Ethical Perspectives on RNA Interference Therapeutics
Ebbesen, Mette; Jensen, Thomas G.; Andersen, Svend; Pedersen, Finn Skou
2008-01-01
RNA interference is a mechanism for controlling normal gene expression which has recently begun to be employed as a potential therapeutic agent for a wide range of disorders, including cancer, infectious diseases and metabolic disorders. Clinical trials with RNA interference have begun. However, challenges such as off-target effects, toxicity and safe delivery methods have to be overcome before RNA interference can be considered as a conventional drug. So, if RNA interference is to be used therapeutically, we should perform a risk-benefit analysis. It is ethically relevant to perform a risk-benefit analysis since ethical obligations about not inflicting harm and promoting good are generally accepted. But the ethical issues in RNA interference therapeutics not only include a risk-benefit analysis, but also considerations about respecting the autonomy of the patient and considerations about justice with regard to the inclusion criteria for participation in clinical trials and health care allocation. RNA interference is considered a new and promising therapeutic approach, but the ethical issues of this method have not been greatly discussed, so this article analyses these issues using the bioethical theory of principles of the American bioethicists, Tom L. Beauchamp and James F. Childress. PMID:18612370
Compositions and Methods for Inhibiting Gene Expressions
NASA Technical Reports Server (NTRS)
Williams, Loren D. (Inventor); Hsiao, Chiaolong (Inventor); Fang, Po-Yu (Inventor); Williams, Justin (Inventor)
2018-01-01
A combined packing and assembly method that efficiently packs ribonucleic acid (RNA) into virus like particles (VLPs) has been developed. The VLPs can spontaneously assemble and load RNA in vivo, efficiently packaging specifically designed RNAs at high densities and with high purity. In some embodiments the RNA is capable of interference activity, or is a precursor of a RNA capable of causing interference activity. Compositions and methods for the efficient expression, production and purification of VLP-RNAs are provided. VLP-RNAs can be used for the storage of RNA for long periods, and provide the ability to deliver RNA in stable form that is readily taken up by cells.
Whitten, Miranda; Dyson, Paul
2017-03-01
Insight into animal biology and development provided by classical genetic analysis of the model organism Drosophila melanogaster was an incentive to develop advanced genetic tools for this insect. But genetic systems for the over one million other known insect species are largely undeveloped. With increasing information about insect genomes resulting from next generation sequencing, RNA interference is now the method of choice for reverse genetics, although it is constrained by the means of delivery of interfering RNA. A recent advance to ensure sustained delivery with minimal experimental intervention or trauma to the insect is to exploit commensal bacteria for symbiont-mediated RNA interference. This technology not only offers an efficient means for RNA interference in insects in laboratory conditions, but also has potential for use in the control of human disease vectors, agricultural pests and pathogens of beneficial insects. © 2017 WILEY Periodicals, Inc.
Using RNA interference to knock down the adhesion protein TES.
Griffith, Elen
2007-01-01
RNA interference (RNAi) is a specific and efficient method to knock down protein levels using small interfering RNAs (siRNAs), which target mRNA degradation. RNAi can be used in mammalian cell culture systems to target any protein of interest, and several studies have used this method to knock down adhesion proteins. We used siRNAs to knock down the levels of TES, a focal adhesion protein, in HeLa cells. We demonstrated knockdown of both TES mRNA and TES protein. Although total knockdown of TES was not achieved, the observed reduction in TES protein was sufficient to result in a cellular phenotype of reduced actin stress fibers.
Chemical modification: the key to clinical application of RNA interference?
Corey, David R.
2007-01-01
RNA interference provides a potent and specific method for controlling gene expression in human cells. To translate this potential into a broad new family of therapeutics, it is necessary to optimize the efficacy of the RNA-based drugs. As discussed in this Review, it might be possible to achieve this optimization using chemical modifications that improve their in vivo stability, cellular delivery, biodistribution, pharmacokinetics, potency, and specificity. PMID:18060019
Advance of RNA interference technique in Hemipteran insects.
Li, Jie; Wang, Xiaoping; Wang, Manqun; Ma, Weihua; Hua, Hongxia
2012-07-24
RNA interference (RNAi) suppressed the expression of the target genes by post transcriptional regulation and the double-stranded RNA (dsRNA) mediated gene silencing has been a conserved mechanism in many eukaryotes, which prompted RNAi to become a valuable tool for unveiling the gene function in many model insects. Recent research attested that RNAi technique can be also effective in downregulation target genes in Hemipteran insects. In this review, we collected the researches of utilizing RNAi technique in gene functional analysis in Hemipteran insects, highlighted the methods of dsRNA/siRNA uptake by insects and discussed the knock-down efficiency of these techniques. Although the RNA interference technique has drawbacks and obscure points, our primary goal of this review is try to exploit it for further discovering gene functions and pest control tactic in the Hemipteran insects. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.
Trojan Horse Strategy for Non-invasive Interference of Clock Gene in the Oyster Crassostrea gigas.
Payton, Laura; Perrigault, Mickael; Bourdineaud, Jean-Paul; Marcel, Anjara; Massabuau, Jean-Charles; Tran, Damien
2017-08-01
RNA interference is a powerful method to inhibit specific gene expression. Recently, silencing target genes by feeding has been successfully carried out in nematodes, insects, and small aquatic organisms. A non-invasive feeding-based RNA interference is reported here for the first time in a mollusk bivalve, the pacific oyster Crassostrea gigas. In this Trojan horse strategy, the unicellular alga Heterocapsa triquetra is the food supply used as a vector to feed oysters with Escherichia coli strain HT115 engineered to express the double-stranded RNA targeting gene. To test the efficacy of the method, the Clock gene, a central gene of the circadian clock, was targeted for knockout. Results demonstrated specific and systemic efficiency of the Trojan horse strategy in reducing Clock mRNA abundance. Consequences of Clock disruption were observed in Clock-related genes (Bmal, Tim1, Per, Cry1, Cry2, Rev.-erb, and Ror) and triploid oysters were more sensitive than diploid to the interference. This non-invasive approach shows an involvement of the circadian clock in oyster bioaccumulation of toxins produced by the harmful alga Alexandrium minutum.
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi) is one of the most powerful and extraordinarily-specific means by which to silence genes. The ability of RNAi to silence genes makes it possible to ascertain function from genomic data, thereby making it an excellent choice for target-site screening. To test the efficacy of...
USDA-ARS?s Scientific Manuscript database
Asian longhorned beetle (ALB), Anoplophora glabripennis, is a serious invasive forest pest in several countries including the United States, Canada, and Europe. RNA interference (RNAi)technology is being developed as a novel method for pest management. Here, we identified the ALB core RNAi genes in...
Next-generation libraries for robust RNA interference-based genome-wide screens
Kampmann, Martin; Horlbeck, Max A.; Chen, Yuwen; Tsai, Jordan C.; Bassik, Michael C.; Gilbert, Luke A.; Villalta, Jacqueline E.; Kwon, S. Chul; Chang, Hyeshik; Kim, V. Narry; Weissman, Jonathan S.
2015-01-01
Genetic screening based on loss-of-function phenotypes is a powerful discovery tool in biology. Although the recent development of clustered regularly interspaced short palindromic repeats (CRISPR)-based screening approaches in mammalian cell culture has enormous potential, RNA interference (RNAi)-based screening remains the method of choice in several biological contexts. We previously demonstrated that ultracomplex pooled short-hairpin RNA (shRNA) libraries can largely overcome the problem of RNAi off-target effects in genome-wide screens. Here, we systematically optimize several aspects of our shRNA library, including the promoter and microRNA context for shRNA expression, selection of guide strands, and features relevant for postscreen sample preparation for deep sequencing. We present next-generation high-complexity libraries targeting human and mouse protein-coding genes, which we grouped into 12 sublibraries based on biological function. A pilot screen suggests that our next-generation RNAi library performs comparably to current CRISPR interference (CRISPRi)-based approaches and can yield complementary results with high sensitivity and high specificity. PMID:26080438
2011-01-01
Background Sensitivity of cancer cells to recombinant arginine deiminase (rADI) depends on expression of argininosuccinate synthetase (AS), a rate-limiting enzyme in synthesis of arginine from citrulline. To understand the efficiency of RNA interfering of AS in sensitizing the resistant cancer cells to rADI, the down regulation of AS transiently and permanently were performed in vitro, respectively. Methods We studied the use of down-regulation of this enzyme by RNA interference in three human cancer cell lines (A375, HeLa, and MCF-7) as a way to restore sensitivity to rADI in resistant cells. The expression of AS at levels of mRNA and protein was determined to understand the effect of RNA interference. Cell viability, cell cycle, and possible mechanism of the restore sensitivity of AS RNA interference in rADI treated cancer cells were evaluated. Results AS DNA was present in all cancer cell lines studied, however, the expression of this enzyme at the mRNA and protein level was different. In two rADI-resistant cell lines, one with endogenous AS expression (MCF-7 cells) and one with induced AS expression (HeLa cells), AS small interference RNA (siRNA) inhibited 37-46% of the expression of AS in MCF-7 cells. ASsiRNA did not affect cell viability in MCF-7 which may be due to the certain amount of residual AS protein. In contrast, ASsiRNA down-regulated almost all AS expression in HeLa cells and caused cell death after rADI treatment. Permanently down-regulated AS expression by short hairpin RNA (shRNA) made MCF-7 cells become sensitive to rADI via the inhibition of 4E-BP1-regulated mTOR signaling pathway. Conclusions Our results demonstrate that rADI-resistance can be altered via AS RNA interference. Although transient enzyme down-regulation (siRNA) did not affect cell viability in MCF-7 cells, permanent down-regulation (shRNA) overcame the problem of rADI-resistance due to the more efficiency in AS silencing. PMID:21453546
Zhang, Qun; Shu, Fu-Li; Jiang, Yu-Feng; Huang, Xin-En
2015-01-01
In this study, influence caused by expression plasmids of connective tissue growth factor (CTGF) and tissue inhibitor of metalloproteinase-1 (TIMP-1) short hairpin RNA (shRNA) on mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII in hepatic tissue with hepatic fibrosis, a precancerous condition, in rats is analyzed. To screen and construct shRNA expression plasimid which effectively interferes RNA targets of CTGF and TIMP-1 in rats. 50 cleaning Wistar male rats are allocated randomly at 5 different groups after precancerous fibrosis models and then injection of shRNA expression plasimids. Plasmid psiRNA-GFP-Com (CTGF and TIMP-1 included), psiRNA-GFP-CTGF, psiRNA-GFP-TIMP-1 and psiRNA- DUO-GFPzeo of blank plasmid are injected at group A, B, C and D, respectively, and as model control group that none plasimid is injected at group E. In 2 weeks after last injection, to hepatic tissue at different groups, protein expression of CTGF, TIMP-1, procol-α1and PC III is tested by immunohistochemical method and,mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII is measured by real-time PCR. One-way ANOVA is used to comparison between-groups. Compared with model group, there is no obvious difference of mRNA expression among CTGF,TIMP-1,procol-α1,PC III and of protein expression among CTGF, TIMP-1, procol-α1, PC III in hepatic tissue at group injected with blank plasmid. Expression quantity of mRNA of CTGF, TIMP-1, procol-α1 and PCIII at group A, B and C decreases, protein expression of CTGF, TIMP-1, procol-α1, PC III in hepatic tissue is lower, where the inhibition of combination RNA interference group (group A) on procol-α1 mRNA transcription and procol-α1 protein expression is superior to that of single interference group (group B and C) (P<0.01 or P<0.05). RNA interference on CTGF and/or TIMP-1 is obviously a inhibiting factor for mRNA and protein expression of CTGF, TIMP-1, procol-α1 and PCIII. Combination RNA interference on genes of CTGF and TIMP-1 is superior to that of single RNA interference, and this could be a contribution for prevention of precancerous condition.
Yao, Juan; Zhang, Zhang; Deng, Zhenghua; Wang, Youqiang; Guo, Yongcan
2017-10-23
An isothermal, enzyme free, ultra-specific and ultra-sensitive protocol for electrochemical detection of miRNAs is proposed based on the toehold-mediated strand displacement reaction (SDR) and non-enzymatic catalytic hairpin reaction (CHA) recycling. The SDR was first triggered only in the presence of target miRNA and this process also affects other miRNA interferences having similar target sequences, thus guaranteeing a high discrimination factor and could be used in rare content miRNA detection with various amounts of interferences having similar target sequences. The output protector strand then triggered enzyme free CHA amplification and generates plenty of hairpin self-assembly products. This process in turn influences SDR equilibrium to move to the right and generates large amounts of protector output to ensure analysis sensitivity. Compared with traditional CHA, our proposed method greatly improved the signal to noise ratio and shows excellent performance in rare miRNA detection with miRNA analogue interference. Under the optimal experimental conditions and using square wave voltammetry, the established biosensor could detect target miRNA-21 down to 30 fM (S/N = 3) with a dynamic range from 100 fM to 2 nM, and discriminate rare target miRNA-21 from mismatched miRNA with high selectivity. This method holds great promise in miRNA detection from human cancer cell lines and would be a versatile and powerful tool for clinical molecular diagnostics.
Gene Silencing in Insect Cells Using RNAi.
Wu, Hsuan-Chen; March, John C; Bentley, William E
2016-01-01
A technique is described for synthesizing and transfecting double stranded RNA (dsRNA) for RNA interference (RNAi) in Sf-21 cell culture. Transfection with dsRNA only requires an hour and the cells usually recover within 12 h. Suggestions for designing dsRNA are included in the methods. Furthermore, websites are provided for rapid and effective dsRNA design. Three kits are essential for using the described methods: RNAqueous®-4PCR, Megascript™ T7 kit, and the Superscript™ III kit from Life Technologies, Inc.
Biochemical and Structural Studies of RNA Modification and Repair
ERIC Educational Resources Information Center
Chan, Chio Mui
2009-01-01
RNA modification, RNA interference, and RNA repair are important events in the cell. This thesis presents three projects related to these three fields. By using both biochemical and structural methods, we characterized enzymatic activities of pseudouridine synthase TruD, solved the structure of "A. aeolicus" GidA, and reconstituted a novel…
An RNA isolation system for plant tissues rich in secondary metabolites
2011-01-01
Background Secondary metabolites are reported to interfere with the isolation of RNA particularly with the recipes that use guanidinium-based salt. Such interference was observed in isolation of RNA with medicinal plants rheum (Rheum australe) and arnebia (Arnebia euchroma). A rapid and less cumbersome system for isolation of RNA was essential to facilitate any study related to gene expression. Findings An RNA isolation system free of guanidinium salt was developed that successfully isolated RNA from rheum and arnebia. The method took about 45 min and was successfully evaluated on twenty one tissues with varied secondary metabolites. The A260/280 ratio ranged between 1.8 - 2.0 with distinct 28 S and 18 S rRNA bands visible on a formaldehyde-agarose gel. Conclusions The present manuscript describes a rapid protocol for isolation of RNA, which works well with all the tissues examined so far. The remarkable feature was the success in isolation of RNA with those tissues, wherein the most commonly used methods failed. Isolated RNA was amenable to downstream applications such as reverse transcription-polymerase chain reaction (RT-PCR), differential display (DD), suppression subtractive hybridization (SSH) library construction, and northern hybridization. PMID:21443767
Basnet, Sanjay; Kamble, Shripat T
2018-05-01
Bed bugs are one the most troublesome household pests that feed primarily on human blood. RNA interference (RNAi) is currently being pursued as a potential tool for insect population management and has shown efficacy against some phytophagous insects. We evaluated the different techniques to deliver dsRNA specific to bed bug muscle actin (dsactin) into bed bugs. Initially, stability of dsRNA in human blood was studied to evaluate the feasibility of feeding method. Adult bed bugs were injected with dsRNA between last thoracic segment and first abdominal segment on the ventral side, with a dose of 0.2 µg dsactin per insect. In addition to injection, dsactin was mixed in acetone and treated topically in the abdomens of fifth stage nymphs. We found the quick degradation of dsRNA in blood. Injection of dsactin caused significant depletion of actin transcripts and substantial reduction in oviposition and lethality in female adults. Topically treated dsRNA in fifth stage nymphs had no effect on actin mRNA expression and survival. Our results demonstrated that injection is a reliable method of dsRNA delivery into bed bugs while topical treatment was not successful. This research provides an understanding on effective delivery methods of dsRNA into bed bugs for functional genomics research and feasibility of the RNAi based molecules for pest management purposes.
Singh, Aditi D.; Wong, Sylvia; Ryan, Calen P.; Whyard, Steven
2013-01-01
RNA interference has already proven itself to be a highly versatile molecular biology tool for understanding gene function in a limited number of insect species, but its widespread use in other species will be dependent on the development of easier methods of double-stranded RNA (dsRNA) delivery. This study demonstrates that RNA interference can be induced in the mosquito Aedes aegypti L. (Diptera: Culicidae) simply by soaking larvae in a solution of dsRNA for two hours. The mRNA transcripts for β-tubulin, chitin synthase-1 and -2, and heat shock protein 83 were reduced between 30 and 50% three days post-dsRNA treatment. The dsRNA was mixed with a visible dye to identify those individuals that fed on the dsRNA, and based on an absence of RNA interference in those individuals that contained no dye within their guts, the primary route of entry of dsRNA is likely through the gut epithelium. RNA interference was systemic in the insects, inducing measurable knock down of gene expression in tissues beyond the gut. Silencing of the β-tubulin and chitin synthase-1 genes resulted in reduced growth and/or mortality of the larvae, demonstrating the utility of dsRNA as a potential mosquito larvicide. Silencing of chitin synthase-2 did not induce mortality in the larvae, and silencing of heat shock protein 83 only induced mortality in the insects if they were subsequently subjected to a heat stress. Drosophila melanogaster Meigen (Diptera: Drosophilidae) larvae were also soaked in dsRNA designed to specifically target either their own β-tubulin gene, or that of A. aegypti, and significant mortality was only seen in larvae treated with dsRNA targeting their own gene, which suggests that dsRNA pesticides could be designed to be species-limited. PMID:24224468
Rouhana, Labib; Weiss, Jennifer A.; Forsthoefel, David J.; Lee, Hayoung; King, Ryan S.; Inoue, Takeshi; Shibata, Norito; Agata, Kiyokazu; Newmark, Phillip A.
2013-01-01
Background The ability to assess gene function is essential for understanding biological processes. Currently, RNA interference (RNAi) is the only technique available to assess gene function in planarians, in which it has been induced via injection of double-stranded RNA (dsRNA), soaking, or ingestion of bacteria expressing dsRNA. Results We describe a simple and robust RNAi protocol, involving in vitro synthesis of dsRNA that is fed to the planarians. Advantages of this protocol include the ability to produce dsRNA from any vector without subcloning, resolution of ambiguities in quantity and quality of input dsRNA, as well as time, and ease of application. We have evaluated the logistics of inducing RNAi in planarians using this methodology in careful detail, from the ingestion and processing of dsRNA in the intestine, to timing and efficacy of knockdown in neoblasts, germline, and soma. We also present systematic comparisons of effects of amount, frequency, and mode of dsRNA delivery. Conclusions This method gives robust and reproducible results and is amenable to high-throughput studies. Overall, this RNAi methodology provides a significant advance by combining the strengths of current protocols available for dsRNA delivery in planarians and has the potential to benefit RNAi methods in other systems. PMID:23441014
Symbiont-mediated RNA interference in insects
Whitten, Miranda M. A.; Facey, Paul D.; Del Sol, Ricardo; Fernández-Martínez, Lorena T.; Evans, Meirwyn C.; Mitchell, Jacob J.; Bodger, Owen G.
2016-01-01
RNA interference (RNAi) methods for insects are often limited by problems with double-stranded (ds) RNA delivery, which restricts reverse genetics studies and the development of RNAi-based biocides. We therefore delegated to insect symbiotic bacteria the task of: (i) constitutive dsRNA synthesis and (ii) trauma-free delivery. RNaseIII-deficient, dsRNA-expressing bacterial strains were created from the symbionts of two very diverse pest species: a long-lived blood-sucking bug, Rhodnius prolixus, and a short-lived globally invasive polyphagous agricultural pest, western flower thrips (Frankliniella occidentalis). When ingested, the manipulated bacteria colonized the insects, successfully competed with the wild-type microflora, and sustainably mediated systemic knockdown phenotypes that were horizontally transmissible. This represents a significant advance in the ability to deliver RNAi, potentially to a large range of non-model insects. PMID:26911963
Crook, Nathan C; Schmitz, Alexander C; Alper, Hal S
2014-05-16
Reduction of endogenous gene expression is a fundamental operation of metabolic engineering, yet current methods for gene knockdown (i.e., genome editing) remain laborious and slow, especially in yeast. In contrast, RNA interference allows facile and tunable gene knockdown via a simple plasmid transformation step, enabling metabolic engineers to rapidly prototype knockdown strategies in multiple strains before expending significant cost to undertake genome editing. Although RNAi is naturally present in a myriad of eukaryotes, it has only been recently implemented in Saccharomyces cerevisiae as a heterologous pathway and so has not yet been optimized as a metabolic engineering tool. In this study, we elucidate a set of design principles for the construction of hairpin RNA expression cassettes in yeast and implement RNA interference to quickly identify routes for improvement of itaconic acid production in this organism. The approach developed here enables rapid prototyping of knockdown strategies and thus accelerates and reduces the cost of the design-build-test cycle in yeast.
Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin
2018-01-01
RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccas e 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like ( Sil1 ), scavenger receptor class C ( Src ), and scavenger receptor class B ( Srb3 and Srb4 ) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean.
Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin
2018-01-01
RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccase 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like (Sil1), scavenger receptor class C (Src), and scavenger receptor class B (Srb3 and Srb4) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean. PMID:29773992
Killiny, Nabil; Kishk, Abdelaziz
2017-06-01
RNA interference (RNAi) is a powerful means to study functional genomics in insects. The delivery of dsRNA is a challenging step in the development of RNAi assay. Here, we describe a new delivery method to increase the effectiveness of RNAi in the Asian citrus psyllid Diaphorina citri. Bromophenol blue droplets were topically applied to fifth instar nymphs and adults on the ventral side of the thorax between the three pairs of legs. In addition to video recordings that showed sucking of the bromophenol blue by the stylets, dissected guts turned blue indicating that the uptake was through feeding. Thus, we called the method topical feeding. We targeted the abnormal wing disc gene (awd), also called nucleoside diphosphate kinase (NDPK), as a reporter gene to prove the uptake of dsRNA via this method of delivery. Our results showed that dsRNA-awd caused reduction of awd expression and nymph mortality. Survival and lifespan of adults emerged from treated nymphs and treated adults were affected. Silencing awd caused wing malformation in the adults emerged from treated nymphs. Topical feeding as a delivery of dsRNA is highly efficient for both nymphs and adults. The described method could be used to increase the efficiency of RNAi in D. citri and other sap piercing-sucking hemipterans. © 2017 Wiley Periodicals, Inc.
RNA virus interference via CRISPR/Cas13a system in plants.
Aman, Rashid; Ali, Zahir; Butt, Haroon; Mahas, Ahmed; Aljedaani, Fatimah; Khan, Muhammad Zuhaib; Ding, Shouwei; Mahfouz, Magdy
2018-01-04
CRISPR/Cas systems confer immunity against invading nucleic acids and phages in bacteria and archaea. CRISPR/Cas13a (known previously as C2c2) is a class 2 type VI-A ribonuclease capable of targeting and cleaving single-stranded RNA (ssRNA) molecules of the phage genome. Here, we employ CRISPR/Cas13a to engineer interference with an RNA virus, Turnip Mosaic Virus (TuMV), in plants. CRISPR/Cas13a produces interference against green fluorescent protein (GFP)-expressing TuMV in transient assays and stable overexpression lines of Nicotiana benthamiana. CRISPR RNA (crRNAs) targeting the HC-Pro and GFP sequences exhibit better interference than those targeting other regions such as coat protein (CP) sequence. Cas13a can also process pre-crRNAs into functional crRNAs. Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses and for other RNA manipulations in plants.
Chemical Ligation Reactions of Oligonucleotides for Biological and Medicinal Applications.
Abe, Hiroshi; Kimura, Yasuaki
2018-01-01
Chemical ligation of oligonucleotides (ONs) is the key reaction for various ON-based technologies. We have tried to solve the problems of RNA interference (RNAi) technology by applying ON chemical ligation to RNAi. We designed a new RNAi system, called intracellular buildup RNAi (IBR-RNAi), where the RNA fragments are built up into active small-interference RNA (siRNA) in cells through a chemical ligation reaction. Using the phosphorothioate and iodoacetyl groups as reactive functional groups for the ligation, we achieved RNAi effects without inducing immune responses. Additionally, we developed a new chemical ligation for IBR-RNAi, which affords a more native-like structure in the ligated product. The new ligation method should be useful not only for IBR-RNAi but also for the chemical synthesis of biofunctional ONs.
A simple and robust vector-based shRNA expression system used for RNA interference.
Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi
2013-01-01
RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.
RNA Interference in Infectious Tropical Diseases
Hong, Young S.
2008-01-01
Introduction of double-stranded RNA (dsRNA) into some cells or organisms results in degradation of its homologous mRNA, a process called RNA interference (RNAi). The dsRNAs are processed into short interfering RNAs (siRNAs) that subsequently bind to the RNA-induced silencing complex (RISC), causing degradation of target mRNAs. Because of this sequence-specific ability to silence target genes, RNAi has been extensively used to study gene functions and has the potential to control disease pathogens or vectors. With this promise of RNAi to control pathogens and vectors, this paper reviews the current status of RNAi in protozoans, animal parasitic helminths and disease-transmitting vectors, such as insects. Many pathogens and vectors cause severe parasitic diseases in tropical regions and it is difficult to control once the host has been invaded. Intracellularly, RNAi can be highly effective in impeding parasitic development and proliferation within the host. To fully realize its potential as a means to control tropical diseases, appropriate delivery methods for RNAi should be developed, and possible off-target effects should be minimized for specific gene suppression. RNAi can also be utilized to reduce vector competence to interfere with disease transmission, as genes critical for pathogenesis of tropical diseases are knockdowned via RNAi. PMID:18344671
Efficient delivery of RNA interference oligonucleotides to polarized airway epithelia in vitro
Ramachandran, Shyam; Krishnamurthy, Sateesh; Jacobi, Ashley M.; Wohlford-Lenane, Christine; Behlke, Mark A.; Davidson, Beverly L.
2013-01-01
Polarized and pseudostratified primary airway epithelia present barriers that significantly reduce their transfection efficiency and the efficacy of RNA interference oligonucleotides. This creates an impediment in studies of the airway epithelium, diminishing the utility of loss-of-function as a research tool. Here we outline methods to introduce RNAi oligonucleotides into primary human and porcine airway epithelia grown at an air-liquid interface and difficult-to-transfect transformed epithelial cell lines grown on plastic. At the time of plating, we reverse transfect small-interfering RNA (siRNA), Dicer-substrate siRNA, or microRNA oligonucleotides into cells by use of lipid or peptide transfection reagents. Using this approach we achieve significant knockdown in vitro of hypoxanthine-guanine phosphoribosyltransferase, IL-8, and CFTR expression at the mRNA and protein levels in 1–3 days. We also attain significant reduction of secreted IL-8 in polarized primary pig airway epithelia 3 days posttransfection and inhibition of CFTR-mediated Cl− conductance in polarized air-liquid interface cultures of human airway epithelia 2 wk posttransfection. These results highlight an efficient means to deliver RNA interference reagents to airway epithelial cells and achieve significant knockdown of target gene expression and function. The ability to reliably conduct loss-of-function assays in polarized primary airway epithelia offers benefits to research in studies of epithelial cell homeostasis, candidate gene function, gene-based therapeutics, microRNA biology, and targeting the replication of respiratory viruses. PMID:23624792
Ghosh, Saikat Kumar B; Hunter, Wayne B; Park, Alexis L; Gundersen-Rindal, Dawn E
2018-05-04
Phloem and plant sap feeding insects invade the integrity of crops and fruits to retrieve nutrients, in the process damaging food crops. Hemipteran insects account for a number of economically substantial pests of plants that cause damage to crops by feeding on phloem sap. The brown marmorated stink bug (BMSB), Halyomorpha halys (Heteroptera: Pentatomidae) and the Asian citrus psyllid (ACP), Diaphorina citri Kuwayama (Hemiptera: Liviidae) are hemipteran insect pests introduced in North America, where they are an invasive agricultural pest of high-value specialty, row, and staple crops and citrus fruits, as well as a nuisance pest when they aggregate indoors. Insecticide resistance in many species has led to the development of alternate methods of pest management strategies. Double-stranded RNA (dsRNA)-mediated RNA interference (RNAi) is a gene silencing mechanism for functional genomic studies that has potential applications as a tool for the management of insect pests. Exogenously synthesized dsRNA or small interfering RNA (siRNA) can trigger highly efficient gene silencing through the degradation of endogenous RNA, which is homologous to that presented. Effective and environmental use of RNAi as molecular biopesticides for biocontrol of hemipteran insects requires the in vivo delivery of dsRNAs through feeding. Here we demonstrate methods for delivery of dsRNA to insects: loading of dsRNA into green beans by immersion, and absorbing of gene-specific dsRNA with oral delivery through ingestion. We have also outlined non-transgenic plant delivery approaches using foliar sprays, root drench, trunk injections as well as clay granules, all of which may be essential for sustained release of dsRNA. Efficient delivery by orally ingested dsRNA was confirmed as an effective dosage to induce a significant decrease in expression of targeted genes, such as juvenile hormone acid O-methyltransferase (JHAMT) and vitellogenin (Vg). These innovative methods represent strategies for delivery of dsRNA to use in crop protection and overcome environmental challenges for pest management.
Hattori, Miki; Miyamoto, Mai; Hosoda, Kazutaka; Umesono, Yoshihiko
2018-01-01
Planarians have become widely recognized as one of the major animal models for regeneration studies in invertebrates. To induce RNA interference (RNAi) by feeding in planarians, the widely accepted protocol is one in which animals undergo two or three feedings of food containing double-stranded RNA (dsRNA) plus visible food coloring (e.g., blood) for confirmation of feeding by individual animals. However, one possible problem is that incorporated food coloring is often retained within the gut for several days, which makes it difficult to confirm the success of each round of dsRNA feeding based on the difference of the color density within the gut before and after feeding. As a consequence, the difference of appetite levels among individuals undergoing dsRNA feeding leads to phenotypic variability among them due to insufficient knockdown. In our attempts to overcome this problem, we have developed a novel method for achieving robust confirmation of the success of dsRNA feeding in individuals fed multiple times by means of including a combination of three different colored chalks (pink, yellow and blue) as food coloring. Notably, we found that this method is superior to the conventional method for positively marking individuals that actively consumed the dsRNA-containing food during four times of once-daily feeding. Using these selected animals, we obtained stable and sufficiently strong RNAi-induced phenotypes. We termed this improved multi-colored chalk-spiked method of feeding RNAi "Candi" and propose its benefits for gene function analysis in planarians. © 2017 Japanese Society of Developmental Biologists.
USDA-ARS?s Scientific Manuscript database
Aflatoxin contamination is a major constraint in the food production worlwide. In peanut these aflatoxins are mainly produced by Aspergillus flavus (Link) and A. parasiticus (Speare). The use of RNA interference (RNAi) is a promising method to reduce or prevent the accumulation of aflatoxin in pean...
McCAIN, JACK
2004-01-01
Mammalian cells dislike double-stranded RNA. They interpret it as a sign of an intruder, and they can unleash a recently discovered defensive mechanism to deal with the problem – they chop the invader into little pieces and use the remnants, called small interfering RNA, to identify and destroy the invader and its progeny. This process, known as RNA interference, may lend itself to new treatments for a wide range of diseases. RNA interference, however, resembles two therapies studied during the 1990s, antisense and ribozymes, in that the gene-silencing target is messenger RNA (mRNA). Is RNA interference really the Next Big Thing – or just a variation on an older but still intriguing theme? PMID:23372488
Evaluation and control of miRNA-like off-target repression for RNA interference.
Seok, Heeyoung; Lee, Haejeong; Jang, Eun-Sook; Chi, Sung Wook
2018-03-01
RNA interference (RNAi) has been widely adopted to repress specific gene expression and is easily achieved by designing small interfering RNAs (siRNAs) with perfect sequence complementarity to the intended target mRNAs. Although siRNAs direct Argonaute (Ago), a core component of the RNA-induced silencing complex (RISC), to recognize and silence target mRNAs, they also inevitably function as microRNAs (miRNAs) and suppress hundreds of off-targets. Such miRNA-like off-target repression is potentially detrimental, resulting in unwanted toxicity and phenotypes. Despite early recognition of the severity of miRNA-like off-target repression, this effect has often been overlooked because of difficulties in recognizing and avoiding off-targets. However, recent advances in genome-wide methods and knowledge of Ago-miRNA target interactions have set the stage for properly evaluating and controlling miRNA-like off-target repression. Here, we describe the intrinsic problems of miRNA-like off-target effects caused by canonical and noncanonical interactions. We particularly focus on various genome-wide approaches and chemical modifications for the evaluation and prevention of off-target repression to facilitate the use of RNAi with secured specificity.
Walker, William B; Allen, Margaret L
2010-01-01
Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris.
Bosher, J M; Dufourcq, P; Sookhareea, S; Labouesse, M
1999-01-01
In nematodes, flies, trypanosomes, and planarians, introduction of double-stranded RNA results in sequence-specific inactivation of gene function, a process termed RNA interference (RNAi). We demonstrate that RNAi against the Caenorhabditis elegans gene lir-1, which is part of the lir-1/lin-26 operon, induced phenotypes very different from a newly isolated lir-1 null mutation. Specifically, lir-1(RNAi) induced embryonic lethality reminiscent of moderately strong lin-26 alleles, whereas the lir-1 null mutant was viable. We show that the lir-1(RNAi) phenotypes resulted from a severe loss of lin-26 gene expression. In addition, we found that RNAi directed against lir-1 or lin-26 introns induced similar phenotypes, so we conclude that lir-1(RNAi) targets the lir-1/lin-26 pre-mRNA. This provides direct evidence that RNA interference can prevent gene expression by targeting nuclear transcripts. Our results highlight that caution may be necessary when interpreting RNA interference without the benefit of mutant alleles. PMID:10545456
Liu, G Y; Gao, Z H; Li, L; Song, T T; Sheng, X G
2016-06-25
To investigate the expression of Jagged1 in human epithelial ovarian carcinoma tissues and the effect of Jagged1 on growth of xenograft in nude mice. (1) Forty-eight cases of ovarian cancer and 30 cases of patients with benign epithelial ovarian tumor in the Henan Province Xinxiang Central Hospital during Feb. 2011 to Mar. 2014 were enrolled in this study. The mRNA expression of Jagged1, Notch1 and the downstream target genes Hes1, Hey1 were analyzed by using realtime PCR method. (2) The ovarian cancer xenograft models in nude mice were constructed by injecting SKOV3 cells in axillary subcutaneouswere. The nude mice were randomly divided into Jagged1 interference group, blank plasmid group and control group. Each group had 10 mice. They were transfected with pcDNA3.1(+)-siRNA-Jagged1, blank plasmid pDC3.1 and phosphate buffer, respectively. The tumor volumes and tumor masses were measured 14 days after transfection and the inhibition rate was calculated. The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues after transfection in each group was detected by using realtime PCR technique and the relative protein expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues was detected by utilizing western blot method. (1) The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in ovarian cancer tissues were higher than benign ovarian tumor tissues, the differences were statistically significant (P<0.01). (2) The tumor volume was (491± 68) mm(3) and tumor mass was (2.6±0.4) g in Jagged1 interference group, which were significantly lower than that in the blank plasmid group [(842±88) mm(3) and (4.4±0.8) g, respectively] and that in the control group [(851±90) mm(3) and (4.5±0.9) g, respectively; P<0.05], the tumor inhibition rate was 42.2% in Jagged1 interference group, which was significantly higher than that in the blank plasmid group and that in the control group (2.2% and 0, respectively), the differences were statistically significant (P<0.05). The relative mRNA and protein expression of Jagged1, Hes1 and Hey1 in xenograft tissues of nude micein Jagged1 interference group were lower than that in the other two groups, the differences were statistically significant (P<0.05). There were no differences of relative mRNA and protein expression of Notch1 in xenograft tissues of nude mice among the three groups (P>0.05). Jagged1 is highly expressed in epithelial ovarian carcinoma. Jagged1 gene interference in xenograft tumor can inhibit ovarian cancer cell growth and improve tumor suppressor rate, which probably play roles by inhibiting Notch1 signaling pathway.
USDA-ARS?s Scientific Manuscript database
Phloem and plant sap feeding insect pests invade the integrity of crops and fruits to retrieve nutrients in the process damaging food productivity. Hemipteran insects account for a number of economically substantial pests of plants that cause damage to crops by feeding on phloem sap. Halyomorpha hal...
[Construction and selection of effective mouse Smad6 recombinant lenti-virus interference vectors].
Yu, Jing; Qi, Mengchun; Deng, Jiupeng; Liu, Gang; Chen, Huaiqing
2010-10-01
This experiment was designed to construct mouse Smad6 recombinant RNA interference vectors and determine their interference effects on bone marrow mesenchymal stem cells (BMSCs). Three recombinant Smad6 RNA interference vectors were constructed by molecular clone techniques with a lenti-virus vector expressing green fluorescent protein (GFP), and the correctness of recombinant vectors was verified by DNA sequencing. Mouse BMSCs were used for transfection experiments and BMP-2 was in use for osteogenic induction of MSCs. The transfection efficiency of recombinant vectors was examined by Laser confocal scanning microscope and the interference effect of recombinant vectors on Smad6 gene expression was determined by real-time RT-PCR and Western blot, respectively. Three Smad6 recombinant RNA interference vectors were successfully constructed and their correctness was proved by DNA sequencing. After transfection, GFPs were effectively expressed in MSCs and all of three recombinant vectors gained high transfection efficiency (> 95%). Both real-time PCR and Western blot examination indicated that among three recombinant vectors, No. 2 Svector had the best interference effect and the interference effect was nearly 91% at protein level. In conclusion, Mouse recombinant Smad6 RNA interference (RNAi) vector was successfully constructed and it provided an effective tool for further studies on BMP signal pathways.
2006-12-01
Defence Research and Recherche et developpement Development Canada pour la defense Canada DEFENCE I I! / DEFENSE Generation of Constructs for DNA... research into specific antiviral strategies. One such strategy is RNA interference. RNA interference involves the targeted silencing of a gene using...of an effective vaccine or therapeutic for VEE, a highly infectious virus, underscores the need for research in this area. In addition, the potential
Li, Zhi; Zhang, Mengying; Li, Xueqin; Lu, Jinming; Xu, Liang
2016-11-01
Objective To investigate the effect of adipose-derived mesenchymal stem cells (ADSCs) on glomerular mesangial cell proliferation via Wnt/β-catenin pathway. Methods The rat glomerular mesangial cells (HBZY-1) were incubated in conditioned ADSC medium. Cell cycle was analyzed with flow cytometry; the proliferation rate of HBZY-1 and the expression levels of relative genes and proteins of Wnt signaling pathway were measured using RNA interference, quantitative real-time PCR and Western blotting, respectively. Results HBZY-1 proliferation was significantly inhibited under the action of conditioned ADSC medium, whereas dickkopf WNT signaling pathway inhibitor 1 (DKK1) mRNA level was up-regulated. Fibronectin and TGF-β1 mRNA expression as well as β-catenin and Bcl-2 protein levels of HBZY-1 were significantly down-regulated. DKK1 gene expression level in ADSCs was significantly higher than that of HBZY-1. After RNA interference, DKK1 expression level in ADSCs was markedly inhibited, yet the β-catenin protein level was notably elevated. The β-catenin and Bcl-2 protein levels of HBZY-1 were also significantly raised in HBZY-1 after cultured with conditioned medium containing ADSCs treated with RNA interference. Conclusion Wnt/β-catenin may be a potential signaling pathway involved in the regulative effect of ADSCs on glomerular mesangial cell proliferation.
DeVincenzo, John P
2009-10-01
A revolution in the understanding of RNA biological processing and control is leading to revolutionary new concepts in human therapeutics. It has become increasingly clear that the so called "non-coding RNA" exerts specific and profound functional control on regulation of protein production and indeed controls the expression of all genes. Harnessing this naturally-occurring RNA-mediated regulation of protein production has immense human therapeutic potential. These processes are collectively known as RNA interference (RNAi). RNAi is a recently discovered, naturally-occurring intracellular process that regulates gene expression through the silencing of specific mRNAs. Methods of harnessing this natural pathway are being developed that allow the catalytic degradation of targeted mRNAs using specifically designed complementary small inhibitory RNAs (siRNA). siRNAs are being chemically modified to acquire drug-like properties. Numerous recent high profile publications have provided proofs of concept that RNA interference may be useful therapeutically. Much of the design of these siRNAs can be accomplished bioinformatically, thus potentially expediting drug discovery and opening new avenues of therapy for many uncommon, orphan, or emerging diseases. This makes this approach very attractive for developing therapies targeting orphan diseases including neonatal diseases. Theoretically, any disease that can be ameliorated through knockdown of any endogenous or exogenous protein is a potential therapeutic target for RNAi-based therapeutics. Lung diseases are particularly attractive targets for RNAi therapeutics since the affected cells' location increases their accessibility to topical administration of siRNA, for example by aerosol. Respiratory viral infections and chronic lung disease are examples of such diseases. RNAi therapeutics have been shown to be active against RSV, parainfluenza and human metapneumoviruses in vitro and in vivo resulting in profound antiviral effects. The first proof of concept test of efficacy of an RNAi-based therapeutic in man has been initiated. A discussion of the science behind RNA interference is followed by a presentation of the potential practical issues in applying this technology to neonatal respiratory viral diseases. RNAi may offer new strategies for the treatment of a variety of orphan diseases including neonatal diseases, RSV infections, and other respiratory viruses.
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi) has gained popularity in several fields of research, silencing targeted genes by degradation of RNA. The objective of this study was to develop RNAi for use as a molecular tool in the control of the invasive pest Lymantria dispar (Lepidoptera: Erebidae), gypsy moth, which ha...
Walker, William B.; Allen, Margaret L.
2010-01-01
Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris. PMID:21062205
Hassan, Ali
2006-06-01
RNA interference (RNAi) in eukaryotes is a recently identified phenomenon in which small double stranded RNA molecules called short interfering RNA (siRNA) interact with messenger RNA (mRNA) containing homologous sequences in a sequence-specific manner. Ultimately, this interaction results in degradation of the target mRNA. Because of the high sequence specificity of the RNAi process, and the apparently ubiquitous expression of the endogenous protein components necessary for RNAi, there appears to be little limitation to the genes that can be targeted for silencing by RNAi. Thus, RNAi has enormous potential, both as a research tool and as a mode of therapy. Several recent patents have described advances in RNAi technology that are likely to lead to new treatments for cardiovascular disease. These patents have described methods for increased delivery of siRNA to cardiovascular target tissues, chemical modifications of siRNA that improve their pharmacokinetic characteristics, and expression vectors capable of expressing RNAi effectors in situ. Though RNAi has only recently been demonstrated to occur in mammalian tissues, work has advanced rapidly in the development of RNAi-based therapeutics. Recently, therapeutic silencing of apoliporotein B, the ligand for the low density lipoprotein receptor, has been demonstrated in adult mice by systemic administration of chemically modified siRNA. This demonstrates the potential for RNAi-based therapeutics, and suggests that the future for RNAi in the treatment of cardiovascular disease is bright.
Immune modulation through RNA interference-mediated silencing of CD40 in dendritic cells.
Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Samiee, Shahram; Ataee, Zahra; Tabei, Seyyed Ziyaoddin; Moazzeni, Seyed Mohammad
2009-01-01
RNA interference (RNAi) is an exciting mechanism for knocking down any target gene in transcriptional level. It is now clear that small interfering RNA (siRNA), a 19-21nt long dsRNA, can trigger a degradation process (RNAi) that specifically silences the expression of a cognate mRNA. Our findings in this study showed that down regulation of CD40 gene expression in dendritic cells (DCs) by RNAi culminated to immune modulation. Effective delivery of siRNA into DCs would be a reasonable method for the blocking of CD40 gene expression at the cell surface without any effect on other genes and cell cytotoxicity. The effects of siRNA against CD40 mRNA on the function and phenotype of DCs were investigated. The DCs were separated from the mice spleen and then cultured in vitro. By the means of Lipofectamine2000, siRNA was delivered to the cells and the efficacy of transfection was estimated by flow cytometry. By Annexine V and Propidium Iodide staining, we could evaluate the transfected cells viability. Also, the mRNA expression and protein synthesis were assessed by real-time PCR and flow cytometry, respectively. Knocking down the CD40 gene in the DCs caused an increase in IL-4 production, decrease in IL-12 production and allostimulation activity. All together, these effects would stimulate Th2 cytokines production from allogenic T-cells in vitro.
Novel Methods for Mosquito Control using RNAi.
USDA-ARS?s Scientific Manuscript database
The discovery and development of novel insecticides for vector control is a primary focus of toxicology research conducted at the Mosquito and Fly Research Unit, Gainesville, FL. Targeting critical genes/proteins in mosquitoes using RNA interference (RNAi) is being investigated as a method to devel...
Carneiro, Joyce S; de la Bastide, Paul Y; Chabot, Meghan; Lerch, Lindsey; Hintz, William E
2010-05-01
The fungal pathogen, Ophiostomo novo-ulmi, has been responsible for the rapid decline of American elm (Ulmus americana) across North America and remains a serious threat to surviving elm populations. The production of pectinolytic polygalacturonase enzymes has been implicated as a virulence factor for many fungal pathogens, including O. novo-ulmi. Previous work has shown that the targeted disruption of the endopolygalacturonase gene locus epg1 of O. novo-ulmi reduced, but did not eliminate pectinase activity. In the present study, we evaluated the use of RNA interference (RNAi) as a method of suppressing expression of the epg1 locus in O. novo-ulmi and compared its efficiency to the gene disruption method. While there was a reduction in epg1-specific mRNA transcripts and in the amount of polygalacturonase enzyme secreted for both methods of gene regulation, neither method completely suppressed the expression of pectinase activity. There was, however, a significantly greater reduction in both transcript levels and secreted enzyme observed for some of the RNAi transformants. As the first demonstration of RNAi in O. novo-ulmi, this method of gene regulation shows promise in future studies of gene expression and pathogenicity. Copyright 2010 Elsevier Inc. All rights reserved.
Ahn, Jeonghyun; Ko, Ara; Jun, Eun Jung; Won, Minah; Kim, Yoo Kyum; Ju, Eun-Seon
2012-01-01
Antiviral therapeutics are currently unavailable for treatment of coxsackievirus B3, which can cause life-threatening myocarditis. A modified small interfering RNA (siRNA) containing 5′-triphosphate, 3p-siRNA, was shown to induce RNA interference and interferon activation. We aimed to develop a potent antiviral treatment using CVB3-specific 3p-siRNA and to understand its underlying mechanisms. Virus-specific 3p-siRNA was superior to both conventional virus-specific siRNA with an empty hydroxyl group at the 5′ end (OH-siRNA) and nonspecific 3p-siRNA in decreasing viral replication and subsequent cytotoxicity. A single administration of 3p-siRNA dramatically attenuated virus-associated pathological symptoms in mice with no signs of toxicity, and their body weights eventually reached the normal range. Myocardial inflammation and fibrosis were rare, and virus production was greatly reduced. A nonspecific 3p-siRNA showed relatively less protective effect under identical conditions, and a virus-specific OH-siRNA showed no protective effects. We confirmed that virus-specific 3p-siRNA simultaneously activated target-specific gene silencing and type I interferon signaling. We provide a clear proof of concept that coxsackievirus B3-specific 3p-siRNA has 2 distinct modes of action, which significantly enhance antiviral activities with minimal organ damage. This is the first direct demonstration of improved antiviral effects with an immunostimulatory virus-specific siRNA in coxsackievirus myocarditis, and this method could be applied to many virus-related diseases. PMID:22508300
2008-01-01
siRNA delivery method in his animal model, it remains to be studied whether this general pproach is safe in humans. Often cited as an advantage of siRNAs...way studying the intravenous delivery f ASO drug candidates targeting Bcl-2 (Genasense®, Genta) nd c-myc (Resten-NG®, AVI BioPharma), while completed... studies have been published investigating MOs as a treatment for EBOV infection, with both showing fficacy in animal models. PMOs were designed to
Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound.
Kopechek, Jonathan A; Carson, Andrew R; McTiernan, Charles F; Chen, Xucai; Klein, Edwin C; Villanueva, Flordeliza S
2016-01-01
RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease.
Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui
2017-02-01
RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.
Establishment of conditional vectors for hairpin siRNA knockdowns
Matsukura, Shiro; Jones, Peter A.; Takai, Daiya
2003-01-01
Small interference RNA (siRNA) is an emerging methodology in reverse genetics. Here we report the development of a new tetracycline-inducible vector-based siRNA system, which uses a tetracycline-responsive derivative of the U6 promoter and the tetracycline repressor for conditional in vivo transcription of short hairpin RNA. This method prevents potential lethality immediately after transfection of a vector when the targeted gene is indispensable, or the phenotype of the knockdown is lethal or results in a growth abnormality. We show that the controlled knockdown of DNA methyltransferase 1 (DNMT1) in human cancer resulted in growth arrest. Removal of the inducer, doxycycline, from treated cells led to re-expression of the targeted gene. Thus the method allows for a highly controlled approach to gene knockdown. PMID:12888529
The promises and pitfalls of RNA-interference-based therapeutics
Castanotto, Daniela; Rossi, John J.
2009-01-01
The discovery that gene expression can be controlled by the Watson–Crick base-pairing of small RNAs with messenger RNAs containing complementary sequence — a process known as RNA interference — has markedly advanced our understanding of eukaryotic gene regulation and function. The ability of short RNA sequences to modulate gene expression has provided a powerful tool with which to study gene function and is set to revolutionize the treatment of disease. Remarkably, despite being just one decade from its discovery, the phenomenon is already being used therapeutically in human clinical trials, and biotechnology companies that focus on RNA-interference-based therapeutics are already publicly traded. PMID:19158789
Misra, Ashish; Green, Michael R
2017-01-01
Alternative splicing is a regulated process that leads to inclusion or exclusion of particular exons in a pre-mRNA transcript, resulting in multiple protein isoforms being encoded by a single gene. With more than 90 % of human genes known to undergo alternative splicing, it represents a major source for biological diversity inside cells. Although in vitro splicing assays have revealed insights into the mechanisms regulating individual alternative splicing events, our global understanding of alternative splicing regulation is still evolving. In recent years, genome-wide RNA interference (RNAi) screening has transformed biological research by enabling genome-scale loss-of-function screens in cultured cells and model organisms. In addition to resulting in the identification of new cellular pathways and potential drug targets, these screens have also uncovered many previously unknown mechanisms regulating alternative splicing. Here, we describe a method for the identification of alternative splicing regulators using genome-wide RNAi screening, as well as assays for further validation of the identified candidates. With modifications, this method can also be adapted to study the splicing regulation of pre-mRNAs that contain two or more splice isoforms.
The inside cover picture shows how siRNAs modified with North bicyclo[3.1.0]hexane 2'-deoxy-pseudosugars are able to activate the RNA interference machinery. The paper confirms that the North conformation is critical for RNAi activity.
Bringing RNA Interference (RNAi) into the High School Classroom
ERIC Educational Resources Information Center
Sengupta, Sibani
2013-01-01
RNA interference (abbreviated RNAi) is a relatively new discovery in the field of mechanisms that serve to regulate gene expression (a.k.a. protein synthesis). Gene expression can be regulated at the transcriptional level (mRNA production, processing, or stability) and at the translational level (protein synthesis). RNAi acts in a gene-specific…
Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing
Salton, Maayan; Kasprzak, Wojciech K.; Voss, Ty; Shapiro, Bruce A.; Poulikakos, Poulikos I.; Misteli, Tom
2015-01-01
Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signaling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumors. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumor formation and slows growth of vemurafenib-resistant tumors. Our results identify an intronic mutation as a molecular basis for RNA splicing-mediated RAF inhibitor resistance and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma. PMID:25971842
Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing.
Salton, Maayan; Kasprzak, Wojciech K; Voss, Ty; Shapiro, Bruce A; Poulikakos, Poulikos I; Misteli, Tom
2015-05-14
Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signalling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumours. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small-molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumour formation and slows growth of vemurafenib-resistant tumours. Our results identify an intronic mutation as the molecular basis for a RNA splicing-mediated RAF inhibitor resistance mechanism and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma.
RNA Interference Therapies for an HIV-1 Functional Cure.
Scarborough, Robert J; Gatignol, Anne
2017-12-27
HIV-1 drug therapies can prevent disease progression but cannot eliminate HIV-1 viruses from an infected individual. While there is hope that elimination of HIV-1 can be achieved, several approaches to reach a functional cure (control of HIV-1 replication in the absence of drug therapy) are also under investigation. One of these approaches is the transplant of HIV-1 resistant cells expressing anti-HIV-1 RNAs, proteins or peptides. Small RNAs that use RNA interference pathways to target HIV-1 replication have emerged as competitive candidates for cell transplant therapy and have been included in all gene combinations that have so far entered clinical trials. Here, we review RNA interference pathways in mammalian cells and the design of therapeutic small RNAs that use these pathways to target pathogenic RNA sequences. Studies that have been performed to identify anti-HIV-1 RNA interference therapeutics are also reviewed and perspectives on their use in combination gene therapy to functionally cure HIV-1 infection are provided.
Argonaute Proteins and Mechanisms of RNA Interference in Eukaryotes and Prokaryotes.
Olina, A V; Kulbachinskiy, A V; Aravin, A A; Esyunina, D M
2018-05-01
Noncoding RNAs play essential roles in genetic regulation in all organisms. In eukaryotic cells, many small noncoding RNAs act in complex with Argonaute proteins and regulate gene expression by recognizing complementary RNA targets. The complexes of Argonaute proteins with small RNAs also play a key role in silencing of mobile genetic elements and, in some cases, viruses. These processes are collectively called RNA interference. RNA interference is a powerful tool for specific gene silencing in both basic research and therapeutic applications. Argonaute proteins are also found in prokaryotic organisms. Recent studies have shown that prokaryotic Argonautes can also cleave their target nucleic acids, in particular DNA. This activity of prokaryotic Argonautes might potentially be used to edit eukaryotic genomes. However, the molecular mechanisms of small nucleic acid biogenesis and the functions of Argonaute proteins, in particular in bacteria and archaea, remain largely unknown. Here we briefly review available data on the RNA interference processes and Argonaute proteins in eukaryotes and prokaryotes.
Generation of siRNA Nanosheets for Efficient RNA Interference
NASA Astrophysics Data System (ADS)
Kim, Hyejin; Lee, Jae Sung; Lee, Jong Bum
2016-04-01
After the discovery of small interference RNA (siRNA), nanostructured siRNA delivery systems have been introduced to achieve an efficient regulation of the target gene expression. Here we report a new siRNA-generating two dimensional nanostructure in a formation of nanosized sheet. Inspired by tunable mechanical and functional properties of the previously reported RNA membrane, siRNA nanosized sheets (siRNA-NS) with multiple Dicer cleavage sites were prepared. The siRNA-NS has two dimensional structure, providing a large surface area for Dicer to cleave the siRNA-NS for the generation of functional siRNAs. Furthermore, downregulation of the cellular target gene expression was achieved by delivery of siRNA-NS without chemical modification of RNA strands or conjugation to other substances.
The use of RNA interference (RNAi) gene silencing technology, particularly RNAi for pesticidal purposes to control macroorganism pests, is a relatively recent innovation. Post-transcriptional silencing of gene function is a very rapid process where double-stranded RNA (dsRNA) dir...
Bohle, Harry; Lorenzen, Niels; Schyth, Brian Dall
2011-06-01
Gene knock down by the use of small interfering RNAs (siRNAs) is widely used as a method for reducing the expression of specific genes in eukaryotic cells via the RNA interference pathway. But, the effectivity of siRNA induced gene knock down in cells from fish has in several studies been questioned and the specificity seems to be a general problem in cells originating from both lower and higher vertebrates. Here we show that we are able to reduce the level of viral gene expression and replication specifically in fish cells in vitro. We do so by using 27/25-mer DsiRNAs acting as substrates for dicer for the generation of siRNAs targeting the nucleoprotein N gene of viral hemorrhagic septicemia virus (VHSV). This rhabdovirus infects salmonid fish and is responsible for large yearly losses in aquaculture production. Specificity of the DsiRNA is assured in two ways: first, by using the conventional method of testing a control DsiRNA which should not target the gene of interest. Second, by assuring that replication of a heterologous virus of the same genus as the target virus was not inhibited by the DsiRNA. Target controls are, as we have previously highlighted, essential for verification of the specificity of siRNA-induced interference with virus multiplication, but they are still not in general use. Copyright © 2011 Elsevier B.V. All rights reserved.
RNA interference can be used to disrupt gene function in tardigrades
Tenlen, Jennifer R.; McCaskill, Shaina; Goldstein, Bob
2012-01-01
How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We show that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions, and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments. PMID:23187800
RNA interference can be used to disrupt gene function in tardigrades.
Tenlen, Jennifer R; McCaskill, Shaina; Goldstein, Bob
2013-05-01
How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We showed that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments.
Construction of siRNA/miRNA expression vectors based on a one-step PCR process
Xu, Jun; Zeng, Jie Qiong; Wan, Gang; Hu, Gui Bin; Yan, Hong; Ma, Li Xin
2009-01-01
Background RNA interference (RNAi) has become a powerful means for silencing target gene expression in mammalian cells and is envisioned to be useful in therapeutic approaches to human disease. In recent years, high-throughput, genome-wide screening of siRNA/miRNA libraries has emerged as a desirable approach. Current methods for constructing siRNA/miRNA expression vectors require the synthesis of long oligonucleotides, which is costly and suffers from mutation problems. Results Here we report an ingenious method to solve traditional problems associated with construction of siRNA/miRNA expression vectors. We synthesized shorter primers (< 50 nucleotides) to generate a linear expression structure by PCR. The PCR products were directly transformed into chemically competent E. coli and converted to functional vectors in vivo via homologous recombination. The positive clones could be easily screened under UV light. Using this method we successfully constructed over 500 functional siRNA/miRNA expression vectors. Sequencing of the vectors confirmed a high accuracy rate. Conclusion This novel, convenient, low-cost and highly efficient approach may be useful for high-throughput assays of RNAi libraries. PMID:19490634
Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound
McTiernan, Charles F.; Chen, Xucai; Klein, Edwin C.; Villanueva, Flordeliza S.
2016-01-01
RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease. PMID:27471848
Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J.; Backofen, Rolf; Marchfelder, Anita
2015-01-01
The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3′ handle are still active in triggering an interference reaction. The complete 3′ handle could be removed without loss of activity. However, manipulations of the 5′ handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. PMID:25512373
van Haaften, Gijs; Vastenhouw, Nadine L.; Nollen, Ellen A. A.; Plasterk, Ronald H. A.; Tijsterman, Marcel
2004-01-01
Here, we describe a systematic search for synthetic gene interactions in a multicellular organism, the nematode Caenorhabditis elegans. We established a high-throughput method to determine synthetic gene interactions by genome-wide RNA interference and identified genes that are required to protect the germ line against DNA double-strand breaks. Besides known DNA-repair proteins such as the C. elegans orthologs of TopBP1, RPA2, and RAD51, eight genes previously unassociated with a double-strand-break response were identified. Knockdown of these genes increased sensitivity to ionizing radiation and camptothecin and resulted in increased chromosomal nondisjunction. All genes have human orthologs that may play a role in human carcinogenesis. PMID:15326288
PEGylated poly(ethylene imine) copolymer-delivered siRNA inhibits HIV replication in vitro.
Weber, Nick D; Merkel, Olivia M; Kissel, Thomas; Muñoz-Fernández, María Ángeles
2012-01-10
RNA interference is increasingly being utilized for the specific targeting and down-regulation of disease-causing genes, including targeting viral infections such as HIV. T lymphocytes, the primary target for HIV, are very difficult to treat with gene therapy applications such as RNA interference because of issues with drug delivery. To circumvent these problems, we investigated poly(ethylene imine) (PEI) as a method of improving transfection efficiency of siRNA to T lymphocytes. Additionally, polyethylene glycol (PEG) moieties were engrafted to the PEI polymers with the goals of improving stability and reducing cytotoxicity. Initial studies on PEG-PEI/siRNA polyplex formation, size and their interaction with cell membranes demonstrated their feasibility as drug delivery agents. Assays with lymphocytes revealed low cytotoxicity profiles of the polyplexes at pharmacologically relevant concentrations with PEGylated copolymers obtaining the best results. Successful transfection of a T cell line or primary T cells with siRNA was observed via flow cytometry and confocal microscopy. Finally, the biological effect of copolymer-delivered siRNA was measured. Of particular significance, siRNA targeted to the HIV gene nef and delivered by one of the PEG-PEI copolymers in repetitive treatments every 2-3 days was observed to inhibit HIV replication to the same extent as azidothymidine over the course of 15 days. Copyright © 2011 Elsevier B.V. All rights reserved.
Molecular Mechanisms of RNA-Targeting by Cas13-containing Type VI CRISPR-Cas Systems.
O'Connell, Mitchell
2018-06-22
Prokaryotic adaptive immune systems use CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats) and CRISPR associated (Cas) proteins for RNA-guided cleavage of foreign genetic elements. The focus of this review, Type VI CRISPR-Cas systems, include a single protein known as Cas13 (formerly C2c2), that when assembled with a crRNA forms a crRNA-guided RNA-targeting effector complex. Type VI CRISPR-Cas systems can be divided into four subtypes (A-D) based on Cas13 phylogeny. All Cas13 proteins studied to date possess two enzymatically distinct ribonuclease activities that are required for optimal interference. One RNase is responsible for pre-crRNA processing to form mature Type VI interference complexes, while the other RNase activity provided by the two HEPN (Higher Eukaryotes and Prokaryotes Nucleotide-binding) domains, is required for degradation of target RNA during viral interference. In this review, I will compare and contrast what is known about the molecular architecture and behavior of Type VI (A-D) CRISPR-Cas13 interference complexes, how this allows them to carry out their RNA-targeting function, how Type VI accessory proteins are able to modulate Cas13 activity, and how together all of these features have led to the rapid development of a range of RNA-targeting applications. Throughout I will also discuss some of the outstanding questions regarding Cas13's molecular behavior, and its role in bacterial adaptive immunity and RNA-targeting applications. Copyright © 2018. Published by Elsevier Ltd.
RNA targeting with CRISPR-Cas13.
Abudayyeh, Omar O; Gootenberg, Jonathan S; Essletzbichler, Patrick; Han, Shuo; Joung, Julia; Belanto, Joseph J; Verdine, Vanessa; Cox, David B T; Kellner, Max J; Regev, Aviv; Lander, Eric S; Voytas, Daniel F; Ting, Alice Y; Zhang, Feng
2017-10-12
RNA has important and diverse roles in biology, but molecular tools to manipulate and measure it are limited. For example, RNA interference can efficiently knockdown RNAs, but it is prone to off-target effects, and visualizing RNAs typically relies on the introduction of exogenous tags. Here we demonstrate that the class 2 type VI RNA-guided RNA-targeting CRISPR-Cas effector Cas13a (previously known as C2c2) can be engineered for mammalian cell RNA knockdown and binding. After initial screening of 15 orthologues, we identified Cas13a from Leptotrichia wadei (LwaCas13a) as the most effective in an interference assay in Escherichia coli. LwaCas13a can be heterologously expressed in mammalian and plant cells for targeted knockdown of either reporter or endogenous transcripts with comparable levels of knockdown as RNA interference and improved specificity. Catalytically inactive LwaCas13a maintains targeted RNA binding activity, which we leveraged for programmable tracking of transcripts in live cells. Our results establish CRISPR-Cas13a as a flexible platform for studying RNA in mammalian cells and therapeutic development.
CRISPR interference: RNA-directed adaptive immunity in bacteria and archaea
Marraffini, Luciano A.; Sontheimer, Erik J.
2010-01-01
Sequence-directed genetic interference pathways control gene expression and preserve genome integrity in all kingdoms of life. The importance of such pathways is highlighted by the extensive study of RNA interference (RNAi) and related processes in eukaryotes. In many bacteria and most archaea, clustered, regularly interspaced short palindromic repeats (CRISPRs) are involved in a more recently discovered interference pathway that protects cells from bacteriophages and conjugative plasmids. CRISPR sequences provide an adaptive, heritable record of past infections and express CRISPR RNAs — small RNAs that target invasive nucleic acids. Here, we review the mechanisms of CRISPR interference and its roles in microbial physiology and evolution. We also discuss potential applications of this novel interference pathway. PMID:20125085
RNA interference-mediated intrinsic antiviral immunity in invertebrates.
Nayak, Arabinda; Tassetto, Michel; Kunitomi, Mark; Andino, Raul
2013-01-01
In invertebrates such as insects and nematodes, RNA interference (RNAi) provides RNA-based protection against viruses. This form of immunity restricts viral replication and dissemination from infected cells and viruses, in turn, have evolved evasion mechanisms or RNAi suppressors to counteract host defenses. Recent advances indicate that, in addition to RNAi, other related small RNA pathways contribute to antiviral functions in invertebrates. This has led to a deeper understanding of fundamental aspects of small RNA-based antiviral immunity in invertebrates and its contribution to viral spread and pathogenesis.
Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J; Backofen, Rolf; Marchfelder, Anita
2015-02-13
The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3' handle are still active in triggering an interference reaction. The complete 3' handle could be removed without loss of activity. However, manipulations of the 5' handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
RNA interference technology to control pest sea lampreys--a proof-of-concept.
Heath, George; Childs, Darcy; Docker, Margaret F; McCauley, David W; Whyard, Steven
2014-01-01
The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0-fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species.
RNA Interference Technology to Control Pest Sea Lampreys - A Proof-of-Concept
Heath, George; Childs, Darcy; Docker, Margaret F.; McCauley, David W.; Whyard, Steven
2014-01-01
The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0–fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species. PMID:24505485
[RNA interference library research progress and its application in cancer research].
Zhao, Ning; Cai, Li
2013-02-01
RNA interference is a homologous mRNA special degradation phenomenon which is caused by the double-stranded RNA. RNAi library is a pooled library that is artificially constructed using RNAi technology. As RNAi library has made a major breakthrough in the field of genetic research, it has been widely used in the field of medical research, especially in the field of cancer research. This review discussed the research progress of RNAi library and its applications in cancer research.
Exploring Fusarium head blight disease control by RNA interference
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi) technology provides a novel tool to study gene function and plant protection strategies. Fusarium graminearum is the causal agent of Fusarium head blight (FHB), which reduces crop yield and quality by producing trichothecene mycotoxins including 3-acetyl deoxynivalenol (3-ADO...
