Ethical Perspectives on RNA Interference Therapeutics

PubMed Central

Ebbesen, Mette; Jensen, Thomas G.; Andersen, Svend; Pedersen, Finn Skou

2008-01-01

RNA interference is a mechanism for controlling normal gene expression which has recently begun to be employed as a potential therapeutic agent for a wide range of disorders, including cancer, infectious diseases and metabolic disorders. Clinical trials with RNA interference have begun. However, challenges such as off-target effects, toxicity and safe delivery methods have to be overcome before RNA interference can be considered as a conventional drug. So, if RNA interference is to be used therapeutically, we should perform a risk-benefit analysis. It is ethically relevant to perform a risk-benefit analysis since ethical obligations about not inflicting harm and promoting good are generally accepted. But the ethical issues in RNA interference therapeutics not only include a risk-benefit analysis, but also considerations about respecting the autonomy of the patient and considerations about justice with regard to the inclusion criteria for participation in clinical trials and health care allocation. RNA interference is considered a new and promising therapeutic approach, but the ethical issues of this method have not been greatly discussed, so this article analyses these issues using the bioethical theory of principles of the American bioethicists, Tom L. Beauchamp and James F. Childress. PMID:18612370

Proteomics for understanding miRNA biology.

PubMed

Huang, Tai-Chung; Pinto, Sneha M; Pandey, Akhilesh

2013-02-01

MicroRNAs (miRNAs) are small noncoding RNAs that play important roles in posttranscriptional regulation of gene expression. Mature miRNAs associate with the RNA interference silencing complex to repress mRNA translation and/or degrade mRNA transcripts. Mass spectrometry-based proteomics has enabled identification of several core components of the canonical miRNA processing pathway and their posttranslational modifications which are pivotal in miRNA regulatory mechanisms. The use of quantitative proteomic strategies has also emerged as a key technique for experimental identification of miRNA targets by allowing direct determination of proteins whose levels are altered because of translational suppression. This review focuses on the role of proteomics and labeling strategies to understand miRNA biology. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Small Molecules Targeting the miRNA-Binding Domain of Argonaute 2: From Computer-Aided Molecular Design to RNA Immunoprecipitation.

PubMed

Bellissimo, Teresa; Masciarelli, Silvia; Poser, Elena; Genovese, Ilaria; Del Rio, Alberto; Colotti, Gianni; Fazi, Francesco

2017-01-01

The development of small-molecule-based target therapy design for human disease and cancer is object of growing attention. Recently, specific microRNA (miRNA) mimicking compounds able to bind the miRNA-binding domain of Argonaute 2 protein (AGO2) to inhibit miRNA loading and its functional activity were described. Computer-aided molecular design techniques and RNA immunoprecipitation represent suitable approaches to identify and experimentally determine if a compound is able to impair the loading of miRNAs on AGO2 protein. Here, we describe these two methodologies that we recently used to select a specific compound able to interfere with the AGO2 functional activity and able to improve the retinoic acid-dependent myeloid differentiation of leukemic cells.

Detection of Hepatitis A Virus by the Nucleic Acid Sequence-Based Amplification Technique and Comparison with Reverse Transcription-PCR

PubMed Central

Jean, Julie; Blais, Burton; Darveau, André; Fliss, Ismaïl

2001-01-01

A nucleic acid sequence-based amplification (NASBA) technique for the detection of hepatitis A virus (HAV) in foods was developed and compared to the traditional reverse transcription (RT)-PCR technique. Oligonucleotide primers targeting the VP1 and VP2 genes encoding the major HAV capsid proteins were used for the amplification of viral RNA in an isothermal process resulting in the accumulation of RNA amplicons. Amplicons were detected by hybridization with a digoxigenin-labeled oligonucleotide probe in a dot blot assay format. Using the NASBA, as little as 0.4 ng of target RNA/ml was detected per comparison to 4 ng/ml for RT-PCR. When crude HAV viral lysate was used, a detection limit of 2 PFU (4 × 102 PFU/ml) was obtained with NASBA, compared to 50 PFU (1 × 104 PFU/ml) obtained with RT-PCR. No interference was encountered in the amplification of HAV RNA in the presence of excess nontarget RNA or DNA. The NASBA system successfully detected HAV recovered from experimentally inoculated samples of waste water, lettuce, and blueberries. Compared to RT-PCR and other amplification techniques, the NASBA system offers several advantages in terms of sensitivity, rapidity, and simplicity. This technique should be readily adaptable for detection of other RNA viruses in both foods and clinical samples. PMID:11722911

Detection of hepatitis A virus by the nucleic acid sequence-based amplification technique and comparison with reverse transcription-PCR.

PubMed

Jean, J; Blais, B; Darveau, A; Fliss, I

2001-12-01

A nucleic acid sequence-based amplification (NASBA) technique for the detection of hepatitis A virus (HAV) in foods was developed and compared to the traditional reverse transcription (RT)-PCR technique. Oligonucleotide primers targeting the VP1 and VP2 genes encoding the major HAV capsid proteins were used for the amplification of viral RNA in an isothermal process resulting in the accumulation of RNA amplicons. Amplicons were detected by hybridization with a digoxigenin-labeled oligonucleotide probe in a dot blot assay format. Using the NASBA, as little as 0.4 ng of target RNA/ml was detected per comparison to 4 ng/ml for RT-PCR. When crude HAV viral lysate was used, a detection limit of 2 PFU (4 x 10(2) PFU/ml) was obtained with NASBA, compared to 50 PFU (1 x 10(4) PFU/ml) obtained with RT-PCR. No interference was encountered in the amplification of HAV RNA in the presence of excess nontarget RNA or DNA. The NASBA system successfully detected HAV recovered from experimentally inoculated samples of waste water, lettuce, and blueberries. Compared to RT-PCR and other amplification techniques, the NASBA system offers several advantages in terms of sensitivity, rapidity, and simplicity. This technique should be readily adaptable for detection of other RNA viruses in both foods and clinical samples.

Renewing the Assault on mRNA

PubMed Central

McCAIN, JACK

2004-01-01

Mammalian cells dislike double-stranded RNA. They interpret it as a sign of an intruder, and they can unleash a recently discovered defensive mechanism to deal with the problem – they chop the invader into little pieces and use the remnants, called small interfering RNA, to identify and destroy the invader and its progeny. This process, known as RNA interference, may lend itself to new treatments for a wide range of diseases. RNA interference, however, resembles two therapies studied during the 1990s, antisense and ribozymes, in that the gene-silencing target is messenger RNA (mRNA). Is RNA interference really the Next Big Thing – or just a variation on an older but still intriguing theme? PMID:23372488

Gene silencing in non-model insects: Overcoming hurdles using symbiotic bacteria for trauma-free sustainable delivery of RNA interference: Sustained RNA interference in insects mediated by symbiotic bacteria: Applications as a genetic tool and as a biocide.

PubMed

Whitten, Miranda; Dyson, Paul

2017-03-01

Insight into animal biology and development provided by classical genetic analysis of the model organism Drosophila melanogaster was an incentive to develop advanced genetic tools for this insect. But genetic systems for the over one million other known insect species are largely undeveloped. With increasing information about insect genomes resulting from next generation sequencing, RNA interference is now the method of choice for reverse genetics, although it is constrained by the means of delivery of interfering RNA. A recent advance to ensure sustained delivery with minimal experimental intervention or trauma to the insect is to exploit commensal bacteria for symbiont-mediated RNA interference. This technology not only offers an efficient means for RNA interference in insects in laboratory conditions, but also has potential for use in the control of human disease vectors, agricultural pests and pathogens of beneficial insects. © 2017 WILEY Periodicals, Inc.

The cytomegalovirus promoter-driven short hairpin RNA constructs mediate effective RNA interference in zebrafish in vivo.

PubMed

Su, Jianguo; Zhu, Zuoyan; Wang, Yaping; Xiong, Feng; Zou, Jun

2008-01-01

The ability to utilize the RNA interference (RNAi) machinery for silencing target-gene expression has created a lot of excitement in the research community. In the present study, we used a cytomegalovirus (CMV) promoter-driven DNA template approach to induce short hairpin RNA (shRNA) triggered RNAi to block exogenous Enhanced Green Fluorescent Protein (EGFP) and endogenous No Tail (NTL) gene expressions. We constructed three plasmids, pCMV-EGFP-CMV-shGFP-SV40, pCMV-EGFP-CMV-shNTL-SV40, and pCMV-EGFP-CMV-shScrambled-SV40, each containing a CMV promoter driving an EGFP reporter cDNA and DNA coding for one shRNA under the control of another CMV promoter. The three shRNA-generating plasmids and pCMV-EGFP control plasmid were introduced into zebrafish embryos by microinjection. Samples were collected at 48 h after injection. Results were evaluated by phenotype observation and real-time fluorescent quantitative reverse-transcription polymerase chain reaction (Q-PCR). The shGFP-generating plasmid significantly inhibited the EGFP expression viewed under fluorescent microscope and reduced by 70.05 +/- 1.26% of exogenous EGFP gene mRNA levels compared with controls by Q-PCR. The shRNA targeting endogenous NTL gene resulted in obvious NTL phenotype of 30 +/- 4% and decreased the level of their corresponding mRNAs up to 54.52 +/- 2.05% compared with nontargeting control shRNA. These data proved the feasibility of the CMV promoter-driven shRNA expression technique to be used to inhibit exogenous and endogenous gene expressions in zebrafish in vivo.

RNA therapeutics targeting osteoclast-mediated excessive bone resorption

PubMed Central

Wang, Yuwei; Grainger, David W

2011-01-01

RNA interference (RNAi) is a sequence-specific post-transcriptional gene silencing technique developed with dramatically increasing utility for both scientific and therapeutic purposes. Short interfering RNA (siRNA) is currently exploited to regulate protein expression relevant to many therapeutic applications, and commonly used as a tool for elucidating disease-associated genes. Osteoporosis and their associated osteoporotic fragility fractures in both men and women are rapidly becoming a global healthcare crisis as average life expectancy increases worldwide. New therapeutics are needed for this increasing patient population. This review describes the diversity of molecular targets suitable for RNAi-based gene knock-down in osteoclasts to control osteoclast-mediated excessive bone resorption. We identify strategies for developing targeted siRNA delivery and efficient gene silencing, and describe opportunities and challenges of introducing siRNA as a therapeutic approach to hard and connective tissue disorders. PMID:21945356

RNA interference can target pre-mRNA: consequences for gene expression in a Caenorhabditis elegans operon.

PubMed Central

Bosher, J M; Dufourcq, P; Sookhareea, S; Labouesse, M

1999-01-01

In nematodes, flies, trypanosomes, and planarians, introduction of double-stranded RNA results in sequence-specific inactivation of gene function, a process termed RNA interference (RNAi). We demonstrate that RNAi against the Caenorhabditis elegans gene lir-1, which is part of the lir-1/lin-26 operon, induced phenotypes very different from a newly isolated lir-1 null mutation. Specifically, lir-1(RNAi) induced embryonic lethality reminiscent of moderately strong lin-26 alleles, whereas the lir-1 null mutant was viable. We show that the lir-1(RNAi) phenotypes resulted from a severe loss of lin-26 gene expression. In addition, we found that RNAi directed against lir-1 or lin-26 introns induced similar phenotypes, so we conclude that lir-1(RNAi) targets the lir-1/lin-26 pre-mRNA. This provides direct evidence that RNA interference can prevent gene expression by targeting nuclear transcripts. Our results highlight that caution may be necessary when interpreting RNA interference without the benefit of mutant alleles. PMID:10545456

Identification and role of regulatory non-coding RNAs in Listeria monocytogenes.

PubMed

Izar, Benjamin; Mraheil, Mobarak Abu; Hain, Torsten

2011-01-01

Bacterial regulatory non-coding RNAs control numerous mRNA targets that direct a plethora of biological processes, such as the adaption to environmental changes, growth and virulence. Recently developed high-throughput techniques, such as genomic tiling arrays and RNA-Seq have allowed investigating prokaryotic cis- and trans-acting regulatory RNAs, including sRNAs, asRNAs, untranslated regions (UTR) and riboswitches. As a result, we obtained a more comprehensive view on the complexity and plasticity of the prokaryotic genome biology. Listeria monocytogenes was utilized as a model system for intracellular pathogenic bacteria in several studies, which revealed the presence of about 180 regulatory RNAs in the listerial genome. A regulatory role of non-coding RNAs in survival, virulence and adaptation mechanisms of L. monocytogenes was confirmed in subsequent experiments, thus, providing insight into a multifaceted modulatory function of RNA/mRNA interference. In this review, we discuss the identification of regulatory RNAs by high-throughput techniques and in their functional role in L. monocytogenes.

RNA interference of argininosuccinate synthetase restores sensitivity to recombinant arginine deiminase (rADI) in resistant cancer cells

PubMed Central

2011-01-01

Background Sensitivity of cancer cells to recombinant arginine deiminase (rADI) depends on expression of argininosuccinate synthetase (AS), a rate-limiting enzyme in synthesis of arginine from citrulline. To understand the efficiency of RNA interfering of AS in sensitizing the resistant cancer cells to rADI, the down regulation of AS transiently and permanently were performed in vitro, respectively. Methods We studied the use of down-regulation of this enzyme by RNA interference in three human cancer cell lines (A375, HeLa, and MCF-7) as a way to restore sensitivity to rADI in resistant cells. The expression of AS at levels of mRNA and protein was determined to understand the effect of RNA interference. Cell viability, cell cycle, and possible mechanism of the restore sensitivity of AS RNA interference in rADI treated cancer cells were evaluated. Results AS DNA was present in all cancer cell lines studied, however, the expression of this enzyme at the mRNA and protein level was different. In two rADI-resistant cell lines, one with endogenous AS expression (MCF-7 cells) and one with induced AS expression (HeLa cells), AS small interference RNA (siRNA) inhibited 37-46% of the expression of AS in MCF-7 cells. ASsiRNA did not affect cell viability in MCF-7 which may be due to the certain amount of residual AS protein. In contrast, ASsiRNA down-regulated almost all AS expression in HeLa cells and caused cell death after rADI treatment. Permanently down-regulated AS expression by short hairpin RNA (shRNA) made MCF-7 cells become sensitive to rADI via the inhibition of 4E-BP1-regulated mTOR signaling pathway. Conclusions Our results demonstrate that rADI-resistance can be altered via AS RNA interference. Although transient enzyme down-regulation (siRNA) did not affect cell viability in MCF-7 cells, permanent down-regulation (shRNA) overcame the problem of rADI-resistance due to the more efficiency in AS silencing. PMID:21453546

[Expression of Jagged1 mRNA in human epithelial ovarian carcinoma tissues and effect of RNA interference of Jagged1 on growth of xenograft in nude mice].

PubMed

Liu, G Y; Gao, Z H; Li, L; Song, T T; Sheng, X G

2016-06-25

To investigate the expression of Jagged1 in human epithelial ovarian carcinoma tissues and the effect of Jagged1 on growth of xenograft in nude mice. (1) Forty-eight cases of ovarian cancer and 30 cases of patients with benign epithelial ovarian tumor in the Henan Province Xinxiang Central Hospital during Feb. 2011 to Mar. 2014 were enrolled in this study. The mRNA expression of Jagged1, Notch1 and the downstream target genes Hes1, Hey1 were analyzed by using realtime PCR method. (2) The ovarian cancer xenograft models in nude mice were constructed by injecting SKOV3 cells in axillary subcutaneouswere. The nude mice were randomly divided into Jagged1 interference group, blank plasmid group and control group. Each group had 10 mice. They were transfected with pcDNA3.1(+)-siRNA-Jagged1, blank plasmid pDC3.1 and phosphate buffer, respectively. The tumor volumes and tumor masses were measured 14 days after transfection and the inhibition rate was calculated. The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues after transfection in each group was detected by using realtime PCR technique and the relative protein expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues was detected by utilizing western blot method. (1) The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in ovarian cancer tissues were higher than benign ovarian tumor tissues, the differences were statistically significant (P<0.01). (2) The tumor volume was (491± 68) mm(3) and tumor mass was (2.6±0.4) g in Jagged1 interference group, which were significantly lower than that in the blank plasmid group [(842±88) mm(3) and (4.4±0.8) g, respectively] and that in the control group [(851±90) mm(3) and (4.5±0.9) g, respectively; P<0.05], the tumor inhibition rate was 42.2% in Jagged1 interference group, which was significantly higher than that in the blank plasmid group and that in the control group (2.2% and 0, respectively), the differences were statistically significant (P<0.05). The relative mRNA and protein expression of Jagged1, Hes1 and Hey1 in xenograft tissues of nude micein Jagged1 interference group were lower than that in the other two groups, the differences were statistically significant (P<0.05). There were no differences of relative mRNA and protein expression of Notch1 in xenograft tissues of nude mice among the three groups (P>0.05). Jagged1 is highly expressed in epithelial ovarian carcinoma. Jagged1 gene interference in xenograft tumor can inhibit ovarian cancer cell growth and improve tumor suppressor rate, which probably play roles by inhibiting Notch1 signaling pathway.

Influence of Expression Plasmid of Connective Tissue Growth Factor and Tissue Inhibitor of Metalloproteinase-1 shRNA on Hepatic Precancerous Fibrosis in Rats.

PubMed

Zhang, Qun; Shu, Fu-Li; Jiang, Yu-Feng; Huang, Xin-En

2015-01-01

In this study, influence caused by expression plasmids of connective tissue growth factor (CTGF) and tissue inhibitor of metalloproteinase-1 (TIMP-1) short hairpin RNA (shRNA) on mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII in hepatic tissue with hepatic fibrosis, a precancerous condition, in rats is analyzed. To screen and construct shRNA expression plasimid which effectively interferes RNA targets of CTGF and TIMP-1 in rats. 50 cleaning Wistar male rats are allocated randomly at 5 different groups after precancerous fibrosis models and then injection of shRNA expression plasimids. Plasmid psiRNA-GFP-Com (CTGF and TIMP-1 included), psiRNA-GFP-CTGF, psiRNA-GFP-TIMP-1 and psiRNA- DUO-GFPzeo of blank plasmid are injected at group A, B, C and D, respectively, and as model control group that none plasimid is injected at group E. In 2 weeks after last injection, to hepatic tissue at different groups, protein expression of CTGF, TIMP-1, procol-α1and PC III is tested by immunohistochemical method and,mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII is measured by real-time PCR. One-way ANOVA is used to comparison between-groups. Compared with model group, there is no obvious difference of mRNA expression among CTGF,TIMP-1,procol-α1,PC III and of protein expression among CTGF, TIMP-1, procol-α1, PC III in hepatic tissue at group injected with blank plasmid. Expression quantity of mRNA of CTGF, TIMP-1, procol-α1 and PCIII at group A, B and C decreases, protein expression of CTGF, TIMP-1, procol-α1, PC III in hepatic tissue is lower, where the inhibition of combination RNA interference group (group A) on procol-α1 mRNA transcription and procol-α1 protein expression is superior to that of single interference group (group B and C) (P<0.01 or P<0.05). RNA interference on CTGF and/or TIMP-1 is obviously a inhibiting factor for mRNA and protein expression of CTGF, TIMP-1, procol-α1 and PCIII. Combination RNA interference on genes of CTGF and TIMP-1 is superior to that of single RNA interference, and this could be a contribution for prevention of precancerous condition.

Generation of Constructs for DNA-Directed RNA Interference of Venezuelan Equine Encephalitis Virus Genes

DTIC Science & Technology

2006-12-01

Defence Research and Recherche et developpement Development Canada pour la defense Canada DEFENCE I I! / DEFENSE Generation of Constructs for DNA... research into specific antiviral strategies. One such strategy is RNA interference. RNA interference involves the targeted silencing of a gene using...of an effective vaccine or therapeutic for VEE, a highly infectious virus, underscores the need for research in this area. In addition, the potential

Double strand RNA-mediated RNA interference through feeding in larval gypsy moth, Lymantria dispar (Lepidoptera: Erebidae)

USDA-ARS?s Scientific Manuscript database

RNA interference (RNAi) has gained popularity in several fields of research, silencing targeted genes by degradation of RNA. The objective of this study was to develop RNAi for use as a molecular tool in the control of the invasive pest Lymantria dispar (Lepidoptera: Erebidae), gypsy moth, which ha...

Downregulation of mouse CCR3 by lentiviral shRNA inhibits proliferation and induces apoptosis of mouse eosinophils.

PubMed

Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui

2017-02-01

RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.

Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound.

PubMed

Kopechek, Jonathan A; Carson, Andrew R; McTiernan, Charles F; Chen, Xucai; Klein, Edwin C; Villanueva, Flordeliza S

2016-01-01

RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease.

The promises and pitfalls of RNA-interference-based therapeutics

PubMed Central

Castanotto, Daniela; Rossi, John J.

2009-01-01

The discovery that gene expression can be controlled by the Watson–Crick base-pairing of small RNAs with messenger RNAs containing complementary sequence — a process known as RNA interference — has markedly advanced our understanding of eukaryotic gene regulation and function. The ability of short RNA sequences to modulate gene expression has provided a powerful tool with which to study gene function and is set to revolutionize the treatment of disease. Remarkably, despite being just one decade from its discovery, the phenomenon is already being used therapeutically in human clinical trials, and biotechnology companies that focus on RNA-interference-based therapeutics are already publicly traded. PMID:19158789

A model for the study of ligand binding to the ribosomal RNA helix h44

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dibrov, Sergey M.; Parsons, Jerod; Hermann, Thomas

2010-09-02

Oligonucleotide models of ribosomal RNA domains are powerful tools to study the binding and molecular recognition of antibiotics that interfere with bacterial translation. Techniques such as selective chemical modification, fluorescence labeling and mutations are cumbersome for the whole ribosome but readily applicable to model RNAs, which are readily crystallized and often give rise to higher resolution crystal structures suitable for detailed analysis of ligand-RNA interactions. Here, we have investigated the HX RNA construct which contains two adjacent ligand binding regions of helix h44 in 16S ribosomal RNA. High-resolution crystal structure analysis confirmed that the HX RNA is a faithful structuralmore » model of the ribosomal target. Solution studies showed that HX RNA carrying a fluorescent 2-aminopurine modification provides a model system that can be used to monitor ligand binding to both the ribosomal decoding site and, through an indirect effect, the hygromycin B interaction region.« less

Regulatory functions of trehalose-6-phosphate synthase in the chitin biosynthesis pathway in Tribolium castaneum (Coleoptera: Tenebrionidae) revealed by RNA interference.

PubMed

Chen, Q W; Jin, S; Zhang, L; Shen, Q D; Wei, P; Wei, Z M; Wang, S G; Tang, B

2018-06-01

RNA interference (RNAi) is a very effective technique for studying gene function and may be an efficient method for controlling pests. Trehalose-6-phosphate synthase (TPS), which plays a key role in the synthesis of trehalose and insect development, was cloned in Tribolium castaneum (Herbst) (TcTPS) and the putative functions were studied using RNAi via the injection of double-stranded RNA (dsRNA) corresponding to conserved TPS and trehalose-6-phosphate phosphatase domains. Expression analyses show that TcTPS is expressed higher in the fat body, while quantitative real-time polymerase chain reaction results show that the expression of four trehalase isoforms was significantly suppressed by dsTPS injection. Additionally, the expression of six chitin synthesis-related genes, such as hexokinase 2 and glutamine-fructose-6-phosphate aminotransferase, was suppressed at 48 and 72 h post-dsTPS-1 and dsTPS-2 RNA injection, which were two dsTPS fragments that had been designed for two different locations in TcTPS open reading frame, and that trehalose content and trehalase 1 activity decreased significantly at 72 h post-dsRNA injection. Furthermore, T. castaneum injected with dsTPS-1 and dsTPS-2 RNA displayed significantly lower levels of chitin and could not complete the molting process from larvae to pupae, revealing abnormal molting phenotypes. These results demonstrate that silencing TPS gene leads to molting deformities and high mortality rates via regulation of gene expression in the chitin biosynthetic pathway, and may be a promising approach for pest control in the future.

Effect of North Bicyclo[3.1.0]hexane 2'-Deoxypseudosugars on RNA Interference: A Novel Class of siRNA Modification | Center for Cancer Research

Cancer.gov

The inside cover picture shows how siRNAs modified with North bicyclo[3.1.0]hexane 2'-deoxy-pseudosugars are able to activate the RNA interference machinery. The paper confirms that the North conformation is critical for RNAi activity.

Bringing RNA Interference (RNAi) into the High School Classroom

ERIC Educational Resources Information Center

Sengupta, Sibani

2013-01-01

RNA interference (abbreviated RNAi) is a relatively new discovery in the field of mechanisms that serve to regulate gene expression (a.k.a. protein synthesis). Gene expression can be regulated at the transcriptional level (mRNA production, processing, or stability) and at the translational level (protein synthesis). RNAi acts in a gene-specific…

Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing

PubMed Central

Salton, Maayan; Kasprzak, Wojciech K.; Voss, Ty; Shapiro, Bruce A.; Poulikakos, Poulikos I.; Misteli, Tom

2015-01-01

Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signaling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumors. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumor formation and slows growth of vemurafenib-resistant tumors. Our results identify an intronic mutation as a molecular basis for RNA splicing-mediated RAF inhibitor resistance and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma. PMID:25971842

Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing.

PubMed

Salton, Maayan; Kasprzak, Wojciech K; Voss, Ty; Shapiro, Bruce A; Poulikakos, Poulikos I; Misteli, Tom

2015-05-14

Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signalling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumours. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small-molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumour formation and slows growth of vemurafenib-resistant tumours. Our results identify an intronic mutation as the molecular basis for a RNA splicing-mediated RAF inhibitor resistance mechanism and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma.

RNA Interference Therapies for an HIV-1 Functional Cure.

PubMed

Scarborough, Robert J; Gatignol, Anne

2017-12-27

HIV-1 drug therapies can prevent disease progression but cannot eliminate HIV-1 viruses from an infected individual. While there is hope that elimination of HIV-1 can be achieved, several approaches to reach a functional cure (control of HIV-1 replication in the absence of drug therapy) are also under investigation. One of these approaches is the transplant of HIV-1 resistant cells expressing anti-HIV-1 RNAs, proteins or peptides. Small RNAs that use RNA interference pathways to target HIV-1 replication have emerged as competitive candidates for cell transplant therapy and have been included in all gene combinations that have so far entered clinical trials. Here, we review RNA interference pathways in mammalian cells and the design of therapeutic small RNAs that use these pathways to target pathogenic RNA sequences. Studies that have been performed to identify anti-HIV-1 RNA interference therapeutics are also reviewed and perspectives on their use in combination gene therapy to functionally cure HIV-1 infection are provided.

Argonaute Proteins and Mechanisms of RNA Interference in Eukaryotes and Prokaryotes.

PubMed

Olina, A V; Kulbachinskiy, A V; Aravin, A A; Esyunina, D M

2018-05-01

Noncoding RNAs play essential roles in genetic regulation in all organisms. In eukaryotic cells, many small noncoding RNAs act in complex with Argonaute proteins and regulate gene expression by recognizing complementary RNA targets. The complexes of Argonaute proteins with small RNAs also play a key role in silencing of mobile genetic elements and, in some cases, viruses. These processes are collectively called RNA interference. RNA interference is a powerful tool for specific gene silencing in both basic research and therapeutic applications. Argonaute proteins are also found in prokaryotic organisms. Recent studies have shown that prokaryotic Argonautes can also cleave their target nucleic acids, in particular DNA. This activity of prokaryotic Argonautes might potentially be used to edit eukaryotic genomes. However, the molecular mechanisms of small nucleic acid biogenesis and the functions of Argonaute proteins, in particular in bacteria and archaea, remain largely unknown. Here we briefly review available data on the RNA interference processes and Argonaute proteins in eukaryotes and prokaryotes.

Generation of siRNA Nanosheets for Efficient RNA Interference

NASA Astrophysics Data System (ADS)

Kim, Hyejin; Lee, Jae Sung; Lee, Jong Bum

2016-04-01

After the discovery of small interference RNA (siRNA), nanostructured siRNA delivery systems have been introduced to achieve an efficient regulation of the target gene expression. Here we report a new siRNA-generating two dimensional nanostructure in a formation of nanosized sheet. Inspired by tunable mechanical and functional properties of the previously reported RNA membrane, siRNA nanosized sheets (siRNA-NS) with multiple Dicer cleavage sites were prepared. The siRNA-NS has two dimensional structure, providing a large surface area for Dicer to cleave the siRNA-NS for the generation of functional siRNAs. Furthermore, downregulation of the cellular target gene expression was achieved by delivery of siRNA-NS without chemical modification of RNA strands or conjugation to other substances.

Human health and ecological risk assessments for SmartStax PRO (MON 89034 x TC1507 x MON 87411 x DAS-59122-7), a plant-incorporated protectant intended to control corn rootworm through ribonucleic acid (RNA) interference

EPA Science Inventory

The use of RNA interference (RNAi) gene silencing technology, particularly RNAi for pesticidal purposes to control macroorganism pests, is a relatively recent innovation. Post-transcriptional silencing of gene function is a very rapid process where double-stranded RNA (dsRNA) dir...

RNA extraction from self-assembling peptide hydrogels to allow qPCR analysis of encapsulated cells.

PubMed

Burgess, Kyle A; Workman, Victoria L; Elsawy, Mohamed A; Miller, Aline F; Oceandy, Delvac; Saiani, Alberto

2018-01-01

Self-assembling peptide hydrogels offer a novel 3-dimensional platform for many applications in cell culture and tissue engineering but are not compatible with current methods of RNA isolation; owing to interactions between RNA and the biomaterial. This study investigates the use of two techniques based on two different basic extraction principles: solution-based extraction and direct solid-state binding of RNA respectively, to extract RNA from cells encapsulated in four β-sheet forming self-assembling peptide hydrogels with varying net positive charge. RNA-peptide fibril interactions, rather than RNA-peptide molecular complexing, were found to interfere with the extraction process resulting in low yields. A column-based approach relying on RNA-specific binding was shown to be more suited to extracting RNA with higher purity from these peptide hydrogels owing to its reliance on strong specific RNA binding interactions which compete directly with RNA-peptide fibril interactions. In order to reduce the amount of fibrils present and improve RNA yields a broad spectrum enzyme solution-pronase-was used to partially digest the hydrogels before RNA extraction. This pre-treatment was shown to significantly increase the yield of RNA extracted, allowing downstream RT-qPCR to be performed.

A High-Throughput Method for Direct Detection of Therapeutic Oligonucleotide-Induced Gene Silencing In Vivo

PubMed Central

Coles, Andrew H.; Osborn, Maire F.; Alterman, Julia F.; Turanov, Anton A.; Godinho, Bruno M.D.C.; Kennington, Lori; Chase, Kathryn; Aronin, Neil

2016-01-01

Preclinical development of RNA interference (RNAi)-based therapeutics requires a rapid, accurate, and robust method of simultaneously quantifying mRNA knockdown in hundreds of samples. The most well-established method to achieve this is quantitative real-time polymerase chain reaction (qRT-PCR), a labor-intensive methodology that requires sample purification, which increases the potential to introduce additional bias. Here, we describe that the QuantiGene® branched DNA (bDNA) assay linked to a 96-well Qiagen TissueLyser II is a quick and reproducible alternative to qRT-PCR for quantitative analysis of mRNA expression in vivo directly from tissue biopsies. The bDNA assay is a high-throughput, plate-based, luminescence technique, capable of directly measuring mRNA levels from tissue lysates derived from various biological samples. We have performed a systematic evaluation of this technique for in vivo detection of RNAi-based silencing. We show that similar quality data is obtained from purified RNA and tissue lysates. In general, we observe low intra- and inter-animal variability (around 10% for control samples), and high intermediate precision. This allows minimization of sample size for evaluation of oligonucleotide efficacy in vivo. PMID:26595721

Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound

PubMed Central

McTiernan, Charles F.; Chen, Xucai; Klein, Edwin C.; Villanueva, Flordeliza S.

2016-01-01

RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease. PMID:27471848

An Active Immune Defense with a Minimal CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) RNA and without the Cas6 Protein*

PubMed Central

Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J.; Backofen, Rolf; Marchfelder, Anita

2015-01-01

The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3′ handle are still active in triggering an interference reaction. The complete 3′ handle could be removed without loss of activity. However, manipulations of the 5′ handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. PMID:25512373

Molecular Mechanisms of RNA-Targeting by Cas13-containing Type VI CRISPR-Cas Systems.

PubMed

O'Connell, Mitchell

2018-06-22

Prokaryotic adaptive immune systems use CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats) and CRISPR associated (Cas) proteins for RNA-guided cleavage of foreign genetic elements. The focus of this review, Type VI CRISPR-Cas systems, include a single protein known as Cas13 (formerly C2c2), that when assembled with a crRNA forms a crRNA-guided RNA-targeting effector complex. Type VI CRISPR-Cas systems can be divided into four subtypes (A-D) based on Cas13 phylogeny. All Cas13 proteins studied to date possess two enzymatically distinct ribonuclease activities that are required for optimal interference. One RNase is responsible for pre-crRNA processing to form mature Type VI interference complexes, while the other RNase activity provided by the two HEPN (Higher Eukaryotes and Prokaryotes Nucleotide-binding) domains, is required for degradation of target RNA during viral interference. In this review, I will compare and contrast what is known about the molecular architecture and behavior of Type VI (A-D) CRISPR-Cas13 interference complexes, how this allows them to carry out their RNA-targeting function, how Type VI accessory proteins are able to modulate Cas13 activity, and how together all of these features have led to the rapid development of a range of RNA-targeting applications. Throughout I will also discuss some of the outstanding questions regarding Cas13's molecular behavior, and its role in bacterial adaptive immunity and RNA-targeting applications. Copyright © 2018. Published by Elsevier Ltd.

RNA targeting with CRISPR-Cas13.

PubMed

Abudayyeh, Omar O; Gootenberg, Jonathan S; Essletzbichler, Patrick; Han, Shuo; Joung, Julia; Belanto, Joseph J; Verdine, Vanessa; Cox, David B T; Kellner, Max J; Regev, Aviv; Lander, Eric S; Voytas, Daniel F; Ting, Alice Y; Zhang, Feng

2017-10-12

RNA has important and diverse roles in biology, but molecular tools to manipulate and measure it are limited. For example, RNA interference can efficiently knockdown RNAs, but it is prone to off-target effects, and visualizing RNAs typically relies on the introduction of exogenous tags. Here we demonstrate that the class 2 type VI RNA-guided RNA-targeting CRISPR-Cas effector Cas13a (previously known as C2c2) can be engineered for mammalian cell RNA knockdown and binding. After initial screening of 15 orthologues, we identified Cas13a from Leptotrichia wadei (LwaCas13a) as the most effective in an interference assay in Escherichia coli. LwaCas13a can be heterologously expressed in mammalian and plant cells for targeted knockdown of either reporter or endogenous transcripts with comparable levels of knockdown as RNA interference and improved specificity. Catalytically inactive LwaCas13a maintains targeted RNA binding activity, which we leveraged for programmable tracking of transcripts in live cells. Our results establish CRISPR-Cas13a as a flexible platform for studying RNA in mammalian cells and therapeutic development.

CRISPR interference: RNA-directed adaptive immunity in bacteria and archaea

PubMed Central

Marraffini, Luciano A.; Sontheimer, Erik J.

2010-01-01

Sequence-directed genetic interference pathways control gene expression and preserve genome integrity in all kingdoms of life. The importance of such pathways is highlighted by the extensive study of RNA interference (RNAi) and related processes in eukaryotes. In many bacteria and most archaea, clustered, regularly interspaced short palindromic repeats (CRISPRs) are involved in a more recently discovered interference pathway that protects cells from bacteriophages and conjugative plasmids. CRISPR sequences provide an adaptive, heritable record of past infections and express CRISPR RNAs — small RNAs that target invasive nucleic acids. Here, we review the mechanisms of CRISPR interference and its roles in microbial physiology and evolution. We also discuss potential applications of this novel interference pathway. PMID:20125085

Next-generation libraries for robust RNA interference-based genome-wide screens

PubMed Central

Kampmann, Martin; Horlbeck, Max A.; Chen, Yuwen; Tsai, Jordan C.; Bassik, Michael C.; Gilbert, Luke A.; Villalta, Jacqueline E.; Kwon, S. Chul; Chang, Hyeshik; Kim, V. Narry; Weissman, Jonathan S.

2015-01-01

Genetic screening based on loss-of-function phenotypes is a powerful discovery tool in biology. Although the recent development of clustered regularly interspaced short palindromic repeats (CRISPR)-based screening approaches in mammalian cell culture has enormous potential, RNA interference (RNAi)-based screening remains the method of choice in several biological contexts. We previously demonstrated that ultracomplex pooled short-hairpin RNA (shRNA) libraries can largely overcome the problem of RNAi off-target effects in genome-wide screens. Here, we systematically optimize several aspects of our shRNA library, including the promoter and microRNA context for shRNA expression, selection of guide strands, and features relevant for postscreen sample preparation for deep sequencing. We present next-generation high-complexity libraries targeting human and mouse protein-coding genes, which we grouped into 12 sublibraries based on biological function. A pilot screen suggests that our next-generation RNAi library performs comparably to current CRISPR interference (CRISPRi)-based approaches and can yield complementary results with high sensitivity and high specificity. PMID:26080438

Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli.

PubMed

Bernheim, Aude G; Libis, Vincent K; Lindner, Ariel B; Wintermute, Edwin H

2016-03-20

RNA-mediated knockdowns are widely used to control gene expression. This versatile family of techniques makes use of short RNA (sRNA) that can be synthesized with any sequence and designed to complement any gene targeted for silencing. Because sRNA constructs can be introduced to many cell types directly or using a variety of vectors, gene expression can be repressed in living cells without laborious genetic modification. The most common RNA knockdown technology, RNA interference (RNAi), makes use of the endogenous RNA-induced silencing complex (RISC) to mediate sequence recognition and cleavage of the target mRNA. Applications of this technique are therefore limited to RISC-expressing organisms, primarily eukaryotes. Recently, a new generation of RNA biotechnologists have developed alternative mechanisms for controlling gene expression through RNA, and so made possible RNA-mediated gene knockdowns in bacteria. Here we describe a method for silencing gene expression in E. coli that functionally resembles RNAi. In this system a synthetic phagemid is designed to express sRNA, which may designed to target any sequence. The expression construct is delivered to a population of E. coli cells with non-lytic M13 phage, after which it is able to stably replicate as a plasmid. Antisense recognition and silencing of the target mRNA is mediated by the Hfq protein, endogenous to E. coli. This protocol includes methods for designing the antisense sRNA, constructing the phagemid vector, packaging the phagemid into M13 bacteriophage, preparing a live cell population for infection, and performing the infection itself. The fluorescent protein mKate2 and the antibiotic resistance gene chloramphenicol acetyltransferase (CAT) are targeted to generate representative data and to quantify knockdown effectiveness.

RNA interference-mediated intrinsic antiviral immunity in invertebrates.

PubMed

Nayak, Arabinda; Tassetto, Michel; Kunitomi, Mark; Andino, Raul

2013-01-01

In invertebrates such as insects and nematodes, RNA interference (RNAi) provides RNA-based protection against viruses. This form of immunity restricts viral replication and dissemination from infected cells and viruses, in turn, have evolved evasion mechanisms or RNAi suppressors to counteract host defenses. Recent advances indicate that, in addition to RNAi, other related small RNA pathways contribute to antiviral functions in invertebrates. This has led to a deeper understanding of fundamental aspects of small RNA-based antiviral immunity in invertebrates and its contribution to viral spread and pathogenesis.

Oral Delivery of Double-Stranded RNA in Larvae of the Yellow Fever Mosquito, Aedes aegypti: Implications for Pest Mosquito Control

PubMed Central

Singh, Aditi D.; Wong, Sylvia; Ryan, Calen P.; Whyard, Steven

2013-01-01

RNA interference has already proven itself to be a highly versatile molecular biology tool for understanding gene function in a limited number of insect species, but its widespread use in other species will be dependent on the development of easier methods of double-stranded RNA (dsRNA) delivery. This study demonstrates that RNA interference can be induced in the mosquito Aedes aegypti L. (Diptera: Culicidae) simply by soaking larvae in a solution of dsRNA for two hours. The mRNA transcripts for β-tubulin, chitin synthase-1 and -2, and heat shock protein 83 were reduced between 30 and 50% three days post-dsRNA treatment. The dsRNA was mixed with a visible dye to identify those individuals that fed on the dsRNA, and based on an absence of RNA interference in those individuals that contained no dye within their guts, the primary route of entry of dsRNA is likely through the gut epithelium. RNA interference was systemic in the insects, inducing measurable knock down of gene expression in tissues beyond the gut. Silencing of the β-tubulin and chitin synthase-1 genes resulted in reduced growth and/or mortality of the larvae, demonstrating the utility of dsRNA as a potential mosquito larvicide. Silencing of chitin synthase-2 did not induce mortality in the larvae, and silencing of heat shock protein 83 only induced mortality in the insects if they were subsequently subjected to a heat stress. Drosophila melanogaster Meigen (Diptera: Drosophilidae) larvae were also soaked in dsRNA designed to specifically target either their own β-tubulin gene, or that of A. aegypti, and significant mortality was only seen in larvae treated with dsRNA targeting their own gene, which suggests that dsRNA pesticides could be designed to be species-limited. PMID:24224468

An active immune defense with a minimal CRISPR (clustered regularly interspaced short palindromic repeats) RNA and without the Cas6 protein.

PubMed

Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J; Backofen, Rolf; Marchfelder, Anita

2015-02-13

The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3' handle are still active in triggering an interference reaction. The complete 3' handle could be removed without loss of activity. However, manipulations of the 5' handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

[RNA interference library research progress and its application in cancer research].

PubMed

Zhao, Ning; Cai, Li

2013-02-01

RNA interference is a homologous mRNA special degradation phenomenon which is caused by the double-stranded RNA. RNAi library is a pooled library that is artificially constructed using RNAi technology. As RNAi library has made a major breakthrough in the field of genetic research, it has been widely used in the field of medical research, especially in the field of cancer research. This review discussed the research progress of RNAi library and its applications in cancer research.

Exploring Fusarium head blight disease control by RNA interference

USDA-ARS?s Scientific Manuscript database

RNA interference (RNAi) technology provides a novel tool to study gene function and plant protection strategies. Fusarium graminearum is the causal agent of Fusarium head blight (FHB), which reduces crop yield and quality by producing trichothecene mycotoxins including 3-acetyl deoxynivalenol (3-ADO...

Compositions and Methods for Inhibiting Gene Expressions

NASA Technical Reports Server (NTRS)

Williams, Loren D. (Inventor); Hsiao, Chiaolong (Inventor); Fang, Po-Yu (Inventor); Williams, Justin (Inventor)

2018-01-01

A combined packing and assembly method that efficiently packs ribonucleic acid (RNA) into virus like particles (VLPs) has been developed. The VLPs can spontaneously assemble and load RNA in vivo, efficiently packaging specifically designed RNAs at high densities and with high purity. In some embodiments the RNA is capable of interference activity, or is a precursor of a RNA capable of causing interference activity. Compositions and methods for the efficient expression, production and purification of VLP-RNAs are provided. VLP-RNAs can be used for the storage of RNA for long periods, and provide the ability to deliver RNA in stable form that is readily taken up by cells.

Altered stoichiometry Escherichia coli Cascade complexes with shortened CRISPR RNA spacers are capable of interference and primed adaptation

DOE PAGES

Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia; ...

2016-10-13

The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less

Altered stoichiometry Escherichia coli Cascade complexes with shortened CRISPR RNA spacers are capable of interference and primed adaptation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia

The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less

RNA therapeutics: Beyond RNA interference and antisense oligonucleotides

PubMed Central

Kole, Ryszard; Krainer, Adrian R.; Altman, Sidney

2016-01-01

Here we discuss three RNA therapeutic technologies exploiting various oligonucleotides that bind RNA by base-pairing in a sequence-specific manner yet have different mechanisms of action and effects. RNA interference and antisense oligonucleotides downregulate gene expression by enzyme-dependent degradation of targeted mRNA. Steric blocking oligonucleotides block access of cellular machinery to pre-mRNA and mRNA without degrading the RNA. Through this mechanism, blocking oligonucleotides can redirect alternative splicing, repair defective RNA, restore protein production or also downregulate gene expression. Moreover, they can be extensively chemically modified, resulting in more drug-like properties. The ability of RNA blocking oligonucleotides to restore gene function makes them suited for treatment of genetic disorders. Positive results from clinical trials for the treatment of Duchenne muscular dystrophy show that this technology is close to realizing its clinical potential. PMID:22262036

Modeling RNA interference in mammalian cells

PubMed Central

2011-01-01

Background RNA interference (RNAi) is a regulatory cellular process that controls post-transcriptional gene silencing. During RNAi double-stranded RNA (dsRNA) induces sequence-specific degradation of homologous mRNA via the generation of smaller dsRNA oligomers of length between 21-23nt (siRNAs). siRNAs are then loaded onto the RNA-Induced Silencing multiprotein Complex (RISC), which uses the siRNA antisense strand to specifically recognize mRNA species which exhibit a complementary sequence. Once the siRNA loaded-RISC binds the target mRNA, the mRNA is cleaved and degraded, and the siRNA loaded-RISC can degrade additional mRNA molecules. Despite the widespread use of siRNAs for gene silencing, and the importance of dosage for its efficiency and to avoid off target effects, none of the numerous mathematical models proposed in literature was validated to quantitatively capture the effects of RNAi on the target mRNA degradation for different concentrations of siRNAs. Here, we address this pressing open problem performing in vitro experiments of RNAi in mammalian cells and testing and comparing different mathematical models fitting experimental data to in-silico generated data. We performed in vitro experiments in human and hamster cell lines constitutively expressing respectively EGFP protein or tTA protein, measuring both mRNA levels, by quantitative Real-Time PCR, and protein levels, by FACS analysis, for a large range of concentrations of siRNA oligomers. Results We tested and validated four different mathematical models of RNA interference by quantitatively fitting models' parameters to best capture the in vitro experimental data. We show that a simple Hill kinetic model is the most efficient way to model RNA interference. Our experimental and modeling findings clearly show that the RNAi-mediated degradation of mRNA is subject to saturation effects. Conclusions Our model has a simple mathematical form, amenable to analytical investigations and a small set of parameters with an intuitive physical meaning, that makes it a unique and reliable mathematical tool. The findings here presented will be a useful instrument for better understanding RNAi biology and as modelling tool in Systems and Synthetic Biology. PMID:21272352

RNA interference: from biology to drugs and therapeutics.

PubMed

Appasani, Krishnarao

2004-07-01

RNA interference (RNAi) is a newly discovered and popular technology platform among researchers not only in the fields of RNA biology and molecular cell biology. It has created excitement in clinical sciences such as oncology, neurology, endocrinology, infectious diseases and drug discovery. There is an urgent need to educate and connect academic and industry researchers for the purpose of knowledge transfer. Thus, GeneExpression Systems of Waltham organized its Second International Conference in Waltham City (May 2-4, 2004, MA, USA) on the theme of 'RNA interference: From Biology to Drugs & Therapeutics.' About 200 participants and 32 speakers attended this two and half-day event which was arranged in six scientific and three technology sessions and ended with a panel discussion. This report covers a few representative talks from academia, biotech and the drug industry.

Respiratory viral diseases: access to RNA interference therapy

PubMed Central

Bitko, Vira; Barik, Sailen

2008-01-01

This review summarizes recent experimental achievements in the area of the development of new RNA interference (RNAi) therapeutics for the treatment of viral respiratory diseases. Delivery of siRNA to their intended target tissue remains the biggest problem for most therapeutic applications of these compounds. Appropriate formulations and chemical modifications for improved stability will boost the probability of utilization of RNAi drugs in the clinical applications. PMID:19081824

Chemical modification: the key to clinical application of RNA interference?

PubMed Central

Corey, David R.

2007-01-01

RNA interference provides a potent and specific method for controlling gene expression in human cells. To translate this potential into a broad new family of therapeutics, it is necessary to optimize the efficacy of the RNA-based drugs. As discussed in this Review, it might be possible to achieve this optimization using chemical modifications that improve their in vivo stability, cellular delivery, biodistribution, pharmacokinetics, potency, and specificity. PMID:18060019

Genetic Manipulation of Schistosoma haematobium, the Neglected Schistosome

PubMed Central

Rinaldi, Gabriel; Okatcha, Tunika I.; Popratiloff, Anastas; Ayuk, Mary A.; Suttiprapa, Sutas; Mann, Victoria H.; Liang, Yung-san; Lewis, Fred A.; Loukas, Alex; Brindley, Paul J.

2011-01-01

Background Minimal information on the genome and proteome of Schistosoma haematobium is available, in marked contrast to the situation with the other major species of human schistosomes for which draft genome sequences have been reported. Accordingly, little is known about functional genomics in S. haematobium, including the utility or not of RNA interference techniques that, if available, promise to guide development of new interventions for schistosomiasis haematobia. Methods/Findings Here we isolated and cultured developmental stages of S. haematobium, derived from experimentally infected hamsters. Targeting different developmental stages, we investigated the utility of soaking and/or square wave electroporation in order to transfect S. haematobium with nucleic acid reporters including Cy3-labeled small RNAs, messenger RNA encoding firefly luciferase, and short interfering RNAs (siRNAs). Three hours after incubation of S. haematobium eggs in 50 ng/µl Cy3-labeled siRNA, fluorescent foci were evident indicating that labeled siRNA had penetrated into miracidia developing within the egg shell. Firefly luciferase activity was detected three hours after square wave electroporation of the schistosome eggs and adult worms in 150 ng/µl of mRNA. RNA interference knockdown (silencing) of reporter luciferase activity was seen following the introduction of dsRNA specific for luciferase mRNA in eggs, schistosomules and mixed sex adults. Moreover, introduction of an endogenous gene-specific siRNA into adult schistosomes silenced transcription of tetraspanin 2 (Sh-tsp-2), the apparent orthologue of the Schistosoma mansoni gene Sm-tsp-2 which encodes the surface localized structural and signaling protein Sm-TSP-2. Together, knockdown of reporter luciferase and Sh-tsp-2 indicated the presence of an intact RNAi pathway in S. haematobium. Also, we employed laser scanning confocal microscopy to view the adult stages of S. haematobium. Conclusions These findings and approaches should facilitate analysis of gene function in S. haematobium, which in turn could facilitate the characterization of prospective intervention targets for this neglected tropical disease pathogen. PMID:22022628

The rde-1 gene, RNA interference, and transposon silencing in C. elegans.

PubMed

Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C

1999-10-15

Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.

Rp-phosphorothioate modifications in RNase P RNA that interfere with tRNA binding.

PubMed Central

Hardt, W D; Warnecke, J M; Erdmann, V A; Hartmann, R K

1995-01-01

We have used Rp-phosphorothioate modifications and a binding interference assay to analyse the role of phosphate oxygens in tRNA recognition by Escherichia coli ribonuclease P (RNase P) RNA. Total (100%) Rp-phosphorothioate modification at A, C or G positions of RNase P RNA strongly impaired tRNA binding and pre-tRNA processing, while effects were less pronounced at U positions. Partially modified E. coli RNase P RNAs were separated into tRNA binding and non-binding fractions by gel retardation. Rp-phosphorothioate modifications that interfered with tRNA binding were found 5' of nucleotides A67, G68, U69, C70, C71, G72, A130, A132, A248, A249, G300, A317, A330, A352, C353 and C354. Manganese rescue at positions U69, C70, A130 and A132 identified, for the first time, sites of direct metal ion coordination in RNase P RNA. Most sites of interference are at strongly conserved nucleotides and nine reside within a long-range base-pairing interaction present in all known RNase P RNAs. In contrast to RNase P RNA, 100% Rp-phosphorothioate substitutions in tRNA showed only moderate effects on binding to RNase P RNAs from E. coli, Bacillus subtilis and Chromatium vinosum, suggesting that pro-Rp phosphate oxygens of mature tRNA contribute relatively little to the formation of the tRNA-RNase P RNA complex. Images PMID:7540978

RNA interference for functional genomics and improvement of cotton (Gossypium species)

USDA-ARS?s Scientific Manuscript database

RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium ssp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function ...

Silence of the transcripts: RNA interference in medicine.

PubMed

Barik, Sailen

2005-10-01

Silencing of gene expression by ribonucleic acid (RNA), known as RNA interference (RNAi), is now recognized as a major means of gene regulation in biology. In this mechanism, small noncoding double-stranded RNA molecules knock down gene expression through a variety of mechanisms that include messenger RNA (mRNA) degradation, inhibition of mRNA translation, or chromatin remodeling. The posttranscriptional mechanism of RNAi has been embraced by researchers as a powerful tool for generating deficient phenotypes without mutating the gene. In parallel, exciting recent results have promised its application in disease therapy. This review aims to summarize the current knowledge in this area and provide a roadmap that may eventually launch RNAi from the research bench to the medicine chest.

RNAi functionalized scaffold for scarless skin regeneration

PubMed Central

Liu, Xing; Ma, Lie; Gao, Changyou

2013-01-01

Combination of a 3-D scaffold with the emerging RNA interference (RNAi) technique represents the latest paradigm of regenerative medicine. In our recent paper “RNAi functionalized collagen-chitosan/silicone membrane bilayer dermal equivalent for full-thickness skin regeneration with inhibited scarring” in the journal Biomaterials, we not only demonstrated a 3-D system for siRNA sustained delivery, but also presented a comprehensive in vivo study by targeting a vital problem in skin regeneration: scarring. It is expected that further development of this kind of RNAi functionalized scaffold can provide a better platform for directing cell fates by integrating the “down-regulating” biomolecular cues into the cellular microenvironment, leading to the complete functional regeneration of skin. PMID:23811756

Gene silencing efficiency and INF-β induction effects of splicing miRNA 155-based artificial miRNA with pre-miRNA stem-loop structures.

PubMed

Sin, Onsam; Mabiala, Prudence; Liu, Ye; Sun, Ying; Hu, Tao; Liu, Qingzhen; Guo, Deyin

2012-02-01

Artificial microRNA (miRNA) expression vectors have been developed and used for RNA interference. The secondary structure of artificial miRNA is important for RNA interference efficacy. We designed two groups of six artificial splicing miRNA 155-based miRNAs (SM155-based miRNAs) with the same target in the coding region or 3' UTR of a target gene and studied their RNA silencing efficiency and interferon β (IFN-β) induction effects. SM155-based miRNA with a mismatch at the +1 position and a bulge at the +11, +12 positions in a miRNA precursor stem-loop structure showed the highest gene silencing efficiency and lowest IFN-β induction effect (increased IFN-β mRNA level by 10% in both target cases), regardless of the specificity of the target sequence, suggesting that pSM155-based miRNA with this design could be a valuable miRNA expression vector.

Silencing the HaHR3 Gene by Transgenic Plant-mediated RNAi to Disrupt Helicoverpa armigera Development

PubMed Central

Xiong, Yehui; Zeng, Hongmei; Zhang, Yuliang; Xu, Dawei; Qiu, Dewen

2013-01-01

RNA interference (RNAi) caused by exogenous double-stranded RNA (dsRNA) has developed into a powerful technique in functional genomics, and to date it is widely used to down-regulate crucial physiology-related genes to control pest insects. A molt-regulating transcription factor gene, HaHR3, of cotton bollworm (Helicoverpa armigera) was selected as the target gene. Four different fragments covering the coding sequence (CDS) of HaHR3 were cloned into vector L4440 to express dsRNAs in Escherichia coli. The most effective silencing fragment was then cloned into a plant over-expression vector to express a hairpin RNA (hpRNA) in transgenic tobacco (Nicotiana tabacum). When H. armigera larvae were fed the E. coli or transgenic plants, the HaHR3 mRNA and protein levels dramatically decreased, resulting developmental deformity and larval lethality. The results demonstrate that both recombinant bacteria and transgenic plants could induce HaHR3 silence to disrupt H. armigera development, transgenic plant-mediated RNAi is emerging as a powerful approach for controlling insect pests. PMID:23630449

Visualizing repetitive diffusion activity of double-strand RNA binding proteins by single molecule fluorescence assays.

PubMed

Koh, Hye Ran; Wang, Xinlei; Myong, Sua

2016-08-01

TRBP, one of double strand RNA binding proteins (dsRBPs), is an essential cofactor of Dicer in the RNA interference pathway. Previously we reported that TRBP exhibits repetitive diffusion activity on double strand (ds)RNA in an ATP independent manner. In the TRBP-Dicer complex, the diffusion mobility of TRBP facilitates Dicer-mediated RNA cleavage. Such repetitive diffusion of dsRBPs on a nucleic acid at the nanometer scale can be appropriately captured by several single molecule detection techniques. Here, we provide a step-by-step guide to four different single molecule fluorescence assays by which the diffusion activity of dsRBPs on dsRNA can be detected. One color assay, termed protein induced fluorescence enhancement enables detection of unlabeled protein binding and diffusion on a singly labeled RNA. Two-color Fluorescence Resonance Energy Transfer (FRET) in which labeled dsRBPs is applied to labeled RNA, allows for probing the motion of protein along the RNA axis. Three color FRET reports on the diffusion movement of dsRBPs from one to the other end of RNA. The single molecule pull down assay provides an opportunity to collect dsRBPs from mammalian cells and examine the protein-RNA interaction at single molecule platform. Copyright © 2016 Elsevier Inc. All rights reserved.

RNA interference-based therapeutics for inherited long QT syndrome.

PubMed

Li, Guoliang; Ma, Shuting; Sun, Chaofeng

2015-08-01

Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved.

RNA interference-based therapeutics for inherited long QT syndrome

PubMed Central

LI, GUOLIANG; MA, SHUTING; SUN, CHAOFENG

2015-01-01

Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved. PMID:26622327

RNA interference in Lepidoptera: an overview of successful and unsuccessful studies and implications for experimental design

USDA-ARS?s Scientific Manuscript database

Gene silencing through RNA interference (RNAi) has revolutionized the study of gene function, particularly in non-model insects. However, in Lepidoptera (moths and butterflies) RNAi has many times proven to be difficult to achieve. Most of the negative results have been anecdotal and the positive ex...

Trojan Horse Strategy for Non-invasive Interference of Clock Gene in the Oyster Crassostrea gigas.

PubMed

Payton, Laura; Perrigault, Mickael; Bourdineaud, Jean-Paul; Marcel, Anjara; Massabuau, Jean-Charles; Tran, Damien

2017-08-01

RNA interference is a powerful method to inhibit specific gene expression. Recently, silencing target genes by feeding has been successfully carried out in nematodes, insects, and small aquatic organisms. A non-invasive feeding-based RNA interference is reported here for the first time in a mollusk bivalve, the pacific oyster Crassostrea gigas. In this Trojan horse strategy, the unicellular alga Heterocapsa triquetra is the food supply used as a vector to feed oysters with Escherichia coli strain HT115 engineered to express the double-stranded RNA targeting gene. To test the efficacy of the method, the Clock gene, a central gene of the circadian clock, was targeted for knockout. Results demonstrated specific and systemic efficiency of the Trojan horse strategy in reducing Clock mRNA abundance. Consequences of Clock disruption were observed in Clock-related genes (Bmal, Tim1, Per, Cry1, Cry2, Rev.-erb, and Ror) and triploid oysters were more sensitive than diploid to the interference. This non-invasive approach shows an involvement of the circadian clock in oyster bioaccumulation of toxins produced by the harmful alga Alexandrium minutum.

Domain motions of Argonaute, the catalytic engine of RNA interference

PubMed Central

Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y

2007-01-01

Background The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. Results The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes – an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Conclusion Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference. PMID:18053142

Domain motions of Argonaute, the catalytic engine of RNA interference.

PubMed

Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y

2007-11-30

The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes - an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference.

RNA interference targeting E637K mutation rescues hERG channel currents and restores its kinetic properties.

PubMed

Lu, Xiaoli; Yang, Xi; Huang, Xiaoyan; Huang, Chen; Sun, Huan Huan; Jin, Lihua; Xu, Weifeng; Mao, Haiyan; Guo, Junming; Zhou, Jianqing; Lian, Jiangfang

2013-01-01

Long QT syndrome (LQTS) is a monogenic proarrhythmic disorder that predisposes affected individuals to sudden death from tachyarrhythmia. As an inherited disease, LQTS cannot be completely cured by conventional treatment modalities. Individualized gene therapy is a promising therapeutic approach. The purpose of this study was to investigate the role of small interference RNA (siRNA) on expression of E637K-hERG (human ether-a-go-go-related gene) mutant and whether it can be used to rescue the mutant's dominant-negative suppressive effects on hERG protein channel function. Western blot was performed to select the most sensitive siRNAs to target E637K-hERG mutant knockdown. Confocal laser scanning microscope was performed to monitor cellular localization of wild-type (WT)-hERG and E637K-hERG with or without siRNA. Patch-clamp technique was used to assess the effect of siRNA on the electrophysiologic characteristics of the rapidly activating delayed rectifier K(+) current I(Kr) of the hERG protein channel. siRNA led to a significant decrease in the level of E637K-hERG protein but did not affect the level of WT-hERG protein. WT-hERG localization in cells coexpressing E637K-hERG mutant was restored to the membrane by siRNA. The siRNA-mediated inhibition of E637K-hERG mutant restored the maximum current and tail current amplitudes. Furthermore, siRNA treatment rescued the kinetic properties of WT/E637K-hERG protein channel to a level comparable to that of WT-hERG protein channel. Our findings illustrated that siRNA can effectively inhibit E637K-hERG protein expression and rescue the dominant-negative effect of this mutation by restoring the kinetic properties of hERG protein channel. It has potential clinical implications with regard to the possibility of using siRNA in the treatment of LQTS. Copyright © 2013 Heart Rhythm Society. All rights reserved.

Prediction of siRNA potency using sparse logistic regression.

PubMed

Hu, Wei; Hu, John

2014-06-01

RNA interference (RNAi) can modulate gene expression at post-transcriptional as well as transcriptional levels. Short interfering RNA (siRNA) serves as a trigger for the RNAi gene inhibition mechanism, and therefore is a crucial intermediate step in RNAi. There have been extensive studies to identify the sequence characteristics of potent siRNAs. One such study built a linear model using LASSO (Least Absolute Shrinkage and Selection Operator) to measure the contribution of each siRNA sequence feature. This model is simple and interpretable, but it requires a large number of nonzero weights. We have introduced a novel technique, sparse logistic regression, to build a linear model using single-position specific nucleotide compositions which has the same prediction accuracy of the linear model based on LASSO. The weights in our new model share the same general trend as those in the previous model, but have only 25 nonzero weights out of a total 84 weights, a 54% reduction compared to the previous model. Contrary to the linear model based on LASSO, our model suggests that only a few positions are influential on the efficacy of the siRNA, which are the 5' and 3' ends and the seed region of siRNA sequences. We also employed sparse logistic regression to build a linear model using dual-position specific nucleotide compositions, a task LASSO is not able to accomplish well due to its high dimensional nature. Our results demonstrate the superiority of sparse logistic regression as a technique for both feature selection and regression over LASSO in the context of siRNA design.

Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences.

PubMed

Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

2018-01-01

RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccas e 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like ( Sil1 ), scavenger receptor class C ( Src ), and scavenger receptor class B ( Srb3 and Srb4 ) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean.

Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences

PubMed Central

Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

2018-01-01

RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccase 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like (Sil1), scavenger receptor class C (Src), and scavenger receptor class B (Srb3 and Srb4) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean. PMID:29773992

Vector-based RNA interference against vascular endothelial growth factor-A significantly limits vascularization and growth of prostate cancer in vivo.

PubMed

Wannenes, Francesca; Ciafré, Silvia Anna; Niola, Francesco; Frajese, Gaetano; Farace, Maria Giulia

2005-12-01

RNA interference technology is emerging as a very potent tool to obtain a cellular knockdown of a desired gene. In this work we used vector-based RNA interference to inhibit vascular endothelial growth factor (VEGF) expression in prostate cancer in vitro and in vivo. We demonstrated that transduction with a plasmid carrying a small interfering RNA targeting all isoforms of VEGF, dramatically impairs the expression of this growth factor in the human prostate cancer cell line PC3. As a consequence, PC3 cells loose their ability to induce one of the fundamental steps of angiogenesis, namely the formation of a tube-like network in vitro. Most importantly, our "therapeutic" vector is able to impair tumor growth rate and vascularization in vivo. We show that a single injection of naked plasmid in developing neoplastic mass significantly decreases microvessel density in an androgen-refractory prostate xenograft and is able to sustain a long-term slowing down of tumor growth. In conclusion, our results confirm the basic role of VEGF in the angiogenic development of prostate carcinoma, and suggest that the use of our vector-based RNA interference approach to inhibit angiogenesis could be an effective tool in view of future gene therapy applications for prostate cancer.

Lipopolysaccharide promotes pulmonary fibrosis in acute respiratory distress syndrome (ARDS) via lincRNA-p21 induced inhibition of Thy-1 expression.

PubMed

Zhou, Wen-Qin; Wang, Peng; Shao, Qiu-Ping; Wang, Jian

2016-08-01

Acute respiratory distress syndrome (ARDS) is a common clinical disorder characterized by pulmonary edema leading to acute lung damage and arterial hypoxemia. Pulmonary fibrosis is a progressive, fibrotic lung disorder, whose pathogenesis in ARDS remains speculative. LincRNA-p21 was a novel regulator of cell proliferation, apoptosis and DNA damage response. This study aims to investigate the effects and mechanism of lincRNA-p21 on pulmonary fibrosis in ARDS. Purified 10 mg/kg LPS was dropped into airways of C57BL/6 mice. Expression levels of lincRNA-p21 and Thy-1 were measured by real-time PCR or western blotting. Proliferation of lung fibroblasts was analyzed by BrdU incorporation assay. Lung and BAL collagen contents were estimated using colorimetric Sircol assay. LincRNA-p21 expression was time-dependently increased and Thy-1 expression was time-dependently reduced in a mouse model of ARDS and in LPS-treated lung fibroblasts. Meanwhile, lung fibroblast proliferation was also time-dependently elevated in LPS-treated lung fibroblasts. In addition, lung fibroblast proliferation could be promoted by lincRNA-p21 overexpression and LPS treatment, however, the elevated lung fibroblast proliferation was further abrogated by Thy-1 overexpression or lincRNA-p21 interference. And Thy-1 interference could elevate cell viability of lung fibroblasts and rescue the reduction of lung fibroblast proliferation induced by lincRNA-p21 interference. Moreover, lincRNA-p21 overexpression dramatically inhibited acetylation of H3 and H4 at the Thy-1 promoter and Thy-1 expression levels in HLF1 cells. Finally, lincRNA-p21 interference rescued LPS-induced increase of lung and BAL collagen contents. LincRNA-p21 could lead to pulmonary fibrosis in ARDS by inhibition of the expression of Thy-1.

