Accumulation of dsRNA in endosomes contributes to inefficient RNA interference in the fall armyworm, Spodoptera frugiperda.

PubMed

Yoon, June-Sun; Gurusamy, Dhandapani; Palli, Subba Reddy

2017-11-01

RNA interference (RNAi) efficiency varies among insects studied. The barriers for successful RNAi include the presence of double-stranded ribonucleases (dsRNase) in the lumen and hemolymph that could potentially digest double-stranded RNA (dsRNA) and the variability in the transport of dsRNA into and within the cells. We recently showed that the dsRNAs are transported into lepidopteran cells, but they are not processed into small interference RNAs (siRNAs) because they are trapped in acidic bodies. In the current study, we focused on the identification of acidic bodies in which dsRNAs accumulate in Sf9 cells. Time-lapse imaging studies showed that dsRNAs enter Sf9 cells and accumulate in acidic bodies within 20 min after their addition to the medium. CypHer-5E-labeled dsRNA also accumulated in the midgut and fat body dissected from Spodoptera frugiperda larvae with similar patterns observed in Sf9 cells. Pharmacological inhibitor assays showed that the dsRNAs use clathrin mediated endocytosis pathway for transport into the cells. We investigated the potential dsRNA accumulation sites employing LysoTracker and double labeling experiments using the constructs to express a fusion of green fluorescence protein with early or late endosomal marker proteins and CypHer-5E-labeled dsRNA. Interestingly, CypHer-5E-labeled dsRNA accumulated predominantly in early and late endosomes. These data suggest that entrapment of internalized dsRNA in endosomes is one of the major factors contributing to inefficient RNAi response in lepidopteran insects. Copyright © 2017 Elsevier Ltd. All rights reserved.

RNA interference can target pre-mRNA: consequences for gene expression in a Caenorhabditis elegans operon.

PubMed Central

Bosher, J M; Dufourcq, P; Sookhareea, S; Labouesse, M

1999-01-01

In nematodes, flies, trypanosomes, and planarians, introduction of double-stranded RNA results in sequence-specific inactivation of gene function, a process termed RNA interference (RNAi). We demonstrate that RNAi against the Caenorhabditis elegans gene lir-1, which is part of the lir-1/lin-26 operon, induced phenotypes very different from a newly isolated lir-1 null mutation. Specifically, lir-1(RNAi) induced embryonic lethality reminiscent of moderately strong lin-26 alleles, whereas the lir-1 null mutant was viable. We show that the lir-1(RNAi) phenotypes resulted from a severe loss of lin-26 gene expression. In addition, we found that RNAi directed against lir-1 or lin-26 introns induced similar phenotypes, so we conclude that lir-1(RNAi) targets the lir-1/lin-26 pre-mRNA. This provides direct evidence that RNA interference can prevent gene expression by targeting nuclear transcripts. Our results highlight that caution may be necessary when interpreting RNA interference without the benefit of mutant alleles. PMID:10545456

EGFP-EGF1-Conjugated PLGA Nanoparticles for Targeted Delivery of siRNA into Injured Brain Microvascular Endothelial Cells for Efficient RNA Interference

PubMed Central

Chen, Chen; Mei, Heng; Shi, Wei; Deng, Jun; Zhang, Bo; Guo, Tao; Wang, Huafang; Hu, Yu

2013-01-01

Injured endothelium is an important target for drug and/or gene therapy because brain microvascular endothelial cells (BMECs) play critical roles in various pathophysiological conditions. RNA-mediated gene silencing presents a new therapeutic approach for treating such diseases, but major challenge is to ensure minimal toxicity and target delivery of siRNA to injured BMECs. Injured BMECs overexpress tissue factor (TF), which the fusion protein EGFP-EGF1 could be targeted to. In this study, TNF alpha (TNF-α) was chosen as a stimulus for primary BMECs to produce injured endothelium in vitro. The EGFP-EGF1-PLGA nanoparticles (ENPs) with loaded TF-siRNA were used as a new carrier for targeted delivery to the injured BMECs. The nanoparticles then produced intracellular RNA interference against TF. We compared ENP-based transfections with NP-mediated transfections, and our studies show that the ENP-based transfections result in a more efficient downregulation of TF. Our findings also show that the TF siRNA-loaded ENPs had minimal toxicity, with almost 96% of the cells viable 24 h after transfection while Lipofectamine-based transfections resulted in only 75% of the cells. Therefore, ENP-based transfection could be used for efficient siRNA transfection to injured BMECs and for efficient RNA interference (RNAi). This transfection could serve as a potential treatment for diseases, such as stroke, atherosclerosis and cancer. PMID:23593330

Efficient delivery of RNA interference oligonucleotides to polarized airway epithelia in vitro

PubMed Central

Ramachandran, Shyam; Krishnamurthy, Sateesh; Jacobi, Ashley M.; Wohlford-Lenane, Christine; Behlke, Mark A.; Davidson, Beverly L.

2013-01-01

Polarized and pseudostratified primary airway epithelia present barriers that significantly reduce their transfection efficiency and the efficacy of RNA interference oligonucleotides. This creates an impediment in studies of the airway epithelium, diminishing the utility of loss-of-function as a research tool. Here we outline methods to introduce RNAi oligonucleotides into primary human and porcine airway epithelia grown at an air-liquid interface and difficult-to-transfect transformed epithelial cell lines grown on plastic. At the time of plating, we reverse transfect small-interfering RNA (siRNA), Dicer-substrate siRNA, or microRNA oligonucleotides into cells by use of lipid or peptide transfection reagents. Using this approach we achieve significant knockdown in vitro of hypoxanthine-guanine phosphoribosyltransferase, IL-8, and CFTR expression at the mRNA and protein levels in 1–3 days. We also attain significant reduction of secreted IL-8 in polarized primary pig airway epithelia 3 days posttransfection and inhibition of CFTR-mediated Cl− conductance in polarized air-liquid interface cultures of human airway epithelia 2 wk posttransfection. These results highlight an efficient means to deliver RNA interference reagents to airway epithelial cells and achieve significant knockdown of target gene expression and function. The ability to reliably conduct loss-of-function assays in polarized primary airway epithelia offers benefits to research in studies of epithelial cell homeostasis, candidate gene function, gene-based therapeutics, microRNA biology, and targeting the replication of respiratory viruses. PMID:23624792

ABCE1 Is a Highly Conserved RNA Silencing Suppressor

PubMed Central

Kärblane, Kairi; Gerassimenko, Jelena; Nigul, Lenne; Piirsoo, Alla; Smialowska, Agata; Vinkel, Kadri; Kylsten, Per; Ekwall, Karl; Swoboda, Peter; Truve, Erkki; Sarmiento, Cecilia

2015-01-01

ATP-binding cassette sub-family E member 1 (ABCE1) is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference. PMID:25659154

Prokaryotic Argonautes - variations on the RNA interference theme.

PubMed

van der Oost, John; Swarts, Daan C; Jore, Matthijs M

2014-04-15

The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes.

Prokaryotic Argonautes - variations on the RNA interference theme

PubMed Central

van der Oost, John; Swarts, Daan C.; Jore, Matthijs M.

2014-01-01

The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes. PMID:28357239

Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences.

PubMed

Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

2018-01-01

RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccas e 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like ( Sil1 ), scavenger receptor class C ( Src ), and scavenger receptor class B ( Srb3 and Srb4 ) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean.

Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences

PubMed Central

Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

2018-01-01

RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccase 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like (Sil1), scavenger receptor class C (Src), and scavenger receptor class B (Srb3 and Srb4) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean. PMID:29773992

Generation of Constructs for DNA-Directed RNA Interference of Venezuelan Equine Encephalitis Virus Genes

DTIC Science & Technology

2006-12-01

Defence Research and Recherche et developpement Development Canada pour la defense Canada DEFENCE I I! / DEFENSE Generation of Constructs for DNA... research into specific antiviral strategies. One such strategy is RNA interference. RNA interference involves the targeted silencing of a gene using...of an effective vaccine or therapeutic for VEE, a highly infectious virus, underscores the need for research in this area. In addition, the potential

The protective effect of Hif3a RNA interference and HIF-prolyl hydroxylase inhibition on cardiomyocytes under anoxia-reoxygenation.

PubMed

Drevytska, T; Gonchar, E; Okhai, I; Lynnyk, O; Mankovska, I; Klionsky, D; Dosenko, V

2018-06-01

The aim of this study was to investigate the molecular mechanisms underlying the protective effects of hypoxia-inducible factor (HIF) signaling pathway activation in cardiomyocytes under anoxia-reoxygenation (A/R) injury. In this study, rat neonatal cardiomyocytes were pretreated with anti-Hif3A/Hif-3α siRNA or HIF-prolyl hydroxylase inhibitor prior to A/R injury. Our results showed that both HIF3A silencing and HIF-prolyl hydroxylase inhibition effectively increased the cell viability during A/R, led to changes in mRNA expression of HIF1-target genes, and reduced the loss of mitochondrial membrane potential (Δψ m ). Furthermore, application of anti-Hif3a siRNA led to an increase in mRNA expression of Epo, Igf1, Slc2a1/Glut-1, and Slc2a4/Glut-4. Similar results were observed with HIF-prolyl hydroxylase inhibition, which additionally upregulated the mRNA expression of Epor, Tert, and Pdk1. Hif3a RNA-interference and application of HIF-prolyl hydroxylase inhibitor during A/R modelling led to an increase of Δψ m on 11.5 and 11.9 mV respectively, compared to the control groups. Thus, Hif3a RNA interference and HIF-prolyl hydroxylase inhibition protect cardiomyocytes against A/R injury via the HIF signaling pathway. Copyright © 2018 Elsevier Inc. All rights reserved.

Fluorescence-based high-throughput screening of dicer cleavage activity.

PubMed

Podolska, Katerina; Sedlak, David; Bartunek, Petr; Svoboda, Petr

2014-03-01

Production of small RNAs by ribonuclease III Dicer is a key step in microRNA and RNA interference pathways, which employ Dicer-produced small RNAs as sequence-specific silencing guides. Further studies and manipulations of microRNA and RNA interference pathways would benefit from identification of small-molecule modulators. Here, we report a study of a fluorescence-based in vitro Dicer cleavage assay, which was adapted for high-throughput screening. The kinetic assay can be performed under single-turnover conditions (35 nM substrate and 70 nM Dicer) in a small volume (5 µL), which makes it suitable for high-throughput screening in a 1536-well format. As a proof of principle, a small library of bioactive compounds was analyzed, demonstrating potential of the assay.

Intergenic Transcriptional Interference Is Blocked by RNA Polymerase III Transcription Factor TFIIIB in Saccharomyces cerevisiae

PubMed Central

Korde, Asawari; Rosselot, Jessica M.; Donze, David

2014-01-01

The major function of eukaryotic RNA polymerase III is to transcribe transfer RNA, 5S ribosomal RNA, and other small non-protein-coding RNA molecules. Assembly of the RNA polymerase III complex on chromosomal DNA requires the sequential binding of transcription factor complexes TFIIIC and TFIIIB. Recent evidence has suggested that in addition to producing RNA transcripts, chromatin-assembled RNA polymerase III complexes may mediate additional nuclear functions that include chromatin boundary, nucleosome phasing, and general genome organization activities. This study provides evidence of another such “extratranscriptional” activity of assembled RNA polymerase III complexes, which is the ability to block progression of intergenic RNA polymerase II transcription. We demonstrate that the RNA polymerase III complex bound to the tRNA gene upstream of the Saccharomyces cerevisiae ATG31 gene protects the ATG31 promoter against readthrough transcriptional interference from the upstream noncoding intergenic SUT467 transcription unit. This protection is predominately mediated by binding of the TFIIIB complex. When TFIIIB binding to this tRNA gene is weakened, an extended SUT467–ATG31 readthrough transcript is produced, resulting in compromised ATG31 translation. Since the ATG31 gene product is required for autophagy, strains expressing the readthrough transcript exhibit defective autophagy induction and reduced fitness under autophagy-inducing nitrogen starvation conditions. Given the recent discovery of widespread pervasive transcription in all forms of life, protection of neighboring genes from intergenic transcriptional interference may be a key extratranscriptional function of assembled RNA polymerase III complexes and possibly other DNA binding proteins. PMID:24336746

Using RNA Interference to Reveal Genetic Vulnerabilities in Human Cancer Cells

DTIC Science & Technology

2005-07-01

pl of RNase/DNase free water and performed PCR amplification in 50pl reaction volumes using Invitrogen’s Platinum® Pfx DNA Polymerase . To obtain a...destroyed1’ 2. This pathway, known as RNA interference (RNAi), has been exploited in organisms ranging from plants to fungi to animals for...experimentally alter its targeting capability. Indeed such strategies have previously succeeded in both plants and animals23󈧜. My initial studies

Biochemical and Structural Studies of RNA Modification and Repair

ERIC Educational Resources Information Center

Chan, Chio Mui

2009-01-01

RNA modification, RNA interference, and RNA repair are important events in the cell. This thesis presents three projects related to these three fields. By using both biochemical and structural methods, we characterized enzymatic activities of pseudouridine synthase TruD, solved the structure of "A. aeolicus" GidA, and reconstituted a novel…

Symbiont-mediated RNA interference in insects

PubMed Central

Whitten, Miranda M. A.; Facey, Paul D.; Del Sol, Ricardo; Fernández-Martínez, Lorena T.; Evans, Meirwyn C.; Mitchell, Jacob J.; Bodger, Owen G.

2016-01-01

RNA interference (RNAi) methods for insects are often limited by problems with double-stranded (ds) RNA delivery, which restricts reverse genetics studies and the development of RNAi-based biocides. We therefore delegated to insect symbiotic bacteria the task of: (i) constitutive dsRNA synthesis and (ii) trauma-free delivery. RNaseIII-deficient, dsRNA-expressing bacterial strains were created from the symbionts of two very diverse pest species: a long-lived blood-sucking bug, Rhodnius prolixus, and a short-lived globally invasive polyphagous agricultural pest, western flower thrips (Frankliniella occidentalis). When ingested, the manipulated bacteria colonized the insects, successfully competed with the wild-type microflora, and sustainably mediated systemic knockdown phenotypes that were horizontally transmissible. This represents a significant advance in the ability to deliver RNAi, potentially to a large range of non-model insects. PMID:26911963

Lipopolysaccharide promotes pulmonary fibrosis in acute respiratory distress syndrome (ARDS) via lincRNA-p21 induced inhibition of Thy-1 expression.

PubMed

Zhou, Wen-Qin; Wang, Peng; Shao, Qiu-Ping; Wang, Jian

2016-08-01

Acute respiratory distress syndrome (ARDS) is a common clinical disorder characterized by pulmonary edema leading to acute lung damage and arterial hypoxemia. Pulmonary fibrosis is a progressive, fibrotic lung disorder, whose pathogenesis in ARDS remains speculative. LincRNA-p21 was a novel regulator of cell proliferation, apoptosis and DNA damage response. This study aims to investigate the effects and mechanism of lincRNA-p21 on pulmonary fibrosis in ARDS. Purified 10 mg/kg LPS was dropped into airways of C57BL/6 mice. Expression levels of lincRNA-p21 and Thy-1 were measured by real-time PCR or western blotting. Proliferation of lung fibroblasts was analyzed by BrdU incorporation assay. Lung and BAL collagen contents were estimated using colorimetric Sircol assay. LincRNA-p21 expression was time-dependently increased and Thy-1 expression was time-dependently reduced in a mouse model of ARDS and in LPS-treated lung fibroblasts. Meanwhile, lung fibroblast proliferation was also time-dependently elevated in LPS-treated lung fibroblasts. In addition, lung fibroblast proliferation could be promoted by lincRNA-p21 overexpression and LPS treatment, however, the elevated lung fibroblast proliferation was further abrogated by Thy-1 overexpression or lincRNA-p21 interference. And Thy-1 interference could elevate cell viability of lung fibroblasts and rescue the reduction of lung fibroblast proliferation induced by lincRNA-p21 interference. Moreover, lincRNA-p21 overexpression dramatically inhibited acetylation of H3 and H4 at the Thy-1 promoter and Thy-1 expression levels in HLF1 cells. Finally, lincRNA-p21 interference rescued LPS-induced increase of lung and BAL collagen contents. LincRNA-p21 could lead to pulmonary fibrosis in ARDS by inhibition of the expression of Thy-1.

Optimization of a yeast RNA interference system for controlling gene expression and enabling rapid metabolic engineering.

PubMed

Crook, Nathan C; Schmitz, Alexander C; Alper, Hal S

2014-05-16

Reduction of endogenous gene expression is a fundamental operation of metabolic engineering, yet current methods for gene knockdown (i.e., genome editing) remain laborious and slow, especially in yeast. In contrast, RNA interference allows facile and tunable gene knockdown via a simple plasmid transformation step, enabling metabolic engineers to rapidly prototype knockdown strategies in multiple strains before expending significant cost to undertake genome editing. Although RNAi is naturally present in a myriad of eukaryotes, it has only been recently implemented in Saccharomyces cerevisiae as a heterologous pathway and so has not yet been optimized as a metabolic engineering tool. In this study, we elucidate a set of design principles for the construction of hairpin RNA expression cassettes in yeast and implement RNA interference to quickly identify routes for improvement of itaconic acid production in this organism. The approach developed here enables rapid prototyping of knockdown strategies and thus accelerates and reduces the cost of the design-build-test cycle in yeast.

[RNA interference: biogenesis molecular mechanisms and its applications in cervical cancer].

PubMed

Peralta-Zaragoza, Oscar; Bermúdez-Morales, Víctor Hugo; Madrid-Marina, Vicente

2010-01-01

RNAi (RNA interference) is a natural process by which eukaryotic cells silence gene expression through small interference RNAs (siRNA) which are complementary to messenger RNA (mRNA). In this process, the siRNA that are 21-25 nucleotides long and are known as microRNA (miRNA), either associate with the RNA-induced silencing complex (RISC), which targets and cleaves the complementary mRNAs by the endonucleolytic pathway, or repress the translation. It is also possible to silence exogenous gene expression during viral infections by using DNA templates to transcribe siRNA with properties that are identical to those of bioactive microRNA. Persistent human papillomavirus (HPV) infection is the main etiological agent during cervical cancer development and the HPV E6 and E7 oncogenes, which induce cellular transformation and immortalization, represent strategic targets to be silenced with siRNA. In several in vitro and in vivo studies, it has been demonstrated that the introduction of siRNA directed against the E6 and E7 oncogenes in human tumoral cervical cells transformed by HPV, leads to the efficient silencing of HPV E6 and E7 oncogene expression, which induces the accumulation of the products of the p53 and pRb tumor suppressor genes and activates the mechanism of programmed cell death by apoptosis; thus, the progression of the tumoral growth process may be prevented. The goal of this review is to analyze the microRNA biogenesis process in the silencing of gene expression and to discuss the different protocols for the use of siRNA as a potential gene therapy strategy for the treatment of cervical cancer.

A potential role for RNA interference in controlling the activity of the human LINE-1 retrotransposon.

PubMed

Soifer, Harris S; Zaragoza, Adriana; Peyvan, Maany; Behlke, Mark A; Rossi, John J

2005-01-01

Long interspersed nuclear elements (LINE-1 or L1) comprise 17% of the human genome, although only 80-100 L1s are considered retrotransposition-competent (RC-L1). Despite their small number, RC-L1s are still potential hazards to genome integrity through insertional mutagenesis, unequal recombination and chromosome rearrangements. In this study, we provide several lines of evidence that the LINE-1 retrotransposon is susceptible to RNA interference (RNAi). First, double-stranded RNA (dsRNA) generated in vitro from an L1 template is converted into functional short interfering RNA (siRNA) by DICER, the RNase III enzyme that initiates RNAi in human cells. Second, pooled siRNA from in vitro cleavage of L1 dsRNA, as well as synthetic L1 siRNA, targeting the 5'-UTR leads to sequence-specific mRNA degradation of an L1 fusion transcript. Finally, both synthetic and pooled siRNA suppressed retrotransposition from a highly active RC-L1 clone in cell culture assay. Our report is the first to demonstrate that a human transposable element is subjected to RNAi.

Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound.

PubMed

Kopechek, Jonathan A; Carson, Andrew R; McTiernan, Charles F; Chen, Xucai; Klein, Edwin C; Villanueva, Flordeliza S

2016-01-01

RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease.

Secondary RNA structure and its role in RNA interference to silence the respiratory syncytial virus fusion protein gene.

PubMed

Vig, Komal; Lewis, Nuruddeen; Moore, Eddie G; Pillai, Shreekumar; Dennis, Vida A; Singh, Shree R

2009-11-01

RNA interference (RNAi) is a post-transcriptional, gene silencing mechanism which uses small interfering RNA molecules (siRNA) for gene silencing. Respiratory Syncytial Virus (RSV) is an important respiratory pathogen of medical significance that causes high mortality in infants. The fusion (F) protein of RSV is a good target for therapeutic purposes as it is primarily responsible for penetration of the virus into host cells and subsequent syncytium formation during infection. In the present study, four siRNAs were designed and used individually as well as a mixture, to silence the RSV F gene. The relationship between siRNA design, target RNA structure, and their thermodynamics was also investigated. Silencing of F gene was observed using indirect immunofluorescence, western blot, reverse transcription PCR, and progeny viral titers. Our results show F gene silencing by all the four siRNAs individually and collectively. RT-PCR analysis revealed a decrease in mRNA level which corresponded to decreased F protein expression. siRNAs also inhibited RSV progeny as shown by viral titer estimation on infected HEp-2 cells. The present study demonstrates the silencing of the F gene using siRNA. Thermodynamic characteristics of the target RSV mRNA and siRNA seem to play an important role in siRNA gene silencing efficiency.

Advance of RNA interference technique in Hemipteran insects.

PubMed

Li, Jie; Wang, Xiaoping; Wang, Manqun; Ma, Weihua; Hua, Hongxia

2012-07-24

RNA interference (RNAi) suppressed the expression of the target genes by post transcriptional regulation and the double-stranded RNA (dsRNA) mediated gene silencing has been a conserved mechanism in many eukaryotes, which prompted RNAi to become a valuable tool for unveiling the gene function in many model insects. Recent research attested that RNAi technique can be also effective in downregulation target genes in Hemipteran insects. In this review, we collected the researches of utilizing RNAi technique in gene functional analysis in Hemipteran insects, highlighted the methods of dsRNA/siRNA uptake by insects and discussed the knock-down efficiency of these techniques. Although the RNA interference technique has drawbacks and obscure points, our primary goal of this review is try to exploit it for further discovering gene functions and pest control tactic in the Hemipteran insects. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.

Effect of North Bicyclo[3.1.0]hexane 2'-Deoxypseudosugars on RNA Interference: A Novel Class of siRNA Modification | Center for Cancer Research

Cancer.gov

The inside cover picture shows how siRNAs modified with North bicyclo[3.1.0]hexane 2'-deoxy-pseudosugars are able to activate the RNA interference machinery. The paper confirms that the North conformation is critical for RNAi activity.

Bringing RNA Interference (RNAi) into the High School Classroom

ERIC Educational Resources Information Center

Sengupta, Sibani

2013-01-01

RNA interference (abbreviated RNAi) is a relatively new discovery in the field of mechanisms that serve to regulate gene expression (a.k.a. protein synthesis). Gene expression can be regulated at the transcriptional level (mRNA production, processing, or stability) and at the translational level (protein synthesis). RNAi acts in a gene-specific…

Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing

PubMed Central

Salton, Maayan; Kasprzak, Wojciech K.; Voss, Ty; Shapiro, Bruce A.; Poulikakos, Poulikos I.; Misteli, Tom

2015-01-01

Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signaling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumors. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumor formation and slows growth of vemurafenib-resistant tumors. Our results identify an intronic mutation as a molecular basis for RNA splicing-mediated RAF inhibitor resistance and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma. PMID:25971842

Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing.

PubMed

Salton, Maayan; Kasprzak, Wojciech K; Voss, Ty; Shapiro, Bruce A; Poulikakos, Poulikos I; Misteli, Tom

2015-05-14

Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signalling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumours. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small-molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumour formation and slows growth of vemurafenib-resistant tumours. Our results identify an intronic mutation as the molecular basis for a RNA splicing-mediated RAF inhibitor resistance mechanism and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma.

Generation of siRNA Nanosheets for Efficient RNA Interference

NASA Astrophysics Data System (ADS)

Kim, Hyejin; Lee, Jae Sung; Lee, Jong Bum

2016-04-01

After the discovery of small interference RNA (siRNA), nanostructured siRNA delivery systems have been introduced to achieve an efficient regulation of the target gene expression. Here we report a new siRNA-generating two dimensional nanostructure in a formation of nanosized sheet. Inspired by tunable mechanical and functional properties of the previously reported RNA membrane, siRNA nanosized sheets (siRNA-NS) with multiple Dicer cleavage sites were prepared. The siRNA-NS has two dimensional structure, providing a large surface area for Dicer to cleave the siRNA-NS for the generation of functional siRNAs. Furthermore, downregulation of the cellular target gene expression was achieved by delivery of siRNA-NS without chemical modification of RNA strands or conjugation to other substances.

Guanosine 2-NH2 groups of Escherichia coli RNase P RNA involved in intramolecular tertiary contacts and direct interactions with tRNA.

PubMed Central

Heide, C; Pfeiffer, T; Nolan, J M; Hartmann, R K

1999-01-01

We have identified by nucleotide analog interference mapping (NAIM) exocyclic NH2 groups of guanosines in RNase P RNA from Escherichia coli that are important for tRNA binding. The majority of affected guanosines represent phylogenetically conserved nucleotides. Several sites of interference could be assigned to direct contacts with the tRNA moiety, whereas others were interpreted as reflecting indirect effects on tRNA binding due to the disruption of tertiary contacts within the catalytic RNA. Our results support the involvement of the 2-NH2 groups of G292/G293 in pairing with C74 and C75 of tRNA CCA-termini, as well as formation of two consecutive base triples involving C75 and A76 of CCA-ends interacting with G292/A258 and G291/G259, respectively. Moreover, we present first biochemical evidence for two tertiary contacts (L18/P8 and L8/P4) within the catalytic RNA, whose formation has been postulated previously on the basis of phylogenetic comparative analyses. The tRNA binding interference data obtained in this and our previous studies are consistent with the formation of a consecutive nucleotide triple and quadruple between the tetraloop L18 and helix P8. Formation of the nucleotide triple (G316 and A94:U104 in wild-type E. coli RNase P RNA) is also supported by mutational analysis. For the mutant RNase P RNA carrying a G94:C104 double mutation, an additional G316-to-A mutation resulted in a restoration of binding affinity for mature and precursor tRNA. PMID:9917070

Human health and ecological risk assessments for SmartStax PRO (MON 89034 x TC1507 x MON 87411 x DAS-59122-7), a plant-incorporated protectant intended to control corn rootworm through ribonucleic acid (RNA) interference

EPA Science Inventory

The use of RNA interference (RNAi) gene silencing technology, particularly RNAi for pesticidal purposes to control macroorganism pests, is a relatively recent innovation. Post-transcriptional silencing of gene function is a very rapid process where double-stranded RNA (dsRNA) dir...

Ribonucleic acid interference knockdown of interleukin 6 attenuates cold-induced hypertension.

PubMed

Crosswhite, Patrick; Sun, Zhongjie

2010-06-01

The purpose of this study was to determine the role of the proinflammatory cytokine interleukin (IL) 6 in cold-induced hypertension. Four groups of male Sprague-Dawley rats were used (6 rats per group). After blood pressure was stabilized, 3 groups received intravenous delivery of adenoassociated virus carrying IL-6 small hairpin RNA (shRNA), adenoassociated virus carrying scrambled shRNA, and PBS, respectively, before exposure to a cold environment (5 degrees C). The last group received PBS and was kept at room temperature (25 degrees C, warm) as a control. Adenoassociated virus delivery of IL-6 shRNA significantly attenuated cold-induced elevation of systolic blood pressure and kept it at the control level for < or =7 weeks (length of the study). Chronic exposure to cold upregulated IL-6 expression in aorta, heart, and kidneys and increased macrophage and T-cell infiltration in kidneys, suggesting that cold exposure increases inflammation. IL-6 shRNA delivery abolished the cold-induced upregulation of IL-6, indicating effective silence of IL-6. Interestingly, RNA interference knockdown of IL-6 prevented cold-induced inflammation, as evidenced by a complete inhibition of tumor necrosis factor-alpha expression and leukocyte infiltration by IL-6 shRNA. RNA interference knockdown of IL-6 significantly decreased the cold-induced increase in vascular superoxide production. It is noted that IL-6 shRNA abolished the cold-induced increase in collagen deposition in the heart, suggesting that inflammation is involved in cold-induced cardiac remodeling. Cold exposure caused glomerular collapses, which could be prevented by knockdown of IL-6, suggesting an important role of inflammation in cold-induced renal damage. In conclusion, cold exposure increased IL-6 expression and inflammation, which play critical roles in the pathogenesis of cold-induced hypertension and cardiac and renal damage.

RNA Interference in Infectious Tropical Diseases

PubMed Central

Hong, Young S.

2008-01-01

Introduction of double-stranded RNA (dsRNA) into some cells or organisms results in degradation of its homologous mRNA, a process called RNA interference (RNAi). The dsRNAs are processed into short interfering RNAs (siRNAs) that subsequently bind to the RNA-induced silencing complex (RISC), causing degradation of target mRNAs. Because of this sequence-specific ability to silence target genes, RNAi has been extensively used to study gene functions and has the potential to control disease pathogens or vectors. With this promise of RNAi to control pathogens and vectors, this paper reviews the current status of RNAi in protozoans, animal parasitic helminths and disease-transmitting vectors, such as insects. Many pathogens and vectors cause severe parasitic diseases in tropical regions and it is difficult to control once the host has been invaded. Intracellularly, RNAi can be highly effective in impeding parasitic development and proliferation within the host. To fully realize its potential as a means to control tropical diseases, appropriate delivery methods for RNAi should be developed, and possible off-target effects should be minimized for specific gene suppression. RNAi can also be utilized to reduce vector competence to interfere with disease transmission, as genes critical for pathogenesis of tropical diseases are knockdowned via RNAi. PMID:18344671

Ingestion of genetically modified yeast symbiont reduces fitness of an insect pest via RNA interference

PubMed Central

Murphy, Katherine A.; Tabuloc, Christine A.; Cervantes, Kevin R.; Chiu, Joanna C.

2016-01-01

RNA interference has had major advances as a developing tool for pest management. In laboratory experiments, double-stranded RNA (dsRNA) is often administered to the insect by genetic modification of the crop, or synthesized in vitro and topically applied to the crop. Here, we engineered genetically modified yeast that express dsRNA targeting y-Tubulin in Drosophila suzukii. Our design takes advantage of the symbiotic interactions between Drosophila, yeast, and fruit crops. Yeast is naturally found growing on the surface of fruit crops, constitutes a major component of the Drosophila microbiome, and is highly attractive to Drosophila. Thus, this naturally attractive yeast biopesticide can deliver dsRNA to an insect pest without the need for genetic crop modification. We demonstrate that this biopesticide decreases larval survivorship, and reduces locomotor activity and reproductive fitness in adults, which are indicative of general health decline. To our knowledge, this is the first study to show that yeast can be used to deliver dsRNA to an insect pest. PMID:26931800

Knockdown of RNA interference pathway genes impacts the fitness of western corn rootworm.

PubMed

Davis-Vogel, Courtney; Ortiz, Angel; Procyk, Lisa; Robeson, Jonathan; Kassa, Adane; Wang, Yiwei; Huang, Emily; Walker, Carl; Sethi, Amit; Nelson, Mark E; Sashital, Dipali G

2018-05-18

Western corn rootworm (Diabrotica virgifera virgifera) is a serious agricultural pest known for its high adaptability to various management strategies, giving rise to a continual need for new control options. Transgenic maize expressing insecticidal RNAs represents a novel mode of action for rootworm management that is dependent on the RNA interference (RNAi) pathways of the insect for efficacy. Preliminary evidence suggests that western corn rootworm could develop broad resistance to all insecticidal RNAs through changes in RNAi pathway genes; however, the likelihood of field-evolved resistance occurring through this mechanism remains unclear. In the current study, eight key genes involved in facilitating interference in the microRNA and small interfering RNA pathways were targeted for knockdown in order to evaluate impact on fitness of western corn rootworm. These genes include drosha, dicer-1, dicer-2, pasha, loquacious, r2d2, argonaute 1, and argonaute 2. Depletion of targeted transcripts in rootworm larvae led to changes in microRNA expression, decreased ability to pupate, reduced adult beetle emergence, and diminished reproductive capacity. The observed effects do not support evolution of resistance through changes in expression of these eight genes due to reduced insect fitness.

Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound

PubMed Central

McTiernan, Charles F.; Chen, Xucai; Klein, Edwin C.; Villanueva, Flordeliza S.

2016-01-01

RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease. PMID:27471848

Cardiovascular RNA interference therapy: the broadening tool and target spectrum.

PubMed

Poller, Wolfgang; Tank, Juliane; Skurk, Carsten; Gast, Martina

2013-08-16

Understanding of the roles of noncoding RNAs (ncRNAs) within complex organisms has fundamentally changed. It is increasingly possible to use ncRNAs as diagnostic and therapeutic tools in medicine. Regarding disease pathogenesis, it has become evident that confinement to the analysis of protein-coding regions of the human genome is insufficient because ncRNA variants have been associated with important human diseases. Thus, inclusion of noncoding genomic elements in pathogenetic studies and their consideration as therapeutic targets is warranted. We consider aspects of the evolutionary and discovery history of ncRNAs, as far as they are relevant for the identification and selection of ncRNAs with likely therapeutic potential. Novel therapeutic strategies are based on ncRNAs, and we discuss here RNA interference as a highly versatile tool for gene silencing. RNA interference-mediating RNAs are small, but only parts of a far larger spectrum encompassing ncRNAs up to many kilobasepairs in size. We discuss therapeutic options in cardiovascular medicine offered by ncRNAs and key issues to be solved before clinical translation. Convergence of multiple technical advances is highlighted as a prerequisite for the translational progress achieved in recent years. Regarding safety, we review properties of RNA therapeutics, which may immunologically distinguish them from their endogenous counterparts, all of which underwent sophisticated evolutionary adaptation to specific biological contexts. Although our understanding of the noncoding human genome is only fragmentary to date, it is already feasible to develop RNA interference against a rapidly broadening spectrum of therapeutic targets and to translate this to the clinical setting under certain restrictions.

An Active Immune Defense with a Minimal CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) RNA and without the Cas6 Protein*

PubMed Central

Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J.; Backofen, Rolf; Marchfelder, Anita

2015-01-01

The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3′ handle are still active in triggering an interference reaction. The complete 3′ handle could be removed without loss of activity. However, manipulations of the 5′ handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. PMID:25512373

SiLEncing SLE: the power and promise of small noncoding RNAs.

PubMed

Rigby, Robert J; Vinuesa, Carola G

2008-09-01

In this study, we outline the evidence suggesting that defects in the RNA silencing machinery can lead to the prototypic systemic autoimmune disease, systemic lupus erythematosus, and describe the potential for RNA interference to provide novel therapeutic agents. Over the last year, a class of small noncoding RNAs--microRNAs--have been shown to play key roles in immune regulation including T-cell selection in the thymus, B cell affinity maturation and selection in germinal centres, and development of regulatory T cells, suggesting that the microRNA machinery may be crucial in the maintenance of immunological tolerance. Two RNA silencing mechanisms have been shown to be involved in lupus pathogenesis: failed Roquin-mediated repression of inducible costimulatory receptors messenger RNA through miR-101 in roquin(san/san) mice and decreased expression of pro-apoptotic molecule and phosphatase and tensin homologue on chromosome 10 in mice transgenic for the miR-17-92 cluster, leading to lymphoproliferation and other lupus manisfestations. MicroRNA array experiments performed on peripheral blood mononuclear cells have revealed different expression profiles in systemic lupus erythematosus patients. RNA interference has also been used ex vivo to silence dysregulated T-cell molecules in cells from systemic lupus erythematosus patients. Dysregulation of the RNA silencing machinery has been implicated in systemic lupus erythematosus pathogenesis. Although microRNA profiling may prove to be a useful diagnostic and prognostic tool for a notoriously heterogeneous disease, manipulation of RNA interference emerges as a powerful and potentially specific means to correct dysregulated gene expression in systemic lupus erythematosus patients.

RNAi therapeutics and applications of microRNAs in cancer treatment.

PubMed

Uchino, Keita; Ochiya, Takahiro; Takeshita, Fumitaka

2013-06-01

RNA interference-based therapies are proving to be powerful tools for combating various diseases, including cancer. Scientists are researching the development of safe and efficient systems for the delivery of small RNA molecules, which are extremely fragile in serum, to target organs and cells in the human body. A dozen pre-clinical and clinical trials have been under way over the past few years involving biodegradable nanoparticles, lipids, chemical modification and conjugation. On the other hand, microRNAs, which control the balance of cellular biological processes, have been studied as attractive therapeutic targets in cancer treatment. In this review, we provide an overview of RNA interference-based therapeutics in clinical trials and discuss the latest technology for the systemic delivery of nucleic acid drugs. Furthermore, we focus on dysregulated microRNAs in human cancer, which have progressed in pre-clinical trials as therapeutic targets, and describe a wide range of strategies to control the expression levels of endogenous microRNAs. Further development of RNA interference technologies and progression of clinical trials will contribute to the achievement of practical applications of nucleic acid drugs.

Next-generation libraries for robust RNA interference-based genome-wide screens

PubMed Central

Kampmann, Martin; Horlbeck, Max A.; Chen, Yuwen; Tsai, Jordan C.; Bassik, Michael C.; Gilbert, Luke A.; Villalta, Jacqueline E.; Kwon, S. Chul; Chang, Hyeshik; Kim, V. Narry; Weissman, Jonathan S.

2015-01-01

Genetic screening based on loss-of-function phenotypes is a powerful discovery tool in biology. Although the recent development of clustered regularly interspaced short palindromic repeats (CRISPR)-based screening approaches in mammalian cell culture has enormous potential, RNA interference (RNAi)-based screening remains the method of choice in several biological contexts. We previously demonstrated that ultracomplex pooled short-hairpin RNA (shRNA) libraries can largely overcome the problem of RNAi off-target effects in genome-wide screens. Here, we systematically optimize several aspects of our shRNA library, including the promoter and microRNA context for shRNA expression, selection of guide strands, and features relevant for postscreen sample preparation for deep sequencing. We present next-generation high-complexity libraries targeting human and mouse protein-coding genes, which we grouped into 12 sublibraries based on biological function. A pilot screen suggests that our next-generation RNAi library performs comparably to current CRISPR interference (CRISPRi)-based approaches and can yield complementary results with high sensitivity and high specificity. PMID:26080438

Differentiating RNA from DNA by a molecular fluorescent probe based on the "door-bolt" mechanism biomaterials.

PubMed

Yao, Qichao; Li, Haidong; Xian, Liman; Xu, Feng; Xia, Jing; Fan, Jiangli; Du, Jianjun; Wang, Jingyun; Peng, Xiaojun

2018-09-01

Although excellent florescent probes have been developed for DNA, good probes for RNA remain lacking. The shortage of reported and commercial RNA probes is attributable to their severe interference from DNA. As DNA and RNA have similar structures but different functions, it has been an imperative challenge to develop RNA probes that differentiate from DNA. In this study, an NIR fluorescent probe, NBE, is described, which contains a bulky julolidine group that can fit in a spacious RNA pocket and emit intense fluorescence. However, NBE has no response to DNA, as it cannot intercalate into the double strands or even in the DNA minor groove. The sensing mechanism is similar to the effect of a door-bolt. NBE shows excellent performance in RNA sensing (outstanding photostability, high selectivity and fast response), whether in aqueous buffers, fixed cells or living cells. These findings might provide not only a potential imaging tool but also a new design strategy for the recognition of RNA while avoiding interference from DNA. Copyright © 2018 Elsevier Ltd. All rights reserved.

RNA interference-mediated intrinsic antiviral immunity in invertebrates.

PubMed

Nayak, Arabinda; Tassetto, Michel; Kunitomi, Mark; Andino, Raul

2013-01-01

In invertebrates such as insects and nematodes, RNA interference (RNAi) provides RNA-based protection against viruses. This form of immunity restricts viral replication and dissemination from infected cells and viruses, in turn, have evolved evasion mechanisms or RNAi suppressors to counteract host defenses. Recent advances indicate that, in addition to RNAi, other related small RNA pathways contribute to antiviral functions in invertebrates. This has led to a deeper understanding of fundamental aspects of small RNA-based antiviral immunity in invertebrates and its contribution to viral spread and pathogenesis.

Steric restrictions of RISC in RNA interference identified with size-expanded RNA nucleobases.

PubMed

Hernández, Armando R; Peterson, Larryn W; Kool, Eric T

2012-08-17

Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC), the key protein complex of RNA interference (RNAi), is of great importance to the development of siRNAs with improved biological and potentially therapeutic function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to -5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3'-end increased activity over that of wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation.

Steric Restrictions of RISC in RNA Interference Identified with Size-Expanded RNA Nucleobases

PubMed Central

Hernández, Armando R.; Peterson, Larryn W.; Kool, Eric T.

2012-01-01

Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC) – the key protein complex of RNA interference (RNAi) – is of great importance to the development of siRNAs with improved biological, and potentially therapeutic, function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases, and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to −5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region, but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3′-end increased activity over wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation. PMID:22646660

An RNA isolation system for plant tissues rich in secondary metabolites

PubMed Central

2011-01-01

Background Secondary metabolites are reported to interfere with the isolation of RNA particularly with the recipes that use guanidinium-based salt. Such interference was observed in isolation of RNA with medicinal plants rheum (Rheum australe) and arnebia (Arnebia euchroma). A rapid and less cumbersome system for isolation of RNA was essential to facilitate any study related to gene expression. Findings An RNA isolation system free of guanidinium salt was developed that successfully isolated RNA from rheum and arnebia. The method took about 45 min and was successfully evaluated on twenty one tissues with varied secondary metabolites. The A260/280 ratio ranged between 1.8 - 2.0 with distinct 28 S and 18 S rRNA bands visible on a formaldehyde-agarose gel. Conclusions The present manuscript describes a rapid protocol for isolation of RNA, which works well with all the tissues examined so far. The remarkable feature was the success in isolation of RNA with those tissues, wherein the most commonly used methods failed. Isolated RNA was amenable to downstream applications such as reverse transcription-polymerase chain reaction (RT-PCR), differential display (DD), suppression subtractive hybridization (SSH) library construction, and northern hybridization. PMID:21443767

An active immune defense with a minimal CRISPR (clustered regularly interspaced short palindromic repeats) RNA and without the Cas6 protein.

PubMed

Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J; Backofen, Rolf; Marchfelder, Anita

2015-02-13

The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3' handle are still active in triggering an interference reaction. The complete 3' handle could be removed without loss of activity. However, manipulations of the 5' handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Silencing the hsp25 Gene Eliminates Migration Capability of the Highly Metastatic Murine 4T1 Breast Adenocarcinoma Cell

PubMed Central

Bausero, Maria A.; Bharti, Ajit; Page, Diana T.; Perez, Kristen D.; Eng, Jason W.-L.; Ordonez, Susana L.; Jantschitsch, Christian; Kindas-Muegge, Ingela; Ciocca, Daniel; Asea, Alexzander

2006-01-01

The 25-kDa heat shock protein (Hsp25) is associated with various malignancies and is expressed at high levels in biopsies as well as circulating in the serum of breast cancer patients. In this study, we used RNA interference technology to silence the hsp25 gene in 4T1 breast adenocarcinoma cells, known as a poorly immunogenic, highly metastatic cell line. We demonstrate that transfection of 4T1 cells with short interference RNA-Hsp25 dramatically inhibits proliferation as compared with control transfected cells. In addition, we show that 4T1 cells transfected with short interference RNA-Hsp25 abrogates tumor migration potential by a mechanism that is in part due to the repression of matrix metalloproteinase 9 expression and a concomitant upregulation of its antagonist, tissue inhibitor metalloproteinase 1. Taken together, these findings provide a model system for the study of metastatic potential of tumors and are suggestive of an earlier unrecognized role for Hsp25 in tumor migration. PMID:16340246

Silencing the hsp25 gene eliminates migration capability of the highly metastatic murine 4T1 breast adenocarcinoma cell.

PubMed

Bausero, Maria A; Bharti, Ajit; Page, Diana T; Perez, Kristen D; Eng, Jason W-L; Ordonez, Susana L; Asea, Edwina E; Jantschitsch, Christian; Kindas-Muegge, Ingela; Ciocca, Daniel; Asea, Alexzander

2006-01-01

The 25-kDa heat shock protein (Hsp25) is associated with various malignancies and is expressed at high levels in biopsies as well as circulating in the serum of breast cancer patients. In this study, we used RNA interference technology to silence the hsp25 gene in 4T1 breast adenocarcinoma cells, known as a poorly immunogenic, highly metastatic cell line. We demonstrate that transfection of 4T1 cells with short interference RNA-Hsp25 dramatically inhibits proliferation as compared with control transfected cells. In addition, we show that 4T1 cells transfected with short interference RNA-Hsp25 abrogates tumor migration potential by a mechanism that is in part due to the repression of matrix metalloproteinase 9 expression and a concomitant upregulation of its antagonist, tissue inhibitor metalloproteinase 1. Taken together, these findings provide a model system for the study of metastatic potential of tumors and are suggestive of an earlier unrecognized role for Hsp25 in tumor migration. Copyright 2006 S. Karger AG, Basel.

Non-target Effects of Green Fluorescent Protein (GFP)-derived Double-Stranded RNA (dsRNA-GFP) Used in Honey Bee RNA Interference (RNAi) Assays

PubMed Central

Nunes, Francis M. F.; Aleixo, Aline C.; Barchuk, Angel R.; Bomtorin, Ana D.; Grozinger, Christina M.; Simões, Zilá L. P.

2013-01-01

RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control. PMID:26466797

Non-Target Effects of Green Fluorescent Protein (GFP)-Derived Double-Stranded RNA (dsRNA-GFP) Used in Honey Bee RNA Interference (RNAi) Assays.

PubMed

Nunes, Francis M F; Aleixo, Aline C; Barchuk, Angel R; Bomtorin, Ana D; Grozinger, Christina M; Simões, Zilá L P

2013-01-04

RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control.

Defective RNA particles derived from Tomato black ring virus genome interfere with the replication of parental virus.

PubMed

Hasiów-Jaroszewska, Beata; Minicka, Julia; Zarzyńska-Nowak, Aleksandra; Budzyńska, Daria; Elena, Santiago F

2018-05-02

Tomato black ring virus (TBRV) is the only member of the Nepovirus genus that is known to form defective RNA particles (D RNAs) during replication. Here, de novo generation of D RNAs was observed during prolonged passages of TBRV isolates originated from Solanum lycopersicum and Lactuca sativa in Chenopodium quinoa plants. D RNAs of about 500 nt derived by a single deletion in the RNA1 molecule and contained a portion of the 5' untranslated region and viral replicase, and almost the entire 3' non-coding region. Short regions of sequence complementarity were found at the 5' and 3' junction borders, which can facilitate formation of the D RNAs. Moreover, in this study we analyzed the effects of D RNAs on TBRV replication and symptoms development of infected plants. C. quinoa, S. lycopersicum, Nicotiana tabacum, and L. sativa were infected with the original TBRV isolates (TBRV-D RNA) and those containing additional D RNA particles (TBRV + D RNA). The viral accumulation in particular hosts was measured up to 28 days post inoculation by RT-qPCR. Statistical analyses revealed that D RNAs interfere with TBRV replication and thus should be referred to as defective interfering particles. The magnitude of the interference effect depends on the interplay between TBRV isolate and host species. Copyright © 2018 Elsevier B.V. All rights reserved.

[RNA interference library research progress and its application in cancer research].

PubMed

Zhao, Ning; Cai, Li

2013-02-01

RNA interference is a homologous mRNA special degradation phenomenon which is caused by the double-stranded RNA. RNAi library is a pooled library that is artificially constructed using RNAi technology. As RNAi library has made a major breakthrough in the field of genetic research, it has been widely used in the field of medical research, especially in the field of cancer research. This review discussed the research progress of RNAi library and its applications in cancer research.

RNA interference by feeding in vitro synthesized double-stranded RNA to planarians: methodology and dynamics

PubMed Central

Rouhana, Labib; Weiss, Jennifer A.; Forsthoefel, David J.; Lee, Hayoung; King, Ryan S.; Inoue, Takeshi; Shibata, Norito; Agata, Kiyokazu; Newmark, Phillip A.

2013-01-01

Background The ability to assess gene function is essential for understanding biological processes. Currently, RNA interference (RNAi) is the only technique available to assess gene function in planarians, in which it has been induced via injection of double-stranded RNA (dsRNA), soaking, or ingestion of bacteria expressing dsRNA. Results We describe a simple and robust RNAi protocol, involving in vitro synthesis of dsRNA that is fed to the planarians. Advantages of this protocol include the ability to produce dsRNA from any vector without subcloning, resolution of ambiguities in quantity and quality of input dsRNA, as well as time, and ease of application. We have evaluated the logistics of inducing RNAi in planarians using this methodology in careful detail, from the ingestion and processing of dsRNA in the intestine, to timing and efficacy of knockdown in neoblasts, germline, and soma. We also present systematic comparisons of effects of amount, frequency, and mode of dsRNA delivery. Conclusions This method gives robust and reproducible results and is amenable to high-throughput studies. Overall, this RNAi methodology provides a significant advance by combining the strengths of current protocols available for dsRNA delivery in planarians and has the potential to benefit RNAi methods in other systems. PMID:23441014

Different effects of enhanced and reduced expression of pub gene on the formation of embryoid bodies by cultured embryonic mouse stem cell.

PubMed

Novosadova, E V; Manuilova, E S; Arsen'eva, E L; Khaidarova, N V; Dolotov, O V; Inozemtseva, L S; Kozachenkov, K Yu; Tarantul, V Z; Grivennikov, I A

2005-07-01

The effects of pub gene on proliferation and initial stages of differentiation of embryonic mouse stem cells were studied in vitro. To this end we used enhanced expression of human pub gene (hpub) and suppression of expression of mouse endogenous pub gene with RNA-interference in embryonic stem cells. Proliferative activity of genetically modified polyclonal lines of the embryonic stem cells transfected with plasmids carrying expressing hpub gene or plasmids generating small interference RNA to this gene did not differ from that of the control cells. Inhibition of expression of endogenous pub gene in embryonic stem cells using small interference RNA 2-fold decreased the formation of embryoid bodies, at the same time additional expression of exogenous hpub gene almost 2-fold increased their number in comparison with the control. It was hypothesized that pub gene participates in early stages of differentiation of embryonic stem cells leading to the formation of embryoid bodies.

Compositions and Methods for Inhibiting Gene Expressions

NASA Technical Reports Server (NTRS)

Williams, Loren D. (Inventor); Hsiao, Chiaolong (Inventor); Fang, Po-Yu (Inventor); Williams, Justin (Inventor)

2018-01-01

A combined packing and assembly method that efficiently packs ribonucleic acid (RNA) into virus like particles (VLPs) has been developed. The VLPs can spontaneously assemble and load RNA in vivo, efficiently packaging specifically designed RNAs at high densities and with high purity. In some embodiments the RNA is capable of interference activity, or is a precursor of a RNA capable of causing interference activity. Compositions and methods for the efficient expression, production and purification of VLP-RNAs are provided. VLP-RNAs can be used for the storage of RNA for long periods, and provide the ability to deliver RNA in stable form that is readily taken up by cells.

Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference

PubMed Central

Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu

2015-01-01

RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells. PMID:25731667

Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference.

PubMed

Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu

2015-03-03

RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells.

Molecular mechanisms influencing efficiency of RNA interference in insects.

PubMed

Cooper, Anastasia M W; Silver, Kristopher; Jianzhen, Zhang; Park, Yoonseong; Zhu, Kun Yan

2018-06-21

RNA interference (RNAi) is an endogenous, sequence-specific gene silencing mechanism elicited by small RNA molecules. RNAi is a powerful reverse genetic tool, and is currently being utilized for managing insects and viruses. Widespread implementation of RNAi-based pest management strategies is currently hindered by inefficient and highly variable results when different insect species, strains, developmental stages, tissues, and genes are targeted. Mechanistic studies have shown that double-stranded ribonucleases (dsRNases), endosomal entrapment, deficient function of the core machinery, and inadequate immune stimulation contribute to limited RNAi efficiency. However, a comprehensive understanding of the molecular mechanisms limiting RNAi efficiency remains elusive. The recent advances in dsRNA stability in physiological tissues, dsRNA internalization into cells, the composition and function of the core RNAi machinery, as well as small-interfering RNA/double-stranded RNA amplification and spreading mechanisms are reviewed to establish a global understanding of the obstacles impeding wider understanding of RNAi mechanisms in insects. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Altered stoichiometry Escherichia coli Cascade complexes with shortened CRISPR RNA spacers are capable of interference and primed adaptation

DOE PAGES

Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia; ...

2016-10-13

The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less

Altered stoichiometry Escherichia coli Cascade complexes with shortened CRISPR RNA spacers are capable of interference and primed adaptation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia

The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less

RNA therapeutics: Beyond RNA interference and antisense oligonucleotides

PubMed Central

Kole, Ryszard; Krainer, Adrian R.; Altman, Sidney

2016-01-01

Here we discuss three RNA therapeutic technologies exploiting various oligonucleotides that bind RNA by base-pairing in a sequence-specific manner yet have different mechanisms of action and effects. RNA interference and antisense oligonucleotides downregulate gene expression by enzyme-dependent degradation of targeted mRNA. Steric blocking oligonucleotides block access of cellular machinery to pre-mRNA and mRNA without degrading the RNA. Through this mechanism, blocking oligonucleotides can redirect alternative splicing, repair defective RNA, restore protein production or also downregulate gene expression. Moreover, they can be extensively chemically modified, resulting in more drug-like properties. The ability of RNA blocking oligonucleotides to restore gene function makes them suited for treatment of genetic disorders. Positive results from clinical trials for the treatment of Duchenne muscular dystrophy show that this technology is close to realizing its clinical potential. PMID:22262036

Modeling RNA interference in mammalian cells

PubMed Central

2011-01-01

Background RNA interference (RNAi) is a regulatory cellular process that controls post-transcriptional gene silencing. During RNAi double-stranded RNA (dsRNA) induces sequence-specific degradation of homologous mRNA via the generation of smaller dsRNA oligomers of length between 21-23nt (siRNAs). siRNAs are then loaded onto the RNA-Induced Silencing multiprotein Complex (RISC), which uses the siRNA antisense strand to specifically recognize mRNA species which exhibit a complementary sequence. Once the siRNA loaded-RISC binds the target mRNA, the mRNA is cleaved and degraded, and the siRNA loaded-RISC can degrade additional mRNA molecules. Despite the widespread use of siRNAs for gene silencing, and the importance of dosage for its efficiency and to avoid off target effects, none of the numerous mathematical models proposed in literature was validated to quantitatively capture the effects of RNAi on the target mRNA degradation for different concentrations of siRNAs. Here, we address this pressing open problem performing in vitro experiments of RNAi in mammalian cells and testing and comparing different mathematical models fitting experimental data to in-silico generated data. We performed in vitro experiments in human and hamster cell lines constitutively expressing respectively EGFP protein or tTA protein, measuring both mRNA levels, by quantitative Real-Time PCR, and protein levels, by FACS analysis, for a large range of concentrations of siRNA oligomers. Results We tested and validated four different mathematical models of RNA interference by quantitatively fitting models' parameters to best capture the in vitro experimental data. We show that a simple Hill kinetic model is the most efficient way to model RNA interference. Our experimental and modeling findings clearly show that the RNAi-mediated degradation of mRNA is subject to saturation effects. Conclusions Our model has a simple mathematical form, amenable to analytical investigations and a small set of parameters with an intuitive physical meaning, that makes it a unique and reliable mathematical tool. The findings here presented will be a useful instrument for better understanding RNAi biology and as modelling tool in Systems and Synthetic Biology. PMID:21272352

RNA interference: from biology to drugs and therapeutics.

PubMed

Appasani, Krishnarao

2004-07-01

RNA interference (RNAi) is a newly discovered and popular technology platform among researchers not only in the fields of RNA biology and molecular cell biology. It has created excitement in clinical sciences such as oncology, neurology, endocrinology, infectious diseases and drug discovery. There is an urgent need to educate and connect academic and industry researchers for the purpose of knowledge transfer. Thus, GeneExpression Systems of Waltham organized its Second International Conference in Waltham City (May 2-4, 2004, MA, USA) on the theme of 'RNA interference: From Biology to Drugs & Therapeutics.' About 200 participants and 32 speakers attended this two and half-day event which was arranged in six scientific and three technology sessions and ended with a panel discussion. This report covers a few representative talks from academia, biotech and the drug industry.

Respiratory viral diseases: access to RNA interference therapy

PubMed Central

Bitko, Vira; Barik, Sailen

2008-01-01

This review summarizes recent experimental achievements in the area of the development of new RNA interference (RNAi) therapeutics for the treatment of viral respiratory diseases. Delivery of siRNA to their intended target tissue remains the biggest problem for most therapeutic applications of these compounds. Appropriate formulations and chemical modifications for improved stability will boost the probability of utilization of RNAi drugs in the clinical applications. PMID:19081824

Chemical modification: the key to clinical application of RNA interference?

PubMed Central

Corey, David R.

2007-01-01

RNA interference provides a potent and specific method for controlling gene expression in human cells. To translate this potential into a broad new family of therapeutics, it is necessary to optimize the efficacy of the RNA-based drugs. As discussed in this Review, it might be possible to achieve this optimization using chemical modifications that improve their in vivo stability, cellular delivery, biodistribution, pharmacokinetics, potency, and specificity. PMID:18060019

Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association.

PubMed

Pulk, Arto; Maiväli, Ulo; Remme, Jaanus

2006-05-01

The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts.

Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association

PubMed Central

Pulk, Arto; Maiväli, Ülo; Remme, Jaanus

2006-01-01

The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts. PMID:16556933

Rp-phosphorothioate modifications in RNase P RNA that interfere with tRNA binding.

PubMed Central

Hardt, W D; Warnecke, J M; Erdmann, V A; Hartmann, R K

1995-01-01

We have used Rp-phosphorothioate modifications and a binding interference assay to analyse the role of phosphate oxygens in tRNA recognition by Escherichia coli ribonuclease P (RNase P) RNA. Total (100%) Rp-phosphorothioate modification at A, C or G positions of RNase P RNA strongly impaired tRNA binding and pre-tRNA processing, while effects were less pronounced at U positions. Partially modified E. coli RNase P RNAs were separated into tRNA binding and non-binding fractions by gel retardation. Rp-phosphorothioate modifications that interfered with tRNA binding were found 5' of nucleotides A67, G68, U69, C70, C71, G72, A130, A132, A248, A249, G300, A317, A330, A352, C353 and C354. Manganese rescue at positions U69, C70, A130 and A132 identified, for the first time, sites of direct metal ion coordination in RNase P RNA. Most sites of interference are at strongly conserved nucleotides and nine reside within a long-range base-pairing interaction present in all known RNase P RNAs. In contrast to RNase P RNA, 100% Rp-phosphorothioate substitutions in tRNA showed only moderate effects on binding to RNase P RNAs from E. coli, Bacillus subtilis and Chromatium vinosum, suggesting that pro-Rp phosphate oxygens of mature tRNA contribute relatively little to the formation of the tRNA-RNase P RNA complex. Images PMID:7540978

RNA interference for functional genomics and improvement of cotton (Gossypium species)

USDA-ARS?s Scientific Manuscript database

RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium ssp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function ...

Knockdown of Midgut Genes by dsRNA-Transgenic Plant-Mediated RNA Interference in the Hemipteran Insect Nilaparvata lugens

PubMed Central

Zha, Wenjun; Peng, Xinxin; Chen, Rongzhi; Du, Bo; Zhu, Lili; He, Guangcun

2011-01-01

Background RNA interference (RNAi) is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA) directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. Methodology/Principal Findings The Hemipteran insect brown planthopper (Nilaparvata lugens Stål) is a typical phloem sap feeder specific to rice (Oryza sativa L.). To analyze the potential of exploiting RNAi-mediated effects in this insect, we identified genes (Nlsid-1 and Nlaub) encoding proteins that might be involved in the RNAi pathway in N. lugens. Both genes are expressed ubiquitously in nymphs and adult insects. Three genes (the hexose transporter gene NlHT1, the carboxypeptidase gene Nlcar and the trypsin-like serine protease gene Nltry) that are highly expressed in the N. lugens midgut were isolated and used to develop dsRNA constructs for transforming rice. RNA blot analysis showed that the dsRNAs were transcribed and some of them were processed to siRNAs in the transgenic lines. When nymphs were fed on rice plants expressing dsRNA, levels of transcripts of the targeted genes in the midgut were reduced; however, lethal phenotypic effects after dsRNA feeding were not observed. Conclusions Our study shows that genes for the RNAi pathway (Nlsid-1 and Nlaub) are present in N. lugens. When insects were fed on rice plant materials expressing dsRNAs, RNA interference was triggered and the target genes transcript levels were suppressed. The gene knockdown technique described here may prove to be a valuable tool for further investigations in N. lugens. The results demonstrate the potential of dsRNA-mediated RNAi for field-level control of planthoppers, but appropriate target genes must be selected when designing the dsRNA-transgenic plants. PMID:21655219

RNA interference for performance enhancement and detection in doping control.

PubMed

Kohler, Maxie; Schänzer, Wilhelm; Thevis, Mario

2011-10-01

RNA interference represents a comparably new route of regulating and manipulating specific gene expression. Promising results were obtained in experimental therapies aim at the treatment of different kinds of diseases including cancer, diabetes mellitus or Dychenne muscular dystrophy. While studies on down-regulation efficiency are often performed by analyzing the regulated protein, the direct detection of small, interfering RNA molecules and antisense oligonucleotides is of great interest for the investigation of the metabolism and degradation and also for the detection of a putative misuse of these molecules in sports. Myostatin down-regulation was shown to result in increased performance and muscle growth and the regulation of several other proteins could be relevant for performance enhancement. This mini-review summarizes current approaches for the mass spectrometric analysis of siRNA and antisense oligonucleotides from biological matrices and the available data on biodistribution, metabolism, and half-life of relevant substances are discussed. Copyright © 2011 John Wiley & Sons, Ltd.

Silence of the transcripts: RNA interference in medicine.

PubMed

Barik, Sailen

2005-10-01

Silencing of gene expression by ribonucleic acid (RNA), known as RNA interference (RNAi), is now recognized as a major means of gene regulation in biology. In this mechanism, small noncoding double-stranded RNA molecules knock down gene expression through a variety of mechanisms that include messenger RNA (mRNA) degradation, inhibition of mRNA translation, or chromatin remodeling. The posttranscriptional mechanism of RNAi has been embraced by researchers as a powerful tool for generating deficient phenotypes without mutating the gene. In parallel, exciting recent results have promised its application in disease therapy. This review aims to summarize the current knowledge in this area and provide a roadmap that may eventually launch RNAi from the research bench to the medicine chest.

In silico molecular docking analysis of the human Argonaute 2 PAZ domain reveals insights into RNA interference.

PubMed

Kandeel, Mahmoud; Kitade, Yukio

2013-07-01

RNA interference (RNAi) is a critical cellular pathway activated by double stranded RNA and regulates the gene expression of target mRNA. During RNAi, the 3' end of siRNA binds with the PAZ domain, followed by release and rebinding in a cyclic manner, which deemed essential for proper gene silencing. Recently, we provided the forces underlying the recognition of small interfering RNA by PAZ in a computational study based on the structure of Drosophila Argonaute 2 (Ago2) PAZ domain. We have now reanalyzed these data within the view of the new available structures from human Argonauts. While the parameters of weak binding are correlated with higher (RNAi) in the Drosophila model, a different profile is predicted with the human Ago2 PAZ domain. On the basis of the human Ago2 PAZ models, the indicators of stronger binding as the total binding energy and the free energy were associated with better RNAi efficacy. This discrepancy might be attributable to differences in the binding site topology and the difference in the conformation of the bound nucleotides.

Terminal Duplex Stability and Nucleotide Identity Differentially Control siRNA Loading and Activity in RNA Interference

PubMed Central

Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi

2016-01-01

Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870

Oligonucleotide Antiviral Therapeutics: Antisense and RNA Interference for Highly Pathogenic RNA Viruses

DTIC Science & Technology

2008-01-01

siRNA delivery method in his animal model, it remains to be studied whether this general pproach is safe in humans. Often cited as an advantage of siRNAs...way studying the intravenous delivery f ASO drug candidates targeting Bcl-2 (Genasense®, Genta) nd c-myc (Resten-NG®, AVI BioPharma), while completed... studies have been published investigating MOs as a treatment for EBOV infection, with both showing fficacy in animal models. PMOs were designed to

Trojan Horse Strategy for Non-invasive Interference of Clock Gene in the Oyster Crassostrea gigas.

PubMed

Payton, Laura; Perrigault, Mickael; Bourdineaud, Jean-Paul; Marcel, Anjara; Massabuau, Jean-Charles; Tran, Damien

2017-08-01

RNA interference is a powerful method to inhibit specific gene expression. Recently, silencing target genes by feeding has been successfully carried out in nematodes, insects, and small aquatic organisms. A non-invasive feeding-based RNA interference is reported here for the first time in a mollusk bivalve, the pacific oyster Crassostrea gigas. In this Trojan horse strategy, the unicellular alga Heterocapsa triquetra is the food supply used as a vector to feed oysters with Escherichia coli strain HT115 engineered to express the double-stranded RNA targeting gene. To test the efficacy of the method, the Clock gene, a central gene of the circadian clock, was targeted for knockout. Results demonstrated specific and systemic efficiency of the Trojan horse strategy in reducing Clock mRNA abundance. Consequences of Clock disruption were observed in Clock-related genes (Bmal, Tim1, Per, Cry1, Cry2, Rev.-erb, and Ror) and triploid oysters were more sensitive than diploid to the interference. This non-invasive approach shows an involvement of the circadian clock in oyster bioaccumulation of toxins produced by the harmful alga Alexandrium minutum.

Iron(II) supramolecular helicates interfere with the HIV-1 Tat-TAR RNA interaction critical for viral replication.

PubMed

Malina, Jaroslav; Hannon, Michael J; Brabec, Viktor

2016-07-12

The interaction between the HIV-1 transactivator protein Tat and TAR (transactivation responsive region) RNA, plays a critical role in HIV-1 transcription. Iron(II) supramolecular helicates were evaluated for their in vitro activity to inhibit Tat-TAR RNA interaction using UV melting studies, electrophoretic mobility shift assay, and RNase A footprinting. The results demonstrate that iron(II) supramolecular helicates inhibit Tat-TAR interaction at nanomolar concentrations by binding to TAR RNA. These studies provide a new insight into the biological potential of metallosupramolecular helicates.

Expression and RNA interference of salivary polygalacturonase genes in the tarnished plant bug, Lygus lineolaris.

PubMed

Walker, William B; Allen, Margaret L

2010-01-01

Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris.

Dietary risk assessment of v-ATPase A dsRNAs on monarch butterfly larvae

USDA-ARS?s Scientific Manuscript database

The goal of this study is to assess the risks of RNA interference (RNAi)-based genetically engineered crops on a non-target arthropod, monarch butterfly, Danaus plexippus. We hypothesize that an insecticidal double-stranded (ds) RNA targeting western corn rootworm, Diabrotica virgifera virgifera, ha...

Dana-Farber Cancer Institute: Genome-wide shRNA Screens with DEMETER Inferred Gene Effects | Office of Cancer Genomics

Cancer.gov

In this study RNA interference (RNAi) screens were performed on 285 cell lines and combined with 216 lines previously screened, which were then analyzed together with DEMETER to discover genetic dependencies across the entire pool of cell lines. Read the abstract

Domain motions of Argonaute, the catalytic engine of RNA interference

PubMed Central

Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y

2007-01-01

Background The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. Results The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes – an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Conclusion Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference. PMID:18053142

Domain motions of Argonaute, the catalytic engine of RNA interference.

PubMed

Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y

2007-11-30

The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes - an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference.

RNA interference of tubulin genes has lethal effects in Mythimna separate.

PubMed

Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji

2018-05-23

RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.

RNA Interference of the Muscle Actin Gene in Bed Bugs: Exploring Injection Versus Topical Application for dsRNA Delivery.