Takata, Nozomu; Sakakura, Eriko; Kasukawa, Takeya; Sakuma, Tetsushi; Yamamoto, Takashi; Sasai, Yoshiki
2016-06-01
The epiblast (foremost embryonic ectoderm) generates all three germ layers and therefore has crucial roles in the formation of all mammalian body cells. However, regulation of epiblast gene expression is poorly understood because of the difficulty of manipulating epiblast tissues in vivo. In the present study, using the self-organizing properties of mouse embryonic stem cell (ESC), we generated and characterized epiblast-like tissue in three-dimensional culture. We identified significant genome-wide gene expression changes in this epiblast-like tissue by transcriptomic analysis. In addition, we identified the particular significance of the Erk/Mapk and integrin-linked kinase pathways, and genes related to ectoderm/epithelial formation, using the bioinformatics resources IPA and DAVID. Here, we focused on Fgf5, which ranked in the top 10 among the discovered genes. To develop a functional analysis of Fgf5, we created an efficient method combining CRISPR/Cas9-mediated genome engineering and RNA interference (RNAi). Notably, we show one-step generation of various Fgf5 reporter lines including heterozygous and homozygous knockins (the GET method). For time- and dose-dependent depletion of fgf5 over the course of development, we generated an ESC line harboring Tol2 transposon-mediated integration of an inducible short hairpin RNA interference system (pdiRNAi). Our findings raised the possibility that Fgf/Erk signaling and apicobasal epithelial integrity are important factors in epiblast development. In addition, our methods provide a framework for a broad array of applications in the areas of mammalian genetics and molecular biology to understand development and to improve future therapeutics.
Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia; ...
2016-10-13
The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia
The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less
RNA therapeutics: Beyond RNA interference and antisense oligonucleotides
Kole, Ryszard; Krainer, Adrian R.; Altman, Sidney
2016-01-01
Here we discuss three RNA therapeutic technologies exploiting various oligonucleotides that bind RNA by base-pairing in a sequence-specific manner yet have different mechanisms of action and effects. RNA interference and antisense oligonucleotides downregulate gene expression by enzyme-dependent degradation of targeted mRNA. Steric blocking oligonucleotides block access of cellular machinery to pre-mRNA and mRNA without degrading the RNA. Through this mechanism, blocking oligonucleotides can redirect alternative splicing, repair defective RNA, restore protein production or also downregulate gene expression. Moreover, they can be extensively chemically modified, resulting in more drug-like properties. The ability of RNA blocking oligonucleotides to restore gene function makes them suited for treatment of genetic disorders. Positive results from clinical trials for the treatment of Duchenne muscular dystrophy show that this technology is close to realizing its clinical potential. PMID:22262036
Modeling RNA interference in mammalian cells
2011-01-01
Background RNA interference (RNAi) is a regulatory cellular process that controls post-transcriptional gene silencing. During RNAi double-stranded RNA (dsRNA) induces sequence-specific degradation of homologous mRNA via the generation of smaller dsRNA oligomers of length between 21-23nt (siRNAs). siRNAs are then loaded onto the RNA-Induced Silencing multiprotein Complex (RISC), which uses the siRNA antisense strand to specifically recognize mRNA species which exhibit a complementary sequence. Once the siRNA loaded-RISC binds the target mRNA, the mRNA is cleaved and degraded, and the siRNA loaded-RISC can degrade additional mRNA molecules. Despite the widespread use of siRNAs for gene silencing, and the importance of dosage for its efficiency and to avoid off target effects, none of the numerous mathematical models proposed in literature was validated to quantitatively capture the effects of RNAi on the target mRNA degradation for different concentrations of siRNAs. Here, we address this pressing open problem performing in vitro experiments of RNAi in mammalian cells and testing and comparing different mathematical models fitting experimental data to in-silico generated data. We performed in vitro experiments in human and hamster cell lines constitutively expressing respectively EGFP protein or tTA protein, measuring both mRNA levels, by quantitative Real-Time PCR, and protein levels, by FACS analysis, for a large range of concentrations of siRNA oligomers. Results We tested and validated four different mathematical models of RNA interference by quantitatively fitting models' parameters to best capture the in vitro experimental data. We show that a simple Hill kinetic model is the most efficient way to model RNA interference. Our experimental and modeling findings clearly show that the RNAi-mediated degradation of mRNA is subject to saturation effects. Conclusions Our model has a simple mathematical form, amenable to analytical investigations and a small set of parameters with an intuitive physical meaning, that makes it a unique and reliable mathematical tool. The findings here presented will be a useful instrument for better understanding RNAi biology and as modelling tool in Systems and Synthetic Biology. PMID:21272352
RNA interference: from biology to drugs and therapeutics.
Appasani, Krishnarao
2004-07-01
RNA interference (RNAi) is a newly discovered and popular technology platform among researchers not only in the fields of RNA biology and molecular cell biology. It has created excitement in clinical sciences such as oncology, neurology, endocrinology, infectious diseases and drug discovery. There is an urgent need to educate and connect academic and industry researchers for the purpose of knowledge transfer. Thus, GeneExpression Systems of Waltham organized its Second International Conference in Waltham City (May 2-4, 2004, MA, USA) on the theme of 'RNA interference: From Biology to Drugs & Therapeutics.' About 200 participants and 32 speakers attended this two and half-day event which was arranged in six scientific and three technology sessions and ended with a panel discussion. This report covers a few representative talks from academia, biotech and the drug industry.
Respiratory viral diseases: access to RNA interference therapy
Bitko, Vira; Barik, Sailen
2008-01-01
This review summarizes recent experimental achievements in the area of the development of new RNA interference (RNAi) therapeutics for the treatment of viral respiratory diseases. Delivery of siRNA to their intended target tissue remains the biggest problem for most therapeutic applications of these compounds. Appropriate formulations and chemical modifications for improved stability will boost the probability of utilization of RNAi drugs in the clinical applications. PMID:19081824
Ribosomal targets for antibiotic drug discovery
Blanchard, Scott C.; Feldman, Michael Brian; Wang, Leyi; Doudna Cate, James H.; Pulk, Arto; Altman, Roger B.; Wasserman, Michael R
2016-09-13
The present invention relates to methods to identify molecules that binds in the neomycin binding pocket of a bacterial ribosome using structures of an intact bacterial ribosome that reveal how the ribosome binds tRNA in two functionally distinct states, determined by x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor (RRF) and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit (P/E) site. Additionally, the invention relates to various assays, including single-molecule assay for ribosome recycling, and methods to identify compounds that interfere with ribosomal function by detecting newly identified intermediate FRET states using known and novel FRET pairs on the ribosome. The invention also provides vectors and compositions with an N-terminally tagged S13 protein.
The rde-1 gene, RNA interference, and transposon silencing in C. elegans.
Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C
1999-10-15
Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.
Rp-phosphorothioate modifications in RNase P RNA that interfere with tRNA binding.
Hardt, W D; Warnecke, J M; Erdmann, V A; Hartmann, R K
1995-01-01
We have used Rp-phosphorothioate modifications and a binding interference assay to analyse the role of phosphate oxygens in tRNA recognition by Escherichia coli ribonuclease P (RNase P) RNA. Total (100%) Rp-phosphorothioate modification at A, C or G positions of RNase P RNA strongly impaired tRNA binding and pre-tRNA processing, while effects were less pronounced at U positions. Partially modified E. coli RNase P RNAs were separated into tRNA binding and non-binding fractions by gel retardation. Rp-phosphorothioate modifications that interfered with tRNA binding were found 5' of nucleotides A67, G68, U69, C70, C71, G72, A130, A132, A248, A249, G300, A317, A330, A352, C353 and C354. Manganese rescue at positions U69, C70, A130 and A132 identified, for the first time, sites of direct metal ion coordination in RNase P RNA. Most sites of interference are at strongly conserved nucleotides and nine reside within a long-range base-pairing interaction present in all known RNase P RNAs. In contrast to RNase P RNA, 100% Rp-phosphorothioate substitutions in tRNA showed only moderate effects on binding to RNase P RNAs from E. coli, Bacillus subtilis and Chromatium vinosum, suggesting that pro-Rp phosphate oxygens of mature tRNA contribute relatively little to the formation of the tRNA-RNase P RNA complex. Images PMID:7540978
New RNAi strategy for selective suppression of a mutant allele in polyglutamine disease.
Kubodera, Takayuki; Yokota, Takanori; Ishikawa, Kinya; Mizusawa, Hidehiro
2005-12-01
In gene therapy of dominantly inherited diseases with small interfering RNA (siRNA), mutant allele specific suppression may be necessary for diseases in which the defective gene normally has an important role. It is difficult, however, to design a mutant allele-specific siRNA for trinucleotide repeat diseases in which the difference of sequences is only repeat length. To overcome this problem, we use a new RNA interference (RNAi) strategy for selective suppression of mutant alleles. Both mutant and wild-type alleles are inhibited by the most effective siRNA, and wild-type protein is restored using the wild-type mRNA modified to be resistant to the siRNA. Here, we applied this method to spinocerebellar ataxia type 6 (SCA6). We discuss its feasibility and problems for future gene therapy.
RNA interference for functional genomics and improvement of cotton (Gossypium species)
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium ssp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function ...
Silence of the transcripts: RNA interference in medicine.
Barik, Sailen
2005-10-01
Silencing of gene expression by ribonucleic acid (RNA), known as RNA interference (RNAi), is now recognized as a major means of gene regulation in biology. In this mechanism, small noncoding double-stranded RNA molecules knock down gene expression through a variety of mechanisms that include messenger RNA (mRNA) degradation, inhibition of mRNA translation, or chromatin remodeling. The posttranscriptional mechanism of RNAi has been embraced by researchers as a powerful tool for generating deficient phenotypes without mutating the gene. In parallel, exciting recent results have promised its application in disease therapy. This review aims to summarize the current knowledge in this area and provide a roadmap that may eventually launch RNAi from the research bench to the medicine chest.
Sin, Onsam; Mabiala, Prudence; Liu, Ye; Sun, Ying; Hu, Tao; Liu, Qingzhen; Guo, Deyin
2012-02-01
Artificial microRNA (miRNA) expression vectors have been developed and used for RNA interference. The secondary structure of artificial miRNA is important for RNA interference efficacy. We designed two groups of six artificial splicing miRNA 155-based miRNAs (SM155-based miRNAs) with the same target in the coding region or 3' UTR of a target gene and studied their RNA silencing efficiency and interferon β (IFN-β) induction effects. SM155-based miRNA with a mismatch at the +1 position and a bulge at the +11, +12 positions in a miRNA precursor stem-loop structure showed the highest gene silencing efficiency and lowest IFN-β induction effect (increased IFN-β mRNA level by 10% in both target cases), regardless of the specificity of the target sequence, suggesting that pSM155-based miRNA with this design could be a valuable miRNA expression vector.
Kretova, Olga V; Chechetkin, Vladimir R; Fedoseeva, Daria M; Kravatsky, Yuri V; Sosin, Dmitri V; Alembekov, Ildar R; Gorbacheva, Maria A; Gashnikova, Natalya M; Tchurikov, Nickolai A
2017-02-01
Any method for silencing the activity of the HIV-1 retrovirus should tackle the extremely high variability of HIV-1 sequences and mutational escape. We studied sequence variability in the vicinity of selected RNA interference (RNAi) targets from isolates of HIV-1 subtype A in Russia, and we propose that using artificial RNAi is a potential alternative to traditional antiretroviral therapy. We prove that using multiple RNAi targets overcomes the variability in HIV-1 isolates. The optimal number of targets critically depends on the conservation of the target sequences. The total number of targets that are conserved with a probability of 0.7-0.8 should exceed at least 2. Combining deep sequencing and multitarget RNAi may provide an efficient approach to cure HIV/AIDS.
Fricano, Meagan M; Ditewig, Amy C; Jung, Paul M; Liguori, Michael J; Blomme, Eric A G; Yang, Yi
2011-01-01
Blood is an ideal tissue for the identification of novel genomic biomarkers for toxicity or efficacy. However, using blood for transcriptomic profiling presents significant technical challenges due to the transcriptomic changes induced by ex vivo handling and the interference of highly abundant globin mRNA. Most whole blood RNA stabilization and isolation methods also require significant volumes of blood, limiting their effective use in small animal species, such as rodents. To overcome these challenges, a QIAzol-based RNA stabilization and isolation method (QSI) was developed to isolate sufficient amounts of high quality total RNA from 25 to 500 μL of rat whole blood. The method was compared to the standard PAXgene Blood RNA System using blood collected from rats exposed to saline or lipopolysaccharide (LPS). The QSI method yielded an average of 54 ng total RNA per μL of rat whole blood with an average RNA Integrity Number (RIN) of 9, a performance comparable with the standard PAXgene method. Total RNA samples were further processed using the NuGEN Ovation Whole Blood Solution system and cDNA was hybridized to Affymetrix Rat Genome 230 2.0 Arrays. The microarray QC parameters using RNA isolated with the QSI method were within the acceptable range for microarray analysis. The transcriptomic profiles were highly correlated with those using RNA isolated with the PAXgene method and were consistent with expected LPS-induced inflammatory responses. The present study demonstrated that the QSI method coupled with NuGEN Ovation Whole Blood Solution system is cost-effective and particularly suitable for transcriptomic profiling of minimal volumes of whole blood, typical of those obtained with small animal species.
Matsa, Elena; Dixon, James E.; Medway, Christopher; Georgiou, Orestis; Patel, Minal J.; Morgan, Kevin; Kemp, Paul J.; Staniforth, Andrew; Mellor, Ian; Denning, Chris
2014-01-01
Aims Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. Methods and results We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K+ currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). Conclusions These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart. PMID:23470493
USDA-ARS?s Scientific Manuscript database
Gene silencing through RNA interference (RNAi) has revolutionized the study of gene function, particularly in non-model insects. However, in Lepidoptera (moths and butterflies) RNAi has many times proven to be difficult to achieve. Most of the negative results have been anecdotal and the positive ex...
Domain motions of Argonaute, the catalytic engine of RNA interference
Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y
2007-01-01
Background The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. Results The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes – an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Conclusion Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference. PMID:18053142
Domain motions of Argonaute, the catalytic engine of RNA interference.
Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y
2007-11-30
The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes - an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference.
Rand, Tim A.; Ginalski, Krzysztof; Grishin, Nick V.; Wang, Xiaodong
2004-01-01
RNA interference is carried out by the small double-stranded RNA-induced silencing complex (RISC). The RISC-bound small RNA guides the RISC complex to identify and cleave mRNAs with complementary sequences. The proteins that make up the RISC complex and cleave mRNA have not been unequivocally defined. Here, we report the biochemical purification of RISC activity to homogeneity from Drosophila Schnieder 2 cell extracts. Argonaute 2 (Ago-2) is the sole protein component present in the purified, functional RISC. By using a bioinformatics method that combines sequence-profile analysis with predicted protein secondary structure, we found homology between the PIWI domain of Ago-2 and endonuclease V and identified potential active-site amino acid residues within the PIWI domain of Ago-2. PMID:15452342
Rand, Tim A; Ginalski, Krzysztof; Grishin, Nick V; Wang, Xiaodong
2004-10-05
RNA interference is carried out by the small double-stranded RNA-induced silencing complex (RISC). The RISC-bound small RNA guides the RISC complex to identify and cleave mRNAs with complementary sequences. The proteins that make up the RISC complex and cleave mRNA have not been unequivocally defined. Here, we report the biochemical purification of RISC activity to homogeneity from Drosophila Schnieder 2 cell extracts. Argonaute 2 (Ago-2) is the sole protein component present in the purified, functional RISC. By using a bioinformatics method that combines sequence-profile analysis with predicted protein secondary structure, we found homology between the PIWI domain of Ago-2 and endonuclease V and identified potential active-site amino acid residues within the PIWI domain of Ago-2.
Nonenzymatic microorganism identification based on ribosomal RNA
NASA Astrophysics Data System (ADS)
Ives, Jeffrey T.; Pierini, Alicia M.; Stokes, Jeffrey A.; Wahlund, Thomas M.; Read, Betsy; Bechtel, James H.; Bronk, Burt V.
1999-11-01
Effective defense against biological warfare (BW) agents requires rapid, fieldable and accurate systems. For micro- organisms like bacteria and viruses, ribosomal RNA (rRNA) provides a valuable target with multiple advantages of species specificity and intrinsic target amplification. Vegetative and spore forms of bacteria contain approximately 104 copies of rRNA. Direct detection of rRNA copies can eliminate some of the interference and preparation difficulties involved in enzymatic amplification methods. In order to apply the advantages of rRNA to BW defense, we are developing a fieldable system based on 16S rRNA, physical disruption of the micro-organism, solid phase hybridization, and fluorescence detection. Our goals include species-specific identification, complete operation from raw sample to identification in 15 minutes or less, and compact, fieldable instrumentation. Initial work on this project has investigated the lysis and hybridization steps, the species-specificity of oligonucleotides probes, and the development of a novel electromagnetic method to physically disrupt the micro- organisms. Target bacteria have been Escherichia coli (E. coli) and Bacillus subtilis (B. subtilis). Continuing work includes further development of methods to rapidly disrupt the micro-organisms and release the rRNA, improved integration and processing, and extension to bacterial and mammalian viruses like MS2 and vesicular stomatitis virus.
Runo, Steven; Alakonya, Amos; Machuka, Jesse; Sinha, Neelima
2011-02-01
Biological crop pests cause serious economic losses. In Africa, the most prevalent parasites are insect pests, plant pathogenic root-knot nematodes, viruses and parasitic plants. African smallholder farmers struggle to overcome these parasitic constraints to agricultural production. Crop losses and the host range of these parasites have continued to increase in spite of the use of widely advocated control methods. A sustainable method to overcome biological pests in Africa would be to develop crop germplasm resistant to parasites. This is achievable using either genetic modification (GM) or a non-GM approach. However, there is a paucity of resistant genes available for introduction. Additionally, the biological processes underpinning host parasite resistance are not sufficiently well understood. The authors review a technology platform for using RNA-mediated interference (RNAi) as bioengineered resistance to important crop parasites in Africa. To achieve acquired resistance, a host crop is stably transformed with a transgene that encodes a hairpin RNA targeting essential parasitic genes. The RNAi sequence is chosen in such a way that it shares no homology with the host's genes, so it remains 'inactive' until parasitism. Upon parasitism, the RNAi sequence enters the parasite and post-transcriptional gene silencing (PTGS) mechanisms are activated, leading to the death of the parasite. Copyright © 2010 Society of Chemical Industry.
Wannenes, Francesca; Ciafré, Silvia Anna; Niola, Francesco; Frajese, Gaetano; Farace, Maria Giulia
2005-12-01
RNA interference technology is emerging as a very potent tool to obtain a cellular knockdown of a desired gene. In this work we used vector-based RNA interference to inhibit vascular endothelial growth factor (VEGF) expression in prostate cancer in vitro and in vivo. We demonstrated that transduction with a plasmid carrying a small interfering RNA targeting all isoforms of VEGF, dramatically impairs the expression of this growth factor in the human prostate cancer cell line PC3. As a consequence, PC3 cells loose their ability to induce one of the fundamental steps of angiogenesis, namely the formation of a tube-like network in vitro. Most importantly, our "therapeutic" vector is able to impair tumor growth rate and vascularization in vivo. We show that a single injection of naked plasmid in developing neoplastic mass significantly decreases microvessel density in an androgen-refractory prostate xenograft and is able to sustain a long-term slowing down of tumor growth. In conclusion, our results confirm the basic role of VEGF in the angiogenic development of prostate carcinoma, and suggest that the use of our vector-based RNA interference approach to inhibit angiogenesis could be an effective tool in view of future gene therapy applications for prostate cancer.
Zhou, Wen-Qin; Wang, Peng; Shao, Qiu-Ping; Wang, Jian
2016-08-01
Acute respiratory distress syndrome (ARDS) is a common clinical disorder characterized by pulmonary edema leading to acute lung damage and arterial hypoxemia. Pulmonary fibrosis is a progressive, fibrotic lung disorder, whose pathogenesis in ARDS remains speculative. LincRNA-p21 was a novel regulator of cell proliferation, apoptosis and DNA damage response. This study aims to investigate the effects and mechanism of lincRNA-p21 on pulmonary fibrosis in ARDS. Purified 10 mg/kg LPS was dropped into airways of C57BL/6 mice. Expression levels of lincRNA-p21 and Thy-1 were measured by real-time PCR or western blotting. Proliferation of lung fibroblasts was analyzed by BrdU incorporation assay. Lung and BAL collagen contents were estimated using colorimetric Sircol assay. LincRNA-p21 expression was time-dependently increased and Thy-1 expression was time-dependently reduced in a mouse model of ARDS and in LPS-treated lung fibroblasts. Meanwhile, lung fibroblast proliferation was also time-dependently elevated in LPS-treated lung fibroblasts. In addition, lung fibroblast proliferation could be promoted by lincRNA-p21 overexpression and LPS treatment, however, the elevated lung fibroblast proliferation was further abrogated by Thy-1 overexpression or lincRNA-p21 interference. And Thy-1 interference could elevate cell viability of lung fibroblasts and rescue the reduction of lung fibroblast proliferation induced by lincRNA-p21 interference. Moreover, lincRNA-p21 overexpression dramatically inhibited acetylation of H3 and H4 at the Thy-1 promoter and Thy-1 expression levels in HLF1 cells. Finally, lincRNA-p21 interference rescued LPS-induced increase of lung and BAL collagen contents. LincRNA-p21 could lead to pulmonary fibrosis in ARDS by inhibition of the expression of Thy-1.
Korde, Asawari; Rosselot, Jessica M.; Donze, David
2014-01-01
The major function of eukaryotic RNA polymerase III is to transcribe transfer RNA, 5S ribosomal RNA, and other small non-protein-coding RNA molecules. Assembly of the RNA polymerase III complex on chromosomal DNA requires the sequential binding of transcription factor complexes TFIIIC and TFIIIB. Recent evidence has suggested that in addition to producing RNA transcripts, chromatin-assembled RNA polymerase III complexes may mediate additional nuclear functions that include chromatin boundary, nucleosome phasing, and general genome organization activities. This study provides evidence of another such “extratranscriptional” activity of assembled RNA polymerase III complexes, which is the ability to block progression of intergenic RNA polymerase II transcription. We demonstrate that the RNA polymerase III complex bound to the tRNA gene upstream of the Saccharomyces cerevisiae ATG31 gene protects the ATG31 promoter against readthrough transcriptional interference from the upstream noncoding intergenic SUT467 transcription unit. This protection is predominately mediated by binding of the TFIIIB complex. When TFIIIB binding to this tRNA gene is weakened, an extended SUT467–ATG31 readthrough transcript is produced, resulting in compromised ATG31 translation. Since the ATG31 gene product is required for autophagy, strains expressing the readthrough transcript exhibit defective autophagy induction and reduced fitness under autophagy-inducing nitrogen starvation conditions. Given the recent discovery of widespread pervasive transcription in all forms of life, protection of neighboring genes from intergenic transcriptional interference may be a key extratranscriptional function of assembled RNA polymerase III complexes and possibly other DNA binding proteins. PMID:24336746
Prokaryotic Argonautes - variations on the RNA interference theme.
van der Oost, John; Swarts, Daan C; Jore, Matthijs M
2014-04-15
The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes.
Prokaryotic Argonautes - variations on the RNA interference theme
van der Oost, John; Swarts, Daan C.; Jore, Matthijs M.
2014-01-01
The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes. PMID:28357239
USDA-ARS?s Scientific Manuscript database
Over the past decade RNA interference (RNAi) technology has emerged as a successful tool not only for functional genomics, but in planta expression of short interfering RNAs (siRNAs) could offer potential for insect pest management. Insects feeding exclusively on plant sap depend on osmotic pressure...
ERIC Educational Resources Information Center
Buluwela, Laki; Kamalati, Tahereh; Photiou, Andy; Heathcote, Dean A.; Jones, Michael D.; Ali, Simak
2010-01-01
RNA mediated gene interference (RNAi) is now a key tool in eukaryotic cell and molecular biology research. This article describes a five session laboratory practical, spread over a seven day period, to introduce and illustrate the technique. During the exercise, students working in small groups purify PCR products that encode "in vitro"…
How Golden Is Silence? Teaching Undergraduates the Power and Limits of RNA Interference
ERIC Educational Resources Information Center
Kuldell, Natalie H.
2006-01-01
It is hard and getting harder to strike a satisfying balance in teaching. Time dedicated to student-generated models or ideas is often sacrificed in an effort to "get through the syllabus." I describe a series of RNA interference (RNAi) experiments for undergraduate students that simultaneously explores fundamental concepts in gene regulation,…
shRNA-Induced Gene Knockdown In Vivo to Investigate Neutrophil Function.
Basit, Abdul; Tang, Wenwen; Wu, Dianqing
2016-01-01
To silence genes in neutrophils efficiently, we exploited the RNA interference and developed an shRNA-based gene knockdown technique. This method involves transfection of mouse bone marrow-derived hematopoietic stem cells with retroviral vector carrying shRNA directed at a specific gene. Transfected stem cells are then transplanted into irradiated wild-type mice. After engraftment of stem cells, the transplanted mice have two sets of circulating neutrophils. One set has a gene of interest knocked down while the other set has full complement of expressed genes. This efficient technique provides a unique way to directly compare the response of neutrophils with a knocked-down gene to that of neutrophils with the full complement of expressed genes in the same environment.
A quantitative framework for the forward design of synthetic miRNA circuits.
Bloom, Ryan J; Winkler, Sally M; Smolke, Christina D
2014-11-01
Synthetic genetic circuits incorporating regulatory components based on RNA interference (RNAi) have been used in a variety of systems. A comprehensive understanding of the parameters that determine the relationship between microRNA (miRNA) and target expression levels is lacking. We describe a quantitative framework supporting the forward engineering of gene circuits that incorporate RNAi-based regulatory components in mammalian cells. We developed a model that captures the quantitative relationship between miRNA and target gene expression levels as a function of parameters, including mRNA half-life and miRNA target-site number. We extended the model to synthetic circuits that incorporate protein-responsive miRNA switches and designed an optimized miRNA-based protein concentration detector circuit that noninvasively measures small changes in the nuclear concentration of β-catenin owing to induction of the Wnt signaling pathway. Our results highlight the importance of methods for guiding the quantitative design of genetic circuits to achieve robust, reliable and predictable behaviors in mammalian cells.
Live cell imaging of Argonaute proteins in mammalian cells.
Pare, Justin M; Lopez-Orozco, Joaquin; Hobman, Tom C
2011-01-01
The central effector of mammalian RNA interference (RNAi) is the RNA-induced silencing complex (RISC). Proteins of the Argonaute family are the core components of RISC. Recent work from multiple laboratories has shown that Argonaute family members are associated with at least two types of cytoplasmic RNA granules: GW/Processing bodies and stress granules. These Argonaute-containing granules harbor proteins that function in mRNA degradation and translational repression in response to stress. The known role of Argonaute proteins in miRNA-mediated translational repression and siRNA-directed mRNA cleavage (i.e., Argonaute 2) has prompted speculation that the association of Argonautes with these granules may reflect the activity of RNAi in vivo. Accordingly, studying the dynamic association between Argonautes and RNA granules in living cells will undoubtedly provide insight into the regulatory mechanisms of RNA-based silencing. This chapter describes a method for imaging fluorescently tagged Argonaute proteins in living mammalian cells using spinning disk confocal microscopy.
Knock down of the myostatin gene by RNA interference increased body weight in chicken.
Bhattacharya, T K; Shukla, R; Chatterjee, R N; Dushyanth, K
2017-01-10
Myostatin is a negative regulator of muscular growth in poultry and other animals. Of several approaches, knocking down the negative regulator is an important aspect to augment muscular growth in chicken. Knock down of myostatin gene has been performed by shRNA acting against the expression of gene in animals. Two methods of knock down of gene in chicken such as embryo manipulation and sperm mediated method have been performed. The hatching percentage in embryo manipulation and sperm mediated method of knock down was 58.0 and 41.5%, respectively. The shRNA in knock down chicken enhanced body weight at 6 weeks by 26.9%. The dressing percentage and serum biochemical parameters such as SGPT and alkaline phosphatase differed significantly (P<0.05) between knock down and control birds. It is concluded that knocking down the myostatin gene successfully augmented growth in chicken. Copyright © 2016 Elsevier B.V. All rights reserved.
2010-01-01
Background Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEXGM-CSF, we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. Methods To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Results Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. Conclusions This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials. PMID:20836854
[RNA interference: biogenesis molecular mechanisms and its applications in cervical cancer].
Peralta-Zaragoza, Oscar; Bermúdez-Morales, Víctor Hugo; Madrid-Marina, Vicente
2010-01-01
RNAi (RNA interference) is a natural process by which eukaryotic cells silence gene expression through small interference RNAs (siRNA) which are complementary to messenger RNA (mRNA). In this process, the siRNA that are 21-25 nucleotides long and are known as microRNA (miRNA), either associate with the RNA-induced silencing complex (RISC), which targets and cleaves the complementary mRNAs by the endonucleolytic pathway, or repress the translation. It is also possible to silence exogenous gene expression during viral infections by using DNA templates to transcribe siRNA with properties that are identical to those of bioactive microRNA. Persistent human papillomavirus (HPV) infection is the main etiological agent during cervical cancer development and the HPV E6 and E7 oncogenes, which induce cellular transformation and immortalization, represent strategic targets to be silenced with siRNA. In several in vitro and in vivo studies, it has been demonstrated that the introduction of siRNA directed against the E6 and E7 oncogenes in human tumoral cervical cells transformed by HPV, leads to the efficient silencing of HPV E6 and E7 oncogene expression, which induces the accumulation of the products of the p53 and pRb tumor suppressor genes and activates the mechanism of programmed cell death by apoptosis; thus, the progression of the tumoral growth process may be prevented. The goal of this review is to analyze the microRNA biogenesis process in the silencing of gene expression and to discuss the different protocols for the use of siRNA as a potential gene therapy strategy for the treatment of cervical cancer.
RNA Interference in Moths: Mechanisms, Applications, and Progress
Xu, Jin; Wang, Xia-Fei; Chen, Peng; Liu, Fang-Tao; Zheng, Shuai-Chao; Ye, Hui; Mo, Ming-He
2016-01-01
The vast majority of lepidopterans, about 90%, are moths. Some moths, particularly their caterpillars, are major agricultural and forestry pests in many parts of the world. However, some other members of moths, such as the silkworm Bombyx mori, are famous for their economic value. Fire et al. in 1998 initially found that exogenous double-stranded RNA (dsRNA) can silence the homolog endogenous mRNA in organisms, which is called RNA interference (RNAi). Soon after, the RNAi technique proved to be very promising not only in gene function determination but also in pest control. However, later studies demonstrate that performing RNAi in moths is not as straightforward as shown in other insect taxa. Nevertheless, since 2007, especially after 2010, an increasing number of reports have been published that describe successful RNAi experiments in different moth species either on gene function analysis or on pest management exploration. So far, more than 100 peer-reviewed papers have reported successful RNAi experiments in moths, covering 10 families and 25 species. By using classic and novel dsRNA delivery methods, these studies effectively silence the expression of various target genes and determine their function in larval development, reproduction, immunology, resistance against chemicals, and other biological processes. In addition, a number of laboratory and field trials have demonstrated that RNAi is also a potential strategy for moth pest management. In this review, therefore, we summarize and discuss the mechanisms and applications of the RNAi technique in moths by focusing on recent progresses. PMID:27775569
Improved silencing properties using small internally segmented interfering RNAs
Bramsen, Jesper B.; Laursen, Maria B.; Damgaard, Christian K.; Lena, Suzy W.; Ravindra Babu, B.; Wengel, Jesper; Kjems, Jørgen
2007-01-01
RNA interference is mediated by small interfering RNAs (siRNAs) that upon incorporation into the RNA-induced silencing complex (RISC) can target complementary mRNA for degradation. Standard siRNA design usually feature a 19–27 base pair contiguous double-stranded region that is believed to be important for RISC incorporation. Here, we describe a novel siRNA design composed of an intact antisense strand complemented with two shorter 10–12 nt sense strands. This three-stranded construct, termed small internally segmented interfering RNA (sisiRNA), is highly functional demonstrating that an intact sense strand is not a prerequisite for RNA interference. Moreover, when using the sisiRNA design only the antisense strand is functional in activated RISC thereby completely eliminating unintended mRNA targeting by the sense strand. Interestingly, the sisiRNA design supports the function of chemically modified antisense strands, which are non-functional within the context of standard siRNA designs. This suggests that the sisiRNA design has a clear potential of improving the pharmacokinetic properties of siRNA in vivo. PMID:17726057
Rodrigues, Simone M; Soares, Virgínia L F; de Oliveira, Tahise M; Gesteira, Abelmon S; Otoni, Wagner C; Costa, Marcio G C
2007-11-01
The tropical plant Bixa orellana L. (annatto) produces an array of natural products, including the pigment bixin used in the food and cosmetics industries. In order to understand the biochemical and molecular basis of the biosynthesis of these natural products, a reliable method for isolating high yields of high-quality RNA is required. Here we described a successful and reproducible method for isolation and purification of high-quantity and high-quality RNA from different tissues of annatto. This protocol overcomes the usual problems associated with large amounts of polyphenols, polysaccharides, pigments, and other secondary metabolites that are not easily removed by conventional extraction procedures. Furthermore, the proposed protocol can be easily carried out in any laboratory and it could also be extended to isolate RNA from other plant species showing similar abundance of compounds that interfere with RNA extractions. The yield and quality of the RNA were monitored by spectrophotometric analysis, separation on agarose gel, Reverse Transcription-Polymerase Chain Reaction (RT-PCR), and construction of a cDNA library.
Predicting gene regulatory networks of soybean nodulation from RNA-Seq transcriptome data.
Zhu, Mingzhu; Dahmen, Jeremy L; Stacey, Gary; Cheng, Jianlin
2013-09-22
High-throughput RNA sequencing (RNA-Seq) is a revolutionary technique to study the transcriptome of a cell under various conditions at a systems level. Despite the wide application of RNA-Seq techniques to generate experimental data in the last few years, few computational methods are available to analyze this huge amount of transcription data. The computational methods for constructing gene regulatory networks from RNA-Seq expression data of hundreds or even thousands of genes are particularly lacking and urgently needed. We developed an automated bioinformatics method to predict gene regulatory networks from the quantitative expression values of differentially expressed genes based on RNA-Seq transcriptome data of a cell in different stages and conditions, integrating transcriptional, genomic and gene function data. We applied the method to the RNA-Seq transcriptome data generated for soybean root hair cells in three different development stages of nodulation after rhizobium infection. The method predicted a soybean nodulation-related gene regulatory network consisting of 10 regulatory modules common for all three stages, and 24, 49 and 70 modules separately for the first, second and third stage, each containing both a group of co-expressed genes and several transcription factors collaboratively controlling their expression under different conditions. 8 of 10 common regulatory modules were validated by at least two kinds of validations, such as independent DNA binding motif analysis, gene function enrichment test, and previous experimental data in the literature. We developed a computational method to reliably reconstruct gene regulatory networks from RNA-Seq transcriptome data. The method can generate valuable hypotheses for interpreting biological data and designing biological experiments such as ChIP-Seq, RNA interference, and yeast two hybrid experiments.
Local gene silencing in plants via synthetic dsRNA and carrier peptide.
Numata, Keiji; Ohtani, Misato; Yoshizumi, Takeshi; Demura, Taku; Kodama, Yutaka
2014-10-01
Quick and facile transient RNA interference (RNAi) is one of the most valuable plant biotechnologies for analysing plant gene functions. To establish a novel double-strand RNA (dsRNA) delivery system for plants, we developed an ionic complex of synthetic dsRNA with a carrier peptide in which a cell-penetrating peptide is fused with a polycation sequence as a gene carrier. The dsRNA-peptide complex is 100-300 nm in diameter and positively charged. Infiltration of the complex into intact leaf cells of Arabidopsis thaliana successfully induced rapid and efficient down-regulation of exogenous and endogenous genes such as yellow fluorescent protein and chalcone synthase. The present method realizes quick and local gene silencing in specific tissues and/or organs in plants. © 2014 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
USDA-ARS?s Scientific Manuscript database
Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...
Chen, Q W; Jin, S; Zhang, L; Shen, Q D; Wei, P; Wei, Z M; Wang, S G; Tang, B
2018-06-01
RNA interference (RNAi) is a very effective technique for studying gene function and may be an efficient method for controlling pests. Trehalose-6-phosphate synthase (TPS), which plays a key role in the synthesis of trehalose and insect development, was cloned in Tribolium castaneum (Herbst) (TcTPS) and the putative functions were studied using RNAi via the injection of double-stranded RNA (dsRNA) corresponding to conserved TPS and trehalose-6-phosphate phosphatase domains. Expression analyses show that TcTPS is expressed higher in the fat body, while quantitative real-time polymerase chain reaction results show that the expression of four trehalase isoforms was significantly suppressed by dsTPS injection. Additionally, the expression of six chitin synthesis-related genes, such as hexokinase 2 and glutamine-fructose-6-phosphate aminotransferase, was suppressed at 48 and 72 h post-dsTPS-1 and dsTPS-2 RNA injection, which were two dsTPS fragments that had been designed for two different locations in TcTPS open reading frame, and that trehalose content and trehalase 1 activity decreased significantly at 72 h post-dsRNA injection. Furthermore, T. castaneum injected with dsTPS-1 and dsTPS-2 RNA displayed significantly lower levels of chitin and could not complete the molting process from larvae to pupae, revealing abnormal molting phenotypes. These results demonstrate that silencing TPS gene leads to molting deformities and high mortality rates via regulation of gene expression in the chitin biosynthetic pathway, and may be a promising approach for pest control in the future.
The RNA-induced silencing complex: a versatile gene-silencing machine.
Pratt, Ashley J; MacRae, Ian J
2009-07-03
RNA interference is a powerful mechanism of gene silencing that underlies many aspects of eukaryotic biology. On the molecular level, RNA interference is mediated by a family of ribonucleoprotein complexes called RNA-induced silencing complexes (RISCs), which can be programmed to target virtually any nucleic acid sequence for silencing. The ability of RISC to locate target RNAs has been co-opted by evolution many times to generate a broad spectrum of gene-silencing pathways. Here, we review the fundamental biochemical and biophysical properties of RISC that facilitate gene targeting and describe the various mechanisms of gene silencing known to exploit RISC activity.
Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.
Parrish, S; Fire, A
2001-10-01
RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed.
Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.
Parrish, S; Fire, A
2001-01-01
RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed. PMID:11680844
Heide, C; Pfeiffer, T; Nolan, J M; Hartmann, R K
1999-01-01
We have identified by nucleotide analog interference mapping (NAIM) exocyclic NH2 groups of guanosines in RNase P RNA from Escherichia coli that are important for tRNA binding. The majority of affected guanosines represent phylogenetically conserved nucleotides. Several sites of interference could be assigned to direct contacts with the tRNA moiety, whereas others were interpreted as reflecting indirect effects on tRNA binding due to the disruption of tertiary contacts within the catalytic RNA. Our results support the involvement of the 2-NH2 groups of G292/G293 in pairing with C74 and C75 of tRNA CCA-termini, as well as formation of two consecutive base triples involving C75 and A76 of CCA-ends interacting with G292/A258 and G291/G259, respectively. Moreover, we present first biochemical evidence for two tertiary contacts (L18/P8 and L8/P4) within the catalytic RNA, whose formation has been postulated previously on the basis of phylogenetic comparative analyses. The tRNA binding interference data obtained in this and our previous studies are consistent with the formation of a consecutive nucleotide triple and quadruple between the tetraloop L18 and helix P8. Formation of the nucleotide triple (G316 and A94:U104 in wild-type E. coli RNase P RNA) is also supported by mutational analysis. For the mutant RNase P RNA carrying a G94:C104 double mutation, an additional G316-to-A mutation resulted in a restoration of binding affinity for mature and precursor tRNA. PMID:9917070
Rodrigues, Thais B; Rieske, Lynne K; J Duan, Jian; Mogilicherla, Kanakachari; Palli, Subba R
2017-08-07
The ingestion of double-strand RNAs (dsRNA) targeting essential genes in an insect could cause mortality. Based on this principle, a new generation of insect control methods using RNA interference (RNAi) are being developed. In this work, we developed a bioassay for oral delivery of dsRNA to an invasive forest and urban tree pest, the emerald ash borer (EAB, Agrilus planipennis). EAB feeds and develops beneath the bark, killing trees rapidly. This behavior, coupled with the lack of a reliable artificial diet for rearing larvae and adults, make them difficult to study. We found that dsRNA is transported and processed to siRNAs by EAB larvae within 72 h after ingestion. Also, feeding neonate larvae with IAP (inhibitor of apoptosis) or COP (COPI coatomer, β subunit) dsRNA silenced their target genes and caused mortality. Both an increase in the concentration of dsRNA fed and sequential feeding of two different dsRNAs increased mortality. Here we provide evidence for successful RNAi in EAB, and demonstrate the development of a rapid and effective bioassay for oral delivery of dsRNA to screen additional genes.
Gene Silencing in Adult Aedes aegypti Mosquitoes Through Oral Delivery of Double-Stranded RNA
2012-01-01
utilization of dsRNA as a bio-insecticide against mosquitoes has only recently begun to be evaluated. Double-stranded RNA targeting chitin syn- thase...double- stranded RNA nanoparticle-mediated RNA interference to silence chitin synthase genes through larval feeding in the African malaria mosquito
Chen, Chen; Mei, Heng; Shi, Wei; Deng, Jun; Zhang, Bo; Guo, Tao; Wang, Huafang; Hu, Yu
2013-01-01
Injured endothelium is an important target for drug and/or gene therapy because brain microvascular endothelial cells (BMECs) play critical roles in various pathophysiological conditions. RNA-mediated gene silencing presents a new therapeutic approach for treating such diseases, but major challenge is to ensure minimal toxicity and target delivery of siRNA to injured BMECs. Injured BMECs overexpress tissue factor (TF), which the fusion protein EGFP-EGF1 could be targeted to. In this study, TNF alpha (TNF-α) was chosen as a stimulus for primary BMECs to produce injured endothelium in vitro. The EGFP-EGF1-PLGA nanoparticles (ENPs) with loaded TF-siRNA were used as a new carrier for targeted delivery to the injured BMECs. The nanoparticles then produced intracellular RNA interference against TF. We compared ENP-based transfections with NP-mediated transfections, and our studies show that the ENP-based transfections result in a more efficient downregulation of TF. Our findings also show that the TF siRNA-loaded ENPs had minimal toxicity, with almost 96% of the cells viable 24 h after transfection while Lipofectamine-based transfections resulted in only 75% of the cells. Therefore, ENP-based transfection could be used for efficient siRNA transfection to injured BMECs and for efficient RNA interference (RNAi). This transfection could serve as a potential treatment for diseases, such as stroke, atherosclerosis and cancer. PMID:23593330
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carbonell, Alberto; Martinez de Alba, Angel-Emilio; Flores, Ricardo
2008-02-05
Infection by viroids, non-protein-coding circular RNAs, occurs with the accumulation of 21-24 nt viroid-derived small RNAs (vd-sRNAs) with characteristic properties of small interfering RNAs (siRNAs) associated to RNA silencing. The vd-sRNAs most likely derive from dicer-like (DCL) enzymes acting on viroid-specific dsRNA, the key elicitor of RNA silencing, or on the highly structured genomic RNA. Previously, viral dsRNAs delivered mechanically or agroinoculated have been shown to interfere with virus infection in a sequence-specific manner. Here, we report similar results with members of the two families of nuclear- and chloroplast-replicating viroids. Moreover, homologous vd-sRNAs co-delivered mechanically also interfered with one ofmore » the viroids examined. The interference was sequence-specific, temperature-dependent and, in some cases, also dependent on the dose of the co-inoculated dsRNA or vd-sRNAs. The sequence-specific nature of these effects suggests the involvement of the RNA induced silencing complex (RISC), which provides sequence specificity to RNA silencing machinery. Therefore, viroid titer in natural infections might be regulated by the concerted action of DCL and RISC. Viroids could have evolved their secondary structure as a compromise between resistance to DCL and RISC, which act preferentially against RNAs with compact and relaxed secondary structures, respectively. In addition, compartmentation, association with proteins or active replication might also help viroids to elude their host RNA silencing machinery.« less
Soifer, Harris S; Zaragoza, Adriana; Peyvan, Maany; Behlke, Mark A; Rossi, John J
2005-01-01
Long interspersed nuclear elements (LINE-1 or L1) comprise 17% of the human genome, although only 80-100 L1s are considered retrotransposition-competent (RC-L1). Despite their small number, RC-L1s are still potential hazards to genome integrity through insertional mutagenesis, unequal recombination and chromosome rearrangements. In this study, we provide several lines of evidence that the LINE-1 retrotransposon is susceptible to RNA interference (RNAi). First, double-stranded RNA (dsRNA) generated in vitro from an L1 template is converted into functional short interfering RNA (siRNA) by DICER, the RNase III enzyme that initiates RNAi in human cells. Second, pooled siRNA from in vitro cleavage of L1 dsRNA, as well as synthetic L1 siRNA, targeting the 5'-UTR leads to sequence-specific mRNA degradation of an L1 fusion transcript. Finally, both synthetic and pooled siRNA suppressed retrotransposition from a highly active RC-L1 clone in cell culture assay. Our report is the first to demonstrate that a human transposable element is subjected to RNAi.
Lowering the quantification limit of the QubitTM RNA HS assay using RNA spike-in.
Li, Xin; Ben-Dov, Iddo Z; Mauro, Maurizio; Williams, Zev
2015-05-06
RNA quantification is often a prerequisite for most RNA analyses such as RNA sequencing. However, the relatively low sensitivity and large sample consumption of traditional RNA quantification methods such as UV spectrophotometry and even the much more sensitive fluorescence-based RNA quantification assays, such as the Qubit™ RNA HS Assay, are often inadequate for measuring minute levels of RNA isolated from limited cell and tissue samples and biofluids. Thus, there is a pressing need for a more sensitive method to reliably and robustly detect trace levels of RNA without interference from DNA. To improve the quantification limit of the Qubit™ RNA HS Assay, we spiked-in a known quantity of RNA to achieve the minimum reading required by the assay. Samples containing trace amounts of RNA were then added to the spike-in and measured as a reading increase over RNA spike-in baseline. We determined the accuracy and precision of reading increases between 1 and 20 pg/μL as well as RNA-specificity in this range, and compared to those of RiboGreen(®), another sensitive fluorescence-based RNA quantification assay. We then applied Qubit™ Assay with RNA spike-in to quantify plasma RNA samples. RNA spike-in improved the quantification limit of the Qubit™ RNA HS Assay 5-fold, from 25 pg/μL down to 5 pg/μL while maintaining high specificity to RNA. This enabled quantification of RNA with original concentration as low as 55.6 pg/μL compared to 250 pg/μL for the standard assay and decreased sample consumption from 5 to 1 ng. Plasma RNA samples that were not measurable by the Qubit™ RNA HS Assay were measurable by our modified method. The Qubit™ RNA HS Assay with RNA spike-in is able to quantify RNA with high specificity at 5-fold lower concentration and uses 5-fold less sample quantity than the standard Qubit™ Assay.
Cardiovascular RNA interference therapy: the broadening tool and target spectrum.
Poller, Wolfgang; Tank, Juliane; Skurk, Carsten; Gast, Martina
2013-08-16
Understanding of the roles of noncoding RNAs (ncRNAs) within complex organisms has fundamentally changed. It is increasingly possible to use ncRNAs as diagnostic and therapeutic tools in medicine. Regarding disease pathogenesis, it has become evident that confinement to the analysis of protein-coding regions of the human genome is insufficient because ncRNA variants have been associated with important human diseases. Thus, inclusion of noncoding genomic elements in pathogenetic studies and their consideration as therapeutic targets is warranted. We consider aspects of the evolutionary and discovery history of ncRNAs, as far as they are relevant for the identification and selection of ncRNAs with likely therapeutic potential. Novel therapeutic strategies are based on ncRNAs, and we discuss here RNA interference as a highly versatile tool for gene silencing. RNA interference-mediating RNAs are small, but only parts of a far larger spectrum encompassing ncRNAs up to many kilobasepairs in size. We discuss therapeutic options in cardiovascular medicine offered by ncRNAs and key issues to be solved before clinical translation. Convergence of multiple technical advances is highlighted as a prerequisite for the translational progress achieved in recent years. Regarding safety, we review properties of RNA therapeutics, which may immunologically distinguish them from their endogenous counterparts, all of which underwent sophisticated evolutionary adaptation to specific biological contexts. Although our understanding of the noncoding human genome is only fragmentary to date, it is already feasible to develop RNA interference against a rapidly broadening spectrum of therapeutic targets and to translate this to the clinical setting under certain restrictions.
Coles, Andrew H.; Osborn, Maire F.; Alterman, Julia F.; Turanov, Anton A.; Godinho, Bruno M.D.C.; Kennington, Lori; Chase, Kathryn; Aronin, Neil
2016-01-01
Preclinical development of RNA interference (RNAi)-based therapeutics requires a rapid, accurate, and robust method of simultaneously quantifying mRNA knockdown in hundreds of samples. The most well-established method to achieve this is quantitative real-time polymerase chain reaction (qRT-PCR), a labor-intensive methodology that requires sample purification, which increases the potential to introduce additional bias. Here, we describe that the QuantiGene® branched DNA (bDNA) assay linked to a 96-well Qiagen TissueLyser II is a quick and reproducible alternative to qRT-PCR for quantitative analysis of mRNA expression in vivo directly from tissue biopsies. The bDNA assay is a high-throughput, plate-based, luminescence technique, capable of directly measuring mRNA levels from tissue lysates derived from various biological samples. We have performed a systematic evaluation of this technique for in vivo detection of RNAi-based silencing. We show that similar quality data is obtained from purified RNA and tissue lysates. In general, we observe low intra- and inter-animal variability (around 10% for control samples), and high intermediate precision. This allows minimization of sample size for evaluation of oligonucleotide efficacy in vivo. PMID:26595721
RNA extraction from self-assembling peptide hydrogels to allow qPCR analysis of encapsulated cells.
Burgess, Kyle A; Workman, Victoria L; Elsawy, Mohamed A; Miller, Aline F; Oceandy, Delvac; Saiani, Alberto
2018-01-01
Self-assembling peptide hydrogels offer a novel 3-dimensional platform for many applications in cell culture and tissue engineering but are not compatible with current methods of RNA isolation; owing to interactions between RNA and the biomaterial. This study investigates the use of two techniques based on two different basic extraction principles: solution-based extraction and direct solid-state binding of RNA respectively, to extract RNA from cells encapsulated in four β-sheet forming self-assembling peptide hydrogels with varying net positive charge. RNA-peptide fibril interactions, rather than RNA-peptide molecular complexing, were found to interfere with the extraction process resulting in low yields. A column-based approach relying on RNA-specific binding was shown to be more suited to extracting RNA with higher purity from these peptide hydrogels owing to its reliance on strong specific RNA binding interactions which compete directly with RNA-peptide fibril interactions. In order to reduce the amount of fibrils present and improve RNA yields a broad spectrum enzyme solution-pronase-was used to partially digest the hydrogels before RNA extraction. This pre-treatment was shown to significantly increase the yield of RNA extracted, allowing downstream RT-qPCR to be performed.
Wuriyanghan, Hada; Falk, Bryce W.
2013-01-01
The potato/tomato psyllid, Bactericera cockerelli (B. cockerelli), is an important plant pest and the vector of the phloem-limited bacterium Candidatus Liberibacter psyllaurous (solanacearum), which is associated with the zebra chip disease of potatoes. Previously, we reported induction of RNA interference effects in B. cockerelli via in vitro-prepared dsRNA/siRNAs after intrathoracic injection, and after feeding of artificial diets containing these effector RNAs. In order to deliver RNAi effectors via plant hosts and to rapidly identify effective target sequences in plant-feeding B. cockerelli, here we developed a plant virus vector-based in planta system for evaluating candidate sequences. We show that recombinant Tobacco mosaic virus (TMV) containing B. cockerelli sequences can efficiently infect and generate small interfering RNAs in tomato (Solanum lycopersicum), tomatillo (Physalis philadelphica) and tobacco (Nicotiana tabacum) plants, and more importantly delivery of interfering sequences via TMV induces RNAi effects, as measured by actin and V-ATPase mRNA reductions, in B. cockerelli feeding on these plants. RNAi effects were primarily detected in the B. cockerelli guts. In contrast to our results with TMV, recombinant Potato virus X (PVX) and Tobacco rattle virus (TRV) did not give robust infections in all plants and did not induce detectable RNAi effects in B. cockerelli. The greatest RNA interference effects were observed when B. cockerelli nymphs were allowed to feed on leaf discs collected from inoculated or lower expanded leaves from corresponding TMV-infected plants. Tomatillo plants infected with recombinant TMV containing B. cockerelli actin or V-ATPase sequences also showed phenotypic effects resulting in decreased B. cockerelli progeny production as compared to plants infected by recombinant TMV containing GFP. These results showed that RNAi effects can be achieved in plants against the phloem feeder, B. cockerelli, and the TMV-plant system will provide a faster and more convenient method for screening of suitable RNAi target sequences in planta. PMID:23824081
SiLEncing SLE: the power and promise of small noncoding RNAs.
Rigby, Robert J; Vinuesa, Carola G
2008-09-01
In this study, we outline the evidence suggesting that defects in the RNA silencing machinery can lead to the prototypic systemic autoimmune disease, systemic lupus erythematosus, and describe the potential for RNA interference to provide novel therapeutic agents. Over the last year, a class of small noncoding RNAs--microRNAs--have been shown to play key roles in immune regulation including T-cell selection in the thymus, B cell affinity maturation and selection in germinal centres, and development of regulatory T cells, suggesting that the microRNA machinery may be crucial in the maintenance of immunological tolerance. Two RNA silencing mechanisms have been shown to be involved in lupus pathogenesis: failed Roquin-mediated repression of inducible costimulatory receptors messenger RNA through miR-101 in roquin(san/san) mice and decreased expression of pro-apoptotic molecule and phosphatase and tensin homologue on chromosome 10 in mice transgenic for the miR-17-92 cluster, leading to lymphoproliferation and other lupus manisfestations. MicroRNA array experiments performed on peripheral blood mononuclear cells have revealed different expression profiles in systemic lupus erythematosus patients. RNA interference has also been used ex vivo to silence dysregulated T-cell molecules in cells from systemic lupus erythematosus patients. Dysregulation of the RNA silencing machinery has been implicated in systemic lupus erythematosus pathogenesis. Although microRNA profiling may prove to be a useful diagnostic and prognostic tool for a notoriously heterogeneous disease, manipulation of RNA interference emerges as a powerful and potentially specific means to correct dysregulated gene expression in systemic lupus erythematosus patients.
Utilization of a tobacco rattle virus vector to clone an Nicotiana benthamiana cDNA library for VIGS
USDA-ARS?s Scientific Manuscript database
Virus-induced gene silencing (VIGS) is an efficient and rapid method to identify plant gene functions. One of the most widely used VIGS vectors is Tobacco rattle virus (TRV) which has been used successfully for RNA interference (RNAi) in N. benthamiana and tomato. We previously modified a TRV VIGS v...
Deng, Yan; Wang, Chi Chiu; Choy, Kwong Wai; Du, Quan; Chen, Jiao; Wang, Qin; Li, Lu; Chung, Tony Kwok Hung; Tang, Tao
2014-04-01
During recent decades there have been remarkable advances in biology, in which one of the most important discoveries is RNA interference (RNAi). RNAi is a specific post-transcriptional regulatory pathway that can result in silencing gene functions. Efforts have been done to translate this new discovery into clinical applications for disease treatment. However, technical difficulties restrict the development of RNAi, including stability, off-target effects, immunostimulation and delivery problems. Researchers have attempted to surmount these barriers and improve the bioavailability and safety of RNAi-based therapeutics by optimizing the chemistry and structure of these molecules. This paper aimed to describe the principles of RNA interference, review the therapeutic potential in various diseases and discuss the new strategies for in vivo delivery of RNAi to overcome the challenges. Copyright © 2013 Elsevier B.V. All rights reserved.
Hu, Hui; Lu, Hong; He, Zhanping; Han, Xiangjun; Chen, Jing; Tu, Rong
2012-01-01
To investigate the effects of mRNA interference on aquaporin-4 expression in swollen tissue of rats with ischemic cerebral edema, and diagnose the significance of diffusion-weighted MRI, we injected 5 μL shRNA- aquaporin-4 (control group) or siRNA- aquaporin-4 solution (1:800) (RNA interference group) into the rat right basal ganglia immediately before occlusion of the middle cerebral artery. At 0.25 hours after occlusion of the middle cerebral artery, diffusion-weighted MRI displayed a high signal; within 2 hours, the relative apparent diffusion coefficient decreased markedly, aquaporin-4 expression increased rapidly, and intracellular edema was obviously aggravated; at 4 and 6 hours, the relative apparent diffusion coefficient slowly returned to control levels, aquaporin-4 expression slightly increased, and angioedema was observed. In the RNA interference group, during 0.25–6 hours after injection of siRNA- aquaporin-4 solution, the relative apparent diffusion coefficient slightly fluctuated and aquaporin-4 expression was upregulated; during 0.5–4 hours, the relative apparent diffusion coefficient was significantly higher, while aquaporin-4 expression was significantly lower when compared with the control group, and intracellular edema was markedly reduced; at 0.25 and 6 hours, the relative apparent diffusion coefficient and aquaporin-4 expression were similar when compared with the control group; obvious angioedema remained at 6 hours. Pearson's correlation test results showed that aquaporin-4 expression was negatively correlated with the apparent diffusion coefficient (r = −0.806, P < 0.01). These findings suggest that upregulated aquaporin-4 expression is likely to be the main molecular mechanism of intracellular edema and may be the molecular basis for decreased relative apparent diffusion coefficient. Aquaporin-4 gene interference can effectively inhibit the upregulation of aquaporin-4 expression during the stage of intracellular edema with time-effectiveness. Moreover, diffusion-weighted MRI can accurately detect intracellular edema. PMID:25657707
Hu, Hui; Lu, Hong; He, Zhanping; Han, Xiangjun; Chen, Jing; Tu, Rong
2012-07-25
To investigate the effects of mRNA interference on aquaporin-4 expression in swollen tissue of rats with ischemic cerebral edema, and diagnose the significance of diffusion-weighted MRI, we injected 5 μL shRNA- aquaporin-4 (control group) or siRNA- aquaporin-4 solution (1:800) (RNA interference group) into the rat right basal ganglia immediately before occlusion of the middle cerebral artery. At 0.25 hours after occlusion of the middle cerebral artery, diffusion-weighted MRI displayed a high signal; within 2 hours, the relative apparent diffusion coefficient decreased markedly, aquaporin-4 expression increased rapidly, and intracellular edema was obviously aggravated; at 4 and 6 hours, the relative apparent diffusion coefficient slowly returned to control levels, aquaporin-4 expression slightly increased, and angioedema was observed. In the RNA interference group, during 0.25-6 hours after injection of siRNA- aquaporin-4 solution, the relative apparent diffusion coefficient slightly fluctuated and aquaporin-4 expression was upregulated; during 0.5-4 hours, the relative apparent diffusion coefficient was significantly higher, while aquaporin-4 expression was significantly lower when compared with the control group, and intracellular edema was markedly reduced; at 0.25 and 6 hours, the relative apparent diffusion coefficient and aquaporin-4 expression were similar when compared with the control group; obvious angioedema remained at 6 hours. Pearson's correlation test results showed that aquaporin-4 expression was negatively correlated with the apparent diffusion coefficient (r = -0.806, P < 0.01). These findings suggest that upregulated aquaporin-4 expression is likely to be the main molecular mechanism of intracellular edema and may be the molecular basis for decreased relative apparent diffusion coefficient. Aquaporin-4 gene interference can effectively inhibit the upregulation of aquaporin-4 expression during the stage of intracellular edema with time-effectiveness. Moreover, diffusion-weighted MRI can accurately detect intracellular edema.
Ewing's Sarcoma: Development of RNA Interference-Based Therapy for Advanced Disease
Simmons, Olivia; Maples, Phillip B.; Senzer, Neil; Nemunaitis, John
2012-01-01
Ewing's sarcoma tumors are associated with chromosomal translocation between the EWS gene and the ETS transcription factor gene. These unique target sequences provide opportunity for RNA interference(i)-based therapy. A summary of RNAi mechanism and therapeutically designed products including siRNA, shRNA and bi-shRNA are described. Comparison is made between each of these approaches. Systemic RNAi-based therapy, however, requires protected delivery to the Ewing's sarcoma tumor site for activity. Delivery systems which have been most effective in preclinical and clinical testing are reviewed, followed by preclinical assessment of various silencing strategies with demonstration of effectiveness to EWS/FLI-1 target sequences. It is concluded that RNAi-based therapeutics may have testable and achievable activity in management of Ewing's sarcoma. PMID:22523703
Elhassan, Mohamed O.; Christie, Jennifer; Duxbury, Mark S.
2012-01-01
Locally initiated RNA interference (RNAi) has the potential for spatial propagation, inducing posttranscriptional gene silencing in distant cells. In Caenorhabditis elegans, systemic RNAi requires a phylogenetically conserved transmembrane channel, SID-1. Here, we show that a human SID-1 orthologue, SIDT1, facilitates rapid, contact-dependent, bidirectional small RNA transfer between human cells, resulting in target-specific non-cell-autonomous RNAi. Intercellular small RNA transfer can be both homotypic and heterotypic. We show SIDT1-mediated intercellular transfer of microRNA-21 to be a driver of resistance to the nucleoside analog gemcitabine in human adenocarcinoma cells. Documentation of a SIDT1-dependent small RNA transfer mechanism and the associated phenotypic effects on chemoresistance in human cancer cells raises the possibility that conserved systemic RNAi pathways contribute to the acquisition of drug resistance. Mediators of non-cell-autonomous RNAi may be tractable targets for novel therapies aimed at improving the efficacy of current cytotoxic agents. PMID:22174421
Oral delivery of dsRNA by microbes: Beyond pest control.
Abrieux, Antoine; Chiu, Joanna C
2016-01-01
RNA interference (RNAi) by oral delivery of dsRNA in insects has great potential as a tool for integrated pest management (IPM), especially with respect to addressing the need to reduce off-target effect and slow down resistance development to chemical insecticides. Employing the natural association existing between insect and yeast, we developed a novel method to enable the knock down of vital genes in the pest insect Drosophila suzukii through oral delivery of species-specific dsRNA using genetically modified Saccharomyces cerevisae. D. suzukii that were fed with our "yeast biopesticide" showed a significant decrease in fitness. In this perspective article, we postulate that this approach could be adapted to a large number of species, given the great diversity of symbiotic interactions involving microorganisms and host species. Furthermore, we speculate that beyond its application as biopesticide, dsRNA delivery by genetically modified microbes can also serve to facilitate reverse genetic applications, specifically in non-model organisms.
Kesanakurti, Prasad; Belton, Mark; Saeed, Hanaa; Rast, Heidi; Boyes, Ian; Rott, Michael
2016-10-01
The majority of plant viruses contain RNA genomes. Detection of viral RNA genomes in infected plant material by next generation sequencing (NGS) is possible through the extraction and sequencing of total RNA, total RNA devoid of ribosomal RNA, small RNA interference (RNAi) molecules, or double stranded RNA (dsRNA). Plants do not typically produce high molecular weight dsRNA, therefore the presence of dsRNA makes it an attractive target for plant virus diagnostics. The sensitivity of NGS as a diagnostic method demands an effective dsRNA protocol that is both representative of the sample and minimizes sample cross contamination. We have developed a modified dsRNA extraction protocol that is more efficient compared to traditional protocols, requiring reduced amounts of starting material, that is less prone to sample cross contamination. This was accomplished by using bead based homogenization of plant material in closed, disposable 50ml tubes. To assess the quality of extraction, we also developed an internal control by designing a real-time (quantitative) PCR (qPCR) assay that targets endornaviruses present in Phaseolus vulgaris cultivar Black Turtle Soup (BTS). Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.
Hydrophobization and bioconjugation for enhanced siRNA delivery and targeting
De Paula, Daniel; Bentley, M. Vitória L.B.; Mahato, Ram I.
2007-01-01
RNA interference (RNAi) is an evolutionarily conserved process by which double-stranded small interfering RNA (siRNA) induces sequence-specific, post-transcriptional gene silencing. Unlike other mRNA targeting strategies, RNAi takes advantage of the physiological gene silencing machinery. The potential use of siRNA as therapeutic agents has attracted great attention as a novel approach for treating severe and chronic diseases. RNAi can be achieved by either delivery of chemically synthesized siRNAs or endogenous expression of small hairpin RNA, siRNA, and microRNA (miRNA). However, the relatively high dose of siRNA required for gene silencing limits its therapeutic applications. This review discusses several strategies to improve therapeutic efficacy as well as to abrogate off-target effects and immunostimulation caused by siRNAs. There is an in-depth discussion on various issues related to the (1) mechanisms of RNAi, (2) methods of siRNA production, (3) barriers to RNAi-based therapies, (4) biodistribution, (5) design of siRNA molecules, (6) chemical modification and bioconjugation, (7) complex formation with lipids and polymers, (8) encapsulation into lipid particles, and (9) target specificity for enhanced therapeutic effectiveness. PMID:17329355
RNA Interference: Biology, Mechanism, and Applications
Agrawal, Neema; Dasaradhi, P. V. N.; Mohmmed, Asif; Malhotra, Pawan; Bhatnagar, Raj K.; Mukherjee, Sunil K.
2003-01-01
Double-stranded RNA-mediated interference (RNAi) is a simple and rapid method of silencing gene expression in a range of organisms. The silencing of a gene is a consequence of degradation of RNA into short RNAs that activate ribonucleases to target homologous mRNA. The resulting phenotypes either are identical to those of genetic null mutants or resemble an allelic series of mutants. Specific gene silencing has been shown to be related to two ancient processes, cosuppression in plants and quelling in fungi, and has also been associated with regulatory processes such as transposon silencing, antiviral defense mechanisms, gene regulation, and chromosomal modification. Extensive genetic and biochemical analysis revealed a two-step mechanism of RNAi-induced gene silencing. The first step involves degradation of dsRNA into small interfering RNAs (siRNAs), 21 to 25 nucleotides long, by an RNase III-like activity. In the second step, the siRNAs join an RNase complex, RISC (RNA-induced silencing complex), which acts on the cognate mRNA and degrades it. Several key components such as Dicer, RNA-dependent RNA polymerase, helicases, and dsRNA endonucleases have been identified in different organisms for their roles in RNAi. Some of these components also control the development of many organisms by processing many noncoding RNAs, called micro-RNAs. The biogenesis and function of micro-RNAs resemble RNAi activities to a large extent. Recent studies indicate that in the context of RNAi, the genome also undergoes alterations in the form of DNA methylation, heterochromatin formation, and programmed DNA elimination. As a result of these changes, the silencing effect of gene functions is exercised as tightly as possible. Because of its exquisite specificity and efficiency, RNAi is being considered as an important tool not only for functional genomics, but also for gene-specific therapeutic activities that target the mRNAs of disease-related genes. PMID:14665679
Ran, Ruixue; Li, Tianyu; Liu, Xinxin; Ni, Hejia; Li, Wenbin; Meng, Fanli
2018-01-01
RNA interference (RNAi) technology may be useful for developing new crop protection strategies against the soybean pod borer (SPB; Leguminivora glycinivorella ), which is a critical soybean pest in northeastern Asia. Immune-related genes have been recently identified as potential RNAi targets for controlling insects. However, little is known about these genes or mechanisms underlying their expression in the SPB. In this study, we completed a transcriptome-wide analysis of SPB immune-related genes. We identified 41 genes associated with SPB microbial recognition proteins, immune-related effectors or signalling molecules in immune response pathways (e.g., Toll and immune deficiency pathways). Eleven of these genes were selected for a double-stranded RNA artificial feeding assay. The down-regulated expression levels of LgToll-5-1a and LgPGRP-LB2a resulted in relatively high larval mortality rates and abnormal development. Our data represent a comprehensive genetic resource for immune-related SPB genes, and may contribute to the elucidation of the mechanism regulating innate immunity in Lepidoptera species. Furthermore, two immune-related SPB genes were identified as potential RNAi targets, which may be used in the development of RNAi-mediated SPB control methods.
