastly, we found overexpressed miR-375 effectively repressed tumor growth in xenograft animal experiments. Taken together, we propose that overexpression of miR-375 may provide a selective growth inhibition for CRC cells by targeting PI3K/Akt signaling pathway.« less
2012-01-01
Background Planarian stem cells, or neoblasts, drive the almost unlimited regeneration capacities of freshwater planarians. Neoblasts are traditionally described by their morphological features and by the fact that they are the only proliferative cell type in asexual planarians. Therefore, they can be specifically eliminated by irradiation. Irradiation, however, is likely to induce transcriptome-wide changes in gene expression that are not associated with neoblast ablation. This has affected the accurate description of their specific transcriptomic profile. Results We introduce the use of Smed-histone-2B RNA interference (RNAi) for genetic ablation of neoblast cells in Schmidtea mediterranea as an alternative to irradiation. We characterize the rapid, neoblast-specific phenotype induced by Smed-histone-2B RNAi, resulting in neoblast ablation. We compare and triangulate RNA-seq data after using both irradiation and Smed-histone-2B RNAi over a time course as means of neoblast ablation. Our analyses show that Smed-histone-2B RNAi eliminates neoblast gene expression with high specificity and discrimination from gene expression in other cellular compartments. We compile a high confidence list of genes downregulated by both irradiation and Smed-histone-2B RNAi and validate their expression in neoblast cells. Lastly, we analyze the overall expression profile of neoblast cells. Conclusions Our list of neoblast genes parallels their morphological features and is highly enriched for nuclear components, chromatin remodeling factors, RNA splicing factors, RNA granule components and the machinery of cell division. Our data reveal that the regulation of planarian stem cells relies on posttranscriptional regulatory mechanisms and suggest that planarians are an ideal model for this understudied aspect of stem cell biology. PMID:22439894
Roy, Arunava; Chakraborty, Prasenjit; Polley, Smarajit; Chattopadhyay, Dhrubajyoti; Roy, Siddhartha
2013-11-01
The fatal illness caused by Chandipura virus (CHPV), an emerging pathogen, presently lacks any therapeutic option. Previous research suggested that interaction between the virally encoded phosphoprotein (P) and the positive sense leader RNA (le-RNA) may play an important role in the viral lifecycle. In this report, we have identified a β-sheet/loop motif in the C-terminal domain of the CHPV P protein as essential for this interaction. A synthetic peptide encompassing this motif and spanning a continuous stretch of 36 amino acids (Pep208-243) was found to bind the le-RNA in vitro and inhibit CHPV growth in infected cells. Furthermore, a stretch of three amino acid residues at position 217-219 was identified as essential for this interaction, both in vitro and in infected cells. siRNA knockdown-rescue experiments demonstrated that these three amino acid residues are crucial for the leader RNA binding function of P protein in the CHPV life cycle. Mutations of these three amino acid residues render the peptide completely ineffective against CHPV. Effect of inhibition of phosphoprotein-leader RNA interaction on viral replication was assayed. Peptide Pep208-243 tagged with a cell penetrating peptide was found to inhibit CHPV replication as ascertained by real time RT-PCR. The specific inhibition of viral growth observed using this peptide suggests a new possibility for designing of anti-viral agents against Mononegavirale group of human viruses. Copyright © 2013. Published by Elsevier B.V.
A Re-Examination of Global Suppression of RNA Interference by HIV-1
Sanghvi, Viraj R.; Steel, Laura F.
2011-01-01
The nature of the interaction between replicating HIV-1 and the cellular RNAi pathway has been controversial, but it is clear that it can be complex and multifaceted. It has been proposed that the interaction is bi-directional, whereby cellular silencing pathways can restrict HIV-1 replication, and in turn, HIV-1 can suppress silencing pathways. Overall suppression of RNAi has been suggested to occur via direct binding and inhibition of Dicer by the HIV-1 Tat protein or through sequestration of TRBP, a Dicer co-factor, by the structured TAR element of HIV-1 transcripts. The role of Tat as an inhibitor of Dicer has been questioned and our results support and extend the conclusion that Tat does not inhibit RNAi that is mediated by either exogenous or endogenous miRNAs. Similarly, we find no suppression of silencing pathways in cells with replicating virus, suggesting that viral products such as the TAR RNA elements also do not reduce the efficacy of cellular RNA silencing. However, knockdown of Dicer does allow increased viral replication and this occurs at a post-transcriptional level. These results support the idea that although individual miRNAs can act to restrict HIV-1 replication, the virus does not counter these effects through a global suppression of RNAi synthesis or processing. PMID:21386885
Hlawaty, Hanna; San Juan, Aurélie; Jacob, Marie-Paule; Vranckx, Roger; Letourneur, Didier; Feldman, Laurent J
2007-12-01
Matrix metalloproteinase-2 (MMP-2) is constitutively expressed in vascular smooth muscle cells (VSMCs). Using small interfering RNA (siRNA), we evaluated the effect of MMP-2 inhibition in VSMCs in vitro and ex vivo. Rabbit VSMCs were transfected in vitro with 50 nmol/l MMP-2 siRNA or scramble siRNA. Flow cytometry and confocal microscopy showed cellular uptake of siRNA in approximately 80% of VSMCs. MMP-2 mRNA levels evaluated by real-time RT-PCR, pro-MMP-2 activity from conditioned culture media evaluated by gelatin zymography, and VSMC migration were reduced by 44 +/- 19%, 43 +/- 14%, and 36 +/- 14%, respectively, in MMP-2 siRNA-transfected compared with scramble siRNA-transfected VSMCs (P < 0.005 for all). Ex vivo MMP-2 siRNA transfection was performed 2 wk after balloon injury of hypercholesterolemic rabbit carotid arteries. Fluorescence microscopy showed circumferential siRNA uptake in neointimal cells. Gelatin zymography of carotid artery culture medium demonstrated a significant decrease of pro-MMP-2 activity in MMP-2 siRNA-transfected compared with scramble siRNA-transfected arteries (P < 0.01). Overall, our results demonstrate that in vitro MMP-2 siRNA transfection in VSMCs markedly inhibits MMP-2 gene expression and VSMC migration and that ex vivo delivery of MMP-2 siRNA in balloon-injured arteries reduces pro-MMP-2 activity in neointimal cells, suggesting that siRNA could be used to modify arterial biology in vivo.
Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.
2011-01-01
Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395
Joliot, Marc; Leroux, Gaëlle; Dubal, Stéphanie; Tzourio-Mazoyer, Nathalie; Houdé, Olivier; Mazoyer, Bernard; Petit, Laurent
2009-08-01
We combined event-related potential (ERP) and magnetoencephalography (MEG) acquisition and analysis to investigate the electrophysiological markers of the inhibitory processes involved in the number/length interference in a Piaget-like numerical task. Eleven healthy subjects performed four gradually interfering conditions with the heuristic "length equals number" to be inhibited. Low resolution tomography reconstruction was performed on the combined grand averaged electromagnetic data at the early (N1, P1) and late (P2, N2, P3(early) and P3(late)) latencies. Every condition was analyzed at both scalp and regional brain levels. The inhibitory processes were visible on the late components of the electromagnetic brain activity. A right P2-related frontal orbital activation reflected the change of strategy in the inhibitory processes. N2-related SMA/cingulate activation revealed the first occurrence of the stimuli processing to be inhibited. Both P3 components revealed the working memory processes operating in a medial temporal complex and the mental imagery processes subtended by the precuneus. Simultaneous ERP and MEG signal acquisition and analysis allowed to describe the spatiotemporal patterns of neural networks involved in the inhibition of the "length equals number" interference. Combining ERP and MEG ensured a sensitivity which could be reached previously only through invasive intracortical recordings.
RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.)
Abdurakhmonov, Ibrokhim Y.; Ayubov, Mirzakamol S.; Ubaydullaeva, Khurshida A.; Buriev, Zabardast T.; Shermatov, Shukhrat E.; Ruziboev, Haydarali S.; Shapulatov, Umid M.; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z.; Percy, Richard G.; Devor, Eric J.; Sharma, Govind C.; Sripathi, Venkateswara R.; Kumpatla, Siva P.; van der Krol, Alexander; Kater, Hake D.; Khamidov, Khakimdjan; Salikhov, Shavkat I.; Jenkins, Johnie N.; Abdukarimov, Abdusattor; Pepper, Alan E.
2016-01-01
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization. PMID:26941765
RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.).
Abdurakhmonov, Ibrokhim Y; Ayubov, Mirzakamol S; Ubaydullaeva, Khurshida A; Buriev, Zabardast T; Shermatov, Shukhrat E; Ruziboev, Haydarali S; Shapulatov, Umid M; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z; Percy, Richard G; Devor, Eric J; Sharma, Govind C; Sripathi, Venkateswara R; Kumpatla, Siva P; van der Krol, Alexander; Kater, Hake D; Khamidov, Khakimdjan; Salikhov, Shavkat I; Jenkins, Johnie N; Abdukarimov, Abdusattor; Pepper, Alan E
2016-01-01
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization.
Li, Lixuan; Li, Jia
2015-05-01
To study the effects of lentivirus-mediated short hairpin RNA (shRNA) silencing of lysosome-associated membrane protein type 2A (LAMP2A) expression on the proliferation of multiple myeloma cells. The constructed shRNA lentiviral vector was applied to infect human multiple myeloma cell line MM.1S, and stable expression cell line was obtained by puromycin screening. Western blotting was used to verify the inhibitory effect on LAMP2A protein expression. MTT assay was conducted to detect the effect of knocked-down LAMP2A on MM.1S cell proliferation, and the anti-tumor potency of suberoylanilide hydroxamic acid (SAHA) against the obtained MM.1S LAMP2A(shRNA) stable cell line. Lactate assay was performed to observe the impact of low LAMP2A expression on cell glycolysis. The stable cell line with low LAMP2A expression were obtained with the constructed human LAMP2A-shRNA lentiviral vector. Down-regulation of LAMP2A expression significantly inhibited MM.1S cell proliferation and enhanced the anti-tumor activity of SAHA. Interestingly, decreased LAMP2A expression also inhibited MM.1S cell lactic acid secretion. Down-regulation of LAMP2A expression could inhibit cell proliferation in multiple myeloma cells.
Caplen, Natasha J.; Parrish, Susan; Imani, Farhad; Fire, Andrew; Morgan, Richard A.
2001-01-01
Short interfering RNAs (siRNAs) are double-stranded RNAs of ≈21–25 nucleotides that have been shown to function as key intermediaries in triggering sequence-specific RNA degradation during posttranscriptional gene silencing in plants and RNA interference in invertebrates. siRNAs have a characteristic structure, with 5′-phosphate/3′-hydroxyl ends and a 2-base 3′ overhang on each strand of the duplex. In this study, we present data that synthetic siRNAs can induce gene-specific inhibition of expression in Caenorhabditis elegans and in cell lines from humans and mice. In each case, the interference by siRNAs was superior to the inhibition of gene expression mediated by single-stranded antisense oligonucleotides. The siRNAs seem to avoid the well documented nonspecific effects triggered by longer double-stranded RNAs in mammalian cells. These observations may open a path toward the use of siRNAs as a reverse genetic and therapeutic tool in mammalian cells. PMID:11481446
Wang, Gang; Lim, Siew Pheng; Chen, Yen-Liang; Hunziker, Jürg; Rao, Ranga; Gu, Feng; Seh, Cheah Chen; Ghafar, Nahdiyah Abdul; Xu, Haoying; Chan, Katherine; Lin, Xiaodong; Saunders, Oliver L; Fenaux, Martijn; Zhong, Weidong; Shi, Pei-Yong; Yokokawa, Fumiaki
2018-05-03
To identify a potent and selective nucleoside inhibitor of dengue virus RNA-dependent RNA polymerase, a series of 2'- and/or 4'-ribose sugar modified uridine nucleoside phosphoramidate prodrugs and their corresponding triphosphates were synthesized and evaluated. Replacement of 2'-OH with 2'-F led to be a poor substrate for both dengue virus and human mitochondrial RNA polymerases. Instead of 2'-fluorination, the introduction of fluorine at the ribose 4'-position was found not to affect the inhibition of the dengue virus polymerase with a reduction in uptake by mitochondrial RNA polymerase. 2'-C-ethynyl-4'-F-uridine phosphoramidate prodrug displayed potent anti-dengue virus activity in the primary human peripheral blood mononuclear cell-based assay with no significant cytotoxicity in human hepatocellular liver carcinoma cell lines and no mitochondrial toxicity in the cell-based assay using human prostate cancer cell lines. Copyright © 2018 Elsevier Ltd. All rights reserved.
Rabies viruses leader RNA interacts with host Hsc70 and inhibits virus replication
Zhang, Ran; Liu, Chuangang; Cao, Yunzi; Jamal, Muhammad; Chen, Xi; Zheng, Jinfang; Li, Liang; You, Jing; Zhu, Qi; Liu, Shiyong; Dai, Jinxia; Cui, Min; Fu, Zhen F.; Cao, Gang
2017-01-01
Viruses have been shown to be equipped with regulatory RNAs to evade host defense system. It has long been known that rabies virus (RABV) transcribes a small regulatory RNA, leader RNA (leRNA), which mediates the transition from viral RNA transcription to replication. However, the detailed molecular mechanism remains enigmatic. In the present study, we determined the genetic architecture of RABV leRNA and demonstrated its inhibitory effect on replication of wild-type rabies, DRV-AH08. The RNA immunoprecipitation results suggest that leRNA inhibits RABV replication via interfering the binding of RABV nucleoprotein with genomic RNA. Furthermore, we identified heat shock cognate 70 kDa protein (Hsc70) as a leRNA host cellular interacting protein, of which the expression level was dynamically regulated by RABV infection. Notably, our data suggest that Hsc70 was involved in suppressing RABV replication by leader RNA. Finally, our experiments imply that leRNA might be potentially useful as a novel drug in rabies post-exposure prophylaxis. Together, this study suggested leRNA in concert with its host interacting protein Hsc70, dynamically down-regulate RABV replication. PMID:28388579
Alakonya, Amos; Kumar, Ravi; Koenig, Daniel; Kimura, Seisuke; Townsley, Brad; Runo, Steven; Garces, Helena M; Kang, Julie; Yanez, Andrea; David-Schwartz, Rakefet; Machuka, Jesse; Sinha, Neelima
2012-07-01
Infection of crop species by parasitic plants is a major agricultural hindrance resulting in substantial crop losses worldwide. Parasitic plants establish vascular connections with the host plant via structures termed haustoria, which allow acquisition of water and nutrients, often to the detriment of the infected host. Despite the agricultural impact of parasitic plants, the molecular and developmental processes by which host/parasitic interactions are established are not well understood. Here, we examine the development and subsequent establishment of haustorial connections by the parasite dodder (Cuscuta pentagona) on tobacco (Nicotiana tabacum) plants. Formation of haustoria in dodder is accompanied by upregulation of dodder KNOTTED-like homeobox transcription factors, including SHOOT MERISTEMLESS-like (STM). We demonstrate interspecific silencing of a STM gene in dodder driven by a vascular-specific promoter in transgenic host plants and find that this silencing disrupts dodder growth. The reduced efficacy of dodder infection on STM RNA interference transgenics results from defects in haustorial connection, development, and establishment. Identification of transgene-specific small RNAs in the parasite, coupled with reduced parasite fecundity and increased growth of the infected host, demonstrates the efficacy of interspecific small RNA-mediated silencing of parasite genes. This technology has the potential to be an effective method of biological control of plant parasite infection.
Valdor, Markus; Wagner, Anke; Röhrs, Viola; Berg, Johanna; Fechner, Henry; Schröder, Wolfgang; Tzschentke, Thomas M; Bahrenberg, Gregor; Christoph, Thomas; Kurreck, Jens
2018-01-01
Activation of the neuronal potassium channel Kv7.2 encoded by the KCNQ2 gene has recently been shown to be an attractive mechanism to inhibit nociceptive transmission. However, potent, selective, and clinically proven activators of Kv7.2/Kv7.3 currents with analgesic properties are still lacking. An important prerequisite for the development of new drugs is a model to test the selectivity of novel agonists by abrogating Kv7.2/Kv7.3 function. Since constitutive knockout mice are not viable, we developed a model based on RNA interference-mediated silencing of KCNQ2. By delivery of a KCNQ2-specific short hairpin RNA with adeno-associated virus vectors, we completely abolished the activity of the specific Kv7.2/Kv7.3-opener ICA-27243 in rat sensory neurons. Results obtained in the silencing experiments were consistent between freshly prepared and cryopreserved dorsal root ganglion neurons, as well as in dorsal root ganglion neurons dissociated and cultured after in vivo administration of the silencing vector by intrathecal injections into rats. Interestingly, the tested associated virus serotypes substantially differed with respect to their transduction capability in cultured neuronal cell lines and primary dorsal root ganglion neurons and the in vivo transfer of transgenes by intrathecal injection of associated virus vectors. However, our study provides the proof-of-concept that RNA interference-mediated silencing of KCNQ2 is a suitable approach to create an ex vivo model for testing the specificity of novel Kv7.2/Kv7.3 agonists.
Stable SET knockdown in breast cell carcinoma inhibits cell migration and invasion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Jie; Key Laboratory of Modern Toxicology of Shenzhen, Shenzhen Center for Disease Control and Prevention, Shenzhen; Yang, Xi-fei
2014-10-10
Highlights: • We employed RNA interference to knockdown SET expression in breast cancer cells. • Knockdown of SET expression inhibits cell proliferation, migration and invasion. • Knockdown of SET expression increases the activity and expression of PP2A. • Knockdown of SET expression decreases the expression of MMP-9. - Abstract: Breast cancer is the most malignant tumor for women, however, the mechanisms underlying this devastating disease remain unclear. SET is an endogenous inhibitor of protein phosphatase 2A (PP2A) and involved in many physiological and pathological processes. SET could promote the occurrence of tumor through inhibiting PP2A. In this study, we exploremore » the role of SET in the migration and invasion of breast cancer cells MDA-MB-231 and ZR-75-30. The stable suppression of SET expression through lentivirus-mediated RNA interference (RNAi) was shown to inhibit the growth, migration and invasion of breast cancer cells. Knockdown of SET increases the activity and expression of PP2Ac and decrease the expression of matrix metalloproteinase 9 (MMP-9). These data demonstrate that SET may be involved in the pathogenic processes of breast cancer, indicating that SET can serve as a potential therapeutic target for the treatment of breast cancer.« less
Lan, Lan; Appelman, Carl; Smith, Amber R; Yu, Jia; Larsen, Sarah; Marquez, Rebecca T; Liu, Hao; Wu, Xiaoqing; Gao, Philip; Roy, Anuradha; Anbanandam, Asokan; Gowthaman, Ragul; Karanicolas, John; De Guzman, Roberto N; Rogers, Steven; Aubé, Jeffrey; Ji, Min; Cohen, Robert S; Neufeld, Kristi L; Xu, Liang
2015-08-01
Musashi-1 (MSI1) is an RNA-binding protein that acts as a translation activator or repressor of target mRNAs. The best-characterized MSI1 target is Numb mRNA, whose encoded protein negatively regulates Notch signaling. Additional MSI1 targets include the mRNAs for the tumor suppressor protein APC that regulates Wnt signaling and the cyclin-dependent kinase inhibitor P21(WAF-1). We hypothesized that increased expression of NUMB, P21 and APC, through inhibition of MSI1 RNA-binding activity might be an effective way to simultaneously downregulate Wnt and Notch signaling, thus blocking the growth of a broad range of cancer cells. We used a fluorescence polarization assay to screen for small molecules that disrupt the binding of MSI1 to its consensus RNA binding site. One of the top hits was (-)-gossypol (Ki = 476 ± 273 nM), a natural product from cottonseed, known to have potent anti-tumor activity and which has recently completed Phase IIb clinical trials for prostate cancer. Surface plasmon resonance and nuclear magnetic resonance studies demonstrate a direct interaction of (-)-gossypol with the RNA binding pocket of MSI1. We further showed that (-)-gossypol reduces Notch/Wnt signaling in several colon cancer cell lines having high levels of MSI1, with reduced SURVIVIN expression and increased apoptosis/autophagy. Finally, we showed that orally administered (-)-gossypol inhibits colon cancer growth in a mouse xenograft model. Our study identifies (-)-gossypol as a potential small molecule inhibitor of MSI1-RNA interaction, and suggests that inhibition of MSI1's RNA binding activity may be an effective anti-cancer strategy. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo
2017-01-17
Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.
Calder, Michele D; Watson, Patricia H; Watson, Andrew J
2011-11-01
During oogenesis, mammalian oocytes accumulate maternal mRNAs that support the embryo until embryonic genome activation. RNA-binding proteins (RBP) may regulate the stability and turnover of maternal and embryonic mRNAs. We hypothesised that varying embryo culture conditions, such as culture medium, oxygen tension and MAPK inhibition, affects regulation of RBPs and their targets during preimplantation development. STAU1, ELAVL1, KHSRP and ZFP36 proteins and mRNAs were detected throughout mouse preimplantation development, whereas Elavl2 mRNA decreased after the two-cell stage. Potential target mRNAs of RBP regulation, Gclc, Slc2a1 and Slc7a1 were detected during mouse preimplantation development. Gclc mRNA was significantly elevated in embryos cultured in Whitten's medium compared with embryos cultured in KSOMaa, and Gclc mRNA was elevated under high-oxygen conditions. Inhibition of the p38 MAPK pathway reduced Slc7a1 mRNA expression while inhibition of ERK increased Slc2a1 mRNA expression. The half-lives of the potential RBP mRNA targets are not regulated in parallel; Slc2a1 mRNA displayed the longest half-life. Our results indicate that mRNAs and proteins encoding five RBPs are present during preimplantation development and more importantly, demonstrate that expression of RBP target mRNAs are regulated by culture medium, gas atmosphere and MAPK pathways.
Interference of transcription across H-NS binding sites and repression by H-NS.
Rangarajan, Aathmaja Anandhi; Schnetz, Karin
2018-05-01
Nucleoid-associated protein H-NS represses transcription by forming extended DNA-H-NS complexes. Repression by H-NS operates mostly at the level of transcription initiation. Less is known about how DNA-H-NS complexes interfere with transcription elongation. In vitro H-NS has been shown to enhance RNA polymerase pausing and to promote Rho-dependent termination, while in vivo inhibition of Rho resulted in a decrease of the genome occupancy by H-NS. Here we show that transcription directed across H-NS binding regions relieves H-NS (and H-NS/StpA) mediated repression of promoters in these regions. Further, we observed a correlation of transcription across the H-NS-bound region and de-repression. The data suggest that the transcribing RNA polymerase is able to remodel the H-NS complex and/or dislodge H-NS from the DNA and thus relieve repression. Such an interference of transcription and H-NS mediated repression may imply that poorly transcribed AT-rich loci are prone to be repressed by H-NS, while efficiently transcribed loci escape repression. © 2018 John Wiley & Sons Ltd.
Yang, Yongbo; Wu, Chengxiang; Wu, Jianguo; Nerurkar, Vivek R; Yanagihara, Richard; Lu, Yuanan
2008-05-01
West Nile virus (WNV) has been responsible for the largest outbreaks of arboviral encephalitis in U.S. history. No specific drug is currently available for the effective treatment of WNV infection. To exploit RNA interference as a potential therapeutic approach, a Moloney murine leukemia virus-based retrovirus vector was used to effectively deliver WNV-specific small interfering RNA (siRNA) into human neuroblastoma HTB-11 cells. Viral plaque assays demonstrated that transduced cells were significantly refractory to WNV replication, as compared to untransduced control cells (P < 0.05), which correlated with the reduced expression of target viral genes and respective viral proteins. Therefore, retrovirus-mediated delivery of siRNA for gene silencing can be used to study the specific functions of viral genes associated with replication and may have potential therapeutic applications.
Zhang, Yijie; Bao, Mingwei; Dai, Mingyan; Wang, Xin; He, Wenbo; Tan, Tuantuan; Lin, Dandan; Wang, Wei; Wen, Ying; Zhang, Rui
2015-06-03
Fatty acid (FA) catabolism abnormality has been proved to play an important role in obesity-related cardiomyopathy. We hypothesized that cardiospecific suppression of CD36, the predominant membrane FA transporter, would protect against obesity-related cardiomyopathy. Four-wk-old male C57BL/6 J mice were fed with either high-fat-diet (HFD) or control-normal-diet for 2 wk. Then they were subjected to intramyocardial injection with recombinant lentiviral vectors containing short hairpin RNAs to selectively downregulate the expression of either cardiac CD36 or irrelevant gene by RNA interference. After a 10-wk continuation of the diet, biochemical, functional, morphological, histological, metabolic and molecular profiles were assessed. HFD administration elicited obesity, cardiac hypertrophy and systolic dysfunction accompanied with elevated serum levels of blood urea nitrogen (BUN), creatinine, fasting serum glucose (FSG), total cholesterol (TC) and triglyceride. Additionally, HFD consumption promoted lipid accumulation and reactive oxygen species (ROS) generation in the cardiomyocytes. Cardiospecific CD36 inhibition protected against HFD induced cardiac remodeling by decreasing heart/body weight ratio, increasing left ventricular (LV) ejection fraction and fractional shortening as well as normalizing LV diameter, without influencing body weight gain. Inhibition of cardiac CD36 also mitigated obesity induced alteration in BUN, creatinine and triglyceride, but had no effect on FSG or TC. Moreover, cardiospecific CD36 deficiency corrected myocardial lipid overaccumulation and intracellular ROS overproduction that were induced by HFD feeding. Cardiospecific CD36 inhibition protects against the aggravation of cardiac functional and morphological changes associated with HFD induced obesity. CD36 represents a potential therapeutic target for obesity cardiomyopathy.
Method for widespread microRNA-155 inhibition prolongs survival in ALS-model mice
Koval, Erica D.; Shaner, Carey; Zhang, Peter; du Maine, Xavier; Fischer, Kimberlee; Tay, Jia; Chau, B. Nelson; Wu, Gregory F.; Miller, Timothy M.