PubMed

Basnet, Sanjay; Kamble, Shripat T

2018-05-01

Bed bugs are one the most troublesome household pests that feed primarily on human blood. RNA interference (RNAi) is currently being pursued as a potential tool for insect population management and has shown efficacy against some phytophagous insects. We evaluated the different techniques to deliver dsRNA specific to bed bug muscle actin (dsactin) into bed bugs. Initially, stability of dsRNA in human blood was studied to evaluate the feasibility of feeding method. Adult bed bugs were injected with dsRNA between last thoracic segment and first abdominal segment on the ventral side, with a dose of 0.2 µg dsactin per insect. In addition to injection, dsactin was mixed in acetone and treated topically in the abdomens of fifth stage nymphs. We found the quick degradation of dsRNA in blood. Injection of dsactin caused significant depletion of actin transcripts and substantial reduction in oviposition and lethality in female adults. Topically treated dsRNA in fifth stage nymphs had no effect on actin mRNA expression and survival. Our results demonstrated that injection is a reliable method of dsRNA delivery into bed bugs while topical treatment was not successful. This research provides an understanding on effective delivery methods of dsRNA into bed bugs for functional genomics research and feasibility of the RNAi based molecules for pest management purposes.

Deletion of Cytoplasmic Double-Stranded RNA Sensors Does Not Uncover Viral Small Interfering RNA Production in Human Cells.

PubMed

Schuster, Susan; Tholen, Lotte E; Overheul, Gijs J; van Kuppeveld, Frank J M; van Rij, Ronald P

2017-01-01

Antiviral immunity in insects and plants is mediated by the RNA interference (RNAi) pathway in which viral long double-stranded RNA (dsRNA) is processed into small interfering RNAs (siRNAs) by Dicer enzymes. Although this pathway is evolutionarily conserved, its involvement in antiviral defense in mammals is the subject of debate. In vertebrates, recognition of viral RNA induces a sophisticated type I interferon (IFN)-based immune response, and it has been proposed that this response masks or inhibits antiviral RNAi. To test this hypothesis, we analyzed viral small RNA production in differentiated cells deficient in the cytoplasmic RNA sensors RIG-I and MDA5. We did not detect 22-nucleotide (nt) viral siRNAs upon infection with three different positive-sense RNA viruses. Our data suggest that the depletion of cytoplasmic RIG-I-like sensors is not sufficient to uncover viral siRNAs in differentiated cells. IMPORTANCE The contribution of the RNA interference (RNAi) pathway in antiviral immunity in vertebrates has been widely debated. It has been proposed that RNAi possesses antiviral activity in mammalian systems but that its antiviral effect is masked by the potent antiviral interferon response in differentiated mammalian cells. In this study, we show that inactivation of the interferon response is not sufficient to uncover antiviral activity of RNAi in human epithelial cells infected with three wild-type positive-sense RNA viruses.

Immune modulation through RNA interference-mediated silencing of CD40 in dendritic cells.

PubMed

Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Samiee, Shahram; Ataee, Zahra; Tabei, Seyyed Ziyaoddin; Moazzeni, Seyed Mohammad

2009-01-01

RNA interference (RNAi) is an exciting mechanism for knocking down any target gene in transcriptional level. It is now clear that small interfering RNA (siRNA), a 19-21nt long dsRNA, can trigger a degradation process (RNAi) that specifically silences the expression of a cognate mRNA. Our findings in this study showed that down regulation of CD40 gene expression in dendritic cells (DCs) by RNAi culminated to immune modulation. Effective delivery of siRNA into DCs would be a reasonable method for the blocking of CD40 gene expression at the cell surface without any effect on other genes and cell cytotoxicity. The effects of siRNA against CD40 mRNA on the function and phenotype of DCs were investigated. The DCs were separated from the mice spleen and then cultured in vitro. By the means of Lipofectamine2000, siRNA was delivered to the cells and the efficacy of transfection was estimated by flow cytometry. By Annexine V and Propidium Iodide staining, we could evaluate the transfected cells viability. Also, the mRNA expression and protein synthesis were assessed by real-time PCR and flow cytometry, respectively. Knocking down the CD40 gene in the DCs caused an increase in IL-4 production, decrease in IL-12 production and allostimulation activity. All together, these effects would stimulate Th2 cytokines production from allogenic T-cells in vitro.

Vector-based RNA interference against vascular endothelial growth factor-A significantly limits vascularization and growth of prostate cancer in vivo.

PubMed

Wannenes, Francesca; Ciafré, Silvia Anna; Niola, Francesco; Frajese, Gaetano; Farace, Maria Giulia

2005-12-01

RNA interference technology is emerging as a very potent tool to obtain a cellular knockdown of a desired gene. In this work we used vector-based RNA interference to inhibit vascular endothelial growth factor (VEGF) expression in prostate cancer in vitro and in vivo. We demonstrated that transduction with a plasmid carrying a small interfering RNA targeting all isoforms of VEGF, dramatically impairs the expression of this growth factor in the human prostate cancer cell line PC3. As a consequence, PC3 cells loose their ability to induce one of the fundamental steps of angiogenesis, namely the formation of a tube-like network in vitro. Most importantly, our "therapeutic" vector is able to impair tumor growth rate and vascularization in vivo. We show that a single injection of naked plasmid in developing neoplastic mass significantly decreases microvessel density in an androgen-refractory prostate xenograft and is able to sustain a long-term slowing down of tumor growth. In conclusion, our results confirm the basic role of VEGF in the angiogenic development of prostate carcinoma, and suggest that the use of our vector-based RNA interference approach to inhibit angiogenesis could be an effective tool in view of future gene therapy applications for prostate cancer.

Diverging affinity of tospovirus RNA silencing suppressor proteins, NSs, for various RNA duplex molecules.

PubMed

Schnettler, Esther; Hemmes, Hans; Huismann, Rik; Goldbach, Rob; Prins, Marcel; Kormelink, Richard

2010-11-01

The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs proteins analyzed exhibited affinity to small double-stranded RNA molecules, i.e., small interfering RNAs (siRNAs) and micro-RNA (miRNA)/miRNA* duplexes. Interestingly, the NSs proteins from tomato spotted wilt virus (TSWV), impatiens necrotic spot virus (INSV), and groundnut ringspot virus (GRSV) also showed affinity to long double-stranded RNA (dsRNA), whereas tomato yellow ring virus (TYRV) NSs did not. The TSWV NSs protein was shown to be capable of inhibiting Dicer-mediated cleavage of long dsRNA in vitro. In addition, it suppressed the accumulation of green fluorescent protein (GFP)-specific siRNAs during coinfiltration with an inverted-repeat-GFP RNA construct in Nicotiana benthamiana. In vivo interference of TSWV NSs in the miRNA pathway was shown by suppression of an enhanced GFP (eGFP) miRNA sensor construct. The ability to stabilize miRNA/miRNA* by different tospovirus NSs proteins in vivo was demonstrated by increased accumulation and detection of both miRNA171c and miRNA171c* in tospovirus-infected N. benthamiana. All together, these data suggest that tospoviruses interfere in the RNA silencing pathway by sequestering siRNA and miRNA/miRNA* molecules before they are uploaded into their respective RNA-induced silencing complexes. The observed affinity to long dsRNA for only a subset of the tospoviruses studied is discussed in light of evolutional divergence and their ancestral relation to the animal-infecting members of the Bunyaviridae.

RNA Interference Based Approach to Down Regulate Osmoregulators of Whitefly (Bemisia tabaci): Potential Technology for the Control of Whitefly

USDA-ARS?s Scientific Manuscript database

Over the past decade RNA interference (RNAi) technology has emerged as a successful tool not only for functional genomics, but in planta expression of short interfering RNAs (siRNAs) could offer potential for insect pest management. Insects feeding exclusively on plant sap depend on osmotic pressure...

RNA interference as a method for target-site screening in the Western Corn Rootworm, Diabrotica virgifera virgifera

USDA-ARS?s Scientific Manuscript database

RNA interference (RNAi) is one of the most powerful and extraordinarily-specific means by which to silence genes. The ability of RNAi to silence genes makes it possible to ascertain function from genomic data, thereby making it an excellent choice for target-site screening. To test the efficacy of...

A Simple Laboratory Practical to Illustrate RNA Mediated Gene Interference Using Drosophila Cell Culture

ERIC Educational Resources Information Center

Buluwela, Laki; Kamalati, Tahereh; Photiou, Andy; Heathcote, Dean A.; Jones, Michael D.; Ali, Simak

2010-01-01

RNA mediated gene interference (RNAi) is now a key tool in eukaryotic cell and molecular biology research. This article describes a five session laboratory practical, spread over a seven day period, to introduce and illustrate the technique. During the exercise, students working in small groups purify PCR products that encode "in vitro"…

How Golden Is Silence? Teaching Undergraduates the Power and Limits of RNA Interference

ERIC Educational Resources Information Center

Kuldell, Natalie H.

2006-01-01

It is hard and getting harder to strike a satisfying balance in teaching. Time dedicated to student-generated models or ideas is often sacrificed in an effort to "get through the syllabus." I describe a series of RNA interference (RNAi) experiments for undergraduate students that simultaneously explores fundamental concepts in gene regulation,…

RNA interference in the Asian Longhorned Beetle:Identification of Key RNAi Genes and Reference Genes for RT-qPCR

USDA-ARS?s Scientific Manuscript database

Asian longhorned beetle (ALB), Anoplophora glabripennis, is a serious invasive forest pest in several countries including the United States, Canada, and Europe. RNA interference (RNAi)technology is being developed as a novel method for pest management. Here, we identified the ALB core RNAi genes in...

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

PubMed Central

Tomoyasu, Yoshinori

2014-01-01

The red flour beetle, Tribolium castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully annotated genome sequence, transposon-based transgenesis, and effective RNA interference (RNAi). Among these advantages, RNAi-based gene knockdown techniques are at the core of Tribolium research. T. castaneum show a robust systemic RNAi response, making it possible to perform RNAi at any life stage by simply injecting double-stranded RNA (dsRNA) into the beetle’s body cavity. In this report, we provide an overview of our larval RNAi technique in T. castaneum. The protocol includes (i) isolation of the proper stage of T. castaneum larvae for injection, (ii) preparation for the injection setting, and (iii) dsRNA injection. Larval RNAi is a simple, but powerful technique that provides us with quick access to loss-of-function phenotypes, including multiple gene knockdown phenotypes as well as a series of hypomorphic phenotypes. Since virtually all T. castaneum tissues are susceptible to extracellular dsRNA, the larval RNAi technique allows researchers to study a wide variety of tissues in diverse contexts, including the genetic basis of organismal responses to the outside environment. In addition, the simplicity of this technique stimulates more student involvement in research, making T. castaneum an ideal genetic system for use in a classroom setting. PMID:25350485

A simple and robust vector-based shRNA expression system used for RNA interference.

PubMed

Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

2013-01-01

RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

Downregulation of mouse CCR3 by lentiviral shRNA inhibits proliferation and induces apoptosis of mouse eosinophils.

PubMed

Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui

2017-02-01

RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.

Specificity Protein (Sp) Transcription Factors and Metformin Regulate Expression of the Long Non-coding RNA HULC

EPA Science Inventory

There is evidence that specificity protein 1 (Sp1) transcription factor (TF) regulates expression of long non-coding RNAs (lncRNAs) in hepatocellular carcinoma (HCC) cells. RNA interference (RNAi) studies showed that among several lncRNAs expressed in HepG2, SNU-449 and SK-Hep-1...

RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems.

PubMed

Dietrich, Isabelle; Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Brennan, Benjamin; Elliott, Richard M; Diallo, Mawlouth; Sall, Amadou A; Failloux, Anna-Bella; Schnettler, Esther; Kohl, Alain; Becker, Stefanie C

2017-01-01

The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus , Bunyaviridae ) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect Drosophila melanogaster . We found that RVFV infection induces both the exogenous small interfering RNA (siRNA) and piRNA pathways, which contribute to the control of viral replication in insects. Furthermore, we demonstrate the production of virus-derived piRNAs in Culex quinquefasciatus mosquitoes. Understanding these pathways and the targets within them offers the potential of the development of novel RVFV control measures in vector-based strategies.

RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems

PubMed Central

Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Elliott, Richard M.; Diallo, Mawlouth; Sall, Amadou A.; Failloux, Anna-Bella; Schnettler, Esther

2017-01-01

ABSTRACT The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus, Bunyaviridae) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect Drosophila melanogaster. We found that RVFV infection induces both the exogenous small interfering RNA (siRNA) and piRNA pathways, which contribute to the control of viral replication in insects. Furthermore, we demonstrate the production of virus-derived piRNAs in Culex quinquefasciatus mosquitoes. Understanding these pathways and the targets within them offers the potential of the development of novel RVFV control measures in vector-based strategies. PMID:28497117

Structural analyses of the CRISPR protein Csc2 reveal the RNA-binding interface of the type I-D Cas7 family.

PubMed

Hrle, Ajla; Maier, Lisa-Katharina; Sharma, Kundan; Ebert, Judith; Basquin, Claire; Urlaub, Henning; Marchfelder, Anita; Conti, Elena

2014-01-01

Upon pathogen invasion, bacteria and archaea activate an RNA-interference-like mechanism termed CRISPR (clustered regularly interspaced short palindromic repeats). A large family of Cas (CRISPR-associated) proteins mediates the different stages of this sophisticated immune response. Bioinformatic studies have classified the Cas proteins into families, according to their sequences and respective functions. These range from the insertion of the foreign genetic elements into the host genome to the activation of the interference machinery as well as target degradation upon attack. Cas7 family proteins are central to the type I and type III interference machineries as they constitute the backbone of the large interference complexes. Here we report the crystal structure of Thermofilum pendens Csc2, a Cas7 family protein of type I-D. We found that Csc2 forms a core RRM-like domain, flanked by three peripheral insertion domains: a lid domain, a Zinc-binding domain and a helical domain. Comparison with other Cas7 family proteins reveals a set of similar structural features both in the core and in the peripheral domains, despite the absence of significant sequence similarity. T. pendens Csc2 binds single-stranded RNA in vitro in a sequence-independent manner. Using a crosslinking - mass-spectrometry approach, we mapped the RNA-binding surface to a positively charged surface patch on T. pendens Csc2. Thus our analysis of the key structural and functional features of T. pendens Csc2 highlights recurring themes and evolutionary relationships in type I and type III Cas proteins.

Expression and RNA Interference of Salivary Polygalacturonase Genes in the Tarnished Plant Bug, Lygus lineolaris

PubMed Central

Walker, William B.; Allen, Margaret L.

2010-01-01

Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris. PMID:21062205

An in vivo and in silico approach to study cis-antisense: a short cut to higher order response

NASA Astrophysics Data System (ADS)

Courtney, Colleen; Varanasi, Usha; Chatterjee, Anushree

2014-03-01

Antisense interactions are present in all domains of life. Typically sense, antisense RNA pairs originate from overlapping genes with convergent face to face promoters, and are speculated to be involved in gene regulation. Recent studies indicate the role of transcriptional interference (TI) in regulating expression of genes in convergent orientation. Modeling antisense, TI gene regulation mechanisms allows us to understand how organisms control gene expression. We present a modeling and experimental framework to understand convergent transcription that combines the effects of transcriptional interference and cis-antisense regulation. Our model shows that combining transcriptional interference and antisense RNA interaction adds multiple-levels of regulation which affords a highly tunable biological output, ranging from first order response to complex higher-order response. To study this system we created a library of experimental constructs with engineered TI and antisense interaction by using face-to-face inducible promoters separated by carefully tailored overlapping DNA sequences to control expression of a set of fluorescent reporter proteins. Studying this gene expression mechanism allows for an understanding of higher order behavior of gene expression networks.

Improved silencing properties using small internally segmented interfering RNAs

PubMed Central

Bramsen, Jesper B.; Laursen, Maria B.; Damgaard, Christian K.; Lena, Suzy W.; Ravindra Babu, B.; Wengel, Jesper; Kjems, Jørgen

2007-01-01

RNA interference is mediated by small interfering RNAs (siRNAs) that upon incorporation into the RNA-induced silencing complex (RISC) can target complementary mRNA for degradation. Standard siRNA design usually feature a 19–27 base pair contiguous double-stranded region that is believed to be important for RISC incorporation. Here, we describe a novel siRNA design composed of an intact antisense strand complemented with two shorter 10–12 nt sense strands. This three-stranded construct, termed small internally segmented interfering RNA (sisiRNA), is highly functional demonstrating that an intact sense strand is not a prerequisite for RNA interference. Moreover, when using the sisiRNA design only the antisense strand is functional in activated RISC thereby completely eliminating unintended mRNA targeting by the sense strand. Interestingly, the sisiRNA design supports the function of chemically modified antisense strands, which are non-functional within the context of standard siRNA designs. This suggests that the sisiRNA design has a clear potential of improving the pharmacokinetic properties of siRNA in vivo. PMID:17726057

Efficacy of a Novel Class of RNA Interference Therapeutic Agents

PubMed Central

Matsumoto, Takahiro; D'Alessandro-Gabazza, Corina N.; Gil-Bernabe, Paloma; Boveda-Ruiz, Daniel; Naito, Masahiro; Kobayashi, Tetsu; Toda, Masaaki; Mizutani, Takayuki; Taguchi, Osamu; Morser, John; Eguchi, Yutaka; Kuroda, Masahiko; Ochiya, Takahiro; Hayashi, Hirotake; Gabazza, Esteban C.; Ohgi, Tadaaki

2012-01-01

RNA interference (RNAi) is being widely used in functional gene research and is an important tool for drug discovery. However, canonical double-stranded short interfering RNAs are unstable and induce undesirable adverse effects, and thus there is no currently RNAi-based therapy in the clinic. We have developed a novel class of RNAi agents, and evaluated their effectiveness in vitro and in mouse models of acute lung injury (ALI) and pulmonary fibrosis. The novel class of RNAi agents (nkRNA®, PnkRNA™) were synthesized on solid phase as single-stranded RNAs that, following synthesis, self-anneal into a unique helical structure containing a central stem and two loops. They are resistant to degradation and suppress their target genes. nkRNA and PnkRNA directed against TGF-β1mRNA ameliorate outcomes and induce no off-target effects in three animal models of lung disease. The results of this study support the pathological relevance of TGF-β1 in lung diseases, and suggest the potential usefulness of these novel RNAi agents for therapeutic application. PMID:22916145

RNA interference-mediated NOTCH3 knockdown induces phenotype switching of vascular smooth muscle cells in vitro

PubMed Central

Liu, Nan; Li, Ying; Chen, Hui; Wei, Wei; An, Yulin; Zhu, Guangming

2015-01-01

Notch3 plays an important role in differentiation, migration and signal transduction of vascular smooth muscle cells (VSMCs). In this study, we used RNA interference (RNAi) technique to investigate the effect of knocking down the expression of the NOTCH3 gene in VSMCs on the phenotype determination under pathologic status. Real-time PCR and Western Blot experiments verified the expression levels of Notch3 mRNA and protein were reduced more than 40% and 50% in the NOTCH3 siRNA group. When the expression of Notch3 was decreased, the proliferation, apoptosis and immigration of VSMCs were enhanced compared to control groups (P < 0.01). NOTCH3 siRNA VSMCs observed using confocal microscopy showed abnormal nuclear configuration, a disorganized actin filament system, polygonal cell shapes, and decreasing cell sizes. Additionally, knocking down the expression of NOTCH3 may evoke the CASR and FAK expression. In Conclusion, interfering with the expression of NOTCH3 causes VSMCs to exhibit an intermediate phenotype. CaSR and FAK may be involved in the Notch3 signaling pathway. PMID:26550181

RNA interference-mediated NOTCH3 knockdown induces phenotype switching of vascular smooth muscle cells in vitro.

PubMed

Liu, Nan; Li, Ying; Chen, Hui; Wei, Wei; An, Yulin; Zhu, Guangming

2015-01-01

Notch3 plays an important role in differentiation, migration and signal transduction of vascular smooth muscle cells (VSMCs). In this study, we used RNA interference (RNAi) technique to investigate the effect of knocking down the expression of the NOTCH3 gene in VSMCs on the phenotype determination under pathologic status. Real-time PCR and Western Blot experiments verified the expression levels of Notch3 mRNA and protein were reduced more than 40% and 50% in the NOTCH3 siRNA group. When the expression of Notch3 was decreased, the proliferation, apoptosis and immigration of VSMCs were enhanced compared to control groups (P < 0.01). NOTCH3 siRNA VSMCs observed using confocal microscopy showed abnormal nuclear configuration, a disorganized actin filament system, polygonal cell shapes, and decreasing cell sizes. Additionally, knocking down the expression of NOTCH3 may evoke the CASR and FAK expression. In Conclusion, interfering with the expression of NOTCH3 causes VSMCs to exhibit an intermediate phenotype. CaSR and FAK may be involved in the Notch3 signaling pathway.

Iron(II) supramolecular helicates interfere with the HIV-1 Tat–TAR RNA interaction critical for viral replication

PubMed Central

Malina, Jaroslav; Hannon, Michael J.; Brabec, Viktor

2016-01-01

The interaction between the HIV-1 transactivator protein Tat and TAR (transactivation responsive region) RNA, plays a critical role in HIV-1 transcription. Iron(II) supramolecular helicates were evaluated for their in vitro activity to inhibit Tat–TAR RNA interaction using UV melting studies, electrophoretic mobility shift assay, and RNase A footprinting. The results demonstrate that iron(II) supramolecular helicates inhibit Tat-TAR interaction at nanomolar concentrations by binding to TAR RNA. These studies provide a new insight into the biological potential of metallosupramolecular helicates. PMID:27405089

Engineered disease resistance in cotton using RNA-interference to knock down cotton leaf curl kokhran virus-Burewala and cotton leaf curl Multan betasatellite

USDA-ARS?s Scientific Manuscript database

Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...

An enzyme free electrochemical biosensor for sensitive detection of miRNA with a high discrimination factor by coupling the strand displacement reaction and catalytic hairpin assembly recycling.

PubMed

Yao, Juan; Zhang, Zhang; Deng, Zhenghua; Wang, Youqiang; Guo, Yongcan

2017-10-23

An isothermal, enzyme free, ultra-specific and ultra-sensitive protocol for electrochemical detection of miRNAs is proposed based on the toehold-mediated strand displacement reaction (SDR) and non-enzymatic catalytic hairpin reaction (CHA) recycling. The SDR was first triggered only in the presence of target miRNA and this process also affects other miRNA interferences having similar target sequences, thus guaranteeing a high discrimination factor and could be used in rare content miRNA detection with various amounts of interferences having similar target sequences. The output protector strand then triggered enzyme free CHA amplification and generates plenty of hairpin self-assembly products. This process in turn influences SDR equilibrium to move to the right and generates large amounts of protector output to ensure analysis sensitivity. Compared with traditional CHA, our proposed method greatly improved the signal to noise ratio and shows excellent performance in rare miRNA detection with miRNA analogue interference. Under the optimal experimental conditions and using square wave voltammetry, the established biosensor could detect target miRNA-21 down to 30 fM (S/N = 3) with a dynamic range from 100 fM to 2 nM, and discriminate rare target miRNA-21 from mismatched miRNA with high selectivity. This method holds great promise in miRNA detection from human cancer cell lines and would be a versatile and powerful tool for clinical molecular diagnostics.

RNA interference inhibits yellow fever virus replication in vitro and in vivo.

PubMed

Pacca, Carolina C; Severino, Adriana A; Mondini, Adriano; Rahal, Paula; D'avila, Solange G P; Cordeiro, José Antonio; Nogueira, Mara Correa Lelles; Bronzoni, Roberta V M; Nogueira, Maurício L

2009-04-01

RNA interference (RNAi) is a process that is induced by double stranded RNA and involves the degradation of specific sequences of mRNA in the cytoplasm of the eukaryotic cells. It has been used as an antiviral tool against many viruses, including flaviviruses. The genus Flavivirus contains the most important arboviruses in the world, i.e., dengue (DENV) and yellow fever (YFV). In our study, we investigated the in vitro and in vivo effect of RNAi against YFV. Using stable cell lines that expressed RNAi against YFV, the cell lines were able to inhibit as much as 97% of the viral replication. Two constructions (one against NS1 and the other against E region of YFV genome) were able to protect the adult Balb/c mice against YFV challenge. The histopathologic analysis demonstrated an important protection of the central nervous system by RNAi after 10 days of viral challenge. Our data suggests that RNAi is a potential viable therapeutic weapon against yellow fever.

The RNA-induced silencing complex: a versatile gene-silencing machine.

PubMed

Pratt, Ashley J; MacRae, Ian J

2009-07-03

RNA interference is a powerful mechanism of gene silencing that underlies many aspects of eukaryotic biology. On the molecular level, RNA interference is mediated by a family of ribonucleoprotein complexes called RNA-induced silencing complexes (RISCs), which can be programmed to target virtually any nucleic acid sequence for silencing. The ability of RISC to locate target RNAs has been co-opted by evolution many times to generate a broad spectrum of gene-silencing pathways. Here, we review the fundamental biochemical and biophysical properties of RISC that facilitate gene targeting and describe the various mechanisms of gene silencing known to exploit RISC activity.

Knockdown of the Chromatin Remodeling Gene Brahma by RNA Interference Reduces Reproductive Fitness and Lifespan in Common Bed Bug (Hemiptera: Cimicidae).

PubMed

Basnet, Sanjay; Kamble, Shripat T

2018-05-04

The common bed bug, Cimex lectularius L. (Hemiptera: Cimicidae) is a nuisance household pest causing significant medical and economic impacts. RNA interference (RNAi) of genes that are involved in vital physiological processes can serve as potential RNAi targets for insect control. Brahma is an ATPase subunit of a chromatin-remodeling complex involved in transcription of several genes for cellular processes, most importantly the homeotic genes. In this study, we used a microinjection technique to deliver double stranded RNA into female bed bugs. Delivery of 0.05 and 0.5 µg/insect of brahma dsRNA directly into hemocele resulted substantial reduction in oviposition. Eggs laid by bed bugs receiving both doses of brahma dsRNA exhibited significantly lower hatching percentage as compared to controls. In addition, brahma RNAi in female bed bugs caused significant mortality. Our results disclosed the potential of brahma RNAi to suppress bed bug population through injection of specific dsRNA, suggesting a critical function of this gene in bed bugs' reproduction and survival. Based on our data, brahma can be a promising RNAi target for suppression of bed bug population.

[Expression of Jagged1 mRNA in human epithelial ovarian carcinoma tissues and effect of RNA interference of Jagged1 on growth of xenograft in nude mice].

PubMed

Liu, G Y; Gao, Z H; Li, L; Song, T T; Sheng, X G

2016-06-25

To investigate the expression of Jagged1 in human epithelial ovarian carcinoma tissues and the effect of Jagged1 on growth of xenograft in nude mice. (1) Forty-eight cases of ovarian cancer and 30 cases of patients with benign epithelial ovarian tumor in the Henan Province Xinxiang Central Hospital during Feb. 2011 to Mar. 2014 were enrolled in this study. The mRNA expression of Jagged1, Notch1 and the downstream target genes Hes1, Hey1 were analyzed by using realtime PCR method. (2) The ovarian cancer xenograft models in nude mice were constructed by injecting SKOV3 cells in axillary subcutaneouswere. The nude mice were randomly divided into Jagged1 interference group, blank plasmid group and control group. Each group had 10 mice. They were transfected with pcDNA3.1(+)-siRNA-Jagged1, blank plasmid pDC3.1 and phosphate buffer, respectively. The tumor volumes and tumor masses were measured 14 days after transfection and the inhibition rate was calculated. The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues after transfection in each group was detected by using realtime PCR technique and the relative protein expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues was detected by utilizing western blot method. (1) The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in ovarian cancer tissues were higher than benign ovarian tumor tissues, the differences were statistically significant (P<0.01). (2) The tumor volume was (491± 68) mm(3) and tumor mass was (2.6±0.4) g in Jagged1 interference group, which were significantly lower than that in the blank plasmid group [(842±88) mm(3) and (4.4±0.8) g, respectively] and that in the control group [(851±90) mm(3) and (4.5±0.9) g, respectively; P<0.05], the tumor inhibition rate was 42.2% in Jagged1 interference group, which was significantly higher than that in the blank plasmid group and that in the control group (2.2% and 0, respectively), the differences were statistically significant (P<0.05). The relative mRNA and protein expression of Jagged1, Hes1 and Hey1 in xenograft tissues of nude micein Jagged1 interference group were lower than that in the other two groups, the differences were statistically significant (P<0.05). There were no differences of relative mRNA and protein expression of Notch1 in xenograft tissues of nude mice among the three groups (P>0.05). Jagged1 is highly expressed in epithelial ovarian carcinoma. Jagged1 gene interference in xenograft tumor can inhibit ovarian cancer cell growth and improve tumor suppressor rate, which probably play roles by inhibiting Notch1 signaling pathway.

Evolution at increased error rate leads to the coexistence of multiple adaptive pathways in an RNA virus.

PubMed

Cabanillas, Laura; Arribas, María; Lázaro, Ester

2013-01-16

When beneficial mutations present in different genomes spread simultaneously in an asexual population, their fixation can be delayed due to competition among them. This interference among mutations is mainly determined by the rate of beneficial mutations, which in turn depends on the population size, the total error rate, and the degree of adaptation of the population. RNA viruses, with their large population sizes and high error rates, are good candidates to present a great extent of interference. To test this hypothesis, in the current study we have investigated whether competition among beneficial mutations was responsible for the prolonged presence of polymorphisms in the mutant spectrum of an RNA virus, the bacteriophage Qβ, evolved during a large number of generations in the presence of the mutagenic nucleoside analogue 5-azacytidine. The analysis of the mutant spectra of bacteriophage Qβ populations evolved at artificially increased error rate shows a large number of polymorphic mutations, some of them with demonstrated selective value. Polymorphisms distributed into several evolutionary lines that can compete among them, making it difficult the emergence of a defined consensus sequence. The presence of accompanying deleterious mutations, the high degree of recurrence of the polymorphic mutations, and the occurrence of epistatic interactions generate a highly complex interference dynamics. Interference among beneficial mutations in bacteriophage Qβ evolved at increased error rate permits the coexistence of multiple adaptive pathways that can provide selective advantages by different molecular mechanisms. In this way, interference can be seen as a positive factor that allows the exploration of the different local maxima that exist in rugged fitness landscapes.

Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.

PubMed

Parrish, S; Fire, A

2001-10-01

RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed.

Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.

PubMed Central

Parrish, S; Fire, A

2001-01-01

RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed. PMID:11680844

Gene Silencing in Adult Aedes aegypti Mosquitoes Through Oral Delivery of Double-Stranded RNA

DTIC Science & Technology

2012-01-01

utilization of dsRNA as a bio-insecticide against mosquitoes has only recently begun to be evaluated. Double-stranded RNA targeting chitin syn- thase...double- stranded RNA nanoparticle-mediated RNA interference to silence chitin synthase genes through larval feeding in the African malaria mosquito

Double-stranded RNA interferes in a sequence-specific manner with the infection of representative members of the two viroid families

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carbonell, Alberto; Martinez de Alba, Angel-Emilio; Flores, Ricardo

2008-02-05

Infection by viroids, non-protein-coding circular RNAs, occurs with the accumulation of 21-24 nt viroid-derived small RNAs (vd-sRNAs) with characteristic properties of small interfering RNAs (siRNAs) associated to RNA silencing. The vd-sRNAs most likely derive from dicer-like (DCL) enzymes acting on viroid-specific dsRNA, the key elicitor of RNA silencing, or on the highly structured genomic RNA. Previously, viral dsRNAs delivered mechanically or agroinoculated have been shown to interfere with virus infection in a sequence-specific manner. Here, we report similar results with members of the two families of nuclear- and chloroplast-replicating viroids. Moreover, homologous vd-sRNAs co-delivered mechanically also interfered with one ofmore » the viroids examined. The interference was sequence-specific, temperature-dependent and, in some cases, also dependent on the dose of the co-inoculated dsRNA or vd-sRNAs. The sequence-specific nature of these effects suggests the involvement of the RNA induced silencing complex (RISC), which provides sequence specificity to RNA silencing machinery. Therefore, viroid titer in natural infections might be regulated by the concerted action of DCL and RISC. Viroids could have evolved their secondary structure as a compromise between resistance to DCL and RISC, which act preferentially against RNAs with compact and relaxed secondary structures, respectively. In addition, compartmentation, association with proteins or active replication might also help viroids to elude their host RNA silencing machinery.« less

A Small GTP-Binding Host Protein Is Required for Entry of Powdery Mildew Fungus into Epidermal Cells of Barley1

PubMed Central

Schultheiss, Holger; Dechert, Cornelia; Kogel, Karl-Heinz; Hückelhoven, Ralph

2002-01-01

Small GTP-binding proteins such as those from the RAC family are cytosolic signal transduction proteins that often are involved in processing of extracellular stimuli. Plant RAC proteins are implicated in regulation of plant cell architecture, secondary wall formation, meristem signaling, and defense against pathogens. We isolated a RacB homolog from barley (Hordeum vulgare) to study its role in resistance to the barley powdery mildew fungus (Blumeria graminis f.sp. hordei). RacB was constitutively expressed in the barley epidermis and its expression level was not strongly influenced by inoculation with B. graminis. However, after biolistic bombardment of barley leaf segments with RacB-double-stranded RNA, sequence-specific RNA interference with RacB function inhibited fungal haustorium establishment in a cell-autonomous and genotype-specific manner. Mutants compromised in function of the Mlo wild-type gene and the Ror1 gene (genotype mlo5 ror1) that are moderately susceptible to B. graminis showed no alteration in powdery mildew resistance upon RacB-specific RNA interference. Thus, the phenotype, induced by RacB-specific RNA interference, was apparently dependent on the same processes as mlo5-mediated broad resistance, which is suppressed by ror1. We conclude that an RAC small GTP-binding protein is required for successful fungal haustorium establishment and that this function may be linked to MLO-associated functions. PMID:11950993

PEGylated poly(ethylene imine) copolymer-delivered siRNA inhibits HIV replication in vitro.

PubMed

Weber, Nick D; Merkel, Olivia M; Kissel, Thomas; Muñoz-Fernández, María Ángeles

2012-01-10

RNA interference is increasingly being utilized for the specific targeting and down-regulation of disease-causing genes, including targeting viral infections such as HIV. T lymphocytes, the primary target for HIV, are very difficult to treat with gene therapy applications such as RNA interference because of issues with drug delivery. To circumvent these problems, we investigated poly(ethylene imine) (PEI) as a method of improving transfection efficiency of siRNA to T lymphocytes. Additionally, polyethylene glycol (PEG) moieties were engrafted to the PEI polymers with the goals of improving stability and reducing cytotoxicity. Initial studies on PEG-PEI/siRNA polyplex formation, size and their interaction with cell membranes demonstrated their feasibility as drug delivery agents. Assays with lymphocytes revealed low cytotoxicity profiles of the polyplexes at pharmacologically relevant concentrations with PEGylated copolymers obtaining the best results. Successful transfection of a T cell line or primary T cells with siRNA was observed via flow cytometry and confocal microscopy. Finally, the biological effect of copolymer-delivered siRNA was measured. Of particular significance, siRNA targeted to the HIV gene nef and delivered by one of the PEG-PEI copolymers in repetitive treatments every 2-3 days was observed to inhibit HIV replication to the same extent as azidothymidine over the course of 15 days. Copyright © 2011 Elsevier B.V. All rights reserved.

Prediction of effective RNA interference targets and pathway-related genes in lepidopteran insects by RNA sequencing analysis.

PubMed

Guan, Ruo-Bing; Li, Hai-Chao; Miao, Xue-Xia

2018-06-01

When using RNA interference (RNAi) to study gene functions in Lepidoptera insects, we discovered that some genes could not be suppressed; instead, their expression levels could be up-regulated by double-stranded RNA (dsRNA). To predict which genes could be easily silenced, we treated the Asian corn borer (Ostrinia furnacalis) with dsGFP (green fluorescent protein) and dsMLP (muscle lim protein). A transcriptome sequence analysis was conducted using the cDNAs 6 h after treatment with dsRNA. The results indicated that 160 genes were up-regulated and 44 genes were down-regulated by the two dsRNAs. Then, 50 co-up-regulated, 25 co-down-regulated and 43 unaffected genes were selected to determine their RNAi responses. All the 25 down-regulated genes were knocked down by their corresponding dsRNA. However, several of the up-regulated and unaffected genes were up-regulated when treated with their corresponding dsRNAs instead of being knocked down. The genes up-regulated by the dsGFP treatment may be involved in insect immune responses or the RNAi pathway. When the immune-related genes were excluded, only seven genes were induced by dsGFP, including ago-2 and dicer-2. These results not only provide a reference for efficient RNAi target predications, but also provide some potential RNAi pathway-related genes for further study. © 2017 Institute of Zoology, Chinese Academy of Sciences.

Reversal of multidrug resistance in MCF-7/Adr cells by codelivery of doxorubicin and BCL2 siRNA using a folic acid-conjugated polyethylenimine hydroxypropyl-β-cyclodextrin nanocarrier

PubMed Central

Li, Jin-Ming; Zhang, Wei; Su, Hua; Wang, Yuan-Yuan; Tan, Cai-Ping; Ji, Liang-Nian; Mao, Zong-Wan

2015-01-01

Systemic administration of chemotherapy for cancer often faces drug resistance, limiting its applications in cancer therapy. In this study, we developed a simple multifunctional nanocarrier based on polyethylenimine (PEI) to codeliver doxorubicin (DOX) and BCL2 small interfering RNA (siRNA) for overcoming multidrug resistance (MDR) and enhancing apoptosis in MCF-7/Adr cancer cells by combining chemotherapy and RNA interference (RNAi) therapy. The low-molecular-weight branch PEI was used to conjugate hydroxypropyl-β-cyclodextrin (HP-β-CD) and folic acid (FA), forming the codelivery nanocarrier (FA-HP-β-CD-PEI) to encapsulate DOX with the cavity HP-β-CD and bind siRNA with the positive charge of PEI for tumor-targeting codelivering drugs. The drug-loaded nanocomplexes (FA-HP-β-CD-PEI/DOX/siRNA) showed uniform size distribution, high cellular uptake, and significant gene suppression of BCL2, displaying the potential of overcoming MDR for enhancing the effect of anticancer drugs. Furthermore, the nanocomplexes achieved significant cell apoptosis through a mechanism of downregulating the antiapoptotic protein BCL2, resulted in improving therapeutic efficacy of the coadministered DOX by tumor targeting and RNA interference. Our study indicated that combined RNAi therapy and chemotherapy using our functional codelivery nanocarrier could overcome MDR and enhance apoptosis in MDR cancer cells for a potential application in treating MDR cancers. PMID:25960653

Therapeutic potentials of gene silencing by RNA interference: principles, challenges, and new strategies.

PubMed

Deng, Yan; Wang, Chi Chiu; Choy, Kwong Wai; Du, Quan; Chen, Jiao; Wang, Qin; Li, Lu; Chung, Tony Kwok Hung; Tang, Tao

2014-04-01

During recent decades there have been remarkable advances in biology, in which one of the most important discoveries is RNA interference (RNAi). RNAi is a specific post-transcriptional regulatory pathway that can result in silencing gene functions. Efforts have been done to translate this new discovery into clinical applications for disease treatment. However, technical difficulties restrict the development of RNAi, including stability, off-target effects, immunostimulation and delivery problems. Researchers have attempted to surmount these barriers and improve the bioavailability and safety of RNAi-based therapeutics by optimizing the chemistry and structure of these molecules. This paper aimed to describe the principles of RNA interference, review the therapeutic potential in various diseases and discuss the new strategies for in vivo delivery of RNAi to overcome the challenges. Copyright © 2013 Elsevier B.V. All rights reserved.

Gene interference regulates aquaporin-4 expression in swollen tissue of rats with cerebral ischemic edema

PubMed Central

Hu, Hui; Lu, Hong; He, Zhanping; Han, Xiangjun; Chen, Jing; Tu, Rong

2012-01-01

To investigate the effects of mRNA interference on aquaporin-4 expression in swollen tissue of rats with ischemic cerebral edema, and diagnose the significance of diffusion-weighted MRI, we injected 5 μL shRNA- aquaporin-4 (control group) or siRNA- aquaporin-4 solution (1:800) (RNA interference group) into the rat right basal ganglia immediately before occlusion of the middle cerebral artery. At 0.25 hours after occlusion of the middle cerebral artery, diffusion-weighted MRI displayed a high signal; within 2 hours, the relative apparent diffusion coefficient decreased markedly, aquaporin-4 expression increased rapidly, and intracellular edema was obviously aggravated; at 4 and 6 hours, the relative apparent diffusion coefficient slowly returned to control levels, aquaporin-4 expression slightly increased, and angioedema was observed. In the RNA interference group, during 0.25–6 hours after injection of siRNA- aquaporin-4 solution, the relative apparent diffusion coefficient slightly fluctuated and aquaporin-4 expression was upregulated; during 0.5–4 hours, the relative apparent diffusion coefficient was significantly higher, while aquaporin-4 expression was significantly lower when compared with the control group, and intracellular edema was markedly reduced; at 0.25 and 6 hours, the relative apparent diffusion coefficient and aquaporin-4 expression were similar when compared with the control group; obvious angioedema remained at 6 hours. Pearson's correlation test results showed that aquaporin-4 expression was negatively correlated with the apparent diffusion coefficient (r = −0.806, P < 0.01). These findings suggest that upregulated aquaporin-4 expression is likely to be the main molecular mechanism of intracellular edema and may be the molecular basis for decreased relative apparent diffusion coefficient. Aquaporin-4 gene interference can effectively inhibit the upregulation of aquaporin-4 expression during the stage of intracellular edema with time-effectiveness. Moreover, diffusion-weighted MRI can accurately detect intracellular edema. PMID:25657707

Gene interference regulates aquaporin-4 expression in swollen tissue of rats with cerebral ischemic edema: Correlation with variation in apparent diffusion coefficient.

PubMed

Hu, Hui; Lu, Hong; He, Zhanping; Han, Xiangjun; Chen, Jing; Tu, Rong

2012-07-25

To investigate the effects of mRNA interference on aquaporin-4 expression in swollen tissue of rats with ischemic cerebral edema, and diagnose the significance of diffusion-weighted MRI, we injected 5 μL shRNA- aquaporin-4 (control group) or siRNA- aquaporin-4 solution (1:800) (RNA interference group) into the rat right basal ganglia immediately before occlusion of the middle cerebral artery. At 0.25 hours after occlusion of the middle cerebral artery, diffusion-weighted MRI displayed a high signal; within 2 hours, the relative apparent diffusion coefficient decreased markedly, aquaporin-4 expression increased rapidly, and intracellular edema was obviously aggravated; at 4 and 6 hours, the relative apparent diffusion coefficient slowly returned to control levels, aquaporin-4 expression slightly increased, and angioedema was observed. In the RNA interference group, during 0.25-6 hours after injection of siRNA- aquaporin-4 solution, the relative apparent diffusion coefficient slightly fluctuated and aquaporin-4 expression was upregulated; during 0.5-4 hours, the relative apparent diffusion coefficient was significantly higher, while aquaporin-4 expression was significantly lower when compared with the control group, and intracellular edema was markedly reduced; at 0.25 and 6 hours, the relative apparent diffusion coefficient and aquaporin-4 expression were similar when compared with the control group; obvious angioedema remained at 6 hours. Pearson's correlation test results showed that aquaporin-4 expression was negatively correlated with the apparent diffusion coefficient (r = -0.806, P < 0.01). These findings suggest that upregulated aquaporin-4 expression is likely to be the main molecular mechanism of intracellular edema and may be the molecular basis for decreased relative apparent diffusion coefficient. Aquaporin-4 gene interference can effectively inhibit the upregulation of aquaporin-4 expression during the stage of intracellular edema with time-effectiveness. Moreover, diffusion-weighted MRI can accurately detect intracellular edema.

Ewing's Sarcoma: Development of RNA Interference-Based Therapy for Advanced Disease

PubMed Central

Simmons, Olivia; Maples, Phillip B.; Senzer, Neil; Nemunaitis, John

2012-01-01

Ewing's sarcoma tumors are associated with chromosomal translocation between the EWS gene and the ETS transcription factor gene. These unique target sequences provide opportunity for RNA interference(i)-based therapy. A summary of RNAi mechanism and therapeutically designed products including siRNA, shRNA and bi-shRNA are described. Comparison is made between each of these approaches. Systemic RNAi-based therapy, however, requires protected delivery to the Ewing's sarcoma tumor site for activity. Delivery systems which have been most effective in preclinical and clinical testing are reviewed, followed by preclinical assessment of various silencing strategies with demonstration of effectiveness to EWS/FLI-1 target sequences. It is concluded that RNAi-based therapeutics may have testable and achievable activity in management of Ewing's sarcoma. PMID:22523703

Homo sapiens Systemic RNA Interference-defective-1 Transmembrane Family Member 1 (SIDT1) Protein Mediates Contact-dependent Small RNA Transfer and MicroRNA-21-driven Chemoresistance*

PubMed Central

Elhassan, Mohamed O.; Christie, Jennifer; Duxbury, Mark S.

2012-01-01

Locally initiated RNA interference (RNAi) has the potential for spatial propagation, inducing posttranscriptional gene silencing in distant cells. In Caenorhabditis elegans, systemic RNAi requires a phylogenetically conserved transmembrane channel, SID-1. Here, we show that a human SID-1 orthologue, SIDT1, facilitates rapid, contact-dependent, bidirectional small RNA transfer between human cells, resulting in target-specific non-cell-autonomous RNAi. Intercellular small RNA transfer can be both homotypic and heterotypic. We show SIDT1-mediated intercellular transfer of microRNA-21 to be a driver of resistance to the nucleoside analog gemcitabine in human adenocarcinoma cells. Documentation of a SIDT1-dependent small RNA transfer mechanism and the associated phenotypic effects on chemoresistance in human cancer cells raises the possibility that conserved systemic RNAi pathways contribute to the acquisition of drug resistance. Mediators of non-cell-autonomous RNAi may be tractable targets for novel therapies aimed at improving the efficacy of current cytotoxic agents. PMID:22174421

Effects of RNA interference-mediated silencing of toll-like receptor 4 gene on proliferation and apoptosis of human breast cancer MCF-7 and MDA-MB-231 cells: An in vitro study.

PubMed

Gao, Xiao-Ling; Yang, Jiao-Jiao; Wang, Shu-Juan; Chen, Yan; Wang, Bei; Cheng, Er-Jing; Gong, Jian-Nan; Dong, Yan-Ting; Liu, Dai; Wang, Xiang-Li; Huang, Ya-Qiong; An, Dong-Dong

2018-06-22

Breast cancer is known as the most prevalent cancer in women worldwide, and has an undeniable negative impact on public health, both physically, and mentally. This study aims to investigate the effects of toll-like receptor 4 (TLR4) gene silencing on proliferation and apoptosis of human breast cancer cells to explore for a new theoretical basis for its treatment. TLR4 small interference RNA (siRNA) fragment recombinant plasmids were constructed, including TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3. Human breast cancer MCF-7 and MDA-MB-231 cells were assigned into blank, negative control (NC), TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3 groups. MCF-7 and MDA-MB-231 cell growth was detected by MTT assay. Apoptosis and cell cycle were determined by flow cytometry. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) and Western blot analysis were conducted to determine the expression of TLR4, CDK4, cyclin D1, Livin, Bcl-2, p53, c-FLIP, and caspase-3. In comparison with the NC and blank groups, the TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3 groups showed decreased the expression of TLR4, inhibited proliferation of MCF-7 and MDA-MB-231 cells and promoted MCF-7 and MDA-MB-231 cell apoptosis, and the cells were blocked in G1 phase. In comparison with the NC and blank groups, in the TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3 groups, siRNA-TLR4 significantly increased expression of p53 and caspase-3 in MCF-7 and MDA-MB-231 cells, while it decreased the expressions of CDK4, cyclinD1, Livin, Bal-2, and c-FLIP. The study demonstrates that TLR4 gene silencing inhibits proliferation and induces apoptosis of MCF-7 and MDA-MB-231 cells. © 2018 Wiley Periodicals, Inc.

The effect of Pokemon on bladder cancer epithelial-mesenchymal transition.

PubMed

Guo, Changcheng; Zhu, Kai; Sun, Wei; Yang, Bin; Gu, Wenyu; Luo, Jun; Peng, Bo; Zheng, Junhua

2014-01-24

This study aimed at detecting Pokemon expression in bladder cancer cell and investigating the relationship between Pokemon and epithelial-mesenchymal transition. Furthermore, we investigated the functions of Pokemon in the carcinogenesis and development of bladder cancer. This study was also designed to observe the inhibitory effects of siRNA expression vector on Pokemon in bladder cancer cell. The siRNA expression vectors which were constructed to express a short hairpin RNA against Pokemon were transfected to the bladder cancer cells T24 with a liposome. Levels of Pokemon, E-cadherin and β-catenin mRNA and protein were examined by real-time quantitative-fluorescent PCR and Western blot analysis, respectively. The effects of Pokemon silencing on epithelial-mesenchymal transition of T24 cells were evaluated with wound-healing assay. Pokemon was strongly inhibited by siRNA treatment, especially siRNA3 treatment group, as it was reflected by Western blot and real-time PCR. The gene and protein of E-cadherin expression level showed increased markedly after Pokemon was inhibited by RNA interference. While there were no differences in the levels of gene and protein of β-catenin among five groups. The bladder cancer cell after Pokemon siRNA interference showed a significantly reduced wound-closing efficiency at 6, 12 and 24h. Our findings suggest Pokemon may inhibit the expression of E-cadherin. The low expression of E-cadherin lead to increasing the phenotype and apical-base polarity of epithelial cells. These changes of cells may result in the recurrence and progression of bladder cancer at last. Copyright © 2013 Elsevier Inc. All rights reserved.

Hypoxia-inducible factor 1–mediated human GATA1 induction promotes erythroid differentiation under hypoxic conditions

PubMed Central

Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu

2012-01-01

Abstract Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type–specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34+ haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl2 induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. PMID:22050843

Noncoding Subgenomic Flavivirus RNA Is Processed by the Mosquito RNA Interference Machinery and Determines West Nile Virus Transmission by Culex pipiens Mosquitoes.

PubMed

Göertz, G P; Fros, J J; Miesen, P; Vogels, C B F; van der Bent, M L; Geertsema, C; Koenraadt, C J M; van Rij, R P; van Oers, M M; Pijlman, G P

2016-11-15

Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5'-3' exoribonuclease XRN1/Pacman on conserved RNA structures in the 3' untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo Two reproducible small-RNA hot spots within the 3' UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3' SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. Understanding the flavivirus transmission cycle is important to identify novel targets to interfere with disease and to aid development of virus control strategies. Flaviviruses produce an abundant noncoding viral RNA called sfRNA in both arthropod and mammalian cells. To evaluate the role of sfRNA in flavivirus transmission, we infected mosquitoes with the flavivirus West Nile virus and an sfRNA-deficient mutant West Nile virus. We demonstrate that sfRNA determines the infection and transmission rates of West Nile virus in Culex pipiens mosquitoes. Comparison of infection via the blood meal versus intrathoracic injection, which bypasses the midgut, revealed that sfRNA is important to overcome the mosquito midgut barrier. We also show that sfRNA is processed by the antiviral RNA interference machinery in mosquitoes. This is the first report to describe a pivotal biological function of sfRNA in arthropods. The results explain why sfRNA production is evolutionarily conserved. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Noncoding Subgenomic Flavivirus RNA Is Processed by the Mosquito RNA Interference Machinery and Determines West Nile Virus Transmission by Culex pipiens Mosquitoes

PubMed Central

Göertz, G. P.; Fros, J. J.; Miesen, P.; Vogels, C. B. F.; van der Bent, M. L.; Geertsema, C.; Koenraadt, C. J. M.; van Oers, M. M.

2016-01-01

ABSTRACT Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5′-3′ exoribonuclease XRN1/Pacman on conserved RNA structures in the 3′ untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo. Two reproducible small-RNA hot spots within the 3′ UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3′ SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. IMPORTANCE Understanding the flavivirus transmission cycle is important to identify novel targets to interfere with disease and to aid development of virus control strategies. Flaviviruses produce an abundant noncoding viral RNA called sfRNA in both arthropod and mammalian cells. To evaluate the role of sfRNA in flavivirus transmission, we infected mosquitoes with the flavivirus West Nile virus and an sfRNA-deficient mutant West Nile virus. We demonstrate that sfRNA determines the infection and transmission rates of West Nile virus in Culex pipiens mosquitoes. Comparison of infection via the blood meal versus intrathoracic injection, which bypasses the midgut, revealed that sfRNA is important to overcome the mosquito midgut barrier. We also show that sfRNA is processed by the antiviral RNA interference machinery in mosquitoes. This is the first report to describe a pivotal biological function of sfRNA in arthropods. The results explain why sfRNA production is evolutionarily conserved. PMID:27581979

The cytomegalovirus promoter-driven short hairpin RNA constructs mediate effective RNA interference in zebrafish in vivo.

PubMed

Su, Jianguo; Zhu, Zuoyan; Wang, Yaping; Xiong, Feng; Zou, Jun

2008-01-01

The ability to utilize the RNA interference (RNAi) machinery for silencing target-gene expression has created a lot of excitement in the research community. In the present study, we used a cytomegalovirus (CMV) promoter-driven DNA template approach to induce short hairpin RNA (shRNA) triggered RNAi to block exogenous Enhanced Green Fluorescent Protein (EGFP) and endogenous No Tail (NTL) gene expressions. We constructed three plasmids, pCMV-EGFP-CMV-shGFP-SV40, pCMV-EGFP-CMV-shNTL-SV40, and pCMV-EGFP-CMV-shScrambled-SV40, each containing a CMV promoter driving an EGFP reporter cDNA and DNA coding for one shRNA under the control of another CMV promoter. The three shRNA-generating plasmids and pCMV-EGFP control plasmid were introduced into zebrafish embryos by microinjection. Samples were collected at 48 h after injection. Results were evaluated by phenotype observation and real-time fluorescent quantitative reverse-transcription polymerase chain reaction (Q-PCR). The shGFP-generating plasmid significantly inhibited the EGFP expression viewed under fluorescent microscope and reduced by 70.05 +/- 1.26% of exogenous EGFP gene mRNA levels compared with controls by Q-PCR. The shRNA targeting endogenous NTL gene resulted in obvious NTL phenotype of 30 +/- 4% and decreased the level of their corresponding mRNAs up to 54.52 +/- 2.05% compared with nontargeting control shRNA. These data proved the feasibility of the CMV promoter-driven shRNA expression technique to be used to inhibit exogenous and endogenous gene expressions in zebrafish in vivo.

In cell mutational interference mapping experiment (in cell MIME) identifies the 5' polyadenylation signal as a dual regulator of HIV-1 genomic RNA production and packaging.

PubMed

Smyth, Redmond P; Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe; von Kleist, Max; Marquet, Roland

2018-05-18

Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5' region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5' PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production.

In cell mutational interference mapping experiment (in cell MIME) identifies the 5′ polyadenylation signal as a dual regulator of HIV-1 genomic RNA production and packaging

PubMed Central

Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe

2018-01-01

Abstract Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5′ region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5′ PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production. PMID:29514260

Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

PubMed Central

2010-01-01

Background Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEXGM-CSF, we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. Methods To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Results Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. Conclusions This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials. PMID:20836854

Messenger RNA transcripts

Treesearch

Dan Cullen

2004-01-01

In contrast to DNA, messenger RNA (mRNA) in complex substrata is rarely analyzed, in large part because labile RNA molecules are difficult to purify. Nucleic acid extractions from fungi that colonize soil are particularly difficult and plagued by humic substances that interfere with Taq polymerase (Tebbe and Vahjen 1993 and references therein). Magnetic capture...

Knockdown of Zinc Transporter ZIP5 by RNA Interference Inhibits Esophageal Cancer Growth In Vivo.

PubMed

Li, Qian; Jin, Jing; Liu, Jianghui; Wang, Liqun; He, Yutong

2016-01-01

We recently found that SLC39A5 (ZIP5), a zinc transporter, is overexpressed in esophageal cancer. Downregulation of ZIP5 inhibited the proliferation, migration, and invasion of the esophageal cancer cell line KYSE170 in vitro. In this study, we found that downregulation of SLC39A5 (ZIP5) by interference resulted in a significant reduction in esophageal cancer tumor volume and weight in vivo. COX2 (cyclooxygenase 2) expression was decreased and E-cadherin expression was increased in the KYSE170K xenografts, which was caused by the downregulation of ZIP5. However, we did not find that the downregulation of ZIP5 caused a change in the relative expressions of cyclin D1, VEGF (vascular endothelial growth factor), MMP9 (matrix metalloprotein 9), and Bcl-2 (B-cell lymphoma/leukmia-2) mRNA or an alteration in the average level of zinc in the peripheral blood and xenografts in vivo. Collectively, these findings indicate that knocking down ZIP5 by small interfering RNA (siRNA) might be a novel treatment strategy for esophageal cancer with ZIP5 overexpression.

RNA interference-based nanosystems for inflammatory bowel disease therapy

PubMed Central

Guo, Jian; Jiang, Xiaojing; Gui, Shuangying

2016-01-01

Inflammatory bowel disease (IBD), which includes ulcerative colitis and Crohn’s disease, is a chronic, recrudescent disease that invades the gastrointestinal tract, and it requires surgery or lifelong medicinal therapy. The conventional medicinal therapies for IBD, such as anti-inflammatories, glucocorticoids, and immunosuppressants, are limited because of their systemic adverse effects and toxicity during long-term treatment. RNA interference (RNAi) precisely regulates susceptibility genes to decrease the expression of proinflammatory cytokines related to IBD, which effectively alleviates IBD progression and promotes intestinal mucosa recovery. RNAi molecules generally include short interfering RNA (siRNA) and microRNA (miRNA). However, naked RNA tends to degrade in vivo as a consequence of endogenous ribonucleases and pH variations. Furthermore, RNAi treatment may cause unintended off-target effects and immunostimulation. Therefore, nanovectors of siRNA and miRNA were introduced to circumvent these obstacles. Herein, we introduce non-viral nanosystems of RNAi molecules and discuss these systems in detail. Additionally, the delivery barriers and challenges associated with RNAi molecules will be discussed from the perspectives of developing efficient delivery systems and potential clinical use. PMID:27789943

Delivery of dsRNA through topical feeding for RNA interference in the citrus sap piercing-sucking hemipteran, Diaphorina citri.

PubMed

Killiny, Nabil; Kishk, Abdelaziz

2017-06-01

RNA interference (RNAi) is a powerful means to study functional genomics in insects. The delivery of dsRNA is a challenging step in the development of RNAi assay. Here, we describe a new delivery method to increase the effectiveness of RNAi in the Asian citrus psyllid Diaphorina citri. Bromophenol blue droplets were topically applied to fifth instar nymphs and adults on the ventral side of the thorax between the three pairs of legs. In addition to video recordings that showed sucking of the bromophenol blue by the stylets, dissected guts turned blue indicating that the uptake was through feeding. Thus, we called the method topical feeding. We targeted the abnormal wing disc gene (awd), also called nucleoside diphosphate kinase (NDPK), as a reporter gene to prove the uptake of dsRNA via this method of delivery. Our results showed that dsRNA-awd caused reduction of awd expression and nymph mortality. Survival and lifespan of adults emerged from treated nymphs and treated adults were affected. Silencing awd caused wing malformation in the adults emerged from treated nymphs. Topical feeding as a delivery of dsRNA is highly efficient for both nymphs and adults. The described method could be used to increase the efficiency of RNAi in D. citri and other sap piercing-sucking hemipterans. © 2017 Wiley Periodicals, Inc.

Endosymbiont interference and microbial diversity of the Pacific coast tick, Dermacentor occidentalis, in San Diego County, California.

PubMed

Gurfield, Nikos; Grewal, Saran; Cua, Lynnie S; Torres, Pedro J; Kelley, Scott T

2017-01-01

The Pacific coast tick, Dermacentor occidentalis Marx, is found throughout California and can harbor agents that cause human diseases such as anaplasmosis, ehrlichiosis, tularemia, Rocky Mountain spotted fever and rickettsiosis 364D. Previous studies have demonstrated that nonpathogenic endosymbiotic bacteria can interfere with Rickettsia co-infections in other tick species. We hypothesized that within D. occidentalis ticks, interference may exist between different nonpathogenic endosymbiotic or nonendosymbiotic bacteria and Spotted Fever group Rickettsia (SFGR). Using PCR amplification and sequencing of the romp A gene and intergenic region we identified a cohort of SFGR-infected and non-infected D. occidentalis ticks collected from San Diego County. We then amplified a partial segment of the 16S rRNA gene and used next-generation sequencing to elucidate the microbiomes and levels of co-infection in the ticks. The SFGR R. philipii str. 364D and R. rhipicephali were detected in 2.3% and 8.2% of the ticks, respectively, via romp A sequencing. Interestingly, next generation sequencing revealed an inverse relationship between the number of Francisella- like endosymbiont (FLE) 16S rRNA sequences and Rickettsia 16S rRNA sequences within individual ticks that is consistent with partial interference between FLE and SFGR infecting ticks. After excluding the Rickettsia and FLE endosymbionts from the analysis, there was a small but significant difference in microbial community diversity and a pattern of geographic isolation by distance between collection locales. In addition, male ticks had a greater diversity of bacteria than female ticks and ticks that weren't infected with SFGR had similar microbiomes to canine skin microbiomes. Although experimental studies are required for confirmation, our findings are consistent with the hypothesis that FLEs and, to a lesser extent, other bacteria, interfere with the ability of D. occidentalis to be infected with certain SFGR. The results also raise interesting possibilities about the effects of putative vertebrate hosts on the tick microbiome.

Homologous interference mediated by defective interfering influenza virus derived from a temperature-sensitive mutant of influenza virus.

PubMed Central

Nayak, D P; Tobita, K; Janda, J M; Davis, A R; De, B K

1978-01-01

A temperature-sensitive group II mutant of influenza virus, ts-52, with a presumed defect in viral RNA synthesis, readily produced von Magnus-type defective interfering virus (DI virus) when passed serially (four times) at high multiplicity in MDBK cells. The defective virus (ts-52 DI virus) had a high hemagglutinin and a low infectivity titer, and strongly interfered with the replication of standard infectious viruses (both ts-52 and wild-type ts+) in co-infected cells. Progeny virus particles produced by co-infection of DI virus and infectious virus were also defective and also had low infectivity, high hemagglutinating activity, and a strong interfering property. Infectious viruses ts+ and ts-52 were indistinguishable from ts-52 DI viruses by sucrose velocity or density gradient analysis. Additionally, these viruses all possessed similar morphology. However, when the RNA of DI viruses was analyzed by use of polyacrylamide gels containing 6 M urea, there was a reduction in the amount of large RNA species (V1 to V4), and a number of new smaller RNA species (D1 to D6) with molecular weights ranging from 2.9 X 10(5) to 1.05 X 10(5) appeared. Since these smaller RNA species (D1 to D6) were absent in some clones of infectious viruses, but were consistently associated with DI viruses and increased during undiluted passages and during co-infection of ts-52 with DI virus, they appeared to be a characteristic of DI viruses. Additionally, the UV target size of interfering activity and infectivity of DI virus indicated that interfering activity was 40 times more resistant to UV irradiation than was infectivity, further implicating small RNA molecules in interference. Our data suggest that the loss of infectivity observed among DI viruses may be due to nonspecific loss of a viral RNA segment(s), and the interfering property of DI viruses may be due to interfering RNA segments (DIRNA, D1 to D6). ts-52 DI virus interfered with the replication of standard virus (ts+) at both permissive (34 degrees C) and nonpermissive temperatures. The infectivity of the progeny virus was reduced to 0.2% for ts+ and 0.05% for ts-52 virus without a reduction in hemagglutinin titer. Interference was dependent on the concentration of DI virus. A particle ratio of 1 between DI virus (0.001 PFU/cell) and infectious virus (1.0 PFU/cell) produced a maximal amount of interference. Infectious virus yield was reduced 99.9% without any reduction of the yield of DI viruses Interference was also dependent on the time of addition of DI virus. Interference was most effective within the first 3 h of infection by infectious virus, indicating interference with an early function during viral replication. Images PMID:702654

RNAimmuno: A database of the nonspecific immunological effects of RNA interference and microRNA reagents

PubMed Central

Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J.

2012-01-01

The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies. PMID:22411954

RNAimmuno: a database of the nonspecific immunological effects of RNA interference and microRNA reagents.

PubMed

Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J

2012-05-01

The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies.

Small RNA binding is a common strategy to suppress RNA silencing by several viral suppressors

PubMed Central

Lakatos, Lóránt; Csorba, Tibor; Pantaleo, Vitantonio; Chapman, Elisabeth J; Carrington, James C; Liu, Yu-Ping; Dolja, Valerian V; Calvino, Lourdes Fernández; López-Moya, Juan José; Burgyán, József

2006-01-01

RNA silencing is an evolutionarily conserved system that functions as an antiviral mechanism in higher plants and insects. To counteract RNA silencing, viruses express silencing suppressors that interfere with both siRNA- and microRNA-guided silencing pathways. We used comparative in vitro and in vivo approaches to analyse the molecular mechanism of suppression by three well-studied silencing suppressors. We found that silencing suppressors p19, p21 and HC-Pro each inhibit the intermediate step of RNA silencing via binding to siRNAs, although the molecular features required for duplex siRNA binding differ among the three proteins. None of the suppressors affected the activity of preassembled RISC complexes. In contrast, each suppressor uniformly inhibited the siRNA-initiated RISC assembly pathway by preventing RNA silencing initiator complex formation. PMID:16724105

Translation Repression in Human Cells by MicroRNA-Induced Gene Silencing Requires RCK/p54

PubMed Central

Chu, Chia-ying

2006-01-01

RNA interference is triggered by double-stranded RNA that is processed into small interfering RNAs (siRNAs) by Dicer enzyme. Endogenously, RNA interference triggers are created from small noncoding RNAs called microRNAs (miRNAs). RNA-induced silencing complexes (RISC) in human cells can be programmed by exogenously introduced siRNA or endogenously expressed miRNA. siRNA-programmed RISC (siRISC) silences expression by cleaving a perfectly complementary target mRNA, whereas miRNA-induced silencing complexes (miRISC) inhibits translation by binding imperfectly matched sequences in the 3′ UTR of target mRNA. Both RISCs contain Argonaute2 (Ago2), which catalyzes target mRNA cleavage by siRISC and localizes to cytoplasmic mRNA processing bodies (P-bodies). Here, we show that RCK/p54, a DEAD box helicase, interacts with argonaute proteins, Ago1 and Ago2, in affinity-purified active siRISC or miRISC from human cells; directly interacts with Ago1 and Ago2 in vivo, facilitates formation of P-bodies, and is a general repressor of translation. Disrupting P-bodies by depleting Lsm1 did not affect RCK/p54 interactions with argonaute proteins and its function in miRNA-mediated translation repression. Depletion of RCK/p54 disrupted P-bodies and dispersed Ago2 throughout the cytoplasm but did not significantly affect siRNA-mediated RNA functions of RISC. Depleting RCK/p54 released general, miRNA-induced, and let-7-mediated translational repression. Therefore, we propose that translation repression is mediated by miRISC via RCK/p54 and its specificity is dictated by the miRNA sequence binding multiple copies of miRISC to complementary 3′ UTR sites in the target mRNA. These studies also suggest that translation suppression by miRISC does not require P-body structures, and location of miRISC to P-bodies is the consequence of translation repression. PMID:16756390

Knockdown of RNA interference pathway genes in western corn rootworm, Diabrotica virgifera virgifera, identifies no fitness costs associated with Argonaute 2 or Dicer-2.

PubMed

Camargo, Carolina; Wu, Ke; Fishilevich, Elane; Narva, Kenneth E; Siegfried, Blair D

2018-06-01

The use of transgenic crops that induce silencing of essential genes using double-stranded RNA (dsRNA) through RNA interference (RNAi) in western corn rootworm, Diabrotica virgifera virgifera, is likely to be an important component of new technologies for the control of this important corn pest. Previous studies have demonstrated that the dsRNA response in D. v. virgifera depends on the presence of RNAi pathway genes including Dicer-2 and Argonaute 2, and that downregulation of these genes limits the lethality of environmental dsRNA. A potential resistance mechanism to lethal dsRNA may involve loss of function of RNAi pathway genes. Howver, the potential for resistance to evolve may depend on whether these pathway genes have essential functions such that the loss of function of core proteins in the RNAi pathway will have fitness costs in D. v. virgifera. Fitness costs associated with potential resistance mechanisms have a central role in determining how resistance can evolve to RNAi technologies in western corn rootworm. We evaluated the effect of dsRNA and microRNA pathway gene knockdown on the development of D. v. virgifera larvae through short-term and long-term exposures to dsRNA for Dicer and Argonaute genes. Downregulation of Argonaute 2, Dicer-2, Dicer-1 did not significantly affect larval survivorship or development through short and long-term exposure to dsRNA. However, downregulation of Argonaute 1 reduced larval survivorship and delayed development. The implications of these results as they relate to D. v. virgifera resistance to lethal dsRNA are discussed. Copyright © 2018 Elsevier Inc. All rights reserved.