Ran, Ruixue; Li, Tianyu; Liu, Xinxin; Ni, Hejia; Li, Wenbin
2018-01-01
RNA interference (RNAi) technology may be useful for developing new crop protection strategies against the soybean pod borer (SPB; Leguminivora glycinivorella), which is a critical soybean pest in northeastern Asia. Immune-related genes have been recently identified as potential RNAi targets for controlling insects. However, little is known about these genes or mechanisms underlying their expression in the SPB. In this study, we completed a transcriptome-wide analysis of SPB immune-related genes. We identified 41 genes associated with SPB microbial recognition proteins, immune-related effectors or signalling molecules in immune response pathways (e.g., Toll and immune deficiency pathways). Eleven of these genes were selected for a double-stranded RNA artificial feeding assay. The down-regulated expression levels of LgToll-5-1a and LgPGRP-LB2a resulted in relatively high larval mortality rates and abnormal development. Our data represent a comprehensive genetic resource for immune-related SPB genes, and may contribute to the elucidation of the mechanism regulating innate immunity in Lepidoptera species. Furthermore, two immune-related SPB genes were identified as potential RNAi targets, which may be used in the development of RNAi-mediated SPB control methods. PMID:29910977
Yoon, June-Sun; Gurusamy, Dhandapani; Palli, Subba Reddy
2017-11-01
RNA interference (RNAi) efficiency varies among insects studied. The barriers for successful RNAi include the presence of double-stranded ribonucleases (dsRNase) in the lumen and hemolymph that could potentially digest double-stranded RNA (dsRNA) and the variability in the transport of dsRNA into and within the cells. We recently showed that the dsRNAs are transported into lepidopteran cells, but they are not processed into small interference RNAs (siRNAs) because they are trapped in acidic bodies. In the current study, we focused on the identification of acidic bodies in which dsRNAs accumulate in Sf9 cells. Time-lapse imaging studies showed that dsRNAs enter Sf9 cells and accumulate in acidic bodies within 20 min after their addition to the medium. CypHer-5E-labeled dsRNA also accumulated in the midgut and fat body dissected from Spodoptera frugiperda larvae with similar patterns observed in Sf9 cells. Pharmacological inhibitor assays showed that the dsRNAs use clathrin mediated endocytosis pathway for transport into the cells. We investigated the potential dsRNA accumulation sites employing LysoTracker and double labeling experiments using the constructs to express a fusion of green fluorescence protein with early or late endosomal marker proteins and CypHer-5E-labeled dsRNA. Interestingly, CypHer-5E-labeled dsRNA accumulated predominantly in early and late endosomes. These data suggest that entrapment of internalized dsRNA in endosomes is one of the major factors contributing to inefficient RNAi response in lepidopteran insects. Copyright © 2017 Elsevier Ltd. All rights reserved.
Hutson, Thomas H.; Foster, Edmund; Dawes, John M.; Hindges, Robert; Yáñez-Muñoz, Rafael J.; Moon, Lawrence D.F.
2017-01-01
Background Knocking down neuronal LINGO-1 using short hairpin RNAs (shRNAs) might enhance axon regeneration in the CNS. Integration-deficient lentiviral vectors have great potential as a therapeutic delivery system for CNS injuries. However, recent studies have revealed that shRNAs can induce an interferon response resulting in off-target effects and cytotoxicity. Methods CNS neurons were transduced with integration-deficient lentiviral vectors in vitro. The transcriptional effect of shRNA expression was analysed using qRT-PCR and northern blots were used to assess shRNA production. Results Integration-deficient lentiviral vectors efficiently transduced CNS neurons and knocked down LINGO-1 mRNA in vitro. However, an increase in cell death was observed when lentiviral vectors encoding an shRNA were applied or when high vector concentrations were used. We demonstrate that high doses of vector or the use of vectors encoding shRNAs can induce an up-regulation of interferon stimulated genes (OAS1 and PKR) and a down-regulation of off- target genes (including p75NTR and NgR1). Furthermore, the northern blot demonstrated that these negative consequences occur even when lentiviral vectors express low levels of shRNAs. Together, these results may explain why neurite outgrowth was not enhanced on an inhibitory substrate after transduction with lentiviral vectors encoding an shRNA targeting LINGO-1. Conclusions These findings highlight the importance of including appropriate controls to verify silencing specificity and the requirement to check for an interferon response when conducting RNA interference experiments. However, the potential benefits that RNA interference and viral vectors offer to gene-based therapies to CNS injuries cannot be overlooked and demand further investigation. PMID:22499506
Manipulation of Cell Physiology Enables Gene Silencing in Well-differentiated Airway Epithelia
Krishnamurthy, Sateesh; Behlke, Mark A; Ramachandran, Shyam; Salem, Aliasger K; McCray Jr, Paul B; Davidson, Beverly L
2012-01-01
The application of RNA interference-based gene silencing to the airway surface epithelium holds great promise to manipulate host and pathogen gene expression for therapeutic purposes. However, well-differentiated airway epithelia display significant barriers to double-stranded small-interfering RNA (siRNA) delivery despite testing varied classes of nonviral reagents. In well-differentiated primary pig airway epithelia (PAE) or human airway epithelia (HAE) grown at the air–liquid interface (ALI), the delivery of a Dicer-substrate small-interfering RNA (DsiRNA) duplex against hypoxanthine–guanine phosphoribosyltransferase (HPRT) with several nonviral reagents showed minimal uptake and no knockdown of the target. In contrast, poorly differentiated cells (2–5-day post-seeding) exhibited significant oligonucleotide internalization and target knockdown. This finding suggested that during differentiation, the barrier properties of the epithelium are modified to an extent that impedes oligonucleotide uptake. We used two methods to overcome this inefficiency. First, we tested the impact of epidermal growth factor (EGF), a known enhancer of macropinocytosis. Treatment of the cells with EGF improved oligonucleotide uptake resulting in significant but modest levels of target knockdown. Secondly, we used the connectivity map (Cmap) database to correlate gene expression changes during small molecule treatments on various cells types with genes that change upon mucociliary differentiation. Several different drug classes were identified from this correlative assessment. Well-differentiated epithelia treated with DsiRNAs and LY294002, a PI3K inhibitor, significantly improved gene silencing and concomitantly reduced target protein levels. These novel findings reveal that well-differentiated airway epithelia, normally resistant to siRNA delivery, can be pretreated with small molecules to improve uptake of synthetic oligonucleotide and RNA interference (RNAi) responses. PMID:23344182
Göertz, G P; Fros, J J; Miesen, P; Vogels, C B F; van der Bent, M L; Geertsema, C; Koenraadt, C J M; van Rij, R P; van Oers, M M; Pijlman, G P
2016-11-15
Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5'-3' exoribonuclease XRN1/Pacman on conserved RNA structures in the 3' untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo Two reproducible small-RNA hot spots within the 3' UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3' SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. Understanding the flavivirus transmission cycle is important to identify novel targets to interfere with disease and to aid development of virus control strategies. Flaviviruses produce an abundant noncoding viral RNA called sfRNA in both arthropod and mammalian cells. To evaluate the role of sfRNA in flavivirus transmission, we infected mosquitoes with the flavivirus West Nile virus and an sfRNA-deficient mutant West Nile virus. We demonstrate that sfRNA determines the infection and transmission rates of West Nile virus in Culex pipiens mosquitoes. Comparison of infection via the blood meal versus intrathoracic injection, which bypasses the midgut, revealed that sfRNA is important to overcome the mosquito midgut barrier. We also show that sfRNA is processed by the antiviral RNA interference machinery in mosquitoes. This is the first report to describe a pivotal biological function of sfRNA in arthropods. The results explain why sfRNA production is evolutionarily conserved. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Göertz, G. P.; Fros, J. J.; Miesen, P.; Vogels, C. B. F.; van der Bent, M. L.; Geertsema, C.; Koenraadt, C. J. M.; van Oers, M. M.
2016-01-01
ABSTRACT Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5′-3′ exoribonuclease XRN1/Pacman on conserved RNA structures in the 3′ untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo. Two reproducible small-RNA hot spots within the 3′ UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3′ SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. IMPORTANCE Understanding the flavivirus transmission cycle is important to identify novel targets to interfere with disease and to aid development of virus control strategies. Flaviviruses produce an abundant noncoding viral RNA called sfRNA in both arthropod and mammalian cells. To evaluate the role of sfRNA in flavivirus transmission, we infected mosquitoes with the flavivirus West Nile virus and an sfRNA-deficient mutant West Nile virus. We demonstrate that sfRNA determines the infection and transmission rates of West Nile virus in Culex pipiens mosquitoes. Comparison of infection via the blood meal versus intrathoracic injection, which bypasses the midgut, revealed that sfRNA is important to overcome the mosquito midgut barrier. We also show that sfRNA is processed by the antiviral RNA interference machinery in mosquitoes. This is the first report to describe a pivotal biological function of sfRNA in arthropods. The results explain why sfRNA production is evolutionarily conserved. PMID:27581979
Drevytska, T; Gonchar, E; Okhai, I; Lynnyk, O; Mankovska, I; Klionsky, D; Dosenko, V
2018-06-01
The aim of this study was to investigate the molecular mechanisms underlying the protective effects of hypoxia-inducible factor (HIF) signaling pathway activation in cardiomyocytes under anoxia-reoxygenation (A/R) injury. In this study, rat neonatal cardiomyocytes were pretreated with anti-Hif3A/Hif-3α siRNA or HIF-prolyl hydroxylase inhibitor prior to A/R injury. Our results showed that both HIF3A silencing and HIF-prolyl hydroxylase inhibition effectively increased the cell viability during A/R, led to changes in mRNA expression of HIF1-target genes, and reduced the loss of mitochondrial membrane potential (Δψ m ). Furthermore, application of anti-Hif3a siRNA led to an increase in mRNA expression of Epo, Igf1, Slc2a1/Glut-1, and Slc2a4/Glut-4. Similar results were observed with HIF-prolyl hydroxylase inhibition, which additionally upregulated the mRNA expression of Epor, Tert, and Pdk1. Hif3a RNA-interference and application of HIF-prolyl hydroxylase inhibitor during A/R modelling led to an increase of Δψ m on 11.5 and 11.9 mV respectively, compared to the control groups. Thus, Hif3a RNA interference and HIF-prolyl hydroxylase inhibition protect cardiomyocytes against A/R injury via the HIF signaling pathway. Copyright © 2018 Elsevier Inc. All rights reserved.
Knockdown of RNA interference pathway genes impacts the fitness of western corn rootworm.
Davis-Vogel, Courtney; Ortiz, Angel; Procyk, Lisa; Robeson, Jonathan; Kassa, Adane; Wang, Yiwei; Huang, Emily; Walker, Carl; Sethi, Amit; Nelson, Mark E; Sashital, Dipali G
2018-05-18
Western corn rootworm (Diabrotica virgifera virgifera) is a serious agricultural pest known for its high adaptability to various management strategies, giving rise to a continual need for new control options. Transgenic maize expressing insecticidal RNAs represents a novel mode of action for rootworm management that is dependent on the RNA interference (RNAi) pathways of the insect for efficacy. Preliminary evidence suggests that western corn rootworm could develop broad resistance to all insecticidal RNAs through changes in RNAi pathway genes; however, the likelihood of field-evolved resistance occurring through this mechanism remains unclear. In the current study, eight key genes involved in facilitating interference in the microRNA and small interfering RNA pathways were targeted for knockdown in order to evaluate impact on fitness of western corn rootworm. These genes include drosha, dicer-1, dicer-2, pasha, loquacious, r2d2, argonaute 1, and argonaute 2. Depletion of targeted transcripts in rootworm larvae led to changes in microRNA expression, decreased ability to pupate, reduced adult beetle emergence, and diminished reproductive capacity. The observed effects do not support evolution of resistance through changes in expression of these eight genes due to reduced insect fitness.
Smyth, Redmond P; Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe; von Kleist, Max; Marquet, Roland
2018-05-18
Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5' region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5' PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production.
Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe
2018-01-01
Abstract Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5′ region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5′ PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production. PMID:29514260
Dan Cullen
2004-01-01
In contrast to DNA, messenger RNA (mRNA) in complex substrata is rarely analyzed, in large part because labile RNA molecules are difficult to purify. Nucleic acid extractions from fungi that colonize soil are particularly difficult and plagued by humic substances that interfere with Taq polymerase (Tebbe and Vahjen 1993 and references therein). Magnetic capture...
RNA interference-based nanosystems for inflammatory bowel disease therapy
Guo, Jian; Jiang, Xiaojing; Gui, Shuangying
2016-01-01
Inflammatory bowel disease (IBD), which includes ulcerative colitis and Crohn’s disease, is a chronic, recrudescent disease that invades the gastrointestinal tract, and it requires surgery or lifelong medicinal therapy. The conventional medicinal therapies for IBD, such as anti-inflammatories, glucocorticoids, and immunosuppressants, are limited because of their systemic adverse effects and toxicity during long-term treatment. RNA interference (RNAi) precisely regulates susceptibility genes to decrease the expression of proinflammatory cytokines related to IBD, which effectively alleviates IBD progression and promotes intestinal mucosa recovery. RNAi molecules generally include short interfering RNA (siRNA) and microRNA (miRNA). However, naked RNA tends to degrade in vivo as a consequence of endogenous ribonucleases and pH variations. Furthermore, RNAi treatment may cause unintended off-target effects and immunostimulation. Therefore, nanovectors of siRNA and miRNA were introduced to circumvent these obstacles. Herein, we introduce non-viral nanosystems of RNAi molecules and discuss these systems in detail. Additionally, the delivery barriers and challenges associated with RNAi molecules will be discussed from the perspectives of developing efficient delivery systems and potential clinical use. PMID:27789943
Using RNA Interference to Reveal Genetic Vulnerabilities in Human Cancer Cells
2005-07-01
pl of RNase/DNase free water and performed PCR amplification in 50pl reaction volumes using Invitrogen’s Platinum® Pfx DNA Polymerase . To obtain a...destroyed1’ 2. This pathway, known as RNA interference (RNAi), has been exploited in organisms ranging from plants to fungi to animals for...experimentally alter its targeting capability. Indeed such strategies have previously succeeded in both plants and animals23. My initial studies
Interfering RNA with multi-targets for efficient gene suppression in HCC cells.
Li, Tiejun; Zhu, York Yuanyuan; Ji, Yi; Zhou, Songfeng
2018-06-01
RNA interference (RNAi) technology has been widely used in therapeutics development, especially multiple targeted RNAi strategy, which is a better method for multiple gene suppression. In the study, interfering RNAs (iRNAs) were designed for carrying two or three different siRNA sequences in different secondary structure formats (loop or cloverleaf). By using these types of iRNAs, co-inhibition of survivin and B-cell lymphoma-2 (Bcl-2) was investigated in hepatocellular carcinoma (HCC) cells, and we obtained promising gene silencing effects without showing undesirable interferon response. Furthermore, suppression effects on proliferation, invasion, and induced apoptosis in HCC cells were validated. The results suggest that long iRNAs with secondary structure may be a preferred strategy for multigenic disease therapy, especially for cancer and viral gene therapy and their iRNA drug development.
Nayak, D P; Tobita, K; Janda, J M; Davis, A R; De, B K
1978-01-01
A temperature-sensitive group II mutant of influenza virus, ts-52, with a presumed defect in viral RNA synthesis, readily produced von Magnus-type defective interfering virus (DI virus) when passed serially (four times) at high multiplicity in MDBK cells. The defective virus (ts-52 DI virus) had a high hemagglutinin and a low infectivity titer, and strongly interfered with the replication of standard infectious viruses (both ts-52 and wild-type ts+) in co-infected cells. Progeny virus particles produced by co-infection of DI virus and infectious virus were also defective and also had low infectivity, high hemagglutinating activity, and a strong interfering property. Infectious viruses ts+ and ts-52 were indistinguishable from ts-52 DI viruses by sucrose velocity or density gradient analysis. Additionally, these viruses all possessed similar morphology. However, when the RNA of DI viruses was analyzed by use of polyacrylamide gels containing 6 M urea, there was a reduction in the amount of large RNA species (V1 to V4), and a number of new smaller RNA species (D1 to D6) with molecular weights ranging from 2.9 X 10(5) to 1.05 X 10(5) appeared. Since these smaller RNA species (D1 to D6) were absent in some clones of infectious viruses, but were consistently associated with DI viruses and increased during undiluted passages and during co-infection of ts-52 with DI virus, they appeared to be a characteristic of DI viruses. Additionally, the UV target size of interfering activity and infectivity of DI virus indicated that interfering activity was 40 times more resistant to UV irradiation than was infectivity, further implicating small RNA molecules in interference. Our data suggest that the loss of infectivity observed among DI viruses may be due to nonspecific loss of a viral RNA segment(s), and the interfering property of DI viruses may be due to interfering RNA segments (DIRNA, D1 to D6). ts-52 DI virus interfered with the replication of standard virus (ts+) at both permissive (34 degrees C) and nonpermissive temperatures. The infectivity of the progeny virus was reduced to 0.2% for ts+ and 0.05% for ts-52 virus without a reduction in hemagglutinin titer. Interference was dependent on the concentration of DI virus. A particle ratio of 1 between DI virus (0.001 PFU/cell) and infectious virus (1.0 PFU/cell) produced a maximal amount of interference. Infectious virus yield was reduced 99.9% without any reduction of the yield of DI viruses Interference was also dependent on the time of addition of DI virus. Interference was most effective within the first 3 h of infection by infectious virus, indicating interference with an early function during viral replication. Images PMID:702654
Gagnon, Keith T.; Li, Liande; Janowski, Bethany A.; Corey, David R.
2014-01-01
RNA interference (RNAi) is well known for its ability to regulate gene expression in the cytoplasm of mammalian cells. In mammalian cell nuclei, however, the impact of RNAi has remained more controversial. A key technical hurdle has been a lack of optimized protocols for the isolation and analysis of cell nuclei. Here we describe a simplified protocol for nuclei isolation from cultured cells that incorporates a method for obtaining nucleoplasmic and chromatin fractions and removing cytoplasmic contamination. Cell fractions can then be used to detect the presence and activity of RNAi factors in the nucleus. We present a protocol for investigating an early step in RNAi, Argonaute protein loading with small RNAs, which is enabled by our improved extract preparations. These protocols facilitate characterization of nuclear RNAi and can be applied to the analysis of other nuclear proteins and pathways. From cellular fractionation to analysis of Argonaute loading results, this protocol takes 4–6 d to complete. PMID:25079428
Murphy, Katherine A.; Tabuloc, Christine A.; Cervantes, Kevin R.; Chiu, Joanna C.
2016-01-01
RNA interference has had major advances as a developing tool for pest management. In laboratory experiments, double-stranded RNA (dsRNA) is often administered to the insect by genetic modification of the crop, or synthesized in vitro and topically applied to the crop. Here, we engineered genetically modified yeast that express dsRNA targeting y-Tubulin in Drosophila suzukii. Our design takes advantage of the symbiotic interactions between Drosophila, yeast, and fruit crops. Yeast is naturally found growing on the surface of fruit crops, constitutes a major component of the Drosophila microbiome, and is highly attractive to Drosophila. Thus, this naturally attractive yeast biopesticide can deliver dsRNA to an insect pest without the need for genetic crop modification. We demonstrate that this biopesticide decreases larval survivorship, and reduces locomotor activity and reproductive fitness in adults, which are indicative of general health decline. To our knowledge, this is the first study to show that yeast can be used to deliver dsRNA to an insect pest. PMID:26931800
ABCE1 Is a Highly Conserved RNA Silencing Suppressor
Kärblane, Kairi; Gerassimenko, Jelena; Nigul, Lenne; Piirsoo, Alla; Smialowska, Agata; Vinkel, Kadri; Kylsten, Per; Ekwall, Karl; Swoboda, Peter; Truve, Erkki; Sarmiento, Cecilia
2015-01-01
ATP-binding cassette sub-family E member 1 (ABCE1) is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference. PMID:25659154
Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J.
2012-01-01
The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies. PMID:22411954
Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J
2012-05-01
The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies.
Systemic RNAi-mediated Gene Silencing in Nonhuman Primate and Rodent Myeloid Cells
Novobrantseva, Tatiana I; Borodovsky, Anna; Wong, Jamie; Klebanov, Boris; Zafari, Mohammad; Yucius, Kristina; Querbes, William; Ge, Pei; Ruda, Vera M; Milstein, Stuart; Speciner, Lauren; Duncan, Rick; Barros, Scott; Basha, Genc; Cullis, Pieter; Akinc, Akin; Donahoe, Jessica S; Narayanannair Jayaprakash, K; Jayaraman, Muthusamy; Bogorad, Roman L; Love, Kevin; Whitehead, Katie; Levins, Chris; Manoharan, Muthiah; Swirski, Filip K; Weissleder, Ralph; Langer, Robert; Anderson, Daniel G; de Fougerolles, Antonin; Nahrendorf, Matthias; Koteliansky, Victor
2012-01-01
Leukocytes are central regulators of inflammation and the target cells of therapies for key diseases, including autoimmune, cardiovascular, and malignant disorders. Efficient in vivo delivery of small interfering RNA (siRNA) to immune cells could thus enable novel treatment strategies with broad applicability. In this report, we develop systemic delivery methods of siRNA encapsulated in lipid nanoparticles (LNP) for durable and potent in vivo RNA interference (RNAi)-mediated silencing in myeloid cells. This work provides the first demonstration of siRNA-mediated silencing in myeloid cell types of nonhuman primates (NHPs) and establishes the feasibility of targeting multiple gene targets in rodent myeloid cells. The therapeutic potential of these formulations was demonstrated using siRNA targeting tumor necrosis factor-α (TNFα) which induced substantial attenuation of disease progression comparable to a potent antibody treatment in a mouse model of rheumatoid arthritis (RA). In summary, we demonstrate a broadly applicable and therapeutically relevant platform for silencing disease genes in immune cells. PMID:23344621
ERIC Educational Resources Information Center
Harrison, Jason Gordon
2013-01-01
Quantum mechanical (QM) and molecular docking methods are used to probe systems of biological and synthetic interest. Probing interactions of nucleobases within proteins, and properly modeling said interactions toward novel nucleobase development, is extremely difficult, and of great utility in RNA interference (RNAi) therapeutics. The issues in…
Genetic Manipulation of Schistosoma haematobium, the Neglected Schistosome
Rinaldi, Gabriel; Okatcha, Tunika I.; Popratiloff, Anastas; Ayuk, Mary A.; Suttiprapa, Sutas; Mann, Victoria H.; Liang, Yung-san; Lewis, Fred A.; Loukas, Alex; Brindley, Paul J.
2011-01-01
Background Minimal information on the genome and proteome of Schistosoma haematobium is available, in marked contrast to the situation with the other major species of human schistosomes for which draft genome sequences have been reported. Accordingly, little is known about functional genomics in S. haematobium, including the utility or not of RNA interference techniques that, if available, promise to guide development of new interventions for schistosomiasis haematobia. Methods/Findings Here we isolated and cultured developmental stages of S. haematobium, derived from experimentally infected hamsters. Targeting different developmental stages, we investigated the utility of soaking and/or square wave electroporation in order to transfect S. haematobium with nucleic acid reporters including Cy3-labeled small RNAs, messenger RNA encoding firefly luciferase, and short interfering RNAs (siRNAs). Three hours after incubation of S. haematobium eggs in 50 ng/µl Cy3-labeled siRNA, fluorescent foci were evident indicating that labeled siRNA had penetrated into miracidia developing within the egg shell. Firefly luciferase activity was detected three hours after square wave electroporation of the schistosome eggs and adult worms in 150 ng/µl of mRNA. RNA interference knockdown (silencing) of reporter luciferase activity was seen following the introduction of dsRNA specific for luciferase mRNA in eggs, schistosomules and mixed sex adults. Moreover, introduction of an endogenous gene-specific siRNA into adult schistosomes silenced transcription of tetraspanin 2 (Sh-tsp-2), the apparent orthologue of the Schistosoma mansoni gene Sm-tsp-2 which encodes the surface localized structural and signaling protein Sm-TSP-2. Together, knockdown of reporter luciferase and Sh-tsp-2 indicated the presence of an intact RNAi pathway in S. haematobium. Also, we employed laser scanning confocal microscopy to view the adult stages of S. haematobium. Conclusions These findings and approaches should facilitate analysis of gene function in S. haematobium, which in turn could facilitate the characterization of prospective intervention targets for this neglected tropical disease pathogen. PMID:22022628
RNAi therapeutics and applications of microRNAs in cancer treatment.
Uchino, Keita; Ochiya, Takahiro; Takeshita, Fumitaka
2013-06-01
RNA interference-based therapies are proving to be powerful tools for combating various diseases, including cancer. Scientists are researching the development of safe and efficient systems for the delivery of small RNA molecules, which are extremely fragile in serum, to target organs and cells in the human body. A dozen pre-clinical and clinical trials have been under way over the past few years involving biodegradable nanoparticles, lipids, chemical modification and conjugation. On the other hand, microRNAs, which control the balance of cellular biological processes, have been studied as attractive therapeutic targets in cancer treatment. In this review, we provide an overview of RNA interference-based therapeutics in clinical trials and discuss the latest technology for the systemic delivery of nucleic acid drugs. Furthermore, we focus on dysregulated microRNAs in human cancer, which have progressed in pre-clinical trials as therapeutic targets, and describe a wide range of strategies to control the expression levels of endogenous microRNAs. Further development of RNA interference technologies and progression of clinical trials will contribute to the achievement of practical applications of nucleic acid drugs.
Fu, Becky Xu Hua; Wainberg, Michael; Kundaje, Anshul; Fire, Andrew Z
2017-08-01
Interactions between Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) RNAs and CRISPR-associated (Cas) proteins form an RNA-guided adaptive immune system in prokaryotes. The adaptive immune system utilizes segments of the genetic material of invasive foreign elements in the CRISPR locus. The loci are transcribed and processed to produce small CRISPR RNAs (crRNAs), with degradation of invading genetic material directed by a combination of complementarity between RNA and DNA and in some cases recognition of adjacent motifs called PAMs (Protospacer Adjacent Motifs). Here we describe a general, high-throughput procedure to test the efficacy of thousands of targets, applying this to the Escherichia coli type I-E Cascade (CRISPR-associated complex for antiviral defense) system. These studies were followed with reciprocal experiments in which the consequence of CRISPR activity was survival in the presence of a lytic phage. From the combined analysis of the Cascade system, we found that (i) type I-E Cascade PAM recognition is more expansive than previously reported, with at least 22 distinct PAMs, with many of the noncanonical PAMs having CRISPR-interference abilities similar to the canonical PAMs; (ii) PAM positioning appears precise, with no evidence for tolerance to PAM slippage in interference; and (iii) while increased guanine-cytosine (GC) content in the spacer is associated with higher CRISPR-interference efficiency, high GC content (>62.5%) decreases CRISPR-interference efficiency. Our findings provide a comprehensive functional profile of Cascade type I-E interference requirements and a method to assay spacer efficacy that can be applied to other CRISPR-Cas systems. Copyright © 2017 by the Genetics Society of America.
Hasiów-Jaroszewska, Beata; Minicka, Julia; Zarzyńska-Nowak, Aleksandra; Budzyńska, Daria; Elena, Santiago F
2018-05-02
Tomato black ring virus (TBRV) is the only member of the Nepovirus genus that is known to form defective RNA particles (D RNAs) during replication. Here, de novo generation of D RNAs was observed during prolonged passages of TBRV isolates originated from Solanum lycopersicum and Lactuca sativa in Chenopodium quinoa plants. D RNAs of about 500 nt derived by a single deletion in the RNA1 molecule and contained a portion of the 5' untranslated region and viral replicase, and almost the entire 3' non-coding region. Short regions of sequence complementarity were found at the 5' and 3' junction borders, which can facilitate formation of the D RNAs. Moreover, in this study we analyzed the effects of D RNAs on TBRV replication and symptoms development of infected plants. C. quinoa, S. lycopersicum, Nicotiana tabacum, and L. sativa were infected with the original TBRV isolates (TBRV-D RNA) and those containing additional D RNA particles (TBRV + D RNA). The viral accumulation in particular hosts was measured up to 28 days post inoculation by RT-qPCR. Statistical analyses revealed that D RNAs interfere with TBRV replication and thus should be referred to as defective interfering particles. The magnitude of the interference effect depends on the interplay between TBRV isolate and host species. Copyright © 2018 Elsevier B.V. All rights reserved.
RNA Interference for improving the Outcome of Islet Transplantation
Li, Feng; Mahato, Ram I
2010-01-01
Islet transplantation has the potential to cure type 1 diabetes. Despite recent therapeutic success, it is still not common because a large number of transpanted islets get damaged by multiple challenges including instant blood mediated inflammatory reaction, hypoxia/reperfusion injury, inflammatory cytokines, and immune rejection. RNA interference (RNAi) is an novel strategy to selectively degrade target mRNA. The use of RNAi technologies to downregulate the expression of harmful genes has the potential to improve the outcome of islet transplantation. The aim of this review is to gain a thorough understanding of biological obstacles to islet transplantation and discuss how to overcome these barriers using different RNAi technologies. This eventually will help improve islet survival and function post transplantaion. Chemically synthesized small interferring RNA (siRNA), vector based short haripin RNA (shRNA), and their critical design elements (such as sequences, promoters, backbone) are discussed. The application of combinatorial RNAi in islet transplantation is also discussed. Last but not the least, several delivery strategies for enhanced gene silencing are discussed, including chemical modification of siRNA, complex formation, bioconjugation, and viral vectors. PMID:21156190
Yao, Qichao; Li, Haidong; Xian, Liman; Xu, Feng; Xia, Jing; Fan, Jiangli; Du, Jianjun; Wang, Jingyun; Peng, Xiaojun
2018-09-01
Although excellent florescent probes have been developed for DNA, good probes for RNA remain lacking. The shortage of reported and commercial RNA probes is attributable to their severe interference from DNA. As DNA and RNA have similar structures but different functions, it has been an imperative challenge to develop RNA probes that differentiate from DNA. In this study, an NIR fluorescent probe, NBE, is described, which contains a bulky julolidine group that can fit in a spacious RNA pocket and emit intense fluorescence. However, NBE has no response to DNA, as it cannot intercalate into the double strands or even in the DNA minor groove. The sensing mechanism is similar to the effect of a door-bolt. NBE shows excellent performance in RNA sensing (outstanding photostability, high selectivity and fast response), whether in aqueous buffers, fixed cells or living cells. These findings might provide not only a potential imaging tool but also a new design strategy for the recognition of RNA while avoiding interference from DNA. Copyright © 2018 Elsevier Ltd. All rights reserved.
New Type of BACE1 siRNA Delivery to Cells
Jabłkowski, Maciej; Szemraj, Maciej; Oszajca, Katarzyna; Janiszewska, Grażyna; Bartkowiak, Jacek; Szemraj, Janusz
2014-01-01
Background Small interfering RNA (siRNA) gene therapy is a new molecular approach in the search for an efficient therapy for Alzheimer disease (AD), based on the principle of RNA interference. Reducing BACE activity can have great therapeutic potential for the treatment of AD. In this study, receptor-mediated delivery was used to deliver opioid peptide-conjugated BACE 1 to INR-32 human neuroblastoma cells. Material/Methods An INR-32 human neuroblastoma cell line was stably transfected to express the APP cDNA coding fragment containing the predicted sites for cleavage by α, β, or γ-secretase. This was then treated with BACE 1 siRNA to silence BACE gene expression. BACE gene transcription and translation was determined using BACE-1 siRNA cross-linked with opioid peptide, together with RT-PCR, Western blot analysis, and ELISA. Results Receptor-mediated delivery was used to introduce BACE1 siRNA to the APP – INR 32 human neuroblastoma cells. Decreased BACE mRNA and protein expression were observed after the cells were transfected with BACE1 siRNA. Conclusions Delivery of BACE1 siRNA appears to specifically reduce the cleavage of APP by inhibiting BACE1 activity. PMID:25491230
Bhinder, Bhavneet; Antczak, Christophe; Ramirez, Christina N.; Shum, David; Liu-Sullivan, Nancy; Radu, Constantin; Frattini, Mark G.
2013-01-01
Abstract RNA interference technology is becoming an integral tool for target discovery and validation.; With perhaps the exception of only few studies published using arrayed short hairpin RNA (shRNA) libraries, most of the reports have been either against pooled siRNA or shRNA, or arrayed siRNA libraries. For this purpose, we have developed a workflow and performed an arrayed genome-scale shRNA lethality screen against the TRC1 library in HeLa cells. The resulting targets would be a valuable resource of candidates toward a better understanding of cellular homeostasis. Using a high-stringency hit nomination method encompassing criteria of at least three active hairpins per gene and filtered for potential off-target effects (OTEs), referred to as the Bhinder–Djaballah analysis method, we identified 1,252 lethal and 6 rescuer gene candidates, knockdown of which resulted in severe cell death or enhanced growth, respectively. Cross referencing individual hairpins with the TRC1 validated clone database, 239 of the 1,252 candidates were deemed independently validated with at least three validated clones. Through our systematic OTE analysis, we have identified 31 microRNAs (miRNAs) in lethal and 2 in rescuer genes; all having a seed heptamer mimic in the corresponding shRNA hairpins and likely cause of the OTE observed in our screen, perhaps unraveling a previously unknown plausible essentiality of these miRNAs in cellular viability. Taken together, we report on a methodology for performing large-scale arrayed shRNA screens, a comprehensive analysis method to nominate high-confidence hits, and a performance assessment of the TRC1 library highlighting the intracellular inefficiencies of shRNA processing in general. PMID:23198867
Ribonucleic acid interference knockdown of interleukin 6 attenuates cold-induced hypertension.
Crosswhite, Patrick; Sun, Zhongjie
2010-06-01
The purpose of this study was to determine the role of the proinflammatory cytokine interleukin (IL) 6 in cold-induced hypertension. Four groups of male Sprague-Dawley rats were used (6 rats per group). After blood pressure was stabilized, 3 groups received intravenous delivery of adenoassociated virus carrying IL-6 small hairpin RNA (shRNA), adenoassociated virus carrying scrambled shRNA, and PBS, respectively, before exposure to a cold environment (5 degrees C). The last group received PBS and was kept at room temperature (25 degrees C, warm) as a control. Adenoassociated virus delivery of IL-6 shRNA significantly attenuated cold-induced elevation of systolic blood pressure and kept it at the control level for < or =7 weeks (length of the study). Chronic exposure to cold upregulated IL-6 expression in aorta, heart, and kidneys and increased macrophage and T-cell infiltration in kidneys, suggesting that cold exposure increases inflammation. IL-6 shRNA delivery abolished the cold-induced upregulation of IL-6, indicating effective silence of IL-6. Interestingly, RNA interference knockdown of IL-6 prevented cold-induced inflammation, as evidenced by a complete inhibition of tumor necrosis factor-alpha expression and leukocyte infiltration by IL-6 shRNA. RNA interference knockdown of IL-6 significantly decreased the cold-induced increase in vascular superoxide production. It is noted that IL-6 shRNA abolished the cold-induced increase in collagen deposition in the heart, suggesting that inflammation is involved in cold-induced cardiac remodeling. Cold exposure caused glomerular collapses, which could be prevented by knockdown of IL-6, suggesting an important role of inflammation in cold-induced renal damage. In conclusion, cold exposure increased IL-6 expression and inflammation, which play critical roles in the pathogenesis of cold-induced hypertension and cardiac and renal damage.
Global effects of the CSR-1 RNA interference pathway on the transcriptional landscape.
Cecere, Germano; Hoersch, Sebastian; O'Keeffe, Sean; Sachidanandam, Ravi; Grishok, Alla
2014-04-01
Argonaute proteins and their small RNA cofactors short interfering RNAs are known to inhibit gene expression at the transcriptional and post-transcriptional levels. In Caenorhabditis elegans, the Argonaute CSR-1 binds thousands of endogenous siRNAs (endo-siRNAs) that are antisense to germline transcripts. However, its role in gene expression regulation remains controversial. Here we used genome-wide profiling of nascent RNA transcripts and found that the CSR-1 RNA interference pathway promoted sense-oriented RNA polymerase II transcription. Moreover, a loss of CSR-1 function resulted in global increase in antisense transcription and ectopic transcription of silent chromatin domains, which led to reduced chromatin incorporation of centromere-specific histone H3. On the basis of these findings, we propose that the CSR-1 pathway helps maintain the directionality of active transcription, thereby propagating the distinction between transcriptionally active and silent genomic regions.
Zha, Wenjun; Peng, Xinxin; Chen, Rongzhi; Du, Bo; Zhu, Lili; He, Guangcun
2011-01-01
Background RNA interference (RNAi) is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA) directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. Methodology/Principal Findings The Hemipteran insect brown planthopper (Nilaparvata lugens Stål) is a typical phloem sap feeder specific to rice (Oryza sativa L.). To analyze the potential of exploiting RNAi-mediated effects in this insect, we identified genes (Nlsid-1 and Nlaub) encoding proteins that might be involved in the RNAi pathway in N. lugens. Both genes are expressed ubiquitously in nymphs and adult insects. Three genes (the hexose transporter gene NlHT1, the carboxypeptidase gene Nlcar and the trypsin-like serine protease gene Nltry) that are highly expressed in the N. lugens midgut were isolated and used to develop dsRNA constructs for transforming rice. RNA blot analysis showed that the dsRNAs were transcribed and some of them were processed to siRNAs in the transgenic lines. When nymphs were fed on rice plants expressing dsRNA, levels of transcripts of the targeted genes in the midgut were reduced; however, lethal phenotypic effects after dsRNA feeding were not observed. Conclusions Our study shows that genes for the RNAi pathway (Nlsid-1 and Nlaub) are present in N. lugens. When insects were fed on rice plant materials expressing dsRNAs, RNA interference was triggered and the target genes transcript levels were suppressed. The gene knockdown technique described here may prove to be a valuable tool for further investigations in N. lugens. The results demonstrate the potential of dsRNA-mediated RNAi for field-level control of planthoppers, but appropriate target genes must be selected when designing the dsRNA-transgenic plants. PMID:21655219
... Century-Old Evolutionary Puzzle Computing Genetics Model Organisms RNA Interference The New Genetics is a science education ... the basics of DNA and its molecular cousin RNA, and new directions in genetic research. The New ...
Fluorescence-based high-throughput screening of dicer cleavage activity.
Podolska, Katerina; Sedlak, David; Bartunek, Petr; Svoboda, Petr
2014-03-01
Production of small RNAs by ribonuclease III Dicer is a key step in microRNA and RNA interference pathways, which employ Dicer-produced small RNAs as sequence-specific silencing guides. Further studies and manipulations of microRNA and RNA interference pathways would benefit from identification of small-molecule modulators. Here, we report a study of a fluorescence-based in vitro Dicer cleavage assay, which was adapted for high-throughput screening. The kinetic assay can be performed under single-turnover conditions (35 nM substrate and 70 nM Dicer) in a small volume (5 µL), which makes it suitable for high-throughput screening in a 1536-well format. As a proof of principle, a small library of bioactive compounds was analyzed, demonstrating potential of the assay.
Vig, Komal; Lewis, Nuruddeen; Moore, Eddie G; Pillai, Shreekumar; Dennis, Vida A; Singh, Shree R
2009-11-01
RNA interference (RNAi) is a post-transcriptional, gene silencing mechanism which uses small interfering RNA molecules (siRNA) for gene silencing. Respiratory Syncytial Virus (RSV) is an important respiratory pathogen of medical significance that causes high mortality in infants. The fusion (F) protein of RSV is a good target for therapeutic purposes as it is primarily responsible for penetration of the virus into host cells and subsequent syncytium formation during infection. In the present study, four siRNAs were designed and used individually as well as a mixture, to silence the RSV F gene. The relationship between siRNA design, target RNA structure, and their thermodynamics was also investigated. Silencing of F gene was observed using indirect immunofluorescence, western blot, reverse transcription PCR, and progeny viral titers. Our results show F gene silencing by all the four siRNAs individually and collectively. RT-PCR analysis revealed a decrease in mRNA level which corresponded to decreased F protein expression. siRNAs also inhibited RSV progeny as shown by viral titer estimation on infected HEp-2 cells. The present study demonstrates the silencing of the F gene using siRNA. Thermodynamic characteristics of the target RSV mRNA and siRNA seem to play an important role in siRNA gene silencing efficiency.
The impact of target site accessibility on the design of effective siRNAs.
Tafer, Hakim; Ameres, Stefan L; Obernosterer, Gregor; Gebeshuber, Christoph A; Schroeder, Renée; Martinez, Javier; Hofacker, Ivo L
2008-05-01
Small-interfering RNAs (siRNAs) assemble into RISC, the RNA-induced silencing complex, which cleaves complementary mRNAs. Despite their fluctuating efficacy, siRNAs are widely used to assess gene function. Although this limitation could be ascribed, in part, to variations in the assembly and activation of RISC, downstream events in the RNA interference (RNAi) pathway, such as target site accessibility, have so far not been investigated extensively. In this study we present a comprehensive analysis of target RNA structure effects on RNAi by computing the accessibility of the target site for interaction with the siRNA. Based on our observations, we developed a novel siRNA design tool, RNAxs, by combining known siRNA functionality criteria with target site accessibility. We calibrated our method on two data sets comprising 573 siRNAs for 38 genes, and tested it on an independent set of 360 siRNAs targeting four additional genes. Overall, RNAxs proves to be a robust siRNA selection tool that substantially improves the prediction of highly efficient siRNAs.
Zhang, Wanna; Liu, Bing; Lu, Yanhui; Liang, Gemei
2017-04-01
Salivary enzymes of many piercing-sucking insects lead to host plant injury. The salivary enzymes, polygalacturonase (PGs), act in insect feeding. PG family genes have been cloned from the mirid bug Apolygus lucorum, a pest of cotton and other host crops in China. We investigated the function of two PG genes that are highly expressed in A. lucorum nymphs (PG3-4) and adults (PG3-5), using siRNA injection-based RNA interference (RNAi). Accumulation of mRNA encoding both genes and their cognate proteins was significantly reduced (>60%) in experimental compared control green fluorescent protein (GFP) siRNA-treated mirids at 48 h post injection. Injury levels of cotton buds were also significantly reduced after injecting saliva isolated from PG3-4 and PG3-5 siRNA-treated A. lucorum. These results demonstrate that these two PG act in A. lucorum elicitation of plant injury. © 2017 Wiley Periodicals, Inc.
Fechner, Henry; Vetter, Roland; Kurreck, Jens; Poller, Wolfgang
2017-01-01
Silencing of cardiac genes by RNA interference (RNAi) has developed into a powerful new method to treat cardiac diseases. Small interfering (si)RNAs are the inducers of RNAi, but cultured primary cardiomyocytes and heart are highly resistant to siRNA transfection. This can be overcome by delivery of small hairpin (sh)RNAs or artificial microRNA (amiRNAs) by cardiotropic adeno-associated virus (AAV) vectors. Here we describe as example of the silencing of a cardiac gene, the generation and cloning of shRNA, and amiRNAs directed against the cardiac protein phospholamban. We further describe the generation of AAV shuttle plasmids with self complementary vector genomes, the production of AAV vectors in roller bottles, and their purification via iodixanol gradient centrifugation and concentration with filter systems. Finally we describe the preparation of primary neonatal rat cardiomyocytes (PNRC), the transduction of PNRC with AAV vectors, and the maintenance of the transduced cell culture.
Crystal structure of the Csm3-Csm4 subcomplex in the type III-A CRISPR-Cas interference complex.
Numata, Tomoyuki; Inanaga, Hideko; Sato, Chikara; Osawa, Takuo
2015-01-30
Clustered, regularly interspaced, short palindromic repeat (CRISPR) loci play a pivotal role in the prokaryotic host defense system against invading genetic materials. The CRISPR loci are transcribed to produce CRISPR RNAs (crRNAs), which form interference complexes with CRISPR-associated (Cas) proteins to target the invading nucleic acid for degradation. The interference complex of the type III-A CRISPR-Cas system is composed of five Cas proteins (Csm1-Csm5) and a crRNA, and targets invading DNA. Here, we show that the Csm1, Csm3, and Csm4 proteins from Methanocaldococcus jannaschii form a stable subcomplex. We also report the crystal structure of the M. jannaschii Csm3-Csm4 subcomplex at 3.1Å resolution. The complex structure revealed the presence of a basic concave surface around their interface, suggesting the RNA and/or DNA binding ability of the complex. A gel retardation analysis showed that the Csm3-Csm4 complex binds single-stranded RNA in a non-sequence-specific manner. Csm4 structurally resembles Cmr3, a component of the type III-B CRISPR-Cas interference complex. Based on bioinformatics, we constructed a model structure of the Csm1-Csm4-Csm3 ternary complex, which provides insights into its role in the Csm interference complex. Copyright © 2014 Elsevier Ltd. All rights reserved.
RNA interference in the clinic: challenges and future directions
Pecot, Chad V.; Calin, George A.; Coleman, Robert L.; Lopez-Berestein, Gabriel; Sood, Anil K.
2011-01-01
Inherent difficulties with blocking many desirable targets using conventional approaches have prompted many to consider using RNA interference (RNAi) as a therapeutic approach. Although exploitation of RNAi has immense potential as a cancer therapeutic, many physiological obstacles stand in the way of successful and efficient delivery. This Review explores current challenges to the development of synthetic RNAi-based therapies and considers new approaches to circumvent biological barriers, to avoid intolerable side effects and to achieve controlled and sustained release. PMID:21160526
Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference
Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu
2015-01-01
RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells. PMID:25731667
Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference.
Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu
2015-03-03
RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells.
Multimodality Imaging of RNA Interference
Nayak, Tapas R.; Krasteva, Lazura K.; Cai, Weibo
2013-01-01
The discovery of small interfering RNAs (siRNAs) and their potential to knock down virtually any gene of interest has ushered in a new era of RNA interference (RNAi). Clinical use of RNAi faces severe limitations due to inefficiency delivery of siRNA or short hairpin RNA (shRNA). Many molecular imaging techniques have been adopted in RNAi-related research for evaluation of siRNA/shRNA delivery, biodistribution, pharmacokinetics, and the therapeutic effect. In this review article, we summarize the current status of in vivo imaging of RNAi. The molecular imaging techniques that have been employed include bioluminescence/fluorescence imaging, magnetic resonance imaging/spectroscopy, positron emission tomography, single-photon emission computed tomography, and various combinations of these techniques. Further development of non-invasive imaging strategies for RNAi, not only focusing on the delivery of siRNA/shRNA but also the therapeutic efficacy, is critical for future clinical translation. Rigorous validation will be needed to confirm that biodistribution of the carrier is correlated with that of siRNA/shRNA, since imaging only detects the label (e.g. radioisotopes) but not the gene or carrier themselves. It is also essential to develop multimodality imaging approaches for realizing the full potential of therapeutic RNAi, as no single imaging modality may be sufficient to simultaneously monitor both the gene delivery and silencing effect of RNAi. PMID:23745567
Engineering functional inorganic-organic hybrid systems: advances in siRNA therapeutics.
Shen, Jianliang; Zhang, Wei; Qi, Ruogu; Mao, Zong-Wan; Shen, Haifa
2018-03-21
Cancer treatment still faces a lot of obstacles such as tumor heterogeneity, drug resistance and systemic toxicities. Beyond the traditional treatment modalities, exploitation of RNA interference (RNAi) as an emerging approach has immense potential for the treatment of various gene-caused diseases including cancer. The last decade has witnessed enormous research and achievements focused on RNAi biotechnology. However, delivery of small interference RNA (siRNA) remains a key challenge in the development of clinical RNAi therapeutics. Indeed, functional nanomaterials play an important role in siRNA delivery, which could overcome a wide range of sequential physiological and biological obstacles. Nanomaterial-formulated siRNA systems have potential applications in protection of siRNA from degradation, improving the accumulation in the target tissues, enhancing the siRNA therapy and reducing the side effects. In this review, we explore and summarize the role of functional inorganic-organic hybrid systems involved in the siRNA therapeutic advancements. Additionally, we gather the surface engineering strategies of hybrid systems to optimize for siRNA delivery. Major progress in the field of inorganic-organic hybrid platforms including metallic/non-metallic cores modified with organic shells or further fabrication as the vectors for siRNA delivery is discussed to give credit to the interdisciplinary cooperation between chemistry, pharmacy, biology and medicine.
Evidence for the involvement of NOD2 in regulating colonic epithelial cell growth and survival
Cruickshank, Sheena M; Wakenshaw, Louise; Cardone, John; Howdle, Peter D; Murray, Peter J; Carding, Simon R
2008-01-01
AIM: To investigate the function of NOD2 in colonic epithelial cells (CEC). METHODS: A combination of in vivo and in vitro analyses of epithelial cell turnover in the presence and absence of a functional NOD2 protein and, in response to enteric Salmonella typhimurium infection, were used. shRNA interference was also used to investigate the consequences of knocking down NOD2 gene expression on the growth and survival of colorectal carcinoma cell lines. RESULTS: In the colonic mucosa the highest levels of NOD2 expression were in proliferating crypt epithelial cells. Muramyl dipeptide (MDP), that is recognized by NOD2, promoted CEC growth in vitro. By contrast, the growth of NOD2-deficient CECs was impaired. In vivo CEC proliferation was also reduced and apoptosis increased in Nod2-/- mice, which were also evident following enteric Salmonella infection. Furthermore, neutralization of NOD2 mRNA expression in human colonic carcinoma cells by shRNA interference resulted in decreased survival due to increased levels of apoptosis. CONCLUSION: These findings are consistent with the involvement of NOD2 protein in promoting CEC growth and survival. Defects in proliferation by CECs in cases of CD may contribute to the underlying pathology of disrupted intestinal homeostasis and excessive inflammation. PMID:18855982
Alakonya, Amos; Kumar, Ravi; Koenig, Daniel; Kimura, Seisuke; Townsley, Brad; Runo, Steven; Garces, Helena M; Kang, Julie; Yanez, Andrea; David-Schwartz, Rakefet; Machuka, Jesse; Sinha, Neelima
2012-07-01
Infection of crop species by parasitic plants is a major agricultural hindrance resulting in substantial crop losses worldwide. Parasitic plants establish vascular connections with the host plant via structures termed haustoria, which allow acquisition of water and nutrients, often to the detriment of the infected host. Despite the agricultural impact of parasitic plants, the molecular and developmental processes by which host/parasitic interactions are established are not well understood. Here, we examine the development and subsequent establishment of haustorial connections by the parasite dodder (Cuscuta pentagona) on tobacco (Nicotiana tabacum) plants. Formation of haustoria in dodder is accompanied by upregulation of dodder KNOTTED-like homeobox transcription factors, including SHOOT MERISTEMLESS-like (STM). We demonstrate interspecific silencing of a STM gene in dodder driven by a vascular-specific promoter in transgenic host plants and find that this silencing disrupts dodder growth. The reduced efficacy of dodder infection on STM RNA interference transgenics results from defects in haustorial connection, development, and establishment. Identification of transgene-specific small RNAs in the parasite, coupled with reduced parasite fecundity and increased growth of the infected host, demonstrates the efficacy of interspecific small RNA-mediated silencing of parasite genes. This technology has the potential to be an effective method of biological control of plant parasite infection.
Parameters on plant absortion of double-stranded Ribonucleic acid, dsRNA
USDA-ARS?s Scientific Manuscript database
Efficient absorption of double-stranded Ribonucleic acid, dsRNA, into citrus is critical for effective psyllid management by RNA interference, RNAi. Parameters which might affect absorption into citrus trees and subsequent ingestion by Asian citrus psyllid were evaluated. Age of leaves, variety of c...
Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli.
Bernheim, Aude G; Libis, Vincent K; Lindner, Ariel B; Wintermute, Edwin H
2016-03-20
RNA-mediated knockdowns are widely used to control gene expression. This versatile family of techniques makes use of short RNA (sRNA) that can be synthesized with any sequence and designed to complement any gene targeted for silencing. Because sRNA constructs can be introduced to many cell types directly or using a variety of vectors, gene expression can be repressed in living cells without laborious genetic modification. The most common RNA knockdown technology, RNA interference (RNAi), makes use of the endogenous RNA-induced silencing complex (RISC) to mediate sequence recognition and cleavage of the target mRNA. Applications of this technique are therefore limited to RISC-expressing organisms, primarily eukaryotes. Recently, a new generation of RNA biotechnologists have developed alternative mechanisms for controlling gene expression through RNA, and so made possible RNA-mediated gene knockdowns in bacteria. Here we describe a method for silencing gene expression in E. coli that functionally resembles RNAi. In this system a synthetic phagemid is designed to express sRNA, which may designed to target any sequence. The expression construct is delivered to a population of E. coli cells with non-lytic M13 phage, after which it is able to stably replicate as a plasmid. Antisense recognition and silencing of the target mRNA is mediated by the Hfq protein, endogenous to E. coli. This protocol includes methods for designing the antisense sRNA, constructing the phagemid vector, packaging the phagemid into M13 bacteriophage, preparing a live cell population for infection, and performing the infection itself. The fluorescent protein mKate2 and the antibiotic resistance gene chloramphenicol acetyltransferase (CAT) are targeted to generate representative data and to quantify knockdown effectiveness.
Identification of phosphates involved in catalysis by the ribozyme RNase P RNA.
Harris, M E; Pace, N R
1995-01-01
The RNA subunit of ribonuclease P (RNase P RNA) is a catalytic RNA that cleaves precursor tRNAs to generate mature tRNA 5' ends. Little is known concerning the identity and arrangement of functional groups that constitute the active site of this ribozyme. We have used an RNase P RNA-substrate conjugate that undergoes rapid, accurate, and efficient self-cleavage in vitro to probe, by phosphorothioate modification-interference, functional groups required for catalysis. We identify four phosphate oxygens where substitution by sulfur significantly reduces the catalytic rate (50-200-fold). Interference at one site was partially rescued in the presence of manganese, suggesting a direct involvement in binding divalent metal ion cofactors required for catalysis. All sites are located in conserved sequence and secondary structure, and positioned adjacent to the substrate phosphate in a tertiary structure model of the ribozyme-substrate complex. The spatial arrangement of phosphorothioate-sensitive sites in RNase P RNA was found to resemble the distribution of analogous positions in the secondary and potential tertiary structures of other large catalytic RNAs. PMID:7585250
Molecular mechanisms influencing efficiency of RNA interference in insects.
Cooper, Anastasia M W; Silver, Kristopher; Jianzhen, Zhang; Park, Yoonseong; Zhu, Kun Yan
2018-06-21
RNA interference (RNAi) is an endogenous, sequence-specific gene silencing mechanism elicited by small RNA molecules. RNAi is a powerful reverse genetic tool, and is currently being utilized for managing insects and viruses. Widespread implementation of RNAi-based pest management strategies is currently hindered by inefficient and highly variable results when different insect species, strains, developmental stages, tissues, and genes are targeted. Mechanistic studies have shown that double-stranded ribonucleases (dsRNases), endosomal entrapment, deficient function of the core machinery, and inadequate immune stimulation contribute to limited RNAi efficiency. However, a comprehensive understanding of the molecular mechanisms limiting RNAi efficiency remains elusive. The recent advances in dsRNA stability in physiological tissues, dsRNA internalization into cells, the composition and function of the core RNAi machinery, as well as small-interfering RNA/double-stranded RNA amplification and spreading mechanisms are reviewed to establish a global understanding of the obstacles impeding wider understanding of RNAi mechanisms in insects. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
[Impact of Pax-8 gene interference on mitochondrial function and cardiomyocyte apoptosis].
Dai, Xiao-chun; Zhou, Xi; Huang, Xiao-yan; Wang, Liang-guo; Lin, Su; Yang, De-ye
2013-01-01
To observe the effects of paired box gene 8 (Pax-8) silencing by RNA interference on mitochondrial function and cardiomyocytes apoptosis. The cultured H9C2 (2-1) myocytes were divided into 3 groups: short interference RNA targeting Pax-8 (Pax-8 siRNA) group, non-specific siRNA group as the negative control (NC siRNA), and blank control group (BC siRNA). Fluorescence spectrophotometry was used to detect the activity of caspase-3. RT-PCR was performed to detect mRNA expression of Bcl2 and Bax. The protein expression of Bcl2, Bax and cytoplasm of Cytochrome was examined by Western blot. Changes of ΔΨm were detected by flow cytometry.ΔΨm with JC-1 monomer/polymer ratio was calculated for measuring mitochondrial depolarization proportion. Compared to NC siRNA and BC siRNA group (0.075 ± 0.021, 0.072 ± 0.019), the activity of caspase-3 in Pax-8 siRNA group (0.167 ± 0.012) was significantly increased (P < 0.05); Bcl2 mRNA and protein expression in Pax-8 siRNA group (0.61 ± 0.06, 0.94 ± 0.11) were significantly downregulated compared with NC siRNA group (0.90 ± 0.070, 1.39 ± 0.15) and BC siRNA group (0.94 ± 0.087, 1.49 ± 0.20) (P < 0.05); Bax mRNA and protein expression in Pax-8 siRNA group (1.05 ± 0.10, 1.25 ± 0.12) were markedly upregulated compared with NC siRNA group (0.72 ± 0.03, 0.99 ± 0.12) and BC siRNA group (0.64 ± 0.03, 0.92 ± 0.06), P < 0.05; cytosolic cytochrome expression in Pax-8 siRNA group (0.75 ± 0.14) was significantly upregulated compared with NC siRNA group (0.51 ± 0.06) and BC siRNA group (0.48 ± 0.07) (P < 0.05); JC-1 monomer/polymer ratio in Pax-8 siRNA group (0.163 ± 0.011) was significantly increased compared with NC siRNA group (0.092 ± 0.015) and BC siRNA group (0.072 ± 0.025) (P < 0.05) indicating mitochondrial membrane potential was significantly reduced in Pax-8 siRNA group. Above parameters were similar between NC siRNA group and BC siRNA group (P > 0.05). Inhibiting Pax-8 results in enhanced cardiomyocytes apoptosis through the mitochondrial pathway.
Genetics Home Reference: myotonic dystrophy
... mutated gene produces an expanded version of messenger RNA , which is a molecular blueprint of the gene ... the production of proteins. The abnormally long messenger RNA forms clumps inside the cell that interfere with ...
Novosadova, E V; Manuilova, E S; Arsen'eva, E L; Khaidarova, N V; Dolotov, O V; Inozemtseva, L S; Kozachenkov, K Yu; Tarantul, V Z; Grivennikov, I A
2005-07-01
The effects of pub gene on proliferation and initial stages of differentiation of embryonic mouse stem cells were studied in vitro. To this end we used enhanced expression of human pub gene (hpub) and suppression of expression of mouse endogenous pub gene with RNA-interference in embryonic stem cells. Proliferative activity of genetically modified polyclonal lines of the embryonic stem cells transfected with plasmids carrying expressing hpub gene or plasmids generating small interference RNA to this gene did not differ from that of the control cells. Inhibition of expression of endogenous pub gene in embryonic stem cells using small interference RNA 2-fold decreased the formation of embryoid bodies, at the same time additional expression of exogenous hpub gene almost 2-fold increased their number in comparison with the control. It was hypothesized that pub gene participates in early stages of differentiation of embryonic stem cells leading to the formation of embryoid bodies.
Pre-microRNA and Mature microRNA in Human Mitochondria
Barrey, Eric; Saint-Auret, Gaelle; Bonnamy, Blandine; Damas, Dominique; Boyer, Orane; Gidrol, Xavier
2011-01-01
Background Because of the central functions of the mitochondria in providing metabolic energy and initiating apoptosis on one hand and the role that microRNA (miRNA) play in gene expression, we hypothesized that some miRNA could be present in the mitochondria for post-transcriptomic regulation by RNA interference. We intend to identify miRNA localized in the mitochondria isolated from human skeletal primary muscular cells. Methodology/Principal Findings To investigate the potential origin of mitochondrial miRNA, we in-silico searched for microRNA candidates in the mtDNA. Twenty five human pre-miRNA and 33 miRNA aligments (E-value<0.1) were found in the reference mitochondrial sequence and some of the best candidates were chosen for a co-localization test. In situ hybridization of pre-mir-302a, pre-let-7b and mir-365, using specific labelled locked nucleic acids and confocal microscopy, demonstrated that these miRNA were localized in mitochondria of human myoblasts. Total RNA was extracted from enriched mitochondria isolated by an immunomagnetic method from a culture of human myotubes. The detection of 742 human miRNA (miRBase) were monitored by RT-qPCR at three increasing mtRNA inputs. Forty six miRNA were significantly expressed (2nd derivative method Cp>35) for the smallest RNA input concentration and 204 miRNA for the maximum RNA input concentration. In silico analysis predicted 80 putative miRNA target sites in the mitochondrial genome (E-value<0.05). Conclusions/Significance The present study experimentally demonstrated for the first time the presence of pre-miRNA and miRNA in the human mitochondria isolated from skeletal muscular cells. A set of miRNA were significantly detected in mitochondria fraction. The origin of these pre-miRNA and miRNA should be further investigate to determine if they are imported from the cytosol and/or if they are partially processed in the mitochondria. PMID:21637849
Bastin, Donald; Aitken, Amelia S; Pelin, Adrian; Pikor, Larissa A; Crupi, Mathieu J F; Huh, Michael S; Bourgeois-Daigneault, Marie-Claude; Bell, John C; Ilkow, Carolina S
2018-06-19
Antiviral responses are barriers that must be overcome for efficacy of oncolytic virotherapy. In mammalian cells, antiviral responses involve the interferon pathway, a protein-signaling cascade that alerts the immune system and limits virus propagation. Tumour-specific defects in interferon signaling enhance viral infection and responses to oncolytic virotherapy, but many human cancers are still refractory to oncolytic viruses. Given that invertebrates, fungi and plants rely on RNA interference pathways for antiviral protection, we investigated the potential involvement of this alternative antiviral mechanism in cancer cells. Here, we detected viral genome-derived small RNAs, indicative of RNAi-mediated antiviral responses, in human cancer cells. As viruses may encode suppressors of the RNA interference pathways, we engineered an oncolytic vesicular stomatitis virus variant to encode the Nodamura virus protein B2, a known inhibitor of RNAi-mediated immune responses. B2-expressing oncolytic virus showed enhanced viral replication and cytotoxicity, impaired viral genome cleavage and altered microRNA processing in cancer cells. Our data establish the improved therapeutic potential of our novel virus which targets the RNAi-mediated antiviral defense of cancer cells.
Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association.
Pulk, Arto; Maiväli, Ulo; Remme, Jaanus
2006-05-01
The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts.
Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association
Pulk, Arto; Maiväli, Ülo; Remme, Jaanus
2006-01-01
The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts. PMID:16556933
NASA Astrophysics Data System (ADS)
Hu, Zongli; Parekh, Urvi; Maruta, Natsumi; Trusov, Yuri; Botella, Jimmy
2015-01-01
Fusarium oxysporum is a devastating pathogen causing extensive yield losses in a variety of crops and development of sustainable, environmentally friendly methods to improve crop resistance is crucial. We have used Host-Derived RNA interference (HD-RNAi) technology to partially silence three different genes (FOW2, FRP1 and OPR) in the hemi-biotrophic fungus Fusarium oxysporum f. sp. conglutinans. Expression of double stranded RNA molecules targeting fungal pathogen genes was achieved in a number of transgenic Arabidopsis lines. F. oxysporum infecting the transgenic lines displayed substantially reduced mRNA levels on all three targeted genes, with an average of 75%, 83% and 72% reduction for FOW2, FRP1 and OPR respectively. The silencing of pathogen genes had a clear positive effect on the ability of the transgenic lines to fight infection. All transgenic lines displayed enhanced resistance to F. oxysporum with delayed disease symptom development, especially FRP1 and OPR lines. Survival rates after fungal infection were higher in the transgenic lines compared to control wild type plants which consistently showed survival rates of 10%, with FOW2 lines showing 25% survival; FRP1 lines 30-50% survival and FOW2 between 45-70% survival. The down-regulation effect was specific for the targeted genes without unintended effects in related genes. In addition to producing resistant crops, HD-RNAi can provide a useful tool to rapidly screen candidate fungal pathogenicity genes without the need to produce fungal knockout mutants.
Chatterjee, Anushree; Drews, Laurie; Mehra, Sarika; Takano, Eriko; Kaznessis, Yiannis N; Hu, Wei-Shou
2011-01-01
cis-encoded antisense RNAs (cis asRNA) have been reported to participate in gene expression regulation in both eukaryotic and prokaryotic organisms. Its presence in Streptomyces coelicolor has also been reported recently; however, its role has yet to be fully investigated. Using mathematical modeling we explore the role of cis asRNA produced as a result of convergent transcription in scbA-scbR genetic switch. scbA and scbR gene pair, encoding repressor-amplifier proteins respectively, mediates the synthesis of a signaling molecule, the γ-butyrolactone SCB1 and controls the onset of antibiotic production. Our model considers that transcriptional interference caused by convergent transcription of two opposing RNA polymerases results in fatal collision and transcriptional termination, which suppresses transcription efficiency. Additionally, convergent transcription causes sense and antisense interactions between complementary sequences from opposing strands, rendering the full length transcript inaccessible for translation. We evaluated the role of transcriptional interference and the antisense effect conferred by convergent transcription on the behavior of scbA-scbR system. Stability analysis showed that while transcriptional interference affects the system, it is asRNA that confers scbA-scbR system the characteristics of a bistable switch in response to the signaling molecule SCB1. With its critical role of regulating the onset of antibiotic synthesis the bistable behavior offers this two gene system the needed robustness to be a genetic switch. The convergent two gene system with potential of transcriptional interference is a frequent feature in various genomes. The possibility of asRNA regulation in other such gene-pairs is yet to be examined.
Interference of hepatitis C virus RNA replication by short interfering RNAs
NASA Astrophysics Data System (ADS)
Kapadia, Sharookh B.; Brideau-Andersen, Amy; Chisari, Francis V.
2003-02-01
Hepatitis C virus (HCV) infection is a major cause of chronic liver disease, which can lead to the development of liver cirrhosis and hepatocellular carcinoma. Current therapy of patients with chronic HCV infection includes treatment with IFN in combination with ribavirin. Because most treated patients do not resolve the infection, alternative treatment is essential. RNA interference (RNAi) is a recently discovered antiviral mechanism present in plants and animals that induces double-stranded RNA degradation. Using a selectable subgenomic HCV replicon cell culture system, we have shown that RNAi can specifically inhibit HCV RNA replication and protein expression in Huh-7 cells that stably replicate the HCV genome, and that this antiviral effect is independent of IFN. These results suggest that RNAi may represent a new approach for the treatment of persistent HCV infection.
PAMP-induced defense responses in potato require both salicylic acid and jasmonic acid.
Halim, Vincentius A; Altmann, Simone; Ellinger, Dorothea; Eschen-Lippold, Lennart; Miersch, Otto; Scheel, Dierk; Rosahl, Sabine
2009-01-01
To elucidate the molecular mechanisms underlying pathogen-associated molecular pattern (PAMP)-induced defense responses in potato (Solanum tuberosum), the role of the signaling compounds salicylic acid (SA) and jasmonic acid (JA) was analyzed. Pep-13, a PAMP from Phytophthora, induces the accumulation of SA, JA and hydrogen peroxide, as well as the activation of defense genes and hypersensitive-like cell death. We have previously shown that SA is required for Pep-13-induced defense responses. To assess the importance of JA, RNA interference constructs targeted at the JA biosynthetic genes, allene oxide cyclase and 12-oxophytodienoic acid reductase, were expressed in transgenic potato plants. In addition, expression of the F-box protein COI1 was reduced by RNA interference. Plants expressing the RNA interference constructs failed to accumulate the respective transcripts in response to wounding or Pep-13 treatment, neither did they contain significant amounts of JA after elicitation. In response to infiltration of Pep-13, the transgenic plants exhibited a highly reduced accumulation of reactive oxygen species as well as reduced hypersensitive cell death. The ability of the JA-deficient plants to accumulate SA suggests that SA accumulation is independent or upstream of JA accumulation. These data show that PAMP responses in potato require both SA and JA and that, in contrast to Arabidopsis, these compounds act in the same signal transduction pathway. Despite their inability to fully respond to PAMP treatment, the transgenic RNA interference plants are not altered in their basal defense against Phytophthora infestans.