2013-01-01
microRNAs (miRNAs) are dysregulated in a variety of disease states, suggesting that this newly discovered class of gene expression repressors may be viable therapeutic targets. A microarray of miRNA changes in ALS-model superoxide dismutase 1 (SOD1)G93A rodents identified 12 miRNAs as significantly changed. Six miRNAs tested in human ALS tissues were confirmed increased. Specifically, miR-155 was increased 5-fold in mice and 2-fold in human spinal cords. To test miRNA inhibition in the central nervous system (CNS) as a potential novel therapeutic, we developed oligonucleotide-based miRNA inhibitors (anti-miRs) that could inhibit miRNAs throughout the CNS and in the periphery. Anti-miR-155 caused global derepression of targets in peritoneal macrophages and, following intraventricular delivery, demonstrated widespread functional distribution in the brain and spinal cord. After treating SOD1G93A mice with anti-miR-155, we significantly extended survival by 10 days and disease duration by 15 days (38%) while a scrambled control anti-miR did not significantly improve survival or disease duration. Therefore, antisense oligonucleotides may be used to successfully inhibit miRNAs throughout the brain and spinal cord, and miR-155 is a promising new therapeutic target for human ALS. PMID:23740943
Misra, Ashish; Green, Michael R
2017-01-01
Alternative splicing is a regulated process that leads to inclusion or exclusion of particular exons in a pre-mRNA transcript, resulting in multiple protein isoforms being encoded by a single gene. With more than 90 % of human genes known to undergo alternative splicing, it represents a major source for biological diversity inside cells. Although in vitro splicing assays have revealed insights into the mechanisms regulating individual alternative splicing events, our global understanding of alternative splicing regulation is still evolving. In recent years, genome-wide RNA interference (RNAi) screening has transformed biological research by enabling genome-scale loss-of-function screens in cultured cells and model organisms. In addition to resulting in the identification of new cellular pathways and potential drug targets, these screens have also uncovered many previously unknown mechanisms regulating alternative splicing. Here, we describe a method for the identification of alternative splicing regulators using genome-wide RNAi screening, as well as assays for further validation of the identified candidates. With modifications, this method can also be adapted to study the splicing regulation of pre-mRNAs that contain two or more splice isoforms.
Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo
2017-01-01
Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA. PMID:28032591
Advances in CRISPR-Cas9 genome engineering: lessons learned from RNA interference
Barrangou, Rodolphe; Birmingham, Amanda; Wiemann, Stefan; Beijersbergen, Roderick L.; Hornung, Veit; Smith, Anja van Brabant
2015-01-01
The discovery that the machinery of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9 bacterial immune system can be re-purposed to easily create deletions, insertions and replacements in the mammalian genome has revolutionized the field of genome engineering and re-invigorated the field of gene therapy. Many parallels have been drawn between the newly discovered CRISPR-Cas9 system and the RNA interference (RNAi) pathway in terms of their utility for understanding and interrogating gene function in mammalian cells. Given this similarity, the CRISPR-Cas9 field stands to benefit immensely from lessons learned during the development of RNAi technology. We examine how the history of RNAi can inform today's challenges in CRISPR-Cas9 genome engineering such as efficiency, specificity, high-throughput screening and delivery for in vivo and therapeutic applications. PMID:25800748
Bastin, Donald; Aitken, Amelia S; Pelin, Adrian; Pikor, Larissa A; Crupi, Mathieu J F; Huh, Michael S; Bourgeois-Daigneault, Marie-Claude; Bell, John C; Ilkow, Carolina S
2018-06-19
Antiviral responses are barriers that must be overcome for efficacy of oncolytic virotherapy. In mammalian cells, antiviral responses involve the interferon pathway, a protein-signaling cascade that alerts the immune system and limits virus propagation. Tumour-specific defects in interferon signaling enhance viral infection and responses to oncolytic virotherapy, but many human cancers are still refractory to oncolytic viruses. Given that invertebrates, fungi and plants rely on RNA interference pathways for antiviral protection, we investigated the potential involvement of this alternative antiviral mechanism in cancer cells. Here, we detected viral genome-derived small RNAs, indicative of RNAi-mediated antiviral responses, in human cancer cells. As viruses may encode suppressors of the RNA interference pathways, we engineered an oncolytic vesicular stomatitis virus variant to encode the Nodamura virus protein B2, a known inhibitor of RNAi-mediated immune responses. B2-expressing oncolytic virus showed enhanced viral replication and cytotoxicity, impaired viral genome cleavage and altered microRNA processing in cancer cells. Our data establish the improved therapeutic potential of our novel virus which targets the RNAi-mediated antiviral defense of cancer cells.
RNA interference therapy: a new solution for intracranial atherosclerosis?
Tang, Tao; Wong, Ka-Sing
2014-01-01
Intracranial atherosclerotic stenosis (ICAS) of a major intracranial artery, especially middle cerebral artery (MCA), is reported to be one leading cause of ischemic stroke throughout the world. Compared with other stroke subtypes, ICAS is associated with a higher risk of recurrent stroke despite aggressive medical therapy. Increased understanding of the pathophysiology of ICAS has highlighted several possible targets for therapeutic interventions. Both luminal stenosis and plaque components of ICAS have been found to be associated with ischemic stroke based a post-mortem study. Recent application of high-resolution magnetic resonance imaging (HRMRI) in evaluating ICAS provides new insight into the vascular biology of plaque morphology and component. High signal on T1-weighted fat-suppressed images (HST1) within MCA plaque of HRMRI, highly suggested of fresh or recent intraplaque hemorrhage, has been found to be associated with ipsilateral brain infarction. Thus, the higher prevalence of intraplaque hemorrhage and neovasculature in symptomatic patients with MCA stenosis may provide a potential target for plaque stabilization. We hypothesize that RNA interference (RNAi) therapy delivered by modified nanoparticles may achieve in vivo biomedical imaging and targeted therapy. With the rapid developments in studies about therapeutic and diagnostic nanomaterials, future studies further exploring the molecular biology of atherosclerosis may provide more drug targets for plaque stabilization. PMID:25333054
Steuten, Benedikt; Wagner, Rolf
2012-12-01
6S RNA is a bacterial transcriptional regulator,which accumulates during stationary phase and inhibits transcription from many promoters due to stable association with σ 70 -containing RNA polymerase. This inhibitory RNA polymerase ∼ 6S RNA complex dissociates during nutritional upshift, when cells undergo outgrowth from stationary phase, releasing active RNA polymerase ready for transcription. The release reaction depends on a characteristic property of 6S RNAs, namely to act as template for the de novo synthesis of small RNAs, termed pRNAs.Here, we used limited hydrolysis with structure-specific RNases and in-line probing of isolated 6S RNA and 6SRNA ∼ pRNA complexes to investigate the molecular details leading to the release reaction. Our results indicate that pRNA transcription induces the refolding of the 6S RNA secondary structure by disrupting part of the closing stem(conserved sequence regions CRI and CRIV) and formation of a new hairpin (conserved sequence regions CRIII and CRIV). Comparison of the dimethylsulfate modification pattern of 6S RNA in living cells at stationary growth and during outgrowth confirmed the conformational change observed in vitro. Based on our results, a model describing the individual steps of the release reaction is presented.
Chromophore-assisted light inactivation of pKi-67 leads to inhibition of ribosomal RNA synthesis.
Rahmanzadeh, R; Hüttmann, G; Gerdes, J; Scholzen, T
2007-06-01
Expression of the nuclear Ki-67 protein (pKi-67) is strongly associated with cell proliferation. For this reason, antibodies against this protein are widely used as prognostic tools for the assessment of cell proliferation in biopsies from cancer patients. Despite this broad application in histopathology, functional evidence for the physiological role of pKi-67 is still missing. Recently, we proposed a function of pKi-67 in the early steps of ribosomal RNA (rRNA) synthesis. Here, we have examined the involvement of pKi-67 in this process by photochemical inhibition using chromophore-assisted light inactivation (CALI). Anti-pKi-67 antibodies were labelled with the fluorochrome fluorescein 5(6)-isothiocyanate and were irradiated after binding to their target protein. Performing CALI in vitro on cell lysates led to specific cross-linking of pKi-67. Moreover, the upstream binding factor (UBF) necessary for rRNA transcription was also partly subjected to cross-link formation, indicating a close spatial proximity of UBF and pKi-67. CALI in living cells, using micro-injected antibody, caused a striking relocalization of UBF from foci within the nucleoli to spots located at the nucleolar rim or within the nucleoplasm. pKi-67-CALI resulted in dramatic inhibition of RNA polymerase I-dependent nucleolar rRNA synthesis, whereas RNA polymerase II-dependent nucleoplasmic RNA synthesis remained almost unaltered. Our data presented here argue for a crucial role of pKi-67 in RNA polymerase I-dependent nucleolar rRNA synthesis.
Ongvarrasopone, Chalermporn; Chomchay, Ekapol; Panyim, Sakol
2010-10-01
PmRab7 is a Penaeus monodon small GTPase protein possibly involved in replication of several shrimp viruses. In this study RNA interference (RNAi) using double-stranded RNA (dsRNA) targeting PmRab7 gene (dsRNA-PmRab7) was employed to silence the expression of PmRab7 to investigate the inhibitory effect on Laem-Singh virus (LSNV) replication. Injection of dsRNA-PmRab7 24h before challenge with the virus resulted in a drastic decrease of PmRab7 mRNA and complete inhibition of LSNV replication at 3 days post-challenge. In a therapeutic mode, shrimp injected with dsRNA-PmRab7 1 day but not at 3 or 5 days post-LSNV challenge resulted in inhibition of LSNV replication. These results pave the way to use dsRNA-PmRab7 to prevent or cure LSNV infection in shrimp. Copyright © 2010 Elsevier B.V. All rights reserved.
Woo, Ha-Na; Lee, Won Il; Kim, Ji Hyun; Ahn, Jeonghyun; Han, Jeong Hee; Lim, Sue Yeon; Lee, Won Woo; Lee, Heuiran
2015-12-01
A proof-of-concept study is presented using dual gene therapy that employed a small hairpin RNA (shRNA) specific for mammalian target of rapamycin (mTOR) and a herpes simplex virus-thymidine kinase (HSV-TK) gene to inhibit the growth of tumors. Recombinant adeno-associated virus (rAAV) vectors containing a mutant TK gene (sc39TK) were transduced into HeLa cells, and the prodrug ganciclovir (GCV) was administered to establish a suicide gene-therapy strategy. Additionally, rAAV vectors expressing an mTOR-targeted shRNA were employed to suppress mTOR-dependent tumor growth. GCV selectively induced death in tumor cells expressing TK, and the mTOR-targeted shRNA altered the cell cycle to impair tumor growth. Combining the TK-GCV system with mTOR inhibition suppressed tumor growth to a greater extent than that achieved with either treatment alone. Furthermore, HSV-TK expression and mTOR inhibition did not mutually interfere with each other. In conclusion, gene therapy that combines the TK-GCV system and mTOR inhibition shows promise as a novel strategy for cancer therapy.
Zinder, John C; Wasmuth, Elizabeth V; Lima, Christopher D
2016-11-17
The eukaryotic RNA exosome is an essential and conserved 3'-to-5' exoribonuclease complex that degrades or processes nearly every class of cellular RNA. The nuclear RNA exosome includes a 9-subunit non-catalytic core that binds Rrp44 (Dis3) and Rrp6 subunits to modulate their processive and distributive 3'-to-5' exoribonuclease activities, respectively. Here we utilize an engineered RNA with two 3' ends to obtain a crystal structure of an 11-subunit nuclear exosome bound to RNA at 3.1 Å. The structure reveals an extended RNA path to Rrp6 that penetrates into the non-catalytic core; contacts between the non-catalytic core and Rrp44, which inhibit exoribonuclease activity; and features of the Rrp44 exoribonuclease site that support its ability to degrade 3' phosphate RNA substrates. Using reconstituted exosome complexes, we show that 3' phosphate RNA is not a substrate for Rrp6 but is readily degraded by Rrp44 in the nuclear exosome. Copyright © 2016 Elsevier Inc. All rights reserved.
RNA editing of microRNA prevents RNA-induced silencing complex recognition of target mRNA
Cui, Yalei; Huang, Tianzhi; Zhang, Xiaobo
2015-01-01
MicroRNAs (miRNAs) integrate with Argonaut (Ago) to create the RNA-induced silencing complex, and regulate gene expression by silencing target mRNAs. RNA editing of miRNA may affect miRNA processing, assembly of the Ago complex and target mRNA binding. However, the function of edited miRNA, assembled within the Ago complex, has not been extensively investigated. In this study, sequence analysis of the Ago complex of Marsupenaeus japonicus shrimp infected with white spot syndrome virus (WSSV) revealed that host ADAR (adenosine deaminase acting on RNA) catalysed A-to-I RNA editing of a viral miRNA (WSSV-miR-N12) at the +16 site. This editing of the non-seed sequence did not affect association of the edited miRNA with the Ago protein, but inhibited interaction between the miRNA and its target gene (wsv399). The WSSV early gene wsv399 inhibited WSSV infection. As a result, the RNA editing of miRNA caused virus latency. Our results highlight a novel example of miRNA editing in the miRNA-induced silencing complex. PMID:26674414
Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok
2012-07-01
A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.
Khandelwal, Nitin; Chander, Yogesh; Rawat, Krishan Dutt; Riyesh, Thachamvally; Nishanth, Chikkahonnaiah; Sharma, Shalini; Jindal, Naresh; Tripathi, Bhupendra N; Barua, Sanjay; Kumar, Naveen
2017-08-01
At a noncytotoxic concentration, emetine was found to inhibit replication of DNA viruses [buffalopoxvirus (BPXV) and bovine herpesvirus 1 (BHV-1)] as well as RNA viruses [peste des petits ruminants virus (PPRV) and Newcastle disease virus (NDV)]. Using the time-of-addition and virus step-specific assays, we showed that emetine treatment resulted in reduced synthesis of viral RNA (PPRV and NDV) and DNA (BPXV and BHV-1) as well as inhibiting viral entry (NDV and BHV-1). In addition, emetine treatment also resulted in decreased synthesis of viral proteins. In a cell free endogenous viral polymerase assay, emetine was found to significantly inhibit replication of NDV, but not BPXV genome, suggesting that besides directly inhibiting specific viral polymerases, emetine may also target other factors essentially required for efficient replication of the viral genome. Moreover, emetine was found to significantly inhibit BPXV-induced pock lesions on chorioallantoic membrane (CAM) along with associated mortality of embryonated chicken eggs. At a lethal dose 50 (LD 50 ) of 126.49 ng/egg and at an effective concentration 50 (EC 50 ) of 3.03 ng/egg, the therapeutic index of the emetine against BPXV was determined to be 41.74. Emetine was also found to significantly delay NDV-induced mortality in chicken embryos associated with reduced viral titers. Further, emetine-resistant mutants were not observed upon long-term (P = 25) sequential passage of BPXV and NDV in cell culture. Collectively, we have extended the effective antiviral activity of emetine against diverse groups of DNA and RNA viruses and propose that emetine could provide significant therapeutic value against some of these viruses without inducing an antiviral drug-resistant phenotype. Copyright © 2017 Elsevier B.V. All rights reserved.
Ramon, A L; Bertrand, J R; de Martimprey, H; Bernard, G; Ponchel, G; Malvy, C; Vauthier, C
2013-07-01
Ewing's sarcoma is a rare, mostly pediatric bone cancer that presents a chromosome abnormality called EWS/Fli-1, responsible for the development of the tumor. In vivo, tumor growth can be inhibited specifically by delivering small interfering RNA (siRNA) associated with nanoparticles. The aim of the work was to design targeted nanoparticles against the cell membrane glycoprotein cd99, which is overexpressed in Ewing's sarcoma cells to improve siRNA delivery to tumor cells. Biotinylated poly(isobutylcyanoacrylate) nanoparticles were conceived as a platform to design targeted nanoparticles with biotinylated ligands and using the biotin-streptavidin coupling method. The targeted nanoparticles were validated in vivo for the targeted delivery of siRNA after systemic administration to mice bearing a tumor model of the Ewing's sarcoma. The expression of the gene responsible of Ewing's sarcoma was inhibited at 78% ± 6% by associating the siRNA with the cd99-targeted nanoparticles compared with an inhibition of only 41% ± 9% achieved with the nontargeted nanoparticles. Copyright © 2013 John Wiley & Sons, Ltd.
HIV-1 RNAs are Not Part of the Argonaute 2 Associated RNA Interference Pathway in Macrophages.
Vongrad, Valentina; Imig, Jochen; Mohammadi, Pejman; Kishore, Shivendra; Jaskiewicz, Lukasz; Hall, Jonathan; Günthard, Huldrych F; Beerenwinkel, Niko; Metzner, Karin J
2015-01-01
MiRNAs and other small noncoding RNAs (sncRNAs) are key players in post-transcriptional gene regulation. HIV-1 derived small noncoding RNAs (sncRNAs) have been described in HIV-1 infected cells, but their biological functions still remain to be elucidated. Here, we approached the question whether viral sncRNAs may play a role in the RNA interference (RNAi) pathway or whether viral mRNAs are targeted by cellular miRNAs in human monocyte derived macrophages (MDM). The incorporation of viral sncRNAs and/or their target RNAs into RNA-induced silencing complex was investigated using photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) as well as high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation (HITS-CLIP), which capture Argonaute2-bound miRNAs and their target RNAs. HIV-1 infected monocyte-derived macrophages (MDM) were chosen as target cells, as they have previously been shown to express HIV-1 sncRNAs. In addition, we applied small RNA deep sequencing to study differential cellular miRNA expression in HIV-1 infected versus non-infected MDMs. PAR-CLIP and HITS-CLIP data demonstrated the absence of HIV-1 RNAs in Ago2-RISC, although the presence of a multitude of HIV-1 sncRNAs in HIV-1 infected MDMs was confirmed by small RNA sequencing. Small RNA sequencing revealed that 1.4% of all sncRNAs were of HIV-1 origin. However, neither HIV-1 derived sncRNAs nor putative HIV-1 target sequences incorporated into Ago2-RISC were identified suggesting that HIV-1 sncRNAs are not involved in the canonical RNAi pathway nor is HIV-1 targeted by this pathway in HIV-1 infected macrophages.
Targeting a KH-domain protein with RNA decoys.
Makeyev, Aleksandr V; Eastmond, Dawn L; Liebhaber, Stephen A
2002-09-01
RNA-binding proteins are involved in the regulation of many aspects of eukaryotic gene expression. Targeted interference with RNA-protein interactions could offer novel approaches to modulation of expression profiles, alteration of developmental pathways, and reversal of certain disease processes. Here we investigate a decoy strategy for the study of the alphaCP subgroup of KH-domain RNA-binding proteins. These poly(C)-binding proteins have been implicated in a wide spectrum of posttranscriptional controls. Three categories of RNA decoys to alphaCPs were studied: poly(C) homopolymers, native mRNA-binding sites, and a high-affinity structure selected from a combinatorial library. Native chemistry was found to be essential for alphaCP decoy action. Because alphaCP proteins are found in both the nucleus and cytoplasm, decoy cassettes were incorporated within both nuclear (U1 snRNA) and cytoplasmic (VA1 RNA) RNA frameworks. Several sequences demonstrated optimal decoy properties when assayed for protein-binding and decoy bioactivity in vitro. A subset of these transcripts was shown to mediate targeted inhibition of alphaCP-dependent translation when expressed in either the nucleus or cytoplasm of transfected cells. Significantly, these studies establish the feasibility of developing RNA decoys that can selectively target biologic functions of abundant and widely expressed RNA binding proteins.
Targeting a KH-domain protein with RNA decoys.
Makeyev, Aleksandr V; Eastmond, Dawn L; Liebhaber, Stephen A
2002-01-01
RNA-binding proteins are involved in the regulation of many aspects of eukaryotic gene expression. Targeted interference with RNA-protein interactions could offer novel approaches to modulation of expression profiles, alteration of developmental pathways, and reversal of certain disease processes. Here we investigate a decoy strategy for the study of the alphaCP subgroup of KH-domain RNA-binding proteins. These poly(C)-binding proteins have been implicated in a wide spectrum of posttranscriptional controls. Three categories of RNA decoys to alphaCPs were studied: poly(C) homopolymers, native mRNA-binding sites, and a high-affinity structure selected from a combinatorial library. Native chemistry was found to be essential for alphaCP decoy action. Because alphaCP proteins are found in both the nucleus and cytoplasm, decoy cassettes were incorporated within both nuclear (U1 snRNA) and cytoplasmic (VA1 RNA) RNA frameworks. Several sequences demonstrated optimal decoy properties when assayed for protein-binding and decoy bioactivity in vitro. A subset of these transcripts was shown to mediate targeted inhibition of alphaCP-dependent translation when expressed in either the nucleus or cytoplasm of transfected cells. Significantly, these studies establish the feasibility of developing RNA decoys that can selectively target biologic functions of abundant and widely expressed RNA binding proteins. PMID:12358435
Zhang, Zhiting; Guo, Qianqian; Zhang, Shufang; Xiang, Chenxi; Guo, Xinwei; Zhang, Feng; Gao, Lanlan; Ni, Haiwei; Xi, Tao; Zheng, Lufeng
2018-05-07
RNA binding proteins (RBPs) are pivotal post-transcriptional regulators. RNPC1, an RBP, acts as a tumor suppressor through binding and regulating the expression of target genes in cancer cells. This study disclosed that RNPC1 expression was positively correlated with breast cancer patients' relapse free and overall survival, and RNPC1suppressed breast cancer cells metastasis. Mechanistically, RNPC1 promoting a competing endogenous network (ceRNA) crosstalk between STARD13, CDH5, HOXD10, and HOXD1 (STARD13-correlated ceRNA network) that we previously confirmed in breast cancer cells through stabilizing the transcripts and thus facilitating the expression of these four genes in breast cancer cells. Furthermore, RNPC1 overexpression restrained the promotion of STARD13, CDH5, HOXD10, and HOXD1 knockdown on cell metastasis. Notably, RNPC1 expression was positively correlated with CDH5, HOXD1 and HOXD10 expression in breast cancer tissues, and attenuated adriamycin resistance. Taken together, these results identified that RNPC1 could inhibit breast cancer cells metastasis via promoting STARD13-correlated ceRNA network.
Liu, Jie-Qiong; Li, Chen-Hong; Luo, Qiong; Yin, Ping-Ping; Lei, Tao; Luo, Fang
2016-11-20
To construct a replication-deficient herpes simplex virus (HSV-1) for delivering a short hairpin RNA (shRNA) targeting vesicular glutamate transporter 3 (VGLUT3) and observe its effect in alleviating allodynia in mice. The recombinant HSV-1 vector carrying the shRNA targeting Vglut3 (HSV-1-shvglut3) was constructed and inoculated in the sciatic nerve in a mouse model of mechanical allodynia to test its analgesia effect. Mechanical allodynia and heat hypersensitivity of the mice were tested by von Frey filaments and Hargreaves' test, respectively. VGLUT3 expression in the dorsal root ganglion (DRG) was evaluated by immunohistochemistry and Western blotting. Following inoculation in the sciatic nerve, the HSV vector HSV-1-shvglut3 was retrogradely transported to the DRG. Mechanical withdraw thresholds of the mouse models receiving HSV-1-shvglut3 inoculation were reversed to nearly the baseline level, and VGLUT3 expression in the DRG was down-regulated 2 weeks after vector inoculation. The analgesic effect lasted for over 2 weeks in these mice without obvious systematic side effects or changes in heat hypersensitivity threshold. Vglut3 in the DRG is a promising therapeutic target for alleviating mechanical allodynia, and HSV-1 vector-mediated RNA interference is safe and efficient for inducing long-lasting analgesia after peripheral inoculation of the vector.
Gently restless: association of ADHD-like traits with response inhibition and interference control.
Polner, Bertalan; Aichert, Désirée; Macare, Christine; Costa, Anna; Ettinger, Ulrich
2015-12-01
Impairment of inhibition-related functions is one of the most pronounced cognitive deficits found in attention-deficit/hyperactivity disorder (ADHD). Compelling evidence from studies of unaffected relatives of patients with ADHD and of ADHD-like traits in healthy subjects suggest the continuous distribution of ADHD symptoms in the population. A more subtle inhibitory deficit can also be found in healthy relatives of patients and in subjects with high ADHD-like traits. Here, we examined the relationship between inhibitory performance and ADHD-like traits, for the first time, in a large sample of healthy adults by applying multiple, widely used tests of inhibition-related functions. ADHD-like traits, in general, were independently predicted by Stroop interference score and, at trend level, by go/no-go commission error rate while controlling for socio-demographic factors, verbal intelligence and neuroticism. Additionally, higher inattentive traits were related to worse Stroop performance at trend level, and higher hyperactive/impulsive traits were significantly associated with more go/no-go commission errors. ADHD-like traits were strongly related to neuroticism. The study shows that individual differences in ADHD-like traits are related to variance in fundamental inhibition-related functions over and above effects of negative affect regulation, but the relationships tend to be small. The results suggest the quasi-dimensionality of ADHD and raise further questions about the relationship between genetic factors and the deficit of inhibition-related functions in the ADHD spectrum.
New basic approach to treat non-small cell lung cancer based on RNA-interference.
Makowiecki, Christina; Nolte, Andrea; Sutaj, Besmire; Keller, Timea; Avci-Adali, Meltem; Stoll, Heidi; Schlensak, Christian; Wendel, Hans Peter; Walker, Tobias
2014-03-01
To date the therapy for non-small cell lung cancer (NSCLC) is associated with severe side effects, frustrating outcomes, and does not consider different tumor characteristics. The RNA-interference (RNAi) pathway represents a potential new approach to treat NSCLC. With small interfering ribonucleic acids (siRNAs), it is possible to reduce the expression of proliferation-dependent proteins in tumor cells, leading to their apoptosis. We propose that siRNAs could be adapted to the tumor type and may cause fewer side effects than current therapy. Four NSCLC cell lines were cultured under standard conditions and transfected with three different concentrations of siRNAs targeted against the hypoxia-inducible factors 1α and 2α (HIF1α and HIF2α) and signal transducer and activator of transcription 3 (STAT3). The expression was observed by quantitative real-time polymerase chain reaction and western blots. For the analysis of cell growth three days after transfection, the cell number was detected using a CASY cell counter system. The results of the silencing of the analyzed factors differ in each cell line. Cell growth was significantly reduced in all cell lines after transfection with HIF1α- and STAT3-siRNA. The silencing of HIF2α resulted in a significant effect on cell growth in squamous, and large-cell lung cancer. This study shows that the knockdown and viability to siRNA transfection differ in each tumor type according to the used siRNA. This implies that the tumor types differ among themselves and should be treated differently. Therefore, the authors suggest a possible approach to a more personalized treatment of NSCLC.