Molecular interactions and immune responses between Maize fine streak virus and the leafhopper vector Graminella nigrifrons through differential expression and RNA interference.

PubMed

Chen, Y; Redinbaugh, M G; Michel, A P

2015-06-01

Graminella nigrifrons is the only known vector for Maize fine streak virus (MFSV). In this study, we used real-time quantitative PCR to compare the expression profiles of transcripts that putatively function in the insect immune response: four peptidoglycan recognition proteins (PGRP-SB1, -SD, -LC and LB), Toll, spaetzle, defensin, Dicer-2 (Dcr-2), Argonaut-2 (Ago-2) and Arsenic resistance protein 2 (Ars-2). Except for PGRP-LB and defensin, transcripts involved in humoral pathways were significantly suppressed in G. nigrifrons fed on MFSV-infected maize. The abundance of three RNA interference (RNAi) pathway transcripts (Dcr-2, Ago-2, Ars-2) was significantly lower in nontransmitting relative to transmitting G. nigrifrons. Injection with double-stranded RNA (dsRNA) encoding segments of the PGRP-LC and Dcr-2 transcripts effectively reduced transcript levels by 90 and 75% over 14 and 22 days, respectively. MFSV acquisition and transmission were not significantly affected by injection of either dsRNA. Knock-down of PGRP-LC resulted in significant mortality (greater than 90%) at 27 days postinjection, and resulted in more abnormal moults relative to those injected with Dcr-2 or control dsRNA. The use of RNAi to silence G. nigrifrons transcripts will facilitate the study of gene function and pathogen transmission, and may provide approaches for developing novel targets of RNAi-based pest control. © 2015 The Royal Entomological Society.

RNA Interference in Moths: Mechanisms, Applications, and Progress

PubMed Central

Xu, Jin; Wang, Xia-Fei; Chen, Peng; Liu, Fang-Tao; Zheng, Shuai-Chao; Ye, Hui; Mo, Ming-He

2016-01-01

The vast majority of lepidopterans, about 90%, are moths. Some moths, particularly their caterpillars, are major agricultural and forestry pests in many parts of the world. However, some other members of moths, such as the silkworm Bombyx mori, are famous for their economic value. Fire et al. in 1998 initially found that exogenous double-stranded RNA (dsRNA) can silence the homolog endogenous mRNA in organisms, which is called RNA interference (RNAi). Soon after, the RNAi technique proved to be very promising not only in gene function determination but also in pest control. However, later studies demonstrate that performing RNAi in moths is not as straightforward as shown in other insect taxa. Nevertheless, since 2007, especially after 2010, an increasing number of reports have been published that describe successful RNAi experiments in different moth species either on gene function analysis or on pest management exploration. So far, more than 100 peer-reviewed papers have reported successful RNAi experiments in moths, covering 10 families and 25 species. By using classic and novel dsRNA delivery methods, these studies effectively silence the expression of various target genes and determine their function in larval development, reproduction, immunology, resistance against chemicals, and other biological processes. In addition, a number of laboratory and field trials have demonstrated that RNAi is also a potential strategy for moth pest management. In this review, therefore, we summarize and discuss the mechanisms and applications of the RNAi technique in moths by focusing on recent progresses. PMID:27775569

Harnessing RNA interference to develop neonatal therapies: from Nobel Prize winning discovery to proof of concept clinical trials.

PubMed

DeVincenzo, John P

2009-10-01

A revolution in the understanding of RNA biological processing and control is leading to revolutionary new concepts in human therapeutics. It has become increasingly clear that the so called "non-coding RNA" exerts specific and profound functional control on regulation of protein production and indeed controls the expression of all genes. Harnessing this naturally-occurring RNA-mediated regulation of protein production has immense human therapeutic potential. These processes are collectively known as RNA interference (RNAi). RNAi is a recently discovered, naturally-occurring intracellular process that regulates gene expression through the silencing of specific mRNAs. Methods of harnessing this natural pathway are being developed that allow the catalytic degradation of targeted mRNAs using specifically designed complementary small inhibitory RNAs (siRNA). siRNAs are being chemically modified to acquire drug-like properties. Numerous recent high profile publications have provided proofs of concept that RNA interference may be useful therapeutically. Much of the design of these siRNAs can be accomplished bioinformatically, thus potentially expediting drug discovery and opening new avenues of therapy for many uncommon, orphan, or emerging diseases. This makes this approach very attractive for developing therapies targeting orphan diseases including neonatal diseases. Theoretically, any disease that can be ameliorated through knockdown of any endogenous or exogenous protein is a potential therapeutic target for RNAi-based therapeutics. Lung diseases are particularly attractive targets for RNAi therapeutics since the affected cells' location increases their accessibility to topical administration of siRNA, for example by aerosol. Respiratory viral infections and chronic lung disease are examples of such diseases. RNAi therapeutics have been shown to be active against RSV, parainfluenza and human metapneumoviruses in vitro and in vivo resulting in profound antiviral effects. The first proof of concept test of efficacy of an RNAi-based therapeutic in man has been initiated. A discussion of the science behind RNA interference is followed by a presentation of the potential practical issues in applying this technology to neonatal respiratory viral diseases. RNAi may offer new strategies for the treatment of a variety of orphan diseases including neonatal diseases, RSV infections, and other respiratory viruses.

A yeast model for the mechanism of the Epstein-Barr virus immune evasion identifies a new therapeutic target to interfere with the virus stealthiness.

PubMed

Lista, María José; Martins, Rodrigo Prado; Angrand, Gaelle; Quillévéré, Alicia; Daskalogianni, Chrysoula; Voisset, Cécile; Teulade-Fichou, Marie-Paule; Fåhraeus, Robin; Blondel, Marc

2017-08-31

The oncogenic Epstein-Barr virus (EBV) evades the immune system but has an Achilles heel: its genome maintenance protein EBNA1. Indeed, EBNA1 is essential for viral genome replication and maintenance but also highly antigenic. Hence, EBV evolved a system in which the glycine-alanine repeat (GAr) of EBNA1 limits the translation of its own mRNA at a minimal level to ensure its essential function thereby, at the same time, minimizing immune recognition. Defining intervention points where to interfere with EBNA1 immune evasion is an important step to trigger an immune response against EBV-carrying cancers. Thanks to a yeast-based assay that recapitulates all the aspects of EBNA1 self-limitation of expression, a recent study by Lista et al. [Nature Communications (2017) 7, 435-444] has uncovered the role of the host cell nucleolin (NCL) in this process via a direct interaction of this protein with G-quadruplexes (G4) formed in GAr-encoding sequence of EBNA1 mRNA. In addition, the G4 ligand PhenDC3 prevents NCL binding on EBNA1 mRNA and reverses GAr-mediated repression of translation and antigen presentation. This shows that the NCL-EBNA1 mRNA interaction is a relevant therapeutic target to unveil EBV-carrying cancers to the immune system and that the yeast model can be successfully used for uncovering drugs and host factors that interfere with EBV stealthiness.

Regulatory functions of trehalose-6-phosphate synthase in the chitin biosynthesis pathway in Tribolium castaneum (Coleoptera: Tenebrionidae) revealed by RNA interference.

PubMed

Chen, Q W; Jin, S; Zhang, L; Shen, Q D; Wei, P; Wei, Z M; Wang, S G; Tang, B

2018-06-01

RNA interference (RNAi) is a very effective technique for studying gene function and may be an efficient method for controlling pests. Trehalose-6-phosphate synthase (TPS), which plays a key role in the synthesis of trehalose and insect development, was cloned in Tribolium castaneum (Herbst) (TcTPS) and the putative functions were studied using RNAi via the injection of double-stranded RNA (dsRNA) corresponding to conserved TPS and trehalose-6-phosphate phosphatase domains. Expression analyses show that TcTPS is expressed higher in the fat body, while quantitative real-time polymerase chain reaction results show that the expression of four trehalase isoforms was significantly suppressed by dsTPS injection. Additionally, the expression of six chitin synthesis-related genes, such as hexokinase 2 and glutamine-fructose-6-phosphate aminotransferase, was suppressed at 48 and 72 h post-dsTPS-1 and dsTPS-2 RNA injection, which were two dsTPS fragments that had been designed for two different locations in TcTPS open reading frame, and that trehalose content and trehalase 1 activity decreased significantly at 72 h post-dsRNA injection. Furthermore, T. castaneum injected with dsTPS-1 and dsTPS-2 RNA displayed significantly lower levels of chitin and could not complete the molting process from larvae to pupae, revealing abnormal molting phenotypes. These results demonstrate that silencing TPS gene leads to molting deformities and high mortality rates via regulation of gene expression in the chitin biosynthetic pathway, and may be a promising approach for pest control in the future.

RNA interference can be used to disrupt gene function in tardigrades

PubMed Central

Tenlen, Jennifer R.; McCaskill, Shaina; Goldstein, Bob

2012-01-01

How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We show that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions, and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments. PMID:23187800

RNA interference can be used to disrupt gene function in tardigrades.

PubMed

Tenlen, Jennifer R; McCaskill, Shaina; Goldstein, Bob

2013-05-01

How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We showed that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments.

Small Molecule Modulators of Pre-mRNA Splicing in Cancer Therapy.

PubMed

Salton, Maayan; Misteli, Tom

2016-01-01

Pre-mRNA splicing is a fundamental process in mammalian gene expression and alternative RNA splicing plays a considerable role in generating protein diversity. RNA splicing events are also key to the pathology of numerous diseases, particularly cancers. Some tumors are molecularly addicted to specific RNA splicing isoforms making interference with pre-mRNA processing a viable therapeutic strategy. Several RNA splicing modulators have recently been characterized, some showing promise in preclinical studies. While the targets of most splicing modulators are constitutive RNA processing components, possibly leading to undesirable side effects, selectivity for individual splicing events has been observed. Given the high prevalence of splicing defects in cancer, small molecule modulators of RNA processing represent a potentially promising novel therapeutic strategy in cancer treatment. Here, we review their reported effects, mechanisms, and limitations. Published by Elsevier Ltd.

RNA Interference for improving the Outcome of Islet Transplantation

PubMed Central

Li, Feng; Mahato, Ram I

2010-01-01

Islet transplantation has the potential to cure type 1 diabetes. Despite recent therapeutic success, it is still not common because a large number of transpanted islets get damaged by multiple challenges including instant blood mediated inflammatory reaction, hypoxia/reperfusion injury, inflammatory cytokines, and immune rejection. RNA interference (RNAi) is an novel strategy to selectively degrade target mRNA. The use of RNAi technologies to downregulate the expression of harmful genes has the potential to improve the outcome of islet transplantation. The aim of this review is to gain a thorough understanding of biological obstacles to islet transplantation and discuss how to overcome these barriers using different RNAi technologies. This eventually will help improve islet survival and function post transplantaion. Chemically synthesized small interferring RNA (siRNA), vector based short haripin RNA (shRNA), and their critical design elements (such as sequences, promoters, backbone) are discussed. The application of combinatorial RNAi in islet transplantation is also discussed. Last but not the least, several delivery strategies for enhanced gene silencing are discussed, including chemical modification of siRNA, complex formation, bioconjugation, and viral vectors. PMID:21156190

A-to-I editing of coding and non-coding RNAs by ADARs

PubMed Central

Nishikura, Kazuko

2016-01-01

Adenosine deaminases acting on RNA (ADARs) convert adenosine to inosine in double-stranded RNA. This A-to-I editing occurs not only in protein-coding regions of mRNAs, but also frequently in non-coding regions that contain inverted Alu repeats. Editing of coding sequences can result in the expression of functionally altered proteins that are not encoded in the genome, whereas the significance of Alu editing remains largely unknown. Certain microRNA (miRNA) precursors are also edited, leading to reduced expression or altered function of mature miRNAs. Conversely, recent studies indicate that ADAR1 forms a complex with Dicer to promote miRNA processing, revealing a new function of ADAR1 in the regulation of RNA interference. PMID:26648264

Global effects of the CSR-1 RNA interference pathway on the transcriptional landscape.

PubMed

Cecere, Germano; Hoersch, Sebastian; O'Keeffe, Sean; Sachidanandam, Ravi; Grishok, Alla

2014-04-01

Argonaute proteins and their small RNA cofactors short interfering RNAs are known to inhibit gene expression at the transcriptional and post-transcriptional levels. In Caenorhabditis elegans, the Argonaute CSR-1 binds thousands of endogenous siRNAs (endo-siRNAs) that are antisense to germline transcripts. However, its role in gene expression regulation remains controversial. Here we used genome-wide profiling of nascent RNA transcripts and found that the CSR-1 RNA interference pathway promoted sense-oriented RNA polymerase II transcription. Moreover, a loss of CSR-1 function resulted in global increase in antisense transcription and ectopic transcription of silent chromatin domains, which led to reduced chromatin incorporation of centromere-specific histone H3. On the basis of these findings, we propose that the CSR-1 pathway helps maintain the directionality of active transcription, thereby propagating the distinction between transcriptionally active and silent genomic regions.

HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs

PubMed Central

Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

2015-01-01

Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses. PMID:25668122

HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs.

PubMed

Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

2015-01-01

Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses.

New Genetics

MedlinePlus

... Century-Old Evolutionary Puzzle Computing Genetics Model Organisms RNA Interference The New Genetics is a science education ... the basics of DNA and its molecular cousin RNA, and new directions in genetic research. The New ...

Chemical Ligation Reactions of Oligonucleotides for Biological and Medicinal Applications.

PubMed

Abe, Hiroshi; Kimura, Yasuaki

2018-01-01

Chemical ligation of oligonucleotides (ONs) is the key reaction for various ON-based technologies. We have tried to solve the problems of RNA interference (RNAi) technology by applying ON chemical ligation to RNAi. We designed a new RNAi system, called intracellular buildup RNAi (IBR-RNAi), where the RNA fragments are built up into active small-interference RNA (siRNA) in cells through a chemical ligation reaction. Using the phosphorothioate and iodoacetyl groups as reactive functional groups for the ligation, we achieved RNAi effects without inducing immune responses. Additionally, we developed a new chemical ligation for IBR-RNAi, which affords a more native-like structure in the ligated product. The new ligation method should be useful not only for IBR-RNAi but also for the chemical synthesis of biofunctional ONs.

RNA interference of GGTA1 physiological and immune functions in immortalized porcine aortic endothelial cells.

PubMed

Han, Wei; Zhou, Jingshi; Li, Xiao; Wang, Jianfeng; Li, Junjie; Zhang, Zhuochao; Yang, Zhaoxu; Wang, Desheng; Tao, Kaishan; Dou, Kefeng

2013-11-01

Pig organs are commonly used in xenotransplantation, and α-1,3-galactose has been shown to be the main cause of hyperacute rejection. The development of transgenic pigs that lack α-1,3-galactosyltransferase (GGTA1) has overcome this problem to a certain extent, but transgenic pigs are difficult to maintain, making their usefulness in basic research limited. For this reason, we propose to establish a cell model to study hyperacute rejection. Immortalized primary porcine aortic endothelial cells were transfected with a short hairpin RNA targeted to GGTA1. Cell proliferation, apoptosis, complement C3 activation, and the binding of human immunoglobulins and components of the complement system, including IgM, IgG, C3, and C5b-9, were examined. After RNA interference, GGTA1 was found to be reduced at both the transcript and protein level as assessed by quantitative polymerase chain reaction and flow cytometry, respectively. When cultured in the presence of human serum, the proliferation rate of the transfected cells was higher than that of untransfected cells, and the apoptosis rate was lower. Additionally, activation of C3 and the binding of human immunoglobulins IgM and IgG and complement component C3 and C5b-9 to the transfected cells were lower than in the immortalized group but higher than in untransfected cells. RNA interference of GGTA1 in cultured porcine endothelial cells reduces the reaction of immunoglobulin and complement system with the cells. Therefore, this in vitro cell model could be useful for further study of xenotransplantation. Copyright © 2013 Elsevier Inc. All rights reserved.

Functional analysis of two polygalacturonase genes in Apolygus lucorum associated with eliciting plant injury using RNA interference.

PubMed

Zhang, Wanna; Liu, Bing; Lu, Yanhui; Liang, Gemei

2017-04-01

Salivary enzymes of many piercing-sucking insects lead to host plant injury. The salivary enzymes, polygalacturonase (PGs), act in insect feeding. PG family genes have been cloned from the mirid bug Apolygus lucorum, a pest of cotton and other host crops in China. We investigated the function of two PG genes that are highly expressed in A. lucorum nymphs (PG3-4) and adults (PG3-5), using siRNA injection-based RNA interference (RNAi). Accumulation of mRNA encoding both genes and their cognate proteins was significantly reduced (>60%) in experimental compared control green fluorescent protein (GFP) siRNA-treated mirids at 48 h post injection. Injury levels of cotton buds were also significantly reduced after injecting saliva isolated from PG3-4 and PG3-5 siRNA-treated A. lucorum. These results demonstrate that these two PG act in A. lucorum elicitation of plant injury. © 2017 Wiley Periodicals, Inc.

C3PO, an endoribonuclease that promotes RNAi by facilitating RISC activation.

PubMed

Liu, Ying; Ye, Xuecheng; Jiang, Feng; Liang, Chunyang; Chen, Dongmei; Peng, Junmin; Kinch, Lisa N; Grishin, Nick V; Liu, Qinghua

2009-08-07

The catalytic engine of RNA interference (RNAi) is the RNA-induced silencing complex (RISC), wherein the endoribonuclease Argonaute and single-stranded small interfering RNA (siRNA) direct target mRNA cleavage. We reconstituted long double-stranded RNA- and duplex siRNA-initiated RISC activities with the use of recombinant Drosophila Dicer-2, R2D2, and Ago2 proteins. We used this core reconstitution system to purify an RNAi regulator that we term C3PO (component 3 promoter of RISC), a complex of Translin and Trax. C3PO is a Mg2+-dependent endoribonuclease that promotes RISC activation by removing siRNA passenger strand cleavage products. These studies establish an in vitro RNAi reconstitution system and identify C3PO as a key activator of the core RNAi machinery.

Crystal structure of the Csm3-Csm4 subcomplex in the type III-A CRISPR-Cas interference complex.

PubMed

Numata, Tomoyuki; Inanaga, Hideko; Sato, Chikara; Osawa, Takuo

2015-01-30

Clustered, regularly interspaced, short palindromic repeat (CRISPR) loci play a pivotal role in the prokaryotic host defense system against invading genetic materials. The CRISPR loci are transcribed to produce CRISPR RNAs (crRNAs), which form interference complexes with CRISPR-associated (Cas) proteins to target the invading nucleic acid for degradation. The interference complex of the type III-A CRISPR-Cas system is composed of five Cas proteins (Csm1-Csm5) and a crRNA, and targets invading DNA. Here, we show that the Csm1, Csm3, and Csm4 proteins from Methanocaldococcus jannaschii form a stable subcomplex. We also report the crystal structure of the M. jannaschii Csm3-Csm4 subcomplex at 3.1Å resolution. The complex structure revealed the presence of a basic concave surface around their interface, suggesting the RNA and/or DNA binding ability of the complex. A gel retardation analysis showed that the Csm3-Csm4 complex binds single-stranded RNA in a non-sequence-specific manner. Csm4 structurally resembles Cmr3, a component of the type III-B CRISPR-Cas interference complex. Based on bioinformatics, we constructed a model structure of the Csm1-Csm4-Csm3 ternary complex, which provides insights into its role in the Csm interference complex. Copyright © 2014 Elsevier Ltd. All rights reserved.

Inhibition of CD147 expression by RNA interference reduces proliferation, invasion and increases chemosensitivity in cancer stem cell-like HT-29 cells.

PubMed

Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui

2015-10-01

The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.

RNA interference in the clinic: challenges and future directions

PubMed Central

Pecot, Chad V.; Calin, George A.; Coleman, Robert L.; Lopez-Berestein, Gabriel; Sood, Anil K.

2011-01-01

Inherent difficulties with blocking many desirable targets using conventional approaches have prompted many to consider using RNA interference (RNAi) as a therapeutic approach. Although exploitation of RNAi has immense potential as a cancer therapeutic, many physiological obstacles stand in the way of successful and efficient delivery. This Review explores current challenges to the development of synthetic RNAi-based therapies and considers new approaches to circumvent biological barriers, to avoid intolerable side effects and to achieve controlled and sustained release. PMID:21160526

Tumor-specific RNA interference targeting Pokemon suppresses tumor growth and induces apoptosis in prostate cancer.

PubMed

Li, Yining; Xu, Shuxiong; Wang, Xiangwei; Shi, Hua; Sun, Zhaolin; Yang, Zhao

2013-02-01

To explore the exact mechanism of Pokemon in prostate cancer. Pokemon is a member of the POK family of transcriptional repressors. Its main function is suppression of the p14ARF (alternate reading frame) tumor suppressor gene. Although Pokemon expression has been found to be increased in various types of lymphoma, the exact mechanism of the gene in prostate cancer is not clear. In the present study, prostate cancer cells were transfected with the specific short hairpin ribonucleic acid (RNA) expression vector targeting Pokemon. The expression of Pokemon messenger RNA and its protein was detected by semiquantitative reverse transcriptase-polymerase chain reaction and Western blotting, respectively. The cell growth and cell apoptosis were also examined using the methyl thiazolyl tetrazolium assay and flow cytometry. The results demonstrated that specific RNA interference (RNAi) could decrease the expression levels of Pokemon gene messenger RNA and protein in prostate cancer cells. In addition, that specific RNAi significantly inhibited the cell proliferation and increased the apoptotic rate. In vivo experiments showed that specific RNAi inhibited the tumorigenicity of prostate cancer cells and significantly suppressed tumor growth. Therefore, an RNAi-targeted Pokemon gene strategy could be a potential approach to prostate cancer therapy. Copyright © 2013 Elsevier Inc. All rights reserved.

DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells

PubMed Central

Spike, Caroline A.; Bader, Jason; Reinke, Valerie; Strome, Susan

2008-01-01

P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs). PMID:18234720

DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells.

PubMed

Spike, Caroline A; Bader, Jason; Reinke, Valerie; Strome, Susan

2008-03-01

P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs).

Evaluation and control of miRNA-like off-target repression for RNA interference.

PubMed

Seok, Heeyoung; Lee, Haejeong; Jang, Eun-Sook; Chi, Sung Wook

2018-03-01

RNA interference (RNAi) has been widely adopted to repress specific gene expression and is easily achieved by designing small interfering RNAs (siRNAs) with perfect sequence complementarity to the intended target mRNAs. Although siRNAs direct Argonaute (Ago), a core component of the RNA-induced silencing complex (RISC), to recognize and silence target mRNAs, they also inevitably function as microRNAs (miRNAs) and suppress hundreds of off-targets. Such miRNA-like off-target repression is potentially detrimental, resulting in unwanted toxicity and phenotypes. Despite early recognition of the severity of miRNA-like off-target repression, this effect has often been overlooked because of difficulties in recognizing and avoiding off-targets. However, recent advances in genome-wide methods and knowledge of Ago-miRNA target interactions have set the stage for properly evaluating and controlling miRNA-like off-target repression. Here, we describe the intrinsic problems of miRNA-like off-target effects caused by canonical and noncanonical interactions. We particularly focus on various genome-wide approaches and chemical modifications for the evaluation and prevention of off-target repression to facilitate the use of RNAi with secured specificity.

Double-stranded RNA Oral Delivery Methods to Induce RNA Interference in Phloem and Plant-sap-feeding Hemipteran Insects.

PubMed

Ghosh, Saikat Kumar B; Hunter, Wayne B; Park, Alexis L; Gundersen-Rindal, Dawn E

2018-05-04

Phloem and plant sap feeding insects invade the integrity of crops and fruits to retrieve nutrients, in the process damaging food crops. Hemipteran insects account for a number of economically substantial pests of plants that cause damage to crops by feeding on phloem sap. The brown marmorated stink bug (BMSB), Halyomorpha halys (Heteroptera: Pentatomidae) and the Asian citrus psyllid (ACP), Diaphorina citri Kuwayama (Hemiptera: Liviidae) are hemipteran insect pests introduced in North America, where they are an invasive agricultural pest of high-value specialty, row, and staple crops and citrus fruits, as well as a nuisance pest when they aggregate indoors. Insecticide resistance in many species has led to the development of alternate methods of pest management strategies. Double-stranded RNA (dsRNA)-mediated RNA interference (RNAi) is a gene silencing mechanism for functional genomic studies that has potential applications as a tool for the management of insect pests. Exogenously synthesized dsRNA or small interfering RNA (siRNA) can trigger highly efficient gene silencing through the degradation of endogenous RNA, which is homologous to that presented. Effective and environmental use of RNAi as molecular biopesticides for biocontrol of hemipteran insects requires the in vivo delivery of dsRNAs through feeding. Here we demonstrate methods for delivery of dsRNA to insects: loading of dsRNA into green beans by immersion, and absorbing of gene-specific dsRNA with oral delivery through ingestion. We have also outlined non-transgenic plant delivery approaches using foliar sprays, root drench, trunk injections as well as clay granules, all of which may be essential for sustained release of dsRNA. Efficient delivery by orally ingested dsRNA was confirmed as an effective dosage to induce a significant decrease in expression of targeted genes, such as juvenile hormone acid O-methyltransferase (JHAMT) and vitellogenin (Vg). These innovative methods represent strategies for delivery of dsRNA to use in crop protection and overcome environmental challenges for pest management.

RNA interference targets arbovirus replication in Culicoides cells.

PubMed

Schnettler, Esther; Ratinier, Maxime; Watson, Mick; Shaw, Andrew E; McFarlane, Melanie; Varela, Mariana; Elliott, Richard M; Palmarini, Massimo; Kohl, Alain

2013-03-01

Arboviruses are transmitted to vertebrate hosts by biting arthropod vectors such as mosquitoes, ticks, and midges. These viruses replicate in both arthropods and vertebrates and are thus exposed to different antiviral responses in these organisms. RNA interference (RNAi) is a sequence-specific RNA degradation mechanism that has been shown to play a major role in the antiviral response against arboviruses in mosquitoes. Culicoides midges are important vectors of arboviruses, known to transmit pathogens of humans and livestock such as bluetongue virus (BTV) (Reoviridae), Oropouche virus (Bunyaviridae), and likely the recently discovered Schmallenberg virus (Bunyaviridae). In this study, we investigated whether Culicoides cells possess an antiviral RNAi response and whether this is effective against arboviruses, including those with double-stranded RNA (dsRNA) genomes, such as BTV. Using reporter gene-based assays, we established the presence of a functional RNAi response in Culicoides sonorensis-derived KC cells which is effective in inhibiting BTV infection. Sequencing of small RNAs from KC and Aedes aegypti-derived Aag2 cells infected with BTV or the unrelated Schmallenberg virus resulted in the production of virus-derived small interfering RNAs (viRNAs) of 21 nucleotides, similar to the viRNAs produced during arbovirus infections of mosquitoes. In addition, viRNA profiles strongly suggest that the BTV dsRNA genome is accessible to a Dicer-type nuclease. Thus, we show for the first time that midge cells target arbovirus replication by mounting an antiviral RNAi response mainly resembling that of other insect vectors of arboviruses.

A model for the study of ligand binding to the ribosomal RNA helix h44

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dibrov, Sergey M.; Parsons, Jerod; Hermann, Thomas

2010-09-02

Oligonucleotide models of ribosomal RNA domains are powerful tools to study the binding and molecular recognition of antibiotics that interfere with bacterial translation. Techniques such as selective chemical modification, fluorescence labeling and mutations are cumbersome for the whole ribosome but readily applicable to model RNAs, which are readily crystallized and often give rise to higher resolution crystal structures suitable for detailed analysis of ligand-RNA interactions. Here, we have investigated the HX RNA construct which contains two adjacent ligand binding regions of helix h44 in 16S ribosomal RNA. High-resolution crystal structure analysis confirmed that the HX RNA is a faithful structuralmore » model of the ribosomal target. Solution studies showed that HX RNA carrying a fluorescent 2-aminopurine modification provides a model system that can be used to monitor ligand binding to both the ribosomal decoding site and, through an indirect effect, the hygromycin B interaction region.« less

Multimodality Imaging of RNA Interference

PubMed Central

Nayak, Tapas R.; Krasteva, Lazura K.; Cai, Weibo

2013-01-01

The discovery of small interfering RNAs (siRNAs) and their potential to knock down virtually any gene of interest has ushered in a new era of RNA interference (RNAi). Clinical use of RNAi faces severe limitations due to inefficiency delivery of siRNA or short hairpin RNA (shRNA). Many molecular imaging techniques have been adopted in RNAi-related research for evaluation of siRNA/shRNA delivery, biodistribution, pharmacokinetics, and the therapeutic effect. In this review article, we summarize the current status of in vivo imaging of RNAi. The molecular imaging techniques that have been employed include bioluminescence/fluorescence imaging, magnetic resonance imaging/spectroscopy, positron emission tomography, single-photon emission computed tomography, and various combinations of these techniques. Further development of non-invasive imaging strategies for RNAi, not only focusing on the delivery of siRNA/shRNA but also the therapeutic efficacy, is critical for future clinical translation. Rigorous validation will be needed to confirm that biodistribution of the carrier is correlated with that of siRNA/shRNA, since imaging only detects the label (e.g. radioisotopes) but not the gene or carrier themselves. It is also essential to develop multimodality imaging approaches for realizing the full potential of therapeutic RNAi, as no single imaging modality may be sufficient to simultaneously monitor both the gene delivery and silencing effect of RNAi. PMID:23745567

Engineering functional inorganic-organic hybrid systems: advances in siRNA therapeutics.

PubMed

Shen, Jianliang; Zhang, Wei; Qi, Ruogu; Mao, Zong-Wan; Shen, Haifa

2018-03-21

Cancer treatment still faces a lot of obstacles such as tumor heterogeneity, drug resistance and systemic toxicities. Beyond the traditional treatment modalities, exploitation of RNA interference (RNAi) as an emerging approach has immense potential for the treatment of various gene-caused diseases including cancer. The last decade has witnessed enormous research and achievements focused on RNAi biotechnology. However, delivery of small interference RNA (siRNA) remains a key challenge in the development of clinical RNAi therapeutics. Indeed, functional nanomaterials play an important role in siRNA delivery, which could overcome a wide range of sequential physiological and biological obstacles. Nanomaterial-formulated siRNA systems have potential applications in protection of siRNA from degradation, improving the accumulation in the target tissues, enhancing the siRNA therapy and reducing the side effects. In this review, we explore and summarize the role of functional inorganic-organic hybrid systems involved in the siRNA therapeutic advancements. Additionally, we gather the surface engineering strategies of hybrid systems to optimize for siRNA delivery. Major progress in the field of inorganic-organic hybrid platforms including metallic/non-metallic cores modified with organic shells or further fabrication as the vectors for siRNA delivery is discussed to give credit to the interdisciplinary cooperation between chemistry, pharmacy, biology and medicine.

Role of caspase-9 in the effector caspases and genome expressions, and growth of bovine skeletal myoblasts.

PubMed

Van Ba, Hoa; Hwang, Inho

2014-02-01

Caspase-9 has been reported as the key regulator of apoptosis, however, its role in skeletal myoblast development and molecular involvements during cell growth still remains unknown. The current study aimed to present the key role of caspase-9 in the expressions of apoptotic caspases and genome, and cell viability during myoblast growth using RNA interference mediated silencing. Three small interference RNA sequences (siRNAs) targeting caspase-9 gene was designed and ligated into pSilencer plasmid vector to construct shRNA expression constructs. Cells were transfected with the constructs for 48 h. Results indicated that all three siRNAs could silence the caspase-9 mRNA expression significantly. Particularly, the mRNA expression level of caspase-9 in the cells transfected by shRNA1, shRNA2 and shRNA3 constructs were reduced by 37.85%, 68.20% and 58.14%, respectively. Suppression of caspase-9 led to the significant increases in the mRNA and protein expressions of effector caspase-3, whereas the reduction in mRNA and protein expressions of caspase-7. The microarray results showed that the suppression of caspase-9 resulted in significant upregulations of cell proliferation-, adhesion-, growth-, development- and division-regulating genes, whereas the reduction in the expressions of cell death program- and stress response-regulating genes. Furthermore, cell viability was significantly increased following the transfection. These data suggest that caspase-9 could play an important role in the control of cell growth, and knockdown of caspase-9 may have genuine potential in the treatment of skeletal muscle atrophy. © 2013 The Authors Development, Growth & Differentiation © 2013 Japanese Society of Developmental Biologists.

Parameters on plant absortion of double-stranded Ribonucleic acid, dsRNA

USDA-ARS?s Scientific Manuscript database

Efficient absorption of double-stranded Ribonucleic acid, dsRNA, into citrus is critical for effective psyllid management by RNA interference, RNAi. Parameters which might affect absorption into citrus trees and subsequent ingestion by Asian citrus psyllid were evaluated. Age of leaves, variety of c...

Identification of phosphates involved in catalysis by the ribozyme RNase P RNA.

PubMed Central

Harris, M E; Pace, N R

1995-01-01

The RNA subunit of ribonuclease P (RNase P RNA) is a catalytic RNA that cleaves precursor tRNAs to generate mature tRNA 5' ends. Little is known concerning the identity and arrangement of functional groups that constitute the active site of this ribozyme. We have used an RNase P RNA-substrate conjugate that undergoes rapid, accurate, and efficient self-cleavage in vitro to probe, by phosphorothioate modification-interference, functional groups required for catalysis. We identify four phosphate oxygens where substitution by sulfur significantly reduces the catalytic rate (50-200-fold). Interference at one site was partially rescued in the presence of manganese, suggesting a direct involvement in binding divalent metal ion cofactors required for catalysis. All sites are located in conserved sequence and secondary structure, and positioned adjacent to the substrate phosphate in a tertiary structure model of the ribozyme-substrate complex. The spatial arrangement of phosphorothioate-sensitive sites in RNase P RNA was found to resemble the distribution of analogous positions in the secondary and potential tertiary structures of other large catalytic RNAs. PMID:7585250

[Impact of Pax-8 gene interference on mitochondrial function and cardiomyocyte apoptosis].

PubMed

Dai, Xiao-chun; Zhou, Xi; Huang, Xiao-yan; Wang, Liang-guo; Lin, Su; Yang, De-ye

2013-01-01

To observe the effects of paired box gene 8 (Pax-8) silencing by RNA interference on mitochondrial function and cardiomyocytes apoptosis. The cultured H9C2 (2-1) myocytes were divided into 3 groups: short interference RNA targeting Pax-8 (Pax-8 siRNA) group, non-specific siRNA group as the negative control (NC siRNA), and blank control group (BC siRNA). Fluorescence spectrophotometry was used to detect the activity of caspase-3. RT-PCR was performed to detect mRNA expression of Bcl2 and Bax. The protein expression of Bcl2, Bax and cytoplasm of Cytochrome was examined by Western blot. Changes of ΔΨm were detected by flow cytometry.ΔΨm with JC-1 monomer/polymer ratio was calculated for measuring mitochondrial depolarization proportion. Compared to NC siRNA and BC siRNA group (0.075 ± 0.021, 0.072 ± 0.019), the activity of caspase-3 in Pax-8 siRNA group (0.167 ± 0.012) was significantly increased (P < 0.05); Bcl2 mRNA and protein expression in Pax-8 siRNA group (0.61 ± 0.06, 0.94 ± 0.11) were significantly downregulated compared with NC siRNA group (0.90 ± 0.070, 1.39 ± 0.15) and BC siRNA group (0.94 ± 0.087, 1.49 ± 0.20) (P < 0.05); Bax mRNA and protein expression in Pax-8 siRNA group (1.05 ± 0.10, 1.25 ± 0.12) were markedly upregulated compared with NC siRNA group (0.72 ± 0.03, 0.99 ± 0.12) and BC siRNA group (0.64 ± 0.03, 0.92 ± 0.06), P < 0.05; cytosolic cytochrome expression in Pax-8 siRNA group (0.75 ± 0.14) was significantly upregulated compared with NC siRNA group (0.51 ± 0.06) and BC siRNA group (0.48 ± 0.07) (P < 0.05); JC-1 monomer/polymer ratio in Pax-8 siRNA group (0.163 ± 0.011) was significantly increased compared with NC siRNA group (0.092 ± 0.015) and BC siRNA group (0.072 ± 0.025) (P < 0.05) indicating mitochondrial membrane potential was significantly reduced in Pax-8 siRNA group. Above parameters were similar between NC siRNA group and BC siRNA group (P > 0.05). Inhibiting Pax-8 results in enhanced cardiomyocytes apoptosis through the mitochondrial pathway.

Decreased low back pain intensity and differential gene expression following Calmare®: results from a double-blinded randomized sham-controlled study.

PubMed

Starkweather, Angela R; Coyne, Patrick; Lyon, Debra E; Elswick, R K; An, Kyungeh; Sturgill, Jamie

2015-02-01

In this double-blinded, randomized controlled trial we evaluated the effects of Calmare®, a non-invasive neurocutaneous electrical pain intervention, on lower back pain intensity as measured by the "worst" pain score and on pain interference using the Brief Pain Inventory-Short Form, on measures of pain sensitivity assessed by quantitative sensory testing, and on mRNA expression of pain sensitivity genes. Thirty participants were randomized to receive up to 10 sessions of Calmare® treatment (n = 15) or a sham treatment (n = 15) using the same device at a non-therapeutic threshold. At 3 weeks after conclusion of treatment, compared with the sham group, the Calmare® group reported a significant decrease in the "worst" pain and interference scores. There were also significant differences in pain sensitivity and differential mRNA expression of 17 pain genes, suggesting that Calmare® can be effective in reducing pain intensity and interference in individuals with persistent low back pain by altering the mechanisms of enhanced pain sensitivity. Further study of long-term pain outcomes, particularly functional status, analgesic use and health care utilization, is warranted. © 2015 Wiley Periodicals, Inc.

Genetics Home Reference: myotonic dystrophy

MedlinePlus

... mutated gene produces an expanded version of messenger RNA , which is a molecular blueprint of the gene ... the production of proteins. The abnormally long messenger RNA forms clumps inside the cell that interfere with ...

Current siRNA Targets in Atherosclerosis and Aortic Aneurysm

PubMed Central

Pradhan-Nabzdyk, Leena; Huang, Chenyu; Logerfo, Frank W.; Nabzdyk, Christoph S.

2014-01-01

Atherosclerosis (ATH) and aortic aneurysms (AA) remain challenging chronic diseases that confer high morbidity and mortality despite advances in medical, interventional, and surgical care. RNA interference represents a promising technology that may be utilized to silence genes contributing to ATH and AA. Despite positive results in preclinical and some clinical feasibility studies, challenges such as target/sequence validation, tissue specificity, transfection efficiency, and mitigation of unwanted off-target effects remain to be addressed. In this review the most current targets and some novel approaches in siRNA delivery are being discussed. Due to the plethora of investigated targets, only studies published between 2010 and 2014 were included. PMID:24882715

Enhanced susceptibility of cancer cells to oncolytic rhabdo-virotherapy by expression of Nodamura virus protein B2 as a suppressor of RNA interference.

PubMed

Bastin, Donald; Aitken, Amelia S; Pelin, Adrian; Pikor, Larissa A; Crupi, Mathieu J F; Huh, Michael S; Bourgeois-Daigneault, Marie-Claude; Bell, John C; Ilkow, Carolina S

2018-06-19

Antiviral responses are barriers that must be overcome for efficacy of oncolytic virotherapy. In mammalian cells, antiviral responses involve the interferon pathway, a protein-signaling cascade that alerts the immune system and limits virus propagation. Tumour-specific defects in interferon signaling enhance viral infection and responses to oncolytic virotherapy, but many human cancers are still refractory to oncolytic viruses. Given that invertebrates, fungi and plants rely on RNA interference pathways for antiviral protection, we investigated the potential involvement of this alternative antiviral mechanism in cancer cells. Here, we detected viral genome-derived small RNAs, indicative of RNAi-mediated antiviral responses, in human cancer cells. As viruses may encode suppressors of the RNA interference pathways, we engineered an oncolytic vesicular stomatitis virus variant to encode the Nodamura virus protein B2, a known inhibitor of RNAi-mediated immune responses. B2-expressing oncolytic virus showed enhanced viral replication and cytotoxicity, impaired viral genome cleavage and altered microRNA processing in cancer cells. Our data establish the improved therapeutic potential of our novel virus which targets the RNAi-mediated antiviral defense of cancer cells.

Usefulness of multiple chalk-based food colorings for inducing better gene silencing by feeding RNA interference in planarians.

PubMed

Hattori, Miki; Miyamoto, Mai; Hosoda, Kazutaka; Umesono, Yoshihiko

2018-01-01

Planarians have become widely recognized as one of the major animal models for regeneration studies in invertebrates. To induce RNA interference (RNAi) by feeding in planarians, the widely accepted protocol is one in which animals undergo two or three feedings of food containing double-stranded RNA (dsRNA) plus visible food coloring (e.g., blood) for confirmation of feeding by individual animals. However, one possible problem is that incorporated food coloring is often retained within the gut for several days, which makes it difficult to confirm the success of each round of dsRNA feeding based on the difference of the color density within the gut before and after feeding. As a consequence, the difference of appetite levels among individuals undergoing dsRNA feeding leads to phenotypic variability among them due to insufficient knockdown. In our attempts to overcome this problem, we have developed a novel method for achieving robust confirmation of the success of dsRNA feeding in individuals fed multiple times by means of including a combination of three different colored chalks (pink, yellow and blue) as food coloring. Notably, we found that this method is superior to the conventional method for positively marking individuals that actively consumed the dsRNA-containing food during four times of once-daily feeding. Using these selected animals, we obtained stable and sufficiently strong RNAi-induced phenotypes. We termed this improved multi-colored chalk-spiked method of feeding RNAi "Candi" and propose its benefits for gene function analysis in planarians. © 2017 Japanese Society of Developmental Biologists.

Convergent transcription in the butyrolactone regulon in Streptomyces coelicolor confers a bistable genetic switch for antibiotic biosynthesis.

PubMed

Chatterjee, Anushree; Drews, Laurie; Mehra, Sarika; Takano, Eriko; Kaznessis, Yiannis N; Hu, Wei-Shou

2011-01-01

cis-encoded antisense RNAs (cis asRNA) have been reported to participate in gene expression regulation in both eukaryotic and prokaryotic organisms. Its presence in Streptomyces coelicolor has also been reported recently; however, its role has yet to be fully investigated. Using mathematical modeling we explore the role of cis asRNA produced as a result of convergent transcription in scbA-scbR genetic switch. scbA and scbR gene pair, encoding repressor-amplifier proteins respectively, mediates the synthesis of a signaling molecule, the γ-butyrolactone SCB1 and controls the onset of antibiotic production. Our model considers that transcriptional interference caused by convergent transcription of two opposing RNA polymerases results in fatal collision and transcriptional termination, which suppresses transcription efficiency. Additionally, convergent transcription causes sense and antisense interactions between complementary sequences from opposing strands, rendering the full length transcript inaccessible for translation. We evaluated the role of transcriptional interference and the antisense effect conferred by convergent transcription on the behavior of scbA-scbR system. Stability analysis showed that while transcriptional interference affects the system, it is asRNA that confers scbA-scbR system the characteristics of a bistable switch in response to the signaling molecule SCB1. With its critical role of regulating the onset of antibiotic synthesis the bistable behavior offers this two gene system the needed robustness to be a genetic switch. The convergent two gene system with potential of transcriptional interference is a frequent feature in various genomes. The possibility of asRNA regulation in other such gene-pairs is yet to be examined.

Interference of hepatitis C virus RNA replication by short interfering RNAs

NASA Astrophysics Data System (ADS)

Kapadia, Sharookh B.; Brideau-Andersen, Amy; Chisari, Francis V.

2003-02-01

Hepatitis C virus (HCV) infection is a major cause of chronic liver disease, which can lead to the development of liver cirrhosis and hepatocellular carcinoma. Current therapy of patients with chronic HCV infection includes treatment with IFN in combination with ribavirin. Because most treated patients do not resolve the infection, alternative treatment is essential. RNA interference (RNAi) is a recently discovered antiviral mechanism present in plants and animals that induces double-stranded RNA degradation. Using a selectable subgenomic HCV replicon cell culture system, we have shown that RNAi can specifically inhibit HCV RNA replication and protein expression in Huh-7 cells that stably replicate the HCV genome, and that this antiviral effect is independent of IFN. These results suggest that RNAi may represent a new approach for the treatment of persistent HCV infection.

PAMP-induced defense responses in potato require both salicylic acid and jasmonic acid.

PubMed

Halim, Vincentius A; Altmann, Simone; Ellinger, Dorothea; Eschen-Lippold, Lennart; Miersch, Otto; Scheel, Dierk; Rosahl, Sabine

2009-01-01

To elucidate the molecular mechanisms underlying pathogen-associated molecular pattern (PAMP)-induced defense responses in potato (Solanum tuberosum), the role of the signaling compounds salicylic acid (SA) and jasmonic acid (JA) was analyzed. Pep-13, a PAMP from Phytophthora, induces the accumulation of SA, JA and hydrogen peroxide, as well as the activation of defense genes and hypersensitive-like cell death. We have previously shown that SA is required for Pep-13-induced defense responses. To assess the importance of JA, RNA interference constructs targeted at the JA biosynthetic genes, allene oxide cyclase and 12-oxophytodienoic acid reductase, were expressed in transgenic potato plants. In addition, expression of the F-box protein COI1 was reduced by RNA interference. Plants expressing the RNA interference constructs failed to accumulate the respective transcripts in response to wounding or Pep-13 treatment, neither did they contain significant amounts of JA after elicitation. In response to infiltration of Pep-13, the transgenic plants exhibited a highly reduced accumulation of reactive oxygen species as well as reduced hypersensitive cell death. The ability of the JA-deficient plants to accumulate SA suggests that SA accumulation is independent or upstream of JA accumulation. These data show that PAMP responses in potato require both SA and JA and that, in contrast to Arabidopsis, these compounds act in the same signal transduction pathway. Despite their inability to fully respond to PAMP treatment, the transgenic RNA interference plants are not altered in their basal defense against Phytophthora infestans.

Ebolavirus proteins suppress the effects of small interfering RNA by direct interaction with the mammalian RNA interference pathway.

PubMed

Fabozzi, Giulia; Nabel, Christopher S; Dolan, Michael A; Sullivan, Nancy J

2011-03-01

Cellular RNA interference (RNAi) provides a natural response against viral infection, but some viruses have evolved mechanisms to antagonize this form of antiviral immunity. To determine whether Ebolavirus (EBOV) counters RNAi by encoding suppressors of RNA silencing (SRSs), we screened all EBOV proteins using an RNAi assay initiated by exogenously delivered small interfering RNAs (siRNAs) against either an EBOV or a reporter gene. In addition to viral protein 35 (VP35), we found that VP30 and VP40 independently act as SRSs. Here, we present the molecular mechanisms of VP30 and VP35. VP30 interacts with Dicer independently of siRNA and with one Dicer partner, TRBP, only in the presence of siRNA. VP35 directly interacts with Dicer partners TRBP and PACT in an siRNA-independent fashion and in the absence of effects on interferon (IFN). Taken together, our findings elucidate a new mechanism of RNAi suppression that extends beyond the role of SRSs in double-stranded RNA (dsRNA) binding and IFN antagonism. The presence of three suppressors highlights the relevance of host RNAi-dependent antiviral immunity in EBOV infection and illustrates the importance of RNAi in shaping the evolution of RNA viruses.

Nanoparticle-mediated RNA interference of angiotensinogen decreases blood pressure and improves myocardial remodeling in spontaneously hypertensive rats.

PubMed

Yuan, Li-Fen; Sheng, Jing; Lu, Ping; Wang, Yu-Qiang; Jin, Tuo; Du, Qin

2015-09-01

Angiotensinogen (AGT) has been shown to have a role in cardiac hypertrophy, while depletion of the AGT gene in spontaneously hypertensive rats (SHR) has not been investigated. The present study investigated the effect of AGT knockdown on cardiac hypertrophy in SHR. For this, small hairpin (sh)RNAs were intravenously injected into SHRs, using a nanoparticle‑mediated transfection system. The experimental rats were divided into the following groups: a) Blank control with water treatment only, b) negative control with biscarbamate‑crosslinked Gal‑polyethylene glycol polyethylenimine nanoparticles (GPE)/negative shRNA, c) AGT‑RNA interference (RNAi) group with GPE/AGT‑shRNA, and 4) normotensive control using Wistar‑Kyoto rats (WKY) with water treatment. Three and five days following the first injection, the levels of hepatic AGT mRNA and AGT protein as well as plasma levels of AGT were markedly decreased in the AGT‑RNAi group (P<0.05). Furthermore, a significant decrease in systolic blood pressure (SBP), left ventricular weight to body weight ratio and heart weight to body weight ratio were observed in the AGT‑RNAi group compared with those in the control groups. The depletion of AGT in SHR led to a reduction in SBP by 30±4 mmHg, which was retained for >10 days. Cardiac hypertrophy was also significantly improved in AGT‑knockdown rats. In conclusion, the present study showed that AGT‑silencing had a significant inhibitory effect on hypertension and hypertensive‑induced cardiac hypertrophy in SHRs.

siRNA-mediated silencing of MDR1 reverses the resistance to oxaliplatin in SW480/OxR colon cancer cells.

PubMed

Montazami, N; Kheir Andish, M; Majidi, J; Yousefi, M; Yousefi, B; Mohamadnejad, L; Shanebandi, D; Estiar, M A; Khaze, V; Mansoori, B; Baghbani, E; Baradaran, B

2015-05-28

One of the most challenging aspects of colon cancer therapy is rapid acquisition of multidrug resistant phenotype. The multidrug resistance gene 1 (MDR1) product, p—glycoprotein (P—gp), pump out a variety of anticancer agents from the cell, giving rise to a general drug resistance against chemotherapeutic agents. The aim of this study was to investigate the effect of a specific MDR1 small interference RNA (siRNA) on sensitivity of oxaliplatin—resistant SW480 human colon cancer cell line (SW480/OxR) to the chemotherapeutic drug oxaliplatin. SW480 cells were made resistant by continuous incubation with stepwise serially increased concentrations of oxaliplatin over a 6—months period. Resistance cell were subsequently transfected with specific MDR1 siRNA. Relative MDR1 mRNA expression was measured by Quantitative real—time PCR. Western blot analysis was performed to determine the protein levels of P—gp. The cytotoxic effects of oxaliplatin and MDR1 siRNA, alone and in combination were assessed using MTT and the number of apoptotic cells was determined with the TUNEL assay. MDR1 siRNA effectively reduced MDR1 expression in both mRNA and protein levels. MDR1 down—regulation synergistically increased the cytotoxic effects of oxaliplatin and spontaneous apoptosis SW480/OxR. Our data demonstrates that RNA interference could down regulate MDR1 gene expression and reduce the P—gp level, and partially reverse the drug resistance in SW480/OxR cells in vitro. Therefore, the results could suggest that MDR1 silencing may be a potent adjuvant in human colon chemotherapy.

Targeted nanobubbles in low-frequency ultrasound-mediated gene transfection and growth inhibition of hepatocellular carcinoma cells.

PubMed

Wu, Bolin; Qiao, Qiang; Han, Xue; Jing, Hui; Zhang, Hao; Liang, Hongjian; Cheng, Wen

2016-09-01

The use of SonoVue combined with ultrasound exposure increases the transfection efficiency of short interfering RNA (siRNA). The objective of this study was to prepare targeted nanobubbles (TNB) conjugated with NET-1 siRNA and an antibody GPC3 to direct nanobubbles to hepatocellular carcinoma cells. SMMC-7721 human hepatocellular carcinoma cells were treated with six different groups. The transfection efficiency and cellular apoptosis were measured by flow cytometry. The protein and messenger RNA (mRNA) expression were measured by Western blot and quantitative real-time PCR, respectively. The migration and invasion potential of the cells were determined by Transwell analysis. The results show that US-guided siRNA-TNB transfection effectively enhanced gene silencing. In summary, siRNA-TNB may be an effective delivery vector to mediate highly effective RNA interference in tumor treatment.

Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA

PubMed Central

Ciganda, Martin; Williams, Noreen

2012-01-01

P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864

dsRNA binding properties of RDE-4 and TRBP reflect their distinct roles in RNAi.

PubMed

Parker, Greg S; Maity, Tuhin Subhra; Bass, Brenda L

2008-12-26

Double-stranded RNA (dsRNA)-binding proteins facilitate Dicer functions in RNA interference. Caenorhabditis elegans RDE-4 facilitates cleavage of long dsRNA to small interfering RNA (siRNA), while human trans-activation response RNA-binding protein (TRBP) functions downstream to pass siRNA to the RNA-induced silencing complex. We show that these distinct in vivo roles are reflected in in vitro binding properties. RDE-4 preferentially binds long dsRNA, while TRBP binds siRNA with an affinity that is independent of dsRNA length. These properties are mechanistically based on the fact that RDE-4 binds cooperatively, via contributions from multiple domains, while TRBP binds noncooperatively. Our studies offer a paradigm for how dsRNA-binding proteins, which are not sequence specific, discern dsRNA length. Additionally, analyses of the ability of RDE-4 deletion constructs and RDE-4/TRBP chimeras to reconstitute Dicer activity suggest RDE-4 promotes activity using its dsRNA-binding motif 2 to bind dsRNA, its linker region to interact with Dicer, and its C-terminus for Dicer activation.

[Wnt/β-catenin pathway involved in the regulation of rat mesangial cell proliferation by adipose-derived mesenchymal stem cells].

PubMed

Li, Zhi; Zhang, Mengying; Li, Xueqin; Lu, Jinming; Xu, Liang

2016-11-01

Objective To investigate the effect of adipose-derived mesenchymal stem cells (ADSCs) on glomerular mesangial cell proliferation via Wnt/β-catenin pathway. Methods The rat glomerular mesangial cells (HBZY-1) were incubated in conditioned ADSC medium. Cell cycle was analyzed with flow cytometry; the proliferation rate of HBZY-1 and the expression levels of relative genes and proteins of Wnt signaling pathway were measured using RNA interference, quantitative real-time PCR and Western blotting, respectively. Results HBZY-1 proliferation was significantly inhibited under the action of conditioned ADSC medium, whereas dickkopf WNT signaling pathway inhibitor 1 (DKK1) mRNA level was up-regulated. Fibronectin and TGF-β1 mRNA expression as well as β-catenin and Bcl-2 protein levels of HBZY-1 were significantly down-regulated. DKK1 gene expression level in ADSCs was significantly higher than that of HBZY-1. After RNA interference, DKK1 expression level in ADSCs was markedly inhibited, yet the β-catenin protein level was notably elevated. The β-catenin and Bcl-2 protein levels of HBZY-1 were also significantly raised in HBZY-1 after cultured with conditioned medium containing ADSCs treated with RNA interference. Conclusion Wnt/β-catenin may be a potential signaling pathway involved in the regulative effect of ADSCs on glomerular mesangial cell proliferation.

RNA Editing Genes Associated with Extreme Old Age in Humans and with Lifespan in C. elegans

PubMed Central

Puca, Annibale; Solovieff, Nadia; Kojima, Toshio; Wang, Meng C.; Melista, Efthymia; Meltzer, Micah; Fischer, Sylvia E. J.; Andersen, Stacy; Hartley, Stephen H.; Sedgewick, Amanda; Arai, Yasumichi; Bergman, Aviv; Barzilai, Nir; Terry, Dellara F.; Riva, Alberto; Anselmi, Chiara Viviani; Malovini, Alberto; Kitamoto, Aya; Sawabe, Motoji; Arai, Tomio; Gondo, Yasuyuki; Steinberg, Martin H.; Hirose, Nobuyoshi; Atzmon, Gil; Ruvkun, Gary; Baldwin, Clinton T.; Perls, Thomas T.

2009-01-01

Background The strong familiality of living to extreme ages suggests that human longevity is genetically regulated. The majority of genes found thus far to be associated with longevity primarily function in lipoprotein metabolism and insulin/IGF-1 signaling. There are likely many more genetic modifiers of human longevity that remain to be discovered. Methodology/Principal Findings Here, we first show that 18 single nucleotide polymorphisms (SNPs) in the RNA editing genes ADARB1 and ADARB2 are associated with extreme old age in a U.S. based study of centenarians, the New England Centenarian Study. We describe replications of these findings in three independently conducted centenarian studies with different genetic backgrounds (Italian, Ashkenazi Jewish and Japanese) that collectively support an association of ADARB1 and ADARB2 with longevity. Some SNPs in ADARB2 replicate consistently in the four populations and suggest a strong effect that is independent of the different genetic backgrounds and environments. To evaluate the functional association of these genes with lifespan, we demonstrate that inactivation of their orthologues adr-1 and adr-2 in C. elegans reduces median survival by 50%. We further demonstrate that inactivation of the argonaute gene, rde-1, a critical regulator of RNA interference, completely restores lifespan to normal levels in the context of adr-1 and adr-2 loss of function. Conclusions/Significance Our results suggest that RNA editors may be an important regulator of aging in humans and that, when evaluated in C. elegans, this pathway may interact with the RNA interference machinery to regulate lifespan. PMID:20011587

Uptake and impact of natural diet-derived small RNA in invertebrates: Implications for ecology and agriculture.

PubMed

Chan, Stephen Y; Snow, Jonathan W

2017-04-03

The putative transfer and gene regulatory activities of diet-derived small RNAs (sRNAs) in ingesting animals are still debated. The existence of natural uptake of diet-derived sRNA by invertebrate species could have significant implication for our understanding of ecological relationships and could synergize with efforts to use RNA interference (RNAi) technology in agriculture. Here, we synthesize information gathered from studies in invertebrates using natural or artificial dietary delivery of sRNA and from studies of sRNA in vertebrate animals and plants to review our current understanding of uptake and impact of natural diet-derived sRNA on invertebrates. Our understanding has been influenced and sometimes confounded by the diversity of invertebrates and ingested plants studied, our limited insights into how gene expression may be modulated by dietary sRNAs at the mechanistic level, and the paucity of studies focusing directly on natural uptake of sRNA. As such, we suggest 2 strategies to investigate this phenomenon more comprehensively and thus facilitate the realization of its potentially broad impact on ecology and agriculture in the future.

Uptake and impact of natural diet-derived small RNA in invertebrates: Implications for ecology and agriculture

PubMed Central

Chan, Stephen Y.; Snow, Jonathan W.

2017-01-01

ABSTRACT The putative transfer and gene regulatory activities of diet-derived small RNAs (sRNAs) in ingesting animals are still debated. The existence of natural uptake of diet-derived sRNA by invertebrate species could have significant implication for our understanding of ecological relationships and could synergize with efforts to use RNA interference (RNAi) technology in agriculture. Here, we synthesize information gathered from studies in invertebrates using natural or artificial dietary delivery of sRNA and from studies of sRNA in vertebrate animals and plants to review our current understanding of uptake and impact of natural diet-derived sRNA on invertebrates. Our understanding has been influenced and sometimes confounded by the diversity of invertebrates and ingested plants studied, our limited insights into how gene expression may be modulated by dietary sRNAs at the mechanistic level, and the paucity of studies focusing directly on natural uptake of sRNA. As such, we suggest 2 strategies to investigate this phenomenon more comprehensively and thus facilitate the realization of its potentially broad impact on ecology and agriculture in the future. PMID:27763816

Analysis of Variability in HIV-1 Subtype A Strains in Russia Suggests a Combination of Deep Sequencing and Multitarget RNA Interference for Silencing of the Virus.

PubMed

Kretova, Olga V; Chechetkin, Vladimir R; Fedoseeva, Daria M; Kravatsky, Yuri V; Sosin, Dmitri V; Alembekov, Ildar R; Gorbacheva, Maria A; Gashnikova, Natalya M; Tchurikov, Nickolai A

2017-02-01

Any method for silencing the activity of the HIV-1 retrovirus should tackle the extremely high variability of HIV-1 sequences and mutational escape. We studied sequence variability in the vicinity of selected RNA interference (RNAi) targets from isolates of HIV-1 subtype A in Russia, and we propose that using artificial RNAi is a potential alternative to traditional antiretroviral therapy. We prove that using multiple RNAi targets overcomes the variability in HIV-1 isolates. The optimal number of targets critically depends on the conservation of the target sequences. The total number of targets that are conserved with a probability of 0.7-0.8 should exceed at least 2. Combining deep sequencing and multitarget RNAi may provide an efficient approach to cure HIV/AIDS.

Determining the Specificity of Cascade Binding, Interference, and Primed Adaptation In Vivo in the Escherichia coli Type I-E CRISPR-Cas System

PubMed Central

Cooper, Lauren A.; Stringer, Anne M.

2018-01-01

ABSTRACT In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo, for the type I-E system of Escherichia coli. Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5′ end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. PMID:29666291

Special Issue: Gene Therapy with Emphasis on RNA Interference

PubMed Central

Lundstrom, Kenneth

2015-01-01

Gene therapy was originally thought to cover replacement of malfunctioning genes in treatment of various diseases. Today, the field has been expanded to application of viral and non-viral vectors for delivery of recombinant proteins for the compensation of missing or insufficient proteins, anti-cancer genes and proteins for destruction of tumor cells, immunostimulatory genes and proteins for stimulation of the host defense system against viral agents and tumors. Recently, the importance of RNA interference and its application in gene therapy has become an attractive alternative for drug development. PMID:26447255

RNAi Screening in Spodoptera frugiperda.

PubMed

Ghosh, Subhanita; Singh, Gatikrushna; Sachdev, Bindiya; Kumar, Ajit; Malhotra, Pawan; Mukherjee, Sunil K; Bhatnagar, Raj K

2016-01-01

RNA interference is a potent and precise reverse genetic approach to carryout large-scale functional genomic studies in a given organism. During the past decade, RNAi has also emerged as an important investigative tool to understand the process of viral pathogenesis. Our laboratory has successfully generated transgenic reporter and RNAi sensor line of Spodoptera frugiperda (Sf21) cells and developed a reversal of silencing assay via siRNA or shRNA guided screening to investigate RNAi factors or viral pathogenic factors with extraordinary fidelity. Here we describe empirical approaches and conceptual understanding to execute successful RNAi screening in Spodoptera frugiperda 21-cell line.

The RNA-mediated, asymmetric ring regulatory mechanism of the transcription termination Rho helicase decrypted by time-resolved nucleotide analog interference probing (trNAIP).

PubMed

Soares, Emilie; Schwartz, Annie; Nollmann, Marcello; Margeat, Emmanuel; Boudvillain, Marc

2014-08-01

Rho is a ring-shaped, ATP-dependent RNA helicase/translocase that dissociates transcriptional complexes in bacteria. How RNA recognition is coupled to ATP hydrolysis and translocation in Rho is unclear. Here, we develop and use a new combinatorial approach, called time-resolved Nucleotide Analog Interference Probing (trNAIP), to unmask RNA molecular determinants of catalytic Rho function. We identify a regulatory step in the translocation cycle involving recruitment of the 2'-hydroxyl group of the incoming 3'-RNA nucleotide by a Rho subunit. We propose that this step arises from the intrinsic weakness of one of the subunit interfaces caused by asymmetric, split-ring arrangement of primary RNA tethers around the Rho hexamer. Translocation is at highest stake every seventh nucleotide when the weak interface engages the incoming 3'-RNA nucleotide or breaks, depending on RNA threading constraints in the Rho pore. This substrate-governed, 'test to run' iterative mechanism offers a new perspective on how a ring-translocase may function or be regulated. It also illustrates the interest and versatility of the new trNAIP methodology to unveil the molecular mechanisms of complex RNA-based systems. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Potential applications of RNA interference-based therapeutics in the treatment of cardiovascular disease.

PubMed

Hassan, Ali

2006-06-01

RNA interference (RNAi) in eukaryotes is a recently identified phenomenon in which small double stranded RNA molecules called short interfering RNA (siRNA) interact with messenger RNA (mRNA) containing homologous sequences in a sequence-specific manner. Ultimately, this interaction results in degradation of the target mRNA. Because of the high sequence specificity of the RNAi process, and the apparently ubiquitous expression of the endogenous protein components necessary for RNAi, there appears to be little limitation to the genes that can be targeted for silencing by RNAi. Thus, RNAi has enormous potential, both as a research tool and as a mode of therapy. Several recent patents have described advances in RNAi technology that are likely to lead to new treatments for cardiovascular disease. These patents have described methods for increased delivery of siRNA to cardiovascular target tissues, chemical modifications of siRNA that improve their pharmacokinetic characteristics, and expression vectors capable of expressing RNAi effectors in situ. Though RNAi has only recently been demonstrated to occur in mammalian tissues, work has advanced rapidly in the development of RNAi-based therapeutics. Recently, therapeutic silencing of apoliporotein B, the ligand for the low density lipoprotein receptor, has been demonstrated in adult mice by systemic administration of chemically modified siRNA. This demonstrates the potential for RNAi-based therapeutics, and suggests that the future for RNAi in the treatment of cardiovascular disease is bright.

Abasic pivot substitution harnesses target specificity of RNA interference

PubMed Central

Lee, Hye-Sook; Seok, Heeyoung; Lee, Dong Ha; Ham, Juyoung; Lee, Wooje; Youm, Emilia Moonkyung; Yoo, Jin Seon; Lee, Yong-Seung; Jang, Eun-Sook; Chi, Sung Wook

2015-01-01

Gene silencing via RNA interference inadvertently represses hundreds of off-target transcripts. Because small interfering RNAs (siRNAs) can function as microRNAs, avoiding miRNA-like off-target repression is a major challenge. Functional miRNA–target interactions are known to pre-require transitional nucleation, base pairs from position 2 to the pivot (position 6). Here, by substituting nucleotide in pivot with abasic spacers, which prevent base pairing and alleviate steric hindrance, we eliminate miRNA-like off-target repression while preserving on-target activity at ∼80–100%. Specifically, miR-124 containing dSpacer pivot substitution (6pi) loses seed-mediated transcriptome-wide target interactions, repression activity and biological function, whereas other conventional modifications are ineffective. Application of 6pi allows PCSK9 siRNA to efficiently lower plasma cholesterol concentration in vivo, and abolish potentially deleterious off-target phenotypes. The smallest spacer, C3, also shows the same improvement in target specificity. Abasic pivot substitution serves as a general means to harness the specificity of siRNA experiments and therapeutic applications. PMID:26679372

Pulmonary Delivery of siRNA via Polymeric Vectors as Therapies of Asthma

PubMed Central

Xie, Yuran; Merkel, Olivia M

2015-01-01

Asthma is a chronic inflammatory disease. Despite the fact that current therapies, such as the combination of inhaled corticosteroids and β2-agonists, can control the symptoms of asthma in most patients, there is still an urgent need for an alternative anti-inflammatory therapy for patients who suffer from severe asthma but lack acceptable response to conventional therapies. Many molecular factors are involved in the inflammatory process in asthma, and thus blocking the function of these factors could efficiently alleviate airway inflammation. RNA interference (RNAi) is often thought to be the answer in the search for more efficient and biocompatible treatments. However, difficulties of efficient delivery of small interference RNA (siRNA), the key factor in RNAi, to target cells and tissues has limited its clinical application. In this review, we summarize cytokines and chemokines, transcription factors, tyrosine kinases and costimulatory factors that have been reported as targets of siRNA mediated treatment in experimental asthma. Additionally, we conclude several targeted delivery systems of siRNA to specific cells such as T cells, macrophages and dendritic cells, which could potentially be applied in asthma therapy. PMID:26148454

Antiviral Effects of Small Interfering RNA Simultaneously Inducing RNA Interference and Type 1 Interferon in Coxsackievirus Myocarditis

PubMed Central

Ahn, Jeonghyun; Ko, Ara; Jun, Eun Jung; Won, Minah; Kim, Yoo Kyum; Ju, Eun-Seon

2012-01-01

Antiviral therapeutics are currently unavailable for treatment of coxsackievirus B3, which can cause life-threatening myocarditis. A modified small interfering RNA (siRNA) containing 5′-triphosphate, 3p-siRNA, was shown to induce RNA interference and interferon activation. We aimed to develop a potent antiviral treatment using CVB3-specific 3p-siRNA and to understand its underlying mechanisms. Virus-specific 3p-siRNA was superior to both conventional virus-specific siRNA with an empty hydroxyl group at the 5′ end (OH-siRNA) and nonspecific 3p-siRNA in decreasing viral replication and subsequent cytotoxicity. A single administration of 3p-siRNA dramatically attenuated virus-associated pathological symptoms in mice with no signs of toxicity, and their body weights eventually reached the normal range. Myocardial inflammation and fibrosis were rare, and virus production was greatly reduced. A nonspecific 3p-siRNA showed relatively less protective effect under identical conditions, and a virus-specific OH-siRNA showed no protective effects. We confirmed that virus-specific 3p-siRNA simultaneously activated target-specific gene silencing and type I interferon signaling. We provide a clear proof of concept that coxsackievirus B3-specific 3p-siRNA has 2 distinct modes of action, which significantly enhance antiviral activities with minimal organ damage. This is the first direct demonstration of improved antiviral effects with an immunostimulatory virus-specific siRNA in coxsackievirus myocarditis, and this method could be applied to many virus-related diseases. PMID:22508300

Gene Silencing in Insect Cells Using RNAi.