Fabozzi, Giulia; Nabel, Christopher S; Dolan, Michael A; Sullivan, Nancy J
2011-03-01
Cellular RNA interference (RNAi) provides a natural response against viral infection, but some viruses have evolved mechanisms to antagonize this form of antiviral immunity. To determine whether Ebolavirus (EBOV) counters RNAi by encoding suppressors of RNA silencing (SRSs), we screened all EBOV proteins using an RNAi assay initiated by exogenously delivered small interfering RNAs (siRNAs) against either an EBOV or a reporter gene. In addition to viral protein 35 (VP35), we found that VP30 and VP40 independently act as SRSs. Here, we present the molecular mechanisms of VP30 and VP35. VP30 interacts with Dicer independently of siRNA and with one Dicer partner, TRBP, only in the presence of siRNA. VP35 directly interacts with Dicer partners TRBP and PACT in an siRNA-independent fashion and in the absence of effects on interferon (IFN). Taken together, our findings elucidate a new mechanism of RNAi suppression that extends beyond the role of SRSs in double-stranded RNA (dsRNA) binding and IFN antagonism. The presence of three suppressors highlights the relevance of host RNAi-dependent antiviral immunity in EBOV infection and illustrates the importance of RNAi in shaping the evolution of RNA viruses.
Photoinduced RNA interference.
Matsushita-Ishiodori, Yuka; Ohtsuki, Takashi
2012-07-17
Because RNA interference (RNAi) can be applied to any gene, this technique has been widely used for studying gene functions. In addition, many researchers are attempting to use RNAi technology in RNAi-based therapies. However, several challenging and controversial issues have arisen during the widespread application of RNAi including target gene specificity, target cell specificity, and spatiotemporal control of gene silencing. To address these issues, several groups have utilized photochemistry to control the RNA release, both spatially and temporally. In this Account, we focus on recent studies using photocleavable protecting groups, photosensitizers, Hand gold nanoparticles for photoinduced RNAi. In 2005 the first report of photoinduced RNAi used a caged short interfering RNA (siRNA), an siRNA carrying a photocleavable protecting group. Caging groups block the bioactivities of target molecules, but allow for complete recovery of these functions via photoactivation. However, some RNAi activity can occur in these caged siRNAs, so it will be necessary to decrease this "leakage" and raise the RNAi activity restored after irradiation. This technique also uses UV light around 350 nm, which is cytotoxic, but in the near future we expect that it will be possible to use visible and near-infrared light We also examine the application of photochemical internalization (PCI) to RNAi technology, which involves a combination of photosensitizers and light. Instead of inducing RNAi using light, the strategy behind this method was to enhance RNAi using RNA carriers. Many wellknown RNA carriers deliver siRNAs into cells by endocytosis. The siRNAs are trapped in endocytic vesicles and have to be released into the cytoplasm in order to express their activity. To achieve the endosomal escape of siRNAs, PCI technology employed photosensitizers to generate light-dependent reactive oxygen species (ROS) that disrupted the endocytic vesicles. In most studies, RNAi-mediated knockdown of the target gene was detected even without PCI. Recently, a polymer capable of trapping the siRNA in endocytic vesicles controlled RNAi almost entirely by light. CLIP-RNAi uses photosensitizing carrier proteins that can be activated over a wide range of visible light wavelengths. With this method RNA carrier/siRNA complexes are completely trapped within endosomes, and RNAi is controlled strictly by light. Such precise, light-dependent control will open up new possibilities for cellular and molecular biology and therapy. Most recently, gold nanoparticles (AuNPs) conjugated to siRNA have provided temporal and spatial control of RNAi. The light-dependent melting of AuNPs accompanied by a shape transformation induces the release of thiolated siRNAs from AuNPs. In this method, the unique optical properties of the AuNP enable deep penetration of the excitation light into tissues at nearinfrared wavelengths. The development of photoinduced RNAi technology will lead to novel insights into gene functions and selective drug delivery, and many other scientific fields will continue to influence its progress.
Kaymak, Ebru; Farley, Brian M.; Hay, Samantha A.; Li, Chihua; Ho, Samantha; Hartman, Daniel J.; Ryder, Sean P.
2016-01-01
Background In C. elegans, germline development and early embryogenesis rely on post-transcriptional regulation of maternally transcribed mRNAs. In many cases, the 3′UTR is sufficient to govern the expression patterns of these transcripts. Several RNA-binding proteins are required to regulate maternal mRNAs through the 3′UTR. Despite intensive efforts to map RNA-binding protein-mRNA interactions in vivo, the biological impact of most binding events remains unknown. Reporter studies using single copy integrated transgenes are essential to evaluate the functional consequences of interactions between RNA-binding proteins and their associated mRNAs. Results In this report, we present an efficient method of generating reporter strains with improved throughput by using a library variant of MosSCI transgenesis. Furthermore, using RNA interference, we identify the suite of RBPs that control the expression pattern of five different maternal mRNAs. Conclusions The results provide a generalizable and efficient strategy to assess the functional relevance of protein-RNA interactions in vivo, and reveal new regulatory connections between key RNA-binding proteins and their maternal mRNA targets. PMID:27294288
Shahzad, Mian MK; Mangala, Lingegowda S; Han, Hee Dong; Lu, Chunhua; Bottsford-Miller, Justin; Nishimura, Masato; Mora, Edna M; Lee, Jeong-Won; Stone, Rebecca L; Pecot, Chad V; Thanapprapasr, Duangmani; Roh, Ju-Won; Gaur, Puja; Nair, Maya P; Park, Yun-Yong; Sabnis, Nirupama; Deavers, Michael T; Lee, Ju-Seog; Ellis, Lee M; Lopez-Berestein, Gabriel; McConathy, Walter J; Prokai, Laszlo; Lacko, Andras G; Sood, Anil K
2011-01-01
RNA interference holds tremendous potential as a therapeutic approach, especially in the treatment of malignant tumors. However, efficient and biocompatible delivery methods are needed for systemic delivery of small interfering RNA (siRNA). To maintain a high level of growth, tumor cells scavenge high-density lipoprotein (HDL) particles by overexpressing its receptor: scavenger receptor type B1 (SR-B1). In this study, we exploited this cellular characteristic to achieve efficient siRNA delivery and established a novel formulation of siRNA by incorporating it into reconstituted HDL (rHDL) nanoparticles. Here, we demonstrate that rHDL nanoparticles facilitate highly efficient systemic delivery of siRNA in vivo, mediated by the SR-B1. Moreover, in therapeutic proof-of-concept studies, these nanoparticles were effective in silencing the expression of two proteins that are key to cancer growth and metastasis (signal transducer and activator of transcription 3 and focal adhesion kinase) in orthotopic mouse models of ovarian and colorectal cancer. These data indicate that an rHDL nanoparticle is a novel and highly efficient siRNA carrier, and therefore, this novel technology could serve as the foundation for new cancer therapeutic approaches. PMID:21472135
Román, Belén; González-Verdejo, Clara I; Peña, Francisco; Nadal, Salvador; Gómez, Pedro
2012-01-01
Quality and integrity of RNA are critical for transcription studies in plant molecular biology. In squash fruit and other high water content crops, the grinding of tissue with mortar and pestle in liquid nitrogen fails to produce a homogeneous and fine powered sample desirable to ensure a good penetration of the extraction reagent. To develop an improved pulverisation method to facilitate the homogenisation process of squash fruit tissue prior to RNA extraction without reducing quality and yield of the extracted RNA. Three methods of pulverisation, each followed by the same extraction protocol, were compared. The first approach consisted of the lyophilisation of the sample in order to remove the excess of water before grinding, the second one used a cryogenic mill and the control one a mortar grinding of frozen tissue. The quality of the isolated RNA was tested by carrying out a quantitative real time downstream amplification. In the three situations considered, mean values for A(260) /A(280) indicated minimal interference by proteins and RNA quality indicator (RQI) values were considered appropriate for quantitative real-time polymerase chain reaction (qRT-PCR) amplification. Successful qRT-PCR amplifications were obtained with cDNA isolated with the three protocols. Both apparatus can improve and facilitate the grinding step in the RNA extraction process in zucchini, resulting in isolated RNA of high quality and integrity as revealed by qRT-PCR downstream application. This is apparently the first time that a cryogenic mill has been used to prepare fruit samples for RNA extraction, thereby improving the sampling strategy because the fine powder obtained represents a homogeneous mix of the organ tissue. Copyright © 2012 John Wiley & Sons, Ltd.
Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi
2016-01-01
Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870
RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems.
Dietrich, Isabelle; Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Brennan, Benjamin; Elliott, Richard M; Diallo, Mawlouth; Sall, Amadou A; Failloux, Anna-Bella; Schnettler, Esther; Kohl, Alain; Becker, Stefanie C
2017-01-01
The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus , Bunyaviridae ) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect Drosophila melanogaster . We found that RVFV infection induces both the exogenous small interfering RNA (siRNA) and piRNA pathways, which contribute to the control of viral replication in insects. Furthermore, we demonstrate the production of virus-derived piRNAs in Culex quinquefasciatus mosquitoes. Understanding these pathways and the targets within them offers the potential of the development of novel RVFV control measures in vector-based strategies.
RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems
Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Elliott, Richard M.; Diallo, Mawlouth; Sall, Amadou A.; Failloux, Anna-Bella; Schnettler, Esther
2017-01-01
ABSTRACT The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus, Bunyaviridae) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect Drosophila melanogaster. We found that RVFV infection induces both the exogenous small interfering RNA (siRNA) and piRNA pathways, which contribute to the control of viral replication in insects. Furthermore, we demonstrate the production of virus-derived piRNAs in Culex quinquefasciatus mosquitoes. Understanding these pathways and the targets within them offers the potential of the development of novel RVFV control measures in vector-based strategies. PMID:28497117
Zha, Lisha; He, Lichun; Xie, Weidong; Cheng, Jin; Li, Tong; Mohsen, Mona O; Lei, Fan; Storni, Federico; Bachmann, Martin; Chen, Hongquan; Zhang, Yaou
2017-01-01
Pleiotrophin (PTN) is a secreted cytokine that is expressed in various cancer cell lines and human tumor such as colon cancer, lung cancer, gastric cancer and melanoma. It plays significant roles in angiogenesis, metastasis, differentiation and cell growth. The expression of PTN in the adult is limited to the hippocampus in an activity-dependent manner, making it a very attractive target for cancer therapy. RNA interference (RNAi) offers great potential as a new powerful therapeutic strategy based on its highly specific and efficient silencing of a target gene. However, efficient delivery of small interfering RNA (siRNA) in vivo remains a significant hurdle for its successful therapeutic application. In this study, we first identified, on a cell-based experiment, applying a 1:1 mixture of two PTN specific siRNA engenders a higher silencing efficiency on both mRNA and protein level than using any of them discretely at the same dose. As a consequence, slower melanoma cells growth was also observed for using two specific siRNA combinatorially. To establish a robust way for siRNA delivery in vivo and further investigate how silence of PTN affects tumor growth, we tested three different methods to deliver siRNA in vivo: first non-targeted in-vivo delivery of siRNA via jetPEI; second lung targeted delivery of siRNA via microbubble coated jetPEI; third tumor cell targeted delivery of siRNA via transferrin-polyethylenimine (Tf-PEI). As a result, we found that all three in-vivo siRNAs delivery methods led to an evident inhibition of melanoma growth in non-immune deficiency C57BL/6 mice without a measureable change of ALT and AST activities. Both targeted delivery methods showed more significant curative effect than jetPEI. The lung targeted delivery by microbubble coated jetPEI revealed a comparable therapeutic effect with Tf-PEI, indicating its potential application for target delivery of siRNA in vivo.
Xie, Weidong; Cheng, Jin; Li, Tong; Mohsen, Mona O.; Lei, Fan; Storni, Federico; Bachmann, Martin; Chen, Hongquan; Zhang, Yaou
2017-01-01
Pleiotrophin (PTN) is a secreted cytokine that is expressed in various cancer cell lines and human tumor such as colon cancer, lung cancer, gastric cancer and melanoma. It plays significant roles in angiogenesis, metastasis, differentiation and cell growth. The expression of PTN in the adult is limited to the hippocampus in an activity-dependent manner, making it a very attractive target for cancer therapy. RNA interference (RNAi) offers great potential as a new powerful therapeutic strategy based on its highly specific and efficient silencing of a target gene. However, efficient delivery of small interfering RNA (siRNA) in vivo remains a significant hurdle for its successful therapeutic application. In this study, we first identified, on a cell-based experiment, applying a 1:1 mixture of two PTN specific siRNA engenders a higher silencing efficiency on both mRNA and protein level than using any of them discretely at the same dose. As a consequence, slower melanoma cells growth was also observed for using two specific siRNA combinatorially. To establish a robust way for siRNA delivery in vivo and further investigate how silence of PTN affects tumor growth, we tested three different methods to deliver siRNA in vivo: first non-targeted in-vivo delivery of siRNA via jetPEI; second lung targeted delivery of siRNA via microbubble coated jetPEI; third tumor cell targeted delivery of siRNA via transferrin-polyethylenimine (Tf-PEI). As a result, we found that all three in-vivo siRNAs delivery methods led to an evident inhibition of melanoma growth in non-immune deficiency C57BL/6 mice without a measureable change of ALT and AST activities. Both targeted delivery methods showed more significant curative effect than jetPEI. The lung targeted delivery by microbubble coated jetPEI revealed a comparable therapeutic effect with Tf-PEI, indicating its potential application for target delivery of siRNA in vivo. PMID:28562667
USDA-ARS?s Scientific Manuscript database
An RNAi based gene construct designated “C2” was used to target the V2 region of the cotton leaf curl virus (CLCuV) genome which is responsible for virus movement. The construct was transformed into two elite cotton varieties MNH-786 and VH-289. A shoot apex method of plant transformation using Agr...
Yau, Edwin H.; Butler, Mark C.; Sullivan, Jack M.
2016-01-01
Major bottlenecks in development of therapeutic post transcriptional gene silencing (PTGS) agents (e.g. ribozymes, RNA interference, antisense) include the challenge of mapping rare accessible regions of the mRNA target that are open for annealing and cleavage, testing and optimization of agents in human cells to identify lead agents, testing for cellular toxicity, and preclinical evaluation in appropriate animal models of disease. Methods for rapid and reliable cellular testing of PTGS agents are needed to identify potent lead candidates for optimization. Our goal was to develop a means of rapid assessment of many RNA agents to identify a lead candidate for a given mRNA associated with a disease state. We developed a rapid human cell-based screening platform to test efficacy of hammerhead ribozyme (hhRz) or RNA interference (RNAi) constructs, using a model retinal degeneration target, human rod opsin (RHO) mRNA. The focus is on RNA Drug Discovery for diverse retinal degeneration targets. To validate the approach, candidate hhRzs were tested against NUH↓ cleavage sites (N=G,C,A,U; H=C,A,U) within the target mRNA of secreted alkaline phosphatase (SEAP), a model gene expression reporter, based upon in silico predictions of mRNA accessibility. HhRzs were embedded in a larger stable adenoviral VAI RNA scaffold for high cellular expression, cytoplasmic trafficking, and stability. Most hhRz expression plasmids exerted statistically significant knockdown of extracellular SEAP enzyme activity when readily assayed by a fluorescence enzyme assay intended for high throughput screening (HTS). Kinetics of PTGS knockdown of cellular targets is measureable in live cells with the SEAP reporter. The validated SEAP HTS platform was transposed to identify lead PTGS agents against a model hereditary retinal degeneration target, RHO mRNA. Two approaches were used to physically fuse the model retinal gene target mRNA to the SEAP reporter mRNA. The most expedient way to evaluate a large set of potential VAI-hhRz expression plasmids against diverse NUH↓ cleavage sites uses cultured human HEK293S cells stably expressing a dicistronic Target-IRES-SEAP target fusion mRNA. Broad utility of this rational RNA drug discovery approach is feasible for any ophthalmological disease-relevant mRNA targets and any disease mRNA targets in general. The approach will permit rank ordering of PTGS agents based on potency to identify a lead therapeutic compound for further optimization. PMID:27233447
Schnettler, Esther; Hemmes, Hans; Huismann, Rik; Goldbach, Rob; Prins, Marcel; Kormelink, Richard
2010-11-01
The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs proteins analyzed exhibited affinity to small double-stranded RNA molecules, i.e., small interfering RNAs (siRNAs) and micro-RNA (miRNA)/miRNA* duplexes. Interestingly, the NSs proteins from tomato spotted wilt virus (TSWV), impatiens necrotic spot virus (INSV), and groundnut ringspot virus (GRSV) also showed affinity to long double-stranded RNA (dsRNA), whereas tomato yellow ring virus (TYRV) NSs did not. The TSWV NSs protein was shown to be capable of inhibiting Dicer-mediated cleavage of long dsRNA in vitro. In addition, it suppressed the accumulation of green fluorescent protein (GFP)-specific siRNAs during coinfiltration with an inverted-repeat-GFP RNA construct in Nicotiana benthamiana. In vivo interference of TSWV NSs in the miRNA pathway was shown by suppression of an enhanced GFP (eGFP) miRNA sensor construct. The ability to stabilize miRNA/miRNA* by different tospovirus NSs proteins in vivo was demonstrated by increased accumulation and detection of both miRNA171c and miRNA171c* in tospovirus-infected N. benthamiana. All together, these data suggest that tospoviruses interfere in the RNA silencing pathway by sequestering siRNA and miRNA/miRNA* molecules before they are uploaded into their respective RNA-induced silencing complexes. The observed affinity to long dsRNA for only a subset of the tospoviruses studied is discussed in light of evolutional divergence and their ancestral relation to the animal-infecting members of the Bunyaviridae.
Cooper, Lauren A.; Stringer, Anne M.
2018-01-01
ABSTRACT In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo, for the type I-E system of Escherichia coli. Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5′ end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. PMID:29666291
Special Issue: Gene Therapy with Emphasis on RNA Interference
Lundstrom, Kenneth
2015-01-01
Gene therapy was originally thought to cover replacement of malfunctioning genes in treatment of various diseases. Today, the field has been expanded to application of viral and non-viral vectors for delivery of recombinant proteins for the compensation of missing or insufficient proteins, anti-cancer genes and proteins for destruction of tumor cells, immunostimulatory genes and proteins for stimulation of the host defense system against viral agents and tumors. Recently, the importance of RNA interference and its application in gene therapy has become an attractive alternative for drug development. PMID:26447255
Delivery of RNAi reagents in murine models of obesity and diabetes.
Wilcox, Denise M; Yang, Ruojing; Morgan, Sherry J; Nguyen, Phong T; Voorbach, Martin J; Jung, Paul M; Haasch, Deanna L; Lin, Emily; Bush, Eugene N; Opgenorth, Terry J; Jacobson, Peer B; Collins, Christine A; Rondinone, Cristina M; Surowy, Terry; Landschulz, Katherine T
2006-11-29
RNA interference (RNAi) is an exciting new tool to effect acute in vivo knockdown of genes for pharmacological target validation. Testing the application of this technology to metabolic disease targets, three RNAi delivery methods were compared in two frequently utilized preclinical models of obesity and diabetes, the diet-induced obese (DIO) and B6.V-Lep
Soares, Emilie; Schwartz, Annie; Nollmann, Marcello; Margeat, Emmanuel; Boudvillain, Marc
2014-08-01
Rho is a ring-shaped, ATP-dependent RNA helicase/translocase that dissociates transcriptional complexes in bacteria. How RNA recognition is coupled to ATP hydrolysis and translocation in Rho is unclear. Here, we develop and use a new combinatorial approach, called time-resolved Nucleotide Analog Interference Probing (trNAIP), to unmask RNA molecular determinants of catalytic Rho function. We identify a regulatory step in the translocation cycle involving recruitment of the 2'-hydroxyl group of the incoming 3'-RNA nucleotide by a Rho subunit. We propose that this step arises from the intrinsic weakness of one of the subunit interfaces caused by asymmetric, split-ring arrangement of primary RNA tethers around the Rho hexamer. Translocation is at highest stake every seventh nucleotide when the weak interface engages the incoming 3'-RNA nucleotide or breaks, depending on RNA threading constraints in the Rho pore. This substrate-governed, 'test to run' iterative mechanism offers a new perspective on how a ring-translocase may function or be regulated. It also illustrates the interest and versatility of the new trNAIP methodology to unveil the molecular mechanisms of complex RNA-based systems. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Schuster, Susan; Tholen, Lotte E; Overheul, Gijs J; van Kuppeveld, Frank J M; van Rij, Ronald P
2017-01-01
Antiviral immunity in insects and plants is mediated by the RNA interference (RNAi) pathway in which viral long double-stranded RNA (dsRNA) is processed into small interfering RNAs (siRNAs) by Dicer enzymes. Although this pathway is evolutionarily conserved, its involvement in antiviral defense in mammals is the subject of debate. In vertebrates, recognition of viral RNA induces a sophisticated type I interferon (IFN)-based immune response, and it has been proposed that this response masks or inhibits antiviral RNAi. To test this hypothesis, we analyzed viral small RNA production in differentiated cells deficient in the cytoplasmic RNA sensors RIG-I and MDA5. We did not detect 22-nucleotide (nt) viral siRNAs upon infection with three different positive-sense RNA viruses. Our data suggest that the depletion of cytoplasmic RIG-I-like sensors is not sufficient to uncover viral siRNAs in differentiated cells. IMPORTANCE The contribution of the RNA interference (RNAi) pathway in antiviral immunity in vertebrates has been widely debated. It has been proposed that RNAi possesses antiviral activity in mammalian systems but that its antiviral effect is masked by the potent antiviral interferon response in differentiated mammalian cells. In this study, we show that inactivation of the interferon response is not sufficient to uncover antiviral activity of RNAi in human epithelial cells infected with three wild-type positive-sense RNA viruses.
Abasic pivot substitution harnesses target specificity of RNA interference
Lee, Hye-Sook; Seok, Heeyoung; Lee, Dong Ha; Ham, Juyoung; Lee, Wooje; Youm, Emilia Moonkyung; Yoo, Jin Seon; Lee, Yong-Seung; Jang, Eun-Sook; Chi, Sung Wook
2015-01-01
Gene silencing via RNA interference inadvertently represses hundreds of off-target transcripts. Because small interfering RNAs (siRNAs) can function as microRNAs, avoiding miRNA-like off-target repression is a major challenge. Functional miRNA–target interactions are known to pre-require transitional nucleation, base pairs from position 2 to the pivot (position 6). Here, by substituting nucleotide in pivot with abasic spacers, which prevent base pairing and alleviate steric hindrance, we eliminate miRNA-like off-target repression while preserving on-target activity at ∼80–100%. Specifically, miR-124 containing dSpacer pivot substitution (6pi) loses seed-mediated transcriptome-wide target interactions, repression activity and biological function, whereas other conventional modifications are ineffective. Application of 6pi allows PCSK9 siRNA to efficiently lower plasma cholesterol concentration in vivo, and abolish potentially deleterious off-target phenotypes. The smallest spacer, C3, also shows the same improvement in target specificity. Abasic pivot substitution serves as a general means to harness the specificity of siRNA experiments and therapeutic applications. PMID:26679372
Kandeel, Mahmoud; Kitade, Yukio
2013-07-01
RNA interference (RNAi) is a critical cellular pathway activated by double stranded RNA and regulates the gene expression of target mRNA. During RNAi, the 3' end of siRNA binds with the PAZ domain, followed by release and rebinding in a cyclic manner, which deemed essential for proper gene silencing. Recently, we provided the forces underlying the recognition of small interfering RNA by PAZ in a computational study based on the structure of Drosophila Argonaute 2 (Ago2) PAZ domain. We have now reanalyzed these data within the view of the new available structures from human Argonauts. While the parameters of weak binding are correlated with higher (RNAi) in the Drosophila model, a different profile is predicted with the human Ago2 PAZ domain. On the basis of the human Ago2 PAZ models, the indicators of stronger binding as the total binding energy and the free energy were associated with better RNAi efficacy. This discrepancy might be attributable to differences in the binding site topology and the difference in the conformation of the bound nucleotides.
Pulmonary Delivery of siRNA via Polymeric Vectors as Therapies of Asthma
Xie, Yuran; Merkel, Olivia M
2015-01-01
Asthma is a chronic inflammatory disease. Despite the fact that current therapies, such as the combination of inhaled corticosteroids and β2-agonists, can control the symptoms of asthma in most patients, there is still an urgent need for an alternative anti-inflammatory therapy for patients who suffer from severe asthma but lack acceptable response to conventional therapies. Many molecular factors are involved in the inflammatory process in asthma, and thus blocking the function of these factors could efficiently alleviate airway inflammation. RNA interference (RNAi) is often thought to be the answer in the search for more efficient and biocompatible treatments. However, difficulties of efficient delivery of small interference RNA (siRNA), the key factor in RNAi, to target cells and tissues has limited its clinical application. In this review, we summarize cytokines and chemokines, transcription factors, tyrosine kinases and costimulatory factors that have been reported as targets of siRNA mediated treatment in experimental asthma. Additionally, we conclude several targeted delivery systems of siRNA to specific cells such as T cells, macrophages and dendritic cells, which could potentially be applied in asthma therapy. PMID:26148454
Suckau, Lennart; Fechner, Henry; Chemaly, Elie; Krohn, Stefanie; Hadri, Lahouaria; Kockskämper, Jens; Westermann, Dirk; Bisping, Egbert; Ly, Hung; Wang, Xiaomin; Kawase, Yoshiaki; Chen, Jiqiu; Liang, Lifan; Sipo, Isaac; Vetter, Roland; Weger, Stefan; Kurreck, Jens; Erdmann, Volker; Tschope, Carsten; Pieske, Burkert; Lebeche, Djamel; Schultheiss, Heinz-Peter; Hajjar, Roger J.; Poller, Wolfgang Ch.
2009-01-01
Background RNA interference (RNAi) has the potential to be a novel therapeutic strategy in diverse areas of medicine. We report on targeted RNAi for the treatment of heart failure (HF), an important disorder in humans resulting from multiple etiologies. Successful treatment of HF is demonstrated in a rat model of transaortic banding by RNAi targeting of phospholamban (PLB), a key regulator of cardiac Ca2+ homeostasis. Whereas gene therapy rests on recombinant protein expression as its basic principle, RNAi therapy employs regulatory RNAs to achieve its effect. Methods and Results We describe structural requirements to obtain high RNAi activity from adenoviral (AdV) and adeno-associated virus (AAV9) vectors and show that an AdV short hairpin RNA vector (AdV-shRNA) silenced PLB in cardiomyocytes (NRCMs) and improved hemodynamics in HF rats 1 month after aortic root injection. For simplified long-term therapy we developed a dimeric cardiotropic AAV vector (rAAV9-shPLB) delivering RNAi activity to the heart via intravenous injection. Cardiac PLB protein was reduced to 25% and SERCA2a suppression in the HF groups was rescued. In contrast to traditional vectors rAAV9 shows high affinity for myocardium, but low affinity for liver and other organs. rAAV9-shPLB therapy restored diastolic (LVEDP, dp/dtmin, Tau) and systolic (fractional shortening) functional parameters to normal range. The massive cardiac dilation was normalized and the cardiac hypertrophy, cardiomyocyte diameter and cardiac fibrosis significantly reduced. Importantly, there was no evidence of microRNA deregulation or hepatotoxicity during these RNAi therapies. Conclusion Our data show, for the first time, high efficacy of an RNAi therapeutic strategy in a cardiac disease. PMID:19237664
RNA interference for performance enhancement and detection in doping control.
Kohler, Maxie; Schänzer, Wilhelm; Thevis, Mario
2011-10-01
RNA interference represents a comparably new route of regulating and manipulating specific gene expression. Promising results were obtained in experimental therapies aim at the treatment of different kinds of diseases including cancer, diabetes mellitus or Dychenne muscular dystrophy. While studies on down-regulation efficiency are often performed by analyzing the regulated protein, the direct detection of small, interfering RNA molecules and antisense oligonucleotides is of great interest for the investigation of the metabolism and degradation and also for the detection of a putative misuse of these molecules in sports. Myostatin down-regulation was shown to result in increased performance and muscle growth and the regulation of several other proteins could be relevant for performance enhancement. This mini-review summarizes current approaches for the mass spectrometric analysis of siRNA and antisense oligonucleotides from biological matrices and the available data on biodistribution, metabolism, and half-life of relevant substances are discussed. Copyright © 2011 John Wiley & Sons, Ltd.
A method for detecting genetic toxicity using the RNA synthesis response to DNA damage.
Morita, Yoko; Iwai, Shigenori; Kuraoka, Isao
2011-10-01
To date, biological risk assessment studies of chemicals that induce DNA lesions have been primarily based on the action of DNA polymerases during replication. However, DNA lesions interfere not only with replication but also with transcription. Therefore, detecting the damaging effects of DNA lesions during transcription might be important for estimating the safety of chemical mutagens and carcinogens. However, methods to address these effects have not been developed. Here, we report a simple, non-isotopic method for determining the toxicity of chemical agents by visualizing transcription in a mammalian cell system. The method is based on the measurement of the incorporation of bromouridine (as the uridine analogue) into the nascent RNA during RNA synthesis inhibition (RSI) induced by the stalling of RNA polymerases at DNA lesions on the transcribed DNA strand, which triggers transcription-coupled nucleotide excision repair (TC-NER). When we tested chemical agents (camptothecin, etoposide, 4-nitroquinoline-1-oxide, mitomycin C, methyl methanesulfonate, and cisplatin) in HeLa cells by the method, RSI indicative of genomic toxicity was observed in the nucleoli of the tested cells. This procedure provides the following advantages: 1) it uses common, affordable mammalian cells (HeLa cells, WI38VA13 cells, human dermal fibroblasts, or Chinese hamster ovary cells) rather than genetically modified microorganisms; 2) it can be completed within approximately 8 hr after the cells are prepared because RNA polymerase responses during TC-NER are faster than other DNA damage responses (replication, recombination, and apoptosis); and 3) it is safe because it uses non-radioactive bromouridine and antibodies to detect RNA synthesis on undamaged transcribed DNA strands.
Takata, Nozomu; Sakakura, Eriko; Sakuma, Tetsushi; Yamamoto, Takashi
2017-01-01
Approaches to investigate gene functions in experimental biology are becoming more diverse and reliable. Furthermore, several kinds of tissues and organs that possess their original identities can be generated in petri dishes from stem cells including embryonic, adult and induced pluripotent stem cells. Researchers now have several choices of experimental methods and their combinations to analyze gene functions in various biological systems. Here, as an example we describe one of the better protocols, which combines three-dimensional embryonic stem cell culture with small regulatory RNA-mediated technologies, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9), and inducible RNA interference (RNAi). This protocol allows investigation of genes of interest to better understand gene functions in target tissues (or organs) during in vitro development.
RNA interference mediated pten knock-down inhibit the formation of polycystic ovary.
Ouyang, Jie-Xiu; Luo, Tao; Sun, Hui-Yun; Huang, Jian; Tang, Dan-Feng; Wu, Lei; Zheng, Yue-Hui; Zheng, Li-Ping
2013-08-01
Pten (phosphatase and tensin homolog deleted on chromosome 10), a kind of tumor suppressor gene, plays important roles in female reproductive system. But its expression and roles in the formation of polycystic ovaries are yet to be known. In this study, we constructed a rat model of PCOS using norethindrone and HCG injections and found the expressions of pten mRNA and PTEN protein increased significantly in the polycystic ovary tissue by immunohistochemistry, RT-PCR, and western blot. Furthermore, the results showed that in vivo ovaries could be effectively transfected by lentiviral vectors through the ovarian microinjection method and indicated that pten shRNA may inhibit the formation of polycystic ovaries by pten down-regulation. Our study provides new information regarding the role of PTEN in female reproductive disorders, such as polycystic ovary syndrome.
CRISPR/Cas9 mediates efficient conditional mutagenesis in Drosophila.
Xue, Zhaoyu; Wu, Menghua; Wen, Kejia; Ren, Menda; Long, Li; Zhang, Xuedi; Gao, Guanjun
2014-09-05
Existing transgenic RNA interference (RNAi) methods greatly facilitate functional genome studies via controlled silencing of targeted mRNA in Drosophila. Although the RNAi approach is extremely powerful, concerns still linger about its low efficiency. Here, we developed a CRISPR/Cas9-mediated conditional mutagenesis system by combining tissue-specific expression of Cas9 driven by the Gal4/upstream activating site system with various ubiquitously expressed guide RNA transgenes to effectively inactivate gene expression in a temporally and spatially controlled manner. Furthermore, by including multiple guide RNAs in a transgenic vector to target a single gene, we achieved a high degree of gene mutagenesis in specific tissues. The CRISPR/Cas9-mediated conditional mutagenesis system provides a simple and effective tool for gene function analysis, and complements the existing RNAi approach. Copyright © 2014 Xue et al.
Zhang, Xiaohua Douglas; Yang, Xiting Cindy; Chung, Namjin; Gates, Adam; Stec, Erica; Kunapuli, Priya; Holder, Dan J; Ferrer, Marc; Espeseth, Amy S
2006-04-01
RNA interference (RNAi) high-throughput screening (HTS) experiments carried out using large (>5000 short interfering [si]RNA) libraries generate a huge amount of data. In order to use these data to identify the most effective siRNAs tested, it is critical to adopt and develop appropriate statistical methods. To address the questions in hit selection of RNAi HTS, we proposed a quartile-based method which is robust to outliers, true hits and nonsymmetrical data. We compared it with the more traditional tests, mean +/- k standard deviation (SD) and median +/- 3 median of absolute deviation (MAD). The results suggested that the quartile-based method selected more hits than mean +/- k SD under the same preset error rate. The number of hits selected by median +/- k MAD was close to that by the quartile-based method. Further analysis suggested that the quartile-based method had the greatest power in detecting true hits, especially weak or moderate true hits. Our investigation also suggested that platewise analysis (determining effective siRNAs on a plate-by-plate basis) can adjust for systematic errors in different plates, while an experimentwise analysis, in which effective siRNAs are identified in an analysis of the entire experiment, cannot. However, experimentwise analysis may detect a cluster of true positive hits placed together in one or several plates, while platewise analysis may not. To display hit selection results, we designed a specific figure called a plate-well series plot. We thus suggest the following strategy for hit selection in RNAi HTS experiments. First, choose the quartile-based method, or median +/- k MAD, for identifying effective siRNAs. Second, perform the chosen method experimentwise on transformed/normalized data, such as percentage inhibition, to check the possibility of hit clusters. If a cluster of selected hits are observed, repeat the analysis based on untransformed data to determine whether the cluster is due to an artifact in the data. If no clusters of hits are observed, select hits by performing platewise analysis on transformed data. Third, adopt the plate-well series plot to visualize both the data and the hit selection results, as well as to check for artifacts.
Chen, Chun-Chieh G; Simard, Martin J; Tabara, Hiroaki; Brownell, Daniel R; McCollough, Jennifer A; Mello, Craig C
2005-02-22
RNA interference (RNAi) is an ancient, highly conserved mechanism in which small RNA molecules (siRNAs) guide the sequence-specific silencing of gene expression . Several silencing machinery protein components have been identified, including helicases, RNase-related proteins, double- and single-stranded RNA binding proteins, and RNA-dependent RNA polymerase-related proteins . Work on these factors has led to the revelation that RNAi mechanisms intersect with cellular pathways required for development and fertility . Despite rapid progress in understanding key steps in the RNAi pathway, it is clear that many factors required for both RNAi and related developmental mechanisms have not yet been identified. Here, we report the characterization of the C. elegans gene rde-3. Genetic analysis of presumptive null alleles indicates that rde-3 is required for siRNA accumulation and for efficient RNAi in all tissues, and it is essential for fertility and viability at high temperatures. RDE-3 contains conserved domains found in the polymerase beta nucleotidyltransferase superfamily, which includes conventional poly(A) polymerases, 2'-5' oligoadenylate synthetase (OAS), and yeast Trf4p . These findings implicate a new enzymatic modality in RNAi and suggest possible models for the role of RDE-3 in the RNAi mechanism.
Suppression of RNA Interference by Adenovirus Virus-Associated RNA†
Andersson, M. Gunnar; Haasnoot, P. C. Joost; Xu, Ning; Berenjian, Saideh; Berkhout, Ben; Akusjärvi, Göran
2005-01-01
We show that human adenovirus inhibits RNA interference (RNAi) at late times of infection by suppressing the activity of two key enzyme systems involved, Dicer and RNA-induced silencing complex (RISC). To define the mechanisms by which adenovirus blocks RNAi, we used a panel of mutant adenoviruses defective in virus-associated (VA) RNA expression. The results show that the virus-associated RNAs, VA RNAI and VA RNAII, function as suppressors of RNAi by interfering with the activity of Dicer. The VA RNAs bind Dicer and function as competitive substrates squelching Dicer. Further, we show that VA RNAI and VA RNAII are processed by Dicer, both in vitro and during a lytic infection, and that the resulting short interfering RNAs (siRNAs) are incorporated into active RISC. Dicer cleaves the terminal stem of both VA RNAI and VA RNAII. However, whereas both strands of the VA RNAI-specific siRNA are incorporated into RISC, the 3′ strand of the VA RNAII-specific siRNA is selectively incorporated during a lytic infection. In summary, our work shows that adenovirus suppresses RNAi during a lytic infection and gives insight into the mechanisms of RNAi suppression by VA RNA. PMID:16014917
RNA interference of tubulin genes has lethal effects in Mythimna separate.
Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji
2018-05-23
RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.
[Expression analysis of a transformer gene in Daphnia pulex after RNAi].
Guo, C Y; Chen, P; Zhang, M M; Ning, J J; Wang, С L; Wang, D L; Zhao, Y L
2016-01-01
In order to explore the importance of the transformer (tra) gene in reproductive mode switching in Daphnia pulex, we studied the effect of silencing of this gene using RNA interference (RNAi). We obtained Dptra dsRNA by constructing and using a dsRNA expression vector and transcription method in vitro. D. pulex individuals in different reproductive modes were treated by soaking in a solution of Dptra dsRNA. We then assayed the expression of the endogenous Dptra mRNA after RNAi treatment using RT-PCR and obtained the suppression ratio. Expression of the tra gene in the RNAi groups was down-regulated compared with the controls after 16 h (p < 0.05). We also analyzed the effect of RNAi on the expression of the TRA protein using Western blot, which showed that the expression level of the TRA protein was reduced after RNAi treatment. Our experimental results showed that soaking of D. pulex adults in tra-specific dsRNA transcribed in vitro can specifically reduce the level of tra mRNA and also reduce the expression of the TRA protein, demonstrating effective in vivo silencing of the tra gene.
A Role for Peptides in Overcoming Endosomal Entrapment in siRNA Delivery – A Focus on Melittin
Hou, Kirk K.; Pan, Hua; Schlesinger, Paul H.; Wickline, Samuel A.
2015-01-01
siRNA has the possibility to revolutionize medicine by enabling highly specific and efficient silencing of proteins involved in disease pathogenesis. Despite nearly 20 years of research dedicated to translating siRNA from a research tool into a clinically relevant therapeutic, minimal success has been had to date. Access to RNA interference machinery located in the cytoplasm is often overlooked, but must be considered when designing the next generation of siRNA delivery strategies. Peptide transduction domains (PTD) have demonstrated moderate siRNA transfection, which is primarily limited by endosomal entrapment. Strategies aimed at overcoming endosomal entrapment associated with peptide vectors are reviewed here, including osmotic methods, lipid conjugation, and fusogenic peptides. As an alternative to traditional PTD, the hemolytic peptide melittin exhibits the native capacity for endosomal disruption but causes cytotoxicity. However, appropriate packaging and protection of melittin with activation and release in the endosomal compartment has allowed melittin-based strategies to demonstrate both in vitro and in vivo safety and efficacy. These data suggest that melittin's membrane disruptive properties can enable safe and effective endosomolysis, building a case for melittin as a key component in a new generation of siRNA therapeutics. PMID:26025036
Hrle, Ajla; Maier, Lisa-Katharina; Sharma, Kundan; Ebert, Judith; Basquin, Claire; Urlaub, Henning; Marchfelder, Anita; Conti, Elena
2014-01-01
Upon pathogen invasion, bacteria and archaea activate an RNA-interference-like mechanism termed CRISPR (clustered regularly interspaced short palindromic repeats). A large family of Cas (CRISPR-associated) proteins mediates the different stages of this sophisticated immune response. Bioinformatic studies have classified the Cas proteins into families, according to their sequences and respective functions. These range from the insertion of the foreign genetic elements into the host genome to the activation of the interference machinery as well as target degradation upon attack. Cas7 family proteins are central to the type I and type III interference machineries as they constitute the backbone of the large interference complexes. Here we report the crystal structure of Thermofilum pendens Csc2, a Cas7 family protein of type I-D. We found that Csc2 forms a core RRM-like domain, flanked by three peripheral insertion domains: a lid domain, a Zinc-binding domain and a helical domain. Comparison with other Cas7 family proteins reveals a set of similar structural features both in the core and in the peripheral domains, despite the absence of significant sequence similarity. T. pendens Csc2 binds single-stranded RNA in vitro in a sequence-independent manner. Using a crosslinking - mass-spectrometry approach, we mapped the RNA-binding surface to a positively charged surface patch on T. pendens Csc2. Thus our analysis of the key structural and functional features of T. pendens Csc2 highlights recurring themes and evolutionary relationships in type I and type III Cas proteins.
RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans.
Tops, Bastiaan B J; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C; Plasterk, Ronald H A; Ketting, René F
2005-01-01
In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of approximately 250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step.
[Study on the inhibition effect of siRNA on herpes simplex virus type 2 ICP4 gene].
Liu, Ji-feng; Guan, Cui-ping; Tang, Xu; Xu, Ai-e
2010-06-01
To explore the inhibition effect of RNA interference on the ICP4 expression and DNA replication of herpes simplex virus type 2 (HSV2). Four pairs of siRNA targeted to HSV2 ICP4 gene and negative control siRNA were synthetized by chemical method, named as siRNA-1, siRNA-2, siRNA-3, siRNA-4 and siRNA-N respecticely. HSV2 HG52 was used to attack Vero cell after transfection overnight. Vero cell and supernatant were collected at 1d, 2d, 3d, 4d and 5d after virus attacking. Flurogenic quantitative reverse transcription polymerase chain reaction (FQ-RT-PCR)was used to detect the expression of HSV2 ICP4 mRNA, flurogenic quantitative polymerase chain reaction(FG-PCR) was used to detect the expression of HSV2 DNA and Western-Blot was used to detect the expression of HSV2 ICP4 protein. All the four pairs of siRNA could significantly inhibit the expression of HSV2 ICP4 mRNA and protein, especially siRNA-2. The above siRNAs could significantly decrease HSV2 DNA copy number,too. siRNAs targeted to HSV2 ICP4 gene could significantly inhibit expression of HSV2 ICP4 mRNA and protein, and decrease HSV2 DNA copy number, suggesting that siRNA can inhibit HSV2 DNA replication through silencing ICP4 gene.
The role of Cas8 in type I CRISPR interference.
Cass, Simon D B; Haas, Karina A; Stoll, Britta; Alkhnbashi, Omer S; Sharma, Kundan; Urlaub, Henning; Backofen, Rolf; Marchfelder, Anita; Bolt, Edward L
2015-05-05
CRISPR (clustered regularly interspaced short palindromic repeat) systems provide bacteria and archaea with adaptive immunity to repel invasive genetic elements. Type I systems use 'cascade' [CRISPR-associated (Cas) complex for antiviral defence] ribonucleoprotein complexes to target invader DNA, by base pairing CRISPR RNA (crRNA) to protospacers. Cascade identifies PAMs (protospacer adjacent motifs) on invader DNA, triggering R-loop formation and subsequent DNA degradation by Cas3. Cas8 is a candidate PAM recognition factor in some cascades. We analysed Cas8 homologues from type IB CRISPR systems in archaea Haloferax volcanii (Hvo) and Methanothermobacter thermautotrophicus (Mth). Cas8 was essential for CRISPR interference in Hvo and purified Mth Cas8 protein responded to PAM sequence when binding to nucleic acids. Cas8 interacted physically with Cas5-Cas7-crRNA complex, stimulating binding to PAM containing substrates. Mutation of conserved Cas8 amino acid residues abolished interference in vivo and altered catalytic activity of Cas8 protein in vitro. This is experimental evidence that Cas8 is important for targeting Cascade to invader DNA. © 2015 Authors.
RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding.
Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung
2014-01-01
RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties.
RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding
Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung
2014-01-01
RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties. PMID:25332689
Bausero, Maria A.; Bharti, Ajit; Page, Diana T.; Perez, Kristen D.; Eng, Jason W.-L.; Ordonez, Susana L.; Jantschitsch, Christian; Kindas-Muegge, Ingela; Ciocca, Daniel; Asea, Alexzander
2006-01-01
The 25-kDa heat shock protein (Hsp25) is associated with various malignancies and is expressed at high levels in biopsies as well as circulating in the serum of breast cancer patients. In this study, we used RNA interference technology to silence the hsp25 gene in 4T1 breast adenocarcinoma cells, known as a poorly immunogenic, highly metastatic cell line. We demonstrate that transfection of 4T1 cells with short interference RNA-Hsp25 dramatically inhibits proliferation as compared with control transfected cells. In addition, we show that 4T1 cells transfected with short interference RNA-Hsp25 abrogates tumor migration potential by a mechanism that is in part due to the repression of matrix metalloproteinase 9 expression and a concomitant upregulation of its antagonist, tissue inhibitor metalloproteinase 1. Taken together, these findings provide a model system for the study of metastatic potential of tumors and are suggestive of an earlier unrecognized role for Hsp25 in tumor migration. PMID:16340246
Bausero, Maria A; Bharti, Ajit; Page, Diana T; Perez, Kristen D; Eng, Jason W-L; Ordonez, Susana L; Asea, Edwina E; Jantschitsch, Christian; Kindas-Muegge, Ingela; Ciocca, Daniel; Asea, Alexzander
2006-01-01
The 25-kDa heat shock protein (Hsp25) is associated with various malignancies and is expressed at high levels in biopsies as well as circulating in the serum of breast cancer patients. In this study, we used RNA interference technology to silence the hsp25 gene in 4T1 breast adenocarcinoma cells, known as a poorly immunogenic, highly metastatic cell line. We demonstrate that transfection of 4T1 cells with short interference RNA-Hsp25 dramatically inhibits proliferation as compared with control transfected cells. In addition, we show that 4T1 cells transfected with short interference RNA-Hsp25 abrogates tumor migration potential by a mechanism that is in part due to the repression of matrix metalloproteinase 9 expression and a concomitant upregulation of its antagonist, tissue inhibitor metalloproteinase 1. Taken together, these findings provide a model system for the study of metastatic potential of tumors and are suggestive of an earlier unrecognized role for Hsp25 in tumor migration. Copyright 2006 S. Karger AG, Basel.
Multifunctional RNA Nanoparticles
2015-01-01
Our recent advancements in RNA nanotechnology introduced novel nanoscaffolds (nanorings); however, the potential of their use for biomedical applications was never fully revealed. As presented here, besides functionalization with multiple different short interfering RNAs for combinatorial RNA interference (e.g., against multiple HIV-1 genes), nanorings also allow simultaneous embedment of assorted RNA aptamers, fluorescent dyes, proteins, as well as recently developed RNA–DNA hybrids aimed to conditionally activate multiple split functionalities inside cells. PMID:25267559
Improving small-angle X-ray scattering data for structural analyses of the RNA world
Rambo, Robert P.; Tainer, John A.
2010-01-01
Defining the shape, conformation, or assembly state of an RNA in solution often requires multiple investigative tools ranging from nucleotide analog interference mapping to X-ray crystallography. A key addition to this toolbox is small-angle X-ray scattering (SAXS). SAXS provides direct structural information regarding the size, shape, and flexibility of the particle in solution and has proven powerful for analyses of RNA structures with minimal requirements for sample concentration and volumes. In principle, SAXS can provide reliable data on small and large RNA molecules. In practice, SAXS investigations of RNA samples can show inconsistencies that suggest limitations in the SAXS experimental analyses or problems with the samples. Here, we show through investigations on the SAM-I riboswitch, the Group I intron P4-P6 domain, 30S ribosomal subunit from Sulfolobus solfataricus (30S), brome mosaic virus tRNA-like structure (BMV TLS), Thermotoga maritima asd lysine riboswitch, the recombinant tRNAval, and yeast tRNAphe that many problems with SAXS experiments on RNA samples derive from heterogeneity of the folded RNA. Furthermore, we propose and test a general approach to reducing these sample limitations for accurate SAXS analyses of RNA. Together our method and results show that SAXS with synchrotron radiation has great potential to provide accurate RNA shapes, conformations, and assembly states in solution that inform RNA biological functions in fundamental ways. PMID:20106957
Smith, Justin D; Suresh, Sundari; Schlecht, Ulrich; Wu, Manhong; Wagih, Omar; Peltz, Gary; Davis, Ronald W; Steinmetz, Lars M; Parts, Leopold; St Onge, Robert P
2016-03-08
Genome-scale CRISPR interference (CRISPRi) has been used in human cell lines; however, the features of effective guide RNAs (gRNAs) in different organisms have not been well characterized. Here, we define rules that determine gRNA effectiveness for transcriptional repression in Saccharomyces cerevisiae. We create an inducible single plasmid CRISPRi system for gene repression in yeast, and use it to analyze fitness effects of gRNAs under 18 small molecule treatments. Our approach correctly identifies previously described chemical-genetic interactions, as well as a new mechanism of suppressing fluconazole toxicity by repression of the ERG25 gene. Assessment of multiple target loci across treatments using gRNA libraries allows us to determine generalizable features associated with gRNA efficacy. Guides that target regions with low nucleosome occupancy and high chromatin accessibility are clearly more effective. We also find that the best region to target gRNAs is between the transcription start site (TSS) and 200 bp upstream of the TSS. Finally, unlike nuclease-proficient Cas9 in human cells, the specificity of truncated gRNAs (18 nt of complementarity to the target) is not clearly superior to full-length gRNAs (20 nt of complementarity), as truncated gRNAs are generally less potent against both mismatched and perfectly matched targets. Our results establish a powerful functional and chemical genomics screening method and provide guidelines for designing effective gRNAs, which consider chromatin state and position relative to the target gene TSS. These findings will enable effective library design and genome-wide programmable gene repression in many genetic backgrounds.
Rathe, Susan K; Moriarity, Branden S; Stoltenberg, Christopher B; Kurata, Morito; Aumann, Natalie K; Rahrmann, Eric P; Bailey, Natashay J; Melrose, Ellen G; Beckmann, Dominic A; Liska, Chase R; Largaespada, David A
2014-08-13
The evolution from microarrays to transcriptome deep-sequencing (RNA-seq) and from RNA interference to gene knockouts using Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs) and Transcription Activator-Like Effector Nucleases (TALENs) has provided a new experimental partnership for identifying and quantifying the effects of gene changes on drug resistance. Here we describe the results from deep-sequencing of RNA derived from two cytarabine (Ara-C) resistance acute myeloid leukemia (AML) cell lines, and present CRISPR and TALEN based methods for accomplishing complete gene knockout (KO) in AML cells. We found protein modifying loss-of-function mutations in Dck in both Ara-C resistant cell lines. CRISPR and TALEN-based KO of Dck dramatically increased the IC₅₀ of Ara-C and introduction of a DCK overexpression vector into Dck KO clones resulted in a significant increase in Ara-C sensitivity. This effort demonstrates the power of using transcriptome analysis and CRISPR/TALEN-based KOs to identify and verify genes associated with drug resistance.
Steric restrictions of RISC in RNA interference identified with size-expanded RNA nucleobases.
Hernández, Armando R; Peterson, Larryn W; Kool, Eric T
2012-08-17
Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC), the key protein complex of RNA interference (RNAi), is of great importance to the development of siRNAs with improved biological and potentially therapeutic function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to -5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3'-end increased activity over that of wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation.
Steric Restrictions of RISC in RNA Interference Identified with Size-Expanded RNA Nucleobases
Hernández, Armando R.; Peterson, Larryn W.; Kool, Eric T.
2012-01-01
Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC) – the key protein complex of RNA interference (RNAi) – is of great importance to the development of siRNAs with improved biological, and potentially therapeutic, function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases, and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to −5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region, but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3′-end increased activity over wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation. PMID:22646660
RNAi-induced silencing of embryonic tryptophan oxygenase in the Pyralid moth, Plodia interpunctella
Fabrick, Jeffrey A.; Kanost, Michael R.; Baker, James E.
2004-01-01
Gene silencing through the introduction of double-stranded RNA (RNA interference, RNAi) provides a powerful tool for the elucidation of gene function in many systems, including those where genomics and proteomics are incomplete. The use of RNAi technology for gene silencing in Lepidoptera has lacked significant attention compared to other systems. To demonstrate that RNAi can be utilized in the lepidopteran, Plodia interpunctella, we cloned a cDNA for tryptophan oxygenase, and showed that silencing of tryptophan oxygenase through RNAi during embryonic development resulted in loss of eye-color pigmentation. The complete amino acid sequence of Plodia tryptophan oxygenase can be accessed through NCBI Protein Database under NCBI Accession # AY427951. Abbreviation RNAi RNA interference PCR polymerase chain reaction RT-PCR reverse transcription-PCR PMID:15861231
Chio, Chung-Ching; Wei, Li; Chen, Tyng Guey; Lin, Chien-Min; Shieh, Ja-Ping; Yeh, Poh-Shiow; Chen, Ruei-Ming
2016-06-01
OBJECT Hypoxia can induce cell death or trigger adaptive mechanisms to guarantee cell survival. Neuron-derived orphan receptor 1 (NOR-1) works as an early-response protein in response to a variety of environmental stresses. In this study, the authors evaluated the roles of NOR-1 in hypoxia-induced neuronal insults. METHODS Neuro-2a cells were exposed to oxygen/glucose deprivation (OGD). Cell viability, cell morphology, cas-pase-3 activity, DNA fragmentation, and cell apoptosis were assayed to determine the mechanisms of OGD-induced neuronal insults. RNA and protein analyses were carried out to evaluate the effects of OGD on expressions of NOR-1, cAMP response element-binding (CREB), and cellular inhibitor of apoptosis protein 2 (cIAP2) genes. Translations of these gene expressions were knocked down using RNA interference. Mice subjected to traumatic brain injury (TBI) and NOR-1 was immunodetected. RESULTS Exposure of neuro-2a cells to OGD decreased cell viability in a time-dependent manner. Additionally, OGD led to cell shrinkage, DNA fragmentation, and cell apoptosis. In parallel, treatment of neuro-2a cells with OGD time dependently increased cellular NOR-1 mRNA and protein expressions. Interestingly, administration of TBI also augmented NOR-1 levels in the impacted regions of mice. As to the mechanism, exposure to OGD increased nuclear levels of the transcription factor CREB protein. Downregulating CREB expression using RNA interference simultaneously inhibited OGD-induced NOR-1 mRNA expression. Also, levels of cIAP2 mRNA and protein in neuro-2a cells were augmented by OGD. After reducing cIAP2 translation, OGD-induced cell death was reduced. Sequentially, application of NOR-1 small interfering RNA to neuro-2a cells significantly inhibited OGD-induced cIAP2 mRNA expression and concurrently alleviated hypoxia-induced alterations in cell viability, caspase-3 activation, DNA damage, and cell apoptosis. CONCLUSIONS This study shows that NOR-1 can transduce survival signals in neuronal cells responsible for hypoxiainduced apoptotic insults through activation of a CREB/cIAP2-dependent mechanism.
Cabanillas, Laura; Arribas, María; Lázaro, Ester
2013-01-16
When beneficial mutations present in different genomes spread simultaneously in an asexual population, their fixation can be delayed due to competition among them. This interference among mutations is mainly determined by the rate of beneficial mutations, which in turn depends on the population size, the total error rate, and the degree of adaptation of the population. RNA viruses, with their large population sizes and high error rates, are good candidates to present a great extent of interference. To test this hypothesis, in the current study we have investigated whether competition among beneficial mutations was responsible for the prolonged presence of polymorphisms in the mutant spectrum of an RNA virus, the bacteriophage Qβ, evolved during a large number of generations in the presence of the mutagenic nucleoside analogue 5-azacytidine. The analysis of the mutant spectra of bacteriophage Qβ populations evolved at artificially increased error rate shows a large number of polymorphic mutations, some of them with demonstrated selective value. Polymorphisms distributed into several evolutionary lines that can compete among them, making it difficult the emergence of a defined consensus sequence. The presence of accompanying deleterious mutations, the high degree of recurrence of the polymorphic mutations, and the occurrence of epistatic interactions generate a highly complex interference dynamics. Interference among beneficial mutations in bacteriophage Qβ evolved at increased error rate permits the coexistence of multiple adaptive pathways that can provide selective advantages by different molecular mechanisms. In this way, interference can be seen as a positive factor that allows the exploration of the different local maxima that exist in rugged fitness landscapes.
Xiang, F; Zhang, D X; Ma, S Y; Huang, Y S
2016-12-20
Objective: To investigate the mechanism of protective effects of tumor necrosis factor receptor associated protein 1 (TRAP1) on hypoxic cardiomyocytes of rats. Methods: Primary cultured cardiomyocytes were obtained from neonatal Sprague-Dawley rats (aged 1 to 3 days) and then used in the following experiments. (1) Cells were divided into group TRAP1 and control group according to the random number table (the same grouping method below), and then the total protein of cells was extracted. Total protein of cells in group TRAP1 was added with mouse anti-rat TRAP1 monoclonal antibody, while that in control group was added with the same type of IgG from mouse. Co-immunoprecipitation and protein mass spectrography analysis were used to determine the possible proteins interacted with TRAP1. (2) Cells were divided into normoxia blank control group (NBC), normoxia+ TRAP1 interference control group (NTIC), normoxia+ TRAP1 interference group (NTI), normoxia+ TRAP1 over-expression control group (NTOC), and normoxia+ TRAP1 over-expression group (NTO), with 1 well in each group. Cells in group NBC were routinely cultured, while cells in the latter four groups were respectively added with TRAP1 RNA interference empty virus vector, TRAP1 RNA interference adenovirus vector, TRAP1 over-expression empty virus vector, and TRAP1 over-expression adenovirus vector. Another batch of cells were divided into group NBC, hypoxic blank control group (HBC), hypoxic+ TRAP1 interference control group (HTIC), hypoxic+ TRAP1 interference group (HTI), hypoxic+ TRAP1 over-expression control group (HTOC), and hypoxic+ TRAP1 over-expression group (HTO), with 1 well in each group. Cells in hypoxic groups were under hypoxic condition for 6 hours after being treated as those in the corresponding normoxia groups, respectively. The mRNA expression of cytochrome c oxidase subunit Ⅱ (COXⅡ) of cells in each group was detected by real time fluorescent quantitive reverse transcription polymerase chain reaction. Experiments were repeated for three times. (3) Cells were divided into group NBC, group HBC, group HTOC, group HTO, hypoxic+ TRAP1 over-expression+ COXⅡinterference control group (HTOCIC), and hypoxic+ TRAP1 over-expression+ COXⅡinterference group (HTOCI), with 3 wells in each group. Cells in the previous 4 groups were treated as those in experiment (2). Cells in group HTOCIC and HTOCI were respectively transfected with COXⅡ RNA interference empty virus vector and COXⅡ RNA interference adenovirus vector, and then both added with TRAP1 over-expression adenovirus vector. The proliferation activity of cells was determined by cell counting kit 8 and microplate reader, and the ratio of death cells was measured by propidium lodide and Hoechst 33342 staining. Another batch of cells were divided into group NBC, group HBC, group HTIC, group HTI, hypoxic+ TRAP1 interference+ COXⅡover-expression control group (HTICOC), and hypoxic+ TRAP1 interference+ COXⅡ over-expression group (HTICO), with 3 wells in each group. Cells in the previous 4 groups were treated as those in experiment (2). Cells in group HTICOC and HTICO were both transfected with TRAP1 RNA interference adenovirus vector, and then respectively added with COXⅡ over-expression empty virus vector and COXⅡ over-expression adenovirus vector. The proliferation activity of cells and the ratio of death cells were detected as before. Experiments were repeated for three times. Data were processed with one-way analysis of variance and LSD test. Results: (1) The expression of TRAP1 was found in cells of group TRAP1, while that was not found in cells of control group. The possible proteins interacted with TRAP1 were keratin, COXⅡ, and an unknown protein with predicted molecular weight 13×10 3 . (2) Compared with that in group NBC, the mRNA expression of COXⅡof cells had no significant change in group NTIC and group NTOC (with P values above 0.05), but significantly decreased in group NTI ( P <0.01), and significantly increased in group NTO ( P <0.01). Compared with that in group NBC, the mRNA expression of COXⅡof cells in group HBC was significantly decreased ( P <0.01). Compared with that in group HBC, the mRNA expression of COXⅡof cells had no significant change in group HTIC and group HTOC (with P values above 0.05), but significantly decreased in group HTI ( P <0.01), and significantly increased in group HTO ( P <0.01). (3) The proliferation activity of cells in group NBC, group HBC, group HTOC, group HTO, group HTOCIC, and group HTOCI was respectively 0.498±0.022, 0.303±0.018, 0.313±0.032, 0.456±0.031, 0.448±0.034, and 0.335±0.026, and the ratios of death cells in above groups were respectively (4.7±1.5)%, (24.7±3.1)%, (26.0±2.7)%, (13.3±2.5)%, (12.7±2.1)%, and (21.0±1.7)%. Compared with those in group NBC, the proliferation activity of cells in HBC was decreased, while the ratio of death cells was increased (with P values below 0.01). Compared with those in group HBC, the proliferation activity of cells and the ratio of death cells in group HTOC had no significant change (with P values above 0.05), while the proliferation activity of cells was increased and the ratio of death cells was decreased in group HTO (with P values below 0.01). Compared with those in group HTO, the proliferation activity of cells and the ratio of death cells in group HTOCIC had no significant change (with P values above 0.05), while the proliferation activity of cells was decreased and the ratio of death cells was increased in group HTOCI (with P values below 0.01). (4) The proliferation activity of cells in group NBC, group HBC, group HTIC, group HTI, group HTICOC, and group HTICO was respectively 0.444±0.025, 0.275±0.016, 0.283±0.021, 0.150±0.009, 0.135±0.011, and 0.237±0.017, and the ratios of death cells in above groups were respectively (3.7±0.6)%, (21.0±2.7)%, (20.3±3.1)%, (31.7±2.5)%, (33.3±3.2)%, and (19.3±1.5)%. Compared with those in group HBC, the proliferation activity of cells and the ratio of death cells in group HTIC had no significant change (with P values above 0.05). Compared with those in group HBC and group HTIC, the proliferation activity of cells was decreased and the ratio of death cells was significantly increased in group HTI (with P values below 0.01). Compared with those in group HTI, the proliferation activity of cells and the ratio of death cells in group HTICOC had no significant change (with P values above 0.05), while the proliferation activity of cells was increased and the ratio of death cells was significantly decreased in group HTICO (with P values below 0.01). Conclusions: TRAP1 can up-regulate the expression of COXⅡ mRNA, and COXⅡ is one of the downstream effector molecules that TRAP1 mediates its protective effects on hypoxic cardiomyocytes.
Mickiewicz, Agnieszka; Sarzyńska, Joanna; Miłostan, Maciej; Kurzyńska-Kokorniak, Anna; Rybarczyk, Agnieszka; Łukasiak, Piotr; Kuliński, Tadeusz; Figlerowicz, Marek; Błażewicz, Jacek
2017-02-01
Plant Dicer-like proteins (DCLs) belong to the Ribonuclease III (RNase III) enzyme family. They are involved in the regulation of gene expression and antiviral defense through RNA interference pathways. A model plant, Arabidopsis thaliana encodes four DCL proteins (AtDCL1-4) that produce different classes of small regulatory RNAs. Our studies focus on AtDCL4 that processes double-stranded RNAs (dsRNAs) into 21 nucleotide trans-acting small interfering RNAs. So far, little is known about the structures of plant DCLs and the complexes they form with dsRNA. In this work, we present models of the catalytic core of AtDCL4 and AtDCL4-dsRNA complex constructed by computational methods. We built a homology model of the catalytic core of AtDCL4 comprising Platform, PAZ, Connector helix and two RNase III domains. To assemble the AtDCL4-dsRNA complex two modeling approaches were used. In the first method, to establish conformations that allow building a consistent model of the complex, we used Normal Mode Analysis for both dsRNA and AtDCL4. The second strategy involved template-based approach for positioning of the PAZ domain and manual arrangement of the Connector helix. Our results suggest that the spatial orientation of the Connector helix, Platform and PAZ relative to the RNase III domains is crucial for measuring dsRNA of defined length. The modeled complexes provide information about interactions that may contribute to the relative orientations of these domains and to dsRNA binding. All these information can be helpful for understanding the mechanism of AtDCL4-mediated dsRNA recognition and binding, to produce small RNA of specific size. Copyright © 2016 Elsevier Ltd. All rights reserved.
Modulating drug resistance by targeting BCRP/ABCG2 using retrovirus-mediated RNA interference.
Xie, Ni; Mou, Lisha; Yuan, Jianhui; Liu, Wenlan; Deng, Tingting; Li, Zigang; Jing, Yi; Jin, Yi; Hu, Zhangli
2014-01-01
The BCRP/ABCG2 transporter, which mediates drug resistance in many types of cells, depends on energy provided by ATP hydrolysis. Here, a retrovirus encoding a shRNA targeting the ATP-binding domain of this protein was used to screen for highly efficient agents that could reverse drug resistance and improve cell sensitivity to drugs, thus laying the foundation for further studies and applications. To target the ATP-binding domain of BCRP/ABCG2, pLenti6/BCRPsi shRNA recombinant retroviruses, with 20 bp target sequences starting from the 270th, 745th and 939th bps of the 6th exon, were constructed and packaged. The pLenti6/BCRPsi retroviruses (V-BCRPi) that conferred significant knockdown effects were screened using a drug-sensitivity experiment and flow cytometry. The human choriocarcinoma cell line JAR, which highly expresses endogenous BCRP/ABCG2, was injected under the dorsal skin of a hairless mouse to initiate a JAR cytoma. After injecting V-BCRPi-infected JAR tumor cells into the dorsal skin of hairless mice, BCRP/ABCG2 expression in the tumor tissue was determined using immunohistochemistry, fluorescent quantitative RT-PCR and Western blot analyses. After intraperitoneal injection of BCRP/ABCG2-tolerant 5-FU, the tumor volume, weight change, and apoptosis rate of the tumor tissue were determined using in situ hybridization. V-BCRPi increased the sensitivity of the tumor histiocytes to 5-FU and improved the cell apoptosis-promoting effects of 5-FU in the tumor. The goal of the in vivo and in vitro studies was to screen for an RNA interference recombinant retrovirus capable of stably targeting the ATP-binding domain of BCRP/ABCG2 (V-BCRPi) to inhibit its function. A new method to improve the chemo-sensitivity of breast cancer and other tumor cells was discovered, and this method could be used for gene therapy and functional studies of malignant tumors.