Interplay of cis- and trans-regulatory mechanisms in the spliceosomal RNA helicase Brr2.
Absmeier, Eva; Becke, Christian; Wollenhaupt, Jan; Santos, Karine F; Wahl, Markus C
2017-01-02
RNA helicase Brr2 is implicated in multiple phases of pre-mRNA splicing and thus requires tight regulation. Brr2 can be auto-inhibited via a large N-terminal region folding back onto its helicase core and auto-activated by a catalytically inactive C-terminal helicase cassette. Furthermore, it can be regulated in trans by the Jab1 domain of the Prp8 protein, which can inhibit Brr2 by intermittently inserting a C-terminal tail in the enzyme's RNA-binding tunnel or activate the helicase after removal of this tail. Presently it is unclear, whether these regulatory mechanisms functionally interact and to which extent they are evolutionarily conserved. Here, we report crystal structures of Saccharomyces cerevisiae and Chaetomium thermophilum Brr2-Jab1 complexes, demonstrating that Jab1-based inhibition of Brr2 presumably takes effect in all eukaryotes but is implemented via organism-specific molecular contacts. Moreover, the structures show that Brr2 auto-inhibition can act in concert with Jab1-mediated inhibition, and suggest that the N-terminal region influences how the Jab1 C-terminal tail interacts at the RNA-binding tunnel. Systematic RNA binding and unwinding studies revealed that the N-terminal region and the Jab1 C-terminal tail specifically interfere with accommodation of double-stranded and single-stranded regions of an RNA substrate, respectively, mutually reinforcing each other. Additionally, such analyses show that regulation based on the N-terminal region requires the presence of the inactive C-terminal helicase cassette. Together, our results outline an intricate system of regulatory mechanisms, which control Brr2 activities during snRNP assembly and splicing.
Hu, Hui; Lu, Hong; He, Zhanping; Han, Xiangjun; Chen, Jing; Tu, Rong
2012-07-25
To investigate the effects of mRNA interference on aquaporin-4 expression in swollen tissue of rats with ischemic cerebral edema, and diagnose the significance of diffusion-weighted MRI, we injected 5 μL shRNA- aquaporin-4 (control group) or siRNA- aquaporin-4 solution (1:800) (RNA interference group) into the rat right basal ganglia immediately before occlusion of the middle cerebral artery. At 0.25 hours after occlusion of the middle cerebral artery, diffusion-weighted MRI displayed a high signal; within 2 hours, the relative apparent diffusion coefficient decreased markedly, aquaporin-4 expression increased rapidly, and intracellular edema was obviously aggravated; at 4 and 6 hours, the relative apparent diffusion coefficient slowly returned to control levels, aquaporin-4 expression slightly increased, and angioedema was observed. In the RNA interference group, during 0.25-6 hours after injection of siRNA- aquaporin-4 solution, the relative apparent diffusion coefficient slightly fluctuated and aquaporin-4 expression was upregulated; during 0.5-4 hours, the relative apparent diffusion coefficient was significantly higher, while aquaporin-4 expression was significantly lower when compared with the control group, and intracellular edema was markedly reduced; at 0.25 and 6 hours, the relative apparent diffusion coefficient and aquaporin-4 expression were similar when compared with the control group; obvious angioedema remained at 6 hours. Pearson's correlation test results showed that aquaporin-4 expression was negatively correlated with the apparent diffusion coefficient (r = -0.806, P < 0.01). These findings suggest that upregulated aquaporin-4 expression is likely to be the main molecular mechanism of intracellular edema and may be the molecular basis for decreased relative apparent diffusion coefficient. Aquaporin-4 gene interference can effectively inhibit the upregulation of aquaporin-4 expression during the stage of intracellular edema with time
Runo, Steven
2011-01-01
RNA interference (RNAi) has rapidly advanced to become a powerful genetic tool and holds promise to revolutionizing agriculture by providing a strategy for controlling a wide array of crop pests. Numerous studies document RNAi efficacy in achieving silencing in viruses, insects, nematodes and weeds parasitizing crops. In general, host derived pest resistance through RNAi is achieved by genetically transforming host plants with double stranded RNA constructs targeted at essential parasite genes leading to generation of small interfering RNAs (siRNAs). Small interfering RNAs formed in the host are then delivered to the parasite and transported to target cells. Delivery can be oral - worms and insects, viral infections, viruses - or through a vascular connections - parasitic plants, while delivery to target cells is by cell to cell systemic movement of the silencing signal. Despite the overall optimism in generating pest resistant crops through RNAi-mediated silencing, some hurdles have recently begun to emerge. Presently, the main challenge is delivery of sufficient siRNAs, in the right cells, and at the right time to mount; a strong, durable, and broad-spectrum posttranscriptional gene silencing (PTGS) signal. This review highlights the novel strategies available for improving host derived RNAi resistance in downstream applied agriculture.
YANG, GUANG; ZHANG, YAN; XIONG, JIANJUN; WU, JING; YANG, CHANGFU; HUANG, HONGBING; ZHU, ZHENYU
2012-01-01
Inhibitor of differentiation or DNA binding (Id1) is a member of the helix-loop-helix transcription factor family that is overexpressed in various types of cancer, including gastric carcinoma. Previous studies showed that Id1 is a prognostic marker in patients with gastric cancer. However, the role of Id1 in the proliferation of human gastric cancer cells has yet to be clarified. In the present study, we downregulated the Id1 gene in SGC-7901 gastric cancer cells by RNA interference, and we also constructed a recombinant plasmid-expressing Id1 to investigate its effects on the proliferation of SGC-7901 cells. Results showed that the downregulation of Id1 inhibited proliferation of SGC-7901 cells, while the upregulation of Id1 had no effect on SGC-7901 cell proliferation. The potential mechanism was also investigated. The changes of certain proteins associated with cell proliferation, apoptosis and the cell cycle were detected by western blotting. Furthermore, we demonstrated a positive correlation between Id1 and phospho-Akt expression in SGC-7901 cells. PMID:22245935
Liu, An; Huang, Chenggang; Xu, Jia; Cai, Xuehong
2016-09-01
Ghrelin, an orexigenic peptide, acts via the growth hormone secretagogue receptor (GHSR) to stimulate the release of growth hormone. Moreover, it has a range of biological actions, including the stimulation of food intake, modulation of insulin signaling and cardiovascular effects. Recently, it has been demonstrated that ghrelin has a proliferative and antiapoptotic effects in cancers, suggesting a potential role in promoting tumor growth. However, it remains unknown whether GHSR contributes to colorectal cancer proliferation. In this study, the therapeutic effect of lentivirus-mediated short hairpin RNA (shRNA) targeting ghrelin receptor 1a (GHSR1a) was analyzed in colorectal cancer cell line SW480 both in vitro and in vivo. Our study demonstrated that ghrelin and GHSR1a are significantly upregulated in cancerous colorectal tissue samples and cell lines. In vitro, human colorectal cancer cell line SW480 with downregulation of GHSR1a by shRNA showed significant inhibition of cell viability compared with blank control (BC) or scrambled control (SC) regardless of the application of exogenous ghrelin. Furthermore, GHSR1a silencing by target specific shRNA was shown capable of increasing PTEN, inhibiting AKT phosphorylation and promoting the release of p53 in SW480 cells. In addition, the effects of GHSR1a knockdown were further explored in vivo using colorectal tumor xenograft mouse model. The tumor weights were decreased markedly in GHSR1α knockdown SW480 mouse xenograft tumors compared with blank control or negative control tumors. Our results suggested that the expression of GHSR1a is significantly correlated with the growth of colorectal cancer cells, and the GHSR1a knockdown approach may be a potential therapy for the treatment of colorectal cancer. © 2016 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.
Sin, Onsam; Mabiala, Prudence; Liu, Ye; Sun, Ying; Hu, Tao; Liu, Qingzhen; Guo, Deyin
2012-02-01
Artificial microRNA (miRNA) expression vectors have been developed and used for RNA interference. The secondary structure of artificial miRNA is important for RNA interference efficacy. We designed two groups of six artificial splicing miRNA 155-based miRNAs (SM155-based miRNAs) with the same target in the coding region or 3' UTR of a target gene and studied their RNA silencing efficiency and interferon β (IFN-β) induction effects. SM155-based miRNA with a mismatch at the +1 position and a bulge at the +11, +12 positions in a miRNA precursor stem-loop structure showed the highest gene silencing efficiency and lowest IFN-β induction effect (increased IFN-β mRNA level by 10% in both target cases), regardless of the specificity of the target sequence, suggesting that pSM155-based miRNA with this design could be a valuable miRNA expression vector.
RNA editing of microRNA prevents RNA-induced silencing complex recognition of target mRNA.
Cui, Yalei; Huang, Tianzhi; Zhang, Xiaobo
2015-12-01
MicroRNAs (miRNAs) integrate with Argonaut (Ago) to create the RNA-induced silencing complex, and regulate gene expression by silencing target mRNAs. RNA editing of miRNA may affect miRNA processing, assembly of the Ago complex and target mRNA binding. However, the function of edited miRNA, assembled within the Ago complex, has not been extensively investigated. In this study, sequence analysis of the Ago complex of Marsupenaeus japonicus shrimp infected with white spot syndrome virus (WSSV) revealed that host ADAR (adenosine deaminase acting on RNA) catalysed A-to-I RNA editing of a viral miRNA (WSSV-miR-N12) at the +16 site. This editing of the non-seed sequence did not affect association of the edited miRNA with the Ago protein, but inhibited interaction between the miRNA and its target gene (wsv399). The WSSV early gene wsv399 inhibited WSSV infection. As a result, the RNA editing of miRNA caused virus latency. Our results highlight a novel example of miRNA editing in the miRNA-induced silencing complex. © 2015 The Authors.
[Construction and selection of effective mouse Smad6 recombinant lenti-virus interference vectors].
Yu, Jing; Qi, Mengchun; Deng, Jiupeng; Liu, Gang; Chen, Huaiqing
2010-10-01
This experiment was designed to construct mouse Smad6 recombinant RNA interference vectors and determine their interference effects on bone marrow mesenchymal stem cells (BMSCs). Three recombinant Smad6 RNA interference vectors were constructed by molecular clone techniques with a lenti-virus vector expressing green fluorescent protein (GFP), and the correctness of recombinant vectors was verified by DNA sequencing. Mouse BMSCs were used for transfection experiments and BMP-2 was in use for osteogenic induction of MSCs. The transfection efficiency of recombinant vectors was examined by Laser confocal scanning microscope and the interference effect of recombinant vectors on Smad6 gene expression was determined by real-time RT-PCR and Western blot, respectively. Three Smad6 recombinant RNA interference vectors were successfully constructed and their correctness was proved by DNA sequencing. After transfection, GFPs were effectively expressed in MSCs and all of three recombinant vectors gained high transfection efficiency (> 95%). Both real-time PCR and Western blot examination indicated that among three recombinant vectors, No. 2 Svector had the best interference effect and the interference effect was nearly 91% at protein level. In conclusion, Mouse recombinant Smad6 RNA interference (RNAi) vector was successfully constructed and it provided an effective tool for further studies on BMP signal pathways.
Sanz, Miguel A; García-Moreno, Manuel; Carrasco, Luis
2015-04-01
Infection of mammalian cells by Sindbis virus (SINV) profoundly blocks cellular mRNA translation. Experimental evidence points to viral non-structural proteins (nsPs), in particular nsP2, as the mediator of this inhibition. However, individual expression of nsP1, nsP2, nsP3 or nsP1-4 does not block cellular protein synthesis in BHK cells. Trans-complementation of a defective SINV replicon lacking most of the coding region for nsPs by the co-expression of nsP1-4 propitiates viral RNA replication at low levels, and inhibition of cellular translation is not observed. Exit of nuclear proteins including T-cell intracellular antigen and polypyrimidine tract-binding protein is clearly detected in SINV-infected cells, but not upon the expression of nsPs, even when the defective replicon was complemented. Analysis of a SINV variant with a point mutation in nsP2, exhibiting defects in the shut-off of host protein synthesis, indicates that both viral RNA replication and the release of nuclear proteins to the cytoplasm are greatly inhibited. Furthermore, nucleoside analogues that inhibit cellular and viral RNA synthesis impede the blockade of host mRNA translation, in addition to the release of nuclear proteins. Prevention of the shut-off of host mRNA translation by nucleoside analogues is not due to the inhibition of eIF2α phosphorylation, as this prevention is also observed in PKR(-/-) mouse embryonic fibroblasts that do not phosphorylate eIF2α after SINV infection. Collectively, our observations are consistent with the concept that for the inhibition of cellular protein synthesis to occur, viral RNA replication must take place at control levels, leading to the release of nuclear proteins to the cytoplasm. © 2014 John Wiley & Sons Ltd.
Tucker, Kathryn; Lin, Xiaoyan; Kao, C. Cheng; Shaw, Ken; Tan, Hua; Symons, Julian; Behera, Ishani; Rajwanshi, Vivek K.; Dyatkina, Natalia; Wang, Guangyi; Beigelman, Leo
2015-01-01
Norovirus (NoV) is a positive-sense single-stranded RNA virus that causes acute gastroenteritis and is responsible for 200,000 deaths per year worldwide. No effective vaccine or treatment is available. Recent studies have shown that the nucleoside analogs favipiravir (T-705) and 2′-C-methyl-cytidine (2CM-C) inhibit NoV replication in vitro and in animal models, but their precise mechanism of action is unknown. We evaluated the molecular interactions between nucleoside triphosphates and NoV RNA-dependent RNA polymerase (NoVpol), the enzyme responsible for replication and transcription of NoV genomic RNA. We found that T-705 ribonucleoside triphosphate (RTP) and 2CM-C triphosphate (2CM-CTP) equally inhibited human and mouse NoVpol activities at concentrations resulting in 50% of maximum inhibition (IC50s) in the low micromolar range. 2CM-CTP inhibited the viral polymerases by competing directly with natural CTP during primer elongation, whereas T-705 RTP competed mostly with ATP and GTP at the initiation and elongation steps. Incorporation of 2CM-CTP into viral RNA blocked subsequent RNA synthesis, whereas T-705 RTP did not cause immediate chain termination of NoVpol. 2CM-CTP and T-705 RTP displayed low levels of enzyme selectivity, as they were both recognized as substrates by human mitochondrial RNA polymerase. The level of discrimination by the human enzyme was increased with a novel analog of T-705 RTP containing a 2′-C-methyl substitution. Collectively, our data suggest that 2CM-C inhibits replication of NoV by acting as a classic chain terminator, while T-705 may inhibit the virus by multiple mechanisms of action. Understanding the precise mechanism of action of anti-NoV compounds could provide a rational basis for optimizing their inhibition potencies and selectivities. PMID:26392512
Impact of the structural integrity of the three-way junction of adenovirus VAI RNA on PKR inhibition
Dzananovic, Edis; Astha; Chojnowski, Grzegorz; Deo, Soumya; Booy, Evan P.; Padilla-Meier, Pauline; McEleney, Kevin; Bujnicki, Janusz M.; McKenna, Sean A.
2017-01-01
Highly structured RNA derived from viral genomes is a key cellular indicator of viral infection. In response, cells produce the interferon inducible RNA-dependent protein kinase (PKR) that, when bound to viral dsRNA, phosphorylates eukaryotic initiation factor 2α and attenuates viral protein translation. Adenovirus can evade this line of defence through transcription of a non-coding RNA, VAI, an inhibitor of PKR. VAI consists of three base-paired regions that meet at a three-way junction; an apical stem responsible for the interaction with PKR, a central stem required for inhibition, and a terminal stem. Recent studies have highlighted the potential importance of the tertiary structure of the three-way junction to PKR inhibition by enabling interaction between regions of the central and terminal stems. To further investigate the role of the three-way junction, we characterized the binding affinity and inhibitory potential of central stem mutants designed to introduce subtle alterations. These results were then correlated with small-angle X-ray scattering solution studies and computational tertiary structural models. Our results demonstrate that while mutations to the central stem have no observable effect on binding affinity to PKR, mutations that appear to disrupt the structure of the three-way junction prevent inhibition of PKR. Therefore, we propose that instead of simply sequestering PKR, a specific structural conformation of the PKR-VAI complex may be required for inhibition. PMID:29053745
Yao, Zhicheng; Luo, Jingyan; Hu, Kunpeng; Lin, Jizong; Huang, He; Wang, Qiangliang; Zhang, Peng; Xiong, Zhiyong; He, Chonghua; Huang, Zejian; Liu, Bo; Yang, Yang
2017-04-01
There is increasing evidence that circular RNA (circRNA) are involved in cancer development, but the regulation and function of human circRNA remain largely unknown. In this study, we demonstrated that ZKSCAN1, a zinc finger family gene, is expressed in both linear and circular (circZKSCAN1) forms of RNA in human hepatocellular carcinoma (HCC) tissues and cell lines. Here, we analyzed a cohort of 102 patients and found that expression of both ZKSCAN1mRNA and circZKSCAN1 was significantly lower (P < 0.05) in the HCC samples compared with that in matched adjacent nontumorous tissues by reverse transcription PCR (RT-PCR). The low expression level of ZKSCAN1 was only associated with tumor size (P = 0.032), while the cirZKSCAN1 levels varied in patients with different tumor numbers (P < 0.01), cirrhosis (P = 0.031), vascular invasion (P = 0.002), or microscopic vascular invasion (P = 0.002), as well as with the tumor grade (P < 0.001). Silencing both ZKSCAN1mRNA and circZKSCAN1 promoted cell proliferation, migration, and invasion. In contrast, overexpression of both forms of RNA repressed HCC progression in vivo and in vitro. Silencing or overexpression of both forms of RNA did not interfere with each other. RNA-seq revealed a very different molecular basis for the observed effects; ZKSCAN1mRNA mainly regulated cellular metabolism, while circZKSCAN1 mediated several cancer-related signaling pathways, suggesting a nonredundant role for ZKSCAN1mRNA and circRNA. In conclusion, our results revealed two post-translational products (ZKSCAN1mRNA and circZKSCAN1) that cooperated closely with one another to inhibit growth, migration, and invasion of HCC. cirZKSCAN1 might be a useful marker for the diagnosis of HCC. © 2017 The Authors. Published by FEBS Press and John Wiley & Sons Ltd.
PAd-shRNA-PTN reduces pleiotrophin of pancreatic cancer cells and inhibits neurite outgrowth of DRG
Yao, Jun; Zhang, Min; Ma, Qing-Yong; Wang, Zheng; Wang, Lian-Cai; Zhang, Dong
2011-01-01
AIM: To investigate the silencing effects of pAd-shRNA-pleiotrophin (PTN) on PTN in pancreatic cancer cells, and to observe the inhibition of pAd-shRNA-PTN on neurite outgrowth from dorsal root ganglion (DRG) neurons in vitro. METHODS: PAd-shRNA-PTN was used to infect pancreatic cancer BxPC-3 cells; assays were conducted for knockdown of the PTN gene on the 0th, 1st, 3rd, 5th, 7th and 9th d after infection using immunocytochemistry, real-time quantitative polymerase chain reaction (PCR), and Western blotting analysis. The morphologic changes of cultured DRG neurons were observed by mono-culture of DRG neurons and co-culture with BXPC-3 cells in vitro. RESULTS: The real-time quantitative PCR showed that the inhibition rates of PTN mRNA expression in the BxPC-3 cells were 20%, 80%, 50% and 25% on the 1st, 3rd, 5th and 7th d after infection. Immunocytochemistry and Western blotting analysis also revealed the same tendency. In contrast to the control, the DRG neurons co-cultured with the infected BxPC-3 cells shrunk; the number and length of neurites were significantly decreased. CONCLUSION: Efficient and specific knockdown of PTN in pancreatic cancer cells and the reduction in PTN expression resulted in the inhibition of neurite outgrowth from DRG neurons. PMID:21677838
Deval, Jerome; Hong, Jin; Wang, Guangyi; Taylor, Josh; Smith, Lucas K.; Fung, Amy; Stevens, Sarah K.; Liu, Hong; Jin, Zhinan; Dyatkina, Natalia; Prhavc, Marija; Stoycheva, Antitsa D.; Serebryany, Vladimir; Liu, Jyanwei; Smith, David B.; Tam, Yuen; Zhang, Qingling; Moore, Martin L.; Fearns, Rachel; Chanda, Sushmita M.; Blatt, Lawrence M.; Symons, Julian A.; Beigelman, Leo
2015-01-01
Respiratory syncytial virus (RSV) causes severe lower respiratory tract infections, yet no vaccines or effective therapeutics are available. ALS-8176 is a first-in-class nucleoside analog prodrug effective in RSV-infected adult volunteers, and currently under evaluation in hospitalized infants. Here, we report the mechanism of inhibition and selectivity of ALS-8176 and its parent ALS-8112. ALS-8176 inhibited RSV replication in non-human primates, while ALS-8112 inhibited all strains of RSV in vitro and was specific for paramyxoviruses and rhabdoviruses. The antiviral effect of ALS-8112 was mediated by the intracellular formation of its 5'-triphosphate metabolite (ALS-8112-TP) inhibiting the viral RNA polymerase. ALS-8112 selected for resistance-associated mutations within the region of the L gene of RSV encoding the RNA polymerase. In biochemical assays, ALS-8112-TP was efficiently recognized by the recombinant RSV polymerase complex, causing chain termination of RNA synthesis. ALS-8112-TP did not inhibit polymerases from host or viruses unrelated to RSV such as hepatitis C virus (HCV), whereas structurally related molecules displayed dual RSV/HCV inhibition. The combination of molecular modeling and enzymatic analysis showed that both the 2'F and the 4'ClCH2 groups contributed to the selectivity of ALS-8112-TP. The lack of antiviral effect of ALS-8112-TP against HCV polymerase was caused by Asn291 that is well-conserved within positive-strand RNA viruses. This represents the first comparative study employing recombinant RSV and HCV polymerases to define the selectivity of clinically relevant nucleotide analogs. Understanding nucleotide selectivity towards distant viral RNA polymerases could not only be used to repurpose existing drugs against new viral infections, but also to design novel molecules. PMID:26098424
Zhang, Wen; Chen, Jieliang; Wu, Min; Zhang, Xiaonan; Zhang, Min; Yue, Lei; Li, Yaming; Liu, Jiangxia; Li, Baocun; Shen, Fang; Wang, Yang; Bai, Lu; Protzer, Ulrike; Levrero, Massimo; Yuan, Zhenghong
2017-08-01
Chronic hepatitis B virus (HBV) infection remains a major health problem worldwide. The covalently closed circular DNA (cccDNA) minichromosome, which serves as the template for the transcription of viral RNAs, plays a key role in viral persistence. While accumulating evidence suggests that cccDNA transcription is regulated by epigenetic machinery, particularly the acetylation of cccDNA-bound histone 3 (H3) and H4, the potential contributions of histone methylation and related host factors remain obscure. Here, by screening a series of methyltransferases and demethylases, we identified protein arginine methyltransferase 5 (PRMT5) as an effective restrictor of HBV transcription and replication. In cell culture-based models for HBV infection and in liver tissues of patients with chronic HBV infection, we found that symmetric dimethylation of arginine 3 on H4 on cccDNA was a repressive marker of cccDNA transcription and was regulated by PRMT5 depending on its methyltransferase domain. Moreover, PRMT5-triggered symmetric dimethylation of arginine 3 on H4 on the cccDNA minichromosome involved an interaction with the HBV core protein and the Brg1-based human SWI/SNF chromatin remodeler, which resulted in down-regulation of the binding of RNA polymerase II to cccDNA. In addition to the inhibitory effect on cccDNA transcription, PRMT5 inhibited HBV core particle DNA production independently of its methyltransferase activity. Further study revealed that PRMT5 interfered with pregenomic RNA encapsidation by preventing its interaction with viral polymerase protein through binding to the reverse transcriptase-ribonuclease H region of polymerase, which is crucial for the polymerase-pregenomic RNA interaction. PRMT5 restricts HBV replication through a two-part mechanism including epigenetic suppression of cccDNA transcription and interference with pregenomic RNA encapsidation; these findings improve the understanding of epigenetic regulation of HBV transcription and host
USDA-ARS?s Scientific Manuscript database
Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...
[Impact of Pax-8 gene interference on mitochondrial function and cardiomyocyte apoptosis].