Intergenic Transcriptional Interference Is Blocked by RNA Polymerase III Transcription Factor TFIIIB in Saccharomyces cerevisiae

PubMed Central

Korde, Asawari; Rosselot, Jessica M.; Donze, David

2014-01-01

The major function of eukaryotic RNA polymerase III is to transcribe transfer RNA, 5S ribosomal RNA, and other small non-protein-coding RNA molecules. Assembly of the RNA polymerase III complex on chromosomal DNA requires the sequential binding of transcription factor complexes TFIIIC and TFIIIB. Recent evidence has suggested that in addition to producing RNA transcripts, chromatin-assembled RNA polymerase III complexes may mediate additional nuclear functions that include chromatin boundary, nucleosome phasing, and general genome organization activities. This study provides evidence of another such “extratranscriptional” activity of assembled RNA polymerase III complexes, which is the ability to block progression of intergenic RNA polymerase II transcription. We demonstrate that the RNA polymerase III complex bound to the tRNA gene upstream of the Saccharomyces cerevisiae ATG31 gene protects the ATG31 promoter against readthrough transcriptional interference from the upstream noncoding intergenic SUT467 transcription unit. This protection is predominately mediated by binding of the TFIIIB complex. When TFIIIB binding to this tRNA gene is weakened, an extended SUT467–ATG31 readthrough transcript is produced, resulting in compromised ATG31 translation. Since the ATG31 gene product is required for autophagy, strains expressing the readthrough transcript exhibit defective autophagy induction and reduced fitness under autophagy-inducing nitrogen starvation conditions. Given the recent discovery of widespread pervasive transcription in all forms of life, protection of neighboring genes from intergenic transcriptional interference may be a key extratranscriptional function of assembled RNA polymerase III complexes and possibly other DNA binding proteins. PMID:24336746

Prokaryotic Argonautes - variations on the RNA interference theme.

PubMed

van der Oost, John; Swarts, Daan C; Jore, Matthijs M

2014-04-15

The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes.

Prokaryotic Argonautes - variations on the RNA interference theme

PubMed Central

van der Oost, John; Swarts, Daan C.; Jore, Matthijs M.

2014-01-01

The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes. PMID:28357239

RNA Interference Based Approach to Down Regulate Osmoregulators of Whitefly (Bemisia tabaci): Potential Technology for the Control of Whitefly

USDA-ARS?s Scientific Manuscript database

Over the past decade RNA interference (RNAi) technology has emerged as a successful tool not only for functional genomics, but in planta expression of short interfering RNAs (siRNAs) could offer potential for insect pest management. Insects feeding exclusively on plant sap depend on osmotic pressure...

RNA interference as a method for target-site screening in the Western Corn Rootworm, Diabrotica virgifera virgifera

USDA-ARS?s Scientific Manuscript database

RNA interference (RNAi) is one of the most powerful and extraordinarily-specific means by which to silence genes. The ability of RNAi to silence genes makes it possible to ascertain function from genomic data, thereby making it an excellent choice for target-site screening. To test the efficacy of...

How Golden Is Silence? Teaching Undergraduates the Power and Limits of RNA Interference

ERIC Educational Resources Information Center

Kuldell, Natalie H.

2006-01-01

It is hard and getting harder to strike a satisfying balance in teaching. Time dedicated to student-generated models or ideas is often sacrificed in an effort to "get through the syllabus." I describe a series of RNA interference (RNAi) experiments for undergraduate students that simultaneously explores fundamental concepts in gene regulation,…

RNA interference in the Asian Longhorned Beetle:Identification of Key RNAi Genes and Reference Genes for RT-qPCR

USDA-ARS?s Scientific Manuscript database

Asian longhorned beetle (ALB), Anoplophora glabripennis, is a serious invasive forest pest in several countries including the United States, Canada, and Europe. RNA interference (RNAi)technology is being developed as a novel method for pest management. Here, we identified the ALB core RNAi genes in...

Activation of different split functionalities upon re-association of RNA-DNA hybrids

PubMed Central

Afonin, Kirill A.; Viard, Mathias; Martins, Angelica N.; Lockett, Stephen J.; Maciag, Anna E.; Freed, Eric O.; Heldman, Eliahu; Jaeger, Luc; Blumenthal, Robert; Shapiro, Bruce A.

2013-01-01

Split-protein systems, an approach that relies on fragmentation of proteins with their further conditional re-association to form functional complexes, are increasingly used for various biomedical applications. This approach offers tight control of the protein functions and improved detection sensitivity. Here we show a similar technique based on a pair of RNA-DNA hybrids that can be generally used for triggering different split functionalities. Individually, each hybrid is inactive but when two cognate hybrids re-associate, different functionalities are triggered inside mammalian cells. As a proof of concept this work is mainly focused on activation of RNA interference; however the release of other functionalities (resonance energy transfer and RNA aptamer) is also shown. Furthermore, in vivo studies demonstrate a significant uptake of the hybrids by tumors together with specific gene silencing. This split-functionality approach presents a new route in the development of “smart” nucleic acids based nanoparticles and switches for various biomedical applications. PMID:23542902

New Aspects of Gene-Silencing for the Treatment of Cardiovascular Diseases

PubMed Central

Koenig, Olivia; Walker, Tobias; Perle, Nadja; Zech, Almuth; Neumann, Bernd; Schlensak, Christian; Wendel, Hans-Peter; Nolte, Andrea

2013-01-01

Coronary heart disease (CHD), mainly caused by atherosclerosis, represents the single leading cause of death in industrialized countries. Besides the classical interventional therapies new applications for treatment of vascular wall pathologies are appearing on the horizon. RNA interference (RNAi) represents a novel therapeutic strategy due to sequence-specific gene-silencing through the use of small interfering RNA (siRNA). The modulation of gene expression by short RNAs provides a powerful tool to theoretically silence any disease-related or disease-promoting gene of interest. In this review we outline the RNAi mechanisms, the currently used delivery systems and their possible applications to the cardiovascular system. Especially, the optimization of the targeting and transfection procedures could enhance the efficiency of siRNA delivery drastically and might open the way to clinical applicability. The new findings of the last years may show the techniques to new innovative therapies and could probably play an important role in treating CHD in the future. PMID:24276320

Predicting gene regulatory networks of soybean nodulation from RNA-Seq transcriptome data.

PubMed

Zhu, Mingzhu; Dahmen, Jeremy L; Stacey, Gary; Cheng, Jianlin

2013-09-22

High-throughput RNA sequencing (RNA-Seq) is a revolutionary technique to study the transcriptome of a cell under various conditions at a systems level. Despite the wide application of RNA-Seq techniques to generate experimental data in the last few years, few computational methods are available to analyze this huge amount of transcription data. The computational methods for constructing gene regulatory networks from RNA-Seq expression data of hundreds or even thousands of genes are particularly lacking and urgently needed. We developed an automated bioinformatics method to predict gene regulatory networks from the quantitative expression values of differentially expressed genes based on RNA-Seq transcriptome data of a cell in different stages and conditions, integrating transcriptional, genomic and gene function data. We applied the method to the RNA-Seq transcriptome data generated for soybean root hair cells in three different development stages of nodulation after rhizobium infection. The method predicted a soybean nodulation-related gene regulatory network consisting of 10 regulatory modules common for all three stages, and 24, 49 and 70 modules separately for the first, second and third stage, each containing both a group of co-expressed genes and several transcription factors collaboratively controlling their expression under different conditions. 8 of 10 common regulatory modules were validated by at least two kinds of validations, such as independent DNA binding motif analysis, gene function enrichment test, and previous experimental data in the literature. We developed a computational method to reliably reconstruct gene regulatory networks from RNA-Seq transcriptome data. The method can generate valuable hypotheses for interpreting biological data and designing biological experiments such as ChIP-Seq, RNA interference, and yeast two hybrid experiments.

Biolistics-based gene silencing in plants using a modified particle inflow gun.

PubMed

Davies, Kevin M; Deroles, Simon C; Boase, Murray R; Hunter, Don A; Schwinn, Kathy E

2013-01-01

RNA interference (RNAi) is one of the most commonly used techniques for examining the function of genes of interest. In this chapter we present two examples of RNAi that use the particle inflow gun for delivery of the DNA constructs. In one example transient RNAi is used to show the function of an anthocyanin regulatory gene in flower petals. In the second example stably transformed cell cultures are produced with an RNAi construct that results in a change in the anthocyanin hydroxylation pattern.

[RNA interference: biogenesis molecular mechanisms and its applications in cervical cancer].

PubMed

Peralta-Zaragoza, Oscar; Bermúdez-Morales, Víctor Hugo; Madrid-Marina, Vicente

2010-01-01

RNAi (RNA interference) is a natural process by which eukaryotic cells silence gene expression through small interference RNAs (siRNA) which are complementary to messenger RNA (mRNA). In this process, the siRNA that are 21-25 nucleotides long and are known as microRNA (miRNA), either associate with the RNA-induced silencing complex (RISC), which targets and cleaves the complementary mRNAs by the endonucleolytic pathway, or repress the translation. It is also possible to silence exogenous gene expression during viral infections by using DNA templates to transcribe siRNA with properties that are identical to those of bioactive microRNA. Persistent human papillomavirus (HPV) infection is the main etiological agent during cervical cancer development and the HPV E6 and E7 oncogenes, which induce cellular transformation and immortalization, represent strategic targets to be silenced with siRNA. In several in vitro and in vivo studies, it has been demonstrated that the introduction of siRNA directed against the E6 and E7 oncogenes in human tumoral cervical cells transformed by HPV, leads to the efficient silencing of HPV E6 and E7 oncogene expression, which induces the accumulation of the products of the p53 and pRb tumor suppressor genes and activates the mechanism of programmed cell death by apoptosis; thus, the progression of the tumoral growth process may be prevented. The goal of this review is to analyze the microRNA biogenesis process in the silencing of gene expression and to discuss the different protocols for the use of siRNA as a potential gene therapy strategy for the treatment of cervical cancer.

Anatomy of RISC: how do small RNAs and chaperones activate Argonaute proteins?

PubMed

Nakanishi, Kotaro

2016-09-01

RNA silencing is a eukaryote-specific phenomenon in which microRNAs and small interfering RNAs degrade messenger RNAs containing a complementary sequence. To this end, these small RNAs need to be loaded onto an Argonaute protein (AGO protein) to form the effector complex referred to as RNA-induced silencing complex (RISC). RISC assembly undergoes multiple and sequential steps with the aid of Hsc70/Hsp90 chaperone machinery. The molecular mechanisms for this assembly process remain unclear, despite their significance for the development of gene silencing techniques and RNA interference-based therapeutics. This review dissects the currently available structures of AGO proteins and proposes models and hypotheses for RISC assembly, covering the conformation of unloaded AGO proteins, the chaperone-assisted duplex loading, and the slicer-dependent and slicer-independent duplex separation. The differences in the properties of RISC between prokaryotes and eukaryotes will also be clarified. WIREs RNA 2016, 7:637-660. doi: 10.1002/wrna.1356 For further resources related to this article, please visit the WIREs website. © 2016 The Authors. WIREs RNA published by Wiley Periodicals, Inc.

Improved silencing properties using small internally segmented interfering RNAs

PubMed Central

Bramsen, Jesper B.; Laursen, Maria B.; Damgaard, Christian K.; Lena, Suzy W.; Ravindra Babu, B.; Wengel, Jesper; Kjems, Jørgen

2007-01-01

RNA interference is mediated by small interfering RNAs (siRNAs) that upon incorporation into the RNA-induced silencing complex (RISC) can target complementary mRNA for degradation. Standard siRNA design usually feature a 19–27 base pair contiguous double-stranded region that is believed to be important for RISC incorporation. Here, we describe a novel siRNA design composed of an intact antisense strand complemented with two shorter 10–12 nt sense strands. This three-stranded construct, termed small internally segmented interfering RNA (sisiRNA), is highly functional demonstrating that an intact sense strand is not a prerequisite for RNA interference. Moreover, when using the sisiRNA design only the antisense strand is functional in activated RISC thereby completely eliminating unintended mRNA targeting by the sense strand. Interestingly, the sisiRNA design supports the function of chemically modified antisense strands, which are non-functional within the context of standard siRNA designs. This suggests that the sisiRNA design has a clear potential of improving the pharmacokinetic properties of siRNA in vivo. PMID:17726057

An enzyme free electrochemical biosensor for sensitive detection of miRNA with a high discrimination factor by coupling the strand displacement reaction and catalytic hairpin assembly recycling.

PubMed

Yao, Juan; Zhang, Zhang; Deng, Zhenghua; Wang, Youqiang; Guo, Yongcan

2017-10-23

An isothermal, enzyme free, ultra-specific and ultra-sensitive protocol for electrochemical detection of miRNAs is proposed based on the toehold-mediated strand displacement reaction (SDR) and non-enzymatic catalytic hairpin reaction (CHA) recycling. The SDR was first triggered only in the presence of target miRNA and this process also affects other miRNA interferences having similar target sequences, thus guaranteeing a high discrimination factor and could be used in rare content miRNA detection with various amounts of interferences having similar target sequences. The output protector strand then triggered enzyme free CHA amplification and generates plenty of hairpin self-assembly products. This process in turn influences SDR equilibrium to move to the right and generates large amounts of protector output to ensure analysis sensitivity. Compared with traditional CHA, our proposed method greatly improved the signal to noise ratio and shows excellent performance in rare miRNA detection with miRNA analogue interference. Under the optimal experimental conditions and using square wave voltammetry, the established biosensor could detect target miRNA-21 down to 30 fM (S/N = 3) with a dynamic range from 100 fM to 2 nM, and discriminate rare target miRNA-21 from mismatched miRNA with high selectivity. This method holds great promise in miRNA detection from human cancer cell lines and would be a versatile and powerful tool for clinical molecular diagnostics.

Using RNA interference to knock down the adhesion protein TES.

PubMed

Griffith, Elen

2007-01-01

RNA interference (RNAi) is a specific and efficient method to knock down protein levels using small interfering RNAs (siRNAs), which target mRNA degradation. RNAi can be used in mammalian cell culture systems to target any protein of interest, and several studies have used this method to knock down adhesion proteins. We used siRNAs to knock down the levels of TES, a focal adhesion protein, in HeLa cells. We demonstrated knockdown of both TES mRNA and TES protein. Although total knockdown of TES was not achieved, the observed reduction in TES protein was sufficient to result in a cellular phenotype of reduced actin stress fibers.

The RNA-induced silencing complex: a versatile gene-silencing machine.

PubMed

Pratt, Ashley J; MacRae, Ian J

2009-07-03

RNA interference is a powerful mechanism of gene silencing that underlies many aspects of eukaryotic biology. On the molecular level, RNA interference is mediated by a family of ribonucleoprotein complexes called RNA-induced silencing complexes (RISCs), which can be programmed to target virtually any nucleic acid sequence for silencing. The ability of RISC to locate target RNAs has been co-opted by evolution many times to generate a broad spectrum of gene-silencing pathways. Here, we review the fundamental biochemical and biophysical properties of RISC that facilitate gene targeting and describe the various mechanisms of gene silencing known to exploit RISC activity.

Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.

PubMed

Parrish, S; Fire, A

2001-10-01

RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed.

Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.

PubMed Central

Parrish, S; Fire, A

2001-01-01

RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed. PMID:11680844

Guanosine 2-NH2 groups of Escherichia coli RNase P RNA involved in intramolecular tertiary contacts and direct interactions with tRNA.

PubMed Central

Heide, C; Pfeiffer, T; Nolan, J M; Hartmann, R K

1999-01-01

We have identified by nucleotide analog interference mapping (NAIM) exocyclic NH2 groups of guanosines in RNase P RNA from Escherichia coli that are important for tRNA binding. The majority of affected guanosines represent phylogenetically conserved nucleotides. Several sites of interference could be assigned to direct contacts with the tRNA moiety, whereas others were interpreted as reflecting indirect effects on tRNA binding due to the disruption of tertiary contacts within the catalytic RNA. Our results support the involvement of the 2-NH2 groups of G292/G293 in pairing with C74 and C75 of tRNA CCA-termini, as well as formation of two consecutive base triples involving C75 and A76 of CCA-ends interacting with G292/A258 and G291/G259, respectively. Moreover, we present first biochemical evidence for two tertiary contacts (L18/P8 and L8/P4) within the catalytic RNA, whose formation has been postulated previously on the basis of phylogenetic comparative analyses. The tRNA binding interference data obtained in this and our previous studies are consistent with the formation of a consecutive nucleotide triple and quadruple between the tetraloop L18 and helix P8. Formation of the nucleotide triple (G316 and A94:U104 in wild-type E. coli RNase P RNA) is also supported by mutational analysis. For the mutant RNase P RNA carrying a G94:C104 double mutation, an additional G316-to-A mutation resulted in a restoration of binding affinity for mature and precursor tRNA. PMID:9917070

Gene Silencing in Adult Aedes aegypti Mosquitoes Through Oral Delivery of Double-Stranded RNA

DTIC Science & Technology

2012-01-01

utilization of dsRNA as a bio-insecticide against mosquitoes has only recently begun to be evaluated. Double-stranded RNA targeting chitin syn- thase...double- stranded RNA nanoparticle-mediated RNA interference to silence chitin synthase genes through larval feeding in the African malaria mosquito

EGFP-EGF1-Conjugated PLGA Nanoparticles for Targeted Delivery of siRNA into Injured Brain Microvascular Endothelial Cells for Efficient RNA Interference

PubMed Central

Chen, Chen; Mei, Heng; Shi, Wei; Deng, Jun; Zhang, Bo; Guo, Tao; Wang, Huafang; Hu, Yu

2013-01-01

Injured endothelium is an important target for drug and/or gene therapy because brain microvascular endothelial cells (BMECs) play critical roles in various pathophysiological conditions. RNA-mediated gene silencing presents a new therapeutic approach for treating such diseases, but major challenge is to ensure minimal toxicity and target delivery of siRNA to injured BMECs. Injured BMECs overexpress tissue factor (TF), which the fusion protein EGFP-EGF1 could be targeted to. In this study, TNF alpha (TNF-α) was chosen as a stimulus for primary BMECs to produce injured endothelium in vitro. The EGFP-EGF1-PLGA nanoparticles (ENPs) with loaded TF-siRNA were used as a new carrier for targeted delivery to the injured BMECs. The nanoparticles then produced intracellular RNA interference against TF. We compared ENP-based transfections with NP-mediated transfections, and our studies show that the ENP-based transfections result in a more efficient downregulation of TF. Our findings also show that the TF siRNA-loaded ENPs had minimal toxicity, with almost 96% of the cells viable 24 h after transfection while Lipofectamine-based transfections resulted in only 75% of the cells. Therefore, ENP-based transfection could be used for efficient siRNA transfection to injured BMECs and for efficient RNA interference (RNAi). This transfection could serve as a potential treatment for diseases, such as stroke, atherosclerosis and cancer. PMID:23593330

Double-stranded RNA interferes in a sequence-specific manner with the infection of representative members of the two viroid families

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carbonell, Alberto; Martinez de Alba, Angel-Emilio; Flores, Ricardo

2008-02-05

Infection by viroids, non-protein-coding circular RNAs, occurs with the accumulation of 21-24 nt viroid-derived small RNAs (vd-sRNAs) with characteristic properties of small interfering RNAs (siRNAs) associated to RNA silencing. The vd-sRNAs most likely derive from dicer-like (DCL) enzymes acting on viroid-specific dsRNA, the key elicitor of RNA silencing, or on the highly structured genomic RNA. Previously, viral dsRNAs delivered mechanically or agroinoculated have been shown to interfere with virus infection in a sequence-specific manner. Here, we report similar results with members of the two families of nuclear- and chloroplast-replicating viroids. Moreover, homologous vd-sRNAs co-delivered mechanically also interfered with one ofmore » the viroids examined. The interference was sequence-specific, temperature-dependent and, in some cases, also dependent on the dose of the co-inoculated dsRNA or vd-sRNAs. The sequence-specific nature of these effects suggests the involvement of the RNA induced silencing complex (RISC), which provides sequence specificity to RNA silencing machinery. Therefore, viroid titer in natural infections might be regulated by the concerted action of DCL and RISC. Viroids could have evolved their secondary structure as a compromise between resistance to DCL and RISC, which act preferentially against RNAs with compact and relaxed secondary structures, respectively. In addition, compartmentation, association with proteins or active replication might also help viroids to elude their host RNA silencing machinery.« less

Efficient delivery of RNA interference oligonucleotides to polarized airway epithelia in vitro

PubMed Central

Ramachandran, Shyam; Krishnamurthy, Sateesh; Jacobi, Ashley M.; Wohlford-Lenane, Christine; Behlke, Mark A.; Davidson, Beverly L.

2013-01-01

Polarized and pseudostratified primary airway epithelia present barriers that significantly reduce their transfection efficiency and the efficacy of RNA interference oligonucleotides. This creates an impediment in studies of the airway epithelium, diminishing the utility of loss-of-function as a research tool. Here we outline methods to introduce RNAi oligonucleotides into primary human and porcine airway epithelia grown at an air-liquid interface and difficult-to-transfect transformed epithelial cell lines grown on plastic. At the time of plating, we reverse transfect small-interfering RNA (siRNA), Dicer-substrate siRNA, or microRNA oligonucleotides into cells by use of lipid or peptide transfection reagents. Using this approach we achieve significant knockdown in vitro of hypoxanthine-guanine phosphoribosyltransferase, IL-8, and CFTR expression at the mRNA and protein levels in 1–3 days. We also attain significant reduction of secreted IL-8 in polarized primary pig airway epithelia 3 days posttransfection and inhibition of CFTR-mediated Cl− conductance in polarized air-liquid interface cultures of human airway epithelia 2 wk posttransfection. These results highlight an efficient means to deliver RNA interference reagents to airway epithelial cells and achieve significant knockdown of target gene expression and function. The ability to reliably conduct loss-of-function assays in polarized primary airway epithelia offers benefits to research in studies of epithelial cell homeostasis, candidate gene function, gene-based therapeutics, microRNA biology, and targeting the replication of respiratory viruses. PMID:23624792

Optimization of a yeast RNA interference system for controlling gene expression and enabling rapid metabolic engineering.

PubMed

Crook, Nathan C; Schmitz, Alexander C; Alper, Hal S

2014-05-16

Reduction of endogenous gene expression is a fundamental operation of metabolic engineering, yet current methods for gene knockdown (i.e., genome editing) remain laborious and slow, especially in yeast. In contrast, RNA interference allows facile and tunable gene knockdown via a simple plasmid transformation step, enabling metabolic engineers to rapidly prototype knockdown strategies in multiple strains before expending significant cost to undertake genome editing. Although RNAi is naturally present in a myriad of eukaryotes, it has only been recently implemented in Saccharomyces cerevisiae as a heterologous pathway and so has not yet been optimized as a metabolic engineering tool. In this study, we elucidate a set of design principles for the construction of hairpin RNA expression cassettes in yeast and implement RNA interference to quickly identify routes for improvement of itaconic acid production in this organism. The approach developed here enables rapid prototyping of knockdown strategies and thus accelerates and reduces the cost of the design-build-test cycle in yeast.

A potential role for RNA interference in controlling the activity of the human LINE-1 retrotransposon.

PubMed

Soifer, Harris S; Zaragoza, Adriana; Peyvan, Maany; Behlke, Mark A; Rossi, John J

2005-01-01

Long interspersed nuclear elements (LINE-1 or L1) comprise 17% of the human genome, although only 80-100 L1s are considered retrotransposition-competent (RC-L1). Despite their small number, RC-L1s are still potential hazards to genome integrity through insertional mutagenesis, unequal recombination and chromosome rearrangements. In this study, we provide several lines of evidence that the LINE-1 retrotransposon is susceptible to RNA interference (RNAi). First, double-stranded RNA (dsRNA) generated in vitro from an L1 template is converted into functional short interfering RNA (siRNA) by DICER, the RNase III enzyme that initiates RNAi in human cells. Second, pooled siRNA from in vitro cleavage of L1 dsRNA, as well as synthetic L1 siRNA, targeting the 5'-UTR leads to sequence-specific mRNA degradation of an L1 fusion transcript. Finally, both synthetic and pooled siRNA suppressed retrotransposition from a highly active RC-L1 clone in cell culture assay. Our report is the first to demonstrate that a human transposable element is subjected to RNAi.

Photoinduced RNA interference.

PubMed

Matsushita-Ishiodori, Yuka; Ohtsuki, Takashi

2012-07-17

Because RNA interference (RNAi) can be applied to any gene, this technique has been widely used for studying gene functions. In addition, many researchers are attempting to use RNAi technology in RNAi-based therapies. However, several challenging and controversial issues have arisen during the widespread application of RNAi including target gene specificity, target cell specificity, and spatiotemporal control of gene silencing. To address these issues, several groups have utilized photochemistry to control the RNA release, both spatially and temporally. In this Account, we focus on recent studies using photocleavable protecting groups, photosensitizers, Hand gold nanoparticles for photoinduced RNAi. In 2005 the first report of photoinduced RNAi used a caged short interfering RNA (siRNA), an siRNA carrying a photocleavable protecting group. Caging groups block the bioactivities of target molecules, but allow for complete recovery of these functions via photoactivation. However, some RNAi activity can occur in these caged siRNAs, so it will be necessary to decrease this "leakage" and raise the RNAi activity restored after irradiation. This technique also uses UV light around 350 nm, which is cytotoxic, but in the near future we expect that it will be possible to use visible and near-infrared light We also examine the application of photochemical internalization (PCI) to RNAi technology, which involves a combination of photosensitizers and light. Instead of inducing RNAi using light, the strategy behind this method was to enhance RNAi using RNA carriers. Many wellknown RNA carriers deliver siRNAs into cells by endocytosis. The siRNAs are trapped in endocytic vesicles and have to be released into the cytoplasm in order to express their activity. To achieve the endosomal escape of siRNAs, PCI technology employed photosensitizers to generate light-dependent reactive oxygen species (ROS) that disrupted the endocytic vesicles. In most studies, RNAi-mediated knockdown of the target gene was detected even without PCI. Recently, a polymer capable of trapping the siRNA in endocytic vesicles controlled RNAi almost entirely by light. CLIP-RNAi uses photosensitizing carrier proteins that can be activated over a wide range of visible light wavelengths. With this method RNA carrier/siRNA complexes are completely trapped within endosomes, and RNAi is controlled strictly by light. Such precise, light-dependent control will open up new possibilities for cellular and molecular biology and therapy. Most recently, gold nanoparticles (AuNPs) conjugated to siRNA have provided temporal and spatial control of RNAi. The light-dependent melting of AuNPs accompanied by a shape transformation induces the release of thiolated siRNAs from AuNPs. In this method, the unique optical properties of the AuNP enable deep penetration of the excitation light into tissues at nearinfrared wavelengths. The development of photoinduced RNAi technology will lead to novel insights into gene functions and selective drug delivery, and many other scientific fields will continue to influence its progress.

Cardiovascular RNA interference therapy: the broadening tool and target spectrum.

PubMed

Poller, Wolfgang; Tank, Juliane; Skurk, Carsten; Gast, Martina

2013-08-16

Understanding of the roles of noncoding RNAs (ncRNAs) within complex organisms has fundamentally changed. It is increasingly possible to use ncRNAs as diagnostic and therapeutic tools in medicine. Regarding disease pathogenesis, it has become evident that confinement to the analysis of protein-coding regions of the human genome is insufficient because ncRNA variants have been associated with important human diseases. Thus, inclusion of noncoding genomic elements in pathogenetic studies and their consideration as therapeutic targets is warranted. We consider aspects of the evolutionary and discovery history of ncRNAs, as far as they are relevant for the identification and selection of ncRNAs with likely therapeutic potential. Novel therapeutic strategies are based on ncRNAs, and we discuss here RNA interference as a highly versatile tool for gene silencing. RNA interference-mediating RNAs are small, but only parts of a far larger spectrum encompassing ncRNAs up to many kilobasepairs in size. We discuss therapeutic options in cardiovascular medicine offered by ncRNAs and key issues to be solved before clinical translation. Convergence of multiple technical advances is highlighted as a prerequisite for the translational progress achieved in recent years. Regarding safety, we review properties of RNA therapeutics, which may immunologically distinguish them from their endogenous counterparts, all of which underwent sophisticated evolutionary adaptation to specific biological contexts. Although our understanding of the noncoding human genome is only fragmentary to date, it is already feasible to develop RNA interference against a rapidly broadening spectrum of therapeutic targets and to translate this to the clinical setting under certain restrictions.

SiLEncing SLE: the power and promise of small noncoding RNAs.

PubMed

Rigby, Robert J; Vinuesa, Carola G

2008-09-01

In this study, we outline the evidence suggesting that defects in the RNA silencing machinery can lead to the prototypic systemic autoimmune disease, systemic lupus erythematosus, and describe the potential for RNA interference to provide novel therapeutic agents. Over the last year, a class of small noncoding RNAs--microRNAs--have been shown to play key roles in immune regulation including T-cell selection in the thymus, B cell affinity maturation and selection in germinal centres, and development of regulatory T cells, suggesting that the microRNA machinery may be crucial in the maintenance of immunological tolerance. Two RNA silencing mechanisms have been shown to be involved in lupus pathogenesis: failed Roquin-mediated repression of inducible costimulatory receptors messenger RNA through miR-101 in roquin(san/san) mice and decreased expression of pro-apoptotic molecule and phosphatase and tensin homologue on chromosome 10 in mice transgenic for the miR-17-92 cluster, leading to lymphoproliferation and other lupus manisfestations. MicroRNA array experiments performed on peripheral blood mononuclear cells have revealed different expression profiles in systemic lupus erythematosus patients. RNA interference has also been used ex vivo to silence dysregulated T-cell molecules in cells from systemic lupus erythematosus patients. Dysregulation of the RNA silencing machinery has been implicated in systemic lupus erythematosus pathogenesis. Although microRNA profiling may prove to be a useful diagnostic and prognostic tool for a notoriously heterogeneous disease, manipulation of RNA interference emerges as a powerful and potentially specific means to correct dysregulated gene expression in systemic lupus erythematosus patients.

Therapeutic potentials of gene silencing by RNA interference: principles, challenges, and new strategies.

PubMed

Deng, Yan; Wang, Chi Chiu; Choy, Kwong Wai; Du, Quan; Chen, Jiao; Wang, Qin; Li, Lu; Chung, Tony Kwok Hung; Tang, Tao

2014-04-01

During recent decades there have been remarkable advances in biology, in which one of the most important discoveries is RNA interference (RNAi). RNAi is a specific post-transcriptional regulatory pathway that can result in silencing gene functions. Efforts have been done to translate this new discovery into clinical applications for disease treatment. However, technical difficulties restrict the development of RNAi, including stability, off-target effects, immunostimulation and delivery problems. Researchers have attempted to surmount these barriers and improve the bioavailability and safety of RNAi-based therapeutics by optimizing the chemistry and structure of these molecules. This paper aimed to describe the principles of RNA interference, review the therapeutic potential in various diseases and discuss the new strategies for in vivo delivery of RNAi to overcome the challenges. Copyright © 2013 Elsevier B.V. All rights reserved.

Gene interference regulates aquaporin-4 expression in swollen tissue of rats with cerebral ischemic edema

PubMed Central

Hu, Hui; Lu, Hong; He, Zhanping; Han, Xiangjun; Chen, Jing; Tu, Rong

2012-01-01

To investigate the effects of mRNA interference on aquaporin-4 expression in swollen tissue of rats with ischemic cerebral edema, and diagnose the significance of diffusion-weighted MRI, we injected 5 μL shRNA- aquaporin-4 (control group) or siRNA- aquaporin-4 solution (1:800) (RNA interference group) into the rat right basal ganglia immediately before occlusion of the middle cerebral artery. At 0.25 hours after occlusion of the middle cerebral artery, diffusion-weighted MRI displayed a high signal; within 2 hours, the relative apparent diffusion coefficient decreased markedly, aquaporin-4 expression increased rapidly, and intracellular edema was obviously aggravated; at 4 and 6 hours, the relative apparent diffusion coefficient slowly returned to control levels, aquaporin-4 expression slightly increased, and angioedema was observed. In the RNA interference group, during 0.25–6 hours after injection of siRNA- aquaporin-4 solution, the relative apparent diffusion coefficient slightly fluctuated and aquaporin-4 expression was upregulated; during 0.5–4 hours, the relative apparent diffusion coefficient was significantly higher, while aquaporin-4 expression was significantly lower when compared with the control group, and intracellular edema was markedly reduced; at 0.25 and 6 hours, the relative apparent diffusion coefficient and aquaporin-4 expression were similar when compared with the control group; obvious angioedema remained at 6 hours. Pearson's correlation test results showed that aquaporin-4 expression was negatively correlated with the apparent diffusion coefficient (r = −0.806, P < 0.01). These findings suggest that upregulated aquaporin-4 expression is likely to be the main molecular mechanism of intracellular edema and may be the molecular basis for decreased relative apparent diffusion coefficient. Aquaporin-4 gene interference can effectively inhibit the upregulation of aquaporin-4 expression during the stage of intracellular edema with time-effectiveness. Moreover, diffusion-weighted MRI can accurately detect intracellular edema. PMID:25657707

Gene interference regulates aquaporin-4 expression in swollen tissue of rats with cerebral ischemic edema: Correlation with variation in apparent diffusion coefficient.

PubMed

Hu, Hui; Lu, Hong; He, Zhanping; Han, Xiangjun; Chen, Jing; Tu, Rong

2012-07-25

To investigate the effects of mRNA interference on aquaporin-4 expression in swollen tissue of rats with ischemic cerebral edema, and diagnose the significance of diffusion-weighted MRI, we injected 5 μL shRNA- aquaporin-4 (control group) or siRNA- aquaporin-4 solution (1:800) (RNA interference group) into the rat right basal ganglia immediately before occlusion of the middle cerebral artery. At 0.25 hours after occlusion of the middle cerebral artery, diffusion-weighted MRI displayed a high signal; within 2 hours, the relative apparent diffusion coefficient decreased markedly, aquaporin-4 expression increased rapidly, and intracellular edema was obviously aggravated; at 4 and 6 hours, the relative apparent diffusion coefficient slowly returned to control levels, aquaporin-4 expression slightly increased, and angioedema was observed. In the RNA interference group, during 0.25-6 hours after injection of siRNA- aquaporin-4 solution, the relative apparent diffusion coefficient slightly fluctuated and aquaporin-4 expression was upregulated; during 0.5-4 hours, the relative apparent diffusion coefficient was significantly higher, while aquaporin-4 expression was significantly lower when compared with the control group, and intracellular edema was markedly reduced; at 0.25 and 6 hours, the relative apparent diffusion coefficient and aquaporin-4 expression were similar when compared with the control group; obvious angioedema remained at 6 hours. Pearson's correlation test results showed that aquaporin-4 expression was negatively correlated with the apparent diffusion coefficient (r = -0.806, P < 0.01). These findings suggest that upregulated aquaporin-4 expression is likely to be the main molecular mechanism of intracellular edema and may be the molecular basis for decreased relative apparent diffusion coefficient. Aquaporin-4 gene interference can effectively inhibit the upregulation of aquaporin-4 expression during the stage of intracellular edema with time-effectiveness. Moreover, diffusion-weighted MRI can accurately detect intracellular edema.

Ewing's Sarcoma: Development of RNA Interference-Based Therapy for Advanced Disease

PubMed Central

Simmons, Olivia; Maples, Phillip B.; Senzer, Neil; Nemunaitis, John

2012-01-01

Ewing's sarcoma tumors are associated with chromosomal translocation between the EWS gene and the ETS transcription factor gene. These unique target sequences provide opportunity for RNA interference(i)-based therapy. A summary of RNAi mechanism and therapeutically designed products including siRNA, shRNA and bi-shRNA are described. Comparison is made between each of these approaches. Systemic RNAi-based therapy, however, requires protected delivery to the Ewing's sarcoma tumor site for activity. Delivery systems which have been most effective in preclinical and clinical testing are reviewed, followed by preclinical assessment of various silencing strategies with demonstration of effectiveness to EWS/FLI-1 target sequences. It is concluded that RNAi-based therapeutics may have testable and achievable activity in management of Ewing's sarcoma. PMID:22523703

Symbiont-mediated RNA interference in insects

PubMed Central

Whitten, Miranda M. A.; Facey, Paul D.; Del Sol, Ricardo; Fernández-Martínez, Lorena T.; Evans, Meirwyn C.; Mitchell, Jacob J.; Bodger, Owen G.

2016-01-01

RNA interference (RNAi) methods for insects are often limited by problems with double-stranded (ds) RNA delivery, which restricts reverse genetics studies and the development of RNAi-based biocides. We therefore delegated to insect symbiotic bacteria the task of: (i) constitutive dsRNA synthesis and (ii) trauma-free delivery. RNaseIII-deficient, dsRNA-expressing bacterial strains were created from the symbionts of two very diverse pest species: a long-lived blood-sucking bug, Rhodnius prolixus, and a short-lived globally invasive polyphagous agricultural pest, western flower thrips (Frankliniella occidentalis). When ingested, the manipulated bacteria colonized the insects, successfully competed with the wild-type microflora, and sustainably mediated systemic knockdown phenotypes that were horizontally transmissible. This represents a significant advance in the ability to deliver RNAi, potentially to a large range of non-model insects. PMID:26911963

Homo sapiens Systemic RNA Interference-defective-1 Transmembrane Family Member 1 (SIDT1) Protein Mediates Contact-dependent Small RNA Transfer and MicroRNA-21-driven Chemoresistance*

PubMed Central

Elhassan, Mohamed O.; Christie, Jennifer; Duxbury, Mark S.

2012-01-01

Locally initiated RNA interference (RNAi) has the potential for spatial propagation, inducing posttranscriptional gene silencing in distant cells. In Caenorhabditis elegans, systemic RNAi requires a phylogenetically conserved transmembrane channel, SID-1. Here, we show that a human SID-1 orthologue, SIDT1, facilitates rapid, contact-dependent, bidirectional small RNA transfer between human cells, resulting in target-specific non-cell-autonomous RNAi. Intercellular small RNA transfer can be both homotypic and heterotypic. We show SIDT1-mediated intercellular transfer of microRNA-21 to be a driver of resistance to the nucleoside analog gemcitabine in human adenocarcinoma cells. Documentation of a SIDT1-dependent small RNA transfer mechanism and the associated phenotypic effects on chemoresistance in human cancer cells raises the possibility that conserved systemic RNAi pathways contribute to the acquisition of drug resistance. Mediators of non-cell-autonomous RNAi may be tractable targets for novel therapies aimed at improving the efficacy of current cytotoxic agents. PMID:22174421

Therapeutic Potency of Nanoformulations of siRNAs and shRNAs in Animal Models of Cancers.

PubMed

Karim, Md Emranul; Tha, Kyi Kyi; Othman, Iekhsan; Borhan Uddin, Mohammad; Chowdhury, Ezharul Hoque

2018-05-26

RNA Interference (RNAi) has brought revolutionary transformations in cancer management in the past two decades. RNAi-based therapeutics including siRNA and shRNA have immense scope to silence the expression of mutant cancer genes specifically in a therapeutic context. Although tremendous progress has been made to establish catalytic RNA as a new class of biologics for cancer management, a lot of extracellular and intracellular barriers still pose a long-lasting challenge on the way to clinical approval. A series of chemically suitable, safe and effective viral and non-viral carriers have emerged to overcome physiological barriers and ensure targeted delivery of RNAi. The newly invented carriers, delivery techniques and gene editing technology made current treatment protocols stronger to fight cancer. This review has provided a platform about the chronicle of siRNA development and challenges of RNAi therapeutics for laboratory to bedside translation focusing on recent advancement in siRNA delivery vehicles with their limitations. Furthermore, an overview of several animal model studies of siRNA- or shRNA-based cancer gene therapy over the past 15 years has been presented, highlighting the roles of genes in multiple cancers, pharmacokinetic parameters and critical evaluation. The review concludes with a future direction for the development of catalytic RNA vehicles and design strategies to make RNAi-based cancer gene therapy more promising to surmount cancer gene delivery challenges.

RNA Interference in Infectious Tropical Diseases

PubMed Central

Hong, Young S.

2008-01-01

Introduction of double-stranded RNA (dsRNA) into some cells or organisms results in degradation of its homologous mRNA, a process called RNA interference (RNAi). The dsRNAs are processed into short interfering RNAs (siRNAs) that subsequently bind to the RNA-induced silencing complex (RISC), causing degradation of target mRNAs. Because of this sequence-specific ability to silence target genes, RNAi has been extensively used to study gene functions and has the potential to control disease pathogens or vectors. With this promise of RNAi to control pathogens and vectors, this paper reviews the current status of RNAi in protozoans, animal parasitic helminths and disease-transmitting vectors, such as insects. Many pathogens and vectors cause severe parasitic diseases in tropical regions and it is difficult to control once the host has been invaded. Intracellularly, RNAi can be highly effective in impeding parasitic development and proliferation within the host. To fully realize its potential as a means to control tropical diseases, appropriate delivery methods for RNAi should be developed, and possible off-target effects should be minimized for specific gene suppression. RNAi can also be utilized to reduce vector competence to interfere with disease transmission, as genes critical for pathogenesis of tropical diseases are knockdowned via RNAi. PMID:18344671

Accumulation of dsRNA in endosomes contributes to inefficient RNA interference in the fall armyworm, Spodoptera frugiperda.

PubMed

Yoon, June-Sun; Gurusamy, Dhandapani; Palli, Subba Reddy

2017-11-01

RNA interference (RNAi) efficiency varies among insects studied. The barriers for successful RNAi include the presence of double-stranded ribonucleases (dsRNase) in the lumen and hemolymph that could potentially digest double-stranded RNA (dsRNA) and the variability in the transport of dsRNA into and within the cells. We recently showed that the dsRNAs are transported into lepidopteran cells, but they are not processed into small interference RNAs (siRNAs) because they are trapped in acidic bodies. In the current study, we focused on the identification of acidic bodies in which dsRNAs accumulate in Sf9 cells. Time-lapse imaging studies showed that dsRNAs enter Sf9 cells and accumulate in acidic bodies within 20 min after their addition to the medium. CypHer-5E-labeled dsRNA also accumulated in the midgut and fat body dissected from Spodoptera frugiperda larvae with similar patterns observed in Sf9 cells. Pharmacological inhibitor assays showed that the dsRNAs use clathrin mediated endocytosis pathway for transport into the cells. We investigated the potential dsRNA accumulation sites employing LysoTracker and double labeling experiments using the constructs to express a fusion of green fluorescence protein with early or late endosomal marker proteins and CypHer-5E-labeled dsRNA. Interestingly, CypHer-5E-labeled dsRNA accumulated predominantly in early and late endosomes. These data suggest that entrapment of internalized dsRNA in endosomes is one of the major factors contributing to inefficient RNAi response in lepidopteran insects. Copyright © 2017 Elsevier Ltd. All rights reserved.

Noncoding Subgenomic Flavivirus RNA Is Processed by the Mosquito RNA Interference Machinery and Determines West Nile Virus Transmission by Culex pipiens Mosquitoes.

PubMed

Göertz, G P; Fros, J J; Miesen, P; Vogels, C B F; van der Bent, M L; Geertsema, C; Koenraadt, C J M; van Rij, R P; van Oers, M M; Pijlman, G P

2016-11-15

Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5'-3' exoribonuclease XRN1/Pacman on conserved RNA structures in the 3' untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo Two reproducible small-RNA hot spots within the 3' UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3' SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. Understanding the flavivirus transmission cycle is important to identify novel targets to interfere with disease and to aid development of virus control strategies. Flaviviruses produce an abundant noncoding viral RNA called sfRNA in both arthropod and mammalian cells. To evaluate the role of sfRNA in flavivirus transmission, we infected mosquitoes with the flavivirus West Nile virus and an sfRNA-deficient mutant West Nile virus. We demonstrate that sfRNA determines the infection and transmission rates of West Nile virus in Culex pipiens mosquitoes. Comparison of infection via the blood meal versus intrathoracic injection, which bypasses the midgut, revealed that sfRNA is important to overcome the mosquito midgut barrier. We also show that sfRNA is processed by the antiviral RNA interference machinery in mosquitoes. This is the first report to describe a pivotal biological function of sfRNA in arthropods. The results explain why sfRNA production is evolutionarily conserved. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Noncoding Subgenomic Flavivirus RNA Is Processed by the Mosquito RNA Interference Machinery and Determines West Nile Virus Transmission by Culex pipiens Mosquitoes

PubMed Central

Göertz, G. P.; Fros, J. J.; Miesen, P.; Vogels, C. B. F.; van der Bent, M. L.; Geertsema, C.; Koenraadt, C. J. M.; van Oers, M. M.

2016-01-01

ABSTRACT Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5′-3′ exoribonuclease XRN1/Pacman on conserved RNA structures in the 3′ untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo. Two reproducible small-RNA hot spots within the 3′ UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3′ SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. IMPORTANCE Understanding the flavivirus transmission cycle is important to identify novel targets to interfere with disease and to aid development of virus control strategies. Flaviviruses produce an abundant noncoding viral RNA called sfRNA in both arthropod and mammalian cells. To evaluate the role of sfRNA in flavivirus transmission, we infected mosquitoes with the flavivirus West Nile virus and an sfRNA-deficient mutant West Nile virus. We demonstrate that sfRNA determines the infection and transmission rates of West Nile virus in Culex pipiens mosquitoes. Comparison of infection via the blood meal versus intrathoracic injection, which bypasses the midgut, revealed that sfRNA is important to overcome the mosquito midgut barrier. We also show that sfRNA is processed by the antiviral RNA interference machinery in mosquitoes. This is the first report to describe a pivotal biological function of sfRNA in arthropods. The results explain why sfRNA production is evolutionarily conserved. PMID:27581979

The protective effect of Hif3a RNA interference and HIF-prolyl hydroxylase inhibition on cardiomyocytes under anoxia-reoxygenation.

PubMed

Drevytska, T; Gonchar, E; Okhai, I; Lynnyk, O; Mankovska, I; Klionsky, D; Dosenko, V

2018-06-01

The aim of this study was to investigate the molecular mechanisms underlying the protective effects of hypoxia-inducible factor (HIF) signaling pathway activation in cardiomyocytes under anoxia-reoxygenation (A/R) injury. In this study, rat neonatal cardiomyocytes were pretreated with anti-Hif3A/Hif-3α siRNA or HIF-prolyl hydroxylase inhibitor prior to A/R injury. Our results showed that both HIF3A silencing and HIF-prolyl hydroxylase inhibition effectively increased the cell viability during A/R, led to changes in mRNA expression of HIF1-target genes, and reduced the loss of mitochondrial membrane potential (Δψ m ). Furthermore, application of anti-Hif3a siRNA led to an increase in mRNA expression of Epo, Igf1, Slc2a1/Glut-1, and Slc2a4/Glut-4. Similar results were observed with HIF-prolyl hydroxylase inhibition, which additionally upregulated the mRNA expression of Epor, Tert, and Pdk1. Hif3a RNA-interference and application of HIF-prolyl hydroxylase inhibitor during A/R modelling led to an increase of Δψ m on 11.5 and 11.9 mV respectively, compared to the control groups. Thus, Hif3a RNA interference and HIF-prolyl hydroxylase inhibition protect cardiomyocytes against A/R injury via the HIF signaling pathway. Copyright © 2018 Elsevier Inc. All rights reserved.

Knockdown of RNA interference pathway genes impacts the fitness of western corn rootworm.

PubMed

Davis-Vogel, Courtney; Ortiz, Angel; Procyk, Lisa; Robeson, Jonathan; Kassa, Adane; Wang, Yiwei; Huang, Emily; Walker, Carl; Sethi, Amit; Nelson, Mark E; Sashital, Dipali G

2018-05-18

Western corn rootworm (Diabrotica virgifera virgifera) is a serious agricultural pest known for its high adaptability to various management strategies, giving rise to a continual need for new control options. Transgenic maize expressing insecticidal RNAs represents a novel mode of action for rootworm management that is dependent on the RNA interference (RNAi) pathways of the insect for efficacy. Preliminary evidence suggests that western corn rootworm could develop broad resistance to all insecticidal RNAs through changes in RNAi pathway genes; however, the likelihood of field-evolved resistance occurring through this mechanism remains unclear. In the current study, eight key genes involved in facilitating interference in the microRNA and small interfering RNA pathways were targeted for knockdown in order to evaluate impact on fitness of western corn rootworm. These genes include drosha, dicer-1, dicer-2, pasha, loquacious, r2d2, argonaute 1, and argonaute 2. Depletion of targeted transcripts in rootworm larvae led to changes in microRNA expression, decreased ability to pupate, reduced adult beetle emergence, and diminished reproductive capacity. The observed effects do not support evolution of resistance through changes in expression of these eight genes due to reduced insect fitness.

In cell mutational interference mapping experiment (in cell MIME) identifies the 5' polyadenylation signal as a dual regulator of HIV-1 genomic RNA production and packaging.

PubMed

Smyth, Redmond P; Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe; von Kleist, Max; Marquet, Roland

2018-05-18

Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5' region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5' PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production.

In cell mutational interference mapping experiment (in cell MIME) identifies the 5′ polyadenylation signal as a dual regulator of HIV-1 genomic RNA production and packaging

PubMed Central

Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe

2018-01-01

Abstract Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5′ region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5′ PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production. PMID:29514260

Reduction of bilirubin by targeting human heme oxygenase-1 through siRNA.

PubMed

Xia, Zhen-Wei; Li, Chun-E; Jin, You-Xin; Shi, Yi; Xu, Li-Qing; Zhong, Wen-Wei; Li, Yun-Zhu; Yu, Shan-Chang; Zhang, Zi-Li

2007-04-01

Neonatal hyperbilirubinemia is a common clinical condition caused mainly by the increased production and decreased excretion of bilirubin. Current treatment is aimed at reducing the serum levels of bilirubin. Heme oxygenase-1 (HO-1) is a rate-limiting enzyme that generates bilirubin. In this study we intended to suppress HO-1 using the RNA interference technique. Small interfering RNA (siRNA)-A, -B, and -C were designed based on human HO-1 (hHO-1) mRNA sequences. siRNA was transfected into a human hepatic cell line (HL-7702). hHO-1 transcription and protein levels were then determined. In addition, the inhibitory effect of siRNA on hHO-1 was assessed in cells treated with hemin or transfected with an hHO-1 plasmid. siRNA-C showed the most potent suppressive effect on hHO-1. This inhibition is dose and time dependent. Compared with control, both hemin and hHO-1 plasmids up-regulated hHO-1 expression in HL-7702 cells. However, the up-regulation was significantly attenuated by siRNA-C. Furthermore, the decrease in hHO-1 activity was coincident with the suppression of its transcription. Finally, siRNA-C was shown to reduce hHO-1 enzymatic activity and bilirubin levels. Thus, this study provides a novel therapeutic rationale by blocking bilirubin formation via siRNA for preventing and treating neonatal hyperbilirubinemia and bilirubin encephalopathy at an early clinical stage.

Messenger RNA transcripts

Treesearch

Dan Cullen

2004-01-01

In contrast to DNA, messenger RNA (mRNA) in complex substrata is rarely analyzed, in large part because labile RNA molecules are difficult to purify. Nucleic acid extractions from fungi that colonize soil are particularly difficult and plagued by humic substances that interfere with Taq polymerase (Tebbe and Vahjen 1993 and references therein). Magnetic capture...

RNA interference-based nanosystems for inflammatory bowel disease therapy

PubMed Central

Guo, Jian; Jiang, Xiaojing; Gui, Shuangying

2016-01-01

Inflammatory bowel disease (IBD), which includes ulcerative colitis and Crohn’s disease, is a chronic, recrudescent disease that invades the gastrointestinal tract, and it requires surgery or lifelong medicinal therapy. The conventional medicinal therapies for IBD, such as anti-inflammatories, glucocorticoids, and immunosuppressants, are limited because of their systemic adverse effects and toxicity during long-term treatment. RNA interference (RNAi) precisely regulates susceptibility genes to decrease the expression of proinflammatory cytokines related to IBD, which effectively alleviates IBD progression and promotes intestinal mucosa recovery. RNAi molecules generally include short interfering RNA (siRNA) and microRNA (miRNA). However, naked RNA tends to degrade in vivo as a consequence of endogenous ribonucleases and pH variations. Furthermore, RNAi treatment may cause unintended off-target effects and immunostimulation. Therefore, nanovectors of siRNA and miRNA were introduced to circumvent these obstacles. Herein, we introduce non-viral nanosystems of RNAi molecules and discuss these systems in detail. Additionally, the delivery barriers and challenges associated with RNAi molecules will be discussed from the perspectives of developing efficient delivery systems and potential clinical use. PMID:27789943

Using RNA Interference to Reveal Genetic Vulnerabilities in Human Cancer Cells

DTIC Science & Technology

2005-07-01

pl of RNase/DNase free water and performed PCR amplification in 50pl reaction volumes using Invitrogen’s Platinum® Pfx DNA Polymerase . To obtain a...destroyed1’ 2. This pathway, known as RNA interference (RNAi), has been exploited in organisms ranging from plants to fungi to animals for...experimentally alter its targeting capability. Indeed such strategies have previously succeeded in both plants and animals23󈧜. My initial studies

Homologous interference mediated by defective interfering influenza virus derived from a temperature-sensitive mutant of influenza virus.

PubMed Central

Nayak, D P; Tobita, K; Janda, J M; Davis, A R; De, B K

1978-01-01

A temperature-sensitive group II mutant of influenza virus, ts-52, with a presumed defect in viral RNA synthesis, readily produced von Magnus-type defective interfering virus (DI virus) when passed serially (four times) at high multiplicity in MDBK cells. The defective virus (ts-52 DI virus) had a high hemagglutinin and a low infectivity titer, and strongly interfered with the replication of standard infectious viruses (both ts-52 and wild-type ts+) in co-infected cells. Progeny virus particles produced by co-infection of DI virus and infectious virus were also defective and also had low infectivity, high hemagglutinating activity, and a strong interfering property. Infectious viruses ts+ and ts-52 were indistinguishable from ts-52 DI viruses by sucrose velocity or density gradient analysis. Additionally, these viruses all possessed similar morphology. However, when the RNA of DI viruses was analyzed by use of polyacrylamide gels containing 6 M urea, there was a reduction in the amount of large RNA species (V1 to V4), and a number of new smaller RNA species (D1 to D6) with molecular weights ranging from 2.9 X 10(5) to 1.05 X 10(5) appeared. Since these smaller RNA species (D1 to D6) were absent in some clones of infectious viruses, but were consistently associated with DI viruses and increased during undiluted passages and during co-infection of ts-52 with DI virus, they appeared to be a characteristic of DI viruses. Additionally, the UV target size of interfering activity and infectivity of DI virus indicated that interfering activity was 40 times more resistant to UV irradiation than was infectivity, further implicating small RNA molecules in interference. Our data suggest that the loss of infectivity observed among DI viruses may be due to nonspecific loss of a viral RNA segment(s), and the interfering property of DI viruses may be due to interfering RNA segments (DIRNA, D1 to D6). ts-52 DI virus interfered with the replication of standard virus (ts+) at both permissive (34 degrees C) and nonpermissive temperatures. The infectivity of the progeny virus was reduced to 0.2% for ts+ and 0.05% for ts-52 virus without a reduction in hemagglutinin titer. Interference was dependent on the concentration of DI virus. A particle ratio of 1 between DI virus (0.001 PFU/cell) and infectious virus (1.0 PFU/cell) produced a maximal amount of interference. Infectious virus yield was reduced 99.9% without any reduction of the yield of DI viruses Interference was also dependent on the time of addition of DI virus. Interference was most effective within the first 3 h of infection by infectious virus, indicating interference with an early function during viral replication. Images PMID:702654

Ingestion of genetically modified yeast symbiont reduces fitness of an insect pest via RNA interference

PubMed Central

Murphy, Katherine A.; Tabuloc, Christine A.; Cervantes, Kevin R.; Chiu, Joanna C.

2016-01-01

RNA interference has had major advances as a developing tool for pest management. In laboratory experiments, double-stranded RNA (dsRNA) is often administered to the insect by genetic modification of the crop, or synthesized in vitro and topically applied to the crop. Here, we engineered genetically modified yeast that express dsRNA targeting y-Tubulin in Drosophila suzukii. Our design takes advantage of the symbiotic interactions between Drosophila, yeast, and fruit crops. Yeast is naturally found growing on the surface of fruit crops, constitutes a major component of the Drosophila microbiome, and is highly attractive to Drosophila. Thus, this naturally attractive yeast biopesticide can deliver dsRNA to an insect pest without the need for genetic crop modification. We demonstrate that this biopesticide decreases larval survivorship, and reduces locomotor activity and reproductive fitness in adults, which are indicative of general health decline. To our knowledge, this is the first study to show that yeast can be used to deliver dsRNA to an insect pest. PMID:26931800

ABCE1 Is a Highly Conserved RNA Silencing Suppressor

PubMed Central

Kärblane, Kairi; Gerassimenko, Jelena; Nigul, Lenne; Piirsoo, Alla; Smialowska, Agata; Vinkel, Kadri; Kylsten, Per; Ekwall, Karl; Swoboda, Peter; Truve, Erkki; Sarmiento, Cecilia

2015-01-01

ATP-binding cassette sub-family E member 1 (ABCE1) is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference. PMID:25659154

RNAimmuno: A database of the nonspecific immunological effects of RNA interference and microRNA reagents

PubMed Central

Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J.

2012-01-01

The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies. PMID:22411954

RNAimmuno: a database of the nonspecific immunological effects of RNA interference and microRNA reagents.

PubMed

Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J

2012-05-01

The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies.

Design and cloning strategies for constructing shRNA expression vectors

PubMed Central

McIntyre, Glen J; Fanning, Gregory C

2006-01-01

Background Short hairpin RNA (shRNA) encoded within an expression vector has proven an effective means of harnessing the RNA interference (RNAi) pathway in mammalian cells. A survey of the literature revealed that shRNA vector construction can be hindered by high mutation rates and the ensuing sequencing is often problematic. Current options for constructing shRNA vectors include the use of annealed complementary oligonucleotides (74 % of surveyed studies), a PCR approach using hairpin containing primers (22 %) and primer extension of hairpin templates (4 %). Results We considered primer extension the most attractive method in terms of cost. However, in initial experiments we encountered a mutation frequency of 50 % compared to a reported 20 – 40 % for other strategies. By modifying the technique to be an isothermal reaction using the DNA polymerase Phi29, we reduced the error rate to 10 %, making primer extension the most efficient and cost-effective approach tested. We also found that inclusion of a restriction site in the loop could be exploited for confirming construct integrity by automated sequencing, while maintaining intended gene suppression. Conclusion In this study we detail simple improvements for constructing and sequencing shRNA that overcome current limitations. We also compare the advantages of our solutions against proposed alternatives. Our technical modifications will be of tangible benefit to researchers looking for a more efficient and reliable shRNA construction process. PMID:16396676

RNAi therapeutics and applications of microRNAs in cancer treatment.

PubMed

Uchino, Keita; Ochiya, Takahiro; Takeshita, Fumitaka

2013-06-01

RNA interference-based therapies are proving to be powerful tools for combating various diseases, including cancer. Scientists are researching the development of safe and efficient systems for the delivery of small RNA molecules, which are extremely fragile in serum, to target organs and cells in the human body. A dozen pre-clinical and clinical trials have been under way over the past few years involving biodegradable nanoparticles, lipids, chemical modification and conjugation. On the other hand, microRNAs, which control the balance of cellular biological processes, have been studied as attractive therapeutic targets in cancer treatment. In this review, we provide an overview of RNA interference-based therapeutics in clinical trials and discuss the latest technology for the systemic delivery of nucleic acid drugs. Furthermore, we focus on dysregulated microRNAs in human cancer, which have progressed in pre-clinical trials as therapeutic targets, and describe a wide range of strategies to control the expression levels of endogenous microRNAs. Further development of RNA interference technologies and progression of clinical trials will contribute to the achievement of practical applications of nucleic acid drugs.

Variation in vasopressin receptor Avpr1a) expression creates diversity in behaviors related to monogamy in prairie voles

PubMed Central

Barrett, Catherine E.; Keebaugh, Alaine C.; Ahern, Todd H.; Bass, Caroline E.; Terwilliger, Ernest F.; Young, Larry J.

2013-01-01

Polymorphisms in noncoding regions of the vasopressin 1a receptor gene (Avpr1a) are associated with a variety of socioemotional characteristics in humans, chimpanzees, and voles, and may impact behavior through site-specific variation in gene expression. The socially monogamous prairie vole offers a unique opportunity to study such neurobiological control of individual differences in complex behavior. Vasopressin 1a receptor (V1aR) signaling is necessary for the formation of the pair bond in males, and prairie voles exhibit greater V1aR binding in the reward-processing ventral pallidum than do asocial voles of the same genus. Diversity in social behavior within prairie voles has been correlated to natural variation in neuropeptide receptor expression in specific brain regions. Here we use RNA interference to examine the causal relationship between intraspecific variation in V1aR and behavioral outcomes, by approximating the degree of naturalistic variation in V1aR expression. Juvenile male prairie voles were injected with viral vectors expressing shRNA sequences targeting Avpr1a mRNA into the ventral pallidum. Down-regulation of pallidal V1aR density resulted in a significant impairment in the preference for a mated female partner and a reduction in anxiety-like behavior in adulthood. No effect on alloparenting was detected. These data demonstrate that within-species naturalistic-like variation in V1aR expression has a profound effect on individual differences in social attachment and emotionality. RNA interference may prove a useful technique to unite the fields of behavioral ecology and neurogenetics to perform ethologically relevant studies of the control of individual variation and offer insight into the evolutionary mechanisms leading to behavioral diversity. PMID:23370363

RNAi-mediated resistance to viruses in genetically engineered plants.

PubMed

Ibrahim, Abdulrazak B; Aragão, Francisco J L

2015-01-01

RNA interference (RNAi) has emerged as a leading technology in designing genetically modified crops engineered to resist viral infection. The last decades have seen the development of a large number of crops whose inherent posttranscriptional gene silencing mechanism has been exploited to target essential viral genes through the production of dsRNA that triggers an endogenous RNA-induced silencing complex (RISC), leading to gene silencing in susceptible viruses conferring them with resistance even before the onset of infection. Selection and breeding events have allowed for establishing this highly important agronomic trait in diverse crops. With improved techniques and the availability of new data on genetic diversity among several viruses, significant progress is being made in engineering plants using RNAi with the release of a number of commercially available crops. Biosafety concerns with respect to consumption of RNAi crops, while relevant, have been addressed, given the fact that experimental evidence using miRNAs associated with the crops shows that they do not pose any health risk to humans and animals.

Harnessing RNA interference to develop neonatal therapies: from Nobel Prize winning discovery to proof of concept clinical trials.

PubMed

DeVincenzo, John P

2009-10-01

A revolution in the understanding of RNA biological processing and control is leading to revolutionary new concepts in human therapeutics. It has become increasingly clear that the so called "non-coding RNA" exerts specific and profound functional control on regulation of protein production and indeed controls the expression of all genes. Harnessing this naturally-occurring RNA-mediated regulation of protein production has immense human therapeutic potential. These processes are collectively known as RNA interference (RNAi). RNAi is a recently discovered, naturally-occurring intracellular process that regulates gene expression through the silencing of specific mRNAs. Methods of harnessing this natural pathway are being developed that allow the catalytic degradation of targeted mRNAs using specifically designed complementary small inhibitory RNAs (siRNA). siRNAs are being chemically modified to acquire drug-like properties. Numerous recent high profile publications have provided proofs of concept that RNA interference may be useful therapeutically. Much of the design of these siRNAs can be accomplished bioinformatically, thus potentially expediting drug discovery and opening new avenues of therapy for many uncommon, orphan, or emerging diseases. This makes this approach very attractive for developing therapies targeting orphan diseases including neonatal diseases. Theoretically, any disease that can be ameliorated through knockdown of any endogenous or exogenous protein is a potential therapeutic target for RNAi-based therapeutics. Lung diseases are particularly attractive targets for RNAi therapeutics since the affected cells' location increases their accessibility to topical administration of siRNA, for example by aerosol. Respiratory viral infections and chronic lung disease are examples of such diseases. RNAi therapeutics have been shown to be active against RSV, parainfluenza and human metapneumoviruses in vitro and in vivo resulting in profound antiviral effects. The first proof of concept test of efficacy of an RNAi-based therapeutic in man has been initiated. A discussion of the science behind RNA interference is followed by a presentation of the potential practical issues in applying this technology to neonatal respiratory viral diseases. RNAi may offer new strategies for the treatment of a variety of orphan diseases including neonatal diseases, RSV infections, and other respiratory viruses.

Biochemical and Structural Studies of RNA Modification and Repair

ERIC Educational Resources Information Center

Chan, Chio Mui

2009-01-01

RNA modification, RNA interference, and RNA repair are important events in the cell. This thesis presents three projects related to these three fields. By using both biochemical and structural methods, we characterized enzymatic activities of pseudouridine synthase TruD, solved the structure of "A. aeolicus" GidA, and reconstituted a novel…

Defective RNA particles derived from Tomato black ring virus genome interfere with the replication of parental virus.

PubMed

Hasiów-Jaroszewska, Beata; Minicka, Julia; Zarzyńska-Nowak, Aleksandra; Budzyńska, Daria; Elena, Santiago F

2018-05-02

Tomato black ring virus (TBRV) is the only member of the Nepovirus genus that is known to form defective RNA particles (D RNAs) during replication. Here, de novo generation of D RNAs was observed during prolonged passages of TBRV isolates originated from Solanum lycopersicum and Lactuca sativa in Chenopodium quinoa plants. D RNAs of about 500 nt derived by a single deletion in the RNA1 molecule and contained a portion of the 5' untranslated region and viral replicase, and almost the entire 3' non-coding region. Short regions of sequence complementarity were found at the 5' and 3' junction borders, which can facilitate formation of the D RNAs. Moreover, in this study we analyzed the effects of D RNAs on TBRV replication and symptoms development of infected plants. C. quinoa, S. lycopersicum, Nicotiana tabacum, and L. sativa were infected with the original TBRV isolates (TBRV-D RNA) and those containing additional D RNA particles (TBRV + D RNA). The viral accumulation in particular hosts was measured up to 28 days post inoculation by RT-qPCR. Statistical analyses revealed that D RNAs interfere with TBRV replication and thus should be referred to as defective interfering particles. The magnitude of the interference effect depends on the interplay between TBRV isolate and host species. Copyright © 2018 Elsevier B.V. All rights reserved.

RNA Interference for improving the Outcome of Islet Transplantation

PubMed Central

Li, Feng; Mahato, Ram I

2010-01-01

Islet transplantation has the potential to cure type 1 diabetes. Despite recent therapeutic success, it is still not common because a large number of transpanted islets get damaged by multiple challenges including instant blood mediated inflammatory reaction, hypoxia/reperfusion injury, inflammatory cytokines, and immune rejection. RNA interference (RNAi) is an novel strategy to selectively degrade target mRNA. The use of RNAi technologies to downregulate the expression of harmful genes has the potential to improve the outcome of islet transplantation. The aim of this review is to gain a thorough understanding of biological obstacles to islet transplantation and discuss how to overcome these barriers using different RNAi technologies. This eventually will help improve islet survival and function post transplantaion. Chemically synthesized small interferring RNA (siRNA), vector based short haripin RNA (shRNA), and their critical design elements (such as sequences, promoters, backbone) are discussed. The application of combinatorial RNAi in islet transplantation is also discussed. Last but not the least, several delivery strategies for enhanced gene silencing are discussed, including chemical modification of siRNA, complex formation, bioconjugation, and viral vectors. PMID:21156190

Differentiating RNA from DNA by a molecular fluorescent probe based on the "door-bolt" mechanism biomaterials.

PubMed

Yao, Qichao; Li, Haidong; Xian, Liman; Xu, Feng; Xia, Jing; Fan, Jiangli; Du, Jianjun; Wang, Jingyun; Peng, Xiaojun

2018-09-01

Although excellent florescent probes have been developed for DNA, good probes for RNA remain lacking. The shortage of reported and commercial RNA probes is attributable to their severe interference from DNA. As DNA and RNA have similar structures but different functions, it has been an imperative challenge to develop RNA probes that differentiate from DNA. In this study, an NIR fluorescent probe, NBE, is described, which contains a bulky julolidine group that can fit in a spacious RNA pocket and emit intense fluorescence. However, NBE has no response to DNA, as it cannot intercalate into the double strands or even in the DNA minor groove. The sensing mechanism is similar to the effect of a door-bolt. NBE shows excellent performance in RNA sensing (outstanding photostability, high selectivity and fast response), whether in aqueous buffers, fixed cells or living cells. These findings might provide not only a potential imaging tool but also a new design strategy for the recognition of RNA while avoiding interference from DNA. Copyright © 2018 Elsevier Ltd. All rights reserved.