USDA-ARS?s Scientific Manuscript database
If validated, diet-derived foreign microRNA absorption and function in consuming vertebrates would drastically alter our understanding of nutrition and ecology. RNA interference (RNAi) mechanisms of Caenorhabditis elegans are enhanced by uptake of environmental RNA and amplification and systemic dis...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nam, Ki Hyun; Haitjema, Charles; Liu, Xueqi
Clustered regularly interspaced short palindromic repeats (CRISPRs), together with an operon of CRISPR-associated (Cas) proteins, form an RNA-based prokaryotic immune system against exogenous genetic elements. Cas5 family proteins are found in several type I CRISPR-Cas systems. Here, we report the molecular function of subtype I-C/Dvulg Cas5d from Bacillus halodurans. We show that Cas5d cleaves pre-crRNA into unit length by recognizing both the hairpin structure and the 3 single stranded sequence in the CRISPR repeat region. Cas5d structure reveals a ferredoxin domain-based architecture and a catalytic triad formed by Y46, K116, and H117 residues. We further show that after pre-crRNA processing,more » Cas5d assembles with crRNA, Csd1, and Csd2 proteins to form a multi-sub-unit interference complex similar to Escherichia coli Cascade (CRISPR-associated complex for antiviral defense) in architecture. Our results suggest that formation of a crRNA-presenting Cascade-like complex is likely a common theme among type I CRISPR subtypes.« less
Basnet, Sanjay; Kamble, Shripat T
2018-05-04
The common bed bug, Cimex lectularius L. (Hemiptera: Cimicidae) is a nuisance household pest causing significant medical and economic impacts. RNA interference (RNAi) of genes that are involved in vital physiological processes can serve as potential RNAi targets for insect control. Brahma is an ATPase subunit of a chromatin-remodeling complex involved in transcription of several genes for cellular processes, most importantly the homeotic genes. In this study, we used a microinjection technique to deliver double stranded RNA into female bed bugs. Delivery of 0.05 and 0.5 µg/insect of brahma dsRNA directly into hemocele resulted substantial reduction in oviposition. Eggs laid by bed bugs receiving both doses of brahma dsRNA exhibited significantly lower hatching percentage as compared to controls. In addition, brahma RNAi in female bed bugs caused significant mortality. Our results disclosed the potential of brahma RNAi to suppress bed bug population through injection of specific dsRNA, suggesting a critical function of this gene in bed bugs' reproduction and survival. Based on our data, brahma can be a promising RNAi target for suppression of bed bug population.
Pulmonary Delivery of siRNA via Polymeric Vectors as Therapies of Asthma.
Xie, Yuran; Merkel, Olivia M
2015-10-01
Asthma is a chronic inflammatory disease. Despite the fact that current therapies, such as the combination of inhaled corticosteroids and β2-agonists, can control the symptoms of asthma in most patients, there is still an urgent need for an alternative anti-inflammatory therapy for patients who suffer from severe asthma but lack acceptable response to conventional therapies. Many molecular factors are involved in the inflammatory process in asthma, and thus blocking the function of these factors could efficiently alleviate airway inflammation. RNA interference (RNAi) is often thought to be the answer in the search for more efficient and biocompatible treatments. However, difficulties of efficient delivery of small interference RNA (siRNA), the key factor in RNAi, to target cells and tissues have limited its clinical application. In this review, we summarize cytokines and chemokines, transcription factors, tyrosine kinases, and costimulatory factors that have been reported as targets of siRNA-mediated treatment in experimental asthma. Additionally, we conclude several targeted delivery systems of siRNA to specific cells such as T cells, macrophages, and dendritic cells, which could potentially be applied in asthma therapy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts
Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng
2014-01-01
Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645
Efficacy of a Novel Class of RNA Interference Therapeutic Agents
Matsumoto, Takahiro; D'Alessandro-Gabazza, Corina N.; Gil-Bernabe, Paloma; Boveda-Ruiz, Daniel; Naito, Masahiro; Kobayashi, Tetsu; Toda, Masaaki; Mizutani, Takayuki; Taguchi, Osamu; Morser, John; Eguchi, Yutaka; Kuroda, Masahiko; Ochiya, Takahiro; Hayashi, Hirotake; Gabazza, Esteban C.; Ohgi, Tadaaki
2012-01-01
RNA interference (RNAi) is being widely used in functional gene research and is an important tool for drug discovery. However, canonical double-stranded short interfering RNAs are unstable and induce undesirable adverse effects, and thus there is no currently RNAi-based therapy in the clinic. We have developed a novel class of RNAi agents, and evaluated their effectiveness in vitro and in mouse models of acute lung injury (ALI) and pulmonary fibrosis. The novel class of RNAi agents (nkRNA®, PnkRNA™) were synthesized on solid phase as single-stranded RNAs that, following synthesis, self-anneal into a unique helical structure containing a central stem and two loops. They are resistant to degradation and suppress their target genes. nkRNA and PnkRNA directed against TGF-β1mRNA ameliorate outcomes and induce no off-target effects in three animal models of lung disease. The results of this study support the pathological relevance of TGF-β1 in lung diseases, and suggest the potential usefulness of these novel RNAi agents for therapeutic application. PMID:22916145
Liu, Nan; Li, Ying; Chen, Hui; Wei, Wei; An, Yulin; Zhu, Guangming
2015-01-01
Notch3 plays an important role in differentiation, migration and signal transduction of vascular smooth muscle cells (VSMCs). In this study, we used RNA interference (RNAi) technique to investigate the effect of knocking down the expression of the NOTCH3 gene in VSMCs on the phenotype determination under pathologic status. Real-time PCR and Western Blot experiments verified the expression levels of Notch3 mRNA and protein were reduced more than 40% and 50% in the NOTCH3 siRNA group. When the expression of Notch3 was decreased, the proliferation, apoptosis and immigration of VSMCs were enhanced compared to control groups (P < 0.01). NOTCH3 siRNA VSMCs observed using confocal microscopy showed abnormal nuclear configuration, a disorganized actin filament system, polygonal cell shapes, and decreasing cell sizes. Additionally, knocking down the expression of NOTCH3 may evoke the CASR and FAK expression. In Conclusion, interfering with the expression of NOTCH3 causes VSMCs to exhibit an intermediate phenotype. CaSR and FAK may be involved in the Notch3 signaling pathway. PMID:26550181
Liu, Nan; Li, Ying; Chen, Hui; Wei, Wei; An, Yulin; Zhu, Guangming
2015-01-01
Notch3 plays an important role in differentiation, migration and signal transduction of vascular smooth muscle cells (VSMCs). In this study, we used RNA interference (RNAi) technique to investigate the effect of knocking down the expression of the NOTCH3 gene in VSMCs on the phenotype determination under pathologic status. Real-time PCR and Western Blot experiments verified the expression levels of Notch3 mRNA and protein were reduced more than 40% and 50% in the NOTCH3 siRNA group. When the expression of Notch3 was decreased, the proliferation, apoptosis and immigration of VSMCs were enhanced compared to control groups (P < 0.01). NOTCH3 siRNA VSMCs observed using confocal microscopy showed abnormal nuclear configuration, a disorganized actin filament system, polygonal cell shapes, and decreasing cell sizes. Additionally, knocking down the expression of NOTCH3 may evoke the CASR and FAK expression. In Conclusion, interfering with the expression of NOTCH3 causes VSMCs to exhibit an intermediate phenotype. CaSR and FAK may be involved in the Notch3 signaling pathway.
Scavenger receptor mediates systemic RNA interference in ticks.
Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Galay, Remil Linggatong; Tanaka, Tetsuya; Fujisaki, Kozo
2011-01-01
RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks.
Scavenger Receptor Mediates Systemic RNA Interference in Ticks
Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Linggatong Galay, Remil; Tanaka, Tetsuya; Fujisaki, Kozo
2011-01-01
RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks. PMID:22145043
RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans
Tops, Bastiaan B. J.; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C.; Plasterk, Ronald H. A.; Ketting, René F.
2005-01-01
In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of ∼250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step. PMID:15653635
Pham, John W; Sontheimer, Erik J
2005-11-25
Complexes in the Drosophila RNA-induced silencing complex (RISC) assembly pathway can be resolved using native gel electrophoresis, revealing an initiator called R1, an intermediate called R2, and an effector called R3 (now referred to as holo-RISC). Here we show that R1 forms when the Dicer-2/R2D2 heterodimer binds short interfering RNA (siRNA) duplexes. The heterodimer alone can initiate RISC assembly, indicating that other factors are dispensable for initiation. During assembly, R2 requires Argonaute 2 to convert into holo-RISC. This requirement is reminiscent of the RISC-loading complex, which also requires Argonaute 2 for assembly into RISC. We have compared R2 to the RISC-loading complex and show that the two complexes are similar in their sensitivities to ATP and to chemical modifications on siRNA duplexes, indicating that they are likely to be identical. We have examined the requirements for RISC formation and show that the siRNA 5'-termini are repeatedly monitored during RISC assembly, first by the Dcr-2/R2D2 heterodimer and again after R2 formation, before siRNA unwinding. The 2'-position of the 5'-terminal nucleotide also affects RISC assembly, because an siRNA strand bearing a 2'-deoxyribose at this position can inhibit the cognate strand from entering holo-RISC; in contrast, the 2'-deoxyribose-modified strand has enhanced activity in the RNA interference pathway.
Molecular imaging of RNA interference therapy targeting PHD2 for treatment of myocardial ischemia.
Huang, Mei; Wu, Joseph C
2011-01-01
Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments.
Molecular Imaging of RNA Interference Therapy Targeting PHD2 for Treatment of Myocardial Ischemia
Huang, Mei; Wu, Joseph C.
2011-01-01
Summary Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments. PMID:21194030
RNA interference inhibits yellow fever virus replication in vitro and in vivo.
Pacca, Carolina C; Severino, Adriana A; Mondini, Adriano; Rahal, Paula; D'avila, Solange G P; Cordeiro, José Antonio; Nogueira, Mara Correa Lelles; Bronzoni, Roberta V M; Nogueira, Maurício L
2009-04-01
RNA interference (RNAi) is a process that is induced by double stranded RNA and involves the degradation of specific sequences of mRNA in the cytoplasm of the eukaryotic cells. It has been used as an antiviral tool against many viruses, including flaviviruses. The genus Flavivirus contains the most important arboviruses in the world, i.e., dengue (DENV) and yellow fever (YFV). In our study, we investigated the in vitro and in vivo effect of RNAi against YFV. Using stable cell lines that expressed RNAi against YFV, the cell lines were able to inhibit as much as 97% of the viral replication. Two constructions (one against NS1 and the other against E region of YFV genome) were able to protect the adult Balb/c mice against YFV challenge. The histopathologic analysis demonstrated an important protection of the central nervous system by RNAi after 10 days of viral challenge. Our data suggests that RNAi is a potential viable therapeutic weapon against yellow fever.
Interference activity of a minimal Type I CRISPR–Cas system from Shewanella putrefaciens
Dwarakanath, Srivatsa; Brenzinger, Susanne; Gleditzsch, Daniel; Plagens, André; Klingl, Andreas; Thormann, Kai; Randau, Lennart
2015-01-01
Type I CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)–Cas (CRISPR-associated) systems exist in bacterial and archaeal organisms and provide immunity against foreign DNA. The Cas protein content of the DNA interference complexes (termed Cascade) varies between different CRISPR-Cas subtypes. A minimal variant of the Type I-F system was identified in proteobacterial species including Shewanella putrefaciens CN-32. This variant lacks a large subunit (Csy1), Csy2 and Csy3 and contains two unclassified cas genes. The genome of S. putrefaciens CN-32 contains only five Cas proteins (Cas1, Cas3, Cas6f, Cas1821 and Cas1822) and a single CRISPR array with 81 spacers. RNA-Seq analyses revealed the transcription of this array and the maturation of crRNAs (CRISPR RNAs). Interference assays based on plasmid conjugation demonstrated that this CRISPR-Cas system is active in vivo and that activity is dependent on the recognition of the dinucleotide GG PAM (Protospacer Adjacent Motif) sequence and crRNA abundance. The deletion of cas1821 and cas1822 reduced the cellular crRNA pool. Recombinant Cas1821 was shown to form helical filaments bound to RNA molecules, which suggests its role as the Cascade backbone protein. A Cascade complex was isolated which contained multiple Cas1821 copies, Cas1822, Cas6f and mature crRNAs. PMID:26350210
Schultheiss, Holger; Dechert, Cornelia; Kogel, Karl-Heinz; Hückelhoven, Ralph
2002-01-01
Small GTP-binding proteins such as those from the RAC family are cytosolic signal transduction proteins that often are involved in processing of extracellular stimuli. Plant RAC proteins are implicated in regulation of plant cell architecture, secondary wall formation, meristem signaling, and defense against pathogens. We isolated a RacB homolog from barley (Hordeum vulgare) to study its role in resistance to the barley powdery mildew fungus (Blumeria graminis f.sp. hordei). RacB was constitutively expressed in the barley epidermis and its expression level was not strongly influenced by inoculation with B. graminis. However, after biolistic bombardment of barley leaf segments with RacB-double-stranded RNA, sequence-specific RNA interference with RacB function inhibited fungal haustorium establishment in a cell-autonomous and genotype-specific manner. Mutants compromised in function of the Mlo wild-type gene and the Ror1 gene (genotype mlo5 ror1) that are moderately susceptible to B. graminis showed no alteration in powdery mildew resistance upon RacB-specific RNA interference. Thus, the phenotype, induced by RacB-specific RNA interference, was apparently dependent on the same processes as mlo5-mediated broad resistance, which is suppressed by ror1. We conclude that an RAC small GTP-binding protein is required for successful fungal haustorium establishment and that this function may be linked to MLO-associated functions. PMID:11950993
Nunes, Francis M. F.; Aleixo, Aline C.; Barchuk, Angel R.; Bomtorin, Ana D.; Grozinger, Christina M.; Simões, Zilá L. P.
2013-01-01
RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control. PMID:26466797
Nunes, Francis M F; Aleixo, Aline C; Barchuk, Angel R; Bomtorin, Ana D; Grozinger, Christina M; Simões, Zilá L P
2013-01-04
RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control.
Double strand RNA delivery system for plant-sap-feeding insects
Ghosh, Saikat Kumar B.; Hunter, Wayne B.; Park, Alexis L.; Gundersen-Rindal, Dawn E.
2017-01-01
Double-stranded RNA (dsRNA)-mediated gene silencing, also known as RNA interference (RNAi), has been a breakthrough technology for functional genomic studies and represents a potential tool for the management of insect pests. Since the inception of RNAi numerous studies documented successful introduction of exogenously synthesized dsRNA or siRNA into an organism triggering highly efficient gene silencing through the degradation of endogenous RNA homologous to the presented siRNA. Managing hemipteran insect pests, especially Halyomorpha halys (Stål) (Heteroptera: Pentatomidae), the brown marmorated stink bug (BMSB), is critical to food productivity. BMSB was recently introduced into North America where it is both an invasive agricultural pest of high value specialty, row, and staple crops, as well as an indoor nuisance pest. RNAi technology may serve as a viable tool to manage this voracious pest, but delivery of dsRNA to piercing-sucking insects has posed a tremendous challenge. Effective and practical use of RNAi as molecular biopesticides for biocontrol of insects like BMSB in the environment requires that dsRNAs be delivered in vivo through ingestion. Therefore, the key challenge for molecular biologists in developing insect-specific molecular biopesticides is to find effective and reliable methods for practical delivery of stable dsRNAs such as through oral ingestion. Here demonstrated is a reliable delivery system of effective insect-specific dsRNAs through oral feeding through a new delivery system to induce a significant decrease in expression of targeted genes such as JHAMT and Vg. This state-of-the-art delivery method overcomes environmental delivery challenges so that RNAi is induced through insect-specific dsRNAs orally delivered to hemipteran and other insect pests. PMID:28182760
Selective gene silencing by viral delivery of short hairpin RNA
2010-01-01
RNA interference (RNAi) technology has not only become a powerful tool for functional genomics, but also allows rapid drug target discovery and in vitro validation of these targets in cell culture. Furthermore, RNAi represents a promising novel therapeutic option for treating human diseases, in particular cancer. Selective gene silencing by RNAi can be achieved essentially by two nucleic acid based methods: i) cytoplasmic delivery of short double-stranded (ds) interfering RNA oligonucleotides (siRNA), where the gene silencing effect is only transient in nature, and possibly not suitable for all applications; or ii) nuclear delivery of gene expression cassettes that express short hairpin RNA (shRNA), which are processed like endogenous interfering RNA and lead to stable gene down-regulation. Both processes involve the use of nucleic acid based drugs, which are highly charged and do not cross cell membranes by free diffusion. Therefore, in vivo delivery of RNAi therapeutics must use technology that enables the RNAi therapeutic to traverse biological membrane barriers in vivo. Viruses and the vectors derived from them carry out precisely this task and have become a major delivery system for shRNA. Here, we summarize and compare different currently used viral delivery systems, give examples of in vivo applications, and indicate trends for new developments, such as replicating viruses for shRNA delivery to cancer cells. PMID:20858246
Meade, Bryan R; Dowdy, Steven F
2008-03-01
The major limitation in utilizing information rich macromolecules for basic science and therapeutic applications is the inability of these large molecules to readily diffuse across the cellular membrane. While this restriction represents an efficient defense system against cellular penetration of unwanted foreign molecules and thus a crucial component of cell survival, overcoming this cellular characteristic for the intracellular delivery of macromolecules has been the focus of a large number of research groups worldwide. Recently, with the discovery of RNA interference, many of these groups have redirected their attention and have applied previously characterized cell delivery methodologies to synthetic short interfering RNA duplexes (siRNA). Protein transduction domain and cell penetrating peptides have been shown to enhance the delivery of multiple types of macromolecular cargo including peptides, proteins and antisense oligonucleotides and are now being utilized to enhance the cellular uptake of siRNA molecules. The dense cationic charge of these peptides that is critical for interaction with cell membrane components prior to internalization has also been shown to readily package siRNA molecules into stable nanoparticles that are capable of traversing the cell membrane. This review discusses the recent advances in noncovalent packaging of siRNA molecules with cationic peptides and the potential for the resulting complexes to successfully induce RNA interference within both in vitro and in vivo settings.
Chen, Min; Cooper, Helen M; Zhou, Ji Zhi; Bartlett, Perry F; Xu, Zhi Ping
2013-01-15
Small interfering RNAs (siRNAs) are a potentially powerful new class of pharmaceutical drugs for many disease. However, the delivery of unprotected siRNAs is ineffective due to their susceptibility to degradation by ubiquitous nucleases under physiological conditions. Layered double hydroxide nanoparticles (LDHs) have been found to be efficient carriers of anionic drugs and nucleic acids. Our previous research has shown that LDHs (with the Z-average particle size of approximately 110 nm) can mediate siRNA delivery in mammalian cells, resulting in gene silencing. However, short double-stranded nucleic acids are mostly adsorbed onto the external surface and not well protected by LDHs. In order to enhance the intercalation of siRNA into the LDH interlayer and the efficiency of subsequent siRNA delivery, we prepared smaller LDHs (with the Z-average particle size of approximately 45 nm) with an engineered non-aqueous method. We demonstrate here that dsDNA/siRNA is more effectively intercalated into these small LDH nanoparticles, more dsDNA/siRNA is transfected into HEK 293T cells, and more efficient silencing of the target gene is achieved using smaller LDHs. Thus, smaller LDH particles have greater potential as a delivery system for the application of RNA interference. Copyright © 2012 Elsevier Inc. All rights reserved.
Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu
2012-01-01
Abstract Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type–specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34+ haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl2 induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. PMID:22050843
RNA interference: learning gene knock-down from cell physiology
Mocellin, Simone; Provenzano, Maurizio
2004-01-01
Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080
Su, Jianguo; Zhu, Zuoyan; Wang, Yaping; Xiong, Feng; Zou, Jun
2008-01-01
The ability to utilize the RNA interference (RNAi) machinery for silencing target-gene expression has created a lot of excitement in the research community. In the present study, we used a cytomegalovirus (CMV) promoter-driven DNA template approach to induce short hairpin RNA (shRNA) triggered RNAi to block exogenous Enhanced Green Fluorescent Protein (EGFP) and endogenous No Tail (NTL) gene expressions. We constructed three plasmids, pCMV-EGFP-CMV-shGFP-SV40, pCMV-EGFP-CMV-shNTL-SV40, and pCMV-EGFP-CMV-shScrambled-SV40, each containing a CMV promoter driving an EGFP reporter cDNA and DNA coding for one shRNA under the control of another CMV promoter. The three shRNA-generating plasmids and pCMV-EGFP control plasmid were introduced into zebrafish embryos by microinjection. Samples were collected at 48 h after injection. Results were evaluated by phenotype observation and real-time fluorescent quantitative reverse-transcription polymerase chain reaction (Q-PCR). The shGFP-generating plasmid significantly inhibited the EGFP expression viewed under fluorescent microscope and reduced by 70.05 +/- 1.26% of exogenous EGFP gene mRNA levels compared with controls by Q-PCR. The shRNA targeting endogenous NTL gene resulted in obvious NTL phenotype of 30 +/- 4% and decreased the level of their corresponding mRNAs up to 54.52 +/- 2.05% compared with nontargeting control shRNA. These data proved the feasibility of the CMV promoter-driven shRNA expression technique to be used to inhibit exogenous and endogenous gene expressions in zebrafish in vivo.
Toward a General Approach for RNA-Templated Hierarchical Assembly of Split-Proteins
Furman, Jennifer L.; Badran, Ahmed H.; Ajulo, Oluyomi; Porter, Jason R.; Stains, Cliff I.; Segal, David J.; Ghosh, Indraneel
2010-01-01
The ability to conditionally turn on a signal or induce a function in the presence of a user-defined RNA target has potential applications in medicine and synthetic biology. Although sequence-specific pumilio repeat proteins can target a limited set of ssRNA sequences, there are no general methods for targeting ssRNA with designed proteins. As a first step toward RNA recognition, we utilized the RNA binding domain of argonaute, implicated in RNA interference, for specifically targeting generic 2-nucleotide, 3' overhangs of any dsRNA. We tested the reassembly of a split-luciferase enzyme guided by argonaute-mediated recognition of newly generated nucleotide overhangs when ssRNA is targeted by a designed complementary guide sequence. This approach was successful when argonaute was utilized in conjunction with a pumilio repeat and expanded the scope of potential ssRNA targets. However, targeting any desired ssRNA remained elusive as two argonaute domains provided minimal reassembled split-luciferase. We next designed and tested a second hierarchical assembly, wherein ssDNA guides are appended to DNA hairpins that serve as a scaffold for high affinity zinc fingers attached to split-luciferase. In the presence of a ssRNA target containing adjacent sequences complementary to the guides, the hairpins are brought into proximity, allowing for zinc finger binding and concomitant reassembly of the fragmented luciferase. The scope of this new approach was validated by specifically targeting RNA encoding VEGF, hDM2, and HER2. These approaches provide potentially general design paradigms for the conditional reassembly of fragmented proteins in the presence of any desired ssRNA target. PMID:20681585
RNA interference tools for the western flower thrips, Frankliniella occidentalis.
Badillo-Vargas, Ismael E; Rotenberg, Dorith; Schneweis, Brandi A; Whitfield, Anna E
2015-05-01
The insect order Thysanoptera is exclusively comprised of small insects commonly known as thrips. The western flower thrips, Frankliniella occidentalis, is an economically important pest amongst thysanopterans due to extensive feeding damage and tospovirus transmission to hundreds of plant species worldwide. Geographically-distinct populations of F. occidentalis have developed resistance against many types of traditional chemical insecticides, and as such, management of thrips and tospoviruses are a persistent challenge in agriculture. Molecular methods for defining the role(s) of specific genes in thrips-tospovirus interactions and for assessing their potential as gene targets in thrips management strategies is currently lacking. The goal of this work was to develop an RNA interference (RNAi) tool that enables functional genomic assays and to evaluate RNAi for its potential as a biologically-based approach for controlling F. occidentalis. Using a microinjection system, we delivered double-stranded RNA (dsRNA) directly to the hemocoel of female thrips to target the vacuolar ATP synthase subunit B (V-ATPase-B) gene of F. occidentalis. Gene expression analysis using real-time quantitative reverse transcriptase-PCR (qRT-PCR) revealed significant reductions of V-ATPase-B transcripts at 2 and 3 days post-injection (dpi) with dsRNA of V-ATPase-B compared to injection with dsRNA of GFP. Furthermore, the effect of knockdown of the V-ATPase-B gene in females at these two time points was mirrored by the decreased abundance of V-ATPase-B protein as determined by quantitative analysis of Western blots. Reduction in V-ATPase-B expression in thrips resulted in increased female mortality and reduced fertility, i.e., number of viable offspring produced. Survivorship decreased significantly by six dpi compared to the dsRNA-GFP control group, which continued decreasing significantly until the end of the bioassay. Surviving female thrips injected with dsRNA-V-ATPase-B produced significantly fewer offspring compared to those in the dsRNA-GFP control group. Our findings indicate that an RNAi-based strategy to study gene function in thrips is feasible, can result in quantifiable phenotypes, and provides a much-needed tool for investigating the molecular mechanisms of thrips-tospovirus interactions. To our knowledge, this represents the first report of RNAi for any member of the insect order Thysanoptera and demonstrates the potential for translational research in the area of thrips pest control. Copyright © 2015 Elsevier Ltd. All rights reserved.
Translation Repression in Human Cells by MicroRNA-Induced Gene Silencing Requires RCK/p54
Chu, Chia-ying
2006-01-01
RNA interference is triggered by double-stranded RNA that is processed into small interfering RNAs (siRNAs) by Dicer enzyme. Endogenously, RNA interference triggers are created from small noncoding RNAs called microRNAs (miRNAs). RNA-induced silencing complexes (RISC) in human cells can be programmed by exogenously introduced siRNA or endogenously expressed miRNA. siRNA-programmed RISC (siRISC) silences expression by cleaving a perfectly complementary target mRNA, whereas miRNA-induced silencing complexes (miRISC) inhibits translation by binding imperfectly matched sequences in the 3′ UTR of target mRNA. Both RISCs contain Argonaute2 (Ago2), which catalyzes target mRNA cleavage by siRISC and localizes to cytoplasmic mRNA processing bodies (P-bodies). Here, we show that RCK/p54, a DEAD box helicase, interacts with argonaute proteins, Ago1 and Ago2, in affinity-purified active siRISC or miRISC from human cells; directly interacts with Ago1 and Ago2 in vivo, facilitates formation of P-bodies, and is a general repressor of translation. Disrupting P-bodies by depleting Lsm1 did not affect RCK/p54 interactions with argonaute proteins and its function in miRNA-mediated translation repression. Depletion of RCK/p54 disrupted P-bodies and dispersed Ago2 throughout the cytoplasm but did not significantly affect siRNA-mediated RNA functions of RISC. Depleting RCK/p54 released general, miRNA-induced, and let-7-mediated translational repression. Therefore, we propose that translation repression is mediated by miRISC via RCK/p54 and its specificity is dictated by the miRNA sequence binding multiple copies of miRISC to complementary 3′ UTR sites in the target mRNA. These studies also suggest that translation suppression by miRISC does not require P-body structures, and location of miRISC to P-bodies is the consequence of translation repression. PMID:16756390
In-silico analysis for RNA-interference mechanism of α-synuclein to treat Parkinson's disease.
Seema, S; Seenivasagam, R; Hemavathi, K
2013-01-01
Parkinson's Disease (PD) causing mutations in α-synuclein gene are ALA30PRO, GLU46LYS and ALA53THR. The conformational changes in proteins with respect to all the three mutations were analysed. These were used to predict the structures of Short Interfering RNA (siRNA) antisense strand and siRNA region. The siRNA binds with the argonaute protein forming RNA Induced Silencing Complex (RISC). Then, siRNA antisense-strand was attached to RISC. The structure of dicer (RNase-III-enzyme) cleaves double-stranded RNA (dsRNA) into two siRNA-strands. Incorporation of single siRNA-strand into RISC guides to pair with the complementary α-synuclein target-messenger RNA (mRNA) thereby enabling it to cleave the target.
Boikos, Constantina; Papenburg, Jesse; Martineau, Christine; Joseph, Lawrence; Scheifele, David; Chilvers, Mark; Lands, Larry C.; De Serres, Gaston; Quach, Caroline
2017-01-01
ABSTRACT Background: The objective of this study was to explore the effects of viral co-detection in individuals recently vaccinated with the live-attenuated intranasal influenza virus vaccine (LAIV) on the detection of influenza RNA. Methods: Before the 2013–2014 influenza season, nasal swabs were obtained from 59 pediatric participants with cystic fibrosis (CF) and 17 of their healthy siblings immediately before vaccination and 4 times during the week of follow-up. Real-time RT-PCR assays were used to detect influenza RNA. Co-detection of a non-influenza respiratory virus (NIRV) at the time of vaccination was determined by a multiplex RT-PCR assay. Differences in the proportions and rates of influenza detection and their 95% credible intervals (CrI) were estimated. Results: Influenza RNA was detected in 16% fewer participants (95% CrI: −7, 39%) throughout follow-up in the NIRV-positive group compared with the NIRV-negative group (59% vs. 75%). This was also observed in participants with CF alone (66% vs. 74%; RD = 8% 95% CrI: −16, 33%) as well as in healthy participants only (75% vs. 30%; RD = 45%, 95% CrI: −2, 81%). Influenza was detected in NIRV-negative subjects for 0.49 d more compared with NIRV-positive subjects (95% CrI: −0.37, 1.26). Conclusion: The observed proportion of subjects in whom influenza RNA was detected and the duration of detection differed slightly between NIRV- positive and −negative subjects. However, wide credible intervals for the difference preclude definitive conclusions. If true, this observed association may be related to a recent viral respiratory infection, a phenomenon known as viral interference. PMID:28273006
Dietary risk assessment of v-ATPase A dsRNAs on monarch butterfly larvae
USDA-ARS?s Scientific Manuscript database
The goal of this study is to assess the risks of RNA interference (RNAi)-based genetically engineered crops on a non-target arthropod, monarch butterfly, Danaus plexippus. We hypothesize that an insecticidal double-stranded (ds) RNA targeting western corn rootworm, Diabrotica virgifera virgifera, ha...
In this study RNA interference (RNAi) screens were performed on 285 cell lines and combined with 216 lines previously screened, which were then analyzed together with DEMETER to discover genetic dependencies across the entire pool of cell lines. Read the abstract
Proteomics for understanding miRNA biology
Huang, Tai-Chung; Pinto, Sneha M.; Pandey, Akhilesh
2013-01-01
MicroRNAs (miRNAs) are small noncoding RNAs that play important roles in posttranscriptional regulation of gene expression. Mature miRNAs associate with the RNA interference silencing complex to repress mRNA translation and/or degrade mRNA transcripts. Mass spectrometry-based proteomics has enabled identification of several core components of the canonical miRNA processing pathway and their posttranslational modifications which are pivotal in miRNA regulatory mechanisms. The use of quantitative proteomic strategies has also emerged as a key technique for experimental identification of miRNA targets by allowing direct determination of proteins whose levels are altered because of translational suppression. This review focuses on the role of proteomics and labeling strategies to understand miRNA biology. PMID:23125164
A forward genetic screen reveals essential and non-essential RNAi factors in Paramecium tetraurelia
Marker, Simone; Carradec, Quentin; Tanty, Véronique; Arnaiz, Olivier; Meyer, Eric
2014-01-01
In most eukaryotes, small RNA-mediated gene silencing pathways form complex interacting networks. In the ciliate Paramecium tetraurelia, at least two RNA interference (RNAi) mechanisms coexist, involving distinct but overlapping sets of protein factors and producing different types of short interfering RNAs (siRNAs). One is specifically triggered by high-copy transgenes, and the other by feeding cells with double-stranded RNA (dsRNA)-producing bacteria. In this study, we designed a forward genetic screen for mutants deficient in dsRNA-induced silencing, and a powerful method to identify the relevant mutations by whole-genome sequencing. We present a set of 47 mutant alleles for five genes, revealing two previously unknown RNAi factors: a novel Paramecium-specific protein (Pds1) and a Cid1-like nucleotidyl transferase. Analyses of allelic diversity distinguish non-essential and essential genes and suggest that the screen is saturated for non-essential, single-copy genes. We show that non-essential genes are specifically involved in dsRNA-induced RNAi while essential ones are also involved in transgene-induced RNAi. One of the latter, the RNA-dependent RNA polymerase RDR2, is further shown to be required for all known types of siRNAs, as well as for sexual reproduction. These results open the way for the dissection of the genetic complexity, interconnection, mechanisms and natural functions of RNAi pathways in P. tetraurelia. PMID:24860163
Design and cloning strategies for constructing shRNA expression vectors
McIntyre, Glen J; Fanning, Gregory C
2006-01-01
Background Short hairpin RNA (shRNA) encoded within an expression vector has proven an effective means of harnessing the RNA interference (RNAi) pathway in mammalian cells. A survey of the literature revealed that shRNA vector construction can be hindered by high mutation rates and the ensuing sequencing is often problematic. Current options for constructing shRNA vectors include the use of annealed complementary oligonucleotides (74 % of surveyed studies), a PCR approach using hairpin containing primers (22 %) and primer extension of hairpin templates (4 %). Results We considered primer extension the most attractive method in terms of cost. However, in initial experiments we encountered a mutation frequency of 50 % compared to a reported 20 – 40 % for other strategies. By modifying the technique to be an isothermal reaction using the DNA polymerase Phi29, we reduced the error rate to 10 %, making primer extension the most efficient and cost-effective approach tested. We also found that inclusion of a restriction site in the loop could be exploited for confirming construct integrity by automated sequencing, while maintaining intended gene suppression. Conclusion In this study we detail simple improvements for constructing and sequencing shRNA that overcome current limitations. We also compare the advantages of our solutions against proposed alternatives. Our technical modifications will be of tangible benefit to researchers looking for a more efficient and reliable shRNA construction process. PMID:16396676
Santangeloyz, K.S.; Bertoneyz, A.L.
2011-01-01
summary Objective To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Methods Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RTPCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2−ΔΔCT) method. Results Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P= 0.0045) or >90% (P= 0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Conclusions Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. PMID:21945742
Gallenberger, Martin; Meinel, Dominik M; Kroeber, Markus; Wegner, Michael; Milkereit, Philipp; Bösl, Michael R; Tamm, Ernst R
2011-02-01
Mutations in WD repeat domain 36 gene (WDR36) play a causative role in some forms of primary open-angle glaucoma, a leading cause of blindness worldwide. WDR36 is characterized by the presence of multiple WD40 repeats and shows homology to Utp21, an essential protein component of the yeast small subunit (SSU) processome required for maturation of 18S rRNA. To clarify the functional role of WDR36 in the mammalian organism, we generated and investigated mutant mice with a targeted deletion of Wdr36. In parallel experiments, we used RNA interference to deplete WDR36 mRNA in mouse embryos and cultured human trabecular meshwork (HTM-N) cells. Deletion of Wdr36 in the mouse caused preimplantation embryonic lethality, and essentially similar effects were observed when WDR36 mRNA was depleted in mouse embryos by RNA interference. Depletion of WDR36 mRNA in HTM-N cells caused apoptotic cell death and upregulation of mRNA for BAX, TP53 and CDKN1A. By immunocytochemistry, staining for WDR36 was observed in the nucleolus of cells, which co-localized with that of nucleolar proteins such as nucleophosmin and PWP2. In addition, recombinant and epitope-tagged WDR36 localized to the nucleolus of HTM-N cells. By northern blot analysis, a substantial decrease in 21S rRNA, the precursor of 18S rRNA, was observed following knockdown of WDR36. In addition, metabolic-labeling experiments consistently showed a delay of 18S rRNA maturation in WDR36-depleted cells. Our results provide evidence that WDR36 is an essential protein in mammalian cells which is involved in the nucleolar processing of SSU 18S rRNA.
Camargo, Carolina; Wu, Ke; Fishilevich, Elane; Narva, Kenneth E; Siegfried, Blair D
2018-06-01
The use of transgenic crops that induce silencing of essential genes using double-stranded RNA (dsRNA) through RNA interference (RNAi) in western corn rootworm, Diabrotica virgifera virgifera, is likely to be an important component of new technologies for the control of this important corn pest. Previous studies have demonstrated that the dsRNA response in D. v. virgifera depends on the presence of RNAi pathway genes including Dicer-2 and Argonaute 2, and that downregulation of these genes limits the lethality of environmental dsRNA. A potential resistance mechanism to lethal dsRNA may involve loss of function of RNAi pathway genes. Howver, the potential for resistance to evolve may depend on whether these pathway genes have essential functions such that the loss of function of core proteins in the RNAi pathway will have fitness costs in D. v. virgifera. Fitness costs associated with potential resistance mechanisms have a central role in determining how resistance can evolve to RNAi technologies in western corn rootworm. We evaluated the effect of dsRNA and microRNA pathway gene knockdown on the development of D. v. virgifera larvae through short-term and long-term exposures to dsRNA for Dicer and Argonaute genes. Downregulation of Argonaute 2, Dicer-2, Dicer-1 did not significantly affect larval survivorship or development through short and long-term exposure to dsRNA. However, downregulation of Argonaute 1 reduced larval survivorship and delayed development. The implications of these results as they relate to D. v. virgifera resistance to lethal dsRNA are discussed. Copyright © 2018 Elsevier Inc. All rights reserved.
RNA interference: new mechanistic and biochemical insights with application in oral cancer therapy.
Buduru, Smaranda; Zimta, Alina-Andreea; Ciocan, Cristina; Braicu, Cornelia; Dudea, Diana; Irimie, Alexandra Iulia; Berindan-Neagoe, Ioana
2018-01-01
Over the last few decades, the incidence of oral cancer has gradually increased, due to the negative influence of environmental factors and also abnormalities within the genome. The main issues in oral cancer treatment consist in surpassing resistance and recurrence. However, continuous discovery of altered signaling pathways in these tumors provides valuable information for the identification of novel gene candidates targeted in personalized therapy. RNA interference (RNAi) is a natural mechanism that involves small interfering RNA (siRNA); this can be exploited in biomedical research by using natural or synthetic constructs for activation of the mechanism. Synthetic siRNA transcripts were developed as a versatile class of molecular tools that have a diverse range of programmable roles, being involved in the regulation of several biological processes, thereby providing the perspective of an alternative option to classical treatment. In this review, we summarize the latest information related to the application of siRNA in oral malignancy together with molecular aspects of the technology and also the perspective upon the delivery system. Also, the emergence of newer technologies such as clustered regularly interspaced short palindromic repeats/Cas9 or transcription activator-like effector nucleases in comparison with the RNAi approach is discussed in this paper.
Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum
Tomoyasu, Yoshinori
2014-01-01
The red flour beetle, Tribolium castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully annotated genome sequence, transposon-based transgenesis, and effective RNA interference (RNAi). Among these advantages, RNAi-based gene knockdown techniques are at the core of Tribolium research. T. castaneum show a robust systemic RNAi response, making it possible to perform RNAi at any life stage by simply injecting double-stranded RNA (dsRNA) into the beetle’s body cavity. In this report, we provide an overview of our larval RNAi technique in T. castaneum. The protocol includes (i) isolation of the proper stage of T. castaneum larvae for injection, (ii) preparation for the injection setting, and (iii) dsRNA injection. Larval RNAi is a simple, but powerful technique that provides us with quick access to loss-of-function phenotypes, including multiple gene knockdown phenotypes as well as a series of hypomorphic phenotypes. Since virtually all T. castaneum tissues are susceptible to extracellular dsRNA, the larval RNAi technique allows researchers to study a wide variety of tissues in diverse contexts, including the genetic basis of organismal responses to the outside environment. In addition, the simplicity of this technique stimulates more student involvement in research, making T. castaneum an ideal genetic system for use in a classroom setting. PMID:25350485
Shimizu, Takumi; Nakazono-Nagaoka, Eiko; Akita, Fusamichi; Uehara-Ichiki, Tamaki; Omura, Toshihiro; Sasaya, Takahide
2011-09-01
The nonstructural protein P9-1 of Rice black streaked dwarf virus has been confirmed to accumulate in viroplasms, the putative sites of viral replication, in infected plants and insects. We transformed rice plants by introducing an RNA interference construct against the P9-1-encoding gene. The resultant transgenic plants accumulated short interfering RNAs specific to the construct. All progenies produced by self-fertilization of these transgenic plants with induced RNA interference against the gene for P9-1 were resistant to infection by the virus. Our results demonstrated that interfering with the expression of a viroplasm component protein of plant reoviruses, which plays an important role in viral proliferation, might be a practical and effective way to control plant reovirus infection in crop plants. Copyright © 2011 Elsevier B.V. All rights reserved.
On future's doorstep: RNA interference and the pharmacopeia of tomorrow.
Gewirtz, Alan M
2007-12-01
Small molecules and antibodies have revolutionized the treatment of malignant diseases and appear promising for the treatment of many others. Nonetheless, there are many candidate therapeutic targets that are not amenable to attack by the current generation of targeted therapies, and in a small but growing number of patients, resistance to initially successful treatments evolves. This Review Series on the medicinal promise of posttranscriptional gene silencing with small interfering RNA and other molecules capable of inducing RNA interference (RNAi) is motivated by the hypothesis that effectors of RNAi can be developed into effective drugs for treating malignancies as well as many other types of disease. As this Review Series points out, there is still much to do, but many in the field now hope that the time has finally arrived when "antisense" therapies will finally come of age and fulfill their promise as the magic bullets of the 21st century.
Postberg, Jan; Jönsson, Franziska; Weil, Patrick Philipp; Bulic, Aneta; Juranek, Stefan Andreas; Lipps, Hans-Joachim
2018-06-12
During sexual reproduction in the unicellular ciliate Stylonychia somatic macronuclei differentiate from germline micronuclei. Thereby, programmed sequence reduction takes place, leading to the elimination of > 95% of germline sequences, which priorly adopt heterochromatin structure via H3K27me3. Simultaneously, 27nt-ncRNAs become synthesized from parental transcripts and are bound by the Argonaute protein PIWI1. These 27nt-ncRNAs cover sequences destined to the developing macronucleus and are thought to protect them from degradation. We provide evidence and propose that RNA/DNA base-pairing guides PIWI1/27nt-RNA complexes to complementary macronucleus-destined DNA target sequences, hence transiently causing locally stalled replication during polytene chromosome formation. This spatiotemporal delay enables the selective deposition of temporarily available histone H3.4K27me3 nucleosomes at all other sequences being continuously replicated, thus dictating their prospective heterochromatin structure before becoming developmentally eliminated. Concomitantly, 27nt-RNA-covered sites remain protected. We introduce the concept of 'RNA-induced DNA replication interference' and explain how the parental functional genome partition could become transmitted to the progeny.
RNA sensor LGP2 inhibits TRAF ubiquitin ligase to negatively regulate innate immune signaling.
Parisien, Jean-Patrick; Lenoir, Jessica J; Mandhana, Roli; Rodriguez, Kenny R; Qian, Kenin; Bruns, Annie M; Horvath, Curt M
2018-06-01
The production of type I interferon (IFN) is essential for cellular barrier functions and innate and adaptive antiviral immunity. In response to virus infections, RNA receptors RIG-I and MDA5 stimulate a mitochondria-localized signaling apparatus that uses TRAF family ubiquitin ligase proteins to activate master transcription regulators IRF3 and NFκB, driving IFN and antiviral target gene expression. Data indicate that a third RNA receptor, LGP2, acts as a negative regulator of antiviral signaling by interfering with TRAF family proteins. Disruption of LGP2 expression in cells results in earlier and overactive transcriptional responses to virus or dsRNA LGP2 associates with the C-terminus of TRAF2, TRAF3, TRAF5, and TRAF6 and interferes with TRAF ubiquitin ligase activity. TRAF interference is independent of LGP2 ATP hydrolysis, RNA binding, or its C-terminal domain, and LGP2 can regulate TRAF-mediated signaling pathways in trans , including IL-1β, TNFα, and cGAMP These findings provide a unique mechanism for LGP2 negative regulation through TRAF suppression and extend the potential impact of LGP2 negative regulation beyond the IFN antiviral response. © 2018 The Authors.
Jang, Bora; Kim, Boyoung; Kim, Hyunsook; Kwon, Hyokyoung; Kim, Minjeong; Seo, Yunmi; Colas, Marion; Jeong, Hansaem; Jeong, Eun Hye; Lee, Kyuri; Lee, Hyukjin
2018-06-08
Enzymatic synthesis of RNA nanostructures is achieved by isothermal rolling circle transcription (RCT). Each arm of RNA nanostructures provides a functional role of Dicer substrate RNA inducing sequence specific RNA interference (RNAi). Three different RNAi sequences (GFP, RFP, and BFP) are incorporated within the three-arm junction RNA nanostructures (Y-RNA). The template and helper DNA strands are designed for the large-scale in vitro synthesis of RNA strands to prepare self-assembled Y-RNA. Interestingly, Dicer processing of Y-RNA is highly influenced by its physical structure and different gene silencing activity is achieved depending on its arm length and overhang. In addition, enzymatic synthesis allows the preparation of various Y-RNA structures using a single DNA template offering on demand regulation of multiple target genes.
Lista, María José; Martins, Rodrigo Prado; Angrand, Gaelle; Quillévéré, Alicia; Daskalogianni, Chrysoula; Voisset, Cécile; Teulade-Fichou, Marie-Paule; Fåhraeus, Robin; Blondel, Marc
2017-08-31
The oncogenic Epstein-Barr virus (EBV) evades the immune system but has an Achilles heel: its genome maintenance protein EBNA1. Indeed, EBNA1 is essential for viral genome replication and maintenance but also highly antigenic. Hence, EBV evolved a system in which the glycine-alanine repeat (GAr) of EBNA1 limits the translation of its own mRNA at a minimal level to ensure its essential function thereby, at the same time, minimizing immune recognition. Defining intervention points where to interfere with EBNA1 immune evasion is an important step to trigger an immune response against EBV-carrying cancers. Thanks to a yeast-based assay that recapitulates all the aspects of EBNA1 self-limitation of expression, a recent study by Lista et al. [Nature Communications (2017) 7, 435-444] has uncovered the role of the host cell nucleolin (NCL) in this process via a direct interaction of this protein with G-quadruplexes (G4) formed in GAr-encoding sequence of EBNA1 mRNA. In addition, the G4 ligand PhenDC3 prevents NCL binding on EBNA1 mRNA and reverses GAr-mediated repression of translation and antigen presentation. This shows that the NCL-EBNA1 mRNA interaction is a relevant therapeutic target to unveil EBV-carrying cancers to the immune system and that the yeast model can be successfully used for uncovering drugs and host factors that interfere with EBV stealthiness.
Interference activity of a minimal Type I CRISPR-Cas system from Shewanella putrefaciens.
Dwarakanath, Srivatsa; Brenzinger, Susanne; Gleditzsch, Daniel; Plagens, André; Klingl, Andreas; Thormann, Kai; Randau, Lennart
2015-10-15
Type I CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas (CRISPR-associated) systems exist in bacterial and archaeal organisms and provide immunity against foreign DNA. The Cas protein content of the DNA interference complexes (termed Cascade) varies between different CRISPR-Cas subtypes. A minimal variant of the Type I-F system was identified in proteobacterial species including Shewanella putrefaciens CN-32. This variant lacks a large subunit (Csy1), Csy2 and Csy3 and contains two unclassified cas genes. The genome of S. putrefaciens CN-32 contains only five Cas proteins (Cas1, Cas3, Cas6f, Cas1821 and Cas1822) and a single CRISPR array with 81 spacers. RNA-Seq analyses revealed the transcription of this array and the maturation of crRNAs (CRISPR RNAs). Interference assays based on plasmid conjugation demonstrated that this CRISPR-Cas system is active in vivo and that activity is dependent on the recognition of the dinucleotide GG PAM (Protospacer Adjacent Motif) sequence and crRNA abundance. The deletion of cas1821 and cas1822 reduced the cellular crRNA pool. Recombinant Cas1821 was shown to form helical filaments bound to RNA molecules, which suggests its role as the Cascade backbone protein. A Cascade complex was isolated which contained multiple Cas1821 copies, Cas1822, Cas6f and mature crRNAs. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Power, Imana L; Dang, Phat M; Sobolev, Victor S; Orner, Valerie A; Powell, Joseph L; Lamb, Marshall C; Arias, Renee S
2017-04-01
Aflatoxin contamination is a major constraint in food production worldwide. In peanut (Arachis hypogaea L.), these toxic and carcinogenic aflatoxins are mainly produced by Aspergillus flavus Link and A. parasiticus Speare. The use of RNA interference (RNAi) is a promising method to reduce or prevent the accumulation of aflatoxin in peanut seed. In this study, we performed high-throughput sequencing of small RNA populations in a control line and in two transformed peanut lines that expressed an inverted repeat targeting five genes involved in the aflatoxin-biosynthesis pathway and that showed up to 100% less aflatoxin B 1 than the controls. The objective was to determine the putative involvement of the small RNA populations in aflatoxin reduction. In total, 41 known microRNA (miRNA) families and many novel miRNAs were identified. Among those, 89 known and 10 novel miRNAs were differentially expressed in the transformed lines. We furthermore found two small interfering RNAs derived from the inverted repeat, and 39 sRNAs that mapped without mismatches to the genome of A. flavus and were present only in the transformed lines. This information will increase our understanding of the effectiveness of RNAi and enable the possible improvement of the RNAi technology for the control of aflatoxins. Copyright © 2017 Elsevier B.V. All rights reserved.
Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple turnover.
Rawlings, Renata A; Krishnan, Vishalakshi; Walter, Nils G
2011-04-29
RNA interference is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response to viruses and retrotransposons. During viral infection, the RNase-III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs) 21-24 nucleotides in length and helps load them into the RNA-induced silencing complex (RISC) to guide the cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressors (RSS) that tightly, and presumably quantitatively, bind siRNAs to thwart RNA-interference-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus, as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding [(1.69 ± 0.07) × 10(8) M(-)(1) s(-1)] and marked dissociation (k(off)=0.062 ± 0.002 s(-1)). We also observe that p19 efficiently competes with recombinant Dicer and inhibits the formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. Copyright © 2011 Elsevier Ltd. All rights reserved.
RNA interference: ready to silence cancer?
Mocellin, Simone; Costa, Rodolfo; Nitti, Donato
2006-01-01
RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.
Induction of RNA interference in dendritic cells.
Li, Mu; Qian, Hua; Ichim, Thomas E; Ge, Wei-Wen; Popov, Igor A; Rycerz, Katarzyna; Neu, John; White, David; Zhong, Robert; Min, Wei-Ping
2004-01-01
Dendritic cells (DC) reside at the center of the immunological universe, possessing the ability both to stimulate and inhibit various types of responses. Tolerogenic/regulatory DC with therapeutic properties can be generated through various means of manipulations in vitro and in vivo. Here we describe several attractive strategies for manipulation of DC using the novel technique of RNA interference (RNAi). Additionally, we overview some of our data regarding yet undescribed characteristics of RNAi in DC such as specific transfection strategies, persistence of gene silencing, and multi-gene silencing. The advantages of using RNAi for DC genetic manipulation gives rise to the promise of generating tailor-made DC that can be used effectively to treat a variety of immunologically mediated diseases.
Kaye, Nicholas M; Christian, Eric L; Harris, Michael E
2002-04-09
The tRNA processing endonuclease ribonuclease P contains an essential and highly conserved RNA molecule (RNase P RNA) that is the catalytic subunit of the enzyme. To identify and characterize functional groups involved in RNase P RNA catalysis, we applied self-cleaving ribozyme-substrate conjugates, on the basis of the RNase P RNA from Escherichia coli, in nucleotide analogue interference mapping (NAIM) and site-specific modification experiments. At high monovalent ion concentrations (3 M) that facilitate protein-independent substrate binding, we find that the ribozyme is largely insensitive to analogue substitution and that concentrations of Mg2+ (1.25 mM) well below that necessary for optimal catalytic rate (>100 mM) are required to produce interference effects because of modification of nucleotide bases. An examination of the pH dependence of the reaction rate at 1.25 mM Mg2+ indicates that the increased sensitivity to analogue interference is not due to a change in the rate-limiting step. The nucleotide positions detected by NAIM under these conditions are located exclusively in the catalytic domain, consistent with the proposed global structure of the ribozyme, and predominantly occur within the highly conserved P1-P4 multihelix junction. Several sensitive positions in J3/4 and J2/4 are proximal to a previously identified site of divalent metal ion binding in the P1-P4 element. Kinetic analysis of ribozymes with site-specific N7-deazaadenosine and deazaguanosine modifications in J3/4 was, in general, consistent with the interference results and also permitted the analysis of sites not accessible by NAIM. These results show that, in this region only, modification of the N7 positions of A62, A65, and A66 resulted in measurable effects on reaction rate and modification at each position displayed distinct sensitivities to Mg2+ concentration. These results reveal a restricted subset of individual functional groups within the catalytic domain that are particularly important for substrate cleavage and demonstrate a close association between catalytic function and metal ion-dependent structure in the highly conserved P1-P4 multihelix junction.
Short hairpin RNA interference therapy for ischemic heart disease
Huang, Mei; Chan, Denise; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Chen, Xiaoyuan; Giaccia, Amato; Wu, Joseph C.
2013-01-01
Background During hypoxia, upregulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. Methods and Results PHD2 was cloned from mouse embryonic stem (ES) cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared to the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of HIF-1α protein and several downstream angiogenic genes by >30% (P<0.01). Afterwards, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending (LAD) artery in mice. Animals were randomized into shPHD2 group (n=20) versus shScramble sequence as control (n=20). Bioluminescence imaging detected transgene expression for 4–5 weeks. Echocardiographic study showed the shPHD2 group had improved fractional shortening compared with the shScramble group at week 4 (33.7%±1.9% vs. 28.4%±2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot anlaysis of explanted hearts also confirm that animals treated with shPHD2 had significantly higher levels of HIF-1α protein. Conclusions This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by shRNA led to significant improvement in angiogenesis and contractility by in vitro and in vivo experiments. With further validation, the combination of shRNA therapy and molecular imaging can be used to track novel cardiovascular gene therapy applications in the future. PMID:18824759
RNAi-mediated resistance to rice black-streaked dwarf virus in transgenic rice.
Ahmed, Mohamed M S; Bian, Shiquan; Wang, Muyue; Zhao, Jing; Zhang, Bingwei; Liu, Qiaoquan; Zhang, Changquan; Tang, Shuzhu; Gu, Minghong; Yu, Hengxiu
2017-04-01
Rice black-streaked dwarf virus (RBSDV), a member of the genus Fijivirus in the family Reoviridae, causes significant economic losses in rice production in China and many other Asian countries. Development of resistant varieties by using conventional breeding methods is limited, as germplasm with high level of resistance to RBSDV have not yet been found. One of the most promising methods to confer resistance against RBSDV is the use of RNA interference (RNAi) technology. RBSDV non-structural protein P7-2, encoded by S7-2 gene, is a potential F-box protein and involved in the plant-virus interaction through the ubiquitination pathway. P8, encoded by S8 gene, is the minor core protein that possesses potent active transcriptional repression activity. In this study, we transformed rice calli using a mini-twin T-DNA vector harboring RNAi constructs of the RBSDV genes S7-2 or S8, and obtained plants harboring the target gene constructs and the selectable marker gene, hygromycin phosphotransferase (HPT). From the offspring of these transgenic plants, we obtained selectable marker (HPT gene)-free plants. Homozygous T 5 transgenic lines which harbored either S7-2-RNAi or S8-RNAi exhibited high level resistance against RBSDV under field infection pressure from indigenous viruliferous small brown planthoppers. Thus, our results showed that RNA interference with the expression of S7-2 or S8 genes seemed an effective way to induce high level resistance in rice against RBSD disease.
There is evidence that specificity protein 1 (Sp1) transcription factor (TF) regulates expression of long non-coding RNAs (lncRNAs) in hepatocellular carcinoma (HCC) cells. RNA interference (RNAi) studies showed that among several lncRNAs expressed in HepG2, SNU-449 and SK-Hep-1...
Knockdown of Zinc Transporter ZIP5 by RNA Interference Inhibits Esophageal Cancer Growth In Vivo.
Li, Qian; Jin, Jing; Liu, Jianghui; Wang, Liqun; He, Yutong
2016-01-01
We recently found that SLC39A5 (ZIP5), a zinc transporter, is overexpressed in esophageal cancer. Downregulation of ZIP5 inhibited the proliferation, migration, and invasion of the esophageal cancer cell line KYSE170 in vitro. In this study, we found that downregulation of SLC39A5 (ZIP5) by interference resulted in a significant reduction in esophageal cancer tumor volume and weight in vivo. COX2 (cyclooxygenase 2) expression was decreased and E-cadherin expression was increased in the KYSE170K xenografts, which was caused by the downregulation of ZIP5. However, we did not find that the downregulation of ZIP5 caused a change in the relative expressions of cyclin D1, VEGF (vascular endothelial growth factor), MMP9 (matrix metalloprotein 9), and Bcl-2 (B-cell lymphoma/leukmia-2) mRNA or an alteration in the average level of zinc in the peripheral blood and xenografts in vivo. Collectively, these findings indicate that knocking down ZIP5 by small interfering RNA (siRNA) might be a novel treatment strategy for esophageal cancer with ZIP5 overexpression.
HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs
Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne
2015-01-01
Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses. PMID:25668122
HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs.
Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne
2015-01-01
Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses.
NASA Astrophysics Data System (ADS)
Aditya Parikesit, Arli; Nurdiansyah, Rizki
2018-01-01
The research for finding the cure for breast cancer is currently entering the interesting phase of the transcriptomics based method. With the application of Next Generation Sequencing (NGS), molecular information on breast cancer could be gathered. Thus, both in silico and wet lab research has determined that the role of lincRNA-RoR/miR-145/ARF6 expression Pathway could not be ignored as one of the cardinal starting points for Triple-Negative Breast Cancer (TNBC). As the most hazardous type of breast cancer, TNBC should be treated with the most advanced approach that available in the scientific community. Bioinformatics approach has found the possible siRNA-based drug candidates for TNBC. It was found that siRNA that interfere with lincRNA-ROR and mRNA ARF6 could be a feasible opportunity as the drug candidate for TNBC. However, this claim should be validated with more thorough thermodynamics and kinetics computational approach as the comprehensive way to comprehend their molecular repertoire. In this respect, the claim was validated using various tools such as the RNAfold server to determine the 2D structure, Barriers server to comprehend the RNA folding kinetics, RNAeval server to validate the siRNA-target interaction. It was found that the thermodynamics and kinetics repertoire of the siRNA are indeed rational and feasible. In this end, our computation approach has proven that our designed siRNA could interact with lincRNA-RoR/miR-145/ARF6 expression Pathway.
RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System.
Liu, Tina Y; Iavarone, Anthony T; Doudna, Jennifer A
2017-01-01
CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) systems are RNA-guided adaptive immunity pathways used by bacteria and archaea to defend against phages and plasmids. Type III-A systems use a multisubunit interference complex called Csm, containing Cas proteins and a CRISPR RNA (crRNA) to target cognate nucleic acids. The Csm complex is intriguing in that it mediates RNA-guided targeting of both RNA and transcriptionally active DNA, but the mechanism is not well understood. Here, we overexpressed the five components of the Thermus thermophilus (T. thermophilus) Type III-A Csm complex (TthCsm) with a defined crRNA sequence, and purified intact TthCsm complexes from E. coli cells. The complexes were thermophilic, targeting complementary ssRNA more efficiently at 65°C than at 37°C. Sequence-independent, endonucleolytic cleavage of single-stranded DNA (ssDNA) by TthCsm was triggered by recognition of a complementary ssRNA, and required a lack of complementarity between the first 8 nucleotides (5' tag) of the crRNA and the 3' flanking region of the ssRNA. Mutation of the histidine-aspartate (HD) nuclease domain of the TthCsm subunit, Cas10/Csm1, abolished DNA cleavage. Activation of DNA cleavage was dependent on RNA binding but not cleavage. This leads to a model in which binding of an ssRNA target to the Csm complex would stimulate cleavage of exposed ssDNA in the cell, such as could occur when the RNA polymerase unwinds double-stranded DNA (dsDNA) during transcription. Our findings establish an amenable, thermostable system for more in-depth investigation of the targeting mechanism using structural biology methods, such as cryo-electron microscopy and x-ray crystallography.
Designing highly active siRNAs for therapeutic applications.
Walton, S Patrick; Wu, Ming; Gredell, Joseph A; Chan, Christina
2010-12-01
The discovery of RNA interference (RNAi) generated considerable interest in developing short interfering RNAs (siRNAs) for understanding basic biology and as the active agents in a new variety of therapeutics. Early studies showed that selecting an active siRNA was not as straightforward as simply picking a sequence on the target mRNA and synthesizing the siRNA complementary to that sequence. As interest in applying RNAi has increased, the methods for identifying active siRNA sequences have evolved from focusing on the simplicity of synthesis and purification, to identifying preferred target sequences and secondary structures, to predicting the thermodynamic stability of the siRNA. As more specific details of the RNAi mechanism have been defined, these have been incorporated into more complex siRNA selection algorithms, increasing the reliability of selecting active siRNAs against a single target. Ultimately, design of the best siRNA therapeutics will require design of the siRNA itself, in addition to design of the vehicle and other components necessary for it to function in vivo. In this minireview, we summarize the evolution of siRNA selection techniques with a particular focus on one issue of current importance to the field, how best to identify those siRNA sequences likely to have high activity. Approaches to designing active siRNAs through chemical and structural modifications will also be highlighted. As the understanding of how to control the activity and specificity of siRNAs improves, the potential utility of siRNAs as human therapeutics will concomitantly grow. © 2010 The Authors Journal compilation © 2010 FEBS.
A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.
Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi
2018-02-12
Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.
Siegmund, Daniela; Hadwiger, Philipp; Pfizenmaier, Klaus; Vornlocher, Hans-Peter; Wajant, Harald
2002-01-01
BACKGROUND: Most tumors express death receptors and their activation represents a potential selective approach in cancer treatment. The most promising candidate for tumor selective death receptor-activation is tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)/Apo2L, which activates the death receptors TRAIL-R1 and TRAIL-R2, and induces apoptosis preferentially in tumor cells but not in normal tissues. However, many cancer cells are not or only moderately sensitive towards TRAIL and require cotreatment with irradiation or chemotherapy to yield a therapeutically reasonable apoptotic response. Because chemotherapy can have a broad range of unwanted side effects, more specific means for sensitizing tumor cells for TRAIL are desirable. The expression of the cellular FLICE-like inhibitory protein (cFLIP) is regarded as a major cause of TRAIL resistance. We therefore analyzed the usefulness of targeting FLIP to sensitize tumor cells for TRAIL-induced apoptosis. MATERIALS AND METHODS: To selectively interfere with expression of cFLIP short double-stranded RNA oligonucleotides (small interfering RNAs [siRNAs]) were introduced in the human cell lines SV80 and KB by electroporation. Effects of siRNA on FLIP expression were analyzed by Western blotting and RNase protection assay and correlated with TRAIL sensitivity upon stimulation with recombinant soluble TRAIL and TRAIL-R1- and TRAIL-R2-specific agonistic antibodies. RESULTS: FLIP expression can be inhibited by RNA interference using siRNAs, evident from reduced levels of FLIP-mRNA and FLIP protein. Inhibition of cFLIP expression sensitizes cells for apoptosis induction by TRAIL and other death ligands. In accordance with the presumed function of FLIP as an inhibitor of death receptor-induced caspase-8 activation, down-regulation of FLIP by siRNAs enhanced TRAIL-induced caspase-8 activation. CONCLUSION: Inhibition of FLIP expression was sufficient to sensitize tumor cells for TRAIL-induced apoptosis. The combination of TRAIL and FLIP-targeting siRNA could therefore be a useful strategy to attack cancer cells, which are resistant to TRAIL alone. PMID:12520089
Chiliveri, Sai Chaitanya; Kumar, Sonu; Marelli, Udaya Kiran; Deshmukh, Mandar V
2012-10-01
The RNAi pathway of several organisms requires presence of double stranded RNA binding proteins for functioning of Dicer in gene regulation. In C. elegans, a double stranded RNA binding protein, RDE-4 (385 aa, 44 kDa) recognizes long exogenous dsRNA and initiates the RNAi pathway. We have achieved complete backbone and stereospecific methyl sidechain Ile (δ1), Leu and Val chemical shifts of first 243 amino acids of RDE-4, namely RDE-4ΔC.
Malina, Jaroslav; Hannon, Michael J; Brabec, Viktor
2016-07-12
The interaction between the HIV-1 transactivator protein Tat and TAR (transactivation responsive region) RNA, plays a critical role in HIV-1 transcription. Iron(II) supramolecular helicates were evaluated for their in vitro activity to inhibit Tat-TAR RNA interaction using UV melting studies, electrophoretic mobility shift assay, and RNase A footprinting. The results demonstrate that iron(II) supramolecular helicates inhibit Tat-TAR interaction at nanomolar concentrations by binding to TAR RNA. These studies provide a new insight into the biological potential of metallosupramolecular helicates.
Shukla, Jayendra Nath; Palli, Subba Reddy
2012-01-01
Sex in insects is determined by a cascade of regulators ultimately controlling sex-specific splicing of a transcription factor, Doublesex (Dsx). We recently identified homolog of dsx in the red flour beetle, Tribolium castaneum (Tcdsx). Here, we report on the identification and characterization of a regulator of Tcdsx splicing in T. castaneum. Two male-specific and one female-specific isoforms of T. castaneum transformer (Tctra) were identified. RNA interference-aided knockdown of Tctra in pupa or adults caused a change in sex from females to males by diverting the splicing of Tcdsx pre-mRNA to male-specific isoform. All the pupa and adults developed from Tctra dsRNA injected final instar larvae showed male-specific sexually dimorphic structures. Tctra parental RNAi caused an elimination of females from the progeny resulting in production of all male progeny. Transformer parental RNAi could be used to produce all male population for use in pest control though sterile male release methods. PMID:22924109
Two classes of silencing RNAs move between C. elegans tissues
Jose, Antony M; Garcia, Giancarlo A; Hunter, Craig P
2011-01-01
Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the endonuclease DCR-1, which cleaves long dsRNA into double-stranded short-interfering RNA (ds-siRNA), and the putative nucleotidyltransferase MUT-2 (RDE-3). However, single-stranded siRNA and downstream secondary siRNA produced upon amplification by the RNA-dependent RNA Polymerase RRF-1 do not generate mobile silencing RNA. Restricting inter-tissue transport to long dsRNA and directly processed siRNA intermediates rather than amplified siRNA may serve to modulate the extent of systemic silencing in proportion to available dsRNA. PMID:21984186
Thermophoretic melting curves quantify the conformation and stability of RNA and DNA
Wienken, Christoph J.; Baaske, Philipp; Duhr, Stefan; Braun, Dieter
2011-01-01
Measuring parameters such as stability and conformation of biomolecules, especially of nucleic acids, is important in the field of biology, medical diagnostics and biotechnology. We present a thermophoretic method to analyse the conformation and thermal stability of nucleic acids. It relies on the directed movement of molecules in a temperature gradient that depends on surface characteristics of the molecule, such as size, charge and hydrophobicity. By measuring thermophoresis of nucleic acids over temperature, we find clear melting transitions and resolve intermediate conformational states. These intermediate states are indicated by an additional peak in the thermophoretic signal preceding most melting transitions. We analysed single nucleotide polymorphisms, DNA modifications, conformational states of DNA hairpins and microRNA duplexes. The method is validated successfully against calculated melting temperatures and UV absorbance measurements. Interestingly, the methylation of DNA is detected by the thermophoretic amplitude even if it does not affect the melting temperature. In the described setup, thermophoresis is measured all-optical in a simple setup using a reproducible capillary format with only 250 nl probe consumption. The thermophoretic analysis of nucleic acids shows the technique’s versatility for the investigation of nucleic acids relevant in cellular processes like RNA interference or gene silencing. PMID:21297115
Van Ba, Hoa; Hwang, Inho
2014-02-01
Caspase-9 has been reported as the key regulator of apoptosis, however, its role in skeletal myoblast development and molecular involvements during cell growth still remains unknown. The current study aimed to present the key role of caspase-9 in the expressions of apoptotic caspases and genome, and cell viability during myoblast growth using RNA interference mediated silencing. Three small interference RNA sequences (siRNAs) targeting caspase-9 gene was designed and ligated into pSilencer plasmid vector to construct shRNA expression constructs. Cells were transfected with the constructs for 48 h. Results indicated that all three siRNAs could silence the caspase-9 mRNA expression significantly. Particularly, the mRNA expression level of caspase-9 in the cells transfected by shRNA1, shRNA2 and shRNA3 constructs were reduced by 37.85%, 68.20% and 58.14%, respectively. Suppression of caspase-9 led to the significant increases in the mRNA and protein expressions of effector caspase-3, whereas the reduction in mRNA and protein expressions of caspase-7. The microarray results showed that the suppression of caspase-9 resulted in significant upregulations of cell proliferation-, adhesion-, growth-, development- and division-regulating genes, whereas the reduction in the expressions of cell death program- and stress response-regulating genes. Furthermore, cell viability was significantly increased following the transfection. These data suggest that caspase-9 could play an important role in the control of cell growth, and knockdown of caspase-9 may have genuine potential in the treatment of skeletal muscle atrophy. © 2013 The Authors Development, Growth & Differentiation © 2013 Japanese Society of Developmental Biologists.