Dai, Xiao-chun; Zhou, Xi; Huang, Xiao-yan; Wang, Liang-guo; Lin, Su; Yang, De-ye
2013-01-01
To observe the effects of paired box gene 8 (Pax-8) silencing by RNA interference on mitochondrial function and cardiomyocytes apoptosis. The cultured H9C2 (2-1) myocytes were divided into 3 groups: short interference RNA targeting Pax-8 (Pax-8 siRNA) group, non-specific siRNA group as the negative control (NC siRNA), and blank control group (BC siRNA). Fluorescence spectrophotometry was used to detect the activity of caspase-3. RT-PCR was performed to detect mRNA expression of Bcl2 and Bax. The protein expression of Bcl2, Bax and cytoplasm of Cytochrome was examined by Western blot. Changes of ΔΨm were detected by flow cytometry.ΔΨm with JC-1 monomer/polymer ratio was calculated for measuring mitochondrial depolarization proportion. Compared to NC siRNA and BC siRNA group (0.075 ± 0.021, 0.072 ± 0.019), the activity of caspase-3 in Pax-8 siRNA group (0.167 ± 0.012) was significantly increased (P < 0.05); Bcl2 mRNA and protein expression in Pax-8 siRNA group (0.61 ± 0.06, 0.94 ± 0.11) were significantly downregulated compared with NC siRNA group (0.90 ± 0.070, 1.39 ± 0.15) and BC siRNA group (0.94 ± 0.087, 1.49 ± 0.20) (P < 0.05); Bax mRNA and protein expression in Pax-8 siRNA group (1.05 ± 0.10, 1.25 ± 0.12) were markedly upregulated compared with NC siRNA group (0.72 ± 0.03, 0.99 ± 0.12) and BC siRNA group (0.64 ± 0.03, 0.92 ± 0.06), P < 0.05; cytosolic cytochrome expression in Pax-8 siRNA group (0.75 ± 0.14) was significantly upregulated compared with NC siRNA group (0.51 ± 0.06) and BC siRNA group (0.48 ± 0.07) (P < 0.05); JC-1 monomer/polymer ratio in Pax-8 siRNA group (0.163 ± 0.011) was significantly increased compared with NC siRNA group (0.092 ± 0.015) and BC siRNA group (0.072 ± 0.025) (P < 0.05) indicating mitochondrial membrane potential was significantly reduced in Pax-8 siRNA group. Above parameters were similar between NC siRNA group and BC siRNA group (P > 0.05). Inhibiting Pax-8 results in enhanced cardiomyocytes apoptosis
Eiring, Anna M.; Harb, Jason G.; Neviani, Paolo; Garton, Christopher; Oaks, Joshua J.; Spizzo, Riccardo; Liu, Shujun; Schwind, Sebastian; Santhanam, Ramasamy; Hickey, Christopher J.; Becker, Heiko; Chandler, Jason C.; Andino, Raul; Cortes, Jorge; Hokland, Peter; Huettner, Claudia S.; Bhatia, Ravi; Roy, Denis C.; Liebhaber, Stephen A.; Caligiuri, Michael A.; Marcucci, Guido; Garzon, Ramiro; Croce, Carlo M.; Calin, George A.; Perrotti, Danilo
2010-01-01
SUMMARY MicroRNAs and heterogeneous ribonucleoproteins (hnRNPs) are posttranscriptional gene regulators that bind mRNA in a sequence-specific manner. Here, we report that loss of miR-328 occurs in blast crisis chronic myelogenous leukemia (CML-BC) in a BCR/ABL dose- and kinase-dependent manner through the MAPK-hnRNP E2 pathway. Restoration of miR-328 expression rescues differentiation and impairs survival of leukemic blasts by simultaneously interacting with the translational regulator poly(rC)-binding protein hnRNP E2 and with the mRNA encoding the survival factor PIM1, respectively. The interaction with hnRNP E2 is independent of the microRNA’s seed sequence and it leads to release of CEBPA mRNA from hnRNP E2-mediated translational inhibition. Altogether, these data reveal the dual ability of a microRNA to control cell fate both through base pairing with mRNA targets and through a decoy activity that interferes with the function of regulatory proteins. PMID:20211135
Zhu, XinWang; Zhang, CongXiao; Fan, QiuLing; Liu, XiaoDan; Yang, Gang; Jiang, Yi; Wang, LiNing
2016-10-22
BACKGROUND Diabetic nephropathy (DN) is the most lethal diabetic microvascular complication; it is a major cause of renal failure, and an increasingly globally prominent healthcare problem. MATERIAL AND METHODS To identify susceptible microRNAs for the pathogenesis of DN and the targets of losartan treatment, microRNA arrays were employed to survey the glomerular microRNA expression profiles of KKAy mice treated with or without losartan. KKAy mice were assigned to either a losartan-treated group or a non-treatment group, with C57BL/6 mice used as a normal control. Twelve weeks after treatment, glomeruli from the mice were isolated. MicroRNA expression profiles were analyzed using microRNA arrays. Real-time PCR was used to confirm the results. RESULTS Losartan treatment improved albuminuria and the pathological lesions of KKAy mice. The expression of 10 microRNAs was higher, and the expression of 12 microRNAs was lower in the glomeruli of the KKAy untreated mice than that of the CL57BL/6 mice. The expression of 4 microRNAs was down-regulated in the glomeruli of the KKAy losartan-treated mice compared to that of the untreated mice. The expression of miRNA-503 and miRNA-181d was apparently higher in the glomeruli of the KKAy untreated mice, and was inhibited by losartan treatment. CONCLUSIONS The over-expression of miR-503 and miR-181d in glomeruli of KKAy mice may be responsible for the pathogenesis of DN and are potential therapeutic targets for DN.
Maxwell, Michele M.; Pasinelli, Piera; Kazantsev, Aleksey G.; Brown, Robert H.
2004-01-01
Amyotrophic lateral sclerosis (ALS) is a progressive and fatal neurodegenerative disorder resulting from selective death of motor neurons in the brain and spinal cord. In ≈25% of familial ALS cases, the disease is caused by dominantly acting point mutations in the gene encoding cytosolic Cu,Zn superoxide dismutase (SOD1). In cell culture and in rodent models of ALS, mutant SOD1 proteins exhibit dose-dependent toxicity; thus, agents that reduce mutant protein expression would be powerful therapeutic tools. A wealth of recent evidence has demonstrated that the mechanism of RNA-mediated interference (RNAi) can be exploited to achieve potent and specific gene silencing in vitro and in vivo. We have evaluated the utility of RNAi for selective silencing of mutant SOD1 expression in cultured cells and have identified small interfering RNAs capable of specifically inhibiting expression of ALS-linked mutant, but not wild-type, SOD1. We have investigated the functional effects of RNAi-mediated silencing of mutant SOD1 in cultured murine neuroblastoma cells. In this model, stable expression of mutant, but not wild-type, human SOD1 sensitizes cells to cytotoxic stimuli. We find that silencing of mutant SOD1 protects these cells against cyclosporin A-induced cell death. These results demonstrate a positive physiological effect caused by RNAi-mediated silencing of a dominant disease allele. The present study further supports the therapeutic potential of RNAi-based methods for the treatment of inherited human diseases, including ALS. PMID:14981234
New Type of BACE1 siRNA Delivery to Cells
Jabłkowski, Maciej; Szemraj, Maciej; Oszajca, Katarzyna; Janiszewska, Grażyna; Bartkowiak, Jacek; Szemraj, Janusz
2014-01-01
Background Small interfering RNA (siRNA) gene therapy is a new molecular approach in the search for an efficient therapy for Alzheimer disease (AD), based on the principle of RNA interference. Reducing BACE activity can have great therapeutic potential for the treatment of AD. In this study, receptor-mediated delivery was used to deliver opioid peptide-conjugated BACE 1 to INR-32 human neuroblastoma cells. Material/Methods An INR-32 human neuroblastoma cell line was stably transfected to express the APP cDNA coding fragment containing the predicted sites for cleavage by α, β, or γ-secretase. This was then treated with BACE 1 siRNA to silence BACE gene expression. BACE gene transcription and translation was determined using BACE-1 siRNA cross-linked with opioid peptide, together with RT-PCR, Western blot analysis, and ELISA. Results Receptor-mediated delivery was used to introduce BACE1 siRNA to the APP – INR 32 human neuroblastoma cells. Decreased BACE mRNA and protein expression were observed after the cells were transfected with BACE1 siRNA. Conclusions Delivery of BACE1 siRNA appears to specifically reduce the cleavage of APP by inhibiting BACE1 activity. PMID:25491230
Cui, Ruibing; Li, Rong; Guo, Xiaolan; Jia, Xiaoqing; Yan, Ming
2018-06-01
Previously we have demonstrated that stromal interacting molecule-1 (STIM1) was involved in ethanol induced liver injury. However, the exact pathogenic mechanism of STIM1 in alcoholic liver disease (ALD) is still unknown. We constructed plasmid vectors encoding short-hairpin RNA against STIM1 to investigate its role in ALD in the rat liver cell line BRL and in Sprague-Dawley rats. The results showed that STIM1 targeted sh-RNA (Sh-STIM1) significantly ameliorated ethanol-induced BRL cells injury and liver injury in rats with 20 weeks-induced alcoholic liver disease. Inhibition of STIM1 also reduced intracellular calcium ion concentration, reactive oxygen species (ROS) production, lipid peroxidation, NF-kappa B activation and TNF-α production under ethanol exposure. STIM1 may play an important role in the pathogenesis of alcoholic liver disease. Silencing STIM1 may be effective in preventing alcoholic liver disease. Copyright © 2018 Elsevier B.V. All rights reserved.
Fuchs, Ryan T.; Grundy, Frank J.; Henkin, Tina M.
2007-01-01
The SMK box is a conserved riboswitch motif found in the 5′ untranslated region of metK genes [encoding S-adenosylmethionine (SAM) synthetase] in lactic acid bacteria, including Enterococcus, Streptococcus, and Lactococcus sp. Previous studies showed that this RNA element binds SAM in vitro, and SAM binding causes a structural rearrangement that sequesters the Shine–Dalgarno (SD) sequence by pairing with an anti-SD (ASD) element. A model was proposed in which SAM binding inhibits metK translation by preventing binding of the ribosome to the SD region of the mRNA. In the current work, the addition of SAM was shown to inhibit binding of 30S ribosomal subunits to SMK box RNA; in contrast, the addition of S-adenosylhomocysteine (SAH) had no effect. A mutant RNA, which has a disrupted SD-ASD pairing, was defective in SAM binding and showed no reduction of ribosome binding in the presence of SAM, whereas a compensatory mutation that restored SD-ASD pairing restored the response to SAM. Primer extension inhibition assays provided further evidence for SD-ASD pairing in the presence of SAM. These results strongly support the model that SMK box translational repression operates through occlusion of the ribosome binding site and that SAM binding requires the SD-ASD pairing. PMID:17360376
Wang, Xinjie; Zheng, Yuling; Fan, Qingxia; Zhang, Xudong; Shi, Yonggang
2014-12-01
The aim of this study was to study RAS-siRNA blocking RAS pathway and suppressing cell growth in human oesophageal squamous cell carcinoma in nude mice. The methods in this study was to construct RAS-siRNA expression vector, establish 40 oesophageal squamous cell carcinoma xenograft animal models and divided them into five groups: control group, siRNA control group, RAS-siRNA group, paclitaxel group and RAS-siRNA and paclitaxel group. We observed tumour growth in nude mice, studied histology by HE staining, tumour growth inhibition by TUNEL assay and detected the RAS, MAPK and cyclin D1 protein expression by immunohistochemistry and western blot. We have obtained the following results: (i) successfully established animal models; (ii) nude mice in each group after treatment inhibited tumour volume was significantly reduced compared with the control group (p < 0.05); (iii) compared with the control group, the number of apoptotic cells were significantly increased in the siRNA control group and the RAS-siRNA group, and the number of apoptosis cells in the paclitaxel and RAS-siRNA group is significantly most than the paclitaxel group and RAS-siRNA group (p < 0.05); and (iv) after treatment, RAS, MAPK and cyclin D1 expression in five groups was decreasing gradually. After adding paclitaxel, the protein expression in the paclitaxel and RAS-siRNA group was significantly lower than that of paclitaxel group, negative control and paclitaxel group (p < 0.05). We therefore conclude that RAS-siRNA can block the RAS signal transduction pathway, reduce the activity of tumour cells, arrest tumour cell cycle, promote apoptosis, inhibit cell proliferation and increase tumour cell sensitivity to chemotherapeutic drugs. Copyright © 2014 John Wiley & Sons, Ltd.
Innovative Delivery of siRNA to Solid Tumors by Super Carbonate Apatite
Wu, Xin; Yamamoto, Hirofumi; Nakanishi, Hiroyuki; Yamamoto, Yuki; Inoue, Akira; Tei, Mitsuyoshi; Hirose, Hajime; Uemura, Mamoru; Nishimura, Junichi; Hata, Taishi; Takemasa, Ichiro; Mizushima, Tsunekazu; Hossain, Sharif; Akaike, Toshihiro; Matsuura, Nariaki; Doki, Yuichiro; Mori, Masaki
2015-01-01
RNA interference (RNAi) technology is currently being tested in clinical trials for a limited number of diseases. However, systemic delivery of small interfering RNA (siRNA) to solid tumors has not yet been achieved in clinics. Here, we introduce an in vivo pH-sensitive delivery system for siRNA using super carbonate apatite (sCA) nanoparticles, which is the smallest class of nanocarrier. These carriers consist simply of inorganic ions and accumulate specifically in tumors, yet they cause no serious adverse events in mice and monkeys. Intravenously administered sCA-siRNA abundantly accumulated in the cytoplasm of tumor cells at 4 h, indicating quick achievement of endosomal escape. sCA-survivin-siRNA induced apoptosis in HT29 tumors and significantly inhibited in vivo tumor growth of HCT116, to a greater extent than two other in vivo delivery reagents. With innovative in vivo delivery efficiency, sCA could be a useful nanoparticle for the therapy of solid tumors. PMID:25738937
Innovative delivery of siRNA to solid tumors by super carbonate apatite.
Wu, Xin; Yamamoto, Hirofumi; Nakanishi, Hiroyuki; Yamamoto, Yuki; Inoue, Akira; Tei, Mitsuyoshi; Hirose, Hajime; Uemura, Mamoru; Nishimura, Junichi; Hata, Taishi; Takemasa, Ichiro; Mizushima, Tsunekazu; Hossain, Sharif; Akaike, Toshihiro; Matsuura, Nariaki; Doki, Yuichiro; Mori, Masaki
2015-01-01
RNA interference (RNAi) technology is currently being tested in clinical trials for a limited number of diseases. However, systemic delivery of small interfering RNA (siRNA) to solid tumors has not yet been achieved in clinics. Here, we introduce an in vivo pH-sensitive delivery system for siRNA using super carbonate apatite (sCA) nanoparticles, which is the smallest class of nanocarrier. These carriers consist simply of inorganic ions and accumulate specifically in tumors, yet they cause no serious adverse events in mice and monkeys. Intravenously administered sCA-siRNA abundantly accumulated in the cytoplasm of tumor cells at 4 h, indicating quick achievement of endosomal escape. sCA-survivin-siRNA induced apoptosis in HT29 tumors and significantly inhibited in vivo tumor growth of HCT116, to a greater extent than two other in vivo delivery reagents. With innovative in vivo delivery efficiency, sCA could be a useful nanoparticle for the therapy of solid tumors.
Hattori, Miki; Miyamoto, Mai; Hosoda, Kazutaka; Umesono, Yoshihiko
2018-01-01
Planarians have become widely recognized as one of the major animal models for regeneration studies in invertebrates. To induce RNA interference (RNAi) by feeding in planarians, the widely accepted protocol is one in which animals undergo two or three feedings of food containing double-stranded RNA (dsRNA) plus visible food coloring (e.g., blood) for confirmation of feeding by individual animals. However, one possible problem is that incorporated food coloring is often retained within the gut for several days, which makes it difficult to confirm the success of each round of dsRNA feeding based on the difference of the color density within the gut before and after feeding. As a consequence, the difference of appetite levels among individuals undergoing dsRNA feeding leads to phenotypic variability among them due to insufficient knockdown. In our attempts to overcome this problem, we have developed a novel method for achieving robust confirmation of the success of dsRNA feeding in individuals fed multiple times by means of including a combination of three different colored chalks (pink, yellow and blue) as food coloring. Notably, we found that this method is superior to the conventional method for positively marking individuals that actively consumed the dsRNA-containing food during four times of once-daily feeding. Using these selected animals, we obtained stable and sufficiently strong RNAi-induced phenotypes. We termed this improved multi-colored chalk-spiked method of feeding RNAi "Candi" and propose its benefits for gene function analysis in planarians. © 2017 Japanese Society of Developmental Biologists.
Yu, Feng; Li, Hua; Bu, Xuefeng; Zhang, Yongjun
2012-01-01
To investigate the effects of integrin-β1 gene expression inhibited by shRNA on invasion of pancreatic carcinoma PANC-1 cells in vitro. The eukaryotic expression plasmid of short hairpin RNA (shRNA) targeting integrin-β1 gene (integrin-β1-shRNA) was constructed and transfected into PANC-1 cells. The expressions of integrin-β1 mRNA and protein were detected by real-time quantitative polymerase chain reaction (PCR) and western blot assay, respectively. The invasive ability of PANC-1 cells was observed with a transwell cell culture chamber and the expressions of MMP-2 and MMP-9 were assayed. Compared to the untransfected group, recombinant expression plasmid integrin-β1-shRNA resulted in reduction of integrin-β1 mRNA and protein by 78.58%±7.24% and 92.88%±3.18%, respectively and the average number of invading PANC-1 cells were decreased from 52±5 to 21±4 (p<0.01) and the expressions of MMP-2 and MMP-9 were inhibited. Recombinant expression plasmid integrin-β1- shRNA can inhibit the expression of integrin-β1 gene and suppress the invasion of PANC-1 cells in vitro significantly.
RNA targeting with CRISPR-Cas13.
Abudayyeh, Omar O; Gootenberg, Jonathan S; Essletzbichler, Patrick; Han, Shuo; Joung, Julia; Belanto, Joseph J; Verdine, Vanessa; Cox, David B T; Kellner, Max J; Regev, Aviv; Lander, Eric S; Voytas, Daniel F; Ting, Alice Y; Zhang, Feng
2017-10-12
RNA has important and diverse roles in biology, but molecular tools to manipulate and measure it are limited. For example, RNA interference can efficiently knockdown RNAs, but it is prone to off-target effects, and visualizing RNAs typically relies on the introduction of exogenous tags. Here we demonstrate that the class 2 type VI RNA-guided RNA-targeting CRISPR-Cas effector Cas13a (previously known as C2c2) can be engineered for mammalian cell RNA knockdown and binding. After initial screening of 15 orthologues, we identified Cas13a from Leptotrichia wadei (LwaCas13a) as the most effective in an interference assay in Escherichia coli. LwaCas13a can be heterologously expressed in mammalian and plant cells for targeted knockdown of either reporter or endogenous transcripts with comparable levels of knockdown as RNA interference and improved specificity. Catalytically inactive LwaCas13a maintains targeted RNA binding activity, which we leveraged for programmable tracking of transcripts in live cells. Our results establish CRISPR-Cas13a as a flexible platform for studying RNA in mammalian cells and therapeutic development.
Quan, Yongsheng; Zhang, Yan; Lin, Wei; Shen, Zhaohua; Wu, Shuai; Zhu, Changxin; Wang, Xiaoyan
2018-03-04
Emerging evidence has demonstrated that long noncoding RNAs (lncRNAs) play a critical role in tumorigenesis of gastric cancer. LncRNA MAP3K20 antisense RNA 1 (MLK7-AS1) has been identified as one of gastric cancer-specific lncRNAs. However, its precise role in gastric cancer remains unknown. In this study, we found that lncRNA MLK7-AS1 was significantly increased in gastric cancer tissues compared with in adjacent tissues. Gastric cancer patients with high MLK7-AS1 expression had a shorter survival and poorer prognosis. By loss-function assay, we demonstrated that knockdown of MLK7-AS1 inhibited cell proliferation and induced apoptosis in HGC27and MKN-45 cells. Furthermore, we identified miR-375 as a target of MLK7-AS1. MLK7-AS1 interacted with Dnmt1 and recruited it to miR-375 promotor, hyper-methylating miR-375 promotor and repressing miR-375 expression. Taken together, our findings demonstrate that knockdown of MLK7-AS1 by siRNA inhibits gastric cancer growth by epigenetically regulating miR-375. Thus, MLK7-AS1 may be a useful prognostic marker and therapeutic target for gastric cancer patients. Copyright © 2018 Elsevier Inc. All rights reserved.
Huang, Jialing; Liang, Zhihui; Yang, Bin; Tian, Heng; Ma, Jin; Zhang, Hui
2007-11-16
The apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3G (APOBEC3G or A3G) and its fellow cytidine deaminase family members are potent restrictive factors for human immunodeficiency virus type 1 (HIV-1) and many other retroviruses. A3G interacts with a vast spectrum of RNA-binding proteins and is located in processing bodies and stress granules. However, its cellular function remains to be further clarified. Using a luciferase reporter gene and green fluorescent protein reporter gene, we demonstrate that A3G and other APOBEC family members can counteract the inhibition of protein synthesis by various microRNAs (miRNAs) such as mir-10b, mir-16, mir-25, and let-7a. A3G could also enhance the expression level of miRNA-targeted mRNA. Further, A3G facilitated the association of microRNA-targeted mRNA with polysomes rather than with processing bodies. Intriguingly, experiments with a C288A/C291A A3G mutant indicated that this function of A3G is separable from its cytidine deaminase activity. Our findings suggest that the major cellular function of A3G, in addition to inhibiting the mobility of retrotransposons and replication of endogenous retroviruses, is most likely to prevent the decay of miRNA-targeted mRNA in processing bodies.
Yu, Jisuk; Lee, Kyung-Mi; Cho, Won Kyong; Park, Ju Yeon; Kim, Kook-Hyung
2018-05-01
The mechanisms of RNA interference (RNAi) as a defense response against viruses remain unclear in many plant-pathogenic fungi. In this study, we used reverse genetics and virus-derived small RNA profiling to investigate the contributions of RNAi components to the antiviral response against Fusarium graminearum viruses 1 to 3 (FgV1, -2, and -3). Real-time reverse transcription-quantitative PCR (qRT-PCR) indicated that infection of Fusarium graminearum by FgV1, -2, or -3 differentially induces the gene expression of RNAi components in F. graminearum Transcripts of the DICER-2 and AGO-1 genes of F. graminearum ( FgDICER-2 and FgAGO-1 ) accumulated at lower levels following FgV1 infection than following FgV2 or FgV3 infection. We constructed gene disruption and overexpression mutants for each of the Argonaute and dicer genes and for two RNA-dependent RNA polymerase (RdRP) genes and generated virus-infected strains of each mutant. Interestingly, mycelial growth was significantly faster for the FgV1-infected FgAGO-1 overexpression mutant than for the FgV1-infected wild type, while neither FgV2 nor FgV3 infection altered the colony morphology of the gene deletion and overexpression mutants. FgV1 RNA accumulation was significantly decreased in the FgAGO-1 overexpression mutant. Furthermore, the levels of induction of FgAGO-1 , FgDICER-2 , and some of the FgRdRP genes caused by FgV2 and FgV3 infection were similar to those caused by hairpin RNA-induced gene silencing. Using small RNA sequencing analysis, we documented different patterns of virus-derived small interfering RNA (vsiRNA) production in strains infected with FgV1, -2, and -3. Our results suggest that the Argonaute protein encoded by FgAGO-1 is required for RNAi in F. graminearum , that FgAGO-1 induction differs in response to FgV1, -2, and -3, and that FgAGO-1 might contribute to the accumulation of vsiRNAs in FgV1-infected F. graminearum IMPORTANCE To increase our understanding of how RNAi components in Fusarium
RNA interference-based therapeutics: new strategies to fight infectious disease.
López-Fraga, M; Wright, N; Jiménez, A
2008-12-01
For many years, there has been an ongoing search for new compounds that can selectively alter gene expression as a new way to treat human disease by addressing targets that are otherwise "undruggable" with traditional pharmaceutical approaches involving small molecules or proteins. RNA interference (RNAi) strategies have raised a lot of attention and several compounds are currently being tested in clinical trials. Viruses are the obvious target for RNAi-therapy, as most are difficult to treat with conventional drugs, they become rapidly resistant to drug treatment and their genes differ substantially from human genes, minimizing side effects. Antisense strategy offers very high target specificity, i.e., any viral sequence could potentially be targeted using the complementary oligonucleotide sequence. Consequently, new antisense-based therapeutics have the potential to lead a revolution in the anti-infective drug development field. Additionally, the relatively short turnaround for efficacy testing of potential RNAi molecules and that any pathogen is theoretically amenable to rapid targeting, make them invaluable tools for treating a wide range of diseases. This review will focus on some of the current efforts to treat infectious disease with RNAi-based therapies and some of the obstacles that have appeared on the road to successful clinical intervention.
Matsa, Elena; Dixon, James E; Medway, Christopher; Georgiou, Orestis; Patel, Minal J; Morgan, Kevin; Kemp, Paul J; Staniforth, Andrew; Mellor, Ian; Denning, Chris
2014-04-01
Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K(+) currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart.
Matsa, Elena; Dixon, James E.; Medway, Christopher; Georgiou, Orestis; Patel, Minal J.; Morgan, Kevin; Kemp, Paul J.; Staniforth, Andrew; Mellor, Ian; Denning, Chris
2014-01-01
Aims Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. Methods and results We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K+ currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). Conclusions These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart. PMID:23470493
Zhang, Y; Guo, Y; Yang, C; Zhang, S; Zhu, X; Cao, L; Nie, W; Yu, H
2017-01-01
Non-small cell lung cancer (NSCLC) is one of the most deadly human cancers. MicroRNA-300 acts as both tumor promoter and suppressor in different types of cancer. Here, we try to identify the function of microRNA-300 in human NSCLC. We compared MicroRNA-300 levels between tumor tissues versus paired adjacent non-tumor lung tissues from NSCLC patients, and in NSCLC versus normal lung cell lines. Effects of microRNA-300 on cell proliferation, invasion and migration were examined in vitro, and on tumor growth in vivo using a xenograft mouse model. Potential mRNA targets of microRNA-300 were predicted and underlying mechanism was explored. MicroRNA-300 expression was lower in both NSCLC tissues and cell lines. Overexpression of microRNA-300 inhibited proliferation, invasion and migration of NSCLC cells in vitro, and tumor growth in vivo. MicroRNA-300 could directly bind to the 3'-UTR of hypoxia inducible factor-3 alpha (HIF3α) mRNA, and inhibit both its mRNA and protein expressions. Restoring HIF3α expression could rescue the inhibitory effects of microRNA-300 on tumorigenesis of NSCLC both in vitro and in vivo. MicroRNA-300 is a tumor suppressor microRNA in NSCLC by downregulating HIF3α expression. Both microRNA-300 and HIF3α may serve as potential therapeutic targets in NSCLC treatment.
[Locally administered lentivirus-mediated siRNA inhibits wear debris-induced inflammation].