An RNA isolation system for plant tissues rich in secondary metabolites

PubMed Central

2011-01-01

Background Secondary metabolites are reported to interfere with the isolation of RNA particularly with the recipes that use guanidinium-based salt. Such interference was observed in isolation of RNA with medicinal plants rheum (Rheum australe) and arnebia (Arnebia euchroma). A rapid and less cumbersome system for isolation of RNA was essential to facilitate any study related to gene expression. Findings An RNA isolation system free of guanidinium salt was developed that successfully isolated RNA from rheum and arnebia. The method took about 45 min and was successfully evaluated on twenty one tissues with varied secondary metabolites. The A260/280 ratio ranged between 1.8 - 2.0 with distinct 28 S and 18 S rRNA bands visible on a formaldehyde-agarose gel. Conclusions The present manuscript describes a rapid protocol for isolation of RNA, which works well with all the tissues examined so far. The remarkable feature was the success in isolation of RNA with those tissues, wherein the most commonly used methods failed. Isolated RNA was amenable to downstream applications such as reverse transcription-polymerase chain reaction (RT-PCR), differential display (DD), suppression subtractive hybridization (SSH) library construction, and northern hybridization. PMID:21443767

Interference Mitigation Effects on Synthetic Aperture Radar Coherent Data Products

DOE Office of Scientific and Technical Information (OSTI.GOV)

Musgrove, Cameron

For synthetic aperture radars radio frequency interference from sources external to the radar system and techniques to mitigate the interference can degrade the quality of the image products. Usually the radar system designer will try to balance the amount of mitigation for an acceptable amount of interference to optimize the image quality. This dissertation examines the effect of interference mitigation upon coherent data products of fine resolution, high frequency synthetic aperture radars using stretch processing. Novel interference mitigation techniques are introduced that operate on single or multiple apertures of data that increase average coherence compared to existing techniques. New metricsmore » are applied to evaluate multiple mitigation techniques for image quality and average coherence. The underlying mechanism for interference mitigation techniques that affect coherence is revealed.« less

Ribonucleic acid interference knockdown of interleukin 6 attenuates cold-induced hypertension.

PubMed

Crosswhite, Patrick; Sun, Zhongjie

2010-06-01

The purpose of this study was to determine the role of the proinflammatory cytokine interleukin (IL) 6 in cold-induced hypertension. Four groups of male Sprague-Dawley rats were used (6 rats per group). After blood pressure was stabilized, 3 groups received intravenous delivery of adenoassociated virus carrying IL-6 small hairpin RNA (shRNA), adenoassociated virus carrying scrambled shRNA, and PBS, respectively, before exposure to a cold environment (5 degrees C). The last group received PBS and was kept at room temperature (25 degrees C, warm) as a control. Adenoassociated virus delivery of IL-6 shRNA significantly attenuated cold-induced elevation of systolic blood pressure and kept it at the control level for < or =7 weeks (length of the study). Chronic exposure to cold upregulated IL-6 expression in aorta, heart, and kidneys and increased macrophage and T-cell infiltration in kidneys, suggesting that cold exposure increases inflammation. IL-6 shRNA delivery abolished the cold-induced upregulation of IL-6, indicating effective silence of IL-6. Interestingly, RNA interference knockdown of IL-6 prevented cold-induced inflammation, as evidenced by a complete inhibition of tumor necrosis factor-alpha expression and leukocyte infiltration by IL-6 shRNA. RNA interference knockdown of IL-6 significantly decreased the cold-induced increase in vascular superoxide production. It is noted that IL-6 shRNA abolished the cold-induced increase in collagen deposition in the heart, suggesting that inflammation is involved in cold-induced cardiac remodeling. Cold exposure caused glomerular collapses, which could be prevented by knockdown of IL-6, suggesting an important role of inflammation in cold-induced renal damage. In conclusion, cold exposure increased IL-6 expression and inflammation, which play critical roles in the pathogenesis of cold-induced hypertension and cardiac and renal damage.

Global effects of the CSR-1 RNA interference pathway on the transcriptional landscape.

PubMed

Cecere, Germano; Hoersch, Sebastian; O'Keeffe, Sean; Sachidanandam, Ravi; Grishok, Alla

2014-04-01

Argonaute proteins and their small RNA cofactors short interfering RNAs are known to inhibit gene expression at the transcriptional and post-transcriptional levels. In Caenorhabditis elegans, the Argonaute CSR-1 binds thousands of endogenous siRNAs (endo-siRNAs) that are antisense to germline transcripts. However, its role in gene expression regulation remains controversial. Here we used genome-wide profiling of nascent RNA transcripts and found that the CSR-1 RNA interference pathway promoted sense-oriented RNA polymerase II transcription. Moreover, a loss of CSR-1 function resulted in global increase in antisense transcription and ectopic transcription of silent chromatin domains, which led to reduced chromatin incorporation of centromere-specific histone H3. On the basis of these findings, we propose that the CSR-1 pathway helps maintain the directionality of active transcription, thereby propagating the distinction between transcriptionally active and silent genomic regions.

New Genetics

MedlinePlus

... Century-Old Evolutionary Puzzle Computing Genetics Model Organisms RNA Interference The New Genetics is a science education ... the basics of DNA and its molecular cousin RNA, and new directions in genetic research. The New ...

Fluorescence-based high-throughput screening of dicer cleavage activity.

PubMed

Podolska, Katerina; Sedlak, David; Bartunek, Petr; Svoboda, Petr

2014-03-01

Production of small RNAs by ribonuclease III Dicer is a key step in microRNA and RNA interference pathways, which employ Dicer-produced small RNAs as sequence-specific silencing guides. Further studies and manipulations of microRNA and RNA interference pathways would benefit from identification of small-molecule modulators. Here, we report a study of a fluorescence-based in vitro Dicer cleavage assay, which was adapted for high-throughput screening. The kinetic assay can be performed under single-turnover conditions (35 nM substrate and 70 nM Dicer) in a small volume (5 µL), which makes it suitable for high-throughput screening in a 1536-well format. As a proof of principle, a small library of bioactive compounds was analyzed, demonstrating potential of the assay.

Chemical Ligation Reactions of Oligonucleotides for Biological and Medicinal Applications.

PubMed

Abe, Hiroshi; Kimura, Yasuaki

2018-01-01

Chemical ligation of oligonucleotides (ONs) is the key reaction for various ON-based technologies. We have tried to solve the problems of RNA interference (RNAi) technology by applying ON chemical ligation to RNAi. We designed a new RNAi system, called intracellular buildup RNAi (IBR-RNAi), where the RNA fragments are built up into active small-interference RNA (siRNA) in cells through a chemical ligation reaction. Using the phosphorothioate and iodoacetyl groups as reactive functional groups for the ligation, we achieved RNAi effects without inducing immune responses. Additionally, we developed a new chemical ligation for IBR-RNAi, which affords a more native-like structure in the ligated product. The new ligation method should be useful not only for IBR-RNAi but also for the chemical synthesis of biofunctional ONs.

Secondary RNA structure and its role in RNA interference to silence the respiratory syncytial virus fusion protein gene.

PubMed

Vig, Komal; Lewis, Nuruddeen; Moore, Eddie G; Pillai, Shreekumar; Dennis, Vida A; Singh, Shree R

2009-11-01

RNA interference (RNAi) is a post-transcriptional, gene silencing mechanism which uses small interfering RNA molecules (siRNA) for gene silencing. Respiratory Syncytial Virus (RSV) is an important respiratory pathogen of medical significance that causes high mortality in infants. The fusion (F) protein of RSV is a good target for therapeutic purposes as it is primarily responsible for penetration of the virus into host cells and subsequent syncytium formation during infection. In the present study, four siRNAs were designed and used individually as well as a mixture, to silence the RSV F gene. The relationship between siRNA design, target RNA structure, and their thermodynamics was also investigated. Silencing of F gene was observed using indirect immunofluorescence, western blot, reverse transcription PCR, and progeny viral titers. Our results show F gene silencing by all the four siRNAs individually and collectively. RT-PCR analysis revealed a decrease in mRNA level which corresponded to decreased F protein expression. siRNAs also inhibited RSV progeny as shown by viral titer estimation on infected HEp-2 cells. The present study demonstrates the silencing of the F gene using siRNA. Thermodynamic characteristics of the target RSV mRNA and siRNA seem to play an important role in siRNA gene silencing efficiency.

Functional analysis of two polygalacturonase genes in Apolygus lucorum associated with eliciting plant injury using RNA interference.

PubMed

Zhang, Wanna; Liu, Bing; Lu, Yanhui; Liang, Gemei

2017-04-01

Salivary enzymes of many piercing-sucking insects lead to host plant injury. The salivary enzymes, polygalacturonase (PGs), act in insect feeding. PG family genes have been cloned from the mirid bug Apolygus lucorum, a pest of cotton and other host crops in China. We investigated the function of two PG genes that are highly expressed in A. lucorum nymphs (PG3-4) and adults (PG3-5), using siRNA injection-based RNA interference (RNAi). Accumulation of mRNA encoding both genes and their cognate proteins was significantly reduced (>60%) in experimental compared control green fluorescent protein (GFP) siRNA-treated mirids at 48 h post injection. Injury levels of cotton buds were also significantly reduced after injecting saliva isolated from PG3-4 and PG3-5 siRNA-treated A. lucorum. These results demonstrate that these two PG act in A. lucorum elicitation of plant injury. © 2017 Wiley Periodicals, Inc.

Crystal structure of the Csm3-Csm4 subcomplex in the type III-A CRISPR-Cas interference complex.

PubMed

Numata, Tomoyuki; Inanaga, Hideko; Sato, Chikara; Osawa, Takuo

2015-01-30

Clustered, regularly interspaced, short palindromic repeat (CRISPR) loci play a pivotal role in the prokaryotic host defense system against invading genetic materials. The CRISPR loci are transcribed to produce CRISPR RNAs (crRNAs), which form interference complexes with CRISPR-associated (Cas) proteins to target the invading nucleic acid for degradation. The interference complex of the type III-A CRISPR-Cas system is composed of five Cas proteins (Csm1-Csm5) and a crRNA, and targets invading DNA. Here, we show that the Csm1, Csm3, and Csm4 proteins from Methanocaldococcus jannaschii form a stable subcomplex. We also report the crystal structure of the M. jannaschii Csm3-Csm4 subcomplex at 3.1Å resolution. The complex structure revealed the presence of a basic concave surface around their interface, suggesting the RNA and/or DNA binding ability of the complex. A gel retardation analysis showed that the Csm3-Csm4 complex binds single-stranded RNA in a non-sequence-specific manner. Csm4 structurally resembles Cmr3, a component of the type III-B CRISPR-Cas interference complex. Based on bioinformatics, we constructed a model structure of the Csm1-Csm4-Csm3 ternary complex, which provides insights into its role in the Csm interference complex. Copyright © 2014 Elsevier Ltd. All rights reserved.

RNA interference in the clinic: challenges and future directions

PubMed Central

Pecot, Chad V.; Calin, George A.; Coleman, Robert L.; Lopez-Berestein, Gabriel; Sood, Anil K.

2011-01-01

Inherent difficulties with blocking many desirable targets using conventional approaches have prompted many to consider using RNA interference (RNAi) as a therapeutic approach. Although exploitation of RNAi has immense potential as a cancer therapeutic, many physiological obstacles stand in the way of successful and efficient delivery. This Review explores current challenges to the development of synthetic RNAi-based therapies and considers new approaches to circumvent biological barriers, to avoid intolerable side effects and to achieve controlled and sustained release. PMID:21160526

Systemic delivery of siRNA with cationic lipid assisted PEG-PLA nanoparticles for cancer therapy.

PubMed

Yang, Xian-Zhu; Dou, Shuang; Sun, Tian-Meng; Mao, Cheng-Qiong; Wang, Hong-Xia; Wang, Jun

2011-12-10

Delivery of small interfering RNA (siRNA) has been one of the major hurdles for the application of RNA interference in therapeutics. Here, we describe a cationic lipid assisted polymeric nanoparticle system with stealthy property for efficient siRNA encapsulation and delivery, which was fabricated with poly(ethylene glycol)-b-poly(d,l-lactide), siRNA and a cationic lipid, using a double emulsion-solvent evaporation technique. By incorporation of the cationic lipid, the encapsulation efficiency of siRNA into the nanoparticles could be above 90% and the siRNA loading weight ratio was up to 4.47%, while the diameter of the nanoparticles was around 170 to 200nm. The siRNA retained its integrity within the nanoparticles, which were effectively internalized by cancer cells and escaped from the endosome, resulting in significant gene knockdown. This effect was demonstrated by significant down-regulation of luciferase expression in HepG2-luciferase cells which stably express luciferase, and suppression of polo-like kinase 1 (Plk1) expression in HepG2 cells, following delivery of specific siRNAs by the nanoparticles. Furthermore, the nanoparticles carrying siRNA targeting the Plk1 gene were found to induce remarkable apoptosis in both HepG2 and MDA-MB-435s cancer cells. Systemic delivery of specific siRNA by nanoparticles significantly inhibited luciferase expression in an orthotopic murine liver cancer model and suppressed tumor growth in a MDA-MB-435s murine xenograft model, suggesting its therapeutic promise in disease treatment. Copyright © 2011 Elsevier B.V. All rights reserved.

Designing highly active siRNAs for therapeutic applications.

PubMed

Walton, S Patrick; Wu, Ming; Gredell, Joseph A; Chan, Christina

2010-12-01

The discovery of RNA interference (RNAi) generated considerable interest in developing short interfering RNAs (siRNAs) for understanding basic biology and as the active agents in a new variety of therapeutics. Early studies showed that selecting an active siRNA was not as straightforward as simply picking a sequence on the target mRNA and synthesizing the siRNA complementary to that sequence. As interest in applying RNAi has increased, the methods for identifying active siRNA sequences have evolved from focusing on the simplicity of synthesis and purification, to identifying preferred target sequences and secondary structures, to predicting the thermodynamic stability of the siRNA. As more specific details of the RNAi mechanism have been defined, these have been incorporated into more complex siRNA selection algorithms, increasing the reliability of selecting active siRNAs against a single target. Ultimately, design of the best siRNA therapeutics will require design of the siRNA itself, in addition to design of the vehicle and other components necessary for it to function in vivo. In this minireview, we summarize the evolution of siRNA selection techniques with a particular focus on one issue of current importance to the field, how best to identify those siRNA sequences likely to have high activity. Approaches to designing active siRNAs through chemical and structural modifications will also be highlighted. As the understanding of how to control the activity and specificity of siRNAs improves, the potential utility of siRNAs as human therapeutics will concomitantly grow. © 2010 The Authors Journal compilation © 2010 FEBS.

Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference

PubMed Central

Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu

2015-01-01

RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells. PMID:25731667

Evaluation and control of miRNA-like off-target repression for RNA interference.

PubMed

Seok, Heeyoung; Lee, Haejeong; Jang, Eun-Sook; Chi, Sung Wook

2018-03-01

RNA interference (RNAi) has been widely adopted to repress specific gene expression and is easily achieved by designing small interfering RNAs (siRNAs) with perfect sequence complementarity to the intended target mRNAs. Although siRNAs direct Argonaute (Ago), a core component of the RNA-induced silencing complex (RISC), to recognize and silence target mRNAs, they also inevitably function as microRNAs (miRNAs) and suppress hundreds of off-targets. Such miRNA-like off-target repression is potentially detrimental, resulting in unwanted toxicity and phenotypes. Despite early recognition of the severity of miRNA-like off-target repression, this effect has often been overlooked because of difficulties in recognizing and avoiding off-targets. However, recent advances in genome-wide methods and knowledge of Ago-miRNA target interactions have set the stage for properly evaluating and controlling miRNA-like off-target repression. Here, we describe the intrinsic problems of miRNA-like off-target effects caused by canonical and noncanonical interactions. We particularly focus on various genome-wide approaches and chemical modifications for the evaluation and prevention of off-target repression to facilitate the use of RNAi with secured specificity.

Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference.

PubMed

Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu

2015-03-03

RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells.

NMR studies of two spliced leader RNAs using isotope labeling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lapham, J.; Crothers, D.M.

1994-12-01

Spliced leader RNAs are a class of RNA molecules (<200 nts) involved in the trans splicing of messenger RNA found in trypanosomes, nematodes, and other lower eukaryotes. The spliced leader RNA from the trypanosome Leptomonas Collosoma exists in two alternate structural forms with similar thermal stabilities. The 54 nucleotides on the 5{prime} end of the SL molecule is structurally independent from the 3{prime} half of the RNA, and displays the two structural forms. Furthermore, the favored of the two structures was shown to contain anomalous nuclease sensitivity and thermal stability features, which suggests that there may be tertiary interactions betweenmore » the splice site and other nucleotides in the 5{prime} end. Multidimensional NMR studies are underway to elucidate the structural elements present in the SL RNAs that give rise to their physical properties. Two spliced leader sequences have been studied. The first, the 54 nucleotides on the 5{prime} end of the L. Collosoma sequence, was selected because of earlier studies in our laboratory. The second sequence is the 5{prime} end of the trypanosome Crithidia Fasciculata, which was chosen because of its greater sequence homology to other SL sequences. Given the complexity of the NMR spectra for RNA molecules of this size, we have incorporated {sup 15}N/{sup 13}C-labeled nucleotides into the RNA. One of the techniques we have developed to simplify the spectra of these RNA molecules is isotope labeling of specific regions of the RNA. This has been especially helpful in assigning the secondary structure of molecules that may be able to adopt multiple conformations. Using this technique one can examine a part of the molecule without spectral interference from the unlabeled portion. We hope this approach will promote an avenue for studying the structure of larger RNAs in their native surroundings.« less

Engineering functional inorganic-organic hybrid systems: advances in siRNA therapeutics.

PubMed

Shen, Jianliang; Zhang, Wei; Qi, Ruogu; Mao, Zong-Wan; Shen, Haifa

2018-03-21

Cancer treatment still faces a lot of obstacles such as tumor heterogeneity, drug resistance and systemic toxicities. Beyond the traditional treatment modalities, exploitation of RNA interference (RNAi) as an emerging approach has immense potential for the treatment of various gene-caused diseases including cancer. The last decade has witnessed enormous research and achievements focused on RNAi biotechnology. However, delivery of small interference RNA (siRNA) remains a key challenge in the development of clinical RNAi therapeutics. Indeed, functional nanomaterials play an important role in siRNA delivery, which could overcome a wide range of sequential physiological and biological obstacles. Nanomaterial-formulated siRNA systems have potential applications in protection of siRNA from degradation, improving the accumulation in the target tissues, enhancing the siRNA therapy and reducing the side effects. In this review, we explore and summarize the role of functional inorganic-organic hybrid systems involved in the siRNA therapeutic advancements. Additionally, we gather the surface engineering strategies of hybrid systems to optimize for siRNA delivery. Major progress in the field of inorganic-organic hybrid platforms including metallic/non-metallic cores modified with organic shells or further fabrication as the vectors for siRNA delivery is discussed to give credit to the interdisciplinary cooperation between chemistry, pharmacy, biology and medicine.

Parameters on plant absortion of double-stranded Ribonucleic acid, dsRNA

USDA-ARS?s Scientific Manuscript database

Efficient absorption of double-stranded Ribonucleic acid, dsRNA, into citrus is critical for effective psyllid management by RNA interference, RNAi. Parameters which might affect absorption into citrus trees and subsequent ingestion by Asian citrus psyllid were evaluated. Age of leaves, variety of c...

Identification of phosphates involved in catalysis by the ribozyme RNase P RNA.

PubMed Central

Harris, M E; Pace, N R

1995-01-01

The RNA subunit of ribonuclease P (RNase P RNA) is a catalytic RNA that cleaves precursor tRNAs to generate mature tRNA 5' ends. Little is known concerning the identity and arrangement of functional groups that constitute the active site of this ribozyme. We have used an RNase P RNA-substrate conjugate that undergoes rapid, accurate, and efficient self-cleavage in vitro to probe, by phosphorothioate modification-interference, functional groups required for catalysis. We identify four phosphate oxygens where substitution by sulfur significantly reduces the catalytic rate (50-200-fold). Interference at one site was partially rescued in the presence of manganese, suggesting a direct involvement in binding divalent metal ion cofactors required for catalysis. All sites are located in conserved sequence and secondary structure, and positioned adjacent to the substrate phosphate in a tertiary structure model of the ribozyme-substrate complex. The spatial arrangement of phosphorothioate-sensitive sites in RNase P RNA was found to resemble the distribution of analogous positions in the secondary and potential tertiary structures of other large catalytic RNAs. PMID:7585250

Molecular mechanisms influencing efficiency of RNA interference in insects.

PubMed

Cooper, Anastasia M W; Silver, Kristopher; Jianzhen, Zhang; Park, Yoonseong; Zhu, Kun Yan

2018-06-21

RNA interference (RNAi) is an endogenous, sequence-specific gene silencing mechanism elicited by small RNA molecules. RNAi is a powerful reverse genetic tool, and is currently being utilized for managing insects and viruses. Widespread implementation of RNAi-based pest management strategies is currently hindered by inefficient and highly variable results when different insect species, strains, developmental stages, tissues, and genes are targeted. Mechanistic studies have shown that double-stranded ribonucleases (dsRNases), endosomal entrapment, deficient function of the core machinery, and inadequate immune stimulation contribute to limited RNAi efficiency. However, a comprehensive understanding of the molecular mechanisms limiting RNAi efficiency remains elusive. The recent advances in dsRNA stability in physiological tissues, dsRNA internalization into cells, the composition and function of the core RNAi machinery, as well as small-interfering RNA/double-stranded RNA amplification and spreading mechanisms are reviewed to establish a global understanding of the obstacles impeding wider understanding of RNAi mechanisms in insects. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

[Impact of Pax-8 gene interference on mitochondrial function and cardiomyocyte apoptosis].

PubMed

Dai, Xiao-chun; Zhou, Xi; Huang, Xiao-yan; Wang, Liang-guo; Lin, Su; Yang, De-ye

2013-01-01

To observe the effects of paired box gene 8 (Pax-8) silencing by RNA interference on mitochondrial function and cardiomyocytes apoptosis. The cultured H9C2 (2-1) myocytes were divided into 3 groups: short interference RNA targeting Pax-8 (Pax-8 siRNA) group, non-specific siRNA group as the negative control (NC siRNA), and blank control group (BC siRNA). Fluorescence spectrophotometry was used to detect the activity of caspase-3. RT-PCR was performed to detect mRNA expression of Bcl2 and Bax. The protein expression of Bcl2, Bax and cytoplasm of Cytochrome was examined by Western blot. Changes of ΔΨm were detected by flow cytometry.ΔΨm with JC-1 monomer/polymer ratio was calculated for measuring mitochondrial depolarization proportion. Compared to NC siRNA and BC siRNA group (0.075 ± 0.021, 0.072 ± 0.019), the activity of caspase-3 in Pax-8 siRNA group (0.167 ± 0.012) was significantly increased (P < 0.05); Bcl2 mRNA and protein expression in Pax-8 siRNA group (0.61 ± 0.06, 0.94 ± 0.11) were significantly downregulated compared with NC siRNA group (0.90 ± 0.070, 1.39 ± 0.15) and BC siRNA group (0.94 ± 0.087, 1.49 ± 0.20) (P < 0.05); Bax mRNA and protein expression in Pax-8 siRNA group (1.05 ± 0.10, 1.25 ± 0.12) were markedly upregulated compared with NC siRNA group (0.72 ± 0.03, 0.99 ± 0.12) and BC siRNA group (0.64 ± 0.03, 0.92 ± 0.06), P < 0.05; cytosolic cytochrome expression in Pax-8 siRNA group (0.75 ± 0.14) was significantly upregulated compared with NC siRNA group (0.51 ± 0.06) and BC siRNA group (0.48 ± 0.07) (P < 0.05); JC-1 monomer/polymer ratio in Pax-8 siRNA group (0.163 ± 0.011) was significantly increased compared with NC siRNA group (0.092 ± 0.015) and BC siRNA group (0.072 ± 0.025) (P < 0.05) indicating mitochondrial membrane potential was significantly reduced in Pax-8 siRNA group. Above parameters were similar between NC siRNA group and BC siRNA group (P > 0.05). Inhibiting Pax-8 results in enhanced cardiomyocytes apoptosis through the mitochondrial pathway.

Genetics Home Reference: myotonic dystrophy

MedlinePlus

... mutated gene produces an expanded version of messenger RNA , which is a molecular blueprint of the gene ... the production of proteins. The abnormally long messenger RNA forms clumps inside the cell that interfere with ...

Different effects of enhanced and reduced expression of pub gene on the formation of embryoid bodies by cultured embryonic mouse stem cell.

PubMed

Novosadova, E V; Manuilova, E S; Arsen'eva, E L; Khaidarova, N V; Dolotov, O V; Inozemtseva, L S; Kozachenkov, K Yu; Tarantul, V Z; Grivennikov, I A

2005-07-01

The effects of pub gene on proliferation and initial stages of differentiation of embryonic mouse stem cells were studied in vitro. To this end we used enhanced expression of human pub gene (hpub) and suppression of expression of mouse endogenous pub gene with RNA-interference in embryonic stem cells. Proliferative activity of genetically modified polyclonal lines of the embryonic stem cells transfected with plasmids carrying expressing hpub gene or plasmids generating small interference RNA to this gene did not differ from that of the control cells. Inhibition of expression of endogenous pub gene in embryonic stem cells using small interference RNA 2-fold decreased the formation of embryoid bodies, at the same time additional expression of exogenous hpub gene almost 2-fold increased their number in comparison with the control. It was hypothesized that pub gene participates in early stages of differentiation of embryonic stem cells leading to the formation of embryoid bodies.

Enhanced susceptibility of cancer cells to oncolytic rhabdo-virotherapy by expression of Nodamura virus protein B2 as a suppressor of RNA interference.

PubMed

Bastin, Donald; Aitken, Amelia S; Pelin, Adrian; Pikor, Larissa A; Crupi, Mathieu J F; Huh, Michael S; Bourgeois-Daigneault, Marie-Claude; Bell, John C; Ilkow, Carolina S

2018-06-19

Antiviral responses are barriers that must be overcome for efficacy of oncolytic virotherapy. In mammalian cells, antiviral responses involve the interferon pathway, a protein-signaling cascade that alerts the immune system and limits virus propagation. Tumour-specific defects in interferon signaling enhance viral infection and responses to oncolytic virotherapy, but many human cancers are still refractory to oncolytic viruses. Given that invertebrates, fungi and plants rely on RNA interference pathways for antiviral protection, we investigated the potential involvement of this alternative antiviral mechanism in cancer cells. Here, we detected viral genome-derived small RNAs, indicative of RNAi-mediated antiviral responses, in human cancer cells. As viruses may encode suppressors of the RNA interference pathways, we engineered an oncolytic vesicular stomatitis virus variant to encode the Nodamura virus protein B2, a known inhibitor of RNAi-mediated immune responses. B2-expressing oncolytic virus showed enhanced viral replication and cytotoxicity, impaired viral genome cleavage and altered microRNA processing in cancer cells. Our data establish the improved therapeutic potential of our novel virus which targets the RNAi-mediated antiviral defense of cancer cells.

Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association.

PubMed

Pulk, Arto; Maiväli, Ulo; Remme, Jaanus

2006-05-01

The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts.

Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association

PubMed Central

Pulk, Arto; Maiväli, Ülo; Remme, Jaanus

2006-01-01

The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts. PMID:16556933

Delivery of RNAi reagents in murine models of obesity and diabetes.

PubMed

Wilcox, Denise M; Yang, Ruojing; Morgan, Sherry J; Nguyen, Phong T; Voorbach, Martin J; Jung, Paul M; Haasch, Deanna L; Lin, Emily; Bush, Eugene N; Opgenorth, Terry J; Jacobson, Peer B; Collins, Christine A; Rondinone, Cristina M; Surowy, Terry; Landschulz, Katherine T

2006-11-29

RNA interference (RNAi) is an exciting new tool to effect acute in vivo knockdown of genes for pharmacological target validation. Testing the application of this technology to metabolic disease targets, three RNAi delivery methods were compared in two frequently utilized preclinical models of obesity and diabetes, the diet-induced obese (DIO) and B6.V-Lep/J (ob/ob) mouse. Intraperitoneal (i.p.) and high pressure hydrodynamic intravenous (i.v.) administration of naked siRNA, and low pressure i.v. administration of shRNA-expressing adenovirus were assessed for both safety and gene knockdown efficacy using constructs targeting cJun N-terminal kinase 1 (JNK1). Hydrodynamic delivery of siRNA lowered liver JNK1 protein levels 40% in DIO mice, but was accompanied by iatrogenic liver damage. The ob/ob model proved even more intolerant of this technique, with hydrodynamic delivery resulting in severe liver damage and death of most animals. While well-tolerated, i.p. injections of siRNA in DIO mice did not result in any knockdown or phenotypic changes in the mice. On the other hand, i.v. injected adenovirus expressing shRNA potently reduced expression of JNK1 in vivo by 95% without liver toxicity. In conclusion, i.p. and hydrodynamic injections of siRNA were ineffective and/or inappropriate for in vivo gene targeting in DIO and ob/ob mice, while adenovirus-mediated delivery of shRNA provided a relatively benign and effective method for exploring liver target silencing.

Non-coding RNAs in crop genetic modification: considerations and predictable environmental risk assessments (ERA).

PubMed

Ramesh, S V

2013-09-01

Of late non-coding RNAs (ncRNAs)-mediated gene silencing is an influential tool deliberately deployed to negatively regulate the expression of targeted genes. In addition to the widely employed small interfering RNA (siRNA)-mediated gene silencing approach, other variants like artificial miRNA (amiRNA), miRNA mimics, and artificial transacting siRNAs (tasiRNAs) are being explored and successfully deployed in developing non-coding RNA-based genetically modified plants. The ncRNA-based gene manipulations are typified with mobile nature of silencing signals, interference from viral genome-derived suppressor proteins, and an obligation for meticulous computational analysis to prevaricate any inadvertent effects. In a broad sense, risk assessment inquiries for genetically modified plants based on the expression of ncRNAs are competently addressed by the environmental risk assessment (ERA) models, currently in vogue, designed for the first generation transgenic plants which are based on the expression of heterologous proteins. Nevertheless, transgenic plants functioning on the foundation of ncRNAs warrant due attention with respect to their unique attributes like off-target or non-target gene silencing effects, small RNAs (sRNAs) persistence, food and feed safety assessments, problems in detection and tracking of sRNAs in food, impact of ncRNAs in plant protection measures, effect of mutations etc. The role of recent developments in sequencing techniques like next generation sequencing (NGS) and the ERA paradigm of the different countries in vogue are also discussed in the context of ncRNA-based gene manipulations.

Convergent transcription in the butyrolactone regulon in Streptomyces coelicolor confers a bistable genetic switch for antibiotic biosynthesis.

PubMed

Chatterjee, Anushree; Drews, Laurie; Mehra, Sarika; Takano, Eriko; Kaznessis, Yiannis N; Hu, Wei-Shou

2011-01-01

cis-encoded antisense RNAs (cis asRNA) have been reported to participate in gene expression regulation in both eukaryotic and prokaryotic organisms. Its presence in Streptomyces coelicolor has also been reported recently; however, its role has yet to be fully investigated. Using mathematical modeling we explore the role of cis asRNA produced as a result of convergent transcription in scbA-scbR genetic switch. scbA and scbR gene pair, encoding repressor-amplifier proteins respectively, mediates the synthesis of a signaling molecule, the γ-butyrolactone SCB1 and controls the onset of antibiotic production. Our model considers that transcriptional interference caused by convergent transcription of two opposing RNA polymerases results in fatal collision and transcriptional termination, which suppresses transcription efficiency. Additionally, convergent transcription causes sense and antisense interactions between complementary sequences from opposing strands, rendering the full length transcript inaccessible for translation. We evaluated the role of transcriptional interference and the antisense effect conferred by convergent transcription on the behavior of scbA-scbR system. Stability analysis showed that while transcriptional interference affects the system, it is asRNA that confers scbA-scbR system the characteristics of a bistable switch in response to the signaling molecule SCB1. With its critical role of regulating the onset of antibiotic synthesis the bistable behavior offers this two gene system the needed robustness to be a genetic switch. The convergent two gene system with potential of transcriptional interference is a frequent feature in various genomes. The possibility of asRNA regulation in other such gene-pairs is yet to be examined.

Interference of hepatitis C virus RNA replication by short interfering RNAs

NASA Astrophysics Data System (ADS)

Kapadia, Sharookh B.; Brideau-Andersen, Amy; Chisari, Francis V.

2003-02-01

Hepatitis C virus (HCV) infection is a major cause of chronic liver disease, which can lead to the development of liver cirrhosis and hepatocellular carcinoma. Current therapy of patients with chronic HCV infection includes treatment with IFN in combination with ribavirin. Because most treated patients do not resolve the infection, alternative treatment is essential. RNA interference (RNAi) is a recently discovered antiviral mechanism present in plants and animals that induces double-stranded RNA degradation. Using a selectable subgenomic HCV replicon cell culture system, we have shown that RNAi can specifically inhibit HCV RNA replication and protein expression in Huh-7 cells that stably replicate the HCV genome, and that this antiviral effect is independent of IFN. These results suggest that RNAi may represent a new approach for the treatment of persistent HCV infection.

PAMP-induced defense responses in potato require both salicylic acid and jasmonic acid.

PubMed

Halim, Vincentius A; Altmann, Simone; Ellinger, Dorothea; Eschen-Lippold, Lennart; Miersch, Otto; Scheel, Dierk; Rosahl, Sabine

2009-01-01

To elucidate the molecular mechanisms underlying pathogen-associated molecular pattern (PAMP)-induced defense responses in potato (Solanum tuberosum), the role of the signaling compounds salicylic acid (SA) and jasmonic acid (JA) was analyzed. Pep-13, a PAMP from Phytophthora, induces the accumulation of SA, JA and hydrogen peroxide, as well as the activation of defense genes and hypersensitive-like cell death. We have previously shown that SA is required for Pep-13-induced defense responses. To assess the importance of JA, RNA interference constructs targeted at the JA biosynthetic genes, allene oxide cyclase and 12-oxophytodienoic acid reductase, were expressed in transgenic potato plants. In addition, expression of the F-box protein COI1 was reduced by RNA interference. Plants expressing the RNA interference constructs failed to accumulate the respective transcripts in response to wounding or Pep-13 treatment, neither did they contain significant amounts of JA after elicitation. In response to infiltration of Pep-13, the transgenic plants exhibited a highly reduced accumulation of reactive oxygen species as well as reduced hypersensitive cell death. The ability of the JA-deficient plants to accumulate SA suggests that SA accumulation is independent or upstream of JA accumulation. These data show that PAMP responses in potato require both SA and JA and that, in contrast to Arabidopsis, these compounds act in the same signal transduction pathway. Despite their inability to fully respond to PAMP treatment, the transgenic RNA interference plants are not altered in their basal defense against Phytophthora infestans.

Ebolavirus proteins suppress the effects of small interfering RNA by direct interaction with the mammalian RNA interference pathway.

PubMed

Fabozzi, Giulia; Nabel, Christopher S; Dolan, Michael A; Sullivan, Nancy J

2011-03-01

Cellular RNA interference (RNAi) provides a natural response against viral infection, but some viruses have evolved mechanisms to antagonize this form of antiviral immunity. To determine whether Ebolavirus (EBOV) counters RNAi by encoding suppressors of RNA silencing (SRSs), we screened all EBOV proteins using an RNAi assay initiated by exogenously delivered small interfering RNAs (siRNAs) against either an EBOV or a reporter gene. In addition to viral protein 35 (VP35), we found that VP30 and VP40 independently act as SRSs. Here, we present the molecular mechanisms of VP30 and VP35. VP30 interacts with Dicer independently of siRNA and with one Dicer partner, TRBP, only in the presence of siRNA. VP35 directly interacts with Dicer partners TRBP and PACT in an siRNA-independent fashion and in the absence of effects on interferon (IFN). Taken together, our findings elucidate a new mechanism of RNAi suppression that extends beyond the role of SRSs in double-stranded RNA (dsRNA) binding and IFN antagonism. The presence of three suppressors highlights the relevance of host RNAi-dependent antiviral immunity in EBOV infection and illustrates the importance of RNAi in shaping the evolution of RNA viruses.

RNA interference (RNAI) as a tool to engineer high nutritional value in chicory (Chicorium intybus).

PubMed

Asad, M

2006-01-01

The major component of chicory (Chicorium intybus) root is inulin, which is a polymer of fructose. Inulin production from chicory is hampered by the enzyme fructan 1-exohydrolase (1-FEH) that degrades inulin and limits its yield. Increased FEH activity results in massive breakdown of fructan and production of Fructose and inulo-n-oses. The latter phenomena are to be avoided for industrial fructan production. RNA silencing, which is termed post-transcriptional gene silencing (PTGS) in plants, is an RNA degradation process through sequence specific nucleotide interactions induced by double-stranded RNA. For genetic improvement of crop plants, RNAi has advantages over antisense-mediated gene silencing and co-suppression, in terms of its efficiency and stability. We are generating a transgenic chicory plants with suppressed FEH (exohydrolas) genes using RNAi resulting in supressed inulin degradation. A small but important part of the construct is a sequence unique for the target gene (exons) or genes,which were cloned. The hairpin constructs were made and chicory was transformed by Agrobacterium tumifaciense, strain (C58C1). The transgenics should be select and check by means of molecular techniques.

Terminal Duplex Stability and Nucleotide Identity Differentially Control siRNA Loading and Activity in RNA Interference

PubMed Central

Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi

2016-01-01

Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870

RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems.

PubMed

Dietrich, Isabelle; Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Brennan, Benjamin; Elliott, Richard M; Diallo, Mawlouth; Sall, Amadou A; Failloux, Anna-Bella; Schnettler, Esther; Kohl, Alain; Becker, Stefanie C

2017-01-01

The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus , Bunyaviridae ) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect Drosophila melanogaster . We found that RVFV infection induces both the exogenous small interfering RNA (siRNA) and piRNA pathways, which contribute to the control of viral replication in insects. Furthermore, we demonstrate the production of virus-derived piRNAs in Culex quinquefasciatus mosquitoes. Understanding these pathways and the targets within them offers the potential of the development of novel RVFV control measures in vector-based strategies.

RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems

PubMed Central

Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Elliott, Richard M.; Diallo, Mawlouth; Sall, Amadou A.; Failloux, Anna-Bella; Schnettler, Esther

2017-01-01

ABSTRACT The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus, Bunyaviridae) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect Drosophila melanogaster. We found that RVFV infection induces both the exogenous small interfering RNA (siRNA) and piRNA pathways, which contribute to the control of viral replication in insects. Furthermore, we demonstrate the production of virus-derived piRNAs in Culex quinquefasciatus mosquitoes. Understanding these pathways and the targets within them offers the potential of the development of novel RVFV control measures in vector-based strategies. PMID:28497117

Silencing of sodium/hydrogen exchanger in the heart by direct injection of naked siRNA.

PubMed

Morgan, Patricio E; Correa, María V; Ennis, Irene L; Ennis, Irene E; Diez, Ariel A; Pérez, Néstor G; Cingolani, Horacio E

2011-08-01

Cardiac Na(+)/H(+) exchanger (NHE1) hyperactivity is a central factor in cardiac remodeling following hypertension, myocardial infarction, ischemia-reperfusion injury, and heart failure. Treatment of these pathologies by inhibiting NHE1 is challenging because specific drugs that have been beneficial in experimental models were associated with undesired side effects in clinical practice. In the present work, small interference RNA (siRNA) produced in vitro to specifically silence NHE1 (siRNA(NHE1)) was injected once in vivo into the apex of the left ventricular wall of mouse myocardium. After 48 h, left ventricular NHE1 protein expression was reduced in siRNA(NHE1)-injected mice compared with scrambled siRNA by 33.2 ± 3.4% (n = 5; P < 0.05). Similarly, NHE1 mRNA levels were reduced by 20 ± 2.0% (n = 4). At 72 h, siRNA(NHE1) spreading was evident from the decrease in NHE1 expression in three portions of the myocardium (apex, medium, base). NHE1 function was assessed based on maximal velocity of intracellular pH (pH(i)) recovery (dpH(i)/dt) after an ammonium prepulse-induced acidic load. Maximal dpH(i)/dt was reduced to 14% in siRNA(NHE1)-isolated left ventricular papillary muscles compared with scrambled siRNA. In conclusion, only one injection of naked siRNA(NHE1) successfully reduced NHE1 expression and activity in the left ventricle. As has been previously suggested, extensive NHE1 expression reduction may indicate myocardial spread of siRNA molecules from the injection site through gap junctions, providing a valid technique not only for further research into NHE1 function, but also for consideration as a potential therapeutic strategy.

[Wnt/β-catenin pathway involved in the regulation of rat mesangial cell proliferation by adipose-derived mesenchymal stem cells].

PubMed

Li, Zhi; Zhang, Mengying; Li, Xueqin; Lu, Jinming; Xu, Liang

2016-11-01

Objective To investigate the effect of adipose-derived mesenchymal stem cells (ADSCs) on glomerular mesangial cell proliferation via Wnt/β-catenin pathway. Methods The rat glomerular mesangial cells (HBZY-1) were incubated in conditioned ADSC medium. Cell cycle was analyzed with flow cytometry; the proliferation rate of HBZY-1 and the expression levels of relative genes and proteins of Wnt signaling pathway were measured using RNA interference, quantitative real-time PCR and Western blotting, respectively. Results HBZY-1 proliferation was significantly inhibited under the action of conditioned ADSC medium, whereas dickkopf WNT signaling pathway inhibitor 1 (DKK1) mRNA level was up-regulated. Fibronectin and TGF-β1 mRNA expression as well as β-catenin and Bcl-2 protein levels of HBZY-1 were significantly down-regulated. DKK1 gene expression level in ADSCs was significantly higher than that of HBZY-1. After RNA interference, DKK1 expression level in ADSCs was markedly inhibited, yet the β-catenin protein level was notably elevated. The β-catenin and Bcl-2 protein levels of HBZY-1 were also significantly raised in HBZY-1 after cultured with conditioned medium containing ADSCs treated with RNA interference. Conclusion Wnt/β-catenin may be a potential signaling pathway involved in the regulative effect of ADSCs on glomerular mesangial cell proliferation.

Transformation of cell-derived microparticles into quantum-dot-labeled nanovectors for antitumor siRNA delivery.

PubMed

Chen, Gang; Zhu, Jun-Yi; Zhang, Zhi-Ling; Zhang, Wei; Ren, Jian-Gang; Wu, Min; Hong, Zheng-Yuan; Lv, Cheng; Pang, Dai-Wen; Zhao, Yi-Fang

2015-01-12

Cell-derived microparticles (MPs) have been recently recognized as critical intercellular information conveyors. However, further understanding of their biological behavior and potential application has been hampered by the limitations of current labeling techniques. Herein, a universal donor-cell-assisted membrane biotinylation strategy was proposed for labeling MPs by skillfully utilizing the natural membrane phospholipid exchange of their donor cells. This innovative strategy conveniently led to specific, efficient, reproducible, and biocompatible quantum dot (QD) labeling of MPs, thereby reliably conferring valuable traceability on MPs. By further loading with small interference RNA, QD-labeled MPs that had inherent cell-targeting and biomolecule-conveying ability were successfully employed for combined bioimaging and tumor-targeted therapy. This study provides the first reliable and biofriendly strategy for transforming biogenic MPs into functionalized nanovectors. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Diverging affinity of tospovirus RNA silencing suppressor proteins, NSs, for various RNA duplex molecules.

PubMed

Schnettler, Esther; Hemmes, Hans; Huismann, Rik; Goldbach, Rob; Prins, Marcel; Kormelink, Richard

2010-11-01

The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs proteins analyzed exhibited affinity to small double-stranded RNA molecules, i.e., small interfering RNAs (siRNAs) and micro-RNA (miRNA)/miRNA* duplexes. Interestingly, the NSs proteins from tomato spotted wilt virus (TSWV), impatiens necrotic spot virus (INSV), and groundnut ringspot virus (GRSV) also showed affinity to long double-stranded RNA (dsRNA), whereas tomato yellow ring virus (TYRV) NSs did not. The TSWV NSs protein was shown to be capable of inhibiting Dicer-mediated cleavage of long dsRNA in vitro. In addition, it suppressed the accumulation of green fluorescent protein (GFP)-specific siRNAs during coinfiltration with an inverted-repeat-GFP RNA construct in Nicotiana benthamiana. In vivo interference of TSWV NSs in the miRNA pathway was shown by suppression of an enhanced GFP (eGFP) miRNA sensor construct. The ability to stabilize miRNA/miRNA* by different tospovirus NSs proteins in vivo was demonstrated by increased accumulation and detection of both miRNA171c and miRNA171c* in tospovirus-infected N. benthamiana. All together, these data suggest that tospoviruses interfere in the RNA silencing pathway by sequestering siRNA and miRNA/miRNA* molecules before they are uploaded into their respective RNA-induced silencing complexes. The observed affinity to long dsRNA for only a subset of the tospoviruses studied is discussed in light of evolutional divergence and their ancestral relation to the animal-infecting members of the Bunyaviridae.

Determining the Specificity of Cascade Binding, Interference, and Primed Adaptation In Vivo in the Escherichia coli Type I-E CRISPR-Cas System

PubMed Central

Cooper, Lauren A.; Stringer, Anne M.

2018-01-01

ABSTRACT In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo, for the type I-E system of Escherichia coli. Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5′ end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. PMID:29666291

Special Issue: Gene Therapy with Emphasis on RNA Interference

PubMed Central

Lundstrom, Kenneth

2015-01-01

Gene therapy was originally thought to cover replacement of malfunctioning genes in treatment of various diseases. Today, the field has been expanded to application of viral and non-viral vectors for delivery of recombinant proteins for the compensation of missing or insufficient proteins, anti-cancer genes and proteins for destruction of tumor cells, immunostimulatory genes and proteins for stimulation of the host defense system against viral agents and tumors. Recently, the importance of RNA interference and its application in gene therapy has become an attractive alternative for drug development. PMID:26447255

The RNA-mediated, asymmetric ring regulatory mechanism of the transcription termination Rho helicase decrypted by time-resolved nucleotide analog interference probing (trNAIP).

PubMed

Soares, Emilie; Schwartz, Annie; Nollmann, Marcello; Margeat, Emmanuel; Boudvillain, Marc

2014-08-01

Rho is a ring-shaped, ATP-dependent RNA helicase/translocase that dissociates transcriptional complexes in bacteria. How RNA recognition is coupled to ATP hydrolysis and translocation in Rho is unclear. Here, we develop and use a new combinatorial approach, called time-resolved Nucleotide Analog Interference Probing (trNAIP), to unmask RNA molecular determinants of catalytic Rho function. We identify a regulatory step in the translocation cycle involving recruitment of the 2'-hydroxyl group of the incoming 3'-RNA nucleotide by a Rho subunit. We propose that this step arises from the intrinsic weakness of one of the subunit interfaces caused by asymmetric, split-ring arrangement of primary RNA tethers around the Rho hexamer. Translocation is at highest stake every seventh nucleotide when the weak interface engages the incoming 3'-RNA nucleotide or breaks, depending on RNA threading constraints in the Rho pore. This substrate-governed, 'test to run' iterative mechanism offers a new perspective on how a ring-translocase may function or be regulated. It also illustrates the interest and versatility of the new trNAIP methodology to unveil the molecular mechanisms of complex RNA-based systems. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Potential applications of RNA interference-based therapeutics in the treatment of cardiovascular disease.

PubMed

Hassan, Ali

2006-06-01

RNA interference (RNAi) in eukaryotes is a recently identified phenomenon in which small double stranded RNA molecules called short interfering RNA (siRNA) interact with messenger RNA (mRNA) containing homologous sequences in a sequence-specific manner. Ultimately, this interaction results in degradation of the target mRNA. Because of the high sequence specificity of the RNAi process, and the apparently ubiquitous expression of the endogenous protein components necessary for RNAi, there appears to be little limitation to the genes that can be targeted for silencing by RNAi. Thus, RNAi has enormous potential, both as a research tool and as a mode of therapy. Several recent patents have described advances in RNAi technology that are likely to lead to new treatments for cardiovascular disease. These patents have described methods for increased delivery of siRNA to cardiovascular target tissues, chemical modifications of siRNA that improve their pharmacokinetic characteristics, and expression vectors capable of expressing RNAi effectors in situ. Though RNAi has only recently been demonstrated to occur in mammalian tissues, work has advanced rapidly in the development of RNAi-based therapeutics. Recently, therapeutic silencing of apoliporotein B, the ligand for the low density lipoprotein receptor, has been demonstrated in adult mice by systemic administration of chemically modified siRNA. This demonstrates the potential for RNAi-based therapeutics, and suggests that the future for RNAi in the treatment of cardiovascular disease is bright.

Deletion of Cytoplasmic Double-Stranded RNA Sensors Does Not Uncover Viral Small Interfering RNA Production in Human Cells.

PubMed

Schuster, Susan; Tholen, Lotte E; Overheul, Gijs J; van Kuppeveld, Frank J M; van Rij, Ronald P

2017-01-01

Antiviral immunity in insects and plants is mediated by the RNA interference (RNAi) pathway in which viral long double-stranded RNA (dsRNA) is processed into small interfering RNAs (siRNAs) by Dicer enzymes. Although this pathway is evolutionarily conserved, its involvement in antiviral defense in mammals is the subject of debate. In vertebrates, recognition of viral RNA induces a sophisticated type I interferon (IFN)-based immune response, and it has been proposed that this response masks or inhibits antiviral RNAi. To test this hypothesis, we analyzed viral small RNA production in differentiated cells deficient in the cytoplasmic RNA sensors RIG-I and MDA5. We did not detect 22-nucleotide (nt) viral siRNAs upon infection with three different positive-sense RNA viruses. Our data suggest that the depletion of cytoplasmic RIG-I-like sensors is not sufficient to uncover viral siRNAs in differentiated cells. IMPORTANCE The contribution of the RNA interference (RNAi) pathway in antiviral immunity in vertebrates has been widely debated. It has been proposed that RNAi possesses antiviral activity in mammalian systems but that its antiviral effect is masked by the potent antiviral interferon response in differentiated mammalian cells. In this study, we show that inactivation of the interferon response is not sufficient to uncover antiviral activity of RNAi in human epithelial cells infected with three wild-type positive-sense RNA viruses.

Immune modulation through RNA interference-mediated silencing of CD40 in dendritic cells.

PubMed

Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Samiee, Shahram; Ataee, Zahra; Tabei, Seyyed Ziyaoddin; Moazzeni, Seyed Mohammad

2009-01-01

RNA interference (RNAi) is an exciting mechanism for knocking down any target gene in transcriptional level. It is now clear that small interfering RNA (siRNA), a 19-21nt long dsRNA, can trigger a degradation process (RNAi) that specifically silences the expression of a cognate mRNA. Our findings in this study showed that down regulation of CD40 gene expression in dendritic cells (DCs) by RNAi culminated to immune modulation. Effective delivery of siRNA into DCs would be a reasonable method for the blocking of CD40 gene expression at the cell surface without any effect on other genes and cell cytotoxicity. The effects of siRNA against CD40 mRNA on the function and phenotype of DCs were investigated. The DCs were separated from the mice spleen and then cultured in vitro. By the means of Lipofectamine2000, siRNA was delivered to the cells and the efficacy of transfection was estimated by flow cytometry. By Annexine V and Propidium Iodide staining, we could evaluate the transfected cells viability. Also, the mRNA expression and protein synthesis were assessed by real-time PCR and flow cytometry, respectively. Knocking down the CD40 gene in the DCs caused an increase in IL-4 production, decrease in IL-12 production and allostimulation activity. All together, these effects would stimulate Th2 cytokines production from allogenic T-cells in vitro.

Abasic pivot substitution harnesses target specificity of RNA interference

PubMed Central

Lee, Hye-Sook; Seok, Heeyoung; Lee, Dong Ha; Ham, Juyoung; Lee, Wooje; Youm, Emilia Moonkyung; Yoo, Jin Seon; Lee, Yong-Seung; Jang, Eun-Sook; Chi, Sung Wook

2015-01-01

Gene silencing via RNA interference inadvertently represses hundreds of off-target transcripts. Because small interfering RNAs (siRNAs) can function as microRNAs, avoiding miRNA-like off-target repression is a major challenge. Functional miRNA–target interactions are known to pre-require transitional nucleation, base pairs from position 2 to the pivot (position 6). Here, by substituting nucleotide in pivot with abasic spacers, which prevent base pairing and alleviate steric hindrance, we eliminate miRNA-like off-target repression while preserving on-target activity at ∼80–100%. Specifically, miR-124 containing dSpacer pivot substitution (6pi) loses seed-mediated transcriptome-wide target interactions, repression activity and biological function, whereas other conventional modifications are ineffective. Application of 6pi allows PCSK9 siRNA to efficiently lower plasma cholesterol concentration in vivo, and abolish potentially deleterious off-target phenotypes. The smallest spacer, C3, also shows the same improvement in target specificity. Abasic pivot substitution serves as a general means to harness the specificity of siRNA experiments and therapeutic applications. PMID:26679372

In silico molecular docking analysis of the human Argonaute 2 PAZ domain reveals insights into RNA interference.

PubMed

Kandeel, Mahmoud; Kitade, Yukio

2013-07-01

RNA interference (RNAi) is a critical cellular pathway activated by double stranded RNA and regulates the gene expression of target mRNA. During RNAi, the 3' end of siRNA binds with the PAZ domain, followed by release and rebinding in a cyclic manner, which deemed essential for proper gene silencing. Recently, we provided the forces underlying the recognition of small interfering RNA by PAZ in a computational study based on the structure of Drosophila Argonaute 2 (Ago2) PAZ domain. We have now reanalyzed these data within the view of the new available structures from human Argonauts. While the parameters of weak binding are correlated with higher (RNAi) in the Drosophila model, a different profile is predicted with the human Ago2 PAZ domain. On the basis of the human Ago2 PAZ models, the indicators of stronger binding as the total binding energy and the free energy were associated with better RNAi efficacy. This discrepancy might be attributable to differences in the binding site topology and the difference in the conformation of the bound nucleotides.

Pulmonary Delivery of siRNA via Polymeric Vectors as Therapies of Asthma

PubMed Central

Xie, Yuran; Merkel, Olivia M

2015-01-01

Asthma is a chronic inflammatory disease. Despite the fact that current therapies, such as the combination of inhaled corticosteroids and β2-agonists, can control the symptoms of asthma in most patients, there is still an urgent need for an alternative anti-inflammatory therapy for patients who suffer from severe asthma but lack acceptable response to conventional therapies. Many molecular factors are involved in the inflammatory process in asthma, and thus blocking the function of these factors could efficiently alleviate airway inflammation. RNA interference (RNAi) is often thought to be the answer in the search for more efficient and biocompatible treatments. However, difficulties of efficient delivery of small interference RNA (siRNA), the key factor in RNAi, to target cells and tissues has limited its clinical application. In this review, we summarize cytokines and chemokines, transcription factors, tyrosine kinases and costimulatory factors that have been reported as targets of siRNA mediated treatment in experimental asthma. Additionally, we conclude several targeted delivery systems of siRNA to specific cells such as T cells, macrophages and dendritic cells, which could potentially be applied in asthma therapy. PMID:26148454

Antiviral Effects of Small Interfering RNA Simultaneously Inducing RNA Interference and Type 1 Interferon in Coxsackievirus Myocarditis

PubMed Central

Ahn, Jeonghyun; Ko, Ara; Jun, Eun Jung; Won, Minah; Kim, Yoo Kyum; Ju, Eun-Seon

2012-01-01

Antiviral therapeutics are currently unavailable for treatment of coxsackievirus B3, which can cause life-threatening myocarditis. A modified small interfering RNA (siRNA) containing 5′-triphosphate, 3p-siRNA, was shown to induce RNA interference and interferon activation. We aimed to develop a potent antiviral treatment using CVB3-specific 3p-siRNA and to understand its underlying mechanisms. Virus-specific 3p-siRNA was superior to both conventional virus-specific siRNA with an empty hydroxyl group at the 5′ end (OH-siRNA) and nonspecific 3p-siRNA in decreasing viral replication and subsequent cytotoxicity. A single administration of 3p-siRNA dramatically attenuated virus-associated pathological symptoms in mice with no signs of toxicity, and their body weights eventually reached the normal range. Myocardial inflammation and fibrosis were rare, and virus production was greatly reduced. A nonspecific 3p-siRNA showed relatively less protective effect under identical conditions, and a virus-specific OH-siRNA showed no protective effects. We confirmed that virus-specific 3p-siRNA simultaneously activated target-specific gene silencing and type I interferon signaling. We provide a clear proof of concept that coxsackievirus B3-specific 3p-siRNA has 2 distinct modes of action, which significantly enhance antiviral activities with minimal organ damage. This is the first direct demonstration of improved antiviral effects with an immunostimulatory virus-specific siRNA in coxsackievirus myocarditis, and this method could be applied to many virus-related diseases. PMID:22508300

Small-Interfering RNA–Eluting Surfaces as a Novel Concept for Intravascular Local Gene Silencing

PubMed Central

Nolte, Andrea; Walker, Tobias; Schneider, Martina; Kray, Oya; Avci-Adali, Meltem; Ziemer, Gerhard; Wendel, Hans Peter

2011-01-01

New drug-eluting stent (DES) methods have recently been demonstrated to improve outcomes of intravascular interventions. A novel technique is the design of gene-silencing stents that elute specific small-interfering RNAs (siRNAs) for better vascular wall regeneration. Although siRNAs used to alter gene expression have surpassed expectations in in vitro experiments, the functional and local delivery of siRNAs is still the major obstacle for the in vivo application of RNA interference. In this preliminary in vitro study we investigated a surface-immobilized siRNA delivery technique that would be readily adaptable for local intravascular applications in vivo. The transfection potency of gelatin coatings consisting of a specific siRNA complexed with polyethylenimine (PEI) was examined in primary human endothelial cells by flow cytometry and quantitative real-time polymerase chain reaction. Several media conditions, such as the presence or absence of serum during cultivation, were investigated. Furthermore, different siRNA and PEI amounts, as well as nitrogen/phosphate ratios, were tested for their transfection efficiency. Gelatin coatings consisting of PEI and siRNA against an exemplary endothelial adhesion molecule receptor achieved a significant knockdown of around 70%. The transfection efficiency of the coatings was not influenced by the presence of serum. The results of this preliminary study support the expectation that this novel coating may be favorable for local in vivo gene silencing (for example, when immobilized on stents or balloons for percutanous transluminal coronary angioplasty). However, further animal experiments are needed to confirm the translation into clinical practice. This intriguing technology leads the way to more sophisticated and individualized coatings for the post-DES era, toward silencing of genes involved in the pathway of intimal hyperplasia. PMID:21792480

RNA interference for performance enhancement and detection in doping control.

PubMed

Kohler, Maxie; Schänzer, Wilhelm; Thevis, Mario

2011-10-01

RNA interference represents a comparably new route of regulating and manipulating specific gene expression. Promising results were obtained in experimental therapies aim at the treatment of different kinds of diseases including cancer, diabetes mellitus or Dychenne muscular dystrophy. While studies on down-regulation efficiency are often performed by analyzing the regulated protein, the direct detection of small, interfering RNA molecules and antisense oligonucleotides is of great interest for the investigation of the metabolism and degradation and also for the detection of a putative misuse of these molecules in sports. Myostatin down-regulation was shown to result in increased performance and muscle growth and the regulation of several other proteins could be relevant for performance enhancement. This mini-review summarizes current approaches for the mass spectrometric analysis of siRNA and antisense oligonucleotides from biological matrices and the available data on biodistribution, metabolism, and half-life of relevant substances are discussed. Copyright © 2011 John Wiley & Sons, Ltd.

Conditional silencing of the Escherichia coli pykF gene results from artificial convergent transcription protected from Rho-dependent termination.

PubMed

Krylov, Alexander A; Airich, Larisa G; Kiseleva, Evgeniya M; Minaeva, Natalia I; Biryukova, Irina V; Mashko, Sergey V

2010-01-01

PykF is one of two pyruvate kinases in Escherichia coli K-12. lambdaP(L) was convergently integrated into the chromosome of the MG1655 strain, downstream of pykF, face-to-face with its native promoter. In the presence of lambdacIts857, efficient pykF ts-silencing was achieved when the 5'-terminus of the P(L)-originated antisense RNA (asRNA), consisting of the rrnG-AT sequence, converted elongation complexes of RNA polymerase to a form resistant to Rho-dependent transcription termination. pykF silencing was detected by the following features: (a) impaired growth of the strain when pykA was also disrupted and when using ribose as a non-phosphotransferase system-transporting carbon source; (b) a pattern of reduced synthesis of the full-sized pykF mRNA, mediated by reverse transcription PCR, and (c) a significant decrease in PykF activity. The advantages of anti-terminated convergent transcription were clearly manifested in the strains where the rho_a-terminator was inserted specifically to interrupt asRNA synthesis. Most likely, the target gene was silenced by transcriptional interference due to collisions between converging RNA polymerases, although, strictly, the role of cis-asRNA effects could not be excluded. While details of the mechanisms have yet to be determined, anti-terminated convergent transcription is a promising new technique for silencing other target genes. Copyright 2010 S. Karger AG, Basel.

Design of S-Allylcysteine in Situ Production and Incorporation Based on a Novel Pyrrolysyl-tRNA Synthetase Variant.

PubMed

Exner, Matthias P; Kuenzl, Tilmann; To, Tuyet Mai T; Ouyang, Zhaofei; Schwagerus, Sergej; Hoesl, Michael G; Hackenberger, Christian P R; Lensen, Marga C; Panke, Sven; Budisa, Nediljko

2017-01-03

The noncanonical amino acid S-allyl cysteine (Sac) is one of the major compounds of garlic extract and exhibits a range of biological activities. It is also a small bioorthogonal alkene tag capable of undergoing controlled chemical modifications, such as photoinduced thiol-ene coupling or Pd-mediated deprotection. Its small size guarantees minimal interference with protein structure and function. Here, we report a simple protocol efficiently to couple in-situ semisynthetic biosynthesis of Sac and its incorporation into proteins in response to amber (UAG) stop codons. We exploited the exceptional malleability of pyrrolysyl-tRNA synthetase (PylRS) and evolved an S-allylcysteinyl-tRNA synthetase (SacRS) capable of specifically accepting the small, polar amino acid instead of its long and bulky aliphatic natural substrate. We succeeded in generating a novel and inexpensive strategy for the incorporation of a functionally versatile amino acid. This will help in the conversion of orthogonal translation from a standard technique in academic research to industrial biotechnology. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

A member of the polymerase beta nucleotidyltransferase superfamily is required for RNA interference in C. elegans.

PubMed

Chen, Chun-Chieh G; Simard, Martin J; Tabara, Hiroaki; Brownell, Daniel R; McCollough, Jennifer A; Mello, Craig C

2005-02-22

RNA interference (RNAi) is an ancient, highly conserved mechanism in which small RNA molecules (siRNAs) guide the sequence-specific silencing of gene expression . Several silencing machinery protein components have been identified, including helicases, RNase-related proteins, double- and single-stranded RNA binding proteins, and RNA-dependent RNA polymerase-related proteins . Work on these factors has led to the revelation that RNAi mechanisms intersect with cellular pathways required for development and fertility . Despite rapid progress in understanding key steps in the RNAi pathway, it is clear that many factors required for both RNAi and related developmental mechanisms have not yet been identified. Here, we report the characterization of the C. elegans gene rde-3. Genetic analysis of presumptive null alleles indicates that rde-3 is required for siRNA accumulation and for efficient RNAi in all tissues, and it is essential for fertility and viability at high temperatures. RDE-3 contains conserved domains found in the polymerase beta nucleotidyltransferase superfamily, which includes conventional poly(A) polymerases, 2'-5' oligoadenylate synthetase (OAS), and yeast Trf4p . These findings implicate a new enzymatic modality in RNAi and suggest possible models for the role of RDE-3 in the RNAi mechanism.

Suppression of RNA Interference by Adenovirus Virus-Associated RNA†

PubMed Central

Andersson, M. Gunnar; Haasnoot, P. C. Joost; Xu, Ning; Berenjian, Saideh; Berkhout, Ben; Akusjärvi, Göran

2005-01-01

We show that human adenovirus inhibits RNA interference (RNAi) at late times of infection by suppressing the activity of two key enzyme systems involved, Dicer and RNA-induced silencing complex (RISC). To define the mechanisms by which adenovirus blocks RNAi, we used a panel of mutant adenoviruses defective in virus-associated (VA) RNA expression. The results show that the virus-associated RNAs, VA RNAI and VA RNAII, function as suppressors of RNAi by interfering with the activity of Dicer. The VA RNAs bind Dicer and function as competitive substrates squelching Dicer. Further, we show that VA RNAI and VA RNAII are processed by Dicer, both in vitro and during a lytic infection, and that the resulting short interfering RNAs (siRNAs) are incorporated into active RISC. Dicer cleaves the terminal stem of both VA RNAI and VA RNAII. However, whereas both strands of the VA RNAI-specific siRNA are incorporated into RISC, the 3′ strand of the VA RNAII-specific siRNA is selectively incorporated during a lytic infection. In summary, our work shows that adenovirus suppresses RNAi during a lytic infection and gives insight into the mechanisms of RNAi suppression by VA RNA. PMID:16014917

RNA interference of tubulin genes has lethal effects in Mythimna separate.

PubMed

Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji

2018-05-23

RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.

Structural analyses of the CRISPR protein Csc2 reveal the RNA-binding interface of the type I-D Cas7 family.

PubMed

Hrle, Ajla; Maier, Lisa-Katharina; Sharma, Kundan; Ebert, Judith; Basquin, Claire; Urlaub, Henning; Marchfelder, Anita; Conti, Elena

2014-01-01

Upon pathogen invasion, bacteria and archaea activate an RNA-interference-like mechanism termed CRISPR (clustered regularly interspaced short palindromic repeats). A large family of Cas (CRISPR-associated) proteins mediates the different stages of this sophisticated immune response. Bioinformatic studies have classified the Cas proteins into families, according to their sequences and respective functions. These range from the insertion of the foreign genetic elements into the host genome to the activation of the interference machinery as well as target degradation upon attack. Cas7 family proteins are central to the type I and type III interference machineries as they constitute the backbone of the large interference complexes. Here we report the crystal structure of Thermofilum pendens Csc2, a Cas7 family protein of type I-D. We found that Csc2 forms a core RRM-like domain, flanked by three peripheral insertion domains: a lid domain, a Zinc-binding domain and a helical domain. Comparison with other Cas7 family proteins reveals a set of similar structural features both in the core and in the peripheral domains, despite the absence of significant sequence similarity. T. pendens Csc2 binds single-stranded RNA in vitro in a sequence-independent manner. Using a crosslinking - mass-spectrometry approach, we mapped the RNA-binding surface to a positively charged surface patch on T. pendens Csc2. Thus our analysis of the key structural and functional features of T. pendens Csc2 highlights recurring themes and evolutionary relationships in type I and type III Cas proteins.

RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans.