Alakonya, Amos; Kumar, Ravi; Koenig, Daniel; Kimura, Seisuke; Townsley, Brad; Runo, Steven; Garces, Helena M.; Kang, Julie; Yanez, Andrea; David-Schwartz, Rakefet; Machuka, Jesse; Sinha, Neelima
2012-01-01
Infection of crop species by parasitic plants is a major agricultural hindrance resulting in substantial crop losses worldwide. Parasitic plants establish vascular connections with the host plant via structures termed haustoria, which allow acquisition of water and nutrients, often to the detriment of the infected host. Despite the agricultural impact of parasitic plants, the molecular and developmental processes by which host/parasitic interactions are established are not well understood. Here, we examine the development and subsequent establishment of haustorial connections by the parasite dodder (Cuscuta pentagona) on tobacco (Nicotiana tabacum) plants. Formation of haustoria in dodder is accompanied by upregulation of dodder KNOTTED-like homeobox transcription factors, including SHOOT MERISTEMLESS-like (STM). We demonstrate interspecific silencing of a STM gene in dodder driven by a vascular-specific promoter in transgenic host plants and find that this silencing disrupts dodder growth. The reduced efficacy of dodder infection on STM RNA interference transgenics results from defects in haustorial connection, development, and establishment. Identification of transgene-specific small RNAs in the parasite, coupled with reduced parasite fecundity and increased growth of the infected host, demonstrates the efficacy of interspecific small RNA–mediated silencing of parasite genes. This technology has the potential to be an effective method of biological control of plant parasite infection. PMID:22822208
Isolation and identification of gene-specific microRNAs.
Lin, Shi-Lung; Chang, Donald C; Ying, Shao-Yao
2006-01-01
Prediction of microRNA (miRNA) candidates using computer programming has identified hundreds and hundreds of genomic hairpin sequences, of which, the functions remain to be determined. Because direct transfection of hairpin-like miRNA precursors (pre)-miRNAs in mammalian cells is not always sufficient to trigger effective RNA-induced gene-silencing complex (RISC) assembly, a key step for RNA interference (RNAi)-related gene silencing, we developed an intronic miRNA-expressing system to overcome this problem, and successfully increased the efficiency and effectiveness of miRNA-associated RNAi induction in vitro and in vivo. By insertion of a hairpin-like pre-miRNA structure into the intron region of a gene, this intronic miRNA biogenesis system has been found to depend on a coupled interaction of nascent precursor messenger RNA transcription and intron excision within a specific nuclear region proximal to genomic perichromatin fibrils. The intronic miRNA was transcribed by RNA type II polymerases, coexpressed with a primary gene transcript, and excised out of its encoding gene transcript by intracellular RNA splicing and processing mechanisms. Currently, some ribonuclease III endonucleases have been found to be involved in the processing of spliced introns and probably facilitating the intronic miRNA maturation. Using this miRNA-expressing system, we have shown for the first time that the intron-derived miRNAs were able to induce strong RNAi effects in not only human and mouse cells but also zebrafish, chicken embryos, and adult mice. Based on the strand complementarity between the designed miRNA and its target gene sequence, we have also developed a miRNA isolation protocol to purify and identify the mature miRNAs generated by the intronic miRNA-expressing system. Several intronic miRNA identities and structures are currently confirmed to be active in vitro and in vivo. According to this proof- of-principle method, we now have the knowledge to design pre-miRNA inserts that are more efficient and effective for the intronic miRNA-expressing system.
Novel small interfering RNA-containing solution protecting donor organs in heart transplantation.
Zheng, Xiufen; Lian, Dameng; Wong, Arthur; Bygrave, Michael; Ichim, Thomas E; Khoshniat, Mahdieh; Zhang, Xusheng; Sun, Hongtao; De Zordo, Tobias; Lacefield, James C; Garcia, Bertha; Jevnikar, Anthony M; Min, Wei-Ping
2009-09-22
Ischemia/reperfusion injury is a major factor in graft quality and subsequent function in the transplantation setting. We hypothesize that the process of RNA interference may be used to "engineer" a graft to suppress expression of genes associated with inflammation, apoptosis, and complement, which are believed to cause ischemia/reperfusion injury. Such manipulation of pathological gene expression may be performed by treatment of the graft ex vivo with small interfering RNA (siRNA) as part of the preservation procedure. Heart grafts from BALB/c mice were preserved in UW solution (control) or UW solution containing siRNAs targeting tumor necrosis factor-alpha, C3, and Fas genes (siRNA solution) at 4 degrees C for 48 hours and subsequently transplanted into syngeneic recipients. Tumor necrosis factor-alpha, C3, and Fas genes were elevated by ischemia/reperfusion injury after 48 hours of preservation in UW solution. Preservation in siRNA solution knocked down gene expression at the level of messenger RNA and protein in the grafts after transplantation. All grafts preserved in siRNA solution showed strong contraction, whereas grafts preserved in control solution demonstrated no detectable contraction by high-frequency ultrasound scanning. siRNA solution-treated organs exhibited improved histology and diminished neutrophil and lymphocyte infiltration compared with control solution-treated organs. Furthermore, the treated heart grafts retained strong beating up to the end of the observation period (>100 days), whereas all control grafts lost function within 8 days. Incorporation of siRNA into organ storage solution is a feasible and effective method of attenuating ischemia/reperfusion injury, protecting cardiac function, and prolonging graft survival.
[Knock-down of ZEB1 inhibits the proliferation, invasion and migration of gastric cancer cells].
Chen, Dengyu; Chu, Yifan; Zheng, Qingwei; Xu, Zhiben; Zhou, Ping; Li, Sheng
2017-08-01
Objective To down-regulate the expression of zinc-finger E-box binding homeobox 1 (ZEB1) gene by shRNA, and investigate its effect on invasion, migration and proliferation, as well as the related gene expressions of lncRNA HOTAIR and E-cadherin in human gastric cancer BGC823 cells. Methods RNA interfering (RNAi) was used to knock down ZEB1 in gastric cancer BGC823 cells. The recombinant plasmid shZEB1 was constructed and transfected into the gastric cancer BGC823 cells by Lipofectamine TM 2000, and the stably transfected cells were isolated by G418 selection and limited dilution. The expression of ZEB1 mRNA and protein was detected by real-time quantitative PCR and Western blot analysis. Cell proliferation was determined by MTT assay, and the invasion and migration abilities of BGC823 cells were monitored by Transwell TM invasion assay and wound healing assay, respectively. The expressions of lncRNA HOTAIR and E-cadherin mRNA were detected by real-time quantitative PCR. Results After ZEB1 expression was successfully down-regulated in BGC823 cells by siRNA, the proliferation, invasion and migration rates in shZEB1 transfection group were significantly lower than those in control group; meanwhile, the expression of lncRNA HOTAIR was reduced and E-cadherin expression was enhanced. Conclusion Knock-down of ZEB1 expression by RNA interference can decease lncRNA HOTAIR expression and restrain cell proliferation, invasion and migration in gastric cancer BGC823 cells.
Promoter of lncRNA Gene PVT1 Is a Tumor-Suppressor DNA Boundary Element. | Office of Cancer Genomics
Noncoding mutations in cancer genomes are frequent but challenging to interpret. PVT1 encodes an oncogenic lncRNA, but recurrent translocations and deletions in human cancers suggest alternative mechanisms. Here, we show that the PVT1 promoter has a tumor-suppressor function that is independent of PVT1 lncRNA. CRISPR interference of PVT1 promoter enhances breast cancer cell competition and growth in vivo.
Sequence-specific inhibition of Dicer measured with a force-based microarray for RNA ligands.
Limmer, Katja; Aschenbrenner, Daniela; Gaub, Hermann E
2013-04-01
Malfunction of protein translation causes many severe diseases, and suitable correction strategies may become the basis of effective therapies. One major regulatory element of protein translation is the nuclease Dicer that cuts double-stranded RNA independently of the sequence into pieces of 19-22 base pairs starting the RNA interference pathway and activating miRNAs. Inhibiting Dicer is not desirable owing to its multifunctional influence on the cell's gene regulation. Blocking specific RNA sequences by small-molecule binding, however, is a promising approach to affect the cell's condition in a controlled manner. A label-free assay for the screening of site-specific interference of small molecules with Dicer activity is thus needed. We used the Molecular Force Assay (MFA), recently developed in our lab, to measure the activity of Dicer. As a model system, we used an RNA sequence that forms an aptamer-binding site for paromomycin, a 615-dalton aminoglycoside. We show that Dicer activity is modulated as a function of concentration and incubation time: the addition of paromomycin leads to a decrease of Dicer activity according to the amount of ligand. The measured dissociation constant of paromomycin to its aptamer was found to agree well with literature values. The parallel format of the MFA allows a large-scale search and analysis for ligands for any RNA sequence.
Sánchez-Luque, Francisco J.; Stich, Michael; Manrubia, Susanna; Briones, Carlos; Berzal-Herranz, Alfredo
2014-01-01
The human immunodeficiency virus type-1 (HIV-1) genome contains multiple, highly conserved structural RNA domains that play key roles in essential viral processes. Interference with the function of these RNA domains either by disrupting their structures or by blocking their interaction with viral or cellular factors may seriously compromise HIV-1 viability. RNA aptamers are amongst the most promising synthetic molecules able to interact with structural domains of viral genomes. However, aptamer shortening up to their minimal active domain is usually necessary for scaling up production, what requires very time-consuming, trial-and-error approaches. Here we report on the in vitro selection of 64 nt-long specific aptamers against the complete 5′-untranslated region of HIV-1 genome, which inhibit more than 75% of HIV-1 production in a human cell line. The analysis of the selected sequences and structures allowed for the identification of a highly conserved 16 nt-long stem-loop motif containing a common 8 nt-long apical loop. Based on this result, an in silico designed 16 nt-long RNA aptamer, termed RNApt16, was synthesized, with sequence 5′-CCCCGGCAAGGAGGGG-3′. The HIV-1 inhibition efficiency of such an aptamer was close to 85%, thus constituting the shortest RNA molecule so far described that efficiently interferes with HIV-1 replication. PMID:25175101
Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui
2015-10-01
The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.
RNA interference targets arbovirus replication in Culicoides cells.
Schnettler, Esther; Ratinier, Maxime; Watson, Mick; Shaw, Andrew E; McFarlane, Melanie; Varela, Mariana; Elliott, Richard M; Palmarini, Massimo; Kohl, Alain
2013-03-01
Arboviruses are transmitted to vertebrate hosts by biting arthropod vectors such as mosquitoes, ticks, and midges. These viruses replicate in both arthropods and vertebrates and are thus exposed to different antiviral responses in these organisms. RNA interference (RNAi) is a sequence-specific RNA degradation mechanism that has been shown to play a major role in the antiviral response against arboviruses in mosquitoes. Culicoides midges are important vectors of arboviruses, known to transmit pathogens of humans and livestock such as bluetongue virus (BTV) (Reoviridae), Oropouche virus (Bunyaviridae), and likely the recently discovered Schmallenberg virus (Bunyaviridae). In this study, we investigated whether Culicoides cells possess an antiviral RNAi response and whether this is effective against arboviruses, including those with double-stranded RNA (dsRNA) genomes, such as BTV. Using reporter gene-based assays, we established the presence of a functional RNAi response in Culicoides sonorensis-derived KC cells which is effective in inhibiting BTV infection. Sequencing of small RNAs from KC and Aedes aegypti-derived Aag2 cells infected with BTV or the unrelated Schmallenberg virus resulted in the production of virus-derived small interfering RNAs (viRNAs) of 21 nucleotides, similar to the viRNAs produced during arbovirus infections of mosquitoes. In addition, viRNA profiles strongly suggest that the BTV dsRNA genome is accessible to a Dicer-type nuclease. Thus, we show for the first time that midge cells target arbovirus replication by mounting an antiviral RNAi response mainly resembling that of other insect vectors of arboviruses.
Guan, Ruo-Bing; Li, Hai-Chao; Miao, Xue-Xia
2018-06-01
When using RNA interference (RNAi) to study gene functions in Lepidoptera insects, we discovered that some genes could not be suppressed; instead, their expression levels could be up-regulated by double-stranded RNA (dsRNA). To predict which genes could be easily silenced, we treated the Asian corn borer (Ostrinia furnacalis) with dsGFP (green fluorescent protein) and dsMLP (muscle lim protein). A transcriptome sequence analysis was conducted using the cDNAs 6 h after treatment with dsRNA. The results indicated that 160 genes were up-regulated and 44 genes were down-regulated by the two dsRNAs. Then, 50 co-up-regulated, 25 co-down-regulated and 43 unaffected genes were selected to determine their RNAi responses. All the 25 down-regulated genes were knocked down by their corresponding dsRNA. However, several of the up-regulated and unaffected genes were up-regulated when treated with their corresponding dsRNAs instead of being knocked down. The genes up-regulated by the dsGFP treatment may be involved in insect immune responses or the RNAi pathway. When the immune-related genes were excluded, only seven genes were induced by dsGFP, including ago-2 and dicer-2. These results not only provide a reference for efficient RNAi target predications, but also provide some potential RNAi pathway-related genes for further study. © 2017 Institute of Zoology, Chinese Academy of Sciences.
Li, Jin-Ming; Zhang, Wei; Su, Hua; Wang, Yuan-Yuan; Tan, Cai-Ping; Ji, Liang-Nian; Mao, Zong-Wan
2015-01-01
Systemic administration of chemotherapy for cancer often faces drug resistance, limiting its applications in cancer therapy. In this study, we developed a simple multifunctional nanocarrier based on polyethylenimine (PEI) to codeliver doxorubicin (DOX) and BCL2 small interfering RNA (siRNA) for overcoming multidrug resistance (MDR) and enhancing apoptosis in MCF-7/Adr cancer cells by combining chemotherapy and RNA interference (RNAi) therapy. The low-molecular-weight branch PEI was used to conjugate hydroxypropyl-β-cyclodextrin (HP-β-CD) and folic acid (FA), forming the codelivery nanocarrier (FA-HP-β-CD-PEI) to encapsulate DOX with the cavity HP-β-CD and bind siRNA with the positive charge of PEI for tumor-targeting codelivering drugs. The drug-loaded nanocomplexes (FA-HP-β-CD-PEI/DOX/siRNA) showed uniform size distribution, high cellular uptake, and significant gene suppression of BCL2, displaying the potential of overcoming MDR for enhancing the effect of anticancer drugs. Furthermore, the nanocomplexes achieved significant cell apoptosis through a mechanism of downregulating the antiapoptotic protein BCL2, resulted in improving therapeutic efficacy of the coadministered DOX by tumor targeting and RNA interference. Our study indicated that combined RNAi therapy and chemotherapy using our functional codelivery nanocarrier could overcome MDR and enhance apoptosis in MDR cancer cells for a potential application in treating MDR cancers. PMID:25960653
Small RNA binding is a common strategy to suppress RNA silencing by several viral suppressors
Lakatos, Lóránt; Csorba, Tibor; Pantaleo, Vitantonio; Chapman, Elisabeth J; Carrington, James C; Liu, Yu-Ping; Dolja, Valerian V; Calvino, Lourdes Fernández; López-Moya, Juan José; Burgyán, József
2006-01-01
RNA silencing is an evolutionarily conserved system that functions as an antiviral mechanism in higher plants and insects. To counteract RNA silencing, viruses express silencing suppressors that interfere with both siRNA- and microRNA-guided silencing pathways. We used comparative in vitro and in vivo approaches to analyse the molecular mechanism of suppression by three well-studied silencing suppressors. We found that silencing suppressors p19, p21 and HC-Pro each inhibit the intermediate step of RNA silencing via binding to siRNAs, although the molecular features required for duplex siRNA binding differ among the three proteins. None of the suppressors affected the activity of preassembled RISC complexes. In contrast, each suppressor uniformly inhibited the siRNA-initiated RISC assembly pathway by preventing RNA silencing initiator complex formation. PMID:16724105
Versatile RNA Interference Nanoplatform for Systemic Delivery of RNAs
2015-01-01
Development of nontoxic, tumor-targetable, and potent in vivo RNA delivery systems remains an arduous challenge for clinical application of RNAi therapeutics. Herein, we report a versatile RNAi nanoplatform based on tumor-targeted and pH-responsive nanoformulas (NFs). The NF was engineered by combination of an artificial RNA receptor, Zn(II)-DPA, with a tumor-targetable and drug-loadable hyaluronic acid nanoparticle, which was further modified with a calcium phosphate (CaP) coating by in situ mineralization. The NF can encapsulate small-molecule drugs within its hydrophobic inner core and strongly secure various RNA molecules (siRNAs, miRNAs, and oligonucleotides) by utilizing Zn(II)-DPA and a robust CaP coating. We substantiated the versatility of the RNAi nanoplatform by demonstrating effective delivery of siRNA and miRNA for gene silencing or miRNA replacement into different human types of cancer cells in vitro and into tumor-bearing mice in vivo by intravenous administration. The therapeutic potential of NFs coloaded with an anticancer drug doxorubicin (Dox) and multidrug resistance 1 gene target siRNA (siMDR) was also demonstrated in this study. NFs loaded with Dox and siMDR could successfully sensitize drug-resistant OVCAR8/ADR cells to Dox and suppress OVCAR8/ADR tumor cell proliferation in vitro and tumor growth in vivo. This gene/drug delivery system appears to be a highly effective nonviral method to deliver chemo- and RNAi therapeutics into host cells. PMID:24779637
Wu, Hui; Shi, Yinfeng; Huang, Chusen; Zhang, Yang; Wu, Jiahui; Shen, Hebai; Jia, Nengqin
2014-04-01
RNA interference-mediated gene silencing relating to disease has recently emerged as a powerful method in gene therapy. Despite the promises, effective transport of siRNA with minimal side effects remains a challenge. Halloysites are cheap and naturally available aluminosilicate clay nanotubes with high mechanical strength and biocompatibility. In this study, a novel multifunctional nanocarrier based on functionalized halloysite nanotubes (f-HNTs) has been developed via electrostatic layer-by-layer assembling approach for loading and intracellular delivery of therapeutic antisurvivin siRNA and simultaneously tracking their intracellular transport, in which PEI-modified HNTs are used as gene vector, antisurvivin siRNA as gene therapeutic agent, and mercaptoacetic acid-capped CdSe quantum dots as fluorescent labeling probes. The successful assembly of the f-HNTs-siRNA complexes was systematically characterized by transmission electron microscopy (TEM), UV-visible spectrophotometry, Zeta potential measurement, fluorescence spectrophotometry, and electrochemical impedance spectroscopy. Confocal microscopy, biological TEM, and flow cytometry studies revealed that the complexes enabled the efficient intracellular delivery of siRNA for cell-specific gene silencing. MTT assays exhibited that the complexes can enhance antitumor activity. Furthermore, Western blot analysis showed that f-HNTs-mediated siRNA delivery effectively knocked down gene expression of survivin and thereby decreased the levels of target proteins of PANC-1 cells. Therefore, this study suggested that the synthesized f-HNTs were a new effective drug delivery system for potential application in cancer gene therapy.
USDA-ARS?s Scientific Manuscript database
The whitefly Bemisia tabaci (Genn.) is a pest and vector of plant viruses affecting plants worldwide. Using RNA interference (RNAi) to downregulate whitefly genes by expressing their homologous double stranded RNAs in plants has great potential for management of whiteflies to reduce plant virus dise...
Lorenzo-Morales, Jacob; Kliescikova, Jarmila; Martinez-Carretero, Enrique; De Pablos, Luis Miguel; Profotova, Bronislava; Nohynkova, Eva; Osuna, Antonio; Valladares, Basilio
2008-03-01
Acanthamoeba infections are difficult to treat due to often late diagnosis and the lack of effective and specific therapeutic agents. The most important reason for unsuccessful therapy seems to be the existence of a double-wall cyst stage that is highly resistant to the available treatments, causing reinfections. The major components of the Acanthamoeba cyst wall are acid-resistant proteins and cellulose. The latter has been reported to be the major component of the inner cyst wall. It has been demonstrated previously that glycogen is the main source of free glucose for the synthesis of cellulose in Acanthamoeba, partly as glycogen levels fall during the encystment process. In other lower eukaryotes (e.g., Dictyostelium discoideum), glycogen phosphorylase has been reported to be the main tool used for glycogen breakdown in order to maintain the free glucose levels during the encystment process. Therefore, it was hypothesized that the regulation of the key processes involved in the Acanthamoeba encystment may be similar to the previously reported regulation mechanisms in other lower eukaryotes. The catalytic domain of the glycogen phosphorylase was silenced using RNA interference methods, and the effect of this phenomenon was assessed by light and electron microscopy analyses, calcofluor staining, expression zymogram assays, and Northern and Western blot analyses of both small interfering RNA-treated and control cells. The present report establishes the role of glycogen phosphorylase during the encystment process of Acanthamoeba. Moreover, the obtained results demonstrate that the enzyme is required for cyst wall assembly, mainly for the formation of the cell wall inner layer.
Yang, X; Liu, H; Lin, Z H; Qian, J; Xu, X R
2016-08-01
To investigate the inhibitory effects of RNA interference targeting GFI-1 on growth and proliferation of atypical chronic myelogenous leukemia (aCML) NT1 cells. NT1 cells were transfected with PBS and liposome complex (vehicle group), scrambled siRNA and liposome complex (negative control, NC group), and GFI-1 siRNA and liposome complex (GFI-1 siRNA group), respectively. Real-time quantitative RT-PCR (qRT-PCR) and Western blot were performed to examine the expression levels of GFI-1 mRNA and protein, respectively. The proliferation abilities of NT1 cells of the three groups were evaluated by MTT assay. The cell cycle in cells of the three groups was analyzed by flow cytometry. Moreover, nude mouse xenograft model was used to detect the tumor formation ability in the three group cells. Quantitative real-time PCR data showed that the expression level of GFI-1 mRNA in GFI-1 siRNA group was significantly lower than those of NC group and vehicle group [(0.367±0.017) vs. (0.918±0.006) and (1.010±0.005), respectively, (P<0.05)]. Western blot results showed that the GFI-1 protein expression level in the GFI-1 siRNA group was also significantly reduced, compared with those of the NC group and vehicle group (P<0.05 for both). From MTT assay data, the absorbance value of NT1 cells in the GFI-1 siRNA group (0.667±0.059) was significantly lower than those of the NC group (1.096±0.049) and vehicle group (1.193±0.064, P=0.023). Flow cytometry data showed that sub-G1 and G0/G1 phase proportions of the GFI-1 siRNA group were significantly higher than those of the NC and vehicle groups [sub-G1: (8.2±2.5)% vs. (1.9±1.3)% and (2.0±3.6)%, respectively, (P<0.05); G0/G1: (66.7±3.8)% vs. (53.3±4.5)% and (48.6±3.2)%, respectively, (P<0.05)]. Furthermore, the tumor weight in the GFI-1 siRNA group [(0.37±0.02) g] was significantly lower than those in the NC group [(0.83±0.06) g] and vehicle group [(0.92±0.04) g] (P<0.05). RNA interference targeting GFI-1 inhibits the growth and proliferation of NT1 cells, which may provide a new therapeutic target for atypical chronic myelogenous leukemia.
Genome Editing in the Cricket, Gryllus bimaculatus.
Watanabe, Takahito; Noji, Sumihare; Mito, Taro
2017-01-01
Hemimetabolous, or incompletely metamorphosing, insects are phylogenetically basal and include many beneficial and deleterious species. The cricket, Gryllus bimaculatus, is an emerging model for hemimetabolous insects, based on the success of RNA interference (RNAi)-based gene-functional analyses and transgenic technology. Taking advantage of genome editing technologies in this species would greatly promote functional genomics studies. Genome editing has proven to be an effective method for site-specific genome manipulation in various species. Here, we describe a protocol for genome editing including gene knockout and gene knockin in G. bimaculatus for functional genomics studies.
The effect of Pokemon on bladder cancer epithelial-mesenchymal transition.
Guo, Changcheng; Zhu, Kai; Sun, Wei; Yang, Bin; Gu, Wenyu; Luo, Jun; Peng, Bo; Zheng, Junhua
2014-01-24
This study aimed at detecting Pokemon expression in bladder cancer cell and investigating the relationship between Pokemon and epithelial-mesenchymal transition. Furthermore, we investigated the functions of Pokemon in the carcinogenesis and development of bladder cancer. This study was also designed to observe the inhibitory effects of siRNA expression vector on Pokemon in bladder cancer cell. The siRNA expression vectors which were constructed to express a short hairpin RNA against Pokemon were transfected to the bladder cancer cells T24 with a liposome. Levels of Pokemon, E-cadherin and β-catenin mRNA and protein were examined by real-time quantitative-fluorescent PCR and Western blot analysis, respectively. The effects of Pokemon silencing on epithelial-mesenchymal transition of T24 cells were evaluated with wound-healing assay. Pokemon was strongly inhibited by siRNA treatment, especially siRNA3 treatment group, as it was reflected by Western blot and real-time PCR. The gene and protein of E-cadherin expression level showed increased markedly after Pokemon was inhibited by RNA interference. While there were no differences in the levels of gene and protein of β-catenin among five groups. The bladder cancer cell after Pokemon siRNA interference showed a significantly reduced wound-closing efficiency at 6, 12 and 24h. Our findings suggest Pokemon may inhibit the expression of E-cadherin. The low expression of E-cadherin lead to increasing the phenotype and apical-base polarity of epithelial cells. These changes of cells may result in the recurrence and progression of bladder cancer at last. Copyright © 2013 Elsevier Inc. All rights reserved.
Nam, Woo Suk; Park, Kwon Moo; Park, Jeen-Woo
2012-08-01
A metabolic abnormality in lipid biosynthesis is frequently associated with obesity and hyperlipidemia. Nicotinamide adenine dinucleotide phosphate-oxidase (NADPH) is an essential reducing equivalent for numerous enzymes required in fat and cholesterol biosynthesis. Cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) has been proposed as a key enzyme for supplying cytosolic NADPH. We report here that knockdown of IDPc expression by Ribonucleic acid (RNA) interference (RNAi) inhibited adipocyte differentiation and lipogenesis in 3T3-L1 preadipocytes and mice. Attenuated IDPc expression by IDPc small interfering RNA (siRNA) resulted in a reduction of differentiation and triglyceride level and adipogenic protein expression as well as suppression of glucose uptake in cultured adipocytes. In addition, the attenuation of Nox activity and Reactive oxygen species (ROS) generation accompanied with knockdown of IDPc was associated with inhibition of adipogenesis and lipogenesis. The loss of body weight and the reduction of triglyceride level were also observed in diet-induced obese mice transduced with IDPc short-hairpin (shRNA). Taken together, the inhibiting effect of RNAi targeting IDPc on adipogenesis and lipid biosynthesis is considered to be of therapeutic value in the treatment and prevention of obesity and obesity-associated metabolic syndrome. © 2012 Elsevier B.V. All rights reserved.
Li, Yining; Xu, Shuxiong; Wang, Xiangwei; Shi, Hua; Sun, Zhaolin; Yang, Zhao
2013-02-01
To explore the exact mechanism of Pokemon in prostate cancer. Pokemon is a member of the POK family of transcriptional repressors. Its main function is suppression of the p14ARF (alternate reading frame) tumor suppressor gene. Although Pokemon expression has been found to be increased in various types of lymphoma, the exact mechanism of the gene in prostate cancer is not clear. In the present study, prostate cancer cells were transfected with the specific short hairpin ribonucleic acid (RNA) expression vector targeting Pokemon. The expression of Pokemon messenger RNA and its protein was detected by semiquantitative reverse transcriptase-polymerase chain reaction and Western blotting, respectively. The cell growth and cell apoptosis were also examined using the methyl thiazolyl tetrazolium assay and flow cytometry. The results demonstrated that specific RNA interference (RNAi) could decrease the expression levels of Pokemon gene messenger RNA and protein in prostate cancer cells. In addition, that specific RNAi significantly inhibited the cell proliferation and increased the apoptotic rate. In vivo experiments showed that specific RNAi inhibited the tumorigenicity of prostate cancer cells and significantly suppressed tumor growth. Therefore, an RNAi-targeted Pokemon gene strategy could be a potential approach to prostate cancer therapy. Copyright © 2013 Elsevier Inc. All rights reserved.
DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells
Spike, Caroline A.; Bader, Jason; Reinke, Valerie; Strome, Susan
2008-01-01
P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs). PMID:18234720
DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells.
Spike, Caroline A; Bader, Jason; Reinke, Valerie; Strome, Susan
2008-03-01
P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs).
RNA interference mediated in human primary cells via recombinant baculoviral vectors.
Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T
2005-04-01
The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.
siRNA Delivery to the Lung: What’s New?
Merkel, Olivia M.; Rubinstein, Israel; Kissel, Thomas
2014-01-01
RNA interference (RNAi) has been thought of as the general answer to many unmet medical needs. After the first success stories, it soon became obvious that short interfering RNA (siRNA) is not suitable for systemic administration due to its poor pharmacokinetics. Therefore local administration routes have been adopted for more successful in vivo RNAi. This paper reviews nucleic acid modifications, nanocarrier chemistry, animal models used in successful pulmonary siRNA delivery, as well as clinical translation approaches. We summarize what has been published recently and conclude with the potential problems that may still hamper the efficient clinical application of RNAi in the lung. PMID:24907426
Improving Small Interfering RNA Delivery In Vivo Through Lipid Conjugation.
Osborn, Maire F; Khvorova, Anastasia
2018-05-10
RNA interference (RNAi)-based therapeutics are approaching clinical approval for genetically defined diseases. Current clinical success is a result of significant innovations in the development of chemical architectures that support sustained, multi-month efficacy in vivo following a single administration. Conjugate-mediated delivery has established itself as the most promising platform for safe and targeted small interfering RNA (siRNA) delivery. Lipophilic conjugates represent a major class of modifications that improve siRNA pharmacokinetics and enable efficacy in a broad range of tissues. Here, we review current literature and define key features and limitations of this approach for in vivo modulation of gene expression.
Isolation and identification of gene-specific microRNAs.
Lin, Shi-Lung; Chang, Donald C; Ying, Shao-Yao
2013-01-01
Computer programming has identified hundreds of genomic hairpin sequences, many with functions remain to be determined. Because direct transfection of hairpin-like miRNA precursors (pre)-miRNAs in mammalian cells is not always sufficient to trigger effective RNA-induced gene silencing complex (RISC) assembly, a key step for RNA interference (RNAi)-related gene silencing, we developed an intronic miRNA-expressing system to overcome this problem by inserting a hairpin-like pre-miRNA structure into the intron region of a gene and successfully increased the efficiency and effectiveness of miRNA-associated RNAi induction in vitro and in vivo. This intronic miRNA biogenesis has been found to depend on a coupled interaction of nascent precursor messenger RNA transcription and intron excision within a specific nuclear region proximal to genomic perichromatin fibrils. The intronic miRNA was transcribed by RNA type II polymerases, coexpressed with a primary gene transcript, and excised out of its encoding gene transcript by intracellular RNA splicing and processing mechanisms. Currently, some ribonuclease III endonucleases have been found to be involved in the processing of spliced introns and probably facilitating the intronic miRNA maturation. Using this miRNA generation system, we have shown for the first time that the intron-derived miRNAs were able to induce strong RNAi effects in not only human and mouse cells but also zebrafishes, chicken embryos, and adult mice. We have also developed an miRNA isolation protocol, based on the complementarity between the designed miRNA and its target gene sequence, to purify and identify the mature miRNAs generated by the intronic miRNA-expressing system. Several intronic miRNA identities and structures are currently confirmed to be active in vitro and in vivo. According to this proven-of-principle method, we now have full knowledge to design pre-miRNA inserts that are more efficient and effective for the intronic miRNA-expressing systems.
Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok
2012-07-01
A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.
Gurfield, Nikos; Grewal, Saran; Cua, Lynnie S; Torres, Pedro J; Kelley, Scott T
2017-01-01
The Pacific coast tick, Dermacentor occidentalis Marx, is found throughout California and can harbor agents that cause human diseases such as anaplasmosis, ehrlichiosis, tularemia, Rocky Mountain spotted fever and rickettsiosis 364D. Previous studies have demonstrated that nonpathogenic endosymbiotic bacteria can interfere with Rickettsia co-infections in other tick species. We hypothesized that within D. occidentalis ticks, interference may exist between different nonpathogenic endosymbiotic or nonendosymbiotic bacteria and Spotted Fever group Rickettsia (SFGR). Using PCR amplification and sequencing of the romp A gene and intergenic region we identified a cohort of SFGR-infected and non-infected D. occidentalis ticks collected from San Diego County. We then amplified a partial segment of the 16S rRNA gene and used next-generation sequencing to elucidate the microbiomes and levels of co-infection in the ticks. The SFGR R. philipii str. 364D and R. rhipicephali were detected in 2.3% and 8.2% of the ticks, respectively, via romp A sequencing. Interestingly, next generation sequencing revealed an inverse relationship between the number of Francisella- like endosymbiont (FLE) 16S rRNA sequences and Rickettsia 16S rRNA sequences within individual ticks that is consistent with partial interference between FLE and SFGR infecting ticks. After excluding the Rickettsia and FLE endosymbionts from the analysis, there was a small but significant difference in microbial community diversity and a pattern of geographic isolation by distance between collection locales. In addition, male ticks had a greater diversity of bacteria than female ticks and ticks that weren't infected with SFGR had similar microbiomes to canine skin microbiomes. Although experimental studies are required for confirmation, our findings are consistent with the hypothesis that FLEs and, to a lesser extent, other bacteria, interfere with the ability of D. occidentalis to be infected with certain SFGR. The results also raise interesting possibilities about the effects of putative vertebrate hosts on the tick microbiome.
Proteomics for understanding miRNA biology.
Huang, Tai-Chung; Pinto, Sneha M; Pandey, Akhilesh
2013-02-01
MicroRNAs (miRNAs) are small noncoding RNAs that play important roles in posttranscriptional regulation of gene expression. Mature miRNAs associate with the RNA interference silencing complex to repress mRNA translation and/or degrade mRNA transcripts. Mass spectrometry-based proteomics has enabled identification of several core components of the canonical miRNA processing pathway and their posttranslational modifications which are pivotal in miRNA regulatory mechanisms. The use of quantitative proteomic strategies has also emerged as a key technique for experimental identification of miRNA targets by allowing direct determination of proteins whose levels are altered because of translational suppression. This review focuses on the role of proteomics and labeling strategies to understand miRNA biology. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Chou, Szu-Ting
Delivery has been the major obstacle for nucleic acid therapeutics, including the RNA interference (RNAi) approach. Mixson's lab has been focused on the development of a non-viral peptide-based delivery system, HK (histidine-lysine) polymers, which have shown promise as carriers of plasmids and small interference RNA (siRNA) in several cell lines and in tumor-bearing models. In a previous study, a four-branched peptide, denoted H3K(+H)4b, with the predominant repeating -HHHK- sequence in the branch, has been shown to be the most effective and least toxic carrier in vitro and in vivo.. Building on these results, I utilized different approaches including several structure and stability molecular characterization methods to study polyplex and to develop more effective carriers for improved therapy with siRNAs targeting malignancies. To understand the role of histidine in the stability of the H3K(+H)4b/siRNA polyplex, the physicochemical properties were investigated. With the use of isothermal titration calorimetry and heteronuclear single quantum coherence NMR, histidines were shown to form hydrogen bonds with siRNA, which enhanced the stability and biological activity of the polyplexes. In addition, to enhance resistance to nucleases and to target the tumors selectively, H3K(+H)4b was chemically modified with different patterns of polyethylene glycol (PEG) and cyclic RGD (Arg-Gly-Asp, cRGD) peptide conjugates. The luciferase marker gene expressed stably by tumor xenografts in mouse models was targeted in order to evaluate the efficacy of HK carriers of siRNA that differed in location and number of cRGD-PEG attachments. The most effective carrier was (RGD-PEG)4H3K(+H) (RP-HK), which has a cRGD-PEG on each of its four terminal branches. Consistent with its prolonged stability, as observed by pharmacokinetic studies, the RP-HK polyplex down-regulated luciferase activity in tumor xenografts by nearly 70% compared with the untreated group. Subsequently, the RP-HK polyplex was used to target the Raf-1 oncogene, an important mediator of tumor cell growth and angiogenesis. As in the luciferase studies, the polyplex reduced Raf-1 mRNA by more than 75%, and more importantly, the treatment inhibited the tumor growth by 60% in a mouse model. We anticipate that further design and engineering of HK carriers will improve the predictability and therapeutic activity of siRNA polyplexes in cancer treatment.
Montazami, N; Kheir Andish, M; Majidi, J; Yousefi, M; Yousefi, B; Mohamadnejad, L; Shanebandi, D; Estiar, M A; Khaze, V; Mansoori, B; Baghbani, E; Baradaran, B
2015-05-28
One of the most challenging aspects of colon cancer therapy is rapid acquisition of multidrug resistant phenotype. The multidrug resistance gene 1 (MDR1) product, p—glycoprotein (P—gp), pump out a variety of anticancer agents from the cell, giving rise to a general drug resistance against chemotherapeutic agents. The aim of this study was to investigate the effect of a specific MDR1 small interference RNA (siRNA) on sensitivity of oxaliplatin—resistant SW480 human colon cancer cell line (SW480/OxR) to the chemotherapeutic drug oxaliplatin. SW480 cells were made resistant by continuous incubation with stepwise serially increased concentrations of oxaliplatin over a 6—months period. Resistance cell were subsequently transfected with specific MDR1 siRNA. Relative MDR1 mRNA expression was measured by Quantitative real—time PCR. Western blot analysis was performed to determine the protein levels of P—gp. The cytotoxic effects of oxaliplatin and MDR1 siRNA, alone and in combination were assessed using MTT and the number of apoptotic cells was determined with the TUNEL assay. MDR1 siRNA effectively reduced MDR1 expression in both mRNA and protein levels. MDR1 down—regulation synergistically increased the cytotoxic effects of oxaliplatin and spontaneous apoptosis SW480/OxR. Our data demonstrates that RNA interference could down regulate MDR1 gene expression and reduce the P—gp level, and partially reverse the drug resistance in SW480/OxR cells in vitro. Therefore, the results could suggest that MDR1 silencing may be a potent adjuvant in human colon chemotherapy.
RNA interference technology in crop protection against arthropod pests, pathogens and nematodes.
Zotti, Moises; Dos Santos, Ericmar Avila; Cagliari, Deise; Christiaens, Olivier; Taning, Clauvis Nji Tizi; Smagghe, Guy
2018-06-01
Scientists have made significant progress in understanding and unraveling several aspects of double-stranded RNA (dsRNA)-mediated gene silencing during the last two decades. Now that the RNA interference (RNAi) mechanism is well understood, it is time to consider how to apply the acquired knowledge to agriculture and crop protection. Some RNAi-based products are already available for farmers and more are expected to reach the market soon. Tailor-made dsRNA as an active ingredient for biopesticide formulations is considered a raw material that can be used for diverse purposes, from pest control and bee protection against viruses to pesticide resistance management. The RNAi mechanism works at the messenger RNA (mRNA) level, exploiting a sequence-dependent mode of action, which makes it unique in potency and selectivity compared with conventional agrochemicals. Furthermore, the use of RNAi in crop protection can be achieved by employing plant-incorporated protectants through plant transformation, but also by non-transformative strategies such as the use of formulations of sprayable RNAs as direct control agents, resistance factor repressors or developmental disruptors. In this review, RNAi is presented in an agricultural context (discussing products that have been launched on the market or will soon be available), and we go beyond the classical presentation of successful examples of RNAi in pest-insect control and comprehensively explore its potential for the control of plant pathogens, nematodes and mites, and to fight against diseases and parasites in beneficial insects. Moreover, we also discuss its use as a repressor for the management of pesticide-resistant weeds and insects. Finally, this review reports on the advances in non-transformative dsRNA delivery and the production costs of dsRNA, and discusses environmental considerations. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Conditional sterility in plants
Meagher, Richard B.; McKinney, Elizabeth; Kim, Tehryung
2010-02-23
The present disclosure provides methods, recombinant DNA molecules, recombinant host cells containing the DNA molecules, and transgenic plant cells, plant tissue and plants which contain and express at least one antisense or interference RNA specific for a thiamine biosynthetic coding sequence or a thiamine binding protein or a thiamine-degrading protein, wherein the RNA or thiamine binding protein is expressed under the regulatory control of a transcription regulatory sequence which directs expression in male and/or female reproductive tissue. These transgenic plants are conditionally sterile; i.e., they are fertile only in the presence of exogenous thiamine. Such plants are especially appropriate for use in the seed industry or in the environment, for example, for use in revegetation of contaminated soils or phytoremediation, especially when those transgenic plants also contain and express one or more chimeric genes which confer resistance to contaminants.
Small Molecule Modulators of Pre-mRNA Splicing in Cancer Therapy.
Salton, Maayan; Misteli, Tom
2016-01-01
Pre-mRNA splicing is a fundamental process in mammalian gene expression and alternative RNA splicing plays a considerable role in generating protein diversity. RNA splicing events are also key to the pathology of numerous diseases, particularly cancers. Some tumors are molecularly addicted to specific RNA splicing isoforms making interference with pre-mRNA processing a viable therapeutic strategy. Several RNA splicing modulators have recently been characterized, some showing promise in preclinical studies. While the targets of most splicing modulators are constitutive RNA processing components, possibly leading to undesirable side effects, selectivity for individual splicing events has been observed. Given the high prevalence of splicing defects in cancer, small molecule modulators of RNA processing represent a potentially promising novel therapeutic strategy in cancer treatment. Here, we review their reported effects, mechanisms, and limitations. Published by Elsevier Ltd.
Specific Silencing of L392V PSEN1 Mutant Allele by RNA Interference
Sierant, Malgorzata; Paduszynska, Alina; Kazmierczak-Baranska, Julia; Nacmias, Benedetta; Sorbi, Sandro; Bagnoli, Silvia; Sochacka, Elzbieta; Nawrot, Barbara
2011-01-01
RNA interference (RNAi) technology provides a powerful molecular tool to reduce an expression of selected genes in eukaryotic cells. Short interfering RNAs (siRNAs) are the effector molecules that trigger RNAi. Here, we describe siRNAs that discriminate between the wild type and mutant (1174 C→G) alleles of human Presenilin1 gene (PSEN1). This mutation, resulting in L392V PSEN1 variant, contributes to early onset familial Alzheimer's disease. Using the dual fluorescence assay, flow cytometry and fluorescent microscopy we identified positions 8th–11th, within the central part of the antisense strand, as the most sensitive to mismatches. 2-Thiouridine chemical modification introduced at the 3′-end of the antisense strand improved the allele discrimination, but wobble base pairing adjacent to the mutation site abolished the siRNA activity. Our data indicate that siRNAs can be designed to discriminate between the wild type and mutant alleles of genes that differ by just a single nucleotide. PMID:21559198
Virus-Derived Gene Expression and RNA Interference Vector for Grapevine
Kurth, Elizabeth G.; Peremyslov, Valera V.; Prokhnevsky, Alexey I.; Kasschau, Kristin D.; Miller, Marilyn; Carrington, James C.
2012-01-01
The improvement of the agricultural and wine-making qualities of the grapevine (Vitis vinifera) is hampered by adherence to traditional varieties, the recalcitrance of this plant to genetic modifications, and public resistance to genetically modified organism (GMO) technologies. To address these challenges, we developed an RNA virus-based vector for the introduction of desired traits into grapevine without heritable modifications to the genome. This vector expresses recombinant proteins in the phloem tissue that is involved in sugar transport throughout the plant, from leaves to roots to berries. Furthermore, the vector provides a powerful RNA interference (RNAi) capability of regulating the expression of endogenous genes via virus-induced gene-silencing (VIGS) technology. Additional advantages of this vector include superb genetic capacity and stability, as well as the swiftness of technology implementation. The most significant applications of the viral vector include functional genomics of the grapevine and disease control via RNAi-enabled vaccination against pathogens or invertebrate pests. PMID:22438553
Thakur, Nidhi; Upadhyay, Santosh Kumar; Verma, Praveen C.; Chandrashekar, Krishnappa; Tuli, Rakesh; Singh, Pradhyumna K.
2014-01-01
Background Expression of double strand RNA (dsRNA) designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi), thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci) upon oral feeding. The v-ATPase subunit A (v-ATPaseA) coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. Methodology/Principal Findings Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. Conclusions/Significance Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops. PMID:24595215
Fallahi, Maryam; Keyhanmanesh, Rana; Khamaneh, Amir Mahdi; Ebrahimi Saadatlou, Mohammad Ali; Saadat, Saeideh; Ebrahimi, Hadi
2016-01-01
Objective: In previous studies the therapeutic effects of Nigella sativa have been demonstrated on asthmatic animals. In the present study, the preventive effect of single dose of alpha-hederin, its active constituent, has been evaluated on lung inflammation and some inflammatory mediators in lungs of ovalbumin sensitized rat in order to elicit its mechanism. Materials and Methods: Forty rats were randomly grouped in 4 groups; control (C), sensitized (S), sensitized pretreated groups with thymoquinone (3 mg/kg i.p., S+TQ) and alpha-hederin (0.02 mg/kg i.p., S+AH). Levels of IL-13 mRNA and miRNA-126 in lung tissue and its pathological changes in each group were assessed. Results: Elevated levels of miRNA-126, IL-13 mRNA and pathological changes were observed in the sensitized group compared to the control group (p<0.001 to p<0.05). All of these factors were significantly reduced in S+TQ and S+AH groups in comparison to S group (p<0.001 to p<0.05). Although alpha-hederin decreased the levels of miRNA-126, IL-13 mRNA and pathological changes in comparison with thymoquinone, the results were statistically not significant. Conclusion: The results suggested that alpha-hederin had preventive effect on sensitized rats like thymoquinone. It may intervene in miRNA-126 expression, which consequently could interfere with IL-13 secretion pathway leading to a reduction in inflammatory responses. PMID:27247924
Cooper, Lauren A; Stringer, Anne M; Wade, Joseph T
2018-04-17
In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo , for the type I-E system of Escherichia coli Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5' end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. IMPORTANCE Many bacterial and archaeal species encode CRISPR-Cas immunity systems that protect against invasion by foreign DNA. In the Escherichia coli CRISPR-Cas system, a protein complex, Cascade, binds 61-nucleotide (nt) CRISPR RNAs (crRNAs). The Cascade complex is directed to invading DNA molecules through base pairing between the crRNA and target DNA. This leads to recruitment of the Cas3 nuclease, which destroys the invading DNA molecule and promotes acquisition of new immunity elements. We made the first in vivo measurements of Cascade binding to DNA targets. Thus, we show that Cascade binding to DNA is highly promiscuous; endogenous E. coli crRNAs can direct Cascade binding to >100 chromosomal locations. In contrast, we show that targeted degradation and acquisition of new immunity elements require highly specific association of Cascade with DNA, limiting CRISPR-Cas function to the appropriate targets. Copyright © 2018 Cooper et al.
2010-01-01
Background The parasitic mite Varroa destructor is considered the major pest of the European honey bee (Apis mellifera) and responsible for declines in honey bee populations worldwide. Exploiting the full potential of gene sequences becoming available for V. destructor requires adaptation of modern molecular biology approaches to this non-model organism. Using a mu-class glutathione S-transferase (VdGST-mu1) as a candidate gene we investigated the feasibility of gene knockdown in V. destructor by double-stranded RNA-interference (dsRNAi). Results Intra-haemocoelic injection of dsRNA-VdGST-mu1 resulted in 97% reduction in VdGST-mu1 transcript levels 48 h post-injection compared to mites injected with a bolus of irrelevant dsRNA (LacZ). This gene suppression was maintained to, at least, 72 h. Total GST catalytic activity was reduced by 54% in VdGST-mu1 gene knockdown mites demonstrating the knockdown was effective at the translation step as well as the transcription steps. Although near total gene knockdown was achieved by intra-haemocoelic injection, only half of such treated mites survived this traumatic method of dsRNA administration and less invasive methods were assessed. V. destructor immersed overnight in 0.9% NaCl solution containing dsRNA exhibited excellent reduction in VdGST-mu1 transcript levels (87% compared to mites immersed in dsRNA-LacZ). Importantly, mites undergoing the immersion approach had greatly improved survival (75-80%) over 72 h, approaching that of mites not undergoing any treatment. Conclusions Our findings on V. destructor are the first report of gene knockdown in any mite species and demonstrate that the small size of such organisms is not a major impediment to applying gene knockdown approaches to the study of such parasitic pests. The immersion in dsRNA solution method provides an easy, inexpensive, relatively high throughput method of gene silencing suitable for studies in V. destructor, other small mites and immature stages of ticks. PMID:20712880
Gao, Xiao-Ling; Yang, Jiao-Jiao; Wang, Shu-Juan; Chen, Yan; Wang, Bei; Cheng, Er-Jing; Gong, Jian-Nan; Dong, Yan-Ting; Liu, Dai; Wang, Xiang-Li; Huang, Ya-Qiong; An, Dong-Dong
2018-06-22
Breast cancer is known as the most prevalent cancer in women worldwide, and has an undeniable negative impact on public health, both physically, and mentally. This study aims to investigate the effects of toll-like receptor 4 (TLR4) gene silencing on proliferation and apoptosis of human breast cancer cells to explore for a new theoretical basis for its treatment. TLR4 small interference RNA (siRNA) fragment recombinant plasmids were constructed, including TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3. Human breast cancer MCF-7 and MDA-MB-231 cells were assigned into blank, negative control (NC), TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3 groups. MCF-7 and MDA-MB-231 cell growth was detected by MTT assay. Apoptosis and cell cycle were determined by flow cytometry. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) and Western blot analysis were conducted to determine the expression of TLR4, CDK4, cyclin D1, Livin, Bcl-2, p53, c-FLIP, and caspase-3. In comparison with the NC and blank groups, the TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3 groups showed decreased the expression of TLR4, inhibited proliferation of MCF-7 and MDA-MB-231 cells and promoted MCF-7 and MDA-MB-231 cell apoptosis, and the cells were blocked in G1 phase. In comparison with the NC and blank groups, in the TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3 groups, siRNA-TLR4 significantly increased expression of p53 and caspase-3 in MCF-7 and MDA-MB-231 cells, while it decreased the expressions of CDK4, cyclinD1, Livin, Bal-2, and c-FLIP. The study demonstrates that TLR4 gene silencing inhibits proliferation and induces apoptosis of MCF-7 and MDA-MB-231 cells. © 2018 Wiley Periodicals, Inc.
Malina, Jaroslav; Hannon, Michael J.; Brabec, Viktor
2016-01-01
The interaction between the HIV-1 transactivator protein Tat and TAR (transactivation responsive region) RNA, plays a critical role in HIV-1 transcription. Iron(II) supramolecular helicates were evaluated for their in vitro activity to inhibit Tat–TAR RNA interaction using UV melting studies, electrophoretic mobility shift assay, and RNase A footprinting. The results demonstrate that iron(II) supramolecular helicates inhibit Tat-TAR interaction at nanomolar concentrations by binding to TAR RNA. These studies provide a new insight into the biological potential of metallosupramolecular helicates. PMID:27405089
Spit, Jornt; Philips, Annelies; Wynant, Niels; Santos, Dulce; Plaetinck, Geert; Vanden Broeck, Jozef
2017-02-01
The responsiveness towards orally delivered dsRNA and the potency of a subsequent environmental RNA interference (RNAi) response strongly differs between different insect species. While some species are very sensitive to dsRNA delivery through the diet, others are not. The underlying reasons for this may vary, but degradation of dsRNA by nucleases in the gut lumen is believed to play a crucial role. The Colorado potato beetle, Leptinotarsa decemlineata, is a voracious defoliator of potato crops worldwide, and is currently under investigation for novel control methods based on dsRNA treatments. Here we describe the identification and characterization of two nuclease genes exclusively expressed in the gut of this pest species. Removal of nuclease activity in adults increased the sensitivity towards dsRNA and resulted in improved protection of potato plants. A similar strategy in the desert locust, Schistocerca gregaria, for which we show a far more potent nuclease activity in the gut juice, did however not lead to an improvement of the RNAi response. Possible reasons for this are discussed. Taken together, the present data confirm a negative effect of nucleases in the gut on the environmental RNAi response, and further suggest that interfering with this activity is a strategy worth pursuing for improving RNAi efficacy in insect pest control applications. Copyright © 2017 Elsevier Ltd. All rights reserved.
Microprocessor mediates transcriptional termination in long noncoding microRNA genes
Dhir, Ashish; Dhir, Somdutta; Proudfoot, Nick J.; Jopling, Catherine L.
2015-01-01
MicroRNA (miRNA) play a major role in the post-transcriptional regulation of gene expression. Mammalian miRNA biogenesis begins with co-transcriptional cleavage of RNA polymerase II (Pol II) transcripts by the Microprocessor complex. While most miRNA are located within introns of protein coding genes, a substantial minority of miRNA originate from long non coding (lnc) RNA where transcript processing is largely uncharacterized. We show, by detailed characterization of liver-specific lnc-pri-miR-122 and genome-wide analysis in human cell lines, that most lnc-pri-miRNA do not use the canonical cleavage and polyadenylation (CPA) pathway, but instead use Microprocessor cleavage to terminate transcription. This Microprocessor inactivation leads to extensive transcriptional readthrough of lnc-pri-miRNA and transcriptional interference with downstream genes. Consequently we define a novel RNase III-mediated, polyadenylation-independent mechanism of Pol II transcription termination in mammalian cells. PMID:25730776
2007-02-05
lines. Three regulatory mechanisms have been examined in our laboratory: antisense inhibition, ribozyme cleavage, and RNA interference (RNAi...cell lines. However, the latter two regulatory mechanisms, ribozyme -based inactivation and RNAi-mediated silencing, demonstrated significant activity...in these cell lines as is briefly described below. Microswitches responsive to the small molecule theophylline and targeting GFP based on a ribozyme
USDA-ARS?s Scientific Manuscript database
Like many a-herpesvirinae subfamily members, bovine herpes virus 1 (BoHV-1) expresses an abundant transcript in latently infected sensory neurons: the latency-related (LR) RNA. LR-RNA encodes a protein (ORF2) that inhibits apoptosis, interacts with Notch family members, interferes with Notch mediate...
Matsa, Elena; Dixon, James E; Medway, Christopher; Georgiou, Orestis; Patel, Minal J; Morgan, Kevin; Kemp, Paul J; Staniforth, Andrew; Mellor, Ian; Denning, Chris
2014-04-01
Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K(+) currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart.
RNA Interference: A Novel Source of Resistance to Combat Plant Parasitic Nematodes.
Banerjee, Sagar; Banerjee, Anamika; Gill, Sarvajeet S; Gupta, Om P; Dahuja, Anil; Jain, Pradeep K; Sirohi, Anil
2017-01-01
Plant parasitic nematodes cause severe damage and yield loss in major crops all over the world. Available control strategies include use of insecticides/nematicides but these have proved detrimental to the environment, while other strategies like crop rotation and resistant cultivars have serious limitations. This scenario provides an opportunity for the utilization of technological advances like RNA interference (RNAi) to engineer resistance against these devastating parasites. First demonstrated in the model free living nematode, Caenorhabtidis elegans ; the phenomenon of RNAi has been successfully used to suppress essential genes of plant parasitic nematodes involved in parasitism, nematode development and mRNA metabolism. Synthetic neurotransmitants mixed with dsRNA solutions are used for in vitro RNAi in plant parasitic nematodes with significant success. However, host delivered in planta RNAi has proved to be a pioneering phenomenon to deliver dsRNAs to feeding nematodes and silence the target genes to achieve resistance. Highly enriched genomic databases are exploited to limit off target effects and ensure sequence specific silencing. Technological advances like gene stacking and use of nematode inducible and tissue specific promoters can further enhance the utility of RNAi based transgenics against plant parasitic nematodes.
Small RNA Transfection in Primary Human Th17 Cells by Next Generation Electroporation.
Montoya, Misty M; Ansel, K Mark
2017-04-13
CD4 + T cells can differentiate into several subsets of effector T helper cells depending on the surrounding cytokine milieu. Th17 cells can be generated from naïve CD4 + T cells in vitro by activating them in the presence of the polarizing cytokines IL-1β, IL-6, IL-23, and TGFβ. Th17 cells orchestrate immunity against extracellular bacteria and fungi, but their aberrant activity has also been associated with several autoimmune and inflammatory diseases. Th17 cells are identified by the chemokine receptor CCR6 and defined by their master transcription factor, RORγt, and characteristic effector cytokine, IL-17A. Optimized culture conditions for Th17 cell differentiation facilitate mechanistic studies of human T cell biology in a controlled environment. They also provide a setting for studying the importance of specific genes and gene expression programs through RNA interference or the introduction of microRNA (miRNA) mimics or inhibitors. This protocol provides an easy to use, reproducible, and highly efficient method for transient transfection of differentiating primary human Th17 cells with small RNAs using a next generation electroporation device.
Meliopoulos, Victoria A.; Andersen, Lauren E.; Birrer, Katherine F.; Simpson, Kaylene J.; Lowenthal, John W.; Bean, Andrew G. D.; Stambas, John; Stewart, Cameron R.; Tompkins, S. Mark; van Beusechem, Victor W.; Fraser, Iain; Mhlanga, Musa; Barichievy, Samantha; Smith, Queta; Leake, Devin; Karpilow, Jon; Buck, Amy; Jona, Ghil; Tripp, Ralph A.
2012-01-01
Influenza virus encodes only 11 viral proteins but replicates in a broad range of avian and mammalian species by exploiting host cell functions. Genome-wide RNA interference (RNAi) has proven to be a powerful tool for identifying the host molecules that participate in each step of virus replication. Meta-analysis of findings from genome-wide RNAi screens has shown influenza virus to be dependent on functional nodes in host cell pathways, requiring a wide variety of molecules and cellular proteins for replication. Because rapid evolution of the influenza A viruses persistently complicates the effectiveness of vaccines and therapeutics, a further understanding of the complex host cell pathways coopted by influenza virus for replication may provide new targets and strategies for antiviral therapy. RNAi genome screening technologies together with bioinformatics can provide the ability to rapidly identify specific host factors involved in resistance and susceptibility to influenza virus, allowing for novel disease intervention strategies.—Meliopoulos, V. A., Andersen, L. E., Birrer, K. F., Simpson, K. J., Lowenthal, J. W., Bean, A. G. D., Stambas, J., Stewart, C. R., Tompkins, S. M., van Beusechem, V. W., Fraser, I., Mhlanga, M., Barichievy, S., Smith, Q., Leake, D., Karpilow, J., Buck, A., Jona, G., Tripp, R. A. Host gene targets for novel influenza therapies elucidated by high-throughput RNA interference screens. PMID:22247330
Lin, Fang-ju; Yang, Xiao-su; Yang, De; Zou, Yan-qun
2013-05-21
To explore the possible roles of KCC2 and NKCC1 in the pathological mechanism of acute insomnia in rats. A total of 18 Sprague-Dawley rats were randomly selected into model, interference and normal control groups.The expressions of KCC2 and NKCC1 in brainstem were detected by reverse transcription-polymerase chain reaction (RT-PCR) and Western blot.The concentration of intracellular Cl(-) ([Cl(-)]i) in brainstem was detected by fluorescence probe MQAE with laser confocal microscopy. (1) Comparing with the control group, both KCC2 mRNA and protein expression were down-regulated in the model and interference groups (mRNA:0.196 ± 0.021 vs 0.939 ± 0.109, P < 0.05; 0.485 ± 0.026 vs 0.939 ± 0.109, P < 0.05; protein expression:0.363 ± 0.058 vs 0.967 ± 0.155, P < 0.05; 0.663 ± 0.106 vs 0.967 ± 0.155, P < 0.05).However they became up-regulated in the interference group versus the model group (mRNA: 0.485 ± 0.026 vs 0.196 ± 0.021, P < 0.05; protein expression:0.663 ± 0.106 vs 0.363 ± 0.058, P < 0.05). (2) Comparing with the control group, both NKCC1 mRNA and protein expression in the model group were slightly up-regulated.But statistical difference was insignificant (mRNA: 0.344 ± 0.026 vs 0.320 ± 0.019, P > 0.05; protein expression:0.244 ± 0.010 vs 0.230 ± 0.021, P > 0.05).There was down-regulation in the interference group versus the model and control groups (mRNA: 0.066 ± 0.031 vs 0.320 ± 0.019, P < 0.05; 0.066 ± 0.031 vs 0.344 ± 0.026, P < 0.05; protein expression:0.131 ± 0.012 vs 0.230 ± 0.021, P < 0.05; 0.131 ± 0.012 vs 0.244 ± 0.010, P < 0.05). (3) Comparing with the control group, [Cl(-)]i became up-regulated in the model group (0.0315 ± 0.0039 vs 0.0164 ± 0.0019, P < 0.05).It was down-regulated in the interference group versus the model group (0.0182 ± 0.0013 vs 0.0315 ± 0.0039, P < 0.05), but higher than control group without statistical difference (0.0182 ± 0.0013 vs 0.0164 ± 0.0019, P > 0.05). The down-regulation of KCC2 and rise of [Cl(-)]i in brainstem may participate in the pathological mechanism of acute insomnia in rats. And the mechanism of sedative-hypnotic diazepam may be operate through an up-regulation of KCC2, a down-regulation of NKCC1 and decreased [Cl(-)]i.
Bellissimo, Teresa; Masciarelli, Silvia; Poser, Elena; Genovese, Ilaria; Del Rio, Alberto; Colotti, Gianni; Fazi, Francesco
2017-01-01
The development of small-molecule-based target therapy design for human disease and cancer is object of growing attention. Recently, specific microRNA (miRNA) mimicking compounds able to bind the miRNA-binding domain of Argonaute 2 protein (AGO2) to inhibit miRNA loading and its functional activity were described. Computer-aided molecular design techniques and RNA immunoprecipitation represent suitable approaches to identify and experimentally determine if a compound is able to impair the loading of miRNAs on AGO2 protein. Here, we describe these two methodologies that we recently used to select a specific compound able to interfere with the AGO2 functional activity and able to improve the retinoic acid-dependent myeloid differentiation of leukemic cells.
A-to-I editing of coding and non-coding RNAs by ADARs
Nishikura, Kazuko
2016-01-01
Adenosine deaminases acting on RNA (ADARs) convert adenosine to inosine in double-stranded RNA. This A-to-I editing occurs not only in protein-coding regions of mRNAs, but also frequently in non-coding regions that contain inverted Alu repeats. Editing of coding sequences can result in the expression of functionally altered proteins that are not encoded in the genome, whereas the significance of Alu editing remains largely unknown. Certain microRNA (miRNA) precursors are also edited, leading to reduced expression or altered function of mature miRNAs. Conversely, recent studies indicate that ADAR1 forms a complex with Dicer to promote miRNA processing, revealing a new function of ADAR1 in the regulation of RNA interference. PMID:26648264
Delivery of RNA interference therapeutics using polycation-based nanoparticles.
Howard, Kenneth Alan
2009-07-25
RNAi-based therapies are dependent on extracellular and intracellular delivery of RNA molecules for enabling target interaction. Polycation-based nanoparticles (or polyplexes) formed by self-assembly with RNA can be used to modulate pharmacokinetics and intracellular trafficking to improve the therapeutic efficacy of RNAi-based therapeutics. This review describes the application of polyplexes for extracellular and intracellular delivery of synthetic RNA molecules. Focus is given to routes of administration and silencing effects in animal disease models. The inclusion of functional components into the nanoparticle for controlling cellular trafficking and RNA release is discussed. This work highlights the versatile nature of polycation-based nanoparticles to fulfil the delivery requirements for RNA molecules with flexibility in design to evolve alongside an expanding repertoire of RNAi-based drugs.
Musiyenko, Alla; Bitko, Vira; Barik, Sailen
2007-07-01
Stable RNA interference (RNAi) is commonly achieved by recombinant expression of short hairpin RNA (shRNA). To generate virus-resistant cell lines, we cloned a shRNA cassette against the phosphoprotein gene of respiratory syncytial virus (RSV) into a polIII-driven plasmid vector. Analysis of individual stable transfectants showed a spectrum of RSV resistance correlating with the levels of shRNA expressed from different chromosomal locations. Interestingly, resistance in a minority of clones was due to mono-allelic disruption of the cellular gene for vasodilator-stimulated phosphoprotein (VASP). Thus, pure clones of chromosomally integrated DNA-directed RNAi can exhibit gene disruption phenotypes resembling but unrelated to RNAi.
C3PO, an endoribonuclease that promotes RNAi by facilitating RISC activation.
Liu, Ying; Ye, Xuecheng; Jiang, Feng; Liang, Chunyang; Chen, Dongmei; Peng, Junmin; Kinch, Lisa N; Grishin, Nick V; Liu, Qinghua
2009-08-07
The catalytic engine of RNA interference (RNAi) is the RNA-induced silencing complex (RISC), wherein the endoribonuclease Argonaute and single-stranded small interfering RNA (siRNA) direct target mRNA cleavage. We reconstituted long double-stranded RNA- and duplex siRNA-initiated RISC activities with the use of recombinant Drosophila Dicer-2, R2D2, and Ago2 proteins. We used this core reconstitution system to purify an RNAi regulator that we term C3PO (component 3 promoter of RISC), a complex of Translin and Trax. C3PO is a Mg2+-dependent endoribonuclease that promotes RISC activation by removing siRNA passenger strand cleavage products. These studies establish an in vitro RNAi reconstitution system and identify C3PO as a key activator of the core RNAi machinery.