Peng, Xiao-chun; Zhang, Xian-long; Tao, Kun; Cheng, Tao; Zhu, Jun-feng; Zeng, Bing-fang
2009-03-01
To determine the safety and efficacy of local administration of lentivirus-mediated small interfering RNA (siRNA) targeting tumor necrosis factor-alpha (TNF-alpha) in murine air pouch model. From May 2007 to April 2008 a siRNA targeting TNF-alpha and a missense siRNA were designed, and recombine lentivirus which coexpressed the green fluorescent protein (GFP) as a marker gene was constructed. Air pouches were established and stimulated by Ti-6Al-4V particles. Pouches were divided into 3 groups randomly. Lentivirus-mediated siRNA targeting TNF-alpha (TNF-alpha group) or lentivirus-mediated missense siRNA (MS group), or virus-free saline (control group) were injected into pouches respectively. Pouch membrane, peripheral blood, heart, liver, spleen, kidney, lung and brain were harvested at 28 d after transfection, and assayed for markers of inflammation using histological, molecular, immunological techniques and Xenogen in vivo imaging system (IVIS) 50 vivo bioluminescent assay system. Xenogen IVIS 50 vivo image revealed strong expression of GFP localized in pouch areas and no expression in other parts of mice both in TNF-alpha group and MS group at 4 weeks after transfection, while no expression of GFP was found in control group. By RT-PCR and ELISA, the mRNA and protein levels of TNF-alpha in TNF-alpha group decreased by 81.6% and 82.6% respectively compared to control group (P < 0.01), and decreased by 78.9% and 84.0% respectively compared to MS group (P < 0.01), whereas TNF-alpha level in peripheral blood, heart, liver, spleen, kidney, lung and brain remained invariant (P > 0.05). Less inflammatory responses (thinner pouch membrane and decreased cellular infiltration) were observed in TNF-alpha group. Efficient local delivery of lentivirus-mediated siRNA targeting TNF-alpha into modified murine air pouch can inhibit debris-induced inflammation effectively, with no systemic adverse effects.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xing, Yu; Laboratory of Forensic Medicine and Biomedical Information, Chongqing Medical University, Chongqing; Qi, Jin
2013-08-01
Integrin-linked kinase (ILK) is a multifunctional serine/threonine kinase. Accumulating evidences suggest that ILK are involved in cell–matrix interactions, cell proliferation, invasion, migration, angiogenesis and Epithelial–mesenchymal transition (EMT). However, the underlying mechanisms remain largely unknown. EMT has been postulated as a prerequisite for metastasis. The reports have demonstrated that EMT was implicated in metastasis of oral squamous cell carcinomas. Therefore, here we further postulate that ILK might participate in EMT of tongue cancer. We showed that ILK siRNA inhibited EMT with low N-cadherin, Vimentin, Snail, Slug and Twist as well as high E-cadherin expression in vivo and in vitro. We foundmore » that knockdown of ILK inhibited cell proliferation, migration and invasion as well as changed cell morphology. We also demonstrated that ILK siRNA inhibited phosphorylation of downstream signaling targets Akt and GSK3β as well as reduced expression of MMP2 and MMP9. Furthermore, we found that the tongue tumor with high metastasis capability showed higher ILK, Vimentin, Snail, Slug and Twist as well as lower E-cadherin expression in clinical specimens. Finally, ILK siRNA led to the suppression for tumorigenesis and metastasis in vivo. Our findings suggest that ILK could be a novel diagnostic and therapeutic target for tongue cancer. Highlights: • ILK siRNA influences cell morphology, cell cycle, migration and invasion. • ILK siRNA affects the expression of proteins associated with EMT. • ILK expression is related to EMT in clinical human tongue tumors. • ILK siRNA inhibits metastasis of the tongue cancer cells through suppressing EMT.« less
Dan Cullen
2004-01-01
In contrast to DNA, messenger RNA (mRNA) in complex substrata is rarely analyzed, in large part because labile RNA molecules are difficult to purify. Nucleic acid extractions from fungi that colonize soil are particularly difficult and plagued by humic substances that interfere with Taq polymerase (Tebbe and Vahjen 1993 and references therein). Magnetic capture...
Circular RNA cSMARCA5 inhibits growth and metastasis in hepatocellular carcinoma.
Yu, Jian; Xu, Qing-Guo; Wang, Zhen-Guang; Yang, Yuan; Zhang, Ling; Ma, Jin-Zhao; Sun, Shu-Han; Yang, Fu; Zhou, Wei-Ping
2018-06-01
In recent years, circular RNAs (circRNAs) have been shown to have critical regulatory roles in cancer biology. However, the contributions of circRNAs to hepatocellular carcinoma (HCC) remain largely unknown. cSMARCA5 (a circRNA derived from exons 15 and 16 of the SMARCA5 gene, hsa_circ_0001445) was identified by RNA-sequencing and validated by quantitative reverse transcription PCR. The role of cSMARCA5 in HCC progression was assessed both in vitro and in vivo. circRNAs in vivo precipitation, luciferase reporter assay, biotin-coupled microRNA capture and fluorescence in situ hybridization were conducted to evaluate the interaction between cSMARCA5 and miR-17-3p/miR-181b-5p. The expression of cSMARCA5 was lower in HCC tissues, because of the regulation of DExH-Box Helicase 9, an abundant nuclear RNA helicase. The downregulation of cSMARCA5 in HCC was significantly correlated with aggressive characteristics and served as an independent risk factor for overall survival and recurrence-free survival in patients with HCC after hepatectomy. Our in vivo and in vitro data indicated that cSMARCA5 inhibits the proliferation and migration of HCC cells. Mechanistically, we found that cSMARCA5 could promote the expression of TIMP3, a well-known tumor suppressor, by sponging miR-17-3p and miR-181b-5p. These results reveal an important role of cSMARCA5 in the growth and metastasis of HCC and provide a fresh perspective on circRNAs in HCC progression. Herein, we studied the role of cSMARCA5, a circular RNA, in hepatocellular carcinoma. Our in vitro and in vivo data showed that cSMARCA5 inhibits the growth and migration of hepatocellular carcinoma cells, making it a potential therapeutic target. Copyright © 2018 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.
Cazenave, C; Stein, C A; Loreau, N; Thuong, N T; Neckers, L M; Subasinghe, C; Hélène, C; Cohen, J S; Toulmé, J J
1989-01-01
We have studied the translation of rabbit globin mRNA in cell free systems (reticulocyte lysate and wheat germ extract) and in microinjected Xenopus oocytes in the presence of anti-sense oligodeoxynucleotides. Results obtained with the unmodified all-oxygen compounds were compared with those obtained when phosphorothioate or alpha-DNA was used. In the wheat germ system a 17-mer sequence targeted to the coding region of beta-globin mRNA was specifically inhibitory when either the unmodified phosphodiester oligonucleotide or its phosphorothioate analogue were used. In contrast no effect was observed with the alpha-oligomer. These results were ascribed to the fact that phosphorothioate oligomers elicit an RNase-H activity comparable to the all-oxygen congeners, while alpha-DNA/mRNA hybrids were a poor substrate. Microinjected Xenopus oocytes followed a similar pattern. The phosphorothioate oligomer was more efficient to prevent translation than the unmodified 17-mer. Inhibition of beta-globin synthesis was observed in the nanomolar concentration range. This result can be ascribed to the nuclease resistance of phosphorothioates as compared to natural phosphodiester linkages, alpha-oligomers were devoid of any inhibitory effect up to 30 microM. Phosphorothioate oligodeoxyribonucleotides were shown to be non-specific inhibitors of protein translation, at concentrations in the micromolar range, in both cell-free systems and oocytes. Non-specific inhibition of translation was dependent on the length of the phosphorothioate oligomer. These non-specific effects were not observed with the unmodified or the alpha-oligonucleotides. Images PMID:2472605
Guo, Hongyan; Song, Xiaoguang; Xie, Chuanmiao; Huo, Yan; Zhang, Fujie; Chen, Xiaoying; Geng, Yunfeng; Fang, Rongxiang
2013-08-01
The P6 protein of Rice yellow stunt rhabdovirus (RYSV) is a virion structural protein that can be phosphorylated in vitro. However its exact function remains elusive. We found that P6 enhanced the virulence of Potato virus X (PVX) in Nicotiana benthamiana and N. tabacum plants, suggesting that it might function as a suppressor of RNA silencing. We examined the mechanism of P6-mediated silencing suppression by transiently expressing P6 in both N. benthamiana leaves and rice protoplasts. Our results showed that P6 could repress the production of secondary siRNAs and inhibit systemic green fluorescent protein RNA silencing but did not interfere with local RNA silencing in N. benthamiana plants or in rice protoplasts. Intriguingly, P6 and RDR6 had overlapping subcellular localization and P6 bound both rice and Arabidopsis RDR6 in vivo. Furthermore, transgenic rice plants expressing P6 showed enhanced susceptibility to infection by Rice stripe virus. Hence, we propose that P6 is part of the RYSV's counter-defense machinery against the plant RNA silencing system and plays a role mainly in affecting RDR6-mediated secondary siRNA synthesis. Our work provides a new perspective on how a plant-infecting nucleorhabdovirus may counteract host RNA silencing-mediated antiviral defense.
Li, Ziye; Yang, Lin; Liu, Xiaojun; Nie, Ziyuan; Luo, Jianmin
2018-05-14
The long noncoding RNA (lnc) maternally expressed 3 (MEG3) is downregulated in many types of cancers. However, the relationship between lncRNA MEG3, microRNA-21 (miR-21) and chronic myeloid leukemia (CML) blast crisis is unknown. This study examined bone marrow samples from 40 CML patients and 10 healthy donors. Proliferation and apoptosis assays, real-time polymerase chain reaction (PCR), bisulfite sequencing PCR, Western blotting, luciferase assay, RNA pull-down, RNA immunoprecipitation (RIP), co-immunoprecipitation (CoIP) and Chromatin immunoprecipitation (ChIP) were performed. We found that MEG3 and PTEN expression were down-regulated, whereas, MDM2, DNMT1 and miR-21 were up-regulated in the accelerated and blast phases of CML. Treated with 5-azacytidine decreased the level of MDM2, DNMT1 and miR21, but increased the level of MEG3 and PTEN. Overexpression of MEG3 and silencing the expression of miR-21 inhibited proliferation and induced apoptosis. MEG3 overexpression and silencing the expression of miR21 influence the levels of MMP-2, MMP-9, bcl-2 and Bax. MEG3 was able to interact with MDM2 and EZH2. MDM2 could interact with DNMT1 and PTEN. MYC and AKT can interact with EZH2. ChIP-seq showed that the promoter of KLF4 and SFRP2 interacts with DNMT1. In conclusion, lncRNA MEG3 and its target miR21 may serve as novel therapeutic targets for CML blast crisis; and demethylation drugs might also have potential clinical application in treating CML blast crisis. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Engeli, Roger T.; Rohrer, Simona R.; Vuorinen, Anna; Herdlinger, Sonja; Kaserer, Teresa; Leugger, Susanne; Schuster, Daniela
2017-01-01
Parabens are effective preservatives widely used in cosmetic products and processed food, with high human exposure. Recent evidence suggests that parabens exert estrogenic effects. This work investigated the potential interference of parabens with the estrogen-activating enzyme 17β-hydroxysteroid dehydrogenase (17β-HSD) 1 and the estrogen-inactivating 17β-HSD2. A ligand-based 17β-HSD2 pharmacophore model was applied to screen a cosmetic chemicals database, followed by in vitro testing of selected paraben compounds for inhibition of 17β-HSD1 and 17β-HSD2 activities. All tested parabens and paraben-like compounds, except their common metabolite p-hydroxybenzoic acid, inhibited 17β-HSD2. Ethylparaben and ethyl vanillate inhibited 17β-HSD2 with IC50 values of 4.6 ± 0.8 and 1.3 ± 0.3 µM, respectively. Additionally, parabens size-dependently inhibited 17β-HSD1, whereby hexyl- and heptylparaben were most active with IC50 values of 2.6 ± 0.6 and 1.8 ± 0.3 µM. Low micromolar concentrations of hexyl- and heptylparaben decreased 17β-HSD1 activity, and ethylparaben and ethyl vanillate decreased 17β-HSD2 activity. However, regarding the very rapid metabolism of these compounds to the inactive p-hydroxybenzoic acid by esterases, it needs to be determined under which conditions low micromolar concentrations of these parabens or their mixtures can occur in target cells to effectively disturb estrogen effects in vivo. PMID:28925944
Long non-coding RNA CTA sensitizes osteosarcoma cells to doxorubicin through inhibition of autophagy
Wang, Zhengguang; Liu, Zhendong; Wu, Song
2017-01-01
Recently, several long non-coding RNAs (lncRNAs) have been implicated in osteosarcoma (OS). However, the regulatory roles of lncRNAs in chemotherapy resistance of OS still remain unclear. This study aimed to screen a novel lncRNA that contributes to chemotherapeutic resistance of OS, and to explore the underlying mechanisms. Our data showed that lncRNA CTA was markedly downregulated in OS tissues compared to their matched non-tumor tissues, and low expression of lncRNA CTA was significantly associated with the advanced clinical stage and tumor size. In addition, OS patients with low lncRNA CTA levels showed a worse prognosis when compared with those with high expression of lncRNA CTA. Furthermore, we report that lncRNA CTA has an inverse relationship with miR-210 expression in OS tissues. LncRNA CTA could be activated by doxorubicin (DOX), and could promote OS cell apoptosis by competitively binding miR-210, while inhibit cell autophagy. On the other hand, lncRNA CTA was downregulated in DOX-resistant OS cells. Overexpression of lncRNA CTA reduced autophagy and subsequently overcame DOX resistance of OS in vitro and in vivo. Therefore, we demonstrate that lncRNA CTA is an essential regulator in DOX-induced OS cell apoptosis, and the lncRNA CTA-miR-210 axis plays an important role in reducing OS chemoresistance. PMID:28415557
Intraperitoneal AAV9-shRNA inhibits target expression in neonatal skeletal and cardiac muscles.
Mayra, Azat; Tomimitsu, Hiroyuki; Kubodera, Takayuki; Kobayashi, Masaki; Piao, Wenying; Sunaga, Fumiko; Hirai, Yukihiko; Shimada, Takashi; Mizusawa, Hidehiro; Yokota, Takanori
2011-02-11
Systemic injections of AAV vectors generally transduce to the liver more effectively than to cardiac and skeletal muscles. The short hairpin RNA (shRNA)-expressing AAV9 (shRNA-AAV9) can also reduce target gene expression in the liver, but not enough in cardiac or skeletal muscles. Higher doses of shRNA-AAV9 required for inhibiting target genes in cardiac and skeletal muscles often results in shRNA-related toxicity including microRNA oversaturation that can induce fetal liver failure. In this study, we injected high-dose shRNA-AAV9 to neonates and efficiently silenced genes in cardiac and skeletal muscles without inducing liver toxicity. This is because AAV is most likely diluted or degraded in the liver than in cardiac or skeletal muscle during cell division after birth. We report that this systemically injected shRNA-AAV method does not induce any major side effects, such as liver dysfunction, and the dose of shRNA-AAV is sufficient for gene silencing in skeletal and cardiac muscle tissues. This novel method may be useful for generating gene knockdown in skeletal and cardiac mouse tissues, thus providing mouse models useful for analyzing diseases caused by loss-of-function of target genes. Copyright © 2011 Elsevier Inc. All rights reserved.
Group II intron inhibits conjugative relaxase expression in bacteria by mRNA targeting
Piazza, Carol Lyn; Smith, Dorie
2018-01-01
Group II introns are mobile ribozymes that are rare in bacterial genomes, often cohabiting with various mobile elements, and seldom interrupting housekeeping genes. What accounts for this distribution has not been well understood. Here, we demonstrate that Ll.LtrB, the group II intron residing in a relaxase gene on a conjugative plasmid from Lactococcus lactis, inhibits its host gene expression and restrains the naturally cohabiting mobile element from conjugative horizontal transfer. We show that reduction in gene expression is mainly at the mRNA level, and results from the interaction between exon-binding sequences (EBSs) in the intron and intron-binding sequences (IBSs) in the mRNA. The spliced intron targets the relaxase mRNA and reopens ligated exons, causing major mRNA loss. Taken together, this study provides an explanation for the distribution and paucity of group II introns in bacteria, and suggests a potential force for those introns to evolve into spliceosomal introns. PMID:29905149
Group II intron inhibits conjugative relaxase expression in bacteria by mRNA targeting.
Qu, Guosheng; Piazza, Carol Lyn; Smith, Dorie; Belfort, Marlene
2018-06-15
Group II introns are mobile ribozymes that are rare in bacterial genomes, often cohabiting with various mobile elements, and seldom interrupting housekeeping genes. What accounts for this distribution has not been well understood. Here, we demonstrate that Ll.LtrB, the group II intron residing in a relaxase gene on a conjugative plasmid from Lactococcus lactis , inhibits its host gene expression and restrains the naturally cohabiting mobile element from conjugative horizontal transfer. We show that reduction in gene expression is mainly at the mRNA level, and results from the interaction between exon-binding sequences (EBSs) in the intron and intron-binding sequences (IBSs) in the mRNA. The spliced intron targets the relaxase mRNA and reopens ligated exons, causing major mRNA loss. Taken together, this study provides an explanation for the distribution and paucity of group II introns in bacteria, and suggests a potential force for those introns to evolve into spliceosomal introns. © 2018, Qu et al.
SiRNA Crosslinked Nanoparticles for the Treatment of Inflammation-induced Liver Injury.
Tang, Yaqin; Zeng, Ziying; He, Xiao; Wang, Tingting; Ning, Xinghai; Feng, Xuli
2017-02-01
RNA interference mediated by small interfering RNA (siRNA) provides a powerful tool for gene regulation, and has a broad potential as a promising therapeutic strategy. However, therapeutics based on siRNA have had limited clinical success due to their undesirable pharmacokinetic properties. This study presents pH-sensitive nanoparticles-based siRNA delivery systems (PNSDS), which are positive-charge-free nanocarriers, composed of siRNA chemically crosslinked with multi-armed poly(ethylene glycol) carriers via acid-labile acetal linkers. The unique siRNA crosslinked structure of PNSDS allows it to have minimal cytotoxicity, high siRNA loading efficiency, and a stimulus-responsive property that enables the selective intracellular release of siRNA in response to pH conditions. This study demonstrates that PNSDS can deliver tumor necrosis factor alpha (TNF-α) siRNA into macrophages and induce the efficient down regulation of the targeted gene in complete cell culture media. Moreover, PNSDS with mannose targeting moieties can selectively accumulate in mice liver, induce specific inhibition of macrophage TNF-α expression in vivo, and consequently protect mice from inflammation-induced liver damages. Therefore, this novel siRNA delivering platform would greatly improve the therapeutic potential of RNAi based therapies.
Wuriyanghan, Hada; Falk, Bryce W.
2013-01-01
The potato/tomato psyllid, Bactericera cockerelli (B. cockerelli), is an important plant pest and the vector of the phloem-limited bacterium Candidatus Liberibacter psyllaurous (solanacearum), which is associated with the zebra chip disease of potatoes. Previously, we reported induction of RNA interference effects in B. cockerelli via in vitro-prepared dsRNA/siRNAs after intrathoracic injection, and after feeding of artificial diets containing these effector RNAs. In order to deliver RNAi effectors via plant hosts and to rapidly identify effective target sequences in plant-feeding B. cockerelli, here we developed a plant virus vector-based in planta system for evaluating candidate sequences. We show that recombinant Tobacco mosaic virus (TMV) containing B. cockerelli sequences can efficiently infect and generate small interfering RNAs in tomato (Solanum lycopersicum), tomatillo (Physalis philadelphica) and tobacco (Nicotiana tabacum) plants, and more importantly delivery of interfering sequences via TMV induces RNAi effects, as measured by actin and V-ATPase mRNA reductions, in B. cockerelli feeding on these plants. RNAi effects were primarily detected in the B. cockerelli guts. In contrast to our results with TMV, recombinant Potato virus X (PVX) and Tobacco rattle virus (TRV) did not give robust infections in all plants and did not induce detectable RNAi effects in B. cockerelli. The greatest RNA interference effects were observed when B. cockerelli nymphs were allowed to feed on leaf discs collected from inoculated or lower expanded leaves from corresponding TMV-infected plants. Tomatillo plants infected with recombinant TMV containing B. cockerelli actin or V-ATPase sequences also showed phenotypic effects resulting in decreased B. cockerelli progeny production as compared to plants infected by recombinant TMV containing GFP. These results showed that RNAi effects can be achieved in plants against the phloem feeder, B. cockerelli, and the TMV-plant system will
Inhibition and interference in the think/no-think task.
Racsmány, Mihály; Conway, Martin A; Keresztes, Attila; Krajcsi, Attila
2012-02-01
Five experiments using the think/no-think (TNT) procedure investigated the effect of the no-think and substitute instructions on cued recall. In Experiment 1, when unrelated A-B paired associates were studied and cued for recall with A items, recall rates were reliably enhanced in the think condition and reliably impaired below baseline in the no-think condition. In Experiments 2 and 5, final recall was cued with B items, leading to reliably higher recall rates, as compared with baseline, in both the think and no-think conditions. This pattern indicates backward priming of no-think items. In Experiments 3 and 4, the no-think instruction was replaced with a thought substitution instruction, and participants were asked to think of another word instead of the studied one when they saw the no-think cued items. As in Experiments 1 and 2, the same amount of forgetting of B items was observed when A items were the cues, but in contrast to Experiment 2, there was no increase in the recall performance of A items when B items were the cues. These results suggest that not thinking of studied items or, alternatively, thinking of a substitute item to avoid a target item may involve different processes: the former featuring inhibition and the latter interference.
Interfering RNA with multi-targets for efficient gene suppression in HCC cells.
Li, Tiejun; Zhu, York Yuanyuan; Ji, Yi; Zhou, Songfeng
2018-06-01
RNA interference (RNAi) technology has been widely used in therapeutics development, especially multiple targeted RNAi strategy, which is a better method for multiple gene suppression. In the study, interfering RNAs (iRNAs) were designed for carrying two or three different siRNA sequences in different secondary structure formats (loop or cloverleaf). By using these types of iRNAs, co-inhibition of survivin and B-cell lymphoma-2 (Bcl-2) was investigated in hepatocellular carcinoma (HCC) cells, and we obtained promising gene silencing effects without showing undesirable interferon response. Furthermore, suppression effects on proliferation, invasion, and induced apoptosis in HCC cells were validated. The results suggest that long iRNAs with secondary structure may be a preferred strategy for multigenic disease therapy, especially for cancer and viral gene therapy and their iRNA drug development.
Spee, Bart; Jonkers, Martijn DB; Arends, Brigitte; Rutteman, Gerard R; Rothuizen, Jan; Penning, Louis C
2006-01-01
Background Apoptosis resistance occurs in various tumors. The anti-apoptotic XIAP protein is responsible for inhibiting apoptosis by reducing caspase-3 activation. Our aim is to evaluate whether RNA inhibition against XIAP increases the sensitivity of canine cell-lines for chemotherapeutics such as TRAIL and doxorubicin. We used small interfering RNA's (siRNA) directed against XIAP in three cell-lines derived from bile-duct epithelia (BDE), mammary carcinoma (P114), and osteosarcoma (D17). These cell-lines represent frequently occurring canine cancers and are highly comparable to their human counterparts. XIAP down-regulation was measured by means of quantitative PCR (Q-PCR) and Western blotting. The XIAP depleted cells were treated with a serial dilution of TRAIL or doxorubicin and compared to mock- and nonsense-treated controls. Viability was measured with a MTT assay. Results All XIAP siRNA treated cell-lines showed a mRNA down-regulation over 80 percent. Western blot analysis confirmed mRNA measurements. No compensatory effect of IAP family members was seen in XIAP depleted cells. The sensitivity of XIAP depleted cells for TRAIL was highest in BDE cells with an increase in the ED50 of 14-fold, compared to mock- and nonsense-treated controls. The sensitivity of P114 and D17 cell-lines increased six- and five-fold, respectively. Doxorubicin treatment in XIAP depleted cells increased sensitivity in BDE cells more than eight-fold, whereas P114 and D17 cell-lines showed an increase in sensitivity of three- and five-fold, respectively. Conclusion XIAP directed siRNA's have a strong sensitizing effect on TRAIL-reduced cell-viability and a smaller but significant effect with the DNA damaging drug doxorubicin. The increase in efficacy of chemotherapeutics with XIAP depletion provides the rationale for the use of XIAP siRNA's in insensitive canine tumors. PMID:16953886
NASA Astrophysics Data System (ADS)
Nollen, Ellen A. A.; Garcia, Susana M.; van Haaften, Gijs; Kim, Soojin; Chavez, Alejandro; Morimoto, Richard I.; Plasterk, Ronald H. A.
2004-04-01
Protein misfolding and the formation of aggregates are increasingly recognized components of the pathology of human genetic disease and hallmarks of many neurodegenerative disorders. As exemplified by polyglutamine diseases, the propensity for protein misfolding is associated with the length of polyglutamine expansions and age-dependent changes in protein-folding homeostasis, suggesting a critical role for a protein homeostatic buffer. To identify the complement of protein factors that protects cells against the formation of protein aggregates, we tested transgenic Caenorhabditis elegans strains expressing polyglutamine expansion yellow fluorescent protein fusion proteins at the threshold length associated with the age-dependent appearance of protein aggregation. We used genome-wide RNA interference to identify genes that, when suppressed, resulted in the premature appearance of protein aggregates. Our screen identified 186 genes corresponding to five principal classes of polyglutamine regulators: genes involved in RNA metabolism, protein synthesis, protein folding, and protein degradation; and those involved in protein trafficking. We propose that each of these classes represents a molecular machine collectively comprising the protein homeostatic buffer that responds to the expression of damaged proteins to prevent their misfolding and aggregation. protein misfolding | neurodegenerative diseases
NASA Astrophysics Data System (ADS)
Hu, Zongli; Parekh, Urvi; Maruta, Natsumi; Trusov, Yuri; Botella, Jimmy
2015-01-01
Fusarium oxysporum is a devastating pathogen causing extensive yield losses in a variety of crops and development of sustainable, environmentally friendly methods to improve crop resistance is crucial. We have used Host-Derived RNA interference (HD-RNAi) technology to partially silence three different genes (FOW2, FRP1 and OPR) in the hemi-biotrophic fungus Fusarium oxysporum f. sp. conglutinans. Expression of double stranded RNA molecules targeting fungal pathogen genes was achieved in a number of transgenic Arabidopsis lines. F. oxysporum infecting the transgenic lines displayed substantially reduced mRNA levels on all three targeted genes, with an average of 75%, 83% and 72% reduction for FOW2, FRP1 and OPR respectively. The silencing of pathogen genes had a clear positive effect on the ability of the transgenic lines to fight infection. All transgenic lines displayed enhanced resistance to F. oxysporum with delayed disease symptom development, especially FRP1 and OPR lines. Survival rates after fungal infection were higher in the transgenic lines compared to control wild type plants which consistently showed survival rates of 10%, with FOW2 lines showing 25% survival; FRP1 lines 30-50% survival and FOW2 between 45-70% survival. The down-regulation effect was specific for the targeted genes without unintended effects in related genes. In addition to producing resistant crops, HD-RNAi can provide a useful tool to rapidly screen candidate fungal pathogenicity genes without the need to produce fungal knockout mutants.