PubMed

Tops, Bastiaan B J; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C; Plasterk, Ronald H A; Ketting, René F

2005-01-01

In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of approximately 250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step.

The role of Cas8 in type I CRISPR interference.

PubMed

Cass, Simon D B; Haas, Karina A; Stoll, Britta; Alkhnbashi, Omer S; Sharma, Kundan; Urlaub, Henning; Backofen, Rolf; Marchfelder, Anita; Bolt, Edward L

2015-05-05

CRISPR (clustered regularly interspaced short palindromic repeat) systems provide bacteria and archaea with adaptive immunity to repel invasive genetic elements. Type I systems use 'cascade' [CRISPR-associated (Cas) complex for antiviral defence] ribonucleoprotein complexes to target invader DNA, by base pairing CRISPR RNA (crRNA) to protospacers. Cascade identifies PAMs (protospacer adjacent motifs) on invader DNA, triggering R-loop formation and subsequent DNA degradation by Cas3. Cas8 is a candidate PAM recognition factor in some cascades. We analysed Cas8 homologues from type IB CRISPR systems in archaea Haloferax volcanii (Hvo) and Methanothermobacter thermautotrophicus (Mth). Cas8 was essential for CRISPR interference in Hvo and purified Mth Cas8 protein responded to PAM sequence when binding to nucleic acids. Cas8 interacted physically with Cas5-Cas7-crRNA complex, stimulating binding to PAM containing substrates. Mutation of conserved Cas8 amino acid residues abolished interference in vivo and altered catalytic activity of Cas8 protein in vitro. This is experimental evidence that Cas8 is important for targeting Cascade to invader DNA. © 2015 Authors.

RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding.

PubMed

Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung

2014-01-01

RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties.

RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding

PubMed Central

Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung

2014-01-01

RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties. PMID:25332689

Silencing the hsp25 Gene Eliminates Migration Capability of the Highly Metastatic Murine 4T1 Breast Adenocarcinoma Cell

PubMed Central

Bausero, Maria A.; Bharti, Ajit; Page, Diana T.; Perez, Kristen D.; Eng, Jason W.-L.; Ordonez, Susana L.; Jantschitsch, Christian; Kindas-Muegge, Ingela; Ciocca, Daniel; Asea, Alexzander

2006-01-01

The 25-kDa heat shock protein (Hsp25) is associated with various malignancies and is expressed at high levels in biopsies as well as circulating in the serum of breast cancer patients. In this study, we used RNA interference technology to silence the hsp25 gene in 4T1 breast adenocarcinoma cells, known as a poorly immunogenic, highly metastatic cell line. We demonstrate that transfection of 4T1 cells with short interference RNA-Hsp25 dramatically inhibits proliferation as compared with control transfected cells. In addition, we show that 4T1 cells transfected with short interference RNA-Hsp25 abrogates tumor migration potential by a mechanism that is in part due to the repression of matrix metalloproteinase 9 expression and a concomitant upregulation of its antagonist, tissue inhibitor metalloproteinase 1. Taken together, these findings provide a model system for the study of metastatic potential of tumors and are suggestive of an earlier unrecognized role for Hsp25 in tumor migration. PMID:16340246

Silencing the hsp25 gene eliminates migration capability of the highly metastatic murine 4T1 breast adenocarcinoma cell.

PubMed

Bausero, Maria A; Bharti, Ajit; Page, Diana T; Perez, Kristen D; Eng, Jason W-L; Ordonez, Susana L; Asea, Edwina E; Jantschitsch, Christian; Kindas-Muegge, Ingela; Ciocca, Daniel; Asea, Alexzander

2006-01-01

The 25-kDa heat shock protein (Hsp25) is associated with various malignancies and is expressed at high levels in biopsies as well as circulating in the serum of breast cancer patients. In this study, we used RNA interference technology to silence the hsp25 gene in 4T1 breast adenocarcinoma cells, known as a poorly immunogenic, highly metastatic cell line. We demonstrate that transfection of 4T1 cells with short interference RNA-Hsp25 dramatically inhibits proliferation as compared with control transfected cells. In addition, we show that 4T1 cells transfected with short interference RNA-Hsp25 abrogates tumor migration potential by a mechanism that is in part due to the repression of matrix metalloproteinase 9 expression and a concomitant upregulation of its antagonist, tissue inhibitor metalloproteinase 1. Taken together, these findings provide a model system for the study of metastatic potential of tumors and are suggestive of an earlier unrecognized role for Hsp25 in tumor migration. Copyright 2006 S. Karger AG, Basel.

Dissection of K+ currents in Caenorhabditis elegans muscle cells by genetics and RNA interference

PubMed Central

Santi, C. M.; Yuan, A.; Fawcett, G.; Wang, Z.-W.; Butler, A.; Nonet, M. L.; Wei, A.; Rojas, P.; Salkoff, L.

2003-01-01

GFP-promoter experiments have previously shown that at least nine genes encoding potassium channel subunits are expressed in Caenorhabditis elegans muscle. By using genetic, RNA interference, and physiological techniques we revealed the molecular identity of the major components of the outward K+ currents in body wall muscle cells in culture. We found that under physiological conditions, outward current is dominated by the products of only two genes, Shaker (Kv1) and Shal (Kv4), both expressing voltage-dependent potassium channels. Other channels may be held in reserve to respond to particular circumstances. Because GFP-promoter experiments indicated that slo-2 expression is prominent, we created a deletion mutant to identify the SLO-2 current in vivo. In both whole-cell and single-channel modes, in vivo SLO-2 channels were active only when intracellular Ca2+ and Cl- were raised above normal physiological conditions, as occurs during hypoxia. Under such conditions, SLO-2 is the largest outward current, contributing up to 87% of the total current. Other channels are present in muscle, but our results suggest that they are unlikely to contribute a large outward component under physiological conditions. However, they, too, may contribute currents conditional on other factors. Hence, the picture that emerges is of a complex membrane with a small number of household conductances functioning under normal circumstances, but with additional conductances that are activated during unusual circumstances. PMID:14612577

Multifunctional RNA Nanoparticles

PubMed Central

2015-01-01

Our recent advancements in RNA nanotechnology introduced novel nanoscaffolds (nanorings); however, the potential of their use for biomedical applications was never fully revealed. As presented here, besides functionalization with multiple different short interfering RNAs for combinatorial RNA interference (e.g., against multiple HIV-1 genes), nanorings also allow simultaneous embedment of assorted RNA aptamers, fluorescent dyes, proteins, as well as recently developed RNA–DNA hybrids aimed to conditionally activate multiple split functionalities inside cells. PMID:25267559

A simple and robust vector-based shRNA expression system used for RNA interference.

PubMed

Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

2013-01-01

RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

A novel dendritic nanocarrier of polyamidoamine-polyethylene glycol-cyclic RGD for “smart” small interfering RNA delivery and in vitro antitumor effects by human ether-à-go-go-related gene silencing in anaplastic thyroid carcinoma cells

PubMed Central

Li, Guanhua; Hu, Zuojun; Yin, Henghui; Zhang, Yunjian; Huang, Xueling; Wang, Shenming; Li, Wen

2013-01-01

The application of RNA interference techniques is promising in gene therapeutic approaches, especially for cancers. To improve safety and efficiency of small interfering RNA (siRNA) delivery, a triblock dendritic nanocarrier, polyamidoamine-polyethylene glycol-cyclic RGD (PAMAM-PEG-cRGD), was developed and studied as an siRNA vector targeting the human ether-à-go-go-related gene (hERG) in human anaplastic thyroid carcinoma cells. Structure characterization, particle size, zeta potential, and gel retardation assay confirmed that complete triblock components were successfully synthesized with effective binding capacity of siRNA in this triblock nanocarrier. Cytotoxicity data indicated that conjugation of PEG significantly alleviated cytotoxicity when compared with unmodified PAMAM. PAMAM-PEG-cRGD exerted potent siRNA cellular internalization in which transfection efficiency measured by flow cytometry was up to 68% when the charge ratio (N/P ratio) was 3.5. Ligand-receptor affinity together with electrostatic interaction should be involved in the nano-siRNA endocytosis mechanism and we then proved that attachment of cRGD enhanced cellular uptake via RGD-integrin recognition. Gene silencing was evaluated by reverse transcription polymerase chain reaction and PAMAM-PEG-cRGD-siRNA complex downregulated the expression of hERG to 26.3% of the control value. Furthermore, gene knockdown of hERG elicited growth suppression as well as activated apoptosis by means of abolishing vascular endothelial growth factor secretion and triggering caspase-3 cascade in anaplastic thyroid carcinoma cells. Our study demonstrates that this novel triblock polymer, PAMAM-PEG-cRGD, exhibits negligible cytotoxicity, effective transfection, “smart” cancer targeting, and therefore is a promising siRNA nanocarrier. PMID:23569377

Steric restrictions of RISC in RNA interference identified with size-expanded RNA nucleobases.

PubMed

Hernández, Armando R; Peterson, Larryn W; Kool, Eric T

2012-08-17

Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC), the key protein complex of RNA interference (RNAi), is of great importance to the development of siRNAs with improved biological and potentially therapeutic function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to -5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3'-end increased activity over that of wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation.

Steric Restrictions of RISC in RNA Interference Identified with Size-Expanded RNA Nucleobases

PubMed Central

Hernández, Armando R.; Peterson, Larryn W.; Kool, Eric T.

2012-01-01

Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC) – the key protein complex of RNA interference (RNAi) – is of great importance to the development of siRNAs with improved biological, and potentially therapeutic, function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases, and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to −5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region, but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3′-end increased activity over wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation. PMID:22646660

Genetic Dissection of Learning and Memory in Mice

PubMed Central

Mineur, Yann S.; Crusio, Wim E.; Sluyter, Frans

2004-01-01

In this minireview, we discuss different strategies to dissect genetically the keystones of learning and memory. First, we broadly sketch the neurogenetic analysis of complex traits in mice. We then discuss two general strategies to find genes affecting learning and memory: candidate gene studies and whole genome searches. Next, we briefly review more recently developed techniques, such as microarrays and RNA interference. In addition, we focus on gene-environment interactions and endophenotypes. All sections are illustrated with examples from the learning and memory field, including a table summarizing the latest information about genes that have been shown to have effects on learning and memory. PMID:15656270

RNAi-induced silencing of embryonic tryptophan oxygenase in the Pyralid moth, Plodia interpunctella

PubMed Central

Fabrick, Jeffrey A.; Kanost, Michael R.; Baker, James E.

2004-01-01

Gene silencing through the introduction of double-stranded RNA (RNA interference, RNAi) provides a powerful tool for the elucidation of gene function in many systems, including those where genomics and proteomics are incomplete. The use of RNAi technology for gene silencing in Lepidoptera has lacked significant attention compared to other systems. To demonstrate that RNAi can be utilized in the lepidopteran, Plodia interpunctella, we cloned a cDNA for tryptophan oxygenase, and showed that silencing of tryptophan oxygenase through RNAi during embryonic development resulted in loss of eye-color pigmentation. The complete amino acid sequence of Plodia tryptophan oxygenase can be accessed through NCBI Protein Database under NCBI Accession # AY427951. Abbreviation RNAi RNA interference PCR polymerase chain reaction RT-PCR reverse transcription-PCR PMID:15861231

Expression and RNA interference of salivary polygalacturonase genes in the tarnished plant bug, Lygus lineolaris.

PubMed

Walker, William B; Allen, Margaret L

2010-01-01

Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris.

Evolution at increased error rate leads to the coexistence of multiple adaptive pathways in an RNA virus.

PubMed

Cabanillas, Laura; Arribas, María; Lázaro, Ester

2013-01-16

When beneficial mutations present in different genomes spread simultaneously in an asexual population, their fixation can be delayed due to competition among them. This interference among mutations is mainly determined by the rate of beneficial mutations, which in turn depends on the population size, the total error rate, and the degree of adaptation of the population. RNA viruses, with their large population sizes and high error rates, are good candidates to present a great extent of interference. To test this hypothesis, in the current study we have investigated whether competition among beneficial mutations was responsible for the prolonged presence of polymorphisms in the mutant spectrum of an RNA virus, the bacteriophage Qβ, evolved during a large number of generations in the presence of the mutagenic nucleoside analogue 5-azacytidine. The analysis of the mutant spectra of bacteriophage Qβ populations evolved at artificially increased error rate shows a large number of polymorphic mutations, some of them with demonstrated selective value. Polymorphisms distributed into several evolutionary lines that can compete among them, making it difficult the emergence of a defined consensus sequence. The presence of accompanying deleterious mutations, the high degree of recurrence of the polymorphic mutations, and the occurrence of epistatic interactions generate a highly complex interference dynamics. Interference among beneficial mutations in bacteriophage Qβ evolved at increased error rate permits the coexistence of multiple adaptive pathways that can provide selective advantages by different molecular mechanisms. In this way, interference can be seen as a positive factor that allows the exploration of the different local maxima that exist in rugged fitness landscapes.

Transfer and functional consequences of dietary microRNAs in vertebrates: Concepts in search of corroboration Negative results challenge the hypothesis that dietary xenomiRs cross the gut and regulate genes ...

USDA-ARS?s Scientific Manuscript database

If validated, diet-derived foreign microRNA absorption and function in consuming vertebrates would drastically alter our understanding of nutrition and ecology. RNA interference (RNAi) mechanisms of Caenorhabditis elegans are enhanced by uptake of environmental RNA and amplification and systemic dis...

Cas5d Protein Processes Pre-crRNA and Assembles into a Cascade-like Interference Complex in Subtype I-C/Dvulg CRISPR-Cas System

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nam, Ki Hyun; Haitjema, Charles; Liu, Xueqi

Clustered regularly interspaced short palindromic repeats (CRISPRs), together with an operon of CRISPR-associated (Cas) proteins, form an RNA-based prokaryotic immune system against exogenous genetic elements. Cas5 family proteins are found in several type I CRISPR-Cas systems. Here, we report the molecular function of subtype I-C/Dvulg Cas5d from Bacillus halodurans. We show that Cas5d cleaves pre-crRNA into unit length by recognizing both the hairpin structure and the 3 single stranded sequence in the CRISPR repeat region. Cas5d structure reveals a ferredoxin domain-based architecture and a catalytic triad formed by Y46, K116, and H117 residues. We further show that after pre-crRNA processing,more » Cas5d assembles with crRNA, Csd1, and Csd2 proteins to form a multi-sub-unit interference complex similar to Escherichia coli Cascade (CRISPR-associated complex for antiviral defense) in architecture. Our results suggest that formation of a crRNA-presenting Cascade-like complex is likely a common theme among type I CRISPR subtypes.« less

Pulmonary Delivery of siRNA via Polymeric Vectors as Therapies of Asthma.

PubMed

Xie, Yuran; Merkel, Olivia M

2015-10-01

Asthma is a chronic inflammatory disease. Despite the fact that current therapies, such as the combination of inhaled corticosteroids and β2-agonists, can control the symptoms of asthma in most patients, there is still an urgent need for an alternative anti-inflammatory therapy for patients who suffer from severe asthma but lack acceptable response to conventional therapies. Many molecular factors are involved in the inflammatory process in asthma, and thus blocking the function of these factors could efficiently alleviate airway inflammation. RNA interference (RNAi) is often thought to be the answer in the search for more efficient and biocompatible treatments. However, difficulties of efficient delivery of small interference RNA (siRNA), the key factor in RNAi, to target cells and tissues have limited its clinical application. In this review, we summarize cytokines and chemokines, transcription factors, tyrosine kinases, and costimulatory factors that have been reported as targets of siRNA-mediated treatment in experimental asthma. Additionally, we conclude several targeted delivery systems of siRNA to specific cells such as T cells, macrophages, and dendritic cells, which could potentially be applied in asthma therapy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Nonviral pulmonary delivery of siRNA.

PubMed

Merkel, Olivia M; Kissel, Thomas

2012-07-17

RNA interference (RNAi) is an important part of the cell's defenses against viruses and other foreign genes. Moreover, the biotechnological exploitation of RNAi offers therapeutic potential for a range of diseases for which drugs are currently unavailable. Unfortunately, the small interfering RNAs (siRNAs) that are central to RNAi in the cytoplasm are readily degradable by ubiquitous nucleases, are inefficiently targeted to desired organs and cell types, and are excreted quickly upon systemic injection. As a result, local administration techniques have been favored over the past few years, resulting in great success in the treatment of viral infections and other respiratory disorders. Because there are several advantages of pulmonary delivery over systemic administration, two of the four siRNA drugs currently in phase II clinical trials are delivered intranasally or by inhalation. The air-blood barrier, however, has only limited permeability toward large, hydrophilic biopharmaceuticals such as nucleic acids; in addition, the lung imposes intrinsic hurdles to efficient siRNA delivery. Thus, appropriate formulations and delivery devices are very much needed. Although many different formulations have been optimized for in vitro siRNA delivery to lung cells, only a few have been reported successful in vivo. In this Account, we discuss both obstacles to pulmonary siRNA delivery and the success stories that have been achieved thus far. The optimal pulmonary delivery vehicle should be neither cytotoxic nor immunogenic, should protect the payload from degradation by nucleases during the delivery process, and should mediate the intracellular uptake of siRNA. Further requirements include the improvement of the pharmacokinetics and lung distribution profiles of siRNA, the extension of lung retention times (through reduced recognition by macrophages), and the incorporation of reversible or stimuli-responsive binding of siRNA to allow for efficient release of the siRNAs at the target site. In addition, the ideal carrier would be biodegradable (to address difficulties with repeated administration for the treatment of chronic diseases) and would contain targeting moieties to enhance uptake by specific cell types. None of the currently available polymer- and lipid-based formulations meet every one of these requirements, but we introduce here several promising new approaches, including a biodegradable, nonimmunogenic polyester. We also discuss imaging techniques for following the biodistribution according to the administration route. This tracking is crucial for better understanding the translocation and clearance of nanoformulated siRNA subsequent to pulmonary delivery. In the literature, the success of pulmonary siRNA delivery is evaluated solely by relief from or prophylaxis against a disease; side effects are not studied in detail. It also remains unclear which cell types in the lung eventually take up siRNA. These are critical issues for the translational use of pulmonary siRNA formulations; accordingly, we present a flow cytometry technique that can be utilized to differentiate transfected cell populations in a mouse model that expresses transgenic enhanced green fluorescence protein (EGFP). This technique, in which different cell types are identified on the basis of their surface antigen expression, may eventually help in the development of safer carriers with minimized side effects in nontargeted tissues.

Efficacy of a Novel Class of RNA Interference Therapeutic Agents

PubMed Central

Matsumoto, Takahiro; D'Alessandro-Gabazza, Corina N.; Gil-Bernabe, Paloma; Boveda-Ruiz, Daniel; Naito, Masahiro; Kobayashi, Tetsu; Toda, Masaaki; Mizutani, Takayuki; Taguchi, Osamu; Morser, John; Eguchi, Yutaka; Kuroda, Masahiko; Ochiya, Takahiro; Hayashi, Hirotake; Gabazza, Esteban C.; Ohgi, Tadaaki

2012-01-01

RNA interference (RNAi) is being widely used in functional gene research and is an important tool for drug discovery. However, canonical double-stranded short interfering RNAs are unstable and induce undesirable adverse effects, and thus there is no currently RNAi-based therapy in the clinic. We have developed a novel class of RNAi agents, and evaluated their effectiveness in vitro and in mouse models of acute lung injury (ALI) and pulmonary fibrosis. The novel class of RNAi agents (nkRNA®, PnkRNA™) were synthesized on solid phase as single-stranded RNAs that, following synthesis, self-anneal into a unique helical structure containing a central stem and two loops. They are resistant to degradation and suppress their target genes. nkRNA and PnkRNA directed against TGF-β1mRNA ameliorate outcomes and induce no off-target effects in three animal models of lung disease. The results of this study support the pathological relevance of TGF-β1 in lung diseases, and suggest the potential usefulness of these novel RNAi agents for therapeutic application. PMID:22916145

Optically Remote Noncontact Heart Rates Sensing Technique

NASA Astrophysics Data System (ADS)

Thongkongoum, W.; Boonduang, S.; Limsuwan, P.

2017-09-01

Heart rate monitoring via optically remote noncontact technique was reported in this research. A green laser (5 mW, 532±10 nm) was projected onto the left carotid artery. The reflected laser light on the screen carried the deviation of the interference patterns. The interference patterns were recorded by the digital camera. The recorded videos of the interference patterns were frame by frame analysed by 2 standard digital image processing (DIP) techniques, block matching (BM) and optical flow (OF) techniques. The region of interest (ROI) pixels within the interference patterns were analysed for periodically changes of the interference patterns due to the heart pumping action. Both results of BM and OF techniques were compared with the reference medical heart rate monitoring device by which a contact measurement using pulse transit technique. The results obtained from BM technique was 74.67 bpm (beats per minute) and OF technique was 75.95 bpm. Those results when compared with the reference value of 75.43±1 bpm, the errors were found to be 1.01% and 0.69%, respectively.

RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans

PubMed Central

Tops, Bastiaan B. J.; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C.; Plasterk, Ronald H. A.; Ketting, René F.

2005-01-01

In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of ∼250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step. PMID:15653635

Molecular requirements for RNA-induced silencing complex assembly in the Drosophila RNA interference pathway.

PubMed

Pham, John W; Sontheimer, Erik J

2005-11-25

Complexes in the Drosophila RNA-induced silencing complex (RISC) assembly pathway can be resolved using native gel electrophoresis, revealing an initiator called R1, an intermediate called R2, and an effector called R3 (now referred to as holo-RISC). Here we show that R1 forms when the Dicer-2/R2D2 heterodimer binds short interfering RNA (siRNA) duplexes. The heterodimer alone can initiate RISC assembly, indicating that other factors are dispensable for initiation. During assembly, R2 requires Argonaute 2 to convert into holo-RISC. This requirement is reminiscent of the RISC-loading complex, which also requires Argonaute 2 for assembly into RISC. We have compared R2 to the RISC-loading complex and show that the two complexes are similar in their sensitivities to ATP and to chemical modifications on siRNA duplexes, indicating that they are likely to be identical. We have examined the requirements for RISC formation and show that the siRNA 5'-termini are repeatedly monitored during RISC assembly, first by the Dcr-2/R2D2 heterodimer and again after R2 formation, before siRNA unwinding. The 2'-position of the 5'-terminal nucleotide also affects RISC assembly, because an siRNA strand bearing a 2'-deoxyribose at this position can inhibit the cognate strand from entering holo-RISC; in contrast, the 2'-deoxyribose-modified strand has enhanced activity in the RNA interference pathway.

Molecular imaging of RNA interference therapy targeting PHD2 for treatment of myocardial ischemia.

PubMed

Huang, Mei; Wu, Joseph C

2011-01-01

Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments.

Molecular Imaging of RNA Interference Therapy Targeting PHD2 for Treatment of Myocardial Ischemia

PubMed Central

Huang, Mei; Wu, Joseph C.

2011-01-01

Summary Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments. PMID:21194030

RNA interference inhibits yellow fever virus replication in vitro and in vivo.

PubMed

Pacca, Carolina C; Severino, Adriana A; Mondini, Adriano; Rahal, Paula; D'avila, Solange G P; Cordeiro, José Antonio; Nogueira, Mara Correa Lelles; Bronzoni, Roberta V M; Nogueira, Maurício L

2009-04-01

RNA interference (RNAi) is a process that is induced by double stranded RNA and involves the degradation of specific sequences of mRNA in the cytoplasm of the eukaryotic cells. It has been used as an antiviral tool against many viruses, including flaviviruses. The genus Flavivirus contains the most important arboviruses in the world, i.e., dengue (DENV) and yellow fever (YFV). In our study, we investigated the in vitro and in vivo effect of RNAi against YFV. Using stable cell lines that expressed RNAi against YFV, the cell lines were able to inhibit as much as 97% of the viral replication. Two constructions (one against NS1 and the other against E region of YFV genome) were able to protect the adult Balb/c mice against YFV challenge. The histopathologic analysis demonstrated an important protection of the central nervous system by RNAi after 10 days of viral challenge. Our data suggests that RNAi is a potential viable therapeutic weapon against yellow fever.

Interference activity of a minimal Type I CRISPR–Cas system from Shewanella putrefaciens

PubMed Central

Dwarakanath, Srivatsa; Brenzinger, Susanne; Gleditzsch, Daniel; Plagens, André; Klingl, Andreas; Thormann, Kai; Randau, Lennart

2015-01-01

Type I CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)–Cas (CRISPR-associated) systems exist in bacterial and archaeal organisms and provide immunity against foreign DNA. The Cas protein content of the DNA interference complexes (termed Cascade) varies between different CRISPR-Cas subtypes. A minimal variant of the Type I-F system was identified in proteobacterial species including Shewanella putrefaciens CN-32. This variant lacks a large subunit (Csy1), Csy2 and Csy3 and contains two unclassified cas genes. The genome of S. putrefaciens CN-32 contains only five Cas proteins (Cas1, Cas3, Cas6f, Cas1821 and Cas1822) and a single CRISPR array with 81 spacers. RNA-Seq analyses revealed the transcription of this array and the maturation of crRNAs (CRISPR RNAs). Interference assays based on plasmid conjugation demonstrated that this CRISPR-Cas system is active in vivo and that activity is dependent on the recognition of the dinucleotide GG PAM (Protospacer Adjacent Motif) sequence and crRNA abundance. The deletion of cas1821 and cas1822 reduced the cellular crRNA pool. Recombinant Cas1821 was shown to form helical filaments bound to RNA molecules, which suggests its role as the Cascade backbone protein. A Cascade complex was isolated which contained multiple Cas1821 copies, Cas1822, Cas6f and mature crRNAs. PMID:26350210

A Small GTP-Binding Host Protein Is Required for Entry of Powdery Mildew Fungus into Epidermal Cells of Barley1

PubMed Central

Schultheiss, Holger; Dechert, Cornelia; Kogel, Karl-Heinz; Hückelhoven, Ralph

2002-01-01

Small GTP-binding proteins such as those from the RAC family are cytosolic signal transduction proteins that often are involved in processing of extracellular stimuli. Plant RAC proteins are implicated in regulation of plant cell architecture, secondary wall formation, meristem signaling, and defense against pathogens. We isolated a RacB homolog from barley (Hordeum vulgare) to study its role in resistance to the barley powdery mildew fungus (Blumeria graminis f.sp. hordei). RacB was constitutively expressed in the barley epidermis and its expression level was not strongly influenced by inoculation with B. graminis. However, after biolistic bombardment of barley leaf segments with RacB-double-stranded RNA, sequence-specific RNA interference with RacB function inhibited fungal haustorium establishment in a cell-autonomous and genotype-specific manner. Mutants compromised in function of the Mlo wild-type gene and the Ror1 gene (genotype mlo5 ror1) that are moderately susceptible to B. graminis showed no alteration in powdery mildew resistance upon RacB-specific RNA interference. Thus, the phenotype, induced by RacB-specific RNA interference, was apparently dependent on the same processes as mlo5-mediated broad resistance, which is suppressed by ror1. We conclude that an RAC small GTP-binding protein is required for successful fungal haustorium establishment and that this function may be linked to MLO-associated functions. PMID:11950993

Non-target Effects of Green Fluorescent Protein (GFP)-derived Double-Stranded RNA (dsRNA-GFP) Used in Honey Bee RNA Interference (RNAi) Assays

PubMed Central

Nunes, Francis M. F.; Aleixo, Aline C.; Barchuk, Angel R.; Bomtorin, Ana D.; Grozinger, Christina M.; Simões, Zilá L. P.

2013-01-01

RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control. PMID:26466797

Non-Target Effects of Green Fluorescent Protein (GFP)-Derived Double-Stranded RNA (dsRNA-GFP) Used in Honey Bee RNA Interference (RNAi) Assays.

PubMed

Nunes, Francis M F; Aleixo, Aline C; Barchuk, Angel R; Bomtorin, Ana D; Grozinger, Christina M; Simões, Zilá L P

2013-01-04

RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control.

Expression and RNA Interference of Salivary Polygalacturonase Genes in the Tarnished Plant Bug, Lygus lineolaris

PubMed Central

Walker, William B.; Allen, Margaret L.

2010-01-01

Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris. PMID:21062205

Enhancing the cellular uptake of siRNA duplexes following noncovalent packaging with protein transduction domain peptides.

PubMed

Meade, Bryan R; Dowdy, Steven F

2008-03-01

The major limitation in utilizing information rich macromolecules for basic science and therapeutic applications is the inability of these large molecules to readily diffuse across the cellular membrane. While this restriction represents an efficient defense system against cellular penetration of unwanted foreign molecules and thus a crucial component of cell survival, overcoming this cellular characteristic for the intracellular delivery of macromolecules has been the focus of a large number of research groups worldwide. Recently, with the discovery of RNA interference, many of these groups have redirected their attention and have applied previously characterized cell delivery methodologies to synthetic short interfering RNA duplexes (siRNA). Protein transduction domain and cell penetrating peptides have been shown to enhance the delivery of multiple types of macromolecular cargo including peptides, proteins and antisense oligonucleotides and are now being utilized to enhance the cellular uptake of siRNA molecules. The dense cationic charge of these peptides that is critical for interaction with cell membrane components prior to internalization has also been shown to readily package siRNA molecules into stable nanoparticles that are capable of traversing the cell membrane. This review discusses the recent advances in noncovalent packaging of siRNA molecules with cationic peptides and the potential for the resulting complexes to successfully induce RNA interference within both in vitro and in vivo settings.

PEGylated poly(ethylene imine) copolymer-delivered siRNA inhibits HIV replication in vitro.

PubMed

Weber, Nick D; Merkel, Olivia M; Kissel, Thomas; Muñoz-Fernández, María Ángeles

2012-01-10

RNA interference is increasingly being utilized for the specific targeting and down-regulation of disease-causing genes, including targeting viral infections such as HIV. T lymphocytes, the primary target for HIV, are very difficult to treat with gene therapy applications such as RNA interference because of issues with drug delivery. To circumvent these problems, we investigated poly(ethylene imine) (PEI) as a method of improving transfection efficiency of siRNA to T lymphocytes. Additionally, polyethylene glycol (PEG) moieties were engrafted to the PEI polymers with the goals of improving stability and reducing cytotoxicity. Initial studies on PEG-PEI/siRNA polyplex formation, size and their interaction with cell membranes demonstrated their feasibility as drug delivery agents. Assays with lymphocytes revealed low cytotoxicity profiles of the polyplexes at pharmacologically relevant concentrations with PEGylated copolymers obtaining the best results. Successful transfection of a T cell line or primary T cells with siRNA was observed via flow cytometry and confocal microscopy. Finally, the biological effect of copolymer-delivered siRNA was measured. Of particular significance, siRNA targeted to the HIV gene nef and delivered by one of the PEG-PEI copolymers in repetitive treatments every 2-3 days was observed to inhibit HIV replication to the same extent as azidothymidine over the course of 15 days. Copyright © 2011 Elsevier B.V. All rights reserved.

Topological Interference Management for K-User Downlink Massive MIMO Relay Network Channel.

PubMed

Selvaprabhu, Poongundran; Chinnadurai, Sunil; Li, Jun; Lee, Moon Ho

2017-08-17

In this paper, we study the emergence of topological interference alignment and the characterizing features of a multi-user broadcast interference relay channel. We propose an alternative transmission strategy named the relay space-time interference alignment (R-STIA) technique, in which a K -user multiple-input-multiple-output (MIMO) interference channel has massive antennas at the transmitter and relay. Severe interference from unknown transmitters affects the downlink relay network channel and degrades the system performance. An additional (unintended) receiver is introduced in the proposed R-STIA technique to overcome the above problem, since it has the ability to decode the desired signals for the intended receiver by considering cooperation between the receivers. The additional receiver also helps in recovering and reconstructing the interference signals with limited channel state information at the relay (CSIR). The Alamouti space-time transmission technique and minimum mean square error (MMSE) linear precoder are also used in the proposed scheme to detect the presence of interference signals. Numerical results show that the proposed R-STIA technique achieves a better performance in terms of the bit error rate (BER) and sum-rate compared to the existing broadcast channel schemes.

Topological Interference Management for K-User Downlink Massive MIMO Relay Network Channel

PubMed Central

Li, Jun; Lee, Moon Ho

2017-01-01

In this paper, we study the emergence of topological interference alignment and the characterizing features of a multi-user broadcast interference relay channel. We propose an alternative transmission strategy named the relay space-time interference alignment (R-STIA) technique, in which a K-user multiple-input-multiple-output (MIMO) interference channel has massive antennas at the transmitter and relay. Severe interference from unknown transmitters affects the downlink relay network channel and degrades the system performance. An additional (unintended) receiver is introduced in the proposed R-STIA technique to overcome the above problem, since it has the ability to decode the desired signals for the intended receiver by considering cooperation between the receivers. The additional receiver also helps in recovering and reconstructing the interference signals with limited channel state information at the relay (CSIR). The Alamouti space-time transmission technique and minimum mean square error (MMSE) linear precoder are also used in the proposed scheme to detect the presence of interference signals. Numerical results show that the proposed R-STIA technique achieves a better performance in terms of the bit error rate (BER) and sum-rate compared to the existing broadcast channel schemes. PMID:28817071

Hypoxia-inducible factor 1–mediated human GATA1 induction promotes erythroid differentiation under hypoxic conditions

PubMed Central

Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu

2012-01-01

Abstract Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type–specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34+ haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl2 induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. PMID:22050843

RNA interference: learning gene knock-down from cell physiology

PubMed Central

Mocellin, Simone; Provenzano, Maurizio

2004-01-01

Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080

Translation Repression in Human Cells by MicroRNA-Induced Gene Silencing Requires RCK/p54

PubMed Central

Chu, Chia-ying

2006-01-01

RNA interference is triggered by double-stranded RNA that is processed into small interfering RNAs (siRNAs) by Dicer enzyme. Endogenously, RNA interference triggers are created from small noncoding RNAs called microRNAs (miRNAs). RNA-induced silencing complexes (RISC) in human cells can be programmed by exogenously introduced siRNA or endogenously expressed miRNA. siRNA-programmed RISC (siRISC) silences expression by cleaving a perfectly complementary target mRNA, whereas miRNA-induced silencing complexes (miRISC) inhibits translation by binding imperfectly matched sequences in the 3′ UTR of target mRNA. Both RISCs contain Argonaute2 (Ago2), which catalyzes target mRNA cleavage by siRISC and localizes to cytoplasmic mRNA processing bodies (P-bodies). Here, we show that RCK/p54, a DEAD box helicase, interacts with argonaute proteins, Ago1 and Ago2, in affinity-purified active siRISC or miRISC from human cells; directly interacts with Ago1 and Ago2 in vivo, facilitates formation of P-bodies, and is a general repressor of translation. Disrupting P-bodies by depleting Lsm1 did not affect RCK/p54 interactions with argonaute proteins and its function in miRNA-mediated translation repression. Depletion of RCK/p54 disrupted P-bodies and dispersed Ago2 throughout the cytoplasm but did not significantly affect siRNA-mediated RNA functions of RISC. Depleting RCK/p54 released general, miRNA-induced, and let-7-mediated translational repression. Therefore, we propose that translation repression is mediated by miRISC via RCK/p54 and its specificity is dictated by the miRNA sequence binding multiple copies of miRISC to complementary 3′ UTR sites in the target mRNA. These studies also suggest that translation suppression by miRISC does not require P-body structures, and location of miRISC to P-bodies is the consequence of translation repression. PMID:16756390

In-silico analysis for RNA-interference mechanism of α-synuclein to treat Parkinson's disease.

PubMed

Seema, S; Seenivasagam, R; Hemavathi, K

2013-01-01

Parkinson's Disease (PD) causing mutations in α-synuclein gene are ALA30PRO, GLU46LYS and ALA53THR. The conformational changes in proteins with respect to all the three mutations were analysed. These were used to predict the structures of Short Interfering RNA (siRNA) antisense strand and siRNA region. The siRNA binds with the argonaute protein forming RNA Induced Silencing Complex (RISC). Then, siRNA antisense-strand was attached to RISC. The structure of dicer (RNase-III-enzyme) cleaves double-stranded RNA (dsRNA) into two siRNA-strands. Incorporation of single siRNA-strand into RISC guides to pair with the complementary α-synuclein target-messenger RNA (mRNA) thereby enabling it to cleave the target.

Dietary risk assessment of v-ATPase A dsRNAs on monarch butterfly larvae

USDA-ARS?s Scientific Manuscript database

The goal of this study is to assess the risks of RNA interference (RNAi)-based genetically engineered crops on a non-target arthropod, monarch butterfly, Danaus plexippus. We hypothesize that an insecticidal double-stranded (ds) RNA targeting western corn rootworm, Diabrotica virgifera virgifera, ha...

Dana-Farber Cancer Institute: Genome-wide shRNA Screens with DEMETER Inferred Gene Effects | Office of Cancer Genomics

Cancer.gov

In this study RNA interference (RNAi) screens were performed on 285 cell lines and combined with 216 lines previously screened, which were then analyzed together with DEMETER to discover genetic dependencies across the entire pool of cell lines. Read the abstract

Characterizing small RNA populations in non-transgenic and aflatoxin-reducing-transgenic peanut lines

USDA-ARS?s Scientific Manuscript database

Aflatoxin contamination is a major constraint in the food production worlwide. In peanut these aflatoxins are mainly produced by Aspergillus flavus (Link) and A. parasiticus (Speare). The use of RNA interference (RNAi) is a promising method to reduce or prevent the accumulation of aflatoxin in pean...

Techniques for characterization and eradication of potato cyst nematode: a review.

PubMed

Bairwa, Aarti; Venkatasalam, E P; Sudha, R; Umamaheswari, R; Singh, B P

2017-09-01

Correct identification of species and pathotypes is must for eradication of potato cyst nematodes (PCN). The identification of PCN species after completing the life cycle is very difficult because it is based on morphological and morphometrical characteristics. Genetically different populations of PCN are morphologically same and differentiated based on the host differential study. Later on these traditional techniques have been replaced by biochemical techniques viz, one and two dimensional gel electrophoresis, capillary gel electrophoresis, isozymes, dot blot hybridization and isoelectric focusing etc. to distinguish both the species. One and two dimensional gel electrophoresis has used to examine inter- and intra-specific differences in proteins of Globodera rostochiensis and G. pallida . Now application of PCR and DNA based characterization techniques like RAPD, AFLP and RFLP are the important tools for differentiating inter- and intra specific variation in PCN and has given opportunities to accurate identification of PCN. For managing the PCN, till now we are following integrated pest management (IPM) strategies, however these strategies are not effective to eradicate the PCN. Therefore to eradicate the PCN we need noval management practices like RNAi (RNA interference) or Gene silencing.

Lack of WDR36 leads to preimplantation embryonic lethality in mice and delays the formation of small subunit ribosomal RNA in human cells in vitro.

PubMed

Gallenberger, Martin; Meinel, Dominik M; Kroeber, Markus; Wegner, Michael; Milkereit, Philipp; Bösl, Michael R; Tamm, Ernst R

2011-02-01

Mutations in WD repeat domain 36 gene (WDR36) play a causative role in some forms of primary open-angle glaucoma, a leading cause of blindness worldwide. WDR36 is characterized by the presence of multiple WD40 repeats and shows homology to Utp21, an essential protein component of the yeast small subunit (SSU) processome required for maturation of 18S rRNA. To clarify the functional role of WDR36 in the mammalian organism, we generated and investigated mutant mice with a targeted deletion of Wdr36. In parallel experiments, we used RNA interference to deplete WDR36 mRNA in mouse embryos and cultured human trabecular meshwork (HTM-N) cells. Deletion of Wdr36 in the mouse caused preimplantation embryonic lethality, and essentially similar effects were observed when WDR36 mRNA was depleted in mouse embryos by RNA interference. Depletion of WDR36 mRNA in HTM-N cells caused apoptotic cell death and upregulation of mRNA for BAX, TP53 and CDKN1A. By immunocytochemistry, staining for WDR36 was observed in the nucleolus of cells, which co-localized with that of nucleolar proteins such as nucleophosmin and PWP2. In addition, recombinant and epitope-tagged WDR36 localized to the nucleolus of HTM-N cells. By northern blot analysis, a substantial decrease in 21S rRNA, the precursor of 18S rRNA, was observed following knockdown of WDR36. In addition, metabolic-labeling experiments consistently showed a delay of 18S rRNA maturation in WDR36-depleted cells. Our results provide evidence that WDR36 is an essential protein in mammalian cells which is involved in the nucleolar processing of SSU 18S rRNA.

Knockdown of RNA interference pathway genes in western corn rootworm, Diabrotica virgifera virgifera, identifies no fitness costs associated with Argonaute 2 or Dicer-2.

PubMed

Camargo, Carolina; Wu, Ke; Fishilevich, Elane; Narva, Kenneth E; Siegfried, Blair D

2018-06-01

The use of transgenic crops that induce silencing of essential genes using double-stranded RNA (dsRNA) through RNA interference (RNAi) in western corn rootworm, Diabrotica virgifera virgifera, is likely to be an important component of new technologies for the control of this important corn pest. Previous studies have demonstrated that the dsRNA response in D. v. virgifera depends on the presence of RNAi pathway genes including Dicer-2 and Argonaute 2, and that downregulation of these genes limits the lethality of environmental dsRNA. A potential resistance mechanism to lethal dsRNA may involve loss of function of RNAi pathway genes. Howver, the potential for resistance to evolve may depend on whether these pathway genes have essential functions such that the loss of function of core proteins in the RNAi pathway will have fitness costs in D. v. virgifera. Fitness costs associated with potential resistance mechanisms have a central role in determining how resistance can evolve to RNAi technologies in western corn rootworm. We evaluated the effect of dsRNA and microRNA pathway gene knockdown on the development of D. v. virgifera larvae through short-term and long-term exposures to dsRNA for Dicer and Argonaute genes. Downregulation of Argonaute 2, Dicer-2, Dicer-1 did not significantly affect larval survivorship or development through short and long-term exposure to dsRNA. However, downregulation of Argonaute 1 reduced larval survivorship and delayed development. The implications of these results as they relate to D. v. virgifera resistance to lethal dsRNA are discussed. Copyright © 2018 Elsevier Inc. All rights reserved.

RNA interference: new mechanistic and biochemical insights with application in oral cancer therapy.

PubMed

Buduru, Smaranda; Zimta, Alina-Andreea; Ciocan, Cristina; Braicu, Cornelia; Dudea, Diana; Irimie, Alexandra Iulia; Berindan-Neagoe, Ioana

2018-01-01

Over the last few decades, the incidence of oral cancer has gradually increased, due to the negative influence of environmental factors and also abnormalities within the genome. The main issues in oral cancer treatment consist in surpassing resistance and recurrence. However, continuous discovery of altered signaling pathways in these tumors provides valuable information for the identification of novel gene candidates targeted in personalized therapy. RNA interference (RNAi) is a natural mechanism that involves small interfering RNA (siRNA); this can be exploited in biomedical research by using natural or synthetic constructs for activation of the mechanism. Synthetic siRNA transcripts were developed as a versatile class of molecular tools that have a diverse range of programmable roles, being involved in the regulation of several biological processes, thereby providing the perspective of an alternative option to classical treatment. In this review, we summarize the latest information related to the application of siRNA in oral malignancy together with molecular aspects of the technology and also the perspective upon the delivery system. Also, the emergence of newer technologies such as clustered regularly interspaced short palindromic repeats/Cas9 or transcription activator-like effector nucleases in comparison with the RNAi approach is discussed in this paper.

Immunity to Rice black streaked dwarf virus, a plant reovirus, can be achieved in rice plants by RNA silencing against the gene for the viroplasm component protein.

PubMed

Shimizu, Takumi; Nakazono-Nagaoka, Eiko; Akita, Fusamichi; Uehara-Ichiki, Tamaki; Omura, Toshihiro; Sasaya, Takahide

2011-09-01

The nonstructural protein P9-1 of Rice black streaked dwarf virus has been confirmed to accumulate in viroplasms, the putative sites of viral replication, in infected plants and insects. We transformed rice plants by introducing an RNA interference construct against the P9-1-encoding gene. The resultant transgenic plants accumulated short interfering RNAs specific to the construct. All progenies produced by self-fertilization of these transgenic plants with induced RNA interference against the gene for P9-1 were resistant to infection by the virus. Our results demonstrated that interfering with the expression of a viroplasm component protein of plant reoviruses, which plays an important role in viral proliferation, might be a practical and effective way to control plant reovirus infection in crop plants. Copyright © 2011 Elsevier B.V. All rights reserved.

On future's doorstep: RNA interference and the pharmacopeia of tomorrow.

PubMed

Gewirtz, Alan M

2007-12-01

Small molecules and antibodies have revolutionized the treatment of malignant diseases and appear promising for the treatment of many others. Nonetheless, there are many candidate therapeutic targets that are not amenable to attack by the current generation of targeted therapies, and in a small but growing number of patients, resistance to initially successful treatments evolves. This Review Series on the medicinal promise of posttranscriptional gene silencing with small interfering RNA and other molecules capable of inducing RNA interference (RNAi) is motivated by the hypothesis that effectors of RNAi can be developed into effective drugs for treating malignancies as well as many other types of disease. As this Review Series points out, there is still much to do, but many in the field now hope that the time has finally arrived when "antisense" therapies will finally come of age and fulfill their promise as the magic bullets of the 21st century.

Delivery of dsRNA through topical feeding for RNA interference in the citrus sap piercing-sucking hemipteran, Diaphorina citri.

PubMed

Killiny, Nabil; Kishk, Abdelaziz

2017-06-01

RNA interference (RNAi) is a powerful means to study functional genomics in insects. The delivery of dsRNA is a challenging step in the development of RNAi assay. Here, we describe a new delivery method to increase the effectiveness of RNAi in the Asian citrus psyllid Diaphorina citri. Bromophenol blue droplets were topically applied to fifth instar nymphs and adults on the ventral side of the thorax between the three pairs of legs. In addition to video recordings that showed sucking of the bromophenol blue by the stylets, dissected guts turned blue indicating that the uptake was through feeding. Thus, we called the method topical feeding. We targeted the abnormal wing disc gene (awd), also called nucleoside diphosphate kinase (NDPK), as a reporter gene to prove the uptake of dsRNA via this method of delivery. Our results showed that dsRNA-awd caused reduction of awd expression and nymph mortality. Survival and lifespan of adults emerged from treated nymphs and treated adults were affected. Silencing awd caused wing malformation in the adults emerged from treated nymphs. Topical feeding as a delivery of dsRNA is highly efficient for both nymphs and adults. The described method could be used to increase the efficiency of RNAi in D. citri and other sap piercing-sucking hemipterans. © 2017 Wiley Periodicals, Inc.

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis

PubMed Central

Santangeloyz, K.S.; Bertoneyz, A.L.

2011-01-01

summary Objective To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Methods Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RTPCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2−ΔΔCT) method. Results Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P= 0.0045) or >90% (P= 0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Conclusions Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. PMID:21945742

27nt-RNAs guide histone variant deposition via 'RNA-induced DNA replication interference' and thus transmit parental genome partitioning in Stylonychia.

PubMed

Postberg, Jan; Jönsson, Franziska; Weil, Patrick Philipp; Bulic, Aneta; Juranek, Stefan Andreas; Lipps, Hans-Joachim

2018-06-12

During sexual reproduction in the unicellular ciliate Stylonychia somatic macronuclei differentiate from germline micronuclei. Thereby, programmed sequence reduction takes place, leading to the elimination of > 95% of germline sequences, which priorly adopt heterochromatin structure via H3K27me3. Simultaneously, 27nt-ncRNAs become synthesized from parental transcripts and are bound by the Argonaute protein PIWI1. These 27nt-ncRNAs cover sequences destined to the developing macronucleus and are thought to protect them from degradation. We provide evidence and propose that RNA/DNA base-pairing guides PIWI1/27nt-RNA complexes to complementary macronucleus-destined DNA target sequences, hence transiently causing locally stalled replication during polytene chromosome formation. This spatiotemporal delay enables the selective deposition of temporarily available histone H3.4K27me3 nucleosomes at all other sequences being continuously replicated, thus dictating their prospective heterochromatin structure before becoming developmentally eliminated. Concomitantly, 27nt-RNA-covered sites remain protected. We introduce the concept of 'RNA-induced DNA replication interference' and explain how the parental functional genome partition could become transmitted to the progeny.

RNA sensor LGP2 inhibits TRAF ubiquitin ligase to negatively regulate innate immune signaling.

PubMed

Parisien, Jean-Patrick; Lenoir, Jessica J; Mandhana, Roli; Rodriguez, Kenny R; Qian, Kenin; Bruns, Annie M; Horvath, Curt M

2018-06-01

The production of type I interferon (IFN) is essential for cellular barrier functions and innate and adaptive antiviral immunity. In response to virus infections, RNA receptors RIG-I and MDA5 stimulate a mitochondria-localized signaling apparatus that uses TRAF family ubiquitin ligase proteins to activate master transcription regulators IRF3 and NFκB, driving IFN and antiviral target gene expression. Data indicate that a third RNA receptor, LGP2, acts as a negative regulator of antiviral signaling by interfering with TRAF family proteins. Disruption of LGP2 expression in cells results in earlier and overactive transcriptional responses to virus or dsRNA LGP2 associates with the C-terminus of TRAF2, TRAF3, TRAF5, and TRAF6 and interferes with TRAF ubiquitin ligase activity. TRAF interference is independent of LGP2 ATP hydrolysis, RNA binding, or its C-terminal domain, and LGP2 can regulate TRAF-mediated signaling pathways in trans , including IL-1β, TNFα, and cGAMP These findings provide a unique mechanism for LGP2 negative regulation through TRAF suppression and extend the potential impact of LGP2 negative regulation beyond the IFN antiviral response. © 2018 The Authors.

Enzymatic Synthesis of Self-assembled Dicer Substrate RNA Nanostructures for Programmable Gene Silencing.

PubMed

Jang, Bora; Kim, Boyoung; Kim, Hyunsook; Kwon, Hyokyoung; Kim, Minjeong; Seo, Yunmi; Colas, Marion; Jeong, Hansaem; Jeong, Eun Hye; Lee, Kyuri; Lee, Hyukjin

2018-06-08

Enzymatic synthesis of RNA nanostructures is achieved by isothermal rolling circle transcription (RCT). Each arm of RNA nanostructures provides a functional role of Dicer substrate RNA inducing sequence specific RNA interference (RNAi). Three different RNAi sequences (GFP, RFP, and BFP) are incorporated within the three-arm junction RNA nanostructures (Y-RNA). The template and helper DNA strands are designed for the large-scale in vitro synthesis of RNA strands to prepare self-assembled Y-RNA. Interestingly, Dicer processing of Y-RNA is highly influenced by its physical structure and different gene silencing activity is achieved depending on its arm length and overhang. In addition, enzymatic synthesis allows the preparation of various Y-RNA structures using a single DNA template offering on demand regulation of multiple target genes.

The requirement for enhanced CREB1 expression in consolidation of long-term synaptic facilitation and long-term excitability in sensory neurons of Aplysia

PubMed Central

Liu, Rong-Yu; Cleary, Leonard J.; Byrne, John H.

2011-01-01

Accumulating evidence suggests that the transcriptional activator CREB1 is important for serotonin (5-HT)-induced long-term facilitation (LTF) of the sensorimotor synapse in Aplysia. Moreover, creb1 is among the genes activated by CREB1, suggesting a role for this protein beyond the induction phase of LTF. The time course of the requirement for CREB1 synthesis in the consolidation of long-term facilitation was examined using RNA interference (RNAi) techniques in sensorimotor co-cultures. Injection of CREB1 small-interfering RNA (siRNA) immediately or 10 h after 5-HT treatment blocked LTF when measured at 24 h and 48 h after treatment. In contrast, CREB1 siRNA did not block LTF when injected 16 h after 5-HT treatment. These results demonstrate that creb1 expression must be sustained for a relatively long time in order to support the consolidation of LTF. In addition, LTF is also accompanied by a long-term increase in the excitability (LTE) of sensory neurons (SNs). Because LTE was observed in the isolated SN after 5-HT treatment, this long-term change was intrinsic to that element of the circuit. LTE was blocked when CREB1 siRNA was injected into isolated SNs immediately after 5-HT treatment. These data suggest that 5-HT-induced CREB1 synthesis is required for consolidation of both LTF and LTE. PMID:21543617

A yeast model for the mechanism of the Epstein-Barr virus immune evasion identifies a new therapeutic target to interfere with the virus stealthiness.

PubMed

Lista, María José; Martins, Rodrigo Prado; Angrand, Gaelle; Quillévéré, Alicia; Daskalogianni, Chrysoula; Voisset, Cécile; Teulade-Fichou, Marie-Paule; Fåhraeus, Robin; Blondel, Marc

2017-08-31

The oncogenic Epstein-Barr virus (EBV) evades the immune system but has an Achilles heel: its genome maintenance protein EBNA1. Indeed, EBNA1 is essential for viral genome replication and maintenance but also highly antigenic. Hence, EBV evolved a system in which the glycine-alanine repeat (GAr) of EBNA1 limits the translation of its own mRNA at a minimal level to ensure its essential function thereby, at the same time, minimizing immune recognition. Defining intervention points where to interfere with EBNA1 immune evasion is an important step to trigger an immune response against EBV-carrying cancers. Thanks to a yeast-based assay that recapitulates all the aspects of EBNA1 self-limitation of expression, a recent study by Lista et al. [Nature Communications (2017) 7, 435-444] has uncovered the role of the host cell nucleolin (NCL) in this process via a direct interaction of this protein with G-quadruplexes (G4) formed in GAr-encoding sequence of EBNA1 mRNA. In addition, the G4 ligand PhenDC3 prevents NCL binding on EBNA1 mRNA and reverses GAr-mediated repression of translation and antigen presentation. This shows that the NCL-EBNA1 mRNA interaction is a relevant therapeutic target to unveil EBV-carrying cancers to the immune system and that the yeast model can be successfully used for uncovering drugs and host factors that interfere with EBV stealthiness.

Interference activity of a minimal Type I CRISPR-Cas system from Shewanella putrefaciens.

PubMed

Dwarakanath, Srivatsa; Brenzinger, Susanne; Gleditzsch, Daniel; Plagens, André; Klingl, Andreas; Thormann, Kai; Randau, Lennart

2015-10-15

Type I CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas (CRISPR-associated) systems exist in bacterial and archaeal organisms and provide immunity against foreign DNA. The Cas protein content of the DNA interference complexes (termed Cascade) varies between different CRISPR-Cas subtypes. A minimal variant of the Type I-F system was identified in proteobacterial species including Shewanella putrefaciens CN-32. This variant lacks a large subunit (Csy1), Csy2 and Csy3 and contains two unclassified cas genes. The genome of S. putrefaciens CN-32 contains only five Cas proteins (Cas1, Cas3, Cas6f, Cas1821 and Cas1822) and a single CRISPR array with 81 spacers. RNA-Seq analyses revealed the transcription of this array and the maturation of crRNAs (CRISPR RNAs). Interference assays based on plasmid conjugation demonstrated that this CRISPR-Cas system is active in vivo and that activity is dependent on the recognition of the dinucleotide GG PAM (Protospacer Adjacent Motif) sequence and crRNA abundance. The deletion of cas1821 and cas1822 reduced the cellular crRNA pool. Recombinant Cas1821 was shown to form helical filaments bound to RNA molecules, which suggests its role as the Cascade backbone protein. A Cascade complex was isolated which contained multiple Cas1821 copies, Cas1822, Cas6f and mature crRNAs. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple turnover.

PubMed

Rawlings, Renata A; Krishnan, Vishalakshi; Walter, Nils G

2011-04-29

RNA interference is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response to viruses and retrotransposons. During viral infection, the RNase-III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs) 21-24 nucleotides in length and helps load them into the RNA-induced silencing complex (RISC) to guide the cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressors (RSS) that tightly, and presumably quantitatively, bind siRNAs to thwart RNA-interference-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus, as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding [(1.69 ± 0.07) × 10(8) M(-)(1) s(-1)] and marked dissociation (k(off)=0.062 ± 0.002 s(-1)). We also observe that p19 efficiently competes with recombinant Dicer and inhibits the formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. Copyright © 2011 Elsevier Ltd. All rights reserved.

RNA interference: ready to silence cancer?

PubMed

Mocellin, Simone; Costa, Rodolfo; Nitti, Donato

2006-01-01

RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.

Electroporation transiently decreases GJB2 (connexin 26) expression in B16/BL6 melanoma cell line.

PubMed

Rangel, Marcelo Monte Mór; Chaible, Lucas Martins; Nagamine, Marcia Kazumi; Mennecier, Gregory; Cogliati, Bruno; de Oliveira, Krishna Duro; Fukumasu, Heidge; Sinhorini, Idércio Luiz; Mir, Lluis Maria; Dagli, Maria Lúcia Zaidan

2015-02-01

Connexins are proteins that form gap junctions. Perturbations in the cell membrane reportedly promote changes in the expression profile of connexins. Electroporation promotes destabilization by applying electrical pulses, and this procedure is used in electrochemotherapy and gene therapy, among others. This in vitro work aimed to study the interference of electroporation on the expression profile of GJB2 (Cx26 gene) and Connexin 26 in melanoma cell line B16/BL6. The techniques of immunocytochemistry, Western blot, and real-time PCR were used. After electroporation, cells showed a transient decrease in GJB2 mRNA. The immunostaining of Cx26 showed no noticeable change after electroporation at different time points. However, Western blot showed a significant reduction in Cx26 30 min after electroporation. Our results showed that electroporation interferes transiently in the expression of Connexin 26 in melanoma and are consistent with the idea that electroporation is a process of intense stress that promotes cell homeostatic imbalance and results in disruption of cell physiological processes such as transcription and translation.

NAIM and site-specific functional group modification analysis of RNase P RNA: magnesium dependent structure within the conserved P1-P4 multihelix junction contributes to catalysis.

PubMed

Kaye, Nicholas M; Christian, Eric L; Harris, Michael E

2002-04-09

The tRNA processing endonuclease ribonuclease P contains an essential and highly conserved RNA molecule (RNase P RNA) that is the catalytic subunit of the enzyme. To identify and characterize functional groups involved in RNase P RNA catalysis, we applied self-cleaving ribozyme-substrate conjugates, on the basis of the RNase P RNA from Escherichia coli, in nucleotide analogue interference mapping (NAIM) and site-specific modification experiments. At high monovalent ion concentrations (3 M) that facilitate protein-independent substrate binding, we find that the ribozyme is largely insensitive to analogue substitution and that concentrations of Mg2+ (1.25 mM) well below that necessary for optimal catalytic rate (>100 mM) are required to produce interference effects because of modification of nucleotide bases. An examination of the pH dependence of the reaction rate at 1.25 mM Mg2+ indicates that the increased sensitivity to analogue interference is not due to a change in the rate-limiting step. The nucleotide positions detected by NAIM under these conditions are located exclusively in the catalytic domain, consistent with the proposed global structure of the ribozyme, and predominantly occur within the highly conserved P1-P4 multihelix junction. Several sensitive positions in J3/4 and J2/4 are proximal to a previously identified site of divalent metal ion binding in the P1-P4 element. Kinetic analysis of ribozymes with site-specific N7-deazaadenosine and deazaguanosine modifications in J3/4 was, in general, consistent with the interference results and also permitted the analysis of sites not accessible by NAIM. These results show that, in this region only, modification of the N7 positions of A62, A65, and A66 resulted in measurable effects on reaction rate and modification at each position displayed distinct sensitivities to Mg2+ concentration. These results reveal a restricted subset of individual functional groups within the catalytic domain that are particularly important for substrate cleavage and demonstrate a close association between catalytic function and metal ion-dependent structure in the highly conserved P1-P4 multihelix junction.

MafA is a Key Molecule in Glucose and Energy Balance in the Central Nervous System and Peripheral Organs

PubMed Central

Tsuchiya, Mariko; Tsuchiya, Ken; Yasuda, Kazuki; Fujita, Mikiko; Takinishi, Akira; Furukawa, Maiko; Nitta, Kosaku; Maeda, Atsushi

2011-01-01

MafA is a strong transactivator of insulin in pancreatic β cells. Elucidating the profile of MafA action in organs other than the pancreas is essential. We established an mRNA interference technique that modifies the level of target mRNAs in mice in vivo. After rapidly injecting MafA-siRNA, the resulting changes in the gene profile were analyzed using a microarray system. Significant suppression of the MafA mRNA levels was observed in the pancreas, liver, adipose tissue, and brain of siRNA-injected mice. As we reported previously, the down-regulation of insulin mRNA and adipocytokines was observed in the pancreas, and MafA siRNA caused alterations in the expressions of genes related to lipid metabolism and cell growth in the liver, and the attenuation of cell differentiation in cultured adipocytes. In addition to the effects on these organs, MafA expression was immunohistochemically detected in the brain in our preliminary data, and the expression level in siRNA-treated mice was significantly suppressed. The expressions of the affected genes were distinct, including growth hormone, vasopressin, hypocretin, and pro-melanin-concentrating hormone, were almost completely down-regulated (to ~1/100). These results suggested that MafA is likely involved in the regulation of hormonal systems related to glucose metabolism, and MafA is likely positioned near the beginning of the cascade or may influence the expressions of the above-mentioned genes in coordination with other factors in brain tissue. Taken together, the findings in this study suggested that MafA functions as a transcription factor with distinct activities in each organ and is cross-linked in several organs. PMID:23675216

Specificity Protein (Sp) Transcription Factors and Metformin Regulate Expression of the Long Non-coding RNA HULC

EPA Science Inventory

There is evidence that specificity protein 1 (Sp1) transcription factor (TF) regulates expression of long non-coding RNAs (lncRNAs) in hepatocellular carcinoma (HCC) cells. RNA interference (RNAi) studies showed that among several lncRNAs expressed in HepG2, SNU-449 and SK-Hep-1...

Knockdown of Zinc Transporter ZIP5 by RNA Interference Inhibits Esophageal Cancer Growth In Vivo.

PubMed

Li, Qian; Jin, Jing; Liu, Jianghui; Wang, Liqun; He, Yutong

2016-01-01

We recently found that SLC39A5 (ZIP5), a zinc transporter, is overexpressed in esophageal cancer. Downregulation of ZIP5 inhibited the proliferation, migration, and invasion of the esophageal cancer cell line KYSE170 in vitro. In this study, we found that downregulation of SLC39A5 (ZIP5) by interference resulted in a significant reduction in esophageal cancer tumor volume and weight in vivo. COX2 (cyclooxygenase 2) expression was decreased and E-cadherin expression was increased in the KYSE170K xenografts, which was caused by the downregulation of ZIP5. However, we did not find that the downregulation of ZIP5 caused a change in the relative expressions of cyclin D1, VEGF (vascular endothelial growth factor), MMP9 (matrix metalloprotein 9), and Bcl-2 (B-cell lymphoma/leukmia-2) mRNA or an alteration in the average level of zinc in the peripheral blood and xenografts in vivo. Collectively, these findings indicate that knocking down ZIP5 by small interfering RNA (siRNA) might be a novel treatment strategy for esophageal cancer with ZIP5 overexpression.

Double-stranded RNA Oral Delivery Methods to Induce RNA Interference in Phloem and Plant-sap-feeding Hemipteran Insects.

PubMed

Ghosh, Saikat Kumar B; Hunter, Wayne B; Park, Alexis L; Gundersen-Rindal, Dawn E

2018-05-04

Phloem and plant sap feeding insects invade the integrity of crops and fruits to retrieve nutrients, in the process damaging food crops. Hemipteran insects account for a number of economically substantial pests of plants that cause damage to crops by feeding on phloem sap. The brown marmorated stink bug (BMSB), Halyomorpha halys (Heteroptera: Pentatomidae) and the Asian citrus psyllid (ACP), Diaphorina citri Kuwayama (Hemiptera: Liviidae) are hemipteran insect pests introduced in North America, where they are an invasive agricultural pest of high-value specialty, row, and staple crops and citrus fruits, as well as a nuisance pest when they aggregate indoors. Insecticide resistance in many species has led to the development of alternate methods of pest management strategies. Double-stranded RNA (dsRNA)-mediated RNA interference (RNAi) is a gene silencing mechanism for functional genomic studies that has potential applications as a tool for the management of insect pests. Exogenously synthesized dsRNA or small interfering RNA (siRNA) can trigger highly efficient gene silencing through the degradation of endogenous RNA, which is homologous to that presented. Effective and environmental use of RNAi as molecular biopesticides for biocontrol of hemipteran insects requires the in vivo delivery of dsRNAs through feeding. Here we demonstrate methods for delivery of dsRNA to insects: loading of dsRNA into green beans by immersion, and absorbing of gene-specific dsRNA with oral delivery through ingestion. We have also outlined non-transgenic plant delivery approaches using foliar sprays, root drench, trunk injections as well as clay granules, all of which may be essential for sustained release of dsRNA. Efficient delivery by orally ingested dsRNA was confirmed as an effective dosage to induce a significant decrease in expression of targeted genes, such as juvenile hormone acid O-methyltransferase (JHAMT) and vitellogenin (Vg). These innovative methods represent strategies for delivery of dsRNA to use in crop protection and overcome environmental challenges for pest management.

HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs

PubMed Central

Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

2015-01-01

Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses. PMID:25668122

HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs.

PubMed

Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

2015-01-01

Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses.

Fluorescence Cross-Correlation Spectroscopy Reveals Mechanistic Insights into the Effect of 2′-O-Methyl Modified siRNAs in Living Cells

PubMed Central

Ohrt, Thomas; Staroske, Wolfgang; Mütze, Jörg; Crell, Karin; Landthaler, Markus; Schwille, Petra

2011-01-01

RNA interference (RNAi) offers a powerful tool to specifically direct the degradation of complementary RNAs, and thus has great therapeutic potential for targeting diseases. Despite the reported preferences of RNAi, there is still a need for new techniques that will allow for a detailed mechanistic characterization of RNA-induced silencing complex (RISC) assembly and activity to further improve the biocompatibility of modified siRNAs. In contrast to previous reports, we investigated the effects of 2′-O-methyl (2′OMe) modifications introduced at specific positions within the siRNA at the early and late stages of RISC assembly, as well as their influence on target recognition and cleavage directly in living cells. We found that six to 10 2′OMe nucleotides on the 3′-end inhibit passenger-strand release as well as target-RNA cleavage without changing the affinity, strand asymmetry, or target recognition. 2′OMe modifications introduced at the 5′-end reduced activated RISC stability, whereas incorporations at the cleavage site showed only minor effects on passenger-strand release when present on the passenger strand. Our new fluorescence cross-correlation spectroscopy assays resolve different steps and stages of RISC assembly and target recognition with heretofore unresolved detail in living cells, which is needed to develop therapeutic siRNAs with optimized in vivo properties. PMID:21689532

Progress in Genome Editing Technology and Its Application in Plants

PubMed Central

Zhang, Kai; Raboanatahiry, Nadia; Zhu, Bin; Li, Maoteng

2017-01-01

Genome editing technology (GET) is a versatile approach that has progressed rapidly as a mechanism to alter the genotype and phenotype of organisms. However, conventional genome modification using GET cannot satisfy current demand for high-efficiency and site-directed mutagenesis, retrofitting of artificial nucleases has developed into a new avenue within this field. Based on mechanisms to recognize target genes, newly-developed GETs can generally be subdivided into three cleavage systems, protein-dependent DNA cleavage systems (i.e., zinc-finger nucleases, ZFN, and transcription activator-like effector nucleases, TALEN), RNA-dependent DNA cleavage systems (i.e., clustered regularly interspaced short palindromic repeats-CRISPR associated proteins, CRISPR-Cas9, CRISPR-Cpf1, and CRISPR-C2c1), and RNA-dependent RNA cleavage systems (i.e., RNA interference, RNAi, and CRISPR-C2c2). All these techniques can lead to double-stranded (DSB) or single-stranded breaks (SSB), and result in either random mutations via non-homologous end-joining (NHEJ) or targeted mutation via homologous recombination (HR). Thus, site-directed mutagenesis can be induced via targeted gene knock-out, knock-in, or replacement to modify specific characteristics including morphology-modification, resistance-enhancement, and physiological mechanism-improvement along with plant growth and development. In this paper, an non-comprehensive review on the development of different GETs as applied to plants is presented. PMID:28261237

Effects of tripolyphosphate on cellular uptake and RNA interference efficiency of chitosan-based nanoparticles in Raw 264.7 macrophages.