Chen, Qing; Rehman, S; Smant, G; Jones, John T
2005-07-01
RNA interference (RNAi) has been used widely as a tool for examining gene function and a method that allows its use with plant-parasitic nematodes recently has been described. Here, we use a modified method to analyze the function of secreted beta-1,4, endoglucanases of the potato cyst nematode Globodera rostochiensis, the first in vivo functional analysis of a pathogenicity protein of a plant-parasitic nematode. Knockout of the beta-1,4, endoglucanases reduced the ability of the nematodes to invade roots. We also use RNAi to show that gr-ams-1, a secreted protein of the main sense organs (the amphids), is essential for host location.
Luan, Ying; Dai, Hai-Li; Yang, Dan; Zhu, Lin; Gao, Tie-Lei; Shao, Hong-Jiang; Peng, Xue; Jin, Zhan-Feng
2012-01-01
Coxsackievirus B3 (CVB3) is the most important causal agent of viral heart muscle disease, but no specific antiviral drug is currently available. Small interfering RNA (siRNA) has been used as an antiviral therapeutic strategy via posttranscriptional gene silencing. In this study, eleven siRNAs were designed to target seven distinct regions of the CVB3 genome including VP1, VP2, VP3, 2A, 2C, 3C, and 3D. All of the siRNAs were individually transfected into HeLa cells, which were subsequently infected with CVB3. The impacts of RNA interference (RNAi) on viral replication were evaluated using five measures: cytopathic effect (CPE), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, 50% tissue culture infectious dose (TCID(50)), real-time RT-PCR, and Western blot. Five of the eleven siRNAs were highly efficient at inhibiting viral replication. This was especially true for siRNA-5, which targeted the ATPase 2C. However, antiviral activity varied significantly among siRNA-9, -10, and -11 even though that they all targeted the 3D region. Our results revealed several effective targets for CVB3 silencing, and provided evidence that sequences except CRE within the 2C region may also be potential targets for CVB3-specific siRNAs design. These data supported a potential role of RNA interference in future antiviral intervention therapies. Copyright © 2011 Elsevier B.V. All rights reserved.
Induction and suppression of antiviral RNA interference by influenza A virus in mammalian cells.
Li, Yang; Basavappa, Megha; Lu, Jinfeng; Dong, Shuwei; Cronkite, D Alexander; Prior, John T; Reinecker, Hans-Christian; Hertzog, Paul; Han, Yanhong; Li, Wan-Xiang; Cheloufi, Sihem; Karginov, Fedor V; Ding, Shou-Wei; Jeffrey, Kate L
2016-12-05
Influenza A virus (IAV) causes annual epidemics and occasional pandemics, and is one of the best-characterized human RNA viral pathogens 1 . However, a physiologically relevant role for the RNA interference (RNAi) suppressor activity of the IAV non-structural protein 1 (NS1), reported over a decade ago 2 , remains unknown 3 . Plant and insect viruses have evolved diverse virulence proteins to suppress RNAi as their hosts produce virus-derived small interfering RNAs (siRNAs) that direct specific antiviral defence 4-7 by an RNAi mechanism dependent on the slicing activity of Argonaute proteins (AGOs) 8,9 . Recent studies have documented induction and suppression of antiviral RNAi in mouse embryonic stem cells and suckling mice 10,11 . However, it is still under debate whether infection by IAV or any other RNA virus that infects humans induces and/or suppresses antiviral RNAi in mature mammalian somatic cells 12-21 . Here, we demonstrate that mature human somatic cells produce abundant virus-derived siRNAs co-immunoprecipitated with AGOs in response to IAV infection. We show that the biogenesis of viral siRNAs from IAV double-stranded RNA (dsRNA) precursors in infected cells is mediated by wild-type human Dicer and potently suppressed by both NS1 of IAV as well as virion protein 35 (VP35) of Ebola and Marburg filoviruses. We further demonstrate that the slicing catalytic activity of AGO2 inhibits IAV and other RNA viruses in mature mammalian cells, in an interferon-independent fashion. Altogether, our work shows that IAV infection induces and suppresses antiviral RNAi in differentiated mammalian somatic cells.
Chen, Y; Redinbaugh, M G; Michel, A P
2015-06-01
Graminella nigrifrons is the only known vector for Maize fine streak virus (MFSV). In this study, we used real-time quantitative PCR to compare the expression profiles of transcripts that putatively function in the insect immune response: four peptidoglycan recognition proteins (PGRP-SB1, -SD, -LC and LB), Toll, spaetzle, defensin, Dicer-2 (Dcr-2), Argonaut-2 (Ago-2) and Arsenic resistance protein 2 (Ars-2). Except for PGRP-LB and defensin, transcripts involved in humoral pathways were significantly suppressed in G. nigrifrons fed on MFSV-infected maize. The abundance of three RNA interference (RNAi) pathway transcripts (Dcr-2, Ago-2, Ars-2) was significantly lower in nontransmitting relative to transmitting G. nigrifrons. Injection with double-stranded RNA (dsRNA) encoding segments of the PGRP-LC and Dcr-2 transcripts effectively reduced transcript levels by 90 and 75% over 14 and 22 days, respectively. MFSV acquisition and transmission were not significantly affected by injection of either dsRNA. Knock-down of PGRP-LC resulted in significant mortality (greater than 90%) at 27 days postinjection, and resulted in more abnormal moults relative to those injected with Dcr-2 or control dsRNA. The use of RNAi to silence G. nigrifrons transcripts will facilitate the study of gene function and pathogen transmission, and may provide approaches for developing novel targets of RNAi-based pest control. © 2015 The Royal Entomological Society.
Xu, Xiao-Tao; Tao, Ze-Zhang; Song, Qi-Bin; Yao, Yi; Ruan, Peng
2012-09-01
In order to investigate the effects of RNA interference of decoy receptor 3 (DcR3) on the sensitivity of gastric cancer cells to 5-fluorouracil (5-FU) and the relevant mechanisms, siRNA against DcR3 was transfected into the gastric cancer cell line AGS. AGS cells were treated with different doses of 5-FU or for different time periods. The sensitivity of AGS cells to 5-FU was determined. The cell survival rate was detected by MTT assay. The apoptotic rate was determined by DAPI staining, and the expression of related proteins were detected by western blot analysis. The results showed that the cell survival rate was significanlty decreased in the knockdown group compared to the control group at different doses of 5-FU (P<0.01). After different time periods of treatment with 5-FU, the cell survival rate in the knockdown group was significantly decreased compared to the control group, respectively (P<0.01). The apoptotic rate of AGS cells in the knockdown group was increased along with the increasing dose of siRNA. The siRNA against DcR3 enhanced the expression of Fas, FasL, caspase-3 and caspase-8. In conclusion, knockdown of DcR3 by RNA interference enhances apoptosis and inhibits the growth of gastric cancer cells. Downregulation of DcR3 enhances the sensitivity of gastric cancer cells to 5-FU and increased the expression of Fas, FasL and caspase-3/8.
Goswami, Suneha; Sahana, Nandita; Pandey, Vanita; Doblas, Paula; Jain, R K; Palukaitis, Peter; Canto, Tomas; Praveen, Shelly
2012-01-01
Groundnut bud necrosis virus (GBNV) infects a large number of leguminous and solanaceous plants. To elucidate the biological function of the non-structural protein encoded by the S RNA of GBNV (NSs), we studied its role in RNA silencing suppression and in viral pathogenesis. Our results demonstrated that GBNV NSs functions as a suppressor of RNA silencing using the agroinfiltration patch assay. An in silico analysis suggested the presence of pro-apoptotic protein Reaper-like sequences in the GBNV NSs, which were known to be present in animal infecting bunyaviruses. Utilizing NSs mutants, we demonstrated that a Leu-rich domain was required for RNA silencing suppression activity, but not the non-overlapping Trp/GH3 motif of the Reaper-like sequence. To investigate the role of NSs in symptom development we generated transgenic tomato expressing the GBNV NSs and showed that the expression of NSs in tomato mimics symptoms induced by infection with GBNV, such as leaf senescence and necrosis. As leaf senescence is controlled by miR319 regulation of the transcription factor TCP1, we assessed the accumulation of both RNAs in transgenic NSs-expressing and GBNV-infected tomato plants. In both types of plants the levels of miR319 decreased, while the levels of TCP1 transcripts increased. We propose that GBNV-NSs affects miRNA biogenesis through its RNA silencing suppressor activity and interferes with TCP1-regulated leaf developmental pathways. Copyright © 2011 Elsevier B.V. All rights reserved.
Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome
NASA Astrophysics Data System (ADS)
Lu, Rui; Folimonov, Alexey; Shintaku, Michael; Li, Wan-Xiang; Falk, Bryce W.; Dawson, William O.; Ding, Shou-Wei
2004-11-01
Viral infection in both plant and invertebrate hosts requires a virus-encoded function to block the RNA silencing antiviral defense. Here, we report the identification and characterization of three distinct suppressors of RNA silencing encoded by the 20-kb plus-strand RNA genome of citrus tristeza virus (CTV). When introduced by genetic crosses into plants carrying a silencing transgene, both p20 and p23, but not coat protein (CP), restored expression of the transgene. Although none of the CTV proteins prevented DNA methylation of the transgene, export of the silencing signal (capable of mediating intercellular silencing spread) was detected only from the F1 plants expressing p23 and not from the CP- or p20-expressing F1 plants, demonstrating suppression of intercellular silencing by CP and p20 but not by p23. Thus, intracellular and intercellular silencing are each targeted by a CTV protein, whereas the third, p20, inhibits silencing at both levels. Notably, CP suppresses intercellular silencing without interfering with intracellular silencing. The novel property of CP suggests a mechanism distinct to p20 and all of the other viral suppressors known to interfere with intercellular silencing and that this class of viral suppressors may not be consistently identified by Agrobacterium coinfiltration because it also induces RNA silencing against the infiltrated suppressor transgene. Our analyses reveal a sophisticated viral counter-defense strategy that targets the silencing antiviral pathway at multiple steps and may be essential for protecting CTV with such a large RNA genome from antiviral silencing in the perennial tree host. RNA interference | citrus tristeza virus | virus synergy | antiviral immunity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Merritt, William M.; Lin, Yvonne G.; Han, Liz Y.
2008-05-06
The clinical and functional significance of RNA interference (RNAi) machinery, Dicer and Drosha, in ovarian cancer is not known and was examined. Dicer and Drosha expression was measured in ovarian cancer cell lines (n=8) and invasive epithelial ovarian cancer specimens (n=111) and correlated with clinical outcome. Validation was performed with previously published cohorts of ovarian, breast, and lung cancer patients. Anti-Galectin-3 siRNA and shRNA transfections were used for in vitro functional studies. Dicer and Drosha mRNA and protein levels were decreased in 37% to 63% of ovarian cancer cell lines and in 60% and 51% of human ovarian cancer specimens,more » respectively. Low Dicer was significantly associated with advanced tumor stage (p=0.007), and low Drosha with suboptimal surgical cytoreduction (p=0.02). Tumors with both high Dicer and Drosha were associated with increased median patient survival (>11 years vs. 2.66 years for other groups; p<0.001). In multivariate analysis, high Dicer (HR=0.48; p=0.02), high-grade histology (HR=2.46; p=0.03), and poor chemoresponse (HR=3.95; p<0.001) were identified as independent predictors of disease-specific survival. Findings of poor clinical outcome with low Dicer expression were validated in separate cohorts of cancer patients. Galectin-3 silencing with siRNA transfection was superior to shRNA in cell lines with low Dicer (78-95% vs. 4-8% compared to non-targeting sequences), and similar in cell lines with high Dicer. Our findings demonstrate the clinical and functional impact of RNAi machinery alterations in ovarian carcinoma and support the use of siRNA constructs that do not require endogenous Dicer and Drosha for therapeutic applications.« less
HIV-1 RNAs are Not Part of the Argonaute 2 Associated RNA Interference Pathway in Macrophages.
Vongrad, Valentina; Imig, Jochen; Mohammadi, Pejman; Kishore, Shivendra; Jaskiewicz, Lukasz; Hall, Jonathan; Günthard, Huldrych F; Beerenwinkel, Niko; Metzner, Karin J
2015-01-01
MiRNAs and other small noncoding RNAs (sncRNAs) are key players in post-transcriptional gene regulation. HIV-1 derived small noncoding RNAs (sncRNAs) have been described in HIV-1 infected cells, but their biological functions still remain to be elucidated. Here, we approached the question whether viral sncRNAs may play a role in the RNA interference (RNAi) pathway or whether viral mRNAs are targeted by cellular miRNAs in human monocyte derived macrophages (MDM). The incorporation of viral sncRNAs and/or their target RNAs into RNA-induced silencing complex was investigated using photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) as well as high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation (HITS-CLIP), which capture Argonaute2-bound miRNAs and their target RNAs. HIV-1 infected monocyte-derived macrophages (MDM) were chosen as target cells, as they have previously been shown to express HIV-1 sncRNAs. In addition, we applied small RNA deep sequencing to study differential cellular miRNA expression in HIV-1 infected versus non-infected MDMs. PAR-CLIP and HITS-CLIP data demonstrated the absence of HIV-1 RNAs in Ago2-RISC, although the presence of a multitude of HIV-1 sncRNAs in HIV-1 infected MDMs was confirmed by small RNA sequencing. Small RNA sequencing revealed that 1.4% of all sncRNAs were of HIV-1 origin. However, neither HIV-1 derived sncRNAs nor putative HIV-1 target sequences incorporated into Ago2-RISC were identified suggesting that HIV-1 sncRNAs are not involved in the canonical RNAi pathway nor is HIV-1 targeted by this pathway in HIV-1 infected macrophages.
Kishk, Abdelaziz; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Gowda, Siddarame; Killiny, Nabil
2017-03-01
Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is an important pest of citrus. In addition, D. citri is the vector of Huanglongbing, a destructive disease in citrus, also known as citrus greening disease caused by Candidatus Liberibacter asiaticus. Huanglongbing causes huge losses for citrus industries. Insecticide application for D. citri is the major strategy to prevent disease spread. The heavy use of insecticides causes development of insecticide resistance. We used RNA interference (RNAi) to silence genes implicated in pesticide resistance in order to increase the susceptibility. The activity of dsRNA to reduce the expression of carboxyesterases including esterases FE4 (EstFE4) and acetylcholinesterases (AChe) in D. citri was investigated. The dsRNA was applied topically to the fourth and fifth instars of nymphs. We targeted several EstFE4 and AChe genes using dsRNA against a consensus sequence for each of them. Five concentrations (25, 50, 75, 100, 125 ng/μl) from both dsRNAs were used. The treatments with the dsRNA caused concentration dependent nymph mortality. The highest gene expression levels of both AChe and EstFE4 were found in the fourth and fifth nymphal instars. Gene expression analysis showed that AChe genes were downregulated in emerged adults from dsRNA-AChe-treated nymphs compared to controls. However, EstFE4 genes were not affected. In the same manner, treatment with dsRNA-EstFE4 reduced expression level of EstFE4 genes in emerged adults from treated nymphs, but did not affect the expression of AChe genes. In the era of environmentally friendly control strategies, RNAi is a new promising venue to reduce pesticide applications. © 2017 Wiley Periodicals, Inc.
Wang, Qi; Wang, Shuai; Sun, Si-Qiao; Cheng, Zhi-Hua; Zhang, Yang; Chen, Guang; Gu, Meng; Yao, Hai-Jun; Wang, Zhong; Zhou, Juan; Peng, Yu-Bing; Xu, Ming-Xi; Zhang, Ke; Sun, Xi-Wei
2016-01-01
This study was to explore the effects of RNA interference mediated vascular endothelial growth factor (VEGF) gene silencing on biological behavior of renal cell carcinoma (RCC), transplanted renal tumor and angiogenesis in nude mice. The specific siRNA sequence targeting VEGF were designed and synthesized to construct hVEGF-siRNA plasmid which was transfected into RCC 786-O cells. Reverse transcriptase-polymerase chain reaction (RT-PCR) was used for the detection of VEGF gene expression and western blot was adopted for the examination of VEGF protein expression. The 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used to detect cell growth as well as cell migration and invasion. The transplanted renal tumor models in nude mice were established, and the growth condition of nude mice, and VEGF protein expression in transplanted tumor slices and the microvessel density (MVD) were detected. The expression level of VEGF mRNA in VEGF-siRNA group was significant lower than that in the control group and negative group, suggesting that establishment of plasmid specifically inhibited the expression of VEGF gene The expression level of VEGF protein in VEGF-siRNA group was significant lower than that in the control group and negative group. VEGF gene silencing has the significant inhibition effects on proliferation, migration and invasion of RCC 786-O cells. The tumor weight, VEGF protein positive rate and MVD in VEGF-siRNA group were significant lower than those in negative group and blank group. The VEGF gene silencing could inhibit the cell proliferation, migration and invasion of RCC 786-O cells; inhibition of VEGF protein expression could prevent transplanted RCC growth and tumor angiogenesis.
Interference of transcription across H-NS binding sites and repression by H-NS.
Rangarajan, Aathmaja Anandhi; Schnetz, Karin
2018-05-01
Nucleoid-associated protein H-NS represses transcription by forming extended DNA-H-NS complexes. Repression by H-NS operates mostly at the level of transcription initiation. Less is known about how DNA-H-NS complexes interfere with transcription elongation. In vitro H-NS has been shown to enhance RNA polymerase pausing and to promote Rho-dependent termination, while in vivo inhibition of Rho resulted in a decrease of the genome occupancy by H-NS. Here we show that transcription directed across H-NS binding regions relieves H-NS (and H-NS/StpA) mediated repression of promoters in these regions. Further, we observed a correlation of transcription across the H-NS-bound region and de-repression. The data suggest that the transcribing RNA polymerase is able to remodel the H-NS complex and/or dislodge H-NS from the DNA and thus relieve repression. Such an interference of transcription and H-NS mediated repression may imply that poorly transcribed AT-rich loci are prone to be repressed by H-NS, while efficiently transcribed loci escape repression. © 2018 John Wiley & Sons Ltd.
An in vivo and in silico approach to study cis-antisense: a short cut to higher order response
NASA Astrophysics Data System (ADS)
Courtney, Colleen; Varanasi, Usha; Chatterjee, Anushree
2014-03-01
Antisense interactions are present in all domains of life. Typically sense, antisense RNA pairs originate from overlapping genes with convergent face to face promoters, and are speculated to be involved in gene regulation. Recent studies indicate the role of transcriptional interference (TI) in regulating expression of genes in convergent orientation. Modeling antisense, TI gene regulation mechanisms allows us to understand how organisms control gene expression. We present a modeling and experimental framework to understand convergent transcription that combines the effects of transcriptional interference and cis-antisense regulation. Our model shows that combining transcriptional interference and antisense RNA interaction adds multiple-levels of regulation which affords a highly tunable biological output, ranging from first order response to complex higher-order response. To study this system we created a library of experimental constructs with engineered TI and antisense interaction by using face-to-face inducible promoters separated by carefully tailored overlapping DNA sequences to control expression of a set of fluorescent reporter proteins. Studying this gene expression mechanism allows for an understanding of higher order behavior of gene expression networks.
RNA Interference in Insect Vectors for Plant Viruses.
Kanakala, Surapathrudu; Ghanim, Murad
2016-12-12
Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists.
RNA Interference in Insect Vectors for Plant Viruses
Kanakala, Surapathrudu; Ghanim, Murad
2016-01-01
Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists. PMID:27973446
Han, Wei; Zhou, Jingshi; Li, Xiao; Wang, Jianfeng; Li, Junjie; Zhang, Zhuochao; Yang, Zhaoxu; Wang, Desheng; Tao, Kaishan; Dou, Kefeng
2013-11-01
Pig organs are commonly used in xenotransplantation, and α-1,3-galactose has been shown to be the main cause of hyperacute rejection. The development of transgenic pigs that lack α-1,3-galactosyltransferase (GGTA1) has overcome this problem to a certain extent, but transgenic pigs are difficult to maintain, making their usefulness in basic research limited. For this reason, we propose to establish a cell model to study hyperacute rejection. Immortalized primary porcine aortic endothelial cells were transfected with a short hairpin RNA targeted to GGTA1. Cell proliferation, apoptosis, complement C3 activation, and the binding of human immunoglobulins and components of the complement system, including IgM, IgG, C3, and C5b-9, were examined. After RNA interference, GGTA1 was found to be reduced at both the transcript and protein level as assessed by quantitative polymerase chain reaction and flow cytometry, respectively. When cultured in the presence of human serum, the proliferation rate of the transfected cells was higher than that of untransfected cells, and the apoptosis rate was lower. Additionally, activation of C3 and the binding of human immunoglobulins IgM and IgG and complement component C3 and C5b-9 to the transfected cells were lower than in the immortalized group but higher than in untransfected cells. RNA interference of GGTA1 in cultured porcine endothelial cells reduces the reaction of immunoglobulin and complement system with the cells. Therefore, this in vitro cell model could be useful for further study of xenotransplantation. Copyright © 2013 Elsevier Inc. All rights reserved.
Valdor, Markus; Wagner, Anke; Röhrs, Viola; Berg, Johanna; Fechner, Henry; Schröder, Wolfgang; Tzschentke, Thomas M; Bahrenberg, Gregor; Christoph, Thomas; Kurreck, Jens
2018-01-01
Activation of the neuronal potassium channel Kv7.2 encoded by the KCNQ2 gene has recently been shown to be an attractive mechanism to inhibit nociceptive transmission. However, potent, selective, and clinically proven activators of Kv7.2/Kv7.3 currents with analgesic properties are still lacking. An important prerequisite for the development of new drugs is a model to test the selectivity of novel agonists by abrogating Kv7.2/Kv7.3 function. Since constitutive knockout mice are not viable, we developed a model based on RNA interference-mediated silencing of KCNQ2. By delivery of a KCNQ2-specific short hairpin RNA with adeno-associated virus vectors, we completely abolished the activity of the specific Kv7.2/Kv7.3-opener ICA-27243 in rat sensory neurons. Results obtained in the silencing experiments were consistent between freshly prepared and cryopreserved dorsal root ganglion neurons, as well as in dorsal root ganglion neurons dissociated and cultured after in vivo administration of the silencing vector by intrathecal injections into rats. Interestingly, the tested associated virus serotypes substantially differed with respect to their transduction capability in cultured neuronal cell lines and primary dorsal root ganglion neurons and the in vivo transfer of transgenes by intrathecal injection of associated virus vectors. However, our study provides the proof-of-concept that RNA interference-mediated silencing of KCNQ2 is a suitable approach to create an ex vivo model for testing the specificity of novel Kv7.2/Kv7.3 agonists.
Diederichs, Sven; Haber, Daniel A
2007-12-14
MicroRNAs are small endogenous noncoding RNAs involved in posttranscriptional gene regulation. During microRNA biogenesis, Drosha and Dicer process the primary transcript (pri-miRNA) through a precursor hairpin (pre-miRNA) to the mature miRNA. The miRNA is incorporated into the RNA-Induced Silencing Complex (RISC) with Argonaute proteins, the effector molecules in RNA interference (RNAi). Here, we show that all Argonautes elevate mature miRNA expression posttranscriptionally, independent of RNase activity. Also, we identify a role for the RISC slicer Argonaute2 (Ago2) in cleaving the pre-miRNA to an additional processing intermediate, termed Ago2-cleaved precursor miRNA or ac-pre-miRNA. This endogenous, on-pathway intermediate results from cleavage of the pre-miRNA hairpin 12 nucleotides from its 3'-end. By analogy to siRNA processing, Ago2 cleavage may facilitate removal of the nicked passenger strand from RISC after maturation. The multiple roles of Argonautes in the RNAi effector phase and miRNA biogenesis and maturation suggest coordinate regulation of microRNA expression and function.
dsRNA binding properties of RDE-4 and TRBP reflect their distinct roles in RNAi.
Parker, Greg S; Maity, Tuhin Subhra; Bass, Brenda L
2008-12-26
Double-stranded RNA (dsRNA)-binding proteins facilitate Dicer functions in RNA interference. Caenorhabditis elegans RDE-4 facilitates cleavage of long dsRNA to small interfering RNA (siRNA), while human trans-activation response RNA-binding protein (TRBP) functions downstream to pass siRNA to the RNA-induced silencing complex. We show that these distinct in vivo roles are reflected in in vitro binding properties. RDE-4 preferentially binds long dsRNA, while TRBP binds siRNA with an affinity that is independent of dsRNA length. These properties are mechanistically based on the fact that RDE-4 binds cooperatively, via contributions from multiple domains, while TRBP binds noncooperatively. Our studies offer a paradigm for how dsRNA-binding proteins, which are not sequence specific, discern dsRNA length. Additionally, analyses of the ability of RDE-4 deletion constructs and RDE-4/TRBP chimeras to reconstitute Dicer activity suggest RDE-4 promotes activity using its dsRNA-binding motif 2 to bind dsRNA, its linker region to interact with Dicer, and its C-terminus for Dicer activation.
Tsuji, A; Sato, Y; Hirano, M; Suga, T; Koshimoto, H; Taguchi, T; Ohsuka, S
2001-01-01
We previously showed that a specific kind of mRNA (c-fos) was detected in a living cell under a microscope by introducing two fluorescently labeled oligodeoxynucleotides, each labeled with donor or acceptor, into the cytoplasm, making them hybridize to adjacent locations on c-fos mRNA, and taking images of fluorescence resonance energy transfer (FRET) (A. Tsuji, H. Koshimoto, Y. Sato, M. Hirano. Y. Sei-Iida, S. Kondo, and K. Ishibashi, 2000, Biophys. J. 78:3260-3274). On the formed hybrid, the distance between donor and acceptor becomes close and FRET occurs. To observe small numbers of mRNA in living cells using this method, it is required that FRET fluorescence of hybrid must be distinguished from fluorescence of excess amounts of non-hybridizing probes and from cell autofluorescence. To meet these requirements, we developed a time-resolved method using acceptor fluorescence decays. When a combination of a donor having longer fluorescence lifetime and an acceptor having shorter lifetime is used, the measured fluorescence decays of acceptors under FRET becomes slower than the acceptor fluorescence decay with direct excitation. A combination of Bodipy493/503 and Cy5 was selected as donor and acceptor. When the formed hybrid had a configuration where the target RNA has no single-strand part between the two fluorophores, the acceptor fluorescence of hybrid had a sufficiently longer delay to detect fluorescence of hybrid in the presence of excess amounts of non-hybridizing probes. Spatial separation of 10-12 bases between two fluorophores on the hybrid is also required. The decay is also much slower than cell autofluorescence, and smaller numbers of hybrid were detected with less interference of cell autofluorescence in the cytoplasm of living cells under a time-resolved fluorescence microscope with a time-gated function equipped camera. The present method will be useful when observing induced expressions of mRNA in living cells. PMID:11423432
Silencing the myotrophin gene by RNA interference leads to the regression of cardiac hypertrophy.
Gupta, Sudhiranjan; Maitra, Ratan; Young, Dave; Gupta, Anasuya; Sen, Subha
2009-08-01
Myotrophin-induced activation of NF-kappaB has been shown to be associated with cardiac hypertrophy (CH) that progresses to heart failure (HF). In the present study, we examined the cause-and-effect relationship between myotrophin and NF-kappaB activation using small hairpin RNA (shRNA) against myotrophin both in vitro (using neonatal rat myocytes) and in vivo [using myotrophin transgenic (Myo-Tg) mice, which overexpress myotrophin in the heart, develop CH, and gradually progress to HF]. Among several lentiviral vectors expressing myotrophin shRNAs, L-sh-109 showed the best silencing effect at both the mRNA (155.3 +/- 5.9 vs. 32.5 +/- 5.5, P < 0.001) and protein levels associated with a significant reduction of atrial natriuretic factor (ANF) and NF-kappaB. In vivo, when L-sh-109 was delivered directly into the hearts of 10-wk-old Myo-Tg mice, we observed a significant regression of cardiac mass (8.0 vs. 5.7 mg/g, P < 0.001) and myotrophin gene expression (54.5% over untreated Myo-Tg mice, P < 0.001) associated with a reduction in ANF and NF-kappaB signaling components. Our data suggest that using RNA interference to silence the myotrophin gene prevents NF-kappaB activation, associated with an attenuation of CH. This strategy could be an excellent therapeutic means for the treatment of CH and HF.
Liu, Jie-Qiong; Li, Chen-Hong; Luo, Qiong; Yin, Ping-Ping; Lei, Tao; Luo, Fang
2016-11-20
To construct a replication-deficient herpes simplex virus (HSV-1) for delivering a short hairpin RNA (shRNA) targeting vesicular glutamate transporter 3 (VGLUT3) and observe its effect in alleviating allodynia in mice. The recombinant HSV-1 vector carrying the shRNA targeting Vglut3 (HSV-1-shvglut3) was constructed and inoculated in the sciatic nerve in a mouse model of mechanical allodynia to test its analgesia effect. Mechanical allodynia and heat hypersensitivity of the mice were tested by von Frey filaments and Hargreaves' test, respectively. VGLUT3 expression in the dorsal root ganglion (DRG) was evaluated by immunohistochemistry and Western blotting. Following inoculation in the sciatic nerve, the HSV vector HSV-1-shvglut3 was retrogradely transported to the DRG. Mechanical withdraw thresholds of the mouse models receiving HSV-1-shvglut3 inoculation were reversed to nearly the baseline level, and VGLUT3 expression in the DRG was down-regulated 2 weeks after vector inoculation. The analgesic effect lasted for over 2 weeks in these mice without obvious systematic side effects or changes in heat hypersensitivity threshold. Vglut3 in the DRG is a promising therapeutic target for alleviating mechanical allodynia, and HSV-1 vector-mediated RNA interference is safe and efficient for inducing long-lasting analgesia after peripheral inoculation of the vector.
Shih, Yao-Ming; Sun, Cheng-Pu; Chou, Hui-Hsien; Wu, Tzu-Hui; Chen, Chun-Chi; Wu, Ping-Yi; Enya Chen, Yu-Chen; Bissig, Karl-Dimiter; Tao, Mi-Hua
2015-01-01
Selection of escape mutants with mutations within the target sequence could abolish the antiviral RNA interference activity. Here, we investigated the impact of a pre-existing shRNA-resistant HBV variant on the efficacy of shRNA therapy. We previously identified a highly potent shRNA, S1, which, when delivered by an adeno-associated viral vector, effectively inhibits HBV replication in HBV transgenic mice. We applied the “PICKY” software to systemically screen the HBV genome, then used hydrodynamic transfection and HBV transgenic mice to identify additional six highly potent shRNAs. Human liver chimeric mice were infected with a mixture of wild-type and T472C HBV, a S1-resistant HBV variant, and then treated with a single or combined shRNAs. The presence of T472C mutant compromised the therapeutic efficacy of S1 and resulted in replacement of serum wild-type HBV by T472C HBV. In contrast, combinatorial therapy using S1 and P28, one of six potent shRNAs, markedly reduced titers for both wild-type and T472C HBV. Interestingly, treatment with P28 alone led to the emergence of escape mutants with mutations in the P28 target region. Our results demonstrate that combinatorial RNAi therapy can minimize the escape of resistant viral mutants in chronic HBV patients. PMID:26482836
ERIC Educational Resources Information Center
Siomi, Haruhiko; Ishizuka, Akira; Siomi, Mikiko C.
2004-01-01
Fragile X syndrome is the most common heritable form of mental retardation caused by loss-of-function mutations in the "FMR1" gene. The "FMR1" gene encodes an RNA-binding protein that associates with translating ribosomes and acts as a negative translational regulator. Recent work in "Drosophila melanogaster" has shown that the fly homolog of…
Anis, Eman A; Dhar, Madhu; Legendre, Alfred M; Wilkes, Rebecca P
2017-06-01
Objectives The goals of the study were: (1) to develop and evaluate non-replicating lentivirus vectors coding for feline coronavirus (FCoV)-specific micro (mi)RNA as a potential antiviral therapy for feline infectious peritonitis (FIP); (2) to assess the feasibility of transducing hematopoietic stem cells (HSCs) with ex vivo introduction of the miRNA-expressing lentivirus vector; and (3) to assess the ability of the expressed miRNA to inhibit FCoV replication in HSCs in vitro. Methods HSCs were obtained from feline bone marrow and replicated in vitro. Three lentiviruses were constructed, each expressing a different anti-FCoV miRNA. HSCs were stably transduced with the miRNA-expressing lentivirus vector that produced the most effective viral inhibition in a feline cell line. The effectiveness of the transduction and the expression of anti-FCoV miRNA were tested by infecting the HSCs with two different strains of FCoV. The inhibition of coronavirus replication was determined by relative quantification of the inhibition of intracellular viral genomic RNA synthesis using real-time, reverse-transcription PCR. The assessment of virus replication inhibition was determined via titration of extracellular virus using the TCID 50 assay. Results Inhibition of FCoV was most significant in feline cells expressing miRNA-L2 that targeted the viral leader sequence, 48 h postinfection. miRNA-L2 expression in stably transduced HSCs resulted in 90% and 92% reductions in FIPV WSU 79-1146 genomic RNA synthesis and extracellular virus production, respectively, as well as 74% and 80% reduction in FECV WSU 79-1683 genomic RNA synthesis and extracellular virus production, respectively, as compared with an infected negative control sample producing non-targeting miRNA. Conclusions and relevance These preliminary results show that genetic modification of HSCs for constitutive production of anti-coronavirus miRNA will reduce FCoV replication.
Plant insects and mites uptake double-stranded RNA upon its exogenous application on tomato leaves.
Gogoi, Anupam; Sarmah, Nomi; Kaldis, Athanasios; Perdikis, Dionysios; Voloudakis, Andreas
2017-12-01
Exogenously applied double-stranded RNA (dsRNA) molecules onto tomato leaves, moved rapidly from local to systemic leaves and were uptaken by agricultural pests namely aphids, whiteflies and mites. Four small interfering RNAs, deriving from the applied dsRNA, were molecularly detected in plants, aphids and mites but not in whiteflies. Double-stranded RNA (dsRNA) acts as the elicitor molecule of the RNA silencing (RNA interference, RNAi), the endogenous and evolutionary conserved surveillance system present in all eukaryotes. DsRNAs and their subsequent degradation products, namely the small interfering RNAs (siRNAs), act in a sequence-specific manner to control gene expression. Exogenous application of dsRNAs onto plants elicits resistance against plant viruses. In the present work, exogenously applied dsRNA molecules, derived from Zucchini yellow mosaic virus (ZYMV) HC-Pro region, onto tomato plants were detected in aphids (Myzus persicae), whiteflies (Trialeurodes vaporariorum) and mites (Tetranychus urticae) that were fed on treated as well as systemic tomato leaves. Furthermore, four siRNAs, deriving from the dsRNA applied, were detected in tomato and the agricultural pests fed on treated tomato plants. More specifically, dsRNA was detected in agricultural pests at 3 and 10 dpt (days post treatment) in dsRNA-treated leaves and at 14 dpt in systemic leaves. In addition, using stem-loop RT-PCR, siRNAs were detected in agricultural pests at 3 and 10 dpt in aphids and mites. Surprisingly, in whiteflies carrying the applied dsRNA, siRNAs were not molecularly detected. Our results showed that, upon exogenous application of dsRNAs molecules, these moved rapidly within tomato and were uptaken by agricultural pests fed on treated tomato. As a result, this non-transgenic method has the potential to control important crop pests via RNA silencing of vital genes of the respective pests.
2011-01-01
Background Chondrosarcoma is virtually resistant to chemotherapy and radiation therapy. Survivin, the smallest member of the inhibitor of apoptosis protein family, is a critical factor for tumor progression and resistance to conventional therapeutic approaches in a wide range of malignancies. However, the role of survivin in chondrosarcoma has not been well studied. We examined the importance of survivin gene expression in chondrosarcoma and analysed its influences on proliferation, apoptosis and resistance to chemotherapy in vitro. Methods Resected chondrosarcoma specimens from which paraffin-embedded tissues could be extracted were available from 12 patients. In vitro experiments were performed in human chondrosarcoma cell lines SW1353 and Hs819.T. Immunohistochemistry, immunoblot, quantitative PCR, RNA interference, gene-overexpression and analyses of cell proliferation and apoptosis were performed. Results Expression of survivin protein was detected in all chondrosarcoma specimens analyzed, while undetectable in adult human cartilage. RNA interference targeting survivin resulted in a G2/M-arrest of the cell cycle and led to increased rates of apoptosis in chondrosarcoma cells in vitro. Overexpression of survivin resulted in pronounced resistance to doxorubicin treatment. Conclusions These findings indicate that survivin plays a role in the pathogenesis and pronounced chemoresistance of high grade chondrosarcoma. Survivin antagonizing therapeutic strategies may lead to new treatment options in unresectable and metastasized chondrosarcoma. PMID:21457573
A lentivirus-free inducible CRISPR-Cas9 system for efficient targeting of human genes.
Bisht, Kamlesh; Grill, Sherilyn; Graniel, Jacqueline; Nandakumar, Jayakrishnan
2017-08-01
CRISPR-Cas9 is a cutting-edge tool for modifying genomes. The efficacy with which Cas9 recognizes its target has revolutionized the engineering of knockouts. However this efficacy complicates the knocking out of important genes in cultured cells. Unedited cells holding a survival advantage within an edited population can confound the knockout phenotype. Here we develop a HeLa-based system that overcomes this limitation, incorporating several attractive features. First, we use Flp-recombinase to generate clones stably integrated for Cas9 and guide RNAs, eliminating the possibility of unedited cells. Second, Cas9 can be induced uniformly in the clonal cultures using doxycycline to measure the knockout phenotype. Third, two genes can be simultaneously knocked out using this approach. Finally, by not involving lentiviruses, our method is appealing to a broad research audience. Using this methodology we generated an inducible AGO2-knockout cell line showing normal RNA interference in the absence of doxycycline. Upon induction of Cas9, the AGO2 locus was cleaved, the AGO2 protein was depleted, and RNA interference was compromised. In addition to generating inducible knockouts, our technology can be adapted to improve other applications of Cas9, including transcriptional/epigenetic modulation and visualization of cellular DNA loci. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Cigarette smoking substantially alters plasma microRNA profiles in healthy subjects
DOE Office of Scientific and Technical Information (OSTI.GOV)
Takahashi, Kei; Yokota, Shin-ichi; Tatsumi, Naoyuki
Circulating microRNAs (miRNAs) are receiving attention as potential biomarkers of various diseases, including cancers, chronic obstructive pulmonary disease, and cardiovascular disease. However, it is unknown whether the levels of circulating miRNAs in a healthy subject might vary with external factors in daily life. In this study, we investigated whether cigarette smoking, a habit that has spread throughout the world and is a risk factor for various diseases, affects plasma miRNA profiles. We determined the profiles of 11 smokers and 7 non-smokers by TaqMan MicroRNA array analysis. A larger number of miRNAs were detected in smokers than in non-smokers, and themore » plasma levels of two-thirds of the detected miRNAs (43 miRNAs) were significantly higher in smokers than in non-smokers. A principal component analysis of the plasma miRNA profiles clearly separated smokers and non-smokers. Twenty-four of the miRNAs were previously reported to be potential biomarkers of disease, suggesting the possibility that smoking status might interfere with the diagnosis of disease. Interestingly, we found that quitting smoking altered the plasma miRNA profiles to resemble those of non-smokers. These results suggested that the differences in the plasma miRNA profiles between smokers and non-smokers could be attributed to cigarette smoking. In addition, we found that an acute exposure of ex-smokers to cigarette smoke (smoking one cigarette) did not cause a dramatic change in the plasma miRNA profile. In conclusion, we found that repeated cigarette smoking substantially alters the plasma miRNA profile, interfering with the diagnosis of disease or signaling potential smoking-related diseases. - Highlights: • Plasma miRNA profiles were unambiguously different between smokers and non-smokers. • Smoking status might interfere with the diagnosis of disease using plasma miRNAs. • Changes of plasma miRNA profiles may be a signal of smoking-related diseases.« less
Amorim, Rebeca Padrão; Araújo, Michelle Gasparetti Leão; Valero, Jorge; Lopes-Cendes, Iscia; Pascoal, Vinicius Davila Bitencourt; Malva, João Oliveira; da Silva Fernandes, Maria José
2017-12-01
Cell signaling mediated by P2X7 receptors (P2X7R) has been suggested to be involved in epileptogenesis, via modulation of intracellular calcium levels, excitotoxicity, activation of inflammatory cascades, and cell death, among other mechanisms. These processes have been described to be involved in pilocarpine-induced status epilepticus (SE) and contribute to hyperexcitability, resulting in spontaneous and recurrent seizures. Here, we aimed to investigate the role of P2X7R in epileptogenesis in vivo using RNA interference (RNAi) to inhibit the expression of this receptor. Small interfering RNA (siRNA) targeting P2X7R mRNA was injected into the lateral ventricles (icv) 6 h after SE. Four groups were studied: Saline-Vehicle, Saline-siRNA, Pilo-Vehicle, and Pilo-siRNA. P2X7R was quantified by western blotting and neuronal death assessed by Fluoro-Jade B histochemistry. The hippocampal volume (edema) was determined 48 h following RNAi. Behavioral parameters as latency to the appearance of spontaneous seizures and the number of seizures were determined until 60 days after the SE onset. The Saline-siRNA and Pilo-siRNA groups showed a 43 and 37% reduction, respectively, in P2X7R protein levels compared to respective vehicle groups. Neuroprotection was observed in CA1 and CA3 of the Pilo-siRNA group compared to Pilo-Vehicle. P2X7R silencing in pilocarpine group reversed the increase in the edema detected in the hilus, suprapyramidal dentate gyrus, CA1, and CA3; reduced mortality rate following SE; increased the time to onset of spontaneous seizure; and reduced the number of seizures, when compared to the Pilo-Vehicle group. Therefore, our data highlights the potential of P2X7R as a therapeutic target for the adjunct treatment of epilepsy.
Jin, Xin; Sun, Tingting; Zhao, Chuanke; Zheng, Yongxiang; Zhang, Yufan; Cai, Weijing; He, Qiuchen; Taira, Kaz; Zhang, Lihe; Zhou, Demin
2012-01-01
Strategies to regulate gene function frequently use small interfering RNAs (siRNAs) that can be made from their shRNA precursors via Dicer. However, when the duplex components of these siRNA effectors are expressed from their respective coding genes, the RNA interference (RNAi) activity is much reduced. Here, we explored the mechanisms of action of shRNA and siRNA and found the expressed siRNA, in contrast to short hairpin RNA (shRNA), exhibits strong strand antagonism, with the sense RNA negatively and unexpectedly regulating RNAi. Therefore, we altered the relative levels of strands of siRNA duplexes during their expression, increasing the level of the antisense component, reducing the level of the sense component, or both and, in this way we were able to enhance the potency of the siRNA. Such vector-delivered siRNA attacked its target effectively. These findings provide new insight into RNAi and, in particular, they demonstrate that strand antagonism is responsible for making siRNA far less potent than shRNA. PMID:22039150
Kocan, Katherine M; Manzano-Roman, Raúl; de la Fuente, José
2007-05-01
RNA interference (RNAi) has become the most powerful experimental tool for the study of gene function in ticks. Subolesin, initially called 4D8, was found to be protective against tick infestations when used as a vaccine and was shown to be highly conserved among ixodid tick species at the nucleotide and protein levels. RNAi caused systemic silencing of subolesin and demonstrated that this protein is involved in regulation of tick feeding, reproduction, and development. Recently, these results were extended to the one-host tick Rhipicephalus (Boophilus) microplus in which injection of dsRNA into replete females resulted in transovarial silencing of subolesin expression in eggs and larvae. Herein, we report transovarial silencing of subolesin by RNAi in the three-host ticks, Amblyomma americanum, Dermacentor variabilis, and Ixodes scapularis. Silencing of subolesin expression by RNAi in these tick species also affected subolesin expression in eggs and larvae. Transovarial RNAi appears to be a common mechanism in ixodid ticks and provides a simple method for the rapid characterization of tick genes involved in oviposition, embryogenesis, and larval development.
Modeling of the structure of ribosomal protein L1 from the archaeon Haloarcula marismortui
NASA Astrophysics Data System (ADS)
Nevskaya, N. A.; Kljashtorny, V. G.; Vakhrusheva, A. V.; Garber, M. B.; Nikonov, S. V.
2017-07-01
The halophilic archaeon Haloarcula marismortui proliferates in the Dead Sea at extremely high salt concentrations (higher than 3 M). This is the only archaeon, for which the crystal structure of the ribosomal 50S subunit was determined. However, the structure of the functionally important side protuberance containing the abnormally negatively charged protein L1 (HmaL1) was not visualized. Attempts to crystallize HmaL1 in the isolated state or as its complex with RNA using normal salt concentrations (≤500 mM) failed. A theoretical model of HmaL1 was built based on the structural data for homologs of the protein L1 from other organisms, and this model was refined by molecular dynamics methods. Analysis of this model showed that the protein HmaL1 can undergo aggregation due to the presence of a cluster of positive charges unique for proteins L1. This cluster is located at the RNA-protein interface, which interferes with the crystallization of HmaL1 and the binding of the latter to RNA.
[Research Progress on Antiviral Activity of Interferon-induced Transmembrane Proteins].
Chen, Yongkun; Zhu, Wenfei; Shu, Yuelong
2016-03-01
Interferon-induced Transmembrane Proteins (IFITMs) were identified through small interference RNA (siRNA) screening method in 1980s. The antiviral properties of the IFITMs were firstly discovered in 1996. Recently, its antiviral effect and mechanism have become a research hotspot. Many studies have shown that IFITM can inhibit the replication of multiple pathogenic viruses, including influenza A virus (IAV), Human Immunodeficiency Virus (HIV-1), hepatitis C virus (HCV), Ebola virus (EBOV), West Nile virus and so on. IFITMs inhibit the replication of virus in the early stage of the viral life cycle, which occurred before the release of viral genomes into the cytosol. Recent studies indicate that IFITM proteins could block viral replication by mediate viral membrane fusion. However, the mechanism is still under investigation. Here we review the discovery and characterization of the IFITM proteins, elucidate their antiviral activities and the potential mechanisms.
Designing and Testing Functional RNA Nanoparticles | Center for Cancer Research
Recent advances in nanotechnology have generated excitement that nanomaterials may provide novel approaches for the diagnosis and treatment of deadly diseases, such as cancer. However, the use of synthetic materials to generate nanoparticles can present challenges with endotoxin content, sterility, or biocompatibility. Employing biological materials may overcome these issues with RNA being particularly attractive given the clinical applications of RNA interference and the abundance of functional RNAs, including aptamers and ribozymes. RNA can form stable three-dimensional nanoparticle structures that can be decorated with other nucleic acids, small molecules, or proteins, potentially increasing local concentrations of therapeutic agents and acting synergistically when combined.
Structural insights into RNA processing by the human RISC-loading complex.
Wang, Hong-Wei; Noland, Cameron; Siridechadilok, Bunpote; Taylor, David W; Ma, Enbo; Felderer, Karin; Doudna, Jennifer A; Nogales, Eva
2009-11-01
Targeted gene silencing by RNA interference (RNAi) requires loading of a short guide RNA (small interfering RNA (siRNA) or microRNA (miRNA)) onto an Argonaute protein to form the functional center of an RNA-induced silencing complex (RISC). In humans, Argonaute2 (AGO2) assembles with the guide RNA-generating enzyme Dicer and the RNA-binding protein TRBP to form a RISC-loading complex (RLC), which is necessary for efficient transfer of nascent siRNAs and miRNAs from Dicer to AGO2. Here, using single-particle EM analysis, we show that human Dicer has an L-shaped structure. The RLC Dicer's N-terminal DExH/D domain, located in a short 'base branch', interacts with TRBP, whereas its C-terminal catalytic domains in the main body are proximal to AGO2. A model generated by docking the available atomic structures of Dicer and Argonaute homologs into the RLC reconstruction suggests a mechanism for siRNA transfer from Dicer to AGO2.
[Long non-coding RNAs in plants].
Xiaoqing, Huang; Dandan, Li; Juan, Wu
2015-04-01
Long non-coding RNAs (lncRNAs), which are longer than 200 nucleotides in length, widely exist in organisms and function in a variety of biological processes. Currently, most of lncRNAs found in plants are transcribed by RNA polymerase Ⅱ and mediate gene expression through multiple mechanisms, such as target mimicry, transcription interference, histone methylation and DNA methylation, and play important roles in flowering, male sterility, nutrition metabolism, biotic and abiotic stress and other biological processes as regulators in plants. In this review, we summarize the databases, prediction methods, and possible functions of plant lncRNAs discovered in recent years.
RNAi in the mouse: rapid and affordable gene function studies in a vertebrate system.
Rytlewski, Julie A; Beronja, Slobodan
2015-01-01
The addition of RNA interference (RNAi) to the mammalian genomic toolbox has significantly expanded our ability to use higher-order models in studies of development and disease. The mouse, in particular, has benefited most from RNAi technology. Unique combinations of RNAi vectors and delivery methods now offer a broad platform for gene silencing in transgenic mice, enabling the design of new physiologically relevant models. The era of RNAi mice has accelerated the pace of genetic study and made high-throughput screens not only feasible but also affordable. © 2014 Wiley Periodicals, Inc.
Wu, Bolin; Qiao, Qiang; Han, Xue; Jing, Hui; Zhang, Hao; Liang, Hongjian; Cheng, Wen
2016-09-01
The use of SonoVue combined with ultrasound exposure increases the transfection efficiency of short interfering RNA (siRNA). The objective of this study was to prepare targeted nanobubbles (TNB) conjugated with NET-1 siRNA and an antibody GPC3 to direct nanobubbles to hepatocellular carcinoma cells. SMMC-7721 human hepatocellular carcinoma cells were treated with six different groups. The transfection efficiency and cellular apoptosis were measured by flow cytometry. The protein and messenger RNA (mRNA) expression were measured by Western blot and quantitative real-time PCR, respectively. The migration and invasion potential of the cells were determined by Transwell analysis. The results show that US-guided siRNA-TNB transfection effectively enhanced gene silencing. In summary, siRNA-TNB may be an effective delivery vector to mediate highly effective RNA interference in tumor treatment.
Steiner, Florian A; Okihara, Kristy L; Hoogstrate, Suzanne W; Sijen, Titia; Ketting, René F
2009-02-01
RNA interference (RNAi) is a process in which double-stranded RNA is cleaved into small interfering RNAs (siRNAs) that induce the destruction of homologous single-stranded mRNAs. Argonaute proteins are essential components of this silencing process; they bind siRNAs directly and can cleave RNA targets using a conserved RNase H motif. In Caenorhabditis elegans, the Argonaute protein RDE-1 has a central role in RNAi. In animals lacking RDE-1, the introduction of double-stranded RNA does not trigger any detectable level of RNAi. Here we show that RNase H activity of RDE-1 is required only for efficient removal of the passenger strand of the siRNA duplex and not for triggering the silencing response at the target-mRNA level. These results uncouple the role of the RDE-1 RNase H activity in small RNA maturation from its role in target-mRNA silencing in vivo.
Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA
Ciganda, Martin; Williams, Noreen
2012-01-01
P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864
DOE Office of Scientific and Technical Information (OSTI.GOV)
Choubey, Amit; Nomura, Ken-ichi; Kalia, Rajiv K.
Small interfering ribonucleic acid (siRNA) molecules play a pivotal role in silencing gene expression via the RNA interference mechanism. A key limitation to the widespread implementation of siRNA therapeutics is the difficulty of delivering siRNA-based drugs to cells. Here, we examine changes in the structure and dynamics of a dipalmitoylphosphatidylcholine bilayer in the presence of a siRNA molecule and mechanical barriers to siRNA transfection in the bilayer. Our all-atom molecular dynamics simulation shows that siRNA induces a liquid crystalline-to-ripple phase transformation in the bilayer. The ripple phase consists of a major region of non-interdigitated and a minor region of interdigitatedmore » lipid molecules with an intervening kink. In the ripple phase, hydrocarbon chains of lipid molecules have large compressive stresses, which present a considerable barrier to siRNA transfection.« less
Kubota, Naoko; Nomoto, Masataka; Hwang, Gi-Wook; Watanabe, Toshihiko; Kohara, Michinori; Wakita, Takaji; Naganuma, Akira; Kuge, Shusuke
2016-01-01
AIM: To address the effect of heat-shock protein 90 (HSP90) inhibitors on the release of the hepatitis C virus (HCV), a cell culture-derived HCV (JFH1/HCVcc) from Huh-7 cells was examined. METHODS: We quantified both the intracellular and extracellular (culture medium) levels of the components (RNA and core) of JFH-1/HCVcc. The intracellular HCV RNA and core levels were determined after the JFH1/HCVcc-infected Huh-7 cells were treated with radicicol for 36 h. The extracellular HCV RNA and core protein levels were determined from the medium of the last 24 h of radicicol treatment. To determine the possible role of the HSP90 inhibitor in HCV release, we examined the effect of a combined application of low doses of the HSP90 inhibitor radicicol and the RNA replication inhibitors cyclosporin A (CsA) or interferon. Finally, we statistically examined the combined effect of radicicol and CsA using the combination index (CI) and graphical representation proposed by Chou and Talalay. RESULTS: We found that the HSP90 inhibitors had greater inhibitory effects on the HCV RNA and core protein levels measured in the medium than inside the cells. This inhibitory effect was observed in the presence of a low level of a known RNA replication inhibitor (CsA or interferon-α). Treating the cells with a combination of radicicol and cyclosporin A for 24 h resulted in significant synergy (CI < 1) that affected the release of both the viral RNA and the core protein. CONCLUSION: In addition to having an inhibitory effect on RNA replication, HSP90 inhibitors may interfere with an HCV replication step that occurs after the synthesis of viral RNA, such as assembly and release. PMID:26925202
Engineered Hydrogels for Local and Sustained Delivery of RNA-Interference Therapies.
Wang, Leo L; Burdick, Jason A
2017-01-01
It has been nearly two decades since RNA-interference (RNAi) was first reported. While there are no approved clinical uses, several phase II and III clinical trials suggest the great promise of RNAi therapeutics. One challenge for RNAi therapies is the controlled localization and sustained presentation to target tissues, to both overcome systemic toxicity concerns and to enhance in vivo efficacy. One approach that is emerging to address these limitations is the entrapment of RNAi molecules within hydrogels for local and sustained release. In these systems, nucleic acids are either delivered as siRNA conjugates or within nanoparticles. A plethora of hydrogels has been implemented using these approaches, including both traditional hydrogels that have already been developed for other applications and new hydrogels developed specifically for RNAi delivery. These hydrogels have been applied to various applications in vivo, including cancer, bone regeneration, inflammation and cardiac repair. This review will examine the design and implementation of such hydrogel RNAi systems and will cover the most recent applications of these systems. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Host-Pathogen interactions modulated by small RNAs.
Islam, Waqar; Islam, Saif Ul; Qasim, Muhammad; Wang, Liande
2017-07-03
Biological processes such as defense mechanisms and microbial offense strategies are regulated through RNA induced interference in eukaryotes. Genetic mutations are modulated through biogenesis of small RNAs which directly impacts upon host development. Plant defense mechanisms are regulated and supported by a diversified group of small RNAs which are involved in streamlining several RNA interference pathways leading toward the initiation of pathogen gene silencing mechanisms. In the similar context, pathogens also utilize the support of small RNAs to launch their offensive attacks. Also there are strong evidences about the active involvement of these RNAs in symbiotic associations. Interestingly, small RNAs are not limited to the individuals in whom they are produced; they also show cross kingdom influences through variable interactions with other species thus leading toward the inter-organismic gene silencing. The phenomenon is understandable in the microbes which utilize these mechanisms to overcome host defense line. Understanding the mechanism of triggering host defense strategies can be a valuable step toward the generation of disease resistant host plants. We think that the cross kingdom trafficking of small RNA is an interesting insight that is needed to be explored for its vitality.
High-throughput screens in mammalian cells using the CRISPR-Cas9 system.
Peng, Jingyu; Zhou, Yuexin; Zhu, Shiyou; Wei, Wensheng
2015-06-01
As a powerful genome-editing tool, the clustered regularly interspaced short palindromic repeats (CRISPR)-clustered regularly interspaced short palindromic repeats-associated protein 9 (Cas9) system has been quickly developed into a large-scale function-based screening strategy in mammalian cells. This new type of genetic library is constructed through the lentiviral delivery of single-guide RNA collections that direct Cas9 or inactive dead Cas9 fused with effectors to interrogate gene function or regulate gene transcription in targeted cells. Compared with RNA interference screening, the CRISPR-Cas9 system demonstrates much higher levels of effectiveness and reliability with respect to both loss-of-function and gain-of-function screening. Unlike the RNA interference strategy, a CRISPR-Cas9 library can target both protein-coding sequences and regulatory elements, including promoters, enhancers and elements transcribing microRNAs and long noncoding RNAs. This powerful genetic tool will undoubtedly accelerate the mechanistic discovery of various biological processes. In this mini review, we summarize the general procedure of CRISPR-Cas9 library mediated functional screening, system optimization strategies and applications of this new genetic toolkit. © 2015 FEBS.
Nollen, Ellen A. A.; Garcia, Susana M.; van Haaften, Gijs; Kim, Soojin; Chavez, Alejandro; Morimoto, Richard I.; Plasterk, Ronald H. A.
2004-01-01
Protein misfolding and the formation of aggregates are increasingly recognized components of the pathology of human genetic disease and hallmarks of many neurodegenerative disorders. As exemplified by polyglutamine diseases, the propensity for protein misfolding is associated with the length of polyglutamine expansions and age-dependent changes in protein-folding homeostasis, suggesting a critical role for a protein homeostatic buffer. To identify the complement of protein factors that protects cells against the formation of protein aggregates, we tested transgenic Caenorhabditis elegans strains expressing polyglutamine expansion yellow fluorescent protein fusion proteins at the threshold length associated with the age-dependent appearance of protein aggregation. We used genome-wide RNA interference to identify genes that, when suppressed, resulted in the premature appearance of protein aggregates. Our screen identified 186 genes corresponding to five principal classes of polyglutamine regulators: genes involved in RNA metabolism, protein synthesis, protein folding, and protein degradation; and those involved in protein trafficking. We propose that each of these classes represents a molecular machine collectively comprising the protein homeostatic buffer that responds to the expression of damaged proteins to prevent their misfolding and aggregation. PMID:15084750
Advances in CRISPR-Cas9 genome engineering: lessons learned from RNA interference
Barrangou, Rodolphe; Birmingham, Amanda; Wiemann, Stefan; Beijersbergen, Roderick L.; Hornung, Veit; Smith, Anja van Brabant
2015-01-01
The discovery that the machinery of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9 bacterial immune system can be re-purposed to easily create deletions, insertions and replacements in the mammalian genome has revolutionized the field of genome engineering and re-invigorated the field of gene therapy. Many parallels have been drawn between the newly discovered CRISPR-Cas9 system and the RNA interference (RNAi) pathway in terms of their utility for understanding and interrogating gene function in mammalian cells. Given this similarity, the CRISPR-Cas9 field stands to benefit immensely from lessons learned during the development of RNAi technology. We examine how the history of RNAi can inform today's challenges in CRISPR-Cas9 genome engineering such as efficiency, specificity, high-throughput screening and delivery for in vivo and therapeutic applications. PMID:25800748
New insights into siRNA amplification and RNAi.
Zhang, Chi; Ruvkun, Gary
2012-08-01
In the nematode Caenorhabditis elegans (C. elegans), gene inactivation by RNA interference can achieve remarkable potency due to the amplification of initial silencing triggers by RNA-dependent RNA polymerases (RdRPs). RdRPs catalyze the biogenesis of an abundant species of secondary small interfering RNAs (siRNAs) using the target mRNA as template. The interaction between primary siRNAs derived from the exogenous double-stranded RNA (dsRNA) trigger and the target mRNA is required for the recruitment of RdRPs. Other genetic requirements for RdRP activities have not been characterized. Recent studies have identified the RDE-10/RDE-11 complex which interacts with the primary siRNA bound target mRNA and acts upstream of the RdRPs. rde-10 and rde-11 mutants show an RNAi defective phenotype because the biogenesis of secondary siRNAs is completely abolished. In addition, the RDE-10/RDE-11 complex plays a similar role in the endogenous RNAi pathway for the biogenesis of a subset of siRNAs targeting recently acquired, duplicated genes.
[Components and assembly of RNA-induced silencing complex].
Song, Xue-Mei; Yan, Fei; Du, Li-Xin
2006-06-01
Degradation of homologous RNA in RNA interference is carried out by functional RNA-induced silencing complex (RISC). RISC contains Dicer, Argonaute proein, siRNA and other components. Researching structures and functions of these components is primary important for understanding assembly and functional mechanism of RISC, as well as the whole RNAi pathway. Recent research works showed that Dicer, containing RNaseIII domain, is responsible for production of siRNA at the beginning of RNAi, and guarantees the stability of RISC intermediate in assembly process. As the core component of RISC, Argonaute protein functions as slicer to cleave target RNA and offers the binding site of siRNA in RISC assembly, which are depended on PIWI domain and PAZ domain separately. Although there is only one strand of siRNA that is the guider of RISC, the double stranded structural character of siRNA is determinant of RNAi. Except those, there are still other components with unknown functions in RISC. The knowledge about RISC components and assembly now, is basis of a presumed RISC assembly model.
RNA major groove modifications improve siRNA stability and biological activity
Terrazas, Montserrat; Kool, Eric T.
2009-01-01
RNA 5-methyl and 5-propynyl pyrimidine analogs were substituted into short interfering RNAs (siRNAs) to probe major groove steric effects in the active RNA-induced silencing complex (RISC). Synthetic RNA guide strands containing varied combinations of propynyl and methyl substitution revealed that all C-5 substitutions increased the thermal stability of siRNA duplexes containing them. Cellular gene suppression experiments using luciferase targets in HeLa cells showed that the bulky 5-propynyl modification was detrimental to RNA interference activity, despite its stabilization of the helix. Detrimental effects of this substitution were greatest at the 5′-half of the guide strand, suggesting close steric approach of proteins in the RISC complex with that end of the siRNA/mRNA duplex. However, substitutions with the smaller 5-methyl group resulted in gene silencing activities comparable to or better than that of wild-type siRNA. The major groove modifications also increased the serum stability of siRNAs. PMID:19042976
Ligtenberg, Maarten A; Pico de Coaña, Yago; Shmushkovich, Taisia; Yoshimoto, Yuya; Truxova, Iva; Yang, Yuan; Betancur-Boissel, Monica; Eliseev, Alexey V; Wolfson, Alexey D; Kiessling, Rolf
2018-06-06
Adoptive cell therapy (ACT) is becoming a prominent alternative therapeutic treatment for cancer patients relapsing on traditional therapies. In parallel, antibodies targeting immune checkpoint molecules, such as cytotoxic-T-lymphocyte-associated antigen 4 (CTLA-4) and cell death protein 1 pathway (PD-1), are rapidly being approved for multiple cancer types, including as first line therapy for PD-L1-expressing non-small-cell lung cancer. The combination of ACT and checkpoint blockade could substantially boost the efficacy of ACT. In this study, we generated a novel self-delivering small interfering RNA (siRNA) (sdRNA) that knocked down PD-1 expression on healthy donor T cells as well as patient-derived tumor-infiltrating lymphocytes (TIL). We have developed an alternative chemical modification of RNA backbone for improved stability and increased efficacy. Our results show that T cells treated with sdRNA specific for PD-1 had increased interferon γ (IFN-γ) secreting capacity and that this modality of gene expression interference could be utilized in our rapid expansion protocol for production of TIL for therapy. TIL expanded in the presence of PD-1-specific sdRNA performed with increased functionality against autologous tumor as compared to control TIL. This method of introducing RNAi into T cells to modify the expression of proteins could easily be adopted into any ACT protocol and will lead to the exploration of new combination therapies. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Hyatt, Sam; Cheung, Kat; Skelton, Andrew J.; Xu, Yaobo; Clark, Ian M.
2017-01-01
Long non-coding RNAs (lncRNAs) are expressed in a highly tissue-specific manner and function in various aspects of cell biology, often as key regulators of gene expression. In this study, we established a role for lncRNAs in chondrocyte differentiation. Using RNA sequencing we identified a human articular chondrocyte repertoire of lncRNAs from normal hip cartilage donated by neck of femur fracture patients. Of particular interest are lncRNAs upstream of the master chondrocyte transcription factor SOX9 locus. SOX9 is an HMG-box transcription factor that plays an essential role in chondrocyte development by directing the expression of chondrocyte-specific genes. Two of these lncRNAs are upregulated during chondrogenic differentiation of mesenchymal stem cells (MSCs). Depletion of one of these lncRNAs, LOC102723505, which we termed ROCR (regulator of chondrogenesis RNA), by RNA interference disrupted MSC chondrogenesis, concomitant with reduced cartilage-specific gene expression and incomplete matrix component production, indicating an important role in chondrocyte biology. Specifically, SOX9 induction was significantly ablated in the absence of ROCR, and overexpression of SOX9 rescued the differentiation of MSCs into chondrocytes. Our work sheds further light on chondrocyte-specific SOX9 expression and highlights a novel method of chondrocyte gene regulation involving a lncRNA. PMID:29084806
The HIV Nef protein modulates cellular and exosomal miRNA profiles in human monocytic cells.
Aqil, Madeeha; Naqvi, Afsar Raza; Mallik, Saurav; Bandyopadhyay, Sanghamitra; Maulik, Ujjwal; Jameel, Shahid
2014-01-01
The HIV Nef protein is a multifunctional virulence factor that perturbs intracellular membranes and signalling and is secreted into exosomes. While Nef-containing exosomes have a distinct proteomic profile, no comprehensive analysis of their miRNA cargo has been carried out. Since Nef functions as a viral suppressor of RNA interference and disturbs the distribution of RNA-induced silencing complex proteins between cells and exosomes, we hypothesized that it might also affect the export of miRNAs into exosomes. Exosomes were purified from human monocytic U937 cells that stably expressed HIV-1 Nef. The RNA from cells and exosomes was profiled for 667 miRNAs using a Taqman Low Density Array. Selected miRNAs and their mRNA targets were validated by quantitative RT-PCR. Bioinformatics analyses were used to identify targets and predict pathways. Nef expression affected a significant fraction of miRNAs in U937 cells. Our analysis showed 47 miRNAs to be selectively secreted into Nef exosomes and 2 miRNAs to be selectively retained in Nef-expressing cells. The exosomal miRNAs were predicted to target several cellular genes in inflammatory cytokine and other pathways important for HIV pathogenesis, and an overwhelming majority had targets within the HIV genome. This is the first study to report miRnome analysis of HIV Nef expressing monocytes and exosomes. Our results demonstrate that Nef causes large-scale dysregulation of cellular miRNAs, including their secretion through exosomes. We suggest this to be a novel viral strategy to affect pathogenesis and to limit the effects of RNA interference on viral replication and persistence.