PubMed

Wu, Hsuan-Chen; March, John C; Bentley, William E

2016-01-01

A technique is described for synthesizing and transfecting double stranded RNA (dsRNA) for RNA interference (RNAi) in Sf-21 cell culture. Transfection with dsRNA only requires an hour and the cells usually recover within 12 h. Suggestions for designing dsRNA are included in the methods. Furthermore, websites are provided for rapid and effective dsRNA design. Three kits are essential for using the described methods: RNAqueous®-4PCR, Megascript™ T7 kit, and the Superscript™ III kit from Life Technologies, Inc.

Species specific inhibition of viral replication using dicer substrate siRNAs (DsiRNAs) targeting the viral nucleoprotein of the fish pathogenic rhabdovirus viral hemorrhagic septicemia virus (VHSV).

PubMed

Bohle, Harry; Lorenzen, Niels; Schyth, Brian Dall

2011-06-01

Gene knock down by the use of small interfering RNAs (siRNAs) is widely used as a method for reducing the expression of specific genes in eukaryotic cells via the RNA interference pathway. But, the effectivity of siRNA induced gene knock down in cells from fish has in several studies been questioned and the specificity seems to be a general problem in cells originating from both lower and higher vertebrates. Here we show that we are able to reduce the level of viral gene expression and replication specifically in fish cells in vitro. We do so by using 27/25-mer DsiRNAs acting as substrates for dicer for the generation of siRNAs targeting the nucleoprotein N gene of viral hemorrhagic septicemia virus (VHSV). This rhabdovirus infects salmonid fish and is responsible for large yearly losses in aquaculture production. Specificity of the DsiRNA is assured in two ways: first, by using the conventional method of testing a control DsiRNA which should not target the gene of interest. Second, by assuring that replication of a heterologous virus of the same genus as the target virus was not inhibited by the DsiRNA. Target controls are, as we have previously highlighted, essential for verification of the specificity of siRNA-induced interference with virus multiplication, but they are still not in general use. Copyright © 2011 Elsevier B.V. All rights reserved.

Interference in plant defense and development by non-structural protein NSs of Groundnut bud necrosis virus.

PubMed

Goswami, Suneha; Sahana, Nandita; Pandey, Vanita; Doblas, Paula; Jain, R K; Palukaitis, Peter; Canto, Tomas; Praveen, Shelly

2012-01-01

Groundnut bud necrosis virus (GBNV) infects a large number of leguminous and solanaceous plants. To elucidate the biological function of the non-structural protein encoded by the S RNA of GBNV (NSs), we studied its role in RNA silencing suppression and in viral pathogenesis. Our results demonstrated that GBNV NSs functions as a suppressor of RNA silencing using the agroinfiltration patch assay. An in silico analysis suggested the presence of pro-apoptotic protein Reaper-like sequences in the GBNV NSs, which were known to be present in animal infecting bunyaviruses. Utilizing NSs mutants, we demonstrated that a Leu-rich domain was required for RNA silencing suppression activity, but not the non-overlapping Trp/GH3 motif of the Reaper-like sequence. To investigate the role of NSs in symptom development we generated transgenic tomato expressing the GBNV NSs and showed that the expression of NSs in tomato mimics symptoms induced by infection with GBNV, such as leaf senescence and necrosis. As leaf senescence is controlled by miR319 regulation of the transcription factor TCP1, we assessed the accumulation of both RNAs in transgenic NSs-expressing and GBNV-infected tomato plants. In both types of plants the levels of miR319 decreased, while the levels of TCP1 transcripts increased. We propose that GBNV-NSs affects miRNA biogenesis through its RNA silencing suppressor activity and interferes with TCP1-regulated leaf developmental pathways. Copyright © 2011 Elsevier B.V. All rights reserved.

Development of RNAi technology for targeted therapy--a track of siRNA based agents to RNAi therapeutics.

PubMed

Zhou, Yinjian; Zhang, Chunling; Liang, Wei

2014-11-10

RNA interference (RNAi) was intensively studied in the past decades due to its potential in therapy of diseases. The target specificity and universal treatment spectrum endowed siRNA advantages over traditional small molecules and protein drugs. However, barriers exist in the blood circulation system and the diseased tissues blocked the actualization of RNAi effect, which raised function versatility requirements to siRNA therapeutic agents. Appropriate functionalization of siRNAs is necessary to break through these barriers and target diseased tissues in local or systemic targeted application. In this review, we summarized that barriers exist in the delivery process and popular functionalized technologies for siRNA such as chemical modification and physical encapsulation. Preclinical targeted siRNA delivery and the current status of siRNA based RNAi therapeutic agents in clinical trial were reviewed and finally the future of siRNA delivery was proposed. The valuable experience from the siRNA agent delivery study and the RNAi therapeutic agents in clinical trial paved ways for practical RNAi therapeutics to emerge early. Copyright © 2014 Elsevier B.V. All rights reserved.

Small interfering RNA against the 2C genomic region of coxsackievirus B3 exerts potential antiviral effects in permissive HeLa cells.

PubMed

Luan, Ying; Dai, Hai-Li; Yang, Dan; Zhu, Lin; Gao, Tie-Lei; Shao, Hong-Jiang; Peng, Xue; Jin, Zhan-Feng

2012-01-01

Coxsackievirus B3 (CVB3) is the most important causal agent of viral heart muscle disease, but no specific antiviral drug is currently available. Small interfering RNA (siRNA) has been used as an antiviral therapeutic strategy via posttranscriptional gene silencing. In this study, eleven siRNAs were designed to target seven distinct regions of the CVB3 genome including VP1, VP2, VP3, 2A, 2C, 3C, and 3D. All of the siRNAs were individually transfected into HeLa cells, which were subsequently infected with CVB3. The impacts of RNA interference (RNAi) on viral replication were evaluated using five measures: cytopathic effect (CPE), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, 50% tissue culture infectious dose (TCID(50)), real-time RT-PCR, and Western blot. Five of the eleven siRNAs were highly efficient at inhibiting viral replication. This was especially true for siRNA-5, which targeted the ATPase 2C. However, antiviral activity varied significantly among siRNA-9, -10, and -11 even though that they all targeted the 3D region. Our results revealed several effective targets for CVB3 silencing, and provided evidence that sequences except CRE within the 2C region may also be potential targets for CVB3-specific siRNAs design. These data supported a potential role of RNA interference in future antiviral intervention therapies. Copyright © 2011 Elsevier B.V. All rights reserved.

Induction and suppression of antiviral RNA interference by influenza A virus in mammalian cells.

PubMed

Li, Yang; Basavappa, Megha; Lu, Jinfeng; Dong, Shuwei; Cronkite, D Alexander; Prior, John T; Reinecker, Hans-Christian; Hertzog, Paul; Han, Yanhong; Li, Wan-Xiang; Cheloufi, Sihem; Karginov, Fedor V; Ding, Shou-Wei; Jeffrey, Kate L

2016-12-05

Influenza A virus (IAV) causes annual epidemics and occasional pandemics, and is one of the best-characterized human RNA viral pathogens 1 . However, a physiologically relevant role for the RNA interference (RNAi) suppressor activity of the IAV non-structural protein 1 (NS1), reported over a decade ago 2 , remains unknown 3 . Plant and insect viruses have evolved diverse virulence proteins to suppress RNAi as their hosts produce virus-derived small interfering RNAs (siRNAs) that direct specific antiviral defence 4-7 by an RNAi mechanism dependent on the slicing activity of Argonaute proteins (AGOs) 8,9 . Recent studies have documented induction and suppression of antiviral RNAi in mouse embryonic stem cells and suckling mice 10,11 . However, it is still under debate whether infection by IAV or any other RNA virus that infects humans induces and/or suppresses antiviral RNAi in mature mammalian somatic cells 12-21 . Here, we demonstrate that mature human somatic cells produce abundant virus-derived siRNAs co-immunoprecipitated with AGOs in response to IAV infection. We show that the biogenesis of viral siRNAs from IAV double-stranded RNA (dsRNA) precursors in infected cells is mediated by wild-type human Dicer and potently suppressed by both NS1 of IAV as well as virion protein 35 (VP35) of Ebola and Marburg filoviruses. We further demonstrate that the slicing catalytic activity of AGO2 inhibits IAV and other RNA viruses in mature mammalian cells, in an interferon-independent fashion. Altogether, our work shows that IAV infection induces and suppresses antiviral RNAi in differentiated mammalian somatic cells.

New insights into siRNA amplification and RNAi.

PubMed

Zhang, Chi; Ruvkun, Gary

2012-08-01

In the nematode Caenorhabditis elegans (C. elegans), gene inactivation by RNA interference can achieve remarkable potency due to the amplification of initial silencing triggers by RNA-dependent RNA polymerases (RdRPs). RdRPs catalyze the biogenesis of an abundant species of secondary small interfering RNAs (siRNAs) using the target mRNA as template. The interaction between primary siRNAs derived from the exogenous double-stranded RNA (dsRNA) trigger and the target mRNA is required for the recruitment of RdRPs. Other genetic requirements for RdRP activities have not been characterized. Recent studies have identified the RDE-10/RDE-11 complex which interacts with the primary siRNA bound target mRNA and acts upstream of the RdRPs. rde-10 and rde-11 mutants show an RNAi defective phenotype because the biogenesis of secondary siRNAs is completely abolished. In addition, the RDE-10/RDE-11 complex plays a similar role in the endogenous RNAi pathway for the biogenesis of a subset of siRNAs targeting recently acquired, duplicated genes.

Lysosomal putative RNA transporter SIDT2 mediates direct uptake of RNA by lysosomes.

PubMed

Aizawa, Shu; Fujiwara, Yuuki; Contu, Viorica Raluca; Hase, Katsunori; Takahashi, Masayuki; Kikuchi, Hisae; Kabuta, Chihana; Wada, Keiji; Kabuta, Tomohiro

2016-01-01

Lysosomes are thought to be the major intracellular compartment for the degradation of macromolecules. We recently identified a novel type of autophagy, RNautophagy, where RNA is directly taken up by lysosomes in an ATP-dependent manner and degraded. However, the mechanism of RNA translocation across the lysosomal membrane and the physiological role of RNautophagy remain unclear. In the present study, we performed gain- and loss-of-function studies with isolated lysosomes, and found that SIDT2 (SID1 transmembrane family, member 2), an ortholog of the Caenorhabditis elegans putative RNA transporter SID-1 (systemic RNA interference deficient-1), mediates RNA translocation during RNautophagy. We also observed that SIDT2 is a transmembrane protein, which predominantly localizes to lysosomes. Strikingly, knockdown of Sidt2 inhibited up to ˜50% of total RNA degradation at the cellular level, independently of macroautophagy. Moreover, we showed that this impairment is mainly due to inhibition of lysosomal RNA degradation, strongly suggesting that RNautophagy plays a significant role in constitutive cellular RNA degradation. Our results provide a novel insight into the mechanisms of RNA metabolism, intracellular RNA transport, and atypical types of autophagy.

Lysosomal putative RNA transporter SIDT2 mediates direct uptake of RNA by lysosomes

PubMed Central

Aizawa, Shu; Fujiwara, Yuuki; Contu, Viorica Raluca; Hase, Katsunori; Takahashi, Masayuki; Kikuchi, Hisae; Kabuta, Chihana; Wada, Keiji; Kabuta, Tomohiro

2016-01-01

ABSTRACT Lysosomes are thought to be the major intracellular compartment for the degradation of macromolecules. We recently identified a novel type of autophagy, RNautophagy, where RNA is directly taken up by lysosomes in an ATP-dependent manner and degraded. However, the mechanism of RNA translocation across the lysosomal membrane and the physiological role of RNautophagy remain unclear. In the present study, we performed gain- and loss-of-function studies with isolated lysosomes, and found that SIDT2 (SID1 transmembrane family, member 2), an ortholog of the Caenorhabditis elegans putative RNA transporter SID-1 (systemic RNA interference deficient-1), mediates RNA translocation during RNautophagy. We also observed that SIDT2 is a transmembrane protein, which predominantly localizes to lysosomes. Strikingly, knockdown of Sidt2 inhibited up to ˜50% of total RNA degradation at the cellular level, independently of macroautophagy. Moreover, we showed that this impairment is mainly due to inhibition of lysosomal RNA degradation, strongly suggesting that RNautophagy plays a significant role in constitutive cellular RNA degradation. Our results provide a novel insight into the mechanisms of RNA metabolism, intracellular RNA transport, and atypical types of autophagy. PMID:27046251

SiRNA Crosslinked Nanoparticles for the Treatment of Inflammation-induced Liver Injury.

PubMed

Tang, Yaqin; Zeng, Ziying; He, Xiao; Wang, Tingting; Ning, Xinghai; Feng, Xuli

2017-02-01

RNA interference mediated by small interfering RNA (siRNA) provides a powerful tool for gene regulation, and has a broad potential as a promising therapeutic strategy. However, therapeutics based on siRNA have had limited clinical success due to their undesirable pharmacokinetic properties. This study presents pH-sensitive nanoparticles-based siRNA delivery systems (PNSDS), which are positive-charge-free nanocarriers, composed of siRNA chemically crosslinked with multi-armed poly(ethylene glycol) carriers via acid-labile acetal linkers. The unique siRNA crosslinked structure of PNSDS allows it to have minimal cytotoxicity, high siRNA loading efficiency, and a stimulus-responsive property that enables the selective intracellular release of siRNA in response to pH conditions. This study demonstrates that PNSDS can deliver tumor necrosis factor alpha (TNF-α) siRNA into macrophages and induce the efficient down regulation of the targeted gene in complete cell culture media. Moreover, PNSDS with mannose targeting moieties can selectively accumulate in mice liver, induce specific inhibition of macrophage TNF-α expression in vivo, and consequently protect mice from inflammation-induced liver damages. Therefore, this novel siRNA delivering platform would greatly improve the therapeutic potential of RNAi based therapies.

Silencing the myotrophin gene by RNA interference leads to the regression of cardiac hypertrophy.

PubMed

Gupta, Sudhiranjan; Maitra, Ratan; Young, Dave; Gupta, Anasuya; Sen, Subha

2009-08-01

Myotrophin-induced activation of NF-kappaB has been shown to be associated with cardiac hypertrophy (CH) that progresses to heart failure (HF). In the present study, we examined the cause-and-effect relationship between myotrophin and NF-kappaB activation using small hairpin RNA (shRNA) against myotrophin both in vitro (using neonatal rat myocytes) and in vivo [using myotrophin transgenic (Myo-Tg) mice, which overexpress myotrophin in the heart, develop CH, and gradually progress to HF]. Among several lentiviral vectors expressing myotrophin shRNAs, L-sh-109 showed the best silencing effect at both the mRNA (155.3 +/- 5.9 vs. 32.5 +/- 5.5, P < 0.001) and protein levels associated with a significant reduction of atrial natriuretic factor (ANF) and NF-kappaB. In vivo, when L-sh-109 was delivered directly into the hearts of 10-wk-old Myo-Tg mice, we observed a significant regression of cardiac mass (8.0 vs. 5.7 mg/g, P < 0.001) and myotrophin gene expression (54.5% over untreated Myo-Tg mice, P < 0.001) associated with a reduction in ANF and NF-kappaB signaling components. Our data suggest that using RNA interference to silence the myotrophin gene prevents NF-kappaB activation, associated with an attenuation of CH. This strategy could be an excellent therapeutic means for the treatment of CH and HF.

A member of the polymerase beta nucleotidyltransferase superfamily is required for RNA interference in C. elegans.

PubMed

Chen, Chun-Chieh G; Simard, Martin J; Tabara, Hiroaki; Brownell, Daniel R; McCollough, Jennifer A; Mello, Craig C

2005-02-22

RNA interference (RNAi) is an ancient, highly conserved mechanism in which small RNA molecules (siRNAs) guide the sequence-specific silencing of gene expression . Several silencing machinery protein components have been identified, including helicases, RNase-related proteins, double- and single-stranded RNA binding proteins, and RNA-dependent RNA polymerase-related proteins . Work on these factors has led to the revelation that RNAi mechanisms intersect with cellular pathways required for development and fertility . Despite rapid progress in understanding key steps in the RNAi pathway, it is clear that many factors required for both RNAi and related developmental mechanisms have not yet been identified. Here, we report the characterization of the C. elegans gene rde-3. Genetic analysis of presumptive null alleles indicates that rde-3 is required for siRNA accumulation and for efficient RNAi in all tissues, and it is essential for fertility and viability at high temperatures. RDE-3 contains conserved domains found in the polymerase beta nucleotidyltransferase superfamily, which includes conventional poly(A) polymerases, 2'-5' oligoadenylate synthetase (OAS), and yeast Trf4p . These findings implicate a new enzymatic modality in RNAi and suggest possible models for the role of RDE-3 in the RNAi mechanism.

Suppression of RNA Interference by Adenovirus Virus-Associated RNA†

PubMed Central

Andersson, M. Gunnar; Haasnoot, P. C. Joost; Xu, Ning; Berenjian, Saideh; Berkhout, Ben; Akusjärvi, Göran

2005-01-01

We show that human adenovirus inhibits RNA interference (RNAi) at late times of infection by suppressing the activity of two key enzyme systems involved, Dicer and RNA-induced silencing complex (RISC). To define the mechanisms by which adenovirus blocks RNAi, we used a panel of mutant adenoviruses defective in virus-associated (VA) RNA expression. The results show that the virus-associated RNAs, VA RNAI and VA RNAII, function as suppressors of RNAi by interfering with the activity of Dicer. The VA RNAs bind Dicer and function as competitive substrates squelching Dicer. Further, we show that VA RNAI and VA RNAII are processed by Dicer, both in vitro and during a lytic infection, and that the resulting short interfering RNAs (siRNAs) are incorporated into active RISC. Dicer cleaves the terminal stem of both VA RNAI and VA RNAII. However, whereas both strands of the VA RNAI-specific siRNA are incorporated into RISC, the 3′ strand of the VA RNAII-specific siRNA is selectively incorporated during a lytic infection. In summary, our work shows that adenovirus suppresses RNAi during a lytic infection and gives insight into the mechanisms of RNAi suppression by VA RNA. PMID:16014917

Fluorescence Reporter-Based Genome-Wide RNA Interference Screening to Identify Alternative Splicing Regulators.

PubMed

Misra, Ashish; Green, Michael R

2017-01-01

Alternative splicing is a regulated process that leads to inclusion or exclusion of particular exons in a pre-mRNA transcript, resulting in multiple protein isoforms being encoded by a single gene. With more than 90 % of human genes known to undergo alternative splicing, it represents a major source for biological diversity inside cells. Although in vitro splicing assays have revealed insights into the mechanisms regulating individual alternative splicing events, our global understanding of alternative splicing regulation is still evolving. In recent years, genome-wide RNA interference (RNAi) screening has transformed biological research by enabling genome-scale loss-of-function screens in cultured cells and model organisms. In addition to resulting in the identification of new cellular pathways and potential drug targets, these screens have also uncovered many previously unknown mechanisms regulating alternative splicing. Here, we describe a method for the identification of alternative splicing regulators using genome-wide RNAi screening, as well as assays for further validation of the identified candidates. With modifications, this method can also be adapted to study the splicing regulation of pre-mRNAs that contain two or more splice isoforms.

Decreased expression of RNA interference machinery, Dicer and Drosha, is associated with poor outcome in ovarian cancer patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Merritt, William M.; Lin, Yvonne G.; Han, Liz Y.

2008-05-06

The clinical and functional significance of RNA interference (RNAi) machinery, Dicer and Drosha, in ovarian cancer is not known and was examined. Dicer and Drosha expression was measured in ovarian cancer cell lines (n=8) and invasive epithelial ovarian cancer specimens (n=111) and correlated with clinical outcome. Validation was performed with previously published cohorts of ovarian, breast, and lung cancer patients. Anti-Galectin-3 siRNA and shRNA transfections were used for in vitro functional studies. Dicer and Drosha mRNA and protein levels were decreased in 37% to 63% of ovarian cancer cell lines and in 60% and 51% of human ovarian cancer specimens,more » respectively. Low Dicer was significantly associated with advanced tumor stage (p=0.007), and low Drosha with suboptimal surgical cytoreduction (p=0.02). Tumors with both high Dicer and Drosha were associated with increased median patient survival (>11 years vs. 2.66 years for other groups; p<0.001). In multivariate analysis, high Dicer (HR=0.48; p=0.02), high-grade histology (HR=2.46; p=0.03), and poor chemoresponse (HR=3.95; p<0.001) were identified as independent predictors of disease-specific survival. Findings of poor clinical outcome with low Dicer expression were validated in separate cohorts of cancer patients. Galectin-3 silencing with siRNA transfection was superior to shRNA in cell lines with low Dicer (78-95% vs. 4-8% compared to non-targeting sequences), and similar in cell lines with high Dicer. Our findings demonstrate the clinical and functional impact of RNAi machinery alterations in ovarian carcinoma and support the use of siRNA constructs that do not require endogenous Dicer and Drosha for therapeutic applications.« less

HIV-1 RNAs are Not Part of the Argonaute 2 Associated RNA Interference Pathway in Macrophages.

PubMed

Vongrad, Valentina; Imig, Jochen; Mohammadi, Pejman; Kishore, Shivendra; Jaskiewicz, Lukasz; Hall, Jonathan; Günthard, Huldrych F; Beerenwinkel, Niko; Metzner, Karin J

2015-01-01

MiRNAs and other small noncoding RNAs (sncRNAs) are key players in post-transcriptional gene regulation. HIV-1 derived small noncoding RNAs (sncRNAs) have been described in HIV-1 infected cells, but their biological functions still remain to be elucidated. Here, we approached the question whether viral sncRNAs may play a role in the RNA interference (RNAi) pathway or whether viral mRNAs are targeted by cellular miRNAs in human monocyte derived macrophages (MDM). The incorporation of viral sncRNAs and/or their target RNAs into RNA-induced silencing complex was investigated using photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) as well as high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation (HITS-CLIP), which capture Argonaute2-bound miRNAs and their target RNAs. HIV-1 infected monocyte-derived macrophages (MDM) were chosen as target cells, as they have previously been shown to express HIV-1 sncRNAs. In addition, we applied small RNA deep sequencing to study differential cellular miRNA expression in HIV-1 infected versus non-infected MDMs. PAR-CLIP and HITS-CLIP data demonstrated the absence of HIV-1 RNAs in Ago2-RISC, although the presence of a multitude of HIV-1 sncRNAs in HIV-1 infected MDMs was confirmed by small RNA sequencing. Small RNA sequencing revealed that 1.4% of all sncRNAs were of HIV-1 origin. However, neither HIV-1 derived sncRNAs nor putative HIV-1 target sequences incorporated into Ago2-RISC were identified suggesting that HIV-1 sncRNAs are not involved in the canonical RNAi pathway nor is HIV-1 targeted by this pathway in HIV-1 infected macrophages.

The effects of RNA interference mediated VEGF gene silencing on biological behavior of renal cell carcinoma and transplanted renal tumor in nude mice.

PubMed

Wang, Qi; Wang, Shuai; Sun, Si-Qiao; Cheng, Zhi-Hua; Zhang, Yang; Chen, Guang; Gu, Meng; Yao, Hai-Jun; Wang, Zhong; Zhou, Juan; Peng, Yu-Bing; Xu, Ming-Xi; Zhang, Ke; Sun, Xi-Wei

2016-01-01

This study was to explore the effects of RNA interference mediated vascular endothelial growth factor (VEGF) gene silencing on biological behavior of renal cell carcinoma (RCC), transplanted renal tumor and angiogenesis in nude mice. The specific siRNA sequence targeting VEGF were designed and synthesized to construct hVEGF-siRNA plasmid which was transfected into RCC 786-O cells. Reverse transcriptase-polymerase chain reaction (RT-PCR) was used for the detection of VEGF gene expression and western blot was adopted for the examination of VEGF protein expression. The 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used to detect cell growth as well as cell migration and invasion. The transplanted renal tumor models in nude mice were established, and the growth condition of nude mice, and VEGF protein expression in transplanted tumor slices and the microvessel density (MVD) were detected. The expression level of VEGF mRNA in VEGF-siRNA group was significant lower than that in the control group and negative group, suggesting that establishment of plasmid specifically inhibited the expression of VEGF gene The expression level of VEGF protein in VEGF-siRNA group was significant lower than that in the control group and negative group. VEGF gene silencing has the significant inhibition effects on proliferation, migration and invasion of RCC 786-O cells. The tumor weight, VEGF protein positive rate and MVD in VEGF-siRNA group were significant lower than those in negative group and blank group. The VEGF gene silencing could inhibit the cell proliferation, migration and invasion of RCC 786-O cells; inhibition of VEGF protein expression could prevent transplanted RCC growth and tumor angiogenesis.

RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans.

PubMed

Tops, Bastiaan B J; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C; Plasterk, Ronald H A; Ketting, René F

2005-01-01

In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of approximately 250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step.

Targeting CCl4 -induced liver fibrosis by RNA interference-mediated inhibition of cyclin E1 in mice.

PubMed

Bangen, Jörg-Martin; Hammerich, Linda; Sonntag, Roland; Baues, Maike; Haas, Ute; Lambertz, Daniela; Longerich, Thomas; Lammers, Twan; Tacke, Frank; Trautwein, Christian; Liedtke, Christian

2017-10-01

Initiation and progression of liver fibrosis requires proliferation and activation of resting hepatic stellate cells (HSCs). Cyclin E1 (CcnE1) is the regulatory subunit of the cyclin-dependent kinase 2 (Cdk2) and controls cell cycle re-entry. We have recently shown that genetic inactivation of CcnE1 prevents activation, proliferation, and survival of HSCs and protects from liver fibrogenesis. The aim of the present study was to translate these findings into preclinical applications using an RNA interference (RNAi)-based approach. CcnE1-siRNA (small interfering RNA) efficiently inhibited CcnE1 gene expression in murine and human HSC cell lines and in primary HSCs, resulting in diminished proliferation and increased cell death. In C57BL/6 wild-type (WT) mice, delivery of stabilized siRNA using a liposome-based carrier targeted approximately 95% of HSCs, 70% of hepatocytes, and 40% of CD45 + cells after single injection. Acute CCl 4 -mediated liver injury in WT mice induced endogenous CcnE1 expression and proliferation of surviving hepatocytes and nonparenchymal cells, including CD45 + leukocytes. Pretreatment with CcnE1-siRNA reverted CcnE1 induction to baseline levels of healthy mice, which was associated with reduced liver injury, diminished proliferation of hepatocytes and leukocytes, and attenuated overall inflammatory response. For induction of liver fibrosis, WT mice were challenged with CCl 4 for 4-6 weeks. Co-treatment with CcnE1-siRNA once a week was sufficient to continuously block CcnE1 expression and cell-cycle activity of hepatocytes and nonparenchymal cells, resulting in significantly ameliorated liver fibrosis and inflammation. Importantly, CcnE1-siRNA also prevented progression of liver fibrosis if applied after onset of chronic liver injury. Therapeutic targeting of CcnE1 in vivo using RNAi is feasible and has high antifibrotic activity. (Hepatology 2017;66:1242-1257). © 2017 by the American Association for the Study of Liver Diseases.

RNA interference-based functional knockdown of the voltage-gated potassium channel Kv7.2 in dorsal root ganglion neurons after in vitro and in vivo gene transfer by adeno-associated virus vectors.

PubMed

Valdor, Markus; Wagner, Anke; Röhrs, Viola; Berg, Johanna; Fechner, Henry; Schröder, Wolfgang; Tzschentke, Thomas M; Bahrenberg, Gregor; Christoph, Thomas; Kurreck, Jens

2018-01-01

Activation of the neuronal potassium channel Kv7.2 encoded by the KCNQ2 gene has recently been shown to be an attractive mechanism to inhibit nociceptive transmission. However, potent, selective, and clinically proven activators of Kv7.2/Kv7.3 currents with analgesic properties are still lacking. An important prerequisite for the development of new drugs is a model to test the selectivity of novel agonists by abrogating Kv7.2/Kv7.3 function. Since constitutive knockout mice are not viable, we developed a model based on RNA interference-mediated silencing of KCNQ2. By delivery of a KCNQ2-specific short hairpin RNA with adeno-associated virus vectors, we completely abolished the activity of the specific Kv7.2/Kv7.3-opener ICA-27243 in rat sensory neurons. Results obtained in the silencing experiments were consistent between freshly prepared and cryopreserved dorsal root ganglion neurons, as well as in dorsal root ganglion neurons dissociated and cultured after in vivo administration of the silencing vector by intrathecal injections into rats. Interestingly, the tested associated virus serotypes substantially differed with respect to their transduction capability in cultured neuronal cell lines and primary dorsal root ganglion neurons and the in vivo transfer of transgenes by intrathecal injection of associated virus vectors. However, our study provides the proof-of-concept that RNA interference-mediated silencing of KCNQ2 is a suitable approach to create an ex vivo model for testing the specificity of novel Kv7.2/Kv7.3 agonists.

The role of Cas8 in type I CRISPR interference.

PubMed

Cass, Simon D B; Haas, Karina A; Stoll, Britta; Alkhnbashi, Omer S; Sharma, Kundan; Urlaub, Henning; Backofen, Rolf; Marchfelder, Anita; Bolt, Edward L

2015-05-05

CRISPR (clustered regularly interspaced short palindromic repeat) systems provide bacteria and archaea with adaptive immunity to repel invasive genetic elements. Type I systems use 'cascade' [CRISPR-associated (Cas) complex for antiviral defence] ribonucleoprotein complexes to target invader DNA, by base pairing CRISPR RNA (crRNA) to protospacers. Cascade identifies PAMs (protospacer adjacent motifs) on invader DNA, triggering R-loop formation and subsequent DNA degradation by Cas3. Cas8 is a candidate PAM recognition factor in some cascades. We analysed Cas8 homologues from type IB CRISPR systems in archaea Haloferax volcanii (Hvo) and Methanothermobacter thermautotrophicus (Mth). Cas8 was essential for CRISPR interference in Hvo and purified Mth Cas8 protein responded to PAM sequence when binding to nucleic acids. Cas8 interacted physically with Cas5-Cas7-crRNA complex, stimulating binding to PAM containing substrates. Mutation of conserved Cas8 amino acid residues abolished interference in vivo and altered catalytic activity of Cas8 protein in vitro. This is experimental evidence that Cas8 is important for targeting Cascade to invader DNA. © 2015 Authors.

RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding.

PubMed

Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung

2014-01-01

RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties.

RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding

PubMed Central

Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung

2014-01-01

RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties. PMID:25332689

Multifunctional RNA Nanoparticles

PubMed Central

2015-01-01

Our recent advancements in RNA nanotechnology introduced novel nanoscaffolds (nanorings); however, the potential of their use for biomedical applications was never fully revealed. As presented here, besides functionalization with multiple different short interfering RNAs for combinatorial RNA interference (e.g., against multiple HIV-1 genes), nanorings also allow simultaneous embedment of assorted RNA aptamers, fluorescent dyes, proteins, as well as recently developed RNA–DNA hybrids aimed to conditionally activate multiple split functionalities inside cells. PMID:25267559

Live cell imaging of Argonaute proteins in mammalian cells.

PubMed

Pare, Justin M; Lopez-Orozco, Joaquin; Hobman, Tom C

2011-01-01

The central effector of mammalian RNA interference (RNAi) is the RNA-induced silencing complex (RISC). Proteins of the Argonaute family are the core components of RISC. Recent work from multiple laboratories has shown that Argonaute family members are associated with at least two types of cytoplasmic RNA granules: GW/Processing bodies and stress granules. These Argonaute-containing granules harbor proteins that function in mRNA degradation and translational repression in response to stress. The known role of Argonaute proteins in miRNA-mediated translational repression and siRNA-directed mRNA cleavage (i.e., Argonaute 2) has prompted speculation that the association of Argonautes with these granules may reflect the activity of RNAi in vivo. Accordingly, studying the dynamic association between Argonautes and RNA granules in living cells will undoubtedly provide insight into the regulatory mechanisms of RNA-based silencing. This chapter describes a method for imaging fluorescently tagged Argonaute proteins in living mammalian cells using spinning disk confocal microscopy.

Lentivirus mediated RNA interference of EMMPRIN (CD147) gene inhibits the proliferation, matrigel invasion and tumor formation of breast cancer cells.

PubMed

Yang, Jing; Wang, Rong; Li, Hongjiang; Lv, Qing; Meng, Wentong; Yang, Xiaoqin

2016-07-08

Overexpression of extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), a glycoprotein enriched on the plasma membrane of tumor cells, promotes proliferation, invasion, metastasis, and survival of malignant tumor cells. In this study, we sought to examine the expression of EMMPRIN in breast tumors, and to identify the potential roles of EMMPRIN on breast cancer cells. EMMPRIN expression in breast cancer tissues was assessed by immunohistochemistry. We used a lentivirus vector-based RNA interference (RNAi) approach expressing short hairpin RNA (shRNA) to knockdown EMMPRIN gene in breast cancer cell lines MDA-MB-231 and MCF-7. In vitro, Cell proliferative, invasive potential were determined by Cell Counting Kit (CCK-8), cell cycle analysis and matrigel invasion assay, respectively. In vivo, tumorigenicity was monitored by inoculating tumor cells into breast fat pad of female nude mice. EMMPRIN was over-expressed in breast tumors and breast cancer cell lines. Down-regulation of EMMPRIN by lentivirus vector-based RNAi led to decreased cell proliferative, decreased matrigel invasion in vitro, and attenuated tumor formation in vivo. High expression of EMMPRIN plays a crucial role in breast cancer cell proliferation, matrigel invasion and tumor formation.

Targeting a KH-domain protein with RNA decoys.

PubMed

Makeyev, Aleksandr V; Eastmond, Dawn L; Liebhaber, Stephen A

2002-09-01

RNA-binding proteins are involved in the regulation of many aspects of eukaryotic gene expression. Targeted interference with RNA-protein interactions could offer novel approaches to modulation of expression profiles, alteration of developmental pathways, and reversal of certain disease processes. Here we investigate a decoy strategy for the study of the alphaCP subgroup of KH-domain RNA-binding proteins. These poly(C)-binding proteins have been implicated in a wide spectrum of posttranscriptional controls. Three categories of RNA decoys to alphaCPs were studied: poly(C) homopolymers, native mRNA-binding sites, and a high-affinity structure selected from a combinatorial library. Native chemistry was found to be essential for alphaCP decoy action. Because alphaCP proteins are found in both the nucleus and cytoplasm, decoy cassettes were incorporated within both nuclear (U1 snRNA) and cytoplasmic (VA1 RNA) RNA frameworks. Several sequences demonstrated optimal decoy properties when assayed for protein-binding and decoy bioactivity in vitro. A subset of these transcripts was shown to mediate targeted inhibition of alphaCP-dependent translation when expressed in either the nucleus or cytoplasm of transfected cells. Significantly, these studies establish the feasibility of developing RNA decoys that can selectively target biologic functions of abundant and widely expressed RNA binding proteins.

Targeting a KH-domain protein with RNA decoys.

PubMed Central

Makeyev, Aleksandr V; Eastmond, Dawn L; Liebhaber, Stephen A

2002-01-01

RNA-binding proteins are involved in the regulation of many aspects of eukaryotic gene expression. Targeted interference with RNA-protein interactions could offer novel approaches to modulation of expression profiles, alteration of developmental pathways, and reversal of certain disease processes. Here we investigate a decoy strategy for the study of the alphaCP subgroup of KH-domain RNA-binding proteins. These poly(C)-binding proteins have been implicated in a wide spectrum of posttranscriptional controls. Three categories of RNA decoys to alphaCPs were studied: poly(C) homopolymers, native mRNA-binding sites, and a high-affinity structure selected from a combinatorial library. Native chemistry was found to be essential for alphaCP decoy action. Because alphaCP proteins are found in both the nucleus and cytoplasm, decoy cassettes were incorporated within both nuclear (U1 snRNA) and cytoplasmic (VA1 RNA) RNA frameworks. Several sequences demonstrated optimal decoy properties when assayed for protein-binding and decoy bioactivity in vitro. A subset of these transcripts was shown to mediate targeted inhibition of alphaCP-dependent translation when expressed in either the nucleus or cytoplasm of transfected cells. Significantly, these studies establish the feasibility of developing RNA decoys that can selectively target biologic functions of abundant and widely expressed RNA binding proteins. PMID:12358435

Saliva of TBP digests double stranded RNAs

USDA-ARS?s Scientific Manuscript database

The tarnished plant bug (TPB), Lygus lineolaris, is a generalist pest of many crops including cotton, strawberries, and alfalfa. While studying gene expression and gene knockdown through RNA interference, my lab was frustrated by an observation. We were unable to replicate knock down effects observe...

Improvement of heterologous protein production in Aspergillus oryzae by RNA interference with alpha-amylase genes.

PubMed

Nemoto, Takashi; Maruyama, Jun-ichi; Kitamoto, Katsuhiko

2009-11-01

Aspergillus oryzae RIB40 has three alpha-amylase genes (amyA, amyB, and amyC), and secretes alpha-amylase abundantly. However, large amounts of endogenous secretory proteins such as alpha-amylase can compete with heterologous protein in the secretory pathway and decrease its production yields. In this study, we examined the effects of suppression of alpha-amylase on heterologous protein production in A. oryzae, using the bovine chymosin (CHY) as a reporter heterologous protein. The three alpha-amylase genes in A. oryzae have nearly identical DNA sequences from those promoters to the coding regions. Hence we performed silencing of alpha-amylase genes by RNA interference (RNAi) in the A. oryzae CHY producing strain. The silenced strains exhibited a reduction in alpha-amylase activity and an increase in CHY production in the culture medium. This result suggests that suppression of alpha-amylase is effective in heterologous protein production in A. oryzae.

RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.)

PubMed Central

Abdurakhmonov, Ibrokhim Y.; Ayubov, Mirzakamol S.; Ubaydullaeva, Khurshida A.; Buriev, Zabardast T.; Shermatov, Shukhrat E.; Ruziboev, Haydarali S.; Shapulatov, Umid M.; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z.; Percy, Richard G.; Devor, Eric J.; Sharma, Govind C.; Sripathi, Venkateswara R.; Kumpatla, Siva P.; van der Krol, Alexander; Kater, Hake D.; Khamidov, Khakimdjan; Salikhov, Shavkat I.; Jenkins, Johnie N.; Abdukarimov, Abdusattor; Pepper, Alan E.

2016-01-01

RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization. PMID:26941765

RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.).

PubMed

Abdurakhmonov, Ibrokhim Y; Ayubov, Mirzakamol S; Ubaydullaeva, Khurshida A; Buriev, Zabardast T; Shermatov, Shukhrat E; Ruziboev, Haydarali S; Shapulatov, Umid M; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z; Percy, Richard G; Devor, Eric J; Sharma, Govind C; Sripathi, Venkateswara R; Kumpatla, Siva P; van der Krol, Alexander; Kater, Hake D; Khamidov, Khakimdjan; Salikhov, Shavkat I; Jenkins, Johnie N; Abdukarimov, Abdusattor; Pepper, Alan E

2016-01-01

RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization.

Complexities in Isolation and Purification of Multiple Viruses from Mixed Viral Infections: Viral Interference, Persistence and Exclusion.

PubMed

Kumar, Naveen; Barua, Sanjay; Riyesh, Thachamvally; Chaubey, Kundan K; Rawat, Krishan Dutt; Khandelwal, Nitin; Mishra, Anil K; Sharma, Nitika; Chandel, Surender S; Sharma, Shalini; Singh, Manoj K; Sharma, Dinesh K; Singh, Shoor V; Tripathi, Bhupendra N

2016-01-01

Successful purification of multiple viruses from mixed infections remains a challenge. In this study, we investigated peste des petits ruminants virus (PPRV) and foot-and-mouth disease virus (FMDV) mixed infection in goats. Rather than in a single cell type, cytopathic effect (CPE) of the virus was observed in cocultured Vero/BHK-21 cells at 6th blind passage (BP). PPRV, but not FMDV could be purified from the virus mixture by plaque assay. Viral RNA (mixture) transfection in BHK-21 cells produced FMDV but not PPRV virions, a strategy which we have successfully employed for the first time to eliminate the negative-stranded RNA virus from the virus mixture. FMDV phenotypes, such as replication competent but noncytolytic, cytolytic but defective in plaque formation and, cytolytic but defective in both plaque formation and standard FMDV genome were observed respectively, at passage level BP8, BP15 and BP19 and hence complicated virus isolation in the cell culture system. Mixed infection was not found to induce any significant antigenic and genetic diversity in both PPRV and FMDV. Further, we for the first time demonstrated the viral interference between PPRV and FMDV. Prior transfection of PPRV RNA, but not Newcastle disease virus (NDV) and rotavirus RNA resulted in reduced FMDV replication in BHK-21 cells suggesting that the PPRV RNA-induced interference was specifically directed against FMDV. On long-term coinfection of some acute pathogenic viruses (all possible combinations of PPRV, FMDV, NDV and buffalopox virus) in Vero cells, in most cases, one of the coinfecting viruses was excluded at passage level 5 suggesting that the long-term coinfection may modify viral persistence. To the best of our knowledge, this is the first documented evidence describing a natural mixed infection of FMDV and PPRV. The study not only provides simple and reliable methodologies for isolation and purification of two epidemiologically and economically important groups of viruses, but could also help in establishing better guidelines for trading animals that could transmit further infections and epidemics in disease free nations.

The involvement of osteopontin and matrix metalloproteinase- 9 in the migration of endometrial epithelial cells in patients with endometriosis.

PubMed

Yang, Mei; Jiang, Chunfan; Chen, Hua; Nian, Yan; Bai, Zhimiao; Ha, Chunfang

2015-08-20

Endometriosis, which shares certain characteristics with cancers, may cause abnormal expression of proteins involved in cell migration. Endometrial epithelial cells (EECs) are believed to play an important role in endometriotic migration. The aim of this study was to investigate the relationship between the expression of osteopontin (OPN) and matrix metalloproteinase-9 (MMP-9) in endometriotic migration. We performed primary culture of EECs and investigated the expression of OPN and MMP-9 in EECs regulated by 17beta-estradiol (E2). OPN-specific siRNA interference was used to down-regulate OPN and to explore the corresponding change in MMP-9 expression. Real-time RT-PCR, western blot analysis and flow cytometry were used to determine the expression levels of OPN and MMP-9. Gelatin zymography was performed to observe the enzymatic activity of MMP-9 in conditioned media. Transwell and wound scratch assays were performed to investigate the migration ability of EECs. The expression levels of OPN and MMP-9 in normal EECs (NEECs) were inferior to those in EECs from patients with endometriosis (EEECs). The expression levels of OPN and MMP-9 from stage III/IV EEECs and secretory-phase EECs were higher than those of stage I/II EEECs or proliferative-phase EECs. The expression levels of OPN and MMP-9 in EEECs were increased by E2 treatment and remarkably decreased by siRNA interference. Active MMP-9 expression increased with E2 treatment and decreased with siRNA treatment in EEECs compared with the same treatments in NEECs. The migratory abilities of EEECs were enhanced after cells were treated with E2; in contrast, these abilities were reduced by siRNA interference. In NEECs, active MMP-9 and cellular migration abilities were only minimally influenced by E2 and siRNA treatment. The present study suggests that the up-regulation of MMP-9 via activation of OPN induced by estrogen may correlate with the migration of endometrial epithelial cells in patients with endometriosis.

Complexities in Isolation and Purification of Multiple Viruses from Mixed Viral Infections: Viral Interference, Persistence and Exclusion

PubMed Central

Kumar, Naveen; Barua, Sanjay; Riyesh, Thachamvally; Chaubey, Kundan K.; Rawat, Krishan Dutt; Khandelwal, Nitin; Mishra, Anil K.; Sharma, Nitika; Chandel, Surender S.; Sharma, Shalini; Singh, Manoj K.; Sharma, Dinesh K.; Singh, Shoor V.; Tripathi, Bhupendra N.

2016-01-01

Successful purification of multiple viruses from mixed infections remains a challenge. In this study, we investigated peste des petits ruminants virus (PPRV) and foot-and-mouth disease virus (FMDV) mixed infection in goats. Rather than in a single cell type, cytopathic effect (CPE) of the virus was observed in cocultured Vero/BHK-21 cells at 6th blind passage (BP). PPRV, but not FMDV could be purified from the virus mixture by plaque assay. Viral RNA (mixture) transfection in BHK-21 cells produced FMDV but not PPRV virions, a strategy which we have successfully employed for the first time to eliminate the negative-stranded RNA virus from the virus mixture. FMDV phenotypes, such as replication competent but noncytolytic, cytolytic but defective in plaque formation and, cytolytic but defective in both plaque formation and standard FMDV genome were observed respectively, at passage level BP8, BP15 and BP19 and hence complicated virus isolation in the cell culture system. Mixed infection was not found to induce any significant antigenic and genetic diversity in both PPRV and FMDV. Further, we for the first time demonstrated the viral interference between PPRV and FMDV. Prior transfection of PPRV RNA, but not Newcastle disease virus (NDV) and rotavirus RNA resulted in reduced FMDV replication in BHK-21 cells suggesting that the PPRV RNA-induced interference was specifically directed against FMDV. On long-term coinfection of some acute pathogenic viruses (all possible combinations of PPRV, FMDV, NDV and buffalopox virus) in Vero cells, in most cases, one of the coinfecting viruses was excluded at passage level 5 suggesting that the long-term coinfection may modify viral persistence. To the best of our knowledge, this is the first documented evidence describing a natural mixed infection of FMDV and PPRV. The study not only provides simple and reliable methodologies for isolation and purification of two epidemiologically and economically important groups of viruses, but could also help in establishing better guidelines for trading animals that could transmit further infections and epidemics in disease free nations. PMID:27227480

RNAi-induced silencing of embryonic tryptophan oxygenase in the Pyralid moth, Plodia interpunctella

PubMed Central

Fabrick, Jeffrey A.; Kanost, Michael R.; Baker, James E.

2004-01-01

Gene silencing through the introduction of double-stranded RNA (RNA interference, RNAi) provides a powerful tool for the elucidation of gene function in many systems, including those where genomics and proteomics are incomplete. The use of RNAi technology for gene silencing in Lepidoptera has lacked significant attention compared to other systems. To demonstrate that RNAi can be utilized in the lepidopteran, Plodia interpunctella, we cloned a cDNA for tryptophan oxygenase, and showed that silencing of tryptophan oxygenase through RNAi during embryonic development resulted in loss of eye-color pigmentation. The complete amino acid sequence of Plodia tryptophan oxygenase can be accessed through NCBI Protein Database under NCBI Accession # AY427951. Abbreviation RNAi RNA interference PCR polymerase chain reaction RT-PCR reverse transcription-PCR PMID:15861231

Suppression of the Epidermal Growth Factor-like Domain 7 and Inhibition of Migration and Epithelial-Mesenchymal Transition in Human Pancreatic Cancer PANC-1 Cells.

PubMed

Wang, Yun-Liang; Dong, Feng-Lin; Yang, Jian; Li, Zhi; Zhi, Qiao-Ming; Zhao, Xin; Yang, Yong; Li, De-Chun; Shen, Xiao-Chun; Zhou, Jin

2015-01-01

Epidermal growth factor-like domain multiple 7 (EGFL7), a secreted protein specifically expressed by endothelial cells during embryogenesis, recently was identified as a critical gene in tumor metastasis. Epithelial-mesenchymal transition (EMT) was found to be closely related with tumor progression. Accordingly, it is important to investigate the migration and EMT change after knock-down of EGFL7 gene expression in human pancreatic cancer cells. EGFL7 expression was firstly testified in 4 pancreatic cancer cell lines by real-time polymerase chain reaction (Real-time PCR) and western blot, and the highest expression of EGFL7 was found in PANC-1 cell line. Then, PANC-1 cells transfected with small interference RNA (siRNA) of EGFL7 using plasmid vector were named si-PANC-1, while transfected with negative control plasmid vector were called NC-PANC-1. Transwell assay was used to analyze the migration of PANC-1 cells. Real-time PCR and western blotting were used to detect the expression change of EGFL7 gene, EMT markers like E-Cadherin, N-Cadherin, Vimentin, Fibronectin and transcription factors like snail, slug in PANC-1, NC- PANC-1, and si-PANC-1 cells, respectively. After successful plasmid transfection, EGFL7 gene were dramatically knock-down by RNA interference in si-PANC-1 group. Meanwhile, migration ability decreased significantly, compared with PANC-1 and NC-PANC-1 group. Meanwhile, the expression of epithelial phenotype marker E-Cadherin increased and that of mesenchymal phenotype markers N-Cadherin, Vimentin, Fibronectin dramatically decreased in si-PANC-1 group, indicating a reversion of EMT. Also, transcription factors snail and slug decreased significantly after RNA interference. Current study suggested that highly-expressed EGFL7 promotes migration of PANC-1 cells and acts through transcription factors snail and slug to induce EMT, and further study is needed to confirm this issue.

RNA interference technology to control pest sea lampreys--a proof-of-concept.

PubMed

Heath, George; Childs, Darcy; Docker, Margaret F; McCauley, David W; Whyard, Steven

2014-01-01

The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0-fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species.

RNA Interference Technology to Control Pest Sea Lampreys - A Proof-of-Concept

PubMed Central

Heath, George; Childs, Darcy; Docker, Margaret F.; McCauley, David W.; Whyard, Steven

2014-01-01

The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0–fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species. PMID:24505485

Cigarette smoking substantially alters plasma microRNA profiles in healthy subjects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Takahashi, Kei; Yokota, Shin-ichi; Tatsumi, Naoyuki

Circulating microRNAs (miRNAs) are receiving attention as potential biomarkers of various diseases, including cancers, chronic obstructive pulmonary disease, and cardiovascular disease. However, it is unknown whether the levels of circulating miRNAs in a healthy subject might vary with external factors in daily life. In this study, we investigated whether cigarette smoking, a habit that has spread throughout the world and is a risk factor for various diseases, affects plasma miRNA profiles. We determined the profiles of 11 smokers and 7 non-smokers by TaqMan MicroRNA array analysis. A larger number of miRNAs were detected in smokers than in non-smokers, and themore » plasma levels of two-thirds of the detected miRNAs (43 miRNAs) were significantly higher in smokers than in non-smokers. A principal component analysis of the plasma miRNA profiles clearly separated smokers and non-smokers. Twenty-four of the miRNAs were previously reported to be potential biomarkers of disease, suggesting the possibility that smoking status might interfere with the diagnosis of disease. Interestingly, we found that quitting smoking altered the plasma miRNA profiles to resemble those of non-smokers. These results suggested that the differences in the plasma miRNA profiles between smokers and non-smokers could be attributed to cigarette smoking. In addition, we found that an acute exposure of ex-smokers to cigarette smoke (smoking one cigarette) did not cause a dramatic change in the plasma miRNA profile. In conclusion, we found that repeated cigarette smoking substantially alters the plasma miRNA profile, interfering with the diagnosis of disease or signaling potential smoking-related diseases. - Highlights: • Plasma miRNA profiles were unambiguously different between smokers and non-smokers. • Smoking status might interfere with the diagnosis of disease using plasma miRNAs. • Changes of plasma miRNA profiles may be a signal of smoking-related diseases.« less

RNA Interference: Biology, Mechanism, and Applications

PubMed Central

Agrawal, Neema; Dasaradhi, P. V. N.; Mohmmed, Asif; Malhotra, Pawan; Bhatnagar, Raj K.; Mukherjee, Sunil K.

2003-01-01

Double-stranded RNA-mediated interference (RNAi) is a simple and rapid method of silencing gene expression in a range of organisms. The silencing of a gene is a consequence of degradation of RNA into short RNAs that activate ribonucleases to target homologous mRNA. The resulting phenotypes either are identical to those of genetic null mutants or resemble an allelic series of mutants. Specific gene silencing has been shown to be related to two ancient processes, cosuppression in plants and quelling in fungi, and has also been associated with regulatory processes such as transposon silencing, antiviral defense mechanisms, gene regulation, and chromosomal modification. Extensive genetic and biochemical analysis revealed a two-step mechanism of RNAi-induced gene silencing. The first step involves degradation of dsRNA into small interfering RNAs (siRNAs), 21 to 25 nucleotides long, by an RNase III-like activity. In the second step, the siRNAs join an RNase complex, RISC (RNA-induced silencing complex), which acts on the cognate mRNA and degrades it. Several key components such as Dicer, RNA-dependent RNA polymerase, helicases, and dsRNA endonucleases have been identified in different organisms for their roles in RNAi. Some of these components also control the development of many organisms by processing many noncoding RNAs, called micro-RNAs. The biogenesis and function of micro-RNAs resemble RNAi activities to a large extent. Recent studies indicate that in the context of RNAi, the genome also undergoes alterations in the form of DNA methylation, heterochromatin formation, and programmed DNA elimination. As a result of these changes, the silencing effect of gene functions is exercised as tightly as possible. Because of its exquisite specificity and efficiency, RNAi is being considered as an important tool not only for functional genomics, but also for gene-specific therapeutic activities that target the mRNAs of disease-related genes. PMID:14665679

Silencing of P2X7R by RNA interference in the hippocampus can attenuate morphological and behavioral impact of pilocarpine-induced epilepsy.

PubMed

Amorim, Rebeca Padrão; Araújo, Michelle Gasparetti Leão; Valero, Jorge; Lopes-Cendes, Iscia; Pascoal, Vinicius Davila Bitencourt; Malva, João Oliveira; da Silva Fernandes, Maria José

2017-12-01

Cell signaling mediated by P2X7 receptors (P2X7R) has been suggested to be involved in epileptogenesis, via modulation of intracellular calcium levels, excitotoxicity, activation of inflammatory cascades, and cell death, among other mechanisms. These processes have been described to be involved in pilocarpine-induced status epilepticus (SE) and contribute to hyperexcitability, resulting in spontaneous and recurrent seizures. Here, we aimed to investigate the role of P2X7R in epileptogenesis in vivo using RNA interference (RNAi) to inhibit the expression of this receptor. Small interfering RNA (siRNA) targeting P2X7R mRNA was injected into the lateral ventricles (icv) 6 h after SE. Four groups were studied: Saline-Vehicle, Saline-siRNA, Pilo-Vehicle, and Pilo-siRNA. P2X7R was quantified by western blotting and neuronal death assessed by Fluoro-Jade B histochemistry. The hippocampal volume (edema) was determined 48 h following RNAi. Behavioral parameters as latency to the appearance of spontaneous seizures and the number of seizures were determined until 60 days after the SE onset. The Saline-siRNA and Pilo-siRNA groups showed a 43 and 37% reduction, respectively, in P2X7R protein levels compared to respective vehicle groups. Neuroprotection was observed in CA1 and CA3 of the Pilo-siRNA group compared to Pilo-Vehicle. P2X7R silencing in pilocarpine group reversed the increase in the edema detected in the hilus, suprapyramidal dentate gyrus, CA1, and CA3; reduced mortality rate following SE; increased the time to onset of spontaneous seizure; and reduced the number of seizures, when compared to the Pilo-Vehicle group. Therefore, our data highlights the potential of P2X7R as a therapeutic target for the adjunct treatment of epilepsy.

Chemical Approaches to Control Gene Expression

PubMed Central

Gottesfeld, Joel M.; Turner, James M.; Dervan, Peter B.

2000-01-01

A current goal in molecular medicine is the development of new strategies to interfere with gene expression in living cells in the hope that novel therapies for human disease will result from these efforts. This review focuses on small-molecule or chemical approaches to manipulate gene expression by modulating either transcription of messenger RNA-coding genes or protein translation. The molecules under study include natural products, designed ligands, and compounds identified through functional screens of combinatorial libraries. The cellular targets for these molecules include DNA, messenger RNA, and the protein components of the transcription, RNA processing, and translational machinery. Studies with model systems have shown promise in the inhibition of both cellular and viral gene transcription and mRNA utilization. Moreover, strategies for both repression and activation of gene transcription have been described. These studies offer promise for treatment of diseases of pathogenic (viral, bacterial, etc.) and cellular origin (cancer, genetic diseases, etc.). PMID:11097426

Altered minor-groove hydrogen bonds in DNA block transcription elongation by T7 RNA polymerase.

PubMed

Tanasova, Marina; Goeldi, Silvan; Meyer, Fabian; Hanawalt, Philip C; Spivak, Graciela; Sturla, Shana J

2015-05-26

DNA transcription depends upon the highly efficient and selective function of RNA polymerases (RNAPs). Modifications in the template DNA can impact the progression of RNA synthesis, and a number of DNA adducts, as well as abasic sites, arrest or stall transcription. Nonetheless, data are needed to understand why certain modifications to the structure of DNA bases stall RNA polymerases while others are efficiently bypassed. In this study, we evaluate the impact that alterations in dNTP/rNTP base-pair geometry have on transcription. T7 RNA polymerase was used to study transcription over modified purines and pyrimidines with altered H-bonding capacities. The results suggest that introducing wobble base-pairs into the DNA:RNA heteroduplex interferes with transcriptional elongation and stalls RNA polymerase. However, transcriptional stalling is not observed if mismatched base-pairs do not H-bond. Together, these studies show that RNAP is able to discriminate mismatches resulting in wobble base-pairs, and suggest that, in cases of modifications with minor steric impact, DNA:RNA heteroduplex geometry could serve as a controlling factor for initiating transcription-coupled DNA repair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Design of siRNA Therapeutics from the Molecular Scale

PubMed Central

Angart, Phillip; Vocelle, Daniel; Chan, Christina; Walton, S. Patrick

2013-01-01

While protein-based therapeutics is well-established in the market, development of nucleic acid therapeutics has lagged. Short interfering RNAs (siRNAs) represent an exciting new direction for the pharmaceutical industry. These small, chemically synthesized RNAs can knock down the expression of target genes through the use of a native eukaryotic pathway called RNA interference (RNAi). Though siRNAs are routinely used in research studies of eukaryotic biological processes, transitioning the technology to the clinic has proven challenging. Early efforts to design an siRNA therapeutic have demonstrated the difficulties in generating a highly-active siRNA with good specificity and a delivery vehicle that can protect the siRNA as it is transported to a specific tissue. In this review article, we discuss design considerations for siRNA therapeutics, identifying criteria for choosing therapeutic targets, producing highly-active siRNA sequences, and designing an optimized delivery vehicle. Taken together, these design considerations provide logical guidelines for generating novel siRNA therapeutics. PMID:23976875

Antiviral effect of PmRab7 knock-down on inhibition of Laem-Singh virus replication in black tiger shrimp.

PubMed

Ongvarrasopone, Chalermporn; Chomchay, Ekapol; Panyim, Sakol

2010-10-01

PmRab7 is a Penaeus monodon small GTPase protein possibly involved in replication of several shrimp viruses. In this study RNA interference (RNAi) using double-stranded RNA (dsRNA) targeting PmRab7 gene (dsRNA-PmRab7) was employed to silence the expression of PmRab7 to investigate the inhibitory effect on Laem-Singh virus (LSNV) replication. Injection of dsRNA-PmRab7 24h before challenge with the virus resulted in a drastic decrease of PmRab7 mRNA and complete inhibition of LSNV replication at 3 days post-challenge. In a therapeutic mode, shrimp injected with dsRNA-PmRab7 1 day but not at 3 or 5 days post-LSNV challenge resulted in inhibition of LSNV replication. These results pave the way to use dsRNA-PmRab7 to prevent or cure LSNV infection in shrimp. Copyright © 2010 Elsevier B.V. All rights reserved.

Transfer and functional consequences of dietary microRNAs in vertebrates: Concepts in search of corroboration Negative results challenge the hypothesis that dietary xenomiRs cross the gut and regulate genes ...

USDA-ARS?s Scientific Manuscript database

If validated, diet-derived foreign microRNA absorption and function in consuming vertebrates would drastically alter our understanding of nutrition and ecology. RNA interference (RNAi) mechanisms of Caenorhabditis elegans are enhanced by uptake of environmental RNA and amplification and systemic dis...

Cas5d Protein Processes Pre-crRNA and Assembles into a Cascade-like Interference Complex in Subtype I-C/Dvulg CRISPR-Cas System

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nam, Ki Hyun; Haitjema, Charles; Liu, Xueqi

Clustered regularly interspaced short palindromic repeats (CRISPRs), together with an operon of CRISPR-associated (Cas) proteins, form an RNA-based prokaryotic immune system against exogenous genetic elements. Cas5 family proteins are found in several type I CRISPR-Cas systems. Here, we report the molecular function of subtype I-C/Dvulg Cas5d from Bacillus halodurans. We show that Cas5d cleaves pre-crRNA into unit length by recognizing both the hairpin structure and the 3 single stranded sequence in the CRISPR repeat region. Cas5d structure reveals a ferredoxin domain-based architecture and a catalytic triad formed by Y46, K116, and H117 residues. We further show that after pre-crRNA processing,more » Cas5d assembles with crRNA, Csd1, and Csd2 proteins to form a multi-sub-unit interference complex similar to Escherichia coli Cascade (CRISPR-associated complex for antiviral defense) in architecture. Our results suggest that formation of a crRNA-presenting Cascade-like complex is likely a common theme among type I CRISPR subtypes.« less

Pulmonary Delivery of siRNA via Polymeric Vectors as Therapies of Asthma.

PubMed

Xie, Yuran; Merkel, Olivia M

2015-10-01

Asthma is a chronic inflammatory disease. Despite the fact that current therapies, such as the combination of inhaled corticosteroids and β2-agonists, can control the symptoms of asthma in most patients, there is still an urgent need for an alternative anti-inflammatory therapy for patients who suffer from severe asthma but lack acceptable response to conventional therapies. Many molecular factors are involved in the inflammatory process in asthma, and thus blocking the function of these factors could efficiently alleviate airway inflammation. RNA interference (RNAi) is often thought to be the answer in the search for more efficient and biocompatible treatments. However, difficulties of efficient delivery of small interference RNA (siRNA), the key factor in RNAi, to target cells and tissues have limited its clinical application. In this review, we summarize cytokines and chemokines, transcription factors, tyrosine kinases, and costimulatory factors that have been reported as targets of siRNA-mediated treatment in experimental asthma. Additionally, we conclude several targeted delivery systems of siRNA to specific cells such as T cells, macrophages, and dendritic cells, which could potentially be applied in asthma therapy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The HIV Nef protein modulates cellular and exosomal miRNA profiles in human monocytic cells.

PubMed

Aqil, Madeeha; Naqvi, Afsar Raza; Mallik, Saurav; Bandyopadhyay, Sanghamitra; Maulik, Ujjwal; Jameel, Shahid

2014-01-01

The HIV Nef protein is a multifunctional virulence factor that perturbs intracellular membranes and signalling and is secreted into exosomes. While Nef-containing exosomes have a distinct proteomic profile, no comprehensive analysis of their miRNA cargo has been carried out. Since Nef functions as a viral suppressor of RNA interference and disturbs the distribution of RNA-induced silencing complex proteins between cells and exosomes, we hypothesized that it might also affect the export of miRNAs into exosomes. Exosomes were purified from human monocytic U937 cells that stably expressed HIV-1 Nef. The RNA from cells and exosomes was profiled for 667 miRNAs using a Taqman Low Density Array. Selected miRNAs and their mRNA targets were validated by quantitative RT-PCR. Bioinformatics analyses were used to identify targets and predict pathways. Nef expression affected a significant fraction of miRNAs in U937 cells. Our analysis showed 47 miRNAs to be selectively secreted into Nef exosomes and 2 miRNAs to be selectively retained in Nef-expressing cells. The exosomal miRNAs were predicted to target several cellular genes in inflammatory cytokine and other pathways important for HIV pathogenesis, and an overwhelming majority had targets within the HIV genome. This is the first study to report miRnome analysis of HIV Nef expressing monocytes and exosomes. Our results demonstrate that Nef causes large-scale dysregulation of cellular miRNAs, including their secretion through exosomes. We suggest this to be a novel viral strategy to affect pathogenesis and to limit the effects of RNA interference on viral replication and persistence.

Lentiviral vectors encoding shRNAs efficiently transduce and knockdown LINGO-1 but induce an interferon response and cytotoxicity in CNS neurons

PubMed Central

Hutson, Thomas H.; Foster, Edmund; Dawes, John M.; Hindges, Robert; Yáñez-Muñoz, Rafael J.; Moon, Lawrence D.F.

2017-01-01

Background Knocking down neuronal LINGO-1 using short hairpin RNAs (shRNAs) might enhance axon regeneration in the CNS. Integration-deficient lentiviral vectors have great potential as a therapeutic delivery system for CNS injuries. However, recent studies have revealed that shRNAs can induce an interferon response resulting in off-target effects and cytotoxicity. Methods CNS neurons were transduced with integration-deficient lentiviral vectors in vitro. The transcriptional effect of shRNA expression was analysed using qRT-PCR and northern blots were used to assess shRNA production. Results Integration-deficient lentiviral vectors efficiently transduced CNS neurons and knocked down LINGO-1 mRNA in vitro. However, an increase in cell death was observed when lentiviral vectors encoding an shRNA were applied or when high vector concentrations were used. We demonstrate that high doses of vector or the use of vectors encoding shRNAs can induce an up-regulation of interferon stimulated genes (OAS1 and PKR) and a down-regulation of off- target genes (including p75NTR and NgR1). Furthermore, the northern blot demonstrated that these negative consequences occur even when lentiviral vectors express low levels of shRNAs. Together, these results may explain why neurite outgrowth was not enhanced on an inhibitory substrate after transduction with lentiviral vectors encoding an shRNA targeting LINGO-1. Conclusions These findings highlight the importance of including appropriate controls to verify silencing specificity and the requirement to check for an interferon response when conducting RNA interference experiments. However, the potential benefits that RNA interference and viral vectors offer to gene-based therapies to CNS injuries cannot be overlooked and demand further investigation. PMID:22499506

[Lentivirus-mediated RNA interference of CD133 inhibits the proliferation of CD133(+) liver cancer stem cells and increases their cisplatin chemosensitivity].

PubMed

Lan, Xi; Wang, Yong; Cao, Shu; Zou, Dongling; Li, Fang; Li, Shaolin

2012-12-01

To study the effects of CD133 suppression by lentivirus-mediated RNA interference (RNAi) on the proliferation and chemosensitivity of CD133(+) cancer stem cells (CSCs) sorted from HepG2 cell line. CD133(+) and CD133- cells were sorted from HepG2 cell line by flow cytometry, and the expression of CD133 before and after cell sorting were detected. The stem cell property of sorted CD133(+) cells were validated by sphere-forming assay in vitro and xenograft experiments in vivo. Lentivirus-mediated short hairpin RNA (shRNA) targeting CD133 were transfected into CD133(+) cells, and CD133 mRNA and protein expressions of the transfected cells were detected by RT-PCR and Western blotting, respectively. Before and after the transfection, the proliferative ability of CD133(+) cells was evaluated by colony formation assay, and the cell growth inhibition rate and apoptosis following cisplatin exposure were detected using CCK-8 assay and flow cytometry. The sorted CD133(+) cells showed a high purity of (88.74∓3.19)%, as compared with the purity of (3.36∓1.80)% before cell sorting. CD133(+) cells showed a high tumor sphere formation ability and tumorigenesis capacity compared with CD133- cells. CD133 shRNA transfection significantly inhibited CD133 mRNA and protein expressions in CD133(+) cells (P<0.01), resulting also in a significantly lowered cell proliferative ability (P<0.01) and an increased growth inhibition rate (P<0.01) and obviously increased cell apoptosis (P<0.05) after cisplatin exposure. Lentivirus-mediated RNAi for CD133 suppression inhibits the proliferation of CD133(+) liver cancer stem cells and increases their chemosensitivity to cisplatin.

RNA interference inhibits herpes simplex virus type 1 isolated from saliva samples and mucocutaneous lesions.