PubMed

Xiao, Bo; Ma, Panpan; Ma, Lijun; Chen, Qiubing; Si, Xiaoying; Walter, Lewins; Merlin, Didier

2017-03-15

Tumor necrosis factor-α (TNF-α) is a major pro-inflammatory cytokine that is mainly secreted by macrophages during inflammation. Here, we synthesized a series of N-(2-hydroxy)propyl-3-trimethyl ammonium chitosan chlorides (HTCCs), and then used a complex coacervation technique or tripolyphosphate (TPP)-assisted ionotropic gelation strategy to complex the HTCCs with TNF-α siRNA (siTNF) to form nanoparticles (NPs). The resultant NPs had a desirable particle size (210-279nm), a slightly positive zeta potential (14-22mV), and negligible cytotoxicity against Raw 264.7 macrophages and colon-26 cells. Subsequent cellular uptake tests demonstrated that the introduction of TPP to the NPs markedly increased their cellular uptake efficiency (to nearly 100%) compared with TPP-free NPs, and yielded a correspondingly higher intracellular concentration of siRNA. Critically, in vitro gene silencing experiments revealed that all of the TPP-containing NPs showed excellent efficiency in inhibiting the mRNA expression level of TNF-α (by approximately 85-92%, which was much higher than that obtained using Oligofectamine/siTNF complexes). Collectively, these results obviously suggest that our non-toxic TPP-containing chitosan-based NPs can be exploited as efficient siTNF carriers for the treatment of inflammatory diseases. Copyright © 2016 Elsevier Inc. All rights reserved.

A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.

PubMed

Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi

2018-02-12

Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.

Backbone and sidechain methyl Ile (δ1), Leu and Val chemical shift assignments of RDE-4 (1-243), an RNA interference initiation protein in C. elegans.

PubMed

Chiliveri, Sai Chaitanya; Kumar, Sonu; Marelli, Udaya Kiran; Deshmukh, Mandar V

2012-10-01

The RNAi pathway of several organisms requires presence of double stranded RNA binding proteins for functioning of Dicer in gene regulation. In C. elegans, a double stranded RNA binding protein, RDE-4 (385 aa, 44 kDa) recognizes long exogenous dsRNA and initiates the RNAi pathway. We have achieved complete backbone and stereospecific methyl sidechain Ile (δ1), Leu and Val chemical shifts of first 243 amino acids of RDE-4, namely RDE-4ΔC.

Iron(II) supramolecular helicates interfere with the HIV-1 Tat-TAR RNA interaction critical for viral replication.

PubMed

Malina, Jaroslav; Hannon, Michael J; Brabec, Viktor

2016-07-12

The interaction between the HIV-1 transactivator protein Tat and TAR (transactivation responsive region) RNA, plays a critical role in HIV-1 transcription. Iron(II) supramolecular helicates were evaluated for their in vitro activity to inhibit Tat-TAR RNA interaction using UV melting studies, electrophoretic mobility shift assay, and RNase A footprinting. The results demonstrate that iron(II) supramolecular helicates inhibit Tat-TAR interaction at nanomolar concentrations by binding to TAR RNA. These studies provide a new insight into the biological potential of metallosupramolecular helicates.

Electronic heterodyne recording of interference patterns

NASA Technical Reports Server (NTRS)

Merat, F. L.; Claspy, P. C.

1979-01-01

An electronic heterodyne technique is being investigated for video (i.e., television rate and format) recording of interference patterns. In the heterodyne technique electro-optic modulation is used to introduce a sinusoidal phase shift between the beams of an interferometer. For phase modulation frequencies between 0.1 and 15 MHz an image dissector camera may be used to scan the resulting temporally modulated interference pattern. Heterodyne detection of the camera output is used to selectively record the interference pattern. An advantage of such synchronous recording is that it permits recording of low-contrast fringes in high ambient light conditions. The application of this technique to the recording of holograms is discussed.

Handling of uncertainty due to interference fringe in FT-NIR transmittance spectroscopy - Performance comparison of interference elimination techniques using glucose-water system

NASA Astrophysics Data System (ADS)

Beganović, Anel; Beć, Krzysztof B.; Henn, Raphael; Huck, Christian W.

2018-05-01

The applicability of two elimination techniques for interferences occurring in measurements with cells of short pathlength using Fourier transform near-infrared (FT-NIR) spectroscopy was evaluated. Due to the growing interest in the field of vibrational spectroscopy in aqueous biological fluids (e.g. glucose in blood), aqueous solutions of D-(+)-glucose were prepared and split into a calibration set and an independent validation set. All samples were measured with two FT-NIR spectrometers at various spectral resolutions. Moving average smoothing (MAS) and fast Fourier transform filter (FFT filter) were applied to the interference affected FT-NIR spectra in order to eliminate the interference pattern. After data pre-treatment, partial least squares regression (PLSR) models using different NIR regions were constructed using untreated (interference affected) spectra and spectra treated with MAS and FFT filter. The prediction of the independent validation set revealed information about the performance of the utilized interference elimination techniques, as well as the different NIR regions. The results showed that the combination band of water at approx. 5200 cm-1 is of great importance since its performance was superior to the one of the so-called first overtone of water at approx. 6800 cm-1. Furthermore, this work demonstrated that MAS and FFT filter are fast and easy-to-use techniques for the elimination of interference fringes in FT-NIR transmittance spectroscopy.

Two classes of silencing RNAs move between C. elegans tissues

PubMed Central

Jose, Antony M; Garcia, Giancarlo A; Hunter, Craig P

2011-01-01

Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the endonuclease DCR-1, which cleaves long dsRNA into double-stranded short-interfering RNA (ds-siRNA), and the putative nucleotidyltransferase MUT-2 (RDE-3). However, single-stranded siRNA and downstream secondary siRNA produced upon amplification by the RNA-dependent RNA Polymerase RRF-1 do not generate mobile silencing RNA. Restricting inter-tissue transport to long dsRNA and directly processed siRNA intermediates rather than amplified siRNA may serve to modulate the extent of systemic silencing in proportion to available dsRNA. PMID:21984186

Role of caspase-9 in the effector caspases and genome expressions, and growth of bovine skeletal myoblasts.

PubMed

Van Ba, Hoa; Hwang, Inho

2014-02-01

Caspase-9 has been reported as the key regulator of apoptosis, however, its role in skeletal myoblast development and molecular involvements during cell growth still remains unknown. The current study aimed to present the key role of caspase-9 in the expressions of apoptotic caspases and genome, and cell viability during myoblast growth using RNA interference mediated silencing. Three small interference RNA sequences (siRNAs) targeting caspase-9 gene was designed and ligated into pSilencer plasmid vector to construct shRNA expression constructs. Cells were transfected with the constructs for 48 h. Results indicated that all three siRNAs could silence the caspase-9 mRNA expression significantly. Particularly, the mRNA expression level of caspase-9 in the cells transfected by shRNA1, shRNA2 and shRNA3 constructs were reduced by 37.85%, 68.20% and 58.14%, respectively. Suppression of caspase-9 led to the significant increases in the mRNA and protein expressions of effector caspase-3, whereas the reduction in mRNA and protein expressions of caspase-7. The microarray results showed that the suppression of caspase-9 resulted in significant upregulations of cell proliferation-, adhesion-, growth-, development- and division-regulating genes, whereas the reduction in the expressions of cell death program- and stress response-regulating genes. Furthermore, cell viability was significantly increased following the transfection. These data suggest that caspase-9 could play an important role in the control of cell growth, and knockdown of caspase-9 may have genuine potential in the treatment of skeletal muscle atrophy. © 2013 The Authors Development, Growth & Differentiation © 2013 Japanese Society of Developmental Biologists.

High-chroma visual cryptography using interference color of high-order retarder films

NASA Astrophysics Data System (ADS)

Sugawara, Shiori; Harada, Kenji; Sakai, Daisuke

2015-08-01

Visual cryptography can be used as a method of sharing a secret image through several encrypted images. Conventional visual cryptography can display only monochrome images. We have developed a high-chroma color visual encryption technique using the interference color of high-order retarder films. The encrypted films are composed of a polarizing film and retarder films. The retarder films exhibit interference color when they are sandwiched between two polarizing films. We propose a stacking technique for displaying high-chroma interference color images. A prototype visual cryptography device using high-chroma interference color is developed.

Genome characterization of Sugarcane Yellow Leaf Virus with special reference to RNAi based molecular breeding.

PubMed

Khalil, Farghama; Yueyu, Xu; Naiyan, Xiao; Di, Liu; Tayyab, Muhammad; Hengbo, Wang; Islam, Waqar; Rauf, Saeed; Pinghua, Chen

2018-05-04

Sugarcane is an essential crop for sugar and biofuel. Globally, its production is severely affected by sugarcane yellow leaf disease (SCYLD) caused by Sugarcane Yellow Leaf Virus (SCYLV). Many aphid vectors are involved in the spread of the disease which reduced the effectiveness of cultural and chemical management. Empirical methods of plant breeding such as introgression from wild and cultivated germplasm were not possible or at least challenging due to the absence of resistance in cultivated and wild germplasm of sugarcane. RNA interference (RNAi) transformation is an effective method to create virus-resistant varieties. Nevertheless, limited progress has been made due to lack of comprehensive research program on SCYLV based on RNAi technique. In order to show improvement and to propose future strategies for the feasibility of the RNAi technique to cope SCYLV, genome-wide consensus sequences of SCYLV were analyzed through GenBank. The coverage rates of every consensus sequence in SCYLV isolates were calculated to evaluate their practicability. Our analysis showed that single consensus sequence from SCYLV could not work well for RNAi based sugarcane breeding programs. This may be due to high mutation rate and continuous recombination within and between various viral strains. Alternative multi-target RNAi strategy is suggested to combat several strains of the viruses and to reduce the silencing escape. The multi-target small interfering RNA (siRNA) can be used together to construct RNAi plant expression plasmid, and to transform sugarcane tissues to develop new sugarcane varieties resistant to SCYLV. Copyright © 2018 Elsevier Ltd. All rights reserved.

Next-gen tissue: preservation of molecular and morphological fidelity in prostate tissue.

PubMed

Gillard, Marc; Tom, Westin R; Antic, Tatjana; Paner, Gladell P; Lingen, Mark W; VanderWeele, David J

2015-01-01

Personalization of cancer therapy requires molecular evaluation of tumor tissue. Traditional tissue preservation involves formalin fixation, which degrades the quality of nucleic acids. Strategies to bank frozen prostate tissue can interfere with diagnostic studies. PAXgene is an alternative fixative that preserves protein and nucleic acid quality. Portions of prostates obtained from autopsy specimens were fixed in either 10% buffered formalin or PAXgene, and processed and embedded in paraffin. Additional sections were immediately embedded in OCT and frozen. DNA and RNA were extracted from the formalin-fixed, PAXgene-fixed, or frozen tissue. Quantitative PCR was used to compare the quality of DNA and RNA obtained from all three tissue types. In addition, 5 μm sections were cut from specimens devoid of cancer and from prostate cancer specimens obtained at prostatectomy and fixed in PAXgene. They were either stained with hematoxylin and eosin or interrogated with antibodies for p63, PSA and p504. Comparable tissue morphology was observed in both the formalin and PAXgene-fixed specimens. Similarly, immunohistochemical expression of the P63, PSA and P504 proteins was comparable between formalin and PAXgene fixation techniques. DNA from the PAXgene-fixed tissue was of similar quality to that from frozen tissue. RNA was also amplified with up to 8-fold greater efficiency in the PAXgene fixed tissue compared to the formalin-fixed tissue. Prostate specimens fixed with PAXgene have preserved histologic morphology, stain appropriately, and have preserved quality of nucleic acids. PAXgene fixation facilitates the use of prostatectomy tissue for molecular biology techniques such as next-generation sequencing.

Promoter of lncRNA Gene PVT1 Is a Tumor-Suppressor DNA Boundary Element. | Office of Cancer Genomics

Cancer.gov

Noncoding mutations in cancer genomes are frequent but challenging to interpret. PVT1 encodes an oncogenic lncRNA, but recurrent translocations and deletions in human cancers suggest alternative mechanisms. Here, we show that the PVT1 promoter has a tumor-suppressor function that is independent of PVT1 lncRNA. CRISPR interference of PVT1 promoter enhances breast cancer cell competition and growth in vivo.

Sequence-specific inhibition of Dicer measured with a force-based microarray for RNA ligands.

PubMed

Limmer, Katja; Aschenbrenner, Daniela; Gaub, Hermann E

2013-04-01

Malfunction of protein translation causes many severe diseases, and suitable correction strategies may become the basis of effective therapies. One major regulatory element of protein translation is the nuclease Dicer that cuts double-stranded RNA independently of the sequence into pieces of 19-22 base pairs starting the RNA interference pathway and activating miRNAs. Inhibiting Dicer is not desirable owing to its multifunctional influence on the cell's gene regulation. Blocking specific RNA sequences by small-molecule binding, however, is a promising approach to affect the cell's condition in a controlled manner. A label-free assay for the screening of site-specific interference of small molecules with Dicer activity is thus needed. We used the Molecular Force Assay (MFA), recently developed in our lab, to measure the activity of Dicer. As a model system, we used an RNA sequence that forms an aptamer-binding site for paromomycin, a 615-dalton aminoglycoside. We show that Dicer activity is modulated as a function of concentration and incubation time: the addition of paromomycin leads to a decrease of Dicer activity according to the amount of ligand. The measured dissociation constant of paromomycin to its aptamer was found to agree well with literature values. The parallel format of the MFA allows a large-scale search and analysis for ligands for any RNA sequence.

Efficient HIV-1 inhibition by a 16 nt-long RNA aptamer designed by combining in vitro selection and in silico optimisation strategies

PubMed Central

Sánchez-Luque, Francisco J.; Stich, Michael; Manrubia, Susanna; Briones, Carlos; Berzal-Herranz, Alfredo

2014-01-01

The human immunodeficiency virus type-1 (HIV-1) genome contains multiple, highly conserved structural RNA domains that play key roles in essential viral processes. Interference with the function of these RNA domains either by disrupting their structures or by blocking their interaction with viral or cellular factors may seriously compromise HIV-1 viability. RNA aptamers are amongst the most promising synthetic molecules able to interact with structural domains of viral genomes. However, aptamer shortening up to their minimal active domain is usually necessary for scaling up production, what requires very time-consuming, trial-and-error approaches. Here we report on the in vitro selection of 64 nt-long specific aptamers against the complete 5′-untranslated region of HIV-1 genome, which inhibit more than 75% of HIV-1 production in a human cell line. The analysis of the selected sequences and structures allowed for the identification of a highly conserved 16 nt-long stem-loop motif containing a common 8 nt-long apical loop. Based on this result, an in silico designed 16 nt-long RNA aptamer, termed RNApt16, was synthesized, with sequence 5′-CCCCGGCAAGGAGGGG-3′. The HIV-1 inhibition efficiency of such an aptamer was close to 85%, thus constituting the shortest RNA molecule so far described that efficiently interferes with HIV-1 replication. PMID:25175101

Inhibition of CD147 expression by RNA interference reduces proliferation, invasion and increases chemosensitivity in cancer stem cell-like HT-29 cells.

PubMed

Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui

2015-10-01

The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.

RNA interference targets arbovirus replication in Culicoides cells.

PubMed

Schnettler, Esther; Ratinier, Maxime; Watson, Mick; Shaw, Andrew E; McFarlane, Melanie; Varela, Mariana; Elliott, Richard M; Palmarini, Massimo; Kohl, Alain

2013-03-01

Arboviruses are transmitted to vertebrate hosts by biting arthropod vectors such as mosquitoes, ticks, and midges. These viruses replicate in both arthropods and vertebrates and are thus exposed to different antiviral responses in these organisms. RNA interference (RNAi) is a sequence-specific RNA degradation mechanism that has been shown to play a major role in the antiviral response against arboviruses in mosquitoes. Culicoides midges are important vectors of arboviruses, known to transmit pathogens of humans and livestock such as bluetongue virus (BTV) (Reoviridae), Oropouche virus (Bunyaviridae), and likely the recently discovered Schmallenberg virus (Bunyaviridae). In this study, we investigated whether Culicoides cells possess an antiviral RNAi response and whether this is effective against arboviruses, including those with double-stranded RNA (dsRNA) genomes, such as BTV. Using reporter gene-based assays, we established the presence of a functional RNAi response in Culicoides sonorensis-derived KC cells which is effective in inhibiting BTV infection. Sequencing of small RNAs from KC and Aedes aegypti-derived Aag2 cells infected with BTV or the unrelated Schmallenberg virus resulted in the production of virus-derived small interfering RNAs (viRNAs) of 21 nucleotides, similar to the viRNAs produced during arbovirus infections of mosquitoes. In addition, viRNA profiles strongly suggest that the BTV dsRNA genome is accessible to a Dicer-type nuclease. Thus, we show for the first time that midge cells target arbovirus replication by mounting an antiviral RNAi response mainly resembling that of other insect vectors of arboviruses.

Prediction of effective RNA interference targets and pathway-related genes in lepidopteran insects by RNA sequencing analysis.

PubMed

Guan, Ruo-Bing; Li, Hai-Chao; Miao, Xue-Xia

2018-06-01

When using RNA interference (RNAi) to study gene functions in Lepidoptera insects, we discovered that some genes could not be suppressed; instead, their expression levels could be up-regulated by double-stranded RNA (dsRNA). To predict which genes could be easily silenced, we treated the Asian corn borer (Ostrinia furnacalis) with dsGFP (green fluorescent protein) and dsMLP (muscle lim protein). A transcriptome sequence analysis was conducted using the cDNAs 6 h after treatment with dsRNA. The results indicated that 160 genes were up-regulated and 44 genes were down-regulated by the two dsRNAs. Then, 50 co-up-regulated, 25 co-down-regulated and 43 unaffected genes were selected to determine their RNAi responses. All the 25 down-regulated genes were knocked down by their corresponding dsRNA. However, several of the up-regulated and unaffected genes were up-regulated when treated with their corresponding dsRNAs instead of being knocked down. The genes up-regulated by the dsGFP treatment may be involved in insect immune responses or the RNAi pathway. When the immune-related genes were excluded, only seven genes were induced by dsGFP, including ago-2 and dicer-2. These results not only provide a reference for efficient RNAi target predications, but also provide some potential RNAi pathway-related genes for further study. © 2017 Institute of Zoology, Chinese Academy of Sciences.

Reversal of multidrug resistance in MCF-7/Adr cells by codelivery of doxorubicin and BCL2 siRNA using a folic acid-conjugated polyethylenimine hydroxypropyl-β-cyclodextrin nanocarrier

PubMed Central

Li, Jin-Ming; Zhang, Wei; Su, Hua; Wang, Yuan-Yuan; Tan, Cai-Ping; Ji, Liang-Nian; Mao, Zong-Wan

2015-01-01

Systemic administration of chemotherapy for cancer often faces drug resistance, limiting its applications in cancer therapy. In this study, we developed a simple multifunctional nanocarrier based on polyethylenimine (PEI) to codeliver doxorubicin (DOX) and BCL2 small interfering RNA (siRNA) for overcoming multidrug resistance (MDR) and enhancing apoptosis in MCF-7/Adr cancer cells by combining chemotherapy and RNA interference (RNAi) therapy. The low-molecular-weight branch PEI was used to conjugate hydroxypropyl-β-cyclodextrin (HP-β-CD) and folic acid (FA), forming the codelivery nanocarrier (FA-HP-β-CD-PEI) to encapsulate DOX with the cavity HP-β-CD and bind siRNA with the positive charge of PEI for tumor-targeting codelivering drugs. The drug-loaded nanocomplexes (FA-HP-β-CD-PEI/DOX/siRNA) showed uniform size distribution, high cellular uptake, and significant gene suppression of BCL2, displaying the potential of overcoming MDR for enhancing the effect of anticancer drugs. Furthermore, the nanocomplexes achieved significant cell apoptosis through a mechanism of downregulating the antiapoptotic protein BCL2, resulted in improving therapeutic efficacy of the coadministered DOX by tumor targeting and RNA interference. Our study indicated that combined RNAi therapy and chemotherapy using our functional codelivery nanocarrier could overcome MDR and enhance apoptosis in MDR cancer cells for a potential application in treating MDR cancers. PMID:25960653

Small RNA binding is a common strategy to suppress RNA silencing by several viral suppressors

PubMed Central

Lakatos, Lóránt; Csorba, Tibor; Pantaleo, Vitantonio; Chapman, Elisabeth J; Carrington, James C; Liu, Yu-Ping; Dolja, Valerian V; Calvino, Lourdes Fernández; López-Moya, Juan José; Burgyán, József

2006-01-01

RNA silencing is an evolutionarily conserved system that functions as an antiviral mechanism in higher plants and insects. To counteract RNA silencing, viruses express silencing suppressors that interfere with both siRNA- and microRNA-guided silencing pathways. We used comparative in vitro and in vivo approaches to analyse the molecular mechanism of suppression by three well-studied silencing suppressors. We found that silencing suppressors p19, p21 and HC-Pro each inhibit the intermediate step of RNA silencing via binding to siRNAs, although the molecular features required for duplex siRNA binding differ among the three proteins. None of the suppressors affected the activity of preassembled RISC complexes. In contrast, each suppressor uniformly inhibited the siRNA-initiated RISC assembly pathway by preventing RNA silencing initiator complex formation. PMID:16724105

CCD filter and transform techniques for interference excision

NASA Technical Reports Server (NTRS)

Borsuk, G. M.; Dewitt, R. N.

1976-01-01

The theoretical and some experimental results of a study aimed at applying CCD filter and transform techniques to the problem of interference excision within communications channels were presented. Adaptive noise (interference) suppression was achieved by the modification of received signals such that they were orthogonal to the recently measured noise field. CCD techniques were examined to develop real-time noise excision processing. They were recursive filters, circulating filter banks, transversal filter banks, an optical implementation of the chirp Z transform, and a CCD analog FFT.

RNAi-mediated mortality of the whitefly through transgenic expression of double-stranded RNA homologous to acetylcholinesterase and ecdysone receptor in tobacco plants

USDA-ARS?s Scientific Manuscript database

The whitefly Bemisia tabaci (Genn.) is a pest and vector of plant viruses affecting plants worldwide. Using RNA interference (RNAi) to downregulate whitefly genes by expressing their homologous double stranded RNAs in plants has great potential for management of whiteflies to reduce plant virus dise...

Double strand RNA oral delivery methods to induce RNA interference in phloem and plant-sap-feeding insects

USDA-ARS?s Scientific Manuscript database

Phloem and plant sap feeding insect pests invade the integrity of crops and fruits to retrieve nutrients in the process damaging food productivity. Hemipteran insects account for a number of economically substantial pests of plants that cause damage to crops by feeding on phloem sap. Halyomorpha hal...

Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

PubMed Central

2010-01-01

Background Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEXGM-CSF, we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. Methods To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Results Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. Conclusions This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials. PMID:20836854

[Inhibitory effect of RNA interference targeting GFI-1 on the proliferation of atypical chronic myelogenous leukemia NT1 cells].

PubMed

Yang, X; Liu, H; Lin, Z H; Qian, J; Xu, X R

2016-08-01

To investigate the inhibitory effects of RNA interference targeting GFI-1 on growth and proliferation of atypical chronic myelogenous leukemia (aCML) NT1 cells. NT1 cells were transfected with PBS and liposome complex (vehicle group), scrambled siRNA and liposome complex (negative control, NC group), and GFI-1 siRNA and liposome complex (GFI-1 siRNA group), respectively. Real-time quantitative RT-PCR (qRT-PCR) and Western blot were performed to examine the expression levels of GFI-1 mRNA and protein, respectively. The proliferation abilities of NT1 cells of the three groups were evaluated by MTT assay. The cell cycle in cells of the three groups was analyzed by flow cytometry. Moreover, nude mouse xenograft model was used to detect the tumor formation ability in the three group cells. Quantitative real-time PCR data showed that the expression level of GFI-1 mRNA in GFI-1 siRNA group was significantly lower than those of NC group and vehicle group [(0.367±0.017) vs. (0.918±0.006) and (1.010±0.005), respectively, (P<0.05)]. Western blot results showed that the GFI-1 protein expression level in the GFI-1 siRNA group was also significantly reduced, compared with those of the NC group and vehicle group (P<0.05 for both). From MTT assay data, the absorbance value of NT1 cells in the GFI-1 siRNA group (0.667±0.059) was significantly lower than those of the NC group (1.096±0.049) and vehicle group (1.193±0.064, P=0.023). Flow cytometry data showed that sub-G1 and G0/G1 phase proportions of the GFI-1 siRNA group were significantly higher than those of the NC and vehicle groups [sub-G1: (8.2±2.5)% vs. (1.9±1.3)% and (2.0±3.6)%, respectively, (P<0.05); G0/G1: (66.7±3.8)% vs. (53.3±4.5)% and (48.6±3.2)%, respectively, (P<0.05)]. Furthermore, the tumor weight in the GFI-1 siRNA group [(0.37±0.02) g] was significantly lower than those in the NC group [(0.83±0.06) g] and vehicle group [(0.92±0.04) g] (P<0.05). RNA interference targeting GFI-1 inhibits the growth and proliferation of NT1 cells, which may provide a new therapeutic target for atypical chronic myelogenous leukemia.

The effect of Pokemon on bladder cancer epithelial-mesenchymal transition.

PubMed

Guo, Changcheng; Zhu, Kai; Sun, Wei; Yang, Bin; Gu, Wenyu; Luo, Jun; Peng, Bo; Zheng, Junhua

2014-01-24

This study aimed at detecting Pokemon expression in bladder cancer cell and investigating the relationship between Pokemon and epithelial-mesenchymal transition. Furthermore, we investigated the functions of Pokemon in the carcinogenesis and development of bladder cancer. This study was also designed to observe the inhibitory effects of siRNA expression vector on Pokemon in bladder cancer cell. The siRNA expression vectors which were constructed to express a short hairpin RNA against Pokemon were transfected to the bladder cancer cells T24 with a liposome. Levels of Pokemon, E-cadherin and β-catenin mRNA and protein were examined by real-time quantitative-fluorescent PCR and Western blot analysis, respectively. The effects of Pokemon silencing on epithelial-mesenchymal transition of T24 cells were evaluated with wound-healing assay. Pokemon was strongly inhibited by siRNA treatment, especially siRNA3 treatment group, as it was reflected by Western blot and real-time PCR. The gene and protein of E-cadherin expression level showed increased markedly after Pokemon was inhibited by RNA interference. While there were no differences in the levels of gene and protein of β-catenin among five groups. The bladder cancer cell after Pokemon siRNA interference showed a significantly reduced wound-closing efficiency at 6, 12 and 24h. Our findings suggest Pokemon may inhibit the expression of E-cadherin. The low expression of E-cadherin lead to increasing the phenotype and apical-base polarity of epithelial cells. These changes of cells may result in the recurrence and progression of bladder cancer at last. Copyright © 2013 Elsevier Inc. All rights reserved.

Usefulness of multiple chalk-based food colorings for inducing better gene silencing by feeding RNA interference in planarians.

PubMed

Hattori, Miki; Miyamoto, Mai; Hosoda, Kazutaka; Umesono, Yoshihiko

2018-01-01

Planarians have become widely recognized as one of the major animal models for regeneration studies in invertebrates. To induce RNA interference (RNAi) by feeding in planarians, the widely accepted protocol is one in which animals undergo two or three feedings of food containing double-stranded RNA (dsRNA) plus visible food coloring (e.g., blood) for confirmation of feeding by individual animals. However, one possible problem is that incorporated food coloring is often retained within the gut for several days, which makes it difficult to confirm the success of each round of dsRNA feeding based on the difference of the color density within the gut before and after feeding. As a consequence, the difference of appetite levels among individuals undergoing dsRNA feeding leads to phenotypic variability among them due to insufficient knockdown. In our attempts to overcome this problem, we have developed a novel method for achieving robust confirmation of the success of dsRNA feeding in individuals fed multiple times by means of including a combination of three different colored chalks (pink, yellow and blue) as food coloring. Notably, we found that this method is superior to the conventional method for positively marking individuals that actively consumed the dsRNA-containing food during four times of once-daily feeding. Using these selected animals, we obtained stable and sufficiently strong RNAi-induced phenotypes. We termed this improved multi-colored chalk-spiked method of feeding RNAi "Candi" and propose its benefits for gene function analysis in planarians. © 2017 Japanese Society of Developmental Biologists.

AKAP-Lbc mobilizes a cardiac hypertrophy signaling pathway.

PubMed

Carnegie, Graeme K; Soughayer, Joseph; Smith, F Donelson; Pedroja, Benjamin S; Zhang, Fang; Diviani, Dario; Bristow, Michael R; Kunkel, Maya T; Newton, Alexandra C; Langeberg, Lorene K; Scott, John D

2008-10-24

Elevated catecholamines in the heart evoke transcriptional activation of the Myocyte Enhancer Factor (MEF) pathway to induce a cellular response known as pathological myocardial hypertrophy. We have discovered that the A-Kinase Anchoring Protein (AKAP)-Lbc is upregulated in hypertrophic cardiomyocytes. It coordinates activation and movement of signaling proteins that initiate MEF2-mediated transcriptional reprogramming events. Live-cell imaging, fluorescent kinase activity reporters, and RNA interference techniques show that AKAP-Lbc couples activation of protein kinase D (PKD) with the phosphorylation-dependent nuclear export of the class II histone deacetylase HDAC5. These studies uncover a role for AKAP-Lbc in which increased expression of the anchoring protein selectively amplifies a signaling pathway that drives cardiac myocytes toward a pathophysiological outcome.

RNA interference targeting cytosolic NADP(+)-dependent isocitrate dehydrogenase exerts anti-obesity effect in vitro and in vivo.

PubMed

Nam, Woo Suk; Park, Kwon Moo; Park, Jeen-Woo

2012-08-01

A metabolic abnormality in lipid biosynthesis is frequently associated with obesity and hyperlipidemia. Nicotinamide adenine dinucleotide phosphate-oxidase (NADPH) is an essential reducing equivalent for numerous enzymes required in fat and cholesterol biosynthesis. Cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) has been proposed as a key enzyme for supplying cytosolic NADPH. We report here that knockdown of IDPc expression by Ribonucleic acid (RNA) interference (RNAi) inhibited adipocyte differentiation and lipogenesis in 3T3-L1 preadipocytes and mice. Attenuated IDPc expression by IDPc small interfering RNA (siRNA) resulted in a reduction of differentiation and triglyceride level and adipogenic protein expression as well as suppression of glucose uptake in cultured adipocytes. In addition, the attenuation of Nox activity and Reactive oxygen species (ROS) generation accompanied with knockdown of IDPc was associated with inhibition of adipogenesis and lipogenesis. The loss of body weight and the reduction of triglyceride level were also observed in diet-induced obese mice transduced with IDPc short-hairpin (shRNA). Taken together, the inhibiting effect of RNAi targeting IDPc on adipogenesis and lipid biosynthesis is considered to be of therapeutic value in the treatment and prevention of obesity and obesity-associated metabolic syndrome. © 2012 Elsevier B.V. All rights reserved.

Tumor-specific RNA interference targeting Pokemon suppresses tumor growth and induces apoptosis in prostate cancer.

PubMed

Li, Yining; Xu, Shuxiong; Wang, Xiangwei; Shi, Hua; Sun, Zhaolin; Yang, Zhao

2013-02-01

To explore the exact mechanism of Pokemon in prostate cancer. Pokemon is a member of the POK family of transcriptional repressors. Its main function is suppression of the p14ARF (alternate reading frame) tumor suppressor gene. Although Pokemon expression has been found to be increased in various types of lymphoma, the exact mechanism of the gene in prostate cancer is not clear. In the present study, prostate cancer cells were transfected with the specific short hairpin ribonucleic acid (RNA) expression vector targeting Pokemon. The expression of Pokemon messenger RNA and its protein was detected by semiquantitative reverse transcriptase-polymerase chain reaction and Western blotting, respectively. The cell growth and cell apoptosis were also examined using the methyl thiazolyl tetrazolium assay and flow cytometry. The results demonstrated that specific RNA interference (RNAi) could decrease the expression levels of Pokemon gene messenger RNA and protein in prostate cancer cells. In addition, that specific RNAi significantly inhibited the cell proliferation and increased the apoptotic rate. In vivo experiments showed that specific RNAi inhibited the tumorigenicity of prostate cancer cells and significantly suppressed tumor growth. Therefore, an RNAi-targeted Pokemon gene strategy could be a potential approach to prostate cancer therapy. Copyright © 2013 Elsevier Inc. All rights reserved.

DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells

PubMed Central

Spike, Caroline A.; Bader, Jason; Reinke, Valerie; Strome, Susan

2008-01-01

P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs). PMID:18234720

DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells.

PubMed

Spike, Caroline A; Bader, Jason; Reinke, Valerie; Strome, Susan

2008-03-01

P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs).

RNA interference mediated in human primary cells via recombinant baculoviral vectors.

PubMed

Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T

2005-04-01

The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.

siRNA Delivery to the Lung: What’s New?

PubMed Central

Merkel, Olivia M.; Rubinstein, Israel; Kissel, Thomas

2014-01-01

RNA interference (RNAi) has been thought of as the general answer to many unmet medical needs. After the first success stories, it soon became obvious that short interfering RNA (siRNA) is not suitable for systemic administration due to its poor pharmacokinetics. Therefore local administration routes have been adopted for more successful in vivo RNAi. This paper reviews nucleic acid modifications, nanocarrier chemistry, animal models used in successful pulmonary siRNA delivery, as well as clinical translation approaches. We summarize what has been published recently and conclude with the potential problems that may still hamper the efficient clinical application of RNAi in the lung. PMID:24907426

Improving Small Interfering RNA Delivery In Vivo Through Lipid Conjugation.

PubMed

Osborn, Maire F; Khvorova, Anastasia

2018-05-10

RNA interference (RNAi)-based therapeutics are approaching clinical approval for genetically defined diseases. Current clinical success is a result of significant innovations in the development of chemical architectures that support sustained, multi-month efficacy in vivo following a single administration. Conjugate-mediated delivery has established itself as the most promising platform for safe and targeted small interfering RNA (siRNA) delivery. Lipophilic conjugates represent a major class of modifications that improve siRNA pharmacokinetics and enable efficacy in a broad range of tissues. Here, we review current literature and define key features and limitations of this approach for in vivo modulation of gene expression.

Illuminating the gateway of gene silencing: perspective of RNA interference technology in clinical therapeutics.

PubMed

Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok

2012-07-01

A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.

Gene interactions in the DNA damage-response pathway identified by genome-wide RNA-interference analysis of synthetic lethality

PubMed Central

van Haaften, Gijs; Vastenhouw, Nadine L.; Nollen, Ellen A. A.; Plasterk, Ronald H. A.; Tijsterman, Marcel

2004-01-01

Here, we describe a systematic search for synthetic gene interactions in a multicellular organism, the nematode Caenorhabditis elegans. We established a high-throughput method to determine synthetic gene interactions by genome-wide RNA interference and identified genes that are required to protect the germ line against DNA double-strand breaks. Besides known DNA-repair proteins such as the C. elegans orthologs of TopBP1, RPA2, and RAD51, eight genes previously unassociated with a double-strand-break response were identified. Knockdown of these genes increased sensitivity to ionizing radiation and camptothecin and resulted in increased chromosomal nondisjunction. All genes have human orthologs that may play a role in human carcinogenesis. PMID:15326288

Endosymbiont interference and microbial diversity of the Pacific coast tick, Dermacentor occidentalis, in San Diego County, California.

PubMed

Gurfield, Nikos; Grewal, Saran; Cua, Lynnie S; Torres, Pedro J; Kelley, Scott T

2017-01-01

The Pacific coast tick, Dermacentor occidentalis Marx, is found throughout California and can harbor agents that cause human diseases such as anaplasmosis, ehrlichiosis, tularemia, Rocky Mountain spotted fever and rickettsiosis 364D. Previous studies have demonstrated that nonpathogenic endosymbiotic bacteria can interfere with Rickettsia co-infections in other tick species. We hypothesized that within D. occidentalis ticks, interference may exist between different nonpathogenic endosymbiotic or nonendosymbiotic bacteria and Spotted Fever group Rickettsia (SFGR). Using PCR amplification and sequencing of the romp A gene and intergenic region we identified a cohort of SFGR-infected and non-infected D. occidentalis ticks collected from San Diego County. We then amplified a partial segment of the 16S rRNA gene and used next-generation sequencing to elucidate the microbiomes and levels of co-infection in the ticks. The SFGR R. philipii str. 364D and R. rhipicephali were detected in 2.3% and 8.2% of the ticks, respectively, via romp A sequencing. Interestingly, next generation sequencing revealed an inverse relationship between the number of Francisella- like endosymbiont (FLE) 16S rRNA sequences and Rickettsia 16S rRNA sequences within individual ticks that is consistent with partial interference between FLE and SFGR infecting ticks. After excluding the Rickettsia and FLE endosymbionts from the analysis, there was a small but significant difference in microbial community diversity and a pattern of geographic isolation by distance between collection locales. In addition, male ticks had a greater diversity of bacteria than female ticks and ticks that weren't infected with SFGR had similar microbiomes to canine skin microbiomes. Although experimental studies are required for confirmation, our findings are consistent with the hypothesis that FLEs and, to a lesser extent, other bacteria, interfere with the ability of D. occidentalis to be infected with certain SFGR. The results also raise interesting possibilities about the effects of putative vertebrate hosts on the tick microbiome.

Transcriptome analysis in cotton boll weevil (Anthonomus grandis) and RNA interference in insect pests.

PubMed

Firmino, Alexandre Augusto Pereira; Fonseca, Fernando Campos de Assis; de Macedo, Leonardo Lima Pepino; Coelho, Roberta Ramos; Antonino de Souza, José Dijair; Togawa, Roberto Coiti; Silva-Junior, Orzenil Bonfim; Pappas, Georgios Joannis; da Silva, Maria Cristina Mattar; Engler, Gilbert; Grossi-de-Sa, Maria Fatima

2013-01-01

Cotton plants are subjected to the attack of several insect pests. In Brazil, the cotton boll weevil, Anthonomus grandis, is the most important cotton pest. The use of insecticidal proteins and gene silencing by interference RNA (RNAi) as techniques for insect control are promising strategies, which has been applied in the last few years. For this insect, there are not much available molecular information on databases. Using 454-pyrosequencing methodology, the transcriptome of all developmental stages of the insect pest, A. grandis, was analyzed. The A. grandis transcriptome analysis resulted in more than 500.000 reads and a data set of high quality 20,841 contigs. After sequence assembly and annotation, around 10,600 contigs had at least one BLAST hit against NCBI non-redundant protein database and 65.7% was similar to Tribolium castaneum sequences. A comparison of A. grandis, Drosophila melanogaster and Bombyx mori protein families' data showed higher similarity to dipteran than to lepidopteran sequences. Several contigs of genes encoding proteins involved in RNAi mechanism were found. PAZ Domains sequences extracted from the transcriptome showed high similarity and conservation for the most important functional and structural motifs when compared to PAZ Domains from 5 species. Two SID-like contigs were phylogenetically analyzed and grouped with T. castaneum SID-like proteins. No RdRP gene was found. A contig matching chitin synthase 1 was mined from the transcriptome. dsRNA microinjection of a chitin synthase gene to A. grandis female adults resulted in normal oviposition of unviable eggs and malformed alive larvae that were unable to develop in artificial diet. This is the first study that characterizes the transcriptome of the coleopteran, A. grandis. A new and representative transcriptome database for this insect pest is now available. All data support the state of the art of RNAi mechanism in insects.

Transcriptome Analysis in Cotton Boll Weevil (Anthonomus grandis) and RNA Interference in Insect Pests

PubMed Central

Coelho, Roberta Ramos; Antonino de Souza Jr, José Dijair; Togawa, Roberto Coiti; Silva-Junior, Orzenil Bonfim; Pappas-Jr, Georgios Joannis; da Silva, Maria Cristina Mattar; Engler, Gilbert; Grossi-de-Sa, Maria Fatima

2013-01-01

Cotton plants are subjected to the attack of several insect pests. In Brazil, the cotton boll weevil, Anthonomus grandis, is the most important cotton pest. The use of insecticidal proteins and gene silencing by interference RNA (RNAi) as techniques for insect control are promising strategies, which has been applied in the last few years. For this insect, there are not much available molecular information on databases. Using 454-pyrosequencing methodology, the transcriptome of all developmental stages of the insect pest, A. grandis, was analyzed. The A. grandis transcriptome analysis resulted in more than 500.000 reads and a data set of high quality 20,841 contigs. After sequence assembly and annotation, around 10,600 contigs had at least one BLAST hit against NCBI non-redundant protein database and 65.7% was similar to Tribolium castaneum sequences. A comparison of A. grandis, Drosophila melanogaster and Bombyx mori protein families’ data showed higher similarity to dipteran than to lepidopteran sequences. Several contigs of genes encoding proteins involved in RNAi mechanism were found. PAZ Domains sequences extracted from the transcriptome showed high similarity and conservation for the most important functional and structural motifs when compared to PAZ Domains from 5 species. Two SID-like contigs were phylogenetically analyzed and grouped with T. castaneum SID-like proteins. No RdRP gene was found. A contig matching chitin synthase 1 was mined from the transcriptome. dsRNA microinjection of a chitin synthase gene to A. grandis female adults resulted in normal oviposition of unviable eggs and malformed alive larvae that were unable to develop in artificial diet. This is the first study that characterizes the transcriptome of the coleopteran, A. grandis. A new and representative transcriptome database for this insect pest is now available. All data support the state of the art of RNAi mechanism in insects. PMID:24386449

siRNA-mediated silencing of MDR1 reverses the resistance to oxaliplatin in SW480/OxR colon cancer cells.

PubMed

Montazami, N; Kheir Andish, M; Majidi, J; Yousefi, M; Yousefi, B; Mohamadnejad, L; Shanebandi, D; Estiar, M A; Khaze, V; Mansoori, B; Baghbani, E; Baradaran, B

2015-05-28

One of the most challenging aspects of colon cancer therapy is rapid acquisition of multidrug resistant phenotype. The multidrug resistance gene 1 (MDR1) product, p—glycoprotein (P—gp), pump out a variety of anticancer agents from the cell, giving rise to a general drug resistance against chemotherapeutic agents. The aim of this study was to investigate the effect of a specific MDR1 small interference RNA (siRNA) on sensitivity of oxaliplatin—resistant SW480 human colon cancer cell line (SW480/OxR) to the chemotherapeutic drug oxaliplatin. SW480 cells were made resistant by continuous incubation with stepwise serially increased concentrations of oxaliplatin over a 6—months period. Resistance cell were subsequently transfected with specific MDR1 siRNA. Relative MDR1 mRNA expression was measured by Quantitative real—time PCR. Western blot analysis was performed to determine the protein levels of P—gp. The cytotoxic effects of oxaliplatin and MDR1 siRNA, alone and in combination were assessed using MTT and the number of apoptotic cells was determined with the TUNEL assay. MDR1 siRNA effectively reduced MDR1 expression in both mRNA and protein levels. MDR1 down—regulation synergistically increased the cytotoxic effects of oxaliplatin and spontaneous apoptosis SW480/OxR. Our data demonstrates that RNA interference could down regulate MDR1 gene expression and reduce the P—gp level, and partially reverse the drug resistance in SW480/OxR cells in vitro. Therefore, the results could suggest that MDR1 silencing may be a potent adjuvant in human colon chemotherapy.

RNA interference technology in crop protection against arthropod pests, pathogens and nematodes.

PubMed

Zotti, Moises; Dos Santos, Ericmar Avila; Cagliari, Deise; Christiaens, Olivier; Taning, Clauvis Nji Tizi; Smagghe, Guy

2018-06-01

Scientists have made significant progress in understanding and unraveling several aspects of double-stranded RNA (dsRNA)-mediated gene silencing during the last two decades. Now that the RNA interference (RNAi) mechanism is well understood, it is time to consider how to apply the acquired knowledge to agriculture and crop protection. Some RNAi-based products are already available for farmers and more are expected to reach the market soon. Tailor-made dsRNA as an active ingredient for biopesticide formulations is considered a raw material that can be used for diverse purposes, from pest control and bee protection against viruses to pesticide resistance management. The RNAi mechanism works at the messenger RNA (mRNA) level, exploiting a sequence-dependent mode of action, which makes it unique in potency and selectivity compared with conventional agrochemicals. Furthermore, the use of RNAi in crop protection can be achieved by employing plant-incorporated protectants through plant transformation, but also by non-transformative strategies such as the use of formulations of sprayable RNAs as direct control agents, resistance factor repressors or developmental disruptors. In this review, RNAi is presented in an agricultural context (discussing products that have been launched on the market or will soon be available), and we go beyond the classical presentation of successful examples of RNAi in pest-insect control and comprehensively explore its potential for the control of plant pathogens, nematodes and mites, and to fight against diseases and parasites in beneficial insects. Moreover, we also discuss its use as a repressor for the management of pesticide-resistant weeds and insects. Finally, this review reports on the advances in non-transformative dsRNA delivery and the production costs of dsRNA, and discusses environmental considerations. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Integration of promoters, inverted repeat sequences and proteomic data into a model for high silencing efficiency of coeliac disease related gliadins in bread wheat

PubMed Central

2013-01-01

Background Wheat gluten has unique nutritional and technological characteristics, but is also a major trigger of allergies and intolerances. One of the most severe diseases caused by gluten is coeliac disease. The peptides produced in the digestive tract by the incomplete digestion of gluten proteins trigger the disease. The majority of the epitopes responsible reside in the gliadin fraction of gluten. The location of the multiple gliadin genes in blocks has to date complicated their elimination by classical breeding techniques or by the use of biotechnological tools. As an approach to silence multiple gliadin genes we have produced 38 transgenic lines of bread wheat containing combinations of two endosperm-specific promoters and three different inverted repeat sequences to silence three fractions of gliadins by RNA interference. Results The effects of the RNA interference constructs on the content of the gluten proteins, total protein and starch, thousand seed weights and SDSS quality tests of flour were analyzed in these transgenic lines in two consecutive years. The characteristics of the inverted repeat sequences were the main factor that determined the efficiency of silencing. The promoter used had less influence on silencing, although a synergy in silencing efficiency was observed when the two promoters were used simultaneously. Genotype and the environment also influenced silencing efficiency. Conclusions We conclude that to obtain wheat lines with an optimum reduction of toxic gluten epitopes one needs to take into account the factors of inverted repeat sequences design, promoter choice and also the wheat background used. PMID:24044767

Biotechnological application of functional genomics towards plant-parasitic nematode control.

PubMed

Li, Jiarui; Todd, Timothy C; Lee, Junghoon; Trick, Harold N

2011-12-01

Plant-parasitic nematodes are primary biotic factors limiting the crop production. Current nematode control strategies include nematicides, crop rotation and resistant cultivars, but each has serious limitations. RNA interference (RNAi) represents a major breakthrough in the application of functional genomics for plant-parasitic nematode control. RNAi-induced suppression of numerous genes essential for nematode development, reproduction or parasitism has been demonstrated, highlighting the considerable potential for using this strategy to control damaging pest populations. In an effort to find more suitable and effective gene targets for silencing, researchers are employing functional genomics methodologies, including genome sequencing and transcriptome profiling. Microarrays have been used for studying the interactions between nematodes and plant roots and to measure both plants and nematodes transcripts. Furthermore, laser capture microdissection has been applied for the precise dissection of nematode feeding sites (syncytia) to allow the study of gene expression specifically in syncytia. In the near future, small RNA sequencing techniques will provide more direct information for elucidating small RNA regulatory mechanisms in plants and specific gene silencing using artificial microRNAs should further improve the potential of targeted gene silencing as a strategy for nematode management. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

Hitting bacteria at the heart of the central dogma: sequence-specific inhibition.

PubMed

Rasmussen, Louise Carøe Vohlander; Sperling-Petersen, Hans Uffe; Mortensen, Kim Kusk

2007-08-10

An important objective in developing new drugs is the achievement of high specificity to maximize curing effect and minimize side-effects, and high specificity is an integral part of the antisense approach. The antisense techniques have been extensively developed from the application of simple long, regular antisense RNA (asRNA) molecules to highly modified versions conferring resistance to nucleases, stability of hybrid formation and other beneficial characteristics, though still preserving the specificity of the original nucleic acids. These new and improved second- and third-generation antisense molecules have shown promising results. The first antisense drug has been approved and more are in clinical trials. However, these antisense drugs are mainly designed for the treatment of different human cancers and other human diseases. Applying antisense gene silencing and exploiting RNA interference (RNAi) are highly developed approaches in many eukaryotic systems. But in bacteria RNAi is absent, and gene silencing by antisense compounds is not nearly as well developed, despite its great potential and the intriguing possibility of applying antisense molecules in the fight against multiresistant bacteria. Recent breakthrough and current status on the development of antisense gene silencing in bacteria including especially phosphorothioate oligonucleotides (PS-ODNs), peptide nucleic acids (PNAs) and phosphorodiamidate morpholino oligomers (PMOs) will be presented in this review.

Small Molecule Modulators of Pre-mRNA Splicing in Cancer Therapy.

PubMed

Salton, Maayan; Misteli, Tom

2016-01-01

Pre-mRNA splicing is a fundamental process in mammalian gene expression and alternative RNA splicing plays a considerable role in generating protein diversity. RNA splicing events are also key to the pathology of numerous diseases, particularly cancers. Some tumors are molecularly addicted to specific RNA splicing isoforms making interference with pre-mRNA processing a viable therapeutic strategy. Several RNA splicing modulators have recently been characterized, some showing promise in preclinical studies. While the targets of most splicing modulators are constitutive RNA processing components, possibly leading to undesirable side effects, selectivity for individual splicing events has been observed. Given the high prevalence of splicing defects in cancer, small molecule modulators of RNA processing represent a potentially promising novel therapeutic strategy in cancer treatment. Here, we review their reported effects, mechanisms, and limitations. Published by Elsevier Ltd.

Specific Silencing of L392V PSEN1 Mutant Allele by RNA Interference

PubMed Central

Sierant, Malgorzata; Paduszynska, Alina; Kazmierczak-Baranska, Julia; Nacmias, Benedetta; Sorbi, Sandro; Bagnoli, Silvia; Sochacka, Elzbieta; Nawrot, Barbara

2011-01-01

RNA interference (RNAi) technology provides a powerful molecular tool to reduce an expression of selected genes in eukaryotic cells. Short interfering RNAs (siRNAs) are the effector molecules that trigger RNAi. Here, we describe siRNAs that discriminate between the wild type and mutant (1174 C→G) alleles of human Presenilin1 gene (PSEN1). This mutation, resulting in L392V PSEN1 variant, contributes to early onset familial Alzheimer's disease. Using the dual fluorescence assay, flow cytometry and fluorescent microscopy we identified positions 8th–11th, within the central part of the antisense strand, as the most sensitive to mismatches. 2-Thiouridine chemical modification introduced at the 3′-end of the antisense strand improved the allele discrimination, but wobble base pairing adjacent to the mutation site abolished the siRNA activity. Our data indicate that siRNAs can be designed to discriminate between the wild type and mutant alleles of genes that differ by just a single nucleotide. PMID:21559198

Virus-Derived Gene Expression and RNA Interference Vector for Grapevine

PubMed Central

Kurth, Elizabeth G.; Peremyslov, Valera V.; Prokhnevsky, Alexey I.; Kasschau, Kristin D.; Miller, Marilyn; Carrington, James C.

2012-01-01

The improvement of the agricultural and wine-making qualities of the grapevine (Vitis vinifera) is hampered by adherence to traditional varieties, the recalcitrance of this plant to genetic modifications, and public resistance to genetically modified organism (GMO) technologies. To address these challenges, we developed an RNA virus-based vector for the introduction of desired traits into grapevine without heritable modifications to the genome. This vector expresses recombinant proteins in the phloem tissue that is involved in sugar transport throughout the plant, from leaves to roots to berries. Furthermore, the vector provides a powerful RNA interference (RNAi) capability of regulating the expression of endogenous genes via virus-induced gene-silencing (VIGS) technology. Additional advantages of this vector include superb genetic capacity and stability, as well as the swiftness of technology implementation. The most significant applications of the viral vector include functional genomics of the grapevine and disease control via RNAi-enabled vaccination against pathogens or invertebrate pests. PMID:22438553

Enhanced Whitefly Resistance in Transgenic Tobacco Plants Expressing Double Stranded RNA of v-ATPase A Gene

PubMed Central

Thakur, Nidhi; Upadhyay, Santosh Kumar; Verma, Praveen C.; Chandrashekar, Krishnappa; Tuli, Rakesh; Singh, Pradhyumna K.

2014-01-01

Background Expression of double strand RNA (dsRNA) designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi), thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci) upon oral feeding. The v-ATPase subunit A (v-ATPaseA) coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. Methodology/Principal Findings Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. Conclusions/Significance Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops. PMID:24595215

Tiny giants of gene regulation: experimental strategies for microRNA functional studies

PubMed Central

Steinkraus, Bruno R.; Toegel, Markus

2016-01-01

The discovery over two decades ago of short regulatory microRNAs (miRNAs) has led to the inception of a vast biomedical research field dedicated to understanding these powerful orchestrators of gene expression. Here we aim to provide a comprehensive overview of the methods and techniques underpinning the experimental pipeline employed for exploratory miRNA studies in animals. Some of the greatest challenges in this field have been uncovering the identity of miRNA–target interactions and deciphering their significance with regard to particular physiological or pathological processes. These endeavors relied almost exclusively on the development of powerful research tools encompassing novel bioinformatics pipelines, high‐throughput target identification platforms, and functional target validation methodologies. Thus, in an unparalleled manner, the biomedical technology revolution unceasingly enhanced and refined our ability to dissect miRNA regulatory networks and understand their roles in vivo in the context of cells and organisms. Recurring motifs of target recognition have led to the creation of a large number of multifactorial bioinformatics analysis platforms, which have proved instrumental in guiding experimental miRNA studies. Subsequently, the need for discovery of miRNA–target binding events in vivo drove the emergence of a slew of high‐throughput multiplex strategies, which now provide a viable prospect for elucidating genome‐wide miRNA–target binding maps in a variety of cell types and tissues. Finally, deciphering the functional relevance of miRNA post‐transcriptional gene silencing under physiological conditions, prompted the evolution of a host of technologies enabling systemic manipulation of miRNA homeostasis as well as high‐precision interference with their direct, endogenous targets. WIREs Dev Biol 2016, 5:311–362. doi: 10.1002/wdev.223 For further resources related to this article, please visit the WIREs website. PMID:26950183

[New advances in animal transgenic technology].

PubMed

Sun, Zhen-Hong; Miao, Xiang-Yang; Zhu, Rui-Liang

2010-06-01

Animal transgenic technology is one of the fastest growing biotechnology in the 21st century. It is used to integrate foreign genes into the animal genome by genetic engineering technology so that foreign genes can be expressed and inherited to the offspring. The transgenic efficiency and precise control of gene expression are the key limiting factors on preparation of transgenic animals. A variety of transgenic techniques are available, each of which has its own advantages and disadvantages and still needs further study because of unresolved technical and safety issues. With the in-depth research, the transgenic technology will have broad application prospects in the fields of exploration of gene function, animal genetic improvement, bioreactor, animal disease models, organ transplantation and so on. This article reviews the recently developed animal gene transfer techniques, including germline stem cell mediated method to improve the efficiency, gene targeting to improve the accuracy, RNA interference (RNAi)-mediated gene silencing technology, and the induced pluripotent stem cells (iPS) transgenic technology. The new transgenic techniques can provide a better platform for the study of trans-genic animals and promote the development of medical sciences, livestock production, and other fields.

Oligonucleotide Antiviral Therapeutics: Antisense and RNA Interference for Highly Pathogenic RNA Viruses

DTIC Science & Technology

2008-01-01

siRNA delivery method in his animal model, it remains to be studied whether this general pproach is safe in humans. Often cited as an advantage of siRNAs...way studying the intravenous delivery f ASO drug candidates targeting Bcl-2 (Genasense®, Genta) nd c-myc (Resten-NG®, AVI BioPharma), while completed... studies have been published investigating MOs as a treatment for EBOV infection, with both showing fficacy in animal models. PMOs were designed to

Maitotoxin Is a Potential Selective Activator of the Endogenous Transient Receptor Potential Canonical Type 1 Channel in Xenopus laevis Oocytes

PubMed Central

Flores, Pedro L.; Rodríguez, Emma; Zapata, Estrella; Carbó, Roxana; Farías, José María; Martínez, Martín

2017-01-01

Maitotoxin (MTX) is the most potent marine toxin known to date. It is responsible for a particular human intoxication syndrome called ciguatera fish poisoning (CFP). Several reports indicate that MTX is an activator of non-selective cation channels (NSCC) in different cell types. The molecular identity of these channels is still an unresolved topic, and it has been proposed that the transient receptor potential (TRP) channels are involved in this effect. In Xenopus laevis oocytes, MTX at picomolar (pM) concentrations induces the activation of NSCC with functional and pharmacological properties that resemble the activity of TRP channels. The purpose of this study was to characterize the molecular identity of the TRP channel involved in the MTX response, using the small interference RNA (siRNA) approach and the two-electrode voltage-clamp technique (TEVC). The injection of a specifically designed siRNA to silence the transient receptor potential canonical type 1 (TRPC1) protein expression abolished the MTX response. MTX had no effect on oocytes, even at doses 20-fold higher compared to cells without injection. Total mRNA and protein levels of TRPC1 were notably diminished. The TRPC4 siRNA did not change the MTX effect, even though it was important to note that the protein level was reduced by the silencing of TRPC4. Our results suggest that MTX could be a selective activator of TRPC1 channels in X. laevis oocytes and a useful pharmacological tool for further studies on these TRP channels. PMID:28672825

Maitotoxin Is a Potential Selective Activator of the Endogenous Transient Receptor Potential Canonical Type 1 Channel in Xenopus laevis Oocytes.

PubMed

Flores, Pedro L; Rodríguez, Emma; Zapata, Estrella; Carbó, Roxana; Farías, José María; Martínez, Martín

2017-06-25

Maitotoxin (MTX) is the most potent marine toxin known to date. It is responsible for a particular human intoxication syndrome called ciguatera fish poisoning (CFP). Several reports indicate that MTX is an activator of non-selective cation channels (NSCC) in different cell types. The molecular identity of these channels is still an unresolved topic, and it has been proposed that the transient receptor potential (TRP) channels are involved in this effect. In Xenopus laevis oocytes, MTX at picomolar (pM) concentrations induces the activation of NSCC with functional and pharmacological properties that resemble the activity of TRP channels. The purpose of this study was to characterize the molecular identity of the TRP channel involved in the MTX response, using the small interference RNA (siRNA) approach and the two-electrode voltage-clamp technique (TEVC). The injection of a specifically designed siRNA to silence the transient receptor potential canonical type 1 (TRPC1) protein expression abolished the MTX response. MTX had no effect on oocytes, even at doses 20-fold higher compared to cells without injection. Total mRNA and protein levels of TRPC1 were notably diminished. The TRPC4 siRNA did not change the MTX effect, even though it was important to note that the protein level was reduced by the silencing of TRPC4. Our results suggest that MTX could be a selective activator of TRPC1 channels in X. laevis oocytes and a useful pharmacological tool for further studies on these TRP channels.

Determining the Specificity of Cascade Binding, Interference, and Primed Adaptation In Vivo in the Escherichia coli Type I-E CRISPR-Cas System.

PubMed

Cooper, Lauren A; Stringer, Anne M; Wade, Joseph T

2018-04-17

In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo , for the type I-E system of Escherichia coli Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5' end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. IMPORTANCE Many bacterial and archaeal species encode CRISPR-Cas immunity systems that protect against invasion by foreign DNA. In the Escherichia coli CRISPR-Cas system, a protein complex, Cascade, binds 61-nucleotide (nt) CRISPR RNAs (crRNAs). The Cascade complex is directed to invading DNA molecules through base pairing between the crRNA and target DNA. This leads to recruitment of the Cas3 nuclease, which destroys the invading DNA molecule and promotes acquisition of new immunity elements. We made the first in vivo measurements of Cascade binding to DNA targets. Thus, we show that Cascade binding to DNA is highly promiscuous; endogenous E. coli crRNAs can direct Cascade binding to >100 chromosomal locations. In contrast, we show that targeted degradation and acquisition of new immunity elements require highly specific association of Cascade with DNA, limiting CRISPR-Cas function to the appropriate targets. Copyright © 2018 Cooper et al.

Effects of RNA interference-mediated silencing of toll-like receptor 4 gene on proliferation and apoptosis of human breast cancer MCF-7 and MDA-MB-231 cells: An in vitro study.

PubMed

Gao, Xiao-Ling; Yang, Jiao-Jiao; Wang, Shu-Juan; Chen, Yan; Wang, Bei; Cheng, Er-Jing; Gong, Jian-Nan; Dong, Yan-Ting; Liu, Dai; Wang, Xiang-Li; Huang, Ya-Qiong; An, Dong-Dong

2018-06-22

Breast cancer is known as the most prevalent cancer in women worldwide, and has an undeniable negative impact on public health, both physically, and mentally. This study aims to investigate the effects of toll-like receptor 4 (TLR4) gene silencing on proliferation and apoptosis of human breast cancer cells to explore for a new theoretical basis for its treatment. TLR4 small interference RNA (siRNA) fragment recombinant plasmids were constructed, including TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3. Human breast cancer MCF-7 and MDA-MB-231 cells were assigned into blank, negative control (NC), TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3 groups. MCF-7 and MDA-MB-231 cell growth was detected by MTT assay. Apoptosis and cell cycle were determined by flow cytometry. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) and Western blot analysis were conducted to determine the expression of TLR4, CDK4, cyclin D1, Livin, Bcl-2, p53, c-FLIP, and caspase-3. In comparison with the NC and blank groups, the TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3 groups showed decreased the expression of TLR4, inhibited proliferation of MCF-7 and MDA-MB-231 cells and promoted MCF-7 and MDA-MB-231 cell apoptosis, and the cells were blocked in G1 phase. In comparison with the NC and blank groups, in the TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3 groups, siRNA-TLR4 significantly increased expression of p53 and caspase-3 in MCF-7 and MDA-MB-231 cells, while it decreased the expressions of CDK4, cyclinD1, Livin, Bal-2, and c-FLIP. The study demonstrates that TLR4 gene silencing inhibits proliferation and induces apoptosis of MCF-7 and MDA-MB-231 cells. © 2018 Wiley Periodicals, Inc.

Iron(II) supramolecular helicates interfere with the HIV-1 Tat–TAR RNA interaction critical for viral replication

PubMed Central

Malina, Jaroslav; Hannon, Michael J.; Brabec, Viktor

2016-01-01

The interaction between the HIV-1 transactivator protein Tat and TAR (transactivation responsive region) RNA, plays a critical role in HIV-1 transcription. Iron(II) supramolecular helicates were evaluated for their in vitro activity to inhibit Tat–TAR RNA interaction using UV melting studies, electrophoretic mobility shift assay, and RNase A footprinting. The results demonstrate that iron(II) supramolecular helicates inhibit Tat-TAR interaction at nanomolar concentrations by binding to TAR RNA. These studies provide a new insight into the biological potential of metallosupramolecular helicates. PMID:27405089

Pulsed coherent population trapping with repeated queries for producing single-peaked high contrast Ramsey interference

NASA Astrophysics Data System (ADS)

Warren, Z.; Shahriar, M. S.; Tripathi, R.; Pati, G. S.

2018-02-01

A repeated query technique has been demonstrated as a new interrogation method in pulsed coherent population trapping for producing single-peaked Ramsey interference with high contrast. This technique enhances the contrast of the central Ramsey fringe by nearly 1.5 times and significantly suppresses the side fringes by using more query pulses ( >10) in the pulse cycle. Theoretical models have been developed to simulate Ramsey interference and analyze the characteristics of the Ramsey spectrum produced by the repeated query technique. Experiments have also been carried out employing a repeated query technique in a prototype rubidium clock to study its frequency stability performance.

Unconventional signal detection techniques with Gaussian probability mixtures adaptation in non-AWGN channels: full resolution receiver

NASA Astrophysics Data System (ADS)

Chabdarov, Shamil M.; Nadeev, Adel F.; Chickrin, Dmitry E.; Faizullin, Rashid R.

2011-04-01

In this paper we discuss unconventional detection technique also known as «full resolution receiver». This receiver uses Gaussian probability mixtures for interference structure adaptation. Full resolution receiver is alternative to conventional matched filter receivers in the case of non-Gaussian interferences. For the DS-CDMA forward channel with presence of complex interferences sufficient performance increasing was shown.

Microprocessor mediates transcriptional termination in long noncoding microRNA genes

PubMed Central

Dhir, Ashish; Dhir, Somdutta; Proudfoot, Nick J.; Jopling, Catherine L.

2015-01-01

MicroRNA (miRNA) play a major role in the post-transcriptional regulation of gene expression. Mammalian miRNA biogenesis begins with co-transcriptional cleavage of RNA polymerase II (Pol II) transcripts by the Microprocessor complex. While most miRNA are located within introns of protein coding genes, a substantial minority of miRNA originate from long non coding (lnc) RNA where transcript processing is largely uncharacterized. We show, by detailed characterization of liver-specific lnc-pri-miR-122 and genome-wide analysis in human cell lines, that most lnc-pri-miRNA do not use the canonical cleavage and polyadenylation (CPA) pathway, but instead use Microprocessor cleavage to terminate transcription. This Microprocessor inactivation leads to extensive transcriptional readthrough of lnc-pri-miRNA and transcriptional interference with downstream genes. Consequently we define a novel RNase III-mediated, polyadenylation-independent mechanism of Pol II transcription termination in mammalian cells. PMID:25730776

Intelligent Therapeutics and Metabolic Programming Through Tailormade, Ligand-Controlled RNA Switches

DTIC Science & Technology

2007-02-05

lines. Three regulatory mechanisms have been examined in our laboratory: antisense inhibition, ribozyme cleavage, and RNA interference (RNAi...cell lines. However, the latter two regulatory mechanisms, ribozyme -based inactivation and RNAi-mediated silencing, demonstrated significant activity...in these cell lines as is briefly described below. Microswitches responsive to the small molecule theophylline and targeting GFP based on a ribozyme

ß-catenin, a transcription factor activated by canonical Wnt signaling, is expressed in sensory neurons of calves latently infected with bovine herpesvirus 1

USDA-ARS?s Scientific Manuscript database

Like many a-herpesvirinae subfamily members, bovine herpes virus 1 (BoHV-1) expresses an abundant transcript in latently infected sensory neurons: the latency-related (LR) RNA. LR-RNA encodes a protein (ORF2) that inhibits apoptosis, interacts with Notch family members, interferes with Notch mediate...

Allele-specific RNA interference rescues the long-QT syndrome phenotype in human-induced pluripotency stem cell cardiomyocytes.