Xu, Hong; Liu, Changle; Rao, Shenqiang; He, Luling; Zhang, Tengling; Sun, Shanshan; Wu, Bing; Zou, Lifang; Wang, Shouyu; Xue, Yun; Jia, Tianyu; Zhao, Shanhong; Li, Guilin; Liu, Shuangmei; Li, Guodong; Liang, Shangdong
2016-12-01
Diabetic cardiac autonomic neuropathy (DCAN) is a serious and common complication in diabetes mellitus (DM). Long noncoding RNAs (lncRNAs), an important class of regulatory molecules in diverse biological processes, have attracted considerable interest in DCAN. Our previous study has indicated a lncRNA, NONRATT021972 (NONCODE ID), was enhanced in sympathetic neuronal-like PC12 cells in the setting of high glucose (HG) and high FFAs (HF); its silence was found to significantly alleviate HGHF-induced tumor necrosis factor-α (TNF-α) release in PC12 cells. Here we further explore the effects of NONRATT021972 small interference RNA (siRNA) on heart rate variability (HRV) mediated by superior cervical ganglia (SCG) in diabetic rats and the possible mechanism underlying. We found an increment of NONRATT021972 in SCG of DM rats. Treatment of NONRATT021972 siRNA in DM rats decreased the elevated expression of TNF-α, blocked serine phosphorylation of insulin receptor substrate (IRS) 1 and increased the down-regulated expression of IRS1 in SCG. Meanwhile, NONRATT021972 siRNA rescued decreased HRV in DM rats. Therefore, inhibition of NONRATT021972 may serve as a novel therapeutic strategy for preventing the development of DCAN. Copyright © 2016 Elsevier B.V. All rights reserved.
Structure-Function Analysis of Rny1 in tRNA Cleavage and Growth Inhibition
Luhtala, Natalie; Parker, Roy
2012-01-01
T2 ribonucleases are conserved nucleases that affect a variety of processes in eukaryotic cells including the regulation of self-incompatibility by S-RNases in plants, modulation of host immune cell responses by viral and schistosome T2 enzymes, and neurological development and tumor progression in humans. These roles for RNaseT2’s can be due to catalytic or catalytic-independent functions of the molecule. Despite this broad importance, the features of RNaseT2 proteins that modulate catalytic and catalytic-independent functions are poorly understood. Herein, we analyze the features of Rny1 in Saccharomyces cerevisiae to determine the requirements for cleaving tRNA in vivo and for inhibiting cellular growth in a catalytic-independent manner. We demonstrate that catalytic-independent inhibition of growth is a combinatorial property of the protein and is affected by a fungal-specific C-terminal extension, the conserved catalytic core, and the presence of a signal peptide. Catalytic functions of Rny1 are independent of the C-terminal extension, are affected by many mutations in the catalytic core, and also require a signal peptide. Biochemical flotation assays reveal that in rny1Δ cells, some tRNA molecules associate with membranes suggesting that cleavage of tRNAs by Rny1 can involve either tRNA association with, or uptake into, membrane compartments. PMID:22829915
Schmidt, R; Brysch, W; Rother, S; Schlingensiepen, K H
1995-10-01
A rapid increase in ependymin mRNA expression demonstrated by semiquantitative in situ hybridization after avoidance conditioning on goldfish suggested a molecular demand for newly synthesized ependymin translation product. To inhibit de novo synthesis of ependymin molecules without interference with preexisting ones, 18 mer anti-ependymin mRNA-phosphorothioate oligodeoxynucleotides (S-ODNs) were injected into the perimeningeal brain fluid before active avoidance training. S-ODN-injected animals learned the avoidance response; however, they were amnesic in the test. When injected into overtrained animals, S-ODNs did not interfere with retrieval or performance of the avoidance response. Fish treated with randomized S-ODN sequences served as further controls. Incorporation of S-ODNs was analyzed by injection of fluorescein isothiocyanate (FITC)-conjugated oligodeoxynucleotide probes. Microscopic observation revealed strong FITC-S-ODN fluorescence in reticular-shaped fibroblasts, the only known site of ependymin synthesis. Results demonstrate that selective inhibition of ependymin gene expression in vivo can specifically prevent memory formation. We conclude that in particular the newly synthesized ependymin molecules are involved in memory consolidation, possibly because they have not yet undergone irreversible molecular changes, which have been reported of this glycoprotein in a low-calcium microenvironment.
Yagi, Nobuhiro; Manabe, Ichiro; Tottori, Tsuneaki; Ishihara, Atsushi; Ogata, Fusa; Kim, Jong Heon; Nishimura, Satoshi; Fujiu, Katsuhito; Oishi, Yumiko; Itaka, Keiji; Kato, Yasuki; Yamauchi, Masahiro; Nagai, Ryozo
2009-08-15
Use of short interfering RNA (siRNA) is a promising new approach thought to have a strong potential to lead to rapid development of gene-oriented therapies. Here, we describe a newly developed, systemically injectable siRNA vehicle, the "wrapsome" (WS), which contains siRNA and a cationic lipofection complex in a core that is fully enveloped by a neutral lipid bilayer and hydrophilic polymers. WS protected siRNA from enzymatic digestion, providing a long half-life in the systemic circulation. Moreover, siRNA/WS leaked from blood vessels within tumors into the tumor tissue, where it accumulated and was subsequently transfected into the tumor cells. Because the transcription factor KLF5 is known to play a role in tumor angiogenesis, we designed KLF5-siRNA to test the antitumor activity of siRNA/WS. KLF5-siRNA/WS exhibited significant antitumor activity, although neither WS containing control scrambled-siRNA nor saline containing KLF5-siRNA affected tumor growth. KLF5-siRNA/WS inhibited Klf5 expression within tumors at both mRNA and protein levels, significantly reducing angiogenesis, and we detected no significant acute or long-term toxicity. Our findings support the idea that siRNA/WS can be used to knock down specific genes within tumors and thereby exert therapeutic effects against cancers.
Wang, Yue; Han, Zhihua; Fan, Yuqi; Zhang, Junfeng; Chen, Kan; Gao, Lin; Zeng, Huasu; Cao, Jiatian; Wang, Changqian
2017-01-01
MicroRNA-9 (miR-9) is involved in inflammatory reaction in atherosclerosis; however, its function and regulatory mechanisms remain unclear. We aimed to uncover the exact roles of miR-9 and downstream signaling pathways using in vitro human atherosclerosis models. We used oxidized low-density lipoprotein (oxLDL)-stimulated human THP-1 derived macrophages, oxLDL-stimulated human primary peripheral blood monocytes and lipopolysaccharides (LPS) or Alum-stimulated human THP-1 derived macrophages as in vitro atherosclerosis inflammation models. Transient transfection of over-expression vectors, small interference RNAs (siRNAs) or antisense oligonucleotides was used to regulate intracellular protein or miR-9 levels. Cell responses and signal transduction were detected by multiple assays including Western blotting, enzyme-linked immunosorbent assay (ELISA) and luciferase reporter assay. MiR-9 inhibited while anti-miR-9 antisense oligonucleotides induced interleukin-1 beta (IL-1β) and NLRP3 inflammasome activation in all in vitro models. Janus kinase 1 (JAK1) and matrix metalloproteinase 13 (MMP-13) were identified as the target genes of miR-9. In oxLDL-stimulated human THP-1 derived macrophages, knockdown of JAK1 by siRNA blocked the phosphorylation of signal transducer and activator of transcription 1 (STAT1) and mimicked the effects of miR-9. In the same model, JAK1 knockdown blocked the phosphorylation of NF-κB p65 in the nuclei and the phosphorylation of NF-κB IκBα in the cytoplasm. Our study demonstrated that miR-9 could inhibit activation of the NLRP3 inflammasome and attenuate atherosclerosis-related inflammation, likely through the JAK1/STAT1 signaling pathway. Therefore, miR-9 may serve as a potential therapeutic target for atherosclerosis. © 2017 The Author(s)Published by S. Karger AG, Basel.
Inhibition and Avoidance of mRNA Degradation by RNA Viruses
Moon, Stephanie L.; Barnhart, Michael D.; Wilusz, Jeffrey
2012-01-01
The cellular mRNA decay machinery plays a major role in regulating the quality and quantity of gene expression in cells. This machinery involves multiple enzymes and pathways that converge to promote the exonucleolytic decay of mRNAs. The transcripts made by RNA viruses are susceptible to degradation by this machinery and, in fact, can be actively targeted. Thus, to maintain gene expression and replication, RNA viruses have evolved a number of strategies to avoid and/or inactivate aspects of the cellular mRNA decay machinery. Recent work uncovering the mechanisms used by RNA viruses to maintain the stability of their transcripts is described below. PMID:22626865
Threat interferes with response inhibition.
Hartikainen, Kaisa M; Siiskonen, Anna R; Ogawa, Keith H
2012-05-09
A potential threat, such as a spider, captures attention and engages executive functions to adjust ongoing behavior and avoid danger. We and many others have reported slowed responses to neutral targets in the context of emotional distractors. This behavioral slowing has been explained in the framework of attentional competition for limited resources with emotional stimuli prioritized. Alternatively, slowed performance could reflect the activation of avoidance/freezing-type motor behaviors associated with threat. Although the interaction of attention and emotion has been widely studied, little is known on the interaction between emotion and executive functions. We studied how threat-related stimuli (spiders) interact with executive performance and whether the interaction profile fits with a resource competition model or avoidance/freezing-type motor behaviors. Twenty-one young healthy individuals performed a Go-NoGo visual discrimination reaction time (RT) task engaging several executive functions with threat-related and emotionally neutral distractors. The threat-related distractors had no effect on the RT or the error rate in the Go trials. The NoGo error rate, reflecting failure in response inhibition, increased significantly because of threat-related distractors in contrast to neutral distractors, P less than 0.05. Thus, threat-related distractors temporarily impaired response inhibition. Threat-related distractors associated with increased commission errors and no effect on RT does not suggest engagement of avoidance/freezing-type motor behaviors. The results fit in the framework of the resource competition model. A potential threat calls for evaluation of affective significance as well as inhibition of undue emotional reactivity. We suggest that these functions tax executive resources and may render other executive functions, such as response inhibition, temporarily compromised when the demands for resources exceed availability.
van der Linden, Lonneke; Vives-Adrián, Laia; Selisko, Barbara; Ferrer-Orta, Cristina; Liu, Xinran; Lanke, Kjerstin; Ulferts, Rachel; De Palma, Armando M; Tanchis, Federica; Goris, Nesya; Lefebvre, David; De Clercq, Kris; Leyssen, Pieter; Lacroix, Céline; Pürstinger, Gerhard; Coutard, Bruno; Canard, Bruno; Boehr, David D; Arnold, Jamie J; Cameron, Craig E; Verdaguer, Nuria; Neyts, Johan; van Kuppeveld, Frank J M
2015-03-01
The genus Enterovirus of the family Picornaviridae contains many important human pathogens (e.g., poliovirus, coxsackievirus, rhinovirus, and enterovirus 71) for which no antiviral drugs are available. The viral RNA-dependent RNA polymerase is an attractive target for antiviral therapy. Nucleoside-based inhibitors have broad-spectrum activity but often exhibit off-target effects. Most non-nucleoside inhibitors (NNIs) target surface cavities, which are structurally more flexible than the nucleotide-binding pocket, and hence have a more narrow spectrum of activity and are more prone to resistance development. Here, we report a novel NNI, GPC-N114 (2,2'-[(4-chloro-1,2-phenylene)bis(oxy)]bis(5-nitro-benzonitrile)) with broad-spectrum activity against enteroviruses and cardioviruses (another genus in the picornavirus family). Surprisingly, coxsackievirus B3 (CVB3) and poliovirus displayed a high genetic barrier to resistance against GPC-N114. By contrast, EMCV, a cardiovirus, rapidly acquired resistance due to mutations in 3Dpol. In vitro polymerase activity assays showed that GPC-N114 i) inhibited the elongation activity of recombinant CVB3 and EMCV 3Dpol, (ii) had reduced activity against EMCV 3Dpol with the resistance mutations, and (iii) was most efficient in inhibiting 3Dpol when added before the RNA template-primer duplex. Elucidation of a crystal structure of the inhibitor bound to CVB3 3Dpol confirmed the RNA-binding channel as the target for GPC-N114. Docking studies of the compound into the crystal structures of the compound-resistant EMCV 3Dpol mutants suggested that the resistant phenotype is due to subtle changes that interfere with the binding of GPC-N114 but not of the RNA template-primer. In conclusion, this study presents the first NNI that targets the RNA template channel of the picornavirus polymerase and identifies a new pocket that can be used for the design of broad-spectrum inhibitors. Moreover, this study provides important new insight into the
van der Linden, Lonneke; Vives-Adrián, Laia; Selisko, Barbara; Ferrer-Orta, Cristina; Liu, Xinran; Lanke, Kjerstin; Ulferts, Rachel; De Palma, Armando M.; Tanchis, Federica; Goris, Nesya; Lefebvre, David; De Clercq, Kris; Leyssen, Pieter; Lacroix, Céline; Pürstinger, Gerhard; Coutard, Bruno; Canard, Bruno; Boehr, David D.; Arnold, Jamie J.; Cameron, Craig E.; Verdaguer, Nuria
2015-01-01
The genus Enterovirus of the family Picornaviridae contains many important human pathogens (e.g., poliovirus, coxsackievirus, rhinovirus, and enterovirus 71) for which no antiviral drugs are available. The viral RNA-dependent RNA polymerase is an attractive target for antiviral therapy. Nucleoside-based inhibitors have broad-spectrum activity but often exhibit off-target effects. Most non-nucleoside inhibitors (NNIs) target surface cavities, which are structurally more flexible than the nucleotide-binding pocket, and hence have a more narrow spectrum of activity and are more prone to resistance development. Here, we report a novel NNI, GPC-N114 (2,2'-[(4-chloro-1,2-phenylene)bis(oxy)]bis(5-nitro-benzonitrile)) with broad-spectrum activity against enteroviruses and cardioviruses (another genus in the picornavirus family). Surprisingly, coxsackievirus B3 (CVB3) and poliovirus displayed a high genetic barrier to resistance against GPC-N114. By contrast, EMCV, a cardiovirus, rapidly acquired resistance due to mutations in 3Dpol. In vitro polymerase activity assays showed that GPC-N114 i) inhibited the elongation activity of recombinant CVB3 and EMCV 3Dpol, (ii) had reduced activity against EMCV 3Dpol with the resistance mutations, and (iii) was most efficient in inhibiting 3Dpol when added before the RNA template-primer duplex. Elucidation of a crystal structure of the inhibitor bound to CVB3 3Dpol confirmed the RNA-binding channel as the target for GPC-N114. Docking studies of the compound into the crystal structures of the compound-resistant EMCV 3Dpol mutants suggested that the resistant phenotype is due to subtle changes that interfere with the binding of GPC-N114 but not of the RNA template-primer. In conclusion, this study presents the first NNI that targets the RNA template channel of the picornavirus polymerase and identifies a new pocket that can be used for the design of broad-spectrum inhibitors. Moreover, this study provides important new insight into the
Yao, Yongxuan; Yang, Bo; Cao, Huang; Zhao, Kaitao; Yuan, Yifei; Chen, Yingshan; Zhang, Zhenhua; Wang, Yun; Pei, Rongjuan; Chen, Jizheng; Hu, Xue; Zhou, Yuan; Lu, Mengji; Wu, Chunchen; Chen, Xinwen
2018-05-14
The terminal redundancy (TR) sequence of the 3.5-kb hepatitis B virus (HBV) RNA contains sites that govern many crucial functions in the viral life cycle, including polyadenylation, translation, RNA packaging, and DNA synthesis. In the present study, RNA-binding motif protein 24 (RBM24) is shown to be involved in the modulation of HBV replication by targeting the TR of HBV RNA. In HBV-transfected hepatoma cell lines, both knockdown and overexpression of RBM24 led to decreased HBV replication and transcription. Ectopic expression of RBM24 inhibited HBV replication, which was partly restored by knockdown of RBM24, indicating that a proper level of RBM24 was required for HBV replication. The regulation of RBM24 of HBV replication and translation was achieved by the interaction between the RNA-binding domains of RBM24 and both the 5' and 3' TR of 3.5-kb RNA. RBM24 interacted with the 5' TR of HBV pregenomic RNA (pgRNA) to block 80S ribosome assembly on HBV pgRNA and thus inhibited core protein translation, whereas the interaction between RBM24 and the 3' TR enhanced the stability of HBV RNA. Finally, the regulatory function of RBM24 on HBV replication was further confirmed in a HBV infection model. In conclusion, the present study demonstrates the dual functions of RBM24 by interacting with different TRs of viral RNA and reveals that RBM24 is an important host gene for HBV replication.
The use of RNA interference (RNAi) gene silencing technology, particularly RNAi for pesticidal purposes to control macroorganism pests, is a relatively recent innovation. Post-transcriptional silencing of gene function is a very rapid process where double-stranded RNA (dsRNA) dir...
Yuan, Li-Fen; Sheng, Jing; Lu, Ping; Wang, Yu-Qiang; Jin, Tuo; Du, Qin
2015-09-01
Angiotensinogen (AGT) has been shown to have a role in cardiac hypertrophy, while depletion of the AGT gene in spontaneously hypertensive rats (SHR) has not been investigated. The present study investigated the effect of AGT knockdown on cardiac hypertrophy in SHR. For this, small hairpin (sh)RNAs were intravenously injected into SHRs, using a nanoparticle‑mediated transfection system. The experimental rats were divided into the following groups: a) Blank control with water treatment only, b) negative control with biscarbamate‑crosslinked Gal‑polyethylene glycol polyethylenimine nanoparticles (GPE)/negative shRNA, c) AGT‑RNA interference (RNAi) group with GPE/AGT‑shRNA, and 4) normotensive control using Wistar‑Kyoto rats (WKY) with water treatment. Three and five days following the first injection, the levels of hepatic AGT mRNA and AGT protein as well as plasma levels of AGT were markedly decreased in the AGT‑RNAi group (P<0.05). Furthermore, a significant decrease in systolic blood pressure (SBP), left ventricular weight to body weight ratio and heart weight to body weight ratio were observed in the AGT‑RNAi group compared with those in the control groups. The depletion of AGT in SHR led to a reduction in SBP by 30±4 mmHg, which was retained for >10 days. Cardiac hypertrophy was also significantly improved in AGT‑knockdown rats. In conclusion, the present study showed that AGT‑silencing had a significant inhibitory effect on hypertension and hypertensive‑induced cardiac hypertrophy in SHRs.
Basnet, Sanjay; Kamble, Shripat T
2018-05-04
The common bed bug, Cimex lectularius L. (Hemiptera: Cimicidae) is a nuisance household pest causing significant medical and economic impacts. RNA interference (RNAi) of genes that are involved in vital physiological processes can serve as potential RNAi targets for insect control. Brahma is an ATPase subunit of a chromatin-remodeling complex involved in transcription of several genes for cellular processes, most importantly the homeotic genes. In this study, we used a microinjection technique to deliver double stranded RNA into female bed bugs. Delivery of 0.05 and 0.5 µg/insect of brahma dsRNA directly into hemocele resulted substantial reduction in oviposition. Eggs laid by bed bugs receiving both doses of brahma dsRNA exhibited significantly lower hatching percentage as compared to controls. In addition, brahma RNAi in female bed bugs caused significant mortality. Our results disclosed the potential of brahma RNAi to suppress bed bug population through injection of specific dsRNA, suggesting a critical function of this gene in bed bugs' reproduction and survival. Based on our data, brahma can be a promising RNAi target for suppression of bed bug population.
Therapeutic RNA interference for neurodegenerative diseases: From promise to progress.
Gonzalez-Alegre, Pedro
2007-04-01
RNA interference (RNAi) has emerged as a powerful tool to manipulate gene expression in the laboratory. Due to its remarkable discriminating properties, individual genes, or even alleles can be targeted with exquisite specificity in cultured cells or living animals. Among its many potential biomedical applications, silencing of disease-linked genes stands out as a promising therapeutic strategy for many incurable disorders. Neurodegenerative diseases represent one of the more attractive targets for the development of therapeutic RNAi. In this group of diseases, the progressive loss of neurons leads to the gradual appearance of disabling neurological symptoms and premature death. Currently available therapies aim to improve the symptoms but not to halt the process of neurodegeneration. The increasing prevalence and economic burden of some of these diseases, such as Alzheimer's disease (AD) or Parkinson's disease (PD), has boosted the efforts invested in the development of interventions, such as RNAi, aimed at altering their natural course. This review will summarize where we stand in the therapeutic application of RNAi for neurodegenerative diseases. The basic principles of RNAi will be reviewed, focusing on features important for its therapeutic manipulation. Subsequently, a stepwise strategy for the development of therapeutic RNAi will be presented. Finally, the different preclinical trials of therapeutic RNAi completed in disease models will be summarized, stressing the experimental questions that need to be addressed before planning application in human disease.
Tangudu, Naveen K; Verma, Vinod K; Clemons, Tristan D; Beevi, Syed S; Hay, Trevor; Mahidhara, Ganesh; Raja, Meera; Nair, Rekha A; Alexander, Liza E; Patel, Anant B; Jose, Jedy; Smith, Nicole M; Zdyrko, Bogdan; Bourdoncle, Anne; Luzinov, Igor; Iyer, K Swaminathan; Clarke, Alan R; Dinesh Kumar, Lekha
2015-05-01
In this article, we report the development and preclinical validation of combinatorial therapy for treatment of cancers using RNA interference (RNAi). RNAi technology is an attractive approach to silence genes responsible for disease onset and progression. Currently, the critical challenge facing the clinical success of RNAi technology is in the difficulty of delivery of RNAi inducers, due to low transfection efficiency, difficulties of integration into host DNA and unstable expression. Using the macromolecule polyglycidal methacrylate (PGMA) as a platform to graft multiple polyethyleneimine (PEI) chains, we demonstrate effective delivery of small oligos (anti-miRs and mimics) and larger DNAs (encoding shRNAs) in a wide variety of cancer cell lines by successful silencing/activation of their respective target genes. Furthermore, the effectiveness of this therapy was validated for in vivo tumor suppression using two transgenic mouse models; first, tumor growth arrest and increased animal survival was seen in mice bearing Brca2/p53-mutant mammary tumors following daily intratumoral treatment with nanoparticles conjugated to c-Myc shRNA. Second, oral delivery of the conjugate to an Apc-deficient crypt progenitor colon cancer model increased animal survival and returned intestinal tissue to a non-wnt-deregulated state. This study demonstrates, through careful design of nonviral nanoparticles and appropriate selection of therapeutic gene targets, that RNAi technology can be made an affordable and amenable therapy for cancer. ©2015 American Association for Cancer Research.
Parecoxib inhibits glioblastoma cell proliferation, migration and invasion by upregulating miRNA-29c
Li, Lin-Yong; Xiao, Jie; Liu, Qiang
2017-01-01
ABSTRACT Glioblastoma (GBM) is one of the most lethal brain cancers worldwide, and there is an urgent need for development of novel therapeutic approaches. Parecoxib is a well-known cyclooxygenase-2 (COX-2) inhibitor, and had already been developed for postoperative analgesia with high efficacy and low adverse reaction. A recent study has suggested that parecoxib potently enhances immunotherapeutic efficacy of GBM, but its effects on GBM growth, migration and invasion have not previously been studied. In the present study, MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] and BrdU (5-bromo-2-deoxyuridine) incorporation assays were used to evaluate the cell proliferation of GBM cells. Wound-healing and transwell assays were preformed to analyze GBM cell migration and invasion, respectively. The results suggested that parecoxib inhibits cell proliferation, migration and invasion of GBM cells in a dose-dependent manner. RT-qPCR (real-time quantitative PCR) analysis demonstrated that miRNA-29c can be significantly induced by parecoxib. Furthermore, our data suggests that a miRNA-29c inhibitor can significantly attenuate parecoxib's effect on proliferation, migration and invasion of GBM. In conclusion, the present study suggests that parecoxib inhibits GBM cell proliferation, migration and invasion by upregulating miRNA-29c. PMID:27895048
Laudenbach, Beatrice Theres; Martínez-Montero, Saúl; Cencic, Regina; Habjan, Matthias; Pichlmair, Andreas; Damha, Masad J.; Pelletier, Jerry; Nagar, Bhushan
2017-01-01
IFIT1 (IFN-induced protein with tetratricopeptide repeats-1) is an effector of the host innate immune antiviral response that prevents propagation of virus infection by selectively inhibiting translation of viral mRNA. It relies on its ability to compete with the translation initiation factor eIF4F to specifically recognize foreign capped mRNAs, while remaining inactive against host mRNAs marked by ribose 2′-O methylation at the first cap-proximal nucleotide (N1). We report here several crystal structures of RNA-bound human IFIT1, including a 1.6-Å complex with capped RNA. IFIT1 forms a water-filled, positively charged RNA-binding tunnel with a separate hydrophobic extension that unexpectedly engages the cap in multiple conformations (syn and anti) giving rise to a relatively plastic and nonspecific mode of binding, in stark contrast to eIF4E. Cap-proximal nucleotides encircled by the tunnel provide affinity to compete with eIF4F while allowing IFIT1 to select against N1 methylated mRNA. Gel-shift binding assays confirm that N1 methylation interferes with IFIT1 binding, but in an RNA-dependent manner, whereas translation assays reveal that N1 methylation alone is not sufficient to prevent mRNA recognition at high IFIT1 concentrations. Structural and functional analysis show that 2′-O methylation at N2, another abundant mRNA modification, is also detrimental for RNA binding, thus revealing a potentially synergistic role for it in self- versus nonself-mRNA discernment. Finally, structure-guided mutational analysis confirms the importance of RNA binding for IFIT1 restriction of a human coronavirus mutant lacking viral N1 methylation. Our structural and biochemical analysis sheds new light on the molecular basis for IFIT1 translational inhibition of capped viral RNA. PMID:28251928
DOE Office of Scientific and Technical Information (OSTI.GOV)
Merritt, William M.; Lin, Yvonne G.; Han, Liz Y.