PubMed

Silva, Amanda Perse da; Lopes, Juliana Freitas; Paula, Vanessa Salete de

2014-01-01

The aim of this study was to evaluate the use of RNA interference to inhibit herpes simplex virus type-1 replication in vitro. For herpes simplex virus type-1 gene silencing, three different small interfering RNAs (siRNAs) targeting the herpes simplex virus type-1 UL39 gene (sequence si-UL 39-1, si-UL 39-2, and si-UL 39-3) were used, which encode the large subunit of ribonucleotide reductase, an essential enzyme for DNA synthesis. Herpes simplex virus type-1 was isolated from saliva samples and mucocutaneous lesions from infected patients. All mucocutaneous lesions' samples were positive for herpes simplex virus type-1 by real-time PCR and by virus isolation; all herpes simplex virus type-1 from saliva samples were positive by real-time PCR and 50% were positive by virus isolation. The levels of herpes simplex virus type-1 DNA remaining after siRNA treatment were assessed by real-time PCR, whose results demonstrated that the effect of siRNAs on gene expression depends on siRNA concentration. The three siRNA sequences used were able to inhibit viral replication, assessed by real-time PCR and plaque assays and among them, the sequence si-UL 39-1 was the most effective. This sequence inhibited 99% of herpes simplex virus type-1 replication. The results demonstrate that silencing herpes simplex virus type-1 UL39 expression by siRNAs effectively inhibits herpes simplex virus type-1 replication, suggesting that siRNA based antiviral strategy may be a potential therapeutic alternative. Copyright © 2014. Published by Elsevier Editora Ltda.

Inhibition of West Nile Virus replication by retrovirus-delivered small interfering RNA in human neuroblastoma cells.

PubMed

Yang, Yongbo; Wu, Chengxiang; Wu, Jianguo; Nerurkar, Vivek R; Yanagihara, Richard; Lu, Yuanan

2008-05-01

West Nile virus (WNV) has been responsible for the largest outbreaks of arboviral encephalitis in U.S. history. No specific drug is currently available for the effective treatment of WNV infection. To exploit RNA interference as a potential therapeutic approach, a Moloney murine leukemia virus-based retrovirus vector was used to effectively deliver WNV-specific small interfering RNA (siRNA) into human neuroblastoma HTB-11 cells. Viral plaque assays demonstrated that transduced cells were significantly refractory to WNV replication, as compared to untransduced control cells (P < 0.05), which correlated with the reduced expression of target viral genes and respective viral proteins. Therefore, retrovirus-mediated delivery of siRNA for gene silencing can be used to study the specific functions of viral genes associated with replication and may have potential therapeutic applications.

RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans

PubMed Central

Tops, Bastiaan B. J.; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C.; Plasterk, Ronald H. A.; Ketting, René F.

2005-01-01

In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of ∼250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step. PMID:15653635

Molecular requirements for RNA-induced silencing complex assembly in the Drosophila RNA interference pathway.

PubMed

Pham, John W; Sontheimer, Erik J

2005-11-25

Complexes in the Drosophila RNA-induced silencing complex (RISC) assembly pathway can be resolved using native gel electrophoresis, revealing an initiator called R1, an intermediate called R2, and an effector called R3 (now referred to as holo-RISC). Here we show that R1 forms when the Dicer-2/R2D2 heterodimer binds short interfering RNA (siRNA) duplexes. The heterodimer alone can initiate RISC assembly, indicating that other factors are dispensable for initiation. During assembly, R2 requires Argonaute 2 to convert into holo-RISC. This requirement is reminiscent of the RISC-loading complex, which also requires Argonaute 2 for assembly into RISC. We have compared R2 to the RISC-loading complex and show that the two complexes are similar in their sensitivities to ATP and to chemical modifications on siRNA duplexes, indicating that they are likely to be identical. We have examined the requirements for RISC formation and show that the siRNA 5'-termini are repeatedly monitored during RISC assembly, first by the Dcr-2/R2D2 heterodimer and again after R2 formation, before siRNA unwinding. The 2'-position of the 5'-terminal nucleotide also affects RISC assembly, because an siRNA strand bearing a 2'-deoxyribose at this position can inhibit the cognate strand from entering holo-RISC; in contrast, the 2'-deoxyribose-modified strand has enhanced activity in the RNA interference pathway.

Suppression of polygalacturonase gene expression in the phytopathogenic fungus Ophiostoma novo-ulmi by RNA interference.

PubMed

Carneiro, Joyce S; de la Bastide, Paul Y; Chabot, Meghan; Lerch, Lindsey; Hintz, William E

2010-05-01

The fungal pathogen, Ophiostomo novo-ulmi, has been responsible for the rapid decline of American elm (Ulmus americana) across North America and remains a serious threat to surviving elm populations. The production of pectinolytic polygalacturonase enzymes has been implicated as a virulence factor for many fungal pathogens, including O. novo-ulmi. Previous work has shown that the targeted disruption of the endopolygalacturonase gene locus epg1 of O. novo-ulmi reduced, but did not eliminate pectinase activity. In the present study, we evaluated the use of RNA interference (RNAi) as a method of suppressing expression of the epg1 locus in O. novo-ulmi and compared its efficiency to the gene disruption method. While there was a reduction in epg1-specific mRNA transcripts and in the amount of polygalacturonase enzyme secreted for both methods of gene regulation, neither method completely suppressed the expression of pectinase activity. There was, however, a significantly greater reduction in both transcript levels and secreted enzyme observed for some of the RNAi transformants. As the first demonstration of RNAi in O. novo-ulmi, this method of gene regulation shows promise in future studies of gene expression and pathogenicity. Copyright 2010 Elsevier Inc. All rights reserved.

Role of RNA interference (RNAi) in the Moss Physcomitrella patens.

PubMed

Arif, Muhammad Asif; Frank, Wolfgang; Khraiwesh, Basel

2013-01-14

RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species.

RNA extraction from self-assembling peptide hydrogels to allow qPCR analysis of encapsulated cells.

PubMed

Burgess, Kyle A; Workman, Victoria L; Elsawy, Mohamed A; Miller, Aline F; Oceandy, Delvac; Saiani, Alberto

2018-01-01

Self-assembling peptide hydrogels offer a novel 3-dimensional platform for many applications in cell culture and tissue engineering but are not compatible with current methods of RNA isolation; owing to interactions between RNA and the biomaterial. This study investigates the use of two techniques based on two different basic extraction principles: solution-based extraction and direct solid-state binding of RNA respectively, to extract RNA from cells encapsulated in four β-sheet forming self-assembling peptide hydrogels with varying net positive charge. RNA-peptide fibril interactions, rather than RNA-peptide molecular complexing, were found to interfere with the extraction process resulting in low yields. A column-based approach relying on RNA-specific binding was shown to be more suited to extracting RNA with higher purity from these peptide hydrogels owing to its reliance on strong specific RNA binding interactions which compete directly with RNA-peptide fibril interactions. In order to reduce the amount of fibrils present and improve RNA yields a broad spectrum enzyme solution-pronase-was used to partially digest the hydrogels before RNA extraction. This pre-treatment was shown to significantly increase the yield of RNA extracted, allowing downstream RT-qPCR to be performed.

New insights into siRNA amplification and RNAi

PubMed Central

Zhang, Chi; Ruvkun, Gary

2012-01-01

In the nematode Caenorhabditis elegans (C. elegans), gene inactivation by RNA interference can achieve remarkable potency due to the amplification of initial silencing triggers by RNA-dependent RNA polymerases (RdRPs). RdRPs catalyze the biogenesis of an abundant species of secondary small interfering RNAs (siRNAs) using the target mRNA as template. The interaction between primary siRNAs derived from the exogenous double-stranded RNA (dsRNA) trigger and the target mRNA is required for the recruitment of RdRPs. Other genetic requirements for RdRP activities have not been characterized. Recent studies have identified the RDE-10/RDE-11 complex which interacts with the primary siRNA bound target mRNA and acts upstream of the RdRPs. rde-10 and rde-11 mutants show an RNAi defective phenotype because the biogenesis of secondary siRNAs is completely abolished. In addition, the RDE-10/RDE-11 complex plays a similar role in the endogenous RNAi pathway for the biogenesis of a subset of siRNAs targeting recently acquired, duplicated genes. PMID:22858672

Molecular imaging of RNA interference therapy targeting PHD2 for treatment of myocardial ischemia.

PubMed

Huang, Mei; Wu, Joseph C

2011-01-01

Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments.

Molecular Imaging of RNA Interference Therapy Targeting PHD2 for Treatment of Myocardial Ischemia

PubMed Central

Huang, Mei; Wu, Joseph C.

2011-01-01

Summary Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments. PMID:21194030

Interference activity of a minimal Type I CRISPR–Cas system from Shewanella putrefaciens

PubMed Central

Dwarakanath, Srivatsa; Brenzinger, Susanne; Gleditzsch, Daniel; Plagens, André; Klingl, Andreas; Thormann, Kai; Randau, Lennart

2015-01-01

Type I CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)–Cas (CRISPR-associated) systems exist in bacterial and archaeal organisms and provide immunity against foreign DNA. The Cas protein content of the DNA interference complexes (termed Cascade) varies between different CRISPR-Cas subtypes. A minimal variant of the Type I-F system was identified in proteobacterial species including Shewanella putrefaciens CN-32. This variant lacks a large subunit (Csy1), Csy2 and Csy3 and contains two unclassified cas genes. The genome of S. putrefaciens CN-32 contains only five Cas proteins (Cas1, Cas3, Cas6f, Cas1821 and Cas1822) and a single CRISPR array with 81 spacers. RNA-Seq analyses revealed the transcription of this array and the maturation of crRNAs (CRISPR RNAs). Interference assays based on plasmid conjugation demonstrated that this CRISPR-Cas system is active in vivo and that activity is dependent on the recognition of the dinucleotide GG PAM (Protospacer Adjacent Motif) sequence and crRNA abundance. The deletion of cas1821 and cas1822 reduced the cellular crRNA pool. Recombinant Cas1821 was shown to form helical filaments bound to RNA molecules, which suggests its role as the Cascade backbone protein. A Cascade complex was isolated which contained multiple Cas1821 copies, Cas1822, Cas6f and mature crRNAs. PMID:26350210

RNA interference of effector gene 16D10 leads to broad meloidogyne resistance in potato

USDA-ARS?s Scientific Manuscript database

Root-knot nematodes (Meloidogyne spp.) are a significant problem in potato (Solanum tuberosum) production. There is no known Meloidogyne resistance gene in cultivated potato, even though sources of resistance were identified in wild potato species. The objective of this study was to generate stable ...

Genomics of peanut leaf-spot pathogens; and RNA-interference-mediated control of aflatoxins

USDA-ARS?s Scientific Manuscript database

An overview update of the research done at USDA-ARS National Peanut Research Laboratory will be presented: including: the release of the Cercospora arachidicola genome, sequencing of Cercosporidium personatum, a workflow to study genetic diversity of aflatoxigenic Aspergillus, and progress on the us...

Enhancing the cellular uptake of siRNA duplexes following noncovalent packaging with protein transduction domain peptides.

PubMed

Meade, Bryan R; Dowdy, Steven F

2008-03-01

The major limitation in utilizing information rich macromolecules for basic science and therapeutic applications is the inability of these large molecules to readily diffuse across the cellular membrane. While this restriction represents an efficient defense system against cellular penetration of unwanted foreign molecules and thus a crucial component of cell survival, overcoming this cellular characteristic for the intracellular delivery of macromolecules has been the focus of a large number of research groups worldwide. Recently, with the discovery of RNA interference, many of these groups have redirected their attention and have applied previously characterized cell delivery methodologies to synthetic short interfering RNA duplexes (siRNA). Protein transduction domain and cell penetrating peptides have been shown to enhance the delivery of multiple types of macromolecular cargo including peptides, proteins and antisense oligonucleotides and are now being utilized to enhance the cellular uptake of siRNA molecules. The dense cationic charge of these peptides that is critical for interaction with cell membrane components prior to internalization has also been shown to readily package siRNA molecules into stable nanoparticles that are capable of traversing the cell membrane. This review discusses the recent advances in noncovalent packaging of siRNA molecules with cationic peptides and the potential for the resulting complexes to successfully induce RNA interference within both in vitro and in vivo settings.

Markov State Models Reveal a Two-Step Mechanism of miRNA Loading into the Human Argonaute Protein: Selective Binding followed by Structural Re-arrangement.

PubMed

Jiang, Hanlun; Sheong, Fu Kit; Zhu, Lizhe; Gao, Xin; Bernauer, Julie; Huang, Xuhui

2015-07-01

Argonaute (Ago) proteins and microRNAs (miRNAs) are central components in RNA interference, which is a key cellular mechanism for sequence-specific gene silencing. Despite intensive studies, molecular mechanisms of how Ago recognizes miRNA remain largely elusive. In this study, we propose a two-step mechanism for this molecular recognition: selective binding followed by structural re-arrangement. Our model is based on the results of a combination of Markov State Models (MSMs), large-scale protein-RNA docking, and molecular dynamics (MD) simulations. Using MSMs, we identify an open state of apo human Ago-2 in fast equilibrium with partially open and closed states. Conformations in this open state are distinguished by their largely exposed binding grooves that can geometrically accommodate miRNA as indicated in our protein-RNA docking studies. miRNA may then selectively bind to these open conformations. Upon the initial binding, the complex may perform further structural re-arrangement as shown in our MD simulations and eventually reach the stable binary complex structure. Our results provide novel insights in Ago-miRNA recognition mechanisms and our methodology holds great potential to be widely applied in the studies of other important molecular recognition systems.

A Significant Increase of RNAi Efficiency in Human Cells by the CMV Enhancer with a tRNAlys Promoter

PubMed Central

Weiwei, Ma; Zhenhua, Xie; Feng, Liu; Hang, Ning; Yuyang, Jiang

2009-01-01

RNA interference (RNAi) is the process of mRNA degradation induced by double-stranded RNA in a sequence-specific manner. Different types of promoters, such as U6, H1, tRNA, and CMV, have been used to control the inhibitory effect of RNAi expression vectors. In the present study, we constructed two shRNA expression vectors, respectively, controlled by tRNAlys and CMV enhancer-tRNAlys promoters. Compared to the vectors with tRNAlys or U6 promoter, the vector with a CMV enhancer-tRNAlys promoter silenced pokemon more efficiently on both the mRNA and the protein levels. Meanwhile, the silencing of pokemon inhibited the proliferation of MCF7 cells, but the induction of apoptosis of MCF7 cells was not observed. We conclude that the CMV enhancer-tRNAlys promoter may be a powerful tool in driving intracellular expression of shRNA which can efficiently silence targeted gene. PMID:19859553

RNA interference: learning gene knock-down from cell physiology

PubMed Central

Mocellin, Simone; Provenzano, Maurizio

2004-01-01

Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080

RNA interference-mediated silencing of genes involved in the immune responses of the soybean pod borer Leguminivora glycinivorella (Lepidoptera: Olethreutidae).

PubMed

Ran, Ruixue; Li, Tianyu; Liu, Xinxin; Ni, Hejia; Li, Wenbin; Meng, Fanli

2018-01-01

RNA interference (RNAi) technology may be useful for developing new crop protection strategies against the soybean pod borer (SPB; Leguminivora glycinivorella ), which is a critical soybean pest in northeastern Asia. Immune-related genes have been recently identified as potential RNAi targets for controlling insects. However, little is known about these genes or mechanisms underlying their expression in the SPB. In this study, we completed a transcriptome-wide analysis of SPB immune-related genes. We identified 41 genes associated with SPB microbial recognition proteins, immune-related effectors or signalling molecules in immune response pathways (e.g., Toll and immune deficiency pathways). Eleven of these genes were selected for a double-stranded RNA artificial feeding assay. The down-regulated expression levels of LgToll-5-1a and LgPGRP-LB2a resulted in relatively high larval mortality rates and abnormal development. Our data represent a comprehensive genetic resource for immune-related SPB genes, and may contribute to the elucidation of the mechanism regulating innate immunity in Lepidoptera species. Furthermore, two immune-related SPB genes were identified as potential RNAi targets, which may be used in the development of RNAi-mediated SPB control methods.

RNA interference-mediated silencing of genes involved in the immune responses of the soybean pod borer Leguminivora glycinivorella (Lepidoptera: Olethreutidae)

PubMed Central

Ran, Ruixue; Li, Tianyu; Liu, Xinxin; Ni, Hejia; Li, Wenbin

2018-01-01

RNA interference (RNAi) technology may be useful for developing new crop protection strategies against the soybean pod borer (SPB; Leguminivora glycinivorella), which is a critical soybean pest in northeastern Asia. Immune-related genes have been recently identified as potential RNAi targets for controlling insects. However, little is known about these genes or mechanisms underlying their expression in the SPB. In this study, we completed a transcriptome-wide analysis of SPB immune-related genes. We identified 41 genes associated with SPB microbial recognition proteins, immune-related effectors or signalling molecules in immune response pathways (e.g., Toll and immune deficiency pathways). Eleven of these genes were selected for a double-stranded RNA artificial feeding assay. The down-regulated expression levels of LgToll-5-1a and LgPGRP-LB2a resulted in relatively high larval mortality rates and abnormal development. Our data represent a comprehensive genetic resource for immune-related SPB genes, and may contribute to the elucidation of the mechanism regulating innate immunity in Lepidoptera species. Furthermore, two immune-related SPB genes were identified as potential RNAi targets, which may be used in the development of RNAi-mediated SPB control methods. PMID:29910977

Engineering host-derived resistance against plant parasites through RNA interference: challenges and opportunities.

PubMed

Runo, Steven

2011-01-01

RNA interference (RNAi) has rapidly advanced to become a powerful genetic tool and holds promise to revolutionizing agriculture by providing a strategy for controlling a wide array of crop pests. Numerous studies document RNAi efficacy in achieving silencing in viruses, insects, nematodes and weeds parasitizing crops. In general, host derived pest resistance through RNAi is achieved by genetically transforming host plants with double stranded RNA constructs targeted at essential parasite genes leading to generation of small interfering RNAs (siRNAs). Small interfering RNAs formed in the host are then delivered to the parasite and transported to target cells. Delivery can be oral - worms and insects, viral infections, viruses - or through a vascular connections - parasitic plants, while delivery to target cells is by cell to cell systemic movement of the silencing signal. Despite the overall optimism in generating pest resistant crops through RNAi-mediated silencing, some hurdles have recently begun to emerge. Presently, the main challenge is delivery of sufficient siRNAs, in the right cells, and at the right time to mount; a strong, durable, and broad-spectrum posttranscriptional gene silencing (PTGS) signal. This review highlights the novel strategies available for improving host derived RNAi resistance in downstream applied agriculture.

In-silico analysis for RNA-interference mechanism of α-synuclein to treat Parkinson's disease.

PubMed

Seema, S; Seenivasagam, R; Hemavathi, K

2013-01-01

Parkinson's Disease (PD) causing mutations in α-synuclein gene are ALA30PRO, GLU46LYS and ALA53THR. The conformational changes in proteins with respect to all the three mutations were analysed. These were used to predict the structures of Short Interfering RNA (siRNA) antisense strand and siRNA region. The siRNA binds with the argonaute protein forming RNA Induced Silencing Complex (RISC). Then, siRNA antisense-strand was attached to RISC. The structure of dicer (RNase-III-enzyme) cleaves double-stranded RNA (dsRNA) into two siRNA-strands. Incorporation of single siRNA-strand into RISC guides to pair with the complementary α-synuclein target-messenger RNA (mRNA) thereby enabling it to cleave the target.

Circular RNA participates in the carcinogenesis and the malignant behavior of cancer.

PubMed

Zhao, Zhen-Jun; Shen, Jun

2017-05-04

Circular RNAs (circRNAs) are long, non-coding RNAs that result from the non-canonical splicing of linear pre-mRNAs. However, the characteristics and the critical role of circRNA in co-/post-transcriptional regulation were not well recognized until the "microRNA sponge" function of circRNA is discovered. Recent studies have mainly been devoted to the function of the circular RNA sponge for miR-7 (ciRS-7) and sex-determining region Y (SRY) by targeting microRNA-7 (miR-7) and microRNA-138 (miR-138), respectively. In this review, we illustrate the specific role of circRNAs in a wide variety of cancers and in regulating the biological behavior of cancers via miR-7 or miR-138 regulation. Furthermore, circRNA, together with its gene silencing ability, also shows its potential in RNA interference (RNAi) therapy by binding to target RNAs, which provides a novel perspective in cancer treatment. Thus, this review concerns the biogenesis, biological function, oncogenesis, progression and possible therapies for cancer involving circRNAs.

Circular RNA participates in the carcinogenesis and the malignant behavior of cancer

PubMed Central

Zhao, Zhen-Jun; Shen, Jun

2017-01-01

Abstract Circular RNAs (circRNAs) are long, non-coding RNAs that result from the non-canonical splicing of linear pre-mRNAs. However, the characteristics and the critical role of circRNA in co-/post-transcriptional regulation were not well recognized until the “microRNA sponge” function of circRNA is discovered. Recent studies have mainly been devoted to the function of the circular RNA sponge for miR-7 (ciRS-7) and sex-determining region Y (SRY) by targeting microRNA-7 (miR-7) and microRNA-138 (miR-138), respectively. In this review, we illustrate the specific role of circRNAs in a wide variety of cancers and in regulating the biological behavior of cancers via miR-7 or miR-138 regulation. Furthermore, circRNA, together with its gene silencing ability, also shows its potential in RNA interference (RNAi) therapy by binding to target RNAs, which provides a novel perspective in cancer treatment. Thus, this review concerns the biogenesis, biological function, oncogenesis, progression and possible therapies for cancer involving circRNAs. PMID:26649774

Targeted Delivery of Small Interfering RNA Using Reconstituted High-Density Lipoprotein Nanoparticles12

PubMed Central

Shahzad, Mian MK; Mangala, Lingegowda S; Han, Hee Dong; Lu, Chunhua; Bottsford-Miller, Justin; Nishimura, Masato; Mora, Edna M; Lee, Jeong-Won; Stone, Rebecca L; Pecot, Chad V; Thanapprapasr, Duangmani; Roh, Ju-Won; Gaur, Puja; Nair, Maya P; Park, Yun-Yong; Sabnis, Nirupama; Deavers, Michael T; Lee, Ju-Seog; Ellis, Lee M; Lopez-Berestein, Gabriel; McConathy, Walter J; Prokai, Laszlo; Lacko, Andras G; Sood, Anil K

2011-01-01

RNA interference holds tremendous potential as a therapeutic approach, especially in the treatment of malignant tumors. However, efficient and biocompatible delivery methods are needed for systemic delivery of small interfering RNA (siRNA). To maintain a high level of growth, tumor cells scavenge high-density lipoprotein (HDL) particles by overexpressing its receptor: scavenger receptor type B1 (SR-B1). In this study, we exploited this cellular characteristic to achieve efficient siRNA delivery and established a novel formulation of siRNA by incorporating it into reconstituted HDL (rHDL) nanoparticles. Here, we demonstrate that rHDL nanoparticles facilitate highly efficient systemic delivery of siRNA in vivo, mediated by the SR-B1. Moreover, in therapeutic proof-of-concept studies, these nanoparticles were effective in silencing the expression of two proteins that are key to cancer growth and metastasis (signal transducer and activator of transcription 3 and focal adhesion kinase) in orthotopic mouse models of ovarian and colorectal cancer. These data indicate that an rHDL nanoparticle is a novel and highly efficient siRNA carrier, and therefore, this novel technology could serve as the foundation for new cancer therapeutic approaches. PMID:21472135

High-Throughput Characterization of Cascade type I-E CRISPR Guide Efficacy Reveals Unexpected PAM Diversity and Target Sequence Preferences.

PubMed

Fu, Becky Xu Hua; Wainberg, Michael; Kundaje, Anshul; Fire, Andrew Z

2017-08-01

Interactions between Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) RNAs and CRISPR-associated (Cas) proteins form an RNA-guided adaptive immune system in prokaryotes. The adaptive immune system utilizes segments of the genetic material of invasive foreign elements in the CRISPR locus. The loci are transcribed and processed to produce small CRISPR RNAs (crRNAs), with degradation of invading genetic material directed by a combination of complementarity between RNA and DNA and in some cases recognition of adjacent motifs called PAMs (Protospacer Adjacent Motifs). Here we describe a general, high-throughput procedure to test the efficacy of thousands of targets, applying this to the Escherichia coli type I-E Cascade (CRISPR-associated complex for antiviral defense) system. These studies were followed with reciprocal experiments in which the consequence of CRISPR activity was survival in the presence of a lytic phage. From the combined analysis of the Cascade system, we found that (i) type I-E Cascade PAM recognition is more expansive than previously reported, with at least 22 distinct PAMs, with many of the noncanonical PAMs having CRISPR-interference abilities similar to the canonical PAMs; (ii) PAM positioning appears precise, with no evidence for tolerance to PAM slippage in interference; and (iii) while increased guanine-cytosine (GC) content in the spacer is associated with higher CRISPR-interference efficiency, high GC content (>62.5%) decreases CRISPR-interference efficiency. Our findings provide a comprehensive functional profile of Cascade type I-E interference requirements and a method to assay spacer efficacy that can be applied to other CRISPR-Cas systems. Copyright © 2017 by the Genetics Society of America.

Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.

PubMed

Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu

2014-02-04

TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.

RNA interference targeting E637K mutation rescues hERG channel currents and restores its kinetic properties.

PubMed

Lu, Xiaoli; Yang, Xi; Huang, Xiaoyan; Huang, Chen; Sun, Huan Huan; Jin, Lihua; Xu, Weifeng; Mao, Haiyan; Guo, Junming; Zhou, Jianqing; Lian, Jiangfang

2013-01-01

Long QT syndrome (LQTS) is a monogenic proarrhythmic disorder that predisposes affected individuals to sudden death from tachyarrhythmia. As an inherited disease, LQTS cannot be completely cured by conventional treatment modalities. Individualized gene therapy is a promising therapeutic approach. The purpose of this study was to investigate the role of small interference RNA (siRNA) on expression of E637K-hERG (human ether-a-go-go-related gene) mutant and whether it can be used to rescue the mutant's dominant-negative suppressive effects on hERG protein channel function. Western blot was performed to select the most sensitive siRNAs to target E637K-hERG mutant knockdown. Confocal laser scanning microscope was performed to monitor cellular localization of wild-type (WT)-hERG and E637K-hERG with or without siRNA. Patch-clamp technique was used to assess the effect of siRNA on the electrophysiologic characteristics of the rapidly activating delayed rectifier K(+) current I(Kr) of the hERG protein channel. siRNA led to a significant decrease in the level of E637K-hERG protein but did not affect the level of WT-hERG protein. WT-hERG localization in cells coexpressing E637K-hERG mutant was restored to the membrane by siRNA. The siRNA-mediated inhibition of E637K-hERG mutant restored the maximum current and tail current amplitudes. Furthermore, siRNA treatment rescued the kinetic properties of WT/E637K-hERG protein channel to a level comparable to that of WT-hERG protein channel. Our findings illustrated that siRNA can effectively inhibit E637K-hERG protein expression and rescue the dominant-negative effect of this mutation by restoring the kinetic properties of hERG protein channel. It has potential clinical implications with regard to the possibility of using siRNA in the treatment of LQTS. Copyright © 2013 Heart Rhythm Society. All rights reserved.

Characterizing small RNA populations in non-transgenic and aflatoxin-reducing-transgenic peanut lines

USDA-ARS?s Scientific Manuscript database

Aflatoxin contamination is a major constraint in the food production worlwide. In peanut these aflatoxins are mainly produced by Aspergillus flavus (Link) and A. parasiticus (Speare). The use of RNA interference (RNAi) is a promising method to reduce or prevent the accumulation of aflatoxin in pean...

Ribosome-targeting antibiotics as inhibitors of oncogenic microRNAs biogenesis: Old scaffolds for new perspectives in RNA targeting.

PubMed

Tran, Thi Phuong Anh; Vo, Duc Duy; Di Giorgio, Audrey; Duca, Maria

2015-09-01

MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression at the post-transcriptional level. It is now well established that the overexpression of some miRNAs (oncogenic miRNAs) is responsible for initiation and progression of human cancers and the discovery of new molecules able to interfere with their production and/or function represents one of the most important challenges of current medicinal chemistry of RNA ligands. In this work, we studied the ability of 18 different antibiotics, known as prokaryotic ribosomal RNA, to bind to oncogenic miRNA precursors (stem-loop structured pre-miRNAs) in order to inhibit miRNAs production. In vitro inhibition, binding constants, thermodynamic parameters and binding sites were investigated and highlighted that aminoglycosides and tetracyclines represent interesting pre-miRNA ligands with the ability to inhibit Dicer processing. Copyright © 2015 Elsevier Ltd. All rights reserved.

Regulation of alternative splicing in Drosophila by 56 RNA binding proteins

DOE PAGES

Brooks, Angela N.; Duff, Michael O.; May, Gemma; ...

2015-08-20

Alternative splicing is regulated by RNA binding proteins (RBPs) that recognize pre-mRNA sequence elements and activate or repress adjacent exons. Here, we used RNA interference and RNA-seq to identify splicing events regulated by 56 Drosophila proteins, some previously unknown to regulate splicing. Nearly all proteins affected alternative first exons, suggesting that RBPs play important roles in first exon choice. Half of the splicing events were regulated by multiple proteins, demonstrating extensive combinatorial regulation. We observed that SR and hnRNP proteins tend to act coordinately with each other, not antagonistically. We also identified a cross-regulatory network where splicing regulators affected themore » splicing of pre-mRNAs encoding other splicing regulators. In conclusion, this large-scale study substantially enhances our understanding of recent models of splicing regulation and provides a resource of thousands of exons that are regulated by 56 diverse RBPs.« less

Conversion of pre-RISC to holo-RISC by Ago2 during assembly of RNAi complexes

PubMed Central

Kim, Kevin; Lee, Young Sik; Carthew, Richard W.

2007-01-01

In the Drosophila RNA interference (RNAi) pathway, small interfering RNAs (siRNAs) direct Argonaute2 (Ago2), an endonuclease, within the RNA-induced silencing complex (RISC) to cleave complementary mRNA targets. In vitro studies have shown that, for each siRNA duplex, RISC retains only one strand, the guide, and releases the other, the passenger, to form a holo-RISC complex. Here, we have isolated a new Ago2 mutant allele and provide, for the first time, in vivo evidence that endogenous Ago2 slicer activity is important to mount an RNAi response in Drosophila. We demonstrate in vivo that efficient removal of the passenger strand from RISC requires the cleavage activity of Ago2. We have also identified a new intermediate complex in the RISC assembly pathway, pre-RISC, in which Ago2 is stably bound to double-stranded siRNA. PMID:17123955

Proteomics for understanding miRNA biology

PubMed Central

Huang, Tai-Chung; Pinto, Sneha M.; Pandey, Akhilesh

2013-01-01

MicroRNAs (miRNAs) are small noncoding RNAs that play important roles in posttranscriptional regulation of gene expression. Mature miRNAs associate with the RNA interference silencing complex to repress mRNA translation and/or degrade mRNA transcripts. Mass spectrometry-based proteomics has enabled identification of several core components of the canonical miRNA processing pathway and their posttranslational modifications which are pivotal in miRNA regulatory mechanisms. The use of quantitative proteomic strategies has also emerged as a key technique for experimental identification of miRNA targets by allowing direct determination of proteins whose levels are altered because of translational suppression. This review focuses on the role of proteomics and labeling strategies to understand miRNA biology. PMID:23125164

Lack of WDR36 leads to preimplantation embryonic lethality in mice and delays the formation of small subunit ribosomal RNA in human cells in vitro.

PubMed

Gallenberger, Martin; Meinel, Dominik M; Kroeber, Markus; Wegner, Michael; Milkereit, Philipp; Bösl, Michael R; Tamm, Ernst R

2011-02-01

Mutations in WD repeat domain 36 gene (WDR36) play a causative role in some forms of primary open-angle glaucoma, a leading cause of blindness worldwide. WDR36 is characterized by the presence of multiple WD40 repeats and shows homology to Utp21, an essential protein component of the yeast small subunit (SSU) processome required for maturation of 18S rRNA. To clarify the functional role of WDR36 in the mammalian organism, we generated and investigated mutant mice with a targeted deletion of Wdr36. In parallel experiments, we used RNA interference to deplete WDR36 mRNA in mouse embryos and cultured human trabecular meshwork (HTM-N) cells. Deletion of Wdr36 in the mouse caused preimplantation embryonic lethality, and essentially similar effects were observed when WDR36 mRNA was depleted in mouse embryos by RNA interference. Depletion of WDR36 mRNA in HTM-N cells caused apoptotic cell death and upregulation of mRNA for BAX, TP53 and CDKN1A. By immunocytochemistry, staining for WDR36 was observed in the nucleolus of cells, which co-localized with that of nucleolar proteins such as nucleophosmin and PWP2. In addition, recombinant and epitope-tagged WDR36 localized to the nucleolus of HTM-N cells. By northern blot analysis, a substantial decrease in 21S rRNA, the precursor of 18S rRNA, was observed following knockdown of WDR36. In addition, metabolic-labeling experiments consistently showed a delay of 18S rRNA maturation in WDR36-depleted cells. Our results provide evidence that WDR36 is an essential protein in mammalian cells which is involved in the nucleolar processing of SSU 18S rRNA.

RNA interference: new mechanistic and biochemical insights with application in oral cancer therapy.

PubMed

Buduru, Smaranda; Zimta, Alina-Andreea; Ciocan, Cristina; Braicu, Cornelia; Dudea, Diana; Irimie, Alexandra Iulia; Berindan-Neagoe, Ioana

2018-01-01

Over the last few decades, the incidence of oral cancer has gradually increased, due to the negative influence of environmental factors and also abnormalities within the genome. The main issues in oral cancer treatment consist in surpassing resistance and recurrence. However, continuous discovery of altered signaling pathways in these tumors provides valuable information for the identification of novel gene candidates targeted in personalized therapy. RNA interference (RNAi) is a natural mechanism that involves small interfering RNA (siRNA); this can be exploited in biomedical research by using natural or synthetic constructs for activation of the mechanism. Synthetic siRNA transcripts were developed as a versatile class of molecular tools that have a diverse range of programmable roles, being involved in the regulation of several biological processes, thereby providing the perspective of an alternative option to classical treatment. In this review, we summarize the latest information related to the application of siRNA in oral malignancy together with molecular aspects of the technology and also the perspective upon the delivery system. Also, the emergence of newer technologies such as clustered regularly interspaced short palindromic repeats/Cas9 or transcription activator-like effector nucleases in comparison with the RNAi approach is discussed in this paper.

Comparison of Dengue Virus Type 2-Specific Small RNAs from RNA Interference-Competent and –Incompetent Mosquito Cells

PubMed Central

Scott, Jaclyn C.; Brackney, Doug E.; Campbell, Corey L.; Bondu-Hawkins, Virginie; Hjelle, Brian; Ebel, Greg D.; Olson, Ken E.; Blair, Carol D.

2010-01-01

The exogenous RNA interference (RNAi) pathway is an important antiviral defense against arboviruses in mosquitoes, and virus-specific small interfering (si)RNAs are key components of this pathway. Understanding the biogenesis of siRNAs in mosquitoes could have important ramifications in using RNAi to control arbovirus transmission. Using deep sequencing technology, we characterized dengue virus type 2 (DENV2)-specific small RNAs produced during infection of Aedes aegypti mosquitoes and A. aegypti Aag2 cell cultures and compared them to those produced in the C6/36 Aedes albopictus cell line. We show that the size and mixed polarity of virus-specific small RNAs from DENV-infected A. aegypti cells indicate that they are products of Dicer-2 (Dcr2) cleavage of long dsRNA, whereas C6/36 cells generate DENV2-specific small RNAs that are longer and predominantly positive polarity, suggesting that they originate from a different small RNA pathway. Examination of virus-specific small RNAs after infection of the two mosquito cell lines with the insect-only flavivirus cell fusing agent virus (CFAV) corroborated these findings. An in vitro assay also showed that Aag2 A. aegypti cells are capable of siRNA production, while C6/36 A. albopictus cells exhibit inefficient Dcr2 cleavage of long dsRNA. Defective expression or function of Dcr2, the key initiator of the RNAi pathway, might explain the comparatively robust growth of arthropod-borne viruses in the C6/36 cell line, which has been used frequently as a surrogate for studying molecular interactions between arboviruses and cells of their mosquito hosts. PMID:21049014

Modulation of RNA function by aminoglycoside antibiotics.

PubMed

Schroeder, R; Waldsich, C; Wank, H

2000-01-04

One of the most important families of antibiotics are the aminoglycosides, including drugs such as neomycin B, paromomycin, gentamicin and streptomycin. With the discovery of the catalytic potential of RNA, these antibiotics became very popular due to their RNA-binding capacity. They serve for the analysis of RNA function as well as for the study of RNA as a potential therapeutic target. Improvements in RNA structure determination recently provided first insights into the decoding site of the ribosome at high resolution and how aminoglycosides might induce misreading of the genetic code. In addition to inhibiting prokaryotic translation, aminoglycosides inhibit several catalytic RNAs such as self-splicing group I introns, RNase P and small ribozymes in vitro. Furthermore, these antibiotics interfere with human immunodeficiency virus (HIV) replication by disrupting essential RNA-protein contacts. Most exciting is the potential of many RNA-binding antibiotics to stimulate RNA activities, conceiving small-molecule partners for the hypothesis of an ancient RNA world. SELEX (systematic evolution of ligands by exponential enrichment) has been used in this evolutionary game leading to small synthetic RNAs, whose NMR structures gave valuable information on how aminoglycosides interact with RNA, which could possibly be used in applied science.

Neuron-derived orphan receptor 1 transduces survival signals in neuronal cells in response to hypoxia-induced apoptotic insults.

PubMed

Chio, Chung-Ching; Wei, Li; Chen, Tyng Guey; Lin, Chien-Min; Shieh, Ja-Ping; Yeh, Poh-Shiow; Chen, Ruei-Ming

2016-06-01

OBJECT Hypoxia can induce cell death or trigger adaptive mechanisms to guarantee cell survival. Neuron-derived orphan receptor 1 (NOR-1) works as an early-response protein in response to a variety of environmental stresses. In this study, the authors evaluated the roles of NOR-1 in hypoxia-induced neuronal insults. METHODS Neuro-2a cells were exposed to oxygen/glucose deprivation (OGD). Cell viability, cell morphology, cas-pase-3 activity, DNA fragmentation, and cell apoptosis were assayed to determine the mechanisms of OGD-induced neuronal insults. RNA and protein analyses were carried out to evaluate the effects of OGD on expressions of NOR-1, cAMP response element-binding (CREB), and cellular inhibitor of apoptosis protein 2 (cIAP2) genes. Translations of these gene expressions were knocked down using RNA interference. Mice subjected to traumatic brain injury (TBI) and NOR-1 was immunodetected. RESULTS Exposure of neuro-2a cells to OGD decreased cell viability in a time-dependent manner. Additionally, OGD led to cell shrinkage, DNA fragmentation, and cell apoptosis. In parallel, treatment of neuro-2a cells with OGD time dependently increased cellular NOR-1 mRNA and protein expressions. Interestingly, administration of TBI also augmented NOR-1 levels in the impacted regions of mice. As to the mechanism, exposure to OGD increased nuclear levels of the transcription factor CREB protein. Downregulating CREB expression using RNA interference simultaneously inhibited OGD-induced NOR-1 mRNA expression. Also, levels of cIAP2 mRNA and protein in neuro-2a cells were augmented by OGD. After reducing cIAP2 translation, OGD-induced cell death was reduced. Sequentially, application of NOR-1 small interfering RNA to neuro-2a cells significantly inhibited OGD-induced cIAP2 mRNA expression and concurrently alleviated hypoxia-induced alterations in cell viability, caspase-3 activation, DNA damage, and cell apoptosis. CONCLUSIONS This study shows that NOR-1 can transduce survival signals in neuronal cells responsible for hypoxiainduced apoptotic insults through activation of a CREB/cIAP2-dependent mechanism.

The role of PACT in the RNA silencing pathway

PubMed Central

Lee, Yoontae; Hur, Inha; Park, Seong-Yeon; Kim, Young-Kook; Suh, Mi Ra; Kim, V Narry

2006-01-01

Small RNA-mediated gene silencing (RNA silencing) has emerged as a major regulatory pathway in eukaryotes. Identification of the key factors involved in this pathway has been a subject of rigorous investigation in recent years. In humans, small RNAs are generated by Dicer and assembled into the effector complex known as RNA-induced silencing complex (RISC) by multiple factors including hAgo2, the mRNA-targeting endonuclease, and TRBP (HIV-1 TAR RNA-binding protein), a dsRNA-binding protein that interacts with both Dicer and hAgo2. Here we describe an additional dsRNA-binding protein known as PACT, which is significant in RNA silencing. PACT is associated with an ∼500 kDa complex that contains Dicer, hAgo2, and TRBP. The interaction with Dicer involves the third dsRNA-binding domain (dsRBD) of PACT and the N-terminal region of Dicer containing the helicase motif. Like TRBP, PACT is not required for the pre-microRNA (miRNA) cleavage reaction step. However, the depletion of PACT strongly affects the accumulation of mature miRNA in vivo and moderately reduces the efficiency of small interfering RNA-induced RNA interference. Our study indicates that, unlike other RNase III type proteins, human Dicer may employ two different dsRBD-containing proteins that facilitate RISC assembly. PMID:16424907

Immunity to Rice black streaked dwarf virus, a plant reovirus, can be achieved in rice plants by RNA silencing against the gene for the viroplasm component protein.

PubMed

Shimizu, Takumi; Nakazono-Nagaoka, Eiko; Akita, Fusamichi; Uehara-Ichiki, Tamaki; Omura, Toshihiro; Sasaya, Takahide

2011-09-01

The nonstructural protein P9-1 of Rice black streaked dwarf virus has been confirmed to accumulate in viroplasms, the putative sites of viral replication, in infected plants and insects. We transformed rice plants by introducing an RNA interference construct against the P9-1-encoding gene. The resultant transgenic plants accumulated short interfering RNAs specific to the construct. All progenies produced by self-fertilization of these transgenic plants with induced RNA interference against the gene for P9-1 were resistant to infection by the virus. Our results demonstrated that interfering with the expression of a viroplasm component protein of plant reoviruses, which plays an important role in viral proliferation, might be a practical and effective way to control plant reovirus infection in crop plants. Copyright © 2011 Elsevier B.V. All rights reserved.

On future's doorstep: RNA interference and the pharmacopeia of tomorrow.

PubMed

Gewirtz, Alan M

2007-12-01

Small molecules and antibodies have revolutionized the treatment of malignant diseases and appear promising for the treatment of many others. Nonetheless, there are many candidate therapeutic targets that are not amenable to attack by the current generation of targeted therapies, and in a small but growing number of patients, resistance to initially successful treatments evolves. This Review Series on the medicinal promise of posttranscriptional gene silencing with small interfering RNA and other molecules capable of inducing RNA interference (RNAi) is motivated by the hypothesis that effectors of RNAi can be developed into effective drugs for treating malignancies as well as many other types of disease. As this Review Series points out, there is still much to do, but many in the field now hope that the time has finally arrived when "antisense" therapies will finally come of age and fulfill their promise as the magic bullets of the 21st century.

Chymotrypsin-like peptidases from Tribolium castaneum: A role in molting revealed by RNA interference

USDA-ARS?s Scientific Manuscript database

Chymotrypsin-like peptidases (CTLPs) of insects are primarily secreted into the gut lumen where they act as digestive enzymes. We studied the gene family encoding CTLPs in the genome of the red flour beetle, Tribolium castaneum. Using an extended search pattern, we identified 14 TcCTLP genes that e...

27nt-RNAs guide histone variant deposition via 'RNA-induced DNA replication interference' and thus transmit parental genome partitioning in Stylonychia.

PubMed

Postberg, Jan; Jönsson, Franziska; Weil, Patrick Philipp; Bulic, Aneta; Juranek, Stefan Andreas; Lipps, Hans-Joachim

2018-06-12

During sexual reproduction in the unicellular ciliate Stylonychia somatic macronuclei differentiate from germline micronuclei. Thereby, programmed sequence reduction takes place, leading to the elimination of > 95% of germline sequences, which priorly adopt heterochromatin structure via H3K27me3. Simultaneously, 27nt-ncRNAs become synthesized from parental transcripts and are bound by the Argonaute protein PIWI1. These 27nt-ncRNAs cover sequences destined to the developing macronucleus and are thought to protect them from degradation. We provide evidence and propose that RNA/DNA base-pairing guides PIWI1/27nt-RNA complexes to complementary macronucleus-destined DNA target sequences, hence transiently causing locally stalled replication during polytene chromosome formation. This spatiotemporal delay enables the selective deposition of temporarily available histone H3.4K27me3 nucleosomes at all other sequences being continuously replicated, thus dictating their prospective heterochromatin structure before becoming developmentally eliminated. Concomitantly, 27nt-RNA-covered sites remain protected. We introduce the concept of 'RNA-induced DNA replication interference' and explain how the parental functional genome partition could become transmitted to the progeny.

RNA sensor LGP2 inhibits TRAF ubiquitin ligase to negatively regulate innate immune signaling.

PubMed

Parisien, Jean-Patrick; Lenoir, Jessica J; Mandhana, Roli; Rodriguez, Kenny R; Qian, Kenin; Bruns, Annie M; Horvath, Curt M

2018-06-01

The production of type I interferon (IFN) is essential for cellular barrier functions and innate and adaptive antiviral immunity. In response to virus infections, RNA receptors RIG-I and MDA5 stimulate a mitochondria-localized signaling apparatus that uses TRAF family ubiquitin ligase proteins to activate master transcription regulators IRF3 and NFκB, driving IFN and antiviral target gene expression. Data indicate that a third RNA receptor, LGP2, acts as a negative regulator of antiviral signaling by interfering with TRAF family proteins. Disruption of LGP2 expression in cells results in earlier and overactive transcriptional responses to virus or dsRNA LGP2 associates with the C-terminus of TRAF2, TRAF3, TRAF5, and TRAF6 and interferes with TRAF ubiquitin ligase activity. TRAF interference is independent of LGP2 ATP hydrolysis, RNA binding, or its C-terminal domain, and LGP2 can regulate TRAF-mediated signaling pathways in trans , including IL-1β, TNFα, and cGAMP These findings provide a unique mechanism for LGP2 negative regulation through TRAF suppression and extend the potential impact of LGP2 negative regulation beyond the IFN antiviral response. © 2018 The Authors.

Enzymatic Synthesis of Self-assembled Dicer Substrate RNA Nanostructures for Programmable Gene Silencing.

PubMed

Jang, Bora; Kim, Boyoung; Kim, Hyunsook; Kwon, Hyokyoung; Kim, Minjeong; Seo, Yunmi; Colas, Marion; Jeong, Hansaem; Jeong, Eun Hye; Lee, Kyuri; Lee, Hyukjin

2018-06-08

Enzymatic synthesis of RNA nanostructures is achieved by isothermal rolling circle transcription (RCT). Each arm of RNA nanostructures provides a functional role of Dicer substrate RNA inducing sequence specific RNA interference (RNAi). Three different RNAi sequences (GFP, RFP, and BFP) are incorporated within the three-arm junction RNA nanostructures (Y-RNA). The template and helper DNA strands are designed for the large-scale in vitro synthesis of RNA strands to prepare self-assembled Y-RNA. Interestingly, Dicer processing of Y-RNA is highly influenced by its physical structure and different gene silencing activity is achieved depending on its arm length and overhang. In addition, enzymatic synthesis allows the preparation of various Y-RNA structures using a single DNA template offering on demand regulation of multiple target genes.

Downregulation of telomerase activity in human promyelocytic cell line using RNA interference.

PubMed

Miri-Moghaddam, E; Deezagi, A; Soheili, Z S

2009-12-01

Telomerase is a ribonucleoprotein complex. It consists of two main components, human telomerase reverse transcriptase (hTERT) and human telomerase RNA. High telomerase activity is present in most malignant cells, but it is barely detectable in majority of somatic cells. The direct correlation between telomerase reactivation and carcinogens has made hTERT a key target for anticancer therapeutic studies. In this study, for the first time, we evaluated the ability of the new generation of short interfering RNA (siRNA) to regulate telomerase activity in the human promyelocytic leukemia cell line (HL-60). Transient transfection cell line by hTERT siRNAs resulted in statistically significant suppression of hTERT messenger RNAs which were detected by quantitative real-time polymerase chain reaction, while the expressed hTERT protein levels were measured by flow cytometry. The results of telomeric repeat amplification protocol showed that telomerase activity was significantly reduced upon transfection of the HL-60 cell line with hTERT siRNAs. The results of this study showed that telomerase activity and cell proliferation were efficiently inhibited in the hTERT siRNA-treated leukemic cell line.

A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex

PubMed Central

Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

2012-01-01

P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981

Specific inhibition of gene expression by small double-stranded RNAs in invertebrate and vertebrate systems

PubMed Central

Caplen, Natasha J.; Parrish, Susan; Imani, Farhad; Fire, Andrew; Morgan, Richard A.

2001-01-01

Short interfering RNAs (siRNAs) are double-stranded RNAs of ≈21–25 nucleotides that have been shown to function as key intermediaries in triggering sequence-specific RNA degradation during posttranscriptional gene silencing in plants and RNA interference in invertebrates. siRNAs have a characteristic structure, with 5′-phosphate/3′-hydroxyl ends and a 2-base 3′ overhang on each strand of the duplex. In this study, we present data that synthetic siRNAs can induce gene-specific inhibition of expression in Caenorhabditis elegans and in cell lines from humans and mice. In each case, the interference by siRNAs was superior to the inhibition of gene expression mediated by single-stranded antisense oligonucleotides. The siRNAs seem to avoid the well documented nonspecific effects triggered by longer double-stranded RNAs in mammalian cells. These observations may open a path toward the use of siRNAs as a reverse genetic and therapeutic tool in mammalian cells. PMID:11481446

A whole genome screening and RNA interference identify a juvenile hormone esterase-like gene of the diamondback moth, Plutella xylostella.

PubMed

Gu, Xiaojun; Kumar, Sunil; Kim, Eunjin; Kim, Yonggyun

2015-09-01

Juvenile hormone (JH) plays a crucial role in preventing precocious metamorphosis and stimulating reproduction. Thus, its hemolymph titer should be under a tight control. As a negative controller, juvenile hormone esterase (JHE) performs a rapid breakdown of residual JH in the hemolymph during last instar to induce a larval-to-pupal metamorphosis. A whole genome of the diamondback moth (DBM), Plutella xylostella, has been annotated and proposed 11 JHE candidates. Sequence analysis using conserved motifs commonly found in other JHEs proposed a putative JHE (Px004817). Px004817 (64.61 kDa, pI=5.28) exhibited a characteristic JHE expression pattern by showing high peak at the early last instar, at which JHE enzyme activity was also at a maximal level. RNA interference of Px004817 reduced JHE activity and interrupted pupal development with a significant increase of larval period. This study identifies Px004817 as a JHE-like gene of P. xylostella. Copyright © 2015 Elsevier Ltd. All rights reserved.

Nanobiotechnology: an efficient approach to drug delivery of unstable biomolecules.

PubMed

Amaral, A C; Felipe, M S S

2013-11-01

Biotechnology and nanotechnology are fields of science that can be applied together to solve a variety of biological issues. In the case of human health, biotechnology attempts to improve advances on the therapy against several diseases. Therapeutic peptides and proteins are promissory molecules for developing new medicines. Gene transfection and RNA interference have been considered important approaches for modern therapy to treat cancer and viral infections. However, because of their instability, these molecules alone cannot be used for in vivo application, since they are easily degraded or presenting a poor efficiency. Nanotechnology can contribute by the development of nanostructured delivery systems to increase the stability and potency of these molecules. Studies involving polymeric and magnetic nanoparticles, dendrimers, and carbon nanotubes have demonstrated a possibility to use these systems as vectors instead of the conventional viral ones, which present adverse effects, such as recombination and immunogenicity. This review presents some possibilities and strategies to efficiently delivery peptides, proteins, gene and RNA interference using nanotechnology approach.

Interference activity of a minimal Type I CRISPR-Cas system from Shewanella putrefaciens.

PubMed

Dwarakanath, Srivatsa; Brenzinger, Susanne; Gleditzsch, Daniel; Plagens, André; Klingl, Andreas; Thormann, Kai; Randau, Lennart

2015-10-15

Type I CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas (CRISPR-associated) systems exist in bacterial and archaeal organisms and provide immunity against foreign DNA. The Cas protein content of the DNA interference complexes (termed Cascade) varies between different CRISPR-Cas subtypes. A minimal variant of the Type I-F system was identified in proteobacterial species including Shewanella putrefaciens CN-32. This variant lacks a large subunit (Csy1), Csy2 and Csy3 and contains two unclassified cas genes. The genome of S. putrefaciens CN-32 contains only five Cas proteins (Cas1, Cas3, Cas6f, Cas1821 and Cas1822) and a single CRISPR array with 81 spacers. RNA-Seq analyses revealed the transcription of this array and the maturation of crRNAs (CRISPR RNAs). Interference assays based on plasmid conjugation demonstrated that this CRISPR-Cas system is active in vivo and that activity is dependent on the recognition of the dinucleotide GG PAM (Protospacer Adjacent Motif) sequence and crRNA abundance. The deletion of cas1821 and cas1822 reduced the cellular crRNA pool. Recombinant Cas1821 was shown to form helical filaments bound to RNA molecules, which suggests its role as the Cascade backbone protein. A Cascade complex was isolated which contained multiple Cas1821 copies, Cas1822, Cas6f and mature crRNAs. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Plant-specific multisubunit RNA polymerase in gene silencing.

PubMed

Lahmy, Sylvie; Bies-Etheve, Natacha; Lagrange, Thierry

2010-01-01

In recent years, a major breakthrough in the study of epigenetic silencing in eukaryotes came with the discovery that the RNA-interference pathway (RNAi) is generally implicated in heterochromatin assembly and gene silencing. An important and paradoxical feature of the RNAi-mediated heterochromatin pathways is their requirement for some form of transcription. In fission yeast, Schizosaccharomyces pombe, centromeric siRNAs have been shown to derive from chromatin-bound nascent transcripts produced by RNA polymerase II (PolII) at the site of heterochromatin formation. Likewise, chromatin-bound nascent transcripts generated by a PolII-related DNA-dependent RNA polymerase, known as PolIVb/PolV, have recently been implicated in RNA-directed DNA methylation (RdDM), the prominent RNAi-mediated chromatin pathway in plants. In this review we discuss recent work on the plant-specific PolII variant enzymes and discuss the mechanistic convergences that have been observed in the role of these enzymes in their respective siRNA-mediated heterochromatin formation pathways.

Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple turnover.

PubMed

Rawlings, Renata A; Krishnan, Vishalakshi; Walter, Nils G

2011-04-29

RNA interference is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response to viruses and retrotransposons. During viral infection, the RNase-III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs) 21-24 nucleotides in length and helps load them into the RNA-induced silencing complex (RISC) to guide the cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressors (RSS) that tightly, and presumably quantitatively, bind siRNAs to thwart RNA-interference-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus, as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding [(1.69 ± 0.07) × 10(8) M(-)(1) s(-1)] and marked dissociation (k(off)=0.062 ± 0.002 s(-1)). We also observe that p19 efficiently competes with recombinant Dicer and inhibits the formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. Copyright © 2011 Elsevier Ltd. All rights reserved.

RNA interference as a key to knockdown overexpressed cyclooxygenase-2 gene in tumour cells

PubMed Central

Strillacci, A; Griffoni, C; Spisni, E; Manara, M C; Tomasi, V

2006-01-01

Silencing those genes that are overexpressed in cancer and contribute to the survival and progression of tumour cells is the aim of several researches. Cyclooxygenase-2 (COX-2) is one of the most intensively studied genes since it is overexpressed in most tumours, mainly in colon cancer. The use of specific COX-2 inhibitors to treat colon cancer has generated great enthusiasm. Yet, the side effects of some inhibitors emerging during long-term treatment have caused much concern. Genes silencing by RNA interference (RNAi) has led to new directions in the field of experimental oncology. In this study, we detected sequences directed against COX-2 mRNA, that potently downregulate COX-2 gene expression and inhibit phorbol 12-myristate 13-acetate-induced angiogenesis in vitro in a specific, nontoxic manner. Moreover, we found that the insertion of a specific cassette carrying anti-COX-2 short hairpin RNA sequence into a viral vector (pSUPER.retro) greatly increased silencing potency in a colon cancer cell line (HT29) without activating any interferon response. Phenotypically, COX-2 deficient HT29 cells showed a significant impairment of their in vitro malignant behaviour. Thus, the retroviral approach enhancing COX-2 knockdown, mediated by RNAi, proved to be an useful tool to better understand the role of COX-2 in colon cancer. Furthermore, the higher infection efficiency we observed in tumour cells, if compared to normal endothelial cells, may disclose the possibility to specifically treat tumour cells without impairing endothelial COX-2 activity. PMID:16622456

The role of mAKAPβ in the process of cardiomyocyte hypertrophy induced by angiotensin II

PubMed Central

GUO, HUIXIN; LIU, BAOXIN; HOU, LEI; THE, ERLINDA; LI, GANG; WANG, DONGZHI; JIE, QIQIANG; CHE, WENLIANG; WEI, YIDONG

2015-01-01

Angiotensin II (AngII) is the central product of the renin-angiotensin system (RAS) and this octapeptide contributes to the pathophysiology of cardiac hypertrophy and remodeling. mAKAPβ is an A-kinase anchoring protein (AKAP) that has the function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. In this study, we aimed to investigate the role of mAKAPβ in AngII-induced cardiomyocyte hypertrophy and the possible mechanisms involved. Cultured cardiomyocytes from neonatal rats were treated with AngII. Subsequently, the morphology of the cardiomyocytes was observed and the expression of mAKAPβ and cardiomyocyte hypertrophic markers was measured. mAKAPβ-shRNA was constructed for RNA interference; the expression of mAKAPβ and hypertrophic markers, the cell surface area and the [3H]Leucine incorporation rate in the AngII-treated rat cardiomyocytes were detected following RNA interference. Simultaneously, changes in the expression levels of phosphorylated extracellular signal-regulated kinase (p-ERK)2 in the cardiomyocytes were assessed. The cell size of the AngII-treated cardiaomyocytes was significantly larger than that of the untreated cardiomyocytes. The expression of hypertrophic markers and p-ERK2, the cell surface area and the [3H]Leucine incorporation rate were all significantly increased in the AngII-treated cells. However, the expression of mAKAPβ remained unaltered in this process. RNA interference simultaneously inhibited the protein expression of mAKAPβ and p-ERK2, and the hypertrophy of the cardiomyocytes induced by AngII was attenuated. These results demonstrate that AngII induces hypertrophy in cardiomyocytes, and mAKAPβ is possibly involved in this process. The effects of mAKAPβ on AngII-induced cardiomyocyte hypertrophy may be associated with p-ERK2 expression. PMID:25739102

RNA interference: ready to silence cancer?

PubMed

Mocellin, Simone; Costa, Rodolfo; Nitti, Donato

2006-01-01

RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.

Induction of RNA interference in dendritic cells.

PubMed

Li, Mu; Qian, Hua; Ichim, Thomas E; Ge, Wei-Wen; Popov, Igor A; Rycerz, Katarzyna; Neu, John; White, David; Zhong, Robert; Min, Wei-Ping

2004-01-01

Dendritic cells (DC) reside at the center of the immunological universe, possessing the ability both to stimulate and inhibit various types of responses. Tolerogenic/regulatory DC with therapeutic properties can be generated through various means of manipulations in vitro and in vivo. Here we describe several attractive strategies for manipulation of DC using the novel technique of RNA interference (RNAi). Additionally, we overview some of our data regarding yet undescribed characteristics of RNAi in DC such as specific transfection strategies, persistence of gene silencing, and multi-gene silencing. The advantages of using RNAi for DC genetic manipulation gives rise to the promise of generating tailor-made DC that can be used effectively to treat a variety of immunologically mediated diseases.

A 3’UTR polymorphism marks differential KLRG1 mRNA levels through disruption of a miR-584-5p binding site and associates with pemphigus foliaceus susceptibility

PubMed Central

Cipolla, Gabriel A.; Park, Jong K.; de Oliveira, Liana A.; Lobo-Alves, Sara Cristina; de Almeida, Rodrigo C.; Farias, Ticiana D. J.; Lemos, Débora de S.; Malheiros, Danielle; Lavker, Robert M.; Petzl-Erler, Maria Luiza

2016-01-01

Genetic variations mapping to 3’ untranslated regions (3’UTRs) may overlap with microRNA (miRNA) binding sites, therefore potentially interfering with translation inhibition or messenger RNA (mRNA) degradation. The aim of this study was to investigate whether single nucleotide polymorphisms (SNPs) located within the 3’UTRs of six candidate genes and predicted to interfere with miRNA ligation could account for disease-relevant differential mRNA levels. Focusing on pemphigus foliaceus (PF) – an autoimmune blistering skin condition with unique endemic patterns – we investigated if nine 3’UTR SNPs from the CD1D, CTLA4, KLRD1, KLRG1, NKG7, and TNFSF13B genes differentially expressed in PF were disease-associated. The heterozygous genotype of the KLRG1 rs1805672 polymorphism was associated with increased predisposition to PF (A/G vs. A/A: P=0.038; OR=1.60), and a trend for augmented susceptibility was observed for carriers of the G allele (P=0.094; OR=1.44). In silico analyses suggested that rs1805672 G allele could disrupt binding of miR-584-5p, and indicated rs1805672 as an expression Quantitative Trait Locus (eQTL), with an effect on KLRG1 gene expression. Dual-luciferase assay showed that miR-584-5p mediated approximately 50% downregulation of the reporter gene’s activity through the 3’UTR of KLRG1 harboring rs1805672 A allele (vs. miRNA-negative condition, P=0.006). This silencing relationship was lost after site-directed mutation to G allele (vs. miRNA-negative condition, P=0.391; vs. rs1805672 A allele, P=0.005). Collectively, these results suggest that a disease-associated SNP located within the 3’UTR of KLRG1 directly interferes with miR-584-5p binding, allowing for KLRG1 mRNA differential accumulation, which in turn may contribute to pathogenesis of autoimmune diseases, such as pemphigus. PMID:27424220

A 3'UTR polymorphism marks differential KLRG1 mRNA levels through disruption of a miR-584-5p binding site and associates with pemphigus foliaceus susceptibility.

PubMed

Cipolla, Gabriel A; Park, Jong Kook; de Oliveira, Liana A; Lobo-Alves, Sara Cristina; de Almeida, Rodrigo C; Farias, Ticiana D J; Lemos, Débora de S; Malheiros, Danielle; Lavker, Robert M; Petzl-Erler, Maria Luiza

2016-10-01

Genetic variations mapping to 3' untranslated regions (3'UTRs) may overlap with microRNA (miRNA) binding sites, therefore potentially interfering with translation inhibition or messenger RNA (mRNA) degradation. The aim of this study was to investigate whether single nucleotide polymorphisms (SNPs) located within the 3'UTRs of six candidate genes and predicted to interfere with miRNA ligation could account for disease-relevant differential mRNA levels. Focusing on pemphigus foliaceus (PF) - an autoimmune blistering skin condition with unique endemic patterns - we investigated whether nine 3'UTR SNPs from the CD1D, CTLA4, KLRD1, KLRG1, NKG7, and TNFSF13B genes differentially expressed in PF were disease-associated. The heterozygous genotype of the KLRG1 rs1805672 polymorphism was associated with increased predisposition to PF (A/G vs. A/A: P=0.038; OR=1.60), and a trend for augmented susceptibility was observed for carriers of the G allele (P=0.094; OR=1.44). In silico analyses suggested that rs1805672 G allele could disrupt binding of miR-584-5p, and indicated rs1805672 as an expression Quantitative Trait Locus (eQTL), with an effect on KLRG1 gene expression. Dual-luciferase assay showed that miR-584-5p mediated approximately 50% downregulation of the reporter gene's activity through the 3'UTR of KLRG1 harboring rs1805672 A allele (vs. miRNA-negative condition, P=0.006). This silencing relationship was lost after site-directed mutation to G allele (vs. miRNA-negative condition, P=0.391; vs. rs1805672 A allele, P=0.005). Collectively, these results suggest that a disease-associated SNP located within the 3'UTR of KLRG1 directly interferes with miR-584-5p binding, allowing for KLRG1 mRNA differential accumulation, which in turn may contribute to pathogenesis of autoimmune diseases, such as pemphigus. Copyright © 2016 Elsevier B.V. All rights reserved.

NAIM and site-specific functional group modification analysis of RNase P RNA: magnesium dependent structure within the conserved P1-P4 multihelix junction contributes to catalysis.

PubMed

Kaye, Nicholas M; Christian, Eric L; Harris, Michael E

2002-04-09

The tRNA processing endonuclease ribonuclease P contains an essential and highly conserved RNA molecule (RNase P RNA) that is the catalytic subunit of the enzyme. To identify and characterize functional groups involved in RNase P RNA catalysis, we applied self-cleaving ribozyme-substrate conjugates, on the basis of the RNase P RNA from Escherichia coli, in nucleotide analogue interference mapping (NAIM) and site-specific modification experiments. At high monovalent ion concentrations (3 M) that facilitate protein-independent substrate binding, we find that the ribozyme is largely insensitive to analogue substitution and that concentrations of Mg2+ (1.25 mM) well below that necessary for optimal catalytic rate (>100 mM) are required to produce interference effects because of modification of nucleotide bases. An examination of the pH dependence of the reaction rate at 1.25 mM Mg2+ indicates that the increased sensitivity to analogue interference is not due to a change in the rate-limiting step. The nucleotide positions detected by NAIM under these conditions are located exclusively in the catalytic domain, consistent with the proposed global structure of the ribozyme, and predominantly occur within the highly conserved P1-P4 multihelix junction. Several sensitive positions in J3/4 and J2/4 are proximal to a previously identified site of divalent metal ion binding in the P1-P4 element. Kinetic analysis of ribozymes with site-specific N7-deazaadenosine and deazaguanosine modifications in J3/4 was, in general, consistent with the interference results and also permitted the analysis of sites not accessible by NAIM. These results show that, in this region only, modification of the N7 positions of A62, A65, and A66 resulted in measurable effects on reaction rate and modification at each position displayed distinct sensitivities to Mg2+ concentration. These results reveal a restricted subset of individual functional groups within the catalytic domain that are particularly important for substrate cleavage and demonstrate a close association between catalytic function and metal ion-dependent structure in the highly conserved P1-P4 multihelix junction.

New Type of BACE1 siRNA Delivery to Cells

PubMed Central

Jabłkowski, Maciej; Szemraj, Maciej; Oszajca, Katarzyna; Janiszewska, Grażyna; Bartkowiak, Jacek; Szemraj, Janusz

2014-01-01

Background Small interfering RNA (siRNA) gene therapy is a new molecular approach in the search for an efficient therapy for Alzheimer disease (AD), based on the principle of RNA interference. Reducing BACE activity can have great therapeutic potential for the treatment of AD. In this study, receptor-mediated delivery was used to deliver opioid peptide-conjugated BACE 1 to INR-32 human neuroblastoma cells. Material/Methods An INR-32 human neuroblastoma cell line was stably transfected to express the APP cDNA coding fragment containing the predicted sites for cleavage by α, β, or γ-secretase. This was then treated with BACE 1 siRNA to silence BACE gene expression. BACE gene transcription and translation was determined using BACE-1 siRNA cross-linked with opioid peptide, together with RT-PCR, Western blot analysis, and ELISA. Results Receptor-mediated delivery was used to introduce BACE1 siRNA to the APP – INR 32 human neuroblastoma cells. Decreased BACE mRNA and protein expression were observed after the cells were transfected with BACE1 siRNA. Conclusions Delivery of BACE1 siRNA appears to specifically reduce the cleavage of APP by inhibiting BACE1 activity. PMID:25491230

Comparing 2-nt 3' overhangs against blunt-ended siRNAs: a systems biology based study.