PubMed

Matsa, Elena; Dixon, James E; Medway, Christopher; Georgiou, Orestis; Patel, Minal J; Morgan, Kevin; Kemp, Paul J; Staniforth, Andrew; Mellor, Ian; Denning, Chris

2014-04-01

Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K(+) currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart.

RNA Interference: A Novel Source of Resistance to Combat Plant Parasitic Nematodes.

PubMed

Banerjee, Sagar; Banerjee, Anamika; Gill, Sarvajeet S; Gupta, Om P; Dahuja, Anil; Jain, Pradeep K; Sirohi, Anil

2017-01-01

Plant parasitic nematodes cause severe damage and yield loss in major crops all over the world. Available control strategies include use of insecticides/nematicides but these have proved detrimental to the environment, while other strategies like crop rotation and resistant cultivars have serious limitations. This scenario provides an opportunity for the utilization of technological advances like RNA interference (RNAi) to engineer resistance against these devastating parasites. First demonstrated in the model free living nematode, Caenorhabtidis elegans ; the phenomenon of RNAi has been successfully used to suppress essential genes of plant parasitic nematodes involved in parasitism, nematode development and mRNA metabolism. Synthetic neurotransmitants mixed with dsRNA solutions are used for in vitro RNAi in plant parasitic nematodes with significant success. However, host delivered in planta RNAi has proved to be a pioneering phenomenon to deliver dsRNAs to feeding nematodes and silence the target genes to achieve resistance. Highly enriched genomic databases are exploited to limit off target effects and ensure sequence specific silencing. Technological advances like gene stacking and use of nematode inducible and tissue specific promoters can further enhance the utility of RNAi based transgenics against plant parasitic nematodes.

Allele-specific RNA interference rescues the long-QT syndrome phenotype in human-induced pluripotency stem cell cardiomyocytes

PubMed Central

Matsa, Elena; Dixon, James E.; Medway, Christopher; Georgiou, Orestis; Patel, Minal J.; Morgan, Kevin; Kemp, Paul J.; Staniforth, Andrew; Mellor, Ian; Denning, Chris

2014-01-01

Aims Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. Methods and results We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K+ currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). Conclusions These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart. PMID:23470493

Host gene targets for novel influenza therapies elucidated by high-throughput RNA interference screens

PubMed Central

Meliopoulos, Victoria A.; Andersen, Lauren E.; Birrer, Katherine F.; Simpson, Kaylene J.; Lowenthal, John W.; Bean, Andrew G. D.; Stambas, John; Stewart, Cameron R.; Tompkins, S. Mark; van Beusechem, Victor W.; Fraser, Iain; Mhlanga, Musa; Barichievy, Samantha; Smith, Queta; Leake, Devin; Karpilow, Jon; Buck, Amy; Jona, Ghil; Tripp, Ralph A.

2012-01-01

Influenza virus encodes only 11 viral proteins but replicates in a broad range of avian and mammalian species by exploiting host cell functions. Genome-wide RNA interference (RNAi) has proven to be a powerful tool for identifying the host molecules that participate in each step of virus replication. Meta-analysis of findings from genome-wide RNAi screens has shown influenza virus to be dependent on functional nodes in host cell pathways, requiring a wide variety of molecules and cellular proteins for replication. Because rapid evolution of the influenza A viruses persistently complicates the effectiveness of vaccines and therapeutics, a further understanding of the complex host cell pathways coopted by influenza virus for replication may provide new targets and strategies for antiviral therapy. RNAi genome screening technologies together with bioinformatics can provide the ability to rapidly identify specific host factors involved in resistance and susceptibility to influenza virus, allowing for novel disease intervention strategies.—Meliopoulos, V. A., Andersen, L. E., Birrer, K. F., Simpson, K. J., Lowenthal, J. W., Bean, A. G. D., Stambas, J., Stewart, C. R., Tompkins, S. M., van Beusechem, V. W., Fraser, I., Mhlanga, M., Barichievy, S., Smith, Q., Leake, D., Karpilow, J., Buck, A., Jona, G., Tripp, R. A. Host gene targets for novel influenza therapies elucidated by high-throughput RNA interference screens. PMID:22247330

[Expression of cation-chloride cotransporters KCC2 and NKCC1 in brainstem of para- chlorophenylalanine-induced acute insomnia rats].

PubMed

Lin, Fang-ju; Yang, Xiao-su; Yang, De; Zou, Yan-qun

2013-05-21

To explore the possible roles of KCC2 and NKCC1 in the pathological mechanism of acute insomnia in rats. A total of 18 Sprague-Dawley rats were randomly selected into model, interference and normal control groups.The expressions of KCC2 and NKCC1 in brainstem were detected by reverse transcription-polymerase chain reaction (RT-PCR) and Western blot.The concentration of intracellular Cl(-) ([Cl(-)]i) in brainstem was detected by fluorescence probe MQAE with laser confocal microscopy. (1) Comparing with the control group, both KCC2 mRNA and protein expression were down-regulated in the model and interference groups (mRNA:0.196 ± 0.021 vs 0.939 ± 0.109, P < 0.05; 0.485 ± 0.026 vs 0.939 ± 0.109, P < 0.05; protein expression:0.363 ± 0.058 vs 0.967 ± 0.155, P < 0.05; 0.663 ± 0.106 vs 0.967 ± 0.155, P < 0.05).However they became up-regulated in the interference group versus the model group (mRNA: 0.485 ± 0.026 vs 0.196 ± 0.021, P < 0.05; protein expression:0.663 ± 0.106 vs 0.363 ± 0.058, P < 0.05). (2) Comparing with the control group, both NKCC1 mRNA and protein expression in the model group were slightly up-regulated.But statistical difference was insignificant (mRNA: 0.344 ± 0.026 vs 0.320 ± 0.019, P > 0.05; protein expression:0.244 ± 0.010 vs 0.230 ± 0.021, P > 0.05).There was down-regulation in the interference group versus the model and control groups (mRNA: 0.066 ± 0.031 vs 0.320 ± 0.019, P < 0.05; 0.066 ± 0.031 vs 0.344 ± 0.026, P < 0.05; protein expression:0.131 ± 0.012 vs 0.230 ± 0.021, P < 0.05; 0.131 ± 0.012 vs 0.244 ± 0.010, P < 0.05). (3) Comparing with the control group, [Cl(-)]i became up-regulated in the model group (0.0315 ± 0.0039 vs 0.0164 ± 0.0019, P < 0.05).It was down-regulated in the interference group versus the model group (0.0182 ± 0.0013 vs 0.0315 ± 0.0039, P < 0.05), but higher than control group without statistical difference (0.0182 ± 0.0013 vs 0.0164 ± 0.0019, P > 0.05). The down-regulation of KCC2 and rise of [Cl(-)]i in brainstem may participate in the pathological mechanism of acute insomnia in rats. And the mechanism of sedative-hypnotic diazepam may be operate through an up-regulation of KCC2, a down-regulation of NKCC1 and decreased [Cl(-)]i.

A-to-I editing of coding and non-coding RNAs by ADARs

PubMed Central

Nishikura, Kazuko

2016-01-01

Adenosine deaminases acting on RNA (ADARs) convert adenosine to inosine in double-stranded RNA. This A-to-I editing occurs not only in protein-coding regions of mRNAs, but also frequently in non-coding regions that contain inverted Alu repeats. Editing of coding sequences can result in the expression of functionally altered proteins that are not encoded in the genome, whereas the significance of Alu editing remains largely unknown. Certain microRNA (miRNA) precursors are also edited, leading to reduced expression or altered function of mature miRNAs. Conversely, recent studies indicate that ADAR1 forms a complex with Dicer to promote miRNA processing, revealing a new function of ADAR1 in the regulation of RNA interference. PMID:26648264

Delivery of RNA interference therapeutics using polycation-based nanoparticles.

PubMed

Howard, Kenneth Alan

2009-07-25

RNAi-based therapies are dependent on extracellular and intracellular delivery of RNA molecules for enabling target interaction. Polycation-based nanoparticles (or polyplexes) formed by self-assembly with RNA can be used to modulate pharmacokinetics and intracellular trafficking to improve the therapeutic efficacy of RNAi-based therapeutics. This review describes the application of polyplexes for extracellular and intracellular delivery of synthetic RNA molecules. Focus is given to routes of administration and silencing effects in animal disease models. The inclusion of functional components into the nanoparticle for controlling cellular trafficking and RNA release is discussed. This work highlights the versatile nature of polycation-based nanoparticles to fulfil the delivery requirements for RNA molecules with flexibility in design to evolve alongside an expanding repertoire of RNAi-based drugs.

RNAi-dependent and -independent antiviral phenotypes of chromosomally integrated shRNA clones: role of VASP in respiratory syncytial virus growth.

PubMed

Musiyenko, Alla; Bitko, Vira; Barik, Sailen

2007-07-01

Stable RNA interference (RNAi) is commonly achieved by recombinant expression of short hairpin RNA (shRNA). To generate virus-resistant cell lines, we cloned a shRNA cassette against the phosphoprotein gene of respiratory syncytial virus (RSV) into a polIII-driven plasmid vector. Analysis of individual stable transfectants showed a spectrum of RSV resistance correlating with the levels of shRNA expressed from different chromosomal locations. Interestingly, resistance in a minority of clones was due to mono-allelic disruption of the cellular gene for vasodilator-stimulated phosphoprotein (VASP). Thus, pure clones of chromosomally integrated DNA-directed RNAi can exhibit gene disruption phenotypes resembling but unrelated to RNAi.

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis.

PubMed

Santangelo, K S; Bertone, A L

2011-12-01

To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RT-PCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2(-ΔΔCT)) method. Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P=0.0045) or >90% (P=0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. Copyright © 2011 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

Tendon transfer fixation: comparing a tendon to tendon technique vs. bioabsorbable interference-fit screw fixation.

PubMed

Sabonghy, Eric Peter; Wood, Robert Michael; Ambrose, Catherine Glauber; McGarvey, William Christopher; Clanton, Thomas Oscar

2003-03-01

Tendon transfer techniques in the foot and ankle are used for tendon ruptures, deformities, and instabilities. This fresh cadaver study compares the tendon fixation strength in 10 paired specimens by performing a tendon to tendon fixation technique or using 7 x 20-25 mm bioabsorbable interference-fit screw tendon fixation technique. Load at failure of the tendon to tendon fixation method averaged 279N (Standard Deviation 81N) and the bioabsorbable screw 148N (Standard Deviation 72N) [p = 0.0008]. Bioabsorbable interference-fit screws in these specimens show decreased fixation strength relative to the traditional fixation technique. However, the mean bioabsorbable screw fixation strength of 148N provides physiologic strength at the tendon-bone interface.

C3PO, an endoribonuclease that promotes RNAi by facilitating RISC activation.

PubMed

Liu, Ying; Ye, Xuecheng; Jiang, Feng; Liang, Chunyang; Chen, Dongmei; Peng, Junmin; Kinch, Lisa N; Grishin, Nick V; Liu, Qinghua

2009-08-07

The catalytic engine of RNA interference (RNAi) is the RNA-induced silencing complex (RISC), wherein the endoribonuclease Argonaute and single-stranded small interfering RNA (siRNA) direct target mRNA cleavage. We reconstituted long double-stranded RNA- and duplex siRNA-initiated RISC activities with the use of recombinant Drosophila Dicer-2, R2D2, and Ago2 proteins. We used this core reconstitution system to purify an RNAi regulator that we term C3PO (component 3 promoter of RISC), a complex of Translin and Trax. C3PO is a Mg2+-dependent endoribonuclease that promotes RISC activation by removing siRNA passenger strand cleavage products. These studies establish an in vitro RNAi reconstitution system and identify C3PO as a key activator of the core RNAi machinery.

Small interfering RNA against the 2C genomic region of coxsackievirus B3 exerts potential antiviral effects in permissive HeLa cells.

PubMed

Luan, Ying; Dai, Hai-Li; Yang, Dan; Zhu, Lin; Gao, Tie-Lei; Shao, Hong-Jiang; Peng, Xue; Jin, Zhan-Feng

2012-01-01

Coxsackievirus B3 (CVB3) is the most important causal agent of viral heart muscle disease, but no specific antiviral drug is currently available. Small interfering RNA (siRNA) has been used as an antiviral therapeutic strategy via posttranscriptional gene silencing. In this study, eleven siRNAs were designed to target seven distinct regions of the CVB3 genome including VP1, VP2, VP3, 2A, 2C, 3C, and 3D. All of the siRNAs were individually transfected into HeLa cells, which were subsequently infected with CVB3. The impacts of RNA interference (RNAi) on viral replication were evaluated using five measures: cytopathic effect (CPE), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, 50% tissue culture infectious dose (TCID(50)), real-time RT-PCR, and Western blot. Five of the eleven siRNAs were highly efficient at inhibiting viral replication. This was especially true for siRNA-5, which targeted the ATPase 2C. However, antiviral activity varied significantly among siRNA-9, -10, and -11 even though that they all targeted the 3D region. Our results revealed several effective targets for CVB3 silencing, and provided evidence that sequences except CRE within the 2C region may also be potential targets for CVB3-specific siRNAs design. These data supported a potential role of RNA interference in future antiviral intervention therapies. Copyright © 2011 Elsevier B.V. All rights reserved.

Induction and suppression of antiviral RNA interference by influenza A virus in mammalian cells.

PubMed

Li, Yang; Basavappa, Megha; Lu, Jinfeng; Dong, Shuwei; Cronkite, D Alexander; Prior, John T; Reinecker, Hans-Christian; Hertzog, Paul; Han, Yanhong; Li, Wan-Xiang; Cheloufi, Sihem; Karginov, Fedor V; Ding, Shou-Wei; Jeffrey, Kate L

2016-12-05

Influenza A virus (IAV) causes annual epidemics and occasional pandemics, and is one of the best-characterized human RNA viral pathogens 1 . However, a physiologically relevant role for the RNA interference (RNAi) suppressor activity of the IAV non-structural protein 1 (NS1), reported over a decade ago 2 , remains unknown 3 . Plant and insect viruses have evolved diverse virulence proteins to suppress RNAi as their hosts produce virus-derived small interfering RNAs (siRNAs) that direct specific antiviral defence 4-7 by an RNAi mechanism dependent on the slicing activity of Argonaute proteins (AGOs) 8,9 . Recent studies have documented induction and suppression of antiviral RNAi in mouse embryonic stem cells and suckling mice 10,11 . However, it is still under debate whether infection by IAV or any other RNA virus that infects humans induces and/or suppresses antiviral RNAi in mature mammalian somatic cells 12-21 . Here, we demonstrate that mature human somatic cells produce abundant virus-derived siRNAs co-immunoprecipitated with AGOs in response to IAV infection. We show that the biogenesis of viral siRNAs from IAV double-stranded RNA (dsRNA) precursors in infected cells is mediated by wild-type human Dicer and potently suppressed by both NS1 of IAV as well as virion protein 35 (VP35) of Ebola and Marburg filoviruses. We further demonstrate that the slicing catalytic activity of AGO2 inhibits IAV and other RNA viruses in mature mammalian cells, in an interferon-independent fashion. Altogether, our work shows that IAV infection induces and suppresses antiviral RNAi in differentiated mammalian somatic cells.

[Screening efficient siRNAs in vitro as the candidate genes for chicken anti-avian influenza virus H5N1 breeding].

PubMed

Zhang, P; Wang, J G; Wan, J G; Liu, W Q

2010-01-01

The frequent disease outbreaks caused by avian influenza virus not only affect the poultry industry but also pose a threat to human safety. To address the problem, RNA interference (RNAi) has recently been widely used as a potential antiviral approach. Transgenesis in combination with RNAi to specifically inhibit avian enza virus gene expression has been proposed to make chickens resistant to the infection. For the transgenic breeding, screening in vitro efficient siRNAs as the candidate genes is one of the most important tasks. Here, we combined an online search tool and a series of bioinformatics programs with a set of rules for designing siRNAs targeted towards different mRNA regions of H5N1 avian influenza virus. Five rational siRNAs were chosen by this method, five U6 promoter-driven shRNA expression plasmids containing the siRNA genes were constructed and used for producing stably transfected MDCK cells. The data obtained by virus titration, IFA, PI-stained flow cytometry, real-time quantitative RT-PCR, and DAS-ELISA analyses showed that all five stably transfected cell lines we re resistant to virusreplication when exposed to 100 CCID50 of avian influenza virus H5N1. Finally, most effective plasmids (pSi-604i and pSi-1597i) as the candidates for making the transgenic chickens were chosen. These findings provide baseline information on use of RNAi technique for breeding transgenic chickens resistant to avian influenza virus.

TTLL12 Inhibits the Activation of Cellular Antiviral Signaling through Interaction with VISA/MAVS.

PubMed

Ju, Lin-Gao; Zhu, Yuan; Lei, Pin-Ji; Yan, Dong; Zhu, Kun; Wang, Xiang; Li, Qing-Lan; Li, Xue-Jing; Chen, Jian-Wen; Li, Lian-Yun; Wu, Min

2017-02-01

Upon virus infection, host cells use retinoic-acid-inducible geneI I (RIG-I)-like receptors to recognize viral RNA and activate type I IFN expression. To investigate the role of protein methylation in the antiviral signaling pathway, we screened all the SET domain-containing proteins and identified TTLL12 as a negative regulator of RIG-I signaling. TTLL12 contains SET and TTL domains, which are predicted to have lysine methyltransferase and tubulin tyrosine ligase activities, respectively. Exogenous expression of TTLL12 represses IFN-β expression induced by Sendai virus. TTLL12 deficiency by RNA interference and CRISPR-gRNA techniques increases the induced IFN-β expression and inhibits virus replication in the cell. The global gene expression profiling indicated that TTLL12 specifically inhibits the expression of the downstream genes of innate immunity pathways. Cell fractionation and fluorescent staining indicated that TTLL12 is localized in the cytosol. The mutagenesis study suggested that TTLL12's ability to repress the RIG-I pathway is probably not dependent on protein modifications. Instead, TTLL12 directly interacts with virus-induced signaling adaptor (VISA), TBK1, and IKKε, and inhibits the interactions of VISA with other signaling molecules. Taken together, our findings demonstrate TTLL12 as a negative regulator of RNA-virus-induced type I IFN expression by inhibiting the interaction of VISA with other proteins. Copyright © 2017 by The American Association of Immunologists, Inc.

A Perspective on the Future of High-Throughput RNAi Screening: Will CRISPR Cut Out the Competition or Can RNAi Help Guide the Way?

PubMed

Taylor, Jessica; Woodcock, Simon

2015-09-01

For more than a decade, RNA interference (RNAi) has brought about an entirely new approach to functional genomics screening. Enabling high-throughput loss-of-function (LOF) screens against the human genome, identifying new drug targets, and significantly advancing experimental biology, RNAi is a fast, flexible technology that is compatible with existing high-throughput systems and processes; however, the recent advent of clustered regularly interspaced palindromic repeats (CRISPR)-Cas, a powerful new precise genome-editing (PGE) technology, has opened up vast possibilities for functional genomics. CRISPR-Cas is novel in its simplicity: one piece of easily engineered guide RNA (gRNA) is used to target a gene sequence, and Cas9 expression is required in the cells. The targeted double-strand break introduced by the gRNA-Cas9 complex is highly effective at removing gene expression compared to RNAi. Together with the reduced cost and complexity of CRISPR-Cas, there is the realistic opportunity to use PGE to screen for phenotypic effects in a total gene knockout background. This review summarizes the exciting development of CRISPR-Cas as a high-throughput screening tool, comparing its future potential to that of well-established RNAi screening techniques, and highlighting future challenges and opportunities within these disciplines. We conclude that the two technologies actually complement rather than compete with each other, enabling greater understanding of the genome in relation to drug discovery. © 2015 Society for Laboratory Automation and Screening.

A Real-Time Interference Monitoring Technique for GNSS Based on a Twin Support Vector Machine Method.

PubMed

Li, Wutao; Huang, Zhigang; Lang, Rongling; Qin, Honglei; Zhou, Kai; Cao, Yongbin

2016-03-04

Interferences can severely degrade the performance of Global Navigation Satellite System (GNSS) receivers. As the first step of GNSS any anti-interference measures, interference monitoring for GNSS is extremely essential and necessary. Since interference monitoring can be considered as a classification problem, a real-time interference monitoring technique based on Twin Support Vector Machine (TWSVM) is proposed in this paper. A TWSVM model is established, and TWSVM is solved by the Least Squares Twin Support Vector Machine (LSTWSVM) algorithm. The interference monitoring indicators are analyzed to extract features from the interfered GNSS signals. The experimental results show that the chosen observations can be used as the interference monitoring indicators. The interference monitoring performance of the proposed method is verified by using GPS L1 C/A code signal and being compared with that of standard SVM. The experimental results indicate that the TWSVM-based interference monitoring is much faster than the conventional SVM. Furthermore, the training time of TWSVM is on millisecond (ms) level and the monitoring time is on microsecond (μs) level, which make the proposed approach usable in practical interference monitoring applications.

A Real-Time Interference Monitoring Technique for GNSS Based on a Twin Support Vector Machine Method

PubMed Central

Li, Wutao; Huang, Zhigang; Lang, Rongling; Qin, Honglei; Zhou, Kai; Cao, Yongbin

2016-01-01

Interferences can severely degrade the performance of Global Navigation Satellite System (GNSS) receivers. As the first step of GNSS any anti-interference measures, interference monitoring for GNSS is extremely essential and necessary. Since interference monitoring can be considered as a classification problem, a real-time interference monitoring technique based on Twin Support Vector Machine (TWSVM) is proposed in this paper. A TWSVM model is established, and TWSVM is solved by the Least Squares Twin Support Vector Machine (LSTWSVM) algorithm. The interference monitoring indicators are analyzed to extract features from the interfered GNSS signals. The experimental results show that the chosen observations can be used as the interference monitoring indicators. The interference monitoring performance of the proposed method is verified by using GPS L1 C/A code signal and being compared with that of standard SVM. The experimental results indicate that the TWSVM-based interference monitoring is much faster than the conventional SVM. Furthermore, the training time of TWSVM is on millisecond (ms) level and the monitoring time is on microsecond (μs) level, which make the proposed approach usable in practical interference monitoring applications. PMID:26959020

Molecular interactions and immune responses between Maize fine streak virus and the leafhopper vector Graminella nigrifrons through differential expression and RNA interference.

PubMed

Chen, Y; Redinbaugh, M G; Michel, A P

2015-06-01

Graminella nigrifrons is the only known vector for Maize fine streak virus (MFSV). In this study, we used real-time quantitative PCR to compare the expression profiles of transcripts that putatively function in the insect immune response: four peptidoglycan recognition proteins (PGRP-SB1, -SD, -LC and LB), Toll, spaetzle, defensin, Dicer-2 (Dcr-2), Argonaut-2 (Ago-2) and Arsenic resistance protein 2 (Ars-2). Except for PGRP-LB and defensin, transcripts involved in humoral pathways were significantly suppressed in G. nigrifrons fed on MFSV-infected maize. The abundance of three RNA interference (RNAi) pathway transcripts (Dcr-2, Ago-2, Ars-2) was significantly lower in nontransmitting relative to transmitting G. nigrifrons. Injection with double-stranded RNA (dsRNA) encoding segments of the PGRP-LC and Dcr-2 transcripts effectively reduced transcript levels by 90 and 75% over 14 and 22 days, respectively. MFSV acquisition and transmission were not significantly affected by injection of either dsRNA. Knock-down of PGRP-LC resulted in significant mortality (greater than 90%) at 27 days postinjection, and resulted in more abnormal moults relative to those injected with Dcr-2 or control dsRNA. The use of RNAi to silence G. nigrifrons transcripts will facilitate the study of gene function and pathogen transmission, and may provide approaches for developing novel targets of RNAi-based pest control. © 2015 The Royal Entomological Society.

Species specific inhibition of viral replication using dicer substrate siRNAs (DsiRNAs) targeting the viral nucleoprotein of the fish pathogenic rhabdovirus viral hemorrhagic septicemia virus (VHSV).

PubMed

Bohle, Harry; Lorenzen, Niels; Schyth, Brian Dall

2011-06-01

Gene knock down by the use of small interfering RNAs (siRNAs) is widely used as a method for reducing the expression of specific genes in eukaryotic cells via the RNA interference pathway. But, the effectivity of siRNA induced gene knock down in cells from fish has in several studies been questioned and the specificity seems to be a general problem in cells originating from both lower and higher vertebrates. Here we show that we are able to reduce the level of viral gene expression and replication specifically in fish cells in vitro. We do so by using 27/25-mer DsiRNAs acting as substrates for dicer for the generation of siRNAs targeting the nucleoprotein N gene of viral hemorrhagic septicemia virus (VHSV). This rhabdovirus infects salmonid fish and is responsible for large yearly losses in aquaculture production. Specificity of the DsiRNA is assured in two ways: first, by using the conventional method of testing a control DsiRNA which should not target the gene of interest. Second, by assuring that replication of a heterologous virus of the same genus as the target virus was not inhibited by the DsiRNA. Target controls are, as we have previously highlighted, essential for verification of the specificity of siRNA-induced interference with virus multiplication, but they are still not in general use. Copyright © 2011 Elsevier B.V. All rights reserved.

siRNA targeting decoy receptor 3 enhances the sensitivity of gastric carcinoma cells to 5-fluorouracil.

PubMed

Xu, Xiao-Tao; Tao, Ze-Zhang; Song, Qi-Bin; Yao, Yi; Ruan, Peng

2012-09-01

In order to investigate the effects of RNA interference of decoy receptor 3 (DcR3) on the sensitivity of gastric cancer cells to 5-fluorouracil (5-FU) and the relevant mechanisms, siRNA against DcR3 was transfected into the gastric cancer cell line AGS. AGS cells were treated with different doses of 5-FU or for different time periods. The sensitivity of AGS cells to 5-FU was determined. The cell survival rate was detected by MTT assay. The apoptotic rate was determined by DAPI staining, and the expression of related proteins were detected by western blot analysis. The results showed that the cell survival rate was significanlty decreased in the knockdown group compared to the control group at different doses of 5-FU (P<0.01). After different time periods of treatment with 5-FU, the cell survival rate in the knockdown group was significantly decreased compared to the control group, respectively (P<0.01). The apoptotic rate of AGS cells in the knockdown group was increased along with the increasing dose of siRNA. The siRNA against DcR3 enhanced the expression of Fas, FasL, caspase-3 and caspase-8. In conclusion, knockdown of DcR3 by RNA interference enhances apoptosis and inhibits the growth of gastric cancer cells. Downregulation of DcR3 enhances the sensitivity of gastric cancer cells to 5-FU and increased the expression of Fas, FasL and caspase-3/8.

Interference in plant defense and development by non-structural protein NSs of Groundnut bud necrosis virus.

PubMed

Goswami, Suneha; Sahana, Nandita; Pandey, Vanita; Doblas, Paula; Jain, R K; Palukaitis, Peter; Canto, Tomas; Praveen, Shelly

2012-01-01

Groundnut bud necrosis virus (GBNV) infects a large number of leguminous and solanaceous plants. To elucidate the biological function of the non-structural protein encoded by the S RNA of GBNV (NSs), we studied its role in RNA silencing suppression and in viral pathogenesis. Our results demonstrated that GBNV NSs functions as a suppressor of RNA silencing using the agroinfiltration patch assay. An in silico analysis suggested the presence of pro-apoptotic protein Reaper-like sequences in the GBNV NSs, which were known to be present in animal infecting bunyaviruses. Utilizing NSs mutants, we demonstrated that a Leu-rich domain was required for RNA silencing suppression activity, but not the non-overlapping Trp/GH3 motif of the Reaper-like sequence. To investigate the role of NSs in symptom development we generated transgenic tomato expressing the GBNV NSs and showed that the expression of NSs in tomato mimics symptoms induced by infection with GBNV, such as leaf senescence and necrosis. As leaf senescence is controlled by miR319 regulation of the transcription factor TCP1, we assessed the accumulation of both RNAs in transgenic NSs-expressing and GBNV-infected tomato plants. In both types of plants the levels of miR319 decreased, while the levels of TCP1 transcripts increased. We propose that GBNV-NSs affects miRNA biogenesis through its RNA silencing suppressor activity and interferes with TCP1-regulated leaf developmental pathways. Copyright © 2011 Elsevier B.V. All rights reserved.

Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome

NASA Astrophysics Data System (ADS)

Lu, Rui; Folimonov, Alexey; Shintaku, Michael; Li, Wan-Xiang; Falk, Bryce W.; Dawson, William O.; Ding, Shou-Wei

2004-11-01

Viral infection in both plant and invertebrate hosts requires a virus-encoded function to block the RNA silencing antiviral defense. Here, we report the identification and characterization of three distinct suppressors of RNA silencing encoded by the 20-kb plus-strand RNA genome of citrus tristeza virus (CTV). When introduced by genetic crosses into plants carrying a silencing transgene, both p20 and p23, but not coat protein (CP), restored expression of the transgene. Although none of the CTV proteins prevented DNA methylation of the transgene, export of the silencing signal (capable of mediating intercellular silencing spread) was detected only from the F1 plants expressing p23 and not from the CP- or p20-expressing F1 plants, demonstrating suppression of intercellular silencing by CP and p20 but not by p23. Thus, intracellular and intercellular silencing are each targeted by a CTV protein, whereas the third, p20, inhibits silencing at both levels. Notably, CP suppresses intercellular silencing without interfering with intracellular silencing. The novel property of CP suggests a mechanism distinct to p20 and all of the other viral suppressors known to interfere with intercellular silencing and that this class of viral suppressors may not be consistently identified by Agrobacterium coinfiltration because it also induces RNA silencing against the infiltrated suppressor transgene. Our analyses reveal a sophisticated viral counter-defense strategy that targets the silencing antiviral pathway at multiple steps and may be essential for protecting CTV with such a large RNA genome from antiviral silencing in the perennial tree host. RNA interference | citrus tristeza virus | virus synergy | antiviral immunity

Decreased expression of RNA interference machinery, Dicer and Drosha, is associated with poor outcome in ovarian cancer patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Merritt, William M.; Lin, Yvonne G.; Han, Liz Y.

2008-05-06

The clinical and functional significance of RNA interference (RNAi) machinery, Dicer and Drosha, in ovarian cancer is not known and was examined. Dicer and Drosha expression was measured in ovarian cancer cell lines (n=8) and invasive epithelial ovarian cancer specimens (n=111) and correlated with clinical outcome. Validation was performed with previously published cohorts of ovarian, breast, and lung cancer patients. Anti-Galectin-3 siRNA and shRNA transfections were used for in vitro functional studies. Dicer and Drosha mRNA and protein levels were decreased in 37% to 63% of ovarian cancer cell lines and in 60% and 51% of human ovarian cancer specimens,more » respectively. Low Dicer was significantly associated with advanced tumor stage (p=0.007), and low Drosha with suboptimal surgical cytoreduction (p=0.02). Tumors with both high Dicer and Drosha were associated with increased median patient survival (>11 years vs. 2.66 years for other groups; p<0.001). In multivariate analysis, high Dicer (HR=0.48; p=0.02), high-grade histology (HR=2.46; p=0.03), and poor chemoresponse (HR=3.95; p<0.001) were identified as independent predictors of disease-specific survival. Findings of poor clinical outcome with low Dicer expression were validated in separate cohorts of cancer patients. Galectin-3 silencing with siRNA transfection was superior to shRNA in cell lines with low Dicer (78-95% vs. 4-8% compared to non-targeting sequences), and similar in cell lines with high Dicer. Our findings demonstrate the clinical and functional impact of RNAi machinery alterations in ovarian carcinoma and support the use of siRNA constructs that do not require endogenous Dicer and Drosha for therapeutic applications.« less

HIV-1 RNAs are Not Part of the Argonaute 2 Associated RNA Interference Pathway in Macrophages.

PubMed

Vongrad, Valentina; Imig, Jochen; Mohammadi, Pejman; Kishore, Shivendra; Jaskiewicz, Lukasz; Hall, Jonathan; Günthard, Huldrych F; Beerenwinkel, Niko; Metzner, Karin J

2015-01-01

MiRNAs and other small noncoding RNAs (sncRNAs) are key players in post-transcriptional gene regulation. HIV-1 derived small noncoding RNAs (sncRNAs) have been described in HIV-1 infected cells, but their biological functions still remain to be elucidated. Here, we approached the question whether viral sncRNAs may play a role in the RNA interference (RNAi) pathway or whether viral mRNAs are targeted by cellular miRNAs in human monocyte derived macrophages (MDM). The incorporation of viral sncRNAs and/or their target RNAs into RNA-induced silencing complex was investigated using photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) as well as high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation (HITS-CLIP), which capture Argonaute2-bound miRNAs and their target RNAs. HIV-1 infected monocyte-derived macrophages (MDM) were chosen as target cells, as they have previously been shown to express HIV-1 sncRNAs. In addition, we applied small RNA deep sequencing to study differential cellular miRNA expression in HIV-1 infected versus non-infected MDMs. PAR-CLIP and HITS-CLIP data demonstrated the absence of HIV-1 RNAs in Ago2-RISC, although the presence of a multitude of HIV-1 sncRNAs in HIV-1 infected MDMs was confirmed by small RNA sequencing. Small RNA sequencing revealed that 1.4% of all sncRNAs were of HIV-1 origin. However, neither HIV-1 derived sncRNAs nor putative HIV-1 target sequences incorporated into Ago2-RISC were identified suggesting that HIV-1 sncRNAs are not involved in the canonical RNAi pathway nor is HIV-1 targeted by this pathway in HIV-1 infected macrophages.

RNA interference of carboxyesterases causes nymph mortality in the Asian citrus psyllid, Diaphorina citri.

PubMed

Kishk, Abdelaziz; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Gowda, Siddarame; Killiny, Nabil

2017-03-01

Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is an important pest of citrus. In addition, D. citri is the vector of Huanglongbing, a destructive disease in citrus, also known as citrus greening disease caused by Candidatus Liberibacter asiaticus. Huanglongbing causes huge losses for citrus industries. Insecticide application for D. citri is the major strategy to prevent disease spread. The heavy use of insecticides causes development of insecticide resistance. We used RNA interference (RNAi) to silence genes implicated in pesticide resistance in order to increase the susceptibility. The activity of dsRNA to reduce the expression of carboxyesterases including esterases FE4 (EstFE4) and acetylcholinesterases (AChe) in D. citri was investigated. The dsRNA was applied topically to the fourth and fifth instars of nymphs. We targeted several EstFE4 and AChe genes using dsRNA against a consensus sequence for each of them. Five concentrations (25, 50, 75, 100, 125 ng/μl) from both dsRNAs were used. The treatments with the dsRNA caused concentration dependent nymph mortality. The highest gene expression levels of both AChe and EstFE4 were found in the fourth and fifth nymphal instars. Gene expression analysis showed that AChe genes were downregulated in emerged adults from dsRNA-AChe-treated nymphs compared to controls. However, EstFE4 genes were not affected. In the same manner, treatment with dsRNA-EstFE4 reduced expression level of EstFE4 genes in emerged adults from treated nymphs, but did not affect the expression of AChe genes. In the era of environmentally friendly control strategies, RNAi is a new promising venue to reduce pesticide applications. © 2017 Wiley Periodicals, Inc.

The effects of RNA interference mediated VEGF gene silencing on biological behavior of renal cell carcinoma and transplanted renal tumor in nude mice.

PubMed

Wang, Qi; Wang, Shuai; Sun, Si-Qiao; Cheng, Zhi-Hua; Zhang, Yang; Chen, Guang; Gu, Meng; Yao, Hai-Jun; Wang, Zhong; Zhou, Juan; Peng, Yu-Bing; Xu, Ming-Xi; Zhang, Ke; Sun, Xi-Wei

2016-01-01

This study was to explore the effects of RNA interference mediated vascular endothelial growth factor (VEGF) gene silencing on biological behavior of renal cell carcinoma (RCC), transplanted renal tumor and angiogenesis in nude mice. The specific siRNA sequence targeting VEGF were designed and synthesized to construct hVEGF-siRNA plasmid which was transfected into RCC 786-O cells. Reverse transcriptase-polymerase chain reaction (RT-PCR) was used for the detection of VEGF gene expression and western blot was adopted for the examination of VEGF protein expression. The 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used to detect cell growth as well as cell migration and invasion. The transplanted renal tumor models in nude mice were established, and the growth condition of nude mice, and VEGF protein expression in transplanted tumor slices and the microvessel density (MVD) were detected. The expression level of VEGF mRNA in VEGF-siRNA group was significant lower than that in the control group and negative group, suggesting that establishment of plasmid specifically inhibited the expression of VEGF gene The expression level of VEGF protein in VEGF-siRNA group was significant lower than that in the control group and negative group. VEGF gene silencing has the significant inhibition effects on proliferation, migration and invasion of RCC 786-O cells. The tumor weight, VEGF protein positive rate and MVD in VEGF-siRNA group were significant lower than those in negative group and blank group. The VEGF gene silencing could inhibit the cell proliferation, migration and invasion of RCC 786-O cells; inhibition of VEGF protein expression could prevent transplanted RCC growth and tumor angiogenesis.

Interference of transcription across H-NS binding sites and repression by H-NS.

PubMed

Rangarajan, Aathmaja Anandhi; Schnetz, Karin

2018-05-01

Nucleoid-associated protein H-NS represses transcription by forming extended DNA-H-NS complexes. Repression by H-NS operates mostly at the level of transcription initiation. Less is known about how DNA-H-NS complexes interfere with transcription elongation. In vitro H-NS has been shown to enhance RNA polymerase pausing and to promote Rho-dependent termination, while in vivo inhibition of Rho resulted in a decrease of the genome occupancy by H-NS. Here we show that transcription directed across H-NS binding regions relieves H-NS (and H-NS/StpA) mediated repression of promoters in these regions. Further, we observed a correlation of transcription across the H-NS-bound region and de-repression. The data suggest that the transcribing RNA polymerase is able to remodel the H-NS complex and/or dislodge H-NS from the DNA and thus relieve repression. Such an interference of transcription and H-NS mediated repression may imply that poorly transcribed AT-rich loci are prone to be repressed by H-NS, while efficiently transcribed loci escape repression. © 2018 John Wiley & Sons Ltd.

An in vivo and in silico approach to study cis-antisense: a short cut to higher order response

NASA Astrophysics Data System (ADS)

Courtney, Colleen; Varanasi, Usha; Chatterjee, Anushree

2014-03-01

Antisense interactions are present in all domains of life. Typically sense, antisense RNA pairs originate from overlapping genes with convergent face to face promoters, and are speculated to be involved in gene regulation. Recent studies indicate the role of transcriptional interference (TI) in regulating expression of genes in convergent orientation. Modeling antisense, TI gene regulation mechanisms allows us to understand how organisms control gene expression. We present a modeling and experimental framework to understand convergent transcription that combines the effects of transcriptional interference and cis-antisense regulation. Our model shows that combining transcriptional interference and antisense RNA interaction adds multiple-levels of regulation which affords a highly tunable biological output, ranging from first order response to complex higher-order response. To study this system we created a library of experimental constructs with engineered TI and antisense interaction by using face-to-face inducible promoters separated by carefully tailored overlapping DNA sequences to control expression of a set of fluorescent reporter proteins. Studying this gene expression mechanism allows for an understanding of higher order behavior of gene expression networks.

RNA Interference in Insect Vectors for Plant Viruses.

PubMed

Kanakala, Surapathrudu; Ghanim, Murad

2016-12-12

Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists.

RNA Interference in Insect Vectors for Plant Viruses

PubMed Central

Kanakala, Surapathrudu; Ghanim, Murad

2016-01-01

Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists. PMID:27973446

RNA Interference towards the Potato Psyllid, Bactericera cockerelli, Is Induced in Plants Infected with Recombinant Tobacco mosaic virus (TMV)

PubMed Central

Wuriyanghan, Hada; Falk, Bryce W.

2013-01-01

The potato/tomato psyllid, Bactericera cockerelli (B. cockerelli), is an important plant pest and the vector of the phloem-limited bacterium Candidatus Liberibacter psyllaurous (solanacearum), which is associated with the zebra chip disease of potatoes. Previously, we reported induction of RNA interference effects in B. cockerelli via in vitro-prepared dsRNA/siRNAs after intrathoracic injection, and after feeding of artificial diets containing these effector RNAs. In order to deliver RNAi effectors via plant hosts and to rapidly identify effective target sequences in plant-feeding B. cockerelli, here we developed a plant virus vector-based in planta system for evaluating candidate sequences. We show that recombinant Tobacco mosaic virus (TMV) containing B. cockerelli sequences can efficiently infect and generate small interfering RNAs in tomato (Solanum lycopersicum), tomatillo (Physalis philadelphica) and tobacco (Nicotiana tabacum) plants, and more importantly delivery of interfering sequences via TMV induces RNAi effects, as measured by actin and V-ATPase mRNA reductions, in B. cockerelli feeding on these plants. RNAi effects were primarily detected in the B. cockerelli guts. In contrast to our results with TMV, recombinant Potato virus X (PVX) and Tobacco rattle virus (TRV) did not give robust infections in all plants and did not induce detectable RNAi effects in B. cockerelli. The greatest RNA interference effects were observed when B. cockerelli nymphs were allowed to feed on leaf discs collected from inoculated or lower expanded leaves from corresponding TMV-infected plants. Tomatillo plants infected with recombinant TMV containing B. cockerelli actin or V-ATPase sequences also showed phenotypic effects resulting in decreased B. cockerelli progeny production as compared to plants infected by recombinant TMV containing GFP. These results showed that RNAi effects can be achieved in plants against the phloem feeder, B. cockerelli, and the TMV-plant system will provide a faster and more convenient method for screening of suitable RNAi target sequences in planta. PMID:23824081

Rapid detection of biofilms and adherent pathogens using scanning confocal laser microscopy and episcopic differential interference contrast microscopy.

PubMed

Keevil, C W

2003-01-01

Knowledge of biofilm structure and function has changed significantly in the last few years due to advances in light microscopy. One pertinent example is the use of scanning confocal laser microscopy (SCLM) to visualise corrosion pits caused by the biofilm mosaic footprint on corroding metal surfaces. Nevertheless, SCLM has some limitations as to its widespread use, including cost, inability to observe motile bacteria and eukaryotic grazers within biofilms, and difficulty to scan a curved surface. By contrast, episcopic differential interference contrast (EDIC) microscopy has provided a rapid, real time analysis of biofilms on opaque, curved, natural or man-made surfaces without the need for cover slips and oil. EDIC, coupled with epi-fluorescence (EDIC/EF), microscopy has been used successfully to visualise the 3-D biofilm structure, physiological niches, protozoal grazing and iron biomineralization, and the location of specific pathogens such as Legionella pneumophila, Campylobacter jejuni and Cryptosporidium parvum. These species were identified using gold nanoparticles or fluorophores coupled to monoclonal antibodies or 16S rRNA probes, respectively. Among its many potential uses, the EDIC technique will provide a rapid procedure to facilitate the calibration of the modern generation of biofilm-sensing electrodes.

Prohibitin-mediated mitochondrial ubiquitination during spermiogenesis in Chinese mitten crab Eriocheir sinensis

PubMed Central

Hou, Cong-Cong; Wei, Chao-Guang; Lu, Cheng-Peng; Gao, Xin-Ming; Yang, Wan-Xi; Zhu, Jun-Quan

2017-01-01

The sperm of Eriocheir sinensis has a cup-shaped nucleus that contains several mitochondria embedded at the opening of the cup. The acrosome vesicle also contains derivants of mitochondria. The mitochondria distribution pattern involves a decrease in the number and changes in the structure and transportation of these organelles. The decreased number of sperm mitochondria is achieved through autophagy or the ubiquitination pathway. Prohibitin (PHB), the mitochondria inner membrane protein, is an evolutionarily highly conserved protein, is closely associated with spermatogenesis and sperm quality control and is also a potential substrate of ubiquitination. However, whether PHB protein mediates the ubiquitination pathway of sperm mitochondria in crustacean animals remains poorly understood. In the present study, we revealed that PHB, a substrate of ubiquitin, participates in the ubiquitination and degradation of mitochondria during spermiogenesis in E. sinensis. To confirm this finding, we used shRNA interference to reduce PHB expression and an overexpression technique to increase PHB expression in vitro. The interference experiment showed that the reduced PHB expression directly affected the polyubiquitination level and mitochondria status, whereas PHB overexpression markedly increased the polyubiquitination level. In vitro experiments also showed that PHB and its ubiquitination decide the fate of mitochondria. PMID:29228727

Genetic manipulation of isoprene emissions in poplar plants remodels the chloroplast proteome.

PubMed

Velikova, Violeta; Ghirardo, Andrea; Vanzo, Elisa; Merl, Juliane; Hauck, Stefanie M; Schnitzler, Jörg-Peter

2014-04-04

Biogenic isoprene (2-methyl-1,3-butadiene) improves the integrity and functionality of thylakoid membranes and scavenges reactive oxygen species (ROS) in plant tissue under stress conditions. On the basis of available physiological studies, we hypothesized that the suppression of isoprene production in the poplar plant by genetic engineering would cause changes in the chloroplast protein pattern, which in turn would compensate for changes in chloroplast functionality and overall plant performance under abiotic stress. To test this hypothesis, we used a stable isotope-coded protein-labeling technique in conjunction with polyacrylamide gel electrophoresis and liquid chromatography tandem mass spectrometry. We analyzed quantitative and qualitative changes in the chloroplast proteome of isoprene-emitting and non isoprene-emitting poplars. Here we demonstrate that suppression of isoprene synthase by RNA interference resulted in decreased levels of chloroplast proteins involved in photosynthesis and increased levels of histones, ribosomal proteins, and proteins related to metabolism. Overall, our results show that the absence of isoprene triggers a rearrangement of the chloroplast protein profile to minimize the negative stress effects resulting from the absence of isoprene. The present data strongly support the idea that isoprene improves/stabilizes thylakoid membrane structure and interferes with the production of ROS.

RNA interference of GGTA1 physiological and immune functions in immortalized porcine aortic endothelial cells.

PubMed

Han, Wei; Zhou, Jingshi; Li, Xiao; Wang, Jianfeng; Li, Junjie; Zhang, Zhuochao; Yang, Zhaoxu; Wang, Desheng; Tao, Kaishan; Dou, Kefeng

2013-11-01

Pig organs are commonly used in xenotransplantation, and α-1,3-galactose has been shown to be the main cause of hyperacute rejection. The development of transgenic pigs that lack α-1,3-galactosyltransferase (GGTA1) has overcome this problem to a certain extent, but transgenic pigs are difficult to maintain, making their usefulness in basic research limited. For this reason, we propose to establish a cell model to study hyperacute rejection. Immortalized primary porcine aortic endothelial cells were transfected with a short hairpin RNA targeted to GGTA1. Cell proliferation, apoptosis, complement C3 activation, and the binding of human immunoglobulins and components of the complement system, including IgM, IgG, C3, and C5b-9, were examined. After RNA interference, GGTA1 was found to be reduced at both the transcript and protein level as assessed by quantitative polymerase chain reaction and flow cytometry, respectively. When cultured in the presence of human serum, the proliferation rate of the transfected cells was higher than that of untransfected cells, and the apoptosis rate was lower. Additionally, activation of C3 and the binding of human immunoglobulins IgM and IgG and complement component C3 and C5b-9 to the transfected cells were lower than in the immortalized group but higher than in untransfected cells. RNA interference of GGTA1 in cultured porcine endothelial cells reduces the reaction of immunoglobulin and complement system with the cells. Therefore, this in vitro cell model could be useful for further study of xenotransplantation. Copyright © 2013 Elsevier Inc. All rights reserved.

RNA interference-based functional knockdown of the voltage-gated potassium channel Kv7.2 in dorsal root ganglion neurons after in vitro and in vivo gene transfer by adeno-associated virus vectors.

PubMed

Valdor, Markus; Wagner, Anke; Röhrs, Viola; Berg, Johanna; Fechner, Henry; Schröder, Wolfgang; Tzschentke, Thomas M; Bahrenberg, Gregor; Christoph, Thomas; Kurreck, Jens

2018-01-01

Activation of the neuronal potassium channel Kv7.2 encoded by the KCNQ2 gene has recently been shown to be an attractive mechanism to inhibit nociceptive transmission. However, potent, selective, and clinically proven activators of Kv7.2/Kv7.3 currents with analgesic properties are still lacking. An important prerequisite for the development of new drugs is a model to test the selectivity of novel agonists by abrogating Kv7.2/Kv7.3 function. Since constitutive knockout mice are not viable, we developed a model based on RNA interference-mediated silencing of KCNQ2. By delivery of a KCNQ2-specific short hairpin RNA with adeno-associated virus vectors, we completely abolished the activity of the specific Kv7.2/Kv7.3-opener ICA-27243 in rat sensory neurons. Results obtained in the silencing experiments were consistent between freshly prepared and cryopreserved dorsal root ganglion neurons, as well as in dorsal root ganglion neurons dissociated and cultured after in vivo administration of the silencing vector by intrathecal injections into rats. Interestingly, the tested associated virus serotypes substantially differed with respect to their transduction capability in cultured neuronal cell lines and primary dorsal root ganglion neurons and the in vivo transfer of transgenes by intrathecal injection of associated virus vectors. However, our study provides the proof-of-concept that RNA interference-mediated silencing of KCNQ2 is a suitable approach to create an ex vivo model for testing the specificity of novel Kv7.2/Kv7.3 agonists.

Dual role for argonautes in microRNA processing and posttranscriptional regulation of microRNA expression.

PubMed

Diederichs, Sven; Haber, Daniel A

2007-12-14

MicroRNAs are small endogenous noncoding RNAs involved in posttranscriptional gene regulation. During microRNA biogenesis, Drosha and Dicer process the primary transcript (pri-miRNA) through a precursor hairpin (pre-miRNA) to the mature miRNA. The miRNA is incorporated into the RNA-Induced Silencing Complex (RISC) with Argonaute proteins, the effector molecules in RNA interference (RNAi). Here, we show that all Argonautes elevate mature miRNA expression posttranscriptionally, independent of RNase activity. Also, we identify a role for the RISC slicer Argonaute2 (Ago2) in cleaving the pre-miRNA to an additional processing intermediate, termed Ago2-cleaved precursor miRNA or ac-pre-miRNA. This endogenous, on-pathway intermediate results from cleavage of the pre-miRNA hairpin 12 nucleotides from its 3'-end. By analogy to siRNA processing, Ago2 cleavage may facilitate removal of the nicked passenger strand from RISC after maturation. The multiple roles of Argonautes in the RNAi effector phase and miRNA biogenesis and maturation suggest coordinate regulation of microRNA expression and function.

dsRNA binding properties of RDE-4 and TRBP reflect their distinct roles in RNAi.

PubMed

Parker, Greg S; Maity, Tuhin Subhra; Bass, Brenda L

2008-12-26

Double-stranded RNA (dsRNA)-binding proteins facilitate Dicer functions in RNA interference. Caenorhabditis elegans RDE-4 facilitates cleavage of long dsRNA to small interfering RNA (siRNA), while human trans-activation response RNA-binding protein (TRBP) functions downstream to pass siRNA to the RNA-induced silencing complex. We show that these distinct in vivo roles are reflected in in vitro binding properties. RDE-4 preferentially binds long dsRNA, while TRBP binds siRNA with an affinity that is independent of dsRNA length. These properties are mechanistically based on the fact that RDE-4 binds cooperatively, via contributions from multiple domains, while TRBP binds noncooperatively. Our studies offer a paradigm for how dsRNA-binding proteins, which are not sequence specific, discern dsRNA length. Additionally, analyses of the ability of RDE-4 deletion constructs and RDE-4/TRBP chimeras to reconstitute Dicer activity suggest RDE-4 promotes activity using its dsRNA-binding motif 2 to bind dsRNA, its linker region to interact with Dicer, and its C-terminus for Dicer activation.

Silencing the myotrophin gene by RNA interference leads to the regression of cardiac hypertrophy.

PubMed

Gupta, Sudhiranjan; Maitra, Ratan; Young, Dave; Gupta, Anasuya; Sen, Subha

2009-08-01

Myotrophin-induced activation of NF-kappaB has been shown to be associated with cardiac hypertrophy (CH) that progresses to heart failure (HF). In the present study, we examined the cause-and-effect relationship between myotrophin and NF-kappaB activation using small hairpin RNA (shRNA) against myotrophin both in vitro (using neonatal rat myocytes) and in vivo [using myotrophin transgenic (Myo-Tg) mice, which overexpress myotrophin in the heart, develop CH, and gradually progress to HF]. Among several lentiviral vectors expressing myotrophin shRNAs, L-sh-109 showed the best silencing effect at both the mRNA (155.3 +/- 5.9 vs. 32.5 +/- 5.5, P < 0.001) and protein levels associated with a significant reduction of atrial natriuretic factor (ANF) and NF-kappaB. In vivo, when L-sh-109 was delivered directly into the hearts of 10-wk-old Myo-Tg mice, we observed a significant regression of cardiac mass (8.0 vs. 5.7 mg/g, P < 0.001) and myotrophin gene expression (54.5% over untreated Myo-Tg mice, P < 0.001) associated with a reduction in ANF and NF-kappaB signaling components. Our data suggest that using RNA interference to silence the myotrophin gene prevents NF-kappaB activation, associated with an attenuation of CH. This strategy could be an excellent therapeutic means for the treatment of CH and HF.

[Herpes simplex virus-mediated RNA interference targeting vesicular glutamate transporter 3 attenuates tactile allodynia in mice].

PubMed

Liu, Jie-Qiong; Li, Chen-Hong; Luo, Qiong; Yin, Ping-Ping; Lei, Tao; Luo, Fang

2016-11-20

To construct a replication-deficient herpes simplex virus (HSV-1) for delivering a short hairpin RNA (shRNA) targeting vesicular glutamate transporter 3 (VGLUT3) and observe its effect in alleviating allodynia in mice. The recombinant HSV-1 vector carrying the shRNA targeting Vglut3 (HSV-1-shvglut3) was constructed and inoculated in the sciatic nerve in a mouse model of mechanical allodynia to test its analgesia effect. Mechanical allodynia and heat hypersensitivity of the mice were tested by von Frey filaments and Hargreaves' test, respectively. VGLUT3 expression in the dorsal root ganglion (DRG) was evaluated by immunohistochemistry and Western blotting. Following inoculation in the sciatic nerve, the HSV vector HSV-1-shvglut3 was retrogradely transported to the DRG. Mechanical withdraw thresholds of the mouse models receiving HSV-1-shvglut3 inoculation were reversed to nearly the baseline level, and VGLUT3 expression in the DRG was down-regulated 2 weeks after vector inoculation. The analgesic effect lasted for over 2 weeks in these mice without obvious systematic side effects or changes in heat hypersensitivity threshold. Vglut3 in the DRG is a promising therapeutic target for alleviating mechanical allodynia, and HSV-1 vector-mediated RNA interference is safe and efficient for inducing long-lasting analgesia after peripheral inoculation of the vector.

RNA interference can be used to disrupt gene function in tardigrades

PubMed Central

Tenlen, Jennifer R.; McCaskill, Shaina; Goldstein, Bob

2012-01-01

How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We show that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions, and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments. PMID:23187800

Combinatorial RNA Interference Therapy Prevents Selection of Pre-existing HBV Variants in Human Liver Chimeric Mice

PubMed Central

Shih, Yao-Ming; Sun, Cheng-Pu; Chou, Hui-Hsien; Wu, Tzu-Hui; Chen, Chun-Chi; Wu, Ping-Yi; Enya Chen, Yu-Chen; Bissig, Karl-Dimiter; Tao, Mi-Hua

2015-01-01

Selection of escape mutants with mutations within the target sequence could abolish the antiviral RNA interference activity. Here, we investigated the impact of a pre-existing shRNA-resistant HBV variant on the efficacy of shRNA therapy. We previously identified a highly potent shRNA, S1, which, when delivered by an adeno-associated viral vector, effectively inhibits HBV replication in HBV transgenic mice. We applied the “PICKY” software to systemically screen the HBV genome, then used hydrodynamic transfection and HBV transgenic mice to identify additional six highly potent shRNAs. Human liver chimeric mice were infected with a mixture of wild-type and T472C HBV, a S1-resistant HBV variant, and then treated with a single or combined shRNAs. The presence of T472C mutant compromised the therapeutic efficacy of S1 and resulted in replacement of serum wild-type HBV by T472C HBV. In contrast, combinatorial therapy using S1 and P28, one of six potent shRNAs, markedly reduced titers for both wild-type and T472C HBV. Interestingly, treatment with P28 alone led to the emergence of escape mutants with mutations in the P28 target region. Our results demonstrate that combinatorial RNAi therapy can minimize the escape of resistant viral mutants in chronic HBV patients. PMID:26482836

RNA interference can be used to disrupt gene function in tardigrades.

PubMed

Tenlen, Jennifer R; McCaskill, Shaina; Goldstein, Bob

2013-05-01

How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We showed that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments.

RNA Interference: A New Mechanism by Which FMRP Acts in the Normal Brain? What Can Drosophila Teach Us?

ERIC Educational Resources Information Center

Siomi, Haruhiko; Ishizuka, Akira; Siomi, Mikiko C.

2004-01-01

Fragile X syndrome is the most common heritable form of mental retardation caused by loss-of-function mutations in the "FMR1" gene. The "FMR1" gene encodes an RNA-binding protein that associates with translating ribosomes and acts as a negative translational regulator. Recent work in "Drosophila melanogaster" has shown that the fly homolog of…

Fingerprint extraction from interference destruction terahertz spectrum.

PubMed

Xiong, Wei; Shen, Jingling

2010-10-11

In this paper, periodic peaks in a terahertz absorption spectrum are confirmed to be induced from interference effects. Theoretically, we explained the periodic peaks and calculated the locations of them. Accordingly, a technique was suggested, with which the interference peaks in a terahertz spectrum can be eliminated and therefore a real terahertz absorption spectrum can be obtained. Experimentally, a sample, Methamphetamine, was investigated and its terahertz fingerprint was successfully extracted from its interference destruction spectrum. This technique is useful in getting samples' terahertz fingerprint spectra, and furthermore provides a fast nondestructive testing method using a large size terahertz beam to identify materials.

Cigarette smoking substantially alters plasma microRNA profiles in healthy subjects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Takahashi, Kei; Yokota, Shin-ichi; Tatsumi, Naoyuki

Circulating microRNAs (miRNAs) are receiving attention as potential biomarkers of various diseases, including cancers, chronic obstructive pulmonary disease, and cardiovascular disease. However, it is unknown whether the levels of circulating miRNAs in a healthy subject might vary with external factors in daily life. In this study, we investigated whether cigarette smoking, a habit that has spread throughout the world and is a risk factor for various diseases, affects plasma miRNA profiles. We determined the profiles of 11 smokers and 7 non-smokers by TaqMan MicroRNA array analysis. A larger number of miRNAs were detected in smokers than in non-smokers, and themore » plasma levels of two-thirds of the detected miRNAs (43 miRNAs) were significantly higher in smokers than in non-smokers. A principal component analysis of the plasma miRNA profiles clearly separated smokers and non-smokers. Twenty-four of the miRNAs were previously reported to be potential biomarkers of disease, suggesting the possibility that smoking status might interfere with the diagnosis of disease. Interestingly, we found that quitting smoking altered the plasma miRNA profiles to resemble those of non-smokers. These results suggested that the differences in the plasma miRNA profiles between smokers and non-smokers could be attributed to cigarette smoking. In addition, we found that an acute exposure of ex-smokers to cigarette smoke (smoking one cigarette) did not cause a dramatic change in the plasma miRNA profile. In conclusion, we found that repeated cigarette smoking substantially alters the plasma miRNA profile, interfering with the diagnosis of disease or signaling potential smoking-related diseases. - Highlights: • Plasma miRNA profiles were unambiguously different between smokers and non-smokers. • Smoking status might interfere with the diagnosis of disease using plasma miRNAs. • Changes of plasma miRNA profiles may be a signal of smoking-related diseases.« less

RNA Interference: Biology, Mechanism, and Applications

PubMed Central

Agrawal, Neema; Dasaradhi, P. V. N.; Mohmmed, Asif; Malhotra, Pawan; Bhatnagar, Raj K.; Mukherjee, Sunil K.

2003-01-01

Double-stranded RNA-mediated interference (RNAi) is a simple and rapid method of silencing gene expression in a range of organisms. The silencing of a gene is a consequence of degradation of RNA into short RNAs that activate ribonucleases to target homologous mRNA. The resulting phenotypes either are identical to those of genetic null mutants or resemble an allelic series of mutants. Specific gene silencing has been shown to be related to two ancient processes, cosuppression in plants and quelling in fungi, and has also been associated with regulatory processes such as transposon silencing, antiviral defense mechanisms, gene regulation, and chromosomal modification. Extensive genetic and biochemical analysis revealed a two-step mechanism of RNAi-induced gene silencing. The first step involves degradation of dsRNA into small interfering RNAs (siRNAs), 21 to 25 nucleotides long, by an RNase III-like activity. In the second step, the siRNAs join an RNase complex, RISC (RNA-induced silencing complex), which acts on the cognate mRNA and degrades it. Several key components such as Dicer, RNA-dependent RNA polymerase, helicases, and dsRNA endonucleases have been identified in different organisms for their roles in RNAi. Some of these components also control the development of many organisms by processing many noncoding RNAs, called micro-RNAs. The biogenesis and function of micro-RNAs resemble RNAi activities to a large extent. Recent studies indicate that in the context of RNAi, the genome also undergoes alterations in the form of DNA methylation, heterochromatin formation, and programmed DNA elimination. As a result of these changes, the silencing effect of gene functions is exercised as tightly as possible. Because of its exquisite specificity and efficiency, RNAi is being considered as an important tool not only for functional genomics, but also for gene-specific therapeutic activities that target the mRNAs of disease-related genes. PMID:14665679

Silencing of P2X7R by RNA interference in the hippocampus can attenuate morphological and behavioral impact of pilocarpine-induced epilepsy.

PubMed

Amorim, Rebeca Padrão; Araújo, Michelle Gasparetti Leão; Valero, Jorge; Lopes-Cendes, Iscia; Pascoal, Vinicius Davila Bitencourt; Malva, João Oliveira; da Silva Fernandes, Maria José

2017-12-01

Cell signaling mediated by P2X7 receptors (P2X7R) has been suggested to be involved in epileptogenesis, via modulation of intracellular calcium levels, excitotoxicity, activation of inflammatory cascades, and cell death, among other mechanisms. These processes have been described to be involved in pilocarpine-induced status epilepticus (SE) and contribute to hyperexcitability, resulting in spontaneous and recurrent seizures. Here, we aimed to investigate the role of P2X7R in epileptogenesis in vivo using RNA interference (RNAi) to inhibit the expression of this receptor. Small interfering RNA (siRNA) targeting P2X7R mRNA was injected into the lateral ventricles (icv) 6 h after SE. Four groups were studied: Saline-Vehicle, Saline-siRNA, Pilo-Vehicle, and Pilo-siRNA. P2X7R was quantified by western blotting and neuronal death assessed by Fluoro-Jade B histochemistry. The hippocampal volume (edema) was determined 48 h following RNAi. Behavioral parameters as latency to the appearance of spontaneous seizures and the number of seizures were determined until 60 days after the SE onset. The Saline-siRNA and Pilo-siRNA groups showed a 43 and 37% reduction, respectively, in P2X7R protein levels compared to respective vehicle groups. Neuroprotection was observed in CA1 and CA3 of the Pilo-siRNA group compared to Pilo-Vehicle. P2X7R silencing in pilocarpine group reversed the increase in the edema detected in the hilus, suprapyramidal dentate gyrus, CA1, and CA3; reduced mortality rate following SE; increased the time to onset of spontaneous seizure; and reduced the number of seizures, when compared to the Pilo-Vehicle group. Therefore, our data highlights the potential of P2X7R as a therapeutic target for the adjunct treatment of epilepsy.

Strand antagonism in RNAi: an explanation of differences in potency between intracellularly expressed siRNA and shRNA

PubMed Central

Jin, Xin; Sun, Tingting; Zhao, Chuanke; Zheng, Yongxiang; Zhang, Yufan; Cai, Weijing; He, Qiuchen; Taira, Kaz; Zhang, Lihe; Zhou, Demin

2012-01-01

Strategies to regulate gene function frequently use small interfering RNAs (siRNAs) that can be made from their shRNA precursors via Dicer. However, when the duplex components of these siRNA effectors are expressed from their respective coding genes, the RNA interference (RNAi) activity is much reduced. Here, we explored the mechanisms of action of shRNA and siRNA and found the expressed siRNA, in contrast to short hairpin RNA (shRNA), exhibits strong strand antagonism, with the sense RNA negatively and unexpectedly regulating RNAi. Therefore, we altered the relative levels of strands of siRNA duplexes during their expression, increasing the level of the antisense component, reducing the level of the sense component, or both and, in this way we were able to enhance the potency of the siRNA. Such vector-delivered siRNA attacked its target effectively. These findings provide new insight into RNAi and, in particular, they demonstrate that strand antagonism is responsible for making siRNA far less potent than shRNA. PMID:22039150

Elimination of interference component in Wigner-Ville distribution for the signal with 1/f spectral characteristic.

PubMed

Chan, H L; Lin, J L; Huang, H H; Wu, C P

1997-09-01

A new technique for interference-term suppression in Wigner-Ville distribution (WVD) is proposed for the signal with 1/f spectrum shape. The spectral characteristic of the signal is altered by f alpha filtering before time-frequency analysis and compensated after analysis. With the utilization of the proposed technique in smoothed pseudo Wigner-Ville distribution, an excellent suppression of interference component can be achieved.

Designing and Testing Functional RNA Nanoparticles | Center for Cancer Research

Cancer.gov

Recent advances in nanotechnology have generated excitement that nanomaterials may provide novel approaches for the diagnosis and treatment of deadly diseases, such as cancer. However, the use of synthetic materials to generate nanoparticles can present challenges with endotoxin content, sterility, or biocompatibility. Employing biological materials may overcome these issues with RNA being particularly attractive given the clinical applications of RNA interference and the abundance of functional RNAs, including aptamers and ribozymes. RNA can form stable three-dimensional nanoparticle structures that can be decorated with other nucleic acids, small molecules, or proteins, potentially increasing local concentrations of therapeutic agents and acting synergistically when combined.

New RNAi strategy for selective suppression of a mutant allele in polyglutamine disease.

PubMed

Kubodera, Takayuki; Yokota, Takanori; Ishikawa, Kinya; Mizusawa, Hidehiro

2005-12-01

In gene therapy of dominantly inherited diseases with small interfering RNA (siRNA), mutant allele specific suppression may be necessary for diseases in which the defective gene normally has an important role. It is difficult, however, to design a mutant allele-specific siRNA for trinucleotide repeat diseases in which the difference of sequences is only repeat length. To overcome this problem, we use a new RNA interference (RNAi) strategy for selective suppression of mutant alleles. Both mutant and wild-type alleles are inhibited by the most effective siRNA, and wild-type protein is restored using the wild-type mRNA modified to be resistant to the siRNA. Here, we applied this method to spinocerebellar ataxia type 6 (SCA6). We discuss its feasibility and problems for future gene therapy.

Structural insights into RNA processing by the human RISC-loading complex.