2008-05-06
The clinical and functional significance of RNA interference (RNAi) machinery, Dicer and Drosha, in ovarian cancer is not known and was examined. Dicer and Drosha expression was measured in ovarian cancer cell lines (n=8) and invasive epithelial ovarian cancer specimens (n=111) and correlated with clinical outcome. Validation was performed with previously published cohorts of ovarian, breast, and lung cancer patients. Anti-Galectin-3 siRNA and shRNA transfections were used for in vitro functional studies. Dicer and Drosha mRNA and protein levels were decreased in 37% to 63% of ovarian cancer cell lines and in 60% and 51% of human ovarian cancer specimens,more » respectively. Low Dicer was significantly associated with advanced tumor stage (p=0.007), and low Drosha with suboptimal surgical cytoreduction (p=0.02). Tumors with both high Dicer and Drosha were associated with increased median patient survival (>11 years vs. 2.66 years for other groups; p<0.001). In multivariate analysis, high Dicer (HR=0.48; p=0.02), high-grade histology (HR=2.46; p=0.03), and poor chemoresponse (HR=3.95; p<0.001) were identified as independent predictors of disease-specific survival. Findings of poor clinical outcome with low Dicer expression were validated in separate cohorts of cancer patients. Galectin-3 silencing with siRNA transfection was superior to shRNA in cell lines with low Dicer (78-95% vs. 4-8% compared to non-targeting sequences), and similar in cell lines with high Dicer. Our findings demonstrate the clinical and functional impact of RNAi machinery alterations in ovarian carcinoma and support the use of siRNA constructs that do not require endogenous Dicer and Drosha for therapeutic applications.« less
Smyth, Redmond P; Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe; von Kleist, Max; Marquet, Roland
2018-05-18
Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5' region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5' PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production.
HIVsirDB: a database of HIV inhibiting siRNAs.
Tyagi, Atul; Ahmed, Firoz; Thakur, Nishant; Sharma, Arun; Raghava, Gajendra P S; Kumar, Manoj
2011-01-01
Human immunodeficiency virus (HIV) is responsible for millions of deaths every year. The current treatment involves the use of multiple antiretroviral agents that may harm patients due to their toxic nature. RNA interference (RNAi) is a potent candidate for the future treatment of HIV, uses short interfering RNA (siRNA/shRNA) for silencing HIV genes. In this study, attempts have been made to create a database HIVsirDB of siRNAs responsible for silencing HIV genes. HIVsirDB is a manually curated database of HIV inhibiting siRNAs that provides comprehensive information about each siRNA or shRNA. Information was collected and compiled from literature and public resources. This database contains around 750 siRNAs that includes 75 partially complementary siRNAs differing by one or more bases with the target sites and over 100 escape mutant sequences. HIVsirDB structure contains sixteen fields including siRNA sequence, HIV strain, targeted genome region, efficacy and conservation of target sequences. In order to facilitate user, many tools have been integrated in this database that includes; i) siRNAmap for mapping siRNAs on target sequence, ii) HIVsirblast for BLAST search against database, iii) siRNAalign for aligning siRNAs. HIVsirDB is a freely accessible database of siRNAs which can silence or degrade HIV genes. It covers 26 types of HIV strains and 28 cell types. This database will be very useful for developing models for predicting efficacy of HIV inhibiting siRNAs. In summary this is a useful resource for researchers working in the field of siRNA based HIV therapy. HIVsirDB database is accessible at http://crdd.osdd.net/raghava/hivsir/.
Postberg, Jan; Jönsson, Franziska; Weil, Patrick Philipp; Bulic, Aneta; Juranek, Stefan Andreas; Lipps, Hans-Joachim
2018-06-12
During sexual reproduction in the unicellular ciliate Stylonychia somatic macronuclei differentiate from germline micronuclei. Thereby, programmed sequence reduction takes place, leading to the elimination of > 95% of germline sequences, which priorly adopt heterochromatin structure via H3K27me3. Simultaneously, 27nt-ncRNAs become synthesized from parental transcripts and are bound by the Argonaute protein PIWI1. These 27nt-ncRNAs cover sequences destined to the developing macronucleus and are thought to protect them from degradation. We provide evidence and propose that RNA/DNA base-pairing guides PIWI1/27nt-RNA complexes to complementary macronucleus-destined DNA target sequences, hence transiently causing locally stalled replication during polytene chromosome formation. This spatiotemporal delay enables the selective deposition of temporarily available histone H3.4K27me3 nucleosomes at all other sequences being continuously replicated, thus dictating their prospective heterochromatin structure before becoming developmentally eliminated. Concomitantly, 27nt-RNA-covered sites remain protected. We introduce the concept of 'RNA-induced DNA replication interference' and explain how the parental functional genome partition could become transmitted to the progeny.
Inhibition of RNA-Dependent DNA Polymerase of Avian Myeloblastosis Virus by Pyran Copolymer
Papas, Takis S.; Pry, Thomas W.; Chirigos, Michael A.
1974-01-01
Pyran copolymer, a known immunostimulator, was found to be a potent inhibitor of purified DNA polymerase (deoxynucleosidetriphosphate: DNA deoxynucleotidyltransferase; EC 2.7.7.7) isolated from avian myeloblastosis virus. Unlike other inhibitors, pyran showed unique features of inhibition. It interacts with the polymerase at a region other than the template site. The inhibitory effect was overcome only by excess enzyme and not affected by excess template. The degree of inhibition was not template specific for the templates tested: 70S RNA from avian myeloblastosis virus, synthetic hybrid poly(rA)·oligo(dT)10, synthetic copolymer poly(dA-dT), and activated calf-thymus DNA. The observed rate of inhibition by pyran was shown to vary with the different polymerases tested. Inhibition was shown with all oncornaviral polymerases and, to a lesser extent, with mammalian polymerases. However, two of the three bacterial polymerases, by contrast, showed a marked activation. PMID:4131275
Paulsson, J; Nordström, K; Ehrenberg, M
1998-01-01
The random distribution of ColE1 plasmids between the daughter cells at cell division introduces large copy number variations. Statistic variation associated with limited copy number in single cells also causes fluctuations to emerge spontaneously during the cell cycle. Efficient replication control out of steady state is therefore important to tame such stochastic effects of small numbers. In the present model, the dynamic features of copy number control are divided into two parts: first, how sharply the replication frequency per plasmid responds to changes in the concentration of the plasmid-coded inhibitor, RNA I, and second, how tightly RNA I and plasmid concentrations are coupled. Single (hyperbolic)- and multiple (exponential)-step inhibition mechanisms are compared out of steady state and it is shown how the response in replication frequency depends on the mode of inhibition. For both mechanisms, sensitivity of inhibition is "bought" at the expense of a rapid turnover of a replication preprimer, RNA II. Conventional, single-step, inhibition kinetics gives a sloppy replication control even at high RNA II turnover rates, whereas multiple-step inhibition has the potential of working with unlimited precision. When plasmid concentration changes rapidly, RNA I must be degraded rapidly to be "up to date" with the change. Adjustment to steady state is drastically impaired when the turnover rate constants of RNA I decrease below certain thresholds, but is basically unaffected for a corresponding increase. Several features of copy number control that are shown to be crucial for the understanding of ColE1-type plasmids still remain to be experimentally characterized. It is shown how steady-state properties reflect dynamics at the heart of regulation and therefore can be used to discriminate between fundamentally different copy number control mechanisms. The experimental tests of the predictions made require carefully planned assays, and some suggestions for suitable
Delivery of RNA interference therapeutics using polycation-based nanoparticles.
Howard, Kenneth Alan
2009-07-25
RNAi-based therapies are dependent on extracellular and intracellular delivery of RNA molecules for enabling target interaction. Polycation-based nanoparticles (or polyplexes) formed by self-assembly with RNA can be used to modulate pharmacokinetics and intracellular trafficking to improve the therapeutic efficacy of RNAi-based therapeutics. This review describes the application of polyplexes for extracellular and intracellular delivery of synthetic RNA molecules. Focus is given to routes of administration and silencing effects in animal disease models. The inclusion of functional components into the nanoparticle for controlling cellular trafficking and RNA release is discussed. This work highlights the versatile nature of polycation-based nanoparticles to fulfil the delivery requirements for RNA molecules with flexibility in design to evolve alongside an expanding repertoire of RNAi-based drugs.
TTLL12 Inhibits the Activation of Cellular Antiviral Signaling through Interaction with VISA/MAVS.
Ju, Lin-Gao; Zhu, Yuan; Lei, Pin-Ji; Yan, Dong; Zhu, Kun; Wang, Xiang; Li, Qing-Lan; Li, Xue-Jing; Chen, Jian-Wen; Li, Lian-Yun; Wu, Min
2017-02-01
Upon virus infection, host cells use retinoic-acid-inducible geneI I (RIG-I)-like receptors to recognize viral RNA and activate type I IFN expression. To investigate the role of protein methylation in the antiviral signaling pathway, we screened all the SET domain-containing proteins and identified TTLL12 as a negative regulator of RIG-I signaling. TTLL12 contains SET and TTL domains, which are predicted to have lysine methyltransferase and tubulin tyrosine ligase activities, respectively. Exogenous expression of TTLL12 represses IFN-β expression induced by Sendai virus. TTLL12 deficiency by RNA interference and CRISPR-gRNA techniques increases the induced IFN-β expression and inhibits virus replication in the cell. The global gene expression profiling indicated that TTLL12 specifically inhibits the expression of the downstream genes of innate immunity pathways. Cell fractionation and fluorescent staining indicated that TTLL12 is localized in the cytosol. The mutagenesis study suggested that TTLL12's ability to repress the RIG-I pathway is probably not dependent on protein modifications. Instead, TTLL12 directly interacts with virus-induced signaling adaptor (VISA), TBK1, and IKKε, and inhibits the interactions of VISA with other signaling molecules. Taken together, our findings demonstrate TTLL12 as a negative regulator of RNA-virus-induced type I IFN expression by inhibiting the interaction of VISA with other proteins. Copyright © 2017 by The American Association of Immunologists, Inc.
Hu, Jiaxin; Rong, Ziye; Gong, Xin; Zhou, Zhengyang; Sharma, Vivek K; Xing, Chao; Watts, Jonathan K; Corey, David R; Mootha, V Vinod
2018-03-15
Fuchs' endothelial corneal dystrophy (FECD) is the most common repeat expansion disorder. FECD impacts 4% of U.S. population and is the leading indication for corneal transplantation. Most cases are caused by an expanded intronic CUG tract in the TCF4 gene that forms nuclear foci, sequesters splicing factors and impairs splicing. We investigated the sense and antisense RNA landscape at the FECD gene and find that the sense-expanded repeat transcript is the predominant species in patient corneas. In patient tissue, sense foci number were negatively correlated with age and showed no correlation with sex. Each endothelial cell has ∼2 sense foci and each foci is single RNA molecule. We designed antisense oligonucleotides (ASOs) to target the mutant-repetitive RNA and demonstrated potent inhibition of foci in patient-derived cells. Ex vivo treatment of FECD human corneas effectively inhibits foci and reverses pathological changes in splicing. FECD has the potential to be a model for treating many trinucleotide repeat diseases and targeting the TCF4 expansion with ASOs represents a promising therapeutic strategy to prevent and treat FECD.
Zhao, Haiyan; Su, Wuyun; Kang, Qingmei; Xing, Ze; Lin, Xue; Wu, Zhongjun
2018-01-01
Natural killer (NK) cells have exhibited promising efficacy in inhibiting cancer growth. We aimed to explorer the effect of NK cells on oxaliplatin-resistant colorectal cancer and the underlying molecular mechanism. Oxaliplatin-resistant colorectal cancer cell lines were co-cultured with NK cells to evaluate the effect on viability, proliferation, migration and invasion in vitro . Oxaliplatin-resistant colorectal cancer cells were also co-injected with NK cells into mice to establish xenograft tumor model, to assess the in vivo effect of NK cells on tumorigenesis of the oxaliplatin-resistant colorectal cancer cells. Expression of WBSCR22 gene was assessed in the oxaliplatin-resistant colorectal cancer cells following NK cell treatment to elucidate the mechanism. NK cell treatment significantly reduces growth of oxaliplatin-resistant colorectal cancer cells both in vitro and in vivo , as well as reduced WBSCR22 expression. MicroRNAs potentially targeting WBSCR22 were analyzed, and microRNA-146b-5p was found to be significantly upregulated following NK cell treatment. MicroRNA-146b-5p directly targeted WBSCR22 mRNA 3'-UTR to inhibit its expression, which was required for NK cell-induced inhibition of oxaliplatin-resistant colorectal cancer cell lines. NK cells inhibit oxaliplatin-resistant colorectal cancer by repressing WBSCR22 via upregulating microRNA-146b-5p, both of which could serve as candidates for targeted therapy against oxaliplatin-resistant colorectal cancer.
MicroRNA-138 inhibits proliferation of cervical cancer cells by targeting c-Met.
Li, B; Yang, X-X; Wang, D; Ji, H-K
2016-01-01
MicroRNAs (miRNAs) function as important post-transcriptional regulators involved in a wide range of biological behaviors. MicroRNA-138 (miR-138) has been shown to play a critical role in tumor pathogenesis, the present study aimed to investigate the role of miR-138 in cervical cancer. CCK-8 assay was performed to measure the viabilities of cancer cells. Quantitative real-time PCR (qRT-PCR) and western blot were used to detect the mRNA and protein expression, respectively. Moreover, the miRNA target genes were validated with luciferase activity assay. In the current study, we found that the expression of miR-138 was significantly down-regulated in cervical cancer tissues compared to the adjacent non-cancer tissues. CCK-8 assay showed that over-expression of miR-138 suppressed the proliferation of four cervical cancer cell lines including HeLa, SiHa, C33A and CaSki. By contrast, down-regulation of miR-138 promoted the growth of cervical cancer cells. In addition, increased expression of miR-138 led to a reduction in c-Met expression, whereas inhibition of miR-138 enhanced c-Met levels in cervical cancer cells. The luciferase reporter assay showed that c-Met was a direct target of miR-138 in cervical cancer cells. These findings demonstrated that miR-138 inhibited cervical cancer cells proliferation via c-Met, providing a novel target for the molecular treatment of cervical cancer.
Tao, Zhi-Wei; Zou, Ping-An
2018-06-13
Osteosarcoma is a disease prone to recurrence and metastasis, and adenovirus expression vector is frequently studied as a therapeutic target of osteosarcoma in recent year. This study attempts to explore the effect of adenovirus-mediated small interfering RNA (siRNA) targeting ezrin on the proliferation, migration, invasion and apoptosis of human osteosarcoma MG-63 cells. Human osteosarcoma MG-63 cell line was selected for construction of recombinant adenovirus vector. The mRNA and protein levels of ezrin, Bcl2-associated X protein (Bax), B cell lymphoma-2 (Bcl-2), p21, p53, Caspase-3, matrix metalloproteinase 2 (MMP-2) and MMP-9, Cyclin D1, and cyclin-dependent kinase 4a (CDK4a) were determined. Through ELISA, the levels of Caspase-3, MMP-2 and MMP-9 were examined. Finally, human osteosarcoma MG-63 cell viability, growth, invasion, migration, and apoptosis were detected. Initially, adenovirus expression vector of ezrin was constructed by ezrin 2 siRNA sequence. Adenovirus-mediated siRNA targeting ezrin reduced expression of ezrin in MG-63 cells. The results revealed that adenovirus-mediated siRNA targeting ezrin elevated expression levels of Bax, P21, P53, and Caspase-3, Cyclin D1, and CDK4a and reduced expression levels of Bcl-2, MMP-2, and MMP-9. Furthermore, adenovirus-mediated siRNA targeting ezrin inhibited human osteosarcoma MG-63 cell viability, growth, invasion, and migration, and promoted apoptosis. Our study demonstrates that adenovirus-mediated siRNA targeting ezrin can induce apoptosis and inhibit the proliferation, migration and invasion of human osteosarcoma MG-63 cells. ©2018 The Author(s).
Soares, Emilie; Schwartz, Annie; Nollmann, Marcello; Margeat, Emmanuel; Boudvillain, Marc
2014-08-01
Rho is a ring-shaped, ATP-dependent RNA helicase/translocase that dissociates transcriptional complexes in bacteria. How RNA recognition is coupled to ATP hydrolysis and translocation in Rho is unclear. Here, we develop and use a new combinatorial approach, called time-resolved Nucleotide Analog Interference Probing (trNAIP), to unmask RNA molecular determinants of catalytic Rho function. We identify a regulatory step in the translocation cycle involving recruitment of the 2'-hydroxyl group of the incoming 3'-RNA nucleotide by a Rho subunit. We propose that this step arises from the intrinsic weakness of one of the subunit interfaces caused by asymmetric, split-ring arrangement of primary RNA tethers around the Rho hexamer. Translocation is at highest stake every seventh nucleotide when the weak interface engages the incoming 3'-RNA nucleotide or breaks, depending on RNA threading constraints in the Rho pore. This substrate-governed, 'test to run' iterative mechanism offers a new perspective on how a ring-translocase may function or be regulated. It also illustrates the interest and versatility of the new trNAIP methodology to unveil the molecular mechanisms of complex RNA-based systems. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
MicroRNA-155 Inhibition Promoted Wound Healing in Diabetic Rats.
Ye, Junna; Kang, Yutian; Sun, Xiaofang; Ni, Pengwen; Wu, Minjie; Lu, Shuliang
2017-06-01
Diabetes leads to amputation in approximately 15% to 20% of patients and is associated with high morbidity and mortality. Thus, improving the quality of wound healing in this condition is essential. Diabetes is associated with acute/chronic inflammation affecting all organs especially the foot, while, inhibition of microRNA-155 (miR-155) has been reported to improve or reduce inflammatory situation. However, the role of miR-155 inhibition in promoting diabetic wound healing is not clear. To further study the potential benefit of miR-155 inhibition, a study of male Sprague-Dawley rats was conducted and diabetes was induced by injection of streptozotocin. Real-time polymerase chain reaction (PCR), hematoxylin and eosin staining and immunohistochemistry were then performed. The PCR results confirmed that miR-155 expression was lower after miR-155 inhibition on days 3, 7, and 13 (all Ps <.05). The wound healing rate between the normal glucose group (N group), diabetic PBS group (PBS group) and the topical miR-155 inhibitor group was compared. Faster healing of cutaneous wounds was observed in the miR-155 inhibitor group than in the PBS group and normal glucose group ( P < .05). In addition, downregulation of inflammatory cells, including neutrophils (MPO-positive) and macrophages (CD68-positive), and upregulation of the angiogenic protein CD31 and markers indicative of fibroblast proliferation and collagen deposition, such as collagen 1, TGF-β1, and α-SMA, were observed. These data permit the observation that miR-155 inhibition possesses the potential to reduce inflammation in acute wounds. This property may benefit the healing of diabetic foot wounds.
Pelliccia, Sveva; Wu, Yu-Hsuan; Coluccia, Antonio; La Regina, Giuseppe; Tseng, Chin-Kai; Famiglini, Valeria; Masci, Domiziana; Hiscott, John; Lee, Jin-Ching; Silvestri, Romano
2017-12-01
Dengue virus (DENV) is the leading mosquito-transmitted viral infection in the world. With more than 390 million new infections annually, and up to 1 million clinical cases with severe disease manifestations, there continues to be a need to develop new antiviral agents against dengue infection. In addition, there is no approved anti-DENV agents for treating DENV-infected patients. In the present study, we identified new compounds with anti-DENV replication activity by targeting viral replication enzymes - NS5, RNA-dependent RNA polymerase (RdRp) and NS3 protease, using cell-based reporter assay. Subsequently, we performed an enzyme-based assay to clarify the action of these compounds against DENV RdRp or NS3 protease activity. Moreover, these compounds exhibited anti-DENV activity in vivo in the ICR-suckling DENV-infected mouse model. Combination drug treatment exhibited a synergistic inhibition of DENV replication. These results describe novel prototypical small anti-DENV molecules for further development through compound modification and provide potential antivirals for treating DENV infection and DENV-related diseases.
Suppression of SOX18 by siRNA inhibits cell growth and invasion of breast cancer cells.
Zhang, Jianxiang; Ma, Yanmei; Wang, Shoujun; Chen, Fu; Gu, Yuanting
2016-06-01
Breast cancer is the most common malignancy in women around the world, and its incidence and mortality rates are still rising. An increasing number of studies have reported that SOX18 plays an important role in various cancers. However, the role of SOX18 in breast cancer remains poorly understood. In this study, we aimed to investigate the biological role and potential molecular mechanism of SOX18 in breast cancer. We found that the mRNA and protein expression levels of SOX18 were prevalently and significantly overexpressed in human breast cancer cell lines. Next, we performed loss-of-function experiments by transfection of two breast cancer cell lines, BT-474 and MCF-7, with SOX18 small interfering RNAs (siRNA). Results showed that SOX18 siRNA transfection significantly suppressed mRNA and protein expression of SOX18 in breast cancer cells. Furthermore, knockdown of SOX18 significantly inhibited cell proliferation and invasion, but promoted apoptosis in breast cancer cells. Importantly, several oncogenic proteins, including the Ras homolog gene family member A (RhoA), platelet-derived growth factor B (PDGFB), Insulin-like growth factor 1 receptor (IGF-1R), and matrix metalloproteinase-7 (MMP-7), were markedly decreased by SOX18 siRNA. Taken together, the results of our study suggest that knockdown of SOX18 inhibits breast cancer cell growth and invasion, possibly by downregulating downstream oncogenic proteins, providing novel insights into the development of breast cancer therapy through targeting of SOX18.
Compositions and Methods for Inhibiting Gene Expressions
NASA Technical Reports Server (NTRS)
Williams, Loren D. (Inventor); Hsiao, Chiaolong (Inventor); Fang, Po-Yu (Inventor); Williams, Justin (Inventor)
2018-01-01
A combined packing and assembly method that efficiently packs ribonucleic acid (RNA) into virus like particles (VLPs) has been developed. The VLPs can spontaneously assemble and load RNA in vivo, efficiently packaging specifically designed RNAs at high densities and with high purity. In some embodiments the RNA is capable of interference activity, or is a precursor of a RNA capable of causing interference activity. Compositions and methods for the efficient expression, production and purification of VLP-RNAs are provided. VLP-RNAs can be used for the storage of RNA for long periods, and provide the ability to deliver RNA in stable form that is readily taken up by cells.
Interference of allelopathic rice with penoxsulam-resistant barnyardgrass.
Yang, Xue-Fang; Kong, Chui-Hua; Yang, Xia; Li, Yong-Feng
2017-11-01
Despite increasing knowledge of allelopathic rice interference with barnyardgrass, relatively little is known about its action on herbicide-resistant barnyardgrass. The incidence of herbicide-resistant barnyardgrass is escalating in paddy fields. Knowledge of the interference of allelopathic rice with herbicide-resistant barnyardgrass and the potential mechanisms involved is warranted. Penoxsulam-resistant and -susceptible barnyardgrass biotypes were identified and segregated from a putative penoxsulam-resistant population occurring in paddy fields in China. Allelopathic rice inhibited the growth of barnyardgrass roots more than shoots, regardless of biotype. In particular, there was a stronger inhibition for resistant barnyardgrass than for susceptible barnyardgrass. Allelopathic rice significantly reduced total root length, total root area, maximum root amplitude and maximum root depth in barnyardgrass. Furthermore, the rice allelochemicals tricin and momilactone B inhibited the growth of both resistant and susceptible barnyardgrass. Compared with root contact, root segregation significantly increased inhibition of barnyardgrass with an increase in rice allelochemicals. Root exudates from barnyardgrass induced the production of rice allelochemicals, but the effect of susceptible barnyardgrass was much stronger than that of resistant barnyardgrass. Allelopathic rice can interfere with the growth of penoxsulam-resistant barnyardgrass through allelochemical-mediated root interactions. This type of allelopathic interference may provide a non-herbicidal alternative for herbicide-resistant weed management in paddy systems. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Carneiro, Joyce S; de la Bastide, Paul Y; Chabot, Meghan; Lerch, Lindsey; Hintz, William E
2010-05-01
The fungal pathogen, Ophiostomo novo-ulmi, has been responsible for the rapid decline of American elm (Ulmus americana) across North America and remains a serious threat to surviving elm populations. The production of pectinolytic polygalacturonase enzymes has been implicated as a virulence factor for many fungal pathogens, including O. novo-ulmi. Previous work has shown that the targeted disruption of the endopolygalacturonase gene locus epg1 of O. novo-ulmi reduced, but did not eliminate pectinase activity. In the present study, we evaluated the use of RNA interference (RNAi) as a method of suppressing expression of the epg1 locus in O. novo-ulmi and compared its efficiency to the gene disruption method. While there was a reduction in epg1-specific mRNA transcripts and in the amount of polygalacturonase enzyme secreted for both methods of gene regulation, neither method completely suppressed the expression of pectinase activity. There was, however, a significantly greater reduction in both transcript levels and secreted enzyme observed for some of the RNAi transformants. As the first demonstration of RNAi in O. novo-ulmi, this method of gene regulation shows promise in future studies of gene expression and pathogenicity. Copyright 2010 Elsevier Inc. All rights reserved.
Runo, Steven; Alakonya, Amos; Machuka, Jesse; Sinha, Neelima
2011-02-01
Biological crop pests cause serious economic losses. In Africa, the most prevalent parasites are insect pests, plant pathogenic root-knot nematodes, viruses and parasitic plants. African smallholder farmers struggle to overcome these parasitic constraints to agricultural production. Crop losses and the host range of these parasites have continued to increase in spite of the use of widely advocated control methods. A sustainable method to overcome biological pests in Africa would be to develop crop germplasm resistant to parasites. This is achievable using either genetic modification (GM) or a non-GM approach. However, there is a paucity of resistant genes available for introduction. Additionally, the biological processes underpinning host parasite resistance are not sufficiently well understood. The authors review a technology platform for using RNA-mediated interference (RNAi) as bioengineered resistance to important crop parasites in Africa. To achieve acquired resistance, a host crop is stably transformed with a transgene that encodes a hairpin RNA targeting essential parasitic genes. The RNAi sequence is chosen in such a way that it shares no homology with the host's genes, so it remains 'inactive' until parasitism. Upon parasitism, the RNAi sequence enters the parasite and post-transcriptional gene silencing (PTGS) mechanisms are activated, leading to the death of the parasite. Copyright © 2010 Society of Chemical Industry.