PubMed

Ghosh, Preetam; Dullea, Robert; Fischer, James E; Turi, Tom G; Sarver, Ronald W; Zhang, Chaoyang; Basu, Kalyan; Das, Sajal K; Poland, Bradley W

2009-07-07

In this study, we formulate a computational reaction model following a chemical kinetic theory approach to predict the binding rate constant for the siRNA-RISC complex formation reaction. The model allowed us to study the potency difference between 2-nt 3' overhangs against blunt-ended siRNA molecules in an RNA interference (RNAi) system. The rate constant predicted by this model was fed into a stochastic simulation of the RNAi system (using the Gillespie stochastic simulator) to study the overall potency effect. We observed that the stochasticity in the transcription/translation machinery has no observable effects in the RNAi pathway. Sustained gene silencing using siRNAs can be achieved only if there is a way to replenish the dsRNA molecules in the cell. Initial findings show about 1.5 times more blunt-ended molecules will be required to keep the mRNA at the same reduced level compared to the 2-nt overhang siRNAs. However, the mRNA levels jump back to saturation after a longer time when blunt-ended siRNAs are used. We found that the siRNA-RISC complex formation reaction rate was 2 times slower when blunt-ended molecules were used pointing to the fact that the presence of the 2-nt overhangs has a greater effect on the reaction in which the bound RISC complex cleaves the mRNA.

Comparing 2-nt 3' overhangs against blunt-ended siRNAs: a systems biology based study

PubMed Central

Ghosh, Preetam; Dullea, Robert; Fischer, James E; Turi, Tom G; Sarver, Ronald W; Zhang, Chaoyang; Basu, Kalyan; Das, Sajal K; Poland, Bradley W

2009-01-01

In this study, we formulate a computational reaction model following a chemical kinetic theory approach to predict the binding rate constant for the siRNA-RISC complex formation reaction. The model allowed us to study the potency difference between 2-nt 3' overhangs against blunt-ended siRNA molecules in an RNA interference (RNAi) system. The rate constant predicted by this model was fed into a stochastic simulation of the RNAi system (using the Gillespie stochastic simulator) to study the overall potency effect. We observed that the stochasticity in the transcription/translation machinery has no observable effects in the RNAi pathway. Sustained gene silencing using siRNAs can be achieved only if there is a way to replenish the dsRNA molecules in the cell. Initial findings show about 1.5 times more blunt-ended molecules will be required to keep the mRNA at the same reduced level compared to the 2-nt overhang siRNAs. However, the mRNA levels jump back to saturation after a longer time when blunt-ended siRNAs are used. We found that the siRNA-RISC complex formation reaction rate was 2 times slower when blunt-ended molecules were used pointing to the fact that the presence of the 2-nt overhangs has a greater effect on the reaction in which the bound RISC complex cleaves the mRNA. PMID:19594876

Interfering RNA with multi-targets for efficient gene suppression in HCC cells.

PubMed

Li, Tiejun; Zhu, York Yuanyuan; Ji, Yi; Zhou, Songfeng

2018-06-01

RNA interference (RNAi) technology has been widely used in therapeutics development, especially multiple targeted RNAi strategy, which is a better method for multiple gene suppression. In the study, interfering RNAs (iRNAs) were designed for carrying two or three different siRNA sequences in different secondary structure formats (loop or cloverleaf). By using these types of iRNAs, co-inhibition of survivin and B-cell lymphoma-2 (Bcl-2) was investigated in hepatocellular carcinoma (HCC) cells, and we obtained promising gene silencing effects without showing undesirable interferon response. Furthermore, suppression effects on proliferation, invasion, and induced apoptosis in HCC cells were validated. The results suggest that long iRNAs with secondary structure may be a preferred strategy for multigenic disease therapy, especially for cancer and viral gene therapy and their iRNA drug development.

Evaluation of metaphylactic RNA interference to prevent equine herpesvirus type 1 infection in experimental herpesvirus myeloencephalopathy in horses.

PubMed

Perkins, Gillian A; Van de Walle, Gerlinde R; Pusterla, Nicola; Erb, Hollis N; Osterrieder, Nikolaus

2013-02-01

To evaluate metaphylactic RNA interference to prevent equine herpesvirus type 1 (EHV-1) infection in experimental herpesvirus myeloencephalopathy in horses and to determine whether horses infected with a neuropathogenic strain of the virus that develop equine herpesvirus myeloencephalopathy (EHM) have differences in viremia. 13 seronegative horses. EHV-1 strain Ab4 was administered intranasally on day 0, and small interfering RNAs (siRNAs [EHV-1 specific siRNAs {n = 7} or an irrelevant siRNA {6}]) were administered intranasally 24 hours before and 12, 24, 36, and 48 hours after infection. Physical and neurologic examinations, nasal swab specimens, and blood samples were collected for virus isolation and quantitative PCR assay. Data from the study were combined with data from a previous study of 14 horses. No significant difference was detected in clinical variables, viremia, or detection of EHV-1 in nasal swab specimens of horses treated with the EHV-1 targeted siRNAs (sigB3-siOri2) versus controls. No significant differences in viremia were detected between horses that developed EHM and those that did not. Administration of siRNAs targeted against EHV-1 around the time of EHV-1 infection was not protective with this experimental design. Horses infected with the neuropathogenic EHV-1 strain Ab4 that developed EHM did not have a more pronounced viremia.

RNA interference in Lepidoptera: an overview of successful and unsuccessful studies and implications for experimental design.

PubMed

Terenius, Olle; Papanicolaou, Alexie; Garbutt, Jennie S; Eleftherianos, Ioannis; Huvenne, Hanneke; Kanginakudru, Sriramana; Albrechtsen, Merete; An, Chunju; Aymeric, Jean-Luc; Barthel, Andrea; Bebas, Piotr; Bitra, Kavita; Bravo, Alejandra; Chevalier, François; Collinge, Derek P; Crava, Cristina M; de Maagd, Ruud A; Duvic, Bernard; Erlandson, Martin; Faye, Ingrid; Felföldi, Gabriella; Fujiwara, Haruhiko; Futahashi, Ryo; Gandhe, Archana S; Gatehouse, Heather S; Gatehouse, Laurence N; Giebultowicz, Jadwiga M; Gómez, Isabel; Grimmelikhuijzen, Cornelis J P; Groot, Astrid T; Hauser, Frank; Heckel, David G; Hegedus, Dwayne D; Hrycaj, Steven; Huang, Lihua; Hull, J Joe; Iatrou, Kostas; Iga, Masatoshi; Kanost, Michael R; Kotwica, Joanna; Li, Changyou; Li, Jianghong; Liu, Jisheng; Lundmark, Magnus; Matsumoto, Shogo; Meyering-Vos, Martina; Millichap, Peter J; Monteiro, Antónia; Mrinal, Nirotpal; Niimi, Teruyuki; Nowara, Daniela; Ohnishi, Atsushi; Oostra, Vicencio; Ozaki, Katsuhisa; Papakonstantinou, Maria; Popadic, Aleksandar; Rajam, Manchikatla V; Saenko, Suzanne; Simpson, Robert M; Soberón, Mario; Strand, Michael R; Tomita, Shuichiro; Toprak, Umut; Wang, Ping; Wee, Choon Wei; Whyard, Steven; Zhang, Wenqing; Nagaraju, Javaregowda; Ffrench-Constant, Richard H; Herrero, Salvador; Gordon, Karl; Swevers, Luc; Smagghe, Guy

2011-02-01

Gene silencing through RNA interference (RNAi) has revolutionized the study of gene function, particularly in non-model insects. However, in Lepidoptera (moths and butterflies) RNAi has many times proven to be difficult to achieve. Most of the negative results have been anecdotal and the positive experiments have not been collected in such a way that they are possible to analyze. In this review, we have collected detailed data from more than 150 experiments including all to date published and many unpublished experiments. Despite a large variation in the data, trends that are found are that RNAi is particularly successful in the family Saturniidae and in genes involved in immunity. On the contrary, gene expression in epidermal tissues seems to be most difficult to silence. In addition, gene silencing by feeding dsRNA requires high concentrations for success. Possible causes for the variability of success in RNAi experiments in Lepidoptera are discussed. The review also points to a need to further investigate the mechanism of RNAi in lepidopteran insects and its possible connection to the innate immune response. Our general understanding of RNAi in Lepidoptera will be further aided in the future as our public database at http://insectacentral.org/RNAi will continue to gather information on RNAi experiments. Copyright © 2010 Elsevier Ltd. All rights reserved.

Sensitivity of Small RNA-Based Detection of Plant Viruses.

PubMed

Santala, Johanna; Valkonen, Jari P T

2018-01-01

Plants recognize unrelated viruses by the antiviral defense system called RNA interference (RNAi). RNAi processes double-stranded viral RNA into small RNAs (sRNAs) of 21-24 nucleotides, the reassembly of which into longer strands in silico allows virus identification by comparison with the sequences available in databases. The aim of this study was to compare the virus detection sensitivity of sRNA-based virus diagnosis with the established virus species-specific polymerase chain reaction (PCR) approach. Viruses propagated in tobacco plants included three engineered, infectious clones of Potato virus A (PVA), each carrying a different marker gene, and an infectious clone of Potato virus Y (PVY). Total RNA (containing sRNA) was isolated and subjected to reverse-transcription real-time PCR (RT-RT-PCR) and sRNA deep-sequencing at different concentrations. RNA extracted from various crop plants was included in the reactions to normalize RNA concentrations. Targeted detection of selected viruses showed a similar threshold for the sRNA and reverse-transcription quantitative PCR (RT-qPCR) analyses. The detection limit for PVY and PVA by RT-qPCR in this study was 3 and 1.5 fg of viral RNA, respectively, in 50 ng of total RNA per PCR reaction. When knowledge was available about the viruses likely present in the samples, sRNA-based virus detection was 10 times more sensitive than RT-RT-PCR. The advantage of sRNA analysis is the detection of all tested viruses without the need for virus-specific primers or probes.

A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.

PubMed

Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi

2018-02-12

Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.

How short RNAs impact the human ribonuclease Dicer activity: putative regulatory feedback-loops and other RNA-mediated mechanisms controlling microRNA processing.

PubMed

Koralewska, Natalia; Hoffmann, Weronika; Pokornowska, Maria; Milewski, Marek; Lipinska, Andrea; Bienkowska-Szewczyk, Krystyna; Figlerowicz, Marek; Kurzynska-Kokorniak, Anna

2016-01-01

Ribonuclease Dicer plays a pivotal role in RNA interference pathways by processing long double-stranded RNAs and single-stranded hairpin RNA precursors into small interfering RNAs (siRNAs) and microRNAs (miRNAs), respectively. While details of Dicer regulation by a variety of proteins are being elucidated, less is known about non-protein factors, e.g. RNA molecules, that may influence this enzyme's activity. Therefore, we decided to investigate the question of whether the RNA molecules can function not only as Dicer substrates but also as its regulators. Our previous in vitro studies indicated that the activity of human Dicer can be influenced by short RNA molecules that either bind to Dicer or interact with its substrates, or both. Those studies were carried out with commercial Dicer preparations. Nevertheless, such preparations are usually not homogeneous enough to carry out more detailed RNA-binding studies. Therefore, we have established our own system for the production of human Dicer in insect cells. In this manuscript, we characterize the RNA-binding and RNA-cleavage properties of the obtained preparation. We demonstrate that Dicer can efficiently bind single-stranded RNAs that are longer than ~20-nucleotides. Consequently, we revisit possible scenarios of Dicer regulation by single-stranded RNA species ranging from ~10- to ~60-nucleotides, in the context of their binding to this enzyme. Finally, we show that siRNA/miRNA-sized RNAs may affect miRNA production either by binding to Dicer or by participating in regulatory feedback-loops. Altogether, our studies suggest a broad regulatory role of short RNAs in Dicer functioning.

Development of marker-free transgenic Jatropha plants with increased levels of seed oleic acid

PubMed Central

2012-01-01

Background Jatropha curcas is recognized as a new energy crop due to the presence of the high amount of oil in its seeds that can be converted into biodiesel. The quality and performance of the biodiesel depends on the chemical composition of the fatty acids present in the oil. The fatty acids profile of the oil has a direct impact on ignition quality, heat of combustion and oxidative stability. An ideal biodiesel composition should have more monounsaturated fatty acids and less polyunsaturated acids. Jatropha seed oil contains 30% to 50% polyunsaturated fatty acids (mainly linoleic acid) which negatively impacts the oxidative stability and causes high rate of nitrogen oxides emission. Results The enzyme 1-acyl-2-oleoyl-sn-glycero-3-phosphocholine delta 12-desaturase (FAD2) is the key enzyme responsible for the production of linoleic acid in plants. We identified three putative delta 12 fatty acid desaturase genes in Jatropha (JcFAD2s) through genome-wide analysis and downregulated the expression of one of these genes, JcFAD2-1, in a seed-specific manner by RNA interference technology. The resulting JcFAD2-1 RNA interference transgenic plants showed a dramatic increase of oleic acid (> 78%) and a corresponding reduction in polyunsaturated fatty acids (< 3%) in its seed oil. The control Jatropha had around 37% oleic acid and 41% polyunsaturated fatty acids. This indicates that FAD2-1 is the major enzyme responsible for converting oleic acid to linoleic acid in Jatropha. Due to the changes in the fatty acids profile, the oil of the JcFAD2-1 RNA interference seed was estimated to yield a cetane number as high as 60.2, which is similar to the required cetane number for conventional premium diesel fuels (60) in Europe. The presence of high seed oleic acid did not have a negative impact on other Jatropha agronomic traits based on our preliminary data of the original plants under greenhouse conditions. Further, we developed a marker-free system to generate the transgenic Jatropha that will help reduce public concerns for environmental issues surrounding genetically modified plants. Conclusion In this study we produced seed-specific JcFAD2-1 RNA interference transgenic Jatropha without a selectable marker. We successfully increased the proportion of oleic acid versus linoleic in Jatropha through genetic engineering, enhancing the quality of its oil. PMID:22377043

Backbone and sidechain methyl Ile (δ1), Leu and Val chemical shift assignments of RDE-4 (1-243), an RNA interference initiation protein in C. elegans.

PubMed

Chiliveri, Sai Chaitanya; Kumar, Sonu; Marelli, Udaya Kiran; Deshmukh, Mandar V

2012-10-01

The RNAi pathway of several organisms requires presence of double stranded RNA binding proteins for functioning of Dicer in gene regulation. In C. elegans, a double stranded RNA binding protein, RDE-4 (385 aa, 44 kDa) recognizes long exogenous dsRNA and initiates the RNAi pathway. We have achieved complete backbone and stereospecific methyl sidechain Ile (δ1), Leu and Val chemical shifts of first 243 amino acids of RDE-4, namely RDE-4ΔC.

Development and biophysical characterization of HK polymer for siRNA delivery to tumor in a mouse model

NASA Astrophysics Data System (ADS)

Chou, Szu-Ting

Delivery has been the major obstacle for nucleic acid therapeutics, including the RNA interference (RNAi) approach. Mixson's lab has been focused on the development of a non-viral peptide-based delivery system, HK (histidine-lysine) polymers, which have shown promise as carriers of plasmids and small interference RNA (siRNA) in several cell lines and in tumor-bearing models. In a previous study, a four-branched peptide, denoted H3K(+H)4b, with the predominant repeating -HHHK- sequence in the branch, has been shown to be the most effective and least toxic carrier in vitro and in vivo.. Building on these results, I utilized different approaches including several structure and stability molecular characterization methods to study polyplex and to develop more effective carriers for improved therapy with siRNAs targeting malignancies. To understand the role of histidine in the stability of the H3K(+H)4b/siRNA polyplex, the physicochemical properties were investigated. With the use of isothermal titration calorimetry and heteronuclear single quantum coherence NMR, histidines were shown to form hydrogen bonds with siRNA, which enhanced the stability and biological activity of the polyplexes. In addition, to enhance resistance to nucleases and to target the tumors selectively, H3K(+H)4b was chemically modified with different patterns of polyethylene glycol (PEG) and cyclic RGD (Arg-Gly-Asp, cRGD) peptide conjugates. The luciferase marker gene expressed stably by tumor xenografts in mouse models was targeted in order to evaluate the efficacy of HK carriers of siRNA that differed in location and number of cRGD-PEG attachments. The most effective carrier was (RGD-PEG)4H3K(+H) (RP-HK), which has a cRGD-PEG on each of its four terminal branches. Consistent with its prolonged stability, as observed by pharmacokinetic studies, the RP-HK polyplex down-regulated luciferase activity in tumor xenografts by nearly 70% compared with the untreated group. Subsequently, the RP-HK polyplex was used to target the Raf-1 oncogene, an important mediator of tumor cell growth and angiogenesis. As in the luciferase studies, the polyplex reduced Raf-1 mRNA by more than 75%, and more importantly, the treatment inhibited the tumor growth by 60% in a mouse model. We anticipate that further design and engineering of HK carriers will improve the predictability and therapeutic activity of siRNA polyplexes in cancer treatment.

Two classes of silencing RNAs move between C. elegans tissues

PubMed Central

Jose, Antony M; Garcia, Giancarlo A; Hunter, Craig P

2011-01-01

Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the endonuclease DCR-1, which cleaves long dsRNA into double-stranded short-interfering RNA (ds-siRNA), and the putative nucleotidyltransferase MUT-2 (RDE-3). However, single-stranded siRNA and downstream secondary siRNA produced upon amplification by the RNA-dependent RNA Polymerase RRF-1 do not generate mobile silencing RNA. Restricting inter-tissue transport to long dsRNA and directly processed siRNA intermediates rather than amplified siRNA may serve to modulate the extent of systemic silencing in proportion to available dsRNA. PMID:21984186

Study of the genetic diversity of the aflatoxin biosynthesis cluster in Aspergillus section Flavi using insertion/deletion markers in peanut seeds from Georgia, USA

USDA-ARS?s Scientific Manuscript database

Aflatoxins are among the most powerful carcinogens in nature. The major aflatoxin-producing fungi are Aspergillus flavus and A. parasiticus. Numerous crops, including peanut, are susceptible to aflatoxin contamination by these fungi. There has been an increased use of RNA interference (RNAi) technol...

Effects of endocrine disrupters on the expression of growth hormone and prolactin mRNA in the rainbow trout pituitary.

USDA-ARS?s Scientific Manuscript database

It is now widely accepted that chemical pollutants in the environment can interfere with the endocrine system of animals, thus affecting development and reproduction. Some of these endocrine disrupters (EDs) can have estrogenic or antiestrogenic effects. Most studies to date have focused on the ef...

Microbiota Small RNAs in Inflammatory Bowel Disease.

PubMed

Filip, Anca T; Balacescu, Ovidiu; Marian, Catalin; Anghel, Andrei

2016-12-01

MiRNAs are a class of potential gene regulators of critical importance in Inflammatory Bowel Disease (IBD). This review aims to present the connection between gut microbiota, probiotics administration and microRNA (miRNA) expression in IBD. It also brings into question cross-kingdom RNAi (RNA interference). Not only that gut host cells garden the intestinal microbiome via miRNA, but also strong evidence supports the idea that different species of bacteria have an impact on the intestinal immune response by modulating miRNA expression. Cross-kingdom RNAi refers to RNA silencing signals that travel between two unrelated, interacting organisms. RNAs communication between prokaryotes and eukaryotes (bacteria and nematodes) via RNAs transfer has been proved. Some authors also support the idea that non-coding RNAs are being transferred by bacterial pathogens to the host cells as part of the intracellular infection process. Further studies are required in order to clarify whether the mechanism by which bacteria modulate miRNA expression concerns RNAs transfer. These findings may lead to a different approach to IBD therapy in the future.

Autoantigen La promotes efficient RNAi, antiviral response, and transposon silencing by facilitating multiple-turnover RISC catalysis

PubMed Central

Liu, Ying; Tan, Huiling; Tian, Hui; Liang, Chunyang; Chen, She; Liu, Qinghua

2011-01-01

SUMMARY The effector of RNA interference (RNAi) is the RNA-induced silencing complex (RISC). C3PO promotes the activation of RISC by degrading Argonaute2 (Ago2)-nicked passenger strand of duplex siRNA. Active RISC is a multiple-turnover enzyme that uses the guide strand of siRNA to direct Ago2-mediated sequence-specific cleavage of complementary mRNA. How this effector step of RNAi is regulated is currently unknown. Here, we used human Ago2 minimal RISC system to purify Sjögren’s syndrome antigen B (SSB)/autoantigen La as an activator of the RISC-mediated mRNA cleavage activity. Our reconstitution studies showed that La could promote multiple-turnover RISC catalysis by facilitating the release of cleaved mRNA from RISC. Moreover, we demonstrated that La was required for efficient RNAi, antiviral defense, and transposon silencing in vivo. Taken together, the findings of C3PO and La reveal a general concept that regulatory factors are required to remove Ago2-cleaved products to assemble or restore active RISC. PMID:22055194

The impact of target site accessibility on the design of effective siRNAs.

PubMed

Tafer, Hakim; Ameres, Stefan L; Obernosterer, Gregor; Gebeshuber, Christoph A; Schroeder, Renée; Martinez, Javier; Hofacker, Ivo L

2008-05-01

Small-interfering RNAs (siRNAs) assemble into RISC, the RNA-induced silencing complex, which cleaves complementary mRNAs. Despite their fluctuating efficacy, siRNAs are widely used to assess gene function. Although this limitation could be ascribed, in part, to variations in the assembly and activation of RISC, downstream events in the RNA interference (RNAi) pathway, such as target site accessibility, have so far not been investigated extensively. In this study we present a comprehensive analysis of target RNA structure effects on RNAi by computing the accessibility of the target site for interaction with the siRNA. Based on our observations, we developed a novel siRNA design tool, RNAxs, by combining known siRNA functionality criteria with target site accessibility. We calibrated our method on two data sets comprising 573 siRNAs for 38 genes, and tested it on an independent set of 360 siRNAs targeting four additional genes. Overall, RNAxs proves to be a robust siRNA selection tool that substantially improves the prediction of highly efficient siRNAs.

RNA interference mediated pten knock-down inhibit the formation of polycystic ovary.

PubMed

Ouyang, Jie-Xiu; Luo, Tao; Sun, Hui-Yun; Huang, Jian; Tang, Dan-Feng; Wu, Lei; Zheng, Yue-Hui; Zheng, Li-Ping

2013-08-01

Pten (phosphatase and tensin homolog deleted on chromosome 10), a kind of tumor suppressor gene, plays important roles in female reproductive system. But its expression and roles in the formation of polycystic ovaries are yet to be known. In this study, we constructed a rat model of PCOS using norethindrone and HCG injections and found the expressions of pten mRNA and PTEN protein increased significantly in the polycystic ovary tissue by immunohistochemistry, RT-PCR, and western blot. Furthermore, the results showed that in vivo ovaries could be effectively transfected by lentiviral vectors through the ovarian microinjection method and indicated that pten shRNA may inhibit the formation of polycystic ovaries by pten down-regulation. Our study provides new information regarding the role of PTEN in female reproductive disorders, such as polycystic ovary syndrome.

Mutations of RNA splicing factors in hematological malignancies.

PubMed

Shukla, Girish C; Singh, Jagjit

2017-11-28

Systematic large-scale cancer genomic studies have produced numerous significant findings. These studies have not only revealed new cancer-promoting genes, but they also have identified cancer-promoting functions of previously known "housekeeping" genes. These studies have identified numerous mutations in genes which play a fundamental role in nuclear precursor mRNA splicing. Somatic mutations and copy number variation in many of the splicing factors which participate in the formation of multiple spliceosomal complexes appear to play a role in many cancers and in particular in myelodysplastic syndromes (MDS). Mutated proteins seem to interfere with the recognition of the authentic splice sites (SS) leading to utilization of suboptimal alternative splicing sites generating aberrantly spliced mRNA isoforms. This short review is focusing on the function of the splice factors involved in the formation of splicing complexes and potential mechanisms which affect usage of the authentic splice site recognition. Copyright © 2017 Elsevier B.V. All rights reserved.

In C. elegans, high levels of dsRNA allow RNAi in the absence of RDE-4.

PubMed

Habig, Jeffrey W; Aruscavage, P Joseph; Bass, Brenda L

2008-01-01

C. elegans Dicer requires an accessory double-stranded RNA binding protein, RDE-4, to enact the first step of RNA interference, the cleavage of dsRNA to produce siRNA. While RDE-4 is typically essential for RNAi, we report that in the presence of high concentrations of trigger dsRNA, rde-4 deficient animals are capable of silencing a transgene. By multiple criteria the silencing occurs by the canonical RNAi pathway. For example, silencing is RDE-1 dependent and exhibits a decrease in the targeted mRNA in response to an increase in siRNA. We also find that high concentrations of dsRNA trigger lead to increased accumulation of primary siRNAs, consistent with the existence of a rate-limiting step during the conversion of primary to secondary siRNAs. Our studies also revealed that transgene silencing occurs at low levels in the soma, even in the presence of ADARs, and that at least some siRNAs accumulate in a temperature-dependent manner. We conclude that an RNAi response varies with different conditions, and this may allow an organism to tailor a response to specific environmental signals.

In C. elegans, High Levels of dsRNA Allow RNAi in the Absence of RDE-4

PubMed Central

Habig, Jeffrey W.; Aruscavage, P. Joseph; Bass, Brenda L.

2008-01-01

C. elegans Dicer requires an accessory double-stranded RNA binding protein, RDE-4, to enact the first step of RNA interference, the cleavage of dsRNA to produce siRNA. While RDE-4 is typically essential for RNAi, we report that in the presence of high concentrations of trigger dsRNA, rde-4 deficient animals are capable of silencing a transgene. By multiple criteria the silencing occurs by the canonical RNAi pathway. For example, silencing is RDE-1 dependent and exhibits a decrease in the targeted mRNA in response to an increase in siRNA. We also find that high concentrations of dsRNA trigger lead to increased accumulation of primary siRNAs, consistent with the existence of a rate-limiting step during the conversion of primary to secondary siRNAs. Our studies also revealed that transgene silencing occurs at low levels in the soma, even in the presence of ADARs, and that at least some siRNAs accumulate in a temperature-dependent manner. We conclude that an RNAi response varies with different conditions, and this may allow an organism to tailor a response to specific environmental signals. PMID:19112503

Role of RNA Interference (RNAi) in Dengue Virus Replication and Identification of NS4B as an RNAi Suppressor

PubMed Central

Kakumani, Pavan Kumar; Ponia, Sanket Singh; S, Rajgokul K.; Sood, Vikas; Chinnappan, Mahendran; Banerjea, Akhil C.; Medigeshi, Guruprasad R.; Malhotra, Pawan

2013-01-01

RNA interference (RNAi) is an important antiviral defense response in plants and invertebrates; however, evidences for its contribution to mammalian antiviral defense are few. In the present study, we demonstrate the anti-dengue virus role of RNAi in mammalian cells. Dengue virus infection of Huh 7 cells decreased the mRNA levels of host RNAi factors, namely, Dicer, Drosha, Ago1, and Ago2, and in corollary, silencing of these genes in virus-infected cells enhanced dengue virus replication. In addition, we observed downregulation of many known human microRNAs (miRNAs) in response to viral infection. Using reversion-of-silencing assays, we further showed that NS4B of all four dengue virus serotypes is a potent RNAi suppressor. We generated a series of deletion mutants and demonstrated that NS4B mediates RNAi suppression via its middle and C-terminal domains, namely, transmembrane domain 3 (TMD3) and TMD5. Importantly, the NS4B N-terminal region, including the signal sequence 2K, which has been implicated in interferon (IFN)-antagonistic properties, was not involved in mediating RNAi suppressor activity. Site-directed mutagenesis of conserved residues revealed that a Phe-to-Ala (F112A) mutation in the TMD3 region resulted in a significant reduction of the RNAi suppression activity. The green fluorescent protein (GFP)-small interfering RNA (siRNA) biogenesis of the GFP-silenced line was considerably reduced by wild-type NS4B, while the F112A mutant abrogated this reduction. These results were further confirmed by in vitro dicer assays. Together, our results suggest the involvement of miRNA/RNAi pathways in dengue virus establishment and that dengue virus NS4B protein plays an important role in the modulation of the host RNAi/miRNA pathway to favor dengue virus replication. PMID:23741001

AMPK regulates energy metabolism through the SIRT1 signaling pathway to improve myocardial hypertrophy.

PubMed

Dong, H-W; Zhang, L-F; Bao, S-L

2018-05-01

We investigated the correlations of adenosine monophosphate-activated protein kinase (AMPK), Silence information regulator 1 (SIRT1) and energy metabolism with myocardial hypertrophy. Myocardial hypertrophy experimental model was established via transverse aortic constriction (TAC)-induced myocardial hypertrophy and phenylephrine (PE)-induced hypertrophic myocardial cell culture. After activation of AMPK, the messenger ribonucleic acid (mRNA) expressions in myocardial tissue- and myocardial cell hypertrophy-related genes, atrial natriuretic peptide (ANP) and β-myosin heavy chain (β-MHC), were detected. The production rate of 14C-labeled 14CO2 from palmitic acid was quantitatively determined to detect the fatty acid and glucose oxidation of hypertrophic myocardial tissues or cells, and the glucose uptake of myocardial cells was studied using [14C] glucose. Reverse transcription-polymerase chain reaction (RT-PCR) and Western blotting were performed to detect the changes in SIRT1 mRNA and protein expressions in hypertrophic myocardial tissues. Moreover, SIRT1 small interfering ribonucleic acid (siRNA) was used to interfere in SIRT1 expression to further investigate the role of SIRT1 in the effect of AMPK activation on myocardial hypertrophy. AMPK activation could significantly reduce the mRNA expressions of ANP and β-MHC in vitro and in vivo. AMPK could increase the ejection fraction (EF) and decrease the protein synthesis rate in myocardial cells in mice with myocardial hypertrophy. Besides, AMPK activation could increase the fatty acid oxidation, improve the glucose uptake and reduce the glucose oxidation. After AMPK activation, both SIRT1 mRNA and protein expressions in hypertrophic myocardial tissues and myocardial cells were increased. After SIRT1 siRNA was further used to interfere in SIRT1 expression in myocardial cells, it was found that mRNA expressions and protein synthesis rates of ANP and β-MHC were increased. The activation of AMPK can inhibit the myocardial hypertrophy, which may be realized through regulating the myocardial energy metabolism via SIRT1 signaling pathway.

RNA interference and retinoblastoma-related genes are required for repression of endogenous siRNA targets in Caenorhabditis elegans.

PubMed

Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A

2008-12-23

In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans.

RNA interference and retinoblastoma-related genes are required for repression of endogenous siRNA targets in Caenorhabditis elegans

PubMed Central

Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A.

2008-01-01

In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans. PMID:19073934

Knockdown of genes in the Toll pathway reveals new lethal RNA interference targets for insect pest control.

PubMed

Bingsohn, L; Knorr, E; Billion, A; Narva, K E; Vilcinskas, A

2017-02-01

RNA interference (RNAi) is a promising alternative strategy for ecologically friendly pest management. However, the identification of RNAi candidate genes is challenging owing to the absence of laboratory strains and the seasonality of most pest species. Tribolium castaneum is a well-established model, with a strong and robust RNAi response, which can be used as a high-throughput screening platform to identify potential RNAi target genes. Recently, the cactus gene was identified as a sensitive RNAi target for pest control. To explore whether the spectrum of promising RNAi targets can be expanded beyond those found by random large-scale screening, to encompass others identified using targeted knowledge-based approaches, we constructed a Cactus interaction network. We tested nine genes in this network and found that the delivery of double-stranded RNA corresponding to fusilli and cactin showed lethal effects. The silencing of cactin resulted in 100% lethality at every developmental stage from the larva to the adult. The knockdown of pelle, Dorsal-related immunity factor and short gastrulation reduced or even prevented egg hatching in the next generation. The combination of such targets with lethal and parental RNAi effects can now be tested against different pest species in field studies. © 2016 The Royal Entomological Society.

Isl-1 down-regulates DRG cell proliferation during chicken embryo development.

PubMed

Chen, Dawei; Wang, Guoxin; Luo, Haoshu; Liu, Jiali; Cui, Sheng

2010-01-01

Protein Isl-1 RNA interference and over expression in early chicken embryo dorsal root ganglia (DRG) were used to investigate the function of Isl-1 in DRG cell proliferation. Isl-1 targeted shRNA expression vector and Isl-1 over-expression vector were transfected into chicken embryo DRG by in ovo electroporation. Then, the DRG proliferation rate was detected by BrdU immunohistochemistry. The rate of DRG cell proliferation increased after Isl-1 knock-down and decreased after Isl-1 over-expression. In this study, we found that Isl-1 negatively modulates DRG cell proliferation.

RNA interference of acetylcholinesterase in the Asian citrus psyllid, Diaphorina citri, increases its susceptibility to carbamate and organophosphate insecticides.

PubMed

Kishk, Abdelaziz; Hijaz, Faraj; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Killiny, Nabil

2017-11-01

The Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Lividae) transmits the Candidatus Liberibacter asiaticus, which causes citrus greening disease or Huanglongbing, (HLB). To date, there is no efficient cure for HLB disease and the control of D. citri using insecticides became the most important tools for the management of HLB. However, the extensive use of insecticides could increase D. citri resistance to these insecticides. The objective of this study was to investigate the effect of RNA interference of acetylcholinesterase (AChE) on the mortality and susceptibility of D. citri to the four major insecticides used in Florida. In this study, we used a consensus sequence derived from the two AChE genes and cholinesterase 2-like (ChE-2-like) gene to target all of the three genes. Treatment with dsRNA-AChE increased the mortality percentages of both nymphs and adults of D. citri. The mortality percentage increased with the increase in the concentration of applied dsRNA-AChE, and the highest mortality (> 60%) was observed at the highest applied concentration (125ng/μl). Treatments of nymphs or adults with dsRNA-AChE down-regulated the expression of the three targeted genes of D. citri. Silencing of AChE and ChE in D. citri nymphs increased the susceptibility of emerged adults to chlorpyrifos and carbaryl, which act as AChE inhibitors. However, treatment with dsRNA-AChE did not increase the susceptibility of emerged adults to imidacloprid, which acts as an agonist of nicotinic acetylcholine receptors. In the same manner, treatment of adults with dsRNA-AChE increased their susceptibility to chlorpyrifos and carbaryl, but did not affect their susceptibility to imidacloprid. The ANOVA did not show any significant increase in susceptibility of D. citri adults to fenpropathrin after treatment with dsRNA-AChE, either as nymphs or as adults. However, simple linear regression showed that treatment with dsRNA-AChE increased D. citri susceptibility to fenpropathrin, which indicated that AChE could be involved in the metabolism of fenpropathrin. Our results indicated that silencing of AChE and ChE genes in D. citri to increase its susceptibility to insecticides could be a promising tool for the control of this important vector. Copyright © 2017 Elsevier Inc. All rights reserved.

Silencing of Y-box binding protein-1 by RNA interference inhibits proliferation, invasion, and metastasis, and enhances sensitivity to cisplatin through NF-κB signaling pathway in human neuroblastoma SH-SY5Y cells.

PubMed

Wang, Hong; Sun, Ruowen; Chi, Zuofei; Li, Shuang; Hao, Liangchun

2017-09-01

Y-box binding protein-1 (YB-1), a member of Y-box protein family binding DNA and RNA, has been proposed as a novel marker in multiple malignant tumors and found to be associated with tumor malignancy. Neuroblastoma is an embryonal tumor arising from neuroblast cells of the autonomic nervous system, which is the most common cancer diagnosed in infants. It has been reported that YB-1 is highly expressing in various human tumors including nasopharynx, thyroid, lung, breast, colon, ovary, and prostate cancers. This study aimed to investigate the functional role of YB-1 in neuroblastoma by silencing YB-1 using RNA interference (shRNA) in neuroblastoma SH-SY5Y cells. We found that silencing of YB-1 decreased the proliferation, migration, and invasion of SH-SY5Y cells. At molecular level, inhibition of YB-1 decreased the expression level of PCNA as well as MMP-2 in neuroblastoma SH-SY5Y cells. Also, we discovered that YB-1 silencing sensitized SH-SY5Y cells to cisplatin and promoted the apoptosis induced by cisplatin due to down-regulation of multidrug resistance (MDR) 1 protein via NF-κB signaling pathway. Therefore, we consider that targeting YB-1 is promising for neuroblastoma treatment and for overcoming its cisplatin resistance in the development of new neuroblastoma therapeutic strategies.

Mitochondrial Effects of PGC-1alpha Silencing in MPP+ Treated Human SH-SY5Y Neuroblastoma Cells

PubMed Central

Ye, Qinyong; Chen, Chun; Si, Erwang; Cai, Yousheng; Wang, Juhua; Huang, Wanling; Li, Dongzhu; Wang, Yingqing; Chen, Xiaochun

2017-01-01

The dopaminergic neuron degeneration and loss that occurs in Parkinson’s disease (PD) has been tightly linked to mitochondrial dysfunction. Although the aged-related cause of the mitochondrial defect observed in PD patients remains unclear, nuclear genes are of potential importance to mitochondrial function. Human peroxisome proliferator-activated receptor γ coactivator-1alpha (PGC-1α) is a multi-functional transcription factor that tightly regulates mitochondrial biogenesis and oxidative capacity. The goal of the present study was to explore the potential pathogenic effects of interference by the PGC-1α gene on N-methyl-4-phenylpyridinium ion (MPP+)-induced SH-SY5Y cells. We utilized RNA interference (RNAi) technology to probe the pathogenic consequences of inhibiting PGC-1α in the SH-SY5Y cell line. Remarkably, a reduction in PGC-1α resulted in the reduction of mitochondrial membrane potential, intracellular ATP content and intracellular H2O2 generation, leading to the translocation of cytochrome c (cyt c) to the cytoplasm in the MPP+-induced PD cell model. The expression of related proteins in the signaling pathway (e.g., estrogen-related receptor α (ERRα), nuclear respiratory factor 1 (NRF-1), NRF-2 and Peroxisome proliferator-activated receptor γ (PPARγ)) also decreased. Our finding indicates that small interfering RNA (siRNA) interference targeting the PGC-1α gene could inhibit the function of mitochondria in several capacities and that the PGC-1α gene may modulate mitochondrial function by regulating the expression of ERRα, NRF-1, NRF-2 and PPARγ. Thus, PGC-1α can be considered a potential therapeutic target for PD. PMID:28611589

Vitamin B6 Generated by Obligate Symbionts Is Critical for Maintaining Proline Homeostasis and Fecundity in Tsetse Flies

PubMed Central

Michalkova, Veronika; Weiss, Brian L.; Attardo, Geoffrey M.; Aksoy, Serap

2014-01-01

The viviparous tsetse fly utilizes proline as a hemolymph-borne energy source. In tsetse, biosynthesis of proline from alanine involves the enzyme alanine-glyoxylate aminotransferase (AGAT), which requires pyridoxal phosphate (vitamin B6) as a cofactor. This vitamin can be synthesized by tsetse's obligate symbiont, Wigglesworthia glossinidia. In this study, we examined the role of Wigglesworthia-produced vitamin B6 for maintenance of proline homeostasis, specifically during the energetically expensive lactation period of the tsetse's reproductive cycle. We found that expression of agat, as well as genes involved in vitamin B6 metabolism in both host and symbiont, increases in lactating flies. Removal of symbionts via antibiotic treatment of flies (aposymbiotic) led to hypoprolinemia, reduced levels of vitamin B6 in lactating females, and decreased fecundity. Proline homeostasis and fecundity recovered partially when aposymbiotic tsetse were fed a diet supplemented with either yeast or Wigglesworthia extracts. RNA interference-mediated knockdown of agat in wild-type flies reduced hemolymph proline levels to that of aposymbiotic females. Aposymbiotic flies treated with agat short interfering RNA (siRNA) remained hypoprolinemic even upon dietary supplementation with microbial extracts or B vitamins. Flies infected with parasitic African trypanosomes display lower hemolymph proline levels, suggesting that the reduced fecundity observed in parasitized flies could result from parasite interference with proline homeostasis. This interference could be manifested by competition between tsetse and trypanosomes for vitamins, proline, or other factors involved in their synthesis. Collectively, these results indicate that the presence of Wigglesworthia in tsetse is critical for the maintenance of proline homeostasis through vitamin B6 production. PMID:25038091

Vitamin B6 generated by obligate symbionts is critical for maintaining proline homeostasis and fecundity in tsetse flies.

PubMed

Michalkova, Veronika; Benoit, Joshua B; Weiss, Brian L; Attardo, Geoffrey M; Aksoy, Serap

2014-09-01

The viviparous tsetse fly utilizes proline as a hemolymph-borne energy source. In tsetse, biosynthesis of proline from alanine involves the enzyme alanine-glyoxylate aminotransferase (AGAT), which requires pyridoxal phosphate (vitamin B6) as a cofactor. This vitamin can be synthesized by tsetse's obligate symbiont, Wigglesworthia glossinidia. In this study, we examined the role of Wigglesworthia-produced vitamin B6 for maintenance of proline homeostasis, specifically during the energetically expensive lactation period of the tsetse's reproductive cycle. We found that expression of agat, as well as genes involved in vitamin B6 metabolism in both host and symbiont, increases in lactating flies. Removal of symbionts via antibiotic treatment of flies (aposymbiotic) led to hypoprolinemia, reduced levels of vitamin B6 in lactating females, and decreased fecundity. Proline homeostasis and fecundity recovered partially when aposymbiotic tsetse were fed a diet supplemented with either yeast or Wigglesworthia extracts. RNA interference-mediated knockdown of agat in wild-type flies reduced hemolymph proline levels to that of aposymbiotic females. Aposymbiotic flies treated with agat short interfering RNA (siRNA) remained hypoprolinemic even upon dietary supplementation with microbial extracts or B vitamins. Flies infected with parasitic African trypanosomes display lower hemolymph proline levels, suggesting that the reduced fecundity observed in parasitized flies could result from parasite interference with proline homeostasis. This interference could be manifested by competition between tsetse and trypanosomes for vitamins, proline, or other factors involved in their synthesis. Collectively, these results indicate that the presence of Wigglesworthia in tsetse is critical for the maintenance of proline homeostasis through vitamin B6 production. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Establishment of Functional Genomics Pipeline in Mouse Epiblast-Like Tissue by Combining Transcriptomic Analysis and Gene Knockdown/Knockin/Knockout, Using RNA Interference and CRISPR/Cas9.

PubMed

Takata, Nozomu; Sakakura, Eriko; Kasukawa, Takeya; Sakuma, Tetsushi; Yamamoto, Takashi; Sasai, Yoshiki

2016-06-01

The epiblast (foremost embryonic ectoderm) generates all three germ layers and therefore has crucial roles in the formation of all mammalian body cells. However, regulation of epiblast gene expression is poorly understood because of the difficulty of manipulating epiblast tissues in vivo. In the present study, using the self-organizing properties of mouse embryonic stem cell (ESC), we generated and characterized epiblast-like tissue in three-dimensional culture. We identified significant genome-wide gene expression changes in this epiblast-like tissue by transcriptomic analysis. In addition, we identified the particular significance of the Erk/Mapk and integrin-linked kinase pathways, and genes related to ectoderm/epithelial formation, using the bioinformatics resources IPA and DAVID. Here, we focused on Fgf5, which ranked in the top 10 among the discovered genes. To develop a functional analysis of Fgf5, we created an efficient method combining CRISPR/Cas9-mediated genome engineering and RNA interference (RNAi). Notably, we show one-step generation of various Fgf5 reporter lines including heterozygous and homozygous knockins (the GET method). For time- and dose-dependent depletion of fgf5 over the course of development, we generated an ESC line harboring Tol2 transposon-mediated integration of an inducible short hairpin RNA interference system (pdiRNAi). Our findings raised the possibility that Fgf/Erk signaling and apicobasal epithelial integrity are important factors in epiblast development. In addition, our methods provide a framework for a broad array of applications in the areas of mammalian genetics and molecular biology to understand development and to improve future therapeutics.

Promoter of lncRNA Gene PVT1 Is a Tumor-Suppressor DNA Boundary Element. | Office of Cancer Genomics

Cancer.gov

Noncoding mutations in cancer genomes are frequent but challenging to interpret. PVT1 encodes an oncogenic lncRNA, but recurrent translocations and deletions in human cancers suggest alternative mechanisms. Here, we show that the PVT1 promoter has a tumor-suppressor function that is independent of PVT1 lncRNA. CRISPR interference of PVT1 promoter enhances breast cancer cell competition and growth in vivo.

Sequence-specific inhibition of Dicer measured with a force-based microarray for RNA ligands.

PubMed

Limmer, Katja; Aschenbrenner, Daniela; Gaub, Hermann E

2013-04-01

Malfunction of protein translation causes many severe diseases, and suitable correction strategies may become the basis of effective therapies. One major regulatory element of protein translation is the nuclease Dicer that cuts double-stranded RNA independently of the sequence into pieces of 19-22 base pairs starting the RNA interference pathway and activating miRNAs. Inhibiting Dicer is not desirable owing to its multifunctional influence on the cell's gene regulation. Blocking specific RNA sequences by small-molecule binding, however, is a promising approach to affect the cell's condition in a controlled manner. A label-free assay for the screening of site-specific interference of small molecules with Dicer activity is thus needed. We used the Molecular Force Assay (MFA), recently developed in our lab, to measure the activity of Dicer. As a model system, we used an RNA sequence that forms an aptamer-binding site for paromomycin, a 615-dalton aminoglycoside. We show that Dicer activity is modulated as a function of concentration and incubation time: the addition of paromomycin leads to a decrease of Dicer activity according to the amount of ligand. The measured dissociation constant of paromomycin to its aptamer was found to agree well with literature values. The parallel format of the MFA allows a large-scale search and analysis for ligands for any RNA sequence.

Efficient HIV-1 inhibition by a 16 nt-long RNA aptamer designed by combining in vitro selection and in silico optimisation strategies

PubMed Central

Sánchez-Luque, Francisco J.; Stich, Michael; Manrubia, Susanna; Briones, Carlos; Berzal-Herranz, Alfredo

2014-01-01

The human immunodeficiency virus type-1 (HIV-1) genome contains multiple, highly conserved structural RNA domains that play key roles in essential viral processes. Interference with the function of these RNA domains either by disrupting their structures or by blocking their interaction with viral or cellular factors may seriously compromise HIV-1 viability. RNA aptamers are amongst the most promising synthetic molecules able to interact with structural domains of viral genomes. However, aptamer shortening up to their minimal active domain is usually necessary for scaling up production, what requires very time-consuming, trial-and-error approaches. Here we report on the in vitro selection of 64 nt-long specific aptamers against the complete 5′-untranslated region of HIV-1 genome, which inhibit more than 75% of HIV-1 production in a human cell line. The analysis of the selected sequences and structures allowed for the identification of a highly conserved 16 nt-long stem-loop motif containing a common 8 nt-long apical loop. Based on this result, an in silico designed 16 nt-long RNA aptamer, termed RNApt16, was synthesized, with sequence 5′-CCCCGGCAAGGAGGGG-3′. The HIV-1 inhibition efficiency of such an aptamer was close to 85%, thus constituting the shortest RNA molecule so far described that efficiently interferes with HIV-1 replication. PMID:25175101

Antiviral RNA silencing initiated in the absence of RDE-4, a double-stranded RNA binding protein, in Caenorhabditis elegans.

PubMed

Guo, Xunyang; Zhang, Rui; Wang, Jeffrey; Lu, Rui

2013-10-01

Small interfering RNAs (siRNAs) processed from double-stranded RNA (dsRNA) of virus origins mediate potent antiviral defense through a process referred to as RNA interference (RNAi) or RNA silencing in diverse organisms. In the simple invertebrate Caenorhabditis elegans, the RNAi process is initiated by a single Dicer, which partners with the dsRNA binding protein RDE-4 to process dsRNA into viral siRNAs (viRNAs). Notably, in C. elegans this RNA-directed viral immunity (RDVI) also requires a number of worm-specific genes for its full antiviral potential. One such gene is rsd-2 (RNAi spreading defective 2), which was implicated in RDVI in our previous studies. In the current study, we first established an antiviral role by showing that rsd-2 null mutants permitted higher levels of viral RNA accumulation, and that this enhanced viral susceptibility was reversed by ectopic expression of RSD-2. We then examined the relationship of rsd-2 with other known components of RNAi pathways and established that rsd-2 functions in a novel pathway that is independent of rde-4 but likely requires the RNA-dependent RNA polymerase RRF-1, suggesting a critical role for RSD-2 in secondary viRNA biogenesis, likely through coordinated action with RRF-1. Together, these results suggest that RDVI in the single-Dicer organism C. elegans depends on the collective actions of both RDE-4-dependent and RDE-4-independent mechanisms to produce RNAi-inducing viRNAs. Our study reveals, for the first time, a novel siRNA-producing mechanism in C. elegans that bypasses the need for a dsRNA-binding protein.

Antiviral RNA Silencing Initiated in the Absence of RDE-4, a Double-Stranded RNA Binding Protein, in Caenorhabditis elegans

PubMed Central

Guo, Xunyang; Zhang, Rui; Wang, Jeffrey

2013-01-01

Small interfering RNAs (siRNAs) processed from double-stranded RNA (dsRNA) of virus origins mediate potent antiviral defense through a process referred to as RNA interference (RNAi) or RNA silencing in diverse organisms. In the simple invertebrate Caenorhabditis elegans, the RNAi process is initiated by a single Dicer, which partners with the dsRNA binding protein RDE-4 to process dsRNA into viral siRNAs (viRNAs). Notably, in C. elegans this RNA-directed viral immunity (RDVI) also requires a number of worm-specific genes for its full antiviral potential. One such gene is rsd-2 (RNAi spreading defective 2), which was implicated in RDVI in our previous studies. In the current study, we first established an antiviral role by showing that rsd-2 null mutants permitted higher levels of viral RNA accumulation, and that this enhanced viral susceptibility was reversed by ectopic expression of RSD-2. We then examined the relationship of rsd-2 with other known components of RNAi pathways and established that rsd-2 functions in a novel pathway that is independent of rde-4 but likely requires the RNA-dependent RNA polymerase RRF-1, suggesting a critical role for RSD-2 in secondary viRNA biogenesis, likely through coordinated action with RRF-1. Together, these results suggest that RDVI in the single-Dicer organism C. elegans depends on the collective actions of both RDE-4-dependent and RDE-4-independent mechanisms to produce RNAi-inducing viRNAs. Our study reveals, for the first time, a novel siRNA-producing mechanism in C. elegans that bypasses the need for a dsRNA-binding protein. PMID:23885080

RNAi-mediated mortality of the whitefly through transgenic expression of double-stranded RNA homologous to acetylcholinesterase and ecdysone receptor in tobacco plants

USDA-ARS?s Scientific Manuscript database

The whitefly Bemisia tabaci (Genn.) is a pest and vector of plant viruses affecting plants worldwide. Using RNA interference (RNAi) to downregulate whitefly genes by expressing their homologous double stranded RNAs in plants has great potential for management of whiteflies to reduce plant virus dise...

Double strand RNA oral delivery methods to induce RNA interference in phloem and plant-sap-feeding insects

USDA-ARS?s Scientific Manuscript database

Phloem and plant sap feeding insect pests invade the integrity of crops and fruits to retrieve nutrients in the process damaging food productivity. Hemipteran insects account for a number of economically substantial pests of plants that cause damage to crops by feeding on phloem sap. Halyomorpha hal...

RNA interference: Applications and advances in insect toxicology and insect pest management.

PubMed

Kim, Young Ho; Soumaila Issa, Moustapha; Cooper, Anastasia M W; Zhu, Kun Yan

2015-05-01

Since its discovery, RNA interference (RNAi) has revolutionized functional genomic studies due to its sequence-specific nature of post-transcriptional gene silencing. In this paper, we provide a comprehensive review of the recent literature and summarize the current knowledge and advances in the applications of RNAi technologies in the field of insect toxicology and insect pest management. Many recent studies have focused on identification and validation of the genes encoding insecticide target proteins, such as acetylcholinesterases, ion channels, Bacillus thuringiensis receptors, and other receptors in the nervous system. RNAi technologies have also been widely applied to reveal the role of genes encoding cytochrome P450 monooxygenases, carboxylesterases, and glutathione S-transferases in insecticide detoxification and resistance. More recently, studies have focused on understanding the mechanism of insecticide-mediated up-regulation of detoxification genes in insects. As RNAi has already shown great potentials for insect pest management, many recent studies have also focused on host-induced gene silencing, in which several RNAi-based transgenic plants have been developed and tested as proof of concept for insect pest management. These studies indicate that RNAi is a valuable tool to address various fundamental questions in insect toxicology and may soon become an effective strategy for insect pest management. Copyright © 2015 Elsevier Inc. All rights reserved.

[Inhibitory effect of RNA interference targeting GFI-1 on the proliferation of atypical chronic myelogenous leukemia NT1 cells].

PubMed

Yang, X; Liu, H; Lin, Z H; Qian, J; Xu, X R

2016-08-01

To investigate the inhibitory effects of RNA interference targeting GFI-1 on growth and proliferation of atypical chronic myelogenous leukemia (aCML) NT1 cells. NT1 cells were transfected with PBS and liposome complex (vehicle group), scrambled siRNA and liposome complex (negative control, NC group), and GFI-1 siRNA and liposome complex (GFI-1 siRNA group), respectively. Real-time quantitative RT-PCR (qRT-PCR) and Western blot were performed to examine the expression levels of GFI-1 mRNA and protein, respectively. The proliferation abilities of NT1 cells of the three groups were evaluated by MTT assay. The cell cycle in cells of the three groups was analyzed by flow cytometry. Moreover, nude mouse xenograft model was used to detect the tumor formation ability in the three group cells. Quantitative real-time PCR data showed that the expression level of GFI-1 mRNA in GFI-1 siRNA group was significantly lower than those of NC group and vehicle group [(0.367±0.017) vs. (0.918±0.006) and (1.010±0.005), respectively, (P<0.05)]. Western blot results showed that the GFI-1 protein expression level in the GFI-1 siRNA group was also significantly reduced, compared with those of the NC group and vehicle group (P<0.05 for both). From MTT assay data, the absorbance value of NT1 cells in the GFI-1 siRNA group (0.667±0.059) was significantly lower than those of the NC group (1.096±0.049) and vehicle group (1.193±0.064, P=0.023). Flow cytometry data showed that sub-G1 and G0/G1 phase proportions of the GFI-1 siRNA group were significantly higher than those of the NC and vehicle groups [sub-G1: (8.2±2.5)% vs. (1.9±1.3)% and (2.0±3.6)%, respectively, (P<0.05); G0/G1: (66.7±3.8)% vs. (53.3±4.5)% and (48.6±3.2)%, respectively, (P<0.05)]. Furthermore, the tumor weight in the GFI-1 siRNA group [(0.37±0.02) g] was significantly lower than those in the NC group [(0.83±0.06) g] and vehicle group [(0.92±0.04) g] (P<0.05). RNA interference targeting GFI-1 inhibits the growth and proliferation of NT1 cells, which may provide a new therapeutic target for atypical chronic myelogenous leukemia.

Insights on ornithine decarboxylase silencing as a potential strategy for targeting retinoblastoma.

PubMed

Muthukumaran, Sivashanmugam; Bhuvanasundar, Renganathan; Umashankar, Vetrivel; Sulochana, K N

2018-02-01

Ornithine Decarboxylase (ODC) is a key enzyme involved in polyamine synthesis and is reported to be up regulated in several cancers. However, the effect of ODC gene silencing in retinoblastoma is to be understood for utilization in therapeutic applications. Hence, in this study, a novel siRNA (small interference RNA) targeting ODC was designed and validated in Human Y79 retinoblastoma cells for its effects on intracellular polyamine levels, Matrix Metalloproteinase 2 & 9 activity and Cell cycle. The designed siRNA showed efficient silencing of ODC mRNA expression and protein levels in Y79 cells. It also showed significant reduction of intracellular polyamine levels and altered levels of oncogenic LIN28b expression. By this study, a regulatory loop is proposed, wherein, ODC silencing in Y79 cells to result in decreased polyamine levels, thereby, leading to altered protein levels of Lin28b, MMP-2 and MMP-9, which falls in line with earlier studies in neuroblastoma. Thus, by this study, we propose ODC silencing as a prospective strategy for targeting retinoblastoma. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

RNA interference targeting cytosolic NADP(+)-dependent isocitrate dehydrogenase exerts anti-obesity effect in vitro and in vivo.

PubMed

Nam, Woo Suk; Park, Kwon Moo; Park, Jeen-Woo

2012-08-01

A metabolic abnormality in lipid biosynthesis is frequently associated with obesity and hyperlipidemia. Nicotinamide adenine dinucleotide phosphate-oxidase (NADPH) is an essential reducing equivalent for numerous enzymes required in fat and cholesterol biosynthesis. Cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) has been proposed as a key enzyme for supplying cytosolic NADPH. We report here that knockdown of IDPc expression by Ribonucleic acid (RNA) interference (RNAi) inhibited adipocyte differentiation and lipogenesis in 3T3-L1 preadipocytes and mice. Attenuated IDPc expression by IDPc small interfering RNA (siRNA) resulted in a reduction of differentiation and triglyceride level and adipogenic protein expression as well as suppression of glucose uptake in cultured adipocytes. In addition, the attenuation of Nox activity and Reactive oxygen species (ROS) generation accompanied with knockdown of IDPc was associated with inhibition of adipogenesis and lipogenesis. The loss of body weight and the reduction of triglyceride level were also observed in diet-induced obese mice transduced with IDPc short-hairpin (shRNA). Taken together, the inhibiting effect of RNAi targeting IDPc on adipogenesis and lipid biosynthesis is considered to be of therapeutic value in the treatment and prevention of obesity and obesity-associated metabolic syndrome. © 2012 Elsevier B.V. All rights reserved.

RNA interference mediated in human primary cells via recombinant baculoviral vectors.

PubMed

Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T

2005-04-01

The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.

siRNA Delivery to the Lung: What’s New?

PubMed Central

Merkel, Olivia M.; Rubinstein, Israel; Kissel, Thomas

2014-01-01

RNA interference (RNAi) has been thought of as the general answer to many unmet medical needs. After the first success stories, it soon became obvious that short interfering RNA (siRNA) is not suitable for systemic administration due to its poor pharmacokinetics. Therefore local administration routes have been adopted for more successful in vivo RNAi. This paper reviews nucleic acid modifications, nanocarrier chemistry, animal models used in successful pulmonary siRNA delivery, as well as clinical translation approaches. We summarize what has been published recently and conclude with the potential problems that may still hamper the efficient clinical application of RNAi in the lung. PMID:24907426

Improving Small Interfering RNA Delivery In Vivo Through Lipid Conjugation.

PubMed

Osborn, Maire F; Khvorova, Anastasia

2018-05-10

RNA interference (RNAi)-based therapeutics are approaching clinical approval for genetically defined diseases. Current clinical success is a result of significant innovations in the development of chemical architectures that support sustained, multi-month efficacy in vivo following a single administration. Conjugate-mediated delivery has established itself as the most promising platform for safe and targeted small interfering RNA (siRNA) delivery. Lipophilic conjugates represent a major class of modifications that improve siRNA pharmacokinetics and enable efficacy in a broad range of tissues. Here, we review current literature and define key features and limitations of this approach for in vivo modulation of gene expression.

Illuminating the gateway of gene silencing: perspective of RNA interference technology in clinical therapeutics.

PubMed

Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok

2012-07-01

A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.

Gene interactions in the DNA damage-response pathway identified by genome-wide RNA-interference analysis of synthetic lethality

PubMed Central

van Haaften, Gijs; Vastenhouw, Nadine L.; Nollen, Ellen A. A.; Plasterk, Ronald H. A.; Tijsterman, Marcel

2004-01-01

Here, we describe a systematic search for synthetic gene interactions in a multicellular organism, the nematode Caenorhabditis elegans. We established a high-throughput method to determine synthetic gene interactions by genome-wide RNA interference and identified genes that are required to protect the germ line against DNA double-strand breaks. Besides known DNA-repair proteins such as the C. elegans orthologs of TopBP1, RPA2, and RAD51, eight genes previously unassociated with a double-strand-break response were identified. Knockdown of these genes increased sensitivity to ionizing radiation and camptothecin and resulted in increased chromosomal nondisjunction. All genes have human orthologs that may play a role in human carcinogenesis. PMID:15326288

Proteomics for understanding miRNA biology.

PubMed

Huang, Tai-Chung; Pinto, Sneha M; Pandey, Akhilesh

2013-02-01

MicroRNAs (miRNAs) are small noncoding RNAs that play important roles in posttranscriptional regulation of gene expression. Mature miRNAs associate with the RNA interference silencing complex to repress mRNA translation and/or degrade mRNA transcripts. Mass spectrometry-based proteomics has enabled identification of several core components of the canonical miRNA processing pathway and their posttranslational modifications which are pivotal in miRNA regulatory mechanisms. The use of quantitative proteomic strategies has also emerged as a key technique for experimental identification of miRNA targets by allowing direct determination of proteins whose levels are altered because of translational suppression. This review focuses on the role of proteomics and labeling strategies to understand miRNA biology. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts

PubMed Central

Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng

2014-01-01

Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645

Cellular La protein shields nonsegmented negative-strand RNA viral leader RNA from RIG-I and enhances virus growth by diverse mechanisms.

PubMed

Bitko, Vira; Musiyenko, Alla; Bayfield, Mark A; Maraia, Richard J; Barik, Sailen

2008-08-01

The La antigen (SS-B) associates with a wide variety of cellular and viral RNAs to affect gene expression in multiple systems. We show that La is the major cellular protein found to be associated with the abundant 44-nucleotide viral leader RNA (leRNA) early after infection with respiratory syncytial virus (RSV), a nonsegmented negative-strand RNA virus. Consistent with this, La redistributes from the nucleus to the cytoplasm in RSV-infected cells. Upon RNA interference knockdown of La, leRNA is redirected to associate with the RNA-binding protein RIG-I, a known activator of interferon (IFN) gene expression, and this is accompanied by the early induction of IFN mRNA. These results suggest that La shields leRNA from RIG-I, abrogating the early viral activation of type I IFN. We mapped the leRNA binding function to RNA recognition motif 1 of La and showed that while wild-type La greatly enhanced RSV growth, a La mutant defective in RSV leRNA binding also did not support RSV growth. Comparative studies of RSV and Sendai virus and the use of IFN-negative Vero cells indicated that La supports the growth of nonsegmented negative-strand RNA viruses by both IFN suppression and a potentially novel IFN-independent mechanism.

Galactosylated magnetic nanovectors for regulation of lipid metabolism based on biomarker-specific RNAi and MR imaging.

PubMed

Heo, Dan; Lee, Chanjoo; Ku, Minhee; Haam, Seungjoo; Suh, Jin-Suck; Huh, Yong-Min; Park, Sahng Wook; Yang, Jaemoon

2015-08-21

The specific delivery of ribonucleic acid (RNA) interfering molecules to disease-related cells is still a critical blockade for in vivo systemic treatment. Here, this study suggests a robust delivery carrier for targeted delivery of RNA-interfering molecules using galactosylated magnetic nanovectors (gMNVs). gMNVs are an organic-inorganic polymeric nanomaterial composed of polycationics and magnetic nanocrystal for delivery of RNA-interfering molecules and tracking via magnetic resonance (MR) imaging. In particular, the surface of gMNVs was modified by galactosylgluconic groups for targeted delivering to asialoglycoprotein receptor (ASGPR) of hepatocytes. Moreover, the small interfering RNAs were used to regulate target proteins related with low-density lipoprotein level and in vivo MR imaging was conducted for tracking of nanovectors. The obtained results show that the prepared gMNVs demonstrate potential as a systemic theragnostic nanoplatform for RNA interference and MR imaging.

RNA interference technology in crop protection against arthropod pests, pathogens and nematodes.

PubMed

Zotti, Moises; Dos Santos, Ericmar Avila; Cagliari, Deise; Christiaens, Olivier; Taning, Clauvis Nji Tizi; Smagghe, Guy

2018-06-01

Scientists have made significant progress in understanding and unraveling several aspects of double-stranded RNA (dsRNA)-mediated gene silencing during the last two decades. Now that the RNA interference (RNAi) mechanism is well understood, it is time to consider how to apply the acquired knowledge to agriculture and crop protection. Some RNAi-based products are already available for farmers and more are expected to reach the market soon. Tailor-made dsRNA as an active ingredient for biopesticide formulations is considered a raw material that can be used for diverse purposes, from pest control and bee protection against viruses to pesticide resistance management. The RNAi mechanism works at the messenger RNA (mRNA) level, exploiting a sequence-dependent mode of action, which makes it unique in potency and selectivity compared with conventional agrochemicals. Furthermore, the use of RNAi in crop protection can be achieved by employing plant-incorporated protectants through plant transformation, but also by non-transformative strategies such as the use of formulations of sprayable RNAs as direct control agents, resistance factor repressors or developmental disruptors. In this review, RNAi is presented in an agricultural context (discussing products that have been launched on the market or will soon be available), and we go beyond the classical presentation of successful examples of RNAi in pest-insect control and comprehensively explore its potential for the control of plant pathogens, nematodes and mites, and to fight against diseases and parasites in beneficial insects. Moreover, we also discuss its use as a repressor for the management of pesticide-resistant weeds and insects. Finally, this review reports on the advances in non-transformative dsRNA delivery and the production costs of dsRNA, and discusses environmental considerations. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Aedes aegypti uses RNA interference in defense against Sindbis virus infection.

PubMed

Campbell, Corey L; Keene, Kimberly M; Brackney, Douglas E; Olson, Ken E; Blair, Carol D; Wilusz, Jeffrey; Foy, Brian D

2008-03-17

RNA interference (RNAi) is an important anti-viral defense mechanism. The Aedes aegypti genome encodes RNAi component orthologs, however, most populations of this mosquito are readily infected by, and subsequently transmit flaviviruses and alphaviruses. The goal of this study was to use Ae. aegypti as a model system to determine how the mosquito's anti-viral RNAi pathway interacts with recombinant Sindbis virus (SINV; family Togaviridae, genus Alphavirus). SINV (TR339-eGFP) (+) strand RNA, infectious virus titers and infection rates transiently increased in mosquitoes following dsRNA injection to cognate Ago2, Dcr2, or TSN mRNAs. Detection of SINV RNA-derived small RNAs at 2 and 7 days post-infection in non-silenced mosquitoes provided important confirmation of RNAi pathway activity. Two different recombinant SINV viruses (MRE16-eGFP and TR339-eGFP) with significant differences in infection kinetics were used to delineate vector/virus interactions in the midgut. We show virus-dependent effects on RNAi component transcript and protein levels during infection. Monitoring midgut Ago2, Dcr2, and TSN transcript levels during infection revealed that only TSN transcripts were significantly increased in midguts over blood-fed controls. Ago2 protein levels were depleted immediately following a non-infectious bloodmeal and varied during SINV infection in a virus-dependent manner. We show that silencing RNAi components in Ae. aegypti results in transient increases in SINV replication. Furthermore, Ae. aegypti RNAi is active during SINV infection as indicated by production of virus-specific siRNAs. Lastly, the RNAi response varies in a virus-dependent manner. These data define important features of RNAi anti-viral defense in Ae. aegypti.

Roles of Heparan Sulfate Sulfation in Dentinogenesis*

PubMed Central

Hayano, Satoru; Kurosaka, Hiroshi; Yanagita, Takeshi; Kalus, Ina; Milz, Fabian; Ishihara, Yoshihito; Islam, Md. Nurul; Kawanabe, Noriaki; Saito, Masahiro; Kamioka, Hiroshi; Adachi, Taiji; Dierks, Thomas; Yamashiro, Takashi

2012-01-01

Cell surface heparan sulfate (HS) is an essential regulator of cell signaling and development. HS traps signaling molecules, like Wnt in the glycosaminoglycan side chains of HS proteoglycans (HSPGs), and regulates their functions. Endosulfatases Sulf1 and Sulf2 are secreted at the cell surface to selectively remove 6-O-sulfate groups from HSPGs, thereby modifying the affinity of cell surface HSPGs for its ligands. This study provides molecular evidence for the functional roles of HSPG sulfation and desulfation in dentinogenesis. We show that odontogenic cells are highly sulfated on the cell surface and become desulfated during their differentiation to odontoblasts, which produce tooth dentin. Sulf1/Sulf2 double null mutant mice exhibit a thin dentin matrix and short roots combined with reduced expression of dentin sialophosphoprotein (Dspp) mRNA, encoding a dentin-specific extracellular matrix precursor protein, whereas single Sulf mutants do not show such defective phenotypes. In odontoblast cell lines, Dspp mRNA expression is potentiated by the activation of the Wnt canonical signaling pathway. In addition, pharmacological interference with HS sulfation promotes Dspp mRNA expression through activation of Wnt signaling. On the contrary, the silencing of Sulf suppresses the Wnt signaling pathway and subsequently Dspp mRNA expression. We also show that Wnt10a protein binds to cell surface HSPGs in odontoblasts, and interference with HS sulfation decreases the binding affinity of Wnt10a for HSPGs, which facilitates the binding of Wnt10a to its receptor and potentiates the Wnt signaling pathway, thereby up-regulating Dspp mRNA expression. These results demonstrate that Sulf-mediated desulfation of cellular HSPGs is an important modification that is critical for the activation of the Wnt signaling in odontoblasts and for production of the dentin matrix. PMID:22351753

PsOr1, a potential target for RNA interference-based pest management.