Lan, Xi; Wang, Yong; Cao, Shu; Zou, Dongling; Li, Fang; Li, Shaolin
2012-12-01
To study the effects of CD133 suppression by lentivirus-mediated RNA interference (RNAi) on the proliferation and chemosensitivity of CD133(+) cancer stem cells (CSCs) sorted from HepG2 cell line. CD133(+) and CD133- cells were sorted from HepG2 cell line by flow cytometry, and the expression of CD133 before and after cell sorting were detected. The stem cell property of sorted CD133(+) cells were validated by sphere-forming assay in vitro and xenograft experiments in vivo. Lentivirus-mediated short hairpin RNA (shRNA) targeting CD133 were transfected into CD133(+) cells, and CD133 mRNA and protein expressions of the transfected cells were detected by RT-PCR and Western blotting, respectively. Before and after the transfection, the proliferative ability of CD133(+) cells was evaluated by colony formation assay, and the cell growth inhibition rate and apoptosis following cisplatin exposure were detected using CCK-8 assay and flow cytometry. The sorted CD133(+) cells showed a high purity of (88.74∓3.19)%, as compared with the purity of (3.36∓1.80)% before cell sorting. CD133(+) cells showed a high tumor sphere formation ability and tumorigenesis capacity compared with CD133- cells. CD133 shRNA transfection significantly inhibited CD133 mRNA and protein expressions in CD133(+) cells (P<0.01), resulting also in a significantly lowered cell proliferative ability (P<0.01) and an increased growth inhibition rate (P<0.01) and obviously increased cell apoptosis (P<0.05) after cisplatin exposure. Lentivirus-mediated RNAi for CD133 suppression inhibits the proliferation of CD133(+) liver cancer stem cells and increases their chemosensitivity to cisplatin.
Yang, Jing; Wang, Rong; Li, Hongjiang; Lv, Qing; Meng, Wentong; Yang, Xiaoqin
2016-07-08
Overexpression of extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), a glycoprotein enriched on the plasma membrane of tumor cells, promotes proliferation, invasion, metastasis, and survival of malignant tumor cells. In this study, we sought to examine the expression of EMMPRIN in breast tumors, and to identify the potential roles of EMMPRIN on breast cancer cells. EMMPRIN expression in breast cancer tissues was assessed by immunohistochemistry. We used a lentivirus vector-based RNA interference (RNAi) approach expressing short hairpin RNA (shRNA) to knockdown EMMPRIN gene in breast cancer cell lines MDA-MB-231 and MCF-7. In vitro, Cell proliferative, invasive potential were determined by Cell Counting Kit (CCK-8), cell cycle analysis and matrigel invasion assay, respectively. In vivo, tumorigenicity was monitored by inoculating tumor cells into breast fat pad of female nude mice. EMMPRIN was over-expressed in breast tumors and breast cancer cell lines. Down-regulation of EMMPRIN by lentivirus vector-based RNAi led to decreased cell proliferative, decreased matrigel invasion in vitro, and attenuated tumor formation in vivo. High expression of EMMPRIN plays a crucial role in breast cancer cell proliferation, matrigel invasion and tumor formation.
Silva, Amanda Perse da; Lopes, Juliana Freitas; Paula, Vanessa Salete de
2014-01-01
The aim of this study was to evaluate the use of RNA interference to inhibit herpes simplex virus type-1 replication in vitro. For herpes simplex virus type-1 gene silencing, three different small interfering RNAs (siRNAs) targeting the herpes simplex virus type-1 UL39 gene (sequence si-UL 39-1, si-UL 39-2, and si-UL 39-3) were used, which encode the large subunit of ribonucleotide reductase, an essential enzyme for DNA synthesis. Herpes simplex virus type-1 was isolated from saliva samples and mucocutaneous lesions from infected patients. All mucocutaneous lesions' samples were positive for herpes simplex virus type-1 by real-time PCR and by virus isolation; all herpes simplex virus type-1 from saliva samples were positive by real-time PCR and 50% were positive by virus isolation. The levels of herpes simplex virus type-1 DNA remaining after siRNA treatment were assessed by real-time PCR, whose results demonstrated that the effect of siRNAs on gene expression depends on siRNA concentration. The three siRNA sequences used were able to inhibit viral replication, assessed by real-time PCR and plaque assays and among them, the sequence si-UL 39-1 was the most effective. This sequence inhibited 99% of herpes simplex virus type-1 replication. The results demonstrate that silencing herpes simplex virus type-1 UL39 expression by siRNAs effectively inhibits herpes simplex virus type-1 replication, suggesting that siRNA based antiviral strategy may be a potential therapeutic alternative. Copyright © 2014. Published by Elsevier Editora Ltda.
SUMOylation of TARBP2 regulates miRNA/siRNA efficiency
Chen, Cheng; Zhu, Changhong; Huang, Jian; Zhao, Xian; Deng, Rong; Zhang, Hailong; Dou, Jinzhuo; Chen, Qin; Xu, Ming; Yuan, Haihua; Wang, Yanli; Yu, Jianxiu
2015-01-01
Small RNA-induced gene silencing is essential for post-transcriptional regulation of gene expression; however, it remains unclear how miRNA/siRNA efficiency is regulated. Here we show that TARBP2 is SUMOylated at K52, which can be enhanced by its phosphorylation. This modification can stabilize TARBP2 via repressing its K48-linked ubiquitination. We find that TARBP2 SUMOylation does not influence the overall production of mature miRNAs, but it regulates miRNA/siRNA efficiency. SUMOylated TARBP2 recruits Ago2 to constitute the RNA-induced silencing complex (RISC)-loading complex (RLC), and simultaneously promotes more pre-miRNAs to load into the RLC. Consequently, Ago2 is stabilized and miRNAs/siRNAs bound by TARBP2/Dicer is effectively transferred to Ago2. Thus, these processes lead to the formation of the effective RISC for RNA interference (RNAi). Collectively, our data suggest that SUMOylation of TARBP2 is required for regulating miRNA/siRNA efficiency, which is a general mechanism of miRNA/siRNA regulation. PMID:26582366
Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange
Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.
2014-01-01
RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198
Zhang, Xiaojuan; Yao, Zhixuan; Duan, Yanting; Zhang, Xiaomei; Shi, Jinsong; Xu, Zhenghong
2018-01-11
The specific recognition and binding of promoter and RNA polymerase is the first step of transcription initiation in bacteria and largely determines transcription activity. Therefore, direct analysis of the interaction between promoter and RNA polymerase in vitro may be a new strategy for promoter characterization, to avoid interference due to the cell's biophysical condition and other regulatory elements. In the present study, the specific interaction between T7 promoter and T7 RNA polymerase was studied as a model system using force spectroscopy based on atomic force microscope (AFM). The specific interaction between T7 promoter and T7 RNA polymerase was verified by control experiments, and the rupture force in this system was measured as 307.2 ± 6.7 pN. The binding between T7 promoter mutants with various promoter activities and T7 RNA polymerase was analyzed. Interaction information including rupture force, rupture distance and binding percentage were obtained in vitro , and reporter gene expression regulated by these promoters was also measured according to a traditional promoter activity characterization method in vivo Using correlation analysis, it was found that the promoter strength characterized by reporter gene expression was closely correlated with rupture force and the binding percentage by force spectroscopy. These results indicated that the analysis of the interaction between promoter and RNA polymerase using AFM-based force spectroscopy was an effective and valid approach for the quantitative characterization of promoters. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Inoh, Yoshikazu; Furuno, Tadahide; Hirashima, Naohide
Highlights: Black-Right-Pointing-Pointer We use MEL-A-containing cationic liposomes for siRNA delivery. Black-Right-Pointing-Pointer MEL-A-containing cationic liposomes can efficiently and rapidly deliver siRNA into the cytoplasm. Black-Right-Pointing-Pointer Rapid delivery of siRNA is due to the membrane fusion between liposomes and plasma membrane. -- Abstract: The downregulation of gene expression by RNA interference holds great potential for genetic analysis and gene therapy. However, a more efficient delivery system for small interfering RNA (siRNA) into the target cells is required for wide fields such as cell biology, physiology, and clinical application. Non-viral vectors are stronger candidates than viral vectors because they are safer and easiermore » to prepare. We have previously used a new method for gene transfection by combining cationic liposomes with the biosurfactant mannosylerythritol lipid-A (MEL-A). The novel MEL-A-containing cationic liposomes rapidly delivered DNA (plasmids and oligonucleotides) into the cytosol and nucleus through membrane fusion between liposomes and the plasma membrane, and consequently, enhanced the gene transfection efficiency. In this study, we determined the efficiency of MEL-A-containing cationic liposomes for siRNA delivery. We observed that exogenous and endogenous protein expression was suppressed by approximately 60% at 24 h after brief (30 min) incubation of target cells with MEL-A-containing cationic liposome/siRNA complexes. Confocal microscopic analysis showed that suppression of protein expression was caused by rapid siRNA delivery into the cytosol. We found that the MEL-A-containing cationic liposomes directly delivered siRNA into the cytoplasm by the membrane fusion in addition to endocytotic pathway whereas Lipofectamine Trade-Mark-Sign RNAiMax delivered siRNA only by the endocytotic pathway. It seems that the ability to rapidly and directly deliver siRNA into the cytosol using MEL-A-containing cationic liposomes is able to reduce immune responses, cytotoxicity, and other side effects caused by viral vectors in clinical applications.« less
A review on current status of antiviral siRNA.
Qureshi, Abid; Tantray, Vaqar Gani; Kirmani, Altaf Rehman; Ahangar, Abdul Ghani
2018-04-15
Viral diseases like influenza, AIDS, hepatitis, and Ebola cause severe epidemics worldwide. Along with their resistant strains, new pathogenic viruses continue to be discovered so creating an ongoing need for new antiviral treatments. RNA interference is a cellular gene-silencing phenomenon in which sequence-specific degradation of target mRNA is achieved by means of complementary short interfering RNA (siRNA) molecules. Short interfering RNA technology affords a potential tractable strategy to combat viral pathogenesis because siRNAs are specific, easy to design, and can be directed against multiple strains of a virus by targeting their conserved gene regions. In this review, we briefly summarize the current status of siRNA therapy for representative examples from different virus families. In addition, other aspects like their design, delivery, medical significance, bioinformatics resources, and limitations are also discussed. Copyright © 2018 John Wiley & Sons, Ltd.
Amicoumacin A inhibits translation by stabilizing mRNA interaction with the ribosome
Polikanov, Yury S.; Osterman, Ilya A.; Szal, Teresa; Tashlitsky, Vadim N.; Serebryakova, Marina V.; Kusochek, Pavel; Bulkley, David; Malanicheva, Irina A.; Efimenko, Tatyana A.; Efremenkova, Olga V.; Konevega, Andrey L.; Shaw, Karen J.; Bogdanov, Alexey A.; Rodnina, Marina V.; Dontsova, Olga A.; Mankin, Alexander S.; Steitz, Thomas A.; Sergiev, Petr V.
2014-01-01
SUMMARY We demonstrate that the antibiotic amicoumacin A (AMI) whose cellular target was unknown, is a potent inhibitor of protein synthesis. Resistance mutations in helix 24 of the 16S rRNA mapped the AMI binding site to the small ribosomal subunit. The crystal structure of bacterial ribosome in complex with AMI solved at 2.4 Å resolution revealed that the antibiotic makes contacts with universally conserved nucleotides of 16S rRNA in the E site and the mRNA backbone. Simultaneous interactions of AMI with 16S rRNA and mRNA and the in vivo experimental evidence suggest that it may inhibit the progression of the ribosome along mRNA. Consistent with this proposal, binding of AMI interferes with translocation in vitro. The inhibitory action of AMI can be partly compensated by mutations in the translation elongation factor G. PMID:25306919
Zhang, Yong Sheng; Du, Ying Chun; Sun, Li Rong; Wang, Xu Hai; Liu, Shuai Bing; Xi, Ji Feng; Li, Chao Cheng; Ying, Rui Wen; Jiang, Song; Wang, Xiang Zu; Shen, Hong; Jia, Bin
2018-03-06
The mammalian Y chromosome plays a critical role in spermatogenesis. However, the exact functions of each gene on the Y chromosome have not been completely elucidated, due, in part, to difficulties in gene targeting analysis of the Y chromosome. The zinc finger protein, Y-linked (ZFY) gene was first proposed to be a sex determination factor, although its function in spermatogenesis has recently been elucidated. Nevertheless, ZFY gene targeting analysis has not been performed to date. In the present study, RNA interference (RNAi) was used to generate ZFY-interrupted Hu sheep by injecting short hairpin RNA (shRNA) into round spermatids. The resulting spermatozoa exhibited abnormal sperm morphology, including spermatozoa without tails and others with head and tail abnormalities. Quantitative real-time polymerase chain reaction analysis showed that ZFY mRNA expression was decreased significantly in Hu sheep with interrupted ZFY compared with wild-type Hu sheep. The sex ratio of lambs also exhibited a bias towards females. Together, the experimental strategy and findings of the present study reveal that ZFY also functions in spermatogenesis in Hu sheep and facilitate the use of RNAi in the control of sex in Hu sheep.
Seefeld, Ting H.; Halpern, Aaron R.; Corn, Robert M.
2012-01-01
Protein microarrays are fabricated from double-stranded DNA (dsDNA) microarrays by a one-step, multiplexed enzymatic synthesis in an on-chip microfluidic format and then employed for antibody biosensing measurements with surface plasmon resonance imaging (SPRI). A microarray of dsDNA elements (denoted as generator elements) that encode either a His-tagged green fluorescent protein (GFP) or a His-tagged luciferase protein is utilized to create multiple copies of messenger RNA (mRNA) in a surface RNA polymerase reaction; the mRNA transcripts are then translated into proteins by cell-free protein synthesis in a microfluidic format. The His-tagged proteins diffuse to adjacent Cu(II)-NTA microarray elements (denoted as detector elements) and are specifically adsorbed. The net result is the on-chip, cell-free synthesis of a protein microarray that can be used immediately for SPRI protein biosensing. The dual element format greatly reduces any interference from the nonspecific adsorption of enzyme or proteins. SPRI measurements for the detection of the antibodies anti-GFP and anti-luciferase were used to verify the formation of the protein microarray. This convenient on-chip protein microarray fabrication method can be implemented for multiplexed SPRI biosensing measurements in both clinical and research applications. PMID:22793370
RNA therapeutics targeting osteoclast-mediated excessive bone resorption
Wang, Yuwei; Grainger, David W
2011-01-01
RNA interference (RNAi) is a sequence-specific post-transcriptional gene silencing technique developed with dramatically increasing utility for both scientific and therapeutic purposes. Short interfering RNA (siRNA) is currently exploited to regulate protein expression relevant to many therapeutic applications, and commonly used as a tool for elucidating disease-associated genes. Osteoporosis and their associated osteoporotic fragility fractures in both men and women are rapidly becoming a global healthcare crisis as average life expectancy increases worldwide. New therapeutics are needed for this increasing patient population. This review describes the diversity of molecular targets suitable for RNAi-based gene knock-down in osteoclasts to control osteoclast-mediated excessive bone resorption. We identify strategies for developing targeted siRNA delivery and efficient gene silencing, and describe opportunities and challenges of introducing siRNA as a therapeutic approach to hard and connective tissue disorders. PMID:21945356
Tabara, Hiroaki; Yigit, Erbay; Siomi, Haruhiko; Mello, Craig C
2002-06-28
Double-stranded (ds) RNA induces potent gene silencing, termed RNA interference (RNAi). At an early step in RNAi, an RNaseIII-related enzyme, Dicer (DCR-1), processes long-trigger dsRNA into small interfering RNAs (siRNAs). DCR-1 is also required for processing endogenous regulatory RNAs called miRNAs, but how DCR-1 recognizes its endogenous and foreign substrates is not yet understood. Here we show that the C. elegans RNAi pathway gene, rde-4, encodes a dsRNA binding protein that interacts during RNAi with RNA identical to the trigger dsRNA. RDE-4 protein also interacts in vivo with DCR-1, RDE-1, and a conserved DExH-box helicase. Our findings suggest a model in which RDE-4 and RDE-1 function together to detect and retain foreign dsRNA and to present this dsRNA to DCR-1 for processing.
Two distinct RNase activities of CRISPR-C2c2 enable guide-RNA processing and RNA detection.
East-Seletsky, Alexandra; O'Connell, Mitchell R; Knight, Spencer C; Burstein, David; Cate, Jamie H D; Tjian, Robert; Doudna, Jennifer A
2016-10-13
Bacterial adaptive immune systems use CRISPRs (clustered regularly interspaced short palindromic repeats) and CRISPR-associated (Cas) proteins for RNA-guided nucleic acid cleavage. Although most prokaryotic adaptive immune systems generally target DNA substrates, type III and VI CRISPR systems direct interference complexes against single-stranded RNA substrates. In type VI systems, the single-subunit C2c2 protein functions as an RNA-guided RNA endonuclease (RNase). How this enzyme acquires mature CRISPR RNAs (crRNAs) that are essential for immune surveillance and how it carries out crRNA-mediated RNA cleavage remain unclear. Here we show that bacterial C2c2 possesses a unique RNase activity responsible for CRISPR RNA maturation that is distinct from its RNA-activated single-stranded RNA degradation activity. These dual RNase functions are chemically and mechanistically different from each other and from the crRNA-processing behaviour of the evolutionarily unrelated CRISPR enzyme Cpf1 (ref. 11). The two RNase activities of C2c2 enable multiplexed processing and loading of guide RNAs that in turn allow sensitive detection of cellular transcripts.
RNAi of selected candidate genes interrupts growth and development of Helicoverpa armigera.
Chikate, Yojana R; Dawkar, Vishal V; Barbole, Ranjit S; Tilak, Priyadarshini V; Gupta, Vidya S; Giri, Ashok P
2016-10-01
Helicoverpa armigera is one of the major crop pests and is less amenable to current pest control approaches. RNA interference (RNAi) is emerging as a potent arsenal for the insect pest control over current methods. Here, we examined the effect on growth and development in H. armigera by targeting various enzymes/proteins such as proteases like trypsins (HaTry2, 3, 4 and 6), chymotrypsin (HaChy4) and cysteine protease like cathepsin (HaCATHL); glutathione S-transferases (HaGST1a, 6 and 8); esterases (HaAce4, HaJHE); catalase (HaCAT); super-oxide-dismutase (HaCu/ZnSOD); fatty acid binding protein (HaFabp) and chitin deacetylase (HaCda5b) through dsRNA approach. Significant downregulation of cognate mRNA expression and reduced activity of trypsin and GST-like enzyme were evident upon feeding candidate dsRNAs to the larvae. Among these, the highest mortality was observed in HaAce4 dsRNA fed larvae followed by HaJHE; HaCAT; HaCuZnSOD; HaFabp and HaTry3 whereas remaining ones showed relatively lower mortality. Furthermore, the dsRNA fed larvae showed significant reduction in the larval mass and abnormalities at the different stages of H. armigera development compared to their control diets. For example, malformed larvae, pupae and moth at a dose of 60μg/day were evident in high number of individual insects fed on dsRNA containing diets. Moreover, the growth and development of insects and moths were retarded in dsRNA fed larvae. These findings might provide potential new candidates for designing effective dsRNA as pesticide in crop protection. Copyright © 2016 Elsevier B.V. All rights reserved.
Detection of small interfering RNA (siRNA) by mass spectrometry procedures in doping controls.
Thomas, Andreas; Walpurgis, Katja; Delahaut, Philippe; Kohler, Maxie; Schänzer, Wilhelm; Thevis, Mario
2013-01-01
Uncovering manipulation of athletic performance via small interfering (si)RNA is an emerging field in sports drug testing. Due to the potential to principally knock down every target gene in the organism by means of the RNA interference pathway, this facet of gene doping has become a realistic scenario. In the present study, two distinct model siRNAs comprising 21 nucleotides were designed as double strands which were perfect counterparts to a sequence of the respective messenger RNA coding the muscle regulator myostatin of Rattus norvegicus. Several modified nucleotides were introduced in both the sense and the antisense strand comprising phosphothioates, 2'-O-methylation, 2'-fluoro-nucleotides, locked nucleic acids and a cholesterol tag at the 3'-end. The model siRNAs were applied to rats at 1 mg/kg (i.v.) and blood as well as urine samples were collected. After isolation of the RNA by means of a RNA purification kit, the target analytes were detected by liquid chromatography - high resolution/high accuracy mass spectrometry (LC-HRMS). Analytes were detected as modified nucleotides after alkaline hydrolysis, as intact oligonucleotide strands (top-down) and by means of denaturing SDS-PAGE analysis. The gel-separated siRNA was further subjected to in-gel hydrolysis with different RNases and subsequent identification of the fragments by untargeted LC-HRMS analysis (bottom-up, 'experimental RNomics'). Combining the results of all approaches, the identification of several 3'-truncated urinary metabolites was accomplished and target analytes were detected up to 24 h after a single administration. Simultaneously collected blood samples yielded no promising results. The methods were validated and found fit-for-purpose for doping controls. Copyright © 2013 John Wiley & Sons, Ltd.
Lysosomal membrane protein SIDT2 mediates the direct uptake of DNA by lysosomes
Aizawa, Shu; Contu, Viorica Raluca; Fujiwara, Yuuki; Hase, Katsunori; Kikuchi, Hisae; Kabuta, Chihana; Wada, Keiji
2017-01-01
ABSTRACT Lysosomes degrade macromolecules such as proteins and nucleic acids. We previously identified 2 novel types of autophagy, RNautophagy and DNautophagy, where lysosomes directly take up RNA and DNA, in an ATP-dependent manner, for degradation. We have also reported that SIDT2 (SID1 transmembrane family, member 2), an ortholog of the Caenorhabditis elegans putative RNA transporter SID-1 (systemic RNA interference defective-1), mediates RNA translocation during RNautophagy. In this addendum, we report that SIDT2 also mediates DNA translocation in the process of DNautophagy. These findings help elucidate the mechanisms underlying the direct uptake of nucleic acids by lysosomes and the physiological functions of DNautophagy. PMID:27846365
Lysosomal membrane protein SIDT2 mediates the direct uptake of DNA by lysosomes.
Aizawa, Shu; Contu, Viorica Raluca; Fujiwara, Yuuki; Hase, Katsunori; Kikuchi, Hisae; Kabuta, Chihana; Wada, Keiji; Kabuta, Tomohiro
2017-01-02
Lysosomes degrade macromolecules such as proteins and nucleic acids. We previously identified 2 novel types of autophagy, RNautophagy and DNautophagy, where lysosomes directly take up RNA and DNA, in an ATP-dependent manner, for degradation. We have also reported that SIDT2 (SID1 transmembrane family, member 2), an ortholog of the Caenorhabditis elegans putative RNA transporter SID-1 (systemic RNA interference defective-1), mediates RNA translocation during RNautophagy. In this addendum, we report that SIDT2 also mediates DNA translocation in the process of DNautophagy. These findings help elucidate the mechanisms underlying the direct uptake of nucleic acids by lysosomes and the physiological functions of DNautophagy.
Yuan, Li-Fen; Sheng, Jing; Lu, Ping; Wang, Yu-Qiang; Jin, Tuo; Du, Qin
2015-09-01
Angiotensinogen (AGT) has been shown to have a role in cardiac hypertrophy, while depletion of the AGT gene in spontaneously hypertensive rats (SHR) has not been investigated. The present study investigated the effect of AGT knockdown on cardiac hypertrophy in SHR. For this, small hairpin (sh)RNAs were intravenously injected into SHRs, using a nanoparticle‑mediated transfection system. The experimental rats were divided into the following groups: a) Blank control with water treatment only, b) negative control with biscarbamate‑crosslinked Gal‑polyethylene glycol polyethylenimine nanoparticles (GPE)/negative shRNA, c) AGT‑RNA interference (RNAi) group with GPE/AGT‑shRNA, and 4) normotensive control using Wistar‑Kyoto rats (WKY) with water treatment. Three and five days following the first injection, the levels of hepatic AGT mRNA and AGT protein as well as plasma levels of AGT were markedly decreased in the AGT‑RNAi group (P<0.05). Furthermore, a significant decrease in systolic blood pressure (SBP), left ventricular weight to body weight ratio and heart weight to body weight ratio were observed in the AGT‑RNAi group compared with those in the control groups. The depletion of AGT in SHR led to a reduction in SBP by 30±4 mmHg, which was retained for >10 days. Cardiac hypertrophy was also significantly improved in AGT‑knockdown rats. In conclusion, the present study showed that AGT‑silencing had a significant inhibitory effect on hypertension and hypertensive‑induced cardiac hypertrophy in SHRs.
Fernandez-Garcia, Maria-Dolores; Meertens, Laurent; Bonazzi, Matteo; Cossart, Pascale; Arenzana-Seisdedos, Fernando; Amara, Ali
2011-03-01
The ubiquitin ligase CBLL1 (also known as HAKAI) has been proposed to be a critical cellular factor exploited by West Nile virus (WNV) for productive infection. CBLL1 has emerged as a major hit in a recent RNA interference screen designed to identify cellular factors required for the early stages of the WNV life cycle. Follow-up experiments showed that HeLa cells knocked down for CBLL1 by a small interfering RNA (siRNA) failed to internalize WNV particles and resisted infection. Furthermore, depletion of a free-ubiquitin pool by the proteasome inhibitor MG132 abolished WNV endocytosis, suggesting that CBLL1 acts in concert with the ubiquitin proteasome system to mediate virus internalization. Here, we examined the effect of CBLL1 knockdown and proteasome inhibitors on infection by WNV and other flaviviruses. We identified new siRNAs that repress the CBLL1 protein and strongly inhibit the endocytosis of Listeria monocytogenes, a bacterial pathogen known to require CBLL1 to invade host cells. Strikingly, however, we detected efficient WNV, dengue virus, and yellow fever virus infection of human cells, despite potent downregulation of CBLL1 by RNA interference. In addition, we found that the proteasome inhibitors MG132 and lactacystin did not affect WNV internalization but strongly repressed flavivirus RNA translation and replication. Together, these data do not support a requirement for CBLL1 during flavivirus entry and rather suggest an essential role of the ubiquitin/proteasome pathway for flavivirus genome amplification.
Role of RNA interference (RNAi) in the Moss Physcomitrella patens.
Arif, Muhammad Asif; Frank, Wolfgang; Khraiwesh, Basel
2013-01-14
RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species.
Starkweather, Angela R; Coyne, Patrick; Lyon, Debra E; Elswick, R K; An, Kyungeh; Sturgill, Jamie
2015-02-01
In this double-blinded, randomized controlled trial we evaluated the effects of Calmare®, a non-invasive neurocutaneous electrical pain intervention, on lower back pain intensity as measured by the "worst" pain score and on pain interference using the Brief Pain Inventory-Short Form, on measures of pain sensitivity assessed by quantitative sensory testing, and on mRNA expression of pain sensitivity genes. Thirty participants were randomized to receive up to 10 sessions of Calmare® treatment (n = 15) or a sham treatment (n = 15) using the same device at a non-therapeutic threshold. At 3 weeks after conclusion of treatment, compared with the sham group, the Calmare® group reported a significant decrease in the "worst" pain and interference scores. There were also significant differences in pain sensitivity and differential mRNA expression of 17 pain genes, suggesting that Calmare® can be effective in reducing pain intensity and interference in individuals with persistent low back pain by altering the mechanisms of enhanced pain sensitivity. Further study of long-term pain outcomes, particularly functional status, analgesic use and health care utilization, is warranted. © 2015 Wiley Periodicals, Inc.
Lu, Xiaoli; Yang, Xi; Huang, Xiaoyan; Huang, Chen; Sun, Huan Huan; Jin, Lihua; Xu, Weifeng; Mao, Haiyan; Guo, Junming; Zhou, Jianqing; Lian, Jiangfang
2013-01-01
Long QT syndrome (LQTS) is a monogenic proarrhythmic disorder that predisposes affected individuals to sudden death from tachyarrhythmia. As an inherited disease, LQTS cannot be completely cured by conventional treatment modalities. Individualized gene therapy is a promising therapeutic approach. The purpose of this study was to investigate the role of small interference RNA (siRNA) on expression of E637K-hERG (human ether-a-go-go-related gene) mutant and whether it can be used to rescue the mutant's dominant-negative suppressive effects on hERG protein channel function. Western blot was performed to select the most sensitive siRNAs to target E637K-hERG mutant knockdown. Confocal laser scanning microscope was performed to monitor cellular localization of wild-type (WT)-hERG and E637K-hERG with or without siRNA. Patch-clamp technique was used to assess the effect of siRNA on the electrophysiologic characteristics of the rapidly activating delayed rectifier K(+) current I(Kr) of the hERG protein channel. siRNA led to a significant decrease in the level of E637K-hERG protein but did not affect the level of WT-hERG protein. WT-hERG localization in cells coexpressing E637K-hERG mutant was restored to the membrane by siRNA. The siRNA-mediated inhibition of E637K-hERG mutant restored the maximum current and tail current amplitudes. Furthermore, siRNA treatment rescued the kinetic properties of WT/E637K-hERG protein channel to a level comparable to that of WT-hERG protein channel. Our findings illustrated that siRNA can effectively inhibit E637K-hERG protein expression and rescue the dominant-negative effect of this mutation by restoring the kinetic properties of hERG protein channel. It has potential clinical implications with regard to the possibility of using siRNA in the treatment of LQTS. Copyright © 2013 Heart Rhythm Society. All rights reserved.
RNAi Screening in Spodoptera frugiperda.
Ghosh, Subhanita; Singh, Gatikrushna; Sachdev, Bindiya; Kumar, Ajit; Malhotra, Pawan; Mukherjee, Sunil K; Bhatnagar, Raj K
2016-01-01
RNA interference is a potent and precise reverse genetic approach to carryout large-scale functional genomic studies in a given organism. During the past decade, RNAi has also emerged as an important investigative tool to understand the process of viral pathogenesis. Our laboratory has successfully generated transgenic reporter and RNAi sensor line of Spodoptera frugiperda (Sf21) cells and developed a reversal of silencing assay via siRNA or shRNA guided screening to investigate RNAi factors or viral pathogenic factors with extraordinary fidelity. Here we describe empirical approaches and conceptual understanding to execute successful RNAi screening in Spodoptera frugiperda 21-cell line.
Nucleic Acid Templated Reactions for Chemical Biology.
Di Pisa, Margherita; Seitz, Oliver
2017-06-21
Nucleic acid directed bioorthogonal reactions offer the fascinating opportunity to unveil and redirect a plethora of intracellular mechanisms. Nano- to picomolar amounts of specific RNA molecules serve as templates and catalyze the selective formation of molecules that 1) exert biological effects, or 2) provide measurable signals for RNA detection. Turnover of reactants on the template is a valuable asset when concentrations of RNA templates are low. The idea is to use RNA-templated reactions to fully control the biodistribution of drugs and to push the detection limits of DNA or RNA analytes to extraordinary sensitivities. Herein we review recent and instructive examples of conditional synthesis or release of compounds for in cellulo protein interference and intracellular nucleic acid imaging. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.
[The role of miRNA in endometrial cancer in the context of miRNA 205].
Wilczyński, Miłosz; Danielska, Justyna; Dzieniecka, Monika; Malinowski, Andrzej
2015-11-01
MiRNAs are small, non-coding molecules of ribonucleic acids of approximately 22 bp length, which serve as regulators of gene expression and protein translation due to interference with messenger RNA (mRNA). MiRNAs, which take part in the regulation of cell cycle and apoptosis, may be associated with carcinogenesis. Aberrant expression of miRNAs in endometrial cancer might contribute to the endometrial cancer initiation or progression, as well as metastasis formation, and may influence cancer invasiveness. Specific-miRNAs expressed in endometrial cancer tissues may serve as diagnostic markers of the disease, prognostic biomarkers, or play an important part in oncological therapy We aimed to describe the role of miRNAs in endometrial cancer with special consideration of miRNA 205.
Flavivirus RNAi suppression: decoding non-coding RNA.
Pijlman, Gorben P
2014-08-01
Flaviviruses are important human pathogens that are transmitted by invertebrate vectors, mostly mosquitoes and ticks. During replication in their vector, flaviviruses are subject to a potent innate immune response known as antiviral RNA interference (RNAi). This defense mechanism is associated with the production of small interfering (si)RNA that lead to degradation of viral RNA. To what extent flaviviruses would benefit from counteracting antiviral RNAi is subject of debate. Here, the experimental evidence to suggest the existence of flavivirus RNAi suppressors is discussed. I will highlight the putative role of non-coding, subgenomic flavivirus RNA in suppression of RNAi in insect and mammalian cells. Novel insights from ongoing research will reveal how arthropod-borne viruses modulate innate immunity including antiviral RNAi. Copyright © 2014 Elsevier B.V. All rights reserved.
Functional Nanostructures for Effective Delivery of Small Interfering RNA Therapeutics
Hong, Cheol Am; Nam, Yoon Sung
2014-01-01
Small interfering RNA (siRNA) has proved to be a powerful tool for target-specific gene silencing via RNA interference (RNAi). Its ability to control targeted gene expression gives new hope to gene therapy as a treatment for cancers and genetic diseases. However, siRNA shows poor pharmacological properties, such as low serum stability, off-targeting, and innate immune responses, which present a significant challenge for clinical applications. In addition, siRNA cannot cross the cell membrane for RNAi activity because of its anionic property and stiff structure. Therefore, the development of a safe, stable, and efficient system for the delivery of siRNA therapeutics into the cytoplasm of targeted cells is crucial. Several nanoparticle platforms for siRNA delivery have been developed to overcome the major hurdles facing the therapeutic uses of siRNA. This review covers a broad spectrum of non-viral siRNA delivery systems developed for enhanced cellular uptake and targeted gene silencing in vitro and in vivo and discusses their characteristics and opportunities for clinical applications of therapeutic siRNA. PMID:25285170
Emerging strategies for RNA interference (RNAi) applications in insects.
Nandety, Raja Sekhar; Kuo, Yen-Wen; Nouri, Shahideh; Falk, Bryce W
2015-01-01
RNA interference (RNAi) in insects is a gene regulatory process that also plays a vital role in the maintenance and in the regulation of host defenses against invading viruses. Small RNAs determine the specificity of the RNAi through precise recognition of their targets. These small RNAs in insects comprise small interfering RNAs (siRNAs), micro RNAs (miRNAs) and Piwi interacting RNAs (piRNAs) of various lengths. In this review, we have explored different forms of the RNAi inducers that are presently in use, and their applications for an effective and efficient fundamental and practical RNAi research with insects. Further, we reviewed trends in next generation sequencing (NGS) technologies and their importance for insect RNAi, including the identification of novel insect targets as well as insect viruses. Here we also describe a rapidly emerging trend of using plant viruses to deliver the RNAi inducer molecules into insects for an efficient RNAi response.
Nemoto, Takashi; Maruyama, Jun-ichi; Kitamoto, Katsuhiko
2009-11-01
Aspergillus oryzae RIB40 has three alpha-amylase genes (amyA, amyB, and amyC), and secretes alpha-amylase abundantly. However, large amounts of endogenous secretory proteins such as alpha-amylase can compete with heterologous protein in the secretory pathway and decrease its production yields. In this study, we examined the effects of suppression of alpha-amylase on heterologous protein production in A. oryzae, using the bovine chymosin (CHY) as a reporter heterologous protein. The three alpha-amylase genes in A. oryzae have nearly identical DNA sequences from those promoters to the coding regions. Hence we performed silencing of alpha-amylase genes by RNA interference (RNAi) in the A. oryzae CHY producing strain. The silenced strains exhibited a reduction in alpha-amylase activity and an increase in CHY production in the culture medium. This result suggests that suppression of alpha-amylase is effective in heterologous protein production in A. oryzae.
RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.)
Abdurakhmonov, Ibrokhim Y.; Ayubov, Mirzakamol S.; Ubaydullaeva, Khurshida A.; Buriev, Zabardast T.; Shermatov, Shukhrat E.; Ruziboev, Haydarali S.; Shapulatov, Umid M.; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z.; Percy, Richard G.; Devor, Eric J.; Sharma, Govind C.; Sripathi, Venkateswara R.; Kumpatla, Siva P.; van der Krol, Alexander; Kater, Hake D.; Khamidov, Khakimdjan; Salikhov, Shavkat I.; Jenkins, Johnie N.; Abdukarimov, Abdusattor; Pepper, Alan E.
2016-01-01
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization. PMID:26941765
RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.).
Abdurakhmonov, Ibrokhim Y; Ayubov, Mirzakamol S; Ubaydullaeva, Khurshida A; Buriev, Zabardast T; Shermatov, Shukhrat E; Ruziboev, Haydarali S; Shapulatov, Umid M; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z; Percy, Richard G; Devor, Eric J; Sharma, Govind C; Sripathi, Venkateswara R; Kumpatla, Siva P; van der Krol, Alexander; Kater, Hake D; Khamidov, Khakimdjan; Salikhov, Shavkat I; Jenkins, Johnie N; Abdukarimov, Abdusattor; Pepper, Alan E
2016-01-01
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization.
Targeting CCl4 -induced liver fibrosis by RNA interference-mediated inhibition of cyclin E1 in mice.
Bangen, Jörg-Martin; Hammerich, Linda; Sonntag, Roland; Baues, Maike; Haas, Ute; Lambertz, Daniela; Longerich, Thomas; Lammers, Twan; Tacke, Frank; Trautwein, Christian; Liedtke, Christian
2017-10-01
Initiation and progression of liver fibrosis requires proliferation and activation of resting hepatic stellate cells (HSCs). Cyclin E1 (CcnE1) is the regulatory subunit of the cyclin-dependent kinase 2 (Cdk2) and controls cell cycle re-entry. We have recently shown that genetic inactivation of CcnE1 prevents activation, proliferation, and survival of HSCs and protects from liver fibrogenesis. The aim of the present study was to translate these findings into preclinical applications using an RNA interference (RNAi)-based approach. CcnE1-siRNA (small interfering RNA) efficiently inhibited CcnE1 gene expression in murine and human HSC cell lines and in primary HSCs, resulting in diminished proliferation and increased cell death. In C57BL/6 wild-type (WT) mice, delivery of stabilized siRNA using a liposome-based carrier targeted approximately 95% of HSCs, 70% of hepatocytes, and 40% of CD45 + cells after single injection. Acute CCl 4 -mediated liver injury in WT mice induced endogenous CcnE1 expression and proliferation of surviving hepatocytes and nonparenchymal cells, including CD45 + leukocytes. Pretreatment with CcnE1-siRNA reverted CcnE1 induction to baseline levels of healthy mice, which was associated with reduced liver injury, diminished proliferation of hepatocytes and leukocytes, and attenuated overall inflammatory response. For induction of liver fibrosis, WT mice were challenged with CCl 4 for 4-6 weeks. Co-treatment with CcnE1-siRNA once a week was sufficient to continuously block CcnE1 expression and cell-cycle activity of hepatocytes and nonparenchymal cells, resulting in significantly ameliorated liver fibrosis and inflammation. Importantly, CcnE1-siRNA also prevented progression of liver fibrosis if applied after onset of chronic liver injury. Therapeutic targeting of CcnE1 in vivo using RNAi is feasible and has high antifibrotic activity. (Hepatology 2017;66:1242-1257). © 2017 by the American Association for the Study of Liver Diseases.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kanungo, Jyotshna
RNA silencing is used as a common method for investigating loss-of-function effects of genes of interest. In mammalian cells, RNA interference (RNAi) or RNA silencing can be achieved by transient siRNA (small or short interfering RNA) transfection or by stable shRNA (short hairpin RNA) systems. Various vectors are used for efficient delivery of shRNA. Lentiviral vectors offer an efficient delivery system for stable and long-term expression of the shRNA in mammalian cells. The widely used lentiviral pLKO.1 plasmid vector is very popular in RNAi studies. A large RNAi database, a TRC (the RNAi Consortium) library, was established based on themore » pLKO.1-TRC plasmid vector. This plasmid (also called pLKO.1-puro) has a puromycin-resistant gene for selection in mammalian cells along with designs for generating lentiviral particles as well for RNA silencing. While using the pLKO.1-puro TRC control shRNA plasmid for transfection in murine P19 embryonic stem (ES) cells, it was unexpectedly discovered that this plasmid vector induced robust endodermal differentiation. Since P19 ES cells are pluripotent and respond to external stimuli that have the potential to alter the phenotype and thus its stemness, other cell types used in RNA silencing studies do not display the obvious effect and therefore, may affect experiments in subtle ways that would go undetected. This study for the first time provides evidence that raises concern and warrants extreme caution while using the pLKO.1-puro control shRNA vector because of its unexpected non-specific effects on cellular integrity. - Highlights: • In P19 ES cells the pLKO.1-puro lentiviral control shRNA vector induced endodermal differentiation. • P19 ES cells harboring the pCDNA3 plasmid vector retained their stem-ness as opposed to those harboring the pLKO.1-puro vector. • P19 ES cells can serve as a sensor to determine vector safety. • Extreme caution is warranted while using the widely used pLKO.1-puro lentiviral vector for experimental and therapeutic designs.« less
Phosphorylation-specific status of RNAi triggers in pharmacokinetic and biodistribution analyses
Trubetskoy, Vladimir S.; Griffin, Jacob B.; Nicholas, Anthony L.; Nord, Eric M.; Xu, Zhao; Peterson, Ryan M.; Wooddell, Christine I.; Rozema, David B.; Wakefield, Darren H.; Lewis, David L.
2017-01-01
Abstract The RNA interference (RNAi)-based therapeutic ARC-520 for chronic hepatitis B virus (HBV) infection consists of a melittin-derived peptide conjugated to N-acetylgalactosamine for hepatocyte targeting and endosomal escape, and cholesterol-conjugated RNAi triggers, which together result in HBV gene silencing. To characterize the kinetics of RNAi trigger delivery and 5΄-phosphorylation of guide strands correlating with gene knockdown, we employed a peptide-nucleic acid (PNA) hybridization assay. A fluorescent sense strand PNA probe binding to RNAi duplex guide strands was coupled with anion exchange high performance liquid chromatography to quantitate guide strands and metabolites. Compared to PCR- or ELISA-based methods, this assay enables separate quantitation of non-phosphorylated full-length guide strands from 5΄-phosphorylated forms that may associate with RNA-induced silencing complexes (RISC). Biodistribution studies in mice indicated that ARC-520 guide strands predominantly accumulated in liver. 5΄-phosphorylation of guide strands was observed within 5 min after ARC-520 injection, and was detected for at least 4 weeks corresponding to the duration of HBV mRNA silencing. Guide strands detected in RISC by AGO2 immuno-isolation represented 16% of total 5΄-phosphorylated guide strands in liver, correlating with a 2.7 log10 reduction of HBsAg. The PNA method enables pharmacokinetic analysis of RNAi triggers, elucidates potential metabolic processing events and defines pharmacokinetic-pharmacodynamic relationships. PMID:28180327
RNA viruses and microRNAs: challenging discoveries for the 21st century
Swaminathan, Gokul; Martin-Garcia, Julio
2013-01-01
RNA viruses represent the predominant cause of many clinically relevant viral diseases in humans. Among several evolutionary advantages acquired by RNA viruses, the ability to usurp host cellular machinery and evade antiviral immune responses is imperative. During the past decade, RNA interference mechanisms, especially microRNA (miRNA)-mediated regulation of cellular protein expression, have revolutionized our understanding of host-viral interactions. Although it is well established that several DNA viruses express miRNAs that play crucial roles in their pathogenesis, expression of miRNAs by RNA viruses remains controversial. However, modulation of the miRNA machinery by RNA viruses may confer multiple benefits for enhanced viral replication and survival in host cells. In this review, we discuss the current literature on RNA viruses that may encode miRNAs and the varied advantages of engineering RNA viruses to express miRNAs as potential vectors for gene therapy. In addition, we review how different families of RNA viruses can alter miRNA machinery for productive replication, evasion of antiviral immune responses, and prolonged survival. We underscore the need to further explore the complex interactions of RNA viruses with host miRNAs to augment our understanding of host-virus interplay. PMID:24046280
Design of siRNA Therapeutics from the Molecular Scale
Angart, Phillip; Vocelle, Daniel; Chan, Christina; Walton, S. Patrick
2013-01-01
While protein-based therapeutics is well-established in the market, development of nucleic acid therapeutics has lagged. Short interfering RNAs (siRNAs) represent an exciting new direction for the pharmaceutical industry. These small, chemically synthesized RNAs can knock down the expression of target genes through the use of a native eukaryotic pathway called RNA interference (RNAi). Though siRNAs are routinely used in research studies of eukaryotic biological processes, transitioning the technology to the clinic has proven challenging. Early efforts to design an siRNA therapeutic have demonstrated the difficulties in generating a highly-active siRNA with good specificity and a delivery vehicle that can protect the siRNA as it is transported to a specific tissue. In this review article, we discuss design considerations for siRNA therapeutics, identifying criteria for choosing therapeutic targets, producing highly-active siRNA sequences, and designing an optimized delivery vehicle. Taken together, these design considerations provide logical guidelines for generating novel siRNA therapeutics. PMID:23976875
Structure of yeast Argonaute with guide RNA
Nakanishi, Kotaro; Weinberg, David E.; Bartel, David P.; Patel, Dinshaw J.
2012-01-01
The RNA-induced silencing complex, comprising Argonaute and guide RNA, mediates RNA interference. Here we report the 3.2 Å crystal structure of Kluyveromyces Argonaute (KpAGO) fortuitously complexed with guide RNA originating from small-RNA duplexes autonomously loaded and processed by recombinant KpAGO. Despite their diverse sequences, guide-RNA nucleotides 1–8 are positioned similarly, with sequence-independent contacts to bases, phosphates and 2′-hydroxyl groups pre-organizing the backbone of nucleotides 2–8 in a near–A-form conformation. Compared with prokaryotic Argonautes, KpAGO has numerous surface-exposed insertion segments, with a cluster of conserved insertions repositioning the N domain to enable full propagation of guide–target pairing. Compared with Argonautes in inactive conformations, KpAGO has a hydrogen-bond network that stabilizes an expanded and repositioned loop, which inserts an invariant glutamate into the catalytic pocket. Mutation analyses and analogies to Ribonuclease H indicate that insertion of this glutamate finger completes a universally conserved catalytic tetrad, thereby activating Argonaute for RNA cleavage. PMID:22722195
Protection from feed-forward amplification in an amplified RNAi mechanism
Pak, Julia; Maniar, Jay Mahesh; Mello, Cecilia Cabral; Fire, Andrew
2012-01-01
SUMMARY The effectiveness of RNA interference (RNAi) in many organisms is potentiated through the signal-amplifying activity of a targeted RNA directed RNA polymerase (RdRP) system that can convert a small population of exogenously-encountered dsRNA fragments into an abundant internal pool of small interfering RNA (siRNA). As for any biological amplification system, we expect an underlying architecture that will limit the ability of a randomly encountered trigger to produce an uncontrolled and self-escalating response. Investigating such limits in C. elegans, we find that feed-forward amplification is limited by a critical biosynthetic and structural distinction at the RNA level between (i) triggers that can produce amplification and (ii) siRNA products of the amplification reaction. By assuring that initial (primary) siRNAs can act as triggers but not templates for activation, and that the resulting (secondary) siRNAs can enforce gene silencing on additional targets without unbridled trigger amplification, the system achieves substantial but fundamentally limited signal amplification. PMID:23141544
Ongvarrasopone, Chalermporn; Chomchay, Ekapol; Panyim, Sakol
2010-10-01
PmRab7 is a Penaeus monodon small GTPase protein possibly involved in replication of several shrimp viruses. In this study RNA interference (RNAi) using double-stranded RNA (dsRNA) targeting PmRab7 gene (dsRNA-PmRab7) was employed to silence the expression of PmRab7 to investigate the inhibitory effect on Laem-Singh virus (LSNV) replication. Injection of dsRNA-PmRab7 24h before challenge with the virus resulted in a drastic decrease of PmRab7 mRNA and complete inhibition of LSNV replication at 3 days post-challenge. In a therapeutic mode, shrimp injected with dsRNA-PmRab7 1 day but not at 3 or 5 days post-LSNV challenge resulted in inhibition of LSNV replication. These results pave the way to use dsRNA-PmRab7 to prevent or cure LSNV infection in shrimp. Copyright © 2010 Elsevier B.V. All rights reserved.
Exaptive origins of regulated mRNA decay in eukaryotes.
Hamid, Fursham M; Makeyev, Eugene V
2016-09-01
Eukaryotic gene expression is extensively controlled at the level of mRNA stability and the mechanisms underlying this regulation are markedly different from their archaeal and bacterial counterparts. We propose that two such mechanisms, nonsense-mediated decay (NMD) and motif-specific transcript destabilization by CCCH-type zinc finger RNA-binding proteins, originated as a part of cellular defense against RNA pathogens. These branches of the mRNA turnover pathway might have been used by primeval eukaryotes alongside RNA interference to distinguish their own messages from those of RNA viruses and retrotransposable elements. We further hypothesize that the subsequent advent of "professional" innate and adaptive immunity systems allowed NMD and the motif-triggered mechanisms to be efficiently repurposed for regulation of endogenous cellular transcripts. This scenario explains the rapid emergence of archetypical mRNA destabilization pathways in eukaryotes and argues that other aspects of post-transcriptional gene regulation in this lineage might have been derived through a similar exaptation route. © 2016 The Authors BioEssays Published by WILEY Periodicals, Inc.
Bioengineered Nanoparticles for siRNA delivery
Kozielski, Kristen L.; Tzeng, Stephany Y.; Green, Jordan J.
2014-01-01
Short interfering RNA (siRNA) has been an important laboratory tool in the last two decades and has allowed researchers to better understand the functions of non-protein-coding genes through RNA interference (RNAi). Although RNAi holds great promise for this purpose as well as for treatment of many diseases, efforts at using siRNA have been hampered by the difficulty of safely and effectively introducing it into cells of interest, both in vitro and in vivo. To overcome this challenge, many biomaterials and nanoparticles (NPs) have been developed and optimized for siRNA delivery, often taking cues from the DNA delivery field, although different barriers exist for these two types of molecules. In this review, we discuss general properties of biomaterials and nanoparticles that are necessary for effective nucleic acid delivery. We also discuss specific examples of bioengineered materials, including lipid-based NPs, polymeric NPs, inorganic NPs, and RNA-based NPs, which clearly illustrate the problems and successes in siRNA delivery. PMID:23821336
Study on Interference Suppression Algorithms for Electronic Noses: A Review
Liang, Zhifang; Zhang, Ci; Sun, Hao; Liu, Tao
2018-01-01
Electronic noses (e-nose) are composed of an appropriate pattern recognition system and a gas sensor array with a certain degree of specificity and broad spectrum characteristics. The gas sensors have their own shortcomings of being highly sensitive to interferences which has an impact on the detection of target gases. When there are interferences, the performance of the e-nose will deteriorate. Therefore, it is urgent to study interference suppression techniques for e-noses. This paper summarizes the sources of interferences and reviews the advances made in recent years in interference suppression for e-noses. According to the factors which cause interference, interferences can be classified into two types: interference caused by changes of operating conditions and interference caused by hardware failures. The existing suppression methods were summarized and analyzed from these two aspects. Since the interferences of e-noses are uncertain and unstable, it can be found that some nonlinear methods have good effects for interference suppression, such as methods based on transfer learning, adaptive methods, etc. PMID:29649152
Kumar, Naveen; Barua, Sanjay; Riyesh, Thachamvally; Chaubey, Kundan K; Rawat, Krishan Dutt; Khandelwal, Nitin; Mishra, Anil K; Sharma, Nitika; Chandel, Surender S; Sharma, Shalini; Singh, Manoj K; Sharma, Dinesh K; Singh, Shoor V; Tripathi, Bhupendra N
2016-01-01
Successful purification of multiple viruses from mixed infections remains a challenge. In this study, we investigated peste des petits ruminants virus (PPRV) and foot-and-mouth disease virus (FMDV) mixed infection in goats. Rather than in a single cell type, cytopathic effect (CPE) of the virus was observed in cocultured Vero/BHK-21 cells at 6th blind passage (BP). PPRV, but not FMDV could be purified from the virus mixture by plaque assay. Viral RNA (mixture) transfection in BHK-21 cells produced FMDV but not PPRV virions, a strategy which we have successfully employed for the first time to eliminate the negative-stranded RNA virus from the virus mixture. FMDV phenotypes, such as replication competent but noncytolytic, cytolytic but defective in plaque formation and, cytolytic but defective in both plaque formation and standard FMDV genome were observed respectively, at passage level BP8, BP15 and BP19 and hence complicated virus isolation in the cell culture system. Mixed infection was not found to induce any significant antigenic and genetic diversity in both PPRV and FMDV. Further, we for the first time demonstrated the viral interference between PPRV and FMDV. Prior transfection of PPRV RNA, but not Newcastle disease virus (NDV) and rotavirus RNA resulted in reduced FMDV replication in BHK-21 cells suggesting that the PPRV RNA-induced interference was specifically directed against FMDV. On long-term coinfection of some acute pathogenic viruses (all possible combinations of PPRV, FMDV, NDV and buffalopox virus) in Vero cells, in most cases, one of the coinfecting viruses was excluded at passage level 5 suggesting that the long-term coinfection may modify viral persistence. To the best of our knowledge, this is the first documented evidence describing a natural mixed infection of FMDV and PPRV. The study not only provides simple and reliable methodologies for isolation and purification of two epidemiologically and economically important groups of viruses, but could also help in establishing better guidelines for trading animals that could transmit further infections and epidemics in disease free nations.
Yang, Mei; Jiang, Chunfan; Chen, Hua; Nian, Yan; Bai, Zhimiao; Ha, Chunfang
2015-08-20
Endometriosis, which shares certain characteristics with cancers, may cause abnormal expression of proteins involved in cell migration. Endometrial epithelial cells (EECs) are believed to play an important role in endometriotic migration. The aim of this study was to investigate the relationship between the expression of osteopontin (OPN) and matrix metalloproteinase-9 (MMP-9) in endometriotic migration. We performed primary culture of EECs and investigated the expression of OPN and MMP-9 in EECs regulated by 17beta-estradiol (E2). OPN-specific siRNA interference was used to down-regulate OPN and to explore the corresponding change in MMP-9 expression. Real-time RT-PCR, western blot analysis and flow cytometry were used to determine the expression levels of OPN and MMP-9. Gelatin zymography was performed to observe the enzymatic activity of MMP-9 in conditioned media. Transwell and wound scratch assays were performed to investigate the migration ability of EECs. The expression levels of OPN and MMP-9 in normal EECs (NEECs) were inferior to those in EECs from patients with endometriosis (EEECs). The expression levels of OPN and MMP-9 from stage III/IV EEECs and secretory-phase EECs were higher than those of stage I/II EEECs or proliferative-phase EECs. The expression levels of OPN and MMP-9 in EEECs were increased by E2 treatment and remarkably decreased by siRNA interference. Active MMP-9 expression increased with E2 treatment and decreased with siRNA treatment in EEECs compared with the same treatments in NEECs. The migratory abilities of EEECs were enhanced after cells were treated with E2; in contrast, these abilities were reduced by siRNA interference. In NEECs, active MMP-9 and cellular migration abilities were only minimally influenced by E2 and siRNA treatment. The present study suggests that the up-regulation of MMP-9 via activation of OPN induced by estrogen may correlate with the migration of endometrial epithelial cells in patients with endometriosis.
Kumar, Naveen; Barua, Sanjay; Riyesh, Thachamvally; Chaubey, Kundan K.; Rawat, Krishan Dutt; Khandelwal, Nitin; Mishra, Anil K.; Sharma, Nitika; Chandel, Surender S.; Sharma, Shalini; Singh, Manoj K.; Sharma, Dinesh K.; Singh, Shoor V.; Tripathi, Bhupendra N.
2016-01-01
Successful purification of multiple viruses from mixed infections remains a challenge. In this study, we investigated peste des petits ruminants virus (PPRV) and foot-and-mouth disease virus (FMDV) mixed infection in goats. Rather than in a single cell type, cytopathic effect (CPE) of the virus was observed in cocultured Vero/BHK-21 cells at 6th blind passage (BP). PPRV, but not FMDV could be purified from the virus mixture by plaque assay. Viral RNA (mixture) transfection in BHK-21 cells produced FMDV but not PPRV virions, a strategy which we have successfully employed for the first time to eliminate the negative-stranded RNA virus from the virus mixture. FMDV phenotypes, such as replication competent but noncytolytic, cytolytic but defective in plaque formation and, cytolytic but defective in both plaque formation and standard FMDV genome were observed respectively, at passage level BP8, BP15 and BP19 and hence complicated virus isolation in the cell culture system. Mixed infection was not found to induce any significant antigenic and genetic diversity in both PPRV and FMDV. Further, we for the first time demonstrated the viral interference between PPRV and FMDV. Prior transfection of PPRV RNA, but not Newcastle disease virus (NDV) and rotavirus RNA resulted in reduced FMDV replication in BHK-21 cells suggesting that the PPRV RNA-induced interference was specifically directed against FMDV. On long-term coinfection of some acute pathogenic viruses (all possible combinations of PPRV, FMDV, NDV and buffalopox virus) in Vero cells, in most cases, one of the coinfecting viruses was excluded at passage level 5 suggesting that the long-term coinfection may modify viral persistence. To the best of our knowledge, this is the first documented evidence describing a natural mixed infection of FMDV and PPRV. The study not only provides simple and reliable methodologies for isolation and purification of two epidemiologically and economically important groups of viruses, but could also help in establishing better guidelines for trading animals that could transmit further infections and epidemics in disease free nations. PMID:27227480
Maxwell, Michele M.; Pasinelli, Piera; Kazantsev, Aleksey G.; Brown, Robert H.
2004-01-01
Amyotrophic lateral sclerosis (ALS) is a progressive and fatal neurodegenerative disorder resulting from selective death of motor neurons in the brain and spinal cord. In ≈25% of familial ALS cases, the disease is caused by dominantly acting point mutations in the gene encoding cytosolic Cu,Zn superoxide dismutase (SOD1). In cell culture and in rodent models of ALS, mutant SOD1 proteins exhibit dose-dependent toxicity; thus, agents that reduce mutant protein expression would be powerful therapeutic tools. A wealth of recent evidence has demonstrated that the mechanism of RNA-mediated interference (RNAi) can be exploited to achieve potent and specific gene silencing in vitro and in vivo. We have evaluated the utility of RNAi for selective silencing of mutant SOD1 expression in cultured cells and have identified small interfering RNAs capable of specifically inhibiting expression of ALS-linked mutant, but not wild-type, SOD1. We have investigated the functional effects of RNAi-mediated silencing of mutant SOD1 in cultured murine neuroblastoma cells. In this model, stable expression of mutant, but not wild-type, human SOD1 sensitizes cells to cytotoxic stimuli. We find that silencing of mutant SOD1 protects these cells against cyclosporin A-induced cell death. These results demonstrate a positive physiological effect caused by RNAi-mediated silencing of a dominant disease allele. The present study further supports the therapeutic potential of RNAi-based methods for the treatment of inherited human diseases, including ALS. PMID:14981234
Shah, Shiraz A; Alkhnbashi, Omer S; Behler, Juliane; Han, Wenyuan; She, Qunxin; Hess, Wolfgang R; Garrett, Roger A; Backofen, Rolf
2018-06-19
A study was undertaken to identify conserved proteins that are encoded adjacent to cas gene cassettes of Type III CRISPR-Cas (Clustered Regularly Interspaced Short Palindromic Repeats - CRISPR associated) interference modules. Type III modules have been shown to target and degrade dsDNA, ssDNA and ssRNA and are frequently intertwined with cofunctional accessory genes, including genes encoding CRISPR-associated Rossman Fold (CARF) domains. Using a comparative genomics approach, and defining a Type III association score accounting for coevolution and specificity of flanking genes, we identified and classified 39 new Type III associated gene families. Most archaeal and bacterial Type III modules were seen to be flanked by several accessory genes, around half of which did not encode CARF domains and remain of unknown function. Northern blotting and interference assays in Synechocystis confirmed that one particular non-CARF accessory protein family was involved in crRNA maturation. Non-CARF accessory genes were generally diverse, encoding nuclease, helicase, protease, ATPase, transporter and transmembrane domains with some encoding no known domains. We infer that additional families of non-CARF accessory proteins remain to be found. The method employed is scalable for potential application to metagenomic data once automated pipelines for annotation of CRISPR-Cas systems have been developed. All accessory genes found in this study are presented online in a readily accessible and searchable format for researchers to audit their model organism of choice: http://accessory.crispr.dk .
Li-Byarlay, Hongmei; Li, Yang; Stroud, Hume; Feng, Suhua; Newman, Thomas C.; Kaneda, Megan; Hou, Kirk K.; Worley, Kim C.; Elsik, Christine G.; Wickline, Samuel A.; Jacobsen, Steven E.; Ma, Jian; Robinson, Gene E.
2013-01-01
Studies of DNA methylation from fungi, plants, and animals indicate that gene body methylation is ancient and highly conserved in eukaryotic genomes, but its role has not been clearly defined. It has been postulated that regulation of alternative splicing of transcripts was an original function of DNA methylation, but a direct experimental test of the effect of methylation on alternative slicing at the whole genome level has never been performed. To do this, we developed a unique method to administer RNA interference (RNAi) in a high-throughput and noninvasive manner and then used it to knock down the expression of DNA methyl-transferase 3 (dnmt3), which is required for de novo DNA methylation. We chose the honey bee (Apis mellifera) for this test because it has recently emerged as an important model organism for studying the effects of DNA methylation on development and social behavior, and DNA methylation in honey bees is predominantly on gene bodies. Here we show that dnmt3 RNAi decreased global genomic methylation level as expected and in addition caused widespread and diverse changes in alternative splicing in fat tissue. Four different types of splicing events were affected by dnmt3 gene knockdown, and change in two types, exon skipping and intron retention, was directly related to decreased methylation. These results demonstrate that one function of gene body DNA methylation is to regulate alternative splicing. PMID:23852726
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.
Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige
2007-07-26
Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.
Bacterial delivery of RNAi effectors: transkingdom RNAi.
Lage, Hermann; Krühn, Andrea
2010-08-18
RNA interference (RNAi) represents a high effective mechanism for specific inhibition of mRNA expression. Besides its potential as a powerful laboratory tool, the RNAi pathway appears to be promising for therapeutic utilization. For development of RNA interference (RNAi)-based therapies, delivery of RNAi-mediating agents to target cells is one of the major obstacles. A novel strategy to overcome this hurdle is transkingdom RNAi (tkRNAi). This technology uses non-pathogenic bacteria, e.g. Escherichia coli, to produce and deliver therapeutic short hairpin RNA (shRNA) into target cells to induce RNAi. A first-generation tkRNAi-mediating vector, TRIP, contains the bacteriophage T7 promoter for expression regulation of a therapeutic shRNA of interest. Furthermore, TRIP has the Inv locus from Yersinia pseudotuberculosis that encodes invasin, which permits natural noninvasive bacteria to enter beta1-integrin-positive mammalian cells and the HlyA gene from Listeria monocytogenes, which produces listeriolysin O. This enzyme allows the therapeutic shRNA to escape from entry vesicles within the cytoplasm of the target cell. TRIP constructs are introduced into a competent non-pathogenic Escherichia coli strain, which encodes T7 RNA polymerase necessary for the T7 promoter-driven synthesis of shRNAs. A well-characterized cancer-associated target molecule for different RNAi strategies is ABCB1 (MDR1/P-glycoprotein, MDR1/P-gp). This ABC-transporter acts as a drug extrusion pump and mediates the "classical" ABCB1-mediated multidrug resistance (MDR) phenotype of human cancer cells which is characterized by a specific cross resistance pattern. Different ABCB1-expressing MDR cancer cells were treated with anti-ABCB1 shRNA expression vector bearing E. coli. This procedure resulted in activation of the RNAi pathways within the cancer cells and a considerable down regulation of the ABCB1 encoding mRNA as well as the corresponding drug extrusion pump. Accordingly, drug accumulation was enhanced in the pristine drug-resistant cancer cells and the MDR phenotype was reversed. By means of this model the data provide the proof-of-concept that tkRNAi is suitable for modulation of cancer-associated factors, e.g. ABCB1, in human cancer cells.
Cipolla, Gabriel A.; Park, Jong K.; de Oliveira, Liana A.; Lobo-Alves, Sara Cristina; de Almeida, Rodrigo C.; Farias, Ticiana D. J.; Lemos, Débora de S.; Malheiros, Danielle; Lavker, Robert M.; Petzl-Erler, Maria Luiza
2016-01-01
Genetic variations mapping to 3’ untranslated regions (3’UTRs) may overlap with microRNA (miRNA) binding sites, therefore potentially interfering with translation inhibition or messenger RNA (mRNA) degradation. The aim of this study was to investigate whether single nucleotide polymorphisms (SNPs) located within the 3’UTRs of six candidate genes and predicted to interfere with miRNA ligation could account for disease-relevant differential mRNA levels. Focusing on pemphigus foliaceus (PF) – an autoimmune blistering skin condition with unique endemic patterns – we investigated if nine 3’UTR SNPs from the CD1D, CTLA4, KLRD1, KLRG1, NKG7, and TNFSF13B genes differentially expressed in PF were disease-associated. The heterozygous genotype of the KLRG1 rs1805672 polymorphism was associated with increased predisposition to PF (A/G vs. A/A: P=0.038; OR=1.60), and a trend for augmented susceptibility was observed for carriers of the G allele (P=0.094; OR=1.44). In silico analyses suggested that rs1805672 G allele could disrupt binding of miR-584-5p, and indicated rs1805672 as an expression Quantitative Trait Locus (eQTL), with an effect on KLRG1 gene expression. Dual-luciferase assay showed that miR-584-5p mediated approximately 50% downregulation of the reporter gene’s activity through the 3’UTR of KLRG1 harboring rs1805672 A allele (vs. miRNA-negative condition, P=0.006). This silencing relationship was lost after site-directed mutation to G allele (vs. miRNA-negative condition, P=0.391; vs. rs1805672 A allele, P=0.005). Collectively, these results suggest that a disease-associated SNP located within the 3’UTR of KLRG1 directly interferes with miR-584-5p binding, allowing for KLRG1 mRNA differential accumulation, which in turn may contribute to pathogenesis of autoimmune diseases, such as pemphigus. PMID:27424220
Cipolla, Gabriel A; Park, Jong Kook; de Oliveira, Liana A; Lobo-Alves, Sara Cristina; de Almeida, Rodrigo C; Farias, Ticiana D J; Lemos, Débora de S; Malheiros, Danielle; Lavker, Robert M; Petzl-Erler, Maria Luiza
2016-10-01
Genetic variations mapping to 3' untranslated regions (3'UTRs) may overlap with microRNA (miRNA) binding sites, therefore potentially interfering with translation inhibition or messenger RNA (mRNA) degradation. The aim of this study was to investigate whether single nucleotide polymorphisms (SNPs) located within the 3'UTRs of six candidate genes and predicted to interfere with miRNA ligation could account for disease-relevant differential mRNA levels. Focusing on pemphigus foliaceus (PF) - an autoimmune blistering skin condition with unique endemic patterns - we investigated whether nine 3'UTR SNPs from the CD1D, CTLA4, KLRD1, KLRG1, NKG7, and TNFSF13B genes differentially expressed in PF were disease-associated. The heterozygous genotype of the KLRG1 rs1805672 polymorphism was associated with increased predisposition to PF (A/G vs. A/A: P=0.038; OR=1.60), and a trend for augmented susceptibility was observed for carriers of the G allele (P=0.094; OR=1.44). In silico analyses suggested that rs1805672 G allele could disrupt binding of miR-584-5p, and indicated rs1805672 as an expression Quantitative Trait Locus (eQTL), with an effect on KLRG1 gene expression. Dual-luciferase assay showed that miR-584-5p mediated approximately 50% downregulation of the reporter gene's activity through the 3'UTR of KLRG1 harboring rs1805672 A allele (vs. miRNA-negative condition, P=0.006). This silencing relationship was lost after site-directed mutation to G allele (vs. miRNA-negative condition, P=0.391; vs. rs1805672 A allele, P=0.005). Collectively, these results suggest that a disease-associated SNP located within the 3'UTR of KLRG1 directly interferes with miR-584-5p binding, allowing for KLRG1 mRNA differential accumulation, which in turn may contribute to pathogenesis of autoimmune diseases, such as pemphigus. Copyright © 2016 Elsevier B.V. All rights reserved.