Delfosse, Verónica C; Agrofoglio, Yamila C; Casse, María F; Kresic, Iván Bonacic; Hopp, H Esteban; Ziegler-Graff, Véronique; Distéfano, Ana J
2014-02-13
Plants employ RNA silencing as a natural defense mechanism against viruses. As a counter-defense, viruses encode silencing suppressor proteins (SSPs) that suppress RNA silencing. Most, but not all, the P0 proteins encoded by poleroviruses have been identified as SSP. In this study, we demonstrated that cotton leafroll dwarf virus (CLRDV, genus Polerovirus) P0 protein suppressed local silencing that was induced by sense or inverted repeat transgenes in Agrobacterium co-infiltration assay in Nicotiana benthamiana plants. A CLRDV full-length infectious cDNA clone that is able to infect N. benthamiana through Agrobacterium-mediated inoculation also inhibited local silencing in co-infiltration assays, suggesting that the P0 protein exhibits similar RNA silencing suppression activity when expressed from the full-length viral genome. On the other hand, the P0 protein did not efficiently inhibit the spread of systemic silencing signals. Moreover, Northern blotting indicated that the P0 protein inhibits the generation of secondary but not primary small interfering RNAs. The study of CLRDV P0 suppression activity may contribute to understanding the molecular mechanisms involved in the induction of cotton blue disease by CLRDV infection. Copyright © 2013 Elsevier B.V. All rights reserved.
Dong, Yong-Cheng; Wang, Zhi-Jian; Chen, Zhen-Zhong; Clarke, Anthony R.; Niu, Chang-Ying
2016-01-01
RNA interference (RNAi) is a genetic technique which has novel application for sustainable pest control. The Sterile Insect Technique (SIT) uses releases of mass-produced, sterile male insects to out-compete wild males for mates to reduce pest populations. RNAi sterilization of SIT males would have several advantages over radiation sterilization, but to achieve this appropriate target genes must first be identified and then targeted with interference technology. With this goal, eight spermatogenesis related candidate genes were cloned and tested for potential activity in Bactrocera dorsalis. The knockdown of candidate genes by oral delivery of dsRNAs did not influence the mating of male flies, but significantly affected the daily average number of eggs laid by females, and reduced egg hatching rate by 16–60%. RNAi negatively affected spermatozoa quantitatively and qualitatively. Following the mating of lola-/topi-/rac-/rho-/upd-/magu-silenced males, we recorded a significant decrease in number and length of spermatozoa in female spermatheca compared to gfp-silenced control group. In a greenhouse trial, the number of damaged oranges and B. dorsalis larvae were significantly reduced in a dsrho-treated group compared with the dsgfp group. This study provides strong evidence for the use RNAi in pest management, especially for the improvement of SIT against B. dorsalis and other species. PMID:27767174
Chan, Jason C K; Erdman, Matthew R; Davis, Sara D
2015-09-01
The mechanism responsible for retrieval-induced forgetting has been the subject of rigorous theoretical debate, with some researchers postulating that retrieval-induced forgetting can be explained by interference (J. G .W. Raaijmakers & E. Jakab, 2013) or context reinstatement (T. R. Jonker, P. Seli, & C. M. MacLeod, 2013), whereas others claim that retrieval-induced forgetting is better explained by inhibition (M. C. Anderson, 2003). A fundamental assumption of the inhibition account is that nonpracticed items are suppressed because they compete for retrieval during initial testing. In the current study, we manipulated competition in a novel interpolated testing paradigm by having subjects learn the nonpracticed items either before (high-competition condition) or after (low-competition condition) they practiced retrieval of the target items. We found retrieval-induced forgetting for the nonpracticed competitors only when they were studied before retrieval practice. This result provides support for a critical assumption of the inhibition account. (c) 2015 APA, all rights reserved).
Small Molecule Inhibition of microRNA-210 Reprograms an Oncogenic Hypoxic Circuit.
Costales, Matthew G; Haga, Christopher L; Velagapudi, Sai Pradeep; Childs-Disney, Jessica L; Phinney, Donald G; Disney, Matthew D
2017-03-08
A hypoxic state is critical to the metastatic and invasive characteristics of cancer. Numerous pathways play critical roles in cancer maintenance, many of which include noncoding RNAs such as microRNA (miR)-210 that regulates hypoxia inducible factors (HIFs). Herein, we describe the identification of a small molecule named Targapremir-210 that binds to the Dicer site of the miR-210 hairpin precursor. This interaction inhibits production of the mature miRNA, derepresses glycerol-3-phosphate dehydrogenase 1-like enzyme (GPD1L), a hypoxia-associated protein negatively regulated by miR-210, decreases HIF-1α, and triggers apoptosis of triple negative breast cancer cells only under hypoxic conditions. Further, Targapremir-210 inhibits tumorigenesis in a mouse xenograft model of hypoxic triple negative breast cancer. Many factors govern molecular recognition of biological targets by small molecules. For protein, chemoproteomics and activity-based protein profiling are invaluable tools to study small molecule target engagement and selectivity in cells. Such approaches are lacking for RNA, leaving a void in the understanding of its druggability. We applied Chemical Cross-Linking and Isolation by Pull Down (Chem-CLIP) to study the cellular selectivity and the on- and off-targets of Targapremir-210. Targapremir-210 selectively recognizes the miR-210 precursor and can differentially recognize RNAs in cells that have the same target motif but have different expression levels, revealing this important feature for selectively drugging RNAs for the first time. These studies show that small molecules can be rapidly designed to selectively target RNAs and affect cellular responses to environmental conditions, resulting in favorable benefits against cancer. Further, they help define rules for identifying druggable targets in the transcriptome.
TLR3 dsRNA agonist inhibits growth and invasion of HepG2.2.15 HCC cells.
Chen, Li; Xu, Yu-Yin; Zhou, Jia-Ming; Wu, Yuan-Yuan; E, Qun; Zhu, Yuan-Yuan
2012-07-01
Toll-like receptor 3 (TLR3) is a pattern-recognizing receptor that is involved in immune signaling and plays a crucial role in survival by being able to recognize various viral components including double-stranded RNA (dsRNA). TLR3 expression and function in cancer cells are not well understood. In this study, we investigated whether TLR3 agonist dsRNA (BM-06) can inhibit proliferation and invasion, and promote apoptosis in HepG2.2.15 cells. HepG2.2.15 cells secreting hepatitis B virus (HBV) were treated with BM-06 and poly(I:C). Western blot analysis and PCR were employed to determine pharmacodynamic changes in biomarkers relevant to TLR3 signaling. Cell proliferation, invasion and apoptosis were analyzed by CCK-8 assay, transwell assay and flow cytometry. The expression of HBsAg, and HBcAg was observed by immunohistochemistry. Compared with untreated cells, pharmacological NF-κB activity of the TLR3 pathway by BM-06 (1.734-fold) or poly(I:C) (1.377-fold) was induced. By western blot analysis, we found that dsRNA induced TLR3-activated HepG2.2.15 cells which expressed NF-κB levels predominantly in the cytoplasmic fraction but fewer signals in the nucleus. BM-06 inhibited the proliferation, invasion and secretion of HBV, and induced apoptosis in HepG2.2.15 cells. In addition, the antitumor effects of BM-06 were superior to poly(I:C). Pharmacological activation of the TLR3 pathway by BM-06 can inhibit HepG2.2.15 cell growth.
Li, Lin-Yong; Xiao, Jie; Liu, Qiang; Xia, Kun
2017-03-15
Glioblastoma (GBM) is one of the most lethal brain cancers worldwide, and there is an urgent need for development of novel therapeutic approaches. Parecoxib is a well-known cyclooxygenase-2 (COX-2) inhibitor, and had already been developed for postoperative analgesia with high efficacy and low adverse reaction. A recent study has suggested that parecoxib potently enhances immunotherapeutic efficacy of GBM, but its effects on GBM growth, migration and invasion have not previously been studied. In the present study, MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] and BrdU (5-bromo-2-deoxyuridine) incorporation assays were used to evaluate the cell proliferation of GBM cells. Wound-healing and transwell assays were preformed to analyze GBM cell migration and invasion, respectively. The results suggested that parecoxib inhibits cell proliferation, migration and invasion of GBM cells in a dose-dependent manner. RT-qPCR (real-time quantitative PCR) analysis demonstrated that miRNA-29c can be significantly induced by parecoxib. Furthermore, our data suggests that a miRNA-29c inhibitor can significantly attenuate parecoxib's effect on proliferation, migration and invasion of GBM. In conclusion, the present study suggests that parecoxib inhibits GBM cell proliferation, migration and invasion by upregulating miRNA-29c. © 2017. Published by The Company of Biologists Ltd.
Cui, Wei; Yoneda, Ryoma; Ueda, Naomi; Kurokawa, Riki
2018-05-21
Translocated in liposarcoma (TLS) is an RNA-binding protein and a transcription-regulatory sensor of DNA damage. TLS binds promoter-associated noncoding RNA (pncRNA) and inhibits histone acetyltransferase (HAT) activity of CREB-binding protein (CBP)/E1A-binding protein P300 (p300) on the cyclin D1 (CCND1) gene. Although post-translational modifications of TLS, such as arginine methylation, are known to regulate TLS's nucleocytoplasmic shuttling and assembly in stress granules, its interactions with RNAs remain poorly characterized. Herein, using various biochemical assays, we confirmed the earlier observations that TLS is methylated by protein arginine methyltransferase 1 (PRMT1) in vitro. The arginine methylation of TLS disrupted binding to pncRNA and also prevented binding of TLS to and inhibition of CBP/p300. This result indicated that arginine methylation of TLS abrogates both binding to pncRNA and TLS-mediated inhibition of CBP/p300 HAT activities. We also report that an arginine residue within the Arg-Gly-Gly domain of TLS, Arg-476, serves as the major determinant for binding to pncRNA. Either methylation or mutation of Arg-476 of TLS significantly decreased pncRNA binding and thereby prevented a pncRNA-induced allosteric alteration in TLS that is required for its interaction with CBP/p300. Moreover, unlike wildtype TLS, an R476A TLS mutant did not inhibit CCND1 promoter activity in luciferase reporter assays. Taken together, we propose the hypothesis that arginine methylation of TLS regulates both TLS-nucleic acid and TLS-protein interactions and thereby participates in transcriptional regulation. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.
Saito, Yuki; Mao, Han; Sekimizu, Kazuhisa; Kaito, Chikara
2014-01-01
Staphylococcal species acquire antibiotic resistance by incorporating the mobile-genetic element SCCmec. We previously found that SCCmec-encoded psm-mec RNA suppresses exotoxin production as a regulatory RNA, and the psm-mec translation product increases biofilm formation in Staphylococcus aureus. Here, we examined whether the regulatory role of psm-mec on host bacterial virulence properties is conserved among other staphylococcal species, S. epidermidis and S. haemolyticus, both of which are important causes of nosocomial infections. In S. epidermidis, introduction of psm-mec decreased the production of cytolytic toxins called phenol-soluble modulins (PSMs) and increased biofilm formation. Introduction of psm-mec with a stop-codon mutation that did not express PSM-mec protein but did express psm-mec RNA also decreased PSM production, but did not increase biofilm formation. Thus, the psm-mec RNA inhibits PSM production, whereas the PSM-mec protein increases biofilm formation in S. epidermidis. In S. haemolyticus, introduction of psm-mec decreased PSM production, but did not affect biofilm formation. The mutated psm-mec with a stop-codon also caused the same effect. Thus, the psm-mec RNA also inhibits PSM production in S. haemolyticus. These findings suggest that the inhibitory role of psm-mec RNA on exotoxin production is conserved among staphylococcal species, although the stimulating effect of the psm-mec gene on biofilm formation is not conserved. PMID:24926994
Leroux, Gaëlle; Joliot, Marc; Dubal, Stéphanie; Mazoyer, Bernard; Tzourio-Mazoyer, Nathalie; Houdé, Olivier
2006-06-01
We sought to determine whether the neural traces of a previous cognitive developmental stage could be evidenced in young adults. In order to do so, 12 young adults underwent two functional imaging acquisitions (EEG then fMRI). During each session, two experimental conditions were applied: a Piaget-like task with number/length interference (INT), and a reference task with number/length covariation (COV). To succeed at Piaget's numerical task, which children under the age of 7 years usually fail, the subjects had to inhibit a misleading strategy, namely, the visuospatial length-equals-number bias, a quantification heuristic that is often relevant and that continues to be used through adulthood. Behavioral data confirmed that although there was an automation in the young adult subjects as assessed by the very high number of accurate responses (>97%), the inhibition of the "length equals number strategy" had a cognitive cost, as the reaction times were significantly higher in INT than in COV (with a difference of 230 ms). The event-related potential results acquired during the first session showed electrophysiological markers of the cognitive inhibition of the number/length interference. Indeed, the frontal N2 was greater during INT than during COV, and a P3(late)/P6 was detected only during INT. During the fMRI session, a greater activation of unimodal areas (the right middle and superior occipital cortex) and in the ventral route (the left inferior temporal cortex) was observed in INT than in COV. These results seem to indicate that when fully automated in adults, inhibition processes might take place in unimodal areas. Copyright 2005 Wiley-Liss, Inc.
Expression of the proto-oncogene Pokemon in colorectal cancer--inhibitory effects of an siRNA.
Zhao, Gan-Ting; Yang, Li-Juan; Li, Xi-Xia; Cui, Hui-Lin; Guo, Rui
2013-01-01
This study aimed to investigate expression of the proto-oncogene POK erythroid myeloid ontogenic factor (Pokemon) in colorectal cancer (CRC), and assess inhibitory effects of a small interference RNA (siRNA) expression vector in SW480 and SW620 cells. Semi-quantitative reverse transcription-polymerase chain reaction (PCR) and immunohistochemistry were performed to determine mRNA and protein expression levels of Pokemon in CRC tissues. Indirect immunofluorescence staining was applied to investigate the location of Pokemon in SW480 and SW620 cells. The siRNA expression vectors that were constructed to express a short hairpin RNA against Pokemon were transfected to the SW480 and SW620 cells with a liposome. Expression levels of Pokemon mRNA and protein were examined by real-time quantitative-fluorescent PCR and western blot analysis. The effects of Pokemon silencing on proliferation of SW480 and SW620 cells were evaluated with reference to growth curves with MTT assays. The mRNA expression level of Pokemon in tumor tissues (0.845 ± 0.344) was significantly higher than that in adjacent tumor specimens (0.321 ± 0.197). The positive expression ratio of Pokemon protein in CRC (87.0%) was significantly higher than that in the adjacent tissues (19.6%). Strong fluorescence staining of Pokemon protein was observed in the cytoplasm of the SW480 and SW620 cells. The inhibition ratios of Pokemon mRNA and protein in the SW480 cells were 83.1% and 73.5% at 48 and 72 h, respectively, compared with those of the negative control cells with the siRNA. In the SW620 cells, the inhibition ratios of Pokemon mRNA and protein were 76.3% and 68.7% at 48 and 72 h, respectively. MTT showed that Pokemon gene silencing inhibited the proliferation of SW480 and SW620 cells. Overexpression of Pokemon in CRC may have a function in carcinogenesis and progression. siRNA expression vectors could effectively inhibit mRNA and protein expression of Pokemon in SW480 and SW620 cells, thereby reducing
Versatile RNA Interference Nanoplatform for Systemic Delivery of RNAs
2015-01-01
Development of nontoxic, tumor-targetable, and potent in vivo RNA delivery systems remains an arduous challenge for clinical application of RNAi therapeutics. Herein, we report a versatile RNAi nanoplatform based on tumor-targeted and pH-responsive nanoformulas (NFs). The NF was engineered by combination of an artificial RNA receptor, Zn(II)-DPA, with a tumor-targetable and drug-loadable hyaluronic acid nanoparticle, which was further modified with a calcium phosphate (CaP) coating by in situ mineralization. The NF can encapsulate small-molecule drugs within its hydrophobic inner core and strongly secure various RNA molecules (siRNAs, miRNAs, and oligonucleotides) by utilizing Zn(II)-DPA and a robust CaP coating. We substantiated the versatility of the RNAi nanoplatform by demonstrating effective delivery of siRNA and miRNA for gene silencing or miRNA replacement into different human types of cancer cells in vitro and into tumor-bearing mice in vivo by intravenous administration. The therapeutic potential of NFs coloaded with an anticancer drug doxorubicin (Dox) and multidrug resistance 1 gene target siRNA (siMDR) was also demonstrated in this study. NFs loaded with Dox and siMDR could successfully sensitize drug-resistant OVCAR8/ADR cells to Dox and suppress OVCAR8/ADR tumor cell proliferation in vitro and tumor growth in vivo. This gene/drug delivery system appears to be a highly effective nonviral method to deliver chemo- and RNAi therapeutics into host cells. PMID:24779637
Deas, Tia S; Binduga-Gajewska, Iwona; Tilgner, Mark; Ren, Ping; Stein, David A; Moulton, Hong M; Iversen, Patrick L; Kauffman, Elizabeth B; Kramer, Laura D; Shi, Pei-Yong
2005-04-01
RNA elements within flavivirus genomes are potential targets for antiviral therapy. A panel of phosphorodiamidate morpholino oligomers (PMOs), whose sequences are complementary to RNA elements located in the 5'- and 3'-termini of the West Nile (WN) virus genome, were designed to anneal to important cis-acting elements and potentially to inhibit WN infection. A novel Arg-rich peptide was conjugated to each PMO for efficient cellular delivery. These PMOs exhibited various degrees of antiviral activity upon incubation with a WN virus luciferase-replicon-containing cell line. Among them, PMOs targeting the 5'-terminal 20 nucleotides (5'End) or targeting the 3'-terminal element involved in a potential genome cyclizing interaction (3'CSI) exhibited the greatest potency. When cells infected with an epidemic strain of WN virus were treated with the 5'End or 3'CSI PMO, virus titers were reduced by approximately 5 to 6 logs at a 5 muM concentration without apparent cytotoxicity. The 3'CSI PMO also inhibited mosquito-borne flaviviruses other than WN virus, and the antiviral potency correlated with the conservation of the targeted 3'CSI sequences of specific viruses. Mode-of-action analyses showed that the 5'End and 3'CSI PMOs suppressed viral infection through two distinct mechanisms. The 5'End PMO inhibited viral translation, whereas the 3'CSI PMO did not significantly affect viral translation but suppressed RNA replication. The results suggest that antisense PMO-mediated blocking of cis-acting elements of flavivirus genomes can potentially be developed into an anti-flavivirus therapy. In addition, we report that although a full-length WN virus containing a luciferase reporter (engineered at the 3' untranslated region of the genome) is not stable, an early passage of this reporting virus can be used to screen for inhibitors against any step of the virus life cycle.
Popik, Waldemar; Khatua, Atanu; Hildreth, James E K; Lee, Benjamin; Alcendor, Donald J
2018-06-01
Zika virus (ZIKV) infection has been associated with microcephaly in infants. Currently there is no treatment or vaccine. Here we explore the use of a morpholino oligonucleotide targeted to the 5' untranslated region (5'-UTR) of the ZIKV RNA to prevent ZIKV replication. Morpholino DWK-1 inhibition of ZIKV replication in human glomerular podocytes was examined by qRT-PCR, reduction in ZIKV genome copy number, western blot analysis, immunofluorescence and proinflammatory cytokine gene expression. Podocytes pretreated with DWK-1 showed reduced levels of both viral mRNA and ZIKV E protein expression compared to controls. We observed suppression in proinflammatory gene expression for IFN-β (interferon β) RANTES (regulated on activation, normal T cell expressed and secreted), MIP-1α (macrophage inflammatory protein-1α), TNF-α (tumor necrosis factor-α) and IL1-α (interleukin 1-α) in ZIKV-infected podocytes pretreated with DWK-1. Morpholino DWK-1 targeting the ZIKV 5'-UTR effectively inhibits ZIKV replication and suppresses ZIKV-induced proinflammatory gene expression. Copyright © 2018 Elsevier Inc. All rights reserved.
Xiang, Jinhua; McLinden, James H.; Rydze, Robert A.; Chang, Qing; Kaufman, Thomas M.; Klinzman, Donna; Stapleton, Jack T.
2013-01-01
Viral infections alter host cell homeostasis and this may lead to immune evasion and/or interfere with the replication of other microbes in coinfected hosts. Two flaviviruses are associated with a reduction in HIV replication or improved survival in HIV-infected people (dengue virus (DV) and GB virus type C (GBV-C)). GBV-C infection and expression of the GBV-C nonstructural protein 5A (NS5A) and the DV NS5 protein in CD4+ T cells inhibit HIV replication in vitro. To determine whether the inhibitory effect on HIV replication is conserved among other flaviviruses and to characterize mechanism(s) of HIV inhibition, the NS5 proteins of GBV-C, DV, hepatitis C virus, West Nile virus, and yellow fever virus (YFV; vaccine strain 17D) were expressed in CD4+ T cells. All NS5 proteins inhibited HIV replication. This correlated with decreased steady-state CD4 mRNA levels and reduced cell surface CD4 protein expression. Infection of CD4+ T cells and macrophages with YFV (17D vaccine strain) also inhibited HIV replication and decreased CD4 gene expression. In contrast, mumps virus was not inhibited by the expression of flavivirus NS5 protein or by YFV infection, and mumps infection did not alter CD4 mRNA or protein levels. In summary, CD4 gene expression is decreased by all human flavivirus NS5 proteins studied. CD4 regulation by flaviviruses may interfere with innate and adaptive immunity and contribute to in vitro HIV replication inhibition. Characterization of the mechanisms by which flaviviruses regulate CD4 expression may lead to novel therapeutic strategies for HIV and immunological diseases. PMID:19923460
Muddashetty, Ravi S.; Nalavadi, Vijayalaxmi C.; Gross, Christina; Yao, Xiaodi; Xing, Lei; Laur, Oskar; Warren, Stephen T.; Bassell, Gary J.
2011-01-01
Summary The molecular mechanism how RISC and microRNAs selectively and reversibly regulate mRNA translation in response to receptor signaling is unknown but could provide a means for temporal and spatial control of translation. Here we show that miR-125a targeting PSD-95 mRNA allows reversible inhibition of translation and regulation by mGluR signaling. Inhibition of miR-125a increased PSD-95 levels in dendrites and altered dendritic spine morphology. Bidirectional control of PSD-95 expression depends on miR-125a and FMRP phosphorylation status. miR-125a levels at synapses and its association with AGO2 is reduced in Fmr1 KO. FMRP phosphorylation promotes the formation of an AGO2-miR-125a inhibitory complex on PSD-95 mRNA, whereas mGluR signaling of translation requires FMRP dephosphorylation and release of AGO2 from the mRNA. These findings reveal a novel mechanism whereby FMRP phosphorylation provides a reversible switch for AGO2 and microRNA to selectively regulate mRNA translation at synapses in response to receptor activation. PMID:21658607
Coliphage HK022 Nun protein inhibits RNA polymerase translocation
Vitiello, Christal L.; Kireeva, Maria L.; Lubkowska, Lucyna; Kashlev, Mikhail; Gottesman, Max
2014-01-01
The Nun protein of coliphage HK022 arrests RNA polymerase (RNAP) in vivo and in vitro at pause sites distal to phage λ N-Utilization (nut) site RNA sequences. We tested the activity of Nun on ternary elongation complexes (TECs) assembled with templates lacking the λ nut sequence. We report that Nun stabilizes both translocation states of RNAP by restricting lateral movement of TEC along the DNA register. When Nun stabilized TEC in a pretranslocated register, immediately after NMP incorporation, it prevented binding of the next NTP and stimulated pyrophosphorolysis of the nascent transcript. In contrast, stabilization of TEC by Nun in a posttranslocated register allowed NTP binding and nucleotidyl transfer but inhibited pyrophosphorolysis and the next round of forward translocation. Nun binding to and action on the TEC requires a 9-bp RNA–DNA hybrid. We observed a Nun-dependent toe print upstream to the TEC. In addition, mutations in the RNAP β′ subunit near the upstream end of the transcription bubble suppress Nun binding and arrest. These results suggest that Nun interacts with RNAP near the 5′ edge of the RNA–DNA hybrid. By stabilizing translocation states through restriction of TEC lateral mobility, Nun represents a novel class of transcription arrest factors. PMID:24853501
Alexiadis, Anastasios; Delidakis, Christos; Kalantidis, Kriton
2017-07-01
The conserved 3'-5' RNA exonuclease ERI1 is implicated in RNA interference inhibition, 5.8S rRNA maturation and histone mRNA maturation and turnover. The single ERI1 homologue in Drosophila melanogaster Snipper (Snp) is a 3'-5' exonuclease, but its in vivo function remains elusive. Here, we report Snp requirement for normal Drosophila development, since its perturbation leads to larval arrest and tissue-specific downregulation results in abnormal tissue development. Additionally, Snp directly interacts with histone mRNA, and its depletion results in drastic reduction in histone transcript levels. We propose that Snp protects the 3'-ends of histone mRNAs and upon its absence, histone transcripts are readily degraded. This in turn may lead to cell cycle delay or arrest, causing growth arrest and developmental perturbations. © 2017 Federation of European Biochemical Societies.
Scott, Jaclyn C.; Brackney, Doug E.; Campbell, Corey L.; Bondu-Hawkins, Virginie; Hjelle, Brian; Ebel, Greg D.; Olson, Ken E.; Blair, Carol D.
2010-01-01
The exogenous RNA interference (RNAi) pathway is an important antiviral defense against arboviruses in mosquitoes, and virus-specific small interfering (si)RNAs are key components of this pathway. Understanding the biogenesis of siRNAs in mosquitoes could have important ramifications in using RNAi to control arbovirus transmission. Using deep sequencing technology, we characterized dengue virus type 2 (DENV2)-specific small RNAs produced during infection of Aedes aegypti mosquitoes and A. aegypti Aag2 cell cultures and compared them to those produced in the C6/36 Aedes albopictus cell line. We show that the size and mixed polarity of virus-specific small RNAs from DENV-infected A. aegypti cells indicate that they are products of Dicer-2 (Dcr2) cleavage of long dsRNA, whereas C6/36 cells generate DENV2-specific small RNAs that are longer and predominantly positive polarity, suggesting that they originate from a different small RNA pathway. Examination of virus-specific small RNAs after infection of the two mosquito cell lines with the insect-only flavivirus cell fusing agent virus (CFAV) corroborated these findings. An in vitro assay also showed that Aag2 A. aegypti cells are capable of siRNA production, while C6/36 A. albopictus cells exhibit inefficient Dcr2 cleavage of long dsRNA. Defective expression or function of Dcr2, the key initiator of the RNAi pathway, might explain the comparatively robust growth of arthropod-borne viruses in the C6/36 cell line, which has been used frequently as a surrogate for studying molecular interactions between arboviruses and cells of their mosquito hosts. PMID:21049014