PubMed

Zhao, Y Y; Liu, F; Yang, G; You, M S

2011-02-01

Insect pests cause billions of dollars in agricultural losses, and attempts to kill them have resulted in growing threats from insecticide resistance, dietary pesticide pollution and environmental destruction. New approaches to control refractory insect pests are therefore needed. The host-plant preferences of insect pests rely on olfaction and are mediated via a seven transmembrane-domain odorant receptor (Or) family. The present study reports the cloning and characterization of PsOr1, the first candidate member of the Or gene family from Phyllotreta striolata, a devastating beetle pest that causes damage worldwide. PsOr1 is remarkably well conserved with respect to other insect orthologues, including DmOr83b from Drosophila melanogaster. These insect orthologues form an essential non-conventional Or sub-family and may play an important and generalized role in insect olfaction. We designed double-stranded (ds) RNA directly against the PsOr1 gene and exploited RNA interference (RNAi) to control P. striolata. The chemotactic behavioural measurements showed that adult beetles were unable to sense the attractant or repellent odour stimulus after microinjection of dsRNA against PsOr1. Reverse Transcription (RT)-PCR analysis showed specific down-regulation of mRNA transcript levels for this gene. Furthermore, host-plant preference experiments confirmed that silencing PsOr1 by RNAi treatment impaired the host-plant preferences of P. striolata for cruciferous vegetables. These results demonstrate that this insect control approach of using RNAi to target PsOr1 and its orthologues might be effective in blocking host-plant-seeking behaviours in diverse insect pests. The results also support the theory that this unique receptor type plays an essential general role in insect olfaction. © 2010 Fujian Agriculture and Forestry University. Insect Molecular Biology © 2010 The Royal Entomological Society.

New basic approach to treat non-small cell lung cancer based on RNA-interference.

PubMed

Makowiecki, Christina; Nolte, Andrea; Sutaj, Besmire; Keller, Timea; Avci-Adali, Meltem; Stoll, Heidi; Schlensak, Christian; Wendel, Hans Peter; Walker, Tobias

2014-03-01

To date the therapy for non-small cell lung cancer (NSCLC) is associated with severe side effects, frustrating outcomes, and does not consider different tumor characteristics. The RNA-interference (RNAi) pathway represents a potential new approach to treat NSCLC. With small interfering ribonucleic acids (siRNAs), it is possible to reduce the expression of proliferation-dependent proteins in tumor cells, leading to their apoptosis. We propose that siRNAs could be adapted to the tumor type and may cause fewer side effects than current therapy. Four NSCLC cell lines were cultured under standard conditions and transfected with three different concentrations of siRNAs targeted against the hypoxia-inducible factors 1α and 2α (HIF1α and HIF2α) and signal transducer and activator of transcription 3 (STAT3). The expression was observed by quantitative real-time polymerase chain reaction and western blots. For the analysis of cell growth three days after transfection, the cell number was detected using a CASY cell counter system. The results of the silencing of the analyzed factors differ in each cell line. Cell growth was significantly reduced in all cell lines after transfection with HIF1α- and STAT3-siRNA. The silencing of HIF2α resulted in a significant effect on cell growth in squamous, and large-cell lung cancer. This study shows that the knockdown and viability to siRNA transfection differ in each tumor type according to the used siRNA. This implies that the tumor types differ among themselves and should be treated differently. Therefore, the authors suggest a possible approach to a more personalized treatment of NSCLC.

Silencing of ecdysone receptor, insect intestinal mucin and sericotropin genes by bacterially produced double-stranded RNA affects larval growth and development in Plutella xylostella and Helicoverpa armigera.

PubMed

Israni, B; Rajam, M V

2017-04-01

RNA interference mediated gene silencing, which is triggered by double-stranded RNA (dsRNA), has become a important tool for functional genomics studies in various systems, including insects. Bacterially produced dsRNA employs the use of a bacterial strain lacking in RNaseIII activity and harbouring a vector with dual T7 promoter sites, which allow the production of intact dsRNA molecules. Here, we report an assessment of the functional relevance of the ecdysone receptor, insect intestinal mucin and sericotropin genes through silencing by dsRNA in two lepidopteran insect pests, Helicoverpa armigera and Plutella xylostella, both of which cause serious crop losses. Oral feeding of dsRNA led to significant reduction in transcripts of the target insect genes, which caused significant larval mortality with various moulting anomalies and an overall developmental delay. We also found a significant decrease in reproductive potential in female moths, with a drop in egg laying and compromised egg hatching from treated larvae as compared to controls. dsRNA was stable in the insect gut and was efficiently processed into small interfering RNAs (siRNAs), thus accounting for the phenotypes observed in the present work. The study revealed the importance of these genes in core insect processes, which are essential for insect development and survival. © 2016 The Royal Entomological Society.

Effective mRNA Inhibition in PANC-1 Cells in Vitro Mediated via an mPEG-SeSe-PEI Delivery System.

PubMed

Zhang, Yuefeng; Yang, Bin; Liu, Yajie; Qin, Wenjie; Li, Chao; Wang, Lantian; Zheng, Wen; Wu, Yulian

2016-05-01

RNA interference (RNAi)-mediated gene therapy is a promising approach to cure various diseases. However, developing an effective, safe, specific RNAi delivery system remains a major challenge. In this study, a novel redox-responsive polyetherimide (PEI)-based nanovector, mPEG-SeSe-PEI, was developed and its efficacy evaluated. We prepared three mPEG-SeSe-PEI vector candidates for small interfering glyceraldehyde-3-phosphate dehydrogenase (siGADPH) and determined their physiochemical properties and transfection efficiency using flow cytometry and PEG11.6-SeSe-PEI polymer. We investigated the silencing efficacy of GADPH mRNA expression in PANC-1 cells and observed that PEG11.6-SeSe-PEI/siGADPH (N/P ratio=10) polyplexes possessed the appropriate size and zeta-potential and exhibited excellent in vitro gene silencing effects with the least cytotoxicity in PANC-1 cells. In conclusion, we present PEG11.6-SeSe-PEI as a potential therapeutic gene delivery system for small interfering RNA (siRNA).

Efficient generation of transgenic reporter strains and analysis of expression patterns in Caenorhabditis elegans using Library MosSCI

PubMed Central

Kaymak, Ebru; Farley, Brian M.; Hay, Samantha A.; Li, Chihua; Ho, Samantha; Hartman, Daniel J.; Ryder, Sean P.

2016-01-01

Background In C. elegans, germline development and early embryogenesis rely on post-transcriptional regulation of maternally transcribed mRNAs. In many cases, the 3′UTR is sufficient to govern the expression patterns of these transcripts. Several RNA-binding proteins are required to regulate maternal mRNAs through the 3′UTR. Despite intensive efforts to map RNA-binding protein-mRNA interactions in vivo, the biological impact of most binding events remains unknown. Reporter studies using single copy integrated transgenes are essential to evaluate the functional consequences of interactions between RNA-binding proteins and their associated mRNAs. Results In this report, we present an efficient method of generating reporter strains with improved throughput by using a library variant of MosSCI transgenesis. Furthermore, using RNA interference, we identify the suite of RBPs that control the expression pattern of five different maternal mRNAs. Conclusions The results provide a generalizable and efficient strategy to assess the functional relevance of protein-RNA interactions in vivo, and reveal new regulatory connections between key RNA-binding proteins and their maternal mRNA targets. PMID:27294288

Specific Silencing of L392V PSEN1 Mutant Allele by RNA Interference

PubMed Central

Sierant, Malgorzata; Paduszynska, Alina; Kazmierczak-Baranska, Julia; Nacmias, Benedetta; Sorbi, Sandro; Bagnoli, Silvia; Sochacka, Elzbieta; Nawrot, Barbara

2011-01-01

RNA interference (RNAi) technology provides a powerful molecular tool to reduce an expression of selected genes in eukaryotic cells. Short interfering RNAs (siRNAs) are the effector molecules that trigger RNAi. Here, we describe siRNAs that discriminate between the wild type and mutant (1174 C→G) alleles of human Presenilin1 gene (PSEN1). This mutation, resulting in L392V PSEN1 variant, contributes to early onset familial Alzheimer's disease. Using the dual fluorescence assay, flow cytometry and fluorescent microscopy we identified positions 8th–11th, within the central part of the antisense strand, as the most sensitive to mismatches. 2-Thiouridine chemical modification introduced at the 3′-end of the antisense strand improved the allele discrimination, but wobble base pairing adjacent to the mutation site abolished the siRNA activity. Our data indicate that siRNAs can be designed to discriminate between the wild type and mutant alleles of genes that differ by just a single nucleotide. PMID:21559198

Virus-Derived Gene Expression and RNA Interference Vector for Grapevine

PubMed Central

Kurth, Elizabeth G.; Peremyslov, Valera V.; Prokhnevsky, Alexey I.; Kasschau, Kristin D.; Miller, Marilyn; Carrington, James C.

2012-01-01

The improvement of the agricultural and wine-making qualities of the grapevine (Vitis vinifera) is hampered by adherence to traditional varieties, the recalcitrance of this plant to genetic modifications, and public resistance to genetically modified organism (GMO) technologies. To address these challenges, we developed an RNA virus-based vector for the introduction of desired traits into grapevine without heritable modifications to the genome. This vector expresses recombinant proteins in the phloem tissue that is involved in sugar transport throughout the plant, from leaves to roots to berries. Furthermore, the vector provides a powerful RNA interference (RNAi) capability of regulating the expression of endogenous genes via virus-induced gene-silencing (VIGS) technology. Additional advantages of this vector include superb genetic capacity and stability, as well as the swiftness of technology implementation. The most significant applications of the viral vector include functional genomics of the grapevine and disease control via RNAi-enabled vaccination against pathogens or invertebrate pests. PMID:22438553

Bactrocera dorsalis male sterilization by targeted RNA interference of spermatogenesis: empowering sterile insect technique programs

PubMed Central

Dong, Yong-Cheng; Wang, Zhi-Jian; Chen, Zhen-Zhong; Clarke, Anthony R.; Niu, Chang-Ying

2016-01-01

RNA interference (RNAi) is a genetic technique which has novel application for sustainable pest control. The Sterile Insect Technique (SIT) uses releases of mass-produced, sterile male insects to out-compete wild males for mates to reduce pest populations. RNAi sterilization of SIT males would have several advantages over radiation sterilization, but to achieve this appropriate target genes must first be identified and then targeted with interference technology. With this goal, eight spermatogenesis related candidate genes were cloned and tested for potential activity in Bactrocera dorsalis. The knockdown of candidate genes by oral delivery of dsRNAs did not influence the mating of male flies, but significantly affected the daily average number of eggs laid by females, and reduced egg hatching rate by 16–60%. RNAi negatively affected spermatozoa quantitatively and qualitatively. Following the mating of lola-/topi-/rac-/rho-/upd-/magu-silenced males, we recorded a significant decrease in number and length of spermatozoa in female spermatheca compared to gfp-silenced control group. In a greenhouse trial, the number of damaged oranges and B. dorsalis larvae were significantly reduced in a dsrho-treated group compared with the dsgfp group. This study provides strong evidence for the use RNAi in pest management, especially for the improvement of SIT against B. dorsalis and other species. PMID:27767174

Preclinical Justification of pbi-shRNA EWS/FLI1 Lipoplex (LPX) Treatment for Ewing's Sarcoma.

PubMed

Rao, Donald D; Jay, Christopher; Wang, Zhaohui; Luo, Xiuquan; Kumar, Padmasini; Eysenbach, Hilary; Ghisoli, Maurizio; Senzer, Neil; Nemunaitis, John

2016-08-01

The EWS/FLI1 fusion gene is well characterized as a driver of Ewing's sarcoma. Bi-shRNA EWS/FLI1 is a functional plasmid DNA construct that transcribes both siRNA and miRNA-like effectors each of which targets the identical type 1 translocation junction region of the EWS/FLI1 transcribed mRNA sequence. Previous preclinical and clinical studies confirm the safety of this RNA interference platform technology and consistently demonstrate designated mRNA and protein target knockdown at greater than 90% efficiency. We initiated development of pbi-shRNA EWS/FLI1 lipoplex (LPX) for the treatment of type 1 Ewing's sarcoma. Clinical-grade plasmid was manufactured and both sequence and activity verified. Target protein and RNA knockdown of 85-92% was demonstrated in vitro in type 1 human Ewing's sarcoma tumor cell lines with the optimal bi-shRNA EWS/FLI1 plasmid. This functional plasmid was placed in a clinically tested, liposomal (LP) delivery vehicle followed by in vivo verification of activity. Type 1 Ewing's sarcoma xenograft modeling confirmed dose related safety and tumor response to pbi-shRNA EWS/FLI1 LPX. Toxicology studies in mini-pigs with doses comparable to the demonstrated in vivo efficacy dose resulted in transient fever, occasional limited hypertension at low- and high-dose assessment and transient liver enzyme elevation at high dose. These results provide the justification to initiate clinical testing.

Preclinical Justification of pbi-shRNA EWS/FLI1 Lipoplex (LPX) Treatment for Ewing's Sarcoma

PubMed Central

Rao, Donald D.; Jay, Christopher; Wang, Zhaohui; Luo, Xiuquan; Kumar, Padmasini; Eysenbach, Hilary; Ghisoli, Maurizio; Senzer, Neil; Nemunaitis, John

2016-01-01

The EWS/FLI1 fusion gene is well characterized as a driver of Ewing's sarcoma. Bi-shRNA EWS/FLI1 is a functional plasmid DNA construct that transcribes both siRNA and miRNA-like effectors each of which targets the identical type 1 translocation junction region of the EWS/FLI1 transcribed mRNA sequence. Previous preclinical and clinical studies confirm the safety of this RNA interference platform technology and consistently demonstrate designated mRNA and protein target knockdown at greater than 90% efficiency. We initiated development of pbi-shRNA EWS/FLI1 lipoplex (LPX) for the treatment of type 1 Ewing's sarcoma. Clinical-grade plasmid was manufactured and both sequence and activity verified. Target protein and RNA knockdown of 85–92% was demonstrated in vitro in type 1 human Ewing's sarcoma tumor cell lines with the optimal bi-shRNA EWS/FLI1 plasmid. This functional plasmid was placed in a clinically tested, liposomal (LP) delivery vehicle followed by in vivo verification of activity. Type 1 Ewing's sarcoma xenograft modeling confirmed dose related safety and tumor response to pbi-shRNA EWS/FLI1 LPX. Toxicology studies in mini-pigs with doses comparable to the demonstrated in vivo efficacy dose resulted in transient fever, occasional limited hypertension at low- and high-dose assessment and transient liver enzyme elevation at high dose. These results provide the justification to initiate clinical testing. PMID:27166877

Reduction of bilirubin by targeting human heme oxygenase-1 through siRNA.

PubMed

Xia, Zhen-Wei; Li, Chun-E; Jin, You-Xin; Shi, Yi; Xu, Li-Qing; Zhong, Wen-Wei; Li, Yun-Zhu; Yu, Shan-Chang; Zhang, Zi-Li

2007-04-01

Neonatal hyperbilirubinemia is a common clinical condition caused mainly by the increased production and decreased excretion of bilirubin. Current treatment is aimed at reducing the serum levels of bilirubin. Heme oxygenase-1 (HO-1) is a rate-limiting enzyme that generates bilirubin. In this study we intended to suppress HO-1 using the RNA interference technique. Small interfering RNA (siRNA)-A, -B, and -C were designed based on human HO-1 (hHO-1) mRNA sequences. siRNA was transfected into a human hepatic cell line (HL-7702). hHO-1 transcription and protein levels were then determined. In addition, the inhibitory effect of siRNA on hHO-1 was assessed in cells treated with hemin or transfected with an hHO-1 plasmid. siRNA-C showed the most potent suppressive effect on hHO-1. This inhibition is dose and time dependent. Compared with control, both hemin and hHO-1 plasmids up-regulated hHO-1 expression in HL-7702 cells. However, the up-regulation was significantly attenuated by siRNA-C. Furthermore, the decrease in hHO-1 activity was coincident with the suppression of its transcription. Finally, siRNA-C was shown to reduce hHO-1 enzymatic activity and bilirubin levels. Thus, this study provides a novel therapeutic rationale by blocking bilirubin formation via siRNA for preventing and treating neonatal hyperbilirubinemia and bilirubin encephalopathy at an early clinical stage.

Enhanced Whitefly Resistance in Transgenic Tobacco Plants Expressing Double Stranded RNA of v-ATPase A Gene

PubMed Central

Thakur, Nidhi; Upadhyay, Santosh Kumar; Verma, Praveen C.; Chandrashekar, Krishnappa; Tuli, Rakesh; Singh, Pradhyumna K.

2014-01-01

Background Expression of double strand RNA (dsRNA) designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi), thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci) upon oral feeding. The v-ATPase subunit A (v-ATPaseA) coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. Methodology/Principal Findings Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. Conclusions/Significance Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops. PMID:24595215

Variation in vasopressin receptor Avpr1a) expression creates diversity in behaviors related to monogamy in prairie voles

PubMed Central

Barrett, Catherine E.; Keebaugh, Alaine C.; Ahern, Todd H.; Bass, Caroline E.; Terwilliger, Ernest F.; Young, Larry J.

2013-01-01

Polymorphisms in noncoding regions of the vasopressin 1a receptor gene (Avpr1a) are associated with a variety of socioemotional characteristics in humans, chimpanzees, and voles, and may impact behavior through site-specific variation in gene expression. The socially monogamous prairie vole offers a unique opportunity to study such neurobiological control of individual differences in complex behavior. Vasopressin 1a receptor (V1aR) signaling is necessary for the formation of the pair bond in males, and prairie voles exhibit greater V1aR binding in the reward-processing ventral pallidum than do asocial voles of the same genus. Diversity in social behavior within prairie voles has been correlated to natural variation in neuropeptide receptor expression in specific brain regions. Here we use RNA interference to examine the causal relationship between intraspecific variation in V1aR and behavioral outcomes, by approximating the degree of naturalistic variation in V1aR expression. Juvenile male prairie voles were injected with viral vectors expressing shRNA sequences targeting Avpr1a mRNA into the ventral pallidum. Down-regulation of pallidal V1aR density resulted in a significant impairment in the preference for a mated female partner and a reduction in anxiety-like behavior in adulthood. No effect on alloparenting was detected. These data demonstrate that within-species naturalistic-like variation in V1aR expression has a profound effect on individual differences in social attachment and emotionality. RNA interference may prove a useful technique to unite the fields of behavioral ecology and neurogenetics to perform ethologically relevant studies of the control of individual variation and offer insight into the evolutionary mechanisms leading to behavioral diversity. PMID:23370363

Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

PubMed Central

Huang, Weizhe; He, Ziying

2013-01-01

RNA interference (RNAi) was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA) are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc.) of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system. PMID:24288498

Determining the Specificity of Cascade Binding, Interference, and Primed Adaptation In Vivo in the Escherichia coli Type I-E CRISPR-Cas System.

PubMed

Cooper, Lauren A; Stringer, Anne M; Wade, Joseph T

2018-04-17

In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo , for the type I-E system of Escherichia coli Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5' end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. IMPORTANCE Many bacterial and archaeal species encode CRISPR-Cas immunity systems that protect against invasion by foreign DNA. In the Escherichia coli CRISPR-Cas system, a protein complex, Cascade, binds 61-nucleotide (nt) CRISPR RNAs (crRNAs). The Cascade complex is directed to invading DNA molecules through base pairing between the crRNA and target DNA. This leads to recruitment of the Cas3 nuclease, which destroys the invading DNA molecule and promotes acquisition of new immunity elements. We made the first in vivo measurements of Cascade binding to DNA targets. Thus, we show that Cascade binding to DNA is highly promiscuous; endogenous E. coli crRNAs can direct Cascade binding to >100 chromosomal locations. In contrast, we show that targeted degradation and acquisition of new immunity elements require highly specific association of Cascade with DNA, limiting CRISPR-Cas function to the appropriate targets. Copyright © 2018 Cooper et al.

Structural and biochemical studies on ATP binding and hydrolysis by the Escherichia coli RNA chaperone Hfq.

PubMed

Hämmerle, Hermann; Beich-Frandsen, Mads; Večerek, Branislav; Rajkowitsch, Lukas; Carugo, Oliviero; Djinović-Carugo, Kristina; Bläsi, Udo

2012-01-01

In Escherichia coli the RNA chaperone Hfq is involved in riboregulation by assisting base-pairing between small regulatory RNAs (sRNAs) and mRNA targets. Several structural and biochemical studies revealed RNA binding sites on either surface of the donut shaped Hfq-hexamer. Whereas sRNAs are believed to contact preferentially the YKH motifs present on the proximal site, poly(A)(15) and ADP were shown to bind to tripartite binding motifs (ARE) circularly positioned on the distal site. Hfq has been reported to bind and to hydrolyze ATP. Here, we present the crystal structure of a C-terminally truncated variant of E. coli Hfq (Hfq(65)) in complex with ATP, showing that it binds to the distal R-sites. In addition, we revisited the reported ATPase activity of full length Hfq purified to homogeneity. At variance with previous reports, no ATPase activity was observed for Hfq. In addition, FRET assays neither indicated an impact of ATP on annealing of two model oligoribonucleotides nor did the presence of ATP induce strand displacement. Moreover, ATP did not lead to destabilization of binary and ternary Hfq-RNA complexes, unless a vast stoichiometric excess of ATP was used. Taken together, these studies strongly suggest that ATP is dispensable for and does not interfere with Hfq-mediated RNA transactions.

The Vasa homolog RDE-12 engages target mRNA and multiple Argonaute proteins to promote RNAi in C. elegans

PubMed Central

Shirayama, Masaki; Stanney, William; Gu, Weifeng; Seth, Meetu; Mello, Craig C.

2014-01-01

Summary Argonaute proteins (AGOs) are key nuclease effectors of RNA interference (RNAi) [1]. Although purified AGOs can mediate a single round of target-RNA cleavage in vitro, accessory factors are required for short-interfering (si)RNAs loading and to achieve multiple-target turnover [2, 3]. To identify AGO co-factors we immunoprecipitated the C. elegans AGO WAGO-1, which engages amplified small RNAs during RNAi [4]. These studies identified a robust association between WAGO-1 and a conserved Vasa ATPase-related protein RDE-12. rde-12 mutants are deficient in RNAi including viral suppression, and fail to produce amplified secondary siRNAs and certain endogenous siRNAs (endo-siRNAs). RDE-12 co-localizes with WAGO-1 in germline P-granules and in cytoplasmic and peri-nuclear foci in somatic cells. These findings and our genetic studies suggest that RDE-12 is first recruited to target mRNA by upstream AGOs (RDE-1 and ERGO-1) where it promotes small-RNA amplification and/or WAGO-1 loading. Downstream of these events, RDE-12 forms an RNase-resistant (target mRNA-independent) complex with WAGO-1 and may thus have additional functions in target mRNA surveillance and silencing. PMID:24684931

Discovery, adaptation and transcriptional activity of two tick promoters: Construction of a dual luciferase reporter system for optimization of RNA interference in Rhipicephalus (Boophilus) microplus cell lines

USDA-ARS?s Scientific Manuscript database

Dual luciferase reporter systems are valuable tools for functional genomic studies, but have not previously been developed for use in tick cell culture. We evaluated expression of available luciferase constructs in tick cell cultures derived from Rhipicephalus (Boophilus) microplus, an important vec...

Understanding the core of RNA interference: The dynamic aspects of Argonaute-mediated processes.

PubMed

Zhu, Lizhe; Jiang, Hanlun; Sheong, Fu Kit; Cui, Xuefeng; Wang, Yanli; Gao, Xin; Huang, Xuhui

2017-09-01

At the core of RNA interference, the Argonaute proteins (Ago) load and utilize small guide nucleic acids to silence mRNAs or cleave foreign nucleic acids in a sequence specific manner. In recent years, based on extensive structural studies of Ago and its interaction with the nucleic acids, considerable progress has been made to reveal the dynamic aspects of various Ago-mediated processes. Here we review these novel insights into the guide-strand loading, duplex unwinding, and effects of seed mismatch, with a focus on two representative Agos, the human Ago 2 (hAgo2) and the bacterial Thermus thermophilus Ago (TtAgo). In particular, comprehensive molecular simulation studies revealed that although sharing similar overall structures, the two Agos have vastly different conformational landscapes and guide-strand loading mechanisms because of the distinct rigidity of their L1-PAZ hinge. Given the central role of the PAZ motions in regulating the exposure of the nucleic acid binding channel, these findings exemplify the importance of protein motions in distinguishing the overlapping, yet distinct, mechanisms of Ago-mediated processes in different organisms. Copyright © 2016 Elsevier Ltd. All rights reserved.

Use of double-stranded RNA-mediated interference to determine the substrates of protein tyrosine kinases and phosphatases.

PubMed

Muda, Marco; Worby, Carolyn A; Simonson-Leff, Nancy; Clemens, James C; Dixon, Jack E

2002-08-15

Despite the wealth of information generated by genome-sequencing projects, the identification of in vivo substrates of specific protein kinases and phosphatases is hampered by the large number of candidate enzymes, overlapping enzyme specificity and sequence similarity. In the present study, we demonstrate the power of RNA interference (RNAi) to dissect signal transduction cascades involving specific kinases and phosphatases. RNAi is used to identify the cellular tyrosine kinases upstream of the phosphorylation of Down-Syndrome cell-adhesion molecule (Dscam), a novel cell-surface molecule of the immunoglobulin-fibronectin super family, which has been shown to be important for axonal path-finding in Drosophila. Tyrosine phosphorylation of Dscam recruits the Src homology 2 domain of the adaptor protein Dock to the receptor. Dock, the ortho- logue of mammalian Nck, is also essential for correct axonal path-finding in Drosophila. We further determined that Dock is tyrosine-phosphorylated in vivo and identified DPTP61F as the protein tyrosine phosphatase responsible for maintaining Dock in its non-phosphorylated state. The present study illustrates the versatility of RNAi in the identification of the physiological substrates for protein kinases and phosphatases.

Microprocessor mediates transcriptional termination in long noncoding microRNA genes

PubMed Central

Dhir, Ashish; Dhir, Somdutta; Proudfoot, Nick J.; Jopling, Catherine L.

2015-01-01

MicroRNA (miRNA) play a major role in the post-transcriptional regulation of gene expression. Mammalian miRNA biogenesis begins with co-transcriptional cleavage of RNA polymerase II (Pol II) transcripts by the Microprocessor complex. While most miRNA are located within introns of protein coding genes, a substantial minority of miRNA originate from long non coding (lnc) RNA where transcript processing is largely uncharacterized. We show, by detailed characterization of liver-specific lnc-pri-miR-122 and genome-wide analysis in human cell lines, that most lnc-pri-miRNA do not use the canonical cleavage and polyadenylation (CPA) pathway, but instead use Microprocessor cleavage to terminate transcription. This Microprocessor inactivation leads to extensive transcriptional readthrough of lnc-pri-miRNA and transcriptional interference with downstream genes. Consequently we define a novel RNase III-mediated, polyadenylation-independent mechanism of Pol II transcription termination in mammalian cells. PMID:25730776

Intelligent Therapeutics and Metabolic Programming Through Tailormade, Ligand-Controlled RNA Switches

DTIC Science & Technology

2007-02-05

lines. Three regulatory mechanisms have been examined in our laboratory: antisense inhibition, ribozyme cleavage, and RNA interference (RNAi...cell lines. However, the latter two regulatory mechanisms, ribozyme -based inactivation and RNAi-mediated silencing, demonstrated significant activity...in these cell lines as is briefly described below. Microswitches responsive to the small molecule theophylline and targeting GFP based on a ribozyme

ß-catenin, a transcription factor activated by canonical Wnt signaling, is expressed in sensory neurons of calves latently infected with bovine herpesvirus 1

USDA-ARS?s Scientific Manuscript database

Like many a-herpesvirinae subfamily members, bovine herpes virus 1 (BoHV-1) expresses an abundant transcript in latently infected sensory neurons: the latency-related (LR) RNA. LR-RNA encodes a protein (ORF2) that inhibits apoptosis, interacts with Notch family members, interferes with Notch mediate...

Fluorescence correlation spectroscopy and fluorescence cross-correlation spectroscopy reveal the cytoplasmic origination of loaded nuclear RISC in vivo in human cells

PubMed Central

Mütze, Jörg; Staroske, Wolfgang; Weinmann, Lasse; Höck, Julia; Crell, Karin; Meister, Gunter; Schwille, Petra

2008-01-01

Studies of RNA interference (RNAi) provide evidence that in addition to the well-characterized cytoplasmic mechanisms, nuclear mechanisms also exist. The mechanism by which the nuclear RNA-induced silencing complex (RISC) is formed in mammalian cells, as well as the relationship between the RNA silencing pathways in nuclear and cytoplasmic compartments is still unknown. Here we show by applying fluorescence correlation and cross-correlation spectroscopy (FCS/FCCS) in vivo that two distinct RISC exist: a large ∼3 MDa complex in the cytoplasm and a 20-fold smaller complex of ∼158 kDa in the nucleus. We further show that nuclear RISC, consisting only of Ago2 and a short RNA, is loaded in the cytoplasm and imported into the nucleus. The loaded RISC accumulates in the nucleus depending on the presence of a target, based on an miRNA-like interaction with impaired cleavage of the cognate RNA. Together, these results suggest a new RISC shuttling mechanism between nucleus and cytoplasm ensuring concomitant gene regulation by small RNAs in both compartments. PMID:18842624

Fluorescence correlation spectroscopy and fluorescence cross-correlation spectroscopy reveal the cytoplasmic origination of loaded nuclear RISC in vivo in human cells.

PubMed

Ohrt, Thomas; Mütze, Jörg; Staroske, Wolfgang; Weinmann, Lasse; Höck, Julia; Crell, Karin; Meister, Gunter; Schwille, Petra

2008-11-01

Studies of RNA interference (RNAi) provide evidence that in addition to the well-characterized cytoplasmic mechanisms, nuclear mechanisms also exist. The mechanism by which the nuclear RNA-induced silencing complex (RISC) is formed in mammalian cells, as well as the relationship between the RNA silencing pathways in nuclear and cytoplasmic compartments is still unknown. Here we show by applying fluorescence correlation and cross-correlation spectroscopy (FCS/FCCS) in vivo that two distinct RISC exist: a large approximately 3 MDa complex in the cytoplasm and a 20-fold smaller complex of approximately 158 kDa in the nucleus. We further show that nuclear RISC, consisting only of Ago2 and a short RNA, is loaded in the cytoplasm and imported into the nucleus. The loaded RISC accumulates in the nucleus depending on the presence of a target, based on an miRNA-like interaction with impaired cleavage of the cognate RNA. Together, these results suggest a new RISC shuttling mechanism between nucleus and cytoplasm ensuring concomitant gene regulation by small RNAs in both compartments.

Contributions of 3'-overhang to the dissociation of small interfering RNAs from the PAZ domain: molecular dynamics simulation study.

PubMed

Lee, Hui Sun; Lee, Soo Nam; Joo, Chul Hyun; Lee, Heuiran; Lee, Han Saem; Yoon, Seung Yong; Kim, Yoo Kyum; Choe, Han

2007-03-01

RNA interference (RNAi) is a 'knock-down' reaction to reduce expression of a specific gene through highly regulated, enzyme-mediated processes. Small interfering RNAs (siRNAs) are RNA molecules that play an effector role in RNAi and can bind the PAZ domains present in Dicer and RISC. We investigated the interaction between the PAZ domain and the siRNA-like duplexes through dissociation molecular dynamics (DMD) simulations. Specifically, we focused on the response of the PAZ domain to various 3'-overhang structures of the siRNA-like duplexes. We found that the siRNA-like duplex with the 3' UU-overhang made relatively more stable complex with the PAZ domain compared to those with 3' CC-, AA-, and GG-overhangs. The siRNA-like duplex with UU-overhang was easily dissociated from the PAZ domain once the structural stability of the complex is impaired. Interestingly, the 3' UU-overhang spent the least time at the periphery region of the binding pocket during the dissociation process, which can be mainly attributable to UU-overhang's smallest number of hydrogen bonds.

Short hairpin RNA interference therapy for ischemic heart disease

PubMed Central

Huang, Mei; Chan, Denise; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Chen, Xiaoyuan; Giaccia, Amato; Wu, Joseph C.

2013-01-01

Background During hypoxia, upregulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. Methods and Results PHD2 was cloned from mouse embryonic stem (ES) cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared to the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of HIF-1α protein and several downstream angiogenic genes by >30% (P<0.01). Afterwards, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending (LAD) artery in mice. Animals were randomized into shPHD2 group (n=20) versus shScramble sequence as control (n=20). Bioluminescence imaging detected transgene expression for 4–5 weeks. Echocardiographic study showed the shPHD2 group had improved fractional shortening compared with the shScramble group at week 4 (33.7%±1.9% vs. 28.4%±2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot anlaysis of explanted hearts also confirm that animals treated with shPHD2 had significantly higher levels of HIF-1α protein. Conclusions This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by shRNA led to significant improvement in angiogenesis and contractility by in vitro and in vivo experiments. With further validation, the combination of shRNA therapy and molecular imaging can be used to track novel cardiovascular gene therapy applications in the future. PMID:18824759

Allele-specific RNA interference rescues the long-QT syndrome phenotype in human-induced pluripotency stem cell cardiomyocytes.

PubMed

Matsa, Elena; Dixon, James E; Medway, Christopher; Georgiou, Orestis; Patel, Minal J; Morgan, Kevin; Kemp, Paul J; Staniforth, Andrew; Mellor, Ian; Denning, Chris

2014-04-01

Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K(+) currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart.

RNA Interference: A Novel Source of Resistance to Combat Plant Parasitic Nematodes.

PubMed

Banerjee, Sagar; Banerjee, Anamika; Gill, Sarvajeet S; Gupta, Om P; Dahuja, Anil; Jain, Pradeep K; Sirohi, Anil

2017-01-01

Plant parasitic nematodes cause severe damage and yield loss in major crops all over the world. Available control strategies include use of insecticides/nematicides but these have proved detrimental to the environment, while other strategies like crop rotation and resistant cultivars have serious limitations. This scenario provides an opportunity for the utilization of technological advances like RNA interference (RNAi) to engineer resistance against these devastating parasites. First demonstrated in the model free living nematode, Caenorhabtidis elegans ; the phenomenon of RNAi has been successfully used to suppress essential genes of plant parasitic nematodes involved in parasitism, nematode development and mRNA metabolism. Synthetic neurotransmitants mixed with dsRNA solutions are used for in vitro RNAi in plant parasitic nematodes with significant success. However, host delivered in planta RNAi has proved to be a pioneering phenomenon to deliver dsRNAs to feeding nematodes and silence the target genes to achieve resistance. Highly enriched genomic databases are exploited to limit off target effects and ensure sequence specific silencing. Technological advances like gene stacking and use of nematode inducible and tissue specific promoters can further enhance the utility of RNAi based transgenics against plant parasitic nematodes.

Allele-specific RNA interference rescues the long-QT syndrome phenotype in human-induced pluripotency stem cell cardiomyocytes

PubMed Central

Matsa, Elena; Dixon, James E.; Medway, Christopher; Georgiou, Orestis; Patel, Minal J.; Morgan, Kevin; Kemp, Paul J.; Staniforth, Andrew; Mellor, Ian; Denning, Chris

2014-01-01

Aims Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. Methods and results We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K+ currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). Conclusions These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart. PMID:23470493

Host gene targets for novel influenza therapies elucidated by high-throughput RNA interference screens

PubMed Central

Meliopoulos, Victoria A.; Andersen, Lauren E.; Birrer, Katherine F.; Simpson, Kaylene J.; Lowenthal, John W.; Bean, Andrew G. D.; Stambas, John; Stewart, Cameron R.; Tompkins, S. Mark; van Beusechem, Victor W.; Fraser, Iain; Mhlanga, Musa; Barichievy, Samantha; Smith, Queta; Leake, Devin; Karpilow, Jon; Buck, Amy; Jona, Ghil; Tripp, Ralph A.

2012-01-01

Influenza virus encodes only 11 viral proteins but replicates in a broad range of avian and mammalian species by exploiting host cell functions. Genome-wide RNA interference (RNAi) has proven to be a powerful tool for identifying the host molecules that participate in each step of virus replication. Meta-analysis of findings from genome-wide RNAi screens has shown influenza virus to be dependent on functional nodes in host cell pathways, requiring a wide variety of molecules and cellular proteins for replication. Because rapid evolution of the influenza A viruses persistently complicates the effectiveness of vaccines and therapeutics, a further understanding of the complex host cell pathways coopted by influenza virus for replication may provide new targets and strategies for antiviral therapy. RNAi genome screening technologies together with bioinformatics can provide the ability to rapidly identify specific host factors involved in resistance and susceptibility to influenza virus, allowing for novel disease intervention strategies.—Meliopoulos, V. A., Andersen, L. E., Birrer, K. F., Simpson, K. J., Lowenthal, J. W., Bean, A. G. D., Stambas, J., Stewart, C. R., Tompkins, S. M., van Beusechem, V. W., Fraser, I., Mhlanga, M., Barichievy, S., Smith, Q., Leake, D., Karpilow, J., Buck, A., Jona, G., Tripp, R. A. Host gene targets for novel influenza therapies elucidated by high-throughput RNA interference screens. PMID:22247330

The use of small interfering RNAs to inhibit adipocyte differentiation in human preadipocytes and fetal-femur-derived mesenchymal cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Y.; Mirmalek-Sani, S.-H.; Yang, X.

2006-06-10

RNA interference (RNAi) has been used in functional genomics and offers innovative approaches in the development of novel therapeutics. Human mesenchymal stem cells offer a unique cell source for tissue engineering/regeneration strategies. The current study examined the potential of small interfering RNAs (siRNA) against human peroxisome proliferator activated receptor gamma (PPAR{gamma}) to suppress adipocyte differentiation (adipogenesis) in human preadipocytes and fetal-femur-derived mesenchymal cells. Adipogenesis was investigated using cellular and biochemical analysis. Transient transfection with PPAR{gamma}-siRNA using a liposomal-based strategy resulted in a significant inhibition of adipogenesis in human preadipocytes and fetal-femur-derived mesenchymal cells, compared to controls (cell, liposomal and negativemore » siRNA). The inhibitory effect of PPAR{gamma}-siRNA was supported by testing human PPAR{gamma} mRNA and adipogenic associated genes using reverse transcription polymerase chain reaction (RT-PCR) to adiponectin receptor 1 and 2 as well as examination of fatty acid binding protein 3 (FABP{sub 3}) expression, an adipocyte-specific marker. The current studies indicate that PPAR{gamma}-siRNA is a useful tool to study adipogenesis in human cells, with potential applications both therapeutic and in the elucidation of mesenchymal cell differentiation in the modulation of cell differentiation in human mesenchymal cells.« less

[Expression of cation-chloride cotransporters KCC2 and NKCC1 in brainstem of para- chlorophenylalanine-induced acute insomnia rats].

PubMed

Lin, Fang-ju; Yang, Xiao-su; Yang, De; Zou, Yan-qun

2013-05-21

To explore the possible roles of KCC2 and NKCC1 in the pathological mechanism of acute insomnia in rats. A total of 18 Sprague-Dawley rats were randomly selected into model, interference and normal control groups.The expressions of KCC2 and NKCC1 in brainstem were detected by reverse transcription-polymerase chain reaction (RT-PCR) and Western blot.The concentration of intracellular Cl(-) ([Cl(-)]i) in brainstem was detected by fluorescence probe MQAE with laser confocal microscopy. (1) Comparing with the control group, both KCC2 mRNA and protein expression were down-regulated in the model and interference groups (mRNA:0.196 ± 0.021 vs 0.939 ± 0.109, P < 0.05; 0.485 ± 0.026 vs 0.939 ± 0.109, P < 0.05; protein expression:0.363 ± 0.058 vs 0.967 ± 0.155, P < 0.05; 0.663 ± 0.106 vs 0.967 ± 0.155, P < 0.05).However they became up-regulated in the interference group versus the model group (mRNA: 0.485 ± 0.026 vs 0.196 ± 0.021, P < 0.05; protein expression:0.663 ± 0.106 vs 0.363 ± 0.058, P < 0.05). (2) Comparing with the control group, both NKCC1 mRNA and protein expression in the model group were slightly up-regulated.But statistical difference was insignificant (mRNA: 0.344 ± 0.026 vs 0.320 ± 0.019, P > 0.05; protein expression:0.244 ± 0.010 vs 0.230 ± 0.021, P > 0.05).There was down-regulation in the interference group versus the model and control groups (mRNA: 0.066 ± 0.031 vs 0.320 ± 0.019, P < 0.05; 0.066 ± 0.031 vs 0.344 ± 0.026, P < 0.05; protein expression:0.131 ± 0.012 vs 0.230 ± 0.021, P < 0.05; 0.131 ± 0.012 vs 0.244 ± 0.010, P < 0.05). (3) Comparing with the control group, [Cl(-)]i became up-regulated in the model group (0.0315 ± 0.0039 vs 0.0164 ± 0.0019, P < 0.05).It was down-regulated in the interference group versus the model group (0.0182 ± 0.0013 vs 0.0315 ± 0.0039, P < 0.05), but higher than control group without statistical difference (0.0182 ± 0.0013 vs 0.0164 ± 0.0019, P > 0.05). The down-regulation of KCC2 and rise of [Cl(-)]i in brainstem may participate in the pathological mechanism of acute insomnia in rats. And the mechanism of sedative-hypnotic diazepam may be operate through an up-regulation of KCC2, a down-regulation of NKCC1 and decreased [Cl(-)]i.

Small Molecules Targeting the miRNA-Binding Domain of Argonaute 2: From Computer-Aided Molecular Design to RNA Immunoprecipitation.

PubMed

Bellissimo, Teresa; Masciarelli, Silvia; Poser, Elena; Genovese, Ilaria; Del Rio, Alberto; Colotti, Gianni; Fazi, Francesco

2017-01-01

The development of small-molecule-based target therapy design for human disease and cancer is object of growing attention. Recently, specific microRNA (miRNA) mimicking compounds able to bind the miRNA-binding domain of Argonaute 2 protein (AGO2) to inhibit miRNA loading and its functional activity were described. Computer-aided molecular design techniques and RNA immunoprecipitation represent suitable approaches to identify and experimentally determine if a compound is able to impair the loading of miRNAs on AGO2 protein. Here, we describe these two methodologies that we recently used to select a specific compound able to interfere with the AGO2 functional activity and able to improve the retinoic acid-dependent myeloid differentiation of leukemic cells.

Scavenger receptor WC1 contributes to the γδ T cell response to Leptospira.

PubMed

Wang, Fei; Herzig, Carolyn T A; Chen, Chuang; Hsu, Haoting; Baldwin, Cynthia L; Telfer, Janice C

2011-03-01

WC1 molecules are exclusively expressed on the surface of γδ T cells. They belong to the scavenger receptor cysteine-rich (SRCR) superfamily and are encoded by a multi-gene family. WC1 molecules have been grouped on the basis of antibody reactivity. The expression of WC1 molecules from these serologically defined groups is correlated with differences in γδ T cell responses. The expression of receptors within the WC1.1 group correlates with the capacity of γδ T cells to respond to Leptospira antigen. In this study, we used RNA interference to directly investigate the role of WC1 expression in the response to Leptospira borgpetersenii. We found that when three out of thirteen WC1 gene products were downregulated by RNA interference, γδ T cell proliferation and IFN-γ production in response to Leptospira antigen was significantly reduced. Our data demonstrate that specific receptors in the WC1 family directly participate in Leptospira recognition and/or activation of γδ T cells. Copyright © 2010 Elsevier Ltd. All rights reserved.

RNA interference-based therapeutics for inherited long QT syndrome.

PubMed

Li, Guoliang; Ma, Shuting; Sun, Chaofeng

2015-08-01

Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved.

RNA interference-based therapeutics for inherited long QT syndrome

PubMed Central

LI, GUOLIANG; MA, SHUTING; SUN, CHAOFENG

2015-01-01

Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved. PMID:26622327

Delivery of RNA interference therapeutics using polycation-based nanoparticles.

PubMed

Howard, Kenneth Alan

2009-07-25

RNAi-based therapies are dependent on extracellular and intracellular delivery of RNA molecules for enabling target interaction. Polycation-based nanoparticles (or polyplexes) formed by self-assembly with RNA can be used to modulate pharmacokinetics and intracellular trafficking to improve the therapeutic efficacy of RNAi-based therapeutics. This review describes the application of polyplexes for extracellular and intracellular delivery of synthetic RNA molecules. Focus is given to routes of administration and silencing effects in animal disease models. The inclusion of functional components into the nanoparticle for controlling cellular trafficking and RNA release is discussed. This work highlights the versatile nature of polycation-based nanoparticles to fulfil the delivery requirements for RNA molecules with flexibility in design to evolve alongside an expanding repertoire of RNAi-based drugs.

RNAi-dependent and -independent antiviral phenotypes of chromosomally integrated shRNA clones: role of VASP in respiratory syncytial virus growth.

PubMed

Musiyenko, Alla; Bitko, Vira; Barik, Sailen

2007-07-01

Stable RNA interference (RNAi) is commonly achieved by recombinant expression of short hairpin RNA (shRNA). To generate virus-resistant cell lines, we cloned a shRNA cassette against the phosphoprotein gene of respiratory syncytial virus (RSV) into a polIII-driven plasmid vector. Analysis of individual stable transfectants showed a spectrum of RSV resistance correlating with the levels of shRNA expressed from different chromosomal locations. Interestingly, resistance in a minority of clones was due to mono-allelic disruption of the cellular gene for vasodilator-stimulated phosphoprotein (VASP). Thus, pure clones of chromosomally integrated DNA-directed RNAi can exhibit gene disruption phenotypes resembling but unrelated to RNAi.

Discovery of centrosomal RNA and centrosomal hypothesis of cellular ageing and differentiation.

PubMed

Chichinadze, Konstantin; Tkemaladze, Jaba; Lazarashvili, Ann

2012-01-01

In 2006, a group of scientists studying centrosomes of Spisula solidissima mollusc oocytes under the leadership of Alliegro (Alliegro, M.C.; Alliegro, M.A.; Palazzo, R.E. Centrosome-associated RNA in surf clam oocytes. Proc. Natl. Acad. Sci. USA 2006, 103(24), 9034-9038) reliably demonstrated the existence of specific RNA in centrosome, called centrosomal RNA (cnRNA). In their first article, five different RNAs (cnRNAs 11, 102, 113, 170, and 184) were described. During the process of full sequencing of the first transcript (cnRNA 11), it was discovered that the transcript contained a conserved structure-a reverse transcriptase domain located together with the most important centrosomal protein, γ-tubulin. In an article published in 2005, we made assumptions about several possible mechanisms for determining the most important functions of centrosomal structures and referred to one of them as a "RNA-dependent mechanism." This idea about participation of hypothetic centrosomal small interference RNA and/or microRNA in the process was made one year prior to the discovery of cnRNA by Alliegro's group. The discovery of specific RNA in a centrosome is indirect evidence of a centrosomal hypothesis of cellular ageing and differentiation. The presence of a reverse transcriptase domain in this type of RNA, together with its uniqueness and specificity, makes the centrosome a place of information storage and reproduction.

RNAi-mediated silencing of enolase confirms its biological importance in Clonorchis sinensis.

PubMed

Wang, Xiaoyun; Chen, Wenjun; Tian, Yanli; Huang, Yan; Li, Xuerong; Yu, Xinbing

2014-04-01

Clonorchis sinensis (C. sinensis) infection is still a common public health problem in freshwater fish consumption areas in Asian countries. More molecular evidence are required to speed up the prevention strategies to control this kind of infectious disease. In the present study, to confirm the biological importance of Csenolase followed by our previous observations of the key metabolic enzyme, we explored the RNA silence effect of the Csenolase-derived RNA interference (RNAi) in C. sinensis. The extramembranous region aa105-226 was selected as the target sequence of RNA silence. Csenolase-derived double strand RNA (dsRNA-Csenolase, 366 bp) was synthetized and delivered into C. sinensis by soaking approach. The penetration of dsRNA into adult worms and metacercariae was tracked using fluorescently labeled RNA. Western blotting and qRT-PCR experiments were performed to determine dsRNA-Csenolase-silencing effect. Our results showed that, after incubating for 120 h, dsRNA-Csenolase could effectively target and downregulate the expression of Csenolase in both adult worms (P < 0.001) and metacercariae (P < 0.01), resulting in a remarkable killing effect on C. sinensis adult worms (P < 0.01). Fluorescent Cy3-labeled dsRNA was mostly deposited in the uterus and vitellarium of adult worm and in the cyst wall of metacercaria. The present study is the first report of RNAi trials in C. sinensis, allowing further applications in identifying functional genes in C. sinensis.

Design and cloning strategies for constructing shRNA expression vectors

PubMed Central

McIntyre, Glen J; Fanning, Gregory C

2006-01-01

Background Short hairpin RNA (shRNA) encoded within an expression vector has proven an effective means of harnessing the RNA interference (RNAi) pathway in mammalian cells. A survey of the literature revealed that shRNA vector construction can be hindered by high mutation rates and the ensuing sequencing is often problematic. Current options for constructing shRNA vectors include the use of annealed complementary oligonucleotides (74 % of surveyed studies), a PCR approach using hairpin containing primers (22 %) and primer extension of hairpin templates (4 %). Results We considered primer extension the most attractive method in terms of cost. However, in initial experiments we encountered a mutation frequency of 50 % compared to a reported 20 – 40 % for other strategies. By modifying the technique to be an isothermal reaction using the DNA polymerase Phi29, we reduced the error rate to 10 %, making primer extension the most efficient and cost-effective approach tested. We also found that inclusion of a restriction site in the loop could be exploited for confirming construct integrity by automated sequencing, while maintaining intended gene suppression. Conclusion In this study we detail simple improvements for constructing and sequencing shRNA that overcome current limitations. We also compare the advantages of our solutions against proposed alternatives. Our technical modifications will be of tangible benefit to researchers looking for a more efficient and reliable shRNA construction process. PMID:16396676

Identification of a novel cytochrome P450 gene, CYP321E1 from the diamondback moth, Plutella xylostella (L.) and RNA interference to evaluate its role in chlorantraniliprole resistance.

PubMed

Hu, Z; Lin, Q; Chen, H; Li, Z; Yin, F; Feng, X

2014-12-01

Insect cytochrome P450 monooxygenases (P450s) play an important role in catalysis of many reactions leading to insecticides resistance. Our previous studies on transcriptome analysis of chlorantraniliprole-resistant development in the diamondback moth, Plutella xylostella revealed that up-regulation of cytochrome P450s are one of the main factors leading to the development of chlorantraniliprole resistance. Here, we report for the first time a novel cytochrome P450 gene CYP321E1, which belongs to the cytochrome P450 gene family CYP321. Real-time quantitative PCR (RT-qPCR) analyses indicated that CYP321E1 was expressed at all developmental stages of P. xylostella but was highest in the fourth-instar larvae; furthermore, the relatively high expression was observed in the midgut of the fourth-instar larvae, followed by fat bodies and epidermis. The expression of CYP321E1 in P. xylostella was differentially affected by three representative insecticides, including alphamethrin, abamectin and chlorantraniliprole. Among them, the exposure to chlorantraniliprole resulted in the largest transcript level of this cytochrome P450 gene. The findings suggested potential involvement of CYP321E1 in chlorantraniliprole resistance of P. xylostella. To assess the functional link of CYP321E1 to chlorantraniliprole resistance, RNA interference (RNAi)-mediated gene silencing by double stranded RNA (dsRNA) injecting was used. Results revealed that injection delivery of dsRNA can greatly reduce gene expression after 24 h. As a consequence of RNAi, a significant increment in mortality of larvae injected CYP321E1 dsRNA was observed after 24 h of exposure to chlorantraniliprole. These results strongly support our notion that this novel cytochrome P450 gene plays an important role in chlorantraniliprole detoxification in the diamondback moth and is partly responsible for its resistance.

[Study on the inhibition effect of siRNA on herpes simplex virus type 2 ICP4 gene].

PubMed

Liu, Ji-feng; Guan, Cui-ping; Tang, Xu; Xu, Ai-e

2010-06-01

To explore the inhibition effect of RNA interference on the ICP4 expression and DNA replication of herpes simplex virus type 2 (HSV2). Four pairs of siRNA targeted to HSV2 ICP4 gene and negative control siRNA were synthetized by chemical method, named as siRNA-1, siRNA-2, siRNA-3, siRNA-4 and siRNA-N respecticely. HSV2 HG52 was used to attack Vero cell after transfection overnight. Vero cell and supernatant were collected at 1d, 2d, 3d, 4d and 5d after virus attacking. Flurogenic quantitative reverse transcription polymerase chain reaction (FQ-RT-PCR)was used to detect the expression of HSV2 ICP4 mRNA, flurogenic quantitative polymerase chain reaction(FG-PCR) was used to detect the expression of HSV2 DNA and Western-Blot was used to detect the expression of HSV2 ICP4 protein. All the four pairs of siRNA could significantly inhibit the expression of HSV2 ICP4 mRNA and protein, especially siRNA-2. The above siRNAs could significantly decrease HSV2 DNA copy number,too. siRNAs targeted to HSV2 ICP4 gene could significantly inhibit expression of HSV2 ICP4 mRNA and protein, and decrease HSV2 DNA copy number, suggesting that siRNA can inhibit HSV2 DNA replication through silencing ICP4 gene.

[Recombinant adeno-associated virus mediated RNA interference of angiogenin expression inhibits cell growth of human lung adenocarcinoma].

PubMed

Li, Bai-Ling; Zhang, Guan-Xin; Hou, Xiao-Lei; Tan, Meng-Wei; Yuan, Yang; Liu, Xiao-Hong; Gong, De-Jun; Huang, Sheng-Dong

2009-03-01

To study the inhibition of angiogenin (ANG) expression in human lung squamous cancer cell strain-A549 through adeno-associated virus (AAV)-mediated RNA-interference, and therefore to observe its effect on the growth of cancer cells and tumor formation. Recombinant AAV expressing H1-promoter-induced small-interference- RNA (siRNA) targeting ANG (AAV-shANG) was constructed, and then transfected into A549 cells. A549 cells and cells transfected with AAV-Null were used as the control groups. The effects of the reduced expression of ANG by RNAi from AAV-shANG on the growth, formation, reproduction, apoptosis, and microvessel-density of the carcinoma were observed. In vitro experiment showed that AAV-shANG was constructed successfully, There was an significant decrease in the expression of ANG protein 72 h after transfection, compared with the normal A459 cells and AAV-Null cells (P < 0.01). Cell cycle analysis showed that the proliferation index (PI) of normal A549 cells, AAV-Null cells and AAVshANG cells were 0.32 +/- 0.29, 0.35 +/- 0.38 and 0.31 +/- 0.43, respectively. There was no statistic difference in the PIs among the 3 groups (P > 0.05). In vivo experiment using thymus-defect mice showed that, there was an remarkable reduction in the mass and volume of tumors in AAV-shANG transfected group, compared to the control groups. Microvessel-density was 9.4 +/- 1.5, 9.8 +/- 2.1 and 5.7 +/- 1.9, respectively in the 3 groups, a statistic difference among the AAV-shANG-transfected group, the normal A549 group and the AAV-Null transfected group. The percentages of apoptotic cells in each group were (7.7 +/- 3.1)%, (8.5 +/- 5.4)%, (17.1 +/- 8.6)%, respectively, the experimental group being higher than those of the control groups. Positive rates of PCNA were (84.8 +/- 9.7)%, (85.8 +/- 9.8)%, and (70.4 +/- 10.1)%, respectively, the AAV-shANG transfected cancer cells showing a lower PCNA index than the control groups. AAV-mediated expression of siRNA could reduce the expression of ANG in cancer cells, significantly enough to inhibit cell proliferation, promote cell apoptosis and inhibit tumor growth.

siRNA targeting decoy receptor 3 enhances the sensitivity of gastric carcinoma cells to 5-fluorouracil.

PubMed

Xu, Xiao-Tao; Tao, Ze-Zhang; Song, Qi-Bin; Yao, Yi; Ruan, Peng

2012-09-01

In order to investigate the effects of RNA interference of decoy receptor 3 (DcR3) on the sensitivity of gastric cancer cells to 5-fluorouracil (5-FU) and the relevant mechanisms, siRNA against DcR3 was transfected into the gastric cancer cell line AGS. AGS cells were treated with different doses of 5-FU or for different time periods. The sensitivity of AGS cells to 5-FU was determined. The cell survival rate was detected by MTT assay. The apoptotic rate was determined by DAPI staining, and the expression of related proteins were detected by western blot analysis. The results showed that the cell survival rate was significanlty decreased in the knockdown group compared to the control group at different doses of 5-FU (P<0.01). After different time periods of treatment with 5-FU, the cell survival rate in the knockdown group was significantly decreased compared to the control group, respectively (P<0.01). The apoptotic rate of AGS cells in the knockdown group was increased along with the increasing dose of siRNA. The siRNA against DcR3 enhanced the expression of Fas, FasL, caspase-3 and caspase-8. In conclusion, knockdown of DcR3 by RNA interference enhances apoptosis and inhibits the growth of gastric cancer cells. Downregulation of DcR3 enhances the sensitivity of gastric cancer cells to 5-FU and increased the expression of Fas, FasL and caspase-3/8.

ADAR RNA editing below the backbone.

PubMed

Keegan, Liam; Khan, Anzer; Vukic, Dragana; O'Connell, Mary

2017-09-01

ADAR RNA editing enzymes ( a denosine d e a minases acting on R NA) that convert adenosine bases to inosines were first identified biochemically 30 years ago. Since then, studies on ADARs in genetic model organisms, and evolutionary comparisons between them, continue to reveal a surprising range of pleiotropic biological effects of ADARs. This review focuses on Drosophila melanogaster , which has a single Adar gene encoding a homolog of vertebrate ADAR2 that site-specifically edits hundreds of transcripts to change individual codons in ion channel subunits and membrane and cytoskeletal proteins. Drosophila ADAR is involved in the control of neuronal excitability and neurodegeneration and, intriguingly, in the control of neuronal plasticity and sleep. Drosophila ADAR also interacts strongly with RNA interference, a key antiviral defense mechanism in invertebrates. Recent crystal structures of human ADAR2 deaminase domain-RNA complexes help to interpret available information on Drosophila ADAR isoforms and on the evolution of ADARs from tRNA deaminase ADAT proteins. ADAR RNA editing is a paradigm for the now rapidly expanding range of RNA modifications in mRNAs and ncRNAs. Even with recent progress, much remains to be understood about these groundbreaking ADAR RNA modification systems. © 2017 Keegan et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Novel AgoshRNA molecules for silencing of the CCR5 co-receptor for HIV-1 infection

PubMed Central

Herrera-Carrillo, Elena

2017-01-01

Allogeneic transplantation of blood stem cells from a CCR5-Δ32 homozygous donor to an HIV-infected individual, the “Berlin patient”, led to a cure. Since then there has been a search for approaches that mimic this intervention in a gene therapy setting. RNA interference (RNAi) has evolved as a powerful tool to regulate gene expression in a sequence-specific manner and can be used to inactivate the CCR5 mRNA. Short hairpin RNA (shRNA) molecules can impair CCR5 expression, but these molecules may cause unintended side effects and they will not be processed in cells that lack Dicer, such as monocytes. Dicer-independent RNAi pathways have opened opportunities for new AgoshRNA designs that rely exclusively on Ago2 for maturation. Furthermore, AgoshRNA processing yields a single active guide RNA, thus reducing off-target effects. In this study, we tested different AgoshRNA designs against CCR5. We selected AgoshRNAs that potently downregulated CCR5 expression on human T cells and peripheral blood mononuclear cells (PBMC) and that had no apparent adverse effect on T cell development as assessed in a competitive cell growth assay. CCR5 knockdown significantly protected T cells from CCR5 tropic HIV-1 infection. PMID:28542329

Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome

NASA Astrophysics Data System (ADS)

Lu, Rui; Folimonov, Alexey; Shintaku, Michael; Li, Wan-Xiang; Falk, Bryce W.; Dawson, William O.; Ding, Shou-Wei

2004-11-01

Viral infection in both plant and invertebrate hosts requires a virus-encoded function to block the RNA silencing antiviral defense. Here, we report the identification and characterization of three distinct suppressors of RNA silencing encoded by the 20-kb plus-strand RNA genome of citrus tristeza virus (CTV). When introduced by genetic crosses into plants carrying a silencing transgene, both p20 and p23, but not coat protein (CP), restored expression of the transgene. Although none of the CTV proteins prevented DNA methylation of the transgene, export of the silencing signal (capable of mediating intercellular silencing spread) was detected only from the F1 plants expressing p23 and not from the CP- or p20-expressing F1 plants, demonstrating suppression of intercellular silencing by CP and p20 but not by p23. Thus, intracellular and intercellular silencing are each targeted by a CTV protein, whereas the third, p20, inhibits silencing at both levels. Notably, CP suppresses intercellular silencing without interfering with intracellular silencing. The novel property of CP suggests a mechanism distinct to p20 and all of the other viral suppressors known to interfere with intercellular silencing and that this class of viral suppressors may not be consistently identified by Agrobacterium coinfiltration because it also induces RNA silencing against the infiltrated suppressor transgene. Our analyses reveal a sophisticated viral counter-defense strategy that targets the silencing antiviral pathway at multiple steps and may be essential for protecting CTV with such a large RNA genome from antiviral silencing in the perennial tree host. RNA interference | citrus tristeza virus | virus synergy | antiviral immunity

RNA interference of carboxyesterases causes nymph mortality in the Asian citrus psyllid, Diaphorina citri.

PubMed

Kishk, Abdelaziz; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Gowda, Siddarame; Killiny, Nabil

2017-03-01

Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is an important pest of citrus. In addition, D. citri is the vector of Huanglongbing, a destructive disease in citrus, also known as citrus greening disease caused by Candidatus Liberibacter asiaticus. Huanglongbing causes huge losses for citrus industries. Insecticide application for D. citri is the major strategy to prevent disease spread. The heavy use of insecticides causes development of insecticide resistance. We used RNA interference (RNAi) to silence genes implicated in pesticide resistance in order to increase the susceptibility. The activity of dsRNA to reduce the expression of carboxyesterases including esterases FE4 (EstFE4) and acetylcholinesterases (AChe) in D. citri was investigated. The dsRNA was applied topically to the fourth and fifth instars of nymphs. We targeted several EstFE4 and AChe genes using dsRNA against a consensus sequence for each of them. Five concentrations (25, 50, 75, 100, 125 ng/μl) from both dsRNAs were used. The treatments with the dsRNA caused concentration dependent nymph mortality. The highest gene expression levels of both AChe and EstFE4 were found in the fourth and fifth nymphal instars. Gene expression analysis showed that AChe genes were downregulated in emerged adults from dsRNA-AChe-treated nymphs compared to controls. However, EstFE4 genes were not affected. In the same manner, treatment with dsRNA-EstFE4 reduced expression level of EstFE4 genes in emerged adults from treated nymphs, but did not affect the expression of AChe genes. In the era of environmentally friendly control strategies, RNAi is a new promising venue to reduce pesticide applications. © 2017 Wiley Periodicals, Inc.

Interference of transcription across H-NS binding sites and repression by H-NS.

PubMed

Rangarajan, Aathmaja Anandhi; Schnetz, Karin

2018-05-01

Nucleoid-associated protein H-NS represses transcription by forming extended DNA-H-NS complexes. Repression by H-NS operates mostly at the level of transcription initiation. Less is known about how DNA-H-NS complexes interfere with transcription elongation. In vitro H-NS has been shown to enhance RNA polymerase pausing and to promote Rho-dependent termination, while in vivo inhibition of Rho resulted in a decrease of the genome occupancy by H-NS. Here we show that transcription directed across H-NS binding regions relieves H-NS (and H-NS/StpA) mediated repression of promoters in these regions. Further, we observed a correlation of transcription across the H-NS-bound region and de-repression. The data suggest that the transcribing RNA polymerase is able to remodel the H-NS complex and/or dislodge H-NS from the DNA and thus relieve repression. Such an interference of transcription and H-NS mediated repression may imply that poorly transcribed AT-rich loci are prone to be repressed by H-NS, while efficiently transcribed loci escape repression. © 2018 John Wiley & Sons Ltd.

RNA Interference in Insect Vectors for Plant Viruses.

PubMed

Kanakala, Surapathrudu; Ghanim, Murad

2016-12-12

Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists.

RNA Interference in Insect Vectors for Plant Viruses

PubMed Central

Kanakala, Surapathrudu; Ghanim, Murad

2016-01-01

Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists. PMID:27973446

Multifunctional nanocarrier based on clay nanotubes for efficient intracellular siRNA delivery and gene silencing.

PubMed

Wu, Hui; Shi, Yinfeng; Huang, Chusen; Zhang, Yang; Wu, Jiahui; Shen, Hebai; Jia, Nengqin

2014-04-01

RNA interference-mediated gene silencing relating to disease has recently emerged as a powerful method in gene therapy. Despite the promises, effective transport of siRNA with minimal side effects remains a challenge. Halloysites are cheap and naturally available aluminosilicate clay nanotubes with high mechanical strength and biocompatibility. In this study, a novel multifunctional nanocarrier based on functionalized halloysite nanotubes (f-HNTs) has been developed via electrostatic layer-by-layer assembling approach for loading and intracellular delivery of therapeutic antisurvivin siRNA and simultaneously tracking their intracellular transport, in which PEI-modified HNTs are used as gene vector, antisurvivin siRNA as gene therapeutic agent, and mercaptoacetic acid-capped CdSe quantum dots as fluorescent labeling probes. The successful assembly of the f-HNTs-siRNA complexes was systematically characterized by transmission electron microscopy (TEM), UV-visible spectrophotometry, Zeta potential measurement, fluorescence spectrophotometry, and electrochemical impedance spectroscopy. Confocal microscopy, biological TEM, and flow cytometry studies revealed that the complexes enabled the efficient intracellular delivery of siRNA for cell-specific gene silencing. MTT assays exhibited that the complexes can enhance antitumor activity. Furthermore, Western blot analysis showed that f-HNTs-mediated siRNA delivery effectively knocked down gene expression of survivin and thereby decreased the levels of target proteins of PANC-1 cells. Therefore, this study suggested that the synthesized f-HNTs were a new effective drug delivery system for potential application in cancer gene therapy.

RNA interference therapy: a new solution for intracranial atherosclerosis?

PubMed Central

Tang, Tao; Wong, Ka-Sing

2014-01-01

Intracranial atherosclerotic stenosis (ICAS) of a major intracranial artery, especially middle cerebral artery (MCA), is reported to be one leading cause of ischemic stroke throughout the world. Compared with other stroke subtypes, ICAS is associated with a higher risk of recurrent stroke despite aggressive medical therapy. Increased understanding of the pathophysiology of ICAS has highlighted several possible targets for therapeutic interventions. Both luminal stenosis and plaque components of ICAS have been found to be associated with ischemic stroke based a post-mortem study. Recent application of high-resolution magnetic resonance imaging (HRMRI) in evaluating ICAS provides new insight into the vascular biology of plaque morphology and component. High signal on T1-weighted fat-suppressed images (HST1) within MCA plaque of HRMRI, highly suggested of fresh or recent intraplaque hemorrhage, has been found to be associated with ipsilateral brain infarction. Thus, the higher prevalence of intraplaque hemorrhage and neovasculature in symptomatic patients with MCA stenosis may provide a potential target for plaque stabilization. We hypothesize that RNA interference (RNAi) therapy delivered by modified nanoparticles may achieve in vivo biomedical imaging and targeted therapy. With the rapid developments in studies about therapeutic and diagnostic nanomaterials, future studies further exploring the molecular biology of atherosclerosis may provide more drug targets for plaque stabilization. PMID:25333054

Effects of Water on the Single-Chain Elasticity of Poly(U) RNA.