PubMed

Wang, Hong-Wei; Noland, Cameron; Siridechadilok, Bunpote; Taylor, David W; Ma, Enbo; Felderer, Karin; Doudna, Jennifer A; Nogales, Eva

2009-11-01

Targeted gene silencing by RNA interference (RNAi) requires loading of a short guide RNA (small interfering RNA (siRNA) or microRNA (miRNA)) onto an Argonaute protein to form the functional center of an RNA-induced silencing complex (RISC). In humans, Argonaute2 (AGO2) assembles with the guide RNA-generating enzyme Dicer and the RNA-binding protein TRBP to form a RISC-loading complex (RLC), which is necessary for efficient transfer of nascent siRNAs and miRNAs from Dicer to AGO2. Here, using single-particle EM analysis, we show that human Dicer has an L-shaped structure. The RLC Dicer's N-terminal DExH/D domain, located in a short 'base branch', interacts with TRBP, whereas its C-terminal catalytic domains in the main body are proximal to AGO2. A model generated by docking the available atomic structures of Dicer and Argonaute homologs into the RLC reconstruction suggests a mechanism for siRNA transfer from Dicer to AGO2.

Targeted nanobubbles in low-frequency ultrasound-mediated gene transfection and growth inhibition of hepatocellular carcinoma cells.

PubMed

Wu, Bolin; Qiao, Qiang; Han, Xue; Jing, Hui; Zhang, Hao; Liang, Hongjian; Cheng, Wen

2016-09-01

The use of SonoVue combined with ultrasound exposure increases the transfection efficiency of short interfering RNA (siRNA). The objective of this study was to prepare targeted nanobubbles (TNB) conjugated with NET-1 siRNA and an antibody GPC3 to direct nanobubbles to hepatocellular carcinoma cells. SMMC-7721 human hepatocellular carcinoma cells were treated with six different groups. The transfection efficiency and cellular apoptosis were measured by flow cytometry. The protein and messenger RNA (mRNA) expression were measured by Western blot and quantitative real-time PCR, respectively. The migration and invasion potential of the cells were determined by Transwell analysis. The results show that US-guided siRNA-TNB transfection effectively enhanced gene silencing. In summary, siRNA-TNB may be an effective delivery vector to mediate highly effective RNA interference in tumor treatment.

RDE-1 slicer activity is required only for passenger-strand cleavage during RNAi in Caenorhabditis elegans.

PubMed

Steiner, Florian A; Okihara, Kristy L; Hoogstrate, Suzanne W; Sijen, Titia; Ketting, René F

2009-02-01

RNA interference (RNAi) is a process in which double-stranded RNA is cleaved into small interfering RNAs (siRNAs) that induce the destruction of homologous single-stranded mRNAs. Argonaute proteins are essential components of this silencing process; they bind siRNAs directly and can cleave RNA targets using a conserved RNase H motif. In Caenorhabditis elegans, the Argonaute protein RDE-1 has a central role in RNAi. In animals lacking RDE-1, the introduction of double-stranded RNA does not trigger any detectable level of RNAi. Here we show that RNase H activity of RDE-1 is required only for efficient removal of the passenger strand of the siRNA duplex and not for triggering the silencing response at the target-mRNA level. These results uncouple the role of the RDE-1 RNase H activity in small RNA maturation from its role in target-mRNA silencing in vivo.

Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA

PubMed Central

Ciganda, Martin; Williams, Noreen

2012-01-01

P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864

Small interfering ribonucleic acid induces liquid-to-ripple phase transformation in a phospholipid membrane

DOE Office of Scientific and Technical Information (OSTI.GOV)

Choubey, Amit; Nomura, Ken-ichi; Kalia, Rajiv K.

Small interfering ribonucleic acid (siRNA) molecules play a pivotal role in silencing gene expression via the RNA interference mechanism. A key limitation to the widespread implementation of siRNA therapeutics is the difficulty of delivering siRNA-based drugs to cells. Here, we examine changes in the structure and dynamics of a dipalmitoylphosphatidylcholine bilayer in the presence of a siRNA molecule and mechanical barriers to siRNA transfection in the bilayer. Our all-atom molecular dynamics simulation shows that siRNA induces a liquid crystalline-to-ripple phase transformation in the bilayer. The ripple phase consists of a major region of non-interdigitated and a minor region of interdigitatedmore » lipid molecules with an intervening kink. In the ripple phase, hydrocarbon chains of lipid molecules have large compressive stresses, which present a considerable barrier to siRNA transfection.« less

Reduction of polyatomic interferences in ICP-MS by collision/reaction cell (CRC-ICP-MS) techniques

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eiden, Greg C; Barinaga, Charles J; Koppenaal, David W

2012-05-01

Polyatomic and other spectral interferences in plasma source mass spectrometry (PSMS) can be dramatically reduced using collision and reaction cells (CRC). These devices have been used for decades in fundamental studies of ion-molecule chemistry, but have only recently been applied to PSMS. Benefits of this approach as applied in inductively coupled plasma MS (ICP-MS) include interference reduction, isobar separation, and thermalization/focusing of ions. Novel ion-molecule chemistry schemes are now routinely designed and empirically evaluated with relative ease. These “chemical resolution” techniques can avert interferences requiring mass spectral resolutions of >600,000 (m/m). Purely physical ion beam processes, including collisional dampening andmore » collisional dissociation, are also employed to provide improved sensitivity, resolution, and spectral simplicity. CRC techniques are now firmly entrenched in current-day ICP-MS technology, enabling unprecedented flexibility and freedom from many spectral interferences. A significant body of applications has now been reported in the literature. CRC techniques are found to be most useful for specialized or difficult analytical needs and situations, and are employed in both single- and multi-element determination modes.« less

A Method for Dynamically Selecting the Best Frequency Hopping Technique in Industrial Wireless Sensor Network Applications

PubMed Central

Fernández de Gorostiza, Erlantz; Mabe, Jon

2018-01-01

Industrial wireless applications often share the communication channel with other wireless technologies and communication protocols. This coexistence produces interferences and transmission errors which require appropriate mechanisms to manage retransmissions. Nevertheless, these mechanisms increase the network latency and overhead due to the retransmissions. Thus, the loss of data packets and the measures to handle them produce an undesirable drop in the QoS and hinder the overall robustness and energy efficiency of the network. Interference avoidance mechanisms, such as frequency hopping techniques, reduce the need for retransmissions due to interferences but they are often tailored to specific scenarios and are not easily adapted to other use cases. On the other hand, the total absence of interference avoidance mechanisms introduces a security risk because the communication channel may be intentionally attacked and interfered with to hinder or totally block it. In this paper we propose a method for supporting the design of communication solutions under dynamic channel interference conditions and we implement dynamic management policies for frequency hopping technique and channel selection at runtime. The method considers several standard frequency hopping techniques and quality metrics, and the quality and status of the available frequency channels to propose the best combined solution to minimize the side effects of interferences. A simulation tool has been developed and used in this work to validate the method. PMID:29473910

A Method for Dynamically Selecting the Best Frequency Hopping Technique in Industrial Wireless Sensor Network Applications.

PubMed

Fernández de Gorostiza, Erlantz; Berzosa, Jorge; Mabe, Jon; Cortiñas, Roberto

2018-02-23

Industrial wireless applications often share the communication channel with other wireless technologies and communication protocols. This coexistence produces interferences and transmission errors which require appropriate mechanisms to manage retransmissions. Nevertheless, these mechanisms increase the network latency and overhead due to the retransmissions. Thus, the loss of data packets and the measures to handle them produce an undesirable drop in the QoS and hinder the overall robustness and energy efficiency of the network. Interference avoidance mechanisms, such as frequency hopping techniques, reduce the need for retransmissions due to interferences but they are often tailored to specific scenarios and are not easily adapted to other use cases. On the other hand, the total absence of interference avoidance mechanisms introduces a security risk because the communication channel may be intentionally attacked and interfered with to hinder or totally block it. In this paper we propose a method for supporting the design of communication solutions under dynamic channel interference conditions and we implement dynamic management policies for frequency hopping technique and channel selection at runtime. The method considers several standard frequency hopping techniques and quality metrics, and the quality and status of the available frequency channels to propose the best combined solution to minimize the side effects of interferences. A simulation tool has been developed and used in this work to validate the method.

Engineered Hydrogels for Local and Sustained Delivery of RNA-Interference Therapies.

PubMed

Wang, Leo L; Burdick, Jason A

2017-01-01

It has been nearly two decades since RNA-interference (RNAi) was first reported. While there are no approved clinical uses, several phase II and III clinical trials suggest the great promise of RNAi therapeutics. One challenge for RNAi therapies is the controlled localization and sustained presentation to target tissues, to both overcome systemic toxicity concerns and to enhance in vivo efficacy. One approach that is emerging to address these limitations is the entrapment of RNAi molecules within hydrogels for local and sustained release. In these systems, nucleic acids are either delivered as siRNA conjugates or within nanoparticles. A plethora of hydrogels has been implemented using these approaches, including both traditional hydrogels that have already been developed for other applications and new hydrogels developed specifically for RNAi delivery. These hydrogels have been applied to various applications in vivo, including cancer, bone regeneration, inflammation and cardiac repair. This review will examine the design and implementation of such hydrogel RNAi systems and will cover the most recent applications of these systems. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Host-Pathogen interactions modulated by small RNAs.

PubMed

Islam, Waqar; Islam, Saif Ul; Qasim, Muhammad; Wang, Liande

2017-07-03

Biological processes such as defense mechanisms and microbial offense strategies are regulated through RNA induced interference in eukaryotes. Genetic mutations are modulated through biogenesis of small RNAs which directly impacts upon host development. Plant defense mechanisms are regulated and supported by a diversified group of small RNAs which are involved in streamlining several RNA interference pathways leading toward the initiation of pathogen gene silencing mechanisms. In the similar context, pathogens also utilize the support of small RNAs to launch their offensive attacks. Also there are strong evidences about the active involvement of these RNAs in symbiotic associations. Interestingly, small RNAs are not limited to the individuals in whom they are produced; they also show cross kingdom influences through variable interactions with other species thus leading toward the inter-organismic gene silencing. The phenomenon is understandable in the microbes which utilize these mechanisms to overcome host defense line. Understanding the mechanism of triggering host defense strategies can be a valuable step toward the generation of disease resistant host plants. We think that the cross kingdom trafficking of small RNA is an interesting insight that is needed to be explored for its vitality.

Fluorescence Reporter-Based Genome-Wide RNA Interference Screening to Identify Alternative Splicing Regulators.

PubMed

Misra, Ashish; Green, Michael R

2017-01-01

Alternative splicing is a regulated process that leads to inclusion or exclusion of particular exons in a pre-mRNA transcript, resulting in multiple protein isoforms being encoded by a single gene. With more than 90 % of human genes known to undergo alternative splicing, it represents a major source for biological diversity inside cells. Although in vitro splicing assays have revealed insights into the mechanisms regulating individual alternative splicing events, our global understanding of alternative splicing regulation is still evolving. In recent years, genome-wide RNA interference (RNAi) screening has transformed biological research by enabling genome-scale loss-of-function screens in cultured cells and model organisms. In addition to resulting in the identification of new cellular pathways and potential drug targets, these screens have also uncovered many previously unknown mechanisms regulating alternative splicing. Here, we describe a method for the identification of alternative splicing regulators using genome-wide RNAi screening, as well as assays for further validation of the identified candidates. With modifications, this method can also be adapted to study the splicing regulation of pre-mRNAs that contain two or more splice isoforms.

High-throughput screens in mammalian cells using the CRISPR-Cas9 system.

PubMed

Peng, Jingyu; Zhou, Yuexin; Zhu, Shiyou; Wei, Wensheng

2015-06-01

As a powerful genome-editing tool, the clustered regularly interspaced short palindromic repeats (CRISPR)-clustered regularly interspaced short palindromic repeats-associated protein 9 (Cas9) system has been quickly developed into a large-scale function-based screening strategy in mammalian cells. This new type of genetic library is constructed through the lentiviral delivery of single-guide RNA collections that direct Cas9 or inactive dead Cas9 fused with effectors to interrogate gene function or regulate gene transcription in targeted cells. Compared with RNA interference screening, the CRISPR-Cas9 system demonstrates much higher levels of effectiveness and reliability with respect to both loss-of-function and gain-of-function screening. Unlike the RNA interference strategy, a CRISPR-Cas9 library can target both protein-coding sequences and regulatory elements, including promoters, enhancers and elements transcribing microRNAs and long noncoding RNAs. This powerful genetic tool will undoubtedly accelerate the mechanistic discovery of various biological processes. In this mini review, we summarize the general procedure of CRISPR-Cas9 library mediated functional screening, system optimization strategies and applications of this new genetic toolkit. © 2015 FEBS.

Genome-wide RNA interference screen identifies previously undescribed regulators of polyglutamine aggregation

PubMed Central

Nollen, Ellen A. A.; Garcia, Susana M.; van Haaften, Gijs; Kim, Soojin; Chavez, Alejandro; Morimoto, Richard I.; Plasterk, Ronald H. A.

2004-01-01

Protein misfolding and the formation of aggregates are increasingly recognized components of the pathology of human genetic disease and hallmarks of many neurodegenerative disorders. As exemplified by polyglutamine diseases, the propensity for protein misfolding is associated with the length of polyglutamine expansions and age-dependent changes in protein-folding homeostasis, suggesting a critical role for a protein homeostatic buffer. To identify the complement of protein factors that protects cells against the formation of protein aggregates, we tested transgenic Caenorhabditis elegans strains expressing polyglutamine expansion yellow fluorescent protein fusion proteins at the threshold length associated with the age-dependent appearance of protein aggregation. We used genome-wide RNA interference to identify genes that, when suppressed, resulted in the premature appearance of protein aggregates. Our screen identified 186 genes corresponding to five principal classes of polyglutamine regulators: genes involved in RNA metabolism, protein synthesis, protein folding, and protein degradation; and those involved in protein trafficking. We propose that each of these classes represents a molecular machine collectively comprising the protein homeostatic buffer that responds to the expression of damaged proteins to prevent their misfolding and aggregation. PMID:15084750

Long non-coding RNA MEG3 inhibits the proliferation and metastasis of oral squamous cell carcinoma by regulating the WNT/β-catenin signaling pathway.

PubMed

Liu, Zongxiang; Wu, Cui; Xie, Nina; Wang, Penglai

2017-10-01

This study aimed to investigate how long non-coding RNA (lncRNA) maternally expressed gene 3 (MEG3) inhibits the growth and metastasis of oral squamous cell carcinoma (OSCC) by regulating WNT/β-catenin signaling pathway in order to explore the antitumor effect of MEG3 and to provide a potential molecular target for the treatment of OSCC. The RT-qPCR technique was used to quantitatively analyze the expression of MEG3 in cancer and adjacent tissues collected from the patients after surgery. Using the Lipofectamine method, the MEG3 overexpression vector and the siRNA interference vector were constructed and transfected into SCC15 and Cal27 cells, respectively, followed by cell proliferation, apoptosis and metastasis analyses. The semi-quantitative analysis of the expression of the β-catenin protein in transfected cells was performed by the western blot analysis, and the activity of the WNT/β-catenin signaling pathway was analyzed using the TOP/FOP flash reporters. In addition, the cells were treated with decitabine to investigate the correlation between the MEG3 expression and the DNA methylation. Results showed that the expression level of MEG3 was significantly decreased in OSCC (p<0.05) and overexpression of MEG3 inhibited the proliferation and metastasis of cancer cells and promoted apoptosis. Importantly, MEG3 played a role as a tumor suppressor by inhibiting the WNT/β-catenin signaling pathway. In addition, the expression of the MEG3 was significantly affected by the degree of DNA methylation. It was concluded that the lncRNA MEG3 can inhibit the growth and metastasis of OSCC by negatively regulating the WNT/β-catenin signaling pathway.

Advances in CRISPR-Cas9 genome engineering: lessons learned from RNA interference

PubMed Central

Barrangou, Rodolphe; Birmingham, Amanda; Wiemann, Stefan; Beijersbergen, Roderick L.; Hornung, Veit; Smith, Anja van Brabant

2015-01-01

The discovery that the machinery of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9 bacterial immune system can be re-purposed to easily create deletions, insertions and replacements in the mammalian genome has revolutionized the field of genome engineering and re-invigorated the field of gene therapy. Many parallels have been drawn between the newly discovered CRISPR-Cas9 system and the RNA interference (RNAi) pathway in terms of their utility for understanding and interrogating gene function in mammalian cells. Given this similarity, the CRISPR-Cas9 field stands to benefit immensely from lessons learned during the development of RNAi technology. We examine how the history of RNAi can inform today's challenges in CRISPR-Cas9 genome engineering such as efficiency, specificity, high-throughput screening and delivery for in vivo and therapeutic applications. PMID:25800748

Analysis of Variability in HIV-1 Subtype A Strains in Russia Suggests a Combination of Deep Sequencing and Multitarget RNA Interference for Silencing of the Virus.

PubMed

Kretova, Olga V; Chechetkin, Vladimir R; Fedoseeva, Daria M; Kravatsky, Yuri V; Sosin, Dmitri V; Alembekov, Ildar R; Gorbacheva, Maria A; Gashnikova, Natalya M; Tchurikov, Nickolai A

2017-02-01

Any method for silencing the activity of the HIV-1 retrovirus should tackle the extremely high variability of HIV-1 sequences and mutational escape. We studied sequence variability in the vicinity of selected RNA interference (RNAi) targets from isolates of HIV-1 subtype A in Russia, and we propose that using artificial RNAi is a potential alternative to traditional antiretroviral therapy. We prove that using multiple RNAi targets overcomes the variability in HIV-1 isolates. The optimal number of targets critically depends on the conservation of the target sequences. The total number of targets that are conserved with a probability of 0.7-0.8 should exceed at least 2. Combining deep sequencing and multitarget RNAi may provide an efficient approach to cure HIV/AIDS.

New insights into siRNA amplification and RNAi.

PubMed

Zhang, Chi; Ruvkun, Gary

2012-08-01

In the nematode Caenorhabditis elegans (C. elegans), gene inactivation by RNA interference can achieve remarkable potency due to the amplification of initial silencing triggers by RNA-dependent RNA polymerases (RdRPs). RdRPs catalyze the biogenesis of an abundant species of secondary small interfering RNAs (siRNAs) using the target mRNA as template. The interaction between primary siRNAs derived from the exogenous double-stranded RNA (dsRNA) trigger and the target mRNA is required for the recruitment of RdRPs. Other genetic requirements for RdRP activities have not been characterized. Recent studies have identified the RDE-10/RDE-11 complex which interacts with the primary siRNA bound target mRNA and acts upstream of the RdRPs. rde-10 and rde-11 mutants show an RNAi defective phenotype because the biogenesis of secondary siRNAs is completely abolished. In addition, the RDE-10/RDE-11 complex plays a similar role in the endogenous RNAi pathway for the biogenesis of a subset of siRNAs targeting recently acquired, duplicated genes.

[Components and assembly of RNA-induced silencing complex].

PubMed

Song, Xue-Mei; Yan, Fei; Du, Li-Xin

2006-06-01

Degradation of homologous RNA in RNA interference is carried out by functional RNA-induced silencing complex (RISC). RISC contains Dicer, Argonaute proein, siRNA and other components. Researching structures and functions of these components is primary important for understanding assembly and functional mechanism of RISC, as well as the whole RNAi pathway. Recent research works showed that Dicer, containing RNaseIII domain, is responsible for production of siRNA at the beginning of RNAi, and guarantees the stability of RISC intermediate in assembly process. As the core component of RISC, Argonaute protein functions as slicer to cleave target RNA and offers the binding site of siRNA in RISC assembly, which are depended on PIWI domain and PAZ domain separately. Although there is only one strand of siRNA that is the guider of RISC, the double stranded structural character of siRNA is determinant of RNAi. Except those, there are still other components with unknown functions in RISC. The knowledge about RISC components and assembly now, is basis of a presumed RISC assembly model.

RNA major groove modifications improve siRNA stability and biological activity

PubMed Central

Terrazas, Montserrat; Kool, Eric T.

2009-01-01

RNA 5-methyl and 5-propynyl pyrimidine analogs were substituted into short interfering RNAs (siRNAs) to probe major groove steric effects in the active RNA-induced silencing complex (RISC). Synthetic RNA guide strands containing varied combinations of propynyl and methyl substitution revealed that all C-5 substitutions increased the thermal stability of siRNA duplexes containing them. Cellular gene suppression experiments using luciferase targets in HeLa cells showed that the bulky 5-propynyl modification was detrimental to RNA interference activity, despite its stabilization of the helix. Detrimental effects of this substitution were greatest at the 5′-half of the guide strand, suggesting close steric approach of proteins in the RISC complex with that end of the siRNA/mRNA duplex. However, substitutions with the smaller 5-methyl group resulted in gene silencing activities comparable to or better than that of wild-type siRNA. The major groove modifications also increased the serum stability of siRNAs. PMID:19042976

The HIV Nef protein modulates cellular and exosomal miRNA profiles in human monocytic cells.

PubMed

Aqil, Madeeha; Naqvi, Afsar Raza; Mallik, Saurav; Bandyopadhyay, Sanghamitra; Maulik, Ujjwal; Jameel, Shahid

2014-01-01

The HIV Nef protein is a multifunctional virulence factor that perturbs intracellular membranes and signalling and is secreted into exosomes. While Nef-containing exosomes have a distinct proteomic profile, no comprehensive analysis of their miRNA cargo has been carried out. Since Nef functions as a viral suppressor of RNA interference and disturbs the distribution of RNA-induced silencing complex proteins between cells and exosomes, we hypothesized that it might also affect the export of miRNAs into exosomes. Exosomes were purified from human monocytic U937 cells that stably expressed HIV-1 Nef. The RNA from cells and exosomes was profiled for 667 miRNAs using a Taqman Low Density Array. Selected miRNAs and their mRNA targets were validated by quantitative RT-PCR. Bioinformatics analyses were used to identify targets and predict pathways. Nef expression affected a significant fraction of miRNAs in U937 cells. Our analysis showed 47 miRNAs to be selectively secreted into Nef exosomes and 2 miRNAs to be selectively retained in Nef-expressing cells. The exosomal miRNAs were predicted to target several cellular genes in inflammatory cytokine and other pathways important for HIV pathogenesis, and an overwhelming majority had targets within the HIV genome. This is the first study to report miRnome analysis of HIV Nef expressing monocytes and exosomes. Our results demonstrate that Nef causes large-scale dysregulation of cellular miRNAs, including their secretion through exosomes. We suggest this to be a novel viral strategy to affect pathogenesis and to limit the effects of RNA interference on viral replication and persistence.

Lentiviral vectors encoding shRNAs efficiently transduce and knockdown LINGO-1 but induce an interferon response and cytotoxicity in CNS neurons

PubMed Central

Hutson, Thomas H.; Foster, Edmund; Dawes, John M.; Hindges, Robert; Yáñez-Muñoz, Rafael J.; Moon, Lawrence D.F.

2017-01-01

Background Knocking down neuronal LINGO-1 using short hairpin RNAs (shRNAs) might enhance axon regeneration in the CNS. Integration-deficient lentiviral vectors have great potential as a therapeutic delivery system for CNS injuries. However, recent studies have revealed that shRNAs can induce an interferon response resulting in off-target effects and cytotoxicity. Methods CNS neurons were transduced with integration-deficient lentiviral vectors in vitro. The transcriptional effect of shRNA expression was analysed using qRT-PCR and northern blots were used to assess shRNA production. Results Integration-deficient lentiviral vectors efficiently transduced CNS neurons and knocked down LINGO-1 mRNA in vitro. However, an increase in cell death was observed when lentiviral vectors encoding an shRNA were applied or when high vector concentrations were used. We demonstrate that high doses of vector or the use of vectors encoding shRNAs can induce an up-regulation of interferon stimulated genes (OAS1 and PKR) and a down-regulation of off- target genes (including p75NTR and NgR1). Furthermore, the northern blot demonstrated that these negative consequences occur even when lentiviral vectors express low levels of shRNAs. Together, these results may explain why neurite outgrowth was not enhanced on an inhibitory substrate after transduction with lentiviral vectors encoding an shRNA targeting LINGO-1. Conclusions These findings highlight the importance of including appropriate controls to verify silencing specificity and the requirement to check for an interferon response when conducting RNA interference experiments. However, the potential benefits that RNA interference and viral vectors offer to gene-based therapies to CNS injuries cannot be overlooked and demand further investigation. PMID:22499506

[Lentivirus-mediated RNA interference of CD133 inhibits the proliferation of CD133(+) liver cancer stem cells and increases their cisplatin chemosensitivity].

PubMed

Lan, Xi; Wang, Yong; Cao, Shu; Zou, Dongling; Li, Fang; Li, Shaolin

2012-12-01

To study the effects of CD133 suppression by lentivirus-mediated RNA interference (RNAi) on the proliferation and chemosensitivity of CD133(+) cancer stem cells (CSCs) sorted from HepG2 cell line. CD133(+) and CD133- cells were sorted from HepG2 cell line by flow cytometry, and the expression of CD133 before and after cell sorting were detected. The stem cell property of sorted CD133(+) cells were validated by sphere-forming assay in vitro and xenograft experiments in vivo. Lentivirus-mediated short hairpin RNA (shRNA) targeting CD133 were transfected into CD133(+) cells, and CD133 mRNA and protein expressions of the transfected cells were detected by RT-PCR and Western blotting, respectively. Before and after the transfection, the proliferative ability of CD133(+) cells was evaluated by colony formation assay, and the cell growth inhibition rate and apoptosis following cisplatin exposure were detected using CCK-8 assay and flow cytometry. The sorted CD133(+) cells showed a high purity of (88.74∓3.19)%, as compared with the purity of (3.36∓1.80)% before cell sorting. CD133(+) cells showed a high tumor sphere formation ability and tumorigenesis capacity compared with CD133- cells. CD133 shRNA transfection significantly inhibited CD133 mRNA and protein expressions in CD133(+) cells (P<0.01), resulting also in a significantly lowered cell proliferative ability (P<0.01) and an increased growth inhibition rate (P<0.01) and obviously increased cell apoptosis (P<0.05) after cisplatin exposure. Lentivirus-mediated RNAi for CD133 suppression inhibits the proliferation of CD133(+) liver cancer stem cells and increases their chemosensitivity to cisplatin.

Manipulation of Cell Physiology Enables Gene Silencing in Well-differentiated Airway Epithelia

PubMed Central

Krishnamurthy, Sateesh; Behlke, Mark A; Ramachandran, Shyam; Salem, Aliasger K; McCray Jr, Paul B; Davidson, Beverly L

2012-01-01

The application of RNA interference-based gene silencing to the airway surface epithelium holds great promise to manipulate host and pathogen gene expression for therapeutic purposes. However, well-differentiated airway epithelia display significant barriers to double-stranded small-interfering RNA (siRNA) delivery despite testing varied classes of nonviral reagents. In well-differentiated primary pig airway epithelia (PAE) or human airway epithelia (HAE) grown at the air–liquid interface (ALI), the delivery of a Dicer-substrate small-interfering RNA (DsiRNA) duplex against hypoxanthine–guanine phosphoribosyltransferase (HPRT) with several nonviral reagents showed minimal uptake and no knockdown of the target. In contrast, poorly differentiated cells (2–5-day post-seeding) exhibited significant oligonucleotide internalization and target knockdown. This finding suggested that during differentiation, the barrier properties of the epithelium are modified to an extent that impedes oligonucleotide uptake. We used two methods to overcome this inefficiency. First, we tested the impact of epidermal growth factor (EGF), a known enhancer of macropinocytosis. Treatment of the cells with EGF improved oligonucleotide uptake resulting in significant but modest levels of target knockdown. Secondly, we used the connectivity map (Cmap) database to correlate gene expression changes during small molecule treatments on various cells types with genes that change upon mucociliary differentiation. Several different drug classes were identified from this correlative assessment. Well-differentiated epithelia treated with DsiRNAs and LY294002, a PI3K inhibitor, significantly improved gene silencing and concomitantly reduced target protein levels. These novel findings reveal that well-differentiated airway epithelia, normally resistant to siRNA delivery, can be pretreated with small molecules to improve uptake of synthetic oligonucleotide and RNA interference (RNAi) responses. PMID:23344182

Lentivirus mediated RNA interference of EMMPRIN (CD147) gene inhibits the proliferation, matrigel invasion and tumor formation of breast cancer cells.

PubMed

Yang, Jing; Wang, Rong; Li, Hongjiang; Lv, Qing; Meng, Wentong; Yang, Xiaoqin

2016-07-08

Overexpression of extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), a glycoprotein enriched on the plasma membrane of tumor cells, promotes proliferation, invasion, metastasis, and survival of malignant tumor cells. In this study, we sought to examine the expression of EMMPRIN in breast tumors, and to identify the potential roles of EMMPRIN on breast cancer cells. EMMPRIN expression in breast cancer tissues was assessed by immunohistochemistry. We used a lentivirus vector-based RNA interference (RNAi) approach expressing short hairpin RNA (shRNA) to knockdown EMMPRIN gene in breast cancer cell lines MDA-MB-231 and MCF-7. In vitro, Cell proliferative, invasive potential were determined by Cell Counting Kit (CCK-8), cell cycle analysis and matrigel invasion assay, respectively. In vivo, tumorigenicity was monitored by inoculating tumor cells into breast fat pad of female nude mice. EMMPRIN was over-expressed in breast tumors and breast cancer cell lines. Down-regulation of EMMPRIN by lentivirus vector-based RNAi led to decreased cell proliferative, decreased matrigel invasion in vitro, and attenuated tumor formation in vivo. High expression of EMMPRIN plays a crucial role in breast cancer cell proliferation, matrigel invasion and tumor formation.

The Impact of Radio Interference on Future Radio Telescopes

NASA Astrophysics Data System (ADS)

Mitchell, Daniel A.; Robertson, Gordon J.; Sault, Robert J.

While future radio telescopes will require technological advances from the communications industry interference from sources such as satellites and mobile phones is a serious concern. In addition to the fact that the level of interference is growing constantly the increased capabilities of next generation instruments make them more prone to harmful interference. These facilities must have mechanisms to allow operation in a crowded spectrum. In this report some of the factors which may limit the effectiveness of these mechanisms are investigated. Radio astronomy is unique among other observing wavelengths in that the radiation can be fully sampled at a rate which completely specifies the electromagnetic environment. Knowledge of phases and antennae gain factors affords one the opportunity to attempt to mitigate interference from the astronomical data. At present several interference mitigation techniques have been demonstrated to be extremely effective. However the observational scales of the new facilities will push the techniques to their limits. Processes such as signal decorrelation varying antenna gain and instabilities in the primary beam will have a serious effect on some of the algorithms. In addition the sheer volume of data produced will render some techniques computationally and financially impossible.

RNA interference inhibits herpes simplex virus type 1 isolated from saliva samples and mucocutaneous lesions.

PubMed

Silva, Amanda Perse da; Lopes, Juliana Freitas; Paula, Vanessa Salete de

2014-01-01

The aim of this study was to evaluate the use of RNA interference to inhibit herpes simplex virus type-1 replication in vitro. For herpes simplex virus type-1 gene silencing, three different small interfering RNAs (siRNAs) targeting the herpes simplex virus type-1 UL39 gene (sequence si-UL 39-1, si-UL 39-2, and si-UL 39-3) were used, which encode the large subunit of ribonucleotide reductase, an essential enzyme for DNA synthesis. Herpes simplex virus type-1 was isolated from saliva samples and mucocutaneous lesions from infected patients. All mucocutaneous lesions' samples were positive for herpes simplex virus type-1 by real-time PCR and by virus isolation; all herpes simplex virus type-1 from saliva samples were positive by real-time PCR and 50% were positive by virus isolation. The levels of herpes simplex virus type-1 DNA remaining after siRNA treatment were assessed by real-time PCR, whose results demonstrated that the effect of siRNAs on gene expression depends on siRNA concentration. The three siRNA sequences used were able to inhibit viral replication, assessed by real-time PCR and plaque assays and among them, the sequence si-UL 39-1 was the most effective. This sequence inhibited 99% of herpes simplex virus type-1 replication. The results demonstrate that silencing herpes simplex virus type-1 UL39 expression by siRNAs effectively inhibits herpes simplex virus type-1 replication, suggesting that siRNA based antiviral strategy may be a potential therapeutic alternative. Copyright © 2014. Published by Elsevier Editora Ltda.

SUMOylation of TARBP2 regulates miRNA/siRNA efficiency

PubMed Central

Chen, Cheng; Zhu, Changhong; Huang, Jian; Zhao, Xian; Deng, Rong; Zhang, Hailong; Dou, Jinzhuo; Chen, Qin; Xu, Ming; Yuan, Haihua; Wang, Yanli; Yu, Jianxiu

2015-01-01

Small RNA-induced gene silencing is essential for post-transcriptional regulation of gene expression; however, it remains unclear how miRNA/siRNA efficiency is regulated. Here we show that TARBP2 is SUMOylated at K52, which can be enhanced by its phosphorylation. This modification can stabilize TARBP2 via repressing its K48-linked ubiquitination. We find that TARBP2 SUMOylation does not influence the overall production of mature miRNAs, but it regulates miRNA/siRNA efficiency. SUMOylated TARBP2 recruits Ago2 to constitute the RNA-induced silencing complex (RISC)-loading complex (RLC), and simultaneously promotes more pre-miRNAs to load into the RLC. Consequently, Ago2 is stabilized and miRNAs/siRNAs bound by TARBP2/Dicer is effectively transferred to Ago2. Thus, these processes lead to the formation of the effective RISC for RNA interference (RNAi). Collectively, our data suggest that SUMOylation of TARBP2 is required for regulating miRNA/siRNA efficiency, which is a general mechanism of miRNA/siRNA regulation. PMID:26582366

Silencing of CXCR4 inhibits tumor cell proliferation and neural invasion in human hilar cholangiocarcinoma.

PubMed

Tan, Xin-Yu; Chang, Shi; Liu, Wei; Tang, Hui-Huan

2014-03-01

To evaluate the expression of CXC motif chemokine receptor 4 (CXCR4) in the tissues of patients with hilar cholangiocarcinoma (hilar-CCA) and to investigate the cell proliferation and frequency of neural invasion (NI) influenced by RNAi-mediated CXCR4 silencing. An immunohistochemical technique was used to detect the expression of CXCR4 in 41 clinical tissues, including hilar-CCA, cholangitis, and normal bile duct tissues. The effects of small interference RNA (siRNA)-mediated CXCR4 silencing were detected in the hilar-CCA cell line QBC939. Cell proliferation was determined by MTT. Expression of CXCR4 was monitored by quantitative real time polymerase chain reaction and Western blot analysis. The NI ability of hilar-CCA cells was evaluated using a perineural cell and hilar-CCA cell coculture migration assay. The expression of CXCR4 was significantly induced in clinical hilar-CCA tissue. There was a positive correlation between the expression of CXCR4 and lymph node metastasis/NI in hilar-CCA patients (p<0.05). Silencing of CXCR4 in tumor cell lines by siRNA led to significantly decreased NI (p<0.05) and slightly decreased cell proliferation. CXCR4 is likely correlated with clinical recurrence of hilar-CCA. CXCR4 is involved in the invasion and proliferation of human hilar-CCA cell line QBC939, indicating that CXCR4 could be a promising therapeutic target for hilar-CCA.

Two techniques for eliminating luminol interference material and flow system configurations for luminol and firefly luciferase systems

NASA Technical Reports Server (NTRS)

Thomas, R. R.

1976-01-01

Two methods for eliminating luminol interference materials are described. One method eliminates interference from organic material by pre-reacting a sample with dilute hydrogen peroxide. The reaction rate resolution method for eliminating inorganic forms of interference is also described. The combination of the two methods makes the luminol system more specific for bacteria. Flow system designs for both the firefly luciferase and luminol bacteria detection systems are described. The firefly luciferase flow system incorporating nitric acid extraction and optimal dilutions has a functional sensitivity of 3 x 100,000 E. coli/ml. The luminol flow system incorporates the hydrogen peroxide pretreatment and the reaction rate resolution techniques for eliminating interference. The functional sensitivity of the luminol flow system is 1 x 10,000 E. coli/ml.

A review on current status of antiviral siRNA.

PubMed

Qureshi, Abid; Tantray, Vaqar Gani; Kirmani, Altaf Rehman; Ahangar, Abdul Ghani

2018-04-15

Viral diseases like influenza, AIDS, hepatitis, and Ebola cause severe epidemics worldwide. Along with their resistant strains, new pathogenic viruses continue to be discovered so creating an ongoing need for new antiviral treatments. RNA interference is a cellular gene-silencing phenomenon in which sequence-specific degradation of target mRNA is achieved by means of complementary short interfering RNA (siRNA) molecules. Short interfering RNA technology affords a potential tractable strategy to combat viral pathogenesis because siRNAs are specific, easy to design, and can be directed against multiple strains of a virus by targeting their conserved gene regions. In this review, we briefly summarize the current status of siRNA therapy for representative examples from different virus families. In addition, other aspects like their design, delivery, medical significance, bioinformatics resources, and limitations are also discussed. Copyright © 2018 John Wiley & Sons, Ltd.

Amicoumacin A inhibits translation by stabilizing mRNA interaction with the ribosome

PubMed Central

Polikanov, Yury S.; Osterman, Ilya A.; Szal, Teresa; Tashlitsky, Vadim N.; Serebryakova, Marina V.; Kusochek, Pavel; Bulkley, David; Malanicheva, Irina A.; Efimenko, Tatyana A.; Efremenkova, Olga V.; Konevega, Andrey L.; Shaw, Karen J.; Bogdanov, Alexey A.; Rodnina, Marina V.; Dontsova, Olga A.; Mankin, Alexander S.; Steitz, Thomas A.; Sergiev, Petr V.

2014-01-01

SUMMARY We demonstrate that the antibiotic amicoumacin A (AMI) whose cellular target was unknown, is a potent inhibitor of protein synthesis. Resistance mutations in helix 24 of the 16S rRNA mapped the AMI binding site to the small ribosomal subunit. The crystal structure of bacterial ribosome in complex with AMI solved at 2.4 Å resolution revealed that the antibiotic makes contacts with universally conserved nucleotides of 16S rRNA in the E site and the mRNA backbone. Simultaneous interactions of AMI with 16S rRNA and mRNA and the in vivo experimental evidence suggest that it may inhibit the progression of the ribosome along mRNA. Consistent with this proposal, binding of AMI interferes with translocation in vitro. The inhibitory action of AMI can be partly compensated by mutations in the translation elongation factor G. PMID:25306919

A quantitative framework for the forward design of synthetic miRNA circuits.

PubMed

Bloom, Ryan J; Winkler, Sally M; Smolke, Christina D

2014-11-01

Synthetic genetic circuits incorporating regulatory components based on RNA interference (RNAi) have been used in a variety of systems. A comprehensive understanding of the parameters that determine the relationship between microRNA (miRNA) and target expression levels is lacking. We describe a quantitative framework supporting the forward engineering of gene circuits that incorporate RNAi-based regulatory components in mammalian cells. We developed a model that captures the quantitative relationship between miRNA and target gene expression levels as a function of parameters, including mRNA half-life and miRNA target-site number. We extended the model to synthetic circuits that incorporate protein-responsive miRNA switches and designed an optimized miRNA-based protein concentration detector circuit that noninvasively measures small changes in the nuclear concentration of β-catenin owing to induction of the Wnt signaling pathway. Our results highlight the importance of methods for guiding the quantitative design of genetic circuits to achieve robust, reliable and predictable behaviors in mammalian cells.

The dsRNA binding protein RDE-4 interacts with RDE-1, DCR-1, and a DExH-box helicase to direct RNAi in C. elegans.

PubMed

Tabara, Hiroaki; Yigit, Erbay; Siomi, Haruhiko; Mello, Craig C

2002-06-28

Double-stranded (ds) RNA induces potent gene silencing, termed RNA interference (RNAi). At an early step in RNAi, an RNaseIII-related enzyme, Dicer (DCR-1), processes long-trigger dsRNA into small interfering RNAs (siRNAs). DCR-1 is also required for processing endogenous regulatory RNAs called miRNAs, but how DCR-1 recognizes its endogenous and foreign substrates is not yet understood. Here we show that the C. elegans RNAi pathway gene, rde-4, encodes a dsRNA binding protein that interacts during RNAi with RNA identical to the trigger dsRNA. RDE-4 protein also interacts in vivo with DCR-1, RDE-1, and a conserved DExH-box helicase. Our findings suggest a model in which RDE-4 and RDE-1 function together to detect and retain foreign dsRNA and to present this dsRNA to DCR-1 for processing.

Live cell imaging of Argonaute proteins in mammalian cells.

PubMed

Pare, Justin M; Lopez-Orozco, Joaquin; Hobman, Tom C

2011-01-01

The central effector of mammalian RNA interference (RNAi) is the RNA-induced silencing complex (RISC). Proteins of the Argonaute family are the core components of RISC. Recent work from multiple laboratories has shown that Argonaute family members are associated with at least two types of cytoplasmic RNA granules: GW/Processing bodies and stress granules. These Argonaute-containing granules harbor proteins that function in mRNA degradation and translational repression in response to stress. The known role of Argonaute proteins in miRNA-mediated translational repression and siRNA-directed mRNA cleavage (i.e., Argonaute 2) has prompted speculation that the association of Argonautes with these granules may reflect the activity of RNAi in vivo. Accordingly, studying the dynamic association between Argonautes and RNA granules in living cells will undoubtedly provide insight into the regulatory mechanisms of RNA-based silencing. This chapter describes a method for imaging fluorescently tagged Argonaute proteins in living mammalian cells using spinning disk confocal microscopy.

Two distinct RNase activities of CRISPR-C2c2 enable guide-RNA processing and RNA detection.

PubMed

East-Seletsky, Alexandra; O'Connell, Mitchell R; Knight, Spencer C; Burstein, David; Cate, Jamie H D; Tjian, Robert; Doudna, Jennifer A

2016-10-13

Bacterial adaptive immune systems use CRISPRs (clustered regularly interspaced short palindromic repeats) and CRISPR-associated (Cas) proteins for RNA-guided nucleic acid cleavage. Although most prokaryotic adaptive immune systems generally target DNA substrates, type III and VI CRISPR systems direct interference complexes against single-stranded RNA substrates. In type VI systems, the single-subunit C2c2 protein functions as an RNA-guided RNA endonuclease (RNase). How this enzyme acquires mature CRISPR RNAs (crRNAs) that are essential for immune surveillance and how it carries out crRNA-mediated RNA cleavage remain unclear. Here we show that bacterial C2c2 possesses a unique RNase activity responsible for CRISPR RNA maturation that is distinct from its RNA-activated single-stranded RNA degradation activity. These dual RNase functions are chemically and mechanistically different from each other and from the crRNA-processing behaviour of the evolutionarily unrelated CRISPR enzyme Cpf1 (ref. 11). The two RNase activities of C2c2 enable multiplexed processing and loading of guide RNAs that in turn allow sensitive detection of cellular transcripts.

Lysosomal membrane protein SIDT2 mediates the direct uptake of DNA by lysosomes

PubMed Central

Aizawa, Shu; Contu, Viorica Raluca; Fujiwara, Yuuki; Hase, Katsunori; Kikuchi, Hisae; Kabuta, Chihana; Wada, Keiji

2017-01-01

ABSTRACT Lysosomes degrade macromolecules such as proteins and nucleic acids. We previously identified 2 novel types of autophagy, RNautophagy and DNautophagy, where lysosomes directly take up RNA and DNA, in an ATP-dependent manner, for degradation. We have also reported that SIDT2 (SID1 transmembrane family, member 2), an ortholog of the Caenorhabditis elegans putative RNA transporter SID-1 (systemic RNA interference defective-1), mediates RNA translocation during RNautophagy. In this addendum, we report that SIDT2 also mediates DNA translocation in the process of DNautophagy. These findings help elucidate the mechanisms underlying the direct uptake of nucleic acids by lysosomes and the physiological functions of DNautophagy. PMID:27846365

Lysosomal membrane protein SIDT2 mediates the direct uptake of DNA by lysosomes.

PubMed

Aizawa, Shu; Contu, Viorica Raluca; Fujiwara, Yuuki; Hase, Katsunori; Kikuchi, Hisae; Kabuta, Chihana; Wada, Keiji; Kabuta, Tomohiro

2017-01-02

Lysosomes degrade macromolecules such as proteins and nucleic acids. We previously identified 2 novel types of autophagy, RNautophagy and DNautophagy, where lysosomes directly take up RNA and DNA, in an ATP-dependent manner, for degradation. We have also reported that SIDT2 (SID1 transmembrane family, member 2), an ortholog of the Caenorhabditis elegans putative RNA transporter SID-1 (systemic RNA interference defective-1), mediates RNA translocation during RNautophagy. In this addendum, we report that SIDT2 also mediates DNA translocation in the process of DNautophagy. These findings help elucidate the mechanisms underlying the direct uptake of nucleic acids by lysosomes and the physiological functions of DNautophagy.

Nanoparticle-mediated RNA interference of angiotensinogen decreases blood pressure and improves myocardial remodeling in spontaneously hypertensive rats.

PubMed

Yuan, Li-Fen; Sheng, Jing; Lu, Ping; Wang, Yu-Qiang; Jin, Tuo; Du, Qin

2015-09-01

Angiotensinogen (AGT) has been shown to have a role in cardiac hypertrophy, while depletion of the AGT gene in spontaneously hypertensive rats (SHR) has not been investigated. The present study investigated the effect of AGT knockdown on cardiac hypertrophy in SHR. For this, small hairpin (sh)RNAs were intravenously injected into SHRs, using a nanoparticle‑mediated transfection system. The experimental rats were divided into the following groups: a) Blank control with water treatment only, b) negative control with biscarbamate‑crosslinked Gal‑polyethylene glycol polyethylenimine nanoparticles (GPE)/negative shRNA, c) AGT‑RNA interference (RNAi) group with GPE/AGT‑shRNA, and 4) normotensive control using Wistar‑Kyoto rats (WKY) with water treatment. Three and five days following the first injection, the levels of hepatic AGT mRNA and AGT protein as well as plasma levels of AGT were markedly decreased in the AGT‑RNAi group (P<0.05). Furthermore, a significant decrease in systolic blood pressure (SBP), left ventricular weight to body weight ratio and heart weight to body weight ratio were observed in the AGT‑RNAi group compared with those in the control groups. The depletion of AGT in SHR led to a reduction in SBP by 30±4 mmHg, which was retained for >10 days. Cardiac hypertrophy was also significantly improved in AGT‑knockdown rats. In conclusion, the present study showed that AGT‑silencing had a significant inhibitory effect on hypertension and hypertensive‑induced cardiac hypertrophy in SHRs.

Appraising the roles of CBLL1 and the ubiquitin/proteasome system for flavivirus entry and replication.

PubMed

Fernandez-Garcia, Maria-Dolores; Meertens, Laurent; Bonazzi, Matteo; Cossart, Pascale; Arenzana-Seisdedos, Fernando; Amara, Ali

2011-03-01

The ubiquitin ligase CBLL1 (also known as HAKAI) has been proposed to be a critical cellular factor exploited by West Nile virus (WNV) for productive infection. CBLL1 has emerged as a major hit in a recent RNA interference screen designed to identify cellular factors required for the early stages of the WNV life cycle. Follow-up experiments showed that HeLa cells knocked down for CBLL1 by a small interfering RNA (siRNA) failed to internalize WNV particles and resisted infection. Furthermore, depletion of a free-ubiquitin pool by the proteasome inhibitor MG132 abolished WNV endocytosis, suggesting that CBLL1 acts in concert with the ubiquitin proteasome system to mediate virus internalization. Here, we examined the effect of CBLL1 knockdown and proteasome inhibitors on infection by WNV and other flaviviruses. We identified new siRNAs that repress the CBLL1 protein and strongly inhibit the endocytosis of Listeria monocytogenes, a bacterial pathogen known to require CBLL1 to invade host cells. Strikingly, however, we detected efficient WNV, dengue virus, and yellow fever virus infection of human cells, despite potent downregulation of CBLL1 by RNA interference. In addition, we found that the proteasome inhibitors MG132 and lactacystin did not affect WNV internalization but strongly repressed flavivirus RNA translation and replication. Together, these data do not support a requirement for CBLL1 during flavivirus entry and rather suggest an essential role of the ubiquitin/proteasome pathway for flavivirus genome amplification.

Role of RNA interference (RNAi) in the Moss Physcomitrella patens.

PubMed

Arif, Muhammad Asif; Frank, Wolfgang; Khraiwesh, Basel

2013-01-14

RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species.

Decreased low back pain intensity and differential gene expression following Calmare®: results from a double-blinded randomized sham-controlled study.

PubMed

Starkweather, Angela R; Coyne, Patrick; Lyon, Debra E; Elswick, R K; An, Kyungeh; Sturgill, Jamie

2015-02-01

In this double-blinded, randomized controlled trial we evaluated the effects of Calmare®, a non-invasive neurocutaneous electrical pain intervention, on lower back pain intensity as measured by the "worst" pain score and on pain interference using the Brief Pain Inventory-Short Form, on measures of pain sensitivity assessed by quantitative sensory testing, and on mRNA expression of pain sensitivity genes. Thirty participants were randomized to receive up to 10 sessions of Calmare® treatment (n = 15) or a sham treatment (n = 15) using the same device at a non-therapeutic threshold. At 3 weeks after conclusion of treatment, compared with the sham group, the Calmare® group reported a significant decrease in the "worst" pain and interference scores. There were also significant differences in pain sensitivity and differential mRNA expression of 17 pain genes, suggesting that Calmare® can be effective in reducing pain intensity and interference in individuals with persistent low back pain by altering the mechanisms of enhanced pain sensitivity. Further study of long-term pain outcomes, particularly functional status, analgesic use and health care utilization, is warranted. © 2015 Wiley Periodicals, Inc.

A novel gene from the takeout family involved in termite trail-following behavior.

PubMed

Schwinghammer, Margaret A; Zhou, Xuguo; Kambhampati, Srinivas; Bennett, Gary W; Scharf, Michael E

2011-03-15

This study investigated physiological and behavioral functions of a novel gene identified from the termite Reticulitermes flavipes. The gene, named deviate, encodes an apparent ligand binding protein from the takeout-homologous family. Initial studies were conducted to investigate deviate mRNA expression among termite castes and body regions, and changes in response to light-dark conditions, starvation, temperature, and juvenile hormone (JH). Deviate has ubiquitous caste and tissue expression, including antennal expression. Consistent with characteristics of other takeout family members, deviate expression is responsive to photophase conditions (p<0.1), and feeding, temperature, and JH (p<0.05). Using RNA-interference (RNAi) techniques, short-interfering RNAs (siRNAs) homologous to the deviate gene were synthesized and injected into worker termites, which were then subjected to bioassays designed to (1) induce caste differentiation or (2) measure various behavioral aspects of foraging and trail following. No impacts on JH-dependent caste differentiation were observable. However, trail following accuracy was significantly reduced in termites that received deviate siRNA injections, and this pattern generally mirrored deviate mRNA attenuation and recovery after RNAi. In a subsequent distance foraging bioassay, deviate-silenced termites exhibited equal feeding levels to controls, suggesting the deviate gene is not linked to general vigor or the ability/motivation of termites to move and forage. These findings are among the first linking the expression of a termite gene with eusocial behavior; they illustrate the connection between deviate expression and trailing behavior, which is a key evolutionary adaptation vital to subterranean social insects such as termites and ants. Copyright © 2010 Elsevier B.V. All rights reserved.

RNAi Screening in Spodoptera frugiperda.

PubMed

Ghosh, Subhanita; Singh, Gatikrushna; Sachdev, Bindiya; Kumar, Ajit; Malhotra, Pawan; Mukherjee, Sunil K; Bhatnagar, Raj K

2016-01-01

RNA interference is a potent and precise reverse genetic approach to carryout large-scale functional genomic studies in a given organism. During the past decade, RNAi has also emerged as an important investigative tool to understand the process of viral pathogenesis. Our laboratory has successfully generated transgenic reporter and RNAi sensor line of Spodoptera frugiperda (Sf21) cells and developed a reversal of silencing assay via siRNA or shRNA guided screening to investigate RNAi factors or viral pathogenic factors with extraordinary fidelity. Here we describe empirical approaches and conceptual understanding to execute successful RNAi screening in Spodoptera frugiperda 21-cell line.

Simple lock-in detection technique utilizing multiple harmonics for digital PGC demodulators.

PubMed

Duan, Fajie; Huang, Tingting; Jiang, Jiajia; Fu, Xiao; Ma, Ling

2017-06-01

A simple lock-in detection technique especially suited for digital phase-generated carrier (PGC) demodulators is proposed in this paper. It mixes the interference signal with rectangular waves whose Fourier expansions contain multiple odd or multiple even harmonics of the carrier to recover the quadrature components needed for interference phase demodulation. In this way, the use of a multiplier is avoided and the efficiency of the algorithm is improved. Noise performance with regard to light intensity variation and circuit noise is analyzed theoretically for both the proposed technique and the traditional lock-in technique, and results show that the former provides a better signal-to-noise ratio than the latter with proper modulation depth and average interference phase. Detailed simulations were conducted and the theoretical analysis was verified. A fiber-optic Michelson interferometer was constructed and the feasibility of the proposed technique is demonstrated.

Adaptive wall research with two- and three-dimensional models in low speed and transonic tunnels

NASA Technical Reports Server (NTRS)

Lewis, M. C.; Neal, G.; Goodyer, M. J.

1988-01-01

This paper summarises recent research at the University of Southampton into adaptive wall technology and outlines the direction of current efforts. The work is aimed at developing techniques for use in test sections where the top and bottom walls may be adjusted in single curvature. Wall streamlining eliminates, as far as experimentally possible, the top and bottom wall interference in low speed and transonic aerofoil testing. A streamlining technique has been developed for low speeds which allows the testing of swept wing panels in low interference environments. At higher speeds, a comparison of several two-dimensional transonic streamlining algorithms has been made and a technique for streamlining with a choked test section has also been developed. Three-dimensional work has mainly concentrated on tests of sidewall mounted half-wings and the development of the software packages required to assess interference and to adjust the flexible walls. It has been demonstrated that two-dimensional wall adaptation can significantly modify the level of wall interference around relatively large three-dimensional models. The residual interferences are small and are probably amenable to standard post-test correction methods. Tests on a calibrated wing-body model are planned in the near future to further validate the proposed streamlining technique.

Biochemical identification of Argonaute 2 as the sole protein required for RNA-induced silencing complex activity

PubMed Central

Rand, Tim A.; Ginalski, Krzysztof; Grishin, Nick V.; Wang, Xiaodong

2004-01-01

RNA interference is carried out by the small double-stranded RNA-induced silencing complex (RISC). The RISC-bound small RNA guides the RISC complex to identify and cleave mRNAs with complementary sequences. The proteins that make up the RISC complex and cleave mRNA have not been unequivocally defined. Here, we report the biochemical purification of RISC activity to homogeneity from Drosophila Schnieder 2 cell extracts. Argonaute 2 (Ago-2) is the sole protein component present in the purified, functional RISC. By using a bioinformatics method that combines sequence-profile analysis with predicted protein secondary structure, we found homology between the PIWI domain of Ago-2 and endonuclease V and identified potential active-site amino acid residues within the PIWI domain of Ago-2. PMID:15452342

Biochemical identification of Argonaute 2 as the sole protein required for RNA-induced silencing complex activity.

PubMed

Rand, Tim A; Ginalski, Krzysztof; Grishin, Nick V; Wang, Xiaodong

2004-10-05

RNA interference is carried out by the small double-stranded RNA-induced silencing complex (RISC). The RISC-bound small RNA guides the RISC complex to identify and cleave mRNAs with complementary sequences. The proteins that make up the RISC complex and cleave mRNA have not been unequivocally defined. Here, we report the biochemical purification of RISC activity to homogeneity from Drosophila Schnieder 2 cell extracts. Argonaute 2 (Ago-2) is the sole protein component present in the purified, functional RISC. By using a bioinformatics method that combines sequence-profile analysis with predicted protein secondary structure, we found homology between the PIWI domain of Ago-2 and endonuclease V and identified potential active-site amino acid residues within the PIWI domain of Ago-2.

Nucleic Acid Templated Reactions for Chemical Biology.

PubMed

Di Pisa, Margherita; Seitz, Oliver

2017-06-21

Nucleic acid directed bioorthogonal reactions offer the fascinating opportunity to unveil and redirect a plethora of intracellular mechanisms. Nano- to picomolar amounts of specific RNA molecules serve as templates and catalyze the selective formation of molecules that 1) exert biological effects, or 2) provide measurable signals for RNA detection. Turnover of reactants on the template is a valuable asset when concentrations of RNA templates are low. The idea is to use RNA-templated reactions to fully control the biodistribution of drugs and to push the detection limits of DNA or RNA analytes to extraordinary sensitivities. Herein we review recent and instructive examples of conditional synthesis or release of compounds for in cellulo protein interference and intracellular nucleic acid imaging. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

Establishment of conditional vectors for hairpin siRNA knockdowns

PubMed Central

Matsukura, Shiro; Jones, Peter A.; Takai, Daiya

2003-01-01

Small interference RNA (siRNA) is an emerging methodology in reverse genetics. Here we report the development of a new tetracycline-inducible vector-based siRNA system, which uses a tetracycline-responsive derivative of the U6 promoter and the tetracycline repressor for conditional in vivo transcription of short hairpin RNA. This method prevents potential lethality immediately after transfection of a vector when the targeted gene is indispensable, or the phenotype of the knockdown is lethal or results in a growth abnormality. We show that the controlled knockdown of DNA methyltransferase 1 (DNMT1) in human cancer resulted in growth arrest. Removal of the inducer, doxycycline, from treated cells led to re-expression of the targeted gene. Thus the method allows for a highly controlled approach to gene knockdown. PMID:12888529

[The role of miRNA in endometrial cancer in the context of miRNA 205].

PubMed

Wilczyński, Miłosz; Danielska, Justyna; Dzieniecka, Monika; Malinowski, Andrzej

2015-11-01

MiRNAs are small, non-coding molecules of ribonucleic acids of approximately 22 bp length, which serve as regulators of gene expression and protein translation due to interference with messenger RNA (mRNA). MiRNAs, which take part in the regulation of cell cycle and apoptosis, may be associated with carcinogenesis. Aberrant expression of miRNAs in endometrial cancer might contribute to the endometrial cancer initiation or progression, as well as metastasis formation, and may influence cancer invasiveness. Specific-miRNAs expressed in endometrial cancer tissues may serve as diagnostic markers of the disease, prognostic biomarkers, or play an important part in oncological therapy We aimed to describe the role of miRNAs in endometrial cancer with special consideration of miRNA 205.

Flavivirus RNAi suppression: decoding non-coding RNA.

PubMed

Pijlman, Gorben P

2014-08-01

Flaviviruses are important human pathogens that are transmitted by invertebrate vectors, mostly mosquitoes and ticks. During replication in their vector, flaviviruses are subject to a potent innate immune response known as antiviral RNA interference (RNAi). This defense mechanism is associated with the production of small interfering (si)RNA that lead to degradation of viral RNA. To what extent flaviviruses would benefit from counteracting antiviral RNAi is subject of debate. Here, the experimental evidence to suggest the existence of flavivirus RNAi suppressors is discussed. I will highlight the putative role of non-coding, subgenomic flavivirus RNA in suppression of RNAi in insect and mammalian cells. Novel insights from ongoing research will reveal how arthropod-borne viruses modulate innate immunity including antiviral RNAi. Copyright © 2014 Elsevier B.V. All rights reserved.

Test techniques: A survey paper on cryogenic tunnels, adaptive wall test sections, and magnetic suspension and balance systems

NASA Technical Reports Server (NTRS)

Kilgore, Robert A.; Dress, David A.; Wolf, Stephen W. D.; Britcher, Colin P.

1989-01-01

The ability to get good experimental data in wind tunnels is often compromised by things seemingly beyond our control. Inadequate Reynolds number, wall interference, and support interference are three of the major problems in wind tunnel testing. Techniques for solving these problems are available. Cryogenic wind tunnels solve the problem of low Reynolds number. Adaptive wall test sections can go a long way toward eliminating wall interference. A magnetic suspension and balance system (MSBS) completely eliminates support interference. Cryogenic tunnels, adaptive wall test sections, and MSBS are surveyed. A brief historical overview is given and the present state of development and application in each area is described.

A Cellular High-Throughput Screening Approach for Therapeutic trans-Cleaving Ribozymes and RNAi against Arbitrary mRNA Disease Targets

PubMed Central

Yau, Edwin H.; Butler, Mark C.; Sullivan, Jack M.

2016-01-01

Major bottlenecks in development of therapeutic post transcriptional gene silencing (PTGS) agents (e.g. ribozymes, RNA interference, antisense) include the challenge of mapping rare accessible regions of the mRNA target that are open for annealing and cleavage, testing and optimization of agents in human cells to identify lead agents, testing for cellular toxicity, and preclinical evaluation in appropriate animal models of disease. Methods for rapid and reliable cellular testing of PTGS agents are needed to identify potent lead candidates for optimization. Our goal was to develop a means of rapid assessment of many RNA agents to identify a lead candidate for a given mRNA associated with a disease state. We developed a rapid human cell-based screening platform to test efficacy of hammerhead ribozyme (hhRz) or RNA interference (RNAi) constructs, using a model retinal degeneration target, human rod opsin (RHO) mRNA. The focus is on RNA Drug Discovery for diverse retinal degeneration targets. To validate the approach, candidate hhRzs were tested against NUH↓ cleavage sites (N=G,C,A,U; H=C,A,U) within the target mRNA of secreted alkaline phosphatase (SEAP), a model gene expression reporter, based upon in silico predictions of mRNA accessibility. HhRzs were embedded in a larger stable adenoviral VAI RNA scaffold for high cellular expression, cytoplasmic trafficking, and stability. Most hhRz expression plasmids exerted statistically significant knockdown of extracellular SEAP enzyme activity when readily assayed by a fluorescence enzyme assay intended for high throughput screening (HTS). Kinetics of PTGS knockdown of cellular targets is measureable in live cells with the SEAP reporter. The validated SEAP HTS platform was transposed to identify lead PTGS agents against a model hereditary retinal degeneration target, RHO mRNA. Two approaches were used to physically fuse the model retinal gene target mRNA to the SEAP reporter mRNA. The most expedient way to evaluate a large set of potential VAI-hhRz expression plasmids against diverse NUH↓ cleavage sites uses cultured human HEK293S cells stably expressing a dicistronic Target-IRES-SEAP target fusion mRNA. Broad utility of this rational RNA drug discovery approach is feasible for any ophthalmological disease-relevant mRNA targets and any disease mRNA targets in general. The approach will permit rank ordering of PTGS agents based on potency to identify a lead therapeutic compound for further optimization. PMID:27233447

Functional Nanostructures for Effective Delivery of Small Interfering RNA Therapeutics

PubMed Central

Hong, Cheol Am; Nam, Yoon Sung

2014-01-01

Small interfering RNA (siRNA) has proved to be a powerful tool for target-specific gene silencing via RNA interference (RNAi). Its ability to control targeted gene expression gives new hope to gene therapy as a treatment for cancers and genetic diseases. However, siRNA shows poor pharmacological properties, such as low serum stability, off-targeting, and innate immune responses, which present a significant challenge for clinical applications. In addition, siRNA cannot cross the cell membrane for RNAi activity because of its anionic property and stiff structure. Therefore, the development of a safe, stable, and efficient system for the delivery of siRNA therapeutics into the cytoplasm of targeted cells is crucial. Several nanoparticle platforms for siRNA delivery have been developed to overcome the major hurdles facing the therapeutic uses of siRNA. This review covers a broad spectrum of non-viral siRNA delivery systems developed for enhanced cellular uptake and targeted gene silencing in vitro and in vivo and discusses their characteristics and opportunities for clinical applications of therapeutic siRNA. PMID:25285170

[Mechanism of protective effects of tumor necrosis factor receptor associated protein 1 on hypoxic cardiomyocytes of rats].

PubMed

Xiang, F; Zhang, D X; Ma, S Y; Huang, Y S

2016-12-20

Objective: To investigate the mechanism of protective effects of tumor necrosis factor receptor associated protein 1 (TRAP1) on hypoxic cardiomyocytes of rats. Methods: Primary cultured cardiomyocytes were obtained from neonatal Sprague-Dawley rats (aged 1 to 3 days) and then used in the following experiments. (1) Cells were divided into group TRAP1 and control group according to the random number table (the same grouping method below), and then the total protein of cells was extracted. Total protein of cells in group TRAP1 was added with mouse anti-rat TRAP1 monoclonal antibody, while that in control group was added with the same type of IgG from mouse. Co-immunoprecipitation and protein mass spectrography analysis were used to determine the possible proteins interacted with TRAP1. (2) Cells were divided into normoxia blank control group (NBC), normoxia+ TRAP1 interference control group (NTIC), normoxia+ TRAP1 interference group (NTI), normoxia+ TRAP1 over-expression control group (NTOC), and normoxia+ TRAP1 over-expression group (NTO), with 1 well in each group. Cells in group NBC were routinely cultured, while cells in the latter four groups were respectively added with TRAP1 RNA interference empty virus vector, TRAP1 RNA interference adenovirus vector, TRAP1 over-expression empty virus vector, and TRAP1 over-expression adenovirus vector. Another batch of cells were divided into group NBC, hypoxic blank control group (HBC), hypoxic+ TRAP1 interference control group (HTIC), hypoxic+ TRAP1 interference group (HTI), hypoxic+ TRAP1 over-expression control group (HTOC), and hypoxic+ TRAP1 over-expression group (HTO), with 1 well in each group. Cells in hypoxic groups were under hypoxic condition for 6 hours after being treated as those in the corresponding normoxia groups, respectively. The mRNA expression of cytochrome c oxidase subunit Ⅱ (COXⅡ) of cells in each group was detected by real time fluorescent quantitive reverse transcription polymerase chain reaction. Experiments were repeated for three times. (3) Cells were divided into group NBC, group HBC, group HTOC, group HTO, hypoxic+ TRAP1 over-expression+ COXⅡinterference control group (HTOCIC), and hypoxic+ TRAP1 over-expression+ COXⅡinterference group (HTOCI), with 3 wells in each group. Cells in the previous 4 groups were treated as those in experiment (2). Cells in group HTOCIC and HTOCI were respectively transfected with COXⅡ RNA interference empty virus vector and COXⅡ RNA interference adenovirus vector, and then both added with TRAP1 over-expression adenovirus vector. The proliferation activity of cells was determined by cell counting kit 8 and microplate reader, and the ratio of death cells was measured by propidium lodide and Hoechst 33342 staining. Another batch of cells were divided into group NBC, group HBC, group HTIC, group HTI, hypoxic+ TRAP1 interference+ COXⅡover-expression control group (HTICOC), and hypoxic+ TRAP1 interference+ COXⅡ over-expression group (HTICO), with 3 wells in each group. Cells in the previous 4 groups were treated as those in experiment (2). Cells in group HTICOC and HTICO were both transfected with TRAP1 RNA interference adenovirus vector, and then respectively added with COXⅡ over-expression empty virus vector and COXⅡ over-expression adenovirus vector. The proliferation activity of cells and the ratio of death cells were detected as before. Experiments were repeated for three times. Data were processed with one-way analysis of variance and LSD test. Results: (1) The expression of TRAP1 was found in cells of group TRAP1, while that was not found in cells of control group. The possible proteins interacted with TRAP1 were keratin, COXⅡ, and an unknown protein with predicted molecular weight 13×10 3 . (2) Compared with that in group NBC, the mRNA expression of COXⅡof cells had no significant change in group NTIC and group NTOC (with P values above 0.05), but significantly decreased in group NTI ( P <0.01), and significantly increased in group NTO ( P <0.01). Compared with that in group NBC, the mRNA expression of COXⅡof cells in group HBC was significantly decreased ( P <0.01). Compared with that in group HBC, the mRNA expression of COXⅡof cells had no significant change in group HTIC and group HTOC (with P values above 0.05), but significantly decreased in group HTI ( P <0.01), and significantly increased in group HTO ( P <0.01). (3) The proliferation activity of cells in group NBC, group HBC, group HTOC, group HTO, group HTOCIC, and group HTOCI was respectively 0.498±0.022, 0.303±0.018, 0.313±0.032, 0.456±0.031, 0.448±0.034, and 0.335±0.026, and the ratios of death cells in above groups were respectively (4.7±1.5)%, (24.7±3.1)%, (26.0±2.7)%, (13.3±2.5)%, (12.7±2.1)%, and (21.0±1.7)%. Compared with those in group NBC, the proliferation activity of cells in HBC was decreased, while the ratio of death cells was increased (with P values below 0.01). Compared with those in group HBC, the proliferation activity of cells and the ratio of death cells in group HTOC had no significant change (with P values above 0.05), while the proliferation activity of cells was increased and the ratio of death cells was decreased in group HTO (with P values below 0.01). Compared with those in group HTO, the proliferation activity of cells and the ratio of death cells in group HTOCIC had no significant change (with P values above 0.05), while the proliferation activity of cells was decreased and the ratio of death cells was increased in group HTOCI (with P values below 0.01). (4) The proliferation activity of cells in group NBC, group HBC, group HTIC, group HTI, group HTICOC, and group HTICO was respectively 0.444±0.025, 0.275±0.016, 0.283±0.021, 0.150±0.009, 0.135±0.011, and 0.237±0.017, and the ratios of death cells in above groups were respectively (3.7±0.6)%, (21.0±2.7)%, (20.3±3.1)%, (31.7±2.5)%, (33.3±3.2)%, and (19.3±1.5)%. Compared with those in group HBC, the proliferation activity of cells and the ratio of death cells in group HTIC had no significant change (with P values above 0.05). Compared with those in group HBC and group HTIC, the proliferation activity of cells was decreased and the ratio of death cells was significantly increased in group HTI (with P values below 0.01). Compared with those in group HTI, the proliferation activity of cells and the ratio of death cells in group HTICOC had no significant change (with P values above 0.05), while the proliferation activity of cells was increased and the ratio of death cells was significantly decreased in group HTICO (with P values below 0.01). Conclusions: TRAP1 can up-regulate the expression of COXⅡ mRNA, and COXⅡ is one of the downstream effector molecules that TRAP1 mediates its protective effects on hypoxic cardiomyocytes.