PubMed

Luo, Zhonglong; Cheng, Bo; Cui, Shuxun

2015-06-09

Water, the dominant component under the physiological condition, is a complicated solvent which greatly affects the properties of solute molecules. Here, we utilize atomic force microscope-based single-molecule force spectroscopy to study the influence of water on the single-molecule elasticity of an unstructured single-stranded RNA (poly(U)). In nonpolar solvents, RNA presents its inherent elasticity, which is consistent with the theoretical single-chain elasticity calculated by quantum mechanics calculations. In aqueous buffers, however, an additional energy of 1.88 kJ/mol·base is needed for the stretching of the ssRNA chain. This energy is consumed by the bound water rearrangement (Ew) during chain elongation. Further experimental results indicate that the Ew value is uncorrelated to the salt concentrations and stretching velocity. The results obtained in an 8 M guanidine·HCl solution provide more evidence that the bound water molecules around RNA give rise to the observed deviation between aqueous and nonaqueous environments. Compared to synthetic water-soluble polymers, the value of Ew of RNA is much lower. The weak interference of water is supposed to be the precondition for the RNA secondary structure to exist in aqueous solution.

Ty3 Retrotransposon Hijacks Mating Yeast RNA Processing Bodies to Infect New Genomes

PubMed Central

Kaake, Robyn; Dawson, Anthony R.; Matheos, Dina; Nagashima, Kunio; Sitlani, Parth; Patterson, Kurt; Chang, Ivan; Huang, Lan; Sandmeyer, Suzanne

2015-01-01

Retrotransposition of the budding yeast long terminal repeat retrotransposon Ty3 is activated during mating. In this study, proteins that associate with Ty3 Gag3 capsid protein during virus-like particle (VLP) assembly were identified by mass spectrometry and screened for roles in mating-stimulated retrotransposition. Components of RNA processing bodies including DEAD box helicases Dhh1/DDX6 and Ded1/DDX3, Sm-like protein Lsm1, decapping protein Dcp2, and 5’ to 3’ exonuclease Xrn1 were among the proteins identified. These proteins associated with Ty3 proteins and RNA, and were required for formation of Ty3 VLP retrosome assembly factories and for retrotransposition. Specifically, Dhh1/DDX6 was required for normal levels of Ty3 genomic RNA, and Lsm1 and Xrn1 were required for association of Ty3 protein and RNA into retrosomes. This role for components of RNA processing bodies in promoting VLP assembly and retrotransposition during mating in a yeast that lacks RNA interference, contrasts with roles proposed for orthologous components in animal germ cell ribonucleoprotein granules in turnover and epigenetic suppression of retrotransposon RNAs. PMID:26421679

Development of RNAi method for screening candidate genes to control emerald ash borer, Agrilus planipennis.

PubMed

Rodrigues, Thais B; Rieske, Lynne K; J Duan, Jian; Mogilicherla, Kanakachari; Palli, Subba R

2017-08-07

The ingestion of double-strand RNAs (dsRNA) targeting essential genes in an insect could cause mortality. Based on this principle, a new generation of insect control methods using RNA interference (RNAi) are being developed. In this work, we developed a bioassay for oral delivery of dsRNA to an invasive forest and urban tree pest, the emerald ash borer (EAB, Agrilus planipennis). EAB feeds and develops beneath the bark, killing trees rapidly. This behavior, coupled with the lack of a reliable artificial diet for rearing larvae and adults, make them difficult to study. We found that dsRNA is transported and processed to siRNAs by EAB larvae within 72 h after ingestion. Also, feeding neonate larvae with IAP (inhibitor of apoptosis) or COP (COPI coatomer, β subunit) dsRNA silenced their target genes and caused mortality. Both an increase in the concentration of dsRNA fed and sequential feeding of two different dsRNAs increased mortality. Here we provide evidence for successful RNAi in EAB, and demonstrate the development of a rapid and effective bioassay for oral delivery of dsRNA to screen additional genes.

A Multiple Aminoacyl-tRNA Synthetase Complex That Enhances tRNA-Aminoacylation in African Trypanosomes

PubMed Central

Cestari, Igor; Kalidas, Savitha; Monnerat, Severine; Anupama, Atashi; Phillips, Margaret A.

2013-01-01

The genes for all cytoplasmic and potentially all mitochondrial aminoacyl-tRNA synthetases (aaRSs) were identified, and all those tested by RNA interference were found to be essential for the growth of Trypanosoma brucei. Some of these enzymes were localized to the cytoplasm or mitochondrion, but most were dually localized to both cellular compartments. Cytoplasmic T. brucei aaRSs were organized in a multiprotein complex in both bloodstream and procyclic forms. The multiple aminoacyl-tRNA synthetase (MARS) complex contained at least six aaRS enzymes and three additional non-aaRS proteins. Steady-state kinetic studies showed that association in the MARS complex enhances tRNA-aminoacylation efficiency, which is in part dependent on a MARS complex-associated protein (MCP), named MCP2, that binds tRNAs and increases their aminoacylation by the complex. Conditional repression of MCP2 in T. brucei bloodstream forms resulted in reduced parasite growth and infectivity in mice. Thus, association in a MARS complex enhances tRNA-aminoacylation and contributes to parasite fitness. The MARS complex may be part of a cellular regulatory system and a target for drug development. PMID:24126051

Autoantigen La promotes efficient RNAi, antiviral response, and transposon silencing by facilitating multiple-turnover RISC catalysis.

PubMed

Liu, Ying; Tan, Huiling; Tian, Hui; Liang, Chunyang; Chen, She; Liu, Qinghua

2011-11-04

The effector of RNA interference (RNAi) is the RNA-induced silencing complex (RISC). C3PO promotes the activation of RISC by degrading the Argonaute2 (Ago2)-nicked passenger strand of duplex siRNA. Active RISC is a multiple-turnover enzyme that uses the guide strand of siRNA to direct the Ago2-mediated sequence-specific cleavage of complementary mRNA. How this effector step of RNAi is regulated is currently unknown. Here, we used the human Ago2 minimal RISC system to purify Sjögren's syndrome antigen B (SSB)/autoantigen La as an activator of the RISC-mediated mRNA cleavage activity. Our reconstitution studies showed that La could promote multiple-turnover RISC catalysis by facilitating the release of cleaved mRNA from RISC. Moreover, we demonstrated that La was required for efficient RNAi, antiviral defense, and transposon silencing in vivo. Taken together, the findings of C3PO and La reveal a general concept that regulatory factors are required to remove Ago2-cleaved products to assemble or restore active RISC. Copyright © 2011 Elsevier Inc. All rights reserved.

[Expression analysis of a transformer gene in Daphnia pulex after RNAi].

PubMed

Guo, C Y; Chen, P; Zhang, M M; Ning, J J; Wang, С L; Wang, D L; Zhao, Y L

2016-01-01

In order to explore the importance of the transformer (tra) gene in reproductive mode switching in Daphnia pulex, we studied the effect of silencing of this gene using RNA interference (RNAi). We obtained Dptra dsRNA by constructing and using a dsRNA expression vector and transcription method in vitro. D. pulex individuals in different reproductive modes were treated by soaking in a solution of Dptra dsRNA. We then assayed the expression of the endogenous Dptra mRNA after RNAi treatment using RT-PCR and obtained the suppression ratio. Expression of the tra gene in the RNAi groups was down-regulated compared with the controls after 16 h (p < 0.05). We also analyzed the effect of RNAi on the expression of the TRA protein using Western blot, which showed that the expression level of the TRA protein was reduced after RNAi treatment. Our experimental results showed that soaking of D. pulex adults in tra-specific dsRNA transcribed in vitro can specifically reduce the level of tra mRNA and also reduce the expression of the TRA protein, demonstrating effective in vivo silencing of the tra gene.

RNA Interference towards the Potato Psyllid, Bactericera cockerelli, Is Induced in Plants Infected with Recombinant Tobacco mosaic virus (TMV)

PubMed Central

Wuriyanghan, Hada; Falk, Bryce W.

2013-01-01

The potato/tomato psyllid, Bactericera cockerelli (B. cockerelli), is an important plant pest and the vector of the phloem-limited bacterium Candidatus Liberibacter psyllaurous (solanacearum), which is associated with the zebra chip disease of potatoes. Previously, we reported induction of RNA interference effects in B. cockerelli via in vitro-prepared dsRNA/siRNAs after intrathoracic injection, and after feeding of artificial diets containing these effector RNAs. In order to deliver RNAi effectors via plant hosts and to rapidly identify effective target sequences in plant-feeding B. cockerelli, here we developed a plant virus vector-based in planta system for evaluating candidate sequences. We show that recombinant Tobacco mosaic virus (TMV) containing B. cockerelli sequences can efficiently infect and generate small interfering RNAs in tomato (Solanum lycopersicum), tomatillo (Physalis philadelphica) and tobacco (Nicotiana tabacum) plants, and more importantly delivery of interfering sequences via TMV induces RNAi effects, as measured by actin and V-ATPase mRNA reductions, in B. cockerelli feeding on these plants. RNAi effects were primarily detected in the B. cockerelli guts. In contrast to our results with TMV, recombinant Potato virus X (PVX) and Tobacco rattle virus (TRV) did not give robust infections in all plants and did not induce detectable RNAi effects in B. cockerelli. The greatest RNA interference effects were observed when B. cockerelli nymphs were allowed to feed on leaf discs collected from inoculated or lower expanded leaves from corresponding TMV-infected plants. Tomatillo plants infected with recombinant TMV containing B. cockerelli actin or V-ATPase sequences also showed phenotypic effects resulting in decreased B. cockerelli progeny production as compared to plants infected by recombinant TMV containing GFP. These results showed that RNAi effects can be achieved in plants against the phloem feeder, B. cockerelli, and the TMV-plant system will provide a faster and more convenient method for screening of suitable RNAi target sequences in planta. PMID:23824081

Silencing the roadblocks to effective triple-negative breast cancer treatments by siRNA nanoparticles.

PubMed

Parvani, Jenny G; Jackson, Mark W

2017-04-01

Over the past decade, RNA interference (RNAi) has been ubiquitously utilized to study biological function in vitro ; however, limitations were associated with its utility in vivo More recently, small interfering RNA (siRNA) nanoparticles with improved biocompatibility have gained prevalence as a potential therapeutic option for the treatment of various diseases. The adaptability of siRNA nanoparticles enables the delivery of virtually any siRNA, which is especially advantageous for therapeutic applications in heterogeneous diseases that lack unifying molecular features, such as triple-negative breast cancer (TNBC). TNBC is an aggressive subtype of breast cancer that is stratified by the lack of estrogen receptor/progesterone receptor expression and HER2 amplification. There are currently no FDA-approved targeted therapies for the treatment of TNBCs, making cytotoxic chemotherapy the only treatment option available to these patients. In this review, we outline the current status of siRNA nanoparticles in clinical trials for cancer treatment and discuss the promising preclinical approaches that have utilized siRNA nanoparticles for TNBC treatment. Next, we address TNBC subtype-specific therapeutic interventions and highlight where and how siRNA nanoparticles fit into these strategies. Lastly, we point out ongoing challenges in the field of siRNA nanoparticle research that, if addressed, would significantly improve the efficacy of siRNA nanoparticles as a therapeutic option for cancer treatment. © 2017 Society for Endocrinology.

Mitochondrial uncoupling proteins regulate angiotensin-converting enzyme expression: crosstalk between cellular and endocrine metabolic regulators suggested by RNA interference and genetic studies.

PubMed

Dhamrait, Sukhbir S; Maubaret, Cecilia; Pedersen-Bjergaard, Ulrik; Brull, David J; Gohlke, Peter; Payne, John R; World, Michael; Thorsteinsson, Birger; Humphries, Steve E; Montgomery, Hugh E

2016-07-01

Uncoupling proteins (UCPs) regulate mitochondrial function, and thus cellular metabolism. Angiotensin-converting enzyme (ACE) is the central component of endocrine and local tissue renin-angiotensin systems (RAS), which also regulate diverse aspects of whole-body metabolism and mitochondrial function (partly through altering mitochondrial UCP expression). We show that ACE expression also appears to be regulated by mitochondrial UCPs. In genetic analysis of two unrelated populations (healthy young UK men and Scandinavian diabetic patients) serum ACE (sACE) activity was significantly higher amongst UCP3-55C (rather than T) and UCP2 I (rather than D) allele carriers. RNA interference against UCP2 in human umbilical vein endothelial cells reduced UCP2 mRNA sixfold (P < 0·01) whilst increasing ACE expression within a physiological range (<1·8-fold at 48 h; P < 0·01). Our findings suggest novel hypotheses. Firstly, cellular feedback regulation may occur between UCPs and ACE. Secondly, cellular UCP regulation of sACE suggests a novel means of crosstalk between (and mutual regulation of) cellular and endocrine metabolism. This might partly explain the reduced risk of developing diabetes and metabolic syndrome with RAS antagonists and offer insight into the origins of cardiovascular disease in which UCPs and ACE both play a role. © 2016 The Authors. BioEssays published by WILEY Periodicals, Inc.

Mitochondrial uncoupling proteins regulate angiotensin‐converting enzyme expression: crosstalk between cellular and endocrine metabolic regulators suggested by RNA interference and genetic studies

PubMed Central

Maubaret, Cecilia; Pedersen‐Bjergaard, Ulrik; Brull, David J.; Gohlke, Peter; Payne, John R.; World, Michael; Thorsteinsson, Birger; Humphries, Steve E.; Montgomery, Hugh E.

2015-01-01

Uncoupling proteins (UCPs) regulate mitochondrial function, and thus cellular metabolism. Angiotensin‐converting enzyme (ACE) is the central component of endocrine and local tissue renin–angiotensin systems (RAS), which also regulate diverse aspects of whole‐body metabolism and mitochondrial function (partly through altering mitochondrial UCP expression). We show that ACE expression also appears to be regulated by mitochondrial UCPs. In genetic analysis of two unrelated populations (healthy young UK men and Scandinavian diabetic patients) serum ACE (sACE) activity was significantly higher amongst UCP3‐55C (rather than T) and UCP2 I (rather than D) allele carriers. RNA interference against UCP2 in human umbilical vein endothelial cells reduced UCP2 mRNA sixfold (P < 0·01) whilst increasing ACE expression within a physiological range (<1·8‐fold at 48 h; P < 0·01). Our findings suggest novel hypotheses. Firstly, cellular feedback regulation may occur between UCPs and ACE. Secondly, cellular UCP regulation of sACE suggests a novel means of crosstalk between (and mutual regulation of) cellular and endocrine metabolism. This might partly explain the reduced risk of developing diabetes and metabolic syndrome with RAS antagonists and offer insight into the origins of cardiovascular disease in which UCPs and ACE both play a role. PMID:27347560

Mitochondrial uncoupling proteins regulate angiotensin-converting enzyme expression: crosstalk between cellular and endocrine metabolic regulators suggested by RNA interference and genetic studies.

PubMed

Dhamrait, Sukhbir S; Maubaret, Cecilia; Pedersen-Bjergaard, Ulrik; Brull, David J; Gohlke, Peter; Payne, John R; World, Michael; Thorsteinsson, Birger; Humphries, Steve E; Montgomery, Hugh E

2016-01-01

Uncoupling proteins (UCPs) regulate mitochondrial function, and thus cellular metabolism. Angiotensin-converting enzyme (ACE) is the central component of endocrine and local tissue renin-angiotensin systems (RAS), which also regulate diverse aspects of whole-body metabolism and mitochondrial function (partly through altering mitochondrial UCP expression). We show that ACE expression also appears to be regulated by mitochondrial UCPs. In genetic analysis of two unrelated populations ( healthy young UK men and Scandinavian diabetic patients ) serum ACE (sACE) activity was significantly higher amongst UCP3-55C (rather than T) and UCP2 I (rather than D) allele carriers. RNA interference against UCP2 in human umbilical vein endothelial cells reduced UCP2 mRNA sixfold ( P  < 0·01) whilst increasing ACE expression within a physiological range (<1·8-fold at 48 h; P  < 0·01). Our findings suggest novel hypotheses. Firstly, cellular feedback regulation may occur between UCPs and ACE. Secondly, cellular UCP regulation of sACE suggests a novel means of crosstalk between (and mutual regulation of) cellular and endocrine metabolism. This might partly explain the reduced risk of developing diabetes and metabolic syndrome with RAS antagonists and offer insight into the origins of cardiovascular disease in which UCPs and ACE both play a role.

A RNA Interference Screen Identifies the Protein Phosphatase 2A Subunit PR55γ as a Stress-Sensitive Inhibitor of c-SRC

PubMed Central

Eichhorn, Pieter J. A; Creyghton, Menno P; Wilhelmsen, Kevin; van Dam, Hans; Bernards, René

2007-01-01

Protein Phosphatase type 2A (PP2A) represents a family of holoenzyme complexes with diverse biological activities. Specific holoenzyme complexes are thought to be deregulated during oncogenic transformation and oncogene-induced signaling. Since most studies on the role of this phosphatase family have relied on the use of generic PP2A inhibitors, the contribution of individual PP2A holoenzyme complexes in PP2A-controlled signaling pathways is largely unclear. To gain insight into this, we have constructed a set of shRNA vectors targeting the individual PP2A regulatory subunits for suppression by RNA interference. Here, we identify PR55γ and PR55δ as inhibitors of c-Jun NH2-terminal kinase (JNK) activation by UV irradiation. We show that PR55γ binds c-SRC and modulates the phosphorylation of serine 12 of c-SRC, a residue we demonstrate to be required for JNK activation by c-SRC. We also find that the physical interaction between PR55γ and c-SRC is sensitive to UV irradiation. Our data reveal a novel mechanism of c-SRC regulation whereby in response to stress c-SRC activity is regulated, at least in part, through loss of the interaction with its inhibitor, PR55γ. PMID:18069897

RNA Interference Using c-Myc-Conjugated Nanoparticles Suppresses Breast and Colorectal Cancer Models.

PubMed

Tangudu, Naveen K; Verma, Vinod K; Clemons, Tristan D; Beevi, Syed S; Hay, Trevor; Mahidhara, Ganesh; Raja, Meera; Nair, Rekha A; Alexander, Liza E; Patel, Anant B; Jose, Jedy; Smith, Nicole M; Zdyrko, Bogdan; Bourdoncle, Anne; Luzinov, Igor; Iyer, K Swaminathan; Clarke, Alan R; Dinesh Kumar, Lekha

2015-05-01

In this article, we report the development and preclinical validation of combinatorial therapy for treatment of cancers using RNA interference (RNAi). RNAi technology is an attractive approach to silence genes responsible for disease onset and progression. Currently, the critical challenge facing the clinical success of RNAi technology is in the difficulty of delivery of RNAi inducers, due to low transfection efficiency, difficulties of integration into host DNA and unstable expression. Using the macromolecule polyglycidal methacrylate (PGMA) as a platform to graft multiple polyethyleneimine (PEI) chains, we demonstrate effective delivery of small oligos (anti-miRs and mimics) and larger DNAs (encoding shRNAs) in a wide variety of cancer cell lines by successful silencing/activation of their respective target genes. Furthermore, the effectiveness of this therapy was validated for in vivo tumor suppression using two transgenic mouse models; first, tumor growth arrest and increased animal survival was seen in mice bearing Brca2/p53-mutant mammary tumors following daily intratumoral treatment with nanoparticles conjugated to c-Myc shRNA. Second, oral delivery of the conjugate to an Apc-deficient crypt progenitor colon cancer model increased animal survival and returned intestinal tissue to a non-wnt-deregulated state. This study demonstrates, through careful design of nonviral nanoparticles and appropriate selection of therapeutic gene targets, that RNAi technology can be made an affordable and amenable therapy for cancer. ©2015 American Association for Cancer Research.

Dual role for argonautes in microRNA processing and posttranscriptional regulation of microRNA expression.

PubMed

Diederichs, Sven; Haber, Daniel A

2007-12-14

MicroRNAs are small endogenous noncoding RNAs involved in posttranscriptional gene regulation. During microRNA biogenesis, Drosha and Dicer process the primary transcript (pri-miRNA) through a precursor hairpin (pre-miRNA) to the mature miRNA. The miRNA is incorporated into the RNA-Induced Silencing Complex (RISC) with Argonaute proteins, the effector molecules in RNA interference (RNAi). Here, we show that all Argonautes elevate mature miRNA expression posttranscriptionally, independent of RNase activity. Also, we identify a role for the RISC slicer Argonaute2 (Ago2) in cleaving the pre-miRNA to an additional processing intermediate, termed Ago2-cleaved precursor miRNA or ac-pre-miRNA. This endogenous, on-pathway intermediate results from cleavage of the pre-miRNA hairpin 12 nucleotides from its 3'-end. By analogy to siRNA processing, Ago2 cleavage may facilitate removal of the nicked passenger strand from RISC after maturation. The multiple roles of Argonautes in the RNAi effector phase and miRNA biogenesis and maturation suggest coordinate regulation of microRNA expression and function.

[Herpes simplex virus-mediated RNA interference targeting vesicular glutamate transporter 3 attenuates tactile allodynia in mice].

PubMed

Liu, Jie-Qiong; Li, Chen-Hong; Luo, Qiong; Yin, Ping-Ping; Lei, Tao; Luo, Fang

2016-11-20

To construct a replication-deficient herpes simplex virus (HSV-1) for delivering a short hairpin RNA (shRNA) targeting vesicular glutamate transporter 3 (VGLUT3) and observe its effect in alleviating allodynia in mice. The recombinant HSV-1 vector carrying the shRNA targeting Vglut3 (HSV-1-shvglut3) was constructed and inoculated in the sciatic nerve in a mouse model of mechanical allodynia to test its analgesia effect. Mechanical allodynia and heat hypersensitivity of the mice were tested by von Frey filaments and Hargreaves' test, respectively. VGLUT3 expression in the dorsal root ganglion (DRG) was evaluated by immunohistochemistry and Western blotting. Following inoculation in the sciatic nerve, the HSV vector HSV-1-shvglut3 was retrogradely transported to the DRG. Mechanical withdraw thresholds of the mouse models receiving HSV-1-shvglut3 inoculation were reversed to nearly the baseline level, and VGLUT3 expression in the DRG was down-regulated 2 weeks after vector inoculation. The analgesic effect lasted for over 2 weeks in these mice without obvious systematic side effects or changes in heat hypersensitivity threshold. Vglut3 in the DRG is a promising therapeutic target for alleviating mechanical allodynia, and HSV-1 vector-mediated RNA interference is safe and efficient for inducing long-lasting analgesia after peripheral inoculation of the vector.

Combinatorial RNA Interference Therapy Prevents Selection of Pre-existing HBV Variants in Human Liver Chimeric Mice

PubMed Central

Shih, Yao-Ming; Sun, Cheng-Pu; Chou, Hui-Hsien; Wu, Tzu-Hui; Chen, Chun-Chi; Wu, Ping-Yi; Enya Chen, Yu-Chen; Bissig, Karl-Dimiter; Tao, Mi-Hua

2015-01-01

Selection of escape mutants with mutations within the target sequence could abolish the antiviral RNA interference activity. Here, we investigated the impact of a pre-existing shRNA-resistant HBV variant on the efficacy of shRNA therapy. We previously identified a highly potent shRNA, S1, which, when delivered by an adeno-associated viral vector, effectively inhibits HBV replication in HBV transgenic mice. We applied the “PICKY” software to systemically screen the HBV genome, then used hydrodynamic transfection and HBV transgenic mice to identify additional six highly potent shRNAs. Human liver chimeric mice were infected with a mixture of wild-type and T472C HBV, a S1-resistant HBV variant, and then treated with a single or combined shRNAs. The presence of T472C mutant compromised the therapeutic efficacy of S1 and resulted in replacement of serum wild-type HBV by T472C HBV. In contrast, combinatorial therapy using S1 and P28, one of six potent shRNAs, markedly reduced titers for both wild-type and T472C HBV. Interestingly, treatment with P28 alone led to the emergence of escape mutants with mutations in the P28 target region. Our results demonstrate that combinatorial RNAi therapy can minimize the escape of resistant viral mutants in chronic HBV patients. PMID:26482836

RNA Interference: A New Mechanism by Which FMRP Acts in the Normal Brain? What Can Drosophila Teach Us?

ERIC Educational Resources Information Center

Siomi, Haruhiko; Ishizuka, Akira; Siomi, Mikiko C.

2004-01-01

Fragile X syndrome is the most common heritable form of mental retardation caused by loss-of-function mutations in the "FMR1" gene. The "FMR1" gene encodes an RNA-binding protein that associates with translating ribosomes and acts as a negative translational regulator. Recent work in "Drosophila melanogaster" has shown that the fly homolog of…

Photoinduced RNA interference.

PubMed

Matsushita-Ishiodori, Yuka; Ohtsuki, Takashi

2012-07-17

Because RNA interference (RNAi) can be applied to any gene, this technique has been widely used for studying gene functions. In addition, many researchers are attempting to use RNAi technology in RNAi-based therapies. However, several challenging and controversial issues have arisen during the widespread application of RNAi including target gene specificity, target cell specificity, and spatiotemporal control of gene silencing. To address these issues, several groups have utilized photochemistry to control the RNA release, both spatially and temporally. In this Account, we focus on recent studies using photocleavable protecting groups, photosensitizers, Hand gold nanoparticles for photoinduced RNAi. In 2005 the first report of photoinduced RNAi used a caged short interfering RNA (siRNA), an siRNA carrying a photocleavable protecting group. Caging groups block the bioactivities of target molecules, but allow for complete recovery of these functions via photoactivation. However, some RNAi activity can occur in these caged siRNAs, so it will be necessary to decrease this "leakage" and raise the RNAi activity restored after irradiation. This technique also uses UV light around 350 nm, which is cytotoxic, but in the near future we expect that it will be possible to use visible and near-infrared light We also examine the application of photochemical internalization (PCI) to RNAi technology, which involves a combination of photosensitizers and light. Instead of inducing RNAi using light, the strategy behind this method was to enhance RNAi using RNA carriers. Many wellknown RNA carriers deliver siRNAs into cells by endocytosis. The siRNAs are trapped in endocytic vesicles and have to be released into the cytoplasm in order to express their activity. To achieve the endosomal escape of siRNAs, PCI technology employed photosensitizers to generate light-dependent reactive oxygen species (ROS) that disrupted the endocytic vesicles. In most studies, RNAi-mediated knockdown of the target gene was detected even without PCI. Recently, a polymer capable of trapping the siRNA in endocytic vesicles controlled RNAi almost entirely by light. CLIP-RNAi uses photosensitizing carrier proteins that can be activated over a wide range of visible light wavelengths. With this method RNA carrier/siRNA complexes are completely trapped within endosomes, and RNAi is controlled strictly by light. Such precise, light-dependent control will open up new possibilities for cellular and molecular biology and therapy. Most recently, gold nanoparticles (AuNPs) conjugated to siRNA have provided temporal and spatial control of RNAi. The light-dependent melting of AuNPs accompanied by a shape transformation induces the release of thiolated siRNAs from AuNPs. In this method, the unique optical properties of the AuNP enable deep penetration of the excitation light into tissues at nearinfrared wavelengths. The development of photoinduced RNAi technology will lead to novel insights into gene functions and selective drug delivery, and many other scientific fields will continue to influence its progress.

Strand antagonism in RNAi: an explanation of differences in potency between intracellularly expressed siRNA and shRNA

PubMed Central

Jin, Xin; Sun, Tingting; Zhao, Chuanke; Zheng, Yongxiang; Zhang, Yufan; Cai, Weijing; He, Qiuchen; Taira, Kaz; Zhang, Lihe; Zhou, Demin

2012-01-01

Strategies to regulate gene function frequently use small interfering RNAs (siRNAs) that can be made from their shRNA precursors via Dicer. However, when the duplex components of these siRNA effectors are expressed from their respective coding genes, the RNA interference (RNAi) activity is much reduced. Here, we explored the mechanisms of action of shRNA and siRNA and found the expressed siRNA, in contrast to short hairpin RNA (shRNA), exhibits strong strand antagonism, with the sense RNA negatively and unexpectedly regulating RNAi. Therefore, we altered the relative levels of strands of siRNA duplexes during their expression, increasing the level of the antisense component, reducing the level of the sense component, or both and, in this way we were able to enhance the potency of the siRNA. Such vector-delivered siRNA attacked its target effectively. These findings provide new insight into RNAi and, in particular, they demonstrate that strand antagonism is responsible for making siRNA far less potent than shRNA. PMID:22039150

A-to-I RNA editing promotes developmental stage–specific gene and lncRNA expression

PubMed Central

Goldstein, Boaz; Agranat-Tamir, Lily; Light, Dean; Ben-Naim Zgayer, Orna; Fishman, Alla; Lamm, Ayelet T.

2017-01-01

A-to-I RNA editing is a conserved widespread phenomenon in which adenosine (A) is converted to inosine (I) by adenosine deaminases (ADARs) in double-stranded RNA regions, mainly noncoding. Mutations in ADAR enzymes in Caenorhabditis elegans cause defects in normal development but are not lethal as in human and mouse. Previous studies in C. elegans indicated competition between RNA interference (RNAi) and RNA editing mechanisms, based on the observation that worms that lack both mechanisms do not exhibit defects, in contrast to the developmental defects observed when only RNA editing is absent. To study the effects of RNA editing on gene expression and function, we established a novel screen that enabled us to identify thousands of RNA editing sites in nonrepetitive regions in the genome. These include dozens of genes that are edited at their 3′ UTR region. We found that these genes are mainly germline and neuronal genes, and that they are down-regulated in the absence of ADAR enzymes. Moreover, we discovered that almost half of these genes are edited in a developmental-specific manner, indicating that RNA editing is a highly regulated process. We found that many pseudogenes and other lncRNAs are also extensively down-regulated in the absence of ADARs in the embryo but not in the fourth larval (L4) stage. This down-regulation is not observed upon additional knockout of RNAi. Furthermore, levels of siRNAs aligned to pseudogenes in ADAR mutants are enhanced. Taken together, our results suggest a role for RNA editing in normal growth and development by regulating silencing via RNAi. PMID:28031250

Transcriptional and phenotypic comparisons of Ppara knockout and siRNA knockdown mice

PubMed Central

De Souza, Angus T.; Dai, Xudong; Spencer, Andrew G.; Reppen, Tom; Menzie, Ann; Roesch, Paula L.; He, Yudong; Caguyong, Michelle J.; Bloomer, Sherri; Herweijer, Hans; Wolff, Jon A.; Hagstrom, James E.; Lewis, David L.; Linsley, Peter S.; Ulrich, Roger G.

2006-01-01

RNA interference (RNAi) has great potential as a tool for studying gene function in mammals. However, the specificity and magnitude of the in vivo response to RNAi remains to be fully characterized. A molecular and phenotypic comparison of a genetic knockout mouse and the corresponding knockdown version would help clarify the utility of the RNAi approach. Here, we used hydrodynamic delivery of small interfering RNA (siRNA) to knockdown peroxisome proliferator activated receptor alpha (Ppara), a gene that is central to the regulation of fatty acid metabolism. We found that Ppara knockdown in the liver results in a transcript profile and metabolic phenotype that is comparable to those of Ppara−/− mice. Combining the profiles from mice treated with the PPARα agonist fenofibrate, we confirmed the specificity of the RNAi response and identified candidate genes proximal to PPARα regulation. Ppara knockdown animals developed hypoglycemia and hypertriglyceridemia, phenotypes observed in Ppara−/− mice. In contrast to Ppara−/− mice, fasting was not required to uncover these phenotypes. Together, these data validate the utility of the RNAi approach and suggest that siRNA can be used as a complement to classical knockout technology in gene function studies. PMID:16945951

Bluetongue virus RNA detection by real-time rt-PCR in post-vaccination samples from cattle.

PubMed

De Leeuw, I; Garigliany, M; Bertels, G; Willems, T; Desmecht, D; De Clercq, K

2015-04-01

Bluetongue virus serotype 8 (BTV-8) was responsible for a large outbreak among European ruminant populations in 2006-2009. In spring 2008, a massive vaccination campaign was undertaken, leading to the progressive disappearance of the virus. During surveillance programmes in Western Europe in 2010-2011, a low but significant number of animals were found weakly positive using BTV-specific real-time RT-PCR, raising questions about a possible low level of virus circulation. An interference of the BTV-8 inactivated vaccine on the result of the real-time RT-PCR was also hypothesized. Several studies specifically addressed the potential association between a recent vaccination and BTV-8 RNA detection in the blood of sheep. Results were contradictory and cattles were not investigated. To enlighten this point, a large study was performed to determine the risks of detection of bluetongue vaccine-associated RNA in the blood and spleen of cattle using real-time RT-PCR. Overall, the results presented clearly demonstrate that vaccine viral RNA can reach the blood circulation in sufficient amounts to be detected by real-time RT-PCR in cattle. This BTV-8 vaccine RNA carriage appears as short lasting. © 2013 Blackwell Verlag GmbH.

Designing and Testing Functional RNA Nanoparticles | Center for Cancer Research

Cancer.gov

Recent advances in nanotechnology have generated excitement that nanomaterials may provide novel approaches for the diagnosis and treatment of deadly diseases, such as cancer. However, the use of synthetic materials to generate nanoparticles can present challenges with endotoxin content, sterility, or biocompatibility. Employing biological materials may overcome these issues with RNA being particularly attractive given the clinical applications of RNA interference and the abundance of functional RNAs, including aptamers and ribozymes. RNA can form stable three-dimensional nanoparticle structures that can be decorated with other nucleic acids, small molecules, or proteins, potentially increasing local concentrations of therapeutic agents and acting synergistically when combined.

Mg2+ Effect on Argonaute and RNA Duplex by Molecular Dynamics and Bioinformatics Implications

PubMed Central

Nam, Seungyoon; Ryu, Hyojung; Son, Won-joon; Kim, Yon Hui; Kim, Kyung Tae; Balch, Curt; Nephew, Kenneth P.; Lee, Jinhyuk

2014-01-01

RNA interference (RNAi), mediated by small non-coding RNAs (e.g., miRNAs, siRNAs), influences diverse cellular functions. Highly complementary miRNA-target RNA (or siRNA-target RNA) duplexes are recognized by an Argonaute family protein (Ago2), and recent observations indicate that the concentration of Mg2+ ions influences miRNA targeting of specific mRNAs, thereby modulating miRNA-mRNA networks. In the present report, we studied the thermodynamic effects of differential [Mg2+] on slicing (RNA silencing cycle) through molecular dynamics simulation analysis, and its subsequent statistical analysis. Those analyses revealed different structural conformations of the RNA duplex in Ago2, depending on Mg2+ concentration. We also demonstrate that cation effects on Ago2 structural flexibility are critical to its catalytic/functional activity, with low [Mg2+] favoring greater Ago2 flexibility (e.g., greater entropy) and less miRNA/mRNA duplex stability, thus favoring slicing. The latter finding was supported by a negative correlation between expression of an Mg2+ influx channel, TRPM7, and one miRNA’s (miR-378) ability to downregulate its mRNA target, TMEM245. These results imply that thermodynamics could be applied to siRNA-based therapeutic strategies, using highly complementary binding targets, because Ago2 is also involved in RNAi slicing by exogenous siRNAs. However, the efficacy of a siRNA-based approach will differ, to some extent, based on the Mg2+ concentration even within the same disease type; therefore, different siRNA-based approaches might be considered for patient-to-patient needs. PMID:25330448

New RNAi strategy for selective suppression of a mutant allele in polyglutamine disease.

PubMed

Kubodera, Takayuki; Yokota, Takanori; Ishikawa, Kinya; Mizusawa, Hidehiro

2005-12-01

In gene therapy of dominantly inherited diseases with small interfering RNA (siRNA), mutant allele specific suppression may be necessary for diseases in which the defective gene normally has an important role. It is difficult, however, to design a mutant allele-specific siRNA for trinucleotide repeat diseases in which the difference of sequences is only repeat length. To overcome this problem, we use a new RNA interference (RNAi) strategy for selective suppression of mutant alleles. Both mutant and wild-type alleles are inhibited by the most effective siRNA, and wild-type protein is restored using the wild-type mRNA modified to be resistant to the siRNA. Here, we applied this method to spinocerebellar ataxia type 6 (SCA6). We discuss its feasibility and problems for future gene therapy.

Structural insights into RNA processing by the human RISC-loading complex.

PubMed

Wang, Hong-Wei; Noland, Cameron; Siridechadilok, Bunpote; Taylor, David W; Ma, Enbo; Felderer, Karin; Doudna, Jennifer A; Nogales, Eva

2009-11-01

Targeted gene silencing by RNA interference (RNAi) requires loading of a short guide RNA (small interfering RNA (siRNA) or microRNA (miRNA)) onto an Argonaute protein to form the functional center of an RNA-induced silencing complex (RISC). In humans, Argonaute2 (AGO2) assembles with the guide RNA-generating enzyme Dicer and the RNA-binding protein TRBP to form a RISC-loading complex (RLC), which is necessary for efficient transfer of nascent siRNAs and miRNAs from Dicer to AGO2. Here, using single-particle EM analysis, we show that human Dicer has an L-shaped structure. The RLC Dicer's N-terminal DExH/D domain, located in a short 'base branch', interacts with TRBP, whereas its C-terminal catalytic domains in the main body are proximal to AGO2. A model generated by docking the available atomic structures of Dicer and Argonaute homologs into the RLC reconstruction suggests a mechanism for siRNA transfer from Dicer to AGO2.

RDE-1 slicer activity is required only for passenger-strand cleavage during RNAi in Caenorhabditis elegans.

PubMed

Steiner, Florian A; Okihara, Kristy L; Hoogstrate, Suzanne W; Sijen, Titia; Ketting, René F

2009-02-01

RNA interference (RNAi) is a process in which double-stranded RNA is cleaved into small interfering RNAs (siRNAs) that induce the destruction of homologous single-stranded mRNAs. Argonaute proteins are essential components of this silencing process; they bind siRNAs directly and can cleave RNA targets using a conserved RNase H motif. In Caenorhabditis elegans, the Argonaute protein RDE-1 has a central role in RNAi. In animals lacking RDE-1, the introduction of double-stranded RNA does not trigger any detectable level of RNAi. Here we show that RNase H activity of RDE-1 is required only for efficient removal of the passenger strand of the siRNA duplex and not for triggering the silencing response at the target-mRNA level. These results uncouple the role of the RDE-1 RNase H activity in small RNA maturation from its role in target-mRNA silencing in vivo.

Small interfering ribonucleic acid induces liquid-to-ripple phase transformation in a phospholipid membrane

DOE Office of Scientific and Technical Information (OSTI.GOV)

Choubey, Amit; Nomura, Ken-ichi; Kalia, Rajiv K.

Small interfering ribonucleic acid (siRNA) molecules play a pivotal role in silencing gene expression via the RNA interference mechanism. A key limitation to the widespread implementation of siRNA therapeutics is the difficulty of delivering siRNA-based drugs to cells. Here, we examine changes in the structure and dynamics of a dipalmitoylphosphatidylcholine bilayer in the presence of a siRNA molecule and mechanical barriers to siRNA transfection in the bilayer. Our all-atom molecular dynamics simulation shows that siRNA induces a liquid crystalline-to-ripple phase transformation in the bilayer. The ripple phase consists of a major region of non-interdigitated and a minor region of interdigitatedmore » lipid molecules with an intervening kink. In the ripple phase, hydrocarbon chains of lipid molecules have large compressive stresses, which present a considerable barrier to siRNA transfection.« less

In Vivo RNA Interference Screening Identifies a Leukemia-Specific Dependence on Integrin Beta 3 Signaling

PubMed Central

Miller, Peter G.; Al-Shahrour, Fatima; Hartwell, Kimberly A.; Chu, Lisa P.; Järås, Marcus; Puram, Rishi V.; Puissant, Alexandre; Callahan, Kevin P.; Ashton, John; McConkey, Marie E.; Poveromo, Luke P.; Cowley, Glenn S.; Kharas, Michael G.; Labelle, Myriam; Shterental, Sebastian; Fujisaki, Joji; Silberstein, Lev; Alexe, Gabriela; Al-Hajj, Muhammad A.; Shelton, Christopher A.; Armstrong, Scott A.; Root, David E.; Scadden, David T.; Hynes, Richard O.; Mukherjee, Siddhartha; Stegmaier, Kimberly; Jordan, Craig T.; Ebert, Benjamin L.

2013-01-01

SUMMARY We used an in vivo short hairpin RNA (shRNA) screening approach to identify genes that are essential for MLL-AF9 acute myeloid leukemia (AML). We found that Integrin Beta 3 (Itgb3) is essential for murine leukemia cells in vivo, and for human leukemia cells in xenotransplantation studies. In leukemia cells, Itgb3 knockdown impaired homing, downregulated LSC transcriptional programs, and induced differentiation via the intracellular kinase, Syk. In contrast, loss of Itgb3 in normal HSPCs did not affect engraftment, reconstitution, or differentiation. Finally, we confirmed that Itgb3 is dispensable for normal hematopoiesis and required for leukemogenesis using an Itgb3 knockout mouse model. Our results establish the significance of the Itgb3 signaling pathway as a potential therapeutic target in AML. PMID:23770013

CRISPR/Cas9 mediates efficient conditional mutagenesis in Drosophila.

PubMed

Xue, Zhaoyu; Wu, Menghua; Wen, Kejia; Ren, Menda; Long, Li; Zhang, Xuedi; Gao, Guanjun

2014-09-05

Existing transgenic RNA interference (RNAi) methods greatly facilitate functional genome studies via controlled silencing of targeted mRNA in Drosophila. Although the RNAi approach is extremely powerful, concerns still linger about its low efficiency. Here, we developed a CRISPR/Cas9-mediated conditional mutagenesis system by combining tissue-specific expression of Cas9 driven by the Gal4/upstream activating site system with various ubiquitously expressed guide RNA transgenes to effectively inactivate gene expression in a temporally and spatially controlled manner. Furthermore, by including multiple guide RNAs in a transgenic vector to target a single gene, we achieved a high degree of gene mutagenesis in specific tissues. The CRISPR/Cas9-mediated conditional mutagenesis system provides a simple and effective tool for gene function analysis, and complements the existing RNAi approach. Copyright © 2014 Xue et al.

A novel albumin nanocomplex containing both small interfering RNA and gold nanorods for synergetic anticancer therapy

NASA Astrophysics Data System (ADS)

Choi, Jin-Ha; Hwang, Hai-Jin; Shin, Seung Won; Choi, Jeong-Woo; Um, Soong Ho; Oh, Byung-Keun

2015-05-01

Therapeutic nanocomplexes have been extensively developed for the effective treatment of aggressive cancers because of their outstanding versatility, easy manipulation, and low cytotoxicity. In this study, we describe the synthesis of a novel bovine serum albumin (BSA)-based nanocomplex harboring both Bcl-2-specific small interfering RNA (siRNA) and gold (Au) nanorods (siRNA and rods encapsulated in BSA; SREB) with the aim of developing a targeted breast cancer therapeutic. The SREB complexes contained 2 × 105 siRNA molecules and eight Au nanorods per BSA complex and were successively functionalized with polyethylene glycol (PEG) and anti-ErbB-2 antibodies to facilitate active targeting. The synergetic therapeutic activity originating from the two components effectively induced cell death (~80% reduction in viability compared with control cells) in target breast cancer cells after a single dose of laser irradiation. Intracellular SREB nanocomplex decomposition by proteolytic enzymes resulted in simultaneous RNA interference and thermal ablation, thus leading to apoptosis in the targeted cancer cells. Moreover, these therapeutic effects were sustained for approximately 72 hours. The intrinsic biocompatibility, multifunctionality, and potent in vitro anticancer properties of these SREB nanocomplexes indicate that they have great therapeutic potential for in vivo targeted cancer therapy, in addition to other areas of nanomedicine.Therapeutic nanocomplexes have been extensively developed for the effective treatment of aggressive cancers because of their outstanding versatility, easy manipulation, and low cytotoxicity. In this study, we describe the synthesis of a novel bovine serum albumin (BSA)-based nanocomplex harboring both Bcl-2-specific small interfering RNA (siRNA) and gold (Au) nanorods (siRNA and rods encapsulated in BSA; SREB) with the aim of developing a targeted breast cancer therapeutic. The SREB complexes contained 2 × 105 siRNA molecules and eight Au nanorods per BSA complex and were successively functionalized with polyethylene glycol (PEG) and anti-ErbB-2 antibodies to facilitate active targeting. The synergetic therapeutic activity originating from the two components effectively induced cell death (~80% reduction in viability compared with control cells) in target breast cancer cells after a single dose of laser irradiation. Intracellular SREB nanocomplex decomposition by proteolytic enzymes resulted in simultaneous RNA interference and thermal ablation, thus leading to apoptosis in the targeted cancer cells. Moreover, these therapeutic effects were sustained for approximately 72 hours. The intrinsic biocompatibility, multifunctionality, and potent in vitro anticancer properties of these SREB nanocomplexes indicate that they have great therapeutic potential for in vivo targeted cancer therapy, in addition to other areas of nanomedicine. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr00211g

Modulating drug resistance by targeting BCRP/ABCG2 using retrovirus-mediated RNA interference.

PubMed

Xie, Ni; Mou, Lisha; Yuan, Jianhui; Liu, Wenlan; Deng, Tingting; Li, Zigang; Jing, Yi; Jin, Yi; Hu, Zhangli

2014-01-01

The BCRP/ABCG2 transporter, which mediates drug resistance in many types of cells, depends on energy provided by ATP hydrolysis. Here, a retrovirus encoding a shRNA targeting the ATP-binding domain of this protein was used to screen for highly efficient agents that could reverse drug resistance and improve cell sensitivity to drugs, thus laying the foundation for further studies and applications. To target the ATP-binding domain of BCRP/ABCG2, pLenti6/BCRPsi shRNA recombinant retroviruses, with 20 bp target sequences starting from the 270th, 745th and 939th bps of the 6th exon, were constructed and packaged. The pLenti6/BCRPsi retroviruses (V-BCRPi) that conferred significant knockdown effects were screened using a drug-sensitivity experiment and flow cytometry. The human choriocarcinoma cell line JAR, which highly expresses endogenous BCRP/ABCG2, was injected under the dorsal skin of a hairless mouse to initiate a JAR cytoma. After injecting V-BCRPi-infected JAR tumor cells into the dorsal skin of hairless mice, BCRP/ABCG2 expression in the tumor tissue was determined using immunohistochemistry, fluorescent quantitative RT-PCR and Western blot analyses. After intraperitoneal injection of BCRP/ABCG2-tolerant 5-FU, the tumor volume, weight change, and apoptosis rate of the tumor tissue were determined using in situ hybridization. V-BCRPi increased the sensitivity of the tumor histiocytes to 5-FU and improved the cell apoptosis-promoting effects of 5-FU in the tumor. The goal of the in vivo and in vitro studies was to screen for an RNA interference recombinant retrovirus capable of stably targeting the ATP-binding domain of BCRP/ABCG2 (V-BCRPi) to inhibit its function. A new method to improve the chemo-sensitivity of breast cancer and other tumor cells was discovered, and this method could be used for gene therapy and functional studies of malignant tumors.

RNA interference tools for the western flower thrips, Frankliniella occidentalis.

PubMed

Badillo-Vargas, Ismael E; Rotenberg, Dorith; Schneweis, Brandi A; Whitfield, Anna E

2015-05-01

The insect order Thysanoptera is exclusively comprised of small insects commonly known as thrips. The western flower thrips, Frankliniella occidentalis, is an economically important pest amongst thysanopterans due to extensive feeding damage and tospovirus transmission to hundreds of plant species worldwide. Geographically-distinct populations of F. occidentalis have developed resistance against many types of traditional chemical insecticides, and as such, management of thrips and tospoviruses are a persistent challenge in agriculture. Molecular methods for defining the role(s) of specific genes in thrips-tospovirus interactions and for assessing their potential as gene targets in thrips management strategies is currently lacking. The goal of this work was to develop an RNA interference (RNAi) tool that enables functional genomic assays and to evaluate RNAi for its potential as a biologically-based approach for controlling F. occidentalis. Using a microinjection system, we delivered double-stranded RNA (dsRNA) directly to the hemocoel of female thrips to target the vacuolar ATP synthase subunit B (V-ATPase-B) gene of F. occidentalis. Gene expression analysis using real-time quantitative reverse transcriptase-PCR (qRT-PCR) revealed significant reductions of V-ATPase-B transcripts at 2 and 3 days post-injection (dpi) with dsRNA of V-ATPase-B compared to injection with dsRNA of GFP. Furthermore, the effect of knockdown of the V-ATPase-B gene in females at these two time points was mirrored by the decreased abundance of V-ATPase-B protein as determined by quantitative analysis of Western blots. Reduction in V-ATPase-B expression in thrips resulted in increased female mortality and reduced fertility, i.e., number of viable offspring produced. Survivorship decreased significantly by six dpi compared to the dsRNA-GFP control group, which continued decreasing significantly until the end of the bioassay. Surviving female thrips injected with dsRNA-V-ATPase-B produced significantly fewer offspring compared to those in the dsRNA-GFP control group. Our findings indicate that an RNAi-based strategy to study gene function in thrips is feasible, can result in quantifiable phenotypes, and provides a much-needed tool for investigating the molecular mechanisms of thrips-tospovirus interactions. To our knowledge, this represents the first report of RNAi for any member of the insect order Thysanoptera and demonstrates the potential for translational research in the area of thrips pest control. Copyright © 2015 Elsevier Ltd. All rights reserved.

Peptides Used in the Delivery of Small Noncoding RNA

PubMed Central

2015-01-01

RNA interference (RNAi) is an endogenous process in which small noncoding RNAs, including small interfering RNAs (siRNAs) and microRNAs (miRNAs), post-transcriptionally regulate gene expressions. In general, siRNA and miRNA/miRNA mimics are similar in nature and activity except their origin and specificity. Although both siRNAs and miRNAs have been extensively studied as novel therapeutics for a wide range of diseases, the large molecular weight, anionic surface charges, instability in blood circulation, and intracellular trafficking to the RISC after cellular uptake have hindered the translation of these RNAs from bench to clinic. As a result, a great variety of delivery systems have been investigated for safe and effective delivery of small noncoding RNAs. Among these systems, peptides, especially cationic peptides, have emerged as a promising type of carrier due to their inherent ability to condense negatively charged RNAs, ease of synthesis, controllable size, and tunable structure. In this review, we will focus on three major types of cationic peptides, including poly(l-lysine) (PLL), protamine, and cell penetrating peptides (CPP), as well as peptide targeting ligands that have been extensively used in RNA delivery. The delivery strategies, applications, and limitations of these cationic peptides in siRNA/miRNA delivery will be discussed. PMID:25157701

Targeting the kinesin Eg5 to monitor siRNA transfection in mammalian cells.

PubMed

Weil, D; Garçon, L; Harper, M; Duménil, D; Dautry, F; Kress, M

2002-12-01

RNA interference, the inhibition of gene expression by double-stranded RNA, provides a powerful tool for functional studies once the sequence of a gene is known. In most mammalian cells, only short molecules can be used because long ones induce the interferon pathway. With the identification of a proper target sequence, the penetration of the oligonucleotides constitutes the most serious limitation in the application of this technique. Here we show that a small interfering RNA (siRNA) targeting the mRNA of the kinesin Eg5 induces a rapid mitotic arrest and provides a convenient assay for the optimization of siRNA transfection. Thus, dose responses can be established for different transfection techniques, highlighting the great differences in response to transfection techniques of various cell types. We report that the calcium phosphate precipitation technique can be an efficient and cost-effective alternative to Oligofectamine in some adherent cells, while electroporation can be efficient for some cells growing in suspension such as hematopoietic cells and some adherent cells. Significantly, the optimal parameters for the electroporation of siRNA differ from those for plasmids, allowing the use of milder conditions that induce less cell toxicity. In summary, a single siRNA leading to an easily assayed phenotype can be used to monitor the transfection of siRNA into any type of proliferating cells of both human and murine origin.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fan, Qi; Wang, Xuedi; Zhang, Hanguang

Highlights: Black-Right-Pointing-Pointer Cat S is highly expressed in HCC cells with high metastatic potential. Black-Right-Pointing-Pointer Knockdown of Cat S inhibits growth and invasion of HCC cells. Black-Right-Pointing-Pointer Knockdown of Cat S inhibits HCC-associated angiogenesis. Black-Right-Pointing-Pointer Cat S might be a potential target for HCC therapy. -- Abstract: Cathepsin S (Cat S) plays an important role in tumor invasion and metastasis by its ability to degrade extracellular matrix (ECM). Our previous study suggested there could be a potential association between Cat S and hepatocellular carcinoma (HCC) metastasis. The present study was designed to determine the role of Cat S in HCCmore » cell growth, invasion and angiogenesis, using RNA interference technology. Small interfering RNA (siRNA) sequences for the Cat S gene were synthesized and transfected into human HCC cell line MHCC97-H. The Cat S gene targeted siRNA-mediated knockdown of Cat S expression, leading to potent suppression of MHCC97-H cell proliferation, invasion and angiogenesis. These data suggest that Cat S might be a potential target for HCC therapy.« less

Oral delivery of double-stranded RNAs induces mortality in nymphs and adults of the Asian citrus psyllid, Diaphorina citri.

PubMed

Galdeano, Diogo Manzano; Breton, Michèle Claire; Lopes, João Roberto Spotti; Falk, Bryce W; Machado, Marcos Antonio

2017-01-01

The Asian citrus psyllid (ACP), Diaphorina citri Kuwayama, is one of the most important citrus pests. ACP is the vector of the phloem-limited bacteria Candidatus Liberibacter americanus and Candidatus Liberibacter asiaticus, the causal agents of the devastating citrus disease huanglongbing (HLB). The management of HLB is based on the use of healthy young plants, eradication of infected plants and chemical control of the vector. RNA interference (RNAi) has proven to be a promising tool to control pests and explore gene functions. Recently, studies have reported that target mRNA knockdown in many insects can be induced through feeding with double-stranded RNA (dsRNA). In the current study, we targeted the cathepsin D, chitin synthase and inhibitor of apoptosis genes of adult and nymph ACP by feeding artificial diets mixed with dsRNAs and Murraya paniculata leaves placed in dsRNAs solutions, respectively. Adult ACP mortality was positively correlated with the amount of dsRNA used. Both nymphs and adult ACP fed dsRNAs exhibited significantly increased mortality over time compared with that of the controls. Moreover, qRT-PCR analysis confirmed the dsRNA-mediated RNAi effects on target mRNAs. These results showed that RNAi can be a powerful tool for gene function studies in ACP and perhaps for HLB control.

Structural and Biochemical Studies on ATP Binding and Hydrolysis by the Escherichia coli RNA Chaperone Hfq

PubMed Central

Večerek, Branislav; Rajkowitsch, Lukas; Carugo, Oliviero; Djinović-Carugo, Kristina; Bläsi, Udo

2012-01-01

In Escherichia coli the RNA chaperone Hfq is involved in riboregulation by assisting base-pairing between small regulatory RNAs (sRNAs) and mRNA targets. Several structural and biochemical studies revealed RNA binding sites on either surface of the donut shaped Hfq-hexamer. Whereas sRNAs are believed to contact preferentially the YKH motifs present on the proximal site, poly(A)15 and ADP were shown to bind to tripartite binding motifs (ARE) circularly positioned on the distal site. Hfq has been reported to bind and to hydrolyze ATP. Here, we present the crystal structure of a C-terminally truncated variant of E. coli Hfq (Hfq65) in complex with ATP, showing that it binds to the distal R-sites. In addition, we revisited the reported ATPase activity of full length Hfq purified to homogeneity. At variance with previous reports, no ATPase activity was observed for Hfq. In addition, FRET assays neither indicated an impact of ATP on annealing of two model oligoribonucleotides nor did the presence of ATP induce strand displacement. Moreover, ATP did not lead to destabilization of binary and ternary Hfq-RNA complexes, unless a vast stoichiometric excess of ATP was used. Taken together, these studies strongly suggest that ATP is dispensable for and does not interfere with Hfq-mediated RNA transactions. PMID:23226421

Engineered Hydrogels for Local and Sustained Delivery of RNA-Interference Therapies.

PubMed

Wang, Leo L; Burdick, Jason A

2017-01-01

It has been nearly two decades since RNA-interference (RNAi) was first reported. While there are no approved clinical uses, several phase II and III clinical trials suggest the great promise of RNAi therapeutics. One challenge for RNAi therapies is the controlled localization and sustained presentation to target tissues, to both overcome systemic toxicity concerns and to enhance in vivo efficacy. One approach that is emerging to address these limitations is the entrapment of RNAi molecules within hydrogels for local and sustained release. In these systems, nucleic acids are either delivered as siRNA conjugates or within nanoparticles. A plethora of hydrogels has been implemented using these approaches, including both traditional hydrogels that have already been developed for other applications and new hydrogels developed specifically for RNAi delivery. These hydrogels have been applied to various applications in vivo, including cancer, bone regeneration, inflammation and cardiac repair. This review will examine the design and implementation of such hydrogel RNAi systems and will cover the most recent applications of these systems. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Host-Pathogen interactions modulated by small RNAs.

PubMed

Islam, Waqar; Islam, Saif Ul; Qasim, Muhammad; Wang, Liande

2017-07-03

Biological processes such as defense mechanisms and microbial offense strategies are regulated through RNA induced interference in eukaryotes. Genetic mutations are modulated through biogenesis of small RNAs which directly impacts upon host development. Plant defense mechanisms are regulated and supported by a diversified group of small RNAs which are involved in streamlining several RNA interference pathways leading toward the initiation of pathogen gene silencing mechanisms. In the similar context, pathogens also utilize the support of small RNAs to launch their offensive attacks. Also there are strong evidences about the active involvement of these RNAs in symbiotic associations. Interestingly, small RNAs are not limited to the individuals in whom they are produced; they also show cross kingdom influences through variable interactions with other species thus leading toward the inter-organismic gene silencing. The phenomenon is understandable in the microbes which utilize these mechanisms to overcome host defense line. Understanding the mechanism of triggering host defense strategies can be a valuable step toward the generation of disease resistant host plants. We think that the cross kingdom trafficking of small RNA is an interesting insight that is needed to be explored for its vitality.

High-throughput screens in mammalian cells using the CRISPR-Cas9 system.

PubMed

Peng, Jingyu; Zhou, Yuexin; Zhu, Shiyou; Wei, Wensheng

2015-06-01

As a powerful genome-editing tool, the clustered regularly interspaced short palindromic repeats (CRISPR)-clustered regularly interspaced short palindromic repeats-associated protein 9 (Cas9) system has been quickly developed into a large-scale function-based screening strategy in mammalian cells. This new type of genetic library is constructed through the lentiviral delivery of single-guide RNA collections that direct Cas9 or inactive dead Cas9 fused with effectors to interrogate gene function or regulate gene transcription in targeted cells. Compared with RNA interference screening, the CRISPR-Cas9 system demonstrates much higher levels of effectiveness and reliability with respect to both loss-of-function and gain-of-function screening. Unlike the RNA interference strategy, a CRISPR-Cas9 library can target both protein-coding sequences and regulatory elements, including promoters, enhancers and elements transcribing microRNAs and long noncoding RNAs. This powerful genetic tool will undoubtedly accelerate the mechanistic discovery of various biological processes. In this mini review, we summarize the general procedure of CRISPR-Cas9 library mediated functional screening, system optimization strategies and applications of this new genetic toolkit. © 2015 FEBS.

Genome-wide RNA interference screen identifies previously undescribed regulators of polyglutamine aggregation

PubMed Central

Nollen, Ellen A. A.; Garcia, Susana M.; van Haaften, Gijs; Kim, Soojin; Chavez, Alejandro; Morimoto, Richard I.; Plasterk, Ronald H. A.

2004-01-01

Protein misfolding and the formation of aggregates are increasingly recognized components of the pathology of human genetic disease and hallmarks of many neurodegenerative disorders. As exemplified by polyglutamine diseases, the propensity for protein misfolding is associated with the length of polyglutamine expansions and age-dependent changes in protein-folding homeostasis, suggesting a critical role for a protein homeostatic buffer. To identify the complement of protein factors that protects cells against the formation of protein aggregates, we tested transgenic Caenorhabditis elegans strains expressing polyglutamine expansion yellow fluorescent protein fusion proteins at the threshold length associated with the age-dependent appearance of protein aggregation. We used genome-wide RNA interference to identify genes that, when suppressed, resulted in the premature appearance of protein aggregates. Our screen identified 186 genes corresponding to five principal classes of polyglutamine regulators: genes involved in RNA metabolism, protein synthesis, protein folding, and protein degradation; and those involved in protein trafficking. We propose that each of these classes represents a molecular machine collectively comprising the protein homeostatic buffer that responds to the expression of damaged proteins to prevent their misfolding and aggregation. PMID:15084750

Catalog of MicroRNA Seed Polymorphisms in Vertebrates

PubMed Central

Calin, George Adrian; Horvat, Simon; Jiang, Zhihua; Dovc, Peter; Kunej, Tanja

2012-01-01

MicroRNAs (miRNAs) are a class of non-coding RNA that plays an important role in posttranscriptional regulation of mRNA. Evidence has shown that miRNA gene variability might interfere with its function resulting in phenotypic variation and disease susceptibility. A major role in miRNA target recognition is ascribed to complementarity with the miRNA seed region that can be affected by polymorphisms. In the present study, we developed an online tool for the detection of miRNA polymorphisms (miRNA SNiPer) in vertebrates (http://www.integratomics-time.com/miRNA-SNiPer) and generated a catalog of miRNA seed region polymorphisms (miR-seed-SNPs) consisting of 149 SNPs in six species. Although a majority of detected polymorphisms were due to point mutations, two consecutive nucleotide substitutions (double nucleotide polymorphisms, DNPs) were also identified in nine miRNAs. We determined that miR-SNPs are frequently located within the quantitative trait loci (QTL), chromosome fragile sites, and cancer susceptibility loci, indicating their potential role in the genetic control of various complex traits. To test this further, we performed an association analysis between the mmu-miR-717 seed SNP rs30372501, which is polymorphic in a large number of standard inbred strains, and all phenotypic traits in these strains deposited in the Mouse Phenome Database. Analysis showed a significant association between the mmu-miR-717 seed SNP and a diverse array of traits including behavior, blood-clinical chemistry, body weight size and growth, and immune system suggesting that seed SNPs can indeed have major pleiotropic effects. The bioinformatics analyses, data and tools developed in the present study can serve researchers as a starting point in testing more targeted hypotheses and designing experiments using optimal species or strains for further mechanistic studies. PMID:22303453

EMMPRIN (basigin/CD147) is involved in the morphogenesis of tooth germ in mouse molars.

PubMed

Xie, Ming; Jiao, Ting; Chen, Yuqin; Xu, Chun; Li, Jing; Jiang, Xinquan; Zhang, Fuqiang

2010-05-01

The pattern of gene expression for extracellular matrix metalloproteinase inducer (EMMPRIN) was revealed in the tooth germ of mouse mandibular molars using quantitative real-time PCR. In situ hybridization and immunohistochemical study demonstrated the characteristic distribution of EMMPRIN in the different stages of tooth germ development. To investigate the functional role played by EMMPRIN in tooth germ development, EMMPRIN siRNA interference approach was carried out in cultured mouse mandibles at embryonic day 11.0 (E11.0). The results showed that EMMPRIN siRNA-treated explants exhibited a marked growth inhibition of tooth germ compared to the control and scrambled siRNA-treated explants. Meanwhile, a significant increase in MT1-MMP mRNA expression and a reduction in MMP-2, MMP-3, MMP-9, MMP-13 and MT2-MMP mRNA expression were observed in the mouse mandibles following EMMPRIN abrogation. The current results indicate that EMMPRIN could thus be involved in the early stage of tooth germ development and morphogenesis, possibly by regulating the expression of MMP genes.

Advances in CRISPR-Cas9 genome engineering: lessons learned from RNA interference

PubMed Central

Barrangou, Rodolphe; Birmingham, Amanda; Wiemann, Stefan; Beijersbergen, Roderick L.; Hornung, Veit; Smith, Anja van Brabant

2015-01-01

The discovery that the machinery of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9 bacterial immune system can be re-purposed to easily create deletions, insertions and replacements in the mammalian genome has revolutionized the field of genome engineering and re-invigorated the field of gene therapy. Many parallels have been drawn between the newly discovered CRISPR-Cas9 system and the RNA interference (RNAi) pathway in terms of their utility for understanding and interrogating gene function in mammalian cells. Given this similarity, the CRISPR-Cas9 field stands to benefit immensely from lessons learned during the development of RNAi technology. We examine how the history of RNAi can inform today's challenges in CRISPR-Cas9 genome engineering such as efficiency, specificity, high-throughput screening and delivery for in vivo and therapeutic applications. PMID:25800748

Highly efficient delivery of siRNA to a heart transplant model by a novel cell penetrating peptide-dsRNA binding domain.

PubMed

Li, Hua; Zheng, Xiangtao; Koren, Viktoria; Vashist, Yogesh Kumar; Tsui, Tung Yu

2014-07-20

Small interfering RNAs (siRNAs) delivery remains a bottleneck for RNA interference (RNAi) - based therapies in the clinic. In the present study, a fusion protein with two cell-penetrating peptides (CPP), Hph1-Hph1, and a double-stranded RNA binding domain (dsRBD), was constructed for the siRNA delivery: dsRBD was designed to bind siRNA, and CPP would subsequently transport the dsRBD/siRNA complex into cells. We assessed the efficiency of the fusion protein, Hph1-Hph1-dsRBD, as a siRNA carrier. Calcium-condensed effects were assessed on GAPDH and green fluorescent protein (GFP) genes by western blot, real time polymerase chain reaction (RT-PCR), and flow cytometry analysis in vitro. Evaluations were also made in an in vivo heart transplantation model. The results demonstrated that the fusion protein, Hph1-Hph1-dsRBD, is highly efficient at delivering siRNA in vitro, and exhibits efficiency on GAPDH and GFP genes similar to or greater than lipofectamine. Interestingly, the calcium-condensed effects dramatically enhanced cellular uptake of the protein-siRNA complex. In vivo, Hph1-Hph1-dsRBD transferred and distributed ^ targeted siRNA throughout the whole mouse heart graft. Together, these results indicate that Hph1-Hph1-dsRBD has potential as an siRNA carrier for applications in the clinic or in biomedical research. Copyright © 2014 Elsevier B.V. All rights reserved.

Biodegradable Nanoparticles of mPEG-PLGA-PLL Triblock Copolymers as Novel Non-Viral Vectors for Improving siRNA Delivery and Gene Silencing

PubMed Central

Du, Jing; Sun, Ying; Shi, Qiu-Sheng; Liu, Pei-Feng; Zhu, Ming-Jie; Wang, Chun-Hui; Du, Lian-Fang; Duan, You-Rong

2012-01-01

Degradation of mRNA by RNA interference is one of the most powerful and specific mechanisms for gene silencing. However, insufficient cellular uptake and poor stability have limited its usefulness. Here, we report efficient delivery of siRNA via the use of biodegradable nanoparticles (NPs) made from monomethoxypoly(ethylene glycol)-poly(lactic-co-glycolic acid)-poly-l-lysine (mPEG-PLGA-PLL) triblock copolymers. Various physicochemical properties of mPEG-PLGA-PLL NPs, including morphology, size, surface charge, siRNA encapsulation efficiency, and in vitro release profile of siRNA from NPs, were characterized by scanning electron microscope, particle size and zeta potential analyzer, and high performance liquid chromatography. The levels of siRNA uptake and targeted gene inhibition were detected in human lung cancer SPC-A1-GFP cells stably expressing green fluorescent protein. Examination of the cultured SPC-A1-GFP cells with fluorescent microscope and flow cytometry showed NPs loading Cy3-labeled siRNA had much higher intracellular siRNA delivery efficiencies than siRNA alone and Lipofectamine-siRNA complexes. The gene silencing efficiency of mPEG-PLGA-PLL NPs was higher than that of commercially available transfecting agent Lipofectamine while showing no cytotoxicity. Thus, the current study demonstrates that biodegradable NPs of mPEG-PLGA-PLL triblock copolymers can be potentially applied as novel non-viral vectors for improving siRNA delivery and gene silencing. PMID:22312268

[Components and assembly of RNA-induced silencing complex].

PubMed

Song, Xue-Mei; Yan, Fei; Du, Li-Xin

2006-06-01

Degradation of homologous RNA in RNA interference is carried out by functional RNA-induced silencing complex (RISC). RISC contains Dicer, Argonaute proein, siRNA and other components. Researching structures and functions of these components is primary important for understanding assembly and functional mechanism of RISC, as well as the whole RNAi pathway. Recent research works showed that Dicer, containing RNaseIII domain, is responsible for production of siRNA at the beginning of RNAi, and guarantees the stability of RISC intermediate in assembly process. As the core component of RISC, Argonaute protein functions as slicer to cleave target RNA and offers the binding site of siRNA in RISC assembly, which are depended on PIWI domain and PAZ domain separately. Although there is only one strand of siRNA that is the guider of RISC, the double stranded structural character of siRNA is determinant of RNAi. Except those, there are still other components with unknown functions in RISC. The knowledge about RISC components and assembly now, is basis of a presumed RISC assembly model.