Development of a nucleic Acid extraction procedure for simultaneous recovery of DNA and RNA from diverse microbes in water.

PubMed

Hill, Vincent R; Narayanan, Jothikumar; Gallen, Rachel R; Ferdinand, Karen L; Cromeans, Theresa; Vinjé, Jan

2015-05-26

Drinking and environmental water samples contain a diverse array of constituents that can interfere with molecular testing techniques, especially when large volumes of water are concentrated to the small volumes needed for effective molecular analysis. In this study, a suite of enteric viruses, bacteria, and protozoan parasites were seeded into concentrated source water and finished drinking water samples, in order to investigate the relative performance of nucleic acid extraction techniques for molecular testing. Real-time PCR and reverse transcription-PCR crossing threshold (CT) values were used as the metrics for evaluating relative performance. Experimental results were used to develop a guanidinium isothiocyanate-based lysis buffer (UNEX buffer) that enabled effective simultaneous extraction and recovery of DNA and RNA from the suite of study microbes. Procedures for bead beating, nucleic acid purification, and PCR facilitation were also developed and integrated in the protocol. The final lysis buffer and sample preparation procedure was found to be effective for a panel of drinking water and source water concentrates when compared to commercial nucleic acid extraction kits. The UNEX buffer-based extraction protocol enabled PCR detection of six study microbes, in 100 L finished water samples from four drinking water treatment facilities, within three CT values (i.e., within 90% difference) of the reagent-grade water control. The results from this study indicate that this newly formulated lysis buffer and sample preparation procedure can be useful for standardized molecular testing of drinking and environmental waters.

Development of a Nucleic Acid Extraction Procedure for Simultaneous Recovery of DNA and RNA from Diverse Microbes in Water

PubMed Central

Hill, Vincent R.; Narayanan, Jothikumar; Gallen, Rachel R.; Ferdinand, Karen L.; Cromeans, Theresa; Vinjé, Jan

2015-01-01

Drinking and environmental water samples contain a diverse array of constituents that can interfere with molecular testing techniques, especially when large volumes of water are concentrated to the small volumes needed for effective molecular analysis. In this study, a suite of enteric viruses, bacteria, and protozoan parasites were seeded into concentrated source water and finished drinking water samples, in order to investigate the relative performance of nucleic acid extraction techniques for molecular testing. Real-time PCR and reverse transcription-PCR crossing threshold (CT) values were used as the metrics for evaluating relative performance. Experimental results were used to develop a guanidinium isothiocyanate-based lysis buffer (UNEX buffer) that enabled effective simultaneous extraction and recovery of DNA and RNA from the suite of study microbes. Procedures for bead beating, nucleic acid purification, and PCR facilitation were also developed and integrated in the protocol. The final lysis buffer and sample preparation procedure was found to be effective for a panel of drinking water and source water concentrates when compared to commercial nucleic acid extraction kits. The UNEX buffer-based extraction protocol enabled PCR detection of six study microbes, in 100 L finished water samples from four drinking water treatment facilities, within three CT values (i.e., within 90% difference) of the reagent-grade water control. The results from this study indicate that this newly formulated lysis buffer and sample preparation procedure can be useful for standardized molecular testing of drinking and environmental waters. PMID:26016775

Emerging strategies for RNA interference (RNAi) applications in insects.

PubMed

Nandety, Raja Sekhar; Kuo, Yen-Wen; Nouri, Shahideh; Falk, Bryce W

2015-01-01

RNA interference (RNAi) in insects is a gene regulatory process that also plays a vital role in the maintenance and in the regulation of host defenses against invading viruses. Small RNAs determine the specificity of the RNAi through precise recognition of their targets. These small RNAs in insects comprise small interfering RNAs (siRNAs), micro RNAs (miRNAs) and Piwi interacting RNAs (piRNAs) of various lengths. In this review, we have explored different forms of the RNAi inducers that are presently in use, and their applications for an effective and efficient fundamental and practical RNAi research with insects. Further, we reviewed trends in next generation sequencing (NGS) technologies and their importance for insect RNAi, including the identification of novel insect targets as well as insect viruses. Here we also describe a rapidly emerging trend of using plant viruses to deliver the RNAi inducer molecules into insects for an efficient RNAi response.

Improvement of heterologous protein production in Aspergillus oryzae by RNA interference with alpha-amylase genes.

PubMed

Nemoto, Takashi; Maruyama, Jun-ichi; Kitamoto, Katsuhiko

2009-11-01

Aspergillus oryzae RIB40 has three alpha-amylase genes (amyA, amyB, and amyC), and secretes alpha-amylase abundantly. However, large amounts of endogenous secretory proteins such as alpha-amylase can compete with heterologous protein in the secretory pathway and decrease its production yields. In this study, we examined the effects of suppression of alpha-amylase on heterologous protein production in A. oryzae, using the bovine chymosin (CHY) as a reporter heterologous protein. The three alpha-amylase genes in A. oryzae have nearly identical DNA sequences from those promoters to the coding regions. Hence we performed silencing of alpha-amylase genes by RNA interference (RNAi) in the A. oryzae CHY producing strain. The silenced strains exhibited a reduction in alpha-amylase activity and an increase in CHY production in the culture medium. This result suggests that suppression of alpha-amylase is effective in heterologous protein production in A. oryzae.

RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.)

PubMed Central

Abdurakhmonov, Ibrokhim Y.; Ayubov, Mirzakamol S.; Ubaydullaeva, Khurshida A.; Buriev, Zabardast T.; Shermatov, Shukhrat E.; Ruziboev, Haydarali S.; Shapulatov, Umid M.; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z.; Percy, Richard G.; Devor, Eric J.; Sharma, Govind C.; Sripathi, Venkateswara R.; Kumpatla, Siva P.; van der Krol, Alexander; Kater, Hake D.; Khamidov, Khakimdjan; Salikhov, Shavkat I.; Jenkins, Johnie N.; Abdukarimov, Abdusattor; Pepper, Alan E.

2016-01-01

RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization. PMID:26941765

RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.).

PubMed

Abdurakhmonov, Ibrokhim Y; Ayubov, Mirzakamol S; Ubaydullaeva, Khurshida A; Buriev, Zabardast T; Shermatov, Shukhrat E; Ruziboev, Haydarali S; Shapulatov, Umid M; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z; Percy, Richard G; Devor, Eric J; Sharma, Govind C; Sripathi, Venkateswara R; Kumpatla, Siva P; van der Krol, Alexander; Kater, Hake D; Khamidov, Khakimdjan; Salikhov, Shavkat I; Jenkins, Johnie N; Abdukarimov, Abdusattor; Pepper, Alan E

2016-01-01

RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization.

High-Throughput Characterization of Cascade type I-E CRISPR Guide Efficacy Reveals Unexpected PAM Diversity and Target Sequence Preferences.

PubMed

Fu, Becky Xu Hua; Wainberg, Michael; Kundaje, Anshul; Fire, Andrew Z

2017-08-01

Interactions between Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) RNAs and CRISPR-associated (Cas) proteins form an RNA-guided adaptive immune system in prokaryotes. The adaptive immune system utilizes segments of the genetic material of invasive foreign elements in the CRISPR locus. The loci are transcribed and processed to produce small CRISPR RNAs (crRNAs), with degradation of invading genetic material directed by a combination of complementarity between RNA and DNA and in some cases recognition of adjacent motifs called PAMs (Protospacer Adjacent Motifs). Here we describe a general, high-throughput procedure to test the efficacy of thousands of targets, applying this to the Escherichia coli type I-E Cascade (CRISPR-associated complex for antiviral defense) system. These studies were followed with reciprocal experiments in which the consequence of CRISPR activity was survival in the presence of a lytic phage. From the combined analysis of the Cascade system, we found that (i) type I-E Cascade PAM recognition is more expansive than previously reported, with at least 22 distinct PAMs, with many of the noncanonical PAMs having CRISPR-interference abilities similar to the canonical PAMs; (ii) PAM positioning appears precise, with no evidence for tolerance to PAM slippage in interference; and (iii) while increased guanine-cytosine (GC) content in the spacer is associated with higher CRISPR-interference efficiency, high GC content (>62.5%) decreases CRISPR-interference efficiency. Our findings provide a comprehensive functional profile of Cascade type I-E interference requirements and a method to assay spacer efficacy that can be applied to other CRISPR-Cas systems. Copyright © 2017 by the Genetics Society of America.

Targeting CCl4 -induced liver fibrosis by RNA interference-mediated inhibition of cyclin E1 in mice.

PubMed

Bangen, Jörg-Martin; Hammerich, Linda; Sonntag, Roland; Baues, Maike; Haas, Ute; Lambertz, Daniela; Longerich, Thomas; Lammers, Twan; Tacke, Frank; Trautwein, Christian; Liedtke, Christian

2017-10-01

Initiation and progression of liver fibrosis requires proliferation and activation of resting hepatic stellate cells (HSCs). Cyclin E1 (CcnE1) is the regulatory subunit of the cyclin-dependent kinase 2 (Cdk2) and controls cell cycle re-entry. We have recently shown that genetic inactivation of CcnE1 prevents activation, proliferation, and survival of HSCs and protects from liver fibrogenesis. The aim of the present study was to translate these findings into preclinical applications using an RNA interference (RNAi)-based approach. CcnE1-siRNA (small interfering RNA) efficiently inhibited CcnE1 gene expression in murine and human HSC cell lines and in primary HSCs, resulting in diminished proliferation and increased cell death. In C57BL/6 wild-type (WT) mice, delivery of stabilized siRNA using a liposome-based carrier targeted approximately 95% of HSCs, 70% of hepatocytes, and 40% of CD45 + cells after single injection. Acute CCl 4 -mediated liver injury in WT mice induced endogenous CcnE1 expression and proliferation of surviving hepatocytes and nonparenchymal cells, including CD45 + leukocytes. Pretreatment with CcnE1-siRNA reverted CcnE1 induction to baseline levels of healthy mice, which was associated with reduced liver injury, diminished proliferation of hepatocytes and leukocytes, and attenuated overall inflammatory response. For induction of liver fibrosis, WT mice were challenged with CCl 4 for 4-6 weeks. Co-treatment with CcnE1-siRNA once a week was sufficient to continuously block CcnE1 expression and cell-cycle activity of hepatocytes and nonparenchymal cells, resulting in significantly ameliorated liver fibrosis and inflammation. Importantly, CcnE1-siRNA also prevented progression of liver fibrosis if applied after onset of chronic liver injury. Therapeutic targeting of CcnE1 in vivo using RNAi is feasible and has high antifibrotic activity. (Hepatology 2017;66:1242-1257). © 2017 by the American Association for the Study of Liver Diseases.

RNA viruses and microRNAs: challenging discoveries for the 21st century

PubMed Central

Swaminathan, Gokul; Martin-Garcia, Julio

2013-01-01

RNA viruses represent the predominant cause of many clinically relevant viral diseases in humans. Among several evolutionary advantages acquired by RNA viruses, the ability to usurp host cellular machinery and evade antiviral immune responses is imperative. During the past decade, RNA interference mechanisms, especially microRNA (miRNA)-mediated regulation of cellular protein expression, have revolutionized our understanding of host-viral interactions. Although it is well established that several DNA viruses express miRNAs that play crucial roles in their pathogenesis, expression of miRNAs by RNA viruses remains controversial. However, modulation of the miRNA machinery by RNA viruses may confer multiple benefits for enhanced viral replication and survival in host cells. In this review, we discuss the current literature on RNA viruses that may encode miRNAs and the varied advantages of engineering RNA viruses to express miRNAs as potential vectors for gene therapy. In addition, we review how different families of RNA viruses can alter miRNA machinery for productive replication, evasion of antiviral immune responses, and prolonged survival. We underscore the need to further explore the complex interactions of RNA viruses with host miRNAs to augment our understanding of host-virus interplay. PMID:24046280

Design of siRNA Therapeutics from the Molecular Scale

PubMed Central

Angart, Phillip; Vocelle, Daniel; Chan, Christina; Walton, S. Patrick

2013-01-01

While protein-based therapeutics is well-established in the market, development of nucleic acid therapeutics has lagged. Short interfering RNAs (siRNAs) represent an exciting new direction for the pharmaceutical industry. These small, chemically synthesized RNAs can knock down the expression of target genes through the use of a native eukaryotic pathway called RNA interference (RNAi). Though siRNAs are routinely used in research studies of eukaryotic biological processes, transitioning the technology to the clinic has proven challenging. Early efforts to design an siRNA therapeutic have demonstrated the difficulties in generating a highly-active siRNA with good specificity and a delivery vehicle that can protect the siRNA as it is transported to a specific tissue. In this review article, we discuss design considerations for siRNA therapeutics, identifying criteria for choosing therapeutic targets, producing highly-active siRNA sequences, and designing an optimized delivery vehicle. Taken together, these design considerations provide logical guidelines for generating novel siRNA therapeutics. PMID:23976875

Structure of yeast Argonaute with guide RNA

PubMed Central

Nakanishi, Kotaro; Weinberg, David E.; Bartel, David P.; Patel, Dinshaw J.

2012-01-01

The RNA-induced silencing complex, comprising Argonaute and guide RNA, mediates RNA interference. Here we report the 3.2 Å crystal structure of Kluyveromyces Argonaute (KpAGO) fortuitously complexed with guide RNA originating from small-RNA duplexes autonomously loaded and processed by recombinant KpAGO. Despite their diverse sequences, guide-RNA nucleotides 1–8 are positioned similarly, with sequence-independent contacts to bases, phosphates and 2′-hydroxyl groups pre-organizing the backbone of nucleotides 2–8 in a near–A-form conformation. Compared with prokaryotic Argonautes, KpAGO has numerous surface-exposed insertion segments, with a cluster of conserved insertions repositioning the N domain to enable full propagation of guide–target pairing. Compared with Argonautes in inactive conformations, KpAGO has a hydrogen-bond network that stabilizes an expanded and repositioned loop, which inserts an invariant glutamate into the catalytic pocket. Mutation analyses and analogies to Ribonuclease H indicate that insertion of this glutamate finger completes a universally conserved catalytic tetrad, thereby activating Argonaute for RNA cleavage. PMID:22722195

Protection from feed-forward amplification in an amplified RNAi mechanism

PubMed Central

Pak, Julia; Maniar, Jay Mahesh; Mello, Cecilia Cabral; Fire, Andrew

2012-01-01

SUMMARY The effectiveness of RNA interference (RNAi) in many organisms is potentiated through the signal-amplifying activity of a targeted RNA directed RNA polymerase (RdRP) system that can convert a small population of exogenously-encountered dsRNA fragments into an abundant internal pool of small interfering RNA (siRNA). As for any biological amplification system, we expect an underlying architecture that will limit the ability of a randomly encountered trigger to produce an uncontrolled and self-escalating response. Investigating such limits in C. elegans, we find that feed-forward amplification is limited by a critical biosynthetic and structural distinction at the RNA level between (i) triggers that can produce amplification and (ii) siRNA products of the amplification reaction. By assuring that initial (primary) siRNAs can act as triggers but not templates for activation, and that the resulting (secondary) siRNAs can enforce gene silencing on additional targets without unbridled trigger amplification, the system achieves substantial but fundamentally limited signal amplification. PMID:23141544

Antiviral effect of PmRab7 knock-down on inhibition of Laem-Singh virus replication in black tiger shrimp.

PubMed

Ongvarrasopone, Chalermporn; Chomchay, Ekapol; Panyim, Sakol

2010-10-01

PmRab7 is a Penaeus monodon small GTPase protein possibly involved in replication of several shrimp viruses. In this study RNA interference (RNAi) using double-stranded RNA (dsRNA) targeting PmRab7 gene (dsRNA-PmRab7) was employed to silence the expression of PmRab7 to investigate the inhibitory effect on Laem-Singh virus (LSNV) replication. Injection of dsRNA-PmRab7 24h before challenge with the virus resulted in a drastic decrease of PmRab7 mRNA and complete inhibition of LSNV replication at 3 days post-challenge. In a therapeutic mode, shrimp injected with dsRNA-PmRab7 1 day but not at 3 or 5 days post-LSNV challenge resulted in inhibition of LSNV replication. These results pave the way to use dsRNA-PmRab7 to prevent or cure LSNV infection in shrimp. Copyright © 2010 Elsevier B.V. All rights reserved.

Exaptive origins of regulated mRNA decay in eukaryotes.

PubMed

Hamid, Fursham M; Makeyev, Eugene V

2016-09-01

Eukaryotic gene expression is extensively controlled at the level of mRNA stability and the mechanisms underlying this regulation are markedly different from their archaeal and bacterial counterparts. We propose that two such mechanisms, nonsense-mediated decay (NMD) and motif-specific transcript destabilization by CCCH-type zinc finger RNA-binding proteins, originated as a part of cellular defense against RNA pathogens. These branches of the mRNA turnover pathway might have been used by primeval eukaryotes alongside RNA interference to distinguish their own messages from those of RNA viruses and retrotransposable elements. We further hypothesize that the subsequent advent of "professional" innate and adaptive immunity systems allowed NMD and the motif-triggered mechanisms to be efficiently repurposed for regulation of endogenous cellular transcripts. This scenario explains the rapid emergence of archetypical mRNA destabilization pathways in eukaryotes and argues that other aspects of post-transcriptional gene regulation in this lineage might have been derived through a similar exaptation route. © 2016 The Authors BioEssays Published by WILEY Periodicals, Inc.

Bioengineered Nanoparticles for siRNA delivery

PubMed Central

Kozielski, Kristen L.; Tzeng, Stephany Y.; Green, Jordan J.

2014-01-01

Short interfering RNA (siRNA) has been an important laboratory tool in the last two decades and has allowed researchers to better understand the functions of non-protein-coding genes through RNA interference (RNAi). Although RNAi holds great promise for this purpose as well as for treatment of many diseases, efforts at using siRNA have been hampered by the difficulty of safely and effectively introducing it into cells of interest, both in vitro and in vivo. To overcome this challenge, many biomaterials and nanoparticles (NPs) have been developed and optimized for siRNA delivery, often taking cues from the DNA delivery field, although different barriers exist for these two types of molecules. In this review, we discuss general properties of biomaterials and nanoparticles that are necessary for effective nucleic acid delivery. We also discuss specific examples of bioengineered materials, including lipid-based NPs, polymeric NPs, inorganic NPs, and RNA-based NPs, which clearly illustrate the problems and successes in siRNA delivery. PMID:23821336

An optofluidic approach for gold nanoprobes based-cancer theranostics

NASA Astrophysics Data System (ADS)

Panwar, Nishtha; Song, Peiyi; Yang, Chengbin; Yong, Ken-Tye; Tjin, Swee Chuan

2017-02-01

Suppression of overexpressed gene mutations in cancer cells through RNA interference (RNAi) technique is a therapeutically effective modality for oncogene silencing. In general, transfection agent is needed for siRNA delivery. Also, it is a tedious and time consuming process to analyze the gene transfection using current conventional flow cytometry systems and commercially available transfection kits. Therefore, there are two urgent challenges that we need to address for understanding and real time monitoring the delivery of siRNA to cancer cells more effectively. One, nontoxic, biocompatible and stable non-viral transfection agents need to be developed and investigated for gene delivery in cancer cells. Two, new, portable optofluidic methods need to be engineered for determining the transfection efficiency of the nanoformulation in real time. First, we demonstrate the feasibility of using gold nanorods (AuNRs) as nanoprobes for the delivery of Interleukin-8 (IL-8) siRNA in a pancreatic cancer cell line- MiaPaCa-2. An optimum ratio of 10:1 for the AuNRs-siRNA nanoformulation required for efficient loading has been experimentally determined. Promising transfection rates (≈88%) of the nanoprobe-assisted gene delivery are quantified by flow cytometry and fluorescence imaging, which are higher than the commercial control, Oligofectamine. The excellent gene knockdown performance (over 81%) of the proposed model support in vivo trials for RNAi-based cancer theranostics. In addition to cancer theranostics, our nanoprobe combination can be also applied for disease outbreak monitoring like MERS. Second, we present an optical fiber-integrated microfluidic chip that utilizes simple hydrodynamic and optical setups for miniaturized on-chip flow cytometry. The chip provides a powerful and convenient tool to quantitatively determine the siRNA transfection into cancer cells without using bulky flow cytometer. These studies outline the role of AuNRs as potential non-viral gene delivery vehicles, and their suitability for microfluidics-based lab-on-chip flow cytometry applications.

Complexities in Isolation and Purification of Multiple Viruses from Mixed Viral Infections: Viral Interference, Persistence and Exclusion.

PubMed

Kumar, Naveen; Barua, Sanjay; Riyesh, Thachamvally; Chaubey, Kundan K; Rawat, Krishan Dutt; Khandelwal, Nitin; Mishra, Anil K; Sharma, Nitika; Chandel, Surender S; Sharma, Shalini; Singh, Manoj K; Sharma, Dinesh K; Singh, Shoor V; Tripathi, Bhupendra N

2016-01-01

Successful purification of multiple viruses from mixed infections remains a challenge. In this study, we investigated peste des petits ruminants virus (PPRV) and foot-and-mouth disease virus (FMDV) mixed infection in goats. Rather than in a single cell type, cytopathic effect (CPE) of the virus was observed in cocultured Vero/BHK-21 cells at 6th blind passage (BP). PPRV, but not FMDV could be purified from the virus mixture by plaque assay. Viral RNA (mixture) transfection in BHK-21 cells produced FMDV but not PPRV virions, a strategy which we have successfully employed for the first time to eliminate the negative-stranded RNA virus from the virus mixture. FMDV phenotypes, such as replication competent but noncytolytic, cytolytic but defective in plaque formation and, cytolytic but defective in both plaque formation and standard FMDV genome were observed respectively, at passage level BP8, BP15 and BP19 and hence complicated virus isolation in the cell culture system. Mixed infection was not found to induce any significant antigenic and genetic diversity in both PPRV and FMDV. Further, we for the first time demonstrated the viral interference between PPRV and FMDV. Prior transfection of PPRV RNA, but not Newcastle disease virus (NDV) and rotavirus RNA resulted in reduced FMDV replication in BHK-21 cells suggesting that the PPRV RNA-induced interference was specifically directed against FMDV. On long-term coinfection of some acute pathogenic viruses (all possible combinations of PPRV, FMDV, NDV and buffalopox virus) in Vero cells, in most cases, one of the coinfecting viruses was excluded at passage level 5 suggesting that the long-term coinfection may modify viral persistence. To the best of our knowledge, this is the first documented evidence describing a natural mixed infection of FMDV and PPRV. The study not only provides simple and reliable methodologies for isolation and purification of two epidemiologically and economically important groups of viruses, but could also help in establishing better guidelines for trading animals that could transmit further infections and epidemics in disease free nations.

The involvement of osteopontin and matrix metalloproteinase- 9 in the migration of endometrial epithelial cells in patients with endometriosis.

PubMed

Yang, Mei; Jiang, Chunfan; Chen, Hua; Nian, Yan; Bai, Zhimiao; Ha, Chunfang

2015-08-20

Endometriosis, which shares certain characteristics with cancers, may cause abnormal expression of proteins involved in cell migration. Endometrial epithelial cells (EECs) are believed to play an important role in endometriotic migration. The aim of this study was to investigate the relationship between the expression of osteopontin (OPN) and matrix metalloproteinase-9 (MMP-9) in endometriotic migration. We performed primary culture of EECs and investigated the expression of OPN and MMP-9 in EECs regulated by 17beta-estradiol (E2). OPN-specific siRNA interference was used to down-regulate OPN and to explore the corresponding change in MMP-9 expression. Real-time RT-PCR, western blot analysis and flow cytometry were used to determine the expression levels of OPN and MMP-9. Gelatin zymography was performed to observe the enzymatic activity of MMP-9 in conditioned media. Transwell and wound scratch assays were performed to investigate the migration ability of EECs. The expression levels of OPN and MMP-9 in normal EECs (NEECs) were inferior to those in EECs from patients with endometriosis (EEECs). The expression levels of OPN and MMP-9 from stage III/IV EEECs and secretory-phase EECs were higher than those of stage I/II EEECs or proliferative-phase EECs. The expression levels of OPN and MMP-9 in EEECs were increased by E2 treatment and remarkably decreased by siRNA interference. Active MMP-9 expression increased with E2 treatment and decreased with siRNA treatment in EEECs compared with the same treatments in NEECs. The migratory abilities of EEECs were enhanced after cells were treated with E2; in contrast, these abilities were reduced by siRNA interference. In NEECs, active MMP-9 and cellular migration abilities were only minimally influenced by E2 and siRNA treatment. The present study suggests that the up-regulation of MMP-9 via activation of OPN induced by estrogen may correlate with the migration of endometrial epithelial cells in patients with endometriosis.

Complexities in Isolation and Purification of Multiple Viruses from Mixed Viral Infections: Viral Interference, Persistence and Exclusion

PubMed Central

Kumar, Naveen; Barua, Sanjay; Riyesh, Thachamvally; Chaubey, Kundan K.; Rawat, Krishan Dutt; Khandelwal, Nitin; Mishra, Anil K.; Sharma, Nitika; Chandel, Surender S.; Sharma, Shalini; Singh, Manoj K.; Sharma, Dinesh K.; Singh, Shoor V.; Tripathi, Bhupendra N.

2016-01-01

Successful purification of multiple viruses from mixed infections remains a challenge. In this study, we investigated peste des petits ruminants virus (PPRV) and foot-and-mouth disease virus (FMDV) mixed infection in goats. Rather than in a single cell type, cytopathic effect (CPE) of the virus was observed in cocultured Vero/BHK-21 cells at 6th blind passage (BP). PPRV, but not FMDV could be purified from the virus mixture by plaque assay. Viral RNA (mixture) transfection in BHK-21 cells produced FMDV but not PPRV virions, a strategy which we have successfully employed for the first time to eliminate the negative-stranded RNA virus from the virus mixture. FMDV phenotypes, such as replication competent but noncytolytic, cytolytic but defective in plaque formation and, cytolytic but defective in both plaque formation and standard FMDV genome were observed respectively, at passage level BP8, BP15 and BP19 and hence complicated virus isolation in the cell culture system. Mixed infection was not found to induce any significant antigenic and genetic diversity in both PPRV and FMDV. Further, we for the first time demonstrated the viral interference between PPRV and FMDV. Prior transfection of PPRV RNA, but not Newcastle disease virus (NDV) and rotavirus RNA resulted in reduced FMDV replication in BHK-21 cells suggesting that the PPRV RNA-induced interference was specifically directed against FMDV. On long-term coinfection of some acute pathogenic viruses (all possible combinations of PPRV, FMDV, NDV and buffalopox virus) in Vero cells, in most cases, one of the coinfecting viruses was excluded at passage level 5 suggesting that the long-term coinfection may modify viral persistence. To the best of our knowledge, this is the first documented evidence describing a natural mixed infection of FMDV and PPRV. The study not only provides simple and reliable methodologies for isolation and purification of two epidemiologically and economically important groups of viruses, but could also help in establishing better guidelines for trading animals that could transmit further infections and epidemics in disease free nations. PMID:27227480

Effect of radiofrequency energy emitted from monopolar "Bovie" instruments on cardiac implantable electronic devices.

PubMed

Robinson, Thomas N; Varosy, Paul D; Guillaume, Girard; Dunning, James E; Townsend, Nicole T; Jones, Edward L; Paniccia, Alessandro; Stiegmann, Greg V; Weyer, Christopher; Rozner, Marc A

2014-09-01

The monopolar "Bovie" instrument emits radiofrequency energy that can disrupt the function of other implanted electronic devices through a phenomenon termed electromagnetic interference. The purpose of this study was to quantify the electromagnetic interference occurring on cardiac implantable devices (CIEDs) resulting from monopolar instrument use in common, modifiable clinical scenarios. Three anesthetized pigs underwent CIED placement (1 pacemaker and 2 defibrillators). Electromagnetic interference was quantified when changing the monopolar instrument parameters of generator power, generator mode, surgical technique, orientation of active electrode cord, pathway of current vector, and proximity of active electrode to the CIED. Monopolar instrument parameters that decreased the electromagnetic interference occurring on the CIED included decreasing generator power from 60 W to 30 W (p < 0.001), using cut mode rather than coag mode (p < 0.001), using desiccation technique rather than fulguration technique (p < 0.001), orienting the active electrode cord from the feet rather than across the chest wall (p < 0.001), and avoiding the current vector from crossing the CIED system (p < 0.001). Increasing the distance between the active electrode tool and the CIED system decreased electromagnetic interference occurring on the CIED in a dose-response fashion up to a distance of 10 cm (ANOVA, p < 0.001), after which the magnitude of electromagnetic interference remained constant. Electromagnetic interference occurring on CIEDs resulting from monopolar instruments is minimized by decreasing generator power, using cut mode, using desiccation technique, orienting the active electrode cord from the feet, avoiding the current vector for crossing the CIED system, and increasing the distance between the active electrode and the CIED. Surgeons and operating room staff can minimize electromagnetic interference on CIEDs during monopolar instrument use by accounting for these modifiable clinical factors. Copyright © 2014 American College of Surgeons. Published by Elsevier Inc. All rights reserved.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Bacterial delivery of RNAi effectors: transkingdom RNAi.

PubMed

Lage, Hermann; Krühn, Andrea

2010-08-18

RNA interference (RNAi) represents a high effective mechanism for specific inhibition of mRNA expression. Besides its potential as a powerful laboratory tool, the RNAi pathway appears to be promising for therapeutic utilization. For development of RNA interference (RNAi)-based therapies, delivery of RNAi-mediating agents to target cells is one of the major obstacles. A novel strategy to overcome this hurdle is transkingdom RNAi (tkRNAi). This technology uses non-pathogenic bacteria, e.g. Escherichia coli, to produce and deliver therapeutic short hairpin RNA (shRNA) into target cells to induce RNAi. A first-generation tkRNAi-mediating vector, TRIP, contains the bacteriophage T7 promoter for expression regulation of a therapeutic shRNA of interest. Furthermore, TRIP has the Inv locus from Yersinia pseudotuberculosis that encodes invasin, which permits natural noninvasive bacteria to enter beta1-integrin-positive mammalian cells and the HlyA gene from Listeria monocytogenes, which produces listeriolysin O. This enzyme allows the therapeutic shRNA to escape from entry vesicles within the cytoplasm of the target cell. TRIP constructs are introduced into a competent non-pathogenic Escherichia coli strain, which encodes T7 RNA polymerase necessary for the T7 promoter-driven synthesis of shRNAs. A well-characterized cancer-associated target molecule for different RNAi strategies is ABCB1 (MDR1/P-glycoprotein, MDR1/P-gp). This ABC-transporter acts as a drug extrusion pump and mediates the "classical" ABCB1-mediated multidrug resistance (MDR) phenotype of human cancer cells which is characterized by a specific cross resistance pattern. Different ABCB1-expressing MDR cancer cells were treated with anti-ABCB1 shRNA expression vector bearing E. coli. This procedure resulted in activation of the RNAi pathways within the cancer cells and a considerable down regulation of the ABCB1 encoding mRNA as well as the corresponding drug extrusion pump. Accordingly, drug accumulation was enhanced in the pristine drug-resistant cancer cells and the MDR phenotype was reversed. By means of this model the data provide the proof-of-concept that tkRNAi is suitable for modulation of cancer-associated factors, e.g. ABCB1, in human cancer cells.

A 3’UTR polymorphism marks differential KLRG1 mRNA levels through disruption of a miR-584-5p binding site and associates with pemphigus foliaceus susceptibility

PubMed Central

Cipolla, Gabriel A.; Park, Jong K.; de Oliveira, Liana A.; Lobo-Alves, Sara Cristina; de Almeida, Rodrigo C.; Farias, Ticiana D. J.; Lemos, Débora de S.; Malheiros, Danielle; Lavker, Robert M.; Petzl-Erler, Maria Luiza

2016-01-01

Genetic variations mapping to 3’ untranslated regions (3’UTRs) may overlap with microRNA (miRNA) binding sites, therefore potentially interfering with translation inhibition or messenger RNA (mRNA) degradation. The aim of this study was to investigate whether single nucleotide polymorphisms (SNPs) located within the 3’UTRs of six candidate genes and predicted to interfere with miRNA ligation could account for disease-relevant differential mRNA levels. Focusing on pemphigus foliaceus (PF) – an autoimmune blistering skin condition with unique endemic patterns – we investigated if nine 3’UTR SNPs from the CD1D, CTLA4, KLRD1, KLRG1, NKG7, and TNFSF13B genes differentially expressed in PF were disease-associated. The heterozygous genotype of the KLRG1 rs1805672 polymorphism was associated with increased predisposition to PF (A/G vs. A/A: P=0.038; OR=1.60), and a trend for augmented susceptibility was observed for carriers of the G allele (P=0.094; OR=1.44). In silico analyses suggested that rs1805672 G allele could disrupt binding of miR-584-5p, and indicated rs1805672 as an expression Quantitative Trait Locus (eQTL), with an effect on KLRG1 gene expression. Dual-luciferase assay showed that miR-584-5p mediated approximately 50% downregulation of the reporter gene’s activity through the 3’UTR of KLRG1 harboring rs1805672 A allele (vs. miRNA-negative condition, P=0.006). This silencing relationship was lost after site-directed mutation to G allele (vs. miRNA-negative condition, P=0.391; vs. rs1805672 A allele, P=0.005). Collectively, these results suggest that a disease-associated SNP located within the 3’UTR of KLRG1 directly interferes with miR-584-5p binding, allowing for KLRG1 mRNA differential accumulation, which in turn may contribute to pathogenesis of autoimmune diseases, such as pemphigus. PMID:27424220

A 3'UTR polymorphism marks differential KLRG1 mRNA levels through disruption of a miR-584-5p binding site and associates with pemphigus foliaceus susceptibility.

PubMed

Cipolla, Gabriel A; Park, Jong Kook; de Oliveira, Liana A; Lobo-Alves, Sara Cristina; de Almeida, Rodrigo C; Farias, Ticiana D J; Lemos, Débora de S; Malheiros, Danielle; Lavker, Robert M; Petzl-Erler, Maria Luiza

2016-10-01

Genetic variations mapping to 3' untranslated regions (3'UTRs) may overlap with microRNA (miRNA) binding sites, therefore potentially interfering with translation inhibition or messenger RNA (mRNA) degradation. The aim of this study was to investigate whether single nucleotide polymorphisms (SNPs) located within the 3'UTRs of six candidate genes and predicted to interfere with miRNA ligation could account for disease-relevant differential mRNA levels. Focusing on pemphigus foliaceus (PF) - an autoimmune blistering skin condition with unique endemic patterns - we investigated whether nine 3'UTR SNPs from the CD1D, CTLA4, KLRD1, KLRG1, NKG7, and TNFSF13B genes differentially expressed in PF were disease-associated. The heterozygous genotype of the KLRG1 rs1805672 polymorphism was associated with increased predisposition to PF (A/G vs. A/A: P=0.038; OR=1.60), and a trend for augmented susceptibility was observed for carriers of the G allele (P=0.094; OR=1.44). In silico analyses suggested that rs1805672 G allele could disrupt binding of miR-584-5p, and indicated rs1805672 as an expression Quantitative Trait Locus (eQTL), with an effect on KLRG1 gene expression. Dual-luciferase assay showed that miR-584-5p mediated approximately 50% downregulation of the reporter gene's activity through the 3'UTR of KLRG1 harboring rs1805672 A allele (vs. miRNA-negative condition, P=0.006). This silencing relationship was lost after site-directed mutation to G allele (vs. miRNA-negative condition, P=0.391; vs. rs1805672 A allele, P=0.005). Collectively, these results suggest that a disease-associated SNP located within the 3'UTR of KLRG1 directly interferes with miR-584-5p binding, allowing for KLRG1 mRNA differential accumulation, which in turn may contribute to pathogenesis of autoimmune diseases, such as pemphigus. Copyright © 2016 Elsevier B.V. All rights reserved.

Local gene silencing in plants via synthetic dsRNA and carrier peptide.

PubMed

Numata, Keiji; Ohtani, Misato; Yoshizumi, Takeshi; Demura, Taku; Kodama, Yutaka

2014-10-01

Quick and facile transient RNA interference (RNAi) is one of the most valuable plant biotechnologies for analysing plant gene functions. To establish a novel double-strand RNA (dsRNA) delivery system for plants, we developed an ionic complex of synthetic dsRNA with a carrier peptide in which a cell-penetrating peptide is fused with a polycation sequence as a gene carrier. The dsRNA-peptide complex is 100-300 nm in diameter and positively charged. Infiltration of the complex into intact leaf cells of Arabidopsis thaliana successfully induced rapid and efficient down-regulation of exogenous and endogenous genes such as yellow fluorescent protein and chalcone synthase. The present method realizes quick and local gene silencing in specific tissues and/or organs in plants. © 2014 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.

PubMed

Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H

2016-06-17

In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.

Different effects of the TAR structure on HIV-1 and HIV-2 genomic RNA translation

PubMed Central

Soto-Rifo, Ricardo; Limousin, Taran; Rubilar, Paulina S.; Ricci, Emiliano P.; Décimo, Didier; Moncorgé, Olivier; Trabaud, Mary-Anne; André, Patrice; Cimarelli, Andrea; Ohlmann, Théophile

2012-01-01

The 5′-untranslated region (5′-UTR) of the genomic RNA of human immunodeficiency viruses type-1 (HIV-1) and type-2 (HIV-2) is composed of highly structured RNA motifs essential for viral replication that are expected to interfere with Gag and Gag-Pol translation. Here, we have analyzed and compared the properties by which the viral 5′-UTR drives translation from the genomic RNA of both human immunodeficiency viruses. Our results showed that translation from the HIV-2 gRNA was very poor compared to that of HIV-1. This was rather due to the intrinsic structural motifs in their respective 5′-UTR without involvement of any viral protein. Further investigation pointed to a different role of TAR RNA, which was much inhibitory for HIV-2 translation. Altogether, these data highlight important structural and functional differences between these two human pathogens. PMID:22121214

Snipper, an Eri1 homologue, affects histone mRNA abundance and is crucial for normal Drosophila melanogaster development.

PubMed

Alexiadis, Anastasios; Delidakis, Christos; Kalantidis, Kriton

2017-07-01

The conserved 3'-5' RNA exonuclease ERI1 is implicated in RNA interference inhibition, 5.8S rRNA maturation and histone mRNA maturation and turnover. The single ERI1 homologue in Drosophila melanogaster Snipper (Snp) is a 3'-5' exonuclease, but its in vivo function remains elusive. Here, we report Snp requirement for normal Drosophila development, since its perturbation leads to larval arrest and tissue-specific downregulation results in abnormal tissue development. Additionally, Snp directly interacts with histone mRNA, and its depletion results in drastic reduction in histone transcript levels. We propose that Snp protects the 3'-ends of histone mRNAs and upon its absence, histone transcripts are readily degraded. This in turn may lead to cell cycle delay or arrest, causing growth arrest and developmental perturbations. © 2017 Federation of European Biochemical Societies.

Defining the molecular profile of planarian pluripotent stem cells using a combinatorial RNA-seq, RNA interference and irradiation approach

PubMed Central

2012-01-01

Background Planarian stem cells, or neoblasts, drive the almost unlimited regeneration capacities of freshwater planarians. Neoblasts are traditionally described by their morphological features and by the fact that they are the only proliferative cell type in asexual planarians. Therefore, they can be specifically eliminated by irradiation. Irradiation, however, is likely to induce transcriptome-wide changes in gene expression that are not associated with neoblast ablation. This has affected the accurate description of their specific transcriptomic profile. Results We introduce the use of Smed-histone-2B RNA interference (RNAi) for genetic ablation of neoblast cells in Schmidtea mediterranea as an alternative to irradiation. We characterize the rapid, neoblast-specific phenotype induced by Smed-histone-2B RNAi, resulting in neoblast ablation. We compare and triangulate RNA-seq data after using both irradiation and Smed-histone-2B RNAi over a time course as means of neoblast ablation. Our analyses show that Smed-histone-2B RNAi eliminates neoblast gene expression with high specificity and discrimination from gene expression in other cellular compartments. We compile a high confidence list of genes downregulated by both irradiation and Smed-histone-2B RNAi and validate their expression in neoblast cells. Lastly, we analyze the overall expression profile of neoblast cells. Conclusions Our list of neoblast genes parallels their morphological features and is highly enriched for nuclear components, chromatin remodeling factors, RNA splicing factors, RNA granule components and the machinery of cell division. Our data reveal that the regulation of planarian stem cells relies on posttranscriptional regulatory mechanisms and suggest that planarians are an ideal model for this understudied aspect of stem cell biology. PMID:22439894

CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.

PubMed

Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A

2014-05-06

In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.

Comparison of Dengue Virus Type 2-Specific Small RNAs from RNA Interference-Competent and –Incompetent Mosquito Cells

PubMed Central

Scott, Jaclyn C.; Brackney, Doug E.; Campbell, Corey L.; Bondu-Hawkins, Virginie; Hjelle, Brian; Ebel, Greg D.; Olson, Ken E.; Blair, Carol D.

2010-01-01

The exogenous RNA interference (RNAi) pathway is an important antiviral defense against arboviruses in mosquitoes, and virus-specific small interfering (si)RNAs are key components of this pathway. Understanding the biogenesis of siRNAs in mosquitoes could have important ramifications in using RNAi to control arbovirus transmission. Using deep sequencing technology, we characterized dengue virus type 2 (DENV2)-specific small RNAs produced during infection of Aedes aegypti mosquitoes and A. aegypti Aag2 cell cultures and compared them to those produced in the C6/36 Aedes albopictus cell line. We show that the size and mixed polarity of virus-specific small RNAs from DENV-infected A. aegypti cells indicate that they are products of Dicer-2 (Dcr2) cleavage of long dsRNA, whereas C6/36 cells generate DENV2-specific small RNAs that are longer and predominantly positive polarity, suggesting that they originate from a different small RNA pathway. Examination of virus-specific small RNAs after infection of the two mosquito cell lines with the insect-only flavivirus cell fusing agent virus (CFAV) corroborated these findings. An in vitro assay also showed that Aag2 A. aegypti cells are capable of siRNA production, while C6/36 A. albopictus cells exhibit inefficient Dcr2 cleavage of long dsRNA. Defective expression or function of Dcr2, the key initiator of the RNAi pathway, might explain the comparatively robust growth of arthropod-borne viruses in the C6/36 cell line, which has been used frequently as a surrogate for studying molecular interactions between arboviruses and cells of their mosquito hosts. PMID:21049014

New insights into siRNA amplification and RNAi

PubMed Central

Zhang, Chi; Ruvkun, Gary

2012-01-01

In the nematode Caenorhabditis elegans (C. elegans), gene inactivation by RNA interference can achieve remarkable potency due to the amplification of initial silencing triggers by RNA-dependent RNA polymerases (RdRPs). RdRPs catalyze the biogenesis of an abundant species of secondary small interfering RNAs (siRNAs) using the target mRNA as template. The interaction between primary siRNAs derived from the exogenous double-stranded RNA (dsRNA) trigger and the target mRNA is required for the recruitment of RdRPs. Other genetic requirements for RdRP activities have not been characterized. Recent studies have identified the RDE-10/RDE-11 complex which interacts with the primary siRNA bound target mRNA and acts upstream of the RdRPs. rde-10 and rde-11 mutants show an RNAi defective phenotype because the biogenesis of secondary siRNAs is completely abolished. In addition, the RDE-10/RDE-11 complex plays a similar role in the endogenous RNAi pathway for the biogenesis of a subset of siRNAs targeting recently acquired, duplicated genes. PMID:22858672

A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi.

PubMed

Tsai, Hsin-Yue; Chen, Chun-Chieh G; Conte, Darryl; Moresco, James J; Chaves, Daniel A; Mitani, Shohei; Yates, John R; Tsai, Ming-Daw; Mello, Craig C

2015-01-29

Effective silencing by RNA-interference (RNAi) depends on mechanisms that amplify and propagate the silencing signal. In some organisms, small-interfering RNAs (siRNAs) are amplified from target mRNAs by RNA-dependent RNA polymerase (RdRP). Both RdRP recruitment and mRNA silencing require Argonaute proteins, which are generally thought to degrade RNAi targets by directly cleaving them. However, in C. elegans, the enzymatic activity of the primary Argonaute, RDE-1, is not required for silencing activity. We show that RDE-1 can instead recruit an endoribonuclease, RDE-8, to target RNA. RDE-8 can cleave RNA in vitro and is needed for the production of 3' uridylated fragments of target mRNA in vivo. We also find that RDE-8 promotes RdRP activity, thereby ensuring amplification of siRNAs. Together, our findings suggest a model in which RDE-8 cleaves target mRNAs to mediate silencing, while generating 3' uridylated mRNA fragments to serve as templates for the RdRP-directed amplification of the silencing signal. Copyright © 2015 Elsevier Inc. All rights reserved.

A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi

PubMed Central

Tsai, Hsin-Yue; Chen, Chun-Chieh G.; Conte, Darryl; Moresco, James J.; Chaves, Daniel A.; Mitani, Shohei; Yates, John R.; Tsai, Ming-Daw; Mello, Craig C.

2015-01-01

SUMMARY Effective silencing by RNA-interference (RNAi) depends on mechanisms that amplify and propagate the silencing signal. In some organisms, small-interfering (si) RNAs are amplified from target mRNAs by RNA-dependent RNA polymerase (RdRP). Both RdRP recruitment and mRNA silencing require Argonaute proteins, which are generally thought to degrade RNAi targets by directly cleaving them. However in C. elegans, the enzymatic activity of the primary Argonaute, RDE-1, is not required for silencing activity. We show that RDE-1 can instead recruit an endoribonuclease, RDE-8, to target RNA. RDE-8 can cleave RNA in vitro and is needed for the production of 3′ uridylated fragments of target mRNA in vivo. We also find that RDE-8 promotes RdRP activity, thereby ensuring amplification of siRNAs. Together, our findings suggest a model in which RDE-8 cleaves target mRNAs to mediate silencing, while generating 3’ uridylated mRNA fragments to serve as templates for the RdRP-directed amplification of the silencing signal. PMID:25635455

Mesoporous silica nanorods toward efficient loading and intracellular delivery of siRNA

NASA Astrophysics Data System (ADS)

Chen, Lijue; She, Xiaodong; Wang, Tao; Shigdar, Sarah; Duan, Wei; Kong, Lingxue

2018-02-01

The technology of RNA interference (RNAi) that uses small interfering RNA (siRNA) to silence the gene expression with complementary messenger RNA (mRNA) sequence has great potential for the treatment of cancer in which certain genes were usually found overexpressed. However, the carry and delivery of siRNA to the target site in the human body can be challenging for this technology to be used clinically to silence the cancer-related gene expression. In this work, rod shaped mesoporous silica nanoparticles (MSNs) were developed as siRNA delivery system for specific intracellular delivery. The rod MSNs with an aspect ratio of 1.5 had a high surface area of 934.28 m2/g and achieved a siRNA loading of more than 80 mg/g. With the epidermal growth factor (EGF) grafted on the surface of the MSNs, siRNA can be delivered to the epidermal growth factor receptor (EGFR) overexpressed colorectal cancer cells with high intracellular concentration compared to MSNs without EGF and lead to survivin gene knocking down to less than 30%.

TLR4-NOX4-AP-1 signaling mediates lipopolysaccharide-induced CXCR6 expression in human aortic smooth muscle cells.

PubMed

Patel, Devang N; Bailey, Steven R; Gresham, John K; Schuchman, David B; Shelhamer, James H; Goldstein, Barry J; Foxwell, Brian M; Stemerman, Michael B; Maranchie, Jodi K; Valente, Anthony J; Mummidi, Srinivas; Chandrasekar, Bysani

2006-09-08

CXCL16 is a transmembrane non-ELR CXC chemokine that signals via CXCR6 to induce aortic smooth muscle cell (ASMC) proliferation. While bacterial lipopolysaccharide (LPS) has been shown to stimulate CXCL16 expression in SMC, its effects on CXCR6 are not known. Here, we demonstrate that LPS upregulates CXCR6 mRNA, protein, and surface expression in human ASMC. Inhibition of TLR4 with neutralizing antibodies or specific siRNA interference blocked LPS-mediated CXCR6 expression. LPS stimulated both AP-1 (c-Fos, c-Jun) and NF-kappaB (p50 and p65) activation, but only inhibition of AP-1 attenuated LPS-induced CXCR6 expression. Using dominant negative expression vectors and siRNA interference, we demonstrate that LPS induces AP-1 activation via MyD88, TRAF6, ERK1/2, and JNK signaling pathways. Furthermore, the flavoprotein inhibitor diphenyleniodonium chloride significantly attenuated LPS-mediated AP-1-dependent CXCR6 expression, as did inhibition of NOX4 NADPH oxidase by siRNA. Finally, CXCR6 knockdown inhibited CXCL16-induced ASMC proliferation. These results demonstrate that LPS-TLR4-NOX4-AP-1 signaling can induce CXCR6 expression in ASMC, and suggest that the CXCL16-CXCR6 axis may be an important proinflammatory pathway in the pathogenesis of atherosclerosis.

TLR4-NOX4-AP-1 signaling mediates lipopolysaccharide-induced CXCR6 expression in human aortic smooth muscle cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patel, Devang N.; Bailey, Steven R.; Gresham, John K.

2006-09-08

CXCL16 is a transmembrane non-ELR CXC chemokine that signals via CXCR6 to induce aortic smooth muscle cell (ASMC) proliferation. While bacterial lipopolysaccharide (LPS) has been shown to stimulate CXCL16 expression in SMC, its effects on CXCR6 are not known. Here, we demonstrate that LPS upregulates CXCR6 mRNA, protein, and surface expression in human ASMC. Inhibition of TLR4 with neutralizing antibodies or specific siRNA interference blocked LPS-mediated CXCR6 expression. LPS stimulated both AP-1 (c-Fos, c-Jun) and NF-{kappa}B (p50 and p65) activation, but only inhibition of AP-1 attenuated LPS-induced CXCR6 expression. Using dominant negative expression vectors and siRNA interference, we demonstrate thatmore » LPS induces AP-1 activation via MyD88, TRAF6, ERK1/2, and JNK signaling pathways. Furthermore, the flavoprotein inhibitor diphenyleniodonium chloride significantly attenuated LPS-mediated AP-1-dependent CXCR6 expression, as did inhibition of NOX4 NADPH oxidase by siRNA. Finally, CXCR6 knockdown inhibited CXCL16-induced ASMC proliferation. These results demonstrate that LPS-TLR4-NOX4-AP-1 signaling can induce CXCR6 expression in ASMC, and suggest that the CXCL16-CXCR6 axis may be an important proinflammatory pathway in the pathogenesis of atherosclerosis.« less

Screening for plant viruses by next generation sequencing using a modified double strand RNA extraction protocol with an internal amplification control.

PubMed

Kesanakurti, Prasad; Belton, Mark; Saeed, Hanaa; Rast, Heidi; Boyes, Ian; Rott, Michael

2016-10-01

The majority of plant viruses contain RNA genomes. Detection of viral RNA genomes in infected plant material by next generation sequencing (NGS) is possible through the extraction and sequencing of total RNA, total RNA devoid of ribosomal RNA, small RNA interference (RNAi) molecules, or double stranded RNA (dsRNA). Plants do not typically produce high molecular weight dsRNA, therefore the presence of dsRNA makes it an attractive target for plant virus diagnostics. The sensitivity of NGS as a diagnostic method demands an effective dsRNA protocol that is both representative of the sample and minimizes sample cross contamination. We have developed a modified dsRNA extraction protocol that is more efficient compared to traditional protocols, requiring reduced amounts of starting material, that is less prone to sample cross contamination. This was accomplished by using bead based homogenization of plant material in closed, disposable 50ml tubes. To assess the quality of extraction, we also developed an internal control by designing a real-time (quantitative) PCR (qPCR) assay that targets endornaviruses present in Phaseolus vulgaris cultivar Black Turtle Soup (BTS). Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

Hydrophobization and bioconjugation for enhanced siRNA delivery and targeting

PubMed Central

De Paula, Daniel; Bentley, M. Vitória L.B.; Mahato, Ram I.

2007-01-01

RNA interference (RNAi) is an evolutionarily conserved process by which double-stranded small interfering RNA (siRNA) induces sequence-specific, post-transcriptional gene silencing. Unlike other mRNA targeting strategies, RNAi takes advantage of the physiological gene silencing machinery. The potential use of siRNA as therapeutic agents has attracted great attention as a novel approach for treating severe and chronic diseases. RNAi can be achieved by either delivery of chemically synthesized siRNAs or endogenous expression of small hairpin RNA, siRNA, and microRNA (miRNA). However, the relatively high dose of siRNA required for gene silencing limits its therapeutic applications. This review discusses several strategies to improve therapeutic efficacy as well as to abrogate off-target effects and immunostimulation caused by siRNAs. There is an in-depth discussion on various issues related to the (1) mechanisms of RNAi, (2) methods of siRNA production, (3) barriers to RNAi-based therapies, (4) biodistribution, (5) design of siRNA molecules, (6) chemical modification and bioconjugation, (7) complex formation with lipids and polymers, (8) encapsulation into lipid particles, and (9) target specificity for enhanced therapeutic effectiveness. PMID:17329355

The NS3 protein of Rice hoja blanca tenuivirus suppresses RNA silencing in plant and insect hosts by efficiently binding both siRNAs and miRNAs

PubMed Central

Hemmes, Hans; Lakatos, Lóránt; Goldbach, Rob; Burgyán, József; Prins, Marcel

2007-01-01

RNA silencing plays a key role in antiviral defense as well as in developmental processes in plants and insects. Negative strand RNA viruses such as the plant virus Rice hoja blanca tenuivirus (RHBV) replicate in plants and in their insect transmission vector. Like most plant-infecting viruses, RHBV encodes an RNA silencing suppressor, the NS3 protein, and here it is demonstrated that this protein is capable of suppressing RNA silencing in both plants and insect cells. Biochemical analyses showed that NS3 efficiently binds siRNA as well as miRNA molecules. Binding of NS3 is greatly influenced by the size of small RNA molecules, as 21 nucleotide (nt) siRNA molecules are bound > 100 times more efficiently than 26 nt species. Competition assays suggest that the activity of NS3 is based on binding to siRNAs prior to strand separation during the assembly of the RNA-induced silencing complex. In addition, NS3 has a high affinity for miRNA/miRNA* duplexes, indicating that its activity might also interfere with miRNA-regulated gene expression in both insects and plants. PMID:17513697

Two Distinct RNase Activities of CRISPR-C2c2 Enable Guide RNA Processing and RNA Detection

PubMed Central

East-Seletsky, Alexandra; O’Connell, Mitchell R.; Knight, Spencer C.; Burstein, David; Cate, Jamie H. D.; Tjian, Robert; Doudna, Jennifer A.

2017-01-01

Bacterial adaptive immune systems employ CRISPRs (clustered regularly interspaced short palindromic repeats) and CRISPR-associated (Cas) proteins for RNA-guided nucleic acid cleavage1,2. Although generally targeted to DNA substrates3–5, the Type III and Type VI CRISPR systems direct interference complexes against single-stranded RNA (ssRNA) substrates6–9. In Type VI systems, the single-subunit C2c2 protein functions as an RNA-guided RNA endonuclease9,10. How this enzyme acquires mature CRISPR RNAs (crRNAs) essential for immune surveillance and its mechanism of crRNA-mediated RNA cleavage remain unclear. Here we show that C2c2 possesses a unique ribonuclease activity responsible for CRISPR RNA maturation that is distinct from its RNA-activated ssRNA-degradation activity. These dual ribonuclease functions are chemically and mechanistically different from each other and from the crRNA-processing behavior of the evolutionarily unrelated CRISPR enzyme Cpf111. We show that the two ribonuclease activities of C2c2 enable multiplexed processing and loading of guide RNAs that in turn allow for sensitive cellular transcript detection. PMID:27669025

Development of marker-free transgenic Jatropha plants with increased levels of seed oleic acid

PubMed Central

2012-01-01

Background Jatropha curcas is recognized as a new energy crop due to the presence of the high amount of oil in its seeds that can be converted into biodiesel. The quality and performance of the biodiesel depends on the chemical composition of the fatty acids present in the oil. The fatty acids profile of the oil has a direct impact on ignition quality, heat of combustion and oxidative stability. An ideal biodiesel composition should have more monounsaturated fatty acids and less polyunsaturated acids. Jatropha seed oil contains 30% to 50% polyunsaturated fatty acids (mainly linoleic acid) which negatively impacts the oxidative stability and causes high rate of nitrogen oxides emission. Results The enzyme 1-acyl-2-oleoyl-sn-glycero-3-phosphocholine delta 12-desaturase (FAD2) is the key enzyme responsible for the production of linoleic acid in plants. We identified three putative delta 12 fatty acid desaturase genes in Jatropha (JcFAD2s) through genome-wide analysis and downregulated the expression of one of these genes, JcFAD2-1, in a seed-specific manner by RNA interference technology. The resulting JcFAD2-1 RNA interference transgenic plants showed a dramatic increase of oleic acid (> 78%) and a corresponding reduction in polyunsaturated fatty acids (< 3%) in its seed oil. The control Jatropha had around 37% oleic acid and 41% polyunsaturated fatty acids. This indicates that FAD2-1 is the major enzyme responsible for converting oleic acid to linoleic acid in Jatropha. Due to the changes in the fatty acids profile, the oil of the JcFAD2-1 RNA interference seed was estimated to yield a cetane number as high as 60.2, which is similar to the required cetane number for conventional premium diesel fuels (60) in Europe. The presence of high seed oleic acid did not have a negative impact on other Jatropha agronomic traits based on our preliminary data of the original plants under greenhouse conditions. Further, we developed a marker-free system to generate the transgenic Jatropha that will help reduce public concerns for environmental issues surrounding genetically modified plants. Conclusion In this study we produced seed-specific JcFAD2-1 RNA interference transgenic Jatropha without a selectable marker. We successfully increased the proportion of oleic acid versus linoleic in Jatropha through genetic engineering, enhancing the quality of its oil. PMID:22377043

Reducing Retroactive Interference through the Use of Different Encoding Techniques: An Exploration of Pre-Test/Post-Test Analyses

ERIC Educational Resources Information Center

Cumming, John M.; De Miranda, Michael A.

2012-01-01

Retroactive interference (RI) in list learning occurs when the learning of a second list of words interferes with the recall of the first learned list. Having the lists be thematically different can reduce retroactive interference within list learning; however, this study demonstrates how RI can be reduced when the lists contain similar words.…

Suppression of the Epidermal Growth Factor-like Domain 7 and Inhibition of Migration and Epithelial-Mesenchymal Transition in Human Pancreatic Cancer PANC-1 Cells.

PubMed

Wang, Yun-Liang; Dong, Feng-Lin; Yang, Jian; Li, Zhi; Zhi, Qiao-Ming; Zhao, Xin; Yang, Yong; Li, De-Chun; Shen, Xiao-Chun; Zhou, Jin

2015-01-01

Epidermal growth factor-like domain multiple 7 (EGFL7), a secreted protein specifically expressed by endothelial cells during embryogenesis, recently was identified as a critical gene in tumor metastasis. Epithelial-mesenchymal transition (EMT) was found to be closely related with tumor progression. Accordingly, it is important to investigate the migration and EMT change after knock-down of EGFL7 gene expression in human pancreatic cancer cells. EGFL7 expression was firstly testified in 4 pancreatic cancer cell lines by real-time polymerase chain reaction (Real-time PCR) and western blot, and the highest expression of EGFL7 was found in PANC-1 cell line. Then, PANC-1 cells transfected with small interference RNA (siRNA) of EGFL7 using plasmid vector were named si-PANC-1, while transfected with negative control plasmid vector were called NC-PANC-1. Transwell assay was used to analyze the migration of PANC-1 cells. Real-time PCR and western blotting were used to detect the expression change of EGFL7 gene, EMT markers like E-Cadherin, N-Cadherin, Vimentin, Fibronectin and transcription factors like snail, slug in PANC-1, NC- PANC-1, and si-PANC-1 cells, respectively. After successful plasmid transfection, EGFL7 gene were dramatically knock-down by RNA interference in si-PANC-1 group. Meanwhile, migration ability decreased significantly, compared with PANC-1 and NC-PANC-1 group. Meanwhile, the expression of epithelial phenotype marker E-Cadherin increased and that of mesenchymal phenotype markers N-Cadherin, Vimentin, Fibronectin dramatically decreased in si-PANC-1 group, indicating a reversion of EMT. Also, transcription factors snail and slug decreased significantly after RNA interference. Current study suggested that highly-expressed EGFL7 promotes migration of PANC-1 cells and acts through transcription factors snail and slug to induce EMT, and further study is needed to confirm this issue.

The role of mAKAPβ in the process of cardiomyocyte hypertrophy induced by angiotensin II

PubMed Central

GUO, HUIXIN; LIU, BAOXIN; HOU, LEI; THE, ERLINDA; LI, GANG; WANG, DONGZHI; JIE, QIQIANG; CHE, WENLIANG; WEI, YIDONG

2015-01-01

Angiotensin II (AngII) is the central product of the renin-angiotensin system (RAS) and this octapeptide contributes to the pathophysiology of cardiac hypertrophy and remodeling. mAKAPβ is an A-kinase anchoring protein (AKAP) that has the function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. In this study, we aimed to investigate the role of mAKAPβ in AngII-induced cardiomyocyte hypertrophy and the possible mechanisms involved. Cultured cardiomyocytes from neonatal rats were treated with AngII. Subsequently, the morphology of the cardiomyocytes was observed and the expression of mAKAPβ and cardiomyocyte hypertrophic markers was measured. mAKAPβ-shRNA was constructed for RNA interference; the expression of mAKAPβ and hypertrophic markers, the cell surface area and the [3H]Leucine incorporation rate in the AngII-treated rat cardiomyocytes were detected following RNA interference. Simultaneously, changes in the expression levels of phosphorylated extracellular signal-regulated kinase (p-ERK)2 in the cardiomyocytes were assessed. The cell size of the AngII-treated cardiaomyocytes was significantly larger than that of the untreated cardiomyocytes. The expression of hypertrophic markers and p-ERK2, the cell surface area and the [3H]Leucine incorporation rate were all significantly increased in the AngII-treated cells. However, the expression of mAKAPβ remained unaltered in this process. RNA interference simultaneously inhibited the protein expression of mAKAPβ and p-ERK2, and the hypertrophy of the cardiomyocytes induced by AngII was attenuated. These results demonstrate that AngII induces hypertrophy in cardiomyocytes, and mAKAPβ is possibly involved in this process. The effects of mAKAPβ on AngII-induced cardiomyocyte hypertrophy may be associated with p-ERK2 expression. PMID:25739102

RNA interference technology to control pest sea lampreys--a proof-of-concept.

PubMed

Heath, George; Childs, Darcy; Docker, Margaret F; McCauley, David W; Whyard, Steven

2014-01-01

The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0-fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species.

RNA Interference Technology to Control Pest Sea Lampreys - A Proof-of-Concept

PubMed Central

Heath, George; Childs, Darcy; Docker, Margaret F.; McCauley, David W.; Whyard, Steven

2014-01-01

The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0–fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species. PMID:24505485

Numerical techniques for high-throughput reflectance interference biosensing

NASA Astrophysics Data System (ADS)

Sevenler, Derin; Ünlü, M. Selim

2016-06-01

We have developed a robust and rapid computational method for processing the raw spectral data collected from thin film optical interference biosensors. We have applied this method to Interference Reflectance Imaging Sensor (IRIS) measurements and observed a 10,000 fold improvement in processing time, unlocking a variety of clinical and scientific applications. Interference biosensors have advantages over similar technologies in certain applications, for example highly multiplexed measurements of molecular kinetics. However, processing raw IRIS data into useful measurements has been prohibitively time consuming for high-throughput studies. Here we describe the implementation of a lookup table (LUT) technique that provides accurate results in far less time than naive methods. We also discuss an additional benefit that the LUT method can be used with a wider range of interference layer thickness and experimental configurations that are incompatible with methods that require fitting the spectral response.

Host-Pathogen interactions modulated by small RNAs

PubMed Central

Islam, Waqar; Islam, Saif ul; Qasim, Muhammad; Wang, Liande

2017-01-01

ABSTRACT Biological processes such as defense mechanisms and microbial offense strategies are regulated through RNA induced interference in eukaryotes. Genetic mutations are modulated through biogenesis of small RNAs which directly impacts upon host development. Plant defense mechanisms are regulated and supported by a diversified group of small RNAs which are involved in streamlining several RNA interference pathways leading toward the initiation of pathogen gene silencing mechanisms. In the similar context, pathogens also utilize the support of small RNAs to launch their offensive attacks. Also there are strong evidences about the active involvement of these RNAs in symbiotic associations. Interestingly, small RNAs are not limited to the individuals in whom they are produced; they also show cross kingdom influences through variable interactions with other species thus leading toward the inter-organismic gene silencing. The phenomenon is understandable in the microbes which utilize these mechanisms to overcome host defense line. Understanding the mechanism of triggering host defense strategies can be a valuable step toward the generation of disease resistant host plants. We think that the cross kingdom trafficking of small RNA is an interesting insight that is needed to be explored for its vitality. PMID:28430077